Science.gov

Sample records for proton form factor

  1. Proton form factor effects in hydrogenic atoms

    SciTech Connect

    Daza, F. Garcia; Kelkar, N. G.; Nowakowski, M.

    2011-10-21

    The proton structure corrections to the hyperfine splittings in electronic and muonic hydrogen are evaluated using the Breit potential with electromagnetic form factors. In contrast to other methods, the Breit equation with q{sup 2} dependent form factors is just an extension of the standard Breit equation which gives the hyperfine splitting Hamiltonian. Precise QED corrections are comparable to the structure corrections which therefore need to be evaluated ab initio.

  2. The Proton Form Factor Ratio Measurements at Jefferson Lab

    SciTech Connect

    Punjabi, Vina A.; Perdrisat, Charles F.

    2014-03-01

    The ratio of the proton form factors, G{sub Ep}/G{sub Mp}, has been measured from Q{sup 2} of 0.5 GeV{sup 2} to 8.5 GeV{sup 2}, at the Jefferson Laboratory, using the polarization transfer method. This ratio is extracted directly from the measured ratio of the transverse and longitudinal polarization components of the recoiling proton in elastic electron-proton scattering. The discovery that the proton form factor ratio measured in these experiments decreases approximately linearly with four-momentum transfer, Q{sup 2}, for values above ~1 GeV{sup 2}, is one of the most significant results to come out of JLab. These results have had a large impact on progress in hadronic physics; and have required a significant rethinking of nucleon structure. The increasingly common use of the double-polarization technique to measure the nucleon form factors, in the last 15 years, has resulted in a dramatic improvement of the quality of all four nucleon electromagnetic form factors, G{sub Ep}, G{sub Mp}, G{sub En} and G{sub Mn}. There is an approved experiment at JLab, GEP(V), to continue the ratio measurements to 12 GeV{sup 2}. A dedicated experimental setup, the Super Bigbite Spectrometer (SBS), will be built for this purpose. It will be equipped with a focal plane polarimeter to measure the polarization of the recoil protons. The scattered electrons will be detected in an electromagnetic calorimeter. In this presentation, I will review the status of the proton elastic electromagnetic form factors and discuss a number of theoretical approaches to describe nucleon form factors.

  3. The Proton Form Factor Ratio Measurements at Jefferson Lab

    NASA Astrophysics Data System (ADS)

    Punjabi, Vina; Perdrisat, Charles F.

    2014-03-01

    The ratio of the proton form factors, GEp/GMp, has been measured from Q2 of 0.5 GeV2 to 8.5 GeV2, at the Jefferson Laboratory, using the polarization transfer method. This ratio is extracted directly from the measured ratio of the transverse and longitudinal polarization components of the recoiling proton in elastic electron-proton scattering. The discovery that the proton form factor ratio measured in these experiments decreases approximately linearly with four-momentum transfer, Q2, for values above ≈ 1 GeV2, is one of the most significant results to come out of JLab. These results have had a large impact on progress in hadronic physics; and have required a significant rethinking of nucleon structure. There is an approved experiment at JLab, GEp(5), to continue the ratio measurements to 12 GeV2. A dedicated experimental setup, the Super Bigbite Spectrometer (SBS), will be built for this purpose. In this paper, the present status of the proton elastic electromagnetic form factors and a number of theoretical approaches to describe nucleon form factors will be discussed.

  4. Reanalysis of Rosenbluth measurements of the proton form factors

    NASA Astrophysics Data System (ADS)

    Gramolin, A. V.; Nikolenko, D. M.

    2016-05-01

    We present a reanalysis of the data from Stanford Linear Accelerator Center (SLAC) experiments E140 [R. C. Walker et al., Phys. Rev. D 49, 5671 (1994), 10.1103/PhysRevD.49.5671] and NE11 [L. Andivahis et al., Phys. Rev. D 50, 5491 (1994), 10.1103/PhysRevD.50.5491] on elastic electron-proton scattering. This work is motivated by recent progress in calculating the corresponding radiative corrections and by the apparent discrepancy between the Rosenbluth and polarization transfer measurements of the proton electromagnetic form factors. New, corrected values for the scattering cross sections are presented, as well as a new form factor fit in the Q2 range from 1 to 8.83 GeV2. We also provide a complete set of revised formulas to account for radiative corrections in single-arm measurements of unpolarized elastic electron-proton scattering.

  5. Periodic Interference Structures in the Timelike Proton Form Factor.

    PubMed

    Bianconi, Andrea; Tomasi-Gustafsson, Egle

    2015-06-12

    An intriguing and elusive feature of the timelike hadron form factor is the possible presence of an imaginary part associated to rescattering processes. We find evidence of that in the recent and precise data on the proton timelike form factor measured by the BABAR Collaboration. By plotting these data as a function of the 3-momentum of the relative motion of the final proton and antiproton, a systematic sinusoidal modulation is highlighted in the near-threshold region. Our analysis attributes this pattern to rescattering processes at a relative distance of 0.7-1.5 fm between the centers of the forming hadrons. This distance implies a large fraction of inelastic processes in pp interactions, and a large imaginary part in the related e(+)e(-)→pp reaction because of unitarity. PMID:26196793

  6. Proton Form Factors Measurements in the Time-Like Region

    SciTech Connect

    Anulli, F.; /Frascati

    2007-10-22

    I present an overview of the measurement of the proton form factors in the time-like region. BABAR has recently measured with great accuracy the e{sup +}e{sup -} {yields} p{bar p} reaction from production threshold up to an energy of {approx} 4.5 GeV, finding evidence for a ratio of the electric to magnetic form factor greater than unity, contrary to expectation. In agreement with previous measurements, BABAR confirmed the steep rise of the magnetic form factor close to the p{bar p} mass threshold, suggesting the possible presence of an under-threshold N{bar N} vector state. These and other open questions related to the nucleon form factors both in the time-like and space-like region, wait for more data with different experimental techniques to be possibly solved.

  7. Helicity non-conserving form factor of the proton

    SciTech Connect

    Voutier, E.; Furget, C.; Knox, S.

    1994-04-01

    The study of the hadron structure in the high Q{sup 2} range contributes to the understanding of the mechanisms responsible for the confinement of quarks and gluons. Among the numerous experimental candidates sensitive to these mechanisms, the helicity non-conserving form factor of the proton is a privileged observable since it is controlled by non-perturbative effects. The authors investigate here the feasibility of high Q{sup 2} measurements of this form factor by means of the recoil polarization method in the context of the CEBAF 8 GeV facility. For that purpose, they discuss the development of a high energy proton polarimeter, based on the H({rvec p},pp) elastic scattering, to be placed at the focal plane of a new hadron spectrometer. It is shown that this experimental method significantly improves the knowledge of the helicity non-conserving form factor of the proton up to 10 GeV{sup 2}/c{sup 2}.

  8. Measurement of the Proton`s Neutral Weak Magnetic Form Factor

    SciTech Connect

    Mueller, B.; Carr, R.; Filippone, B.W.; Korsch, W.; McKeown, R.D.; Pitt, M.; Beck, D.H.; Cardman, L.; Forest, T.; Gao, H.; Nilsson, D.; Simicevic, N.; Terburg, B.; Beise, E.J.; Duncan, F.; Lung, A.; Mohring, R.; Candell, E.; DiBari, R.C.; Napolitano, J.; Dodson, G.; Dow, K.; Farkhondeh, M.; Kowalski, S.; Wells, S.P.

    1997-05-01

    We report the first measurement of the parity-violating asymmetry in elastic electron scattering from the proton. The asymmetry depends on the neutral weak magnetic form factor of the proton which contains new information on the contribution of strange quark-antiquark pairs to the magnetic moment of the proton. We obtain the value {ital G}{sup Z}{sub M}=0.34{plus_minus}0.09{plus_minus}0.04{plus_minus} 0.05 n.m. at {ital Q}{sup 2}=0.1 (GeV/c){sup 2}. {copyright} {ital 1997} {ital The American Physical Society}

  9. Proton Form Factor Measurements Using Polarization Method: Beyond Born Approximation

    SciTech Connect

    Pentchev, Lubomir

    2008-10-13

    Significant theoretical and experimental efforts have been made over the past 7 years aiming to explain the discrepancy between the proton form factor ratio data obtained at JLab using the polarization method and the previous Rosenbluth measurements. Preliminary results from the first high precision polarization experiment dedicated to study effects beyond Born approximation will be presented. The ratio of the transferred polarization components and, separately, the longitudinal polarization in ep elastic scattering have been measured at a fixed Q{sup 2} of 2.5 GeV{sup 2} over a wide kinematic range. The two quantities impose constraints on the real part of the ep elastic amplitudes.

  10. Electric and magnetic form factors of the proton

    NASA Astrophysics Data System (ADS)

    Bernauer, J. Â. C.; Distler, M. Â. O.; Friedrich, J.; Walcher, Th.; Achenbach, P.; Ayerbe Gayoso, C.; Böhm, R.; Bosnar, D.; Debenjak, L.; Doria, L.; Esser, A.; Fonvieille, H.; Gómez Rodríguez de la Paz, M.; Friedrich, J. Â. M.; Makek, M.; Merkel, H.; Middleton, D. Â. G.; Müller, U.; Nungesser, L.; Pochodzalla, J.; Potokar, M.; Sánchez Majos, S.; Schlimme, B. Â. S.; Širca, S.; Weinriefer, M.; A1 Collaboration

    2014-07-01

    This paper describes a precise measurement of electron scattering off the proton at momentum transfers of 0.003≲Q2≲1 GeV2. The average point-to-point error of the cross sections in this experiment is ˜0.37%. These data are used for a coherent new analysis together with all world data of unpolarized and polarized electron scattering from the very smallest to the highest momentum transfers so far measured. The extracted electric and magnetic form factors provide new insight into their exact shape, deviating from the classical dipole form, and of structure on top of this gross shape. The data reaching very low Q2 values are used for a new determination of the electric and magnetic radii. An empirical determination of the two-photon-exchange correction is presented. The implications of this correction on the radii and the question of a directly visible signal of the pion cloud are addressed.

  11. Proton form factors and two-photon exchange in elastic electron-proton scattering

    SciTech Connect

    Nikolenko, D. M.; Arrington, J.; Barkov, L. M.; Vries, H. de; Gauzshtein, V. V.; Golovin, R. A.; Gramolin, A. V.; Dmitriev, V. F.; Zhilich, V. N.; Zevakov, S. A.; Kaminsky, V. V.; Lazarenko, B. A.; Mishnev, S. I.; Muchnoi, N. Yu.; Neufeld, V. V.; Rachek, I. A.; Sadykov, R. Sh.; Stibunov, V. N.; Toporkov, D. K.; Holt, R. J.; and others

    2015-05-15

    Proton electromagnetic form factors are among the most important sources of information about the internal structure of the proton. Two different methods for measuring these form factors, the method proposed by Rosenbluth and the polarization-transfer method, yield contradictory results. It is assumed that this contradiction can be removed upon taking into account the hard part of the contribution of two-photon exchange to the cross section for elastic electron-proton scattering. This contribution can measured experimentally via a precision comparison of the cross sections for the elastic scattering of positrons and electrons on protons. Such a measurement, performed at the VEPP-3 storage ring in Novosibirsk at the beam energies of 1.6 and 1.0 GeV for positron (electron) scattering angles in the ranges of θ{sub e} = 15°–25° and 55°–75° in the first case and in the range of θ{sub e} = 65°–105° in the second case is described in the present article. Preliminary results of this experiment and their comparison with theoretical predictions are described.

  12. Low-Q2 measurements of the proton form factor ratio μpGE/GM

    NASA Astrophysics Data System (ADS)

    Ron, G.; Zhan, X.; Glister, J.; Lee, B.; Allada, K.; Armstrong, W.; Arrington, J.; Beck, A.; Benmokhtar, F.; Berman, B. L.; Boeglin, W.; Brash, E.; Camsonne, A.; Calarco, J.; Chen, J. P.; Choi, Seonho; Chudakov, E.; Coman, L.; Craver, B.; Cusanno, F.; Dumas, J.; Dutta, C.; Feuerbach, R.; Freyberger, A.; Frullani, S.; Garibaldi, F.; Gilman, R.; Hansen, O.; Higinbotham, D. W.; Holmstrom, T.; Hyde, C. E.; Ibrahim, H.; Ilieva, Y.; de Jager, C. W.; Jiang, X.; Jones, M.; Kelleher, A.; Khrosinkova, E.; Kuchina, E.; Kumbartzki, G.; Lerose, J. J.; Lindgren, R.; Markowitz, P.; Beck, S. May-Tal; McCullough, E.; Meziane, M.; Meziani, Z.-E.; Michaels, R.; Moffit, B.; Norum, B. E.; Oh, Y.; Olson, M.; Paolone, M.; Paschke, K.; Perdrisat, C. F.; Piasetzky, E.; Potokar, M.; Pomatsalyuk, R.; Pomerantz, I.; Puckett, A. J. R.; Punjabi, V.; Qian, X.; Qiang, Y.; Ransome, R.; Reyhan, M.; Roche, J.; Rousseau, Y.; Saha, A.; Sarty, A. J.; Sawatzky, B.; Schulte, E.; Shabestari, M.; Shahinyan, A.; Shneor, R.; Širca, S.; Slifer, K.; Solvignon, P.; Song, J.; Sparks, R.; Subedi, R.; Strauch, S.; Urciuoli, G. M.; Wang, K.; Wojtsekhowski, B.; Yan, X.; Yao, H.; Zhu, X.

    2011-11-01

    We present an updated extraction of the proton electromagnetic form factor ratio, μpGE/GM, at low Q2. The form factors are sensitive to the spatial distribution of the proton, and precise measurements can be used to constrain models of the proton. An improved selection of the elastic events and reduced background contributions yielded a small systematic reduction in the ratio μpGE/GM compared to the original analysis.

  13. Theoretical and Experimental Review on Proton Form Factors

    NASA Astrophysics Data System (ADS)

    Baldini Ferroli, Rinaldo; Pacetti, Simone

    2014-12-01

    During the last three lustra nucleon form factors experiments have lived a golden age, full of interesting results, that likely will continue and culminate when new data will come from BESIII, SND, CMD3 and PANDA, in the time-like region and, Jefferson Lab and A1 in the space-like region. On the other hand, from theoretical point of view, mainly concerning the possibility of descriptions in all kinematical regions, no great breakthrough has been made.

  14. Transition Form Factors of the Proton at Higher Momentum Transfer

    SciTech Connect

    Paul Stoler

    1998-12-01

    Recently there hae been promising developments in bridging the high and low Q{sup 2} extremes with a QCD quark-parton description of exclusive reactions. In this approach the perturbative hard part of the reaction, which is calculable, is isolated from the non-perturbative soft, physics which is parameterized in terms of off-forward parton distributions (OFPD), generically illustrated in a figure. An attractive aspect of this is that the same OFPD's are common to different exclusive reactions which involve the same set of hadrons. In the limit of forward scattering it is shown that the OFPD become the usual inclusive parton distribution functions, as illustrated for the case of virtual Compton scattering in a figure. A figure illustrates how they are related specifically to baryon elastic and transition form factors, which is the subject of this article.

  15. Recoil polarization measurements of the proton electromagnetic form factor ratio at high momentum transfer

    SciTech Connect

    Andrew Puckett

    2009-12-01

    Electromagnetic form factors are fundamental properties of the nucleon that describe the effect of its internal quark structure on the cross section and spin observables in elastic lepton-nucleon scattering. Double-polarization experiments have become the preferred technique to measure the proton and neutron electric form factors at high momentum transfers. The recently completed GEp-III experiment at the Thomas Jefferson National Accelerator Facility used the recoil polarization method to extend the knowledge of the proton electromagnetic form factor ratio GpE/GpM to Q2 = 8.5 GeV2. In this paper we present the preliminary results of the experiment.

  16. Proton electromagnetic form factors: present status and future perspectives at PANDA

    NASA Astrophysics Data System (ADS)

    Tomasi-Gustafsson, E.

    2015-05-01

    Data and models on electromagnetic proton form factors are reviewed, highlighting the contribution foreseen by the PANDA collaboration. Electromagnetic hadron form factors contain essential information on the internal structure of hadrons. Precise and surprising data have been obtained at electron accelerators, applying the polarization method in electron-proton elastic scattering. At electron-positron colliders, using initial state radiation, BABAR measured proton time-like form factors in a wide time-like kinematical region and the BESIII collaboration will measure very precisely proton and neutron form factors in the threshold region. In the next future an antiproton beam with momentum up to 15 GeV/c will be available at FAIR (Darmstadt). Measurements of the reaction p̅ + p → e+ + e- by the PANDA collaboration will contribute to the individual determination of electric and magnetic form factors in the time-like region of momentum transfer squared, as well as to their first determination in the unphysical region (below the kinematical threshold), through the reaction p̅ + p → e+ + e- + π0. From the discussion on feasibility studies at PANDA, we focus on the consequences of such measurements in view of an unified description of form factors in the full kinematical region. We present models which have the necessary analytical requirements and apply to the data in the whole kinematical region.

  17. The Proton Coulomb Form Factor from Polarized Inclusive e-p Scattering

    SciTech Connect

    Chris Harris

    2001-08-01

    The proton form factors provide information on the fundamental properties of the proton and provide a test for models based on QCD. In 1998 at Jefferson Lab (JLAB) in Newport News, VA, experiment E93026 measured the inclusive e-p scattering cross section from a polarized ammonia (15NH3) target at a four momentum transfer squared of Q2 = 0.5 (GeV/c)2. Longitudinally polarized electrons were scattered from the polarized target and the scattered electron was detected. Data has been analyzed to obtain the asymmetry from elastically scattered electrons from hydrogen in 15NH3. The asymmetry, Ap, has been used to determine the proton elastic form factor GEp. The result is consistent with the dipole model and data from previous experiments. However, due to the choice of kinematics, the uncertainty in the measurement is large.

  18. Two-Photon Exchange Corrections to Precise Measurements of Proton Electroweak Form Factors

    NASA Astrophysics Data System (ADS)

    Afanasev, Andrei

    2004-10-01

    Higher-order QED effects play an important role for extracting information on proton form factors from electron scattering data. For the electric form factor of the proton, a previously neglected two-photon-exchange correction reconciles an observed discrepancy between Rosenbluth and polarization techniques [1]. We use a similar approach based on General Parton Distributions to compute additional radiative corrections to parity-violating electron scattering. [1] Y.C. Chen, A. Afanasev, S.J. Brodsky, C.E. Carlson and M. Vanderhaeghen, ``Partonic calculation of the two-photon exchange contribution to elastic electron proton scattering at large momentum transfer,`` arXiv:hep-ph/0403058, to appear in Phys.Rev.Lett.

  19. High Precision Measurement of the Proton Elastic Form Factor Ratio at Low Q2

    SciTech Connect

    Xiaohui Zhan

    2009-12-01

    A high precision measurement of the proton elastic form factor ratio µpGEp/GMp in the range Q2 = 0.3–0.7 GeV2/c2 was performed using recoil polarimetry in Jefferson Lab Hall A. In this low Q2 range, previous data from LEDEX [5] along with many fits and calculations [2, 3, 4] indicate substantial deviations of the ratio from unity. In this new measurement, with 80% polarized electron beam for 24 days, we are able to achieve <1% statistical uncertainty. Preliminary results are a few percent lower than expected from previous world data and fits, indicating a smaller GEp at this region. Beyond the intrinsic interest in nucleon structure, the improved form factor measurements also have implications for DVCS, determinations of the proton Zemach radius and strangeness form factors through parity violation experiments.

  20. High-Precision Determination of the Electric and Magnetic Form Factors of the Proton

    SciTech Connect

    Bernauer, J. C.; Achenbach, P.; Ayerbe Gayoso, C.; Boehm, R.; Distler, M. O.; Doria, L.; Esser, A.; Friedrich, J.; Gomez Rodriguez de la Paz, M.; Merkel, H.; Middleton, D. G.; Mueller, U.; Nungesser, L.; Pochodzalla, J.; Sanchez Majos, S.; Schlimme, B. S.; Walcher, Th.; Weinriefer, M.; Bosnar, D.; Makek, M.

    2010-12-10

    New precise results of a measurement of the elastic electron-proton scattering cross section performed at the Mainz Microtron MAMI are presented. About 1400 cross sections were measured with negative four-momentum transfers squared up to Q{sup 2}=1 (GeV/c){sup 2} with statistical errors below 0.2%. The electric and magnetic form factors of the proton were extracted by fits of a large variety of form factor models directly to the cross sections. The form factors show some features at the scale of the pion cloud. The charge and magnetic radii are determined to be {sup 1/2}=0.879(5){sub stat}(4){sub syst}(2){sub model}(4){sub group} fm and {sup 1/2}=0.777(13){sub stat}(9){sub syst}(5){sub model}(2){sub group} fm.

  1. Towards a Resolution of the Proton Form Factor Problem: New Electron and Positron Scattering Data

    DOE PAGESBeta

    Adikaram, D.; Rimal, D.; Weinstein, L. B.; Raue, B.; Khetarpal, P.; Bennett, R.; Arrington, J.; Brooks, W.; Adhikari, K.; Afanasev, A.; et al

    2015-02-10

    There is a significant discrepancy between the values of the proton electric form factor, GpE, extracted using unpolarized and polarized electron scattering. Calculations predict that small two-photon exchange (TPE) contributions can significantly affect the extraction of GpE from the unpolarized electron-proton cross sections. We determined the TPE contribution by measuring the ratio of positron-proton to electron-proton elastic scattering cross sections using a simultaneous, tertiary electron-positron beam incident on a liquid hydrogen target and detecting the scattered particles in the Jefferson Lab CLAS detector. This novel technique allowed us to cover a wide range in virtual photon polarization (epsilon) and momentummore » transfer (Q2) simultaneously, as well as to cancel luminosity-related systematic errors. The cross section ratio increases with decreasing ε at Q2=1.45 GeV2. This measurement is consistent with the size of the form factor discrepancy at Q2≈1.75 GeV2 and with hadronic calculations including nucleon and Delta intermediate states, which have been shown to resolve the discrepancy up to 2-3 GeV2.« less

  2. Towards a Resolution of the Proton Form Factor Problem: New Electron and Positron Scattering Data

    SciTech Connect

    Adikaram, D.; Rimal, D.; Weinstein, L. B.; Raue, B.; Khetarpal, P.; Bennett, R.; Arrington, J.; Brooks, W.; Adhikari, K.; Afanasev, A.; Amaryan, M.; Anderson, M.; Anefalos Pereira, S.; Avakian, H.; Ball, J.; Battaglieri, M.; Bedlinskiy, I.; Biselli, A.; Bono, J.; Boiarinov, S.; Briscoe, W.; Burkert, V.; Carman, D.; Careccia, S.; Celentano, A.; Chandavar, S.; Charles, G.; Colaneri, L.; Cole, P.; Contalbrigo, M.; Crede, V.; D'Angelo, A.; Dashyan, N.; De Vita, R.; De Sanctis, E.; Deur, A.; Djalali, C.; Dodge, G.; Dupre, R.; Egiyan, H.; El Alaoui, A.; El Fassi, L.; Elouadrhiri, L.; Eugenio, P.; Fedotov, G.; Fegan, S.; Filippi, A.; Fleming, J.; Fradi, A.; Garillon, B.; Gilfoyle, G.; Giovanetti, K.; Girod, F.; Goetz, J.; Gohn, W.; Golovatch, E.; Gothe, R.; Griffioen, K.; Guegan, B.; Guidal, M.; Guo, L.; Hafidi, K.; Hakobyan, H.; Hanretty, C.; Harrison, N.; Hattawy, M.; Hicks, K.; Holtrop, M.; Hughes, S.; Hyde, C. E.; Ilieva, Y.; Ireland, D.; Ishkhanov, B.; Jenkins, D.; Jiang, H.; Jo, H.; Joo, K.; Joosten, S.; Kalantarians, N.; Keller, D.; Khandaker, M.; Kim, A.; Kim, W.; Klein, A.; Klein, F.; Koirala, S.; Kubarovsky, V.; Kuhn, S.; Livingston, K.; Lu, H.; MacGregor, I.; Markov, N.; Mattione, P.; Mayer, M.; McKinnon, B.; Mestayer, M.; Meyer, C.; Mirazita, M.; Mokeev, V.; Montgomery, R.; Moody, C.; Moutarde, H.; Movsisyan, A.; Camacho, C. Munoz; Nadel-Turonski, P.; Niccolai, S.; Niculescu, G.; Osipenko, M.; Ostrovidov, A.; Park, K.; Pasyuk, E.; Pisano, S.; Pogorelko, O.; Price, J.; Procureur, S.; Prok, Y.; Protopopescu, D.; Puckett, A.; Ripani, M.; Rizzo, A.; Rosner, G.; Rossi, P.; Roy, P.; Sabati, F.; Salgado, C.; Schott, D.; Schumacher, R.; Seder, E.; Sharabian, Y.; Simonyan, A.; Skorodumina, I.; Smith, E.; Smith, G.; Sober, D.; Sokhan, D.; Sparveris, N.; Stepanyan, S.; Stoler, P.; Strauch, S.; Sytnik, V.; Taiuti, M.; Tian, Ye; Trivedi, A.; Ungaro, M.; Voskanyan, H.; Voutier, E.; Walford, N.; Watts, D.; Wei, X.; Wood, M.; Zachariou, N.; Zana, L.; Zhang, J.; Zhao, Z.; Zonta, I.

    2015-02-10

    There is a significant discrepancy between the values of the proton electric form factor, GpE, extracted using unpolarized and polarized electron scattering. Calculations predict that small two-photon exchange (TPE) contributions can significantly affect the extraction of GpE from the unpolarized electron-proton cross sections. We determined the TPE contribution by measuring the ratio of positron-proton to electron-proton elastic scattering cross sections using a simultaneous, tertiary electron-positron beam incident on a liquid hydrogen target and detecting the scattered particles in the Jefferson Lab CLAS detector. This novel technique allowed us to cover a wide range in virtual photon polarization (epsilon) and momentum transfer (Q2) simultaneously, as well as to cancel luminosity-related systematic errors. The cross section ratio increases with decreasing ε at Q2=1.45 GeV2. This measurement is consistent with the size of the form factor discrepancy at Q2≈1.75 GeV2 and with hadronic calculations including nucleon and Delta intermediate states, which have been shown to resolve the discrepancy up to 2-3 GeV2.

  3. Towards a resolution of the proton form factor problem: new electron and positron scattering data.

    PubMed

    Adikaram, D; Rimal, D; Weinstein, L B; Raue, B; Khetarpal, P; Bennett, R P; Arrington, J; Brooks, W K; Adhikari, K P; Afanasev, A V; Amaryan, M J; Anderson, M D; Anefalos Pereira, S; Avakian, H; Ball, J; Battaglieri, M; Bedlinskiy, I; Biselli, A S; Bono, J; Boiarinov, S; Briscoe, W J; Burkert, V D; Carman, D S; Careccia, S; Celentano, A; Chandavar, S; Charles, G; Colaneri, L; Cole, P L; Contalbrigo, M; Crede, V; D'Angelo, A; Dashyan, N; De Vita, R; De Sanctis, E; Deur, A; Djalali, C; Dodge, G E; Dupre, R; Egiyan, H; El Alaoui, A; El Fassi, L; Elouadrhiri, L; Eugenio, P; Fedotov, G; Fegan, S; Filippi, A; Fleming, J A; Fradi, A; Garillon, B; Gilfoyle, G P; Giovanetti, K L; Girod, F X; Goetz, J T; Gohn, W; Golovatch, E; Gothe, R W; Griffioen, K A; Guegan, B; Guidal, M; Guo, L; Hafidi, K; Hakobyan, H; Hanretty, C; Harrison, N; Hattawy, M; Hicks, K; Holtrop, M; Hughes, S M; Hyde, C E; Ilieva, Y; Ireland, D G; Ishkhanov, B S; Jenkins, D; Jiang, H; Jo, H S; Joo, K; Joosten, S; Kalantarians, N; Keller, D; Khandaker, M; Kim, A; Kim, W; Klein, A; Klein, F J; Koirala, S; Kubarovsky, V; Kuhn, S E; Livingston, K; Lu, H Y; MacGregor, I J D; Markov, N; Mattione, P; Mayer, M; McKinnon, B; Mestayer, M D; Meyer, C A; Mirazita, M; Mokeev, V; Montgomery, R A; Moody, C I; Moutarde, H; Movsisyan, A; Camacho, C Munoz; Nadel-Turonski, P; Niccolai, S; Niculescu, G; Osipenko, M; Ostrovidov, A I; Park, K; Pasyuk, E; Peña, C; Pisano, S; Pogorelko, O; Price, J W; Procureur, S; Prok, Y; Protopopescu, D; Puckett, A J R; Ripani, M; Rizzo, A; Rosner, G; Rossi, P; Roy, P; Sabatié, F; Salgado, C; Schott, D; Schumacher, R A; Seder, E; Sharabian, Y G; Simonyan, A; Skorodumina, I; Smith, E S; Smith, G D; Sober, D I; Sokhan, D; Sparveris, N; Stepanyan, S; Stoler, P; Strauch, S; Sytnik, V; Taiuti, M; Tian, Ye; Trivedi, A; Ungaro, M; Voskanyan, H; Voutier, E; Walford, N K; Watts, D P; Wei, X; Wood, M H; Zachariou, N; Zana, L; Zhang, J; Zhao, Z W; Zonta, I

    2015-02-13

    There is a significant discrepancy between the values of the proton electric form factor, G(E)(p), extracted using unpolarized and polarized electron scattering. Calculations predict that small two-photon exchange (TPE) contributions can significantly affect the extraction of G(E)(p) from the unpolarized electron-proton cross sections. We determined the TPE contribution by measuring the ratio of positron-proton to electron-proton elastic scattering cross sections using a simultaneous, tertiary electron-positron beam incident on a liquid hydrogen target and detecting the scattered particles in the Jefferson Lab CLAS detector. This novel technique allowed us to cover a wide range in virtual photon polarization (ϵ) and momentum transfer (Q(2)) simultaneously, as well as to cancel luminosity-related systematic errors. The cross section ratio increases with decreasing ϵ at Q(2)=1.45  GeV(2). This measurement is consistent with the size of the form factor discrepancy at Q(2)≈1.75  GeV(2) and with hadronic calculations including nucleon and Δ intermediate states, which have been shown to resolve the discrepancy up to 2-3  GeV(2).

  4. Towards a Resolution of the Proton Form Factor Problem: New Electron and Positron Scattering Data

    SciTech Connect

    Adikaram, D.; Rimal, D.; Weinstein, L. B.; Raue, B.; Khetarpal, P.; Bennett, R. P.; Arrington, J.; Brooks, W. K.; Adhikari, K. P.; Afanasev, A. V.; Dupre, R.; El Alaoui, A.; El Fassi, L.; Hafidi, K.; Moody, C. I.

    2015-02-10

    There is a significant discrepancy between the values of the proton electric form factor, G(E)(p), extracted using unpolarized and polarized electron scattering. Calculations predict that small two-photon exchange (TPE) contributions can significantly affect the extraction of G(E)(p). from the unpolarized electron-proton cross sections. We determined the TPE contribution by measuring the ratio of positron-proton to electron-proton elastic scattering cross sections using a simultaneous, tertiary electron-positron beam incident on a liquid hydrogen target and detecting the scattered particles in the Jefferson Lab CLAS detector. This novel technique allowed us to cover a wide range in virtual photon polarization (epsilon) and momentum transfer (Q(2)) simultaneously, as well as to cancel luminosity-related systematic errors. The cross section ratio increases with decreasing epsilon at Q(2) = 1.45 GeV2. This measurement is consistent with the size of the form factor discrepancy at Q(2) approximate to 1.75 GeV2 and with hadronic calculations including nucleon and Delta intermediate states, which have been shown to resolve the discrepancy up to 2-3 GeV2.

  5. New Precision Limit on the Strange Vector Form Factors of the Proton

    SciTech Connect

    Ahmed, Z.; Allada, K.; Aniol, K. A.; Armstrong, D. S.; Arrington, J.; Baturin, P.; Bellini, V.; Benesch, J.; Beminiwattha, R.; Benmokhtar, F.; Canan, M.; Camsonne, A.; Cates, G. D.; Chen, J. -P.; Chudakov, E.; Cisbani, E.; Dalton, M. M.; de Jager, C. W.; De Leo, R.; Deconinck, W.; Decowski, P.; Deng, X.; Deur, A.; Dutta, C.; Franklin, G. B.; Friend, M.; Frullani, S.; Garibaldi, F.; Giusa, A.; Glamazdin, A.; Golge, S.; Grimm, K.; Hansen, O.; Higinbotham, D. W.; Holmes, R.; Holmstrom, T.; Huang, J.; Huang, M.; Hyde, C. E.; Jen, C. M.; Jin, G.; Jones, D.; Kang, H.; King, P.; Kowalski, S.; Kumar, K. S.; Lee, J. H.; LeRose, J. J.; Liyanage, N.; Long, E.; McNulty, D.; Margaziotis, D.; Meddi, F.; Meekins, D. G.; Mercado, L.; Meziani, Z. -E.; Michaels, R.; Muñoz-Camacho, C.; Mihovilovic, M.; Muangma, N.; Myers, K. E.; Nanda, S.; Narayan, A.; Nelyubin, V.; Nuruzzaman, None; Oh, Y.; Pan, K.; Parno, D.; Paschke, K. D.; Phillips, S. K.; Qian, X.; Qiang, Y.; Quinn, B.; Rakhman, A.; Reimer, P. E.; Rider, K.; Riordan, S.; Roche, J.; Rubin, J.; Russo, G.; Saenboonruang, K.; Saha, A.; Sawatzky, B.; Silwal, R.; Sirca, S.; Souder, P. A.; Sperduto, M.; Subedi, R.; Suleiman, R.; Sulkosky, V.; Sutera, C. M.; Tobias, W. A.; Urciuoli, G. M.; Waidyawansa, B.; Wang, D.; Wexler, J.; Wilson, R.; Wojtsekhowski, B.; Zhan, X.; Yan, X.; Yao, H.; Ye, L.; Zhao, B.; Zheng, X.

    2012-03-01

    The parity-violating cross-section asymmetry in the elastic scattering of polarized electrons from unpolarized protons has been measured at a four-momentum transfer squared Q2 = 0.624 GeV2 and beam energy Eb = 3.48 GeV to be APV = -23.80 ± 0.78 (stat) ± 0.36 (syst) parts per million. This result is consistent with zero contribution of strange quarks to the combination of electric and magnetic form factors GEs + 0.517 GMs = 0.003 ± 0.010 (stat) ± 0.004 (syst) ± 0.009 (ff), where the third error is due to the limits of precision on the electromagnetic form factors and radiative corrections. With this measurement, the world data on strange contributions to nucleon form factors are seen to be consistent with zero and not more than a few percent of the proton form factors.

  6. New Precision Limit on the Strange Vector Form Factors of the Proton

    DOE PAGESBeta

    Ahmed, Z.; Allada, K.; Aniol, K. A.; Armstrong, D. S.; Arrington, J.; Baturin, P.; Bellini, V.; Benesch, J.; Beminiwattha, R.; Benmokhtar, F.; et al

    2012-03-01

    The parity-violating cross-section asymmetry in the elastic scattering of polarized electrons from unpolarized protons has been measured at a four-momentum transfer squared Q2 = 0.624 GeV2 and beam energy Eb = 3.48 GeV to be APV = -23.80 ± 0.78 (stat) ± 0.36 (syst) parts per million. This result is consistent with zero contribution of strange quarks to the combination of electric and magnetic form factors GEs + 0.517 GMs = 0.003 ± 0.010 (stat) ± 0.004 (syst) ± 0.009 (ff), where the third error is due to the limits of precision on the electromagnetic form factors and radiative corrections.more » With this measurement, the world data on strange contributions to nucleon form factors are seen to be consistent with zero and not more than a few percent of the proton form factors.« less

  7. Feasibility studies on time-like proton electromagnetic form factors at PANDA-FAIR

    NASA Astrophysics Data System (ADS)

    Zimmermann, Iris; Dbeyssi, Alaa; Khaneft, Dmitry

    2016-05-01

    This contribution reports on the latest status of the feasibility studies for the measurement of time-like proton electromagnetic form factors (FF's) at the PANDA experiment [1] at FAIR (Germany). Electromagnetic FF's are fundamental quantities parameterizing the electric and magnetic structure of hadrons. In the time-like region proton FF's can be accessed experimentally through the annihilation processes p ¯p → l+l- (l = e, μ), assuming that the interaction takes place through the exchange of one virtual photon. Due to the low luminosity available at colliders in the past, an individual determination of the time-like electric and magnetic proton FF's was not feasible. The statistical precision, at which the proton FF's will be determined at PANDA, is estimated for both signal processes p ¯p → l+l- (l = e, μ) using the PandaRoot software, which encompasses full detector simulation and event reconstruction. The signal identification and suppression of the main background process (p ¯p → π+π-) is studied. Different methods have been used to generate and analyze the processes of interest. The results from the different analyses show that time-like electromagnetic FF's can be measured at PANDA with unprecedented statistical accuracy.

  8. The proton form factor measurements at Jefferson Lab, past and future

    SciTech Connect

    Punjabi, Vina A.

    2014-01-01

    Use of the double-polarization technique to obtain the elastic nucleon form factors has resulted in a dramatic improvement of the quality of two of the four nucleon electromagnetic form factors, G{sub Ep} and G{sub En}. It has also changed our understanding of the proton structure, having resulted in a distinctly different Q 2-dependence for both G{sub Ep} and G{sub Mp}, contradicting the prevailing wisdom of the 1990’s based on cross section measurements, namely that G{sub Ep} and G{sub Mp} obey a “scaling” relation {mu}G{sub Ep} ~ G{sub Mp}. A related consequence of the faster decrease of G{sub Ep} revealed by the Jefferson Lab (Jlab) polarization results was the disappearance of the early scaling F{sub 2}/F{sub 1} ~ 1/Q{sup 2} predicted by perturbative QCD. In three experiments, Gep(1), Gep(2) and Gep(3), in Halls A and C at Jlab, the ratio of the proton’s electromagnetic elastic form factors, G{sub Ep} /G{sub Mp} , was measured up to four momentum transfer Q{sup 2} of 8.5 GeV{sup 2} with high precision, using the recoil polarization technique. The initial discovery that the proton form factor ratio measured in these three experiments decreases approximately linearly with four-momentum transfer, Q{sup 2}, for values above ~ 1 GeV{sup 2}, was modified by the Gep(3) results, which suggests a slowing down of this decrease. There is an approved experiment, Gep(5), to continue these measurements to 15 GeV{sup 2}. A dedicated experimental setup, the super bigbite spectrometer (SBS), will be built for this purpose. It will be equipped with a new focal plane polarimeter to measure the polarization of the recoil protons. In this presentation, I will review the status of the proton elastic electromagnetic form factors, mention succinctly a number of theoretical approaches to describe results and show some features required for the future Gep(5) experiment.

  9. Measurement of the proton form factor by studying e+e-→p p ¯

    NASA Astrophysics Data System (ADS)

    Ablikim, M.; Achasov, M. N.; Ai, X. C.; Albayrak, O.; Albrecht, M.; Ambrose, D. J.; Amoroso, A.; An, F. F.; An, Q.; Bai, J. Z.; Baldini Ferroli, R.; Ban, Y.; Bennett, D. W.; Bennett, J. V.; Bertani, M.; Bettoni, D.; Bian, J. M.; Bianchi, F.; Boger, E.; Bondarenko, O.; Boyko, I.; Briere, R. A.; Cai, H.; Cai, X.; Cakir, O.; Calcaterra, A.; Cao, G. F.; Cetin, S. A.; Chang, J. F.; Chelkov, G.; Chen, G.; Chen, H. S.; Chen, H. Y.; Chen, J. C.; Chen, M. L.; Chen, S. J.; Chen, X.; Chen, X. R.; Chen, Y. B.; Cheng, H. P.; Chu, X. K.; Cibinetto, G.; Cronin-Hennessy, D.; Dai, H. L.; Dai, J. P.; Dbeyssi, A.; Dedovich, D.; Deng, Z. Y.; Denig, A.; Denysenko, I.; Destefanis, M.; de Mori, F.; Ding, Y.; Dong, C.; Dong, J.; Dong, L. Y.; Dong, M. Y.; Du, S. X.; Duan, P. F.; Fan, J. Z.; Fang, J.; Fang, S. S.; Fang, X.; Fang, Y.; Fava, L.; Feldbauer, F.; Felici, G.; Feng, C. Q.; Fioravanti, E.; Fritsch, M.; Fu, C. D.; Gao, Q.; Gao, X. Y.; Gao, Y.; Gao, Z.; Garzia, I.; Geng, C.; Goetzen, K.; Gong, W. X.; Gradl, W.; Greco, M.; Gu, M. H.; Gu, Y. T.; Guan, Y. H.; Guo, A. Q.; Guo, L. B.; Guo, Y.; Guo, Y. P.; Haddadi, Z.; Hafner, A.; Han, S.; Han, Y. L.; Hao, X. Q.; Harris, F. A.; He, K. L.; He, Z. Y.; Held, T.; Heng, Y. K.; Hou, Z. L.; Hu, C.; Hu, H. M.; Hu, J. F.; Hu, T.; Hu, Y.; Huang, G. M.; Huang, G. S.; Huang, H. P.; Huang, J. S.; Huang, X. T.; Huang, Y.; Hussain, T.; Ji, Q.; Ji, Q. P.; Ji, X. B.; Ji, X. L.; Jiang, L. L.; Jiang, L. W.; Jiang, X. S.; Jiao, J. B.; Jiao, Z.; Jin, D. P.; Jin, S.; Johansson, T.; Julin, A.; Kalantar-Nayestanaki, N.; Kang, X. L.; Kang, X. S.; Kavatsyuk, M.; Ke, B. C.; Kliemt, R.; Kloss, B.; Kolcu, O. B.; Kopf, B.; Kornicer, M.; Kühn, W.; Kupsc, A.; Lai, W.; Lange, J. S.; Lara, M.; Larin, P.; Leng, C.; Li, C. H.; Li, Cheng; Li, D. M.; Li, F.; Li, G.; Li, H. B.; Li, J. C.; Li, Jin; Li, K.; Li, K.; Li, Lei; Li, P. R.; Li, T.; Li, W. D.; Li, W. G.; Li, X. L.; Li, X. M.; Li, X. N.; Li, X. Q.; Li, Z. B.; Liang, H.; Liang, Y. F.; Liang, Y. T.; Liao, G. R.; Lin, D. X.; Liu, B. J.; Liu, C. X.; Liu, F. H.; Liu, Fang; Liu, Feng; Liu, H. B.; Liu, H. H.; Liu, H. H.; Liu, H. M.; Liu, J.; Liu, J. P.; Liu, J. Y.; Liu, K.; Liu, K. Y.; Liu, L. D.; Liu, P. L.; Liu, Q.; Liu, S. B.; Liu, X.; Liu, X. X.; Liu, Y. B.; Liu, Z. A.; Liu, Zhiqiang; Liu, Zhiqing; Loehner, H.; Lou, X. C.; Lu, H. J.; Lu, J. G.; Lu, R. Q.; Lu, Y.; Lu, Y. P.; Luo, C. L.; Luo, M. X.; Luo, T.; Luo, X. L.; Lv, M.; Lyu, X. R.; Ma, F. C.; Ma, H. L.; Ma, L. L.; Ma, Q. M.; Ma, S.; Ma, T.; Ma, X. N.; Ma, X. Y.; Maas, F. E.; Maggiora, M.; Malik, Q. A.; Mao, Y. J.; Mao, Z. P.; Marcello, S.; Messchendorp, J. G.; Min, J.; Min, T. J.; Mitchell, R. E.; Mo, X. H.; Mo, Y. J.; Morales Morales, C.; Moriya, K.; Muchnoi, N. Yu.; Muramatsu, H.; Nefedov, Y.; Nerling, F.; Nikolaev, I. B.; Ning, Z.; Nisar, S.; Niu, S. L.; Niu, X. Y.; Olsen, S. L.; Ouyang, Q.; Pacetti, S.; Patteri, P.; Pelizaeus, M.; Peng, H. P.; Peters, K.; Pettersson, J.; Ping, J. L.; Ping, R. G.; Poling, R.; Pu, Y. N.; Qi, M.; Qian, S.; Qiao, C. F.; Qin, L. Q.; Qin, N.; Qin, X. S.; Qin, Y.; Qin, Z. H.; Qiu, J. F.; Rashid, K. H.; Redmer, C. F.; Ren, H. L.; Ripka, M.; Rong, G.; Ruan, X. D.; Santoro, V.; Sarantsev, A.; Savrié, M.; Schoenning, K.; Schumann, S.; Shan, W.; Shao, M.; Shen, C. P.; Shen, P. X.; Shen, X. Y.; Sheng, H. Y.; Song, W. M.; Song, X. Y.; Sosio, S.; Spataro, S.; Sun, G. X.; Sun, J. F.; Sun, S. S.; Sun, Y. J.; Sun, Y. Z.; Sun, Z. J.; Sun, Z. T.; Tang, C. J.; Tang, X.; Tapan, I.; Thorndike, E. H.; Tiemens, M.; Toth, D.; Ullrich, M.; Uman, I.; Varner, G. S.; Wang, B.; Wang, B. L.; Wang, D.; Wang, D. Y.; Wang, K.; Wang, L. L.; Wang, L. S.; Wang, M.; Wang, P.; Wang, P. L.; Wang, Q. J.; Wang, S. G.; Wang, W.; Wang, X. F.; Wang, Y. D.; Wang, Y. F.; Wang, Y. Q.; Wang, Z.; Wang, Z. G.; Wang, Z. H.; Wang, Z. Y.; Weber, T.; Wei, D. H.; Wei, J. B.; Weidenkaff, P.; Wen, S. P.; Wiedner, U.; Wolke, M.; Wu, L. H.; Wu, Z.; Xia, L. G.; Xia, Y.; Xiao, D.; Xiao, Z. J.; Xie, Y. G.; Xiu, Q. L.; Xu, G. F.; Xu, L.; Xu, Q. J.; Xu, Q. N.; Xu, X. P.; Yan, L.; Yan, W. B.; Yan, W. C.; Yan, Y. H.; Yang, H. X.; Yang, L.; Yang, Y.; Yang, Y. X.; Ye, H.; Ye, M.; Ye, M. H.; Yin, J. H.; Yu, B. X.; Yu, C. X.; Yu, H. W.; Yu, J. S.; Yuan, C. Z.; Yuan, W. L.; Yuan, Y.; Yuncu, A.; Zafar, A. A.; Zallo, A.; Zeng, Y.; Zhang, B. X.; Zhang, B. Y.; Zhang, C.; Zhang, C. C.; Zhang, D. H.; Zhang, H. H.; Zhang, H. Y.; Zhang, J. J.; Zhang, J. L.; Zhang, J. Q.; Zhang, J. W.; Zhang, J. Y.; Zhang, J. Z.; Zhang, K.; Zhang, L.; Zhang, S. H.; Zhang, X. Y.; Zhang, Y.; Zhang, Y. H.; Zhang, Y. T.; Zhang, Z. H.; Zhang, Z. P.; Zhang, Z. Y.; Zhao, G.; Zhao, J. W.; Zhao, J. Y.; Zhao, J. Z.; Zhao, Lei; Zhao, Ling; Zhao, M. G.; Zhao, Q.; Zhao, Q. W.; Zhao, S. J.; Zhao, T. C.; Zhao, Y. B.; Zhao, Z. G.; Zhemchugov, A.; Zheng, B.; Zheng, J. P.; Zheng, W. J.; Zheng, Y. H.; Zhong, B.; Zhou, L.; Zhou, Li; Zhou, X.; Zhou, X. K.; Zhou, X. R.; Zhou, X. Y.; Zhu, K.; Zhu, K. J.; Zhu, S.; Zhu, X. L.; Zhu, Y. C.; Zhu, Y. S.; Zhu, Z. A.; Zhuang, J.; Zotti, L.; Zou, B. S.; Zou, J. H.; Besiii Collaboration

    2015-06-01

    Using data samples collected with the BESIII detector at the BEPCII collider, we measure the Born cross section of e+e-→p p ¯ at 12 center-of-mass energies from 2232.4 to 3671.0 MeV. The corresponding effective electromagnetic form factor of the proton is deduced under the assumption that the electric and magnetic form factors are equal (|GE|=|GM|). In addition, the ratio of electric to magnetic form factors, |GE/GM|, and |GM| are extracted by fitting the polar angle distribution of the proton for the data samples with larger statistics, namely at √{s }=2232.4 and 2400.0 MeV and a combined sample at √{s }=3050.0 , 3060.0 and 3080.0 MeV, respectively. The measured cross sections are in agreement with recent results from BABAR, improving the overall uncertainty by about 30%. The |GE/GM| ratios are close to unity and consistent with BABAR results in the same q2 region, which indicates the data are consistent with the assumption that |GE|=|GM| within uncertainties.

  10. New measurement of the proton form factor ratio with polarized beam and target

    NASA Astrophysics Data System (ADS)

    Liyanage, Anusha; SANE Collaboration

    2013-10-01

    The form factors are fundamental properties of the nucleon representing the effect of its structure on the response to electromagnetic probes. The ratio of the electric and magnetic form factors of the proton has been measured with doubly polarized elastic electron-proton scattering at Q2 = 2.06 and 5.66 (GeV/c)2 using the double spin asymmetry for a target spin aligned nearly perpendicular to the beam direction. This alternative measurement of GEp /GMp has verified and confirmed the dramatic discrepancy at high Q2 between the Rosenbluth separation and polarization transfer methods with a different technique and systematic uncertainties uncorrelated to those of the recoil-polarization measurements. The measurement of the form factor ratio at Q2 = 2.06 (GeV/c)2 is in agreement with an earlier measurement with the polarized target technique at similar kinematics. The four-momentum transfer squared of Q2 = 5.66 (GeV/c)2 represents the highest Q2 value reached with the double spin asymmetry to date. The results of this experiment will be presented.

  11. Measurement of the Proton Form Factor Ratio GE /GM from Double Spin Asymmetries

    NASA Astrophysics Data System (ADS)

    Liyanage, Anusha; SANE Collaboration

    2011-04-01

    Experiment E03-109 (SANE, Spin Asymmetries of the Nucleon Experiment) was carried out in Hall C at Jefferson Lab to study the proton spin structure functions with a dynamically polarized ammonia target and longitudinally polarized electron beam. Scattered electrons were detected by the Big Electron Telescope Array (BETA), and a set of elastic data was collected by detecting the recoiling proton in the High Momentum Spectrometer (HMS) in coincidence with the electron. The measurement of the elastic double spin asymmetry allows to extract the proton electric to magnetic form factor ratio GE /GM at high four-momentum transfers, Q2 = 5.25 (GeV/c)2 and Q2 = 6.25 (GeV/c)2. In addition to the coincidence data, inclusively scattered electrons from the polarized ammonia target were detected by HMS, which allows to extract GE /GM from the beam-target asymmetry in the elastic region at lower four-momentum transfer, Q2 = 2.2 (GeV/c)2. These alternative measurements of GE /GM will verify the dramatic discrepancy at high Q2 between the Rosenbluth and the recoil polarization transfer method. The current status of the analysis will be presented.

  12. Proton Form Factor Ratio GE/GM from Double Spin Asymmetry with Polarized Beam and Target

    NASA Astrophysics Data System (ADS)

    Liyanage, Anusha

    2010-11-01

    Along with experiment E07-003 (SANE, Spin Asymmetries of the Nucleon Experiment), which has been performed in Hall C at Jefferson Lab with a polarized ammonia target to study the proton's spin structure, elastic scattering was carried out simultaneously, with electrons detected in the Big Electron Telescope Array (BETA) in coincidence with recoiling protons reconstructed by the High Momentum Spectrometer (HMS). The elastic double spin asymmetry allows to extract the proton electric to magnetic form factor ratio GE/GM at high momentum transfers, Q^2 = 5.25 (GeV/c)^2 and Q^2 = 6.25 (GeV/c)^2. In addition to the coincidence data, inclusively scattered electrons from polarized ammonia were detected by HMS, which allows to measure the beam-target asymmetry in the elastic region and to extract the GE/GM at Q^2 = 2.2 (GeV/c)^2. This alternative measurement of GE/GM will verify the dramatic discrepancy at high Q^2 between the Rosenbluth and the recoil polarization transfer method with a different technique. The current status of the analysis and some preliminary results will be presented.

  13. Monte Carlo Study of Electromagnetic Calorimeter Performance for Proton Form Factor Measurements at JLab

    NASA Astrophysics Data System (ADS)

    Obrecht, Richard; Puckett, Andrew; Super BigBite Spectrometer Collaboration

    2015-04-01

    Jefferson Lab's continuous electron beam, capable of luminosities approaching 1039 cm-2 s-1, has recently been upgraded to a maximum energy of 12 GeV, allowing the proton electromagnetic form factor ratio GEp /GMp to be measured at momentum transfer Q2 of up to 12 GeV2 via the polarization transfer method. The measurement will use the Super BigBite Spectrometer (SBS), a new magnetic spectrometer capable of operating at forward scattering angles under high luminosity conditions, to detect and measure the polarization of elastically scattered protons. The measurement of GEp /GMp also requires detection of the elastically scattered electron in coincidence using a lead-glass electromagnetic calorimeter (ECal). ECal, the subject of this talk, is based on the ``BigCal'' detector used in a predecessor experiment in Hall C, re-configured to match the acceptance of SBS for elastically scattered protons. This talk will present an overview of ECal, its role in the measurement of GEp at large Q2, and the technical challenges involved in its operation in the high-radiation environment of Hall A, followed by the results of of detailed GEANT4-based Monte Carlo simulations characterizing its expected performance under experimental conditions.

  14. Proton Magnetic Form Factor from Existing Elastic e-p Cross Section Data

    NASA Astrophysics Data System (ADS)

    Ou, Longwu; Christy, Eric; Gilad, Shalev; Keppel, Cynthia; Schmookler, Barak; Wojtsekhowski, Bogdan

    2015-04-01

    The proton magnetic form factor GMp, in addition to being an important benchmark for all cross section measurements in hadron physics, provides critical information on proton structure. Extraction of GMp from e-p cross section data is complicated by two-photon exchange (TPE) effects, where available calculations still have large theoretical uncertainties. Studies of TPE contributions to e-p scattering have observed no nonlinear effects in Rosenbluth separations. Recent theoretical investigations show that the TPE correction goes to 0 when ɛ approaches 1, where ɛ is the virtual photon polarization parameter. In this talk, existing e-p elastic cross section data are reanalyzed by extrapolating the reduced cross section for ɛ approaching 1. Existing polarization transfer data, which is supposed to be relatively immune to TPE effects, are used to produce a ratio of electric and magnetic form factors. The extrapolated reduced cross section and polarization transfer ratio are then used to calculate GEp and GMp at different Q2 values.

  15. Measurements of the deuteron and proton magnetic form factors at large momentum transfers

    SciTech Connect

    Bosted, P.E.; Katramatou, A.T.; Arnold, R.G.; Benton, D.; Clogher, L.; DeChambrier, G.; Lambert, J.; Lung, A.; Petratos, G.G.; Rahbar, A.; Rock, S.E.; Szalata, Z.M. ); Debebe, B.; Frodyma, M.; Hicks, R.S.; Hotta, A.; Peterson, G.A. ); Gearhart, R.A. ); Alster, J.; Lichtenstadt, J. ); Dietrich, F.; van Bibber, K. )

    1990-07-01

    Measurements of the deuteron elastic magnetic structure function {ital B}({ital Q}{sup 2}) are reported at squared four-momentum transfer values 1.20{le}{ital Q}{sup 2}{le}2.77 (GeV/{ital c}){sup 2}. Also reported are values for the proton magnetic form factor {ital G}{sub {ital M}{ital p}}({ital Q}{sup 2}) at 11 {ital Q}{sup 2} values between 0.49 and 1.75 (GeV/{ital c}){sup 2}. The data were obtained using an electron beam of 0.5 to 1.3 GeV. Electrons backscattered near 180{degree} were detected in coincidence with deuterons or protons recoiling near 0{degree} in a large solid-angle double-arm spectrometer system. The data for {ital B}({ital Q}{sup 2}) are found to decrease rapidly from {ital Q}{sup 2}=1.2 to 2 (GeV/{ital c}){sup 2}, and then rise to a secondary maximum around {ital Q}{sup 2}=2.5 (GeV/{ital c}){sup 2}. Reasonable agreement is found with several different models, including those in the relativistic impulse approximation, nonrelativistic calculations that include meson-exchange currents, isobar configurations, and six-quark configurations, and one calculation based on the Skyrme model. All calculations are very sensitive to the choice of deuteron wave function and nucleon form factor parametrization. The data for {ital G}{sub {ital M}{ital p}}({ital Q}{sup 2}) are in good agreement with the empirical dipole fit.

  16. The Proton Elastic Form Factor Ratio mu(p) G**p(E)/G**p(M) at Low Momentum Transfer

    SciTech Connect

    G. Ron; J. Glister; B. Lee; K. Allada; W. Armstrong; J. Arrington; A. Beck; F. Benmokhtar; B.L. Berman; W. Boeglin; E. Brash; A. Camsonne; J. Calarco; J. P. Chen; Seonho Choi; E. Chudakov; L. Coman; B. Craver; F. Cusanno; J. Dumas; C. Dutta; R. Feuerbach; A. Freyberger; S. Frullani; F. Garibaldi; R. Gilman; O. Hansen; D. W. Higinbotham; T. Holmstrom; C.E. Hyde; H. Ibrahim; Y. Ilieva; C. W. de Jager; X. Jiang; M. K. Jones; A. Kelleher; E. Khrosinkova; E. Kuchina; G. Kumbartzki; J. J. LeRose; R. Lindgren; P. Markowitz; S. May-Tal Beck; E. McCullough; D. Meekins; M. Meziane; Z.-E. Meziani; R. Michaels; B. Moffit; B.E. Norum; Y. Oh; M. Olson; M. Paolone; K. Paschke; C. F. Perdrisat; E. Piasetzky; M. Potokar; R. Pomatsalyuk; I. Pomerantz; A. Puckett; V. Punjabi; X. Qian; Y. Qiang; R. Ransome; M. Reyhan; J. Roche; Y. Rousseau; A. Saha; A.J. Sarty; B. Sawatzky; E. Schulte; M. Shabestari; A. Shahinyan; R. Shneor; S. ˇ Sirca; K. Slifer; P. Solvignon; J. Song; R. Sparks; R. Subedi; S. Strauch; G. M. Urciuoli; K. Wang; B. Wojtsekhowski; X. Yan; H. Yao; X. Zhan; X. Zhu

    2007-11-01

    High precision measurements of the proton elastic form factor ratio have been made at four-momentum transfers, Q^2, between 0.2 and 0.5 GeV^2. The new data, while consistent with previous results, clearly show a ratio less than unity and significant differences from the central values of several recent phenomenological fits. By combining the new form-factor ratio data with an existing cross-section measurement, one finds that in this Q^2 range the deviation from unity is primarily due to GEp being smaller than the dipole parameterization.

  17. High-precision measurement of the proton elastic form factor ratio μpGE/GM at low Q2

    DOE PAGESBeta

    Zhan, X.; Allada, K.; Armstrong, D. S.; Arrington, J.; Bertozzi, W.; Boeglin, W.; Chen, J. -P.; Chirapatpimol, K.; Choi, S.; Chudakov, E.; et al

    2011-10-06

    Here, we report a new high precision measurement of the proton elastic form factor ratio μpGE/GM for the four-momentum transfer squared Q2 = 0.3-0.7 (GeV/c)2. The measurement was performed at Jefferson Lab (JLab) in Hall A using recoil polarimetry. With the achieved ~1% total uncertainty, the new data clearly show that the deviation of the ratio μpGE/GM from unity observed in previous polarization measurements at high Q2 continues down to the lowest Q2 value of this measurement. The updated global fit that includes the new results yields in this Q2 range an electric (magnetic) form factor ~2% smaller (~1% larger)more » than the previous global fit. We obtain new extractions of the proton electric and magnetic radii, which are (rE2)1/2 = 0.875 ± 0.010 fm and (rM2)1/2 = 0.867 ± 0.020 fm. Moreover, the charge radius is consistent with other recent extractions based on the electron-proton interaction, including the atomic hydrogen Lamb shift measruements, which suggests a missing correction in the comparison of measurements of the proton charge radius using electron probes and the recent extraction from the muonic hydrogen Lamb shift.« less

  18. High Precision Measurement of the Proton Elastic Form Factor Ratio at Low Q2

    SciTech Connect

    Zhan, Xiaohui

    2010-01-01

    Experiment E08-007 measured the proton elastic form factor ratio μpGE/GM in the range of Q2 = 0.3-0.7(GeV/c)2 by recoil polarimetry. Data were taken in 2008 at the Thomas Jefferson National Accelerator Facility in Virginia, USA. A 1.2 GeV polarized electron beam was scattered off a cryogenic hydrogen target. The recoil proton was detected in the left HRS in coincidence with the elasticly scattered electrons tagged by the BigBite spectrometer. The proton polarization was measured by the focal plane polarimeter (FPP). In this low Q2 region, previous measurement from Jefferson Lab Hall A (LEDEX) along with various fits and calculations indicate substantial deviations of the ratio from unity. For this new measurement, the proposed statistical uncertainty (< 1%) was achieved. These new results are a few percent lower than expected from previous world data and fits, which indicate a smaller GEp at this region. Beyond the intrinsic interest in nucleon structure, the new results also have implications in determining the proton Zemach radius and the strangeness form factors from parity violation experiments.

  19. High-precision measurement of the proton elastic form factor ratio μpGE /GM at low Q2

    NASA Astrophysics Data System (ADS)

    Zhan, X.; Allada, K.; Armstrong, D. S.; Arrington, J.; Bertozzi, W.; Boeglin, W.; Chen, J.-P.; Chirapatpimol, K.; Choi, S.; Chudakov, E.; Cisbani, E.; Decowski, P.; Dutta, C.; Frullani, S.; Fuchey, E.; Garibaldi, F.; Gilad, S.; Gilman, R.; Glister, J.; Hafidi, K.; Hahn, B.; Hansen, J.-O.; Higinbotham, D. W.; Holmstrom, T.; Holt, R. J.; Huang, J.; Huber, G. M.; Itard, F.; de Jager, C. W.; Jiang, X.; Johnson, M.; Katich, J.; de Leo, R.; LeRose, J. J.; Lindgren, R.; Long, E.; Margaziotis, D. J.; May-Tal Beck, S.; Meekins, D.; Michaels, R.; Moffit, B.; Norum, B. E.; Olson, M.; Piasetzky, E.; Pomerantz, I.; Protopopescu, D.; Qian, X.; Qiang, Y.; Rakhman, A.; Ransome, R. D.; Reimer, P. E.; Reinhold, J.; Riordan, S.; Ron, G.; Saha, A.; Sarty, A. J.; Sawatzky, B.; Schulte, E. C.; Shabestari, M.; Shahinyan, A.; Shneor, R.; Širca, S.; Solvignon, P.; Sparveris, N. F.; Strauch, S.; Subedi, R.; Sulkosky, V.; Vilardi, I.; Wang, Y.; Wojtsekhowski, B.; Ye, Z.; Zhang, Y.

    2011-11-01

    We report a new, high-precision measurement of the proton elastic form factor ratio μpGE /GM for the four-momentum transfer squared Q2 = 0.3- 0.7(GeV / c) 2. The measurement was performed at Jefferson Lab (JLab) in Hall A using recoil polarimetry. With a total uncertainty of approximately 1%, the new data clearly show that the deviation of the ratio μpGE /GM from unity observed in previous polarization measurements at high Q2 continues down to the lowest Q2 value of this measurement. The updated global fit that includes the new results yields an electric (magnetic) form factor roughly 2% smaller (1% larger) than the previous global fit in this Q2 range. We obtain new extractions of the proton electric and magnetic radii, which are 1 / 2 = 0.875 ± 0.010 fm and 1 / 2 = 0.867 ± 0.020 fm. The charge radius is consistent with other recent extractions based on the electron-proton interaction, including the atomic hydrogen Lamb shift measurements, which suggests a missing correction in the comparison of measurements of the proton charge radius using electron probes and the recent extraction from the muonic hydrogen Lamb shift.

  20. New Measurement of Parity Violation in Elastic Electron-Proton Scattering and Implications for Strange Form Factors

    SciTech Connect

    Konrad Aniol; David Armstrong; Todd Averett; Maud Baylac; Etienne Burtin; John Calarco; Gordon Cates; Christian Cavata; Zhengwei Chai; C. Chang; Jian-Ping Chen; Eugene Chudakov; Evaristo Cisbani; Marius Coman; Daniel Dale; Alexandre Deur; Pibero Djawotho; Martin Epstein; Stephanie Escoffier; Lars Ewell; Nicolas Falletto; John Finn; A. Fleck; Bernard Frois; Salvatore Frullani; Juncai Gao; Franco Garibaldi; Ashot Gasparian; G. M. Gerstner; Ronald Gilman; Oleksandr Glamazdin; Javier Gomez; Viktor Gorbenko; Jens-ole Hansen; F. Hersman; Douglas Higinbotham; Richard Holmes; Maurik Holtrop; Thomas Humensky; Sebastien Incerti; Mauro Iodice; Cornelis De Jager; Johann Jardillier; Xiaodong Jiang; Mark Jones; J. Jorda; Christophe Jutier; W. Kahl; James Kelly; Donghee Kim; M. -J. Kim; Minsuk Kim; Ioannis Kominis; Edgar Kooijman; Kevin Kramer; Krishna Kumar; Michael Kuss; John LeRose; Raffaele De Leo; M. Leuschner; David Lhuillier; Meihua Liang; Nilanga Liyanage; R. Lourie; Richard Madey; Sergey Malov; Demetrius Margaziotis; Frederic Marie; Pete Markowitz; Jacques Martino; Peter Mastromarino; Kathy McCormick; Justin McIntyre; Zein-Eddine Meziani; Robert Michaels; Brian Milbrath; Gerald Miller; Joseph Mitchell; Ludyvine Morand; Damien Neyret; Gerassimos Petratos; Roman Pomatsalyuk; John Price; David Prout; Thierry Pussieux; Gilles Quemener; Ronald Ransome; David Relyea; Yves Roblin; Julie Roche; Gary Rutledge; Paul Rutt; Marat Rvachev; Franck Sabatie; Arunava Saha; Paul Souder; Marcus Spradlin; Steffen Strauch; Riad Suleiman; Jeffrey Templon; T. Teresawa; James Thompson; Raphael Tieulent; Luminita Todor; Baris Tonguc; Paul Ulmer; Guido Urciuoli; Branislav Vlahovic; Krishni Wijesooriya; R. Wilson; Bogdan Wojtsekhowski; Rhett Woo; Wang Xu; Imran Younus; C. Zhang

    2001-06-01

    We have measured the parity-violating electroweak asymmetry in the elastic scattering of polarized electrons from the proton. The result is A = -15.05 +- 0.98(stat) {+-} 0.56(syst) ppm at the kinematic point theta{sub lab} = 12.3 degrees and Q{sup 2} = 0.477 (GeV/c){sup 2}. The measurement implies that the value for the strange form factor (G{sub E}{sup s} + 0.392 G{sub M}{sup s})/(G{sub M}{sup p} {mu}{sub p}) = 0.069 +- 0.056 +- 0.039, where the first error is experimental and the second arises from the uncertainties in electromagnetic form factors. This measurement is the first fixed-target parity violation experiment that used either a ''strained'' GaAs photocathode to produce highly polarized electrons or a Compton polarimeter to continuously monitor the electron beam polarization.

  1. Parity-Violating Electron Deuteron Scattering and the Proton's Neutral Weak Axial Vector Form Factor

    SciTech Connect

    Ito, Takeyasu; Averett, Todd; Barkhuff, David; Batigne, Guillaume; Beck, Douglas; Beise, Elizabeth; Blake, A.; Breuer, Herbert; Carr, Robert; Clasie, Benjamin; Covrig, Silviu; Danagoulian, Areg; Dodson, George; Dow, Karen; Dutta, Dipangkar; Farkhondeh, Manouchehr; Filippone, Bradley; FRANKLIN, W.; Furget, Christophe; Gao, Haiyan; Gao, Juncai; Gustafsson, Kenneth; Hannelius, Lars; Hasty, R.; Allen, Alice; Herda, M.C.; Jones, CE; King, Paul; Korsch, Wolfgang; Kowalski, Stanley; Kox, Serge; Kramer, Kevin; Lee, P.; Liu, Jinghua; Martin, Jeffery; McKeown, Robert; Mueller, B.; Pitt, Mark; Plaster, Bradley; Quemener, Gilles; Real, Jean-Sebastien; Ritter, J.; Roche, Julie; Savu, V.; Schiavilla, Rocco; Seely, Charles; Spayde, Damon; Suleiman, Riad; Taylor, S.; Tieulent, Raphael; Tipton, Bryan; Tsentalovich, E.; Wells, Steven; Yang, Bin; Yuan, Jing; Yun, Junho; Zwart, Townsend

    2004-03-01

    We report on a new measurement of the parity-violating asymmetry in quasielastic electron scattering from the deuteron at backward angles at Q2 = 0.038 (GeV/c)2. This quantity provides a determination of the neutral weak axial vector form factor of the nucleon, which can potentially receive large electroweak corrections. The measured asymmetry A = z3.51±0.57 (stat)±0.58 (syst) ppm is consistent with theoretical predictions. We also report on updated results of the previous experiment at Q2 = 0.091 (GeV/c)2, which are also consistent with theoretical predictions.

  2. A Precision Measurement of the Proton Strange-Quark Form Factors at Q2 = 0.624 GeV2

    NASA Astrophysics Data System (ADS)

    Friend, Megan Lynn

    The parity-violating asymmetry of the elastic scattering of highly polarized 3.84 GeV electrons from unpolarized protons at Q2 = 0.624 GeV2 has been measured to high precision. The measurement was carried out by the HAPPEX collaboration in Hall A of Jefferson Lab's Continuous Electron Beam Accelerator Facility. This precision measurement required careful control of any potential systematic effects, as well as a very precise determination of the absolute electron-beam polarization. In order to obtain the required precision on the electron-beam polarization measurement, an upgrade of the Hall A Compton polarimeter, and, in particular, the polarimeter's photon-arm detector and data acquisition system, was completed. A parity-violating asymmetry of APV = --23.80 +/- 0.78(stat) +/- 0.36(syst) ppm was measured. The predicted parity-violating asymmetry in the absence of strange quarks is ANS = --24.062 +/- 0.734 ppm. This allows for the extraction of the linear combination of proton strange-quark form factors GsE + 0.517 GsM = 0.003 +/- 0.010(stat) +/- 0.004(syst) +/- 0.009( ANS), where the third error is due to uncertainties in the nucleon electromagnetic form factors and radiative corrections. This measurement is consistent with zero strange contribution to the proton form factors at Q2 = 0.624 GeV2.

  3. Proton form factor ratio, micro(p) G(p as power)E/G(p as power)M from double spin asymmetry

    NASA Astrophysics Data System (ADS)

    Habarakada Liyanage, Anusha Pushpakumari

    The form factors are fundamental properties of the nucleon representing the effect of its structure on its response to electromagnetic probes such as electrons. They are functions of the four-momentum transfer squared Q² between the electron and the proton. This thesis reports the results of a new measurement of the ratio of the electric and magnetic form factors of the proton up to Q² = 5.66 (GeV/c)² using the double spin asymmetry with a polarized beam and target. Experiment E07-003 (SANE, Spin Asymmetries of the Nucleon Experiment) was carried out in Hall C at Jefferson Lab in 2009 to study the proton spin structure functions with a dynamically polarized ammonia target and longitudinally polarized electron beam. By detecting elastically scattered protons in the High-Momentum Spectrometer (HMS) in coincidence with the electrons in the Big Electron Telescope Array (BETA), elastic measurements were carried out in parallel. The elastic double spin asymmetry allows one to extract the proton electric to magnetic form factor ratio GpE/GpM at high-momentum transfer, Q² = 5.66 (GeV/c)². In addition to the coincidence data, inclusively scattered electrons from the polarized ammonia target were detected by HMS, which allows to measure the beam-target asymmetry in the elastic region with the target spin nearly perpendicular to the momentum transfer, and to extract GpE/GpM at low Q² = 2.06 (GeV/c)². This alternative measurement of GpE/GpM has verified and confirmed the dramatic discrepancy at high Q² between the Rosenbluth and the recoil-polarization-transfer method with a different measurement technique and systematic uncertainties uncorrelated to those of the recoil-polarization measurements. The measurement of the form factor ratio at Q² = 2.06 (GeV/c)² has been determined as μP GpE/GpM = 0.605 +/- 0.178stat +/- 0.033 sys which is in agreement with an earlier measurement with the polarized target technique at similar kinematics. The measurement of the form

  4. Nucleon Electromagnetic Form Factors

    SciTech Connect

    Marc Vanderhaeghen; Charles Perdrisat; Vina Punjabi

    2007-10-01

    There has been much activity in the measurement of the elastic electromagnetic proton and neutron form factors in the last decade, and the quality of the data has greatly improved by performing double polarization experiments, in comparison with previous unpolarized data. Here we review the experimental data base in view of the new results for the proton, and neutron, obtained at JLab, MAMI, and MIT-Bates. The rapid evolution of phenomenological models triggered by these high-precision experiments will be discussed, including the recent progress in the determination of the valence quark generalized parton distributions of the nucleon, as well as the steady rate of improvements made in the lattice QCD calculations.

  5. Nucleon Electromagnetic Form Factors

    SciTech Connect

    Kees de Jager

    2004-08-01

    Although nucleons account for nearly all the visible mass in the universe, they have a complicated structure that is still incompletely understood. The first indication that nucleons have an internal structure, was the measurement of the proton magnetic moment by Frisch and Stern (1933) which revealed a large deviation from the value expected for a point-like Dirac particle. The investigation of the spatial structure of the nucleon, resulting in the first quantitative measurement of the proton charge radius, was initiated by the HEPL (Stanford) experiments in the 1950s, for which Hofstadter was awarded the 1961 Nobel prize. The first indication of a non-zero neutron charge distribution was obtained by scattering thermal neutrons off atomic electrons. The recent revival of its experimental study through the operational implementation of novel instrumentation has instigated a strong theoretical interest. Nucleon electro-magnetic form factors (EMFFs) are optimally studied through the exchange of a virtual photon, in elastic electron-nucleon scattering. The momentum transferred to the nucleon by the virtual photon can be selected to probe different scales of the nucleon, from integral properties such as the charge radius to scaling properties of its internal constituents. Polarization instrumentation, polarized beams and targets, and the measurement of the polarization of the recoiling nucleon have been essential in the accurate separation of the charge and magnetic form factors and in studies of the elusive neutron charge form factor.

  6. Precision Measurement of the proton neutral weak form factors at Q2 ~ 0.1 GeV2

    SciTech Connect

    Kaufman, Lisa J.

    2007-02-01

    This thesis reports the HAPPEX measurement of the parity-violating asymmetry for longitudinally polarized electrons elastically scattered from protons in a liquid hydrogen target. The measurement was carried out in Hall A at Thomas Jefferson National Accelerator Facility using a beam energy E = 3 GeV and scattering angle <θ{sub lab}> = 6°. The asymmetry is sensitive to the weak neutral form factors from which we extract the strange quark electric and magnetic form factors (G$s\\atop{E}$ and G$s\\atop{M}$) of the proton. The measurement was conducted during two data-taking periods in 2004 and 2005. This thesis describes the methods for controlling the helicity-correlated beam asymmetries and the analysis of the raw asymmetry. The parity-violating asymmetry has been measured to be APV = -1.14± 0.24 (stat)±0.06 (syst) ppm at 2> = 0.099 GeV2 (2004), and APV = -1.58±0.12 (stat)±0.04 (syst) ppm at 2> = 0.109 GeV2 (2005). The strange quark form factors extracted from the asymmetry are G$s\\atop{E}$ + 0.080G$s\\atop{M}$ = 0.030 ± 0.025 (stat) ± 0.006 (syst) ± 0.012 (FF) (2004) and G$s\\atop{E}$ +0.088G$s\\atop{M}$ = 0.007±0.011 (stat)±0.004 (syst)±0.005 (FF) (2005). These results place the most precise constraints on the strange quark form factors and indicate little strange dynamics in the proton.

  7. Anomalous tensor magnetic moments and form factors of the proton in the self-consistent chiral quark-soliton model

    SciTech Connect

    Ledwig, Tim; Silva, Antonio

    2010-09-01

    We investigate the form factors of the chiral-odd nucleon matrix element of the tensor current. In particular, we aim at the anomalous tensor magnetic form factors of the nucleon within the framework of the SU(3) and SU(2) chiral quark-soliton model. We consider 1/N{sub c} rotational corrections and linear effects of SU(3) symmetry breaking with the symmetry-conserving quantization employed. We first obtain the results of the anomalous tensor magnetic moments for the up and down quarks: {kappa}{sub T}{sup u}=3.56 and {kappa}{sub T}{sup d}=1.83, respectively. The strange anomalous tensor magnetic moment is yielded to be {kappa}{sub T}{sup s}=0.2{approx}-0.2, that is compatible with zero. We also calculate the corresponding form factors {kappa}{sub T}{sup q}(Q{sup 2}) up to a momentum transfer Q{sup 2{<=}}1 GeV{sup 2} at a renormalization scale of 0.36 GeV{sup 2}.

  8. Proton elastic form factor ratios to Q{sup 2} = 3.5 GeV{sup 2} by polarization transfer

    SciTech Connect

    V. Punjabi; C.F. Perdrisat; et al

    2005-01-01

    The ratio of the proton elastic electromagnetic form factors, G{sub E{sub p}}/G{sub M{sub p}}, was obtained by measuring P{sub t} and P{sub {ell}}, the transverse and longitudinal recoil proton polarization components, respectively, for the elastic {rvec e}p {yields} e{rvec p} reaction in the four-momentum transfer squared range of 0.5 to 3.5 GeV{sup 2}. In the single-photon exchange approximation, the ratio G{sub E{sub p}}/G{sub M{sub p}} is directly proportional to the ratio P{sub t}/P{sub {ell}}. The simultaneous measurement of P{sub t} and P{sub {ell}} in a polarimeter reduces systematic uncertainties. The results for the ratio G{sub E{sub p}}/G{sub M{sub p}} show a systematic decrease with increasing Q{sup 2}, indicating for the first time a definite difference in the distribution of charge and magnetization in the proton. The data have been re-analyzed and systematic uncertainties have become significantly smaller than previously published results.

  9. Proton elastic form factor ratios to Q{sup 2}=3.5 GeV{sup 2} by polarization transfer

    SciTech Connect

    Punjabi, V.; Perdrisat, C.F.; Gerstner, G.; Pentchev, L.; Rutledge, G.; Strauch, S.; Wijesooriya, K.; Aniol, K.A.; Epstein, M.B.; Margaziotis, D.J.; Baker, F.T.; Templon, J.A.; Berthot, J.; Bertin, P.Y.; Besson, A.; Fonvieille, H.; Jaminion, S.; Laveissiere, G.

    2005-05-01

    The ratio of the proton elastic electromagnetic form factors, G{sub Ep}/G{sub Mp}, was obtained by measuring P{sub t} and P{sub l}, the transverse and longitudinal recoil proton polarization components, respectively, for the elastic e{sup {yields}}p{yields}ep{sup {yields}}reaction in the four-momentum transfer squared range of 0.5 to 3.5 GeV{sup 2}. In the single-photon exchange approximation, G{sub Ep}/G{sub Mp} is directly proportional to P{sub t}/P{sub l}. The simultaneous measurement of P{sub t} and P{sub l} in a polarimeter reduces systematic uncertainties. The results for G{sub Ep}/G{sub Mp} show a systematic decrease with increasing Q{sup 2}, indicating for the first time a definite difference in the distribution of charge and magnetization in the proton. The data have been reanalyzed and their systematic uncertainties have become significantly smaller than those reported previously.

  10. Proton form factor ratio, μpGEP/GMP from double spin asymmetry

    SciTech Connect

    Habarakada Liyanage, Anusha Pushpakumari

    2013-08-01

    The form factors are fundamental properties of the nucleon representing the effect of its structure on its response to electromagnetic probes such as electrons. They are functions of the four-momentum transfer squared Q2 between the electron and the proton. This thesis reports the results of a new measurement of the ratio of the electric and magnetic form factors of the proton up to Q2 = 5.66 (GeV/c)2 using the double spin asymmetry with a polarized beam and target. Experiment E07-003 (SANE, Spin Asymmetries of the Nucleon Experiment) was carried out in Hall C at Jefferson Lab in 2009 to study the proton spin structure functions with a dynamically polarized ammonia target and longitudinally polarized electron beam. By detecting elastically scattered protons in the High-Momentum Spectrometer (HMS) in coincidence with the electrons in the Big Electron Telescope Array (BETA), elastic measurements were carried out in parallel. The elastic double spin asymmetry allows one to extract the proton electric to magnetic form factor ratio GpE/GpM at high-momentum transfer, Q2= 5.66 (GeV/c)2. In addition to the coincidence data, inclusively scattered electrons from the polarized ammonia target were detected by HMS, which allows to measure the beam-target asymmetry in the elastic region with the target spin nearly perpendicular to the momentum transfer, and to extract GpE/GpM at low Q2= 2.06 (GeV/c)2. This alternative measurement of GpE/GpM has verified and confirmed the dramatic discrepancy at high Q2 between the Rosenbluth and the recoil-polarization-transfer iv method with a different measurement technique and systematic uncertainties uncorrelated to those of the recoil-polarization measurements. The measurement of the form factor ratio at Q2 = 2

  11. Final analysis of proton form factor ratio data at Q2 = 4.0, 4.8, and 5.6 GeV2

    DOE PAGESBeta

    Puckett, A. J. R.; Brash, E. J.; Gayou, O.; Jones, M. K.; Pentchev, L.; Perdrisat, C. F.; Punjabi, V.; Aniol, K. A.; Averett, T.; Benmokhtar, F.; et al

    2012-04-11

    Recently published measurements of the proton electromagnetic form factor ratio R = μp GEp/GMp at momentum transfers Q2 up to 8.5 GeV2 in Jefferson Lab Hall C deviate from the linear trend of previous measurements in Jefferson Lab Hall A, favoring a slower rate of decrease of R with Q2. While statistically compatible in the region of overlap with Hall A, the Hall C data hint at a systematic difference between the two experiments. This possibility was investigated in a reanalysis of the Hall A data. We find that the original analysis underestimated the background in the selection of elasticmore » events. The application of an additional cut to further suppress the background increases the results for R, improving the consistency between Halls A and C.« less

  12. Measurements of the electric and magnetic form factors of the proton from Q sup 2 =1. 75 to 8. 83 (GeV/ c ) sup 2

    SciTech Connect

    Bosted, P.E.; Andivahis, L.; Lung, A.; Stuart, L.M.; Alster, J.; Arnold, R.G.; Chang, C.C.; Dietrich, F.S.; Dodge, W.; Gearhart, R.; Gomez, J.; Griffioen, K.A.; Hicks, R.S.; Hyde-Wright, C.E.; Keppel, C.; Kuhn, S.E.; Lichtenstadt, J.; Miskimen, R.A.; Peterson, G.A.; Petratos, G.G.; Rock, S.E.; Rokni, S.; Sakumoto, W.K.; Spengos, M.; Swartz, K.; Szalata, Z.; Tao, L.H. University of California, Davis, California 95616 Continuous Electron Beam Acceleratorr Facility, Newport News, Virginia 23606 Lawrence Livermore National Laboratory, Livermore, California 94550 University of Maryland, College Park, Maryland 20742 University of Massachusetts, Amherst, Massachusetts 01003 National Institute of Standards and Technology, Gaithersburg, Maryland 20899 University of Pennsylvania, Philadelphia, Pennsylvania 19104 Universi

    1992-06-29

    The proton elastic electric and magnetic form factors, {ital G}{sub {ital E}{ital p}}({ital Q}{sup 2}) and {ital G}{sub {ital M}{ital p}}({ital Q}{sup 2}), have been separately measured in the range {ital Q}{sup 2}=1.75 to 8.83 (GeV/{ital c}){sup 2}, more than doubling the {ital Q}{sup 2} range of previous data. Scaled by the dipole fit, {ital G}{sub {ital D}}({ital Q}{sup 2}), the results for {ital G}{sub {ital M}{ital p}}({ital Q}{sup 2})/{mu}{sub {ital p}G{ital D}}({ital Q}{sup 2}) decrease smoothly from 1.05 to 0.91, while {ital G}{sub {ital E}{ital p}}({ital Q}{sup 2})/{ital G}{sub {ital D}}({ital Q}{sup 2}) is consistent with unity. Comparisons are made to QCD sum rule, diquark, constitutent quark, and vector meson dominance models, none of which agree with all of the new data. The ratio {ital Q}{sup 2}{ital F}{sub 2}/{ital F}{sub 1} approaches a constant value for {ital Q}{sup 2}{gt}3 (GeV/{ital c}){sup 2}.

  13. Final analysis of proton form factor ratio data at Q2=4.0, 4.8, and 5.6 GeV2

    NASA Astrophysics Data System (ADS)

    Puckett, A. J. R.; Brash, E. J.; Gayou, O.; Jones, M. K.; Pentchev, L.; Perdrisat, C. F.; Punjabi, V.; Aniol, K. A.; Averett, T.; Benmokhtar, F.; Bertozzi, W.; Bimbot, L.; Calarco, J. R.; Cavata, C.; Chai, Z.; Chang, C.-C.; Chang, T.; Chen, J. P.; Chudakov, E.; De Leo, R.; Dieterich, S.; Endres, R.; Epstein, M. B.; Escoffier, S.; Fissum, K. G.; Fonvieille, H.; Frullani, S.; Gao, J.; Garibaldi, F.; Gilad, S.; Gilman, R.; Glamazdin, A.; Glashausser, C.; Gomez, J.; Hansen, J.-O.; Higinbotham, D.; Huber, G. M.; Iodice, M.; de Jager, C. W.; Jiang, X.; Khandaker, M.; Kozlov, S.; Kramer, K. M.; Kumbartzki, G.; LeRose, J. J.; Lhuillier, D.; Lindgren, R. A.; Liyanage, N.; Lolos, G. J.; Margaziotis, D. J.; Marie, F.; Markowitz, P.; McCormick, K.; Michaels, R.; Milbrath, B. D.; Nanda, S. K.; Neyret, D.; Piskunov, N. M.; Ransome, R. D.; Raue, B. A.; Roché, R.; Rvachev, M.; Salgado, C.; Sirca, S.; Sitnik, I.; Strauch, S.; Todor, L.; Tomasi-Gustafsson, E.; Urciuoli, G. M.; Voskanyan, H.; Wijesooriya, K.; Wojtsekhowski, B. B.; Zheng, X.; Zhu, L.

    2012-04-01

    Precise measurements of the proton electromagnetic form factor ratio R=μpGEp/GMp using the polarization transfer method at Jefferson Lab have revolutionized the understanding of nucleon structure by revealing the strong decrease of R with momentum transfer Q2 for Q2≳1 GeV2, in strong disagreement with previous extractions of R from cross-section measurements. In particular, the polarization transfer results have exposed the limits of applicability of the one-photon-exchange approximation and highlighted the role of quark orbital angular momentum in the nucleon structure. The GEp-II experiment in Jefferson Lab's Hall A measured R at four Q2 values in the range 3.5GeV2≤Q2≤5.6GeV2. A possible discrepancy between the originally published GEp-II results and more recent measurements at higher Q2 motivated a new analysis of the GEp-II data. This article presents the final results of the GEp-II experiment, including details of the new analysis, an expanded description of the apparatus, and an overview of theoretical progress since the original publication. The key result of the final analysis is a systematic increase in the results for R, improving the consistency of the polarization transfer data in the high-Q2 region. This increase is the result of an improved selection of elastic events which largely removes the systematic effect of the inelastic contamination, underestimated by the original analysis.

  14. The Form Factors of the Nucleons

    SciTech Connect

    Perdrisat, Charles F.

    2013-11-01

    There has been much activity in the measurement of the elastic electromagnetic proton and neutron form factors in the last decade, and the quality of the data has been greatly improved by performing double-polarization experiments, in comparison with with pre-vious unpolarized cross section data. Here we will review the experimental data base in view of the new results for the proton and the neutron, obtained at MIT-Bates, JLab and MAMI. The rapid evolution of phenomenological models triggered by these high- precision experiments will be discussed. In particular, the possibility that the proton is non-spherical in its ground state, and that the transverse charge density are model in- dependently defined in the infinite momentum frame. Likewise, flavor decomposition of the nucleon form factors into dressed u and d quark form factors, may give information about the quark-diquark structure of the nucleon. The current proton radius "crisis" will also be discussed.

  15. The form factors of the nucleons

    NASA Astrophysics Data System (ADS)

    Perdrisat, C. F.

    2013-11-01

    There has been much activity in the measurement of the elastic electromagnetic proton and neutron form factors in the last decade, and the quality of the data has been greatly improved by performing double-polarization experiments, in comparison with with previous unpolarized cross section data. Here we will review the experimental data base in view of the new results for the proton and the neutron, obtained at MIT-Bates, JLab and MAMI. The rapid evolution of phenomenological models triggered by these high-precision experiments will be discussed. In particular, the possibility that the proton is non-spherical in its ground state, and that the transverse charge density are model independently defined in the infinite momentum frame. Likewise, flavor decomposition of the nucleon form factors into dressed u and d quark form factors, may give information about the quark-diquark structure of the nucleon. The current proton radius "crisis" will also be discussed.

  16. Electromagnetic nucleon form factors

    SciTech Connect

    Bender, A.; Roberts, C.D.; Frank, M.R.

    1995-08-01

    The Dyson-Schwinger equation framework is employed to obtain expressions for the electromagnetic nucleon form factor. In generalized impulse approximation the form factor depends on the dressed quark propagator, the dressed quark-photon vertex, which is crucial to ensuring current conservation, and the nucleon Faddeev amplitude. The approach manifestly incorporates the large space-like-q{sup 2} renormalization group properties of QCD and allows a realistic extrapolation to small space-like-q{sup 2}. This extrapolation allows one to relate experimental data to the form of the quark-quark interaction at small space-like-q{sup 2}, which is presently unknown. The approach provides a means of unifying, within a single framework, the treatment of the perturbative and nonperturbative regimes of QCD. The wealth of experimental nucleon form factor data, over a large range of q{sup 2}, ensures that this application will provide an excellent environment to test, improve and extend our approach.

  17. Measurement of the proton form factors ratio G{sub E}/G{sub M} to Q{sup 2} = 5.6 GeV{sup 2} by recoil polarimetry

    SciTech Connect

    Olivier Gayou

    2002-04-01

    In this thesis, we present the results of the experiment E99-007, which measured the ratio of the electric to magnetic form factors of the proton to the four momentum transfer square Q{sup 2} = 5.6 GeV{sup 2}, by recoil polarimetry. Data were taken in 2000 at the Thomas Jefferson National Accelerator Facility in Virginia, USA. A 4.6 GeV polarized electron beam was scattered off a cryogenic hydrogen target. The polarization of the recoil proton was measured in the Focal Plane Polarimeter, located after one of the two High Resolution Spectrometers in the hall. The ratio of the transverse to longitudinal components of the recoil proton polarization is proportional to the ratio of the form factors. Elastic events were selected by detecting the scattered electron in a large acceptance lead-glass calorimeter. The main result of this experiment is the linear decrease of the form factor ratio with increasing Q{sup 2}, corresponding to different spatial distributions of the electric charge and the magnetization. Numerous theoretical calculations show that relativistic effects, such as mixing of spin states due to Lorentz boosts, are important to account for the observed data in this critical intermediate kinematic region.

  18. Nucleon Form Factors - A Jefferson Lab Perspective

    SciTech Connect

    John Arrington, Kees de Jager, Charles F. Perdrisat

    2011-06-01

    The charge and magnetization distributions of the proton and neutron are encoded in their elastic electromagnetic form factors, which can be measured in elastic electron--nucleon scattering. By measuring the form factors, we probe the spatial distribution of the proton charge and magnetization, providing the most direct connection to the spatial distribution of quarks inside the proton. For decades, the form factors were probed through measurements of unpolarized elastic electron scattering, but by the 1980s, progress slowed dramatically due to the intrinsic limitations of the unpolarized measurements. Early measurements at several laboratories demonstrated the feasibility and power of measurements using polarization degrees of freedom to probe the spatial structure of the nucleon. A program of polarization measurements at Jefferson Lab led to a renaissance in the field of study, and significant new insight into the structure of matter.

  19. Inelastic Scattering Form Factors

    1992-01-01

    ATHENA-IV computes form factors for inelastic scattering calculations, using single-particle wave functions that are eigenstates of motion in either a Woods-Saxon potential well or a harmonic oscillator well. Two-body forces of Gauss, Coulomb, Yukawa, and a sum of cut-off Yukawa radial dependences are available.

  20. Analytic pion form factor

    NASA Astrophysics Data System (ADS)

    Lomon, Earle L.; Pacetti, Simone

    2016-09-01

    The pion electromagnetic form factor and two-pion production in electron-positron collisions are simultaneously fitted by a vector dominance model evolving to perturbative QCD at large momentum transfer. This model was previously successful in simultaneously fitting the nucleon electromagnetic form factors (spacelike region) and the electromagnetic production of nucleon-antinucleon pairs (timelike region). For this pion case dispersion relations are used to produce the analytic connection of the spacelike and timelike regions. The fit to all the data is good, especially for the newer sets of timelike data. The description of high-q2 data, in the timelike region, requires one more meson with ρ quantum numbers than listed in the 2014 Particle Data Group review.

  1. Precision Rosenbluth Measurement of the Proton Elastic Electromagnetic Form Factors and Their Ratio at Q2=2.64, 3.20, and 4.10 GeV2

    SciTech Connect

    Qattan, Issam A.

    2005-12-01

    Due to the inconsistency in the results of the mupGEp/GMp ratio of the proton, as extracted from the Rosenbluth and recoil polarization techniques, high precision measurements of the e-p elastic scattering cross sections were made at Q2 = 2.64, 3.20, and 4.10 GeV2. Protons were detected, in contrast to previous measurements where the scattered electrons were detected, which dramatically decreased-dependent systematic uncertainties and corrections. A single spectrometer measured the scattered protons of interest while simultaneous measurements at Q2 = 0.5 GeV2 were carried out using another spectrometer which served as a luminosity monitor in order to remove any uncertainties due to beam charge and target density fluctuations. The absolute uncertainty in the measured cross sections is ~3% for both spectrometers and with relative uncertainties, random and slope, below 1% for the higher Q2 protons, and below 1% random and 6% slope for the monitor spectrometer. The extracted electric and magnetic form factors were determined to 4%-7% for GEp and 1.5% for GMp. The ratio mupGEp/GMp was determined to 4%-7% and showed mupGEp/GMp ~ 1.0. The results of this work are in agreement with the previous Rosenbluth data and inconsistent with high-Q2 recoil polarization results, implying a systematic difference between the two techniques.

  2. Electromagnetic pion form factor

    SciTech Connect

    Roberts, C.D.

    1995-08-01

    A phenomenological Dyson-Schwinger/Bethe-Salpeter equation approach to QCD, formalized in terms of a QCD-based model field theory, the Global Color-symmetry Model (GCM), was used to calculate the generalized impulse approximation contribution to the electromagnetic pion form factor at space-like q{sup 2} on the domain [0,10] GeV{sup 2}. In effective field theories this form factor is sometimes understood as simply being due to Vector Meson Dominance (VMD) but this does not allow for a simple connection with QCD where the VMD contribution is of higher order than that of the quark core. In the GCM the pion is treated as a composite bound state of a confined quark and antiquark interacting via the exchange of colored vector-bosons. A direct study of the quark core contribution is made, using a quark propagator that manifests the large space-like-q{sup 2} properties of QCD, parameterizes the infrared behavior and incorporates confinement. It is shown that the few parameters which characterize the infrared form of the quark propagator may be chosen so as to yield excellent agreement with the available data. In doing this one directly relates experimental observables to properties of QCD at small space-like-q{sup 2}. The incorporation of confinement eliminates endpoint and pinch singularities in the calculation of F{sub {pi}}(q{sup 2}). With asymptotic freedom manifest in the dressed quark propagator the calculation yields q{sup 4}F{sub {pi}}(q{sup 2}) = constant, up to [q{sup 2}]- corrections, for space-like-q{sup 2} {approx_gt} 35 GeV{sup 2}, which indicates that soft, nonperturbative contributions dominate the form factor at presently accessible q{sup 2}. This means that the often-used factorization Ansatz fails in this exclusive process. A paper describing this work was submitted for publication. In addition, these results formed the basis for an invited presentation at a workshop on chiral dynamics and will be published in the proceedings.

  3. Nucleon elastic form factors

    SciTech Connect

    D. Day

    2007-03-01

    The nucleon form factors are still the subject of active investigation even after an experimental effort spanning 50 years. This is because they are of critical importance to our understanding of the electromagnetic properties of nuclei and provide a unique testing ground for QCD motivated models of nucleon structure. Progress in polarized beams, polarized targets and recoil polarimetry have allowed an important and precise set of data to be collected over the last decade. I will review the experimental status of elastic electron scattering from the nucleon along with an outlook for future progress.

  4. Pion form factor

    SciTech Connect

    Ryong Ji, C.; Pang, A.; Szczepaniak, A.

    1994-04-01

    It is pointed out that the correct criterion to define the legal PQCD contribution to the exclusive processes in the lightcone perturbative expansion should be based on the large off-shellness of the lightcone energy in the intermediate states. In the lightcone perturbative QCD calculation of the pion form factor, the authors find that the legal PQCD contribution defined by the lightcone energy cut saturates in the smaller Q{sup 2} region compared to that defined by the gluon four-momentum square cut. This is due to the contribution by the highly off-energy-shell gluons in the end point regions of the phase space, indicating that the gluon four-momentum-square cut may have cut too much to define the legal PQCD.

  5. Survey of nucleon electromagnetic form factors

    SciTech Connect

    Perdrisat, Charles F.; Punjabi, Vina A.

    2011-09-20

    There has been much activity in the measurement of the elastic electromagnetic proton and neutron form factors in the last decade, and the quality of the data has been greatly improved by performing double polarization experiments, in compar- ison with previous unpolarized data. Here we review the experimental data base in view of the new results for the proton, and neutron, obtained at MIT-Bates, MAMI, and JLab. The rapid evolution of phenomenological models triggered by these high-precision experiments will be discussed.

  6. Nucleon form factor studies at JLab.

    PubMed

    Giusa, A; Bellini, V; Mammoliti, F; Russo, G; Sperduto, M L; Sutera, C M; Cisbani, E; Garibaldi, F; Urciuoli, G M; Capogni, M; Cates, G D; de Jager, K; Wojtsekhowski, B

    2011-08-01

    The ratio of the electromagnetic proton elastic form factors, G(p)(E)/G(p)(M), has been measured at Jefferson Lab up to Q(2) approximately 9(GeV/c)(2), by using the CEBAF 6GeV electron beam, and revealing an unexpected and challenging physical behaviour. The 2014 scheduled 12GeV upgrade will allow the measurement of G(p)(E)/G(p)(M) up to Q(2) approximately 15(GeV/c)(2), by taking advantage of the new large-acceptance forward spectrometer Super BigBite (SBS) in Hall A. Measurements of neutron form factors in the region around 10(GeV/c)(2), where quark confinement plays an important role, are expected to show the behaviour already observed in the proton case. PMID:21145242

  7. Nucleon form factor studies at Jlab

    SciTech Connect

    Giusa, A; Mammoliti, F; Russo, G; Sperduto, M L; Sutera, C M; Cisbani, E; Garibaldi, F; Urciuoli, G M; Capogni, M; Cates, G D; de Jager, K; Wojtsekhowski, B

    2011-08-01

    The ratio of the electromagnetic proton elastic form factors, GpE/GpM, has been measured at Jefferson Lab up to View the MathML source, by using the CEBAF 6 GeV electron beam, and revealing an unexpected and challenging physical behaviour. The 2014 scheduled 12 GeV upgrade will allow the measurement of GpE/GpM up to View the MathML source, by taking advantage of the new large-acceptance forward spectrometer Super BigBite (SBS) in Hall A. Measurements of neutron form factors in the region around 10 (GeV/c)2, where quark confinement plays an important role, are expected to show the behaviour already observed in the proton case.

  8. Elastic form factors at higher CEBAF energies

    SciTech Connect

    Petratos, G.G.

    1994-04-01

    The prospects for elastic scattering from few body systems with higher beam energies at CEBAF is presented. The deuteron and{sup 3}He elastic structure functions A(Q{sup 2}) can be measured at sufficiently high momentum transfers to study the transition between the conventional meson-nucleon and the constituent quark-gluon descriptions. Possible improvements in the proton magnetic form factor data are also presented.

  9. Final analysis of proton form factor ratio data at Q2 = 4.0, 4.8, and 5.6 GeV2

    SciTech Connect

    Puckett, A. J. R.; Brash, E. J.; Gayou, O.; Jones, M. K.; Pentchev, L.; Perdrisat, C. F.; Punjabi, V.; Aniol, K. A.; Averett, T.; Benmokhtar, F.; Bertozzi, W.; Bimbot, L.; Calarco, J. R.; Cavata, C.; Chai, Z.; Chang, C. -C.; Chang, T.; Chen, J. P.; Chudakov, E.; De Leo, R.; Dieterich, S.; Endres, R.; Epstein, M. B.; Escoffier, S.; Fissum, K. G.; Fonvieille, H.; Frullani, S.; Gao, J.; Garibaldi, F.; Gilad, S.; Gilman, R.; Glamazdin, A.; Glashausser, C.; Gomez, J.; Hansen, J. -O.; Higinbotham, D.; Huber, G. M.; Iodice, M.; de Jager, C. W.; Jiang, X.; Khandaker, M.; Kozlov, S.; Kramer, K. M.; Kumbartzki, G.; LeRose, J. J.; Lhuillier, D.; Lindgren, R. A.; Liyanage, N.; Lolos, G. J.; Margaziotis, D. J.; Marie, F.; Markowitz, P.; McCormick, K.; Michaels, R.; Milbrath, B. D.; Nanda, S. K.; Neyret, D.; Piskunov, N. M.; Ransome, R. D.; Raue, B. A.; Roché, R.; Rvachev, M.; Salgado, C.; Sirca, S.; Sitnik, I.; Strauch, S.; Todor, L.; Tomasi-Gustafsson, E.; Urciuoli, G. M.; Voskanyan, H.; Wijesooriya, K.; Wojtsekhowski, B. B.; Zheng, X.; Zhu, L.

    2012-04-11

    Recently published measurements of the proton electromagnetic form factor ratio R = μp GEp/GMp at momentum transfers Q2 up to 8.5 GeV2 in Jefferson Lab Hall C deviate from the linear trend of previous measurements in Jefferson Lab Hall A, favoring a slower rate of decrease of R with Q2. While statistically compatible in the region of overlap with Hall A, the Hall C data hint at a systematic difference between the two experiments. This possibility was investigated in a reanalysis of the Hall A data. We find that the original analysis underestimated the background in the selection of elastic events. The application of an additional cut to further suppress the background increases the results for R, improving the consistency between Halls A and C.

  10. Measurements of the {Delta}(1232) transition form factor and the ratio {sigma}{sub n}/{sigma}{sub p} from inelastic electron-proton and electron-deuteron scattering

    SciTech Connect

    Bosted, P.E.; Andivahis, L.; Lung, A.; Arnold, R.G.; Keppel, C.; Rock, S.E.; Spengos, M.; Szalata, Z.; Tao, L.H.; Stuart, L.M.; Gomez, J.; Stuart, L.M.; Dietrich, F.S.; Chang, C.C.; Hicks, R.S.; Miskimen, R.A.; Peterson, G.A.; Rokni, S.H.; Dodge, W.R.; Griffioen, K.A.; Petratos, G.G.; Sakumoto, W.K.; Stuart, L.M.; Gearhart, R.; Kuhn, S.E.; Alster, J.; Lichtenstadt, J.; Hyde-Wright, C.E.; Swartz, K.

    1998-08-01

    Measurements of inclusive electron-scattering cross sections using hydrogen and deuterium targets in the region of the {Delta}(1232) resonance are reported. A global fit to these new data and previous data in the resonance region is also reported for the proton. Transition form factors have been extracted from the proton cross sections for this experiment over the four-momentum transfer squared range 1.64{lt}Q{sup 2}{lt}6.75 (GeV/c){sup 2} and from previous data over the range 2.41{lt}Q{sup 2}{lt}9.82 (GeV/c){sup 2}. The results confirm previous reports that the {Delta}(1232) transition form factor decreases more rapidly with Q{sup 2} than expected from perturbative QCD. The ratio of {sigma}{sub n}/{sigma}{sub p} in the {Delta}(1232) resonance region has been extracted from the deuteron data for this experiment in the range 1.64{lt}Q{sup 2}{lt}3.75 (GeV/c){sup 2} and for a previous experiment in the range 2.4{lt}Q{sup 2}{lt}7.9 (GeV/c){sup 2}. A study has been made of the model dependence of these results. This ratio {sigma}{sub n}/{sigma}{sub p} for {Delta}(1232) production is slightly less than unity, while {sigma}{sub n}/{sigma}{sub p} for the nonresonant cross sections is approximately 0.5, which is consistent with deep inelastic scattering results. thinsp {copyright} {ital 1998} {ital The American Physical Society}

  11. Hadronic form factors in kaon photoproduction

    SciTech Connect

    Syukurilla, L. Mart, T.

    2014-09-25

    We have revisited the effect of hadronic form factors in kaon photoproduction process by utilizing an isobaric model developed for kaon photoproduction off the proton. The model is able to reproduce the available experimental data nicely as well as to reveal the origin of the second peak in the total cross section, which was the main source of confusion for decades. Different from our previous study, in the present work we explore the possibility of using different hadronic form factors in each of the KΛN vertices. The use of different hadronic form factors, e.g. dipole, Gaussian, and generalized dipole, has been found to produce a more flexible isobar model, which can provide a significant improvement in the model.

  12. The Dirac form factor predicts the Pauli form factor in the Endpoint Model

    NASA Astrophysics Data System (ADS)

    Dagaonkar, Sumeet K.; Jain, Pankaj; Ralston, John P.

    2016-07-01

    We compute the momentum-transfer dependence of the proton Pauli form factor F2 in the Endpoint overlap Model. We find the model correctly reproduces the scaling of the ratio of F2 with the Dirac form factor F1 observed at the Jefferson Laboratory. The calculation uses the leading-power, leading-twist Dirac structure of the quark light-cone wave function and the same endpoint dependence previously determined from the Dirac form factor F1. There are no parameters and no adjustable functions in the Endpoint Model's prediction for the scaling behavior of F2. The model's predicted momentum dependence of the ratio F2(Q2)/F1(Q2) is quite insensitive to the endpoint wave function, which explains why the observed ratio scales like 1 / Q down to rather low momentum transfers. We also fit the magnitude of this ratio by adjusting the parameters of the wave function. The Endpoint Model appears to be the only comprehensive model consistent with all form factor information as well as reproducing fixed-angle proton-proton scattering at large momentum transfer. Any one of the processes is capable of predicting the others.

  13. The structure of the nucleon: Elastic electromagnetic form factors

    SciTech Connect

    Punjabi, V.; Perdrisat, C. F.; Jones, M. K.; Brash, E. J.; Carlson, C. E.

    2015-07-10

    Precise proton and neutron form factor measurements at Jefferson Lab, using spin observables, have recently made a significant contribution to the unraveling of the internal structure of the nucleon. Accurate experimental measurements of the nucleon form factors are a test-bed for understanding how the nucleon's static properties and dynamical behavior emerge from QCD, the theory of the strong interactions between quarks. There has been enormous theoretical progress, since the publication of the Jefferson Lab proton form factor ratio data, aiming at reevaluating the picture of the nucleon. We will review the experimental and theoretical developments in this field and discuss the outlook for the future.

  14. Probing non-polar interstellar molecules through their protonated form: Detection of protonated cyanogen (NCCNH+)

    NASA Astrophysics Data System (ADS)

    Agúndez, M.; Cernicharo, J.; de Vicente, P.; Marcelino, N.; Roueff, E.; Fuente, A.; Gerin, M.; Guélin, M.; Albo, C.; Barcia, A.; Barbas, L.; Bolaño, R.; Colomer, F.; Diez, M. C.; Gallego, J. D.; Gómez-González, J.; López-Fernández, I.; López-Fernández, J. A.; López-Pérez, J. A.; Malo, I.; Serna, J. M.; Tercero, F.

    2015-07-01

    Cyanogen (NCCN) is the simplest member of the series of dicyanopolyynes. It has been hypothesized that this family of molecules can be important constituents of interstellar and circumstellar media, although the lack of a permanent electric dipole moment prevents its detection through radioastronomical techniques. Here we present the first solid evidence of the presence of cyanogen in interstellar clouds by detection of its protonated form toward the cold dark clouds TMC-1 and L483. Protonated cyanogen (NCCNH+) has been identified through the J = 5-4 and J = 10-9 rotational transitions using the 40 m radiotelescope of Yebes and the IRAM 30 m telescope. We derive beam-averaged column densities for NCCNH+ of (8.6 ± 4.4) × 1010 cm-2 in TMC-1 and (3.9 ± 1.8) × 1010 cm-2 in L483, which translate into fairly low fractional abundances relative to H2, in the range (1-10) × 10-12. The chemistry of protonated molecules in dark clouds is discussed, and it is found that, in general terms, the abundance ratio between the protonated and non-protonated forms of a molecule increases with increasing proton affinity. Our chemical model predicts an abundance ratio NCCNH+/NCCN of ~10-4, which implies that the abundance of cyanogen in dark clouds could be as high as (1-10) × 10-8 relative to H2, i.e., comparable to that of other abundant nitriles such as HCN, HNC, and HC3N. Based on observations carried out with the IRAM 30 m Telescope and the Yebes 40 m Telescope. IRAM is supported by INSU/CNRS (France), MPG (Germany) and IGN (Spain). The 40 m radiotelescope at Yebes Observatory is operated by the Spanish National Geographic Institute (IGN, Ministerio de Fomento).

  15. Probing non polar interstellar molecules through their protonated form: Detection of protonated cyanogen (NCCNH+)★

    PubMed Central

    Agúndez, M.; Cernicharo, J.; de Vicente, P.; Marcelino, N.; Roueff, E.; Fuente, A.; Gerin, M.; Guélin, M.; Albo, C.; Barcia, A.; Barbas, L.; Bolaño, R.; Colomer, F.; Diez, M. C.; Gallego, J. D.; Gómez-González, J.; López-Fernández, I.; López-Fernández, J. A.; López-Pérez, J. A.; Malo, I.; Serna, J. M.; Tercero, F.

    2015-01-01

    Cyanogen (NCCN) is the simplest member of the series of dicyanopolyynes. It has been hypothesized that this family of molecules can be important constituents of interstellar and circumstellar media, although the lack of a permanent electric dipole moment prevents its detection through radioastronomical techniques. Here we present the first solid evidence of the presence of cyanogen in interstellar clouds through the detection of its protonated form toward the cold dark clouds TMC-1 and L483. Protonated cyanogen (NCCNH+) has been identified through the J = 5 – 4 and J = 10 – 9 rotational transitions using the 40m radiotelescope of Yebes and the IRAM 30m telescope. We derive beam averaged column densities for NCCNH+ of (8.6 ± 4.4) × 1010 cm−2 in TMC-1 and (3.9 ± 1.8) × 1010 cm−2 in L483, which translate to fairly low fractional abundances relative to H2, in the range (1-10) × 10−12. The chemistry of protonated molecules in dark clouds is discussed, and it is found that, in general terms, the abundance ratio between the protonated and non protonated forms of a molecule increases with increasing proton affinity. Our chemical model predicts an abundance ratio NCCNH+/NCCN of ~ 10−4, which implies that the abundance of cyanogen in dark clouds could be as high as (1-10) × 10−8 relative to H2, i.e., comparable to that of other abundant nitriles such as HCN, HNC, and HC3N. PMID:26543239

  16. Protonated thiophene-based oligomers as formed within zeolites: understanding their electron delocalization and aromaticity.

    PubMed

    Valencia, Diego; Whiting, Gareth T; Bulo, Rosa E; Weckhuysen, Bert M

    2016-01-21

    In an earlier work, protonated thiophene-based oligomers were identified inside ZSM-5 zeolites. The novel compounds exhibited π-π* absorption wavelengths deep within the visible region, earmarking them for possible use as chromophores in a variety of applications. In this computational study, we determine the factors that cause such low-energy transitions, and describe the electronic structure of these remarkable compounds. DFT calculations of conjugated thiophene-based oligomers with up to five monomer units reveal that the main absorption band of each protonated oligomer is strongly red-shifted compared to the unprotonated form. This effect is counterintuitive, since protonation is expected to diminish aromaticity, and thereby increase the HOMO-LUMO gap. We find that upon protonation the π-electrons remain delocalized over the entire π-conjugated molecule, but the positive charge is localized predominantly on the protonated side of the molecule. A possible explanation for this ground-state charge localization is the participation of the C-H bond in the π-system of the protonated ring, locally providing aromatic stabilization for the positive charge. The addition of the proton stabilizes all electronic orbitals, but due to the ground state π-electron distribution away from the added nucleus, the HOMO is stabilized less than the LUMO. The main absorption peak upon protonation corresponds to the charge transfer excitation involving the frontier orbitals, and the small band gap explains the observed red shift. Analogue calculations on thiophene within a ZSM-5 zeolite cluster model confirm the same trends upon protonation as observed in the non-interacting compounds. Understanding the electronic structure of these compounds is very relevant to correlate UV-Vis bands with acidic strength and possibly environment in zeolites and to improve their performance in catalytic and energy related applications. PMID:26685895

  17. Possible diquark signatures in the elastic nucleon form factors

    NASA Astrophysics Data System (ADS)

    Cates, Gordon

    2013-10-01

    There has been considerable interest in the elastic nucleon form factors ever since the discovery that the proton form-factor ratio, GEp /GMp , decreases nearly linearly above roughly Q2 = 1 GeV2 . More recent measurements of the neutron form-factor ratio, GEn /GMn , up to 3 . 4 GeV2 have made it possible to constrain calculations using both proton and neutron data in the Q2 regime where the interesting behavior of the proton was first observed. Calculations based on QCD's Dyson-Schwinger equations, as well as certain relativistic constituent quark models, suggest that the observed behavior is related to the importance of diquark degrees of freedom. To understand this connection, it is particularly useful to consider the flavor-separated form factors, which can be extracted by combining proton and neutron data, and assuming charge symmetry. Distinctly different behavior is seen for the u - and d - quarks. The behaviors of the different quark flavors and the connection to diquarks can also be understood using naive scaling arguments, although this approach has yet to be made more rigorous. This talk will discuss how measurements of the nucleon form factors at high Q2 provides a rich opportunity to better understand the structure of the nucleon.

  18. Nucleon and Elastic and Transition Form Factors

    NASA Astrophysics Data System (ADS)

    Segovia, Jorge; Cloët, Ian C.; Roberts, Craig D.; Schmidt, Sebastian M.

    2014-12-01

    We present a unified study of nucleon and elastic and transition form factors, and compare predictions made using a framework built upon a Faddeev equation kernel and interaction vertices that possess QCD-like momentum dependence with results obtained using a symmetry-preserving treatment of a vector vector contact-interaction. The comparison emphasises that experiments are sensitive to the momentum dependence of the running couplings and masses in the strong interaction sector of the Standard Model and highlights that the key to describing hadron properties is a veracious expression of dynamical chiral symmetry breaking in the bound-state problem. Amongst the results we describe, the following are of particular interest: possesses a zero at Q 2 = 9.5 GeV2; any change in the interaction which shifts a zero in the proton ratio to larger Q 2 relocates a zero in to smaller Q 2; there is likely a value of momentum transfer above which ; and the presence of strong diquark correlations within the nucleon is sufficient to understand empirical extractions of the flavour-separated form factors. Regarding the -baryon, we find that, inter alia: the electric monopole form factor exhibits a zero; the electric quadrupole form factor is negative, large in magnitude, and sensitive to the nature and strength of correlations in the Faddeev amplitude; and the magnetic octupole form factor is negative so long as rest-frame P- and D-wave correlations are included. In connection with the transition, the momentum-dependence of the magnetic transition form factor, , matches that of once the momentum transfer is high enough to pierce the meson-cloud; and the electric quadrupole ratio is a keen measure of diquark and orbital angular momentum correlations, the zero in which is obscured by meson-cloud effects on the domain currently accessible to experiment. Importantly, within each framework, identical propagators and vertices are sufficient to describe all properties discussed herein. Our

  19. Flavor decomposition of the nucleon electromagnetic form factors at low Q2

    NASA Astrophysics Data System (ADS)

    Qattan, I. A.; Arrington, J.; Alsaad, A.

    2015-06-01

    Background: The spatial distribution of charge and magnetization within the proton is encoded in the elastic form factors. These have been precisely measured in elastic electron scattering, and the combination of proton and neutron form factors allows for the separation of the up- and down-quark contributions. Purpose: In this work, we extract the proton and neutron form factors from worldwide data with an emphasis on precise new data covering the low-momentum region, which is sensitive to the large-scale structure of the nucleon. From these, we separate the up- and down-quark contributions to the proton form factors. Method: We combine cross section and polarization measurements of elastic electron-proton scattering to separate the proton form factors and two-photon exchange (TPE) contributions. We combine the proton form factors with parametrization of the neutron form factor data and uncertainties to separate the up- and down-quark contributions to the proton's charge and magnetic form factors. Results: The extracted TPE corrections are compared to previous phenomenological extractions, TPE calculations, and direct measurements from the comparison of electron and positron scattering. The flavor-separated form factors are extracted and compared to models of the nucleon structure. Conclusions: With the inclusion of the precise new data, the extracted TPE contributions show a clear change of sign at low Q2, which is necessary to explain the high-Q2 form factor discrepancy while being consistent with the known Q2→0 limit. We find that the new Mainz data yield a significantly different result for the proton magnetic form factor and its flavor-separated contributions. We also observe that the rms radius of both the up- and down-quark distributions are smaller than the rms charge radius of the proton.

  20. The structure of the nucleon: Elastic electromagnetic form factors

    DOE PAGESBeta

    Punjabi, V.; Perdrisat, C. F.; Jones, M. K.; Brash, E. J.; Carlson, C. E.

    2015-07-10

    Precise proton and neutron form factor measurements at Jefferson Lab, using spin observables, have recently made a significant contribution to the unraveling of the internal structure of the nucleon. Accurate experimental measurements of the nucleon form factors are a test-bed for understanding how the nucleon's static properties and dynamical behavior emerge from QCD, the theory of the strong interactions between quarks. There has been enormous theoretical progress, since the publication of the Jefferson Lab proton form factor ratio data, aiming at reevaluating the picture of the nucleon. We will review the experimental and theoretical developments in this field and discussmore » the outlook for the future.« less

  1. Form factors from lattice QCD

    SciTech Connect

    Dru Renner

    2012-04-01

    Precision computation of hadronic physics with lattice QCD is becoming feasible. The last decade has seen precent-level calculations of many simple properties of mesons, and the last few years have seen calculations of baryon masses, including the nucleon mass, accurate to a few percent. As computational power increases and algorithms advance, the precise calculation of a variety of more demanding hadronic properties will become realistic. With this in mind, I discuss the current lattice QCD calculations of generalized parton distributions with an emphasis on the prospects for well-controlled calculations for these observables as well. I will do this by way of several examples: the pion and nucleon form factors and moments of the nucleon parton and generalized-parton distributions.

  2. Flavor decomposition of the nucleon electromagnetic form factors

    NASA Astrophysics Data System (ADS)

    Qattan, I. A.; Arrington, J.

    2012-12-01

    Background: The spatial distribution of charge and magnetization in the proton and neutron are encoded in the nucleon electromagnetic form factors. The form factors are all approximated by a simple dipole function, normalized to the charge or magnetic moment of the nucleon. The differences between the proton and neutron form factors and the deviation of GEn from zero are sensitive to the difference between up- and down-quark contributions to the form factors.Purpose: Recent measurements of GEn up to 3.4 (GeV/c)2 allow for a much more detailed examination of the form factors. The flavor-separated form factors provide information on the quark flavor dependence of the nucleon structure and test theoretical models of the form factors.Methods: We combine recent measurements of the neutron form factors with updated extractions of the proton form factors, accounting for two-photon exchange corrections and including an estimate of the uncertainties for all of the form factors to obtain a complete set of measurements up to Q2≈4 (GeV/c)2. We use this to extract the up- and down-quark contributions which we compare to recent fits and calculations.Results: We find large differences between the up- and down-quark contributions to GE and GM, implying significant flavor dependence in the charge and magnetization distributions. The rapid falloff of the ratio GEp/GMp does not appear in the individual quark form factors, but arises from a cancellation between the up- and down-quark contributions. We see indications that the down-quark contributions to the Dirac and Pauli form factors deviate from the suggested 1/Q4 scaling behavior suggested by a previous analysis. While recent models provide a generally good qualitative description of the data, the down-quark contribution to GE/GM and F2/F1 are not reproduced by any of the models. Finally, we note that, while the inclusion of recent GMn data from the CLAS Collaboration modifies the high-Q2 behavior slightly, the tension between

  3. Proton interactions in the resting form of cytochrome oxidase.

    PubMed

    Papadopoulos, P G; Walter, S A; Li, J W; Baker, G M

    1991-01-22

    The effect of pH on the near-UV absorption spectrum of cytochrome oxidase has been examined. Several lines of evidence implicate a proton binding site that can modulate the optical properties of cytochrome alpha 3 in the resting enzyme. Changing the pH within the range 6.5-10.5 was found to reversibly shift the position of the Soret band over an 11-nm range. The lower pH values caused a progressive blue shift in the Soret band, whereas the high-pH range promoted a gradual red shift. Limiting band positions were approximately 416 and 427 nm. The incubation time required to reach a stable band position varied somewhat as did the actual extent of the shift. In most cases, the shift was associated with an isosbestic point. A pH titration profile for the apparent equilibrium position of the Soret band was obtained. Nonlinear least-squares fitting to a scatter plot, assuming a single acid/base group, showed an apparent pKa of 7.8. Magnetic circular dichroism (MCD) spectra of the low-pH form at 416 nm, the high-pH form at 427 nm, and the cyanide derivative at 428 nm were compared. No evidence of a high-pH-dependent low-spin transition or a change in the redox state of cytochrome a3 was found, confirming earlier work [Baker, G. M., Noguchi, M., & Palmer, G. (1987) J. Biol. Chem. 262, 595-604]. Subtraction of ferricytochrome a [spectrum taken from Vanneste, W. H. (1966) Biochemistry 5, 838-848] from a series of blue-shifting spectra showed a band at 414 nm that progressively gained amplitude and a band at 430 nm that correspondingly lost amplitude. A series of red-shifting spectra showed the opposite behavior with a clear isosbestic point being evident in both cases. The difference extinction change at 414 and 430 nm depended linearly on the position of the Soret band, both showing a reversible dependence on pH. The 430-nm band is noted to be unusually red-shifted for high-spin ferric heme a. An additional, pH-insensitive band was observed at 408-410 nm which was eliminated

  4. Transition Form Factor from CLAS

    SciTech Connect

    Park, Kijun

    2009-01-01

    The excitation of nucleon resonances in electromagnetic interaction has long been studied. The study of resonances helps us to understand the long- and short- range structures of the nucleon and its excited states in terms of quark confinement. While the existing data of the low-lying resonances are consistent with the well-studied SU(6) circle times operator O(3) constituent quark model classification, many open questions still remain. Exclusive electro-production is one of the best ways to investigate nucleon resonances. The exclusive electro-production process View the MathML source was measured in the photon virtuality range Q2 = 1.7 â 4.5 GeV2 and the invariant mass range for the n?+ system of W = 1.15 â 1.7 GeV using the CEBAF Large Acceptance Spectrometer. For the first time, these kinematics are probed in exclusive ?+ production from protons with nearly full coverage in the azimuthal and polar angles of the n?+ center-of-mass system. The n?+ channel has particular sensitivity t

  5. Physical and biological factors determining the effective proton range

    SciTech Connect

    Grün, Rebecca; Friedrich, Thomas; Krämer, Michael; Scholz, Michael; Zink, Klemens; Durante, Marco; Engenhart-Cabillic, Rita

    2013-11-15

    Purpose: Proton radiotherapy is rapidly becoming a standard treatment option for cancer. However, even though experimental data show an increase of the relative biological effectiveness (RBE) with depth, particularly at the distal end of the treatment field, a generic RBE of 1.1 is currently used in proton radiotherapy. This discrepancy might affect the effective penetration depth of the proton beam and thus the dose to the surrounding tissue and organs at risk. The purpose of this study was thus to analyze the impact of a tissue and dose dependent RBE of protons on the effective range of the proton beam in comparison to the range based on a generic RBE of 1.1.Methods: Factors influencing the biologically effective proton range were systematically analyzed by means of treatment planning studies using the Local Effect Model (LEM IV) and the treatment planning software TRiP98. Special emphasis was put on the comparison of passive and active range modulation techniques.Results: Beam energy, tissue type, and dose level significantly affected the biological extension of the treatment field at the distal edge. Up to 4 mm increased penetration depth as compared to the depth based on a constant RBE of 1.1. The extension of the biologically effective range strongly depends on the initial proton energy used for the most distal layer of the field and correlates with the width of the distal penumbra. Thus, the range extension, in general, was more pronounced for passive as compared to active range modulation systems, whereas the maximum RBE was higher for active systems.Conclusions: The analysis showed that the physical characteristics of the proton beam in terms of the width of the distal penumbra have a great impact on the RBE gradient and thus also the biologically effective penetration depth of the beam.

  6. Proton Conductivities of Lamellae-Forming Bioinspired Block Copolymer Thin Films Containing Silver Nanoparticles.

    PubMed

    Yabu, Hiroshi; Matsui, Jun; Hara, Mitsuo; Nagano, Shusaku; Matsuo, Yasutaka; Nagao, Yuki

    2016-09-20

    Size-controlled metal nanoparticles (NPs) were spontaneously formed when the amphiphilic diblock copolymers consisting of poly(vinyl catechol) and polystyrene (PVCa-b-PSt) were used as reductants and templates for NPs. In the present study, the proton conductivity of well-aligned lamellae structured PVCa-b-PSt films with Ag NPs was evaluated. We found that the proton conductivity of PVCa-b-PSt film was increased 10-fold by the addition of Ag NPs into the proton conduction channels filled with catechol moieties. In addition, the effect of humidity and the origin of proton conductivity enhancement was investigated. PMID:27589224

  7. Proton Conductivities of Lamellae-Forming Bioinspired Block Copolymer Thin Films Containing Silver Nanoparticles.

    PubMed

    Yabu, Hiroshi; Matsui, Jun; Hara, Mitsuo; Nagano, Shusaku; Matsuo, Yasutaka; Nagao, Yuki

    2016-09-20

    Size-controlled metal nanoparticles (NPs) were spontaneously formed when the amphiphilic diblock copolymers consisting of poly(vinyl catechol) and polystyrene (PVCa-b-PSt) were used as reductants and templates for NPs. In the present study, the proton conductivity of well-aligned lamellae structured PVCa-b-PSt films with Ag NPs was evaluated. We found that the proton conductivity of PVCa-b-PSt film was increased 10-fold by the addition of Ag NPs into the proton conduction channels filled with catechol moieties. In addition, the effect of humidity and the origin of proton conductivity enhancement was investigated.

  8. Isomers and conformational barriers of gas phase nicotine, nornicotine and their protonated forms

    SciTech Connect

    Yoshida, Tomoki; Farone, William A.; Xantheas, Sotiris S.

    2014-07-17

    We report extensive conformational searches of the neutral nicotine, nornicotine and their protonated analogs that are based on ab-initio second order Møller-Plesset perturbation (MP2) electronic structure calculations. Initial searches were performed with the 6-31G(d,p) and the energetics of the most important structures were further refined from geometry optimizations with the aug-cc-pVTZ basis set. Based on the calculated free energies at T=298 K for the gas phase molecules, neutral nicotine has two dominant trans conformers, whereas neutral nornicotine is a mixture of several conformers. For nicotine, the protonation on both the pyridine and the pyrrolidine sites is energetically competitive, whereas nornicotine prefers protonation on the pyridine nitrogen. The protonated form of nicotine is mainly a mixture of two pyridine-protonated trans conformers and two pyrrolidine-protonated trans conformers, whereas the protonated form of nornicotine is a mixture of four pyridine-protonated trans conformers. Nornicotine is conformationally more flexible than nicotine, however it is less protonated at the biologically important pyrrolidine nitrogen site. The lowest energy isomers for each case were found to interconvert via low (< 6 kcal/mol) rotational barriers around the pyridine-pyrrolidine bond.

  9. Processes forming and sustaining Saturn's proton radiation belts

    NASA Astrophysics Data System (ADS)

    Kollmann, P.; Roussos, E.; Paranicas, C.; Krupp, N.; Haggerty, D. K.

    2013-01-01

    Saturn's proton radiation belts extend over the orbits of several moons that split this region of intense radiation into several distinct belts. Understanding their distribution requires to understand how their particles are created and evolve. High-energy protons are thought to be dominantly produced by cosmic ray albedo neutron decay (CRAND). The source of the lower energies and the role of other effects such as charge exchange with the gas originating from Enceladus is still an open question. There is also no certainty so far if the belts exist independently from each other and the rest of the magnetosphere or if and how particles are exchanged between these regions. We approach these problems by using measurements acquired by the MIMI/LEMMS instrument onboard the Cassini spacecraft. Protons in the range from 500 keV to 40 MeV are considered. Their intensities are averaged over 7 years of the mission and converted to phase space densities at constant first and second adiabatic invariant. We reproduce the resulting radial profiles with a numerical model that includes radial diffusion, losses from moons and interactions with gas, and a phenomenological source. Our results show that the dominating effects away from the moon sweeping corridors are diffusion and the source, while interactions with gas are secondary. Based on a GEANT4 simulation of the interaction of cosmic rays with Saturn's rings, we conclude that secondary particles produced within the rings can only account for the high-energy part of the source. A comparison with the equivalent processes within Earth's atmosphere shows that Saturn's atmosphere can contribute to the production of the lower energies and might be even dominating at the higher energies. Other possibilities to supply the belts and exchange particles between them, as diffusion and injections from outside the belts, or stripping of ENAs, can be excluded.

  10. Flavor Decomposition of the Elastic Nucleon Electromagnetic Form Factors

    NASA Astrophysics Data System (ADS)

    Cates, G. D.; de Jager, C. W.; Riordan, S.; Wojtsekhowski, B.

    2011-06-01

    The u- and d-quark contributions to the elastic nucleon electromagnetic form factors have been determined by using experimental data on GEn, GMn, GEp, and GMp. Such a flavor separation of the form factors became possible up to negative four-momentum transfer squared Q2=3.4GeV2 with recent data on GEn from Hall A at Jefferson Lab. For Q2 above 1GeV2, for both the u and the d quark, the ratio of the Pauli and Dirac form factors, F2/F1, was found to be almost constant in sharp contrast to the behavior of F2/F1 for the proton as a whole. Also, again for Q2>1GeV2, both F2d and F1d are roughly proportional to 1/Q4, whereas the dropoff of F2u and F1u is more gradual.

  11. Form factors in the radiative pion decay

    NASA Astrophysics Data System (ADS)

    Mateu, V.; Portolés, J.

    2007-10-01

    We perform an analysis of the form factors that rule the structure-dependent amplitude in radiative pion decay. The resonance contributions to π→eνeγ decays are computed through the proper construction of the vector and axial-vector form factors by setting the QCD driven asymptotic properties of the three-point Green functions and , and by demanding the smoothening of the form factors at high transfer of momentum. A comparison between theoretical and experimental determination of the form factors is also carried out. We also consider and evaluate the role played by a non-standard tensor form factor. We conclude that, at present and due to the hadronic uncertainties, the search for new physics in this process is not feasible.

  12. Form factor and boundary contribution of amplitude

    NASA Astrophysics Data System (ADS)

    Huang, Rijun; Jin, Qingjun; Feng, Bo

    2016-06-01

    The boundary contribution of an amplitude in the BCFW recursion relation can be considered as a form factor involving boundary operator and unshifted particles. At the tree-level, we show that by suitable construction of Lagrangian, one can relate the leading order term of boundary operators to some composite operators of mathcal{N} = 4 superYang-Mills theory, then the computation of form factors is translated to the computation of amplitudes. We compute the form factors of these composite operators through the computation of corresponding double trace amplitudes.

  13. Nucleon and Δ electromagnetic form factors

    NASA Astrophysics Data System (ADS)

    Bartoš, Erik; Dubnička, Stanislav; Dubničková, Anna-Zuzana

    2015-11-01

    The unitary and analytic model for nucleons works very well. The model for spin 1 2+ baryons can predict static parameters for Λ, Σ+, Σ0, Σ-, Ξ, Ξ-. We prepared the scheme how to construct the model also for Δ nucleon resonance. It was used to describe transition form factor GM∗ and the experimentally measured ratio RSM with the help of relations for magnetic dipole transition and charge quadrupole form factors.

  14. Predictive factors for the development of rubeosis following proton beam radiotherapy for uveal melanoma

    PubMed Central

    Foss, A.; Whelehan, I.; Hungerford, J.; Anderson, D.; Errington, R; Kacperek, A.; Restori, M.; Kongerud, J.; Sheen, M.

    1997-01-01

    AIMS/BACKGROUND—Proton beam radiotherapy can effectively treat primary uveal melanomas of any size. Some patients, however, develop adverse late effects following treatment and the purpose of this study was to determine which factors give rise to a poor local outcome.
METHODS—The hospital records from a first cohort of 127 patients treated by protons from 1989 to 1992 were reviewed retrospectively. The presence of rubeosis was selected as a measure of significant ocular damage. Split file analysis was performed with 73 cases forming a test group with the remaining 54 cases acting as a validation group.
RESULTS—Large tumour size and the presence of retinal detachment were significant, independent risk factors for developing rubeosis for both the test and validation groups. These factors also predicted subsequent enucleation for uncontrolled ocular pain. Patients with tumours too large to plaque and with an associated retinal detachment had a 90% chance of developing rubeosis within 4 years of proton beam radiotherapy.
CONCLUSIONS—Patients with a uveal melanoma too large for plaque therapy and an associated retinal detachment run a very high risk of developing rubeosis after proton beam radiotherapy and one third of individuals developing rubeosis required enucleation for pain even if local tumour control was satisfactory.

 PMID:9422926

  15. Electromagnetic Form Factors of Hadrons in Quantum Field Theories

    SciTech Connect

    Dominguez, C. A.

    2008-10-13

    In this talk, recent results are presented of calculations of electromagnetic form factors of hadrons in the framework of two quantum field theories (QFT), (a) Dual-Large N{sub c} QCD (Dual-QCD{sub {infinity}}) for the pion, proton, and {delta}(1236), and (b) the Kroll-Lee-Zumino (KLZ) fully renormalizable Abelian QFT for the pion form factor. Both theories provide a QFT platform to improve on naive (tree-level) Vector Meson Dominance (VMD). Dual-QCD{sub {infinity}} provides a tree-level improvement by incorporating an infinite number of zero-width resonances, which can be subsequently shifted from the real axis to account for the time-like behaviour of the form factors. The renormalizable KLZ model provides a QFT improvement of VMD in the framework of perturbation theory. Due to the relative mildness of the {rho}{pi}{pi} coupling, and the size of loop suppression factors, the perturbative expansion is well defined in spite of this being a strong coupling theory. Both approaches lead to considerable improvements of VMD predictions for electromagnetic form factors, in excellent agreement with data.

  16. Systematic Structural Elucidation for the Protonated Form of Rare Earth Bis(porphyrinato) Double-Decker Complexes: Direct Structural Evidence of the Location of the Attached Proton.

    PubMed

    Yamashita, Ken-Ichi; Sakata, Naoya; Ogawa, Takuji

    2016-09-01

    Direct structural evidence of the presence and location of the attached proton in the protonated form of rare earth bis(porphyrinato) double-decker complexes is obtained from an X-ray diffraction study of single crystals for a series of protonated forms of bis(tetraphenylporphyrinato) complexes [M(III)(tpp)(tppH)] (M = Tb, Y, Sm, Nd, and La). When CHCl3 is used as a solvent for crystallization of the complexes, their nondisordered molecular structures are obtained and the attached proton is identified on one of the eight nitrogen atoms. Use of other solvents affords another type of crystal, in which the position of the proton is disordered and thus the molecular structure is averaged. La complex also affords the disordered average structure even when CHCl3 is used for crystallization. A variable-temperature diffraction study for the Tb complex reveals that the dynamics of the proton in the nondisordered crystal is restricted. PMID:27541189

  17. Systematic Structural Elucidation for the Protonated Form of Rare Earth Bis(porphyrinato) Double-Decker Complexes: Direct Structural Evidence of the Location of the Attached Proton.

    PubMed

    Yamashita, Ken-Ichi; Sakata, Naoya; Ogawa, Takuji

    2016-09-01

    Direct structural evidence of the presence and location of the attached proton in the protonated form of rare earth bis(porphyrinato) double-decker complexes is obtained from an X-ray diffraction study of single crystals for a series of protonated forms of bis(tetraphenylporphyrinato) complexes [M(III)(tpp)(tppH)] (M = Tb, Y, Sm, Nd, and La). When CHCl3 is used as a solvent for crystallization of the complexes, their nondisordered molecular structures are obtained and the attached proton is identified on one of the eight nitrogen atoms. Use of other solvents affords another type of crystal, in which the position of the proton is disordered and thus the molecular structure is averaged. La complex also affords the disordered average structure even when CHCl3 is used for crystallization. A variable-temperature diffraction study for the Tb complex reveals that the dynamics of the proton in the nondisordered crystal is restricted.

  18. Experimental validation of beam quality correction factors for proton beams.

    PubMed

    Gomà, Carles; Hofstetter-Boillat, Bénédicte; Safai, Sairos; Vörös, Sándor

    2015-04-21

    This paper presents a method to experimentally validate the beam quality correction factors (kQ) tabulated in IAEA TRS-398 for proton beams and to determine the kQ of non-tabulated ionization chambers (based on the already tabulated values). The method is based exclusively on ionometry and it consists in comparing the reading of two ionization chambers under the same reference conditions in a proton beam quality Q and a reference beam quality (60)Co. This allows one to experimentally determine the ratio between the kQ of the two ionization chambers. In this work, 7 different ionization chamber models were irradiated under the IAEA TRS-398 reference conditions for (60)Co beams and proton beams. For the latter, the reference conditions for both modulated beams (spread-out Bragg peak field) and monoenergetic beams (pseudo-monoenergetic field) were studied. For monoenergetic beams, it was found that the experimental kQ values obtained for plane-parallel chambers are consistent with the values tabulated in IAEA TRS-398; whereas the kQ values obtained for cylindrical chambers are not consistent--being higher than the tabulated values. These results support the suggestion (of previous publications) that the IAEA TRS-398 reference conditions for monoenergetic proton beams should be revised so that the effective point of measurement of cylindrical ionization chambers is taken into account when positioning the reference point of the chamber at the reference depth. For modulated proton beams, the tabulated kQ values of all the ionization chambers studied in this work were found to be consistent with each other--except for the IBA FC65-G, whose experimental kQ value was found to be 0.6% lower than the tabulated one. The kQ of the PTW Advanced Markus chamber, which is not tabulated in IAEA TRS-398, was found to be 0.997 ± 0.042 (k = 2), based on the tabulated value of the PTW Markus chamber.

  19. Charm form factors in hadronic interactions

    SciTech Connect

    Bracco, M. E.; Navarra, F. S.; Nielsen, M.; Chiapparini, M.

    2010-12-28

    We calculate the form factors and the coupling constants in vertices with charm mesons, such as {rho}D*D*, in the framework of QCD sum rules. We first discuss the applications of these form factors in heavy ion collisions and in B decays. We then present an introduction to the method of QCD sum rules and describe how to work with the three-point function. We give special attention to the procedure employed to extrapolate results obtained in the deep euclidean region to the poles of the particles, located in the time-like region. Finally we present a table of ready-to-use parametrizations of all the form factors, which are relevant for the processes mentioned in the introduction. We also give the coupling constants.

  20. Energy-dependent dipole form factor in a QCD-inspired model

    NASA Astrophysics Data System (ADS)

    Bahia, C. A. S.; Broilo, M.; Luna, E. G. S.

    2016-04-01

    We consider the effect of an energy-dependent dipole form factor in the high-energy behavior of the forward amplitude. The connection between the semihard parton-level dynamics and the hadron-hadron scattering is established by an eikonal QCD-based model. Our results for the proton-proton (pp) and antiproton-proton (¯pp) total cross sections, σpp,\\bar{pp}tot(s), obtained using the CTEQ6L1 parton distribution function, are consistent with the recent data from the TOTEM experiment.

  1. Form factor effects in the direct detection of isospin-violating dark matter

    SciTech Connect

    Zheng, Hao; Zhang, Zhen; Chen, Lie-Wen E-mail: malkuth@sjtu.edu.cn

    2014-08-01

    Isospin-violating dark matter (IVDM) provides a possible mechanism to ameliorate the tension among recent direct detection experiments. For IVDM, we demonstrate that the results of direct detection experiments based on neutron-rich target nuclei may depend strongly on the density dependence of the symmetry energy which is presently largely unknown and controls the neutron skin thickness that reflects the relative difference of neutron and proton form factors in the neutron-rich nuclei. In particular, using the neutron and proton form factors obtained from Skyrme-Hartree-Fock calculations by varying the symmetry energy within the uncertainty region set by the latest model-independent measurement of the neutron skin thickness of {sup 208}Pb from PREX experiment at JLab, we find that, for IVDM with neutron-to-proton coupling ratio fixed to f{sub n}/f{sub p}=-0.7, the form factor effect may enhance the sensitivity of Xe-based detectors (e.g., XENON100 and LUX) to the DM-proton cross section by a factor of 3 in the DM mass region constrained by CMDS-II(Si) and even by more than an order of magnitude for heavy DM with mass larger than 80 GeV, compared with the results using the empirical Helm form factor. Our results further indicate that the form factor effect can significantly modify the recoil spectrum of Xe-based detectors for heavy IVDM with f{sub n}/f{sub p}=-0.7.

  2. Form factor effects in the direct detection of isospin-violating dark matter

    NASA Astrophysics Data System (ADS)

    Zheng, Hao; Zhang, Zhen; Chen, Lie-Wen

    2014-08-01

    Isospin-violating dark matter (IVDM) provides a possible mechanism to ameliorate the tension among recent direct detection experiments. For IVDM, we demonstrate that the results of direct detection experiments based on neutron-rich target nuclei may depend strongly on the density dependence of the symmetry energy which is presently largely unknown and controls the neutron skin thickness that reflects the relative difference of neutron and proton form factors in the neutron-rich nuclei. In particular, using the neutron and proton form factors obtained from Skyrme-Hartree-Fock calculations by varying the symmetry energy within the uncertainty region set by the latest model-independent measurement of the neutron skin thickness of 208Pb from PREX experiment at JLab, we find that, for IVDM with neutron-to-proton coupling ratio fixed to fn/fp=-0.7, the form factor effect may enhance the sensitivity of Xe-based detectors (e.g., XENON100 and LUX) to the DM-proton cross section by a factor of 3 in the DM mass region constrained by CMDS-II(Si) and even by more than an order of magnitude for heavy DM with mass larger than 80 GeV, compared with the results using the empirical Helm form factor. Our results further indicate that the form factor effect can significantly modify the recoil spectrum of Xe-based detectors for heavy IVDM with fn/fp=-0.7.

  3. Proton Therapy

    MedlinePlus

    ... nucleus is surrounded by electrons. In proton therapy, beams of fast-moving protons are used to destroy ... atoms to release proton, neutron, and helium ion beams. In this highly specialized form of radiosurgery , proton ...

  4. Electromagnetic charged and neutral kaon form factors

    SciTech Connect

    Roberts, C.D.; Burden, C.J.; Thomson, M.J.

    1995-08-01

    The electromagnetic form factor of the charged and neutral kaon is calculated using the approach applied in the successful study of the pion form factor, described above. The charged kaon form factor will be measured in forthcoming experiments at CEBAF. Our calculation involves the dressed strange quark propagator, to which F{sub {pi}}(q{sup 2}) is not sensitive, and hence it provides us with constraints on the strange-quark sector of QCD. Our preliminary results are encouraging. We find that the strange and up/down quark propagators are not too different, once the change in the current-quark-mass is accounted for. However, the difference that remains is important since it allows {l_angle}{bar s}s{r_angle}<{l_angle}{bar u}u{r_angle}. This calculation is the first to yield a value of f{sub K}/f{sub {pi}} that is in good agreement with experiment and also yields r{sub K+}/r{sub {pi}} in good agreement with experiment. Our calculated charged kaon form factor provides a prediction that will be tested in the forthcoming CEBAF experiments. Our studies also show that K{sup 0} has a negative charge radius, as is to be expected. Our calculated value will be compared with that measured in K{sub s}{sup 0} regeneration from electrons.

  5. Electromagnetic Transition form Factor of Nucleon Resonances

    NASA Astrophysics Data System (ADS)

    Sato, Toru

    2016-10-01

    A dynamical coupled channel model for electron and neutrino induced meson production reactions is developed. The model is an extension of our previous reaction model to describe reactions at finite Q^2. The electromagnetic transition form factors of the first (3/2^+,3/2) and (3/2^-,1/2) resonances extracted from partial wave amplitude are discussed.

  6. Form Factors and Radii of Light Nuclei

    SciTech Connect

    Sick, Ingo

    2015-09-15

    We discuss the determination of electromagnetic form factors from the world data on electron–nucleus scattering for nuclei Z ≤ 3, with particular emphasis on the derivation of the moments required for comparison with measurements from electronic/muonic atoms and isotope shifts.

  7. Meson-photon transition form factors

    SciTech Connect

    Balakireva, Irina; Lucha, Wolfgang; Melikhov, Dmitri

    2012-10-23

    We present the results of our recent analysis of the meson-photon transition form factors F{sub P{gamma}}(Q{sup 2}) for the pseudoscalar mesons P {pi}{sup 0},{eta},{eta} Prime ,{eta}{sub c}, using the local-duality version of QCD sum rules.

  8. Ferroelectric inversion layers formed by heat treatment of proton-exchanged LiTaO3

    NASA Astrophysics Data System (ADS)

    Nakamura, Kiyoshi; Shimizu, Hiroshi

    1990-04-01

    We report that a ferroelectric inversion layer can be formed in LiTaO3 by proton exchange in benzoic acid melts followed by heat treatment at temperatures just below the Curie point. It is demonstrated that the inversion layer appears at the -c surface for LiTaO3, whereas it appears at the +c surface for LiNbO3. The dependence of the inversion layer thickness on the conditions of proton exchange and heat treatment is also reported.

  9. Nucleon and Deuteron Form Factors from BLAST

    SciTech Connect

    Hasell, D. K.

    2009-12-17

    The BLAST experiment was designed to study in a systematic manner the spin-dependent, electromagnetic interaction on hydrogen and deuterium. Measuring only asymmetries in electron scattering with respect to the beam helicity, target spin, or both; the BLAST experiment was able to extract information on nucleon and deuteron form factors independent of beam intensity or target density. By further forming 'super-ratios' of asymmetries, measurements were possible independent of beam and target polarization thus reducing uncertainties due to these quantities as well. Some of the form factor results from BLAST will be briefly presented here. Also, in response to observed discrepancies between polarization measurements and those obtained using traditional Rosenbluth separation techniques a proposed experiment, OLYMPUS, which will use the BLAST detector to measure the two photon contribution to elastic electron scattering will also be presented.

  10. Unified description of kaon electroweak form factors

    SciTech Connect

    A. Afanasev; W. Buck

    1996-06-01

    A calculation of the semileptonic decays of the kaon (K{sub l3}) is presented. The results are direct predictions of a covariant model of the pion and kaon introduced earlier by Ito, Buck, Gross. The weak form factors for K{sub l3} are predicted with absolutely no parameter adjustments of the model. The authors obtained for the form factor parameters: f{sub {minus}}(q{sup 2}=m{sub l}{sup 2})/f{sub +}(q{sup 2}=m{sub l}{sup 2})={minus}0.28 and {lambda}{sub +}= 0.028, both within experimental error bars. Connections of this approach to heavy quark symmetry will also be discussed.

  11. Form factors for Russian doll droplet models

    NASA Astrophysics Data System (ADS)

    Wilemski, G.; Obeidat, A.; Hrahsheh, F.

    2013-05-01

    Molecular dynamics (MD) simulations of nanodroplets containing water and nonane show them to be nonspherical and strongly phase separated. A simple, but realistic model for these "Russian doll" structures is a spherical nonane lens that partially wets a spherical water droplet. This document contains an analytical calculation of the particle form factor P(q) needed to analyze experimental measurements of small angle neutron and x-ray scattering from aerosols of particles with this type of structure. In addition, an exact formulation of the particle form factor is developed for cylindrically symmetric droplets with otherwise arbitrary scattering length density functions. This result will be useful to calculate P(q) directly from MD simulation results. We compare results using both formulations and find excellent agreement between them.

  12. Use of form factors in electromagnetic interactions

    SciTech Connect

    Naus, H.W.L.; Koch, J.H.

    1989-05-01

    We comment on the description of electromagnetic reactions involving hadrons, when the internal structure of the hadrons is taken into account. General off-shell vertex operators, only constrained by Lorentz and gauge invariance, are used. The electromagnetic production of pions on a nucleon is discussed as an example. Commonly used ad hoc recipes involving phenomenological form factors are discussed in the framework of an exact formulation.

  13. Heavy to light baryon transition form factors

    SciTech Connect

    Guo, X. |; Huang, T. |; Li, Z.

    1996-05-01

    Recently, Stech found form factor relations for heavy to light transitions based on two simple dynamical assumptions for a spectator particle. In this paper we generalize his approach to the case of baryons and find that for {Lambda}{sub {ital Q}}{r_arrow}{Lambda} ({ital Q}={ital b} or {ital c}) only one independent form factor remains in the limit {ital m}{sub {ital Q}}{r_arrow}{infinity}. Furthermore, combining with the model of Guo and Kroll we determine both of the two form factors for {Lambda}{sub {ital Q}}{r_arrow}{Lambda} in the heavy quark limit. The results are applied to {Lambda}{sub {ital b}}{r_arrow}{Lambda}+{ital J}/{psi} which is not clarified both theoretically and experimentally. It is found that the branching ratio of {Lambda}{sub {ital b}}{r_arrow}{Lambda}+{ital J}/{psi} is of order 10{sup {minus}5}. {copyright} {ital 1996 The American Physical Society.}

  14. Transverse form factors of [sup 117]Sn

    SciTech Connect

    Baghaei, H.; Dubach, J.; Frodyma, M.B.; Hicks, R.S.; Miskimen, R.A.; Peterson, G.A.; Rokni, S.H. ); Hotta, A. ); Suzuki, T. )

    1993-08-01

    Transverse elastic and inelastic form factors for low-lying levels in [sup 117]Sn have been measured by 180[degree] electron scattering in the momentum transfer range [ital q][sub eff]=1.1--2.4 fm[sup [minus]1]. The simple independent-particle model fails to account for these data, predicting form factors that are much too large. In better quantitative agreement with the data are the results of more detailed calculations that allow for configuration mixing of valence nucleons, as well as first-order core polarization. As in the similar case of [sup 205]Tl, these calculations successfully predict the presence of a deep diffraction minimum observed in the intermediate [ital q] region of the elastic [ital M]1 form factor. Nevertheless, the overall description of the data by the detailed calculations remains quantitatively unsatisfactory. A more complete understanding of these data may rely upon the consideration of multiparticle-multihole configurations outside the 0[h bar][omega] basis space.

  15. High duty factor plasma generator for CERN's Superconducting Proton Linac.

    PubMed

    Lettry, J; Kronberger, M; Scrivens, R; Chaudet, E; Faircloth, D; Favre, G; Geisser, J-M; Küchler, D; Mathot, S; Midttun, O; Paoluzzi, M; Schmitzer, C; Steyaert, D

    2010-02-01

    CERN's Linac4 is a 160 MeV linear accelerator currently under construction. It will inject negatively charged hydrogen ions into CERN's PS-Booster. Its ion source is a noncesiated rf driven H(-) volume source directly inspired from the one of DESY and is aimed to deliver pulses of 80 mA of H(-) during 0.4 ms at a 2 Hz repetition rate. The Superconducting Proton Linac (SPL) project is part of the luminosity upgrade of the Large Hadron Collider. It consists of an extension of Linac4 up to 5 GeV and is foreseen to deliver protons to a future 50 GeV synchrotron (PS2). For the SPL high power option (HP-SPL), the ion source would deliver pulses of 80 mA of H(-) during 1.2 ms and operate at a 50 Hz repetition rate. This significant upgrade motivates the design of the new water cooled plasma generator presented in this paper. Its engineering is based on the results of a finite element thermal study of the Linac4 H(-) plasma generator that identified critical components and thermal barriers. A cooling system is proposed which achieves the required heat dissipation and maintains the original functionality. Materials with higher thermal conductivity are selected and, wherever possible, thermal barriers resulting from low pressure contacts are removed by brazing metals on insulators. The AlN plasma chamber cooling circuit is inspired from the approach chosen for the cesiated high duty factor rf H(-) source operating at SNS. PMID:20192392

  16. High duty factor plasma generator for CERN's Superconducting Proton Linac.

    PubMed

    Lettry, J; Kronberger, M; Scrivens, R; Chaudet, E; Faircloth, D; Favre, G; Geisser, J-M; Küchler, D; Mathot, S; Midttun, O; Paoluzzi, M; Schmitzer, C; Steyaert, D

    2010-02-01

    CERN's Linac4 is a 160 MeV linear accelerator currently under construction. It will inject negatively charged hydrogen ions into CERN's PS-Booster. Its ion source is a noncesiated rf driven H(-) volume source directly inspired from the one of DESY and is aimed to deliver pulses of 80 mA of H(-) during 0.4 ms at a 2 Hz repetition rate. The Superconducting Proton Linac (SPL) project is part of the luminosity upgrade of the Large Hadron Collider. It consists of an extension of Linac4 up to 5 GeV and is foreseen to deliver protons to a future 50 GeV synchrotron (PS2). For the SPL high power option (HP-SPL), the ion source would deliver pulses of 80 mA of H(-) during 1.2 ms and operate at a 50 Hz repetition rate. This significant upgrade motivates the design of the new water cooled plasma generator presented in this paper. Its engineering is based on the results of a finite element thermal study of the Linac4 H(-) plasma generator that identified critical components and thermal barriers. A cooling system is proposed which achieves the required heat dissipation and maintains the original functionality. Materials with higher thermal conductivity are selected and, wherever possible, thermal barriers resulting from low pressure contacts are removed by brazing metals on insulators. The AlN plasma chamber cooling circuit is inspired from the approach chosen for the cesiated high duty factor rf H(-) source operating at SNS.

  17. Alpha-helical hydrophobic polypeptides form proton-selective channels in lipid bilayers.

    PubMed Central

    Oliver, A E; Deamer, D W

    1994-01-01

    Proton translocation is important in membrane-mediated processes such as ATP-dependent proton pumps, ATP synthesis, bacteriorhodopsin, and cytochrome oxidase function. The fundamental mechanism, however, is poorly understood. To test the theoretical possibility that bundles of hydrophobic alpha-helices could provide a low energy pathway for ion translocation through the lipid bilayer, polyamino acids were incorporated into extruded liposomes and planar lipid membranes, and proton translocation was measured. Liposomes with incorporated long-chain poly-L-alanine or poly-L-leucine were found to have proton permeability coefficients 5 to 7 times greater than control liposomes, whereas short-chain polyamino acids had relatively little effect. Potassium permeability was not increased markedly by any of the polyamino acids tested. Analytical thin layer chromatography measurements of lipid content and a fluorescamine assay for amino acids showed that there were approximately 135 polyleucine or 65 polyalanine molecules associated with each liposome. Fourier transform infrared spectroscopy indicated that a major fraction of the long-chain hydrophobic peptides existed in an alpha-helical conformation. Single-channel recording in both 0.1 N HCl and 0.1 M KCl was also used to determine whether proton-conducting channels formed in planar lipid membranes (phosphatidylcholine/phosphatidylethanolamine, 1:1). Poly-L-leucine and poly-L-alanine in HCl caused a 10- to 30-fold increase in frequency of conductive events compared to that seen in KCl or by the other polyamino acids in either solution. This finding correlates well with the liposome observations in which these two polyamino acids caused the largest increase in membrane proton permeability but had little effect on potassium permeability. Poly-L-leucine was considerably more conductive than poly-L-alanine due primarily to larger event amplitudes and, to a lesser extent, a higher event frequency. Poly-L-leucine caused two

  18. Alpha-helical hydrophobic polypeptides form proton-selective channels in lipid bilayers

    NASA Technical Reports Server (NTRS)

    Oliver, A. E.; Deamer, D. W.

    1994-01-01

    Proton translocation is important in membrane-mediated processes such as ATP-dependent proton pumps, ATP synthesis, bacteriorhodopsin, and cytochrome oxidase function. The fundamental mechanism, however, is poorly understood. To test the theoretical possibility that bundles of hydrophobic alpha-helices could provide a low energy pathway for ion translocation through the lipid bilayer, polyamino acids were incorporated into extruded liposomes and planar lipid membranes, and proton translocation was measured. Liposomes with incorporated long-chain poly-L-alanine or poly-L-leucine were found to have proton permeability coefficients 5 to 7 times greater than control liposomes, whereas short-chain polyamino acids had relatively little effect. Potassium permeability was not increased markedly by any of the polyamino acids tested. Analytical thin layer chromatography measurements of lipid content and a fluorescamine assay for amino acids showed that there were approximately 135 polyleucine or 65 polyalanine molecules associated with each liposome. Fourier transform infrared spectroscopy indicated that a major fraction of the long-chain hydrophobic peptides existed in an alpha-helical conformation. Single-channel recording in both 0.1 N HCl and 0.1 M KCl was also used to determine whether proton-conducting channels formed in planar lipid membranes (phosphatidylcholine/phosphatidylethanolamine, 1:1). Poly-L-leucine and poly-L-alanine in HCl caused a 10- to 30-fold increase in frequency of conductive events compared to that seen in KCl or by the other polyamino acids in either solution. This finding correlates well with the liposome observations in which these two polyamino acids caused the largest increase in membrane proton permeability but had little effect on potassium permeability. Poly-L-leucine was considerably more conductive than poly-L-alanine due primarily to larger event amplitudes and, to a lesser extent, a higher event frequency. Poly-L-leucine caused two

  19. Fabrication of metallic bipolar plate for proton exchange membrane fuel cells by rubber pad forming

    NASA Astrophysics Data System (ADS)

    Liu, Yanxiong; Hua, Lin

    In this paper, the rubber pad forming process is used to fabricate the metallic bipolar plate for a proton exchange membrane (PEM) fuel cell, which has multi-array micro-scale flow channels on its surface. The rubber pad forming process has the following advantages: high surface quality and dimensional accuracy of the formed parts, low cost of the die because only one rigid die is required, and high efficiency. The process control parameters (rubber hardness, internal and outer radii, draft angle) of the rubber pad forming are analyzed by the finite element method using the commercial software Abaqus. After that, the rubber pad forming process is used to manufacture a metallic bipolar plate of SS304 stainless steel with perfect flow micro-channels. The results of this effort indicated that the rubber pad forming process is a feasible technique for fabricating the bipolar plates of PEM fuel cells.

  20. Lattice Calculations of Nucleon Form Factors

    SciTech Connect

    Syritsyn, S. N.

    2011-10-24

    We present recent results of calculation of the isovector electromagnetic and axial form factors of the nucleon using lattice QCD with three different lattice actions and pion masses down to m{sub {pi}} > or approx. 300 MeV. Because of the precision of our high-statistics calculations, we can test predictions of baryon chiral perturbation theory for the charge and axial radii of the nucleon. We find that currently available baryon ChPT calculations disagree with our data, indicating that the corresponding effective theory approximations are not valid above m{sub {pi}{approx_equal}3}00 MeV.

  1. Neutron electric form factor via recoil polarimetry

    SciTech Connect

    Madey, Richard; Semenov, Andrei; Taylor, Simon; Aghalaryan, Aram; Crouse, Erick; MacLachlan, Glen; Plaster, Bradley; Tajima, Shigeyuki; Tireman, William; Yan, Chenyu; Ahmidouch, Abdellah; Anderson, Brian; Asaturyan, Razmik; Baker, O; Baldwin, Alan; Breuer, Herbert; Carlini, Roger; Christy, Michael; Churchwell, Steve; Cole, Leon; Danagoulian, Samuel; Day, Donal; Elaasar, Mostafa; Ent, Rolf; Farkhondeh, Manouchehr; Fenker, Howard; Finn, John; Gan, Liping; Garrow, Kenneth; Gueye, Paul; Howell, Calvin; Hu, Bitao; Jones, Mark; Kelly, James; Keppel, Cynthia; Khandaker, Mahbubul; Kim, Wooyoung; Kowalski, Stanley; Lung, Allison; Mack, David; Manley, D; Markowitz, Pete; Mitchell, Joseph; Mkrtchyan, Hamlet; Opper, Allena; Perdrisat, Charles; Punjabi, Vina; Raue, Brian; Reichelt, Tilmann; Reinhold, Joerg; Roche, Julie; Sato, Yoshinori; Seo, Wonick; Simicevic, Neven; Smith, Gregory; Stepanyan, Samuel; Tadevosyan, Vardan; Tang, Liguang; Ulmer, Paul; Vulcan, William; Watson, John; Wells, Steven; Wesselmann, Frank; Wood, Stephen; Yan, Chen; Yang, Seunghoon; Yuan, Lulin; Zhang, Wei-Ming; Zhu, Hong Guo; Zhu, Xiaofeng

    2003-05-01

    The ratio of the electric to the magnetic form factor of the neutron, G_En/G_Mn, was measured via recoil polarimetry from the quasielastic d({pol-e},e'{pol-n)p reaction at three values of Q^2 [viz., 0.45, 1.15 and 1.47 (GeV/c)^2] in Hall C of the Thomas Jefferson National Accelerator Facility. Preliminary data indicate that G_En follows the Galster parameterization up to Q^2 = 1.15 (GeV/c)^2 and appears to rise above the Galster parameterization at Q^2 = 1.47 (GeV/c)^2.

  2. Pseudoscalar transition form factors from rational approximants

    NASA Astrophysics Data System (ADS)

    Masjuan, Pere

    2014-06-01

    The π0, η, and η' transition form factors in the space-like region are analyzed at low and intermediate energies in a model-independent way through the use of rational approximants. Slope and curvature parameters as well as their values at infinity are extracted from experimental data. These results are suited for constraining hadronic models such as the ones used for the hadronic light-by-light scattering part of the anomalous magnetic moment of the muon, and for the mixing parameters of the η - η' system.

  3. Helium Compton Form Factor Measurements at CLAS

    SciTech Connect

    Voutier, Eric J.-M.

    2013-07-01

    The distribution of the parton content of nuclei, as encoded via the generalized parton distributions (GPDs), can be accessed via the deeply virtual Compton scattering (DVCS) process contributing to the cross section for leptoproduction of real photons. Similarly to the scattering of light by a material, DVCS provides information about the dynamics and the spatial structure of hadrons. The sensitivity of this process to the lepton beam polarization allows to single-out the DVCS amplitude in terms of Compton form factors that contain GPDs information. The beam spin asymmetry of the $^4$He($\\vec {\\mathrm e}$,e$' \\gamma ^4$He) process was measured in the experimental Hall B of the Jefferson Laboratory to extract the real and imaginary parts of the twist-2 Compton form factor of the $^4$He nucleus. The experimental results reported here demonstrate the relevance of this method for such a goal, and suggest the dominance of the Bethe-Heitler amplitude to the unpolarized process in the kinematic range explored by the experiment.

  4. Electromagnetic Transition Form Factors of Nucleon Resonances

    SciTech Connect

    Burkert, Volker D.

    2008-10-13

    Recent measurements of nucleon resonance transition form factors with CLAS at Jefferson Lab are discussed. The new data resolve a long-standing puzzle of the nature of the Roper resonance, and confirm the assertion of the symmetric constituent quark model of the Roper as the first radial excitation of the nucleon. The data on high Q{sup 2} n{pi}{sup +} production confirm the slow fall off of the S{sub 11}(1535) transition form factor with Q{sup 2}, and better constrain the branching ratios {beta}{sub N{pi}} = 0.50 and {beta}{sub N{eta}} = 0.45. For the first time, the longitudinal transition amplitude to the S{sub 11}(1535) was extracted from the n{pi}{sup +} data. Also, new results on the transition amplitudes for the D{sub 13}(1520) resonance are presented showing a rapid transition from helicity 3/2 dominance seen at the real photon point to helicty 1/2 dominance at higher Q{sup 2}.

  5. Measurements of hadron form factors at BESIII

    NASA Astrophysics Data System (ADS)

    Morales, Cristina Morales

    2016-05-01

    BEPCII is a symmetric e+e--collider located in Beijing running at center-of-mass energies between 2.0 and 4.6 GeV. This energy range allows the BESIII-experiment to measure hadron form factors both from direct e+e--annihilation and from initial state radiation processes. In this paper, results on e+e- → p p ¯ based on data collected by BESIII in 2011 and 2012 are presented. We also present preliminary results on e+e- → Λ Λ ¯ based on the same data samples at 4 center-of-mass energies. BESIII results obtained from e+e- → π+π- using the initial state radiation technique at the center-of-mass energy of 3.773 GeV are also summarized. Finally, expectations on the measurement of baryon electromagnetic form factors from the BESIII high luminosity energy scan in 2015 and from initial state radiation processes at different center-of-mass energies are also explained.

  6. Elastic and Transition Form Factors in DSEs

    NASA Astrophysics Data System (ADS)

    Segovia, Jorge

    2016-06-01

    A symmetry preserving framework for the study of continuum quantum chromodynamics (QCD) is obtained from a truncated solution of the QCD equations of motion or QCD's Dyson-Schwinger equations (DSEs). A nonperturbative solution of the DSEs enables the study of, e.g., hadrons as composites of dressed-quarks and dressed-gluons, the phenomena of confinement and dynamical chiral symmetry breaking, and therefrom an articulation of any connection between them. It is within this context that we present a unified study of Nucleon, Delta and Roper elastic and transition form factors, and compare predictions made using a framework built upon a Faddeev equation kernel and interaction vertices that possess QCD-like momentum dependence with results obtained using a symmetry-preserving treatment of a vector ⊗ vector contact-interaction.

  7. Nucleon Transition Form Factors and New Perspectives

    SciTech Connect

    Gothe, R W

    2007-10-01

    The status of the electro-excitation program to study baryon resonances at Jefferson Lab will be exemplified by the most recent results on resonance parameters and transition form factors in single and double-pion production. These results demonstrate that the separation of resonance and background contributions and therefore the extraction of the electro-coupling amplitudes of resonances become easier and cleaner at higher four-momentum transfers (Q2). Furthermore, the double-pion in comparison to the single-pion channel shows a higher sensitivity to higher excited resonances and a distinctly different Q2 dependence of the background amplitudes. The combined analysis of the single- and double-pion data reduces model dependent uncertainties significantly, which allows us to extract the resonant electrocoupling amplitudes with an unprecedented quality.

  8. Neutron-Proton Asymmetry Dependence of Spectroscopic Factors in Ar Isotopes

    SciTech Connect

    Lee, Jenny; Tsang, Betty; Shapira, Dan

    2010-01-01

    Spectroscopic factors have been extracted for proton-rich 34Ar and neutron-rich 46Ar using the (p, d) neutron transfer reaction. The experimental results show little reduction of the ground state neutron spectroscopic factor of the proton-rich nucleus 34Ar compared to that of 46Ar. The results suggest that correlations, which generally reduce such spectroscopic factors, do not depend strongly on the neutron-proton asymmetry of the nucleus in this isotopic region as was reported in knockout reactions. The present results are consistent with results from systematic studies of transfer reactions but inconsistent with the trends observed in knockout reaction measurements.

  9. Structure of olefin-imidacloprid and gas-phase fragmentation chemistry of its protonated form.

    PubMed

    Fusetto, Roberto; White, Jonathan M; Hutton, Craig A; O'Hair, Richard A J

    2016-02-01

    One of the major insect metabolites of the widely used neonicotinoid insecticide imidacloprid, 1 (1-[(6-chloro-3-pyridinyl)methyl]-N-nitro-1H-imidazol-2-amine), is the olefin 2. To better understand how the structure of olefin 2 relates to the gas-phase fragmentation of its protonated form, 2H(+), X-ray crystallography, tandem mass spectrometry experiments and DFT calculations were carried out. Olefin 2 was found to be in a tautomeric form where the proton is on the N(1) position of the imidazole ring and forms a hydrogen bond to one of the oxygen atoms of the coplanar nitroamine group. Under conditions of low-energy collision-induced dissociation (CID) in a linear ion trap, 2H(+), formed via electrospray ionization (ESI), fragments via a major loss of water, together with minor competing losses of HNO2 and NO2•.This contrasts with 1H+, which mainly undergoes bond homolysis via NO2• loss. Thus, installation of the double bond in 2 plays a key role in facilitating the loss of water. DFT calculations, carried out using the B3LYP/6-311G++(d,p) level of theory, revealed that loss of water was energetically more favourable compared to HNO2 and NO2• loss. Three multistep, energetically accessible mechanisms were identified for loss of water from 2H(+), and these have the following barriers: (I) direct proton transfer from N(5) of the pyridine to O(1) on the NO2 group (119 kJ mol(-1)); (II) rotation of the N(2)-N(4) bond (117 kJ mol(-1)); (III) 1,3-intramolecular proton transfer between the two oxygen atoms of the NO2 group (145 kJ mol(-1)). Given that the lowest barrier for the losses of HNO2 and NO2• is 156 kJ mol(-1), it is likely that all three water loss mechanisms occur concurrently.

  10. Baryon Transition Form Factors at JLab: Status and Outlook

    SciTech Connect

    Ralf Gothe

    2009-12-01

    The measurements of exclusive single-meson and double-pion electro-production cross sections off the proton to study nucleon resonances will be extended to higher momentum transfers with the CLAS12 detector and the energy upgraded CEBAF beam. Based on new theoretical developments to extract and interpret the electromagnetic transition form factors and on the experience gained from the most recent results, the newly formed collaboration of experimentalists and theorists shall enable us to provide unprecedented high-precision data, high-quality analyses, and state-of-the-art model and QCD based calculations in a Q domain up to 10 GeV{sup 2}. For the first time nucleon resonance structures will be studied at still unexplored distance scales, where the dressed quark contributions are the dominating degrees of freedom and their strong interaction is responsible for the ground and excited nucleon state formation. These studies also open up a promising opportunity to understand the origin of more than 98% of the nucleon mass that is created by strong fields predominantly at these distance scales by dressing the current quarks.

  11. Nucleon Structure and hyperon form factors from lattice QCD

    SciTech Connect

    Lin, Huey-Wen

    2007-06-11

    In this work, I report the latest lattice QCD calculations of nucleon and hyperon structure from chiral fermions in 2+1-flavor dynamical simulations. All calculations are done with a chirally symmetric fermion action, domain-wall fermions, for valence quarks. I begin with the latest lattice results on the nucleon structure, focusing on results from RBC/UKQCD using 2+1-flavor chiral fermion actions. We find the chiral-extrapolated axial coupling constant at physical pion mass point to be 1.23(5), consistant with experimental value. The renormalization constants for the structure functions are obtained from RI/MOM-scheme non-perturbative renormalization. We find first moments of the polarized and unpolarized nucleon structure functions at zero transfer momentum to be 0.133(13) and 0.203(23) respectively, using continuum chiral extrapolation. These are consistent with the experimental values, unlike previous calculations which have been 50% larger. We also have a prediction for the transversity, which we find to be 0.56(4). The twist-3 matrix element is consistent with zero which agrees with the prediction of the Wandzura-Wilczek relation. In the second half of this work, I report an indirect dynamical estimation of the strangeness proton magnetic moments using mixed actions. With the analysis of hyperon form factors and using charge symmetry, the strangeness of proton is found to be -0.066(26), consistent with the Adelaide-JLab Collaboration's result. The hyperon Sigma and Xi axial coupling constants are also performed for the first time in a lattice calculation, g_SigmaSigma = 0.441(14) and g_XiXi = -0.277(11).

  12. Nucleon Structure and Hyperon Form Factors from Lattice QCD.

    SciTech Connect

    Lin,H.W.

    2007-06-11

    In this work, I report the latest lattice QCD calculations of nucleon and hyperon structure from chiral fermions in 2+1-flavor dynamical simulations. All calculations are done with a chirally symmetric fermion action, domain-wall fermions, for valence quarks. I begin with the latest lattice results on the nucleon structure, focusing on results from RBC/UKQCD using 2+1-flavor chiral fermion actions. We find the chiral-extrapolated axial coupling constant at physical pion mass point. to be 1.23(5), consistent with experimental value. The renormalization constants for the structure functions are obtained from RI/MOM-scheme non-perturbative renormalization. We find first moments of the polarized and unpolarized nucleon structure functions at zero transfer momentum to be 0.133(13) and 0.203(23) respectively, using continuum chiral extrapolation. These are consistent with the experimental values, unlike previous calculations which have been 50% larger. We also have a prediction for the transversity, which we find to be 0.56(4). The twist-3 matrix element is consistent with zero which agrees with the prediction of the Wandzura-Wilczek relation. In the second half of this work, I report an indirect dynamical estimation of the strangeness proton magnetic moments using mixed actions. With the analysis of hyperon form factors and using charge symmetry, the strangeness of proton is found to be -0.066(2G), consistent with the Adelaide-JLab Collaboration's result. The hyperon {Sigma} and {Xi} axial coupling constants are also performed for the first time in a lattice calculation, g{sub {Sigma}{Sigma}} = 0.441(14) and g{sub {Xi}{Xi}} = -0.277(11).

  13. Vector and Axial Vector Pion Form Factors

    NASA Astrophysics Data System (ADS)

    Vitz, Michael; PEN Collaboration

    2015-04-01

    Radiative pion decay π+ -->e+ νγ (RPD) provides critical input to chiral perturbation theory (χPT). Aside from the uninteresting ``inner bremsstrahlung'' contribution from QED, the RPD rate contains ``structure dependent'' terms given by FV and FA, the vector and axial-vector pion form factors, respectively. The two appear in the decay rate in combinations FV -FA and FV +FA , i.e., in the so-called SD- and SD+ terms, respectively. The latter has been measured to high precision by the PIBETA collaboration. We report on the analysis of new data, measured by the PEN collaboration in runs between 2008 and 2010 at the Paul Scherrer Institute, Switzerland. We particularly focus on the possibility of improvement in the determination of the SD- term. Precise determinations of FV and FA test the validity of the CVC hypothesis, provide numerical input for the l9 +l10 terms in the χPT lagrangian, and constrain potential non-(V - A) terms, such as a possible tensor term FT. NSF grants PHY-0970013, 1307328, and others.

  14. Gravitational form factors and nucleon spin structure

    NASA Astrophysics Data System (ADS)

    Teryaev, O. V.

    2016-10-01

    Nucleon scattering by the classical gravitational field is described by the gravitational (energy-momentum tensor) form factors (GFFs), which also control the partition of nucleon spin between the total angular momenta of quarks and gluons. The equivalence principle (EP) for spin dynamics results in the identically zero anomalous gravitomagnetic moment, which is the straightforward analog of its electromagnetic counterpart. The extended EP (ExEP) describes its (approximate) validity separately for quarks and gluons and, in turn, results in equal partition of the momentum and total angular momentum. It is violated in quantum electrodynamics and perturbative quantum chromodynamics (QCD), but may be restored in nonperturbative QCD because of confinement and spontaneous chiral symmetry breaking, which is supported by models and lattice QCD calculations. It may, in principle, be checked by extracting the generalized parton distributions from hard exclusive processes. The EP for spin-1 hadrons is also manifested in inclusive processes (deep inelastic scattering and the Drell-Yan process) in sum rules for tensor structure functions and parton distributions. The ExEP may originate in either gravity-proof confinement or in the closeness of the GFF to its asymptotic values in relation to the mediocrity principle. The GFFs in time-like regions reveal some similarity between inflation and annihilation.

  15. Neutrons in proton pencil beam scanning: parameterization of energy, quality factors and RBE

    NASA Astrophysics Data System (ADS)

    Schneider, Uwe; Hälg, Roger A.; Baiocco, Giorgio; Lomax, Tony

    2016-08-01

    The biological effectiveness of neutrons produced during proton therapy in inducing cancer is unknown, but potentially large. In particular, since neutron biological effectiveness is energy dependent, it is necessary to estimate, besides the dose, also the energy spectra, in order to obtain quantities which could be a measure of the biological effectiveness and test current models and new approaches against epidemiological studies on cancer induction after proton therapy. For patients treated with proton pencil beam scanning, this work aims to predict the spatially localized neutron energies, the effective quality factor, the weighting factor according to ICRP, and two RBE values, the first obtained from the saturation corrected dose mean lineal energy and the second from DSB cluster induction. A proton pencil beam was Monte Carlo simulated using GEANT. Based on the simulated neutron spectra for three different proton beam energies a parameterization of energy, quality factors and RBE was calculated. The pencil beam algorithm used for treatment planning at PSI has been extended using the developed parameterizations in order to calculate the spatially localized neutron energy, quality factors and RBE for each treated patient. The parameterization represents the simple quantification of neutron energy in two energy bins and the quality factors and RBE with a satisfying precision up to 85 cm away from the proton pencil beam when compared to the results based on 3D Monte Carlo simulations. The root mean square error of the energy estimate between Monte Carlo simulation based results and the parameterization is 3.9%. For the quality factors and RBE estimates it is smaller than 0.9%. The model was successfully integrated into the PSI treatment planning system. It was found that the parameterizations for neutron energy, quality factors and RBE were independent of proton energy in the investigated energy range of interest for proton therapy. The pencil beam algorithm has

  16. Neutrons in proton pencil beam scanning: parameterization of energy, quality factors and RBE.

    PubMed

    Schneider, Uwe; Hälg, Roger A; Baiocco, Giorgio; Lomax, Tony

    2016-08-21

    The biological effectiveness of neutrons produced during proton therapy in inducing cancer is unknown, but potentially large. In particular, since neutron biological effectiveness is energy dependent, it is necessary to estimate, besides the dose, also the energy spectra, in order to obtain quantities which could be a measure of the biological effectiveness and test current models and new approaches against epidemiological studies on cancer induction after proton therapy. For patients treated with proton pencil beam scanning, this work aims to predict the spatially localized neutron energies, the effective quality factor, the weighting factor according to ICRP, and two RBE values, the first obtained from the saturation corrected dose mean lineal energy and the second from DSB cluster induction. A proton pencil beam was Monte Carlo simulated using GEANT. Based on the simulated neutron spectra for three different proton beam energies a parameterization of energy, quality factors and RBE was calculated. The pencil beam algorithm used for treatment planning at PSI has been extended using the developed parameterizations in order to calculate the spatially localized neutron energy, quality factors and RBE for each treated patient. The parameterization represents the simple quantification of neutron energy in two energy bins and the quality factors and RBE with a satisfying precision up to 85 cm away from the proton pencil beam when compared to the results based on 3D Monte Carlo simulations. The root mean square error of the energy estimate between Monte Carlo simulation based results and the parameterization is 3.9%. For the quality factors and RBE estimates it is smaller than 0.9%. The model was successfully integrated into the PSI treatment planning system. It was found that the parameterizations for neutron energy, quality factors and RBE were independent of proton energy in the investigated energy range of interest for proton therapy. The pencil beam algorithm has

  17. Neutrons in proton pencil beam scanning: parameterization of energy, quality factors and RBE.

    PubMed

    Schneider, Uwe; Hälg, Roger A; Baiocco, Giorgio; Lomax, Tony

    2016-08-21

    The biological effectiveness of neutrons produced during proton therapy in inducing cancer is unknown, but potentially large. In particular, since neutron biological effectiveness is energy dependent, it is necessary to estimate, besides the dose, also the energy spectra, in order to obtain quantities which could be a measure of the biological effectiveness and test current models and new approaches against epidemiological studies on cancer induction after proton therapy. For patients treated with proton pencil beam scanning, this work aims to predict the spatially localized neutron energies, the effective quality factor, the weighting factor according to ICRP, and two RBE values, the first obtained from the saturation corrected dose mean lineal energy and the second from DSB cluster induction. A proton pencil beam was Monte Carlo simulated using GEANT. Based on the simulated neutron spectra for three different proton beam energies a parameterization of energy, quality factors and RBE was calculated. The pencil beam algorithm used for treatment planning at PSI has been extended using the developed parameterizations in order to calculate the spatially localized neutron energy, quality factors and RBE for each treated patient. The parameterization represents the simple quantification of neutron energy in two energy bins and the quality factors and RBE with a satisfying precision up to 85 cm away from the proton pencil beam when compared to the results based on 3D Monte Carlo simulations. The root mean square error of the energy estimate between Monte Carlo simulation based results and the parameterization is 3.9%. For the quality factors and RBE estimates it is smaller than 0.9%. The model was successfully integrated into the PSI treatment planning system. It was found that the parameterizations for neutron energy, quality factors and RBE were independent of proton energy in the investigated energy range of interest for proton therapy. The pencil beam algorithm has

  18. Predictions of diffractive cross sections in proton-proton collisions

    SciTech Connect

    Goulianos, Konstantin

    2013-04-15

    We review our pre-LHC predictions of the total, elastic, total-inelastic, and diffractive components of proton-proton cross sections at high energies, expressed in the form of unitarized expressions based on a special parton-model approach to diffraction employing inclusive proton parton distribution functions and QCD color factors and compare with recent LHC results.

  19. Calculation of neutral weak nucleon form factors with the AdS/QCD correspondence

    NASA Astrophysics Data System (ADS)

    Lohmann, Mark

    The AdS/QCD (Anti-de Sitter/Quantum Chromodynamics) is a mathematical formalism applied to a theory based on the original AdS/CFT (Anti-de Sitter/ Conformal Field Theory) correspondence. The aim is to describe properties of the strong force in an essentially non-perturbative way. AdS/QCD theories break the conformal symmetry of the AdS metric (a sacrifice) to arrive at a boundary theory which is QCD-like (a payoff). This correspondence has been used to calculate well-known quantities in nucleon spectra and structure like Regge trajectories, form factors, and many others within an error of less than 20% from experiment. This is impressive considering that ordinary perturbation theory in QCD applied to the strongly interacting domain usually obtains an error of about 30%. In this thesis, the AdS/QCD correspondence method of light-front holography established by Brodsky and de Teramond is used in an attempt to calculate the Dirac and Pauli neutral weak form factors, FZ1 (Q2) and FZ2 (Q 2) respectively, for both the proton and the neutron. With this approach, we were able to determine the neutral weak Dirac form factor for both nucleons and the Pauli form factor for the proton, while the method did not succeed at determining the neutral weak Pauli form factor for the neutron. With these we were also able to extract the proton's strange electric and magnetic form factor, which addresses important questions in nucleon sub-structure that are currently being investigated through experiments at the Thomas Jefferson National Accelerator Facility.

  20. Nucleon form factors to next-to-leading order with light-cone sum rules

    SciTech Connect

    Passek-Kumericki, K.; Peters, G.

    2008-08-01

    We have calculated the leading-twist next-to-leading order (NLO), i.e., O({alpha}{sub s}), correction to the light-cone sum rules prediction for the electromagnetic form factors of the nucleon. We have used the Ioffe nucleon interpolation current and worked in M{sub N}=0 approximation, with M{sub N} being the mass of the nucleon. In this approximation, only the Pauli form factor F{sub 2} receives a correction and the calculated correction is quite sizable (ca. 60%). The numerical results for the proton form factors show the improved agreement with the experimental data. We also discuss the problems encountered when going away from M{sub N}=0 approximation at NLO, as well as gauge invariance of the perturbative results. This work presents the first step towards the NLO accuracy in the light-cone sum rules for baryon form factors.

  1. Molecular mobility of imidazoles in molten state as a key factor to enhance proton conductivity

    NASA Astrophysics Data System (ADS)

    Jarumaneeroj, Chatchai; Tashiro, Kohji; Chirachanchai, Suwabun

    2014-03-01

    A systematic study on alkyl urocanates related to the proton conductivity performances to clarify the role of molecular mobility and hydrogen bond in proton transfer is carried out. Depending on the methylene units, the melting (Tm) and degradation temperatures (Td) change remarkably. When methylene unit is four, C4U shows the lowest melting point (as low as 46 °C) and this suggests the favorable molecular mobility in the molten state. The short hydrogen bond distance and the short T1 relaxation time lead to a scheme of proton conductivity of C4U to be under a regular imidazole arrangement with highly active alkyl chain molecular motion. When C4U is in molten state, the proton transfer is under vehicle mechanism clarified by Volgel-Tammann-Fulcher (VTF) equation. By applying C4U as a proton conductive additive in a sulfonated poly(ether ether ketone) (SPEEK) membrane without any acid dopants, the proton conductivity in the heating process up to 170 °C continuously increases to be ∼104 times higher than that of the neat SPEEK. The present work not only demonstrates the thermal mobility as a key factor to govern the proton conductivity but also proposes the effective proton transfer of heterocyclic compounds based on the molten state.

  2. Factor Structure of the Resident Evaluation Form.

    ERIC Educational Resources Information Center

    Forsythe, George B.; And Others

    1985-01-01

    The Resident Evaluation Form (REF) was developed to assess resident physicians' clinical performance. This research sought to empirically evaluate the intuitively derived REF scales representing areas of clinical performance: interpersonal ability, cognitive ability, clinical skills, and professional attributes. Analysis yielded cognitive…

  3. The energy spectra of solar energetic protons in the large energy range: their functional form and parameters.

    NASA Astrophysics Data System (ADS)

    Nymmik, Rikho; Pervaia, Taisia

    2016-07-01

    Experimental data on the fluxes of protons of solar energetic particles (SEP) are analyzed. It is known that above energies of 2-45 MeV (averaging 27-30 MeV), the proton spectra are a power-law function of the energy (at relativistic energies - from the momentum) of the particles. At lower energies, the spectra become harder, with the high-energy part of the spectra forming the "knee". This report is devoted to the determination of the parameters of the SEP spectra, having the form of a "double power-law shape", to ascertain the reliability of the parameters of the approximations of the experimental data.

  4. A density functional study of crystalline acetic acid and its proton transfer polymorphic forms

    NASA Astrophysics Data System (ADS)

    Rovira, Carme; Novoa, Juan J.

    2000-11-01

    We present a density functional study of the structure and dynamics of solid acetic acid. Our calculations are based on density functional theory combined with molecular dynamics, within the Car-Parrinello scheme. The computed structure of the acetic acid crystal, optimized without symmetry constraints, is in very good agreement with the experiment and reproduces the changes in the intramolecular structure when going from the gas phase to the solid. The cell parameters of the experimental structure are also well reproduced. Cooperative effects along the molecular chains building the crystal are found to be small (1.2 kcal/mol), although larger than it had been previously estimated. The anti conformation of the COOH fragment leads to a stable structure up to 250 K, with an energy of only 3 kcal/mol above that of the known syn form. The energy barrier associated with the most likely pathway for the syn to anti conformations, involving proton transfer along the OH⋯O units (<5.8 kcal/mol) is much smaller than the experimental barrier for the syn/anti isomerism in gas phase and in solution. Intramolecular and intermolecular reorganizations upon change to the anti structure are analyzed. Overall, our results pinpoint the anti form as a good candidate for a possible acetic acid polymorph.

  5. Studies of Nucleon Form Factors with 12 GeV CEBAF and SuperBigBite

    SciTech Connect

    Hansen, Jens-Ole

    2012-04-01

    The elastic electromagnetic form factors are among the most fundamental quantities that describe the ground-state structure of the proton and neutron. Precision data of the form factors over a wide kinematical range provide a powerful test of current theories of hadron structure. A number of experiments aiming to measure the electric and magnetic elastic form factors of the neutron, G{sub E}{sup n} and G{sub M}{sup n}, and proton, G{sub E}{sup p}, at very high momentum transfer, up to the range of Q{sup 2} = 10-14 (GeV/c){sup 2}, are planned to be carried out with the future 11 GeV electron beam of the upgraded CEBAF at Jefferson Lab. These experiments will determine the nucleon form factors with unprecedented precision to Q{sup 2}-values up to three times higher than those of existing data. We review the approved proposals and the conceptual design of a new spectrometer, SuperBigBite, that will be used in these and other future experiments at Jefferson Lab.

  6. Virtuality Distributions and Pion Transition Form Factor

    DOE PAGESBeta

    Radyushkin, Anatoly V.

    2015-03-01

    Using the example of hard exclusive transition process γ*γ → π0 at the handbag level, we outline basics of a new approach to transverse momentum dependence in hard processes. In coordinate representation, matrix elements of operators (in the simplest case, bilocal O(0,z)) describing a hadron with momentum p, are functions of (pz) and z2 parametrized through virtuality distribution amplitudes (VDA) Φ(x, σ), with x being Fourier-conjugate to (pz) and σ Laplace-conjugate to z2. For intervals with z+=0, we introduce the transverse momentum distribution amplitude (TMDA) Ψ(x, k_perp), and write it in terms of VDA Φ(x,σ). We propose models for softmore » VDAs/TMDAs, and use them for comparison of handbag results with experimental (BaBar and BELLE) data. We also discuss the generation of hard tails of TMDAs from initially soft forms.« less

  7. Virtuality Distributions and Pion Transition Form Factor

    NASA Astrophysics Data System (ADS)

    Radyushkin, A. V.

    2015-02-01

    Using the example of hard exclusive transition process γ*γ → π0 at the handbag level, we outline basics of a new approach to transverse momentum dependence in hard processes. In coordinate representation, matrix elements of operators (in the simplest case, bilocal 𝒪(0, z)) describing a hadron with momentum p, are functions of (pz) and z2 parametrized through virtuality distribution amplitudes (VDA) Φ(x, σ), with x being Fourier-conjugate to (pz) and σ Laplace-conjugate to z2. For intervals with z+ = 0, we introduce the transverse momentum distribution amplitude (TMDA) Ψ(x, k⊥), and write it in terms of VDA Φ(x, σ). We propose models for soft VDAs/TMDAs, and use them for comparison of handbag results with experimental (BaBar and BELLE) data. We also discuss the generation of hard tails of TMDAs from initially soft forms.

  8. Factor Structure of the Personality Research Form-E: A Maximum Likelihood Analysis.

    ERIC Educational Resources Information Center

    Fowler, Patrick C.

    1985-01-01

    Presents a five-factor, structural model of the Personality Research Form-E for 140 university undergraduates. All factors demonstrated an excellent level of similarity to those previously reported for other forms of the PRF, as well as to the conceptual scheme developed by Jackson (1974). (Author/JAC)

  9. Virtuality Distributions and Pion Transition Form Factor

    SciTech Connect

    Radyushkin, Anatoly V.

    2015-03-01

    Using the example of hard exclusive transition process γ*γ → π0 at the handbag level, we outline basics of a new approach to transverse momentum dependence in hard processes. In coordinate representation, matrix elements of operators (in the simplest case, bilocal O(0,z)) describing a hadron with momentum p, are functions of (pz) and z2 parametrized through virtuality distribution amplitudes (VDA) Φ(x, σ), with x being Fourier-conjugate to (pz) and σ Laplace-conjugate to z2. For intervals with z+=0, we introduce the transverse momentum distribution amplitude (TMDA) Ψ(x, k_perp), and write it in terms of VDA Φ(x,σ). We propose models for soft VDAs/TMDAs, and use them for comparison of handbag results with experimental (BaBar and BELLE) data. We also discuss the generation of hard tails of TMDAs from initially soft forms.

  10. Progress in the Calculation of Nucleon Transition form Factors

    NASA Astrophysics Data System (ADS)

    Eichmann, Gernot

    2016-10-01

    We give a brief account of the Dyson-Schwinger and Faddeev-equation approach and its application to nucleon resonances and their transition form factors. We compare the three-body with the quark-diquark approach and present a quark-diquark calculation for the low-lying nucleon resonances including scalar, axialvector, pseudoscalar and vector diquarks. We also discuss the timelike structure of transition form factors and highlight the advantages of form factors over helicity amplitudes.

  11. Progress in the Calculation of Nucleon Transition form Factors

    NASA Astrophysics Data System (ADS)

    Eichmann, Gernot

    2016-06-01

    We give a brief account of the Dyson-Schwinger and Faddeev-equation approach and its application to nucleon resonances and their transition form factors. We compare the three-body with the quark-diquark approach and present a quark-diquark calculation for the low-lying nucleon resonances including scalar, axialvector, pseudoscalar and vector diquarks. We also discuss the timelike structure of transition form factors and highlight the advantages of form factors over helicity amplitudes.

  12. Analytical evaluation of atomic form factors: Application to Rayleigh scattering

    SciTech Connect

    Safari, L.; Santos, J. P.; Amaro, P.; Jänkälä, K.; Fratini, F.

    2015-05-15

    Atomic form factors are widely used for the characterization of targets and specimens, from crystallography to biology. By using recent mathematical results, here we derive an analytical expression for the atomic form factor within the independent particle model constructed from nonrelativistic screened hydrogenic wave functions. The range of validity of this analytical expression is checked by comparing the analytically obtained form factors with the ones obtained within the Hartee-Fock method. As an example, we apply our analytical expression for the atomic form factor to evaluate the differential cross section for Rayleigh scattering off neutral atoms.

  13. Relativistic quark model for the Omega- electromagnetic form factors

    SciTech Connect

    G. Ramalho, K. Tsushima, Franz Gross

    2009-08-01

    We compute the Omega- electromagnetic form factors and the decuplet baryon magnetic moments using a quark model application of the Covariant Spectator Theory. Our predictions for the Omega- electromagnetic form factors can be tested in the future by lattice QCD simulations at the physical strange quark mass.

  14. X-Ray Form Factor, Attenuation and Scattering Tables

    National Institute of Standards and Technology Data Gateway

    SRD 66 X-Ray Form Factor, Attenuation and Scattering Tables (Web, free access)   This database collects tables and graphs of the form factors, the photoabsorption cross section, and the total attenuation coefficient for any element (Z <= 92).

  15. Nucleon Form Factors experiments with 12 GeV CEBAF

    SciTech Connect

    Wojtsekhowski, B.

    2008-10-13

    A number of precision form factor experiments at high momentum transfer will be performed with the 11 GeV electron beam of CEBAF. We review the approved proposals and the conceptual schemes of several new suggestions. Form factor data will serve as a major input for the construction of a tomographic image of the nucleon.

  16. Orthopositronium decay form factors and two-photon correlations

    SciTech Connect

    Adkins, Gregory S.; Droz, Daniel R.; Rastawicki, Dominik; Fell, Richard N.

    2010-04-15

    We give results for the orthopositronium decay form factors through one-loop order. We use the form factors to calculate momentum correlations of the final-state photons and , including one-loop corrections, for ensembles of initial orthopositronium atoms having arbitrary polarization.

  17. Nickel phlorin intermediate formed by proton-coupled electron transfer in hydrogen evolution mechanism

    PubMed Central

    Solis, Brian H.; Maher, Andrew G.; Dogutan, Dilek K.; Nocera, Daniel G.; Hammes-Schiffer, Sharon

    2016-01-01

    The development of more effective energy conversion processes is critical for global energy sustainability. The design of molecular electrocatalysts for the hydrogen evolution reaction is an important component of these efforts. Proton-coupled electron transfer (PCET) reactions, in which electron transfer is coupled to proton transfer, play an important role in these processes and can be enhanced by incorporating proton relays into the molecular electrocatalysts. Herein nickel porphyrin electrocatalysts with and without an internal proton relay are investigated to elucidate the hydrogen evolution mechanisms and thereby enable the design of more effective catalysts. Density functional theory calculations indicate that electrochemical reduction leads to dearomatization of the porphyrin conjugated system, thereby favoring protonation at the meso carbon of the porphyrin ring to produce a phlorin intermediate. A key step in the proposed mechanisms is a thermodynamically favorable PCET reaction composed of intramolecular electron transfer from the nickel to the porphyrin and proton transfer from a carboxylic acid hanging group or an external acid to the meso carbon of the porphyrin. The C–H bond of the active phlorin acts similarly to the more traditional metal-hydride by reacting with acid to produce H2. Support for the theoretically predicted mechanism is provided by the agreement between simulated and experimental cyclic voltammograms in weak and strong acid and by the detection of a phlorin intermediate through spectroelectrochemical measurements. These results suggest that phlorin species have the potential to perform unique chemistry that could prove useful in designing more effective electrocatalysts. PMID:26655344

  18. Towards an explanation of transverse single-spin asymmetries in proton-proton collisions: The role of fragmentation in collinear factorization

    NASA Astrophysics Data System (ADS)

    Kanazawa, Koichi; Koike, Yuji; Metz, Andreas; Pitonyak, Daniel

    2014-06-01

    We study the transverse single-spin asymmetry for single-hadron production in proton-proton collisions within the framework of collinear twist-3 factorization in quantum chromodynamics. By taking into account the contribution due to parton fragmentation, we obtain a very good description of all high transverse-momentum data for neutral and charged pion production from the Relativistic Heavy Ion Collider. Our study may provide the crucial step toward a final solution to the long-standing problem of what causes transverse single-spin asymmetries in hadronic collisions within quantum chromodynamics. We show for the first time that it is possible to simultaneously describe spin/azimuthal asymmetries in proton-proton collisions, semi-inclusive deep-inelastic scattering, and electron-positron annihilation by using collinear twist-3 factorization in the first process along with transverse-momentum-dependent functions extracted from the latter two reactions.

  19. Electromagnetic structure of the proton within the CP-violation hypothesis

    SciTech Connect

    Krutov, A. F. Kudinov, M. Yu.

    2013-11-15

    The so-called non-Rosenbluth behavior of the proton electromagnetic form factors can be explained within the hypothesis of CP violation in electromagnetic processes involving composite systems of strongly interacting particles. It is shown that this hypothesis leads to the appearance of an additional, anapole, form factor of the proton. The proton electromagnetic form factors, including the anapole form factor, are estimated on the basis of experimental data on elastic electron-proton scattering.

  20. Factor Structure of the Supervisor Emphasis Rating Form.

    ERIC Educational Resources Information Center

    Lanning, Wayne, L.; And Others

    1994-01-01

    Describes investigation examining factor structure of Supervisor Emphasis Rating Form (SERF). Factor analysis of SERF suggests presence of two underlying factors corresponding to supervisors' focus on professional behavior and process skills. Suggests revision of SERF to accommodate need for information regarding congruence between supervisor…

  1. Relationship Domain of Form Six Teachers Thinking in Teaching with External Factors of Form Six Teachers

    ERIC Educational Resources Information Center

    bin Pet, Mokhtar; Sihes, Ahmad Johari Hj

    2015-01-01

    This study aims to examine the external factors of form six teachers who can influence thinking domain form six teachers in their teaching. This study was conducted using a quantitative approach using questionnaires. A total of 300 form six teacher schools in Johor were chosen as respondents. The findings were obtained as student background…

  2. Light-Cone Sum Rule Approach for Baryon Form Factors

    NASA Astrophysics Data System (ADS)

    Offen, Nils

    2016-10-01

    We present the state-of-the-art of the light-cone sum rule approach to Baryon form factors. The essence of this approach is that soft Feynman contributions are calculated in terms of small transverse distance quantities using dispersion relations and duality. The form factors are thus expressed in terms of nucleon wave functions at small transverse separations, called distribution amplitudes, without any additional parameters. The distribution amplitudes, therefore, can be extracted from the comparison with the experimental data on form factors and compared to the results of lattice QCD simulations.

  3. Roaming form factors for the tricritical to critical Ising flow

    NASA Astrophysics Data System (ADS)

    Horváth, D. X.; Dorey, P. E.; Takács, G.

    2016-07-01

    We study the massless flows described by the staircase model introduced by Al.B. Zamolodchikov through the analytic continuation of the sinh-Gordon S-matrix, focusing on the renormalisation group flow from the tricritical to the critical Ising model. We show that the properly defined roaming limits of certain sinh-Gordon form factors are identical to the form factors of the order and disorder operators for the massless flow. As a by-product, we also construct form factors for a semi-local field in the sinh-Gordon model, which can be associated with the twist field in the ultraviolet limiting free massless bosonic theory.

  4. Light-Cone Sum Rule Approach for Baryon Form Factors

    NASA Astrophysics Data System (ADS)

    Offen, Nils

    2016-08-01

    We present the state-of-the-art of the light-cone sum rule approach to Baryon form factors. The essence of this approach is that soft Feynman contributions are calculated in terms of small transverse distance quantities using dispersion relations and duality. The form factors are thus expressed in terms of nucleon wave functions at small transverse separations, called distribution amplitudes, without any additional parameters. The distribution amplitudes, therefore, can be extracted from the comparison with the experimental data on form factors and compared to the results of lattice QCD simulations.

  5. Longitudinal vector form factors in weak decays of nuclei

    SciTech Connect

    Šimkovic, F.; Kovalenko, S.; Krivoruchenko, M. I.

    2015-10-28

    The longitudinal form factors of the weak vector current of particles with spin J = 1/2 and isospin I = 1/2 are determined by the mass difference and the charge radii of members of the isotopic doublets. The most promising reactions to measure these form factors are the reactions with large momentum transfers involving the spin-1/2 isotopic doublets with a maximum mass splitting. Numerical estimates of longitudinal form factors are given for nucleons and eight nuclear spin-1/2 isotopic doublets.

  6. Ab initio study of the molecular structure and vibrational spectrum of nitric acid and its protonated forms

    NASA Technical Reports Server (NTRS)

    Lee, Timothy J.; Rice, Julia E.

    1992-01-01

    The equilibrium structures, harmonic vibrational frequencies, IR intensities, and relative energetics of HNO3 and its protonated form H2NO3+ were investigated using double-zeta plus polarization and triple-zeta plus polarization basis sets in conjunction with high-level ab initio methods. The latter include second-order Moller-Plesset perturbation theory, the single and double excitation coupled cluster (CCSD) methods, a perturbational estimate of the effects of connected triple excitations (CCSD(T)), and the self-consistent field. To determine accurate energy differences CCSD(T) energies were computed using large atomic natural orbital basis sets. Four different isomers of H2NO3+ were considered. The lowest energy form of protonated nitric acid was found to correspond to a complex between H2O and NO2+, which is consistent with earlier theoretical and experimental studies.

  7. Personality Research Form: Factor Structure and Response Style Involvement

    ERIC Educational Resources Information Center

    Stricker, Lawrence J.

    1974-01-01

    Explores factor structure of the Personality Research Form (PRF) and examines the inventory's relations with response styles. In general, the PRF content scales correlate moderately with each other and with measures of acquiescence, social desirability, and defensiveness response biases. (Author)

  8. Hadronic Form Factors in Asymptotically Free Field Theories

    DOE R&D Accomplishments Database

    Gross, D. J.; Treiman, S. B.

    1974-01-01

    The breakdown of Bjorken scaling in asymptotically free gauge theories of the strong interactions is explored for its implications on the large q{sup 2} behavior of nucleon form factors. Duality arguments of Bloom and Gilman suggest a connection between the form factors and the threshold properties of the deep inelastic structure functions. The latter are addressed directly in an analysis of asymptotically free theories; and through the duality connection we are then led to statements about the form factors. For very large q{sup 2} the form factors are predicted to fall faster than any inverse power of q{sup 2}. For the more modest range of q{sup 2} reached in existing experiments the agreement with data is fairly good, though this may well be fortuitous. Extrapolations beyond this range are presented.

  9. Exploring strange nucleon form factors on the lattice

    NASA Astrophysics Data System (ADS)

    Babich, Ronald; Brower, Richard C.; Clark, Michael A.; Fleming, George T.; Osborn, James C.; Rebbi, Claudio; Schaich, David

    2012-03-01

    We discuss techniques for evaluating sea quark contributions to hadronic form factors on the lattice and apply these to an exploratory calculation of the strange electromagnetic, axial, and scalar form factors of the nucleon. We employ the Wilson gauge and fermion actions on an anisotropic 243×64 lattice, probing a range of momentum transfer with Q2<1GeV2. The strange electric and magnetic form factors, GEs(Q2) and GMs(Q2), are found to be small and consistent with zero within the statistics of our calculation. The lattice data favor a small negative value for the strange axial form factor GAs(Q2) and exhibit a strong signal for the bare strange scalar matrix element ⟨N|s¯s|N⟩0. We discuss the unique systematic uncertainties affecting the latter quantity relative to the continuum, as well as prospects for improving future determinations with Wilson-like fermions.

  10. Finite volume form factors in the presence of integrable defects

    NASA Astrophysics Data System (ADS)

    Bajnok, Z.; Buccheri, F.; Hollo, L.; Konczer, J.; Takacs, G.

    2014-05-01

    We developed the theory of finite volume form factors in the presence of integrable defects. These finite volume form factors are expressed in terms of the infinite volume form factors and the finite volume density of states and incorporate all polynomial corrections in the inverse of the volume. We tested our results, in the defect Lee-Yang model, against numerical data obtained by truncated conformal space approach (TCSA), which we improved by renormalization group methods adopted to the defect case. To perform these checks we determined the infinite volume defect form factors in the Lee-Yang model exactly, including their vacuum expectation values. We used these data to calculate the two point functions, which we compared, at short distance, to defect CFT. We also derived explicit expressions for the exact finite volume one point functions, which we checked numerically. In all of these comparisons excellent agreement was found.

  11. Pion form factor in the NLC QCD SR approach

    SciTech Connect

    Bakulev, A. P. Pimikov, A. V.; Stefanis, N. G.

    2010-06-15

    We present results of a calculation of the electromagnetic pion form factor within the framework of QCD sum rules with nonlocal condensates and using a perturbative spectral density which includes O({alpha}{sub s}) contributions.

  12. Deuteron form factor measurements at low momentum transfers

    NASA Astrophysics Data System (ADS)

    Schlimme, B. S.; Achenbach, P.; Beričič, J.; Böhm, R.; Bosnar, D.; Correa, L.; Distler, M. O.; Esser, A.; Fonvieille, H.; Friščić, I.; Griffioen, K. A.; Huan, Y.; Kegel, S.; Kohl, Y.; Merkel, H.; Mihovilovič, M.; Müller, J.; Müller, U.; Pochodzalla, J.; Schoth, M.; Schulz, F.; Sfienti, C.; Širca, S.; Štajner, S.; Thiel, M.; Weber, A.

    2016-03-01

    A precise measurement of the elastic electron-deuteron scattering cross section at four-momentum transfers of 0.24 fm-1 ≤ Q ≤ 2.7 fm-1 has been performed at the Mainz Microtron. In this paper we describe the utilized experimental setup and the necessary analysis procedure to precisely determine the deuteron charge form factor from these data. Finally, the deuteron charge radius rd can be extracted from an extrapolation of that form factor to Q2 = 0.

  13. Charm and bottom hadronic form factors with QCD sum rules

    SciTech Connect

    Bracco, M. E.; Rodrigues, B. O.; Cerqueira, A. Jr.

    2013-03-25

    We present a brief review of some calculations of form factors and coupling constants in vertices with charm and bottom mesons in the framework of QCD sum rules. We first discuss the motivation for this work, describing possible applications of these form factors to charm and bottom decays processes. We first make a summarize of the QCD sum rules method. We give special attention to the uncertainties of the method introducing by the intrinsic variation of the parameters. Finally we conclude.

  14. High-precision calculation of the strange nucleon electromagnetic form factors

    SciTech Connect

    Green, Jeremy; Meinel, Stefan; Engelhardt, Michael G.; Krieg, Stefan; Laeuchli, Jesse; Negele, John W.; Orginos, Kostas; Pochinsky, Andrew; Syritsyn, Sergey

    2015-08-26

    We report a direct lattice QCD calculation of the strange nucleon electromagnetic form factors GsE and GsM in the kinematic range 0 ≤ Q2 ≤ 1.2GeV2. For the first time, both GsE and GsM are shown to be nonzero with high significance. This work uses closer-to-physical lattice parameters than previous calculations, and achieves an unprecented statistical precision by implementing a recently proposed variance reduction technique called hierarchical probing. We perform model-independent fits of the form factor shapes using the z-expansion and determine the strange electric and magnetic radii and magnetic moment. As a result, we compare our results to parity-violating electron-proton scattering data and to other theoretical studies.

  15. Renormalization versus strong form factors for one-boson-exchange potentials

    SciTech Connect

    Calle Cordon, A.; Ruiz Arriola, E.

    2010-04-15

    We analyze the one-boson-exchange potential from the point of view of renormalization theory. We show that the nucleon-meson Lagrangian, while predicting the NN force, does not predict the NN scattering matrix nor the deuteron properties unambiguously due to the appearance of short distance singularities. While the problem has traditionally been circumvented by introducing vertex functions via phenomenological strong form factors, we propose to impose physical renormalization conditions on the scattering amplitude at low energies. Working in the large N{sub c} approximation with pi, sigma, rho, and omega mesons we show that, once these conditions are applied, results for low-energy phases of proton-neutron scattering as well as deuteron properties become largely insensitive to the form factors and to the vector mesons yielding reasonable agreement with the data and for realistic values of the coupling constants.

  16. SU-E-T-577: Obliquity Factor and Surface Dose in Proton Beam Therapy

    SciTech Connect

    Das, I; Andersen, A; Coutinho, L

    2015-06-15

    Purpose: The advantage of lower skin dose in proton beam may be diminished creating radiation related sequalae usually seen with photon and electron beams. This study evaluates the surface dose as a complex function of beam parameters but more importantly the effect of beam angle. Methods: Surface dose in proton beam depends on the beam energy, source to surface distance, the air gap between snout and surface, field size, material thickness in front of surface, atomic number of the medium, beam angle and type of nozzle (ie double scattering, (DS), uniform scanning (US) or pencil beam scanning (PBS). Obliquity factor (OF) is defined as ratio of surface dose in 0° to beam angle Θ. Measurements were made in water phantom at various beam angles using very small microdiamond that has shown favorable beam characteristics for high, medium and low proton energy. Depth dose measurements were performed in the central axis of the beam in each respective gantry angle. Results: It is observed that surface dose is energy dependent but more predominantly on the SOBP. It is found that as SSD increases, surface dose decreases. In general, SSD, and air gap has limited impact in clinical proton range. High energy has higher surface dose and so the beam angle. The OF rises with beam angle. Compared to OF of 1.0 at 0° beam angle, the value is 1.5, 1.6, 1,7 for small, medium and large range respectively for 60 degree angle. Conclusion: It is advised that just like range and SOBP, surface dose should be clearly understood and a method to reduce the surface dose should be employed. Obliquity factor is a critical parameter that should be accounted in proton beam therapy and a perpendicular beam should be used to reduce surface dose.

  17. [Featuring pathogenicity factors in biofilm-forming and no-biofilm forming strains of Staphylococcus epidermidis].

    PubMed

    Sidashenko, O I; Voronkova, O S; Sirokvasha, O A; Vinnikov, A I

    2015-01-01

    A comparative study of the manifestation of pathogenicity factors: hemolytic, lipase, letsytinase activity and ability to adhere in 20 film-forming and 17 non-film-forming strains of S. epidermidis. Studying pathogenicity factors of the film-forming strains it was found that complete hemolysis and lipase activity shown was by all the film-forming strains of S. epidermidis, letsytinase activity was observed in 80%. Among the non-film-forming strains complete hemolysis and lipase activity were observed in 89% and letsytinase - 71%. Researched non-film-forming and film-forming strains of S. epidermidis showed the ability to adhere to buccal epithelial cells of humans. Found that all the film-forming strains of S. epidermidis were hight level adgesion, the highest IAM was equal to 11,84. It was found that among non-film-forming strains of S. epidermidis were low-, medium- and hight level adgesion. IAM of non-film-forming strains of S. epidermidis is 3 times lower compared to the IAM of the film-forming strains of human epithelial cells and was 3.2.

  18. SU-E-T-595: Output Factor Calculation for a Uniform Scanning Proton Therapy System

    SciTech Connect

    Hecksel, D; Stauffer, N; DeFillippo, G; Edwards, J; Pankuch, M

    2015-06-15

    Purpose: To develop an analytical model that predicts dose output factors for patient treatment fields in a uniform scanning proton therapy system. Methods: A model to predict output factors for patient specific treatment fields was produced based on the methods developed by Kooy et al. (2003). The Kooy model predicts the output factor based on the ratio of the entrance dose under calibration conditions to that for a given range and modulation corrected for the inverse square effect. Field specific output factors were plotted as a function of a single parameter r, where r = (Range-Modulation)/Modulation. The model targeted user range 1 sub-span 3 through user range 2 sup-span 2 of the IBA uniform scanning proton therapy system. The data set included points measured using the 10 cm and 18 cm snout sizes to eliminate stem effects on the monitor unit chambers. The data was fit using equation 15 from Kooy et al. (2003), and the resulting model was tested against measurements that were not included in the original data set. Results: For the range and sub span investigated, 120 data points were tested against the model prediction. The model predicted the output factor within 2% for 96% of the points tested and within 2.5% for 99% of the points tested. All points were within 3% of the predicted values. Conclusion: Monitor units for patient treatment fields with proton ranges that fall within the tested interval can be predicted using a model based on the methods developed at MGH. With further evaluation, it will be possible to model all user ranges and sub-spans of the IBA system. Further testing is also needed to predict output factors using a 25 cm snout which introduces variable scanning pattern sizes and stem effects on the monitor unit chambers.

  19. Visualization of semileptonic form factors from lattice QCD

    SciTech Connect

    Bernard, C.; Laiho, J.; DeTar, C.; Levkova, L.; Oktay, M. B.; Di Pierro, M.; El-Khadra, A. X.; Evans, R. T.; Gamiz, E.; Freeland, E. D.; Gottlieb, Steven; Heller, U. M.; Hetrick, J. E.; Kronfeld, A. S.; Mackenzie, P. B.; Okamoto, M.; Simone, J. N.; Sugar, R.; Toussaint, D.; Van de Water, R. S.

    2009-08-01

    Comparisons of lattice-QCD calculations of semileptonic form factors with experimental measurements often display two sets of points, one each for lattice QCD and experiment. Here we propose to display the output of a lattice-QCD analysis as a curve and error band. This is justified, because lattice-QCD results rely in part on fitting, both for the chiral extrapolation and to extend lattice-QCD data over the full physically allowed kinematic domain. To display an error band, correlations in the fit parameters must be taken into account. For the statistical error, the correlation comes from the fit. To illustrate how to address correlations in the systematic errors, we use the Becirevic-Kaidalov parametrization of the D{yields}{pi}l{nu} and D{yields}Kl{nu} form factors, and an analyticity-based fit for the B{yields}{pi}l{nu} form factor f{sub +}.

  20. Measurements of the Helium Form Factors at JLab

    SciTech Connect

    Khrosinkova, Elena

    2007-10-26

    An experiment to measure elastic electron scattering off {sup 3}He and {sup 4}He at large momentum transfers is presented. The experiment was carried out in the Hall A Facility of Jefferson Lab. Elastic electron scattering off {sup 3}He was measured at forward and backward electron scattering angles to extract the isotope's charge and magnetic form factors. The charge form factor of {sup 4}He will be extracted from forward-angle electron scattering angle measurements. The data are expected to significantly extend and improve the existing measurements of the three- and four-body form factors. The results will be crucial for the establishment of a canonical standard model for the few-body nuclear systems and for testing predictions of quark dimensional scaling and hybrid nucleon-quark models.

  1. Dirac and Pauli form factors based on consideration of the gluon effect in light-cone wave functions

    NASA Astrophysics Data System (ADS)

    Shojaei, Mohammad Reza; Nikkhoo, Negin Sattary

    2015-11-01

    We discuss Dirac and Pauli form factors based on a generalized parton distribution framework in the range of high momentum transfers of t < 30 GeV2 and calculate the electromagnetic form factors, GE and GM, for the proton. In previous work, Gaussian parameterization has been used in wave functions for calculating electromagnetic form factors at intermediate-high momentum transfers of 1 GeV2 < t < 10 GeV2; in this paper, by considering an improved Gaussian ansatz, we not only calculate the electromagnetic form factors at moderately high momentum transfers t but also can calculate these quantities at high momentum transfers, achieving reasonable agreement with experimental data and other previous work.

  2. Are protons nonidentical fermions?

    SciTech Connect

    Mart, T.

    2014-09-25

    We briefly review the progress of our investigation on the electric (charge) radius of the proton. In order to explain the recently measured proton radius, which is significantly smaller than the standard CODATA value, we assume that the real protons radii are not identical, they are randomly distributed in a certain range. To obtain the measured radius we average the radii and fit both the mean radius and the range. By using an averaged dipole form factor we obtain the charge radius r{sub E} = 0.8333 fm, in accordance with the recent measurement of the Lamb shift in muonic hydrogen.

  3. Kinetics and Mechanism of Deoxygenation Reactions over Proton-Form and Molybdenum-Modified Zeolite Catalysts

    NASA Astrophysics Data System (ADS)

    Bedard, Jeremy William

    The depletion of fossil fuel resources and the environmental consequences of their use have dictated the development of new sources of energy that are both sustainable and economical. Biomass has emerged as a renewable carbon feedstock that can be used to produce chemicals and fuels traditionally obtained from petroleum. The oxygen content of biomass prohibits its use without modification because oxygenated hydrocarbons are non-volatile and have lower energy content. Chemical processes that eliminate oxygen and keep the carbon backbone intact are required for the development of biomass as a viable chemical feedstock. This dissertation reports on the kinetic and mechanistic studies conducted on high and low temperature catalytic processes for deoxygenation of biomass precursors to produce high-value chemicals and fuels. Low temperature, steady state reaction studies of acetic acid and ethanol were used to identify co-adsorbed acetic acid/ethanol dimers as surface intermediates within specific elementary steps involved in the esterification of acetic acid with ethanol on zeolites. A reaction mechanism involving two dominating surface species, an inactive ethanol dimeric species adsorbed on Bronsted sites inhibiting ester formation and a co-adsorbed complex of acetic acid and ethanol on the active site reacting to produce ethyl acetate, is shown to describe the reaction rate as a function of temperature (323 -- 383 K), acetic acid (0.5 -- 6.0 kPa), and ethanol (5.0 -- 13.0 kPa) partial pressure on proton-form BEA, FER, MFI, and MOR zeolites. Measured differences in rates as a function of zeolite structure and the rigorous interpretation of these differences in terms of esterification rate and equilibrium constants is presented to show that the intrinsic rate constant for the activation of the co-adsorbed complex increases in the order FER < MOR < MFI < BEA. High temperature co-processing of acetic acid, formic acid, or carbon dioxide with methane (CH3COOH/CH4 = 0

  4. Master integrals for the four-loop Sudakov form factor

    NASA Astrophysics Data System (ADS)

    Boels, Rutger H.; Kniehl, Bernd A.; Yang, Gang

    2016-01-01

    The light-like cusp anomalous dimension is a universal function in the analysis of infrared divergences. In maximally (N = 4) supersymmetric Yang-Mills theory (SYM) in the planar limit, it is known, in principle, to all loop orders. The non-planar corrections are not known in any theory, with the first appearing at the four-loop order. The simplest quantity which contains this correction is the four-loop two-point form factor of the stress tensor multiplet. This form factor was largely obtained in integrand form in a previous work for N = 4 SYM, up to a free parameter. In this work, a reduction of the appearing integrals obtained by solving integration-by-parts (IBP) identities using a modified version of Reduze is reported. The form factor is shown to be independent of the remaining parameter at integrand level due to an intricate pattern of cancellations after IBP reduction. Moreover, two of the integral topologies vanish after reduction. The appearing master integrals are cross-checked using independent algebraic-geometry techniques explored in the Mint package. The latter results provide the basis of master integrals applicable to generic form factors, including those in Quantum Chromodynamics. Discrepancies between explicitly solving the IBP relations and the MINT approach are highlighted. Remaining bottlenecks to completing the computation of the four-loop non-planar cusp anomalous dimension in N = 4 SYM and beyond are identified.

  5. Electromagnetic form factors of the Δ with D-waves

    SciTech Connect

    Ramalho, Gilberto T.F.; Pena, Maria Teresa; Gross, Franz L.

    2010-06-01

    The electromagnetic form factors of the Δ baryon are evaluated within the framework of a covariant spectator quark model, where S and D-states are included in the Δ wave function. We predict all the four Δ multipole form factors: the electric charge GE0, the magnetic dipole GM1, the electric quadrupole GE2 and the magnetic octupole GM3. We compare our predictions with other theoretical calculations. Our results are compatible with the available experimental data and recent lattice QCD data.

  6. Transversity form factors of the pion in chiral quark models

    SciTech Connect

    Broniowski, Wojciech; Dorokhov, Alexander E.; Arriola, Enrique Ruiz

    2010-11-01

    The transversity form factors of the pion, involving matrix elements of bilocal tensor currents, are evaluated in chiral quark models, both in the local Nambu-Jona-Lasinio with the Pauli-Villars regularization, as well as in nonlocal models involving momentum-dependent quark mass. After suitable QCD evolution, the agreement with recent lattice calculations is very good, in accordance to the fact that the spontaneously broken chiral symmetry governs the dynamics of the pion. Meson dominance of form factors with expected meson masses also works properly, conforming to the parton-hadron duality in the considered process.

  7. Note on the QCD evolution of generalized form factors

    SciTech Connect

    Broniowski, Wojciech; Arriola, Enrique Ruiz

    2009-03-01

    Generalized form factors of hadrons are objects appearing in moments of the generalized parton distributions. Their leading-order DGLAP-ERBL QCD evolution is exceedingly simple and the solution is given in terms of matrix triangular structures of linear equations where the coefficients are the evolution ratios. We point out that this solution has a practical importance in analyses where the generalized form factors are basic objects, e.g., the lattice-gauge studies or models. It also displays general features of their evolution.

  8. Pion electromagnetic form factor in the Covariant Spectator Theory

    SciTech Connect

    Biernat, Elmar P.; Gross, Franz L.; Pena, Teresa; Stadler, Alfred

    2014-01-01

    The pion electromagnetic form factor at spacelike momentum transfer is calculated in relativistic impulse approximation using the Covariant Spectator Theory. The same dressed quark mass function and the equation for the pion bound-state vertex function as discussed in the companion paper are used for the calculation, together with a dressed quark current that satisfies the Ward-Takahashi identity. The results obtained for the pion form factor are in agreement with experimental data, they exhibit the typical monopole behavior at high momentum transfer and they satisfy some remarkable scaling relations.

  9. The B → K* form factors on the lattice

    NASA Astrophysics Data System (ADS)

    Agadjanov, Andria; Bernard, Véronique; Meißner, Ulf-G.; Rusetsky, Akaki

    2016-09-01

    The extraction of the B →K* transition form factors from lattice data is studied, applying non-relativistic effective field theory in a finite volume. The possible mixing of πK and ηK states is taken into account. The two-channel analogue of the Lellouch-Lüscher formula is reproduced. Due to the resonance nature of the K*, an equation is derived, which allows to determine the form factors at the pole position in a process-independent manner. The infinitely-narrow width approximation of the results is discussed.

  10. Pion Electromagnetic Form Factor in Virtuality Distribution Formalism

    SciTech Connect

    Radyushkin, Anatoly V.

    2016-01-01

    We discuss two applications of the {\\it Virtuality Distribution Amplitudes} (VDA) formalism developed in our recent papers. We start with an overview of the main properties of the pion distribution amplitude emphasizing the quantitative measures of its width, and possibility to access them through the pion transition form factor studies. We formulate the basic concepts of the VDA approach and introduce the pion {\\it transverse momentum distribution amplitude} (TMDA) which plays, in a covariant Lagrangian formulation, a role similar to that of the pion wave function in the 3-dimensional Hamiltonian light-front approach. We propose simple factorized models for soft TMDAs, and use them to describe existing data on the pion transition form factor, thus fixing the scale determining the size of the transverse-momentum effects. Finally, we apply the VDA approach to the one-gluon exchange contribution for the pion electromagnetic form factor. We observe a very late $Q^2 \\gtrsim 20$ GeV$^2$ onset of transition to the asymptotic pQCD predictions and show that in the $Q^2 \\lesssim 10$ GeV$^2$ region there is essentially no sensitivity to the shape of the pion distribution amplitude. Furthermore, the magnitude of the one-gluon exchange contribution in this region is estimated to be an order of magnitude below the Jefferson Lab data, thus leaving the Feynman mechanism as the only one relevant to the pion electromagnetic form factor behavior for accessible $Q^2$.

  11. Determination of the quenching correction factors for plastic scintillation detectors in therapeutic high-energy proton beams

    PubMed Central

    Wang, L L W; Perles, L A; Archambault, L; Sahoo, N; Mirkovic, D; Beddar, S

    2013-01-01

    The plastic scintillation detectors (PSD) have many advantages over other detectors in small field dosimetry due to its high spatial resolution, excellent water equivalence and instantaneous readout. However, in proton beams, the PSDs will undergo a quenching effect which makes the signal level reduced significantly when the detector is close to Bragg peak where the linear energy transfer (LET) for protons is very high. This study measures the quenching correction factor (QCF) for a PSD in clinical passive-scattering proton beams and investigates the feasibility of using PSDs in depth-dose measurements in proton beams. A polystyrene based PSD (BCF-12, ϕ0.5mm×4mm) was used to measure the depth-dose curves in a water phantom for monoenergetic unmodulated proton beams of nominal energies 100, 180 and 250 MeV. A Markus plane-parallel ion chamber was also used to get the dose distributions for the same proton beams. From these results, the QCF as a function of depth was derived for these proton beams. Next, the LET depth distributions for these proton beams were calculated by using the MCNPX Monte Carlo code, based on the experimentally validated nozzle models for these passive-scattering proton beams. Then the relationship between the QCF and the proton LET could be derived as an empirical formula. Finally, the obtained empirical formula was applied to the PSD measurements to get the corrected depth-dose curves and they were compared to the ion chamber measurements. A linear relationship between QCF and LET, i.e. Birks' formula, was obtained for the proton beams studied. The result is in agreement with the literature. The PSD measurements after the quenching corrections agree with ion chamber measurements within 5%. PSDs are good dosimeters for proton beam measurement if the quenching effect is corrected appropriately. PMID:23128412

  12. The Modern description of semileptonic meson form factors

    SciTech Connect

    Hill, Richard J.

    2006-06-01

    I describe recent advances in our understanding of the hadronic form factors governing semileptonic meson transitions. The resulting framework provides a systematic approach to the experimental data, as a means of extracting precision observables, testing nonperturbative field theory methods, and probing a poorly understood limit of QCD.

  13. Personality Research Form: Factor Structure and Response Style Involvement.

    ERIC Educational Resources Information Center

    Stricker, Lawrence J.

    The aims of this study were (1) to explore the factor structure of the Personality Research Form (PRF) and (2) to examine the inventory's relations with response styles. In general the PRF content scales correlated moderately with each other and with measures of acquiesence, social desirability, and defensiveness response Biases. Six oblique…

  14. Nucleon form factors program with SBS at JLAB

    SciTech Connect

    Wojtsekhowski, Bogdan B.

    2014-12-01

    The physics of the nucleon form factors is the basic part of the Jefferson Laboratory program. We review the achievements of the 6-GeV era and the program with the 12- GeV beam with the SBS spectrometer in Hall A, with a focus on the nucleon ground state properties.

  15. Rigorous pion electromagnetic form factor behavior in the spacelike region

    SciTech Connect

    Belicka, M.; Dubnickova, A. Z.; Dubnicka, S.; Liptaj, A.

    2011-02-15

    Precise experimental information on {sigma}{sub tot}(e{sup +}e{sup -}{yields}{pi}{sup +}{pi}{sup -}) is transferred into the spacelike region by taking advantage of the analyticity. As a result, rigorous pion electromagnetic form factor behavior in spacelike region is obtained. The latter is compared with some existing model predictions.

  16. Measurement of the pion form factor at higher energies

    SciTech Connect

    Mack, D.J.

    1994-04-01

    One of the strongest arguments for increasing the nominal CEBAF beam energy to equal or exceed 6 GeV is that one would be able to make quality high Q{sup 2} measurements of the charged pion form factor.

  17. The Super Bigbite Project: A Study of Nucleon Form Factors

    SciTech Connect

    Jager, Kees de

    2010-06-01

    A proposed set of instrumentation, collectively referred to as the Super Bigbite project, is presented. Used in three different con figurations it will allow measurements of three nucleon electromagnetic form factors GEn, GEp, and GMn with unprecedented precision to Q2-values up to three times higher than existing data.

  18. Spin-2 form factors at three loop in QCD

    NASA Astrophysics Data System (ADS)

    Ahmed, Taushif; Das, Goutam; Mathews, Prakash; Rana, Narayan; Ravindran, V.

    2015-12-01

    Spin-2 fields are often candidates in physics beyond the Standard Model namely the models with extra-dimensions where spin-2 Kaluza-Klein gravitons couple to the fields of the Standard Model. Also, in the context of Higgs searches, spin-2 fields have been studied as an alternative to the scalar Higgs boson. In this article, we present the complete three loop QCD radiative corrections to the spin-2 quark-antiquark and spin-2 gluon-gluon form factors in SU(N) gauge theory with n f light flavors. These form factors contribute to both quark-antiquark and gluon-gluon initiated processes involving spin-2 particle in the hadronic reactions at the LHC. We have studied the structure of infrared singularities in these form factors up to three loop level using Sudakov integro-differential equation and found that the anomalous dimensions originating from soft and collinear regions of the loop integrals coincide with those of the electroweak vector boson and Higgs form factors confirming the universality of the infrared singularities in QCD amplitudes.

  19. Analytic two-loop form factors in {N} = 4 SYM

    NASA Astrophysics Data System (ADS)

    Brandhuber, Andreas; Travaglini, Gabriele; Yang, Gang

    2012-05-01

    We derive a compact expression for the three-point MHV form factors of half- BPS operators in {N} = 4 super Yang-Mills at two loops. The main tools of our calculation are generalised unitarity applied at the form factor level, and the compact expressions for supersymmetric tree-level form factors and amplitudes entering the cuts. We confirm that infrared divergences exponentiate as expected, and that collinear factorisation is entirely captured by an ABDK/BDS ansatz. Next, we construct the two-loop remainder function obtained by subtracting this ansatz from the full two-loop form factor and compute it numerically. Using symbology, combined with various physical constraints and symme- tries, we find a unique solution for its symbol. With this input we construct a remarkably compact analytic expression for the remainder function, which contains only classical poly- logarithms, and compare it to our numerical results. Furthermore, we make the surprising observation that our remainder is equal to the maximally transcendental piece of the two- loop Higgs plus three-gluon scattering amplitudes in QCD.

  20. Proton Conductive Nanosheets Formed by Alignment of Metallo-Supramolecular Polymers.

    PubMed

    Pandey, Rakesh K; Rana, Utpal; Chakraborty, Chanchal; Moriyama, Satoshi; Higuchi, Masayoshi

    2016-06-01

    Linear Fe(II)-based metallo-supramolecular polymer chains were precisely aligned by the simple replacement of the counteranion with an N,N'-bis(4-benzosulfonic acid)perylene-3,4,9,10-tetracarboxylbisimide (PSA) dianion, which linked the polymer chains strongly. A parallel alignment of the polymer chains promoted by the PSA dianions yielded nanosheets formation. The nanosheets' structure was analyzed with FESEM, HRTEM, UV-vis, and XRD in detail. The nanosheets showed more than 5 times higher proton conductivity than the original polymer due to the smooth ionic conduction through the aligned polymer chains. The complex impedance plot with two semicircles also suggested the presence of grain boundaries in the polymer nanosheets. PMID:27164027

  1. Quantitative investigation of physical factors contributing to gold nanoparticle-mediated proton dose enhancement.

    PubMed

    Cho, Jongmin; Gonzalez-Lepera, Carlos; Manohar, Nivedh; Kerr, Matthew; Krishnan, Sunil; Cho, Sang Hyun

    2016-03-21

    Some investigators have shown tumor cell killing enhancement in vitro and tumor regression in mice associated with the loading of gold nanoparticles (GNPs) before proton treatments. Several Monte Carlo (MC) investigations have also demonstrated GNP-mediated proton dose enhancement. However, further studies need to be done to quantify the individual physical factors that contribute to the dose enhancement or cell-kill enhancement (or radiosensitization). Thus, the current study investigated the contributions of particle-induced x-ray emission (PIXE), particle-induced gamma-ray emission (PIGE), Auger and secondary electrons, and activation products towards the total dose enhancement. Specifically, GNP-mediated dose enhancement was measured using strips of radiochromic film that were inserted into vials of cylindrical GNPs, i.e. gold nanorods (GNRs), dispersed in a saline solution (0.3 mg of GNRs/g or 0.03% of GNRs by weight), as well as vials containing water only, before proton irradiation. MC simulations were also performed with the tool for particle simulation code using the film measurement setup. Additionally, a high-purity germanium detector system was used to measure the photon spectrum originating from activation products created from the interaction of protons and spherical GNPs present in a saline solution (20 mg of GNPs/g or 2% of GNPs by weight). The dose enhancement due to PIXE/PIGE recorded on the films in the GNR-loaded saline solution was less than the experimental uncertainty of the film dosimetry (<2%). MC simulations showed highly localized dose enhancement (up to a factor 17) in the immediate vicinity (<100 nm) of GNRs, compared with hypothetical water nanorods (WNRs), mostly due to GNR-originated Auger/secondary electrons; however, the average dose enhancement over the entire GNR-loaded vial was found to be minimal (0.1%). The dose enhancement due to the activation products from GNPs was minimal (<0.1%) as well. In conclusion, under the currently

  2. Finite volume form factors and correlation functions at finite temperature

    NASA Astrophysics Data System (ADS)

    Pozsgay, Balázs

    2009-07-01

    In this thesis we investigate finite size effects in 1+1 dimensional integrable QFT. In particular we consider matrix elements of local operators (finite volume form factors) and vacuum expectation values and correlation functions at finite temperature. In the first part of the thesis we give a complete description of the finite volume form factors in terms of the infinite volume form factors (solutions of the bootstrap program) and the S-matrix of the theory. The calculations are correct to all orders in the inverse of the volume, only exponentially decaying (residual) finite size effects are neglected. We also consider matrix elements with disconnected pieces and determine the general rule for evaluating such contributions in a finite volume. The analytic results are tested against numerical data obtained by the truncated conformal space approach in the Lee-Yang model and the Ising model in a magnetic field. In a separate section we also evaluate the leading exponential correction (the μ-term) associated to multi-particle energies and matrix elements. In the second part of the thesis we show that finite volume factors can be used to derive a systematic low-temperature expansion for correlation functions at finite temperature. In the case of vacuum expectation values the series is worked out up to the third non-trivial order and a complete agreement with the LeClair-Mussardo formula is observed. A preliminary treatment of the two-point function is also given by considering the first nontrivial contributions.

  3. The structure of light-front wavefunctions and constraints on hadronic form factors

    SciTech Connect

    S. J. Brodsky; J. R. Hiller; D. S. Hwang; V. A. Karmanov

    2003-11-17

    We study the analytic structure of light-front wave functions (LFWFs) and its consequences for hadron form factors using an explicitly Lorentz-invariant formulation of the front form. The normal to the light front is specified by a general null vector {omega}{sup {mu}}. The LFWFs with definite total angular momentum are eigenstates of a kinematic angular momentum operator and satisfy all Lorentz symmetries. They are analytic functions of the invariant mass squared of the constituents M{sub 0}{sup 2} = ({Sigma} k{sup {mu}}){sup 2} and the light-cone momentum fractions x{sub i} = k{sub i} {center_dot} {omega}/p {center_dot} {omega} multiplied by invariants constructed from the spin matrices, polarization vectors, and {omega}{sup {mu}}. These properties are illustrated using known nonperturbative eigensolutions of the Wick-Cutkosky model. We analyze the LFWFs introduced by Chung and Coester to describe static and low momentum properties of the nucleons. They correspond to the spin-locking of a quark with the spin of its parent nucleon, tog ether with a positive-energy projection constraint. These extra constraints lead to anomalous dependence of form factors on Q rather than Q{sup 2}. In contrast, the dependence of LFWFs on M{sub 0}{sup 2} implies that hadron form factors are analytic functions of Q{sup 2} in agreement with dispersion theory and perturbative QCD. We show that a model incorporating the leading-twist perturbative QCD prediction is consistent with recent data for the ratio of proton Pauli and Dirac form factors.

  4. Measurement of the gamma gamma* -> pi0 transition form factor

    SciTech Connect

    Aubert, B.

    2009-06-02

    We study the reaction e{sup +}e{sup -} {yields} e{sup +}e{sup -}{pi}{sup 0} in the single tag mode and measure the differential cross section d{sigma}/dQ{sup 2} and the {gamma}{gamma}* {yields} {pi}{sup 0} transition form factor in the mometum transfer range from 4 to 40 GeV{sup 2}. At Q{sup 2} > 10 GeV{sup 2} the measured form factor exceeds the asymptotic limit predicted by perturbative QCD. The analysis is based on 442 fb{sup -1} of integrated luminosity collected at PEP-II with the BABAR detector at e{sup +}e{sup -} center-of-mass energies near 10.6 GeV.

  5. Octet Baryon Electromagnetic Form Factors in a Relativistic Quark Model

    SciTech Connect

    Gilberto Ramalho, Kazuo Tsushima

    2011-09-01

    We study the octet baryon electromagnetic properties by applying the covariant spectator quark model, and provide covariant parametrization that can be used to study baryon electromagnetic reactions. While we use the lattice QCD data in the large pion mass regime (small pion cloud effects) to determine the parameters of the model in the valence quark sector, we use the nucleon physical and octet baryon magnetic moment data to parameterize the pion cloud contributions. The valence quark contributions for the octet baryon electromagnetic form factors are estimated by extrapolating the lattice parametrization in the large pion mass regime to the physical regime. As for the pion cloud contributions, we parameterize them in a covariant, phenomenological manner, combined with SU(3) symmetry. We also discuss the impact of the pion cloud effects on the octet baryon electromagnetic form factors and their radii.

  6. Small form factor full parallax tiled light field display

    NASA Astrophysics Data System (ADS)

    Alpaslan, Zahir Y.; El-Ghoroury, Hussein S.

    2015-03-01

    With the recent introduction of Ostendo's Quantum Photonic Imager (QPI) display technology, a very small pixel pitch, emissive display with high brightness and low power consumption became available. We used QPI's to create a high performance light field display tiles with a very small form factor. Using 8 of these QPI light field displays tiled in a 4x2 array we created a tiled full parallax light field display. Each individual light field display tile combines custom designed micro lens array layers with monochrome green QPIs. Each of the light field display tiles can address 1000 x 800 pixels placed under an array of 20 x 16 lenslets with 500 μm diameters. The light field display tiles are placed with small gaps to create a tiled display of approximately 46 mm (W) x 17 mm (H) x 2 mm (D) in mechanical dimensions. The prototype tiled full parallax light field display demonstrates small form factor, high resolution and focus cues.

  7. η' transition form factor from space- and timelike experimental data

    NASA Astrophysics Data System (ADS)

    Escribano, R.; Gonzàlez-Solís, S.; Masjuan, P.; Sanchez-Puertas, P.

    2016-09-01

    The η' transition form factor is reanalyzed in view of the recent first observation by BESIII of the Dalitz decay η'→γ e+e- in both space- and timelike regions at low and intermediate energies using the Padé approximants method. The present analysis provides a suitable parametrization for reproducing the measured form factor in the whole energy region and allows one to extract the corresponding low-energy parameters together with a prediction of their values at the origin, related to Γη'→γ γ , and the asymptotic limit. The η - η' mixing is reassessed within a mixing scheme compatible with the large-Nc chiral perturbation theory at next-to-leading order, with particular attention to the Okubo-Zweig-Iizuka-rule-violating parameters. The J /ψ , Z →η(')γ decays are also considered and predictions are reported.

  8. Nonlocal form factors for curved-space antisymmetric fields

    NASA Astrophysics Data System (ADS)

    Netto, Tibério de Paula; Shapiro, Ilya L.

    2016-07-01

    In a recent paper, Buchbinder, Kirillova, and Pletnev presented formal arguments concerning the quantum equivalence of free massive antisymmetric tensor fields of the second and third rank to the free Proca theory and massive scalar field with minimal coupling to gravity, respectively. We confirm this result using explicit covariant calculations of nonlocal form factors based on the heart-kernel technique and discuss the discontinuity of quantum contributions in the massless limit.

  9. Stackable Form-Factor Peripheral Component Interconnect Device and Assembly

    NASA Technical Reports Server (NTRS)

    Somervill, Kevin M. (Inventor); Ng, Tak-kwong (Inventor); Torres-Pomales, Wilfredo (Inventor); Malekpour, Mahyar R. (Inventor)

    2013-01-01

    A stackable form-factor Peripheral Component Interconnect (PCI) device can be configured as a host controller or a master/target for use on a PCI assembly. PCI device may comprise a multiple-input switch coupled to a PCI bus, a multiplexor coupled to the switch, and a reconfigurable device coupled to one of the switch and multiplexor. The PCI device is configured to support functionality from power-up, and either control function or add-in card function.

  10. Axial form factor of the nucleon at large momentum transfers

    NASA Astrophysics Data System (ADS)

    Anikin, I. V.; Braun, V. M.; Offen, N.

    2016-08-01

    Motivated by the emerging possibilities to study threshold pion electroproduction at large momentum transfers at Jefferson Laboratory following the 12 GeV upgrade, we provide a short theory summary and an estimate of the nucleon axial form factor for large virtualities in the Q2=1 - 10 GeV2 range using next-to-leading-order light-cone sum rules.

  11. Pion transverse charge density from timelike form factor data

    SciTech Connect

    Gerald Miller, Mark Strikman, Christian Weiss

    2011-01-01

    The transverse charge density in the pion can be represented as a dispersion integral of the imaginary part of the pion form factor in the timelike region. This formulation incorporates information from e+e- annihilation experiments and allows one to reconstruct the transverse density much more accurately than from the spacelike pion form factor data alone. We calculate the transverse density using an empirical parametrization of the timelike pion form factor and estimate that it is determined to an accuracy of ~10% at a distance b ~ 0.1 fm, and significantly better at larger distances. The density is found to be close to that obtained from a zero-width rho meson pole over a wide range and shows a pronounced rise at small distances. The resulting two-dimensional image of the fast-moving pion can be interpreted in terms of its partonic structure in QCD. We argue that the singular behavior of the charge density at the center requires a substantial presence of pointlike configurations in the pion's partonic wave function, which can be probed in other high-momentum transfer processes.

  12. Form factor and width of a quantum string

    NASA Astrophysics Data System (ADS)

    Rajantie, Arttu; Rummukainen, Kari; Weir, David J.

    2012-12-01

    In the Yang-Mills theory, the apparent thickness of the confining string is known to grow logarithmically when its length increases. The same logarithmic broadening also happens to strings in other quantum field theories and domain walls in statistical physics models. Even in quantum field theories, the correlators used to measure and characterize this phenomenon are analogous to those in statistical physics. In this paper we describe it using the string form factor which is a meaningful quantum observable, obtainable in principle from scattering experiments. We show how the form factor can be obtained from field correlation functions calculated in lattice Monte Carlo simulations. We apply this method to 2+1-dimensional scalar theory in the strong coupling limit, where it is equivalent to the 3D Ising model, and through duality also to 2+1-dimensional Z2 gauge theory. We measure the string form factor by simulating the Ising model, and demonstrate that it displays the same logarithmic broadening as observed by other quantities.

  13. Astrophysical S factors for radiative proton capture by {sup 3}H and {sup 7}Li nuclei

    SciTech Connect

    Dubovichenko, S. B.

    2011-03-15

    Within the potential cluster model where orbital states are classified according to Young diagrams and isospin, astrophysical S factors are considered for radiative proton capture by {sup 3}H and {sup 7}Li nuclei at energies of up to 1 and 10 keV, respectively. It is shown that the approach used, which takes into account only the E1 transition for the p{sup 3}H capture process, makes it possible to describe well the most recent experimental data at c.m. energies in the range from 50 keV to 5MeV. In the case of proton capture by {sup 7}Li nuclei, an M1 processwas taken into account in addition to the E1 transition, and a general behavior and the magnitude of the experimental S factor could be correctly reproduced owing to this at astrophysical energies, including the region around the resonance at 0.441 MeV (in the laboratory frame).

  14. Meson Transition Form Factors in Light-Front Holographic QCD

    SciTech Connect

    Brodsky, Stanley J.; Cao, Fu-Guang; de Teramond, Guy F.; /Costa Rica U.

    2011-06-22

    We study the photon-to-meson transition form factors (TFFs) F{sub M{gamma}}(Q{sup 2}) for {gamma}{gamma}* {yields} M using light-front holographic methods. The Chern-Simons action, which is a natural form in 5-dimensional anti-de Sitter (AdS) space, leads directly to an expression for the photon-to-pion TFF for a class of confining models. Remarkably, the predicted pion TFF is identical to the leading order QCD result where the distribution amplitude has asymptotic form. The Chern-Simons form is local in AdS space and is thus somewhat limited in its predictability. It only retains the q{bar q} component of the pion wavefunction, and further, it projects out only the asymptotic form of the meson distribution amplitude. It is found that in order to describe simultaneously the decay process {pi}{sup 0} {yields} {gamma}{gamma} and the pion TFF at the asymptotic limit, a probability for the q{bar q} component of the pion wavefunction P{sub q{bar q}} = 0.5 is required; thus giving indication that the contributions from higher Fock states in the pion light-front wavefunction need to be included in the analysis. The probability for the Fock state containing four quarks (anti-quarks) which follows from analyzing the hadron matrix elements, P{sub q{bar q}q{bar q}} {approx} 10%, agrees with the analysis of the pion elastic form factor using light-front holography including higher Fock components in the pion wavefunction. The results for the TFFs for the {eta} and {eta}{prime} mesons are also presented. The rapid growth of the pion TFF exhibited by the BABAR data at high Q{sup 2} is not compatible with the models discussed in this article, whereas the theoretical calculations are in agreement with the experimental data for the {eta} and {eta}{prime} TFFs.

  15. Bunch coalescing in the main ring to form intense proton and antiproton bunches without RF counterphasing

    SciTech Connect

    Griffin, J.E.; MacLachlan, J.A.; Nicholls, G.N.; Qian, Z.B.

    1984-08-09

    Both the proton and antiproton bunches which will collide in the Tevatron have longitudinal emittance greater than can be accelerated by the main ring from 8 GeV without large loss and emittance growth. We have previously described the technique of combining several smaller bunches at the Tevatron injection energy with little increase in the total emittance and negligible loss. This technique requires adiabatic debunching of several adjacent 53 MHz bunches by smooth reduction of the RF voltage from approx. 1 MV to approx. 100 V. The very low voltage is extremely difficult to attain with a high-Q system designed for megavolt accelerating potential. The counterphasing technique of voltage reduction which we have used in main ring experiments and proposed for the TeV I project is to divide the accelerating cavities into two closely matched groups and to smoothly shift the relative phase of the drive to the two groups by 180 degrees. When the net voltage has been reduced by this means to the lowest practical level, about 10 kV, the final voltage reduction may be performed by turning off the high-Q system and using a low-Q cavity. The voltage induced on the undriven gaps of the high-Q system is low enough not to be a major problem because the total intensity is low. However, the effects are not negligible, and dynamic beam loading compensation is required. This memo proposes that the process described above be simplified somewhat by replacing the counterphasing voltage reduction with a zero-voltage spreading of the bunches for several milliseconds followed by a few hundred microseconds of rotation to minimum energy spread in buckets produced at high voltage.

  16. Comparative proton nuclear magnetic resonance studies of amantadine complexes formed in aqueous solutions with three major cyclodextrins.

    PubMed

    Lis-Cieplak, Agnieszka; Sitkowski, Jerzy; Kolodziejski, Waclaw

    2014-01-01

    Host-guest complexes of alpha-, beta-, and gamma-cyclodextrins (α-CD, β-CD, and γ-CD, respectively) with amantadine (1-aminoadamantane, AMA; an antiviral agent) were characterized in aqueous solutions using proton nuclear magnetic resonance (NMR) spectroscopy. Host-guest molecular interactions were manifested by changes in the chemical shifts of AMA protons. NMR Job's plots showed that the stoichiometry of all the studied complexes was 1:1. Two-dimensional T-ROESY experiments demonstrated that the complexes were formed by different degrees of incorporation of the adamantyl group of AMA into the CD cavity. The mode of AMA binding was proposed. The AMA molecule came into the α-CD cavity (the smallest size) or β-CD cavity (the intermediate size) through its wide entrance to become shallowly or deeply accommodated, respectively. In the complex of AMA with γ-CD (the largest cavity size), the adamantyl group was also quite deeply inserted into the CD cavity, but it arrived there through the narrow cavity entrance. It was found that the adamantyl group of AMA was best accommodated by the β-CD cavity. The binding constants Kaa of the studied complexes (in M(-1) ), determined from DOSY NMR, were fairly high; their values in an ascending order were: α-CD (183) < γ-CD (306) ≪ β-CD (5150).

  17. Scattering form factors for self-assembled network junctions

    NASA Astrophysics Data System (ADS)

    Foster, T.; Safran, S. A.; Sottmann, T.; Strey, R.

    2007-11-01

    The equilibrium microstructures in microemulsions and other self-assembled systems show complex, connected shapes such as symmetric bicontinuous spongelike structures and asymmetric bicontinuous networks formed by cylinders interconnected at junctions. In microemulsions, these cylinder network microstructures may mediate the structural transition from a spherical or globular phase to the bicontinuous microstructure. To understand the structural and statistical properties of such cylinder network microstructures as measured by scattering experiments, models are needed to extract the real-space structure from the scattering data. In this paper, we calculate the scattering functions appropriate for cylinder network microstructures. We focus on such networks that contain a high density of network junctions that connect the cylindrical elements. In this limit, the network microstructure can be regarded as an assembly of randomly oriented, closed packed network junctions (i.e., the cylinder scattering contributions are neglected). Accordingly, the scattering spectrum of the network microstructure can be calculated as the product of the junction number density, the junction form factor, which describes the scattering from the surface of a single junction, and a structure factor, which describes the local correlations of different junctions due to junction interactions (including their excluded volume). This approach is applied to analyze the scattering data from a bicontinuous microemulsion with equal volumes of water and oil. In a second approach, we included the cylinder scattering contribution in the junction form factor by calculating the scattering intensity of Y junctions to which three rods with spherical cross section are attached. The respective theoretical predictions are compared with results of neutron scattering measurements on a water-in-oil microemulsion with a connected microstructure.

  18. Introducing soil forming factors with mini campus field trips

    NASA Astrophysics Data System (ADS)

    Quinton, John; Haygarth, Phil

    2013-04-01

    Students like field work, yet the proportion of time spent in the field during many soil science courses is small. Here we describe an introductory lecture on the soil forming factors based around a mini field trip in which we spend 45 minutes exploring these factors on the Lancaster University campus. In the 'trip' we visit some woodland to consider the effects of organic matter , vegetation and time on soil development and then take in a football pitch to examine the effects of landscape position, parent material and climate. Student responses are overwhelmingly positive and we suggest that more use can be made of our often mundane surroundings to explore soil formation. Soil functions and soil processes.

  19. Cytokinin response factors regulate PIN-FORMED auxin transporters.

    PubMed

    Šimášková, Mária; O'Brien, José Antonio; Khan, Mamoona; Van Noorden, Giel; Ötvös, Krisztina; Vieten, Anne; De Clercq, Inge; Van Haperen, Johanna Maria Adriana; Cuesta, Candela; Hoyerová, Klára; Vanneste, Steffen; Marhavý, Peter; Wabnik, Krzysztof; Van Breusegem, Frank; Nowack, Moritz; Murphy, Angus; Friml, Jiří; Weijers, Dolf; Beeckman, Tom; Benková, Eva

    2015-11-06

    Auxin and cytokinin are key endogenous regulators of plant development. Although cytokinin-mediated modulation of auxin distribution is a developmentally crucial hormonal interaction, its molecular basis is largely unknown. Here we show a direct regulatory link between cytokinin signalling and the auxin transport machinery uncovering a mechanistic framework for cytokinin-auxin cross-talk. We show that the CYTOKININ RESPONSE FACTORS (CRFs), transcription factors downstream of cytokinin perception, transcriptionally control genes encoding PIN-FORMED (PIN) auxin transporters at a specific PIN CYTOKININ RESPONSE ELEMENT (PCRE) domain. Removal of this cis-regulatory element effectively uncouples PIN transcription from the CRF-mediated cytokinin regulation and attenuates plant cytokinin sensitivity. We propose that CRFs represent a missing cross-talk component that fine-tunes auxin transport capacity downstream of cytokinin signalling to control plant development.

  20. Baryon octet electromagnetic form factors in a confining NJL model

    NASA Astrophysics Data System (ADS)

    Carrillo-Serrano, Manuel E.; Bentz, Wolfgang; Cloët, Ian C.; Thomas, Anthony W.

    2016-08-01

    Electromagnetic form factors of the baryon octet are studied using a Nambu-Jona-Lasinio model which utilizes the proper-time regularization scheme to simulate aspects of colour confinement. In addition, the model also incorporates corrections to the dressed quarks from vector meson correlations in the t-channel and the pion cloud. Comparison with recent chiral extrapolations of lattice QCD results shows a remarkable level of consistency. For the charge radii we find the surprising result that rEp < rEΣ+ and | rEn | < | rEΞ0 |, whereas the magnetic radii have a pattern largely consistent with a naive expectation based on the dressed quark masses.

  1. Minimal form factor digital-image sensor for endoscopic applications

    NASA Astrophysics Data System (ADS)

    Wäny, Martin; Voltz, Stephan; Gaspar, Fabio; Chen, Lei

    2009-02-01

    This paper presents a digital image sensor SOC featuring a total chip area (including dicing tolerances) of 0.34mm2 for endoscopic applications. Due to this extremely small form factor the sensor enables integration in endoscopes, guide wires and locater devices of less than 1mm outer diameter. The sensor embeds a pixel matrix of 10'000 pixels with a pitch of 3um x 3um covered with RGB filters in Bayer pattern. The sensor operates fully autonomous, controlled by an on chip ring oscillator and readout state machine, which controls integration AD conversion and data transmission, thus the sensor only requires 4 pin's for power supply and data communication. The sensor provides a frame rate of 40Frames per second over a LVDS serial data link. The endoscopic application requires that the sensor must work without any local power decoupling capacitances at the end of up to 2m cabling and be able to sustain data communication over the same wire length without deteriorating image quality. This has been achieved by implementation of a current mode successive approximation ADC and current steering LVDS data transmission. An band gap circuit with -40dB PSRR at the data frequency was implemented as on chip reference to improve robustness against power supply ringing due to the high series inductance of the long cables. The B&W versions of the sensor provides a conversion gain of 30DN/nJ/cm2 at 550nm with a read noise in dark of 1.2DN when operated at 2m cable. Using the photon transfer method according to EMVA1288 standard the full well capacity was determined to be 18ke-. According to our knowledge the presented work is the currently world smallest fully digital image sensor. The chip was designed along with a aspheric single surface lens to assemble on the chip without increasing the form factor. The extremely small form factor of the resulting camera permit's to provide visualization with much higher than state of the art spatial resolution in sub 1mm endoscopic

  2. P and T Violating Form Factors of the Deuteron

    SciTech Connect

    Vries, J. de; Timmermans, R. G. E.; Mereghetti, E.; Kolck, U. van

    2011-08-26

    We calculate the electric-dipole and magnetic-quadrupole form factors of the deuteron that arise as a low-energy manifestation of parity and time-reversal violation in quark-gluon interactions. We consider the QCD vacuum angle and the dimension-six operators that originate from physics beyond the standard model: the quark electric and chromoelectric dipole moments and the gluon chromoelectric dipole moment. Within the framework of two-flavor chiral perturbation theory, we show that in combination with the nucleon electric dipole moment, the deuteron moments would allow an identification of the dominant source(s) of symmetry violation.

  3. CEBAF at higher energies and the kaon electromagnetic form factor

    SciTech Connect

    Baker, O.K.

    1994-04-01

    The electromagnetic production of strangeness, the physics of exciting systems having strangeness degrees of freedom (production of hadrons with one or more strange constituent quarks) using electromagnetic probes (real or virtual photons), is one of the frontier areas of research which will be investigated at the Continuous Electron Beam Accelerator Facility (CEBAF) when it becomes operational. CEBAF is expected to have an important impact upon this field of research using its specialized set of detection instruments and high quality electron beam. This paper focusses upon one aspect of the associated production of strangeness - the determination of the kaon electromagnetic form factor at high squared momentum transfers.

  4. Meson transition form factors in light-front holographic QCD

    SciTech Connect

    Brodsky, Stanley J.; Cao Fuguang; de Teramond, Guy F.

    2011-10-01

    We study the photon-to-meson transition form factors (TFFs) F{sub M}{gamma}(Q{sup 2}) for {gamma}{gamma}{sup *}{yields}M using light-front holographic methods. The Chern-Simons action, which is a natural form in five-dimensional anti-de Sitter (AdS) space, is required to describe the anomalous coupling of mesons to photons using holographic methods and leads directly to an expression for the photon-to-pion TFF for a class of confining models. Remarkably, the predicted pion TFF is identical to the leading order QCD result where the distribution amplitude has asymptotic form. The Chern-Simons form is local in AdS space and is thus somewhat limited in its predictability. It only retains the qq component of the pion wave function, and further, it projects out only the asymptotic form of the meson distribution amplitude. It is found that in order to describe simultaneously the decay process {pi}{sup 0}{yields}{gamma}{gamma} and the pion TFF at the asymptotic limit, a probability for the qq component of the pion wave function P{sub qq}=0.5 is required, thus giving indication that the contributions from higher Fock states in the pion light-front wave function need to be included in the analysis. The probability for the Fock state containing four quarks P{sub qqqq}{approx}10%, which follows from analyzing the hadron matrix elements for a dressed current model, agrees with the analysis of the pion elastic form factor using light-front holography including higher Fock components in the pion wave function. The results for the TFFs for the {eta} and {eta}{sup '} mesons are also presented. The rapid growth of the pion TFF exhibited by the BABAR data at high Q{sup 2} is not compatible with the models discussed in this article, whereas the theoretical calculations are in agreement with the experimental data for the {eta} and {eta}{sup '} TFFs.

  5. ρ γ*→π (ρ ) transition form factors in the perturbative QCD factorization approach

    NASA Astrophysics Data System (ADS)

    Zhang, Ya-Lan; Cheng, Shan; Hua, Jun; Xiao, Zhen-Jun

    2015-11-01

    In this paper, we studied the ρ γ*→π and ρ γ*→ρ transition processes and made the calculations for the ρ π transition form factor Q4Fρ π(Q2) and the ρ -meson electromagnetic form factors, FLL ,LT ,TT(Q2) and F1 ,2 ,3(Q2), by employing the perturbative QCD (PQCD) factorization approach. For the ρ γ*→π transition, we found that the contribution to form factor Q4Fρ π(Q2) from the term proportional to the distribution amplitude combination ϕρT(x1)ϕπP(x2) is absolutely dominant, and the PQCD predictions for both the size and the Q2-dependence of this form factor Q4Fρ π(Q2) agree well with those from the extended anti-de Sitter/QCD models or the light-cone QCD sum rule. For the ρ γ*→ρ transition and in the region of Q2≥3 GeV2 , furthermore, we found that the PQCD predictions for the magnitude and their Q2-dependence of the F1(Q2) and F2(Q2) form factors agree well with those from the QCD sum rule, while the PQCD prediction for F3(Q2) is much larger than the one from the QCD sum rule.

  6. Improved semileptonic form factor calculations in lattice QCD

    SciTech Connect

    Evans, Richard; Bali, Gunnar; Collins, Sara

    2010-11-01

    We investigate the computational efficiency of two stochastic based alternatives to the sequential propagator method used in lattice QCD calculations of heavy-light semileptonic form factors. In the first method, we replace the sequential propagator, which couples the calculation of two of the three propagators required for the calculation, with a stochastic propagator so that the calculations of all three propagators are independent. This method is more flexible than the sequential propagator method but introduces stochastic noise. We study the noise to determine when this method becomes competitive with the sequential propagator method, and find that for any practical calculation it is competitive with or superior to the sequential propagator method. We also examine a second stochastic method, the so-called 'one-end trick', concluding it is relatively inefficient in this context. The investigation is carried out on two gauge field ensembles, using the nonperturbatively improved Wilson-Sheikholeslami-Wohlert action with N{sub f}=2 mass-degenerate sea quarks. The two ensembles have similar lattice spacings but different sea-quark masses. We use the first stochastic method to extract O(a)-improved, matched lattice results for the semileptonic form factors on the ensemble with lighter sea quarks, extracting f{sub +}(0).

  7. Astrophysical S-factor of the radiative proton capture on 14C at low energies

    NASA Astrophysics Data System (ADS)

    Dubovichenko, Sergey; Burtebaev, Nasurlla; Dzhazairov-Kakhramanov, Albert; Alimov, Dilshod

    2014-07-01

    The phase shift analysis for position location of the 2S1/2 resonance at 1.5 MeV was carried out on the basis of the known experimental measurements of the excitation functions of the p14C elastic scattering at four angles from 90° to 165° and more than 100 energy values in the range from 600-800 keV to 2200-2400 keV. Also, the possibility to describe the available experimental data on the astrophysical S-factor for the proton capture reaction on 14C to the ground state (GS) of 15N at astrophysical energies was considered in the frame of modified potential cluster model (MPCM).

  8. Spontaneous electromagnetic fluctuations in unmagnetized plasmas. II. Relativistic form factors of aperiodic thermal modes

    SciTech Connect

    Felten, T.; Schlickeiser, R.; Yoon, P. H.; Lazar, M.

    2013-05-15

    General expressions for the electromagnetic fluctuation spectra in unmagnetized plasmas are derived using fully relativistic dispersion functions and form factors for the important class of isotropic plasma particle distribution functions including in particular relativistic Maxwellian distributions. In order to obtain fluctuation spectra valid in the entire complex frequency plane, the proper analytical continuations of the unmagnetized form factors and dispersion functions are presented. The results are illustrated for the important special case of isotropic Maxwellian particle distribution functions providing in particular the thermal fluctuations of aperiodic modes. No restriction to the plasma temperature value is made, and the electromagnetic fluctuation spectra of ultrarelativistic thermal plasmas are calculated. The fully relativistic calculations also provide more general results in the limit of nonrelativistic plasma temperatures being valid in the entire complex frequency plane. They complement our earlier results in paper I and III of this series for negative values of the imaginary part of the frequency. A new collective, transverse, damped aperiodic mode with the damping rate γ∝−k{sup −5/3} is discovered in an isotropic thermal electron-proton plasma with nonrelativistic temperatures.

  9. The impact of s-bar{s} asymmetry on the strange electromagnetic form factor

    NASA Astrophysics Data System (ADS)

    Ghasempour Nesheli, Ali

    2016-09-01

    The existence of the strange quark asymmetry in the nucleon sea has been indicated by both the experimental and theoretical analyses. Although it is well known that the s-bar{{s}} asymmetry is important for some processes in high-energy hadron collisions, it has also been indicated that it can be related to the strange Dirac form factor F 1 s. In this work, we have studied the impact of s- bar{{s}} asymmetry and its uncertainty from various modern parton distribution functions (PDFs) on F 1 s and compared the obtained results with the available experimental information. As a result, we found that the uncertainty in F 1 s( t) due to the s( x) - bar{s}( x) distribution is rather large so that it dominates the model uncertainty at all values of the squared momentum transfer t. However, taking into account the uncertainties, the theoretical predictions of F 1 s( t) are fully compatible with the estimate extracted from experiment. We concluded that the future accurate experimental data of the strange Dirac form factor might be used to put direct constraints on the strange content of the proton and reduce its uncertainty that has always been a challenge.

  10. Delirium in the geriatric unit: proton-pump inhibitors and other risk factors

    PubMed Central

    Otremba, Iwona; Wilczyński, Krzysztof; Szewieczek, Jan

    2016-01-01

    Background Delirium remains a major nosocomial complication of hospitalized elderly. Predictive models for delirium may be useful for identification of high-risk patients for implementation of preventive strategies. Objective Evaluate specific factors for development of delirium in a geriatric ward setting. Methods Prospective cross-sectional study comprised 675 consecutive patients aged 79.2±7.7 years (66% women and 34% men), admitted to the subacute geriatric ward of a multiprofile university hospital after exclusion of 113 patients treated with antipsychotic medication because of behavioral disorders before admission. Comprehensive geriatric assessments including a structured interview, physical examination, geriatric functional assessment, blood sampling, ECG, abdominal ultrasound, chest X-ray, Confusion Assessment Method for diagnosis of delirium, Delirium-O-Meter to assess delirium severity, Richmond Agitation-Sedation Scale to assess sedation or agitation, visual analog scale and Doloplus-2 scale to assess pain level were performed. Results Multivariate logistic regression analysis revealed five independent factors associated with development of delirium in geriatric inpatients: transfer between hospital wards (odds ratio [OR] =2.78; confidence interval [CI] =1.54–5.01; P=0.001), preexisting dementia (OR =2.29; CI =1.44–3.65; P<0.001), previous delirium incidents (OR =2.23; CI =1.47–3.38; P<0.001), previous fall incidents (OR =1.76; CI =1.17–2.64; P=0.006), and use of proton-pump inhibitors (OR =1.67; CI =1.11–2.53; P=0.014). Conclusion Transfer between hospital wards, preexisting dementia, previous delirium incidents, previous fall incidents, and use of proton-pump inhibitors are predictive of development of delirium in the geriatric inpatient setting. PMID:27103793

  11. Proton Gradients as a Key Physical Factor in the Evolution of the Forced Transport Mechanism Across the Lipid Membrane

    NASA Astrophysics Data System (ADS)

    Strbak, Oliver; Kanuchova, Zuzana; Krafcik, Andrej

    2016-04-01

    A critical phase in the transition from prebiotic chemistry to biological evolution was apparently an asymmetric ion flow across the lipid membrane. Due to imbalance in the ion flow, the early lipid vesicles could selectively take the necessary molecules from the environment, and release the side-products from the vesicle. Natural proton gradients played a definitively crucial role in this process, since they remain the basis of energy transfer in the present-day cells. On the basis of this supposition, and the premise of the early vesicle membrane's impermeability to protons, we have shown that the emergence of the proton gradient in the lipid vesicle could be a key physical factor in the evolution of the forced transport mechanism (pore formation and active transport) across the lipid bilayer. This driven flow of protons across the membrane is the result of the electrochemical proton gradient and osmotic pressures on the integrity of the lipid vesicle. At a critical number of new lipid molecules incorporated into the vesicle, the energies associated with the creation of the proton gradient exceed the bending stiffness of the lipid membrane, and overlap the free energy of the lipid bilayer pore formation.

  12. Effects of a granulocyte colony stimulating factor, Neulasta, in mini pigs exposed to total body proton irradiation

    NASA Astrophysics Data System (ADS)

    Sanzari, Jenine K.; Krigsfeld, Gabriel S.; Shuman, Anne L.; Diener, Antonia K.; Lin, Liyong; Mai, Wilfried; Kennedy, Ann R.

    2015-04-01

    Astronauts could be exposed to solar particle event (SPE) radiation, which is comprised mostly of proton radiation. Proton radiation is also a treatment option for certain cancers. Both astronauts and clinical patients exposed to ionizing radiation are at risk for loss of white blood cells (WBCs), which are the body's main defense against infection. In this report, the effect of Neulasta treatment, a granulocyte colony stimulating factor, after proton radiation exposure is discussed. Mini pigs exposed to total body proton irradiation at a dose of 2 Gy received 4 treatments of either Neulasta or saline injections. Peripheral blood cell counts and thromboelastography parameters were recorded up to 30 days post-irradiation. Neulasta significantly improved WBC loss, specifically neutrophils, in irradiated animals by approximately 60% three days after the first injection, compared to the saline treated, irradiated animals. Blood cell counts quickly decreased after the last Neulasta injection, suggesting a transient effect on WBC stimulation. Statistically significant changes in hemostasis parameters were observed after proton radiation exposure in both the saline and Neulasta treated irradiated groups, as well as internal organ complications such as pulmonary changes. In conclusion, Neulasta treatment temporarily alleviates proton radiation-induced WBC loss, but has no effect on altered hemostatic responses.

  13. Effects of a granulocyte colony stimulating factor, Neulasta, in mini pigs exposed to total body proton irradiation

    PubMed Central

    Sanzari, Jenine K.; Krigsfeld, Gabriel S.; Shuman, Anne L.; Diener, Antonia K.; Lin, Liyong; Mai, Wilfried; Kennedy, Ann R.

    2015-01-01

    Astronauts could be exposed to solar particle event (SPE) radiation, which is comprised mostly of proton radiation. Proton radiation is also a treatment option for certain cancers. Both astronauts and clinical patients exposed to ionizing radiation are at risk for white blood cell (WBC) loss, which are the body’s main defense against infection. In this report, the effect of Neulasta treatment, a granulocyte colony stimulating factor, after proton radiation exposure is discussed. Mini pigs exposed to total body proton irradiation at a dose of 2 Gy received 4 treatments of either Neulasta or saline injections. Peripheral blood cell counts and thromboelastography parameters were recorded up to 30 days post-irradiation. Neulasta significantly improved white blood cell (WBC), specifically neutrophil, loss in irradiated animals by approximately 60% three days after the first injection, compared to the saline treated irradiated animals. Blood cell counts quickly decreased after the last Neulasta injection, suggesting a transient effect on WBC stimulation. Statistically significant changes in hemostasis parameters were observed after proton radiation exposure in both the saline and Neulasta treated irradiated groups, as well internal organ complications such as pulmonary changes. In conclusion, Neulasta treatment temporarily alleviates proton radiation-induced WBC loss, but has no effect on altered hemostatic responses. PMID:25909052

  14. Proton Gradients as a Key Physical Factor in the Evolution of the Forced Transport Mechanism Across the Lipid Membrane

    NASA Astrophysics Data System (ADS)

    Strbak, Oliver; Kanuchova, Zuzana; Krafcik, Andrej

    2016-11-01

    A critical phase in the transition from prebiotic chemistry to biological evolution was apparently an asymmetric ion flow across the lipid membrane. Due to imbalance in the ion flow, the early lipid vesicles could selectively take the necessary molecules from the environment, and release the side-products from the vesicle. Natural proton gradients played a definitively crucial role in this process, since they remain the basis of energy transfer in the present-day cells. On the basis of this supposition, and the premise of the early vesicle membrane's impermeability to protons, we have shown that the emergence of the proton gradient in the lipid vesicle could be a key physical factor in the evolution of the forced transport mechanism (pore formation and active transport) across the lipid bilayer. This driven flow of protons across the membrane is the result of the electrochemical proton gradient and osmotic pressures on the integrity of the lipid vesicle. At a critical number of new lipid molecules incorporated into the vesicle, the energies associated with the creation of the proton gradient exceed the bending stiffness of the lipid membrane, and overlap the free energy of the lipid bilayer pore formation.

  15. Deuteron Electromagnetic Form Factors in AdS/QCD

    NASA Astrophysics Data System (ADS)

    Lyubovitskij, Valery E.; Gutsche, Thomas; Schmidt, Ivan; Vega, Alfredo

    2016-07-01

    We extend a soft-wall AdS/QCD approach to a description of deuteron properties. Our framework is based an effective action formulated in terms of AdS fields, which are holographically equivalent to the deuteron and photon fields. This action produces the equation of motion for the deuteron wave function and the Q^2-dependent electromagnetic current, which are then used to calculate the deuteron electromagnetic form factors and structure functions in the Euclidean region. We show that the predicted deuteron quantities are expressed through a universal function, which is defined by a single scale parameter κ and which has the correct 1/Q^{10} power scaling at large Q^2.

  16. Measurements of deuteron magnetic form factor high momentum transfer

    SciTech Connect

    Arnold, R.G.; Benton, D.; Bosted, P.; Clogher, L.; DeChambrier, G.; Katramatou, A.T.; Lambert, J.; Lung, A.; Petratos, G.G.; Rahbar, A.; and others

    1987-04-27

    The deuteron magnetic form factor B(Q/sup 2/) has been measured at momentum transfers Q/sup 2/ = 1.21, 1.49, 1.61, 1.74, 1.98, 2.23, 2.48, 2.53, and 2.77 (GeV/c)/sup 2/ at the Stanford Linear Accelerator Center by detection of electrons backscattered at 180/sup 0/ in coincidence with recoiling deuterons at 0/sup 0/. The data for B(Q/sup 2/) are found to decrease rapidly from Q/sup 2/ = 1.2 to 2 (GeV/c)/sup 2/, then rise to a secondary maximum around Q/sup 2/ = 2.5 (GeV/c)/sup 2/, in qualitative agreement with impulse-approximation calculations.

  17. Thin and small form factor cells : simulated behavior.

    SciTech Connect

    Clews, Peggy Jane; Pluym, Tammy; Grubbs, Robert K.; Cruz-Campa, Jose Luis; Zubia, David; Young, Ralph Watson; Okandan, Murat; Gupta, Vipin P.; Nielson, Gregory N.; Resnick, Paul James

    2010-07-01

    Thin and small form factor cells have been researched lately by several research groups around the world due to possible lower assembly costs and reduced material consumption with higher efficiencies. Given the popularity of these devices, it is important to have detailed information about the behavior of these devices. Simulation of fabrication processes and device performance reveals some of the advantages and behavior of solar cells that are thin and small. Three main effects were studied: the effect of surface recombination on the optimum thickness, efficiency, and current density, the effect of contact distance on the efficiency for thin cells, and lastly the effect of surface recombination on the grams per Watt-peak. Results show that high efficiency can be obtained in thin devices if they are well-passivated and the distance between contacts is short. Furthermore, the ratio of grams per Watt-peak is greatly reduced as the device is thinned.

  18. Proton charge extensions

    NASA Astrophysics Data System (ADS)

    Stryker, Jesse R.; Miller, Gerald A.

    2016-01-01

    We examine how corrections to S -state energy levels En S in hydrogenic atoms due to the finite proton size are affected by moments of the proton charge distribution. The corrections to En S are computed moment by moment. The results demonstrate that the next-to-leading order term in the expansion is of order rp/aB times the size of the leading order term. Our analysis thus dispels any concern that the larger relative size of this term for muonic hydrogen versus electronic hydrogen might account for the current discrepancy of proton radius measurements extracted from the two systems. Furthermore, the next-to-leading order term in powers of rp/aB that we derive from a dipole proton form factor is proportional to , rather than , as would be expected from the scalar nature of the form factor. The dependence of the finite-size correction on and higher odd-power moments is shown to be a general result for any spherically symmetric proton charge distribution. A method for computing the moment expansion of the finite-size correction to arbitrary order is introduced and the results are tabulated for principal quantum numbers up to n =7 .

  19. An experiment for the direct determination of the g-factor of a single proton in a Penning trap

    NASA Astrophysics Data System (ADS)

    Rodegheri, C. C.; Blaum, K.; Kracke, H.; Kreim, S.; Mooser, A.; Quint, W.; Ulmer, S.; Walz, J.

    2012-06-01

    A new apparatus has been designed that aims at a direct precision measurement of the g-factor of a single isolated proton or antiproton in a Penning trap. We present a thorough discussion on the trap design and a method for the experimental trap optimization using a single stored proton. A first attempt at the g-factor determination has been made in a section of the trap with a magnetic bottle. The Larmor frequency of the proton has been measured with a relative uncertainty of 1.8 × 10-6 and the magnetic moment has been determined with a relative uncertainty of 8.9 × 10-6. A g-factor of 5.585 696(50) has been obtained, which is in excellent agreement with previous measurements and predictions. Future experiments shall drive the spin-flip transition in a section of the trap with a homogeneous magnetic field. This has the potential to improve the precision of the measured g-factor of the proton and the antiproton by several orders of magnitude.

  20. Measurement of the neutron magnetic form factor at high Q-2 using the ratio method on deuterium

    SciTech Connect

    G.P. Gilfoyle, W.K. Brooks, K. Hafidi

    2011-05-01

    The 12-GeV Upgrade at Jefferson Lab will create an opportunity to dramatically extend our knowledge of the magnetic form factor of the neutron G^n_M and the other elastic, electromagnetic form factors. We describe here an approved experiment that will cover a Q2 range (3.5 – 14 GeV2) with significant discovery potential. Different theoretical approaches (generalized parton distributions, Dyson-Schwinger equations, etc) diverge is this region and existing data cannot distinguish among them. The proposed measurement will be performed in Hall B with the CLAS12 detector and will have statistical and systematic uncertainties below 3%. It is based on the ratio of electron-neutron to electron-proton scattering that was successfully applied in the CLAS detector at Jefferson Lab.

  1. Measurement of the generalized form factors near threshold via γ*p → nπ+ at high Q2

    DOE PAGESBeta

    Park, K.; Adhikari, K. P.; Adikaram, D.; Anghinolfi, M.; Baghdasaryan, H.; Ball, J.; Battaglieri, M.; Batourine, V.; Bedlinskiy, I.; Bennett, R. P.; et al

    2012-03-26

    We report the first extraction of the pion-nucleon multipoles near the production threshold for the nπ+ channel at relatively high momentum transfer (Q2 up to 4.2 GeV2). The dominance of the s-wave transverse multipole (E0+), expected in this region, allowed us to access the generalized form factor G1 within the light-cone sum rule (LCSR) framework as well as the axial form factor GA. The data analyzed in this work were collected by the nearly 4π CEBAF Large Acceptance Spectrometer (CLAS) using a 5.754-GeV electron beam on a proton target. The differential cross section and the π-N multipole E0+/GD were measuredmore » using two different methods, the LCSR and a direct multipole fit. The results from the two methods are found to be consistent and almost Q2 independent.« less

  2. Nucleon form factors and hidden symmetry in holographic QCD

    SciTech Connect

    Hong, Deog Ki; Rho, Mannque; Yee, Ho-Ung; Yi, Piljin

    2008-01-01

    The vector dominance of the electromagnetic form factors both for mesons and baryons arises naturally in holographic QCD, where both the number of colors and the 't Hooft coupling are taken to be very large, offering a bona-fide derivation of the notion of vector dominance. The crucial ingredient for this is the infinite tower of vector mesons in the approximations made which share features that are characteristic of the quenched approximation in lattice QCD. We approximate the infinite sum by contributions from the lowest four vector mesons of the tower which turn out to saturate the charge and magnetic moment sum rules within a few percent and compute them totally free of unknown parameters for momentum transfers Q{sup 2} < or approx. 1 GeV{sup 2}. We identify certain observables that can be reliably computed within the approximations and others that are not, and discuss how the improvement of the latter can enable one to bring holographic QCD closer to QCD proper.

  3. Measurement of the magnetic form factor of the neutron

    SciTech Connect

    Baldwin, Alan; Ni, Benwen; Anderson, Brian; Flanders, Bruce; Chang, C.; Chang, C.C.; Hyde, Charles; Manley, D.; Tieger, Daniel; Barkhuff, David; Keane, Declan; Dodson, George; Arenhovel, Hartmuth; Kelly, James; Mougey, Jean; Cameron, John; Dow, Karen; Beard, Kevin; Weinstein, Lawrence; Farkhondeh, Manouchehr; Spraker, Mark; Finn, Michael; Rutt, Paul; Ulmer, Paul; Markowitz, Pete; Pella, Peter; Whitney, R.; Madey, Richard; Lourie, Robert; Van Verst, Scott; Kowalski, Stanley; Eden, Thomas; Payerle, Thomas; Reichelt, Tilmann; Jiang, W.; Zhang, Wei-Ming; Bertozzi, William; Turchinetz, William; Watson, William; Korsch, Wolfgang

    1992-01-01

    The 2H(e,e'n)1H quasielastic cross section was measured at Q2 values of 0.109, 0.176, and 0.255 (GeV/c)2. The neutron detection efficiency was determined by the associated particle technique with the 2H( gamma ,pn) reaction for each of the three neutron kinetic energies. These 2H(e,e'n) measurements of the coincidence cross sections are the first at low Q2. The cross sections are sensitive primarily to the neutron magnetic form factor GnM at these kinematics. The extracted GnM values have smaller uncertainties than previous data and are consistent with the dipole parametrization at the two higher momentum transfers; at the lowest momentum transfer, the value of GnM is ~10% higher than t

  4. Reversible inhibition of proton release activity and the anesthetic-induced acid-base equilibrium between the 480 and 570 nm forms of bacteriorhodopsin.

    PubMed Central

    Boucher, F; Taneva, S G; Elouatik, S; Déry, M; Messaoudi, S; Harvey-Girard, E; Beaudoin, N

    1996-01-01

    In purple membrane added with general anesthetics, there exists an acid-base equilibrium between two spectral forms of the pigment: bR570 and bR480 (apparent pKa = 7.3). As the purple 570 nm bacteriorhodopsin is reversibly transformed into its red 480 nm form, the proton pumping capability of the pigment reversibly decreases, as indicated by transient proton release measurements and proton translocation action spectra of mixture of both spectral forms. It happens in spite of a complete photochemical activity in bR480 that is mostly characterized by fast deprotonation and slow reprotonation steps and which, under continuous illumination, bleaches with a yield comparable to that of bR570. This modified photochemical activity has a correlated specific photoelectrical counterpart: a faster proton extrusion current and a slower reprotonation current. The relative areas of all photocurrent phases are reduced in bR480, most likely because its photochemistry is accompanied by charge movements for shorter distances than in the native pigment, reflecting a reversible inhibition of the pumping activity. PMID:8789112

  5. Energy transport mechanism in the form of proton soliton in a one-dimensional hydrogen-bonded polypeptide chain.

    PubMed

    Kavitha, L; Priya, R; Ayyappan, N; Gopi, D; Jayanthi, S

    2016-01-01

    The dynamics of protons in a one-dimensional hydrogen-bonded (HB) polypeptide chain (PC) is investigated theoretically. A new Hamiltonian is formulated with the inclusion of higher-order molecular interactions between peptide groups (PGs). The wave function of the excitation state of a single particle is replaced by a new wave function of a two-quanta quasi-coherent state. The dynamics is governed by a higher-order nonlinear Schrödinger equation and the energy transport is performed by the proton soliton. A nonlinear multiple-scale perturbation analysis has been performed and the evolution of soliton parameters such as velocity and amplitude is explored numerically. The proton soliton is thermally stable and very robust against these perturbations. The energy transport by the proton soliton is more appropriate to understand the mechanism of energy transfer in biological processes such as muscle contraction, DNA replication, and neuro-electric pulse transfer on biomembranes.

  6. Nucleon Form Factors above 6 GeV

    DOE R&D Accomplishments Database

    Taylor, R. E.

    1967-09-01

    This report describes the results from a preliminary analysis of an elastic electron-proton scattering experiment... . We have measured cross sections for e-p scattering in the range of q{sup 2} from 0.7 to 25.0 (GeV/c){sup 2}, providing a large region of overlap with previous measurements. In this experiment we measure the cross section by observing electrons scattered from a beam passing through a liquid hydrogen target. The scattered particles are momentum analyzed by a magnetic spectrometer and identified as electrons in a total absorption shower counter. Data have been obtained with primary electron energies from 4.0 to 17.9 GeV and at scattering angles from 12.5 to 35.0 degrees. In general, only one measurement of a cross section has been made at each momentum transfer.

  7. Weak charge form factor and radius of 208Pb through parity violation in electron scattering

    DOE PAGESBeta

    Horowitz, C. J.; Ahmed, Z.; Jen, C. -M.; Rakhman, A.; Souder, P. A.; Dalton, M. M.; Liyanage, N.; Paschke, K. D.; Saenboonruang, K.; Silwal, R.; et al

    2012-03-26

    We use distorted wave electron scattering calculations to extract the weak charge form factor FW(more » $$\\bar{q}$$), the weak charge radius RW, and the point neutron radius Rn, of 208Pb from the PREX parity violating asymmetry measurement. The form factor is the Fourier transform of the weak charge density at the average momentum transfer $$\\bar{q}$$ = 0.475 fm-1. We find FW($$\\bar{q}$$) = 0.204 ± 0.028(exp) ± 0.001(model). We use the Helm model to infer the weak radius from FW($$\\bar{q}$$). We find RW = 5.826 ± 0.181(exp) ± 0.027(model) fm. Here the exp error includes PREX statistical and systematic errors, while the model error describes the uncertainty in RW from uncertainties in the surface thickness σ of the weak charge density. The weak radius is larger than the charge radius, implying a 'weak charge skin' where the surface region is relatively enriched in weak charges compared to (electromagnetic) charges. We extract the point neutron radius Rn = 5.751 ± 0.175 (exp) ± 0.026(model) ± 0.005(strange) fm, from RW. Here there is only a very small error (strange) from possible strange quark contributions. We find Rn to be slightly smaller than RW because of the nucleon's size. As a result, we find a neutron skin thickness of Rn-Rp = 0.302 ± 0.175 (exp) ± 0.026 (model) ± 0.005 (strange) fm, where Rp is the point proton radius.« less

  8. Assignment of selected hyperfine proton NMR resonances in the met forms of Glycera dibranchiata monomer hemoglobins and comparisons with sperm whale metmyoglobin

    SciTech Connect

    Constantinidis, I.; Satterlee, J.D.; Pandey, R.K.; Leung, H.K.; Smith, K.M.

    1988-04-19

    This work indicates a high degree of purity for our preparations of all three of the primary Glycera dibranchiata monomer hemoglobins and details assignments of the heme methyl and vinyl protons in the hyperfine shift region of the ferric (aquo.) protein forms. The assignments were carried out by reconstituting the apoproteins of each component with selectively deuteriated hemes. The results indicate that even though the individual component preparations consist of essentially a single protein, the proton NMR spectra indicate spectroscopic heterogeneity. Evidence is presented for identification and classification of major and minor protein forms that are present in solutions of each component. Finally, in contrast to previous results, a detailed analysis of the proton hyperfine shift patterns of the major and minor forms of each component, in comparison to the major and minor forms of metmyoglobin, leads to the conclusions that the corresponding forms of the proteins from each species have strikingly similar heme-globin contacts and display nearly identical heme electronic structures and coordination numbers.

  9. A human factors approach to waste form design

    SciTech Connect

    Rodriguez, M.A.

    1994-04-01

    The current study consist of two experiments and an example of a revised waste form to demonstrate the necessity of careful form design and provide guidance in obtaining accurate information through written solicitation of any kind. In Experiment 1, two differently designed forms were used to solicit the same list of specific information. The data suggest that the more clearly designed form significantly produced more of the specific information required than the form that just listed the questions. Experiment 2, which is to be conducted during the spring semester 1994, is designed to address three specific aspects of form design. The results of this Experiment 2 will be interpreted and presented at the 1994 International High-Level Radioactive Waste Management Conference, May 22--26. Guidelines and examples of form design are given.

  10. Factors governing the protonation state of Zn-bound histidine in proteins: a DFT/CDM study.

    PubMed

    Lin, Yen-lin; Lim, Carmay

    2004-03-01

    We have performed systematic theoretical studies to elucidate the factors governing the His protonation/deprotonation state in Zn-binding sites, especially those containing the ubiquitous Zn-His-Asp/Glu triad. Specifically, we have addressed the following three questions: (1) How does the transfer of the Zn-bound His imidazole proton to the second-shell Asp/Glu carboxylate oxygen depend on the composition of the other first-shell ligands and the solvent accessibility of the metal-binding site? (2) Can any second-shell ligand with a proton acceptor group such as the backbone carbonyl oxygen also act as a proton acceptor? (3) What is the effect of the Asp/Glu in the Zn-His-Asp/Glu triad on the Zn-bound water protonation state? To address these questions, we used a combination of quantum mechanical and continuum dielectric methods to compute the free energies for deprotonating a Zn-bound imidazole/water in various Zn complexes. The calculations show that whether the Zn-bound His is protonated or deprotonated depends on (1) the solvent accessibility of the metal-binding site, and (2) the Lewis acid ability of Zn, which is indirectly determined by both the first- and the second-shell Zn ligands. The calculations also show that the effect of the Zn-His-Asp/Glu interaction on the nucleophilicity of the Zn-bound water depends on the solvent accessibility of the catalytic Zn site. Furthermore, they show that the Asp/Glu side chain in the Zn-His-Asp/Glu triad can increase the negative charge of its partner, His, and create an anionic hole that may stabilize a cation in buried cavities, provided that the Zn complex is cationic/neutral. The findings of this work are in accord with available experimental data.

  11. Proton Transport

    NASA Technical Reports Server (NTRS)

    Pohorille, Andrew; DeVincenzi, Donald L. (Technical Monitor)

    2001-01-01

    The transport of protons across membranes is an essential process for both bioenergetics of modern cells and the origins of cellular life. All living systems make use of proton gradients across cell walls to convert environmental energy into a high-energy chemical compound, adenosine triphosphate (ATP), synthesized from adenosine diphosphate. ATP, in turn, is used as a source of energy to drive many cellular reactions. The ubiquity of this process in biology suggests that even the earliest cellular systems were relying on proton gradient for harvesting environmental energy needed to support their survival and growth. In contemporary cells, proton transfer is assisted by large, complex proteins embedded in membranes. The issue addressed in this Study was: how the same process can be accomplished with the aid of similar but much simpler molecules that could have existed in the protobiological milieu? The model system used in the study contained a bilayer membrane made of phospholipid, dimyristoylphosphatidylcholine (DMPC) which is a good model of the biological membranes forming cellular boundaries. Both sides of the bilayer were surrounded by water which simulated the environment inside and outside the cell. Embedded in the membrane was a fragment of the Influenza-A M$_2$ protein and enough sodium counterions to maintain system neutrality. This protein has been shown to exhibit remarkably high rates of proton transport and, therefore, is an excellent model to study the formation of proton gradients across membranes. The Influenza M$_2$ protein is 97 amino acids in length, but a fragment 25 amino acids long. which contains a transmembrane domain of 19 amino acids flanked by three amino acids on each side. is sufficient to transport protons. Four identical protein fragments, each folded into a helix, aggregate to form small channels spanning the membrane. Protons are conducted through a narrow pore in the middle of the channel in response to applied voltage. This

  12. Next-to-leading-order correction to pion form factor in k{sub T} factorization

    SciTech Connect

    Li Hsiangnan; Shen Yuelong; Wang Yuming; Zou Hao

    2011-03-01

    We calculate the next-to-leading-order (NLO) correction to the pion electromagnetic form factor at leading twist in the k{sub T} factorization theorem. Partons off-shell by k{sub T}{sup 2} are considered in both quark diagrams and effective diagrams for the transverse-momentum-dependent pion wave function. The light-cone singularities in the transverse-momentum-dependent pion wave function are regularized by rotating the Wilson lines away from the light cone. The soft divergences from gluon exchanges among initial- and fal-state partons cancel exactly. We derive the infrared-finite k{sub T}-dependent NLO hard kernel for the pion electromagnetic form factor by taking the difference of the above two sets of diagrams. Varying the renormalization and factorization scales, we find that the NLO correction is smaller, when both the scales are set to the invariant masses of internal particles: it becomes lower than 40% of the leading-order contribution for momentum transfer squared Q{sup 2}>7 GeV{sup 2}. It is observed that the NLO leading-twist correction does not play an essential role in explaining the experimental data, but the leading-order higher-twist contribution does.

  13. Overview of nucleon form factor experiments with 12 GeV at Jefferson Lab

    NASA Astrophysics Data System (ADS)

    Cisbani, Evaristo

    2014-06-01

    Since the R. Hofstadter pioneering experiments in the '50s, the measurements of the electromagnetic space-like nucleon form factors (FF's) have been a precious source of information for the understanding of the internal structure of the nucleons. In the last 15 years, the polarization transfer experiments at the Thomas Jefferson National Accelerator Facility (JLab) have undermined our view of the mechanism of the electron scattering and renewed critical interest in the FF measurements. In the coming years, JLab, with its upgraded 12 GeV polarized, high intensity, electron beam combined to new targets and readout equipments, will offer unprecedented opportunities to extend the current proton and neutron FF's measurements to higher momentum transfer Q2 and to improve statistical and uncertainties at lower Q2, where the nucleon size can be accurately investigated. The measurements at high Q2 will provide also new insights on the elusive quark orbital angular momenta, will contribute to constraint two of the nucleon Generalized Parton Distributions that are expected to describe more consistently the nucleon structure, and in general will test the validity of quite a few fundamental nucleon models in a region of transition between perturbative and non perturbative regimes. A selection of the relevant properties of the FF's, and the main results of JLab are shortly reviewed; the new proposed and approved experiments on FF's at JLab are presented addressing some key details, the expected experimental achievements and the new equipment designed for them.

  14. Ir-Uv Double Resonance Spectroscopy of a Cold Protonated Fibril-Forming Peptide: NNQQNY\\cdotH+

    NASA Astrophysics Data System (ADS)

    DeBlase, Andrew F.; Harrilal, Christopher P.; Walsh, Patrick S.; McLuckey, Scott A.; Zwier, Timothy S.

    2016-06-01

    Protein aggregation to form amyloid-like fibrils is a purported molecular manifestation that leads to Alzheimer's, Huntington's, and other neurodegenerative diseases. The propensity for a protein to aggregate is often driven by the presence of glutamine (Q) and asparagine (N) rich tracts within the primary sequence. For example, Eisenberg and coworkers [Nature 2006, 435, 773] have shown by X-ray crystallography that the peptides NNQQNY and GNNQQNY aggregate into a parallel β-sheet configuration with side chains that intercalate into a "steric zipper". These sequences are commonly found at the N-terminus of the prion-determining domain in the yeast protein Sup35, a typical fibril-forming protein. Herein, we invoke recent advances in cold ion spectroscopy to explore the nascent conformational preferences of the protonated peptides that are generated by electrospray ionization. Towards this aim, we have used UV and IR spectroscopy to record conformation-specific photofragment action spectra of the NNQQNY monomer cryogenically cooled in an octopole ion trap. This short peptide contains 20 hydride stretch oscillators, leading to a rich infrared spectrum with at least 18 resolved transitions in the 2800-3800 cm-1 region. The infrared spectrum suggests the presence of both a free acid OH moiety and an H-bonded tyrosine OH group. We compare our results with resonant ion dip infrared spectra (RIDIRS) of the acyl/NH-benzyl capped neutral glutamine amino acid and its corresponding dipeptide: Ac-Q-NHBn and Ac-QQ-NHBn, respectively. These comparisons bring empirical insight to the NH stretching region of the spectrum, which contains contributions from free and singly H-bonded NH2 side-chain groups, and from peptide backbone amide NH groups. We further compare our spectrum to harmonic calculations at the M05-2X/6-31+G* level of theory, which were performed on low energy structures obtained from Monte Carlo conformational searches using the Amber* and OPLS force fields to assess

  15. Mechanisms for Two-Step Proton Transfer Reactions in the Outward-Facing Form of MATE Transporter.

    PubMed

    Nishima, Wataru; Mizukami, Wataru; Tanaka, Yoshiki; Ishitani, Ryuichiro; Nureki, Osamu; Sugita, Yuji

    2016-03-29

    Bacterial pathogens or cancer cells can acquire multidrug resistance, which causes serious clinical problems. In cells with multidrug resistance, various drugs or antibiotics are extruded across the cell membrane by multidrug transporters. The multidrug and toxic compound extrusion (MATE) transporter is one of the five families of multidrug transporters. MATE from Pyrococcus furiosus uses H(+) to transport a substrate from the cytoplasm to the outside of a cell. Crystal structures of MATE from P. furiosus provide essential information on the relevant H(+)-binding sites (D41 and D184). Hybrid quantum mechanical/molecular mechanical simulations and continuum electrostatic calculations on the crystal structures predict that D41 is protonated in one structure (Straight) and, both D41 and D184 protonated in another (Bent). All-atom molecular dynamics simulations suggest a dynamic equilibrium between the protonation states of the two aspartic acids and that the protonation state affects hydration in the substrate binding cavity and lipid intrusion in the cleft between the N- and C-lobes. This hypothesis is examined in more detail by quantum mechanical/molecular mechanical calculations on snapshots taken from the molecular dynamics trajectories. We find the possibility of two proton transfer (PT) reactions in Straight: the 1st PT takes place between side-chains D41 and D184 through a transient formation of low-barrier hydrogen bonds and the 2nd through another H(+) from the headgroup of a lipid that intrudes into the cleft resulting in a doubly protonated (both D41 and D184) state. The 1st PT affects the local hydrogen bond network and hydration in the N-lobe cavity, which would impinge on the substrate-binding affinity. The 2nd PT would drive the conformational change from Straight to Bent. This model may be applicable to several prokaryotic H(+)-coupled MATE multidrug transporters with the relevant aspartic acids. PMID:27028644

  16. Factors for converting dose measured in polystyrene phantoms to dose reported in water phantoms for incident proton beams

    SciTech Connect

    Moyers, M. F.; Vatnitsky, A. S.; Vatnitsky, S. M.

    2011-10-15

    Purpose: Previous dosimetry protocols allowed calibrations of proton beamline dose monitors to be performed in plastic phantoms. Nevertheless, dose determinations were referenced to absorbed dose-to-muscle or absorbed dose-to-water. The IAEA Code of Practice TRS 398 recommended that dose calibrations be performed with ionization chambers only in water phantoms because plastic-to-water dose conversion factors were not available with sufficient accuracy at the time of its writing. These factors are necessary, however, to evaluate the difference in doses delivered to patients if switching from calibration in plastic to a protocol that only allows calibration in water. Methods: This work measured polystyrene-to-water dose conversion factors for this purpose. Uncertainties in the results due to temperature, geometry, and chamber effects were minimized by using special experimental set-up procedures. The measurements were validated by Monte Carlo simulations. Results: At the peak of non-range-modulated beams, measured polystyrene-to-water factors ranged from 1.015 to 1.024 for beams with ranges from 36 to 315 mm. For beams with the same ranges and medium sized modulations, the factors ranged from 1.005 to 1.019. The measured results were used to generate tables of polystyrene-to-water dose conversion factors. Conclusions: The dose conversion factors can be used at clinical proton facilities to support beamline and patient specific dose per monitor unit calibrations performed in polystyrene phantoms.

  17. Iso-vector form factors of the delta and nucleon in QCD sum rules

    SciTech Connect

    Ozpineci, A.

    2012-10-23

    Form factors are important non-perturbative properties of hadrons. They give information about the internal structure of the hadrons. In this work, iso-vector axial-vector and iso-vector tensor form factors of the nucleon and the iso-vector axial-vector {Delta}{yields}N transition form factor calculations in QCD Sum Rules are presented.

  18. Semi-analytical model for output factor calculations in proton beam therapy with consideration for the collimator aperture edge

    NASA Astrophysics Data System (ADS)

    Kase, Yuki; Yamashita, Haruo; Sakama, Makoto; Mizota, Manabu; Maeda, Yoshikazu; Tameshige, Yuji; Murayama, Shigeyuki

    2015-08-01

    In the development of an external radiotherapy treatment planning system, the output factor (OPF) is an important value for the monitor unit calculations. We developed a proton OPF calculation model with consideration for the collimator aperture edge to account for the dependence of the OPF on the collimator aperture and distance in proton beam therapy. Five parameters in the model were obtained by fitting with OPFs measured by a pinpoint chamber with the circular radiation fields of various field radii and collimator distances. The OPF model calculation using the fitted model parameters could explain the measurement results to within 1.6% error in typical proton treatment beams with 6- and 12 cm SOBP widths through a range shifter and a circular aperture more than 10.6 mm in radius. The calibration depth dependences of the model parameters were approximated by linear or quadratic functions. The semi-analytical OPF model calculation was tested with various MLC aperture shapes that included circles of various sizes as well as a rectangle, parallelogram, and L-shape for an intermediate proton treatment beam condition. The pre-calculated OPFs agreed well with the measured values, to within 2.7% error up to 620 mm in the collimator distance, though the maximum difference was 5.1% in the case of the largest collimator distance of 740 mm. The OPF calculation model would allow more accurate monitor unit calculations for therapeutic proton beams within the expected range of collimator conditions in clinical use.

  19. Monte Carlo calculation of beam quality correction factors in proton beams using detailed simulation of ionization chambers

    NASA Astrophysics Data System (ADS)

    Gomà, Carles; Andreo, Pedro; Sempau, Josep

    2016-03-01

    This work calculates beam quality correction factors (k Q ) in monoenergetic proton beams using detailed Monte Carlo simulation of ionization chambers. It uses the Monte Carlo code penh and the electronic stopping powers resulting from the adoption of two different sets of mean excitation energy values for water and graphite: (i) the currently ICRU 37 and ICRU 49 recommended {{I}\\text{w}}=75~\\text{eV} and {{I}\\text{g}}=78~\\text{eV} and (ii) the recently proposed {{I}\\text{w}}=78~\\text{eV} and {{I}\\text{g}}=81.1~\\text{eV} . Twelve different ionization chambers were studied. The k Q factors calculated using the two different sets of I-values were found to agree with each other within 1.6% or better. k Q factors calculated using current ICRU I-values were found to agree within 2.3% or better with the k Q factors tabulated in IAEA TRS-398, and within 1% or better with experimental values published in the literature. k Q factors calculated using the new I-values were also found to agree within 1.1% or better with the experimental values. This work concludes that perturbation correction factors in proton beams—currently assumed to be equal to unity—are in fact significantly different from unity for some of the ionization chambers studied.

  20. Measurement of the isovector axial form factor at Q2 = 0.23 (GeV/c)2

    NASA Astrophysics Data System (ADS)

    Ríos, D. Balaguer; Baunack, S.; Glaser, B.; Maas, F.; Imai, Y.

    2013-11-01

    We present the preliminary value of the measurement of the parity violating asymmetry in the cross section of quasi-elastic scattering of longitudinally polarized electrons on deuteron at backward angles at Q2 = 0.23. The preliminary asymmetry is APVd(Q2 = 0.23) = (-20.77±0.84stat±1.23syst)˙10-6. From this value a preliminary linear combination of the GMs and the isovector axial form factor ˜GA can be extracted ˜GAT = 1+0.59˙GMs = -0.53±0.37±0.02. Combining this preliminary linear combination with that extracted from the measurement of the parity violating asymmetry on proton, already publish, it is possible to disentagle the form factors and thus we can obtain a preliminary experimental determination of the isovector axial form factor ˜GAT = 1 = -0.43±0.46.

  1. Alternative way to understand the unexpected results of the JLab polarization experiments to measure the Sachs form factors ratio

    NASA Astrophysics Data System (ADS)

    Galynskii, M. V.; Kuraev, E. A.

    2014-03-01

    In the one-photon exchange approximation we discuss questions related to the interpretation of unexpected results of the JLab polarization experiments to measure the Sachs form factors ratio GE/GM in the region 1.0≤Q2≤8.5 GeV2. For this purpose, we developed an approach which essentially is a generalization of the constituent-counting rules of the perturbative QCD (pQCD) for the case of massive quarks. We assume that at the lower boundary of the considered region the hard-scattering mechanism of pQCD is realized. Within the framework of the developed approach we calculated the hard kernel of the proton current matrix elements Jp±δ ,δ for the full set of spin combinations corresponding to the number of the spin-flipped quarks, which contribute to the proton transition without spin-flip (Jpδ ,δ) and with spin-flip (Jp-δ,δ). This allows us to state that (i) around the lower boundary of the considered region, the leading scaling behavior of the Sachs form factors has the form GE,GM˜1/Q6, (ii) the dipole dependence (GE,GM˜1/Q4) is realized in the asymptotic regime of pQCD when τ ≫1 (τ =Q2/4M2) in the case when the quark transitions with spin-flip dominate, (iii) the asymptotic regime of pQCD in the JLab experiments has not yet been achieved, and (iv) the linear decrease of the ratio GE/GM at τ <1 is due to additional contributions to Jpδ ,δ by spin-flip transitions of two quarks and an additional contribution to Jp-δ,δ by spin-flip transitions of three quarks.

  2. Synthesis and characterization of a new four-layer Aurivillius phase Bi 2SrNa 2Nb 4O 15 and its protonated form

    NASA Astrophysics Data System (ADS)

    Liang, Zhenhua; Tang, Kaibin; Zeng, Suyuan; Wang, Dong; Li, Tanwei; Zheng, Huagui

    2008-10-01

    A new four-layer Aurivillius phase Bi 2SrNa 2Nb 4O 15 has been synthesized by solid-state reaction of Bi 2SrNb 2O 9 and NaNbO 3 at 1100 °C. The detailed structure determination of Bi 2SrNa 2Nb 4O 15 performed by powder X-ray diffraction (XRD) shows that it crystallizes in the space group I4/ mmm [ a˜3.9021(1) Å, c˜40.7554(10) Å]. Protonated form of Bi 2SrNa 2Nb 4O 15 was obtained by the substitution of bismuth oxide sheets with protons via acid treatment. The conversion into the protonated forms was achieved easily using 6 M HCl at room temperature. Preservation of the structure of the perovskite-like slabs and contraction in the c-axis were confirmed by X-ray analysis. The compositions of the resulting products were determined to be H 1.8[Sr 0.8Bi 0.2Na 2Nb 4O 13] by X-ray fluorescence spectroscopy (XFS) and thermogravimetry.

  3. Factors influencing the accuracy of beam range estimation in proton therapy using prompt gamma emission

    NASA Astrophysics Data System (ADS)

    Janssen, FMFC; Landry, G.; Cambraia Lopes, P.; Dedes, G.; Smeets, J.; Schaart, D. R.; Parodi, K.; Verhaegen, F.

    2014-08-01

    In-vivo imaging is a strategy to monitor the range of protons inside the patient during radiation treatment. A possible method of in-vivo imaging is detection of secondary ‘prompt’ gamma (PG) photons outside the body, which are produced by inelastic proton-nuclear interactions inside the patient. In this paper, important parameters influencing the relationship between the PG profile and percentage depth dose (PDD) in a uniform cylindrical phantom are explored. Monte Carlo simulations are performed with the new Geant4 based code TOPAS for mono-energetic proton pencil beams (range: 100-250 MeV) and an idealized PG detector. PG depth profiles are evaluated using the inflection point on a sigmoid fit in the fall-off region of the profile. A strong correlation between the inflection point and the proton range determined from the PDD is found for all conditions. Variations between 1.5 mm and 2.7 mm in the distance between the proton range and the inflection point are found when either the mass density, phantom diameter, or detector acceptance angle is changed. A change in cut-off energy of the detector could induce a range difference of maximum 4 mm. Applying time-of-flight discrimination during detection, changing the primary energy of the beam or changing the elemental composition of the tissue affects the accuracy of the range prediction by less than 1 mm. The results indicate that the PG signal is rather robust to many parameter variations, but millimetre accurate range monitoring requires all medium and detector properties to be carefully taken into account.

  4. On the formation of proton-shared and contact ion pair forms during the dissociation of moderately strong acids: an Ab initio molecular dynamics investigation.

    PubMed

    Thomas, Vibin; Maurer, Patrick; Iftimie, Radu

    2010-06-24

    Acid ionization and dissociation are phenomena that play a fundamental role in chemistry and biology, but their microscopic details are largely unknown. We use ab initio molecular dynamics to identify and characterize various structures that are formed along the pathway of dissociation of trifluoroacetic acid (pK(a) = 0.5). The present results demonstrate that solutions of moderately strong (-1 forms whose bonding patterns are intermediate between those of covalent and dissociated structures, R-COOH...OH(2) and R-COO(-)(aq) + H(3)O(+)(aq), respectively. The first is a proton-shared structure of the form R-COO(delta-).H.(delta+)OH(2) which can be distinguished from the covalent form by its characteristic "continuous" absorption below 1700 cm(-1). The second is a contact ion pair whose average structure can be written as R-COO(-).H(3)O(+). We demonstrate that the transformation of proton-shared into contact ion pair forms coincides with the disappearance of the carbonyl vibration mode centered around 1720 cm(-1) and the appearance of the asymmetric and symmetric carboxylate [Formula: see text] vibration modes at 1620 and 1380 cm(-1), respectively. The aforementioned transformation is accompanied by significant changes in the first solvation shell of the acid molecule which we discuss.

  5. Chiral perturbation theory and off-shell electromagnetic form factors

    SciTech Connect

    Rudy, T.E.; Fearing, H.W.; Scherer, S.

    1995-05-10

    The off-shell electromagnetic vertex of pions and kaons is calculated to {ital O}({ital p}{sup 4}) in the momentum expansion within the framework of chiral perturbation theory to one loop. The formalism of Gasser and Leutwyler is extended to accommodate the most general form for off-shell Green`s functions in the pseudoscalar meson sector. To that end we identify the structures at {ital O}({ital p}{sup 4}) which were initially removed by using the equation of motion of the lowest-order lagrangian. {copyright} {ital 1995} {ital American} {ital Institute} {ital of} {ital Physics}.

  6. SU-E-T-491: Importance of Energy Dependent Protons Per MU Calibration Factors in IMPT Dose Calculations Using Monte Carlo Technique

    SciTech Connect

    Randeniya, S; Mirkovic, D; Titt, U; Guan, F; Mohan, R

    2014-06-01

    Purpose: In intensity modulated proton therapy (IMPT), energy dependent, protons per monitor unit (MU) calibration factors are important parameters that determine absolute dose values from energy deposition data obtained from Monte Carlo (MC) simulations. Purpose of this study was to assess the sensitivity of MC-computed absolute dose distributions to the protons/MU calibration factors in IMPT. Methods: A “verification plan” (i.e., treatment beams applied individually to water phantom) of a head and neck patient plan was calculated using MC technique. The patient plan had three beams; one posterior-anterior (PA); two anterior oblique. Dose prescription was 66 Gy in 30 fractions. Of the total MUs, 58% was delivered in PA beam, 25% and 17% in other two. Energy deposition data obtained from the MC simulation were converted to Gy using energy dependent protons/MU calibrations factors obtained from two methods. First method is based on experimental measurements and MC simulations. Second is based on hand calculations, based on how many ion pairs were produced per proton in the dose monitor and how many ion pairs is equal to 1 MU (vendor recommended method). Dose distributions obtained from method one was compared with those from method two. Results: Average difference of 8% in protons/MU calibration factors between method one and two converted into 27 % difference in absolute dose values for PA beam; although dose distributions preserved the shape of 3D dose distribution qualitatively, they were different quantitatively. For two oblique beams, significant difference in absolute dose was not observed. Conclusion: Results demonstrate that protons/MU calibration factors can have a significant impact on absolute dose values in IMPT depending on the fraction of MUs delivered. When number of MUs increases the effect due to the calibration factors amplify. In determining protons/MU calibration factors, experimental method should be preferred in MC dose calculations

  7. Spontaneous electromagnetic fluctuations in unmagnetized plasmas. V. Relativistic form factors of weakly damped/amplified thermal modes

    SciTech Connect

    Felten, T.; Schlickeiser, R.

    2013-08-15

    Closed analytical expressions for the spontaneously emitted fluctuation spectra of weakly damped/amplified fluctuations in unmagnetized plasmas are derived using fully relativistic dispersion functions and form factors for the important class of isotropic thermal plasmas. Especially, an electron-proton plasma is investigated in the limits of nonrelativistic and ultrarelativistic plasma temperatures. The results confirm the earlier nonrelativistic approach for positive values of the imaginary frequency γ and complete the nonrelativistic treatment for negative values of γ<0. The well known electrostatic, collective Langmuir mode also occurs within the relativistic theory of spontaneously emitted fluctuations and is analytically and graphically identified. For the first time, the ultrarelativistic temperature limit is analyzed for subluminal phase speeds, which leads to the identification of an additional, so far unknown, longitudinal subluminal collective mode.

  8. Spontaneous electromagnetic fluctuations in unmagnetized plasmas. V. Relativistic form factors of weakly damped/amplified thermal modes

    NASA Astrophysics Data System (ADS)

    Felten, T.; Schlickeiser, R.

    2013-08-01

    Closed analytical expressions for the spontaneously emitted fluctuation spectra of weakly damped/amplified fluctuations in unmagnetized plasmas are derived using fully relativistic dispersion functions and form factors for the important class of isotropic thermal plasmas. Especially, an electron-proton plasma is investigated in the limits of nonrelativistic and ultrarelativistic plasma temperatures. The results confirm the earlier nonrelativistic approach for positive values of the imaginary frequency γ and complete the nonrelativistic treatment for negative values of γ <0. The well known electrostatic, collective Langmuir mode also occurs within the relativistic theory of spontaneously emitted fluctuations and is analytically and graphically identified. For the first time, the ultrarelativistic temperature limit is analyzed for subluminal phase speeds, which leads to the identification of an additional, so far unknown, longitudinal subluminal collective mode.

  9. Simultaneous Precipitation of Solar Protons and Relativistic Electrons as a New Factor Affecting the Earth's Atmosphere

    NASA Astrophysics Data System (ADS)

    Shirochkov, A. V.; Sokolov, S. N.

    In the field of solar - terrestrial physics during the last decade there has been renewed interest in the effects produced in the Earth atmosphere and ionosphere by fluxes of precipitated highly relativistic electrons. A series of investigation on the subject (preferably by means of satellite measurements) was performed recently, which discussed different aspects of these phenomena called HRE events. More careful study of the HRE events revealed previously unnoticed geophysical phenomenon: a great majority of the solar proton events (SPE) were accompanied by simultaneous precipitation of relativistic electron fluxes. The studies of previous SPE events attributed their atmospheric and ionospheric effects entirely to the solar proton fluxes. It turned out that such an assumption is wrong. Therefore we have actually a new class of geophysical phenomena when the Earth's atmosphere and ionosphere experience combined impact of simultaneously precipitating fluxes of solar protons and relativistic electrons. If one takes into accounts effect of enhanced density of the solar wind during the SPEs (i.e. its dynamic pressure) the real situation during these combined events became more complicated. In this paper the effects during the storm of May 1992 are analyzed as an example of such unusual combination. The methods of separation of the effects produced by different precipitation particles are presented. Other similar events are considered to demonstrate that such complex events are not unique geophysical phenomena.

  10. Factors governing substrate-induced generation and extrusion of protons in the yeast Saccharomyces cerevisiae.

    PubMed

    Sigler, K; Knotková, A; Kotyk, A

    1981-05-20

    Experiments with respiration deficient (rho-), ADP/ATP transport deficient (op1) and double (op1 rho-) mutants, with glycolytic and tricarboxylic acid cycle substrates showed that the substrate-induced acidification of yeast suspensions is closely associated with glycolysis. The glucose/proton stoichiometry is 2.5 : 1 to 4 : 1 depending on glucose concentration. The kinetics of the process are complex, the acidification curve having a very fast initial component and two slower exponential components. The first component suggests an initial proton efflux from endogenous sources, triggered by exogenous substrates. The acidification process exhibits two Km values at about 1 and 15 mM D-glucose, indicating two distinct saturable pathways of proton extrusion. The total extent of acidification and thus the final pHout reaches a saturation value with increasing glucose concentration and suspension density. Both the total extent and the rate of acidification are subject to control by extracellular pH which reflects the tendency of the cells to build a fixed [H+]out/[H+]in ratio. When the control is lifted, both quantities are considerably increased. A crucial role in the substrate-induced acidification is thus played by active membrane processes and their control mechanisms.

  11. Resource Form Factor and Installation of GFA Controllers

    SciTech Connect

    DeSteese, John G.; Hammerstrom, Donald J.

    2009-11-15

    The focus of this task is to optimize the form and placement of a controller comprising the Grid Friendly™ appliance (GFA) controller, power supply and power relay (and/or a solid-state power electronic switch) that would command a domestic water heater to shed its load in response to stress on the electric power grid. The GFA controller would disconnect the water heater from its supply circuit whenever it senses a low voltage signal or other indicators of system stress communicated via the electric power distribution system. Power would be reconnected to the appliance when the GFA controller senses the absence of these signals. This project has also considered more frequent cycling of this controller’s relay switch to perform demand-side frequency regulation. The principal criteria considered in this optimization are reliability, cost and life expectancy of the GFA components. The alternative embodiments of the GFA equipment under consideration are: Option 1- installation inside the insulation space of the water heater between the tank and jacket Option 2 containment in a separate nearby electrical enclosure Option 3 - as a modification or adjunct to the distribution panel housing and/or the breaker that protects the water heater supply circuit.

  12. Fluence correction factors for graphite calorimetry in a low-energy clinical proton beam: I. Analytical and Monte Carlo simulations.

    PubMed

    Palmans, H; Al-Sulaiti, L; Andreo, P; Shipley, D; Lühr, A; Bassler, N; Martinkovič, J; Dobrovodský, J; Rossomme, S; Thomas, R A S; Kacperek, A

    2013-05-21

    The conversion of absorbed dose-to-graphite in a graphite phantom to absorbed dose-to-water in a water phantom is performed by water to graphite stopping power ratios. If, however, the charged particle fluence is not equal at equivalent depths in graphite and water, a fluence correction factor, kfl, is required as well. This is particularly relevant to the derivation of absorbed dose-to-water, the quantity of interest in radiotherapy, from a measurement of absorbed dose-to-graphite obtained with a graphite calorimeter. In this work, fluence correction factors for the conversion from dose-to-graphite in a graphite phantom to dose-to-water in a water phantom for 60 MeV mono-energetic protons were calculated using an analytical model and five different Monte Carlo codes (Geant4, FLUKA, MCNPX, SHIELD-HIT and McPTRAN.MEDIA). In general the fluence correction factors are found to be close to unity and the analytical and Monte Carlo codes give consistent values when considering the differences in secondary particle transport. When considering only protons the fluence correction factors are unity at the surface and increase with depth by 0.5% to 1.5% depending on the code. When the fluence of all charged particles is considered, the fluence correction factor is about 0.5% lower than unity at shallow depths predominantly due to the contributions from alpha particles and increases to values above unity near the Bragg peak. Fluence correction factors directly derived from the fluence distributions differential in energy at equivalent depths in water and graphite can be described by kfl = 0.9964 + 0.0024·zw-eq with a relative standard uncertainty of 0.2%. Fluence correction factors derived from a ratio of calculated doses at equivalent depths in water and graphite can be described by kfl = 0.9947 + 0.0024·zw-eq with a relative standard uncertainty of 0.3%. These results are of direct relevance to graphite calorimetry in low-energy protons but given that the fluence

  13. Risk factors in familial forms of celiac disease.

    PubMed

    Freeman, Hugh James

    2010-04-21

    Celiac disease has been reported in up to 2% of some European populations. A similar risk has been identified in the America and Australia where immigration of Europeans has occurred. Moreover, an increasing number of celiac disease patients are being identified in many Asian countries, including China and India. Finally, celiac disease has also been detected in Asian immigrants and their descendants to other countries, such as Canada. Within these so-called "general" celiac populations, however, there are specific high risk groups that have an even higher prevalence of celiac disease. Indeed, the single most important risk factor for celiac disease is having a first-degree relative with already-defined celiac disease, particularly a sibling. A rate up to 20% or more has been noted. Risk is even greater if a specific family has 2 siblings affected, particularly if a male carries the human leukocyte antigen-DQ2. Both structural changes in the small bowel architecture occur along with functional changes in permeability, even in asymptomatic first-degree relatives. Even if celiac disease is not evident, the risk of other autoimmune disorders seems significantly increased in first-degree relatives as well as intestinal lymphoma. Identification of celiac disease is important since recent long-term studies have shown that the mortality of celiac disease is increased, if it is unrecognized and untreated.

  14. Highly Efficient Small Form Factor LED Retrofit Lamp

    SciTech Connect

    Steven Allen; Fred Palmer; Ming Li

    2011-09-11

    This report summarizes work to develop a high efficiency LED-based MR16 lamp downlight at OSRAM SYLVANIA under US Department of Energy contract DE-EE0000611. A new multichip LED package, electronic driver, and reflector optic were developed for these lamps. At steady-state, the lamp luminous flux was 409 lumens (lm), luminous efficacy of 87 lumens per watt (LPW), CRI (Ra) of 87, and R9 of 85 at a correlated color temperature (CCT) of 3285K. The LED alone achieved 120 lumens per watt efficacy and 600 lumen flux output at 25 C. The driver had 90% electrical conversion efficiency while maintaining excellent power quality with power factor >0.90 at a power of only 5 watts. Compared to similar existing MR16 lamps using LED sources, these lamps had much higher efficacy and color quality. The objective of this work was to demonstrate a LED-based MR16 retrofit lamp for replacement of 35W halogen MR16 lamps having (1) luminous flux of 500 lumens, (2) luminous efficacy of 100 lumens per watt, (3) beam angle less than 40{sup o} and center beam candlepower of at least 1000 candelas, and (4) excellent color quality.

  15. Concerted O atom–proton transfer in the O—O bond forming step in water oxidation

    PubMed Central

    Chen, Zuofeng; Concepcion, Javier J.; Hu, Xiangqian; Yang, Weitao; Hoertz, Paul G.; Meyer, Thomas J.

    2010-01-01

    As the terminal step in photosystem II, and a potential half-reaction for artificial photosynthesis, water oxidation (2H2O → O2 + 4e- + 4H+) is key, but it imposes a significant mechanistic challenge with requirements for both 4e-/4H+ loss and O—O bond formation. Significant progress in water oxidation catalysis has been achieved recently by use of single-site Ru metal complex catalysts such as [Ru(Mebimpy)(bpy)(OH2)]2+ [Mebimpy = 2,6-bis(1-methylbenzimidazol-2-yl)pyridine; bpy = 2,2′-bipyridine]. When oxidized from to RuV = O3+, these complexes undergo O—O bond formation by O-atom attack on a H2O molecule, which is often the rate-limiting step. Microscopic details of O—O bond formation have been explored by quantum mechanical/molecular mechanical (QM/MM) simulations the results of which provide detailed insight into mechanism and a strategy for enhancing catalytic rates. It utilizes added bases as proton acceptors and concerted atom–proton transfer (APT) with O-atom transfer to the O atom of a water molecule in concert with proton transfer to the base (B). Base catalyzed APT reactivity in water oxidation is observed both in solution and on the surfaces of oxide electrodes derivatized by attached phosphonated metal complex catalysts. These results have important implications for catalytic, electrocatalytic, and photoelectrocatalytic water oxidation. PMID:20360565

  16. Two-photon exchange and elastic electron-proton scattering

    SciTech Connect

    Peter Blunden; Wally Melnitchouk; John Tjon

    2003-06-01

    Two-photon exchange contributions to elastic electron-proton scattering cross sections are evaluated in a simple hadronic model including the finite size of the proton. The corrections are found to be small, but with a strong angular dependence at fixed Q{sup 2}. This is significant for the Rosenbluth technique for determining the ratio of electric and magnetic form factors of the proton, and partly reconciles the apparent discrepancy with the results of the polarization transfer technique.

  17. Proton Irradiation Sensitizes Radioresistant Non-small Cell Lung Cancer Cells by Modulating Epidermal Growth Factor Receptor-mediated DNA Repair.

    PubMed

    Park, Hyung Ju; Oh, Jeong Su; Chang, Jong Wook; Hwang, Sang-Gu; Kim, Jae-Sung

    2016-01-01

    Although proton radiotherapy is effective in treating various types of cancer, little is known on the biological responses triggered by proton irradiation. In the present study, we investigated protein profiles following proton irradiation of non-small cell lung cancer (NSCLC) cells and defined the role of proton-induced epidermal growth factor receptor (EGFR) expression in NSCLC cells. We found that proton irradiation more effectively sensitized NSCLC cells than gamma irradiation did. The expression profiles of radiosensitive and radioresistant NSCLC cells following proton and gamma irradiation were examined using antibody arrays. With regard to proteins, expression of EGFR was the most highly induced by proton irradiation. In addition, we found that EGFR inhibition with gefinitib significantly increased the radiosensitivity of NSCLC cells, and that increased radiosensitivity due to gefinitib was mediated by the suppression of DNA repair in radioresistant NSCLC cells. Thus, our data provide the first evidence that proton irradiation sensitizes radioresistant NSCLC cancer cells by modulating EGFR-mediated DNA repair.

  18. Form factors of the monodromy matrix entries in gl (2 | 1)-invariant integrable models

    NASA Astrophysics Data System (ADS)

    Hutsalyuk, A.; Liashyk, A.; Pakuliak, S. Z.; Ragoucy, E.; Slavnov, N. A.

    2016-10-01

    We study integrable models solvable by the nested algebraic Bethe ansatz and described by gl (2 | 1) or gl (1 | 2) superalgebras. We obtain explicit determinant representations for form factors of the monodromy matrix entries. We show that all form factors are related to each other at special limits of the Bethe parameters. Our results allow one to obtain determinant formulas for form factors of local operators in the supersymmetric t- J model.

  19. Exotic Protonated Species Produced by UV-Induced Photofragmentation of a Protonated Dimer: Metastable Protonated Cinchonidine.

    PubMed

    Alata, Ivan; Scuderi, Debora; Lepere, Valeria; Steinmetz, Vincent; Gobert, Fabrice; Thiao-Layel, Loïc; Le Barbu-Debus, Katia; Zehnacker-Rentien, Anne

    2015-10-01

    A metastable protonated cinchona alkaloid was produced in the gas phase by UV-induced photodissociation (UVPD) of its protonated dimer in a Paul ion trap. The infrared multiple photon dissociation (IRMPD) spectrum of the molecular ion formed by UVPD was obtained and compared to DFT calculations to characterize its structure. The protonation site obtained thereby is not accessible by classical protonation ways. The protonated monomer directly formed in the ESI source or by collision-induced dissociation (CID) of the dimer undergoes protonation at the most basic alkaloid nitrogen. In contrast, protonation occurs at the quinoline aromatic ring nitrogen in the UVPD-formed monomer. PMID:26347997

  20. Exotic Protonated Species Produced by UV-Induced Photofragmentation of a Protonated Dimer: Metastable Protonated Cinchonidine.

    PubMed

    Alata, Ivan; Scuderi, Debora; Lepere, Valeria; Steinmetz, Vincent; Gobert, Fabrice; Thiao-Layel, Loïc; Le Barbu-Debus, Katia; Zehnacker-Rentien, Anne

    2015-10-01

    A metastable protonated cinchona alkaloid was produced in the gas phase by UV-induced photodissociation (UVPD) of its protonated dimer in a Paul ion trap. The infrared multiple photon dissociation (IRMPD) spectrum of the molecular ion formed by UVPD was obtained and compared to DFT calculations to characterize its structure. The protonation site obtained thereby is not accessible by classical protonation ways. The protonated monomer directly formed in the ESI source or by collision-induced dissociation (CID) of the dimer undergoes protonation at the most basic alkaloid nitrogen. In contrast, protonation occurs at the quinoline aromatic ring nitrogen in the UVPD-formed monomer.

  1. A Semi-Empirical Method to Estimate the Response Factors for VOCs in Proton-Transfer Reaction Mass Spectrometry

    NASA Astrophysics Data System (ADS)

    Li, S.; Leithead, A.; De Gouw, J. A.; Warneke, C.; Graus, M.; Veres, P. R.; Murphy, S. M.

    2013-12-01

    Volatile organic compounds are essential in sustaining atmospheric chemical processes which lie at the heart of most atmospheric environmental issues. Recent advances in VOC measurement technologies have allowed rapid detection of the primary VOCs and their oxidation products. Proton-Transfer-Reaction Mass Spectrometry (PTRMS) has been widely used to determine air concentrations of many hydrocarbons and oxygenated hydrocarbons rapidly. The recent advance in PTRMS with time-of-flight mass (TOF) detection, allows hundreds of VOC compounds to be detected simultaneously and rapidly. Converting these detected signals into air concentrations is a challenge. This is usually accomplished with calibrations using a limited number of target compounds at known concentrations. However, for the hundreds of masses in the PTR mass spectrum particularly from TOF detectors, conversion to air concentration is not always practical nor possible if their compound identities are not known. Here, we have developed a new method to estimate the response factors for VOCs to convert the measured ion signals into air concentrations. This method is based on semi-empirical calculations of the rate constants for the proton transfer reactions between the hydronium ion and target hydrocarbons using polarizabilities and permanent dipole moments, and extrapolation to unknown hydrocarbons. The method is further validated with calibration results for selected hydrocarbons. Using these response factors, conversion to air concentrations for many signals in a PTR MS of unknown chemical structures can be accomplished.

  2. SU-E-T-464: On the Equivalence of the Quality Correction Factor for Pencil Beam Scanning Proton Therapy

    SciTech Connect

    Sorriaux, J; Paganetti, H; Testa, M; Giantsoudi, D; Schuemann, J; Bertrand, D; Orban de Xivry, J.; Lee, J; Palmans, H; Vynckier, S; Sterpin, E

    2014-06-01

    Purpose: In current practice, most proton therapy centers apply IAEA TRS-398 reference dosimetry protocol. Quality correction factors (kQ) take into account in the dose determination process the differences in beam qualities used for calibration unit and for treatment unit. These quality correction factors are valid for specific reference conditions. TRS-398 reference conditions should be achievable in both scattered proton beams (i.e. DS) and scanned proton beams (i.e. PBS). However, it is not a priori clear if TRS-398 kQ data, which are based on Monte Carlo (MC) calculations in scattered beams, can be used for scanned beams. Using TOPAS-Geant4 MC simulations, the study aims to determine whether broad beam quality correction factors calculated in TRS-398 can be directly applied to PBS delivery modality. Methods: As reference conditions, we consider a 10×10×10 cm{sup 3} homogeneous dose distribution delivered by PBS system in a water phantom (32/10 cm range/modulation) and an air cavity placed at the center of the spread-out-Bragg-peak. In order to isolate beam differences, a hypothetical broad beam is simulated. This hypothetical beam reproduces exactly the same range modulation, and uses the same energy layers than the PBS field. Ion chamber responses are computed for the PBS and hypothetical beams and then compared. Results: For an air cavity of 2×2×0.2 cm{sup 3}, the ratio of ion chamber responses for the PBS and hypothetical beam qualities is 0.9991 ± 0.0016. Conclusion: Quality correction factors are insensitive to the delivery pattern of the beam (broad beam or PBS), as long as similar dose distributions are achieved. This investigation, for an air cavity, suggests that broad beam quality correction factors published in TRS-398 can be applied for scanned beams. J. Sorriaux is financially supported by a public-private partnership involving the company Ion Beam Applications (IBA)

  3. Nucleon form factors from high statistics mixed-action calculations with 2+1 flavors

    SciTech Connect

    Schroers, Wolfram; Edwards, Robert G; Engelhardt, Michael; Fleming, George Taminga; Hagler, Philipp; Lin, Huey-Wen; Lin, Mei-Feng; Meyer, Harvey B; Musch, Bernhard; Negele, John W; Orginos, Kostas; Pochinsky, Andrew V; Procura, Massimiliano; Renner, Dru B; Richards, David G; Syritsyn, Sergey N; Walker-Loud, Andre P

    2009-12-01

    We present new high-statistics results for nucleon form factors at pion masses of approximately 290, 350, 500, and 600 MeV using a mixed action of domain wall valence quarks on an improved staggered sea. We perform chiral fits to both vector and axial form factors and compare our results to experiment.

  4. Form factors and decay rate of Bc * Dsl+l- decays in the QCD sum rules

    NASA Astrophysics Data System (ADS)

    Zeynali, K.; Bashiry, V.; Zolfagharpour, F.

    2014-08-01

    Rare exclusive decays are analyzed in the framework of the three-point QCD sum rules approach. The two-gluon condensate corrections to the correlation function are included and the form factors of this transition are evaluated. Using the form factors, the decay width and integrated decay rate for these decays are also calculated.

  5. Form factors in quantum integrable models with GL(3)-invariant R-matrix

    NASA Astrophysics Data System (ADS)

    Pakuliak, S.; Ragoucy, E.; Slavnov, N. A.

    2014-04-01

    We study integrable models solvable by the nested algebraic Bethe ansatz and possessing GL(3)-invariant R-matrix. We obtain determinant representations for form factors of off-diagonal entries of the monodromy matrix. These representations can be used for the calculation of form factors and correlation functions of the XXX SU(3)-invariant Heisenberg chain.

  6. Axial form factors of the octet baryons in a covariant quark model

    NASA Astrophysics Data System (ADS)

    Ramalho, G.; Tsushima, K.

    2016-07-01

    We study the weak interaction axial form factors of the octet baryons, within the covariant spectator quark model, focusing on the dependence of four-momentum transfer squared, Q2. In our model the axial form factors GA(Q2) (axial-vector form factor) and GP(Q2) (induced pseudoscalar form factor) are calculated based on the constituent quark axial form factors and the octet baryon wave functions. The quark axial current is parametrized by the two constituent quark form factors, the axial-vector form factor gAq(Q2), and the induced pseudoscalar form factor gPq(Q2). The baryon wave functions are composed of a dominant S -state and a P -state mixture for the relative angular momentum of the quarks. First, we study in detail the nucleon case. We assume that the quark axial-vector form factor gAq(Q2) has the same function form as that of the quark electromagnetic isovector form factor. The remaining parameters of the model, the P -state mixture and the Q2 dependence of gPq(Q2), are determined by a fit to the nucleon axial form factor data obtained by lattice QCD simulations with large pion masses. In this lattice QCD regime the meson cloud effects are small, and the physics associated with the valence quarks can be better calibrated. Once the valence quark model is calibrated, we extend the model to the physical regime and use the low Q2 experimental data to estimate the meson cloud contributions for GA(Q2) and GP(Q2). Using the calibrated quark axial form factors and the generalization of the nucleon wave function for the other octet baryon members, we make predictions for all the possible weak interaction axial form factors GA(Q2) and GP(Q2) of the octet baryons. The results are compared with the corresponding experimental data for GA(0 ) and with the estimates of baryon-meson models based on S U (6 ) symmetry.

  7. Off-shell electromagnetic form factors of pions and kaons in chiral perturbation theory

    SciTech Connect

    Rudy, T.E.; Fearing, H.W.; Scherer, S. )

    1994-07-01

    The off-shell electromagnetic vertex of a (pseudo)scalar particle contains, in general, two form factors [ital F] and [ital G] which depend, in addition to the squared momentum transfer, on the invariant masses associated with the initial and final legs of the vertex. Chiral perturbation theory to one loop is used to calculate the off-shell form factors of pions and kaons. The formalism of Gasser and Leutwyler, which was previously used to calculate the on-shell limit of the form factor [ital F], is extended to accommodate the most general form for off-shell Green's functions in the pseudoscalar meson sector. We find that chiral symmetry predicts that the form factors [ital F] of the charged pions and kaons go off-shell in the same way, i.e., the off-shell slope at the real photon point is given by the same new phenomenological constant [beta][sub 1]. Furthermore, it is shown that at order [ital p][sup 4] the form factor [ital F] of the [ital K][sup 0] does not show any off-shell dependence. The form factors [ital G] are all related to the form factors [ital F] in the correct fashion as required by the Ward-Takahashi identity. Numerical results for different off-shell kinematics are presented.

  8. Proton Therapy - Accelerating Protons to Save Lives

    SciTech Connect

    Keppel, Cynthia

    2011-10-25

    In 1946, physicist Robert Wilson first suggested that protons could be used as a form of radiation therapy in the treatment of cancer because of the sharp drop-off that occurs on the distal edge of the radiation dose. Research soon confirmed that high-energy protons were particularly suitable for treating tumors near critical structures, such as the heart and spinal column. The precision with which protons can be delivered means that more radiation can be deposited into the tumor while the surrounding healthy tissue receives substantially less or, in some cases, no radiation. Since these times, particle accelerators have continuously been used in cancer therapy and today new facilities specifically designed for proton therapy are being built in many countries. Proton therapy has been hailed as a revolutionary cancer treatment, with higher cure rates and fewer side effects than traditional X-ray photon radiation therapy. Proton therapy is the modality of choice for treating certain small tumors of the eye, head or neck. Because it exposes less of the tissue surrounding a tumor to the dosage, proton therapy lowers the risk of secondary cancers later in life - especially important for young children. To date, over 80,000 patients worldwide have been treated with protons. Currently, there are nine proton radiation therapy facilities operating in the United States, one at the Hampton University Proton Therapy Institute. An overview of the treatment technology and this new center will be presented.

  9. Factor Structure of the Woodcock Reading Mastery Tests--Revised, Forms G and H.

    ERIC Educational Resources Information Center

    Williams, Thomas O., Jr.; Eaves, Ronald C.; Cox, Cynthia

    2001-01-01

    This study analyzed the factor structure of the Woodcock Reading Mastery Tests Revised (WRMT-R), a test battery used to measure basic reading skills. Findings indicated that both forms of the WRMT-R contain a large unrotated general factor and, when rotated obliquely, two correlated factors representing basic skills and reading comprehension.…

  10. The neutron electric form factor to Q² = 1.45 (GeV/c)²

    SciTech Connect

    Plaster, Bradley

    2004-02-01

    The nucleon elastic electromagnetic form factors are fundamental quantities needed for an understanding of nucleon and nuclear electromagnetic structure. The evolution of the Sachs electric and magnetic form factors with Q2, the square of the four-momentum transfer, is related to the distribution of charge and magnetization within the nucleon. High precision measurements of the nucleon form factors are essential for stringent tests of our current theoretical understanding of confinement within the nucleon. Measurements of the neutron form factors, in particular, those of the neutron electric form factor, have been notoriously difficult due to the lack of a free neutron target and the vanishing integral charge of the neutron. Indeed, a precise measurement of the neutron electric form factor has eluded experimentalists for decades; however, with the advent of high duty-factor polarized electron beam facilities, experiments employing polarization degrees of freedom have finally yielded the first precise measurements of this fundamental quantity. Following a general overview of the experimental and theoretical status of the nucleon form factors, a detailed description of an experiment designed to extract the neutron electric form factor from measurements of the neutron's recoil polarization in quasielastic 2H(e, e')1H scattering is presented. The experiment described here employed the Thomas Jefferson National Accelerator Facility's longitudinally polarized electron beam, a magnetic spectrometer for detection of the scattered electron, and a neutron polarimeter designed specifically for this experiment. Measurements were conducted at three Q2 values of 0.45, 1.13, and 1.45 (GeV/c)2, and the final results extracted from an analysis of the data acquired in this experiment are reported and compared with recent theoretical predictions for the nucleon form factors.

  11. On-shell diagrams, Graßmannians and integrability for form factors

    NASA Astrophysics Data System (ADS)

    Frassek, Rouven; Meidinger, David; Nandan, Dhritiman; Wilhelm, Matthias

    2016-01-01

    We apply on-shell and integrability methods that have been developed in the context of scattering amplitudes in {N}=4 SYM theory to tree-level form factors of this theory. Focussing on the colour-ordered super form factors of the chiral part of the stress-tensor multiplet as an example, we show how to systematically construct on-shell diagrams for these form factors with the minimal form factor as further building block in addition to the three-point amplitudes. Moreover, we obtain analytic representations in terms of Graßmannian integrals in spinor helicity, twistor and momentum twistor variables. While Yangian invariance is broken by the operator insertion, we find that the form factors are eigenstates of the integrable spin-chain transfer matrix built from the monodromy matrix that yields the Yangian generators. Constructing them via the method of R operators allows to introduce deformations that preserve the integrable structure. We finally show that the integrable properties extend to minimal tree-level form factors of generic composite operators as well as certain leading singularities of their n-point loop-level form factors.

  12. Can Nonrelativistic QCD Explain the γ γ*→ηc Transition Form Factor Data?

    NASA Astrophysics Data System (ADS)

    Feng, Feng; Jia, Yu; Sang, Wen-Long

    2015-11-01

    Unlike the bewildering situation in the γ γ*→π form factor, a widespread view is that perturbative QCD can decently account for the recent BABAR measurement of the γ γ*→ηc transition form factor. The next-to-next-to-leading-order perturbative correction to the γ γ*→ηc ,b form factor, is investigated in the nonrelativistic QCD (NRQCD) factorization framework for the first time. As a byproduct, we obtain, by far, the most precise order-αs2 NRQCD matching coefficient for the ηc ,b→γ γ process. After including the substantial negative order-αs2 correction, the good agreement between NRQCD prediction and the measured γ γ*→ηc form factor is completely ruined over a wide range of momentum transfer squared. This eminent discrepancy casts some doubts on the applicability of the NRQCD approach to hard exclusive reactions involving charmonium.

  13. An experimental survey of the factors that affect leaching from low-level radioactive waste forms

    SciTech Connect

    Dougherty, D.R.; Pietrzak, R.F.; Fuhrmann, M.; Colombo, P.

    1988-09-01

    This report represents the results of an experimental survey of the factors that affect leaching from several types of solidified low-level radioactive waste forms. The goal of these investigations was to determine those factors that accelerate leaching without changing its mechanism(s). Typically, although not in every case,the accelerating factors include: increased temperature, increased waste loading (i.e., increased waste to binder ratio), and decreased size (i.e., decreased waste form volume to surface area ratio). Additional factors that were studied were: increased leachant volume to waste form surface area ratio, pH, leachant composition (groundwaters, natural and synthetic chelating agents), leachant flow rate or replacement frequency and waste form porosity and surface condition. Other potential factors, including the radiation environment and pressure, were omitted based on a survey of the literature. 82 refs., 236 figs., 13 tabs.

  14. Delta and Omega electromagnetic form factors in a Dyson-Schwinger/Bethe-Salpeter approach

    SciTech Connect

    Diana Nicmorus, Gernot Eichmann, Reinhard Alkofer

    2010-12-01

    We investigate the electromagnetic form factors of the Delta and the Omega baryons within the Poincare-covariant framework of Dyson-Schwinger and Bethe-Salpeter equations. The three-quark core contributions of the form factors are evaluated by employing a quark-diquark approximation. We use a consistent setup for the quark-gluon dressing, the quark-quark bound-state kernel and the quark-photon interaction. Our predictions for the multipole form factors are compatible with available experimental data and quark-model estimates. The current-quark mass evolution of the static electromagnetic properties agrees with results provided by lattice calculations.

  15. Parity-Violating Electron Scattering and the Electric and Magnetic Strange Form Factors of the Nucleon

    SciTech Connect

    Armstrong, David S.; McKeown, Robert

    2012-11-01

    Measurement of the neutral weak vector form factors of the nucleon provides unique access to the strange quark content of the nucleon. These form factors can be studied using parity-violating electron scattering. A comprehensive program of experiments has been performed at three accelerator laboratories to determine the role of strange quarks in the electromagnetic form factors of the nucleon. This article reviews the remarkable technical progress associated with this program, describes the various methods used in the different experiments, and summarizes the physics results along with recent theoretical calculations.

  16. Pion Form Factor in Chiral Limit of Hard-Wall AdS/QCD Model

    SciTech Connect

    Anatoly Radyushkin; Hovhannes Grigoryan

    2007-12-01

    We develop a formalism to calculate form factor and charge density distribution of pion in the chiral limit using the holographic dual model of QCD with hard-wall cutoff. We introduce two conjugate pion wave functions and present analytic expressions for these functions and for the pion form factor. They allow to relate such observables as the pion decay constant and the pion charge electric radius to the values of chiral condensate and hard-wall cutoff scale. The evolution of the pion form factor to large values of the momentum transfer is discussed, and results are compared to existing experimental data.

  17. The form factors for the photon to pseudoscalar meson transitions—an update

    NASA Astrophysics Data System (ADS)

    Kroll, P.

    2011-04-01

    The form factors for the transitions πγ, ηγ, η' γ and η c γ are analyzed within the modified perturbative approach in which quark transverse degrees of freedom are retained. The results for the form factors are compared to experiment in detail. As compared to previous calculations within the same approach only little modifications of the meson distribution amplitudes are required in general in order to achieve reasonable agreement with experiment. Only for the πγ form factor a strong contribution from the second Gegenbauer term is found. It also commented on the case of two virtual photons and on the transition form factors in the time-like region.

  18. Electric form factors of the octet baryons from lattice QCD and chiral extrapolation

    NASA Astrophysics Data System (ADS)

    Shanahan, P. E.; Horsley, R.; Nakamura, Y.; Pleiter, D.; Rakow, P. E. L.; Schierholz, G.; Stüben, H.; Thomas, A. W.; Young, R. D.; Zanotti, J. M.; Cssm; Qcdsf/Ukqcd Collaborations

    2014-08-01

    We apply a formalism inspired by heavy-baryon chiral perturbation theory with finite-range regularization to dynamical 2+1-flavor CSSM/QCDSF/UKQCD Collaboration lattice QCD simulation results for the electric form factors of the octet baryons. The electric form factor of each octet baryon is extrapolated to the physical pseudoscalar masses, after finite-volume corrections have been applied, at six fixed values of Q2 in the range 0.2-1.3 GeV2. The extrapolated lattice results accurately reproduce the experimental form factors of the nucleon at the physical point, indicating that omitted disconnected quark loop contributions are small relative to the uncertainties of the calculation. Furthermore, using the results of a recent lattice study of the magnetic form factors, we determine the ratio μpGEp/GMp. This quantity decreases with Q2 in a way qualitatively consistent with recent experimental results.

  19. The spin-dependent neutralino-nucleus form factor for {sup 127}I

    SciTech Connect

    Ressell, M.T.; Dean, D.J.

    1996-12-01

    We present the results of detailed shell model calculations of the spin-dependent elastic form factor for the nucleus {sup 127}I. the calculations were performed in extremely large model spaces which adequately describe the configuration mixing in this nucleus. Good agreement between the calculated and experimental values of the magnetic moment are found. Other nuclear observables are also compared to experiment. The dependence of the form factor upon the model space and effective interaction is discussed.

  20. Nucleon-to-{delta} axial transition form factors in relativistic baryon chiral perturbation theory

    SciTech Connect

    Geng, L. S.; Camalich, J. Martin; Alvarez-Ruso, L.; Vacas, M. J. Vicente

    2008-07-01

    We report a theoretical study of the axial nucleon-to-delta (1232) (N{yields}{delta}) transition form factors up to one-loop order in relativistic baryon chiral perturbation theory. We adopt a formalism in which the {delta} couplings obey the spin-3/2 gauge symmetry and, therefore, decouple the unphysical spin-1/2 fields. We compare the results with phenomenological form factors obtained from neutrino bubble-chamber data and in quark models.

  1. Evidence for a Proton Transfer Network and a Required Persulfide-Bond-Forming Cysteine Residue in Ni-Containing Carbon Monoxide Dehydrogenases

    SciTech Connect

    Eun Jin Kim; Jian Feng; Matthew R. Bramlett; Paul A. Lindahl

    2004-05-18

    OAK-B135 Carbon monoxide dehydrogenase from Moorella thermoacetica catalyzes the reversible oxidation of CO to CO2 at a nickel-iron-sulfur active-site called the C-cluster. Mutants of a proposed proton transfer pathway and of a cysteine residue recently found to form a persulfide bond with the C-cluster were characterized. Four semi-conserved histidine residues were individually mutated to alanine. His116 and His122 were essential to catalysis, while His113 and His119 attenuated catalysis but were not essential. Significant activity was ''rescued'' by a double mutant where His116 was replaced by Ala and His was also introduced at position 115. Activity was also rescued in double mutants where His122 was replaced by Ala and His was simultaneously introduced at either position 121 or 123. Activity was also ''rescued'' by replacing His with Cys at position 116. Mutation of conserved Lys587 near the C-cluster attenuated activity but did not eliminate it. Activity was virtually abolished in a double mutant where Lys587 and His113 were both changed to Ala. Mutations of conserved Asn284 also attenuated activity. These effects suggest the presence of a network of amino acid residues responsible for proton transfer rather than a single linear pathway. The Ser mutant of the persulfide-forming Cys316 was essentially inactive and displayed no EPR signals originating from the C-cluster. Electronic absorption and metal analysis suggests that the C-cluster is absent in this mutant. The persulfide bond appears to be essential for either the assembly or stability of the C-cluster, and/or for eliciting the redox chemistry of the C-cluster required for catalytic activity.

  2. Form factors of the transitions {gamma}{sup *}{pi}{sup 0} {r_arrow} {gamma} and {gamma}{sup *}{eta}{r_arrow}{gamma}

    SciTech Connect

    Afanasev, A.

    1994-04-01

    The author discusses possibilities to study {gamma}*{pi}{sup 0} and {gamma}*{eta} {r_arrow} {gamma} transition form factors at CEBAF energies. The author shows that for 4 GeV electron beam, these form factors can be measured at CEBAF for the 4-momentum transfers Q{sup 2} {le} 2.5 (GeV/c){sup 2} using virtual Compton scattering on the proton and nuclear target in the kinematic regime of low momentum transfers to the target. These measurements can be extended to Q{sup 2} {le} 4.0 (GeV/c){sup 2} using the electron beam with the energy 6 GeV.

  3. $$B\\to Kl^+l^-$$ decay form factors from three-flavor lattice QCD

    DOE PAGESBeta

    Bailey, Jon A.

    2016-01-27

    We compute the form factors for the B → Kl+l- semileptonic decay process in lattice QCD using gauge-field ensembles with 2+1 flavors of sea quark, generated by the MILC Collaboration. The ensembles span lattice spacings from 0.12 to 0.045 fm and have multiple sea-quark masses to help control the chiral extrapolation. The asqtad improved staggered action is used for the light valence and sea quarks, and the clover action with the Fermilab interpretation is used for the heavy b quark. We present results for the form factors f+(q2), f0(q2), and fT(q2), where q2 is the momentum transfer, together with a comprehensivemore » examination of systematic errors. Lattice QCD determines the form factors for a limited range of q2, and we use the model-independent z expansion to cover the whole kinematically allowed range. We present our final form-factor results as coefficients of the z expansion and the correlations between them, where the errors on the coefficients include statistical and all systematic uncertainties. Lastly, we use this complete description of the form factors to test QCD predictions of the form factors at high and low q2.« less

  4. Effects of core deformations and collective rotational currents on electron-nucleus magnetic form factors

    SciTech Connect

    Lin, C.K.

    1983-01-01

    The collective model H/sub int/ + H/sub coll/ is used to study the magnetic form factors. For the intrinsic Hamiltonian, we use the Nilsson model to generate the intrinsic state. For the collective Hamiltonian, two models are considered, the rigid body model and the liquid soap model. We use the particle-rotor model to derive the collective operators and their reduced matrix elements, and then apply this model to the elastic M1 form factor of /sup 13/C. One sees clearly the interplay of the intrinsic form factor and the collective form factor. Since the form factor is essentially a Fourier transform of the current density operator, one also sees the effects of the collective current density distribution due to all the particles in addition to that of the intrinsic current due to the unpaired nucleons. The effects of core deformation are explored. This includes discussions on the difference between the variation before projection and the variation after projection. Analytic results are obtained in the case of weak deformations. The collective model focuses on the effects of the quadrupole deformation on the M1 form factor of /sup 13/C, whereas the calculation involving core polarization stresses the monopole effects. By introducing a quenching of the isovector g/sub s/, the fits by the collective models are very comparable to the fit by the core polarization, although the justification for this procedure in light nuclei is questionable.

  5. B →K l+l- decay form factors from three-flavor lattice QCD

    NASA Astrophysics Data System (ADS)

    Bailey, Jon A.; Bazavov, A.; Bernard, C.; Bouchard, C. M.; DeTar, C.; Du, Daping; El-Khadra, A. X.; Foley, J.; Freeland, E. D.; Gámiz, E.; Gottlieb, Steven; Heller, U. M.; Jain, R. D.; Komijani, J.; Kronfeld, A. S.; Laiho, J.; Levkova, L.; Liu, Yuzhi; Mackenzie, P. B.; Meurice, Y.; Neil, E. T.; Qiu, Si-Wei; Simone, J. N.; Sugar, R.; Toussaint, D.; Van de Water, R. S.; Zhou, Ran; Fermilab Lattice; MILC Collaborations

    2016-01-01

    We compute the form factors for the B →K l+l- semileptonic decay process in lattice QCD using gauge-field ensembles with 2 +1 flavors of sea quark, generated by the MILC Collaboration. The ensembles span lattice spacings from 0.12 to 0.045 fm and have multiple sea-quark masses to help control the chiral extrapolation. The asqtad improved staggered action is used for the light valence and sea quarks, and the clover action with the Fermilab interpretation is used for the heavy b quark. We present results for the form factors f+(q2), f0(q2), and fT(q2), where q2 is the momentum transfer, together with a comprehensive examination of systematic errors. Lattice QCD determines the form factors for a limited range of q2, and we use the model-independent z expansion to cover the whole kinematically allowed range. We present our final form-factor results as coefficients of the z expansion and the correlations between them, where the errors on the coefficients include statistical and all systematic uncertainties. We use this complete description of the form factors to test QCD predictions of the form factors at high and low q2.

  6. Mixed-state form factors of U(1) twist fields in the Dirac theory

    NASA Astrophysics Data System (ADS)

    Chen, Yixiong

    2016-08-01

    Using the ‘Liouville space’ (the space of operators) of the massive Dirac theory, we define mixed-state form factors of U(1) twist fields. We consider mixed states with density matrices diagonal in the asymptotic particle basis. This includes the thermal Gibbs state as well as all generalized Gibbs ensembles of the Dirac theory. When the mixed state is specialized to a thermal Gibbs state, using a Riemann-Hilbert problem and low-temperature expansion, we obtain finite-temperature form factors of U(1) twist fields. We then propose the expression for form factors of U(1) twist fields in general diagonal mixed states. We verify that these form factors satisfy a system of nonlinear functional differential equations, which is derived from the trace definition of mixed-state form factors. At last, under weak analytic conditions on the eigenvalues of the density matrix, we write down the large distance form factor expansions of two-point correlation functions of these twist fields. Using the relation between the Dirac and Ising models, this provides the large-distance expansion of the Rényi entropy (for integer Rényi parameter) in the Ising model in diagonal mixed states.

  7. Protons are one of the limiting factors in determining sensitivity of nano surface-assisted (+)-mode LDI MS analyses.

    PubMed

    Cho, Eunji; Ahn, Miri; Kim, Young Hwan; Kim, Jongwon; Kim, Sunghwan

    2013-10-01

    A proton source employing a nanostructured gold surface for use in (+)-mode laser desorption ionization mass spectrometry (LDI-MS) was evaluated. Analysis of perdeuterated polyaromatic hydrocarbon compound dissolved in regular toluene, perdeuterated toluene, and deuterated methanol all showed that protonated ions were generated irregardless of solvent system. Therefore, it was concluded that residual water on the surface of the LDI plate was the major source of protons. The fact that residual water remaining after vacuum drying was the source of protons suggests that protons may be the limiting reagent in the LDI process and that overall ionization efficiency can be improved by incorporating an additional proton source. When extra proton sources, such as thiolate compounds and/or citric acid, were added to a nanostructured gold surface, the protonated signal abundance increased. These data show that protons are one of the limiting components in (+)-mode LDI MS analyses employing nanostructured gold surfaces. Therefore, it has been suggested that additional efforts are required to identify compounds that can act as proton donors without generating peaks that interfere with mass spectral interpretation.

  8. Form and structure factors for impedance and reflection from periodic layers.

    PubMed

    Pan, Janet L

    2007-01-20

    In an exact treatment of the Maxwell equations, we derive form and structure factors for reflection from periodic layers, and we show that these factors are significantly different from their analogs in kinematic x-ray diffraction. Quite generally, we show that reflection and impedance can be written precisely as the sum of an additive form factor and the product of a structure factor and a second form factor. This additive form factor does not have an analog in kinematic x-ray diffraction. It is demonstrated that the form factors are found by analytic continuation to an arbitrary wavelength of expressions for the impedance both at long wavelengths and at quarter wavelengths. A correction to the Bragg law relating fringe spacing to the total structure thickness is derived. We go beyond previous numerical work by deriving simple analytic exact expressions for reflection and impedance of periodic layers for all frequencies within the reflection passband, and for an arbitrary number of periods in the structure, an arbitrary index profile within each period, arbitrary layer thicknesses (not just quarter-wave layers), and for arbitrary sizes of the refractive index differences.

  9. Singular or Plural? Children's Knowledge of the Factors that Determine the Appropriate Form of Count Nouns

    ERIC Educational Resources Information Center

    Ferenz, Krag S.; Prasada, Sandeep

    2002-01-01

    Two experiments investigated the factors that govern children's use of singular and plural forms of count nouns. Experiment 1 used an elicited production task to investigate whether children use referential and/or syntactic information to determine the form of the count nouns when the two sources of information conflict (e.g. "each x, one of the…

  10. Charged pion form factor between $Q^2$=0.60 and 2.45 GeV$^2$. II. Determination of, and results for, the pion form factor

    SciTech Connect

    Huber, Garth; Blok, Henk; Horn, Tanja; Beise, Elizabeth; Gaskell, David; Mack, David; Tadevosyan, Vardan; Volmer, Jochen; Abbott, David; Aniol, Konrad; Anklin, Heinz; Armstrong, Christopher; Arrington, John; Assamagan, Ketevi; Avery, Steven; Baker, O.; Barrett, Robert; Bochna, Christopher; Boeglin, Werner; Brash, Edward; Breuer, Herbert; Chang, C.; Chang, C.C.; Chant, Nicholas; Christy, Michael; Dunne, James; Eden, Thomas; Ent, Rolf; Fenker, Benjamin; Gibson, Edward; Gilman, Ronald; Gustafsson, Kenneth; Hinton, Wendy; Holt, Roy; Jackson, Harold; uk Jin, Seong; Jones, Mark; Keppel, Cynthia; Kim, pyunghun; Kim, Wooyoung; King, Paul; Klein, Andreas; Koltenuk, Douglas; Kovaltchouk, Vitali; Liang, Meihua; Liu, Jinghua; Lolos, George; Lung, Allison; Margaziotis, Demetrius; Markowitz, Pete; Matsumura, Akihiko; McKee, David; Meekins, David; Mitchell, Joseph; Miyoshi, Toshinobu; Mkrtchyan, Hamlet; Mueller, Robert; Niculescu, Gabriel; Niculescu, Maria-Ioana; Okayasu, Yuichi; Pentchev, Lubomir; Perdrisat, Charles; Pitz, David; Potterveld, David; Punjabi, Vina; Qin, Liming; Reimer, Paul; Reinhold, Joerg; Roche, Julie; Roos, Philip; Sarty, Adam; Shin, Ilkyoung; Smith, Gregory; Stepanyan, Stepan; Tang, Liguang; Tvaskis, Vladas; van der Meer, Rob; Vansyoc, Kelley; Van Westrum, Derek; Vidakovic, Sandra; Vulcan, William; Warren, Glen; Wood, Stephen; Xu, Chen; Yan, Chen; Zhao, Wenxia; Zheng, Xiaochao; Zihlmann, Benedikt

    2008-10-01

    DOI: http://dx.doi.org/10.1103/PhysRevC.78.045203
    The charged pion form factor, Fpi(Q2), is an important quantity that can be used to advance our knowledge of hadronic structure. However, the extraction of Fpi from data requires a model of the 1H(e,e'pi+)n reaction and thus is inherently model dependent. Therefore, a detailed description of the extraction of the charged pion form factor from electroproduction data obtained recently at Jefferson Lab is presented, with particular focus given to the dominant uncertainties in this procedure. Results for Fpi are presented for Q2=0.60-2.45 GeV2. Above Q2=1.5 GeV2, the Fpi values are systematically below the monopole parametrization that describes the low Q2 data used to determine the pion charge radius. The pion form factor can be calculated in a wide variety of theoretical approaches, and the experimental results are compared to a number of calculations. This comparison is helpful in understanding the role of soft versus hard c

  11. Factor Structure and Psychometric Properties of the Young Schema Questionnaire (Short Form) in Chinese Undergraduate Students

    ERIC Educational Resources Information Center

    Cui, Lixia; Lin, Wenwen; Oei, Tian P. S.

    2011-01-01

    This study investigated cross-cultural differences in the factor structure and psychometric properties of the Young Schema Questionnaire (short form; YSQ-SF). The participants were 712 Chinese undergraduate students. The total sample was randomly divided into two sub-samples. Exploratory Factor Analysis (EFA) was conducted on questionnaire results…

  12. Factor Structure and Validity of the Parenting Stress Index-Short Form

    ERIC Educational Resources Information Center

    Haskett, Mary E.; Ahern, Lisa S.; Ward, Caryn S.; Allaire, Jason C.

    2006-01-01

    The psychometric properties of the Parenting Stress Index-Short Form (PSI-SF) were examined in a sample of 185 mothers and fathers. Factor analysis revealed 2 reasonably distinct factors involving parental distress and dysfunctional parent-child interactions. Both scales were internally consistent, and these scales were correlated with measures of…

  13. Forms, Factors and Consequences of Cheating in University Examinations: Insight from Open and Distance Learning Students

    ERIC Educational Resources Information Center

    Mokula, Lebeloane Lazarus Donald; Lovemore, Nyaumwe

    2014-01-01

    The present study narrated the forms, factors and consequences of cheating in university examinations by UNISA Open and Distance learning students from anecdotal data. The results showed that the perpetrators mostly used crib materials on paper, ruler and calculator cover. The factors that influenced examination cheating were gender, age range and…

  14. SU-E-T-586: Field Size Dependence of Output Factor for Uniform Scanning Proton Beams: A Comparison of TPS Calculation, Measurement and Monte Carlo Simulation

    SciTech Connect

    Zheng, Y; Singh, H; Islam, M

    2014-06-01

    Purpose: Output dependence on field size for uniform scanning beams, and the accuracy of treatment planning system (TPS) calculation are not well studied. The purpose of this work is to investigate the dependence of output on field size for uniform scanning beams and compare it among TPS calculation, measurements and Monte Carlo simulations. Methods: Field size dependence was studied using various field sizes between 2.5 cm diameter to 10 cm diameter. The field size factor was studied for a number of proton range and modulation combinations based on output at the center of spread out Bragg peak normalized to a 10 cm diameter field. Three methods were used and compared in this study: 1) TPS calculation, 2) ionization chamber measurement, and 3) Monte Carlos simulation. The XiO TPS (Electa, St. Louis) was used to calculate the output factor using a pencil beam algorithm; a pinpoint ionization chamber was used for measurements; and the Fluka code was used for Monte Carlo simulations. Results: The field size factor varied with proton beam parameters, such as range, modulation, and calibration depth, and could decrease over 10% from a 10 cm to 3 cm diameter field for a large range proton beam. The XiO TPS predicted the field size factor relatively well at large field size, but could differ from measurements by 5% or more for small field and large range beams. Monte Carlo simulations predicted the field size factor within 1.5% of measurements. Conclusion: Output factor can vary largely with field size, and needs to be accounted for accurate proton beam delivery. This is especially important for small field beams such as in stereotactic proton therapy, where the field size dependence is large and TPS calculation is inaccurate. Measurements or Monte Carlo simulations are recommended for output determination for such cases.

  15. One-pion exchange current effects on magnetic form factor in the relativistic formalism

    NASA Astrophysics Data System (ADS)

    Zhang, Cun; Liu, Jian; Ren, Zhongzhou

    2016-08-01

    One-pion exchange current effects on the magnetic form factors of some odd nuclei are studied in the relativistic formalism. The Dirac wave functions of nucleons are calculated from the relativistic mean-field theory. After fitting to experimental data by quenching factors, it is found that taking the one-pion exchange currents into account gives a better description of the magnetic form factor. The root-mean-square radii of the valance nucleon orbits are also calculated in RMF model, which coincide with experimental radii extracted with meson exchange current corrections.

  16. B to tensor meson form factors in the perturbative QCD approach

    SciTech Connect

    Wang Wei

    2011-01-01

    We calculate the B{sub u,d,s}{yields}T form factors within the framework of the perturbative QCD approach, where T denotes a light tensor meson with J{sup P}=2{sup +}. Because of the similarities between the wave functions of a vector and a tensor meson, the factorization formulas of B{yields}T form factors can be obtained from the B{yields}V transition through a replacement rule. As a consequence, we find that these two sets of form factors have the same signs and correlated q{sup 2}-dependence behaviors. At q{sup 2}=0 point, the B{yields}T form factors are smaller than the B{yields}V ones, in accordance with the experimental data of radiative B decays. In addition, we use our results for the form factors to explore semilteptonic B{yields}Tl{nu}{sub l} decays and the branching fractions can reach the order 10{sup -4}.

  17. Constraints on the light pseudoscalar meson distribution amplitudes from their meson-photon transition form factors

    SciTech Connect

    Wu Xinggang; Huang Tao

    2011-10-01

    The meson-photon transition form factors {gamma}{gamma}*{yields}P (P stands for {pi}, {eta} and {eta}') provide strong constraints on the distribution amplitudes of the pseudoscalar mesons. In this paper, these transition form factors are calculated under the light-cone perturbative QCD approach, in which both the valence and nonvalence quarks' contributions have been taken into consideration. To be consistent, a unified wave function model is adopted to analyze these form factors. It is shown that with the proper charm component f{sub {eta}}'{sup c}{approx}-30 MeV and a moderate DA with B{approx}0.30, the experimental data on Q{sup 2}F{sub {eta}{gamma}}(Q{sup 2}) and Q{sup 2}F{sub {eta}'{gamma}}(Q{sup 2}) in the whole Q{sup 2} region can be explained simultaneously. Furthermore, a detailed discussion on the form factors' uncertainties caused by the constituent quark masses m{sub q} and m{sub s}, the parameter B, the mixing angle {phi}, and f{sub {eta}'}{sup c} are presented. It is found that, by adjusting these parameters within their reasonable regions, one can improve the form factor to a certain degree but cannot solve the puzzle for Q{sup 2}F{sub {pi}{gamma}}(Q{sup 2}), especially to explain the behavior of the {pi}-{gamma} form factor within the whole Q{sup 2} region consistently. We hope further experimental data on these form factors in the large Q{sup 2} region can clarify the present situation.

  18. Regularization of multi-soliton form factors in sine-Gordon model

    NASA Astrophysics Data System (ADS)

    Pálmai, T.

    2012-08-01

    A general and systematic regularization is developed for the exact solitonic form factors of exponential operators in the (1+1)-dimensional sine-Gordon model by analytical continuation of their integral representations. The procedure is implemented in Mathematica. Test results are shown for four- and six-soliton form factors. Catalogue identifier: AEMG_v1_0 Program summary URL:http://cpc.cs.qub.ac.uk/summaries/AEMG_v1_0.html Program obtainable from: CPC Program Library, Queen's University, Belfast, N. Ireland Licensing provisions: Standard CPC licence, http://cpc.cs.qub.ac.uk/licence/licence.html No. of lines in distributed program, including test data, etc.: 1462 No. of bytes in distributed program, including test data, etc.: 15 488 Distribution format: tar.gz Programming language: Mathematica [1] Computer: PC Operating system: Cross-platform Classification: 7.7, 11.1, 23 Nature of problem: The multi-soliton form factors of the sine-Gordon model (relevant in two-dimensional physics) were given only by highly non-trivial integral representation with a limited domain of convergence. Practical applications of the form factors, e.g. calculation of correlation functions in two-dimensional condensed matter systems, were not possible in general. Solution method: Using analytic continuation techniques an efficient algorithm is found and implemented in Mathematica, which provides a general and systematic way to calculate multi-soliton form factors in the sine-Gordon model. The package contains routines to compute the two-, four- and six-soliton form factors. Running time: Strongly dependent on the desired accuracy and the number of solitons. For physical rapidities after an initialization of about 30 s, the calculation of the two-, four- and six-soliton form factors at a single point takes approximately 0.5 s, 2.5 s and 8 s, respectively. Wolfram Research, Inc., Mathematica Edition: Version 7.0, Wolfram Research, Inc., Champaign, Illinois, 2008.

  19. Interaction of the Saccharomyces cerevisiae. alpha. -factor with phospholipid vesicles as revealed by proton and phosphorus NMR

    SciTech Connect

    Jelicks, L.A.; Broido, M.S.; Becker, J.M.; Naider, F.R. )

    1989-05-16

    Proton and phosphorus-31 nuclear magnetic resonance ({sup 1}H and {sup 31}P NMR) studies of the interaction between a tridecapeptide pheromone, the {alpha}-factor of Saccharomyces cerevisiae, and sonicated lipid vesicles are reported. {sup 31}P NMR studies demonstrate that there is interaction of the peptide with the phosphorus headgroups, and quasielastic light scattering (QLS) studies indicate that lipid vesicles increase in size upon addition of peptide. Previous solution (aqueous and DMSO) studies from this laboratory indicate that {alpha}-factor is highly flexible with only one long-lived identifiable structural feature, a type II {beta}-turn spanning the central portion of the peptide. Two-dimensional (2D) {sup 1}H nuclear Overhauser effect spectroscopy (NOESY) studies demonstrate a marked ordering of the peptide upon interaction with lipid, suggesting a compact N-terminus, in addition to a stabilized {beta}-turn. In contrast to these results in both solution and lipid environment, Wakamatsu et al. proposed a lipid environment conformation, on the basis of one-dimensional transferred NOE studies in D{sub 2}O, which does not include the {beta}-turn.

  20. A chloride capturing system via proton-induced structure transformation between opened- and closed-forms of dodecavanadates.

    PubMed

    Inoue, Yoshitaka; Kikukawa, Yuji; Kuwajima, Sho; Hayashi, Yoshihito

    2016-05-01

    Chloride-incorporated dodecavanadates show two distinct structures of the monoprotonated-form [HV12O32(Cl)](4-) (closed-V12) with a spherical closed-structure and the opened-form [V12O32(Cl)](5-) (opened-V12). The reaction of closed-V12 with a stoichiometric amount of ethylenediamine drives the structure transformation reaction to opened-V12, quantitatively. From time dependent observations of (51)V NMR, a tube-type intermediate [V12O32(Cl)](5-) (tube-V12) was observed in the transformation process. Isolation of the intermediate was achieved by the deprotonation reaction of closed-V12 with diethylamine, and the structure transformation was confirmed by using the isolated intermediate. The reverse transformation from opened-V12 to closed-V12 was also achieved by addition of trifluoroacetic acid. The geometrical difference between closed-V12 and opened-V12 is reflected in the reactivity difference to the external reagents, and this was demonstrated by examining the chloride removal reaction by using a silver cation. The incorporated chloride was preserved in the closed-V12 cage even in the presence of a silver cation. In contrast, the chloride in opened-V12 was removed as AgCl by the silver cation. In addition, by the reaction of chloride-free opened-V12 with a quantitative amount of {Et4N}Cl retrieved opened-V12, showing the capability of opened-V12 to recapture a guest chloride in the cavity. This transformation between two isomeric dodecavanadate structures is regarded as the movement of a molecular mitt to catch a ball and secure it.

  1. Sedimentation equilibrium of a small oligomer-forming membrane protein: effect of histidine protonation on pentameric stability.

    PubMed

    Surya, Wahyu; Torres, Jaume

    2015-04-02

    Analytical ultracentrifugation (AUC) can be used to study reversible interactions between macromolecules over a wide range of interaction strengths and under physiological conditions. This makes AUC a method of choice to quantitatively assess stoichiometry and thermodynamics of homo- and hetero-association that are transient and reversible in biochemical processes. In the modality of sedimentation equilibrium (SE), a balance between diffusion and sedimentation provides a profile as a function of radial distance that depends on a specific association model. Herein, a detailed SE protocol is described to determine the size and monomer-monomer association energy of a small membrane protein oligomer using an analytical ultracentrifuge. AUC-ES is label-free, only based on physical principles, and can be used on both water soluble and membrane proteins. An example is shown of the latter, the small hydrophobic (SH) protein in the human respiratory syncytial virus (hRSV), a 65-amino acid polypeptide with a single α-helical transmembrane (TM) domain that forms pentameric ion channels. NMR-based structural data shows that SH protein has two protonatable His residues in its transmembrane domain that are oriented facing the lumen of the channel. SE experiments have been designed to determine how pH affects association constant and the oligomeric size of SH protein. While the pentameric form was preserved in all cases, its association constant was reduced at low pH. These data are in agreement with a similar pH dependency observed for SH channel activity, consistent with a lumenal orientation of the two His residues in SH protein. The latter may experience electrostatic repulsion and reduced oligomer stability at low pH. In summary, this method is applicable whenever quantitative information on subtle protein-protein association changes in physiological conditions have to be measured.

  2. Weak charge form factor and radius of 208Pb through parity violation in electron scattering

    SciTech Connect

    Horowitz, C. J.; Ahmed, Z.; Jen, C. -M.; Rakhman, A.; Souder, P. A.; Dalton, M. M.; Liyanage, N.; Paschke, K. D.; Saenboonruang, K.; Silwal, R.; Franklin, G. B.; Friend, M.; Quinn, B.; Kumar, K. S.; McNulty, D.; Mercado, L.; Riordan, S.; Wexler, J.; Michaels, R. W.; Urciuoli, G. M.

    2012-03-26

    We use distorted wave electron scattering calculations to extract the weak charge form factor FW($\\bar{q}$), the weak charge radius RW, and the point neutron radius Rn, of 208Pb from the PREX parity violating asymmetry measurement. The form factor is the Fourier transform of the weak charge density at the average momentum transfer $\\bar{q}$ = 0.475 fm-1. We find FW($\\bar{q}$) = 0.204 ± 0.028(exp) ± 0.001(model). We use the Helm model to infer the weak radius from FW($\\bar{q}$). We find RW = 5.826 ± 0.181(exp) ± 0.027(model) fm. Here the exp error includes PREX statistical and systematic errors, while the model error describes the uncertainty in RW from uncertainties in the surface thickness σ of the weak charge density. The weak radius is larger than the charge radius, implying a 'weak charge skin' where the surface region is relatively enriched in weak charges compared to (electromagnetic) charges. We extract the point neutron radius Rn = 5.751 ± 0.175 (exp) ± 0.026(model) ± 0.005(strange) fm, from RW. Here there is only a very small error (strange) from possible strange quark contributions. We find Rn to be slightly smaller than RW because of the nucleon's size. As a result, we find a neutron skin thickness of Rn-Rp = 0.302 ± 0.175 (exp) ± 0.026 (model) ± 0.005 (strange) fm, where Rp is the point proton radius.

  3. Threshold pion production from proton-proton collisions

    SciTech Connect

    Lee, T.S.H.

    1995-08-01

    We showed that the threshold production of {pi}{sup 0}pp, {pi}{sup +}np, and {pi}{sup +}d from proton-proton collisions can be consistently described by a model consisting of pion s-wave rescattering and N{bar N} pair-terms of heavy-meson exchanges. The large difference between {sigma}{sup tot}(pp {yields} {pi}{sup +}d) and {sigma}{sup tot}(pp {yields} {pi}{sup +}np) is understood from the orthogonality of the deuteron and the np scattering wave functions. In a calculation using the Paris potential, we find that the data can be reproduced best by using a soft {pi}NN form factor with {Delta} = 650 MeV for a monopole form. This is consistent with our earlier studies of pion production in the A-excitation region. A paper describing this result was submitted for publication.

  4. Gravitational and higher-order form factors of the pion in chiral quark models

    SciTech Connect

    Broniowski, Wojciech; Arriola, Enrique Ruiz

    2008-11-01

    The gravitational form factor of the pion is evaluated in two chiral quark models and confronted with the recent full-QCD lattice data. We find good agreement for the case of the spectral quark model, which builds in the vector-meson dominance for the charge form factor. We derive a simple relation between the gravitational and electromagnetic form factors, holding in the considered quark models in the chiral limit. The relation implies that the gravitational mean squared radius is half the electromagnetic one. We also analyze higher-order quark generalized form factors of the pion, related to higher moments in the symmetric Bjorken X variable of the generalized parton distribution functions, and discuss their perturbative QCD evolution, which is needed to relate the quark-model predictions to the lattice data. The values of the higher-order quark form factors at t=0, computed on the lattice, also agree with our quark-model results within the statistical and method uncertainties.

  5. Flavor dependence of the pion and kaon form factors and parton distribution functions

    NASA Astrophysics Data System (ADS)

    Hutauruk, Parada T. P.; Cloët, Ian C.; Thomas, Anthony W.

    2016-09-01

    The separate quark flavor contributions to the pion and kaon valence quark distribution functions are studied, along with the corresponding electromagnetic form factors in the space-like region. The calculations are made using the solution of the Bethe-Salpeter equation for the model of Nambu and Jona-Lasinio with proper-time regularization. Both the pion and kaon form factors and the valence quark distribution functions reproduce many features of the available empirical data. The larger mass of the strange quark naturally explains the empirical fact that the ratio uK+(x ) /uπ+(x ) drops below unity at large x , with a value of approximately Mu2/Ms2 as x →1 . With regard to the elastic form factors we report a large flavor dependence, with the u -quark contribution to the kaon form factor being an order of magnitude smaller than that of the s -quark at large Q2, which may be a sensitive measure of confinement effects in QCD. Surprisingly though, the total K+ and π+ form factors differ by only 10%. In general we find that flavor breaking effects are typically around 20%.

  6. B → πℓ+ℓ- form factors reexamined in the whole kinematically accessible region

    NASA Astrophysics Data System (ADS)

    Li, Zuo-Hong; Si, Zong-Guo; Wang, Ying; Zhu, Nan

    2015-11-01

    We reexamine the B → πℓ+ℓ- (ℓ = e, μ, τ) form factors, f+B→π (q2), f0B→π (q2) and fTB→π (q2), in the entire region of the momentum transfer squared q2, by taking advantage of the complementarity between lattice QCD (LQCD) simulation and light cone sum rule approach (LCSR), and analyticity of the form factors. A LCSR calculation with a chiral current correlator, which could avoid pollution by twist-3 components, is performed at twist-2 next-to-leading order (NLO) accuracy, to determinate the form factor shapes in the small and intermediate q2 region. Further, fitting simultaneously the LCSR results for these form factors and the related LQCD ones (available or based on a SUF (3) symmetry breaking ansatz) to a Bourrely-Caprini-Lellouch (BCL) parametrization, we get a global understanding of their q2 behaviors. Our findings turn out to be consistent with the recent study by Ali, Parkhomenko and Rusov, and the resulting observation for the vector form factor provides support for the existing LQCD as well as LCSR predictions extrapolated to the entire kinematically accessible region.

  7. Nuclear modification factor for charged pions and protons at forward rapidity in central Au + Au collisions at 200 GeV

    NASA Astrophysics Data System (ADS)

    Brahms Collaboration; Arsene, I.; Bearden, I. G.; Beavis, D.; Besliu, C.; Budick, B.; Bøggild, H.; Chasman, C.; Christensen, C. H.; Christiansen, P.; Debbe, R.; Enger, E.; Gaardhøje, J. J.; Germinario, M.; Hagel, K.; Holm, A.; Ito, H.; Jipa, A.; Jundt, F.; Jørdre, J. I.; Jørgensen, C. E.; Karabowicz, R.; Kim, E. J.; Kozik, T.; Larsen, T. M.; Lee, J. H.; Lee, Y. K.; Lindal, S.; Lystad, G.; Løvhøiden, G.; Majka, Z.; Makeev, A.; Mikelsen, M.; Murray, M.; Natowitz, J.; Nielsen, B. S.; Ouerdane, D.; Płaneta, R.; Rami, F.; Ristea, C.; Ristea, O.; Röhrich, D.; Samset, B. H.; Sandberg, D.; Sanders, S. J.; Staszel, P.; Tveter, T. S.; Videbæk, F.; Wada, R.; Yang, H.; Yin, Z.; Zgura, I. S.

    2007-07-01

    We present spectra of charged pions and protons in 0 10% central Au + Au collisions at s=200 GeV at mid-rapidity (y=0) and forward pseudorapidity (η=2.2) measured with the BRAHMS experiment at RHIC. The spectra are compared to spectra from p+p collisions at the same energy scaled by the number of binary collisions. The resulting nuclear modification factors for central Au + Au collisions at both y=0 and η=2.2 exhibit suppression for charged pions but not for (anti-) protons at intermediate p. The p¯/π ratios have been measured up to p˜3 GeV/c at the two rapidities and the results indicate that a significant fraction of the charged hadrons produced at intermediate p range are (anti-) protons at both mid-rapidity and η=2.2.

  8. Nuclear modification factor for charged pions and protons at forward rapidity in central Au + Au collisions at 200 GeV

    NASA Astrophysics Data System (ADS)

    Arsene, I.; Bearden, I. G.; Beavis, D.; Besliu, C.; Budick, B.; Bøggild, H.; Chasman, C.; Christensen, C. H.; Christiansen, P.; Debbe, R.; Enger, E.; Gaardhøje, J. J.; Germinario, M.; Hagel, K.; Holm, A.; Ito, H.; Jipa, A.; Jundt, F.; Jørdre, J. I.; Jørgensen, C. E.; Karabowicz, R.; Kim, E. J.; Kozik, T.; Larsen, T. M.; Lee, J. H.; Lee, Y. K.; Lindal, S.; Lystad, G.; Løvhøiden, G.; Majka, Z.; Makeev, A.; Mikelsen, M.; Murray, M.; Natowitz, J.; Nielsen, B. S.; Ouerdane, D.; Płaneta, R.; Rami, F.; Ristea, C.; Ristea, O.; Röhrich, D.; Samset, B. H.; Sandberg, D.; Sanders, S. J.; Staszel, P.; Tveter, T. S.; Videbæk, F.; Wada, R.; Yang, H.; Yin, Z.; Zgura, I. S.; Brahms Collaboration

    2007-07-01

    We present spectra of charged pions and protons in 0-10% central Au + Au collisions at √{sNN} = 200 GeV at mid-rapidity (y = 0) and forward pseudorapidity (η = 2.2) measured with the BRAHMS experiment at RHIC. The spectra are compared to spectra from p + p collisions at the same energy scaled by the number of binary collisions. The resulting nuclear modification factors for central Au + Au collisions at both y = 0 and η = 2.2 exhibit suppression for charged pions but not for (anti-) protons at intermediate pT. The pbar /π- ratios have been measured up to pT ∼ 3 GeV / c at the two rapidities and the results indicate that a significant fraction of the charged hadrons produced at intermediate pT range are (anti-) protons at both mid-rapidity and η = 2.2.

  9. Proton NMR assignment and secondary structural elements of human transforming growth factor. alpha

    SciTech Connect

    Brown, S.C.; Mueller, L.; Jeffs, P.W. )

    1989-01-24

    The {sup 1}H NMR spectrum of human transforming growth factor {alpha} (hTGF-{alpha}) has been completely assigned, and secondary structural elements have been identified as a preliminary step in determining the structure of this protein by distance geometry methods. Many of these structural elements closely correspond to those previously found in a truncated human EGF and murine EGF. These include the presence of an antiparallel {beta}-sheet between residues G19 and C34 with a type I {beta}-turn at V25-D28, a type II {beta}-turn at H35-Y38, and another short {beta}-sheet between residues Y38-V39 and H45-A46.

  10. Helicobacter pylori virulence factors affecting gastric proton pump expression and acid secretion.

    PubMed

    Hammond, Charles E; Beeson, Craig; Suarez, Giovanni; Peek, Richard M; Backert, Steffen; Smolka, Adam J

    2015-08-01

    Acute Helicobacter pylori infection of gastric epithelial cells and human gastric biopsies represses H,K-ATPase α subunit (HKα) gene expression and inhibits acid secretion, causing transient hypochlorhydria and supporting gastric H. pylori colonization. Infection by H. pylori strains deficient in the cag pathogenicity island (cag PAI) genes cagL, cagE, or cagM, which do not transfer CagA into host cells or induce interleukin-8 secretion, does not inhibit HKα expression, nor does a cagA-deficient strain that induces IL-8. To test the hypothesis that virulence factors other than those mediating CagA translocation or IL-8 induction participate in HKα repression by activating NF-κB, AGS cells transfected with HKα promoter-Luc reporter constructs containing an intact or mutated NF-κB binding site were infected with wild-type H. pylori strain 7.13, isogenic mutants lacking cag PAI genes responsible for CagA translocation and/or IL-8 induction (cagA, cagζ, cagε, cagZ, and cagβ), or deficient in genes encoding two peptidoglycan hydrolases (slt and cagγ). H. pylori-induced AGS cell HKα promoter activities, translocated CagA, and IL-8 secretion were measured by luminometry, immunoblotting, and ELISA, respectively. Human gastric biopsy acid secretion was measured by microphysiometry. Taken together, the data showed that HKα repression is independent of IL-8 expression, and that CagA translocation together with H. pylori transglycosylases encoded by slt and cagγ participate in NF-κB-dependent HKα repression and acid inhibition. The findings are significant because H. pylori factors other than CagA and IL-8 secretion are now implicated in transient hypochlorhydria which facilitates gastric colonization and potential triggering of epithelial progression to neoplasia.

  11. The B {r{underscore}arrow} D*{ell}{nu} form factor at zero recoil

    SciTech Connect

    Simone, J.N.; Hashimoto, S.; El-Khadra, A.X.; Kronfeld, A.S.; Mackenzie, P.B.; Ryan, S.M.

    2000-01-26

    The authors describe a model independent lattice QCD method for determining the deviation from unity for h{sub A{sub 1}}, the B {r{underscore}arrow} D*{ell}{nu} form factor at zero recoil. They extend the double ratio method previously used to determine the B {r{underscore}arrow} D{ell}{nu} form factor. The bulk of statistical and systematic errors cancel in the double ratios they consider, yielding form factors which promise to reduce present theoretical uncertainties in the determination of {vert{underscore}bar}V{sub cb}{vert{underscore}bar}. They present results from a prototype calculation at a single lattice spacing corresponding to {beta} = 5.7.

  12. Form Factors and Wave Functions of Vector Mesons in Holographic QCD

    SciTech Connect

    Hovhannes R. Grigoryan; Anatoly V. Radyushkin

    2007-07-01

    Within the framework of a holographic dual model of QCD, we develop a formalism for calculating form factors of vector mesons. We show that the holographic bound states can be described not only in terms of eigenfunctions of the equation of motion, but also in terms of conjugate wave functions that are close analogues of quantum-mechanical bound state wave functions. We derive a generalized VMD representation for form factors, and find a very specific VMD pattern, in which form factors are essentially given by contributions due to the first two bound states in the Q^2-channel. We calculate electric radius of the \\rho-meson, finding the value < r_\\rho^2>_C = 0.53 fm^2.

  13. Master Integrals for Fermionic Contributions to Massless Three-Loop Form Factors

    SciTech Connect

    Heinrich, G.; Huber, T.; Maitre, D.

    2007-11-28

    In this letter we continue the calculation of master integrals for massless three-loop form factors by giving analytical results for those diagrams which are relevant for the fermionic contributions proportional to N{sub F}{sup 2}, N{sub F} {center_dot} N, and N{sub F}/N. Working in dimensional regularization, we express one of the diagrams in a closed form which is exact to all orders in {epsilon}, containing {Lambda}-functions and hypergeometric functions of unit argument. In all other cases we derive multiple Mellin-Barnes representations from which the coefficients of the Laurent expansion in {epsilon} are extracted in an analytical form. To obtain the finite part of the three-loop quark and gluon form factors, all coefficients through transcendentality six in the Riemann {zeta}-function have to be included.

  14. Research on design method of the full form ship with minimum thrust deduction factor

    NASA Astrophysics Data System (ADS)

    Zhang, Bao-ji; Miao, Ai-qin; Zhang, Zhu-xin

    2015-04-01

    In the preliminary design stage of the full form ships, in order to obtain a hull form with low resistance and maximum propulsion efficiency, an optimization design program for a full form ship with the minimum thrust deduction factor has been developed, which combined the potential flow theory and boundary layer theory with the optimization technique. In the optimization process, the Sequential Unconstrained Minimization Technique (SUMT) interior point method of Nonlinear Programming (NLP) was proposed with the minimum thrust deduction factor as the objective function. An appropriate displacement is a basic constraint condition, and the boundary layer separation is an additional one. The parameters of the hull form modification function are used as design variables. At last, the numerical optimization example for lines of after-body of 50000 DWT product oil tanker was provided, which indicated that the propulsion efficiency was improved distinctly by this optimal design method.

  15. Constraints on the ωπ form factor from analyticity and unitarity

    NASA Astrophysics Data System (ADS)

    Ananthanarayan, B.; Caprini, Irinel; Kubis, Bastian

    2016-05-01

    Form factors are important low-energy quantities and an accurate knowledge of these sheds light on the strong interactions. A variety of methods based on general principles have been developed to use information known in different energy regimes to constrain them in regions where experimental information needs to be tested precisely. Here we review our recent work on the electromagnetic ωπ form factor in a model-independent framework known as the method of unitarity bounds, partly motivated by the discrepancies noted recently between the theoretical calculations of the form factor based on dispersion relations and certain experimental data measured from the decay ω → π0γ∗. We have applied a modified dispersive formalism, which uses as input the discontinuity of the ωπ form factor calculated by unitarity below the ωπ threshold and an integral constraint on the square of its modulus above this threshold. The latter constraint was obtained by exploiting unitarity and the positivity of the spectral function of a QCD correlator, computed on the spacelike axis by operator product expansion and perturbative QCD. An alternative constraint is obtained by using data available at higher energies for evaluating an integral of the modulus squared with a suitable weight function. From these conditions we derived upper and lower bounds on the modulus of the ωπ form factor in the region below the ωπ threshold. The results confirm the existence of a disagreement between dispersion theory and experimental data on the ωπ form factor around 0.6 GeV, including those from NA60 published in 2016.

  16. A form-factor method for determining the structure of distorted stars

    NASA Technical Reports Server (NTRS)

    Wolfe, R. H., Jr.; Kern, J. W.

    1979-01-01

    The equilibrium equations of a uniformly rotating and tidally distorted star are reduced to the same form as for a spherical star except for the inclusion of two form factors. One factor, expressing the buoyancy effects of centrifugal force, is determined directly from the integrated structure variables. The other factor, expressing the deviation from spherical shape, is shown to be relatively insensitive to errors in the assumed shape, so that accurate solutions are obtained in spite of the use of an a priori shape. The method is employed by adding computations for the factors to an existing spherical model program. Upper Main Sequence models determined by this method compare closely with results from the double approximation method even for critical rotation and tidal distortion.

  17. JLab measurement of the 4He charge form factor at large momentum transfers.

    PubMed

    Camsonne, A; Katramatou, A T; Olson, M; Sparveris, N; Acha, A; Allada, K; Anderson, B D; Arrington, J; Baldwin, A; Chen, J-P; Choi, S; Chudakov, E; Cisbani, E; Craver, B; Decowski, P; Dutta, C; Folts, E; Frullani, S; Garibaldi, F; Gilman, R; Gomez, J; Hahn, B; Hansen, J-O; Higinbotham, D W; Holmstrom, T; Huang, J; Iodice, M; Jiang, X; Kelleher, A; Khrosinkova, E; Kievsky, A; Kuchina, E; Kumbartzki, G; Lee, B; LeRose, J J; Lindgren, R A; Lott, G; Lu, H; Marcucci, L E; Margaziotis, D J; Markowitz, P; Marrone, S; Meekins, D; Meziani, Z-E; Michaels, R; Moffit, B; Norum, B; Petratos, G G; Puckett, A; Qian, X; Rondon, O; Saha, A; Sawatzky, B; Segal, J; Shabestari, M; Shahinyan, A; Solvignon, P; Subedi, R R; Suleiman, R; Sulkosky, V; Urciuoli, G M; Viviani, M; Wang, Y; Wojtsekhowski, B B; Yan, X; Yao, H; Zhang, W-M; Zheng, X; Zhu, L

    2014-04-01

    The charge form factor of 4He has been extracted in the range 29  fm(-2) ≤ Q2 ≤ 77  fm(-2) from elastic electron scattering, detecting 4He recoil nuclei and electrons in coincidence with the high resolution spectrometers of the Hall A Facility of Jefferson Lab. The measurements have uncovered a second diffraction minimum for the form factor, which was predicted in the Q2 range of this experiment. The data are in qualitative agreement with theoretical calculations based on realistic interactions and accurate methods to solve the few-body problem. PMID:24745410

  18. Hyperon elastic electromagnetic form factors in the space-like momentum region

    NASA Astrophysics Data System (ADS)

    Sanchis-Alepuz, Hèlios; Fischer, Christian S.

    2016-02-01

    We present a calculation of the electric and magnetic form factors of ground-state octet and decuplet baryons including strange quarks. We work with a combination of Dyson-Schwinger equations for the quark propagator and covariant Bethe-Salpeter equations describing baryons as bound states of three (non-perturbative) quarks. Our form factors for the octet baryons are in good agreement with corresponding lattice data at finite Q2; deviations in some isospin channels for the magnetic moments can be explained by missing meson cloud effects. At larger Q2 our quark core calculation has predictive power for both, the octet and decuplet baryons.

  19. The η (η‧) gamma transition form factor and the gluon-gluon distribution amplitude

    NASA Astrophysics Data System (ADS)

    Kroll, P.; Passek-Kumerički, K.

    2013-07-01

    The ηγ and η‧γ transition form factors are analyzed to leading-twist accuracy and next-to-leading order of perturbative QCD. Using an η-η‧ mixing scheme and all currently available experimental data the lowest Gegenbauer coefficients of the distribution amplitudes for the valence octet and singlet q\\bar{q} and the gluon-gluon Fock components are extracted. Predictions for the g*g*η‧ vertex function are presented. We also comment on the new BELLE results for the πγ transition form factor.

  20. Pion-photon transition form factor in light-cone sum rules

    SciTech Connect

    Pimikov, A. V.; Bakulev, A. P.; Mikhailov, S. V.; Stefanis, N. G.

    2012-10-23

    We extract constraints on the pion distribution amplitude from available data on the pionphoton transition form factor in the framework of light-cone sum rules. A pronounced discrepancy (2.7 - 3){sigma} between the Gegenbauer expansion coefficients extracted from the CELLO, CLEO, and Belle experimental data relative to those from BaBar is found. Predictions for the pion-photon transition form factor are presented by employing a pion distribution amplitude obtained long ago from QCD sum rules with nonlocal condensates. These predictions comply with the Belle data but disagree with those of BaBar beyond 9 GeV{sup 2}.

  1. Analysis of the J /ψ →π0γ* transition form factor

    NASA Astrophysics Data System (ADS)

    Kubis, Bastian; Niecknig, Franz

    2015-02-01

    In view of the first measurement of the branching fraction for J /ψ →π0e+e- by the BESIII collaboration, we analyze what can be learned on the corresponding transition form factor using dispersion theory. We show that light-quark degrees of freedom dominate the spectral function, in particular two-pion intermediate states. Estimating the effects of multipion states as well as charmonium, we arrive at a prediction for the complete form factor that should be scrutinized experimentally in the future.

  2. Measurement of the γγ*→π0 transition form factor

    NASA Astrophysics Data System (ADS)

    Aubert, B.; Karyotakis, Y.; Lees, J. P.; Poireau, V.; Prencipe, E.; Prudent, X.; Tisserand, V.; Garra Tico, J.; Grauges, E.; Martinelli, M.; Palano, A.; Pappagallo, M.; Eigen, G.; Stugu, B.; Sun, L.; Battaglia, M.; Brown, D. N.; Kerth, L. T.; Kolomensky, Yu. G.; Lynch, G.; Osipenkov, I. L.; Tackmann, K.; Tanabe, T.; Hawkes, C. M.; Soni, N.; Watson, A. T.; Koch, H.; Schroeder, T.; Asgeirsson, D. J.; Fulsom, B. G.; Hearty, C.; Mattison, T. S.; McKenna, J. A.; Barrett, M.; Khan, A.; Randle-Conde, A.; Blinov, V. E.; Bukin, A. D.; Buzykaev, A. R.; Druzhinin, V. P.; Golubev, V. B.; Onuchin, A. P.; Serednyakov, S. I.; Skovpen, Yu. I.; Solodov, E. P.; Todyshev, K. Yu.; Bondioli, M.; Curry, S.; Eschrich, I.; Kirkby, D.; Lankford, A. J.; Lund, P.; Mandelkern, M.; Martin, E. C.; Stoker, D. P.; Atmacan, H.; Gary, J. W.; Liu, F.; Long, O.; Vitug, G. M.; Yasin, Z.; Zhang, L.; Sharma, V.; Campagnari, C.; Hong, T. M.; Kovalskyi, D.; Mazur, M. A.; Richman, J. D.; Beck, T. W.; Eisner, A. M.; Heusch, C. A.; Kroseberg, J.; Lockman, W. S.; Martinez, A. J.; Schalk, T.; Schumm, B. A.; Seiden, A.; Wang, L.; Winstrom, L. O.; Cheng, C. H.; Doll, D. A.; Echenard, B.; Fang, F.; Hitlin, D. G.; Narsky, I.; Piatenko, T.; Porter, F. C.; Andreassen, R.; Mancinelli, G.; Meadows, B. T.; Mishra, K.; Sokoloff, M. D.; Bloom, P. C.; Ford, W. T.; Gaz, A.; Hirschauer, J. F.; Nagel, M.; Nauenberg, U.; Smith, J. G.; Wagner, S. R.; Ayad, R.; Toki, W. H.; Wilson, R. J.; Feltresi, E.; Hauke, A.; Jasper, H.; Karbach, T. M.; Merkel, J.; Petzold, A.; Spaan, B.; Wacker, K.; Kobel, M. J.; Nogowski, R.; Schubert, K. R.; Schwierz, R.; Volk, A.; Bernard, D.; Latour, E.; Verderi, M.; Clark, P. J.; Playfer, S.; Watson, J. E.; Andreotti, M.; Bettoni, D.; Bozzi, C.; Calabrese, R.; Cecchi, A.; Cibinetto, G.; Fioravanti, E.; Franchini, P.; Luppi, E.; Munerato, M.; Negrini, M.; Petrella, A.; Piemontese, L.; Santoro, V.; Baldini-Ferroli, R.; Calcaterra, A.; de Sangro, R.; Finocchiaro, G.; Pacetti, S.; Patteri, P.; Peruzzi, I. M.; Piccolo, M.; Rama, M.; Zallo, A.; Contri, R.; Guido, E.; Lo Vetere, M.; Monge, M. R.; Passaggio, S.; Patrignani, C.; Robutti, E.; Tosi, S.; Chaisanguanthum, K. S.; Morii, M.; Adametz, A.; Marks, J.; Schenk, S.; Uwer, U.; Bernlochner, F. U.; Klose, V.; Lacker, H. M.; Bard, D. J.; Dauncey, P. D.; Tibbetts, M.; Behera, P. K.; Charles, M. J.; Mallik, U.; Cochran, J.; Crawley, H. B.; Dong, L.; Eyges, V.; Meyer, W. T.; Prell, S.; Rosenberg, E. I.; Rubin, A. E.; Gao, Y. Y.; Gritsan, A. V.; Guo, Z. J.; Arnaud, N.; Béquilleux, J.; D'Orazio, A.; Davier, M.; Derkach, D.; Firmino da Costa, J.; Grosdidier, G.; Le Diberder, F.; Lepeltier, V.; Lutz, A. M.; Malaescu, B.; Pruvot, S.; Roudeau, P.; Schune, M. H.; Serrano, J.; Sordini, V.; Stocchi, A.; Wormser, G.; Lange, D. J.; Wright, D. M.; Bingham, I.; Burke, J. P.; Chavez, C. A.; Fry, J. R.; Gabathuler, E.; Gamet, R.; Hutchcroft, D. E.; Payne, D. J.; Touramanis, C.; Bevan, A. J.; Clarke, C. K.; di Lodovico, F.; Sacco, R.; Sigamani, M.; Cowan, G.; Paramesvaran, S.; Wren, A. C.; Brown, D. N.; Davis, C. L.; Denig, A. G.; Fritsch, M.; Gradl, W.; Hafner, A.; Alwyn, K. E.; Bailey, D.; Barlow, R. J.; Jackson, G.; Lafferty, G. D.; West, T. J.; Yi, J. I.; Anderson, J.; Chen, C.; Jawahery, A.; Roberts, D. A.; Simi, G.; Tuggle, J. M.; Dallapiccola, C.; Salvati, E.; Saremi, S.; Cowan, R.; Dujmic, D.; Fisher, P. H.; Henderson, S. W.; Sciolla, G.; Spitznagel, M.; Yamamoto, R. K.; Zhao, M.; Patel, P. M.; Robertson, S. H.; Schram, M.; Lazzaro, A.; Lombardo, V.; Palombo, F.; Stracka, S.; Bauer, J. M.; Cremaldi, L.; Godang, R.; Kroeger, R.; Sonnek, P.; Summers, D. J.; Zhao, H. W.; Simard, M.; Taras, P.; Nicholson, H.; de Nardo, G.; Lista, L.; Monorchio, D.; Onorato, G.; Sciacca, C.; Raven, G.; Snoek, H. L.; Jessop, C. P.; Knoepfel, K. J.; Losecco, J. M.; Wang, W. F.; Corwin, L. A.; Honscheid, K.; Kagan, H.; Kass, R.; Morris, J. P.; Rahimi, A. M.; Regensburger, J. J.; Sekula, S. J.; Wong, Q. K.; Blount, N. L.; Brau, J.; Frey, R.; Igonkina, O.; Kolb, J. A.; Lu, M.; Rahmat, R.; Sinev, N. B.; Strom, D.; Strube, J.; Torrence, E.; Castelli, G.; Gagliardi, N.; Margoni, M.; Morandin, M.; Posocco, M.; Rotondo, M.; Simonetto, F.; Stroili, R.; Voci, C.; Del Amo Sanchez, P.; Ben-Haim, E.; Bonneaud, G. R.; Briand, H.; Chauveau, J.; Hamon, O.; Leruste, Ph.; Marchiori, G.; Ocariz, J.; Perez, A.; Prendki, J.; Sitt, S.; Gladney, L.; Biasini, M.; Manoni, E.; Angelini, C.; Batignani, G.; Bettarini, S.; Calderini, G.; Carpinelli, M.; Cervelli, A.; Forti, F.; Giorgi, M. A.; Lusiani, A.; Morganti, M.; Neri, N.; Paoloni, E.; Rizzo, G.; Walsh, J. J.; Lopes Pegna, D.; Lu, C.; Olsen, J.; Smith, A. J. S.; Telnov, A. V.; Anulli, F.; Baracchini, E.; Cavoto, G.; Faccini, R.; Ferrarotto, F.; Ferroni, F.; Gaspero, M.; Jackson, P. D.; Li Gioi, L.; Mazzoni, M. A.; Morganti, S.; Piredda, G.; Renga, F.; Voena, C.; Ebert, M.; Hartmann, T.; Schröder, H.; Waldi, R.; Adye, T.; Franek, B.; Olaiya, E. O.; Wilson, F. F.; Emery, S.; Esteve, L.; Hamel de Monchenault, G.; Kozanecki, W.; Vasseur, G.; Yèche, Ch.; Zito, M.; Allen, M. T.; Aston, D.; Bartoldus, R.; Benitez, J. F.; Cenci, R.; Coleman, J. P.; Convery, M. R.; Dingfelder, J. C.; Dorfan, J.; Dubois-Felsmann, G. P.; Dunwoodie, W.; Field, R. C.; Franco Sevilla, M.; Gabareen, A. M.; Graham, M. T.; Grenier, P.; Hast, C.; Innes, W. R.; Kaminski, J.; Kelsey, M. H.; Kim, H.; Kim, P.; Kocian, M. L.; Leith, D. W. G. S.; Li, S.; Lindquist, B.; Luitz, S.; Luth, V.; Lynch, H. L.; Macfarlane, D. B.; Marsiske, H.; Messner, R.; Muller, D. R.; Neal, H.; Nelson, S.; O'Grady, C. P.; Ofte, I.; Perl, M.; Ratcliff, B. N.; Roodman, A.; Salnikov, A. A.; Schindler, R. H.; Schwiening, J.; Snyder, A.; Su, D.; Sullivan, M. K.; Suzuki, K.; Swain, S. K.; Thompson, J. M.; Va'Vra, J.; Wagner, A. P.; Weaver, M.; West, C. A.; Wisniewski, W. J.; Wittgen, M.; Wright, D. H.; Wulsin, H. W.; Yarritu, A. K.; Young, C. C.; Ziegler, V.; Chen, X. R.; Liu, H.; Park, W.; Purohit, M. V.; White, R. M.; Wilson, J. R.; Burchat, P. R.; Edwards, A. J.; Miyashita, T. S.; Ahmed, S.; Alam, M. S.; Ernst, J. A.; Pan, B.; Saeed, M. A.; Zain, S. B.; Soffer, A.; Spanier, S. M.; Wogsland, B. J.; Eckmann, R.; Ritchie, J. L.; Ruland, A. M.; Schilling, C. J.; Schwitters, R. F.; Wray, B. C.; Drummond, B. W.; Izen, J. M.; Lou, X. C.; Bianchi, F.; Gamba, D.; Pelliccioni, M.; Bomben, M.; Bosisio, L.; Cartaro, C.; Della Ricca, G.; Lanceri, L.; Vitale, L.; Azzolini, V.; Lopez-March, N.; Martinez-Vidal, F.; Milanes, D. A.; Oyanguren, A.; Albert, J.; Banerjee, Sw.; Bhuyan, B.; Choi, H. H. F.; Hamano, K.; King, G. J.; Kowalewski, R.; Lewczuk, M. J.; Nugent, I. M.; Roney, J. M.; Sobie, R. J.; Gershon, T. J.; Harrison, P. F.; Ilic, J.; Latham, T. E.; Mohanty, G. B.; Puccio, E. M. T.; Band, H. R.; Chen, X.; Dasu, S.; Flood, K. T.; Pan, Y.; Prepost, R.; Vuosalo, C. O.; Wu, S. L.

    2009-09-01

    We study the reaction e+e-→e+e-π0 in the single tag mode and measure the differential cross section dσ/dQ2 and the γγ*→π0 transition form factor in the momentum transfer range from 4 to 40GeV2. At Q2>10GeV2 the measured form factor exceeds the asymptotic limit predicted by perturbative QCD. The analysis is based on 442fb-1 of integrated luminosity collected at PEP-II with the BABAR detector at e+e- center-of-mass energies near 10.6 GeV.

  3. Computation of form factors in massless QCD with finite master integrals

    NASA Astrophysics Data System (ADS)

    von Manteuffel, Andreas; Panzer, Erik; Schabinger, Robert M.

    2016-06-01

    We present the bare one-, two-, and three-loop form factors in massless quantum chromodynamics as linear combinations of finite master integrals. Using symbolic integration, we compute their ɛ expansions and thereby reproduce all known results with an independent method. Remarkably, in our finite basis, only integrals with a less-than-maximal number of propagators contribute to the cusp anomalous dimensions. We report on indications of this phenomenon at four loops, including the result for a finite, irreducible, twelve-propagator form factor integral. Together with this article, we provide our automated software setup for the computation of finite master integrals.

  4. Identification and characterisation of a G-quadruplex forming sequence in the promoter region of nuclear factor (erythroid-derived 2)-like 2 (Nrf2)

    SciTech Connect

    Waller, Zoë A.E. Howell, Lesley A.; MacDonald, Colin J.; O’Connell, Maria A.; Searcey, Mark

    2014-04-25

    Highlights: • Discovery of a G-quadruplex forming sequence in the promoter sequence of Nrf2. • Characterisation of the G-quadruplex by UV, CD and NMR. • Conformational switching of G-quadruplex induced by 9-aminoacridine. - Abstract: The transcription factor nuclear factor (erythroid-derived 2)-like 2 (Nrf2) regulates multiple antioxidants, Phase II detoxification enzymes and other cytoprotective enzymes in cells. Activation of Nrf2 is recognised as being of potential therapeutic benefit in inflammatory-diseases whereas more recently, it has become clear that the inhibition of Nrf2 may have benefit in the alleviation of resistance in some tumour types. A potential G-quadruplex forming sequence was identified in the promoter region of Nrf2, close to a number of putative transcription factor binding sites. Characterisation of the sequence 5’-d[GGGAAGGGAGCAAGGGCGGGAGGG]-3’ using CD spectroscopy, imino proton NMR resonances and UV melting experiments demonstrated the formation of a parallel intramolecular G-quadruplex in the presence of K{sup +} ions. Incubation with 9-aminoacridine ligands induced a switch from antiparallel to parallel forms. The presence of a G-quadruplex forming sequence in the promoter region of Nrf2 suggests an approach to targeting the production of the protein through stabilisation of the structure, thereby avoiding resistance to antitumour drugs.

  5. A framework for the calculation of the ΔNγ* transition form factors on the lattice

    NASA Astrophysics Data System (ADS)

    Agadjanov, Andria; Bernard, Véronique; Meißner, Ulf-G.; Rusetsky, Akaki

    2014-09-01

    Using the non-relativistic effective field theory framework in a finite volume, we discuss the extraction of the ΔNγ* transition form factors from lattice data. A counterpart of the Lüscher approach for the matrix elements of unstable states is formulated. In particular, we thoroughly discuss various kinematic settings, which are used in the calculation of the above matrix element on the lattice. The emerging Lüscher-Lellouch factor and the analytic continuation of the matrix elements into the complex plane are also considered in detail. A full group-theoretical analysis of the problem is made, including the partial-wave mixing and projecting out the invariant form factors from data. In Refs. [39,40], an elastic resonance form factor (an example: the electromagnetic form factor ΔΔγ*) has been considered. In this paper, we address transition form factors, in particular, ΔNγ* that is more interesting from the phenomenological point of view. It turns out that the presence of one stable particle in the out-state (here, the nucleon) leads to crucial simplifications. As we shall demonstrate, the finite fixed points do not exist in this case, so the measurement of a single energy level (albeit at several volumes) will suffice. We shall discuss in detail various lattice settings, which provide an access to the measurement of the form factor. All particles and currents, considered in Refs. [39,40], were scalar. On the other hand, the particles, whose form factors we want to calculate, have spin. In this paper, we consider the inclusion of spin into the formalism and carry out a full group-theoretical analysis of the obtained equations along the lines described in Ref. [16]. The paper is organized as follows. In Section 2, we start from defining the resonance form factor in the infinite volume and discuss the analytic continuation into the complex plane. The projection of various scalar form factors will be considered. In Section 3 we consider the kinematics, which

  6. Clean measurements of the nucleon axial-vector and free-neutron magnetic form factors

    NASA Astrophysics Data System (ADS)

    Deur, A.

    2013-11-01

    We discuss the feasibility of a weak charged current experiment using a low energy electron beam. A first goal is to measure the Q2 dependence of the axial-vector form factor ga(Q2). It can be measured model-independently and as robustly as for electromagnetic form factors from typical electron scattering experiments, in contrast to the methods used so far to measure ga(Q2). If ga(Q2) follows a dipole form, the axial mass can be extracted with a better accuracy than the world data altogether. The most important detection equipment would be a segmented neutron detector with good momentum and angular resolution that is symmetric about the beam direction, and covers a moderate angular range. A high intensity beam (100 uA) is necessary. Beam polarization is highly desirable as it provides a clean measurement of the backgrounds. Beam energies between 70 and 110 MeV are ideal. This range would provide a Q2 mapping of ga between 0.01 form factor GMn. The experiment employs the usual techniques of electron-nucleon scattering and presents no special difficulty. Higher energy extensions are possible. They could yield measurements of ga(Q2) up to Q2=3 GeV2 and the possibility to access other form factors, such as the almost unknown pseudoscalar form factor gP. However, the experiments become much more challenging as soon as beam energies pass the pion production threshold.

  7. Measuring the axial form factor of {sup 3}He using weak capture of polarized electrons

    SciTech Connect

    Dutta, D.

    2013-11-07

    A low energy, high intensity polarized electron beam could enable the extraction of the A=3 weak axial form factors F{sub A} using the reaction →e+{sup 3}He→{sup 3}H+ν. These form factors have never been measured before. We discuss the feasibility of such an experiment using a small toroidal magnet and a radial low energy recoil detector to tag the recoil tritons. A moderately high intensity polarized electron beam (>500 μA) with beam energies between 50 - 150 MeV is necessary for the cross section measurement and to provides a free clean measurement of the background. Moreover, in addition to the cross section, by measuring the electron spin and recoil triton correlation coefficient it may be possible to search for second class currents and to extract the ratio of the axial to the vector form factor of the nucleon. Such novel electron scattering based measurements would have a completely different set of systematic uncertainties compared to polarized neutron beta decay, neutrino scattering and muon capture experiments which are typically used to extract the weak form-factors.

  8. Form factor dispersion at La M5,4 edges and average density of resonant atoms.

    PubMed

    Smadici, S; Lee, J C T; Logvenov, G; Bozovic, I; Abbamonte, P

    2014-01-15

    Resonant soft x-ray scattering on complex oxide superlattices shows very large variations in the superlattice reflection position and intensity near La M5,4 edges. Resonant dispersion of the La x-ray form factor describes the observations well. We determine the average density of resonant La atoms and the thickness of superlattice layers. PMID:24318961

  9. A small-form-factor piezoelectric vibration energy harvester using a resonant frequency-down conversion

    SciTech Connect

    Sun, Kyung Ho; Kim, Young-Cheol; Kim, Jae Eun

    2014-10-15

    While environmental vibrations are usually in the range of a few hundred Hertz, small-form-factor piezoelectric vibration energy harvesters will have higher resonant frequencies due to the structural size effect. To address this issue, we propose a resonant frequency-down conversion based on the theory of dynamic vibration absorber for the design of a small-form-factor piezoelectric vibration energy harvester. The proposed energy harvester consists of two frequency-tuned elastic components for lowering the first resonant frequency of an integrated system but is so configured that an energy harvesting beam component is inverted with respect to the other supporting beam component for a small form factor. Furthermore, in order to change the unwanted modal characteristic of small separation of resonant frequencies, as is the case with an inverted configuration, a proof mass on the supporting beam component is slightly shifted toward a second proof mass on the tip of the energy harvesting beam component. The proposed small-form-factor design capability was experimentally verified using a fabricated prototype with an occupation volume of 20 × 39 × 6.9 mm{sup 3}, which was designed for a target frequency of as low as 100 Hz.

  10. Constraints on the form factors for K ---> pi l nu and implications for |V(us)|

    SciTech Connect

    Hill, Richard J.; /Fermilab

    2006-07-01

    Rigorous bounds are established for the expansion coefficients governing the shape of semileptonic K {yields} {pi} form factors. The constraints enforced by experimental data from {tau} {yields} K{pi}{nu} eliminate uncertainties associated with model parameterizations in the determination of |V{sub us}|. The results support the validity of a powerful expansion that can be applied to other semileptonic transitions.

  11. Structure of the neutral pion and its electromagnetic transition form factor

    NASA Astrophysics Data System (ADS)

    Raya, Khépani; Chang, Lei; Bashir, Adnan; Cobos-Martinez, J. Javier; Gutiérrez-Guerrero, L. Xiomara; Roberts, Craig D.; Tandy, Peter C.

    2016-04-01

    The γ*γ →π0 transition form factor, G (Q2), is computed on the entire domain of spacelike momenta using a continuum approach to the two valence body bound-state problem in relativistic quantum field theory: the result agrees with data obtained by the CELLO, CLEO, and Belle Collaborations. The analysis unifies this prediction with that of the pion's valence-quark parton distribution amplitude (PDA) and elastic electromagnetic form factor and demonstrates, too, that a fully self-consistent treatment can readily connect a pion PDA that is a broad, concave function at the hadronic scale with the perturbative QCD prediction for the transition form factor in the hard photon limit. The normalization of that limit is set by the scale of dynamical chiral symmetry breaking, which is a crucial feature of the Standard Model. Understanding of the latter will thus remain incomplete until definitive transition form factor data are available on Q2>10 GeV2 .

  12. Nonperturbative study of the 't Hooft-Polyakov monopole form factors

    NASA Astrophysics Data System (ADS)

    Rajantie, Arttu; Weir, David J.

    2012-01-01

    The mass and interactions of a quantum ’t Hooft-Polyakov monopole are measured nonperturbatively using correlation functions in lattice Monte Carlo simulations. A method of measuring the form factors for interactions between the monopole and fundamental particles, such as the photon, is demonstrated. These quantities are potentially of experimental relevance in searches for magnetic monopoles.

  13. The charge form factor of pseudoscalar mesons in a relativistic constituent quark model

    SciTech Connect

    Cardarelli, F.; Pace, E.; Grach, I.L.

    1994-04-01

    The charge form factor of pseudoscalar mesons has been investigated in the light-cone formalism, up to Q{sup 2} relevant to CEBAF energies. The consequences of adopting the meson wave functions generated through the Godfrey-Isgur q{bar q} potential, which reproduces the mass spectra, are discussed.

  14. Measurement of real and imaginary form factors of silver atom using a high resolution HPGe detector.

    PubMed

    Krishnananda; Niranjana, K M; Badiger, N M

    2013-01-01

    The real and imaginary form factors of silver atom have been determined by using EDXRF method. The K x-ray photons in the energy range from 8.62 keV to 52.18 keV are generated by sending 59.56 keV gamma photons from ^{241}Am radioactive source on various targets. These K x-ray photons are transmitted through silver foils of suitable thickness. The incident and transmitted K x-ray photon intensities have been measured with a high resolution HPGe detector which is coupled to 16K MCA. The photoelectric cross sections at different K x-ray energies have been determined by measuring the intensities of the incident and transmitted x-ray photons. From these photoelectric cross section values, the imaginary form factors and the real form factors have been determined at various photon energies. Measured imaginary and real form factor values have been compared with theoretical values predicted by XCOM [23] and FFAST [24].

  15. SU-E-T-72: Commissioning of a Standardized SRS Cone Set: Determination of the Bolus Gap Factors in a Passively Scattered Proton Beam

    SciTech Connect

    Simpson, R; Gordon, I; Ghebremedhin, A; Wroe, A; Schulte, R; Bush, D; Slater, J; Patyal, B

    2014-06-01

    Purpose: To determine the proton output factors for an SRS cone set using standardized apertures and varied range compensators (bolus blanks); specifically, to determine the best method for modeling the bolus gap factor (BGF) and eliminate the need for patient specific calibrations. Methods: A Standard Imaging A-16 chamber was placed in a Plastic Water phantom to measure the change in dose/MU with different treatment combinations for a proton SRS cone, using standardized apertures and range compensators. Measurements were made with all apertures in the SRS cone set, with four different range compensator thicknesses and five different air gaps between the end of the SRS cone and the surface of the phantom. The chamber was located at iso-center and maintained at a constant depth at the center of modulation for all measurements. Each aperture was placed in the cone to measure the change in MU needed to maintain constant dose at the chamber, as the air gap was increased with different thicknesses of bolus. Results: The dose/MU varied significantly with decreasing aperture size, increasing bolus thickness, or increasing air gap. The measured data was fitted with the lowest order polynomials that accurately described the data, to create a model for determining the change in output for any potential combination of devices used to treat a patient. For a given standardized aperture, the BGF could be described by its constituent factors: the bolus thickness factor (BTF) and the nozzle extension factor (NEF). Conclusion: The methods used to model the dose at the calibration point could be used to accurately predict the change in output for SRS proton beams due to the BGF, eliminating the need for patient specific calibrations. This method for modeling SRS treatments could also be applied to model other treatments using passively scattered proton beams.

  16. QCD corrections to B → π form factors from light-cone sum rules

    NASA Astrophysics Data System (ADS)

    Wang, Yu-Ming; Shen, Yue-Long

    2015-09-01

    We compute perturbative corrections to B → π form factors from QCD light-cone sum rules with B-meson distribution amplitudes. Applying the method of regions we demonstrate factorization of the vacuum-to-B-meson correlation function defined with an interpolating current for pion, at one-loop level, explicitly in the heavy quark limit. The short-distance functions in the factorization formulae of the correlation function involves both hard and hard-collinear scales; and these functions can be further factorized into hard coefficients by integrating out the hard fluctuations and jet functions encoding the hard-collinear information. Resummation of large logarithms in the short-distance functions is then achieved via the standard renormalization-group approach. We further show that structures of the factorization formulae for fBπ+ (q2) and fBπ0 (q2) at large hadronic recoil from QCD light-cone sum rules match that derived in QCD factorization. In particular, we perform an exploratory phenomenological analysis of B → π form factors, paying attention to various sources of perturbative and systematic uncertainties, and extract |Vub | = (3.05-0.38+0.54|th. ± 0.09|exp.) ×10-3 with the inverse moment of the B-meson distribution amplitude ϕB+ (ω) determined by reproducing fBπ+ (q2 = 0) obtained from the light-cone sum rules with π distribution amplitudes. Furthermore, we present the invariant-mass distributions of the lepton pair for B → πℓνℓ (ℓ = μ, τ) in the whole kinematic region. Finally, we discuss non-valence Fock state contributions to the B → π form factors fBπ+ (q2) and fBπ0 (q2) in brief.

  17. The effect of intramolecular H-bonds on the aqueous solution continuum description of the N-protonated form of dopamine

    NASA Astrophysics Data System (ADS)

    Alagona, Giuliano; Ghio, Caterina

    1996-04-01

    The conformational properties in vacuo and in solution of N-protonated dopamine have been studied making use of ab initio SCF calculations in vacuo and free energy calculations in aqueous solution, in the framework of the polarizable continuum model (PCM), on the STO-3G, 4-31G and 6-31G ∗ optimized geometries obtained in vacuo. The in vacuo energy profiles along a few sections of the potential energy surface turn out to be very close for the extended basis sets, while the STO-3G eresults are slightly dispalced. The largest difference between the minimal and the extended basis sets is found for the perpendicular arrangement, which is however the lowest energy profile with low barriers to the CCCN rotation both invacuo and in solution. The solvent stabilizes the trans over the gauche rotamers. Teh conformers without intramolecular H-bond between the -OH side chains are favored by the solvent, which makes the planar i, anti conformers as stable as the corresponding conformers with an intramolecular H-bond in aqueous solution. The solvation free energy is considerably less basis set dependent than the potential energy in vacuo. The ab initio PCM results slightly favor the planar 1 form over the planar 2 form whereas the semiempirical AMSOL results of Urban, Cramer and Famini (J. Am. Chem. Soc. 114 (1992) 8226) do the opposite. The cavitation free energy is nearly independent of the basis set. The almost constant (about 4.4 kcal/mol) cavitation and dispersion-repulsion corrections do not affect the differential quantities.

  18. Proton NMR sequential resonance assignments, secondary structure, and global fold in solution of the major (trans-Pro43) form of bovine calbindin D sub 9k

    SciTech Connect

    Koerdel, J.; Forsen, S.; Chazin, W.J. )

    1989-08-22

    A wide range of two-dimensional {sup 1}H NMR experiments have been used to completely assign the 500-MHz {sup 1}H NMR spectrum of recombinant Ca{sup 2+}-saturated bovine calbindin D{sub 9k}. In solution, calbindin D{sub 9k} exists as an equilibrium mixture of isoforms with trans (75%) and cis (25%) isomers of the peptide bond at Pro43 which results in two sets of {sup 1}H NMR signals from approximately half of the amino acids. The complete {sup 1}H NMR assignments for the major, trans-pro43 isoform are presented here. By use of an integrated strategy for spin system identification, 62 of the 76 spin systems could be assigned to the appropriate residue type. Sequence-specific assignments were then obtained by the standard method. Secondary structure elements were identified on the basis of networks of sequential and medium-range nuclear Overhauser effects (NOEs), {sup 3}J{sub HN{alpha}} spin coupling constants, and the location of slowly exchanging amide protons. Four helical segments and a short {beta}-sheet between the two calcium binding loops are found. These elements of secondary structure and a few additional long-range NOEs provide the global fold. Good agreement is found between the solution and crystal structures of the minor A form of bovine calbindin D{sub 9k} and between the solution structures of the minor A form of bovine calbindin D{sub 9k} and intact porcine calbindin D{sub 9k}.

  19. New physics effects and hadronic form factor uncertainties in B→K*ℓ+ℓ-

    NASA Astrophysics Data System (ADS)

    Das, Diganta; Sinha, Rahul

    2012-09-01

    It is well known that new physics can contribute to weak decays of heavy mesons via virtual processes during its decays. The discovery of new physics, using such decays is made difficult due to intractable strong interaction effects needed to describe it. Modes such as B→K*ℓ+ℓ- offer an advantage as they provide a multitude of observables via angular analysis. We show how the multitude of “related observables” obtained from B→K*ℓ+ℓ-, can provide many new “clean tests” of the standard model. The hallmark of these tests is that several of them are independent of the unknown universal form factors that describe the decay in heavy quark effective theory. We derive a relation between observables that is free of form factors and Wilson coefficients, the violation of which will be an unambiguous signal of new physics. We also derive relations between observables and form factors that are independent of Wilson coefficients and enable verification of hadronic estimates. We show how form factor ratios can be measured directly from helicity fraction with out any assumptions what so ever. We find that the allowed parameter space for observables is very tightly constrained in standard model, thereby providing clean signals of new physics. We examine in detail both the large-recoil and low-recoil regions of the K* meson and point out special features and derive relations between observables valid in the two limits. In the large-recoil regions several of the relations are unaffected by corrections to all orders in αs. We present yet another new relation involving only observables that would verify the validity of the relations between form factors assumed in the low-recoil region. The several relations and constraints derived will provide unambiguous signals of new physics if it contributes to these decays.

  20. Platelets do not express the oxidized or reduced forms of tissue factor

    PubMed Central

    Bouchard, Beth A.; Gissel, Matthew T.; Whelihan, Matthew F.; Mann, Kenneth G.; Butenas, Saulius

    2014-01-01

    Background Expression of tissue factor (TF) antigen and activity in platelets is controversial and dependent upon the laboratory and reagents used. Two forms of TF were described: an oxidized functional form and a reduced nonfunctional form that is converted to the active form through the formation of an allosteric disulfide. This study tests the hypothesis that the discrepancies regarding platelet TF expression are due to differential expression of the two forms. Methods Specific reagents that recognize both oxidized and reduced TF were used in flow cytometry of unactivated and activated platelets and western blotting of whole platelet lysates. TF-dependent activity measurements were used to confirm the results. Results Western blotting analyses of placental TF demonstrated that, in contrast to anti-TF#5, which is directed against the oxidized form of TF, a sheep anti-human TF polyclonal antibody recognizes both the reduced and oxidized forms. Flow cytometric analyses demonstrated that the sheep antibody did not react with the surface of unactivated platelets or platelets activated with thrombin receptor agonist peptide, PAR-1. This observation was confirmed using biotinylated active site-blocked factor (F)VIIa: no binding was observed. Likewise, neither form of TF was detected by western blotting of whole platelet lysates with sheep anti-hTF. Consistent with these observations, no FXa or FIXa generation by FVIIa was detected at the surface of these platelets. Similarly, no TF-related activity was observed in whole blood using thomboelastography. Conclusion and Significance Platelets from healthy donors do not express either oxidized (functional) or reduced (nonfunctional) forms of TF. PMID:24361609

  1. TWO-PHOTON EXCHANGE IN ELECTRON-PROTON ELASTIC SCATTERING: THEORY UPDATE

    SciTech Connect

    Andrei Afanasev

    2007-05-21

    Recent theoretical developments in the studies of two-photon exchange effects in elastic electron-proton scattering are reviewed. Two-photon exchange mechanism is considered a likely source of discrepancy between polarized and unpolarized experimental measurements of the proton electric form factor at momentum transfers of several GeV$^2$. This mechanism predicts measurable effects that are currently studied experimentally.

  2. Analysis of approximations used in calculations of radiative corrections to electron-proton scattering cross section

    SciTech Connect

    Gerasimov, R. E. Fadin, V. S.

    2015-01-15

    An analysis of approximations used in calculations of radiative corrections to electron-proton scattering cross section is presented. We investigate the difference between the relatively recent Maximon and Tjon result and the Mo and Tsai result, which was used in the analysis of experimental data. We also discuss the proton form factors ratio dependence on the way we take into account radiative corrections.

  3. Alcohol Dimer is Requisite to Form an Alkyl Oxonium Ion in the Proton Transfer of a Strong (Photo)Acid to Alcohol.

    PubMed

    Park, Sun-Young; Lee, Young Min; Kwac, Kijeong; Jung, Yousung; Kwon, Oh-Hoon

    2016-03-18

    Alcohols, the simplest amphiprotic organic compounds, can exhibit either acidic or basic behavior by donating or accepting a proton. In this study, proton dissociation of a model photoacid in solution is explored by using time-resolved spectroscopy, revealing quantitatively for the first time that alcohol acts as a Brønsted base because of H-bonded cluster formation to enhance the reactivity. The protonated alcohol cluster, the alkyl oxonium ion, can be regarded as a key reaction intermediate in the well-established alcohol dehydration reaction. This finding signifies, as in water, the cooperativity of protic solvent molecules to facilitate nonaqueous acid-base reactions. PMID:26757097

  4. Proton transfer in organic scaffolds

    NASA Astrophysics Data System (ADS)

    Basak, Dipankar

    This dissertation focuses on the fundamental understanding of the proton transfer process and translating the knowledge into design/development of new organic materials for efficient non-aqueous proton transport. For example, what controls the shuttling of a proton between two basic sites? a) Distance between two groups? or b) the basicity? c) What is the impact of protonation on molecular conformation when the basic sites are attached to rigid scaffolds? For this purpose, we developed several tunable proton sponges and studied proton transfer in these scaffolds theoretically as well as experimentally. Next we moved our attention to understand long-range proton conduction or proton transport. We introduced liquid crystalline (LC) proton conductor based on triphenylene molecule and established that activation energy barrier for proton transport is lower in the LC phase compared to the crystalline phase. Furthermore, we investigated the impact of several critical factors: the choice of the proton transferring groups, mobility of the charge carriers, intrinsic vs. extrinsic charge carrier concentrations and the molecular architectures on long-range proton transport. The outcome of this research will lead to a deeper understanding of non-aqueous proton transfer process and aid the design of next generation proton exchange membrane (PEM) for fuel cell.

  5. Deciphering the Positional Influence of the Hydroxyl Group in the Cinnamoyl Part of 3-Hydroxy Flavonoids for Structural Modification and Their Interaction with the Protonated and B Form of Calf Thymus DNA Using Spectroscopic and Molecular Modeling Studies.

    PubMed

    Pradhan, Ankur Bikash; Haque, Lucy; Bhuiya, Sutanwi; Ganguly, Aniruddha; Das, Suman

    2015-06-11

    Studies on the interaction of naturally occurring flavonoids with different polymorphic forms of nucleic acid are helpful for understanding the molecular aspects of binding mode and providing direction for the use and design of new efficient therapeutic agents. However, much less information is available on the interactions of these compounds with different polymorphic forms of DNA at the molecular level. In this report we investigated the interaction of two widely abundant dietary flavonoids quercetin (Q) and morin (M) with calf thymus (CT) DNA. Spectrophotometric, spectropolarimetric, viscosity measurement, and molecular docking simulation methods are used as tools to delineate the binding mode and probable location of the flavonoids and their effects on the stability and conformation of DNA. It is observed that in the presence of the protonated form of DNA the dual fluorescence of Q and M resulting from the excited-state intramolecular proton transfer (ESIPT) is modified significantly. Structural analysis showed Q and M binds weakly to the B form (groove binding) compared to the protonated form of CT DNA (electrostatic interaction). In both cases, Q binds strongly to both forms of DNA compared to M.

  6. Measurement of the isovector axial form factor at Q{sup 2} = 0.23 (GeV/c){sup 2}

    SciTech Connect

    Ríos, D. Balaguer; Baunack, S.; Glaser, B.; Maas, F.; Imai, Y.

    2013-11-07

    We present the preliminary value of the measurement of the parity violating asymmetry in the cross section of quasi-elastic scattering of longitudinally polarized electrons on deuteron at backward angles at Q{sup 2} = 0.23. The preliminary asymmetry is A{sub PV}{sup d}(Q{sup 2} = 0.23) = (−20.77±0.84{sub stat}±1.23{sub syst})10{sup −6}. From this value a preliminary linear combination of the G{sub M}{sup s} and the isovector axial form factor G{sub A} can be extracted G{sub A}{sup T = 1}+0.59G{sub M}{sup s} = −0.53±0.37±0.02. Combining this preliminary linear combination with that extracted from the measurement of the parity violating asymmetry on proton, already publish, it is possible to disentagle the form factors and thus we can obtain a preliminary experimental determination of the isovector axial form factor G{sub A}{sup T = 1} = −0.43±0.46.

  7. Factors affecting the C=N stretching in protonated retinal Schiff base: a model study for bacteriorhodopsin and visual pigments

    SciTech Connect

    Baasov, T.; Friedman, N.; Sheves, M.

    1987-06-02

    Factors affecting the C=N stretching frequency of protonated retinal Schiff base (RSBH/sup +/) were studied with a series of synthetic chromophores and measured under different conditions. Interaction of RSBH/sup +/ with nonconjugated positive charges in the vicinity of the ring moiety or a planar polyene conformation (in contrast to the twisted retinal conformation in solution) shifted the absorption maxima but did not affect the C=N stretching frequency. The latter, however, was affected by environmental perturbations in the vicinity of the Schiff base linkage. Diminished ion pairing achieved either by substituting a more bulky counteranion or by designing models with a homoconjugation effect lowered the C=N stretch energy. Decreasing solvation of the positively charged nitrogen leads to a similar trend. These effects in the vicinity of the Schiff base linkage also perturb the deuterium isotope effect observed upon deuteriation of the Schiff base. The results are interpreted by considering the mixing of the C=N stretching and C=N-H bending vibration. The C=N mode is shifted due to electrostatic interaction with nonconjugated positive charges in the vicinity of the Schiff base linkage, an interaction that does not influence the isotope effect. Weak hydrogen bonding between the Schiff base linkage in bacteriorhodopsin (bR) and its counteranion or, alternatively, poor solvation of the positively charged Schiff base nitrogen can account for the C=N stretching frequency of 1640 cm/sup -1/ and the deuterium isotope effect of 17 cm/sup -1/ observed in this pigment. Conversion of bR to the photochemically induced intermediate K/sub 610/ involves environmental perturbation in the vicinity of the C=N linkage, lowering the C=N stretch energy.

  8. Form factors of descendant operators: reduction to perturbed M (2 , 2 s + 1) models

    NASA Astrophysics Data System (ADS)

    Lashkevich, Michael; Pugai, Yaroslav

    2015-04-01

    In the framework of the algebraic approach to form factors in two-dimensional integrable models of quantum field theory we consider the reduction of the sine-Gordon model to the Φ13-perturbation of minimal conformal models of the M (2 , 2 s + 1) series. We find in an algebraic form the condition of compatibility of local operators with the reduction. We propose a construction that make it possible to obtain reduction compatible local operators in terms of screening currents. As an application we obtain exact multiparticle form factors for the compatible with the reduction conserved currents T ±2 k , Θ±(2 k-2), which correspond to the spin ±(2 k - 1) integrals of motion, for any positive integer k. Furthermore, we obtain all form factors of the operators T 2 k T -2 l , which generalize the famous operator. The construction is analytic in the s parameter and, therefore, makes sense in the sine-Gordon theory.

  9. Proton therapy

    MedlinePlus

    ... direction of the tumor. A machine called a synchrotron or cyclotron creates and speeds up the protons. ... redness in the radiation area, and temporary hair loss. AFTER THE PROCEDURE Following proton therapy, you should ...

  10. Factor structure and differential item functioning of the BASC-2 BESS Spanish Language Parent Form.

    PubMed

    Dever, Bridget V; Raines, Tara C; Dowdy, Erin

    2016-06-01

    Given the steady increase of students from diverse backgrounds in the U.S. educational system, in particular immigrant and Latino students, it is important to consider how to best support all students within our schools. The present study focuses on the Behavior Assessment System for Children-Second Edition (BASC-2) Behavioral and Emotional Screening System (BESS) Parent Spanish form, which is a promising assessment tool for those who are interested in screening for behavioral and emotional risk among Spanish-speaking populations. The present study included 725 students of Latino descent in Grades K-6 in an urban school district and their parents or legal guardians, who served as the informants. All parents completed the BESS language form (English or Spanish) of their choice. A confirmatory factor analysis (CFA) supported a 4-factor structure (Externalizing, Internalizing, Inattention, and Adaptive Skills) similar to that of the BESS Parent English form: χ2(77) = 248.06, p < .001; CFI = 0.903; TLI = 0.940. However, differential item functioning (DIF) analyses revealed 5 items (16.7%) demonstrated significant levels of DIF, with 4 of the 5 being easier to endorse in English. This study provides preliminary evidence of partial invariance of the BESS Parent across language forms. Although some evidence of invariance across language forms at the structural and item levels exists, more research is necessary to determine whether the DIF found in the present study results in any perceptible test bias. (PsycINFO Database Record PMID:27243244

  11. Enantioselective Protonation

    PubMed Central

    Mohr, Justin T.; Hong, Allen Y.; Stoltz, Brian M.

    2010-01-01

    Enantioselective protonation is a common process in biosynthetic sequences. The decarboxylase and esterase enzymes that effect this valuable transformation are able to control both the steric environment around the proton acceptor (typically an enolate) and the proton donor (typically a thiol). Recently, several chemical methods to achieve enantioselective protonation have been developed by exploiting various means of enantiocontrol in different mechanisms. These laboratory transformations have proven useful for the preparation of a number of valuable organic compounds. PMID:20428461

  12. Rho-omega mixing and the pion form factor in the timelike region

    SciTech Connect

    Gardner, S.; OConnell, H.B.

    1998-03-01

    We determine the magnitude, phase, and s dependence of {rho}-{omega} {open_quotes}mixing{close_quotes} in the pion form factor in the timelike region through fits to e{sup +}e{sup {minus}}{r_arrow}{pi}{sup +}{pi}{sup {minus}} data. The associated systematic errors in these quantities, arising from the functional form used to fit the {rho} resonance, are small. The systematic errors in the {rho} mass and width, however, are larger than previously estimated. {copyright} {ital 1998} {ital The American Physical Society}

  13. Medical Applications: Proton Radiotherapy

    NASA Astrophysics Data System (ADS)

    Keppel, Cynthia

    2009-05-01

    Proton therapy is a highly advanced and precise form of radiation treatment for cancer. Due to the characteristic Bragg peak associated with ion energy deposition, proton therapy provides the radiation oncologist with an improved method of treatment localization within a patient, as compared with conventional radiation therapy using X-rays or electrons. Controlling disease and minimizing side effects are the twin aims of radiation treatment. Proton beams enhance the opportunity for both by facilitating maximal dose to tumor and minimal dose to surrounding tissue. In the United States, five proton radiotherapy centers currently treat cancer patients, with more in the construction phase. New facilities and enabling technologies abound. An overview of the treatment modality generally, as well as of the capabilities and research planned for the field and for the Hampton University Proton Therapy Institute in particular, will be presented.

  14. High-throughput spectrometer designs in a compact form-factor: principles and applications

    NASA Astrophysics Data System (ADS)

    Norton, S. M.

    2013-05-01

    Many compact, portable Raman spectrometers have entered the market in the past few years with applications in narcotics and hazardous material identification, as well as verification applications in pharmaceuticals and security screening. Often, the required compact form-factor has forced designers to sacrifice throughput and sensitivity for portability and low-cost. We will show that a volume phase holographic (VPH)-based spectrometer design can achieve superior throughput and thus sensitivity over conventional Czerny-Turner reflective designs. We will look in depth at the factors influencing throughput and sensitivity and illustrate specific VPH-based spectrometer examples that highlight these design principles.

  15. Factor structure and validity of the parenting stress index-short form.

    PubMed

    Haskett, Mary E; Ahern, Lisa S; Ward, Caryn S; Allaire, Jason C

    2006-06-01

    The psychometric properties of the Parenting Stress Index-Short Form (PSI-SF) were examined in a sample of 185 mothers and fathers. Factor analysis revealed 2 reasonably distinct factors involving parental distress and dysfunctional parent-child interactions. Both scales were internally consistent, and these scales were correlated with measures of parent psychopathology, parental perceptions of child adjustment, and observed parent and child behavior. PSI-SF scores were related to parent reports of child behavior 1 year later, and the Childrearing Stress subscale was a significant predictor of a parental history of abuse.

  16. Theoretical Description and Measurement of the Pion-Photon Transition Form Factor

    NASA Astrophysics Data System (ADS)

    Mikhailov, S. V.; Pimikov, A. V.; Stefanis, N. G.

    2014-06-01

    Detailed predictions for the scaled pion-photon transition form factor are given, derived with the method of light-cone sum rules and using pion distribution amplitudes with two and three Gegenbauer coefficients obtained from QCD sum rules with nonlocal condensates. These predictions agree well with all experimental data that are compatible with QCD scaling (and collinear factorization), but disagree with the high- Q 2 data of the BaBar Collaboration that grow with the momentum. A good agreement of our predictions with results obtained from AdS/QCD models and Dyson-Schwinger computations is found.

  17. OPE for all helicity amplitudes II. Form factors and data analysis

    NASA Astrophysics Data System (ADS)

    Basso, Benjamin; Caetano, João; Córdova, Lucía; Sever, Amit; Vieira, Pedro

    2015-12-01

    We present the general flux tube integrand for MHV and non-MHV amplitudes, in planar N=4 SYM theory, up to a group theoretical rational factor. We find that the MHV and non-MHV cases only differ by simple form factors which we derive. This information allows us to run the operator product expansion program for all sorts of non-MHV amplitudes and to test the recently proposed map with the so called charged pentagons transitions. Perfect agreement is found, on a large sample of non-MHV amplitudes, with the perturbative data available in the literature.

  18. The electromagnetic form factors of the Λ in the timelike region

    NASA Astrophysics Data System (ADS)

    Haidenbauer, J.; Meißner, U.-G.

    2016-10-01

    The reaction e+e- → Λ bar Λ is investigated for energies close to the threshold. Specific emphasis is put on the role played by the interaction in the final Λ bar Λ system which is taken into account rigorously. For that interaction a variety of Λ bar Λ potential models is employed that have been constructed for the analysis of the reaction p bar p → Λ bar Λ in the past. The enhancement of the effective form factor for energies close to the Λ bar Λ threshold, seen in pertinent experiments, is reproduced. Predictions for the Λ electromagnetic form factors GM and GE in the timelike region and for spin-dependent observables such as spin-correlation parameters are presented.

  19. B→πll Form Factors for New Physics Searches from Lattice QCD.

    PubMed

    Bailey, Jon A; Bazavov, A; Bernard, C; Bouchard, C M; DeTar, C; Du, Daping; El-Khadra, A X; Freeland, E D; Gámiz, E; Gottlieb, Steven; Heller, U M; Kronfeld, A S; Laiho, J; Levkova, L; Liu, Yuzhi; Lunghi, E; Mackenzie, P B; Meurice, Y; Neil, E; Qiu, Si-Wei; Simone, J N; Sugar, R; Toussaint, D; Van de Water, R S; Zhou, Ran

    2015-10-01

    The rare decay B→πℓ^{+}ℓ^{-} arises from b→d flavor-changing neutral currents and could be sensitive to physics beyond the standard model. Here, we present the first ab initio QCD calculation of the B→π tensor form factor f_{T}. Together with the vector and scalar form factors f_{+} and f_{0} from our companion work [J. A. Bailey et al., Phys. Rev. D 92, 014024 (2015)], these parametrize the hadronic contribution to B→π semileptonic decays in any extension of the standard model. We obtain the total branching ratio BR(B^{+}→π^{+}μ^{+}μ^{-})=20.4(2.1)×10^{-9} in the standard model, which is the most precise theoretical determination to date, and agrees with the recent measurement from the LHCb experiment [R. Aaij et al., J. High Energy Phys. 12 (2012) 125].

  20. B →π l l Form Factors for New Physics Searches from Lattice QCD

    NASA Astrophysics Data System (ADS)

    Bailey, Jon A.; Bazavov, A.; Bernard, C.; Bouchard, C. M.; DeTar, C.; Du, Daping; El-Khadra, A. X.; Freeland, E. D.; Gámiz, E.; Gottlieb, Steven; Heller, U. M.; Kronfeld, A. S.; Laiho, J.; Levkova, L.; Liu, Yuzhi; Lunghi, E.; Mackenzie, P. B.; Meurice, Y.; Neil, E.; Qiu, Si-Wei; Simone, J. N.; Sugar, R.; Toussaint, D.; Van de Water, R. S.; Zhou, Ran; Fermilab Lattice; MILC Collaborations

    2015-10-01

    The rare decay B →π ℓ+ℓ-arises from b →d flavor-changing neutral currents and could be sensitive to physics beyond the standard model. Here, we present the first ab initio QCD calculation of the B →π tensor form factor fT . Together with the vector and scalar form factors f+ and f0 from our companion work [J. A. Bailey et al., Phys. Rev. D 92, 014024 (2015)], these parametrize the hadronic contribution to B →π semileptonic decays in any extension of the standard model. We obtain the total branching ratio BR (B +→π+μ+μ-)=20.4 (2.1 )×10-9 in the standard model, which is the most precise theoretical determination to date, and agrees with the recent measurement from the LHCb experiment [R. Aaij et al., J. High Energy Phys. 12 (2012) 125].

  1. Pion electromagnetic form factor, perturbative QCD, and large-N{sub c} Regge models

    SciTech Connect

    Arriola, Enrique Ruiz; Broniowski, Wojciech

    2008-08-01

    We present a construction of the pion electromagnetic form factor where the transition from large-N{sub c} Regge vector-meson dominance models with infinitely many resonances to perturbative QCD is built in explicitly. The construction is based on an appropriate assignment of residues to the Regge poles, which fulfills the constraints of the parton-hadron duality and perturbative QCD. The model contains a slowly falling off nonperturbative contribution, which dominates over the perturbative QCD radiative corrections for the experimentally accessible momenta. The leading order and next-to-leading order calculations show a converging pattern that describes the available data within uncertainties, while the onset of asymptotic QCD takes place at extremely high momenta Q{approx}10{sup 3}-10{sup 4} GeV. The method can be straightforwardly extended to study other form factors where the perturbative QCD result is available.

  2. Pion transition form factor and distribution amplitudes in large-N{sub c} Regge models

    SciTech Connect

    Arriola, Enrique Ruiz; Broniowski, Wojciech

    2006-08-01

    We analyze the {pi}{gamma}*{gamma}* amplitude in the framework of radial Regge models in the large-N{sub c} limit. With the assumption of similarity of the asymptotic Regge {rho} and {omega} meson spectra we find that the pion distribution amplitude is constant in the large-N{sub c} limit at the scale Q{sub 0} where the QCD radiative corrections are absent--a result found earlier in a class of chiral quark models. We discuss the constraints on the couplings from the anomaly and from the limit of large photon virtualities, and find that the coupling of the pion to excited {rho} and {omega} mesons must be asymptotically constant. We also discuss the effects of the QCD evolution on the pion electromagnetic transition form factor. Finally, we use the Regge model to evaluate the slope of the form factor at zero momentum and compare the value to the experiment, finding very reasonable agreement.

  3. B→πll Form Factors for New Physics Searches from Lattice QCD.

    PubMed

    Bailey, Jon A; Bazavov, A; Bernard, C; Bouchard, C M; DeTar, C; Du, Daping; El-Khadra, A X; Freeland, E D; Gámiz, E; Gottlieb, Steven; Heller, U M; Kronfeld, A S; Laiho, J; Levkova, L; Liu, Yuzhi; Lunghi, E; Mackenzie, P B; Meurice, Y; Neil, E; Qiu, Si-Wei; Simone, J N; Sugar, R; Toussaint, D; Van de Water, R S; Zhou, Ran

    2015-10-01

    The rare decay B→πℓ^{+}ℓ^{-} arises from b→d flavor-changing neutral currents and could be sensitive to physics beyond the standard model. Here, we present the first ab initio QCD calculation of the B→π tensor form factor f_{T}. Together with the vector and scalar form factors f_{+} and f_{0} from our companion work [J. A. Bailey et al., Phys. Rev. D 92, 014024 (2015)], these parametrize the hadronic contribution to B→π semileptonic decays in any extension of the standard model. We obtain the total branching ratio BR(B^{+}→π^{+}μ^{+}μ^{-})=20.4(2.1)×10^{-9} in the standard model, which is the most precise theoretical determination to date, and agrees with the recent measurement from the LHCb experiment [R. Aaij et al., J. High Energy Phys. 12 (2012) 125]. PMID:26550717

  4. Pion-photon transition form factor in light-cone sum rules

    NASA Astrophysics Data System (ADS)

    Pimikov, A. V.; Bakulev, A. P.; Mikhailov, S. V.; Stefanis, N. G.

    2012-10-01

    We extract constraints on the pion distribution amplitude from available data on the pionphoton transition form factor in the framework of light-cone sum rules. A pronounced discrepancy (2.7 - 3)σ between the Gegenbauer expansion coefficients extracted from the CELLO, CLEO, and Belle experimental data relative to those from BaBar is found. Predictions for the pion-photon transition form factor are presented by employing a pion distribution amplitude obtained long ago from QCD sum rules with nonlocal condensates. These predictions comply with the Belle data but disagree with those of BaBar beyond 9 GeV2. This original article was incorrectly published with a corrupt version of Fig. 1. The corrigendum (which is attached to this article) includes the correct version of the figure.

  5. Form factors of descendant operators: resonance identities in the sinh-Gordon model

    NASA Astrophysics Data System (ADS)

    Lashkevich, Michael; Pugai, Yaroslav

    2014-12-01

    We study the space of local operators in the sinh-Gordon model in the framework of the bootstrap form factor approach. Our final goal is to identify the operators obtained by solving bootstrap equations with those defined in terms of the Lagrangian field. Here we try to identify operators at some very particular points, where the phenomenon of operator resonance takes place. The operator resonance phenomenon being perturbative, nevertheless, results in exact identities between some local operators. By applying an algebraic approach developed earlier for form factors we derive an infinite set of identities between particular descendant and exponential operators in the sinh-Gordon theory, which generalize the quantum equation of motion. We identify the corresponding descendant operators by comparing them with the result of perturbation theory.

  6. $$B\\to\\pi\\ell\\ell$$ Form Factors for New-Physics Searches from Lattice QCD

    DOE PAGESBeta

    Bailey, Jon A.

    2015-10-07

    The rare decay B→πℓ+ℓ- arises from b→d flavor-changing neutral currents and could be sensitive to physics beyond the standard model. Here, we present the first ab initio QCD calculation of the B→π tensor form factor fT. Together with the vector and scalar form factors f+ and f0 from our companion work [J. A. Bailey et al., Phys. Rev. D 92, 014024 (2015)], these parametrize the hadronic contribution to B→π semileptonic decays in any extension of the standard model. We obtain the total branching ratio BR(B+→π+μ+μ-)=20.4(2.1)×10-9 in the standard model, which is the most precise theoretical determination to date, and agreesmore » with the recent measurement from the LHCb experiment [R. Aaij et al., J. High Energy Phys. 12 (2012) 125].« less

  7. CFD-based method of determining form factor k for different ship types and different drafts

    NASA Astrophysics Data System (ADS)

    Wang, Jinbao; Yu, Hai; Zhang, Yuefeng; Xiong, Xiaoqing

    2016-07-01

    The value of form factor k at different drafts is important in predicting full-scale total resistance and speed for different types of ships. In the ITTC community, most organizations predict form factor k using a low-speed model test. However, this method is problematic for ships with bulbous bows and transom. In this article, a Computational Fluid Dynamics (CFD)-based method is introduced to obtain k for different type of ships at different drafts, and a comparison is made between the CFD method and the model test. The results show that the CFD method produces reasonable k values. A grid generating method and turbulence model are briefly discussed in the context of obtaining a consistent k using CFD.

  8. Covariant spectator theory for the electromagnetic three-nucleon form factors: Complete impulse approximation

    SciTech Connect

    Pinto, Sérgio Alexandre; Stadler, Alfred; Gross, Franz

    2009-05-01

    We present the first calculations of the electromagnetic form factors of 3He and 3H within the framework of the Covariant Spectator Theory (CST). This first exploratory study concentrates on the sensitivity of the form factors to the strength of the scalar meson-nucleon off-shell coupling, known from previous studies to have a strong influence on the three-body binding energy. Results presented here were obtained using the complete impulse approximation (CIA), which includes contributions of relativistic origin that appear as two-body corrections in a non-relativistic framework, such as "Z-graphs," but omits other two and three-body currents. Finally, we compare our results to non-relativistic calculations augmented by relativistic corrections of O(v/c)2.

  9. Shock Response of the Clamped Disk in Small Form Factor Hard Disk Drive

    NASA Astrophysics Data System (ADS)

    Gu, Bin; Shu, Dongwei; Shi, Baojun; Lu, Guoxing

    As small form factor (one-inch and smaller) hard disk drives are widely used in portable consumer appliances and gadgets, their mechanical robustness is of greater concern. In the previous work, it is found that when the disk is more tightly clamped, it helps to decrease the shock response of the disk and then avoid the head slap. In this paper, the real boundary condition of the disk for a small form factor hard disk drive from Seagate is investigated numerically. The disk is clamped between the clamp and the hub. The shock response of the disk under a half-sine acceleration pulse is simulated by using the finite element method. In the finite element model, both contact between disk and clamp and contact between disk and hub are considered. According to the simulation results, how to decrease the shock response of the disk is suggested.

  10. LETTER TO THE EDITOR: The semiclassical origin of the logarithmic singularity in the symplectic form factor

    NASA Astrophysics Data System (ADS)

    Heusler, Stefan

    2001-08-01

    Sieber and Richter achieved a breakthrough towards a proof of the universality of spectral fluctuations of chaotic quantum systems conjectured by Bohigas, Giannoni and Schmidt by calculating semiclassically the first term beyond the diagonal approximation of the orthogonal form factor. In this letter, the semiclassical origin of the logarithmic singularity of the symplectic form factor is deduced perturbatively by combining this result with the contribution that arises due to the spin. This approach stands in contrast to the duality approach introduced by Bogomolny and Keating, which is essentially non-perturbative, and where the structure around the Heisenberg time is related to the structure for very small time which can be deduced using the diagonal approximation.

  11. Covariant spectator theory for the electromagnetic three-nucleon form factors: Complete impulse approximation

    SciTech Connect

    Alexandre Pinto, SÂ ergio; Stadler, Alfred; Gross, Franz

    2009-01-01

    We present the first calculations of the electromagnetic form factors of 3He and 3H within the framework of the Covariant Spectator Theory (CST). This first exploratory study concentrates on the sensitivity of the form factors to the strength of the scalar meson-nucleon off-shell coupling, known from previous studies to have a strong influence on the three-body binding energy. Results presented here were obtained using the complete impulse approximation (CIA), which includes contributions of relativistic origin that appear as two-body corrections in a non-relativistic framework, such as ?Z-graphs?, but omits other two and three-body currents. We compare our results to non-relativistic calculations augmented by relativistic corrections of O(v/c)2.

  12. Covariant spectator theory for the electromagnetic three-nucleon form factors: Complete impulse approximation

    SciTech Connect

    Pinto, Sergio Alexandre; Stadler, Alfred; Gross, Franz

    2009-05-15

    We present the first calculations of the electromagnetic form factors of {sup 3}He and {sup 3}H within the framework of the Covariant Spectator Theory (CST). This first exploratory study concentrates on the sensitivity of the form factors to the strength of the scalar meson-nucleon off-shell coupling, known from previous studies to have a strong influence on the three-body binding energy. Results presented here were obtained using the complete impulse approximation (CIA), which includes contributions of relativistic origin that appear as two-body corrections in a nonrelativistic framework, such as 'Z-graphs', but omits other two and three-body currents. We compare our results to nonrelativistic calculations augmented by relativistic corrections of O(v/c){sup 2}.

  13. Form factors of the spin-1 analogue of the eight-vertex model

    NASA Astrophysics Data System (ADS)

    Quano, Yas-Hiro

    2015-12-01

    The twenty-one-vertex model, the spin-1 analogue of the eight-vertex model, is considered on the basis of free-field representations of vertex operators in the 2× 2-fold fusion solid on solid (SOS) model and vertex-face transformation. The tail operators, which translate corner transfer matrices of the twenty-one-vertex model into those of the fusion SOS model, are constructed by using free bosons and fermions for both diagonal and off-diagonal matrix elements with respect to the ground-state sectors. Form factors of any local operators are therefore obtained in terms of multiple integral formulae, in principle. As the simplest example, the two-particle form factor of the spin operator is calculated explicitly.

  14. CFD-based method of determining form factor k for different ship types and different drafts

    NASA Astrophysics Data System (ADS)

    Wang, Jinbao; Yu, Hai; Zhang, Yuefeng; Xiong, Xiaoqing

    2016-09-01

    The value of form factor k at different drafts is important in predicting full-scale total resistance and speed for different types of ships. In the ITTC community, most organizations predict form factor k using a low-speed model test. However, this method is problematic for ships with bulbous bows and transom. In this article, a Computational Fluid Dynamics (CFD)-based method is introduced to obtain k for different type of ships at different drafts, and a comparison is made between the CFD method and the model test. The results show that the CFD method produces reasonable k values. A grid generating method and turbulence model are briefly discussed in the context of obtaining a consistent k using CFD.

  15. On the form factors of relevant operators and their cluster property

    NASA Astrophysics Data System (ADS)

    Acerbi, C.; Mussardo, G.; Valleriani, A.

    1997-05-01

    We compute the form factors of the relevant scaling operators in a class of integrable models without internal symmetries by exploiting their cluster properties. Their identification is established by computing the corresponding anomalous dimensions by means of the Delfino - Simonetti - Cardy sum rule and further confirmed it by comparing some universal ratios of the nearby non-integrable quantum field theories with their independent numerical determination.

  16. A study of the N to Delta transition form factors in full QCD

    SciTech Connect

    Constantia Alexandrou; Robert Edwards; Giannis Koutsou; Theodoros Leontiou; Hartmut Neff; John W. Negele; Wolfram Schroers; Antonios Tsapalis

    2005-07-01

    The N to Delta transition form factors GM1, GE2 and GC2 are evaluated using dynamical MILC configurations and valence domain wall fermions at three values of quark mass corresponding to pion mass 606 MeV, 502 MeV and 364 MeV on lattices of spatial size 20{sup 3} and 28{sup 3}. The unquenched results are compared to those obtained at similar pion mass in the quenched theory.

  17. K →π semileptonic form factors with Nf=2 +1 +1 twisted mass fermions

    NASA Astrophysics Data System (ADS)

    Carrasco, N.; Lami, P.; Lubicz, V.; Riggio, L.; Simula, S.; Tarantino, C.; ETM Collaboration

    2016-06-01

    We present a lattice QCD determination of the vector and scalar form factors of the semileptonic K →π ℓν decay which are relevant for the extraction of the Cabibbo-Kobayashi-Maskawa matrix element |Vu s| from experimental data. Our results are based on the gauge configurations produced by the European Twisted Mass Collaboration with Nf=2 +1 +1 dynamical fermions, which include in the sea, besides two light mass degenerate quarks, also the strange and the charm quarks. We use data simulated at three different values of the lattice spacing and with pion masses as small as 210 MeV. Our final result for the vector form factor at zero momentum transfer is f+(0 )=0.9709 (46 ) , where the uncertainty is both statistical and systematic combined in quadrature. Using the latest experimental value of f+(0 )|Vu s| from Kℓ3 decays, we obtain |Vu s|=0.2230 (11 ) , which allows us to test the unitarity constraint of the Standard Model below the permille level once the determination of |Vu d| from superallowed nuclear β decays is adopted. A slight tension with unitarity at the level of ˜2 standard deviations is observed. Moreover, we present our results for the semileptonic scalar f0(q2) and vector f+(q2) form factors in the whole range of values of the squared four-momentum transfer q2 measured in Kℓ3 decays, obtaining a very good agreement with the momentum dependence of the experimental data. We provide a set of synthetic data points representing our results for the vector and scalar form factors at the physical point for several selected values of q2.

  18. Measurement of the neutron electric form factor GEn in quasielastic scattering

    SciTech Connect

    Donal Day

    2003-07-15

    We have measured the electric form factor of the neutron, GEn, at two momentum transfers (Q2= 0.5 and Q2= 1.0 GeV/c2) through quasielastic scattering in Jefferson Lab's Hall C. Longitudinally polarized electrons scattered from polarized deuterated ammonia and GEn was extracted from the beam-target asymmetry AVed which, in quasielastic kinematics, is particularly sensitive to GEn and insensitive to MEC and FSI.

  19. Light meson electromagnetic form factors from three-flavor lattice QCD with exact chiral symmetry

    NASA Astrophysics Data System (ADS)

    Aoki, S.; Cossu, G.; Feng, X.; Hashimoto, S.; Kaneko, T.; Noaki, J.; Onogi, T.

    2016-02-01

    We study the chiral behavior of the electromagnetic (EM) form factors of pions and kaons in three-flavor lattice QCD. In order to make a direct comparison of the lattice data with chiral perturbation theory (ChPT), we employ the overlap quark action that has exact chiral symmetry. Gauge ensembles are generated at a lattice spacing of 0.11 fm with four pion masses ranging between Mπ≃290 MeV and 540 MeV and with a strange quark mass ms close to its physical value. We utilize the all-to-all quark propagator technique to calculate the EM form factors with high precision. Their dependence on ms and on the momentum transfer is studied by using the reweighting technique and the twisted boundary conditions for the quark fields, respectively. A detailed comparison with SU(2) and SU(3) ChPT reveals that the next-to-next-to-leading order terms in the chiral expansion are important to describe the chiral behavior of the form factors in the pion mass range studied in this work. We estimate the relevant low-energy constants and the charge radii, and find reasonable agreement with phenomenological and experimental results.

  20. Λb→pl⁻ν¯l form factors from lattice QCD with static b quarks

    DOE PAGESBeta

    Detmold, William; Lin, C.-J. David; Meinel, Stefan; Wingate, Matthew

    2013-07-23

    We present a lattice QCD calculation of form factors for the decay Λb→pμ⁻ν¯μ, which is a promising channel for determining the Cabibbo-Kobayashi-Maskawa matrix element |Vub| at the Large Hadron Collider. In this initial study we work in the limit of static b quarks, where the number of independent form factors reduces to two. We use dynamical domain-wall fermions for the light quarks, and perform the calculation at two different lattice spacings and at multiple values of the light-quark masses in a single large volume. Using our form factor results, we calculate the Λb→pμ⁻ν¯μ differential decay rate in the range 14more » GeV²≤q²≤q²max, and obtain the integral ∫q²max 14 GeV²[dΓ/dq²]dq²/|Vub|²=15.3±4.2 ps⁻¹. Combined with future experimental data, this will give a novel determination of |Vub| with about 15% theoretical uncertainty. The uncertainty is dominated by the use of the static approximation for the b quark, and can be reduced further by performing the lattice calculation with a more sophisticated heavy-quark action.« less

  1. Measurement of the Hadronic Form Factors in Ds to phi e nu Decays

    SciTech Connect

    Serrano, J

    2006-09-26

    Based on the measured four-dimensional rate for D{sub s}{sup +} {yields} {phi}e{sup +}{nu}{sub e} decays, they have determined the ratios of the three hadronic form factors, {tau}{sub V} = V(0)/A{sub 1}(0) = 1.636 {+-} 0.067 {+-} 0.038 and {tau}{sub 2} = A{sub 2}(0)/A{sub 1}(0) = 0.705 {+-} 0.056 {+-} 0.029, using a simple pole ansatz for the q{sup 2} dependence, with fixed values of the pole masses for both the vector and axial form factors. By a separate fit to the same data, they have also extracted the pole mass for the axial form factors, m{sub A}: {tau}{sub V} = V(0)/A{sub 1}(0) = 1.633 {+-} 0.081 {+-} 0.068, {tau}{sub 2} = A{sub 2}(0)/A{sub 1}(0) = 0.711 {+-} 0.111 {+-} 0.096 and m{sub A} = (2.53{sub -0.35}{sup +0.54} {+-} 0.54)GeV/c{sup 2}.

  2. Light-cone sum rules for B → π form factors revisited

    NASA Astrophysics Data System (ADS)

    Duplancić, G.; Khodjamirian, A.; Mannel, Th.; Melić, B.; Offen, N.

    2008-04-01

    We reconsider and update the QCD light-cone sum rules for B → π form factors. The gluon radiative corrections to the twist-2 and twist-3 terms in the correlation functions are calculated. The overline-MS b-quark mass is employed, instead of the one-loop pole mass used in the previous analyses. The light-cone sum rule for f+Bπ(q2) is fitted to the measured q2-distribution in B → πlνl, fixing the input parameters with the largest uncertainty: the Gegenbauer moments of the pion distribution amplitude. For the B → π vector form factor at zero momentum transfer we predict f+Bπ(0) = 0.26+0.04-0.03. Combining it with the value of the product |Vubf+Bπ(0)| extracted from experiment, we obtain |Vub| = (3.5±0.4±0.2±0.1) × 10-3. In addition, the scalar and penguin B → π form factors f0Bπ(q2) and fTBπ(q2) are calculated.

  3. Testing the consistency of the ω π transition form factor with unitarity and analyticity

    NASA Astrophysics Data System (ADS)

    Caprini, I.

    2015-07-01

    We perform a dispersive analysis of the ω π electromagnetic transition form factor, using as input the discontinuity provided by unitarity below the ω π threshold and including for the first time experimental data on the modulus measured from e+e-→ω π0 at higher energies. The input leads to stringent parametrization-free constraints on the modulus of the form factor below the ω π threshold, which are in disagreement with some experimental values measured from ω →π0γ* decay. We discuss the dependence on the input parameters in the unitarity relation, using for illustration an N /D formalism for the P partial wave of the scattering process ω π →π π , improved by a simple prescription which simulates the rescattering in the crossed channels. Our results confirm the existence of a conflict between experimental data and theoretical calculations of the ω π form factor in the region around 0.6 GeV and bring further arguments in support of renewed experimental efforts to measure more precisely the ω →π0γ* decay.

  4. Roles of Different Forms of Scale Factor in Non-linear Electrodynamics for Accelerating Universe

    NASA Astrophysics Data System (ADS)

    Maity, Sayani; Debnath, Ujjal

    2013-07-01

    In this work, we have assumed the modified Lagrangian of non-linear electrodynamics for accelerated universe. The energy density and pressure for non-linear electromagnetic theory have been considered in terms of both electric and magnetic fields. The Einstein's filed equations have been considered in FRW universe for Hořava-Lifshitz gravity. Since we are considering the non-linear form of Lagrangian for accelerating universe, so four forms of scale factors like logamediate, intermediate, emergent and power law forms are chosen in our investigation. For every expansion, the natures of electric field and magnetic field have been shown through graphical representation. The electric and magnetic fields increase for logamediate, intermediate and emergent expansion and decrease in power law expansion.

  5. Theoretical study on the ground state intramolecular proton transfer (IPT) and solvation effect in two Schiff bases formed by 2-aminopyridine with 2-hydroxy-1- naphthaldehyde and 2-hydroxy salicylaldehyde.

    PubMed

    Tezer, N; Karakus, N

    2009-03-01

    The tautomerization mechanism the isolated and monohydrated forms of two Schiff bases 1 and 2, and the effect of solvation on the proton transfer from enol-imine form to the keto-enamine form have been investigated using the B3LYP hybrid density functional method at the 6-31G** basis set level. The barrier heights for H(2)O-assisted reactions are significantly lower than that of unassisted tautomerization reaction in the gas phase. Nonspecific solvent effects have also been taken into account by using the continuum model (IPCM) of four different solvent. The tautomerization energies and the potential energy barriers are decreased by increasing solvent polarity.

  6. Dose-rate effects of protons on in vivo activation of nuclear factor-kappa B and cytokines in mouse bone marrow cells

    SciTech Connect

    Rithidech, K.N.; Rusek, A.; Reungpatthanaphong, P.; Honikel, L.; Simon, S.R.

    2010-05-28

    The objective of this study was to determine the kinetics of nuclear factor-kappa B (NF-{kappa}B) activation and cytokine expression in bone marrow (BM) cells of exposed mice as a function of the dose rate of protons. The cytokines included in this study are pro-inflammatory [i.e., tumor necrosis factor-alpha (TNF-{alpha}), interleukin-1beta (IL-1{beta}), and IL-6] and anti-inflammatory cytokines (i.e., IL-4 and IL-10). We gave male BALB/cJ mice a whole-body exposure to 0 (sham-controls) or 1.0 Gy of 100 MeV protons, delivered at 5 or 10 mGy min{sup -1}, the dose and dose rates found during solar particle events in space. As a reference radiation, groups of mice were exposed to 0 (sham-controls) or 1 Gy of {sup 137}Cs {gamma} rays (10 mGy min{sup -1}). After irradiation, BM cells were collected at 1.5, 3, 24 h, and 1 month for analyses (five mice per treatment group per harvest time). The results indicated that the in vivo time course of effects induced by a single dose of 1 Gy of 100 MeV protons or {sup 137}Cs {gamma} rays, delivered at 10 mGy min{sup -1}, was similar. Although statistically significant levels of NF-{kappa}B activation and pro-inflammatory cytokines in BM cells of exposed mice when compared to those in the corresponding sham controls (Student's t-test, p < 0.05 or < 0.01) were induced by either dose rate, these levels varied over time for each protein. Further, only a dose rate of 5 mGy min{sup -1} induced significant levels of anti-inflammatory cytokines. The results indicate dose-rate effects of protons.

  7. The multiple complexes formed by the interaction of platelet factor 4 with heparin.

    PubMed Central

    Bock, P E; Luscombe, M; Marshall, S E; Pepper, D S; Holbrook, J J

    1980-01-01

    The anisotropy of the fluorescence of dansyl (5-dimethylaminonaphthalene-1- sulphonyl) groups covalently attached to human platelet factor 4 was used to detect the macromolecular compounds formed when the factor was mixed with heparin. At low heparin/protein ratios a very-high-molecular-weight compound (1) was formed that dissociated to give a smaller compound (2) when excess heparin was added. 2. A large complex was also detected as a precipitate that formed at high protein concentrations in chloride buffer. It contained 15.7% (w/w) polysaccharide, equivalent to four or five heparin tetrasaccharide units per protein tetramer. In this complex, more than one molecule of protein binds to each heparin molecule of molecular weight greater than about 6 X 10(3).3. The stability of these complexes varied with pH, salt concentration and the chain length of the heparin. The limit complexes found in excess of the larger heparins consisted of only one heparin molecule per protein tetramer, and the failure to observe complexes with four heparin molecules/protein tetramer is discussed. PMID:7283972

  8. Clean measurements of the nucleon axial-vector and free-neutron magnetic form factors

    SciTech Connect

    Deur, Alexandre P.

    2013-11-01

    We discuss the feasibility of a weak charged current experiment using a low energy electron beam. A first goal is to measure the Q^2 dependence of the axial-vector form factor g_a(Q^2). It can be measured model-independently and as robustly as for electromagnetic form factors from typical electron scattering experiments, in contrast to the methods used so far to measure g_a(Q^2). If g_a(Q^2) follows a dipole form, the axial mass can be extracted with a better accuracy than the world data altogether. The most important detection equipment would be a segmented neutron detector with good momentum and angular resolution that is symmetric about the beam direction, and covers a moderate angular range. A high intensity beam (100 uA) is necessary. Beam polarization is highly desirable as it provides a clean measurement of the backgrounds. Beam energies between 70 and 110 MeV are ideal. This range would provide a Q^2 mapping of g_a between 0.01

  9. Nematicidal spore-forming Bacilli share similar virulence factors and mechanisms.

    PubMed

    Zheng, Ziqiang; Zheng, Jinshui; Zhang, Zhengming; Peng, Donghai; Sun, Ming

    2016-01-01

    In the soil environment, Bacilli can affect nematode development, fecundity and survival. However, although many Bacillus species can kill nematodes, the virulence mechanisms Bacilli utilize remain unknown. In this study, we collected 120 strains comprising 30 species across the Bacillaceae and Paenibacillaceae families of the Bacillales order and measured their nematicidal activities in vitro. Comparison of these strains' nematicidal capacities revealed that nine species, including Bacillus thuringiensis, B. cereus, B. subtilis, B. pumilus, B. firmus, B. toyonensis, Lysinibacillus sphaericus, Brevibacillus laterosporus and B. brevis, were highly nematicidal, the first of which showed the highest activity. Genome sequencing and analysis identified many potential virulence factors, which grouped into five types. At least four possible mechanisms were deduced on the basis of the combination of these factors and the bacterial nematicidal activity, including a pore-forming mechanism of crystal proteins, an inhibition-like mechanism of thuringiensin and a degradation mechanism of proteases and/or chitinases. Our results demonstrate that 120 spore-forming Bacilli across different families share virulence factors that may contribute to their nematicidal capacity. PMID:27539267

  10. The Use of Soil Forming Factors in the Development of Soil Taxonomy

    NASA Astrophysics Data System (ADS)

    Bockheim, JG; Gennadiyev, AN; Hartemink, Alfred E.; Brevik, Eric C.

    2014-05-01

    The past and present roles of the five soil-forming factors in creating categories in USDA Soil Taxonomy have been analyzed. The factorial and genetic approach is clearly present in Soil Taxonomy, but was not so evident in the 7th Approximation of 1960. Soil climate is the most important factor in Soil Taxonomy. Climate is used at the highest level to define two of the 12 soil orders: Aridisols, the soils of the dry regions, and Gelisols, the permafrost-affected soils and is also used to differentiate suborders in eight of the remaining orders. Parent material is used to fully define two orders: Histosols and Andisols, and partially to define the suborders in the Entisol order (Fluvents, Psamments). Only one group of organisms, the worms (Verm-), is used at the great-group and subgroup levels in several orders. Relief and time are not used in defining taxa in Soil Taxonomy. Three of the eight epipedons are defined on the basis of parent material (folistic, histic, melanic), two on the basis of human activities (anthropic and plaggen), and two from the interaction of climate and vegetation (mollic and umbric). Of the 19 subsurface horizons, 11 originate from the interaction of climate and parent material. This analysis reveals there is an imbalance in the utilization of the soil-forming factors in Soil Taxonomy, with an emphasis on climate and parent material.

  11. Nematicidal spore-forming Bacilli share similar virulence factors and mechanisms

    PubMed Central

    Zheng, Ziqiang; Zheng, Jinshui; Zhang, Zhengming; Peng, Donghai; Sun, Ming

    2016-01-01

    In the soil environment, Bacilli can affect nematode development, fecundity and survival. However, although many Bacillus species can kill nematodes, the virulence mechanisms Bacilli utilize remain unknown. In this study, we collected 120 strains comprising 30 species across the Bacillaceae and Paenibacillaceae families of the Bacillales order and measured their nematicidal activities in vitro. Comparison of these strains’ nematicidal capacities revealed that nine species, including Bacillus thuringiensis, B. cereus, B. subtilis, B. pumilus, B. firmus, B. toyonensis, Lysinibacillus sphaericus, Brevibacillus laterosporus and B. brevis, were highly nematicidal, the first of which showed the highest activity. Genome sequencing and analysis identified many potential virulence factors, which grouped into five types. At least four possible mechanisms were deduced on the basis of the combination of these factors and the bacterial nematicidal activity, including a pore-forming mechanism of crystal proteins, an inhibition-like mechanism of thuringiensin and a degradation mechanism of proteases and/or chitinases. Our results demonstrate that 120 spore-forming Bacilli across different families share virulence factors that may contribute to their nematicidal capacity. PMID:27539267

  12. Polynesian head form: an interpretation of a factor analysis of Cartesian co-ordinate data.

    PubMed Central

    Buranarugsa, M; Houghton, P

    1981-01-01

    The three dimensional co-ordinates of a large number of landmarks on a series of Polynesian skulls have been obtained by means of a diagraph, and from standard lateral cephalograms. The method is accurate, and a very large amount of data is stored in the concise form of the standardized co-ordinates. A factor analysis of some of these data defines a number of distinct craniofacial segments showing independent variation in positioning, and therefore presumably growth, along defined axes. The segments thus defined relate well to the conclusions of other studies of skull growth and form, and support the view that the basis of cranial variation is the same for all Homo sapiens. It is suggested that the strict independence of the isolated craniofacial segments may be a consequence of the particular method, and may not truly reflect the situation in the growing skull. PMID:7328041

  13. Isovector and isoscalar meson cloud contributions to the nucleon electromagnetic form factors

    SciTech Connect

    Tegen, R. |

    1998-01-01

    We have calculated the nucleon form factors G{sub E,M}{sup (p,n)}(q{sup 2}) in the linear {sigma} model to one-meson-loop order plus (two-loop) {gamma}{pi}{pi}{pi} anomaly. The previously derived {gamma}{pi}{pi}{pi} anomaly generally reduces the nucleon radii and produces a shift of the magnetic moments of order 0.1 {mu}{sub N} or less. We present analytical results for G{sub E,M}{sup p,n}(0) which display explicitly their dependence on hadron masses and coupling constants. Analytical results for the radii are also given and the chiral singularities they contain (lnm{sub {pi}} and m{sub {pi}}{sup {minus}1}) are exposed. These come from the {pi}{pi} intermediate state contribution to the form factors and {ital not} from the chiral quark substructure of nucleons or mesons. The leading chiral singularity has a {ital universal} strength while the chiral log (next-to-leading singularity) picks up a model (or approximation) dependence in terms of g{sub A} and the threshold behavior of the {pi}N amplitude A{sup ({minus})}({nu},0). The chiral singularities appear only in the iso{ital vector} nucleon radii {l_angle}r{sub 1,2}{sup 2}{r_angle}{sup I=1}, the leading m{sub {pi}}{sup {minus}1} term appears only in {l_angle}r{sub 2}{sup 2}{r_angle}{sup I=1} due to a peculiar cancellation between two independent form factor combinations {Gamma}{sub 1,3}(q{sup 2}). The isoscalar anomaly {gamma}{pi}{pi}{pi} is finite for m{sub {pi}}{r_arrow}0. {copyright} {ital 1998} {ital The American Physical Society}

  14. Proton Therapy

    NASA Astrophysics Data System (ADS)

    Oelfke, Uwe

    Proton therapy is one of the most rapidly developing new treatment technologies in radiation oncology. This treatment approach has — after roughly 40 years of technical developments — reached a mature state that allows a widespread clinical application. We therefore review the basic physical and radio-biological properties of proton beams. The main physical aspect is the elemental dose distribution arising from an infinitely narrow proton pencil beam. This includes the physics of proton stopping powers and the concept of CSDA range. Furthermore, the process of multiple Coulomb scattering is discussed for the lateral dose distribution. Next, the basic terms for the description of radio-biological properties of proton beams like LET and RBE are briefly introduced. Finally, the main concepts of modern proton dose delivery concepts are introduced before the standard method of inverse treatment planning for hadron therapy is presented.

  15. Measurement of the gamma gamma* --> eta and gamma gamma* --> eta' transition form factors

    SciTech Connect

    del Amo Sanchez et al, P.

    2011-02-07

    We study the reactions e{sup +}e{sup -} {yields} e{sup +}e{sup -} {eta}{sup (/)} in the single-tag mode and measure the {gamma}{gamma}* {yields} {eta}{sup (/)} transition form factors in the momentum transfer range from 4 to 40 GeV{sup 2}. The analysis is based on 469 fb{sup -1} of integrated luminosity collected at PEP-II with the BABAR detector at e{sup +}e{sup -} center-of-mass energies near 10.6 GeV.

  16. K(13) FORM FACTOR WITH TWO FLAVORS OF DYNAMICAL DOMAIN WALL QUARKS.

    SciTech Connect

    SONI, A.; DAWSON, T.; IZUBUCHI, T.; KANEKO, T.; SASAKI, S.

    2005-07-25

    We report on our calculation of K {yields} {pi} vector form factor by numerical simulations of two-flavor QCD on a 16{sup 3} x 32 x 12 lattice at a {approx_equal} 0.12 fm using domain-wall quarks and DBW2 glue. Our preliminary result at a single sea quark mass corresponding to m{sub PS}/m{sub V} {approx_equal} 0.53 shows a good agreement with previous estimate in quenched QCD and that from a phenomenological model.

  17. All tree-level MHV form factors in N = 4 SYM from twistor space

    NASA Astrophysics Data System (ADS)

    Koster, Laura; Mitev, Vladimir; Staudacher, Matthias; Wilhelm, Matthias

    2016-06-01

    We incorporate all gauge-invariant local composite operators into the twistor-space formulation of N = 4 SYM theory, detailing and expanding on ideas we presented recently in [1]. The vertices for these operators contain infinitely many terms and we show how they can be constructed by taking suitable derivatives of a light-like Wilson loop in twistor space and shrinking it down to a point. In particular, these vertices directly yield the tree-level MHV super form factors of all composite operators in N = 4 SYM theory.

  18. Extraction of the Compton Form Factor H from DVCS measurements at Jefferson Lab

    SciTech Connect

    Moutarde, H

    2009-05-01

    In the framework of Generalised Parton Distributions, we study the helicity-dependent and independent cross sections measured in Hall A and the beam spin asymmetries measured in Hall B at Jefferson Laboratory. We perform a global fit of these data and fits on each kinematical bin. We extract the real and imaginary parts of the Compton Form Factor $\\mathcal{H}$ under the main hypothesis of dominance of the Generalised Parton Distribution $H$ and twist 2 accuracy. We discuss our results and compare to previous extractions as well as to the VGG model. We pay extra attention to the estimation of errors on the extraction of $\\mathcal{H}$.

  19. Measurement of the Form-Factor Ratios for D+ --> K¯*0e+νe

    NASA Astrophysics Data System (ADS)

    Aitala, E. M.; Amato, S.; Anjos, J. C.; Appel, J. A.; Ashery, D.; Banerjee, S.; Bediaga, I.; Blaylock, G.; Bracker, S. B.; Burchat, P. R.; Burnstein, R. A.; Carter, T.; Carvalho, H. S.; Copty, N. K.; Cremaldi, L. M.; Darling, C.; Denisenko, K.; Fernandez, A.; Fox, G.; Gagnon, G. P.; Gounder, K.; Halling, A. M.; Herrera, G.; Hurvits, G.; James, C.; Kasper, P. A.; Kwan, S.; Langs, D. C.; Leslie, J.; Lundberg, B.; Maytal-Beck, S.; Meadows, B.; de Mello Neto, J. R.; Mihalcea, D.; Milburn, R. H.; de Miranda, J. M.; Napier, A.; Nguyen, A.; D'Oliveira, A. B.; O'Shaughnessy, K.; Peng, K. C.; Perera, L. P.; Purohit, M. V.; Quinn, B.; Radeztsky, S.; Rafatian, A.; Reay, N. W.; Reidy, J. J.; Dos Reis, A. C.; Rubin, H. A.; Sanders, D. A.; Santha, A. K.; Santoro, A. F.; Schwartz, A. J.; Sheaff, M.; Sidwell, R. A.; Slaughter, A. J.; Sokoloff, M. D.; Solano, J.; Stanton, N. R.; Stenson, K.; Summers, D. J.; Takach, S.; Thorne, K.; Tripathi, A. K.; Watanabe, S.; Weiss-Babai, R.; Wiener, J.; Witchey, N.; Wolin, E.; Yi, D.; Yoshida, S.; Zaliznyak, R.; Zhang, C.

    1998-02-01

    We present a measurement of the form-factor ratios rV = V\\(0\\)/A1\\(0\\) and r2 = A2\\(0\\)/A1\\(0\\) for the decay D+-->K¯ *0e+νe. The measurement is based on a signal of approximately 3000 D+-->K¯ *0e+νe, K¯ *0-->K-π+ decays reconstructed in data from charm hadroproduction experiment E791 at Fermilab. The results are rV = 1.84+/-0.11+/-0.08 and r2 = 0.71+/-0.08+/-0.09.

  20. Measurement of the form-factor ratios for D+s-- >φl+νl

    NASA Astrophysics Data System (ADS)

    E791 Collaboration; Aitala, E. M.; Amato, S.; Anjos, J. C.; Appel, J. A.; Ashery, D.; Banerjee, S.; Bediaga, I.; Blaylock, G.; Bracker, S. B.; Burchat, P. R.; Burnstein, R. A.; Carter, T.; Carvalho, H. S.; Copty, N. K.; Cremaldi, L. M.; Darling, C.; Denisenko, K.; Fernandez, A.; Fox, G. F.; Gagnon, P.; Gobel, C.; Gounder, K.; Halling, A. M.; Herrera, G.; Hurvits, G.; James, C.; Kasper, P. A.; Kwan, S.; Langs, D. C.; Leslie, J.; Lundberg, B.; Maytal-Beck, S.; Meadows, B.; de Mello Neto, J. R. T.; Mihalcea, D.; Milburn, R. H.; de Miranda, J. M.; Napier, A.; Nguyen, A.; D'Oliveira, A. B.; O'Shaughnessy, K.; Peng, K. C.; Perera, L. P.; Purohit, M. V.; Quinn, B.; Radeztsky, S.; Rafatian, A.; Reay, N. W.; Reidy, J. J.; Dos Reis, A. C.; Rubin, H. A.; Sanders, D. A.; Santha, A. K. S.; Santoro, A. F. S.; Schwartz, A. J.; Sheaff, M.; Sidwell, R. A.; Slaughter, A. J.; Sokoloff, M. D.; Solano, J.; Stanton, N. R.; Stefanski, R. J.; Stenson, K.; Summers, D. J.; Takach, S.; Thorne, K.; Tripathi, A. K.; Watanabe, S.; Weiss-Babai, R.; Wiener, J.; Witchey, N.; Wolin, E.; Yang, S. M.; Yi, D.; Yoshida, S.; Zaliznyak, R.; Zhang, C.

    1999-03-01

    We have measured the form factor ratios rV=V(0)/A1(0) and r2=A2(0)/A1(0) for the decay Ds+-->φ l+ νl, φ-->K+ K-, using data from charm hadroproduction experiment E791 at Fermilab. Results are based on 144 signal and 22 background events in the electron channel and 127 signal and 34 background events in the muon channel. We combine the measurements from both lepton channels to obtain rV=2.27+/-0.35+/-0.22 and r2=1.57+/-0.25+/-0.19.

  1. Trinucleon Electromagnetic Form Factors and the Light-Front Hamiltonian Dynamics

    SciTech Connect

    Baroncini, F.; Kievsky, A.; Pace, E.; Salme, G.

    2008-10-13

    This contribution briefly illustrates preliminary calculations of the electromagnetic form factors of {sup 3}He and {sup 3}H, obtained within the Light-front Relativistic Hamiltonian Dynamics, adopting i) a Poincare covariant current operator, without dynamical two-body currents, and ii) realistic nuclear bound states with S, P and D waves. The kinematical region of few (GeV/c){sup 2}, relevant for forthcoming TJLAB experiments, has been investigated, obtaining possible signatures of relativistic effects for Q{sup 2}>2.5(GeV/c){sup 2}.

  2. Measurement of the Neutron Electric Form Factor GEN at High Q2

    NASA Astrophysics Data System (ADS)

    McCormick, Kathy

    2003-01-01

    Experiment E02-0131 at Thomas Jefferson National Accelerator Facility (Jefferson Lab) will measure the neutron electric form factor GEn at the high four-momentum transfer values of Q2 ≈ 1.3, 2.4 and 3.4 (GeV/c)2 via a measurement of the cross section asymmetry AT in the reaction {}3vec He(vec e, e'n)pp . This measurement was approved for 32 days of running by Jefferson Lab PAC 212 in January 2002.

  3. Valence quark contributions for the gamma N -> P11(1440) form factors

    SciTech Connect

    Gilberto Ramalho, Kazuo Tsushima

    2010-04-01

    Using a covariant spectator quark model we estimate valence quark contributions to the F_1*(Q2) and F2*(Q2) transition form factors for the gamma N -> P11(1440) reaction. The Roper resonance, P11(1440), is assumed to be the first radial excitation of the nucleon. The present model requires no extra parameters except for those already fixed by the previous studies for the nucleon. Our results are consistent with the experimental data in the high Q2 region, and those from lattice QCD. We also estimate the meson cloud contributions, focusing on the low Q2 region, where they are expected to be dominant.

  4. Precise Determination of the Neutron Magnetic Form Factor to Higher Q{sup 2}

    SciTech Connect

    William K. Brooks; Jeffery D. Lachniet

    2004-10-01

    The neutron elastic magnetic form factor G{sub M}{sup n} has been extracted from quasielastic scattering from deuterium in the CEBAF Large Acceptance Spectrometer, CLAS. The kinematic coverage of the measurement is continuous over a broad range, extending from below 1 GeV{sup 2} to nearly 5 GeV{sup 2} in four-momentum transfer squared. High precision is achieved by employing a ratio technique in which most uncertainties cancel, and by a simultaneous in-situ calibration of the neutron detection efficiency, the largest correction to the data. Preliminary results are shown with statistical errors only.

  5. Characterization of pH titration shifts for all the nonlabile proton resonances a protein by two-dimensional NMR: the case of mouse epidermal growth factor.

    PubMed

    Kohda, D; Sawada, T; Inagaki, F

    1991-05-21

    The pH titration shifts for all the nonlabile proton resonances in a 53-residue protein (mouse epidermal growth factor) were measured in the p2H range 1.5-9 with two-dimensional (2D) 1H NMR. The 2D NMR pH titration experiment made it possible to determine the pK values for all the ionizable groups which were titrated in the pH range 1.5-9 in the protein. The pK values of the nine ionizable groups (alpha-amino group, four Asp, two Glu, one His, and alpha-carboxyl group) were found to be near their normal values. The 2D titration experiment also provided a detailed description of the pH-dependent behavior of the proton chemical shifts and enabled us to characterize the pH-dependent changes of protein conformation. Analysis of the pH-dependent shifts of ca. 200 proton resonances offered evidence of conformational changes in slightly basic pH solution: The deprotonation of the N-terminal alpha-amino group induced a widespread conformational change over the beta-sheet structure in the protein, while the effects of deprotonation of the His22 imidazole group were relatively localized. We found that the 2D NMR pH titration experiment is a powerful tool for investigating the structural and dynamic properties of proteins. PMID:2036358

  6. Exploring universality of transversity in proton-proton collisions

    NASA Astrophysics Data System (ADS)

    Radici, Marco; Ricci, Alessandro M.; Bacchetta, Alessandro; Mukherjee, Asmita

    2016-08-01

    We consider the azimuthal correlations of charged hadron pairs with large total transverse momentum and small relative momentum, produced in proton-proton collisions with one transversely polarized proton. One of these correlations directly probes the chiral-odd transversity parton distribution in connection with a chiral-odd interference fragmentation function. We present predictions for this observable based on previous extractions of transversity (from charged pion pair production in semi-inclusive deep-inelastic scattering) and of the interference fragmentation function (from the production of back-to-back charged pion pairs in electron-positron annihilations). All analyses are performed in the framework of collinear factorization. We compare our predictions to the recent data on proton-proton collisions released by the STAR Collaboration at RHIC, and we find them reasonably compatible. This comparison confirms for the first time the predicted role of transversity in proton-proton collisions, and it allows us to test its universality.

  7. Strong diquark correlations inside the proton

    NASA Astrophysics Data System (ADS)

    Segovia, Jorge

    2016-03-01

    Quantum Chromodynamics is thought to be the relativistic quantum field theory that describes the strong interaction of the Standard Model. This interaction produces mesons but it is also able to generate quark-quark (diquark) correlations inside baryons. In this work, we employ a continuum approach to QCD based on Dyson-Schwinger equations to calculate the electromagnetic form factors of the proton and analyze in a deeper way the consequences of having strong diquark correlations. Comparison with the experimental data reveals that the presence of strong diquark correlations within the proton is sufficient to understand empirical extractions of the flavour-separated form factors. The explained reduction of the ratios F1d/F1u and F2d/F2u at high Q2 in the quark-diquark picture are responsible of the precocious scaling of the F2p/F1p observed experimentally.

  8. Biochemical and proton NMR characterization of the isolated functional beta-subunit of coupling factor one from spinach chloroplasts

    SciTech Connect

    Roux-Fromy, M.; Neumann, J.M.; Andre, F.; Berger, G.; Girault, G.; Galmiche, J.M.; Remy, R.

    1987-04-29

    Beta subunits have been dissociated from CF1 of spinach chloroplasts, purified by HPLC and characterized by two-dimensional electrophoresis and fluorescence emission. The solutions of isolated beta subunits are able to hydrolyze MgATP; this ATPase activity is an intrinsic property of the beta molecule. From proton NMR at 300 and 500 MHz, it is shown that the preparations are fully reproducible and that beta subunits remain monomeric with 75% aliphatic protons associated with rigid parts of the molecule. The other 25% give rise to separate resonances and belong to mobile side-chains and/or to flexible regions. The measurement of the transverse relaxation times T2 has permitted a detailed characterization of the molecular dynamics of the isolated beta subunits.

  9. Pion transition form factor in the Regge approach and incomplete vector-meson dominance

    SciTech Connect

    Ruiz Arriola, Enrique; Broniowski, Wojciech

    2010-05-01

    The concept of incomplete vector-meson dominance and Regge models is applied to the transition form factor of the pion. First, we argue that variants of the chiral quark model fulfilling the chiral anomaly may violate the Terazawa-West unitarity bounds, as these bounds are based on unverified assumptions for the real parts of the amplitudes, precluding a possible presence of polynomial terms. A direct consequence is that the transition form factor need not necessarily vanish at large values of the photon virtuality. Moreover, in the range of the BABAR experiment, the Terazawa-West bound is an order of magnitude above the data, thus is of formal rather than practical interest. Then we demonstrate how the experimental data may be properly explained with incomplete vector-meson dominance in a simple model with one state, as well as in more sophisticated Regge models. Generalizations of the simple Regge model along the lines of Dominguez result in a proper description of the data, where one may adjust the parameters in such a way that the Terazawa-West bound is satisfied or violated. We also impose the experimental constraint from the Z{yields}{pi}{sub 0{gamma}} decay. Finally, we point out that the photon momentum asymmetry parameter may noticeably influence the precision analysis.

  10. Can we understand an auxetic pion-photon transition form factor within QCD?

    NASA Astrophysics Data System (ADS)

    Stefanis, N. G.; Bakulev, A. P.; Mikhailov, S. V.; Pimikov, A. V.

    2013-05-01

    A state-of-the-art analysis of the pion-photon transition form factor is presented based on an improved theoretical calculation that includes the effect of a finite virtuality of the quasireal photon in the method of light-cone sum rules. We carry out a detailed statistical analysis of the existing experimental data using this method and by employing pion distribution amplitudes with up to three Gegenbauer coefficients a2, a4, a6. Allowing for an error range in the coefficient a6≈0, the theoretical predictions for γ*γ→π0 obtained with nonlocal QCD sum rules are found to be in good agreement with all data that support a scaling behavior of the transition form factor at higher Q2, like those of the Belle Collaboration. The data on γ*γ→η/η' from CLEO and BABAR are also reproduced, while there is a strong conflict with the auxetic trend of the BABAR data above 10GeV2. The broader implications of these findings are discussed.

  11. Measurement of the form-factor ratios for D+-->K¯*0l +νl

    NASA Astrophysics Data System (ADS)

    Fermilab E791 Collaboration; Aitala, E. M.; Amato, S.; Anjos, J. C.; Appel, J. A.; Ashery, D.; Banerjee, S.; Bediaga, I.; Blaylock, G.; Bracker, S. B.; Burchat, P. R.; Burnstein, R. A.; Carter, T.; Carvalho, H. S.; Copty, N. K.; Cremaldi, L. M.; Darling, C.; Denisenko, K.; Fernandez, A.; Fox, G. F.; Gagnon, P.; Gobel, C.; Gounder, K.; Halling, A. M.; Herrera, G.; Hurvits, G.; James, C.; Kasper, P. A.; Kwan, S.; Langs, D. C.; Leslie, J.; Lundberg, B.; Maytal-Beck, S.; Meadows, B.; de Mello Neto, J. R. T.; Mihalcea, D.; Milburn, R. H.; de Miranda, J. M.; Napier, A.; Nguyen, A.; D'Oliveira, A. B.; O'Shaughnessy, K.; Peng, K. C.; Perera, L. P.; Purohit, M. V.; Quinn, B.; Radeztsky, S.; Rafatian, A.; Reay, N. W.; Reidy, J. J.; Dos Reis, A. C.; Rubin, H. A.; Sanders, D. A.; Santha, A. K. S.; Santoro, A. F. S.; Schwartz, A. J.; Sheaff, M.; Sidwell, R. A.; Slaughter, A. J.; Sokoloff, M. D.; Solano, J.; Stanton, N. R.; Stefanski, R. J.; Stenson, K.; Summers, D. J.; Takach, S.; Thorne, K.; Tripathi, A. K.; Watanabe, S.; Weiss-Babai, R.; Wiener, J.; Witchey, N.; Wolin, E.; Yi, D.; Yang, S. M.; Yoshida, S.; Zaliznyak, R.; Zhang, C.

    1998-11-01

    The form factor ratios rV=V(0)/A1(0), r2=A2(0)/A1(0) and r3=A3(0)/A1(0) in the decay D+-->K¯*0l +νl, K¯*0-->K-π+ have been measured using data from charm hadroproduction experiment E791 at Fermilab. From 3034 (595) signal (background) events in the muon channel, we obtain rV=1.84+/-0.11+/-0.09, r2=0.75+/-0.08+/-0.09 and, as a first measurement of r3, we find 0.04+/-0.33+/-0.29. The values of the form factor ratios rV and r2 measured for the muon channel are combined with the values of rV and r2 that we have measured in the electron channel. The combined E791 results for the muon and electron channels are rV=1.87+/-0.08+/-0.07 and r2=0.73+/-0.06+/-0.08.

  12. Measurement of the Hadronic Form factor in D0 to K- e+ nu_e Decays

    SciTech Connect

    Aubert, B.; Bona, M.; Boutigny, D.; Karyotakis, Y.; Lees, J.P.; Poireau, V.; Prudent, X.; Tisserand, V.; Zghiche, A.; Garra Tico, J.; Grauges, E.; Lopez, L.; Palano, A.; Eigen, G.; Stugu, B.; Sun, L.; Abrams, G.S.; Battaglia, M.; Brown, D.N.; Button-Shafer, J.; Cahn, R.N.; /Energy Sci. Network /Birmingham U. /Ruhr U., Bochum /Bristol U. /British Columbia U. /Brunel U. /Novosibirsk, IYF /UC, Irvine /UCLA /UC, Riverside /UC, San Diego /UC, Santa Barbara /UC, Santa Cruz /Caltech /Cincinnati U. /Colorado U. /Colorado State U. /Dortmund U. /Leipzig, Tech. Hochsch. /Ecole Polytechnique /Edinburgh U. /Ferrara U. /Frascati /Genoa U. /Harvard U. /Heidelberg U. /Imperial Coll., London /Iowa U. /Iowa State U. /Johns Hopkins U. /Karlsruhe U. /Paris U., VI-VII /LLNL, Livermore /Liverpool U. /Queen Mary, U. of London /Royal Holloway, U. of London /Louisville U. /Manchester U. /Maryland U. /Massachusetts U., Amherst /MIT, LNS /McGill U. /Milan U. /Mississippi U. /Concordia U., Montreal /Mt. Holyoke Coll. /Naples U. /NIKHEF, Amsterdam /Notre Dame U. /Ohio State U. /Oregon U. /Padua U. /Paris U., VI-VII /Pennsylvania U. /Perugia U. /Pisa U. /Prairie View A-M /Princeton U. /INFN, Rome /Rostock U. /Rutherford /DSM, DAPNIA, Saclay /South Carolina U. /SLAC /Stanford U., Phys. Dept. /SUNY, Albany /Tennessee U. /Texas U. /Texas U., Dallas /Turin U. /Trieste U. /Valencia U., IFIC /Victoria U. /Warwick U. /Wisconsin U., Madison /Yale U.

    2007-04-09

    The shape of the hadronic form factor f{sub +} (q{sup 2}) in the decay D{sup 0} {yields} K{sup -} e{sup +}{nu}{sub e} has been measured in a model independent analysis and compared with theoretical calculations. They use 75 fb{sup -1} of data recorded by the BABAR detector at the PEPII electron-positron collider. The corresponding decay branching fraction, relative to the decay D{sup 0} {yields} K{sup -} {pi}{sup +}, has also been measured to be R{sub D} = BR(D{sup 0} {yields} K{sup -}e{sup +}{nu}{sub e})/BR(D{sup 0} {yields} K{sup -}{pi}{sup +}) = 0.927 {+-} 0.007 {+-} 0.012. From these results, and using the present world average value for BR(D{sup 0} {yields} K{sup -}{pi}{sup +}), the normalization of the form factor at q{sup 2} = 0 is determined to be f{sub +}(0) = 0.727 {+-} 0.007 {+-} 0.005 {+-} 0.007 where the uncertainties are statistical, systematic, and from external inputs, respectively.

  13. The SU(2|3) dynamic two-loop form factors

    NASA Astrophysics Data System (ADS)

    Brandhuber, A.; Kostacinska, M.; Penante, B.; Travaglini, G.; Young, D.

    2016-08-01

    We compute two-loop form factors of operators in the SU(2|3) closed subsector of {N}=4 supersymmetric Yang-Mills. In particular, we focus on the non-protected, dimension-three operators Tr( X[ Y, Z]) and Tr( ψψ) for which we compute the four possible two-loop form factors, and corresponding remainder functions, with external states < overline{X}overline{Y}overline{Z}| and < overline{ψ}overline{ψ}| . Interestingly, the maximally transcendental part of the two-loop remainder of < overline{X}overline{Y}overline{Z}|Tr(X[Y, Z])|0rangle turns out to be identical to that of the corresponding known quantity for the half-BPS operator Tr( X 3). We also find a surprising connection between the terms subleading in transcendentality and certain a priori unrelated remainder densities introduced in the study of the spin chain Hamiltonian in the SU(2) sector. Next, we use our calculation to resolve the mixing, recovering anomalous dimensions and eigenstates of the dilatation operator in the SU(2|3) sector at two loops. We also speculate on potential connections between our calculations in {N}=4 super Yang-Mills and Higgs + multi-gluon amplitudes in QCD in an effective Lagrangian approach.

  14. $B\\to\\pi\\ell\\ell$ Form Factors for New-Physics Searches from Lattice QCD

    SciTech Connect

    Bailey, Jon A.

    2015-10-07

    The rare decay B→πℓ+- arises from b→d flavor-changing neutral currents and could be sensitive to physics beyond the standard model. Here, we present the first ab initio QCD calculation of the B→π tensor form factor fT. Together with the vector and scalar form factors f+ and f0 from our companion work [J. A. Bailey et al., Phys. Rev. D 92, 014024 (2015)], these parametrize the hadronic contribution to B→π semileptonic decays in any extension of the standard model. We obtain the total branching ratio BR(B+→π+μ+μ-)=20.4(2.1)×10-9 in the standard model, which is the most precise theoretical determination to date, and agrees with the recent measurement from the LHCb experiment [R. Aaij et al., J. High Energy Phys. 12 (2012) 125].

  15. Extraction of Electromagnetic Transition Form Factors for Nucleon Resonances within a Dynamical Coupled-Channels Model

    SciTech Connect

    N. Suzuki, T. Sato, T.-S. H. Lee

    2010-10-01

    We explain the application of a recently developed analytic continuation method to extract the electromagnetic transition form factors for the nucleon resonances ($N^*$) within a dynamical coupled-channel model of meson-baryon reactions.Illustrative results of the obtained $N^*\\rightarrow \\gamma N$ transition form factors, defined at the resonance pole positions on the complex energy plane, for the well isolated $P_{33}$ and $D_{13}$, and the complicated $P_{11}$ resonances are presented. A formula has been developed to give an unified representation of the effects due to the first two $P_{11}$ poles, which are near the $\\pi\\Delta$ threshold, but are on different Riemann sheets. We also find that a simple formula, with its parameters determined in the Laurent expansions of $\\pi N \\rightarrow \\pi N$ and $\\gamma N \\rightarrow\\pi N$ amplitudes, can reproduce to a very large extent the exact solutions of the considered model at energies near the real parts of the extracted resonance positions. We indicate the differences between our results and those extracted from the approaches using the Breit-Wigner parametrization of resonant amplitudes to fit the data.

  16. Measurement of the generalized form factors near threshold via γ*p → nπ+ at high Q2

    SciTech Connect

    Park, K.; Adhikari, K. P.; Adikaram, D.; Anghinolfi, M.; Baghdasaryan, H.; Ball, J.; Battaglieri, M.; Batourine, V.; Bedlinskiy, I.; Bennett, R. P.; Biselli, A. S.; Bookwalter, C.; Boiarinov, S.; Branford, D.; Briscoe, W. J.; Brooks, W. K.; Burkert, V. D.; Carman, D. S.; Celentano, A.; Chandavar, S.; Charles, G.; Cole, P. L.; Contalbrigo, M.; Crede, V.; D'Angelo, A.; Daniel, A.; Dashyan, N.; De Vita, R.; De Sanctis, E.; Deur, A.; Djalali, C.; Doughty, D.; Dupre, R.; El Alaoui, A.; El Fassi, L.; Euginio, P.; Fedotov, G.; Fradi, A.; Gabrielyan, M. Y.; Gevorgyan, N.; Gilfoyle, G. P.; Giovanetti, K. L.; Girod, F. X.; Goetz, J. T.; Gohn, W.; Golovatch, E.; Graham, L.; Griffioen, K. A.; Guidal, M.; Guo, L.; Hafidi, K.; Hakobyan, H.; Hanretty, C.; Heddle, D.; Hicks, K.; Holtrop, M.; Ilieva, Y.; Ireland, D. G.; Ishkhanov, B. S.; Isupov, E. L.; Jenkins, D.; Jo, H. S.; Joo, K.; Khandaker, M.; Khertarpal, P.; Kim, A.; Kim, W.; Klein, F. J.; Kubarovsky, A.; Kubarovsky, V.; Kuhn, S. E.; Kuleshov, S. V.; Kvaltine, N. D.; Livingston, K.; Lu, H. Y.; MacGregor, J. D.; Markov, N.; Mayer, M.; McKinnon, B.; Mestayer, M. D.; Meyer, C. A.; Mineeva, T.; Mirazita, M.; Mokeev, V.; Moutarde, H.; Munevar, E.; Nadel-Turonski, P.; Nasseripour, R.; Niccolai, S.; Niculescu, G.; Niculescu, I.; Osipenko, M.; Ostrovidov, A. I; Paolone, M.; Pappalardo, L.; Paremuzyan, R.; Park, S.; Anefalos Pereira, S.; Phelps, E.; Pisano, S.; Pogorelko, O.; Pozdniakov, S.; Price, J. W.; Procureur, S.; Prok, Y.; Ricco, G.; Rimal, D.; Ripani, M.; Ritchie, B. G.; Rosner, G.; Rossi, P.; Sabati ee, F.; Saini, M. S.; Salgado, C.; Schott, D.; Schumacher, R. A.; Seraydaryan, H.; Sharabian, Y. G.; Smith, E. S.; Smith, G. D.; Sober, D. I.; Sokhan, D.; Stepanyan, S. S.; Stepanyan, S.; Stoler, P.; Strakovsky, I. I.; Strauch, S.; Taiuti, M.; Tang, W.; Taylor, C. E.; Tian, Y.; Tkachenko, S.; Trivedi, A.; Ungaro, M.; Vernarsky, B.; Vlassov, A. V.; Voutier, E.; Watts, D. P.; Weygand, D. P.; Wood, M. H.; Zachariou, N.; Zhao, B.; Zhao, Z. W.

    2012-03-26

    We report the first extraction of the pion-nucleon multipoles near the production threshold for the nπ+ channel at relatively high momentum transfer (Q2 up to 4.2 GeV2). The dominance of the s-wave transverse multipole (E0+), expected in this region, allowed us to access the generalized form factor G1 within the light-cone sum rule (LCSR) framework as well as the axial form factor GA. The data analyzed in this work were collected by the nearly 4π CEBAF Large Acceptance Spectrometer (CLAS) using a 5.754-GeV electron beam on a proton target. The differential cross section and the π-N multipole E0+/GD were measured using two different methods, the LCSR and a direct multipole fit. The results from the two methods are found to be consistent and almost Q2 independent.

  17. Direct CP Violation, Branching Ratios and Form Factors B --> pi, B --> K in B decays

    SciTech Connect

    O. Leitner; X.-H. Guo; A.W. Thomas

    2004-11-01

    The B {yields} {pi} and B {yields} K transitions involved in hadronic B decays are investigated in a phenomenological way through the framework of QCD factorization. By comparing our results with experimental branching ratios from the BELLE, BABAR and CLEO collaborations for all the B decays including either a pion or a kaon, we propose boundaries for the transition form factors B {yields} {pi} and B {yields} K depending on the CKM matrix element parameters {rho} and {eta}. From this analysis, the form factors required to reproduce the experimental data for branching ratios are F{sup B {yields} {pi}} = 0.31 {+-} 0.12 and F{sup B {yields} K} = 0.37 {+-} 0.13. We calculate the direct CP violating asymmetry parameter, a{sub CP}, for B {yields} {pi}{sup +}{pi}{sup -}{pi} and B {yields} {pi}{sup +}{pi}{sup -} K decays, in the case where {rho} - {omega} mixing effects are taken into account. Based on these results, we find that the direct CP asymmetry for B{sup -} {yields} {pi}{sup +}{pi}{sup -}{pi}{sup -}, {bar B}{sup 0} {yields} {pi}{sup +}{pi}{sup -}{pi}{sup 0}, B{sup -} {yields} {pi}{sup +}{pi}{sup -}K{sup -}, and {bar B}{sup 0} {yields} {pi}{sup +}{pi}{sup -} {bar K}{sup 0}, reaches its maximum when the invariant mass {pi}{sup +}{pi}{sup -} is in the vicinity of the {omega} meson mass. The inclusion of {rho} - {omega} mixing provides an opportunity to erase, without ambiguity, the phase uncertainty mod{pi} in the determination of th CKM angles {alpha} in case of b {yields} u and {gamma} in case of b {yields} s.

  18. Joint resummation for pion wave function and pion transition form factor

    NASA Astrophysics Data System (ADS)

    Li, Hsiang-nan; Shen, Yue-Long; Wang, Yu-Ming

    2014-01-01

    We construct an evolution equation for the pion wave function in the k T factorization formalism, whose solution sums the mixed logarithm ln x ln k T to all orders, with x ( k T ) being a parton momentum fraction (transverse momentum). This joint resummation induces strong suppression of the pion wave function in the small x and large b regions, b being the impact parameter conjugate to k T , and improves the applicability of perturbative QCD to hard exclusive processes. The above effect is similar to those from the conventional threshold resummation for the double logarithm ln2 x and the conventional k T resummation for ln2 k T . Combining the evolution equation for the hard kernel, we are able to organize all large logarithms in the γ * π 0 → γ scattering, and to establish a scheme-independent k T factorization formula. It will be shown that the significance of next-to-leading-order contributions and saturation behaviors of this process at high energy differ from those under the conventional resummations. It implies that QCD logarithmic corrections to a process must be handled appropriately, before its data are used to extract a hadron wave function. Our predictions for the involved pion transition form factor, derived under the joint resummation and the input of a non-asymptotic pion wave function with the second Gegenbauer moment a 2 = 0 .05, match reasonably well the CLEO, BaBar, and Belle data.

  19. Structure in the Proton and the Neutron

    DOE R&D Accomplishments Database

    Hofstadter, R.

    1958-06-01

    A survey of the recent work on the structures of the proton and the neutron carried out by high-energy electron-scattering methods is presented. Early work established finite size effects in the proton and led to information about the charge and magnetic density distributions in the proton. The rms size was established to be close to (0.77 plus or minus 0.10) x 10{sup -13} cm, and the density distributions of charge and anomalous magnetic moment were shown to be approximately of the same shape. The form factors could be described in terms of several alternative models given, for example, by an exponential, gaussian, hollow exponential, hollow gaussian, etc., distribution of densities. Many other shapes were excluded by the experimental data. Recent work by Bumiller and Hofstadter now fixes one among these models that is appropriate to the proton and provides an extremely good fit at all angles between energies of 200 and 650 Mev. The new evidence clearly favors the exponential model with rms radius (0.80 plus or minus 0.04) 10{sup -13} cm. Recent studies of the proton have attempted to answer the question: how closely similar are the charge and magnetic form factors? This work now shows that the distributions have the same sizes and shapes to within 10 per cent, and each distribution is given very closely by the exponential model described above with radius (0.80 plus or minus 0.04) x 10{sup -13}. Certain other similar models will be discussed. Early work on the inelastic continuum in the deuteron established that the neutron's magnetic structure was extended and not a point. It was further shown that the neutron's size was approximately the same as that of the proton. This work has recently been extended by Yearian and Hofstadter to a determination of the variation of the neutron's magnetic form factor over the range where the proton's form factor is known. The new results show: (1) the neutron is not a point, (2) the neutron's magnetic structure has a size lying

  20. Large-N{sub c} relations for the electromagnetic nucleon-to-{delta} form factors

    SciTech Connect

    Pascalutsa, Vladimir; Vanderhaeghen, Marc

    2007-12-01

    We examine the large-N{sub c} relations which express the electromagnetic N-to-{delta} transition quantities in terms of the electromagnetic properties of the nucleon. These relations are based on the known large-N{sub c} relation between the N{yields}{delta} electric quadrupole moment and the neutron charge radius, and a newly derived large-N{sub c} relation between the electric quadrupole (E2) and Coulomb quadrupole (C2) transitions. Extending these relations to finite, but small, momentum transfer, we find that the description of the electromagnetic N{yields}{delta} ratios (R{sub EM} and R{sub SM}) in terms of the nucleon form factors predicts a structure which may be ascribed to the effect of the 'pion cloud'. These relations also provide useful constraints for the N{yields}{delta} generalized parton distributions.

  1. Optimization of Seesaw Swing Arm Actuator Design for Small Form Factor Optical Disk Drive

    NASA Astrophysics Data System (ADS)

    Po-Chien Chou,; Yu-Cheng Lin,; Stone Cheng,

    2010-05-01

    Many small form factor (SFF) optical pickup heads based on the swing arm design utilize a piezoelectric material or the slim metal plate to perform the focusing action. The seesaw-type actuator is a new mechanism used in the focusing action for SFF optical data storage devices. The swing arm nutates along a pivot instead of a hinge in the vertical movement. In this paper, an optimized design of a biaxial voice coil motor (VCM), in which the tracking and focusing VCMs are combined in the rear of the swing arm, is proposed. Simulation and experiment results demonstrate the effectiveness of the proposed design methodology by showing that the stress magnitude distribution characteristics, mechanism stiffness, and driving stability of the optimized design are enhanced in comparison with those of the original.

  2. JLab Measurement of the 4He Charge Form Factor at Large Momentum Transfers

    SciTech Connect

    Camsonne, Alexandre; Katramatou, A. T.; Olson, M.; Sparveris, Nikolaos; Acha, Armando; Allada, Kalyan; Anderson, Bryon; Arrington, John; Baldwin, Alan; Chen, Jian-Ping; Choi, Seonho; Chudakov, Eugene; Cisbani, Evaristo; Craver, Brandon; Decowski, Piotr; Dutta, Chiranjib; Folts, Edward; Frullani, Salvatore; Garibaldi, Franco; Gilman, Ronald; Gomez, Javier; Hahn, Brian; Hansen, Jens-Ole; Higinbotham, Douglas; Holmstrom, Timothy; Huang, Jian; Iodice, Mauro; Kelleher, Aidan; Khrosinkova, Elena; Kievsky, A.; Kuchina, Elena; Kumbartzki, Gerfried; Lee, Byungwuek; LeRose, John; Lindgren, Richard; Lott, Gordon; Lu, H.; Marcucci, Laura; Margaziotis, Demetrius; Markowitz, Pete; Marrone, Stefano; Meekins, David; Meziani, Zein-Eddine; Michaels, Robert; Moffit, Bryan; Norum, Blaine; Petratos, Gerassimos; Puckett, Andrew; Qian, Xin; Rondon-Aramayo, Oscar; Saha, Arunava; Sawatzky, Bradley; Segal, John; Hashemi, Mitra; Shahinyan, Albert; Solvignon-Slifer, Patricia; Subedi, Ramesh; Suleiman, Riad; Sulkosky, Vincent; Urciuoli, Guido; Viviani, Michele; Wang, Y.; Wojtsekhowski, Bogdan; Yan, X.; Yao, H.; Zhang, W. -M.; Zheng, X.; Zhu, L.

    2014-04-01

    The charge form factor of 4He has been extracted in the range 29 fm-2 <= Q2 <= 77 fm-2 from elastic electron scattering, detecting 4He nuclei and electrons in coincidence with the High Resolution Spectrometers of the Hall A Facility of Jefferson Lab. The results are in qualitative agreement with realistic meson-nucleon theoretical calculations. The data have uncovered a second diffraction minimum, which was predicted in the Q2 range of this experiment, and rule out conclusively long-standing predictions of dimensional scaling of high-energy amplitudes using quark counting.

  3. Fabrication and verification for the small-form-factor holographic optical pickup

    NASA Astrophysics Data System (ADS)

    Hou, Kuan Chou; Chou, Po Chien; Cheng, Stone; Lin, Yue Jheng; Chiu, Yi; Chiou, Jin Chern

    2011-01-01

    In this investigation, a small-form-factor (SFF) pickup head with a holographic optical element (HOE) is fabricated. The system employs a finite-conjugate object lens to focus a light beam. A holographic optical element is used to simplify the optical configuration. It provides a better means of alignment of fabrication and reduces the size of system relative to reflective light route. Micro prisms are fastened with HOE and a silicon substrate, laser diode and photodiode are integrated into the optical system. The pickup head system based on discrete components and a flip chip bonder with highly accurate alignment was to integrate it. The micro holographic optical pickup head is fabricated and tested. Experimental results including the spot diameter and the focusing error signal (FES), demonstrate that the optical system is a feasible.

  4. Scattering from phase-separated vesicles. I. An analytical form factor for multiple static domains

    SciTech Connect

    Heberle, Frederick A.; Anghel, Vinicius N. P.; Katsaras, John

    2015-08-18

    This is the first in a series of studies considering elastic scattering from laterally heterogeneous lipid vesicles containing multiple domains. Unique among biophysical tools, small-angle neutron scattering can in principle give detailed information about the size, shape and spatial arrangement of domains. A general theory for scattering from laterally heterogeneous vesicles is presented, and the analytical form factor for static domains with arbitrary spatial configuration is derived, including a simplification for uniformly sized round domains. The validity of the model, including series truncation effects, is assessed by comparison with simulated data obtained from a Monte Carlo method. Several aspects of the analytical solution for scattering intensity are discussed in the context of small-angle neutron scattering data, including the effect of varying domain size and number, as well as solvent contrast. Finally, the analysis indicates that effects of domain formation are most pronounced when the vesicle's average scattering length density matches that of the surrounding solvent.

  5. Pion mass dependence of the K l3 semileptonic scalar form factor within finite volume

    NASA Astrophysics Data System (ADS)

    Ghorbani, K.; Yazdanpanah, M. M.; Mirjalili, A.

    2011-06-01

    We calculate the scalar semileptonic kaon decay in finite volume at the momentum transfer t m =( m K - m π )2, using chiral perturbation theory. At first we obtain the hadronic matrix element to be calculated in finite volume. We then evaluate the finite size effects for two volumes with L=1.83 fm and L=2.73 fm and find that the difference between the finite volume corrections of the two volumes are larger than the difference as quoted in Boyle et al. (Phys. Rev. Lett. 100:141601, 2008). It appears then that the pion masses used for the scalar form factor in ChPT are large which result in large finite volume corrections. If appropriate values for pion mass are used, we believe that the finite size effects estimated in this paper can be useful for lattice data to extrapolate at large lattice size.

  6. An important factor powerfully influencing the Al Ni-based alloys' glass-forming ability

    NASA Astrophysics Data System (ADS)

    Bo, Zhang; Xiufang, Bian; Chunxia, Fu; Na, Han; Jiankun, Zhou; Weimin, Wang

    2005-12-01

    In order to get better glass-forming abilities (GFAs), Ni atoms are partially replaced by Cu and Co atoms in Al84Ni12Zr4 alloys. Thermal analysis shows that the reduced crystallization temperature Trx has no direct correlation with the GFA of the alloys. However, it is notable that prepeaks have been found in the total structure factors of the amorphous Al84Ni(12-x)Zr4Cux and Al84Ni(12-x)Zr4Cox alloys. In addition, the results prove that the intensity of the prepeaks influences the GFA powerfully. The amorphous alloys with larger intensity of the prepeak show better GFA. The influence of prepeaks on the GFA can be explained by the atomic configuration difference among the liquid, crystal and glass states.

  7. Scaling study of the pion electroproduction cross sections and the pion form factor

    SciTech Connect

    Tanja Horn; Xin Qian; John Arrington; Razmik Asaturyan; Fatiha Benmokthar; Werner Boeglin; Peter Bosted; Antje Bruell; Eric Christy; Eugene Chudakov; Ben Clasie; Mark Dalton; AJI Daniel; Donal Day; Dipangkar Dutta; Lamiaa El Fassi; Rolf Ent; Howard Fenker; J. Ferrer; Nadia Fomin; H. Gao; K Garrow; Dave Gaskell; C Gray; G. Huber; M. Jones; N Kalantarians; C. Keppel; K Kramer; Y Li; Y Liang; A. Lung; S Malace; P. Markowitz; A. Matsumura; D. Meekins; T Mertens; T Miyoshi; H. Mykrtchyan; R. Monson; T. Navasardyan; G. Niculescu; I. Niculescu; Y. Okayasu; A. Opper; C Perdrisat; V. Punjabi; A. Rauf; V. Rodriguez; D. Rohe; J Seely; E Segbefia; G. Smith; M. Sumihama; V. Tadevoyan; L Tang; V. Tvaskis; A. Villano; W. Vulcan; F. Wesselmann; S. Wood; L. Yuan; X. Zheng

    2007-07-12

    The $^{1}$H($e,e^\\prime \\pi^+$)n cross section was measured for a range of four-momentum transfer up to $Q^2$=3.91 GeV$^2$ at values of the invariant mass, $W$, above the resonance region. The $Q^2$-dependence of the longitudinal component is consistent with the $Q^2$-scaling prediction for hard exclusive processes. This suggests that perturbative QCD concepts are applicable at rather low values of $Q^2$. Pion form factor results, while consistent with the $Q^2$-scaling prediction, are inconsistent in magnitude with perturbative QCD calculations. The extraction of Generalized Parton Distributions from hard exclusive processes assumes the dominance of the longitudinal term. However, transverse contributions to the cross section are still significant at $Q^2$=3.91 GeV$^2$.

  8. {nu} induced threshold production of two pions and N*(1440) electroweak form factors

    SciTech Connect

    Hernandez, E.; Nieves, J.; Valverde, M.; Singh, S. K.; Vacas, M. J. Vicente

    2008-03-01

    We study the threshold production of two pions induced by neutrinos in nucleon targets. The contribution of nucleon, pion, and contact terms are calculated using a chiral Lagrangian. The contribution of the Roper resonance, neglected in earlier studies, has also been taken into account. The numerical results for the cross sections are presented and compared with the available experimental data. It has been found that in the two-pion channels with {pi}{sup +}{pi}{sup -} and {pi}{sup 0}{pi}{sup 0} in the final state, the contribution of the N*(1440) is quite important and could be used to determine the N*(1440) electroweak transition form factors if experimental data with better statistics become available in the future.

  9. The Spectroscopy and Form Factors of Nucleon Resonances from Superconformal Quantum Mechanics and Holographic QCD

    NASA Astrophysics Data System (ADS)

    de Téramond, Guy F.

    2016-10-01

    The superconformal algebraic approach to hadronic physics is used to construct a semiclassical effective theory for nucleons which incorporates essential nonperturbative dynamical features, such as the emergence of a confining scale and the Regge resonance spectrum. Relativistic bound-state equations for nucleons follow from the extension of superconformal quantum mechanics to the light front and its holographic embedding in a higher dimensional gravity theory. Superconformal algebra has been used elsewhere to describe the connections between the light mesons and baryons, but in the present context it relates the fermion positive and negative chirality states and uniquely determines the confinement potential of nucleons. The holographic mapping of multi-quark bound states also leads to a light-front cluster decomposition of form factors for an arbitrary number of constituents. The remarkable analytical structure which follows incorporates the correct scaling behavior at high photon virtualities and also vector dominance at low energies.

  10. Form factors and complete spectrum of XXX antiperiodic higher spin chains by quantum separation of variables

    SciTech Connect

    Niccoli, G.

    2013-05-15

    The antiperiodic transfer matrices associated to higher spin representations of the rational 6-vertex Yang-Baxter algebra are analyzed by generalizing the approach introduced recently in the framework of Sklyanin's quantum separation of variables (SOV) for cyclic representations, spin-1/2 highest weight representations, and also for spin-1/2 representations of the 6-vertex reflection algebra. Such SOV approach allow us to derive exactly results which represent complicate tasks for more traditional methods based on Bethe ansatz and Baxter Q-operator. In particular, we both prove the completeness of the SOV characterization of the transfer matrix spectrum and its simplicity. Then, the derived characterization of local operators by Sklyanin's quantum separate variables and the expression of the scalar products of separate states by determinant formulae allow us to compute the form factors of the local spin operators by one determinant formulae similar to those of the scalar products.

  11. Precision determination of the pion form factor and calculation of the muon g-2

    NASA Astrophysics Data System (ADS)

    de Trocóniz, J. F.; Ynduráin, F. J.

    2002-05-01

    We perform a new calculation of the hadronic contributions, a(Hadronic), to the anomalous magnetic moment of the muon, aμ. For the low-energy contributions of order α2 we carry over an analysis of the pion form factor Fπ(t) using recent data both on e+e--->π+π- and τ+-->νbarτπ+π0. In this analysis we take into account that the phase of the form factor is equal to that of ππ scattering. This allows us to profit fully from analyticity properties so we can also use experimental information on Fπ(t) at spacelike t. At higher energy we use QCD to supplement experimental data, including the recent measurements of e+e--->hadrons both around 1 GeV and near the cbarc threshold. This yields a precise determination of the O(α2) and O(α2)+O(α3) hadronic part of the photon vacuum polarization 1011×a(2)(h.v.p.)=6909+/-64 1011×a(2+3)(h.v.p.)=7002+/-66. As by-products we also get the masses and widths of the ρ0, ρ+, and very accurate values for the charge radius and second coefficient of the pion. Adding the remaining order α3 hadronic contributions we find 1011×atheory(hadronic)=6993+/-69 (e+e-+τ+spacel). The error above includes statistical, systematic, and estimated theoretical errors. The figures given are obtained including τ decay data; if we restrict ourselves to e+e- data, slightly lower values and somewhat higher errors are found. This is to be compared with the figure obtained by subtracting pure electroweak contributions from the recent experimental value, obtained from measurements of the muon gyromagnetic ratio (g-2), which reads 1011×aexpt(hadronic)=7174+/-150.

  12. Transition Form Factors: a Unique Opportunity to Connect Non-Perturbative Strong Interactions to QCD

    NASA Astrophysics Data System (ADS)

    Gothe, Ralf W.

    2014-01-01

    Meson-photoproduction measurements and their reaction-amplitude analyses can establish more sensitively, and in some cases in an almost model-independent way, nucleon excitations and non-resonant reaction amplitudes. However, to investigate the strong interaction from explored — where meson-cloud degrees of freedom contribute substantially to the baryon structure — to still unexplored distance scales — where quark degrees of freedom dominate and the transition from dressed to current quarks occurs — we depend on experiments that allow us to measure observables that are probing this evolving non-perturbative QCD regime over its full range. Elastic and transition form factors are uniquely suited to trace this evolution by measuring elastic electron scattering and exclusive single-meson and double-pion electroproduction cross sections off the nucleon. These exclusive measurements will be extended to higher momentum transfers with the energy-upgraded CEBAF beam at JLab to study the quark degrees of freedom, where their strong interaction is responsible for the ground and excited nucleon state formations. After establishing unprecedented high-precision data, the imminent next challenge is a high-quality analysis to extract these relevant electrocoupling parameters for various resonances that then can be compared to state-of-the-art models and QCD-based calculations. Recent results will demonstrate the status of the analysis and of their theoretical descriptions, and an experimental and theoretical outlook will highlight what shall and may be achieved in the new era of the 12-GeV upgraded transition form factor program.

  13. Transition Form Factors: A Unique Opportunity to Connect Non-Perturbative Strong Interactions to QCD

    SciTech Connect

    Gothe, Ralf W.

    2014-01-01

    Meson-photoproduction measurements and their reaction-amplitude analyses can establish more sensitively, and in some cases in an almost model-independent way, nucleon excitations and non-resonant reaction amplitudes. However, to investigate the strong interaction from explored — where meson-cloud degrees of freedom contribute substantially to the baryon structure — to still unexplored distance scales — where quark degrees of freedom dominate and the transition from dressed to current quarks occurs — we depend on experiments that allow us to measure observables that are probing this evolving non-perturbative QCD regime over its full range. Elastic and transition form factors are uniquely suited to trace this evolution by measuring elastic electron scattering and exclusive single-meson and double-pion electroproduction cross sections off the nucleon. These exclusive measurements will be extended to higher momentum transfers with the energy-upgraded CEBAF beam at JLab to study the quark degrees of freedom, where their strong interaction is responsible for the ground and excited nucleon state formations. After establishing unprecedented high-precision data, the imminent next challenge is a high-quality analysis to extract these relevant electrocoupling parameters for various resonances that then can be compared to state-of-the-art models and QCD-based calculations. Recent results will demonstrate the status of the analysis and of their theoretical descriptions, and an experimental and theoretical outlook will highlight what shall and may be achieved in the new era of the 12-GeV upgraded transition form factor program.

  14. Universal behavior of the γ⁎γ→(π0,η,η′) transition form factors

    PubMed Central

    Melikhov, Dmitri; Stech, Berthold

    2012-01-01

    The photon transition form factors of π, η and η′ are discussed in view of recent measurements. It is shown that the exact axial anomaly sum rule allows a precise comparison of all three form factors at high-Q2 independent of the different structures and distribution amplitudes of the participating pseudoscalar mesons. We conclude: (i) The πγ form factor reported by Belle is in excellent agreement with the nonstrange I=0 component of the η and η′ form factors obtained from the BaBar measurements. (ii) Within errors, the πγ form factor from Belle is compatible with the asymptotic pQCD behavior, similar to the η and η′ form factors from BaBar. Still, the best fits to the data sets of πγ, ηγ, and η′γ form factors favor a universal small logarithmic rise Q2FPγ(Q2)∼log(Q2). PMID:23226917

  15. Sulphur abundance determinations in star-forming regions - I. Ionization correction factor

    NASA Astrophysics Data System (ADS)

    Dors, O. L.; Pérez-Montero, E.; Hägele, G. F.; Cardaci, M. V.; Krabbe, A. C.

    2016-03-01

    In this work, we used a grid of photoionization models combined with stellar population synthesis models to derive reliable ionization correction factors (ICFs) for the sulphur in star-forming regions. These models cover a large range of nebular parameters and yielding ionic abundances in consonance with those derived through optical and infrared observational data of star-forming regions. From our theoretical ICFs, we suggested an α value of 3.27 ± 0.01 in the classical Stasińska formulae. We compared the total sulphur abundance in the gas phase of a large sample of objects by using our theoretical ICF and other approaches. In average, the differences between the determinations via the use of the different ICFs considered are similar to the uncertainties in the S/H estimations. Nevertheless, we noted that for some objects it could reach up to about 0.3 dex for the low-metallicity regime. Despite of the large scatter of the points, we found a trend of S/O ratio to decrease with the metallicity, independently of the ICF used to compute the sulphur total abundance.

  16. Supra­molecular hydrogen-bonding patterns in the N(9)—H protonated and N(7)—H tautomeric form of an N6-benzoyl­adenine salt: N 6-benzoyl­adeninium nitrate

    PubMed Central

    Karthikeyan, Ammasai; Jeeva Jasmine, Nithianantham; Thomas Muthiah, Packianathan; Perdih, Franc

    2016-01-01

    In the title molecular salt, C12H10N5O+·NO3 −, the adenine unit has an N 9-protonated N(7)—H tautomeric form with non-protonated N1 and N3 atoms. The dihedral angle between the adenine ring system and the phenyl ring is 51.10 (10)°. The typical intra­molecular N7—H⋯O hydrogen bond with an S(7) graph-set motif is also present. The benzoyl­adeninium cations also form base pairs through N—H⋯O and C—H⋯N hydrogen bonds involving the Watson–Crick face of the adenine ring and the C and O atoms of the benzoyl ring of an adjacent cation, forming a supra­molecular ribbon with R 2 2(9) rings. Benzoyl­adeninum cations are also bridged by one of the oxygen atoms of the nitrate anion, which acts as a double acceptor, forming a pair of N—H⋯O hydrogen bonds to generate a second ribbon motif. These ribbons together with π–π stacking inter­actions between the phenyl ring and the five- and six-membered adenine rings of adjacent mol­ecules generate a three-dimensional supra­molecular architecture. PMID:26958373

  17. Crystal Structure of a Translation Termination Complex Formed With Release Factor RF2

    SciTech Connect

    Korostelev, A.; Asahara, H.; Lancaster, L.; Laurberg, M.; Hirschi, A.; Zhu, J.; Trakhanov, S.; Scott, W.G.; Noller, H.F.

    2009-05-20

    We report the crystal structure of a translation termination complex formed by the Thermus thermophilus 70S ribosome bound with release factor RF2, in response to a UAA stop codon, solved at 3 {angstrom} resolution. The backbone of helix -5 and the side chain of serine of the conserved SPF motif of RF2 recognize U1 and A2 of the stop codon, respectively. A3 is unstacked from the first 2 bases, contacting Thr-216 and Val-203 of RF2 and stacking on G530 of 16S rRNA. The structure of the RF2 complex supports our previous proposal that conformational changes in the ribosome in response to recognition of the stop codon stabilize rearrangement of the switch loop of the release factor, resulting in docking of the universally conserved GGQ motif in the PTC of the 50S subunit. As seen for the RF1 complex, the main-chain amide nitrogen of glutamine in the GGQ motif is positioned to contribute directly to catalysis of peptidyl-tRNA hydrolysis, consistent with mutational studies, which show that most side-chain substitutions of the conserved glutamine have little effect. We show that when the H-bonding capability of the main-chain N-H of the conserved glutamine is eliminated by substitution with proline, peptidyl-tRNA esterase activity is abolished, consistent with its proposed role in catalysis.

  18. Factors Influencing Shear Alignment of Cylinder-Forming Block Copolymer Thin Films

    NASA Astrophysics Data System (ADS)

    Davis, Raleigh; Register, Richard; Chaikin, Paul

    2014-03-01

    Application of shear stress to block copolymers is known to preferentially orient the microdomains in the direction of applied shear. While this phenomenon has been well studied for bulk block copolymer systems, the use of shear stress to align microdomains in block copolymer thin films (typically one to several microdomain layers) is still an active area of research. Numerous experimental factors influence the ease with which orientation is achieved as well as the ultimate quality of alignment observed. The present work investigates several of these factors using a series of cylinder-forming poly(styrene)-poly(hexylmethacrylate) copolymers. Parameters studied include film thickness, block copolymer molecular weight and composition, substrate wetting conditions (controlled via grafted polymer brush layers of either polystyrene or polyhexylmethacrylate), and applied shear stress. Quality of alignment is assessed via atomic force microscopy and subsequent computation of an orientational order parameter and the density of defects in the microdomain lattice. The results are compared to a melting-recrystallization model, thus providing greater insight into the fundamental mechanisms and key parameters which control how microdomains order in response to shear. In general monolayers are observed to align more poorly than thicker films, though the influence of film thickness on orientation depends strongly on polymer composition. Alignment quality is ultimately limited by inherent fluctuations in the cylinder trajectories as well as the presence of isolated dislocations.

  19. Factors limiting the establishment of canopy-forming algae on artificial structures

    NASA Astrophysics Data System (ADS)

    Cacabelos, Eva; Martins, Gustavo M.; Thompson, Richard; Prestes, Afonso C. L.; Azevedo, José Manuel N.; Neto, Ana I.

    2016-11-01

    Macroalgal canopies are important ecosystem engineers, contributing to coastal productivity and supporting a rich assemblage of associated flora and fauna. However, they are often absent from infrastructures such as coastal defences and there has been a worldwide decline in their distribution in urbanised coastal areas. The macroalga Fucus spiralis is the only high-shore canopy forming species present in the Azores. It is widely distributed in the archipelago but is never found on coastal infrastructures. Here we evaluate factors that may potentially limit its establishment on artificial structures. A number of observational and manipulative experiments were used to test the hypotheses that: (i) limited-dispersal ability limits the colonisation of new plants onto artificial structures, (ii) vertical substratum slope negatively influences the survivorship of recruits, and (iii) vertical substratum slope also negatively influences the survivorship and fitness of adults. Results showed that the limited dispersal from adult plants may be a more important factor than slope in limiting the species ability to colonise coastal infrastructures, since the vertical substratum slope does not affect its fitness or survivorship.

  20. Proton interrogation

    SciTech Connect

    Morris, Christopher L

    2008-01-01

    Energetic proton beams may provide an attractive alternative when compared to electromagnetic and neutron beams for active interrogation of nuclear threats because: they have large fission cross sections, long mean free paths and high penetration, and proton beams can be manipulated with magnetic optics. We have measured time-dependent cross sections for delayed neutrons and gamma-rays using the 800 MeV proton beam from the Los Alamos Neutron Science Center for a set of bare and shielded targets. The results show significant signals from both unshielded and shielded nuclear materials. Results will be presented.

  1. A Non-parametric approach to the D+ ---> anti-K*0 mu+ nu form-factors

    SciTech Connect

    Link, J.M.; Yager, P.M.; Anjos, J.C.; Bediaga, I.; Castromonte, C.; Machado, A.A.; Magnin, J.; Massafferri, A.; de Miranda, J.M.; Pepe, I.M.; Polycarpo, E.; dos Reis, A.C.; Carrillo, S.; Casimiro, E.; Cuautle, E.; Sanchez-Hernandez, A.; Uribe, C.; Vazquez, F.; Agostino, L.; Cinquini, L.; Cumalat, J.P.; /Colorado U. /Fermilab /Frascati /Guanajuato U. /Illinois U., Urbana /Indiana U. /Korea U. /Kyungpook Natl. U. /INFN, Milan /Milan U. /North Carolina U. /Pavia U. /INFN, Pavia /Rio de Janeiro, Pont. U. Catol. /Puerto Rico U., Mayaguez /South Carolina U. /Tennessee U. /Vanderbilt U. /Wisconsin U., Madison

    2005-09-01

    Using a large sample of D{sup +} {yields} K{sup -} {pi}{sup +} {mu}{sup +}{nu} decays collected by the FOCUS photo-production experiment at Fermilab, we present the first measurements of the helicity basis form factors free from the assumption of spectroscopic pole dominance. We also present the first information on the form factor that controls the s-wave interference discussed in a previous paper by the FOCUS collaboration. We find reasonable agreement with the usual assumption of spectroscopic pole dominance and measured form factor ratios.

  2. First principles calculations of nucleon and pion form factors: understanding the building blocks of nuclear matter from lattice QCD

    SciTech Connect

    Constantia Alexandrou; Bojan Bistrovic; Robert Edwards; P de Forcrand; George Fleming; Philipp Haegler; John Negele; Konstantinos Orginos; Andrew Pochinsky; Dru Renner; David Richards; Wolfram Schroers; Antonios Tsapalis

    2005-10-01

    Lattice QCD is an essential complement to the current and anticipated DOE-supported experimental program in hadronic physics. In this poster we address several key questions central to our understanding of the building blocks of nuclear matter, nucleons and pions. Firstly, we describe progress at computing the electromagnetic form factors of the nucleon, describing the distribution of charge and current, before considering the role played by the strange quarks. We then describe the study of transition form factors to the Delta resonance. Finally, we present recent work to determine the pion form factor, complementary to the current JLab experimental determination and providing insight into the approach to asymptotic freedom.

  3. Inward diffusion and loss of radiation belt protons

    NASA Astrophysics Data System (ADS)

    Selesnick, R. S.; Baker, D. N.; Jaynes, A. N.; Li, X.; Kanekal, S. G.; Hudson, M. K.; Kress, B. T.

    2016-03-01

    Radiation belt protons in the kinetic energy range 24 to 76 MeV are being measured by the Relativistic Electron Proton Telescope on each of the two Van Allen Probes. Data have been processed for the purpose of studying variability in the trapped proton intensity during October 2013 to August 2015. For the lower energies (≲32 MeV), equatorial proton intensity near L = 2 showed a steady increase that is consistent with inward diffusion of trapped solar protons, as shown by positive radial gradients in phase space density at fixed values of the first two adiabatic invariants. It is postulated that these protons were trapped with enhanced efficiency during the 7 March 2012 solar proton event. A model that includes radial diffusion, along with known trapped proton source and loss processes, shows that the observed average rate of increase near L = 2 is predicted by the same model diffusion coefficient that is required to form the entire proton radiation belt, down to low L, over an extended (˜103 year) interval. A slower intensity decrease for lower energies near L = 1.5 may also be caused by inward diffusion, though it is faster than predicted by the model. Higher-energy (≳40 MeV) protons near the L = 1.5 intensity maximum are from cosmic ray albedo neutron decay. Their observed intensity is lower than expected by a factor ˜2, but the discrepancy is resolved by adding an unspecified loss process to the model with a mean lifetime ˜120 years.

  4. Electron- and positron-proton elastic scattering in CLAS

    SciTech Connect

    L.B. Weinstein

    2009-08-01

    There is a significant disagreement between measurements of the proton electric form factor, G{sup p}{sub E}, using Rosenbluth separations and polarization transfer. This disagreement, if not explained, could pose a fundamental challenge to our understanding of electron scattering or proton structure. Two-photon exchange (TPE) processes, although not fully calculable, are the most likely explanation of this disagreement. We will definitively test this assertion by comparing the electron-proton and positron-proton elastic scattering cross section in the Jefferson Lab CLAS. We will make a mixed identical electron and positron tertiary beam by passing a 5.5 GeV primary electron beam through a radiator to make a photon beam and then passing the photon beam through a converter to make electron-positron pairs. Measuring the elastic cross sections simultaneously using identical lepton beams should significantly reduce systematic uncertainties.

  5. Characterization of the clotting activities of structurally different forms of activated factor IX. Enzymatic properties of normal human factor IXa alpha, factor IXa beta, and activated factor IX Chapel Hill.

    PubMed Central

    Griffith, M J; Breitkreutz, L; Trapp, H; Briet, E; Noyes, C M; Lundblad, R L; Roberts, H R

    1985-01-01

    Two structurally different forms of activated human Factor IX (Factor IXa alpha and IXa beta) have been previously reported to have essentially identical clotting activity in vitro. Although it has been shown that activated Factor IX Chapel Hill, an abnormal Factor IX isolated from the plasma of a patient with mild hemophilia B, and normal Factor IXa alpha are structurally very similar, the clotting activity of activated Factor IX Chapel Hill is much lower (approximately fivefold) than that of normal Factor IXa beta. In the present study we have prepared activated Factor IX by incubating human Factor IX with calcium and Russell's viper venom covalently bound to agarose. Fractionation of the activated Factor IX by high-performance liquid chromatography demonstrated the presence of both Factors IXa alpha and IXa beta. On the basis of active site concentration, determined by titration with antithrombin III, the clotting activities of activated Factor IX Chapel Hill and IXa alpha were similar, but both activities were less than 20% of the clotting activity of Factor IXa beta. Activated Factor IX activity was also measured in the absence of calcium, phospholipid, and Factor VIII, by determination of the rate of Factor X activation in the presence of polylysine. In the presence of polylysine, the rates of Factor X activation by activated Factor IX Chapel Hill, Factor IXa alpha, and Factor IXa beta were essentially identical. We conclude that the clotting activity of activated Factor IX Chapel Hill is reduced when compared with that of Factor IXa beta but essentially normal when compared with that of Factor IXa alpha. PMID:3871202

  6. A new set of regulatory molecules in plants: A plant phospholipid similar to platelet-activating factor stimulates protein kinase and proton-translocating ATPase in membrane vesicles.

    PubMed

    Scherer, G F; Martiny-Baron, G; Stoffel, B

    1988-08-01

    1-O-alkyl-2-acetyl-sn-glycero-3-phosphocholine, an ether phospholipid from mammals known as platelet-activating factor (PAF), specifically stimulates proton transport in zucchini (Cucurbita pepo L.) microsomes (G.F.E. Scherer, 1985, Biochem. Biophys. Res. Commm. 133, 1160-1167). When plant lipids were analyzed by two-dimensional thin-layer chromatography a lipid was found with chromatographic properties very similar to the PAF (G.F.E. Scherer and B. Stoffel, 1987, Planta, 172, 127-130). This lipid was isolated from zucchini hypocotyls, red beet root, lupin root, maize seedlings and crude soybean phospholipids. It had biological activity similar to that of the PAF, based on phosphorus content, and stimulated the steady-state ΔpH in zucchini hypocotyl microsomes about twofold. Other phospholipids, monoglyceride, diglyceride, triglyceride, oleic acid, phorbol ester, and 1-O-alkylglycerol did not stimulate proton transport. When microsomes were washed the PAF was ineffective but when soluble protein was added the PAF stimulation of H(+) transport was reconstituted. The soluble protein responsible for the PAF-dependent stimulation of transport activity could be partially purified by diethylaminoethyl Sephacel column chromatography. In the same fractions where the PAF-dependent transport-stimulatory protien was found, a protein kinase was active. This protein kinase was stimulated twofold either by the PAF or by Ca(2+). When Ca(2+) was present the PAF did not stimulate protein-kinase activity. When either the PAF, protein kinase, or both were added to membranes isolated on a linear sucrose gradient, ATPase activity was stimulated up to 30%. Comparison with marker enzymes indicated the possibility that tonoplast and plasma-membrane H(+)-ATPase might be stimulated by the PAF and protein kinase. We speculate that a PAF-dependent protein kinase is involved in the regulation of proton transport in plants in vitro and in vivo.

  7. Aspects of Precision Calculations of Nucleon Generalized Form Factors with Domain Wall Fermions on an Asqtad Sea

    SciTech Connect

    Bratt, Jonathan; Edwards, Robert; Engelhardt, Michael; Fleming, George; Hagler, Ph.; Lin, Meifeng; Meyer, Harvey; Musch, Bernhard; Negele, John; Orginos, Konstantinos; Pochinsky, Andrew; Procura, M.; Renner, Dru; Richards, David; Schroers, Wolfram; Syritsyn, Sergey

    2008-12-01

    In order to advance lattice calculations of moments of unpolarized, helicity, and transversity distributions, electromagnetic form factors, and generalized form factors of the nucleon to a new level of precision, this work investigates several key aspects of precision lattice calculations. We calculate the number of configurations required for constant statistical errors as a function of pion mass, describe the coherent sink method to help achieve these statistics, examine the statistical correlations between separate measurements, study correlations in the behavior of form factors at different momentum transfer, examine volume dependence, and compare mixed action results with those using comparable dynamical domain wall configurations. We also show selected form factor results and comment on the QCD evolution of our calculations of the flavor non-singlet nucleon angular momentum.

  8. Measurement of the neutron magnetic form factor from inclusive quasielastic scattering of polarized electrons from polarized [sup 3]He

    SciTech Connect

    Gao, H.; Arrington, J.; Beise, E.J.; Bray, B.; Carr, R.W.; Filippone, B.W.; Lung, A.; McKeown, R.D.; Mueller, B.; Pitt, M.L. ); Jones, C.E. ); DeSchepper, D.; Dodson, G.; Dow, K.; Ent, R.; Farkhondeh, M.; Hansen, J.; Korsch, W.; Kramer, L.H.; Lee, K.; Makins, N.; Milner, R.G.; Tieger, D.R.; Welch, T.P. ); Candell, E.; Napolitano, J.; Wojtsekhowski, B.B.; Tripp, C. ); Lorenzon, W. )

    1994-08-01

    We report a measurement of the asymmetry in spin-dependent quasielastic scattering of longitudinally polarized electrons from a polarized [sup 3]He target. The neutron magnetic form factor [ital G][sup [ital n

  9. Mechanism and Influencing Factors of Iron Nuggets Forming in Rotary Hearth Furnace Process at Lower Temperature

    NASA Astrophysics Data System (ADS)

    Han, Hongliang; Duan, Dongping; Chen, Siming; Yuan, Peng

    2015-10-01

    In order to improve the efficiency of slag and iron separation, a new idea of "the separation of slag (solid state) and iron (molten state) in rotary hearth furnace process at lower temperature" is put forward. In this paper, the forming process of iron nuggets has been investigated. Based on those results, the forming mechanisms and influencing factors of iron nugget at low temperature are discussed experimentally using an electric resistance furnace simulating a rotary hearth furnace process. Results show that the reduction of iron ore, carburization of reduced iron, and the composition and quantity of slag are very important for producing iron nuggets at lower temperature. Reduction reaction of carbon-containing pellets is mainly at 1273 K and 1473 K (1000 °C and 1200 °C). When the temperature is above 1473 K (1200 °C), the metallization rate of carbon-containing pellets exceeds 93 pct, and the reduction reaction is substantially complete. Direct carburization is the main method for carburization of reduced iron. This reaction occurs above 1273 K (1000 °C), with carburization degree increasing greatly at 1473 K and 1573 K (1200 °C and 1300 °C) after particular holding times. Besides, to achieve the "slag (solid state) and iron (molten state) separation," the melting point of the slag phase should be increased. Slag (solid state) and iron (molten state) separation can be achieved below 1573 K (1300 °C), and when the holding time is 20 minutes, C/O is 0.7, basicity is less than 0.5 and a Na2CO3 level of 3 pct, the recovery rate of iron can reach 90 pct, with a proportion of iron nuggets more than 3.15 mm of nearly 90 pct. This study can provide theoretical and technical basis for iron nugget production.

  10. Measurements of the Electric Form Factor of the Neutron at Q^2=0.45 and 1.13 (GeV/c)^2

    SciTech Connect

    Shigeyuki Tajima

    2003-12-31

    .45 (GeV/c)2 are more precise than prior measurements at lower Q2. In this dissertation, the data analyses and our results for g and Gn E at Q2=0.45 (GeV/c)2 and Q2=1.13 (GeV/c)2 are given. Our high-accuracy data are included with the ?world? data for Gn E to form an improved data set that was fit with an empirical function to give a simple parameterization of Gn E as a function of Q2. In addition, the data for the ratio Gn E/Gn M are compared to theoretical models of the nucleon. We found that no theoretical model predicts both proton and neutron form factor data.

  11. Extracellular acidification induces connective tissue growth factor production through proton-sensing receptor OGR1 in human airway smooth muscle cells

    SciTech Connect

    Matsuzaki, Shinichi; Ishizuka, Tamotsu; Yamada, Hidenori; Kamide, Yosuke; Hisada, Takeshi; Ichimonji, Isao; Aoki, Haruka; Yatomi, Masakiyo; Komachi, Mayumi; Tsurumaki, Hiroaki; Ono, Akihiro; Koga, Yasuhiko; Dobashi, Kunio; Mogi, Chihiro; Sato, Koichi; Tomura, Hideaki; Mori, Masatomo; Okajima, Fumikazu

    2011-10-07

    Highlights: {yields} The involvement of extracellular acidification in airway remodeling was investigated. {yields} Extracellular acidification alone induced CTGF production in human ASMCs. {yields} Extracellular acidification enhanced TGF-{beta}-induced CTGF production in human ASMCs. {yields} Proton-sensing receptor OGR1 was involved in acidic pH-stimulated CTGF production. {yields} OGR1 may play an important role in airway remodeling in asthma. -- Abstract: Asthma is characterized by airway inflammation, hyper-responsiveness and remodeling. Extracellular acidification is known to be associated with severe asthma; however, the role of extracellular acidification in airway remodeling remains elusive. In the present study, the effects of acidification on the expression of connective tissue growth factor (CTGF), a critical factor involved in the formation of extracellular matrix proteins and hence airway remodeling, were examined in human airway smooth muscle cells (ASMCs). Acidic pH alone induced a substantial production of CTGF, and enhanced transforming growth factor (TGF)-{beta}-induced CTGF mRNA and protein expression. The extracellular acidic pH-induced effects were inhibited by knockdown of a proton-sensing ovarian cancer G-protein-coupled receptor (OGR1) with its specific small interfering RNA and by addition of the G{sub q/11} protein-specific inhibitor, YM-254890, or the inositol-1,4,5-trisphosphate (IP{sub 3}) receptor antagonist, 2-APB. In conclusion, extracellular acidification induces CTGF production through the OGR1/G{sub q/11} protein and inositol-1,4,5-trisphosphate-induced Ca{sup 2+} mobilization in human ASMCs.

  12. Development and application of fully functional epitope-tagged forms of transforming growth factor-beta.

    PubMed

    Wolfraim, Lawrence A; Alkemade, Gonnie M; Alex, Biju; Sharpe, Shellyann; Parks, W Tony; Letterio, John J

    2002-08-01

    Administration of transforming growth factor-beta (TGF-beta) has been found to be of therapeutic benefit in various mouse disease models and has potential clinical usefulness. However, the ability to track the distribution of exogenously administered, recombinant forms of these proteins has been restricted by cross-reactivity with endogenous TGF-beta and related TGF-beta isoforms. We describe novel FLAG- and hemagglutinin (HA)-tagged versions of mature TGF-beta1 that retain full biological activity as demonstrated by their ability to inhibit the growth of Mv1Lu epithelial cells, and to induce phosphorylation of the TGF-beta signaling intermediate, smad 2. Intracellular FLAG- and HA-TGF-beta1 can be detected in transfected cells by confocal immunofluorescence microscopy. We also describe sandwich ELISAs designed to specifically detect epitope-tagged TGF-beta and demonstrate the utility of these tagged ligands as probes for TGF-beta receptor expression by flow cytometry. The design of these fully functional epitope-tagged TGF-beta proteins should facilitate studies such as the evaluation of in vivo peptide pharmacodynamics and trafficking of TGF-beta ligand-receptor complexes.

  13. Strange Baryon Electromagnetic Form Factors and SU(3) Flavor Symmetry Breaking

    SciTech Connect

    Lin, Huey-Wen; Orginos, Konstantinos

    2009-01-01

    We study the nucleon, Sigma and cascade octet baryon electromagnetic form factors and the effects of SU(3) flavor symmetry breaking from 2+1-flavor lattice calculations. We find that electric and magnetic radii are similar; the maximum discrepancy is about 10\\%. In the pion-mass region we explore, both the quark-component and full-baryon moments have small SU(3) symmetry breaking. We extrapolate the charge radii and the magnetic moments using three-flavor heavy-baryon chiral perturbation theory (HBXPT). The systematic errors due to chiral and continuum extrapolations remain significant, giving rise to charge radii for $p$ and $\\Sigma^-$ that are 3--4 standard deviations away from the known experimental ones. Within these systematics the predicted $\\Sigma^+$ and $\\Xi^-$ radii are 0.67(5) and 0.306(15)~fm$^2$ respectively. When the next-to-next-to-leading order of HBXPT is included, the extrapolated magnetic moments are less than 3 standard deviations away from PDG values, and the d

  14. Atomic-scale electronic structure of the cuprate d-symmetry form factor density wave state

    NASA Astrophysics Data System (ADS)

    Hamidian, M. H.; Edkins, S. D.; Kim, Chung Koo; Davis, J. C.; MacKenzie, A. P.; Eisaki, H.; Uchida, S.; Lawler, M. J.; Kim, E.-A.; Sachdev, S.; Fujita, K.

    2016-02-01

    Research on high-temperature superconducting cuprates is at present focused on identifying the relationship between the classic `pseudogap’ phenomenon and the more recently investigated density wave state. This state is generally characterized by a wavevector Q parallel to the planar Cu-O-Cu bonds along with a predominantly d-symmetry form factor (dFF-DW). To identify the microscopic mechanism giving rise to this state, one must identify the momentum-space states contributing to the dFF-DW spectral weight, determine their particle-hole phase relationship about the Fermi energy, establish whether they exhibit a characteristic energy gap, and understand the evolution of all these phenomena throughout the phase diagram. Here we use energy-resolved sublattice visualization of electronic structure and reveal that the characteristic energy of the dFF-DW modulations is actually the `pseudogap’ energy Δ1. Moreover, we demonstrate that the dFF-DW modulations at E = -Δ1 (filled states) occur with relative phase π compared to those at E = Δ1 (empty states). Finally, we show that the conventionally defined dFF-DW Q corresponds to scattering between the `hot frontier’ regions of momentum-space beyond which Bogoliubov quasiparticles cease to exist. These data indicate that the cuprate dFF-DW state involves particle-hole interactions focused at the pseudogap energy scale and between the four pairs of `hot frontier’ regions in momentum space where the pseudogap opens.

  15. Scattering from phase-separated vesicles. I. An analytical form factor for multiple static domains

    DOE PAGESBeta

    Heberle, Frederick A.; Anghel, Vinicius N. P.; Katsaras, John

    2015-08-18

    This is the first in a series of studies considering elastic scattering from laterally heterogeneous lipid vesicles containing multiple domains. Unique among biophysical tools, small-angle neutron scattering can in principle give detailed information about the size, shape and spatial arrangement of domains. A general theory for scattering from laterally heterogeneous vesicles is presented, and the analytical form factor for static domains with arbitrary spatial configuration is derived, including a simplification for uniformly sized round domains. The validity of the model, including series truncation effects, is assessed by comparison with simulated data obtained from a Monte Carlo method. Several aspects ofmore » the analytical solution for scattering intensity are discussed in the context of small-angle neutron scattering data, including the effect of varying domain size and number, as well as solvent contrast. Finally, the analysis indicates that effects of domain formation are most pronounced when the vesicle's average scattering length density matches that of the surrounding solvent.« less

  16. ηc elastic and transition form factors: Contact interaction and algebraic model

    NASA Astrophysics Data System (ADS)

    Bedolla, Marco A.; Raya, Khépani; Cobos-Martínez, J. J.; Bashir, Adnan

    2016-05-01

    For the flavor-singlet heavy-quark system of charmonia in the pseudoscalar [ηc(1 S ) ] channel, we calculate the elastic (EFF) and transition form factors (TFFs) [ηc(1 S )→γ γ* ] for a wide range of photon momentum transfer squared (Q2). The framework for this analysis is provided by a symmetry-preserving Schwinger-Dyson equation and Bethe-Salpeter equation treatment of a vector×vector contact interaction. We also employ an algebraic model, developed earlier to describe the light-quark systems. It correctly correlates infrared and ultraviolet dynamics of quantum chromodynamics (QCD). The contact interaction results agree with the lattice data for low Q2. For Q2≥Q02 , the results start deviating from the lattice results by more than 20%. Q02≈2.5 GeV2 for the EFF, and ≈25 GeV2 for the TFF. We also present the results for the EFF, TFF, and ηc(1 S ) parton distribution amplitude for the algebraic model. Wherever the comparison is possible, these results are in excellent agreement with the lattice, perturbative QCD, results obtained through a Schwinger-Dyson equation-Bethe-Salpeter equation study, employing refined truncations, and the experimental findings of the BABAR experiment.

  17. Small Form Factor Information Storage Devices for Mobile Applications in Korea

    NASA Astrophysics Data System (ADS)

    Park, Young-Pil; Park, No-Cheol; Kim, Chul-Jin

    Recently, the ubiquitous environment in which anybody can reach a lot of information data without any limitations on the place and time has become an important social issue. There are two basic requirements in the field of information storage devices which have to be satisfied; the first is the demand for the improvement of memory capacity to manage the increased data capacity in personal and official purposes. The second is the demand for new development of information storage devices small enough to be applied to mobile multimedia digital electronics, including digital camera, PDA and mobile phones. To summarize, for the sake of mobile applications, it is necessary to develop information storage devices which have simultaneously a large capacity and a small size. Korea possesses the necessary infrastructure for developing such small sized information storage devices. It has a good digital market, major digital companies, and various research institutes. Nowadays, many companies and research institutes including university cooperate together in the research on small sized information storage devices. Thus, it is expected that small form factor optical disk drives will be commercialized in the very near future in Korea.

  18. Hadronic form factor models and spectroscopy within the gauge/gravity correspondence

    SciTech Connect

    de Teramond, Guy F.; Brodsky, Stanley J.; /SLAC

    2012-03-20

    We show that the nonperturbative light-front dynamics of relativistic hadronic bound states has a dual semiclassical gravity description on a higher dimensional warped AdS space in the limit of zero quark masses. This mapping of AdS gravity theory to the boundary quantum field theory, quantized at fixed light-front time, allows one to establish a precise relation between holographic wave functions in AdS space and the light-front wavefunctions describing the internal structure of hadrons. The resulting AdS/QCD model gives a remarkably good accounting of the spectrum, elastic and transition form factors of the light-quark hadrons in terms of one parameter, the QCD gap scale. The light-front holographic approach described here thus provides a frame-independent first approximation to the light-front Hamiltonian problem for QCD. This article is based on lectures at the Niccolo Cabeo International School of Hadronic Physics, Ferrara, Italy, May 2011.

  19. Assessment of Factors Affecting Adolescent Patients’ Compliance with Hawley and Vacuum Formed Retainers

    PubMed Central

    Mirzakouchaki, Behnam; Sharghi, Reza; Shirazi, Samaneh

    2016-01-01

    Introduction Success of orthodontic retention with removable retainers almost entirely depends on patients’ compliance. Aim This study was carried out to investigate the relationship between adolescent orthodontic patients’ compliance and various clinical and social factors. Materials and Methods The data were collected from 77 orthodontic patients aged 7-11 years old who had finished the full fixed appliance therapy. Hawley’s retainers were used in 34 patients and 43 patients used Vacuum Formed Retainers (VFRs). The subjects completed a questionnaire including several identifiers allowing the respondents to be classified into subgroups. They were also asked to indicate how long they wore their retainers during the day, by writing the number of hours in the report-card for the next three months. Comparison of the results was performed by one-way ANOVA and independent sample-t tests. Results No significant differences were found between males and females. Type of the retainer, patients’ grade of study, mothers’ occupation, clinicians’ and parents’ attitudes and filling the report cards had significant effect on mean wear hours per day. When compliance of the patients was assessed according to treatment location, Living place, parents’ educational degrees and ethnicity, no significant differences could be found. Conclusion The adolescent patients’ compliance was greater with VFRs than with Hawley’s retainers. Parental attitude and doctor-patient relationship had a great impact on adolescent patients’ compliance. PMID:27504404

  20. ES1 is a mitochondrial enlarging factor contributing to form mega-mitochondria in zebrafish cones.

    PubMed

    Masuda, Takamasa; Wada, Yasutaka; Kawamura, Satoru

    2016-03-01

    Total mass of mitochondria increases during cell proliferation and differentiation through mitochondrial biogenesis, which includes mitochondrial proliferation and growth. During the mitochondrial growth, individual mitochondria have been considered to be enlarged independently of mitochondrial fusion. However, molecular basis for this enlarging process has been poorly understood. Cone photoreceptor cells in the retina possess large mitochondria, so-called mega-mitochondria that have been considered to arise via the enlarging process. Here we show that ES1 is a novel mitochondria-enlarging factor contributing to form mega-mitochondria in cones. ES1 is specifically expressed in cones and localized to mitochondria including mega-mitochondria. Knockdown of ES1 markedly reduced the mitochondrial size in cones. In contrast, ectopic expression of ES1 in rods significantly increased both the size of individual mitochondria and the total mass of the mitochondrial cluster without changing the number of them. RNA-seq analysis showed that ERRα and its downstream mitochondrial genes were significantly up-regulated in the ES1-expressing rods, suggesting facilitation of mitochondrial enlargement via ERRα-dependent processes. Furthermore, higher energy state was detected in the ES1-expressing rods, indicating that the enlarged mitochondria by ES1 are capable of producing high energy. ES1 is the mitochondrial protein that is first found to promote enlargement of individual mitochondria.

  1. Aged adrenal medullary tissue survives intraocular grafting, forms nerve fibers and responds to nerve growth factor.

    PubMed

    Strömberg, I; Ebendal, T

    1989-06-01

    Adrenal medullary tissue from aged (24 months old) and young adult (2 months old) rats was grafted to the anterior chamber of the eye of previously sympathectomized animals. Nerve growth factor (NGF) was administered by weekly bilateral intraocular injections. Five weeks postgrafting, irides were prepared as whole mounts and processed for Falck-Hillarp histochemistry for visualization of catecholamines. NGF appeared to partially prevent the reduction in volume that both old and young grafts underwent. In the presence of NGF, an extensive, dense fiber network, closely resembling the normal adrenergic innervation, was formed in the host irides by grafts from aged donors. The area of outgrowth from aged transplants without NGF treatment was as large as with NGF treatment but less dense. The reinnervation of irides by NGF-treated young adult grafts occupied a similar area as that seen with aged grafts, but the pattern of innervation was irregular, particularly close to the transplants. Transplants from young adult donors without NGF treatment generated a sparse, limited network of nerves in the irides. All grafts were tyrosine hydroxylase-, adrenaline-, and dopamine-beta-hydroxylase-immunoreactive in about the same proportion of cells, but the grafts from the young donors were smaller in size. We concluded that the ability of chromaffin cells to transform toward a neuronal phenotype, produce nerve fibers, and respond to exogenous NGF is maintained in aged adrenals. PMID:2754763

  2. Covariant Spectator Theory of np scattering: Deuteron magnetic moment and form factors

    SciTech Connect

    Gross, Franz L.

    2014-06-01

    The deuteron magnetic moment is calculated using two model wave functions obtained from 2007 high precision fits to $np$ scattering data. Included in the calculation are a new class of isoscalar $np$ interaction currents which are automatically generated by the nuclear force model used in these fits. After normalizing the wave functions, nearly identical predictions are obtained: model WJC-1, with larger relativistic P-state components, gives 0.863(2), while model WJC-2 with very small $P$-state components gives 0.864(2) These are about 1\\% larger than the measured value of the moment, 0.857 n.m., giving a new prediction for the size of the $\\rho\\pi\\gamma$ exchange, and other purely transverse interaction currents that are largely unconstrained by the nuclear dynamics. The physical significance of these results is discussed, and general formulae for the deuteron form factors, expressed in terms of deuteron wave functions and a new class of interaction current wave functions, are given.

  3. Virtuality Distributions in application to gamma gamma* to pi^0 Transition Form Factor at Handbag Level

    SciTech Connect

    Radyushkin, Anatoly V.

    2014-07-01

    We outline basics of a new approach to transverse momentum dependence in hard processes. As an illustration, we consider hard exclusive transition process gamma*gamma -> to pi^0 at the handbag level. Our starting point is coordinate representation for matrix elements of operators (in the simplest case, bilocal O(0,z)) describing a hadron with momentum p. Treated as functions of (pz) and z^2, they are parametrized through a virtuality distribution amplitude (VDA) Phi (x, sigma), with x being Fourier-conjugate to (pz) and sigma Laplace-conjugate to z^2. For intervals with z^+=0, we introduce transverse momentum distribution amplitude (TMDA) Psi (x, k_\\perp), and write it in terms of VDA Phi (x, \\sigma). The results of covariant calculations, written in terms of Phi (x sigma) are converted into expressions involving Psi (x, k_\\perp. Starting with scalar toy models, we extend the analysis onto the case of spin-1/2 quarks and QCD. We propose simple models for soft VDAs/TMDAs, and use them for comparison of handbag results with experimental (BaBar and BELLE) data on the pion transition form factor. We also discuss how one can generate high-k_\\perp tails from primordial soft distributions.

  4. ES1 is a mitochondrial enlarging factor contributing to form mega-mitochondria in zebrafish cones

    PubMed Central

    Masuda, Takamasa; Wada, Yasutaka; Kawamura, Satoru

    2016-01-01

    Total mass of mitochondria increases during cell proliferation and differentiation through mitochondrial biogenesis, which includes mitochondrial proliferation and growth. During the mitochondrial growth, individual mitochondria have been considered to be enlarged independently of mitochondrial fusion. However, molecular basis for this enlarging process has been poorly understood. Cone photoreceptor cells in the retina possess large mitochondria, so-called mega-mitochondria that have been considered to arise via the enlarging process. Here we show that ES1 is a novel mitochondria-enlarging factor contributing to form mega-mitochondria in cones. ES1 is specifically expressed in cones and localized to mitochondria including mega-mitochondria. Knockdown of ES1 markedly reduced the mitochondrial size in cones. In contrast, ectopic expression of ES1 in rods significantly increased both the size of individual mitochondria and the total mass of the mitochondrial cluster without changing the number of them. RNA-seq analysis showed that ERRα and its downstream mitochondrial genes were significantly up-regulated in the ES1-expressing rods, suggesting facilitation of mitochondrial enlargement via ERRα-dependent processes. Furthermore, higher energy state was detected in the ES1-expressing rods, indicating that the enlarged mitochondria by ES1 are capable of producing high energy. ES1 is the mitochondrial protein that is first found to promote enlargement of individual mitochondria. PMID:26926452

  5. Scalar K{pi} form factor and light-quark masses

    SciTech Connect

    Jamin, Matthias; Oller, Jose Antonio; Pich, Antonio

    2006-10-01

    Recent experimental improvements on K-decay data allow for a precise extraction of the strangeness-changing scalar K{pi} form factor and the related strange scalar spectral function. On the basis of this scalar as well as the corresponding pseudoscalar spectral function, the strange quark mass is determined to be m{sub s}(2 GeV)=92{+-}9 MeV. Further taking into account chiral perturbation theory mass ratios, the light up and down quark masses turn out to be m{sub u}(2 GeV)=2.7{+-}0.4 MeV as well as m{sub d}(2 GeV)=4.8{+-}0.5 MeV. As a by-product, we also find a value for the Cabibbo angle |V{sub us}|=0.2236(29) and the ratio of meson decay constants F{sub K}/F{sub {pi}}=1.203(16). Performing a global average of the strange mass by including extractions from other channels as well as lattice QCD results yields m{sub s}(2 GeV)=94{+-}6 MeV.

  6. Measurement of the gamma gamma* to eta_c transition form factor

    SciTech Connect

    Lees, J.P.; Poireau, V.; Prencipe, E.; Tisserand, V.; Garra Tico, J.; Grauges, E.; Martinelli, M.; Palano, A.; Pappagallo, M.; Eigen, G.; Stugu, B.; Sun, L.; Battaglia, M.; Brown, D.N.; Hooberman, B.; Kerth, L.T.; Kolomensky, Yu.G.; Lynch, G.; Osipenkov, I.L.; Tanabe, T.; Hawkes, C.M.; /Birmingham U. /Ruhr U., Bochum /British Columbia U. /Brunel U. /Novosibirsk, IYF /UC, Irvine /UC, Riverside /UC, San Diego /UC, Santa Barbara /UC, Santa Cruz /Caltech /Cincinnati U. /Colorado U. /Colorado State U. /Dortmund U. /Dresden, Tech. U. /Ecole Polytechnique /Edinburgh U. /INFN, Ferrara /Ferrara U. /INFN, Ferrara /INFN, Ferrara /Ferrara U. /INFN, Ferrara /INFN, Ferrara /Ferrara U. /Frascati /INFN, Genoa /Genoa U. /INFN, Genoa /INFN, Genoa /Genoa U. /INFN, Genoa /INFN, Genoa /Genoa U. /Indian Inst. Tech., Guwahati /Harvard U. /Heidelberg U. /Humboldt U., Berlin /Imperial Coll., London /Iowa State U. /Iowa State U. /Johns Hopkins U. /Orsay, LAL /LLNL, Livermore /Liverpool U. /Queen Mary, U. of London /Royal Holloway, U. of London /Louisville U. /Mainz U., Inst. Kernphys. /Manchester U. /Maryland U. /Massachusetts U., Amherst /MIT /McGill U. /INFN, Milan /Milan U. /INFN, Milan /INFN, Milan /Milan U. /Mississippi U. /Montreal U. /INFN, Naples /Naples U. /NIKHEF, Amsterdam /NIKHEF, Amsterdam /Notre Dame U. /Ohio State U. /Oregon U. /INFN, Padua /Padua U. /INFN, Padua /INFN, Padua /Padua U. /Paris U., VI-VII /INFN, Perugia /Perugia U. /INFN, Pisa /Pisa U. /INFN, Pisa /Pisa, Scuola Normale Superiore /INFN, Pisa /Pisa U. /INFN, Pisa /Princeton U. /INFN, Rome /INFN, Rome /Rome U. /INFN, Rome /INFN, Rome /Rome U. /INFN, Rome /INFN, Rome /Rome U. /INFN, Rome /INFN, Rome /Rome U. /Rostock U. /Rutherford /DAPNIA, Saclay /SLAC /South Carolina U. /Stanford U., Phys. Dept. /SUNY, Albany /Tel Aviv U. /Tennessee U. /Texas Nuclear Corp., Austin /Texas U., Dallas /INFN, Turin /Turin U. /INFN, Trieste /Trieste U. /Valencia U. /Victoria U. /Warwick U. /Wisconsin U., Madison

    2010-04-28

    The authors study the reaction e{sup +}e{sup -} {yields} e{sup +}e{sup -} {eta}{sub c}, {eta}{sub c} {yields} K{sub S}K{sup {+-}}{pi}{sup {-+}} and obtain {eta}{sub c} mass and width values 2982.2 {+-} 0.4 {+-} 1.6 MeV/c{sup 2} and 31.7 {+-} 1.2 {+-} 0.8 MeV, respectively. They find {Lambda}({eta}{sub c} {yields} {gamma}{gamma}){Beta}({eta}{sub c} {yields} K{bar K}{pi}) = 0.374 {+-} 0.009 {+-} 0.031 keV, and measure the {gamma}{gamma}* {yields} {eta}{sub c} transition form factor in the momentum transfer range from 2 to 50 GeV{sup 2}. The analysis is based on 469 fb{sup -1} of integrated luminosity collected at PEP-II with the BABAR detector at e{sup +}e{sup -} center-of-mass energies near 10.6 GeV.

  7. Global Developmental Gene Programing Involves a Nuclear Form of Fibroblast Growth Factor Receptor-1 (FGFR1)

    PubMed Central

    Terranova, Christopher; Narla, Sridhar T.; Lee, Yu-Wei; Bard, Jonathan; Parikh, Abhirath; Stachowiak, Ewa K.; Tzanakakis, Emmanuel S.; Buck, Michael J.; Birkaya, Barbara; Stachowiak, Michal K.

    2015-01-01

    Genetic studies have placed the Fgfr1 gene at the top of major ontogenic pathways that enable gastrulation, tissue development and organogenesis. Using genome-wide sequencing and loss and gain of function experiments the present investigation reveals a mechanism that underlies global and direct gene regulation by the nuclear form of FGFR1, ensuring that pluripotent Embryonic Stem Cells differentiate into Neuronal Cells in response to Retinoic Acid. Nuclear FGFR1, both alone and with its partner nuclear receptors RXR and Nur77, targets thousands of active genes and controls the expression of pluripotency, homeobox, neuronal and mesodermal genes. Nuclear FGFR1 targets genes in developmental pathways represented by Wnt/β-catenin, CREB, BMP, the cell cycle and cancer-related TP53 pathway, neuroectodermal and mesodermal programing networks, axonal growth and synaptic plasticity pathways. Nuclear FGFR1 targets the consensus sequences of transcription factors known to engage CREB-binding protein, a common coregulator of transcription and established binding partner of nuclear FGFR1. This investigation reveals the role of nuclear FGFR1 as a global genomic programmer of cell, neural and muscle development. PMID:25923916

  8. Measurement of the g{sub piNN} Form Factor

    SciTech Connect

    Kelley Vansyoc

    2001-08-01

    Cross sections were measured for the reaction 1H(e, e' {pi}+ )n at the energy W = 1.95 GeV and momentum transfer Q 2 = 0.6 (GeV/c) 2 . At this W and Q 2 , the longitudinal cross section is dominated by t-channel production, giving a unique opportunity to examine the strong coupling form factor g {pi}NN (t). The measured cross sections were separated using a method similar to a Rosenbluth separation. For the extraction of g {pi}NN (t), the Actor and Korner model [42] and a parameterization of the MAID2000 model [3] were employed to fit the longitudinal cross section. Three parameterizations g {pi}NN (t) were used in both models. These fits resulted in a strong coupling constant g {pi}NN (m 2 / {pi} ) that is consistent with theoretical predictions. However, this coupling constant leads to a cutoff parameter that is less than 1 GeV.

  9. Factor Structure of the Torrance Tests of Creative Thinking Verbal Form B in a Spanish-Speaking Population

    ERIC Educational Resources Information Center

    Krumm, Gabriela; Aranguren, María; Arán Filippetti, Vanessa; Lemos, Viviana

    2016-01-01

    The objective of this study was to compare, through a Confirmatory Factor Analysis, two different theoretical models that explain the operationalized creativity construct with the Verbal Torrance Tests of Creative Thinking (TTCT), Form B. Model 1 is represented by six factors which correspond to each activity and its respective indicators while…

  10. Evolved QCD predictions for the meson-photon transition form factors: beyond the semiclassical AdS/QCD approximation

    SciTech Connect

    Brodsky, Stanley J.; Cao, Fu-Guang; de Teramond, Guy F.; /Costa Rica U.

    2011-11-04

    The QCD evolution of the pion distribution amplitude (DA) {phi}{sub {pi}} (x, Q{sup 2}) is computed for several commonly used models. Our analysis includes the nonperturbative form predicted by lightfront holographic QCD, thus combining the nonperturbative bound state dynamics of the pion with the perturbative ERBL evolution of the pion distribution amplitude. We calculate the meson-photon transition form factors for the {pi}{sup 0}, {eta} and {eta}' using the hard-scattering formalism. We point out that a widely-used approximation of replacing {phi} (x; (1 - x)Q) with {phi} (x;Q) in the calculations will unjustifiably reduce the predictions for the meson-photon transition form factors. It is found that the four models of the pion DA discussed give very different predictions for the Q{sup 2} dependence of the meson-photon transition form factors in the region of Q{sup 2} > 30 GeV{sup 2}. More accurate measurements of these transition form factors at the large Q{sup 2} region will be able to distinguish the four models of the pion DA. The rapid growth of the large Q{sup 2} data for the pion-photon transition form factor reported by the BABAR Collaboration is difficult to explain within the current framework of QCD. If the BABAR data for the meson-photon transition form factor for the {pi}{sup 0} is confirmed, it could indicate physics beyond-the-standard model, such as a weakly-coupled elementary C = + axial vector or pseudoscalar z{sup 0} in the few GeV domain, an elementary field which would provide the coupling {gamma}{sup *}{gamma} {yields} z{sup 0} {yields} {pi}{sup 0} at leading twist. Our analysis thus indicates the importance of additional measurements of the pion-photon transition form factor at large Q{sup 2}.

  11. Proton Pair Production Cross Sections at BESIII

    NASA Astrophysics Data System (ADS)

    Zhou, Xiaorong

    Using data samples collected with the BESIII detector at the BEPCII collider, the Born cross section of e + e - to pbar{p} at 12 center-of-mass energies from 2232.4 to 3671.0 MeV is provided. The corresponding effective electromagnetic form factor of the proton is deduced under the assumption that the electric and magnetic form factors are equal. In addition, the ratio of electric to magnetic form factors are extracted for the data samples with larger statistics. The measured cross sections are in agreement with recent results from BaBar, improving the overall uncertainty by about 30%. The |GE/GM| ratios are close to unity and consistent with BaBar results in the same q2 region.

  12. Blackbody Infrared Radiative Dissociation of Protonated Oligosaccharides

    NASA Astrophysics Data System (ADS)

    Fentabil, Messele A.; Daneshfar, Rambod; Kitova, Elena N.; Klassen, John S.

    2011-12-01

    The dissociation pathways, kinetics, and energetics of protonated oligosaccharides in the gas phase were investigated using blackbody infrared radiative dissociation (BIRD). Time-resolved BIRD measurements were performed on singly protonated ions of cellohexaose (Cel6), which is composed of β-(1 → 4)-linked glucopyranose rings, and five malto-oligosaccharides (Malx, where x = 4-8), which are composed of α-(1 → 4)-linked glucopyranose units. At the temperatures investigated (85-160 °C), the oligosaccharides dissociate at the glycosidic linkages or by the loss of a water molecule to produce B- or Y-type ions. The Y ions dissociate to smaller Y or B ions, while the B ions yield exclusively smaller B ions. The sequential loss of water molecules from the smallest B ions (B1 and B2) also occurs. Rate constants for dissociation of the protonated oligosaccharides and the corresponding Arrhenius activation parameters (Ea and A) were determined. The Ea and A-factors measured for protonated Malx (x > 4) are indistinguishable within error (~19 kcal mol-1, 1010 s-1), which is consistent with the ions being in the rapid energy exchange limit. In contrast, the Arrhenius parameters for protonated Cel6 (24 kcal mol-1, 1012 s-1) are significantly larger. These results indicate that both the energy and entropy changes associated with the glycosidic bond cleavage are sensitive to the anomeric configuration. Based on the results of this study, it is proposed that formation of B and Y ions occurs through a common dissociation mechanism, with the position of the proton establishing whether a B or Y ion is formed upon glycosidic bond cleavage.

  13. SU-E-T-246: MU Model Implementation for a Passively Scattered Proton Beam: Inclusion of the Bolus Gap and Nozzle Extension Factors

    SciTech Connect

    Simpson, R; Ghebremedhin, A; Gordon, I; Patyal, B; Piskulich, F.; LeMaster, Brett

    2014-06-01

    Purpose: To develop and implement an MU model for a passively scattered proton beam, and eliminate the need for patient specific calibrations for field sizes from 3cm to 15cm. This would enable consistent and timely calibrations for a wide variety of patient portals, streamlining the treatment process. Methods: Measurements were initially made using a Standard Imaging A-16 ion chamber and a modified water tank to determine the bolus gap factors (BGF) for multiple combinations of aperture size, bolus thickness, and air gap. The BGF was then separated into two component factors: the bolus thickness factor (BTF) and the nozzle extension factor (NEF). Polynomial curves were generated using the measured data to produce BTF tables for air gaps from 0cm to 30cm and for bolus thicknesses from 0cm to 10cm, and NEF tables for the full range of clinically used nozzle extensions. Additionally, data tables were created for every factor that affects beam output in the MU model. The MUs were then modeled for 487 patient portals and retrospectively compared to the MUs generated from the physical calibrations previously performed. Results: Of the 487 patient portals tested, 100% of the portals used for the comparison were within 2.5% from the MUs generated using a physical calibration, and 95.9% of the MU model portals tested were within 2%. The patient portals tested had field sizes ranging from 2.1cm to 10.1cm, with air gaps from 2cm to 25cm. Output factors for field sizes below 3cm with irregularly shaped fields demonstrated inconsistent results and will be further studied. Conclusion: The most problematic output factor, the BGF, was modeled accurately and consistently using the lowest order polynomial curve fits and interpolation between measured data. The study results demonstrate the robustness of the MU model and the potential for saving valuable personnel and beam time.

  14. The types II and III transforming growth factor-beta receptors form homo-oligomers

    PubMed Central

    1994-01-01

    Affinity-labeling experiments have detected hetero-oligomers of the types I, II, and III transforming growth factor beta (TGF-beta) receptors which mediate intracellular signaling by TGF-beta, but the oligomeric state of the individual receptor types remains unknown. Here we use two types of experiments to show that a major portion of the receptor types II and III forms homo-oligomers both in the absence and presence of TGF-beta. Both experiments used COS-7 cells co-transfected with combinations of these receptors carrying different epitope tags at their extracellular termini. In immunoprecipitation experiments, radiolabeled TGF-beta was bound and cross-linked to cells co-expressing two differently tagged type II receptors. Sequential immunoprecipitations using anti-epitope monoclonal antibodies showed that type II TGF-beta receptors form homo-oligomers. In cells co- expressing epitope-tagged types II and III receptors, a low level of co- precipitation of the ligand-labeled receptors was observed, indicating that some hetero-oligomers of the types II and III receptors exist in the presence of ligand. Antibody-mediated cross-linking studies based on double-labeling immunofluorescence explored co-patching of the receptors at the cell surface on live cells. In cells co-expressing two differently tagged type II receptors or two differently tagged type III receptors, forcing one receptor into micropatches by IgG induced co- patching of the receptor carrying the other tag, labeled by noncross- linking monovalent Fab'. These studies showed that homo-oligomers of the types II and III receptors exist on the cell surface in the absence or presence of TGF-beta 1 or -beta 2. In cells co-expressing types II and III receptors, the amount of heterocomplexes at the cell surface was too low to be detected in the immunofluorescence co-patching experiments, confirming that hetero-oligomers of the types II and III receptors are minor and probably transient species. PMID:8027173

  15. Oscillations of solar activity - the main climate-forming factor in millennium scale.

    NASA Astrophysics Data System (ADS)

    Khorozov, S. V.; Budovy, V. I.; Medvedev, V. A.

    Here is advanced and substantiated the hypothesis of existence of the physical mechanism, by means of which alteration of solar activity leads to change of the "greenhouse effect". This hypothetical mechanism can be the following one. The increase of solar activity leads to considerable magnification of ultra-violet radiation in a solar spectrum and to increase of ion concentration in the upper stratums of an atmosphere (including upper troposphere). Accordingly, the rise of condensation kernels concentration (of water vapour) occurs, and, as a result, the transparency decrease of an atmosphere concerning infrared radiation of the Earth takes place. For checkout of the hypothesis the simplified physical-statistical model of energy-balance of atmosphere and hydrosphere is constructed. The modelling of the global temperatures and the temperature in the different regions of the North hemisphere was made. The effective coefficients of the model take into account, in particular, the features of ocean and atmosphere circulation. They were determined with use of step-by-step procedure of correction based on a Monte-Carlo method, under condition of achievement of the greatest correspondence between simulated and actual values of global temperature. The constructed model allows to explain (without attraction of the anthropogenous factor) modern global warming, and also known data about temperature oscillations during second millennium. The comparative analysis of model results with independently reconstructed regional temperatures, including Central England (1000-1659 years), China (1000-1990 years), Gulf of Alaska and Pacific Northwest (1752-1983 years), shows their good enough correspondence which allows to assume, that the solar activity oscillations really can be the main climate-forming factor in millennium scale. Moreover, there had been detected the close correlation between the rate of increase of CO2 concentration and the simulated temperature of the upper layer of

  16. Phenomenology of Semileptonic B-Meson Decays with Form Factors from Lattice QCD

    DOE PAGESBeta

    Du, Daping; El-Khadra, A. X.; Gottlieb, Steven; Kronfeld, A. S.; Laiho, J.; Lunghi, E.; Van de Water, R. S.; Zhou, Ran

    2016-02-03

    We study the exclusive semileptonic B-meson decays B→K(π)ℓ+ℓ-, B→K(π)νν¯, and B→πτν, computing observables in the Standard model using the recent lattice-QCD results for the underlying form factors from the Fermilab Lattice and MILC Collaborations. These processes provide theoretically clean windows into physics beyond the Standard Model because the hadronic uncertainties are now under good control. The resulting partially-integrated branching fractions for B→πμ+μ- and B→Kμ+μ- outside the charmonium resonance region are 1-2σ higher than the LHCb Collaboration's recent measurements, where the theoretical and experimental errors are commensurate. The combined tension is 1.7σ. Combining the Standard-Model rates with LHCb's measurements yields valuesmore » for the Cabibbo-Kobayashi-Maskawa (CKM) matrix elements |Vtd|=7.45(69)×10-3, |Vts|=35.7(1.5)×10-3, and |Vtd/Vts|=0.201(20), which are compatible with the values obtained from neutral B(s)-meson oscillations and have competitive uncertainties. Alternatively, taking the CKM matrix elements from unitarity, we constrain new-physics contributions at the electroweak scale. Furthermore, the constraints on the Wilson coefficients Re(C9) and Re(C10) from B→πμ+μ- and B→Kμ+μ- are competitive with those from B→K*μ+μ-, and display a 2.0σ tension with the Standard Model. Our predictions for B→K(π)νν¯ and B→πτν are close to the current experimental limits.« less

  17. Isolation and characterization of a regulated form of actin depolymerizing factor.

    PubMed

    Morgan, T E; Lockerbie, R O; Minamide, L S; Browning, M D; Bamburg, J R

    1993-08-01

    Actin depolymerizing factor (ADF) is an 18.5-kD protein with pH-dependent reciprocal F-actin binding and severing/depolymerizing activities. We previously showed developing muscle down-regulates ADF (J. R. Bamburg and D. Bray. 1987. J. Cell Biol. 105: 2817-2825). To further study this process, we examined ADF expression in chick myocytes cultured in vitro. Surprisingly, ADF immunoreactivity increases during the first 7-10 d in culture. This increase is due to the presence of a new ADF species with higher relative molecular weight which reacts identically to brain ADF with antisera raised against either brain ADF or recombinant ADF. We have purified both ADF isoforms from myocytes and have shown by peptide mapping and partial sequence analysis that the new isoform is structurally related to ADF. Immunoprecipitation of both isoforms from extracts of cells prelabeled with [32P]orthophosphate showed that the new isoform is radiolabeled, predominantly on a serine residue, and hence is called pADF. pADF can be converted into a form which comigrates with ADF on 1-D and 2-D gels by treatment with alkaline phosphatase. pADF has been quantified in a number of cells and tissues where it is present from approximately 18% to 150% of the amount of unphosphorylated ADF. pADF, unlike ADF, does not bind to G-actin, or affect the rate or extent of actin assembly. Four ubiquitous protein kinases failed to phosphorylate ADF in vitro suggesting that ADF phosphorylation in vivo is catalyzed by a more specific kinase. We conclude that the ability to regulate ADF activity is important to muscle development since myocytes have both pre- and posttranslational mechanisms for regulating ADF activity. The latter mechanism is apparently a general one for cell regulation of ADF activity.

  18. Isolation and characterization of a regulated form of actin depolymerizing factor

    PubMed Central

    1993-01-01

    Actin depolymerizing factor (ADF) is an 18.5-kD protein with pH- dependent reciprocal F-actin binding and severing/depolymerizing activities. We previously showed developing muscle down-regulates ADF (J. R. Bamburg and D. Bray. 1987. J. Cell Biol. 105: 2817-2825). To further study this process, we examined ADF expression in chick myocytes cultured in vitro. Surprisingly, ADF immunoreactivity increases during the first 7-10 d in culture. This increase is due to the presence of a new ADF species with higher relative molecular weight which reacts identically to brain ADF with antisera raised against either brain ADF or recombinant ADF. We have purified both ADF isoforms from myocytes and have shown by peptide mapping and partial sequence analysis that the new isoform is structurally related to ADF. Immunoprecipitation of both isoforms from extracts of cells prelabeled with [32P]orthophosphate showed that the new isoform is radiolabeled, predominantly on a serine residue, and hence is called pADF. pADF can be converted into a form which comigrates with ADF on 1-D and 2-D gels by treatment with alkaline phosphatase. pADF has been quantified in a number of cells and tissues where it is present from approximately 18% to 150% of the amount of unphosphorylated ADF. pADF, unlike ADF, does not bind to G-actin, or affect the rate or extent of actin assembly. Four ubiquitous protein kinases failed to phosphorylate ADF in vitro suggesting that ADF phosphorylation in vivo is catalyzed by a more specific kinase. We conclude that the ability to regulate ADF activity is important to muscle development since myocytes have both pre- and posttranslational mechanisms for regulating ADF activity. The latter mechanism is apparently a general one for cell regulation of ADF activity. PMID:7687605

  19. Atomic-scale electronic structure of the cuprate d-symmetry form factor density wave state

    SciTech Connect

    M. H. Hamidian; Kim, Chung Koo; Edkins, S. D.; Davis, J. C.; Mackenzie, A. P.; Eisaki, H.; Uchida, S.; Lawler, M. J.; Kim, E. -A.; Sachdev, S.; Fujita, K.

    2015-10-26

    Research on high-temperature superconducting cuprates is at present focused on identifying the relationship between the classic ‘pseudogap’ phenomenon1, 2 and the more recently investigated density wave state3–13. This state is generally characterized by a wavevector Q parallel to the planar Cu–O–Cu bonds 4–13 along with a predominantly d-symmetry form factor 14–17 (dFF-DW). To identify the microscopic mechanism giving rise to this state 18–30, one must identify the momentum-space states contributing to the dFF-DW spectral weight, determine their particle–hole phase relationship about the Fermi energy, establish whether they exhibit a characteristic energy gap, and understand the evolution of all these phenomena throughout the phase diagram. Here we use energy-resolved sublattice visualization14 of electronic structure and reveal that the characteristic energy of the dFF-DW modulations is actually the ‘pseudogap’ energy Δ1. Moreover, we demonstrate that the dFF-DW modulations at E = –Δ1 (filled states) occur with relative phase π compared to those at E = Δ1 (empty states). Lastly, we show that the conventionally defined dFF-DW Q corresponds to scattering between the ‘hot frontier’ regions of momentum-space beyond which Bogoliubov quasiparticles cease to exist30–32. These data indicate that the cuprate dFF-DW state involves particle–hole interactions focused at the pseudogap energy scale and between the four pairs of ‘hot frontier’ regions in momentum space where the pseudogap opens.

  20. Atomic-scale electronic structure of the cuprate d-symmetry form factor density wave state

    DOE PAGESBeta

    M. H. Hamidian; Kim, Chung Koo; Edkins, S. D.; Davis, J. C.; Mackenzie, A. P.; Eisaki, H.; Uchida, S.; Lawler, M. J.; Kim, E. -A.; Sachdev, S.; et al

    2015-10-26

    Research on high-temperature superconducting cuprates is at present focused on identifying the relationship between the classic ‘pseudogap’ phenomenon1, 2 and the more recently investigated density wave state3–13. This state is generally characterized by a wavevector Q parallel to the planar Cu–O–Cu bonds 4–13 along with a predominantly d-symmetry form factor 14–17 (dFF-DW). To identify the microscopic mechanism giving rise to this state 18–30, one must identify the momentum-space states contributing to the dFF-DW spectral weight, determine their particle–hole phase relationship about the Fermi energy, establish whether they exhibit a characteristic energy gap, and understand the evolution of all these phenomenamore » throughout the phase diagram. Here we use energy-resolved sublattice visualization14 of electronic structure and reveal that the characteristic energy of the dFF-DW modulations is actually the ‘pseudogap’ energy Δ1. Moreover, we demonstrate that the dFF-DW modulations at E = –Δ1 (filled states) occur with relative phase π compared to those at E = Δ1 (empty states). Lastly, we show that the conventionally defined dFF-DW Q corresponds to scattering between the ‘hot frontier’ regions of momentum-space beyond which Bogoliubov quasiparticles cease to exist30–32. These data indicate that the cuprate dFF-DW state involves particle–hole interactions focused at the pseudogap energy scale and between the four pairs of ‘hot frontier’ regions in momentum space where the pseudogap opens.« less