Science.gov

Sample records for proton form factor

  1. OLYMPUS and the proton form factor puzzle

    NASA Astrophysics Data System (ADS)

    Ice, Lauren; Alarcon, Ricardo; Olympus Collaboration

    2012-02-01

    Recent measurements of the proton electric to magnetic form factor ratio using polarization techniques reveal a large discrepancy with measurements found using the Rosenbluth separation technique. It has been proposed that this discrepancy is due to a non-negligible multiple photon exchange contribution in the electron-proton elastic scattering cross section. The OLYMPUS experiment will measure the multiple photon exchange contribution by finding the cross section ratio of positron-proton to electron-proton scattering within 1%. The experiment will be carried out at the DESY laboratory in Hamburg Germany using the electron and positron storage ring DORIS and an internal unpolarized hydrogen gas target. The scattered particles will be detected using the Bates Large Acceptance Spectrometer Toroid (BLAST).

  2. The Proton Form Factor Ratio Measurements at Jefferson Lab

    SciTech Connect

    Punjabi, Vina A.; Perdrisat, Charles F.

    2014-03-01

    The ratio of the proton form factors, G{sub Ep}/G{sub Mp}, has been measured from Q{sup 2} of 0.5 GeV{sup 2} to 8.5 GeV{sup 2}, at the Jefferson Laboratory, using the polarization transfer method. This ratio is extracted directly from the measured ratio of the transverse and longitudinal polarization components of the recoiling proton in elastic electron-proton scattering. The discovery that the proton form factor ratio measured in these experiments decreases approximately linearly with four-momentum transfer, Q{sup 2}, for values above ~1 GeV{sup 2}, is one of the most significant results to come out of JLab. These results have had a large impact on progress in hadronic physics; and have required a significant rethinking of nucleon structure. The increasingly common use of the double-polarization technique to measure the nucleon form factors, in the last 15 years, has resulted in a dramatic improvement of the quality of all four nucleon electromagnetic form factors, G{sub Ep}, G{sub Mp}, G{sub En} and G{sub Mn}. There is an approved experiment at JLab, GEP(V), to continue the ratio measurements to 12 GeV{sup 2}. A dedicated experimental setup, the Super Bigbite Spectrometer (SBS), will be built for this purpose. It will be equipped with a focal plane polarimeter to measure the polarization of the recoil protons. The scattered electrons will be detected in an electromagnetic calorimeter. In this presentation, I will review the status of the proton elastic electromagnetic form factors and discuss a number of theoretical approaches to describe nucleon form factors.

  3. Reanalysis of Rosenbluth measurements of the proton form factors

    NASA Astrophysics Data System (ADS)

    Gramolin, Alexander; Nikolenko, Dmitry

    2017-01-01

    We have reanalyzed the elastic electron-proton scattering data from SLAC experiments E140 and NE11. This work was motivated by recent progress in calculating the corresponding radiative corrections and by the apparent discrepancy between the Rosenbluth and polarization transfer measurements of the proton electromagnetic form factors. New, corrected values for the scattering cross sections are presented, as well as a new form factor fit in the Q2 range from 1 to 8 . 83GeV2 . Our reanalysis brings the combined results of the SLAC experiments into better agreement with the polarization transfer data, but a significant discrepancy remains for Q2 > 3GeV2 .

  4. Reanalysis of Rosenbluth measurements of the proton form factors

    NASA Astrophysics Data System (ADS)

    Gramolin, A. V.; Nikolenko, D. M.

    2016-05-01

    We present a reanalysis of the data from Stanford Linear Accelerator Center (SLAC) experiments E140 [R. C. Walker et al., Phys. Rev. D 49, 5671 (1994), 10.1103/PhysRevD.49.5671] and NE11 [L. Andivahis et al., Phys. Rev. D 50, 5491 (1994), 10.1103/PhysRevD.50.5491] on elastic electron-proton scattering. This work is motivated by recent progress in calculating the corresponding radiative corrections and by the apparent discrepancy between the Rosenbluth and polarization transfer measurements of the proton electromagnetic form factors. New, corrected values for the scattering cross sections are presented, as well as a new form factor fit in the Q2 range from 1 to 8.83 GeV2. We also provide a complete set of revised formulas to account for radiative corrections in single-arm measurements of unpolarized elastic electron-proton scattering.

  5. Proton Elastic Form Factor Ratio: the JLab Polarization Experiments

    SciTech Connect

    Charles Perdrisat; Vina Punjabi

    2003-07-30

    The ratio of the electric and magnetic proton form factors, G{sub Ep}/G{sub Mp}, has been obtained in two Hall A experiments, from measurements of the longitudinal and transverse polarization of the recoil proton, P{sub l} and P{sub t}, respectively, in the elastic scattering of polarized electrons, {rvec e}p {yields} e{rvec p}. Together these experiments cover the Q{sup 2}-range 0.5 to 5.6 GeV{sup 2}. A new experiment is currently being prepared, to extend the Q{sup 2}-range to 9 GeV{sup 2} in Hall C.

  6. Precision Rosenbluth measurement of the proton elastic form factors

    SciTech Connect

    I. A. Qattan; J. Arrington; R. E. Segel; X. Zheng; K. Aniol; O. K. Baker; R. Beams; E. J. Brash; J. Calarco; A. Camsonne; J.-P. Chen; M. E. Christy; D. Dutta; R. Ent; S. Frullani; D. Gaskell; O. Gayou; R. Gilman; C. Glashausser; K. Hafidi; J.-O. Hansen; D. W. Higinbotham; W. Hinton; R. J. Holt; G. M. Huber; H. Ibrahim; L. Jisonna; M. K. Jones; C. E. Keppel; E. Kinney; G. J. Kumbartzki; A. Lung; D. J. Margaziotis; K. McCormick; D. Meekins; R. Michaels; P. Monaghan; P. Moussiegt; L. Pentchev; C. Perdrisat; V. Punjabi; R. Ransome; J. Reinhold; B. Reitz; A. Saha; A. Sarty; E. C. Schulte; K. Slifer; P. Solvignon; V. Sulkosky; K. Wijesooriya; B. Zeidman

    2004-10-01

    We report the results of a new Rosenbluth measurement of the proton form factors at Q{sup 2} values of 2.64, 3.20 and 4.10 GeV{sup 2}. Cross sections were determined by detecting the recoiling proton in contrast to previous measurements in which the scattered electron was detected. At each Q{sup 2}, relative cross sections were determined to better than 1%. The measurement focused on the extraction of G{sub E}/G{sub M} which was determined to 4-8% and found to approximate form factor scaling, i.e. {mu}{sub p}G{sub E} {approx} G{sub M}. These results are consistent with and much more precise than previous Rosenbluth extractions. However, they are inconsistent with recent polarization transfer measurements of comparable precision, implying a systematic difference between the two techniques.

  7. Proton Form Factors Measurements in the Time-Like Region

    SciTech Connect

    Anulli, F.; /Frascati

    2007-10-22

    I present an overview of the measurement of the proton form factors in the time-like region. BABAR has recently measured with great accuracy the e{sup +}e{sup -} {yields} p{bar p} reaction from production threshold up to an energy of {approx} 4.5 GeV, finding evidence for a ratio of the electric to magnetic form factor greater than unity, contrary to expectation. In agreement with previous measurements, BABAR confirmed the steep rise of the magnetic form factor close to the p{bar p} mass threshold, suggesting the possible presence of an under-threshold N{bar N} vector state. These and other open questions related to the nucleon form factors both in the time-like and space-like region, wait for more data with different experimental techniques to be possibly solved.

  8. Helicity non-conserving form factor of the proton

    SciTech Connect

    Voutier, E.; Furget, C.; Knox, S.

    1994-04-01

    The study of the hadron structure in the high Q{sup 2} range contributes to the understanding of the mechanisms responsible for the confinement of quarks and gluons. Among the numerous experimental candidates sensitive to these mechanisms, the helicity non-conserving form factor of the proton is a privileged observable since it is controlled by non-perturbative effects. The authors investigate here the feasibility of high Q{sup 2} measurements of this form factor by means of the recoil polarization method in the context of the CEBAF 8 GeV facility. For that purpose, they discuss the development of a high energy proton polarimeter, based on the H({rvec p},pp) elastic scattering, to be placed at the focal plane of a new hadron spectrometer. It is shown that this experimental method significantly improves the knowledge of the helicity non-conserving form factor of the proton up to 10 GeV{sup 2}/c{sup 2}.

  9. Proton Form Factor Measurements Using Polarization Method: Beyond Born Approximation

    SciTech Connect

    Pentchev, Lubomir

    2008-10-13

    Significant theoretical and experimental efforts have been made over the past 7 years aiming to explain the discrepancy between the proton form factor ratio data obtained at JLab using the polarization method and the previous Rosenbluth measurements. Preliminary results from the first high precision polarization experiment dedicated to study effects beyond Born approximation will be presented. The ratio of the transferred polarization components and, separately, the longitudinal polarization in ep elastic scattering have been measured at a fixed Q{sup 2} of 2.5 GeV{sup 2} over a wide kinematic range. The two quantities impose constraints on the real part of the ep elastic amplitudes.

  10. Precision Measurements of the Proton Elastic Form Factor Ratio

    SciTech Connect

    Douglas Higinbotham

    2010-08-01

    New high precision polarization measurements of the proton elastic form factor ratio in the Q^2 from 0.3 to 0.7 [GeV/c]^2 have been made. These elastic H(e,e'p) measurementswere done in Jefferson Lab's Hall A using 80% longitudinally polarized electrons and recoil polarimetry. For Q^2 greater than 1 [GeV/c]^2, previous polarization data indicated a strong deviation of the form factor ratio from unity which sparked renewed theoretical and experimental interest in how two-photon diagrams have been taken into account. The new high precision data indicate that the deviation from unity, while small, persists even at Q^2 less than 1 [GeV/c]^2.

  11. Proton form factors and two-photon exchange in elastic electron-proton scattering

    SciTech Connect

    Nikolenko, D. M.; Arrington, J.; Barkov, L. M.; Vries, H. de; Gauzshtein, V. V.; Golovin, R. A.; Gramolin, A. V.; Dmitriev, V. F.; Zhilich, V. N.; Zevakov, S. A.; Kaminsky, V. V.; Lazarenko, B. A.; Mishnev, S. I.; Muchnoi, N. Yu.; Neufeld, V. V.; Rachek, I. A.; Sadykov, R. Sh.; Stibunov, V. N.; Toporkov, D. K.; Holt, R. J.; and others

    2015-05-15

    Proton electromagnetic form factors are among the most important sources of information about the internal structure of the proton. Two different methods for measuring these form factors, the method proposed by Rosenbluth and the polarization-transfer method, yield contradictory results. It is assumed that this contradiction can be removed upon taking into account the hard part of the contribution of two-photon exchange to the cross section for elastic electron-proton scattering. This contribution can measured experimentally via a precision comparison of the cross sections for the elastic scattering of positrons and electrons on protons. Such a measurement, performed at the VEPP-3 storage ring in Novosibirsk at the beam energies of 1.6 and 1.0 GeV for positron (electron) scattering angles in the ranges of θ{sub e} = 15°–25° and 55°–75° in the first case and in the range of θ{sub e} = 65°–105° in the second case is described in the present article. Preliminary results of this experiment and their comparison with theoretical predictions are described.

  12. Measurement of the Neutral Weak Form Factors of the Proton

    SciTech Connect

    Deur, Alexandre; Fleck, Andre; Saha, Arunava; Gasparian, Ashot; Frois, Bernard; Wojtsekhowski, Bogdan; Vlahovic, Branislav; Perdrisat, Charles; Cavata, Christian; Jutier, Christophe; De Jager, Cornelis; Neyret, Damien; Dale, Daniel; Armstrong, David; Lhuillier, David; Prout, David; Margaziotis, Demetrius; Kim, Donghee; Burtin, Etienne; Chudakov, Eugene; Hersman, F.; Garibaldi, Franco; Marie, Frederic; Miller, Greg; Rutledge, Gary; Gerstner, George; Petratos, Gerassimos; Quemener, Gilles; Cates, Gordon; Thompson, J.; Martino, Jacques; Gomez, Javier; Jorda, Jean-Paul; Hansen, Jens-Ole; Chen, Jian-Ping; Jardillier, Johann; Calarco, John; LeRose, John; Price, John; Gao, Juncai; McIntyre, Justin; McCormick, Kathy; Fissum, Kevin; Kramer, Kevin; Aniol, Konrad; Kumar, Krishna; Wijesooriya, Krishni; Ewell, Lars; Todor, Luminita; Spradlin, Marcus; Jones, Mark; Leuschner, Mark; Epstein, Martin; Baylac, Maud; Holtrop, Maurik; Finn, Michael; Kuss, Michael; Kim, Min; Falletto, Nicolas; Liyanage, Nilanga; Glamazdin, Oleksandr; Rutt, Paul; Souder, Paul; Ulmer, Paul; Mastromarino, Peter; Djawotho, Pibero; Wilson, Richard; Suleiman, Riad; Holmes, Richard; Madey, Richard; Lourie, Robert; Michaels, Robert; Pomatsalyuk, Roman; Gilman, Ronald; Incerti, Sebastien; Escoffier, Stephanie; Pussieux, Thierry; Humensky, Thomas; Gorbenko, Viktor; Punjabi, Vina; Kahl, William; Meziani, Zein-Eddine

    1999-02-01

    We have measured the parity-violating electroweak asymmetry in the elastic scattering of polarized electrons from the proton. The kinematic point [(Thetalab) = 12.3r and (Q2) = 0.48 (GeV/c)2] is chosen to provide sensitivity, at a level that is of theoretical interest, to the strange electric form factor GsE. The result, A = - 14.5 + or - 2.2 ppm, is consistent with the electroweak standard model and no additional contributions from strange quarks. In particular, the measurement implies GsE + 0.39GsM = 0.023 + or - 0.034(stat) + or - 0.022(syst) + or - 0.026(delta-GnE), where the last uncertainty arises from the estimated uncertainty in the neutron electric form factor.

  13. Measurement of the ratio of the proton's electric to magnetic form factors by recoil polarization

    SciTech Connect

    Mark K. Jones; Hall A Collaboration

    1999-03-01

    The longitudinal and transverse polarizations of the outgoing proton were measured for the reaction {sup 1}H(e,e' p) at four-momentum transfer squared of 0.5 to 3.5 GeV{sup 2}. The ratio of the electric to magnetic form factors of the proton is proportional to the ratio of the transverse to longitudinal polarizations.

  14. Recoil polarization measurements of the proton electromagnetic form factor ratio at high momentum transfer

    SciTech Connect

    Andrew Puckett

    2009-12-01

    Electromagnetic form factors are fundamental properties of the nucleon that describe the effect of its internal quark structure on the cross section and spin observables in elastic lepton-nucleon scattering. Double-polarization experiments have become the preferred technique to measure the proton and neutron electric form factors at high momentum transfers. The recently completed GEp-III experiment at the Thomas Jefferson National Accelerator Facility used the recoil polarization method to extend the knowledge of the proton electromagnetic form factor ratio GpE/GpM to Q2 = 8.5 GeV2. In this paper we present the preliminary results of the experiment.

  15. Proton electromagnetic form factors: present status and future perspectives at PANDA

    NASA Astrophysics Data System (ADS)

    Tomasi-Gustafsson, E.

    2015-05-01

    Data and models on electromagnetic proton form factors are reviewed, highlighting the contribution foreseen by the PANDA collaboration. Electromagnetic hadron form factors contain essential information on the internal structure of hadrons. Precise and surprising data have been obtained at electron accelerators, applying the polarization method in electron-proton elastic scattering. At electron-positron colliders, using initial state radiation, BABAR measured proton time-like form factors in a wide time-like kinematical region and the BESIII collaboration will measure very precisely proton and neutron form factors in the threshold region. In the next future an antiproton beam with momentum up to 15 GeV/c will be available at FAIR (Darmstadt). Measurements of the reaction p̅ + p → e+ + e- by the PANDA collaboration will contribute to the individual determination of electric and magnetic form factors in the time-like region of momentum transfer squared, as well as to their first determination in the unphysical region (below the kinematical threshold), through the reaction p̅ + p → e+ + e- + π0. From the discussion on feasibility studies at PANDA, we focus on the consequences of such measurements in view of an unified description of form factors in the full kinematical region. We present models which have the necessary analytical requirements and apply to the data in the whole kinematical region.

  16. Feasibility studies of time-like proton electromagnetic form factors at overlinePANDA at FAIR

    NASA Astrophysics Data System (ADS)

    Singh, B.; Erni, W.; Krusche, B.; Steinacher, M.; Walford, N.; Liu, B.; Liu, H.; Liu, Z.; Shen, X.; Wang, C.; Zhao, J.; Albrecht, M.; Erlen, T.; Fink, M.; Heinsius, F.; Held, T.; Holtmann, T.; Jasper, S.; Keshk, I.; Koch, H.; Kopf, B.; Kuhlmann, M.; Kümmel, M.; Leiber, S.; Mikirtychyants, M.; Musiol, P.; Mustafa, A.; Pelizäus, M.; Pychy, J.; Richter, M.; Schnier, C.; Schröder, T.; Sowa, C.; Steinke, M.; Triffterer, T.; Wiedner, U.; Ball, M.; Beck, R.; Hammann, C.; Ketzer, B.; Kube, M.; Mahlberg, P.; Rossbach, M.; Schmidt, C.; Schmitz, R.; Thoma, U.; Urban, M.; Walther, D.; Wendel, C.; Wilson, A.; Bianconi, A.; Bragadireanu, M.; Caprini, M.; Pantea, D.; Patel, B.; Czyzycki, W.; Domagala, M.; Filo, G.; Jaworowski, J.; Krawczyk, M.; Lisowski, F.; Lisowski, E.; Michałek, M.; Poznański, P.; Płażek, J.; Korcyl, K.; Kozela, A.; Kulessa, P.; Lebiedowicz, P.; Pysz, K.; Schäfer, W.; Szczurek, A.; Fiutowski, T.; Idzik, M.; Mindur, B.; Przyborowski, D.; Swientek, K.; Biernat, J.; Kamys, B.; Kistryn, S.; Korcyl, G.; Krzemien, W.; Magiera, A.; Moskal, P.; Pyszniak, A.; Rudy, Z.; Salabura, P.; Smyrski, J.; Strzempek, P.; Wronska, A.; Augustin, I.; Böhm, R.; Lehmann, I.; Nicmorus Marinescu, D.; Schmitt, L.; Varentsov, V.; Al-Turany, M.; Belias, A.; Deppe, H.; Dzhygadlo, R.; Ehret, A.; Flemming, H.; Gerhardt, A.; Götzen, K.; Gromliuk, A.; Gruber, L.; Karabowicz, R.; Kliemt, R.; Krebs, M.; Kurilla, U.; Lehmann, D.; Löchner, S.; Lühning, J.; Lynen, U.; Orth, H.; Patsyuk, M.; Peters, K.; Saito, T.; Schepers, G.; Schmidt, C. J.; Schwarz, C.; Schwiening, J.; Täschner, A.; Traxler, M.; Ugur, C.; Voss, B.; Wieczorek, P.; Wilms, A.; Zühlsdorf, M.; Abazov, V.; Alexeev, G.; Arefiev, V. A.; Astakhov, V.; Barabanov, M. Yu.; Batyunya, B. V.; Davydov, Y.; Dodokhov, V. Kh.; Efremov, A.; Fechtchenko, A.; Fedunov, A. G.; Galoyan, A.; Grigoryan, S.; Koshurnikov, E. K.; Lobanov, Y. Yu.; Lobanov, V. I.; Makarov, A. F.; Malinina, L. V.; Malyshev, V.; Olshevskiy, A. G.; Perevalova, E.; Piskun, A. A.; Pocheptsov, T.; Pontecorvo, G.; Rodionov, V.; Rogov, Y.; Salmin, R.; Samartsev, A.; Sapozhnikov, M. G.; Shabratova, G.; Skachkov, N. B.; Skachkova, A. N.; Strokovsky, E. A.; Suleimanov, M.; Teshev, R.; Tokmenin, V.; Uzhinsky, V.; Vodopianov, A.; Zaporozhets, S. A.; Zhuravlev, N. I.; Zorin, A. G.; Branford, D.; Glazier, D.; Watts, D.; Böhm, M.; Britting, A.; Eyrich, W.; Lehmann, A.; Pfaffinger, M.; Uhlig, F.; Dobbs, S.; Seth, K.; Tomaradze, A.; Xiao, T.; Bettoni, D.; Carassiti, V.; Cotta Ramusino, A.; Dalpiaz, P.; Drago, A.; Fioravanti, E.; Garzia, I.; Savrie, M.; Akishina, V.; Kisel, I.; Kozlov, G.; Pugach, M.; Zyzak, M.; Gianotti, P.; Guaraldo, C.; Lucherini, V.; Bersani, A.; Bracco, G.; Macri, M.; Parodi, R. F.; Biguenko, K.; Brinkmann, K.; Di Pietro, V.; Diehl, S.; Dormenev, V.; Drexler, P.; Düren, M.; Etzelmüller, E.; Galuska, M.; Gutz, E.; Hahn, C.; Hayrapetyan, A.; Kesselkaul, M.; Kühn, W.; Kuske, T.; Lange, J. S.; Liang, Y.; Metag, V.; Nanova, M.; Nazarenko, S.; Novotny, R.; Quagli, T.; Reiter, S.; Rieke, J.; Rosenbaum, C.; Schmidt, M.; Schnell, R.; Stenzel, H.; Thöring, U.; Ullrich, M.; Wagner, M. N.; Wasem, T.; Wohlfahrt, B.; Zaunick, H.; Ireland, D.; Rosner, G.; Seitz, B.; Deepak, P. N.; Kulkarni, A.; Apostolou, A.; Babai, M.; Kavatsyuk, M.; Lemmens, P. J.; Lindemulder, M.; Loehner, H.; Messchendorp, J.; Schakel, P.; Smit, H.; Tiemens, M.; van der Weele, J. C.; Veenstra, R.; Vejdani, S.; Dutta, K.; Kalita, K.; Kumar, A.; Roy, A.; Sohlbach, H.; Bai, M.; Bianchi, L.; Büscher, M.; Cao, L.; Cebulla, A.; Dosdall, R.; Gillitzer, A.; Goldenbaum, F.; Grunwald, D.; Herten, A.; Hu, Q.; Kemmerling, G.; Kleines, H.; Lehrach, A.; Nellen, R.; Ohm, H.; Orfanitski, S.; Prasuhn, D.; Prencipe, E.; Pütz, J.; Ritman, J.; Schadmand, S.; Sefzick, T.; Serdyuk, V.; Sterzenbach, G.; Stockmanns, T.; Wintz, P.; Wüstner, P.; Xu, H.; Zambanini, A.; Li, S.; Li, Z.; Sun, Z.; Xu, H.; Rigato, V.; Isaksson, L.; Achenbach, P.; Corell, O.; Denig, A.; Distler, M.; Hoek, M.; Karavdina, A.; Lauth, W.; Liu, Z.; Merkel, H.; Müller, U.; Pochodzalla, J.; Sanchez, S.; Schlimme, S.; Sfienti, C.; Thiel, M.; Ahmadi, H.; Ahmed, S.; Bleser, S.; Capozza, L.; Cardinali, M.; Dbeyssi, A.; Deiseroth, M.; Feldbauer, F.; Fritsch, M.; Fröhlich, B.; Jasinski, P.; Kang, D.; Khaneft, D.; Klasen, R.; Leithoff, H. H.; Lin, D.; Maas, F.; Maldaner, S.; Martínez, M.; Michel, M.; Mora Espí, M. C.; Morales Morales, C.; Motzko, C.; Nerling, F.; Noll, O.; Pflüger, S.; Pitka, A.; Rodríguez Piñeiro, D.; Sanchez-Lorente, A.; Steinen, M.; Valente, R.; Weber, T.; Zambrana, M.; Zimmermann, I.; Fedorov, A.; Korjik, M.; Missevitch, O.; Boukharov, A.; Malyshev, O.; Marishev, I.; Balanutsa, V.; Balanutsa, P.; Chernetsky, V.; Demekhin, A.; Dolgolenko, A.; Fedorets, P.; Gerasimov, A.; Goryachev, V.; Chandratre, V.; Datar, V.; Dutta, D.; Jha, V.; Kumawat, H.; Mohanty, A. K.; Parmar, A.; Roy, B.; Sonika, G.; Fritzsch, C.; Grieser, S.; Hergemöller, A.; Hetz, B.; Hüsken, N.; Khoukaz, A.; Wessels, J. P.; Khosonthongkee, K.; Kobdaj, C.; Limphirat, A.; Srisawad, P.; Yan, Y.; Barnyakov, M.; Barnyakov, A. Yu.; Beloborodov, K.; Blinov, A. E.; Blinov, V. E.; Bobrovnikov, V. S.; Kononov, S.; Kravchenko, E. A.; Kuyanov, I. A.; Martin, K.; Onuchin, A. P.; Serednyakov, S.; Sokolov, A.; Tikhonov, Y.; Atomssa, E.; Kunne, R.; Marchand, D.; Ramstein, B.; van de Wiele, J.; Wang, Y.; Boca, G.; Costanza, S.; Genova, P.; Montagna, P.; Rotondi, A.; Abramov, V.; Belikov, N.; Bukreeva, S.; Davidenko, A.; Derevschikov, A.; Goncharenko, Y.; Grishin, V.; Kachanov, V.; Kormilitsin, V.; Levin, A.; Melnik, Y.; Minaev, N.; Mochalov, V.; Morozov, D.; Nogach, L.; Poslavskiy, S.; Ryazantsev, A.; Ryzhikov, S.; Semenov, P.; Shein, I.; Uzunian, A.; Vasiliev, A.; Yakutin, A.; Tomasi-Gustafsson, E.; Roy, U.; Yabsley, B.; Belostotski, S.; Gavrilov, G.; Izotov, A.; Manaenkov, S.; Miklukho, O.; Veretennikov, D.; Zhdanov, A.; Makonyi, K.; Preston, M.; Tegner, P.; Wölbing, D.; Bäck, T.; Cederwall, B.; Rai, A. K.; Godre, S.; Calvo, D.; Coli, S.; De Remigis, P.; Filippi, A.; Giraudo, G.; Lusso, S.; Mazza, G.; Mignone, M.; Rivetti, A.; Wheadon, R.; Balestra, F.; Iazzi, F.; Introzzi, R.; Lavagno, A.; Olave, J.; Amoroso, A.; Bussa, M. P.; Busso, L.; De Mori, F.; Destefanis, M.; Fava, L.; Ferrero, L.; Greco, M.; Hu, J.; Lavezzi, L.; Maggiora, M.; Maniscalco, G.; Marcello, S.; Sosio, S.; Spataro, S.; Birsa, R.; Bradamante, F.; Bressan, A.; Martin, A.; Calen, H.; Ikegami Andersson, W.; Johansson, T.; Kupsc, A.; Marciniewski, P.; Papenbrock, M.; Pettersson, J.; Schönning, K.; Wolke, M.; Galnander, B.; Diaz, J.; Pothodi Chackara, V.; Chlopik, A.; Kesik, G.; Melnychuk, D.; Slowinski, B.; Trzcinski, A.; Wojciechowski, M.; Wronka, S.; Zwieglinski, B.; Bühler, P.; Marton, J.; Steinschaden, D.; Suzuki, K.; Widmann, E.; Zmeskal, J.

    2016-10-01

    Simulation results for future measurements of electromagnetic proton form factors at overlinePANDA (FAIR) within the PandaRoot software framework are reported. The statistical precision with which the proton form factors can be determined is estimated. The signal channel bar{p}p→ e+e- is studied on the basis of two different but consistent procedures. The suppression of the main background channel, i.e. bar{p}p→ π+π-, is studied. Furthermore, the background versus signal efficiency, statistical and systematical uncertainties on the extracted proton form factors are evaluated using two different procedures. The results are consistent with those of a previous simulation study using an older, simplified framework. However, a slightly better precision is achieved in the PandaRoot study in a large range of momentum transfer, assuming the nominal beam conditions and detector performance.

  17. High Precision Measurement of the Proton Elastic Form Factor Ratio at Low Q2

    SciTech Connect

    Xiaohui Zhan

    2009-12-01

    A high precision measurement of the proton elastic form factor ratio µpGEp/GMp in the range Q2 = 0.3–0.7 GeV2/c2 was performed using recoil polarimetry in Jefferson Lab Hall A. In this low Q2 range, previous data from LEDEX [5] along with many fits and calculations [2, 3, 4] indicate substantial deviations of the ratio from unity. In this new measurement, with 80% polarized electron beam for 24 days, we are able to achieve <1% statistical uncertainty. Preliminary results are a few percent lower than expected from previous world data and fits, indicating a smaller GEp at this region. Beyond the intrinsic interest in nucleon structure, the improved form factor measurements also have implications for DVCS, determinations of the proton Zemach radius and strangeness form factors through parity violation experiments.

  18. Fourth dimension of the nucleon structure: Spacetime analysis of the timelike electromagnetic proton form factors

    NASA Astrophysics Data System (ADS)

    Bianconi, Andrea; Tomasi-Gustafsson, Egle

    2017-01-01

    As is well known, spacelike proton form factors expressed in the Breit frame may be interpreted as the Fourier transform of static space distributions of electric charge and current. In particular, the electric form factor is simply the Fourier transform of the charge distribution F (q ) =∫ei q ⃗.r ⃗ρ (r ) d3r . We do not have an intuitive interpretation of the same level of simplicity for the proton timelike form factor appearing in the reactions e+e-↔p ¯p . However, one may suggest that, in the center-of-mass frame, where qμxμ=q t , a timelike electric form factor is the Fourier transform F (q ) =∫ei q tR (t ) d t of a function R (t ) expressing how the electric properties of the forming (or annihilating) proton-antiproton pair evolve in time. Here we analyze in depth this idea and show that the functions ρ (r ) and R (t ) can be formally written as the time and space integrals of a unique correlation function depending on both time and space coordinates.

  19. Global analysis of proton elastic form factor data with two-photon exchange corrections

    SciTech Connect

    J. Arrington; W. Melnitchouk; J. A. Tjon

    2007-09-01

    We use the world's data on elastic electron-proton scattering and calculations of two-photon exchange effects to extract corrected values of the proton's electric and magnetic form factors over the full Q^2 range of the existing data. Our analysis combines the corrected Rosenbluth cross section and polarization transfer data, and is the first extraction of G_Ep and G_Mp including explicit two-photon exchange corrections and their associated uncertainties. In addition, we examine the angular dependence of the corrected cross sections, and discuss the possible nonlinearities of the cross section as a function of epsilon.

  20. The time-like electromagnetic form factors of proton and charged kaon at high energies

    NASA Astrophysics Data System (ADS)

    Anulli, Fabio

    2016-05-01

    The Initial State Radiation method in the BABAR experiment has been used to measure the time-like electromagnetic form factors at the momentum transfer from 9 to 42 (GeV/c)2 for proton and from 7 to 56 (GeV/c)2 for charged kaon. The obtained data show the tendency to approach the QCD asymptotic prediction for kaons and space-like form factor values for proton. The BABAR data have been used together with data from other experiments, to perform a model-independent determination of the relative phases between the single-photon and the three-gluon amplitudes in ψ → KK ¯ decays. The values of the branching fractions measured in the reaction e+e- → K+ K- are shifted due to interference of resonant and nonresonant amplitudes. We have determined the absolute values of the shifts to be 5% for J/ψ and 15% for ψ(2S) decays.

  1. Towards a Resolution of the Proton Form Factor Problem: New Electron and Positron Scattering Data

    SciTech Connect

    Adikaram, D.; Rimal, D.; Weinstein, L. B.; Raue, B.; Khetarpal, P.; Bennett, R.; Arrington, J.; Brooks, W.; Adhikari, K.; Afanasev, A.; Amaryan, M.; Anderson, M.; Anefalos Pereira, S.; Avakian, H.; Ball, J.; Battaglieri, M.; Bedlinskiy, I.; Biselli, A.; Bono, J.; Boiarinov, S.; Briscoe, W.; Burkert, V.; Carman, D.; Careccia, S.; Celentano, A.; Chandavar, S.; Charles, G.; Colaneri, L.; Cole, P.; Contalbrigo, M.; Crede, V.; D'Angelo, A.; Dashyan, N.; De Vita, R.; De Sanctis, E.; Deur, A.; Djalali, C.; Dodge, G.; Dupre, R.; Egiyan, H.; El Alaoui, A.; El Fassi, L.; Elouadrhiri, L.; Eugenio, P.; Fedotov, G.; Fegan, S.; Filippi, A.; Fleming, J.; Fradi, A.; Garillon, B.; Gilfoyle, G.; Giovanetti, K.; Girod, F.; Goetz, J.; Gohn, W.; Golovatch, E.; Gothe, R.; Griffioen, K.; Guegan, B.; Guidal, M.; Guo, L.; Hafidi, K.; Hakobyan, H.; Hanretty, C.; Harrison, N.; Hattawy, M.; Hicks, K.; Holtrop, M.; Hughes, S.; Hyde, C. E.; Ilieva, Y.; Ireland, D.; Ishkhanov, B.; Jenkins, D.; Jiang, H.; Jo, H.; Joo, K.; Joosten, S.; Kalantarians, N.; Keller, D.; Khandaker, M.; Kim, A.; Kim, W.; Klein, A.; Klein, F.; Koirala, S.; Kubarovsky, V.; Kuhn, S.; Livingston, K.; Lu, H.; MacGregor, I.; Markov, N.; Mattione, P.; Mayer, M.; McKinnon, B.; Mestayer, M.; Meyer, C.; Mirazita, M.; Mokeev, V.; Montgomery, R.; Moody, C.; Moutarde, H.; Movsisyan, A.; Camacho, C. Munoz; Nadel-Turonski, P.; Niccolai, S.; Niculescu, G.; Osipenko, M.; Ostrovidov, A.; Park, K.; Pasyuk, E.; Pisano, S.; Pogorelko, O.; Price, J.; Procureur, S.; Prok, Y.; Protopopescu, D.; Puckett, A.; Ripani, M.; Rizzo, A.; Rosner, G.; Rossi, P.; Roy, P.; Sabati, F.; Salgado, C.; Schott, D.; Schumacher, R.; Seder, E.; Sharabian, Y.; Simonyan, A.; Skorodumina, I.; Smith, E.; Smith, G.; Sober, D.; Sokhan, D.; Sparveris, N.; Stepanyan, S.; Stoler, P.; Strauch, S.; Sytnik, V.; Taiuti, M.; Tian, Ye; Trivedi, A.; Ungaro, M.; Voskanyan, H.; Voutier, E.; Walford, N.; Watts, D.; Wei, X.; Wood, M.; Zachariou, N.; Zana, L.; Zhang, J.; Zhao, Z.; Zonta, I.

    2015-02-10

    There is a significant discrepancy between the values of the proton electric form factor, GpE, extracted using unpolarized and polarized electron scattering. Calculations predict that small two-photon exchange (TPE) contributions can significantly affect the extraction of GpE from the unpolarized electron-proton cross sections. We determined the TPE contribution by measuring the ratio of positron-proton to electron-proton elastic scattering cross sections using a simultaneous, tertiary electron-positron beam incident on a liquid hydrogen target and detecting the scattered particles in the Jefferson Lab CLAS detector. This novel technique allowed us to cover a wide range in virtual photon polarization (epsilon) and momentum transfer (Q2) simultaneously, as well as to cancel luminosity-related systematic errors. The cross section ratio increases with decreasing ε at Q2=1.45 GeV2. This measurement is consistent with the size of the form factor discrepancy at Q2≈1.75 GeV2 and with hadronic calculations including nucleon and Delta intermediate states, which have been shown to resolve the discrepancy up to 2-3 GeV2.

  2. Towards a Resolution of the Proton Form Factor Problem: New Electron and Positron Scattering Data

    NASA Astrophysics Data System (ADS)

    Adikaram, D.; Rimal, D.; Weinstein, L. B.; Raue, B.; Khetarpal, P.; Bennett, R. P.; Arrington, J.; Brooks, W. K.; Adhikari, K. P.; Afanasev, A. V.; Amaryan, M. J.; Anderson, M. D.; Anefalos Pereira, S.; Avakian, H.; Ball, J.; Battaglieri, M.; Bedlinskiy, I.; Biselli, A. S.; Bono, J.; Boiarinov, S.; Briscoe, W. J.; Burkert, V. D.; Carman, D. S.; Careccia, S.; Celentano, A.; Chandavar, S.; Charles, G.; Colaneri, L.; Cole, P. L.; Contalbrigo, M.; Crede, V.; D'Angelo, A.; Dashyan, N.; De Vita, R.; De Sanctis, E.; Deur, A.; Djalali, C.; Dodge, G. E.; Dupre, R.; Egiyan, H.; El Alaoui, A.; El Fassi, L.; Elouadrhiri, L.; Eugenio, P.; Fedotov, G.; Fegan, S.; Filippi, A.; Fleming, J. A.; Fradi, A.; Garillon, B.; Gilfoyle, G. P.; Giovanetti, K. L.; Girod, F. X.; Goetz, J. T.; Gohn, W.; Golovatch, E.; Gothe, R. W.; Griffioen, K. A.; Guegan, B.; Guidal, M.; Guo, L.; Hafidi, K.; Hakobyan, H.; Hanretty, C.; Harrison, N.; Hattawy, M.; Hicks, K.; Holtrop, M.; Hughes, S. M.; Hyde, C. E.; Ilieva, Y.; Ireland, D. G.; Ishkhanov, B. S.; Jenkins, D.; Jiang, H.; Jo, H. S.; Joo, K.; Joosten, S.; Kalantarians, N.; Keller, D.; Khandaker, M.; Kim, A.; Kim, W.; Klein, A.; Klein, F. J.; Koirala, S.; Kubarovsky, V.; Kuhn, S. E.; Livingston, K.; Lu, H. Y.; MacGregor, I. J. D.; Markov, N.; Mattione, P.; Mayer, M.; McKinnon, B.; Mestayer, M. D.; Meyer, C. A.; Mirazita, M.; Mokeev, V.; Montgomery, R. A.; Moody, C. I.; Moutarde, H.; Movsisyan, A.; Camacho, C. Munoz; Nadel-Turonski, P.; Niccolai, S.; Niculescu, G.; Osipenko, M.; Ostrovidov, A. I.; Park, K.; Pasyuk, E.; Peña, C.; Pisano, S.; Pogorelko, O.; Price, J. W.; Procureur, S.; Prok, Y.; Protopopescu, D.; Puckett, A. J. R.; Ripani, M.; Rizzo, A.; Rosner, G.; Rossi, P.; Roy, P.; Sabatié, F.; Salgado, C.; Schott, D.; Schumacher, R. A.; Seder, E.; Sharabian, Y. G.; Simonyan, A.; Skorodumina, I.; Smith, E. S.; Smith, G. D.; Sober, D. I.; Sokhan, D.; Sparveris, N.; Stepanyan, S.; Stoler, P.; Strauch, S.; Sytnik, V.; Taiuti, M.; Tian, Ye; Trivedi, A.; Ungaro, M.; Voskanyan, H.; Voutier, E.; Walford, N. K.; Watts, D. P.; Wei, X.; Wood, M. H.; Zachariou, N.; Zana, L.; Zhang, J.; Zhao, Z. W.; Zonta, I.; CLAS Collaboration

    2015-02-01

    There is a significant discrepancy between the values of the proton electric form factor, GEp, extracted using unpolarized and polarized electron scattering. Calculations predict that small two-photon exchange (TPE) contributions can significantly affect the extraction of GEp from the unpolarized electron-proton cross sections. We determined the TPE contribution by measuring the ratio of positron-proton to electron-proton elastic scattering cross sections using a simultaneous, tertiary electron-positron beam incident on a liquid hydrogen target and detecting the scattered particles in the Jefferson Lab CLAS detector. This novel technique allowed us to cover a wide range in virtual photon polarization (ɛ ) and momentum transfer (Q2) simultaneously, as well as to cancel luminosity-related systematic errors. The cross section ratio increases with decreasing ɛ at Q2=1.45 GeV2 . This measurement is consistent with the size of the form factor discrepancy at Q2≈1.75 GeV2 and with hadronic calculations including nucleon and Δ intermediate states, which have been shown to resolve the discrepancy up to 2 - 3 GeV2 .

  3. Towards a Resolution of the Proton Form Factor Problem: New Electron and Positron Scattering Data

    DOE PAGES

    Adikaram, D.; Rimal, D.; Weinstein, L. B.; ...

    2015-02-10

    There is a significant discrepancy between the values of the proton electric form factor, GpE, extracted using unpolarized and polarized electron scattering. Calculations predict that small two-photon exchange (TPE) contributions can significantly affect the extraction of GpE from the unpolarized electron-proton cross sections. We determined the TPE contribution by measuring the ratio of positron-proton to electron-proton elastic scattering cross sections using a simultaneous, tertiary electron-positron beam incident on a liquid hydrogen target and detecting the scattered particles in the Jefferson Lab CLAS detector. This novel technique allowed us to cover a wide range in virtual photon polarization (epsilon) and momentummore » transfer (Q2) simultaneously, as well as to cancel luminosity-related systematic errors. The cross section ratio increases with decreasing ε at Q2=1.45 GeV2. This measurement is consistent with the size of the form factor discrepancy at Q2≈1.75 GeV2 and with hadronic calculations including nucleon and Delta intermediate states, which have been shown to resolve the discrepancy up to 2-3 GeV2.« less

  4. Towards a resolution of the proton form factor problem: new electron and positron scattering data.

    PubMed

    Adikaram, D; Rimal, D; Weinstein, L B; Raue, B; Khetarpal, P; Bennett, R P; Arrington, J; Brooks, W K; Adhikari, K P; Afanasev, A V; Amaryan, M J; Anderson, M D; Anefalos Pereira, S; Avakian, H; Ball, J; Battaglieri, M; Bedlinskiy, I; Biselli, A S; Bono, J; Boiarinov, S; Briscoe, W J; Burkert, V D; Carman, D S; Careccia, S; Celentano, A; Chandavar, S; Charles, G; Colaneri, L; Cole, P L; Contalbrigo, M; Crede, V; D'Angelo, A; Dashyan, N; De Vita, R; De Sanctis, E; Deur, A; Djalali, C; Dodge, G E; Dupre, R; Egiyan, H; El Alaoui, A; El Fassi, L; Elouadrhiri, L; Eugenio, P; Fedotov, G; Fegan, S; Filippi, A; Fleming, J A; Fradi, A; Garillon, B; Gilfoyle, G P; Giovanetti, K L; Girod, F X; Goetz, J T; Gohn, W; Golovatch, E; Gothe, R W; Griffioen, K A; Guegan, B; Guidal, M; Guo, L; Hafidi, K; Hakobyan, H; Hanretty, C; Harrison, N; Hattawy, M; Hicks, K; Holtrop, M; Hughes, S M; Hyde, C E; Ilieva, Y; Ireland, D G; Ishkhanov, B S; Jenkins, D; Jiang, H; Jo, H S; Joo, K; Joosten, S; Kalantarians, N; Keller, D; Khandaker, M; Kim, A; Kim, W; Klein, A; Klein, F J; Koirala, S; Kubarovsky, V; Kuhn, S E; Livingston, K; Lu, H Y; MacGregor, I J D; Markov, N; Mattione, P; Mayer, M; McKinnon, B; Mestayer, M D; Meyer, C A; Mirazita, M; Mokeev, V; Montgomery, R A; Moody, C I; Moutarde, H; Movsisyan, A; Camacho, C Munoz; Nadel-Turonski, P; Niccolai, S; Niculescu, G; Osipenko, M; Ostrovidov, A I; Park, K; Pasyuk, E; Peña, C; Pisano, S; Pogorelko, O; Price, J W; Procureur, S; Prok, Y; Protopopescu, D; Puckett, A J R; Ripani, M; Rizzo, A; Rosner, G; Rossi, P; Roy, P; Sabatié, F; Salgado, C; Schott, D; Schumacher, R A; Seder, E; Sharabian, Y G; Simonyan, A; Skorodumina, I; Smith, E S; Smith, G D; Sober, D I; Sokhan, D; Sparveris, N; Stepanyan, S; Stoler, P; Strauch, S; Sytnik, V; Taiuti, M; Tian, Ye; Trivedi, A; Ungaro, M; Voskanyan, H; Voutier, E; Walford, N K; Watts, D P; Wei, X; Wood, M H; Zachariou, N; Zana, L; Zhang, J; Zhao, Z W; Zonta, I

    2015-02-13

    There is a significant discrepancy between the values of the proton electric form factor, G(E)(p), extracted using unpolarized and polarized electron scattering. Calculations predict that small two-photon exchange (TPE) contributions can significantly affect the extraction of G(E)(p) from the unpolarized electron-proton cross sections. We determined the TPE contribution by measuring the ratio of positron-proton to electron-proton elastic scattering cross sections using a simultaneous, tertiary electron-positron beam incident on a liquid hydrogen target and detecting the scattered particles in the Jefferson Lab CLAS detector. This novel technique allowed us to cover a wide range in virtual photon polarization (ϵ) and momentum transfer (Q(2)) simultaneously, as well as to cancel luminosity-related systematic errors. The cross section ratio increases with decreasing ϵ at Q(2)=1.45  GeV(2). This measurement is consistent with the size of the form factor discrepancy at Q(2)≈1.75  GeV(2) and with hadronic calculations including nucleon and Δ intermediate states, which have been shown to resolve the discrepancy up to 2-3  GeV(2).

  5. On the ππ continuum in the nucleon form factors and the proton radius puzzle

    NASA Astrophysics Data System (ADS)

    Hoferichter, M.; Kubis, B.; Ruiz de Elvira, J.; Hammer, H.-W.; Meißner, U.-G.

    2016-11-01

    We present an improved determination of the ππ continuum contribution to the isovector spectral functions of the nucleon electromagnetic form factors. Our analysis includes the most up-to-date results for the ππ→bar{N} N partial waves extracted from Roy-Steiner equations, consistent input for the pion vector form factor, and a thorough discussion of isospin-violating effects and uncertainty estimates. As an application, we consider the ππ contribution to the isovector electric and magnetic radii by means of sum rules, which, in combination with the accurately known neutron electric radius, are found to slightly prefer a small proton charge radius.

  6. New Precision Limit on the Strange Vector Form Factors of the Proton

    SciTech Connect

    Ahmed, Z.; Allada, K.; Aniol, K. A.; Armstrong, D. S.; Arrington, J.; Baturin, P.; Bellini, V.; Benesch, J.; Beminiwattha, R.; Benmokhtar, F.; Canan, M.; Camsonne, A.; Cates, G. D.; Chen, J. -P.; Chudakov, E.; Cisbani, E.; Dalton, M. M.; de Jager, C. W.; De Leo, R.; Deconinck, W.; Decowski, P.; Deng, X.; Deur, A.; Dutta, C.; Franklin, G. B.; Friend, M.; Frullani, S.; Garibaldi, F.; Giusa, A.; Glamazdin, A.; Golge, S.; Grimm, K.; Hansen, O.; Higinbotham, D. W.; Holmes, R.; Holmstrom, T.; Huang, J.; Huang, M.; Hyde, C. E.; Jen, C. M.; Jin, G.; Jones, D.; Kang, H.; King, P.; Kowalski, S.; Kumar, K. S.; Lee, J. H.; LeRose, J. J.; Liyanage, N.; Long, E.; McNulty, D.; Margaziotis, D.; Meddi, F.; Meekins, D. G.; Mercado, L.; Meziani, Z. -E.; Michaels, R.; Muñoz-Camacho, C.; Mihovilovic, M.; Muangma, N.; Myers, K. E.; Nanda, S.; Narayan, A.; Nelyubin, V.; Nuruzzaman, None; Oh, Y.; Pan, K.; Parno, D.; Paschke, K. D.; Phillips, S. K.; Qian, X.; Qiang, Y.; Quinn, B.; Rakhman, A.; Reimer, P. E.; Rider, K.; Riordan, S.; Roche, J.; Rubin, J.; Russo, G.; Saenboonruang, K.; Saha, A.; Sawatzky, B.; Silwal, R.; Sirca, S.; Souder, P. A.; Sperduto, M.; Subedi, R.; Suleiman, R.; Sulkosky, V.; Sutera, C. M.; Tobias, W. A.; Urciuoli, G. M.; Waidyawansa, B.; Wang, D.; Wexler, J.; Wilson, R.; Wojtsekhowski, B.; Zhan, X.; Yan, X.; Yao, H.; Ye, L.; Zhao, B.; Zheng, X.

    2012-03-01

    The parity-violating cross-section asymmetry in the elastic scattering of polarized electrons from unpolarized protons has been measured at a four-momentum transfer squared Q2 = 0.624 GeV2 and beam energy Eb = 3.48 GeV to be APV = -23.80 ± 0.78 (stat) ± 0.36 (syst) parts per million. This result is consistent with zero contribution of strange quarks to the combination of electric and magnetic form factors GEs + 0.517 GMs = 0.003 ± 0.010 (stat) ± 0.004 (syst) ± 0.009 (ff), where the third error is due to the limits of precision on the electromagnetic form factors and radiative corrections. With this measurement, the world data on strange contributions to nucleon form factors are seen to be consistent with zero and not more than a few percent of the proton form factors.

  7. New Precision Limit on the Strange Vector Form Factors of the Proton

    DOE PAGES

    Ahmed, Z.; Allada, K.; Aniol, K. A.; ...

    2012-03-01

    The parity-violating cross-section asymmetry in the elastic scattering of polarized electrons from unpolarized protons has been measured at a four-momentum transfer squared Q2 = 0.624 GeV2 and beam energy Eb = 3.48 GeV to be APV = -23.80 ± 0.78 (stat) ± 0.36 (syst) parts per million. This result is consistent with zero contribution of strange quarks to the combination of electric and magnetic form factors GEs + 0.517 GMs = 0.003 ± 0.010 (stat) ± 0.004 (syst) ± 0.009 (ff), where the third error is due to the limits of precision on the electromagnetic form factors and radiative corrections.more » With this measurement, the world data on strange contributions to nucleon form factors are seen to be consistent with zero and not more than a few percent of the proton form factors.« less

  8. The Proton Coulomb Form Factor from Polarized Inclusive e-p Scattering

    SciTech Connect

    Harris, Christopher Matthew

    2001-05-01

    The proton form factors provide information on the fundamental properties of the proton and provide a test for models based on QCD. In 1998 at Jefferson Lab (JLAB) in Newport News, VA, experiment E93026 measured the inclusive e-p scattering cross section from a polarized ammonia (15NH3) target at a four momentum transfer squared of Q2 = 0.5 (GeV/c)2. Longitudinally polarized electrons were scattered from the polarized target and the scattered electron was detected. Data has been analyzed to obtain the asymmetry from elastically scattered electrons from hydrogen in 15NH3. The asymmetry, Ap, has been used to determine the proton elastic form factor GEp. The result is consistent with the dipole model and data from previous experiments. However, due to the choice of kinematics, the uncertainty in the measurement is large.

  9. Feasibility studies on time-like proton electromagnetic form factors at PANDA-FAIR

    NASA Astrophysics Data System (ADS)

    Zimmermann, Iris; Dbeyssi, Alaa; Khaneft, Dmitry

    2016-05-01

    This contribution reports on the latest status of the feasibility studies for the measurement of time-like proton electromagnetic form factors (FF's) at the PANDA experiment [1] at FAIR (Germany). Electromagnetic FF's are fundamental quantities parameterizing the electric and magnetic structure of hadrons. In the time-like region proton FF's can be accessed experimentally through the annihilation processes p ¯p → l+l- (l = e, μ), assuming that the interaction takes place through the exchange of one virtual photon. Due to the low luminosity available at colliders in the past, an individual determination of the time-like electric and magnetic proton FF's was not feasible. The statistical precision, at which the proton FF's will be determined at PANDA, is estimated for both signal processes p ¯p → l+l- (l = e, μ) using the PandaRoot software, which encompasses full detector simulation and event reconstruction. The signal identification and suppression of the main background process (p ¯p → π+π-) is studied. Different methods have been used to generate and analyze the processes of interest. The results from the different analyses show that time-like electromagnetic FF's can be measured at PANDA with unprecedented statistical accuracy.

  10. The proton form factor measurements at Jefferson Lab, past and future

    SciTech Connect

    Punjabi, Vina A.

    2014-01-01

    Use of the double-polarization technique to obtain the elastic nucleon form factors has resulted in a dramatic improvement of the quality of two of the four nucleon electromagnetic form factors, G{sub Ep} and G{sub En}. It has also changed our understanding of the proton structure, having resulted in a distinctly different Q 2-dependence for both G{sub Ep} and G{sub Mp}, contradicting the prevailing wisdom of the 1990’s based on cross section measurements, namely that G{sub Ep} and G{sub Mp} obey a “scaling” relation {mu}G{sub Ep} ~ G{sub Mp}. A related consequence of the faster decrease of G{sub Ep} revealed by the Jefferson Lab (Jlab) polarization results was the disappearance of the early scaling F{sub 2}/F{sub 1} ~ 1/Q{sup 2} predicted by perturbative QCD. In three experiments, Gep(1), Gep(2) and Gep(3), in Halls A and C at Jlab, the ratio of the proton’s electromagnetic elastic form factors, G{sub Ep} /G{sub Mp} , was measured up to four momentum transfer Q{sup 2} of 8.5 GeV{sup 2} with high precision, using the recoil polarization technique. The initial discovery that the proton form factor ratio measured in these three experiments decreases approximately linearly with four-momentum transfer, Q{sup 2}, for values above ~ 1 GeV{sup 2}, was modified by the Gep(3) results, which suggests a slowing down of this decrease. There is an approved experiment, Gep(5), to continue these measurements to 15 GeV{sup 2}. A dedicated experimental setup, the super bigbite spectrometer (SBS), will be built for this purpose. It will be equipped with a new focal plane polarimeter to measure the polarization of the recoil protons. In this presentation, I will review the status of the proton elastic electromagnetic form factors, mention succinctly a number of theoretical approaches to describe results and show some features required for the future Gep(5) experiment.

  11. Phenomenological analysis of near-threshold periodic modulations of the proton timelike form factor

    NASA Astrophysics Data System (ADS)

    Bianconi, A.; Tomasi-Gustafsson, E.

    2016-03-01

    We have recently highlighted the presence of a periodically oscillating 10% modulation in the BABAR Collaboration data on the proton timelike form factors, expressing the deviations from the pointlike behavior of the proton-antiproton electromagnetic current in the reaction e++e-→p ¯+p . Here we deepen our previous data analysis and confirm that in the case of several standard parametrizations it is possible to write the form factor in the form F0+Fosc , where F0 is a parametrization expressing the long-range trend of the form factor (for q2 ranging from the p ¯p threshold to 36 GeV2), and Fosc is a function of the form exp(-B p )cos(C p ) , where p is the relative momentum of the final p ¯p pair. Error bars allow for a clean identification of the main features of this modulation for q2<10 GeV2 . Assuming this oscillatory modulation to be an effect of final-state interactions between the forming proton and the antiproton, we propose a phenomenological model based on a double-layer imaginary optical potential. This potential is flux absorbing when the distance between the proton and antiproton centers of mass is ≳1.7 - 1.8 fm and flux generating when it is ≲1.7 - 1.8 fm. The main features of the oscillations may be reproduced with some freedom in the potential parameters, but the transition between the two layers must be sudden (0-0.2 fm) to get the correct oscillation period. The flux-absorbing part of the p ¯p interaction is well known in the phenomenology of small-energy antiproton interactions and is due to the annihilation of p ¯p pairs into multimeson states. We interpret the flux-creating part of the potential as due to the creation of a 1 /q -ranged state when the virtual photon decays into a set of current quarks and antiquarks. This short-lived compact state may be expressed as a sum of several hadronic states including the ones with large mass Qn≫q , that may exist for a time t ˜1 /(Qn-q ) . The decay of these large-mass states leads to an

  12. Proton Form Factor Puzzle and the CEBAF Large Acceptance Spectrometer (CLAS) two-photon exchange experiment

    NASA Astrophysics Data System (ADS)

    Rimal, Dipak

    The electromagnetic form factors are the most fundamental observables that encode information about the internal structure of the nucleon. The electric (GE) and the magnetic ( GM) form factors contain information about the spatial distribution of the charge and magnetization inside the nucleon. A significant discrepancy exists between the Rosenbluth and the polarization transfer measurements of the electromagnetic form factors of the proton. One possible explanation for the discrepancy is the contributions of two-photon exchange (TPE) effects. Theoretical calculations estimating the magnitude of the TPE effect are highly model dependent, and limited experimental evidence for such effects exists. Experimentally, the TPE effect can be measured by comparing the ratio of positron-proton elastic scattering cross section to that of the electron-proton [R = sigma(e +p)/sigma(e+p)]. The ratio R was measured over a wide range of kinematics, utilizing a 5.6 GeV primary electron beam produced by the Continuous Electron Beam Accelerator Facility (CEBAF) at Jefferson Lab. This dissertation explored dependence of R on kinematic variables such as squared four-momentum transfer (Q2) and the virtual photon polarization parameter (epsilon). A mixed electron-positron beam was produced from the primary electron beam in experimental Hall B. The mixed beam was scattered from a liquid hydrogen (LH2) target. Both the scattered lepton and the recoil proton were detected by the CEBAF Large Acceptance Spectrometer (CLAS). The elastic events were then identified by using elastic scattering kinematics. This work extracted the Q2 dependence of R at high epsilon(epsilon > 0.8) and the $epsilon dependence of R at approx 0.85 GeV2. In these kinematics, our data confirm the validity of the hadronic calculations of the TPE effect by Blunden, Melnitchouk, and Tjon. This hadronic TPE effect, with additional corrections contributed by higher excitations of the intermediate state nucleon, largely

  13. Electromagnetic proton form factors in dual large-Nc QCD: An update

    NASA Astrophysics Data System (ADS)

    Bisschoff, B.; Dominguez, C. A.; Hernandez, L. A.

    2017-02-01

    An updated determination is presented of the electric and magnetic form factors of the proton, in the framework of a dual-model realization of quantum chromodynamics (QCD) in the limit of an infinite number of colors. Very good agreement with data is obtained in the space-like region up to q2 ≃‑30GeV2. In particular, the ratio μPGE(q2)/G M(q2) is predicted in very good agreement with recoil polarization measurements from Jefferson Lab, up to q2 ≃‑8.5GeV2.

  14. Proton Magnetic Form Factor from Existing Elastic e-p Cross Section Data

    NASA Astrophysics Data System (ADS)

    Ou, Longwu; Christy, Eric; Gilad, Shalev; Keppel, Cynthia; Schmookler, Barak; Wojtsekhowski, Bogdan

    2015-04-01

    The proton magnetic form factor GMp, in addition to being an important benchmark for all cross section measurements in hadron physics, provides critical information on proton structure. Extraction of GMp from e-p cross section data is complicated by two-photon exchange (TPE) effects, where available calculations still have large theoretical uncertainties. Studies of TPE contributions to e-p scattering have observed no nonlinear effects in Rosenbluth separations. Recent theoretical investigations show that the TPE correction goes to 0 when ɛ approaches 1, where ɛ is the virtual photon polarization parameter. In this talk, existing e-p elastic cross section data are reanalyzed by extrapolating the reduced cross section for ɛ approaching 1. Existing polarization transfer data, which is supposed to be relatively immune to TPE effects, are used to produce a ratio of electric and magnetic form factors. The extrapolated reduced cross section and polarization transfer ratio are then used to calculate GEp and GMp at different Q2 values.

  15. Strange magnetic form factor of the proton at $Q^2 = 0.23$ GeV$^2$

    SciTech Connect

    Wang, Ping; Leinweber, Derek; Thomas, Anthony; Young, Ross

    2009-06-01

    We determine the $u$ and $d$ quark contributions to the proton magnetic form factor at finite momentum transfer by applying chiral corrections to quenched lattice data. Heavy baryon chiral perturbation theory is applied at next to leading order in the quenched, and full QCD cases for the valence sector using finite range regularization. Under the assumption of charge symmetry these values can be combined with the experimental values of the proton and neutron magnetic form factors to deduce a relatively accurate value for the strange magnetic form factor at $Q^2=0.23$ GeV$^2$, namely $G_M^s=-0.034 \\pm 0.021$ $\\mu_N$.

  16. Antiproton-nucleus electromagnetic annihilation as a way to access the proton timelike form factors

    NASA Astrophysics Data System (ADS)

    Fonvieille, H.; Karmanov, V. A.

    2009-11-01

    Contrary to the reaction bar{{p}} p rightarrow e + e - with a high-momentum incident antiproton on a free target proton at rest, in which the invariant mass M of the e + e - pair is necessarily much larger than the bar{{p}} p mass 2 m , in the reaction bar{{p}} d rightarrow e + e - n the value of M can take values near or below the bar{{p}} p mass. In the antiproton-deuteron electromagnetic annihilation, this allows to access the proton electromagnetic form factors in the timelike region of q2 near the bar{{p}} p threshold. We estimate the cross-section dσ _{bar pd to e^ + e^ - n} /dmathcal{M} for an antiproton beam momentum of 1.5GeV/ c. We find that near the bar{{p}} p threshold this cross-section is about 1pb/MeV. The case of heavy-nuclei target is also discussed. Elements of experimental feasibility are presented for the process bar{{p}} d rightarrow e + e - n in the context of the overline{{P}} ANDA project.

  17. Feasibility studies of time-like proton electromagnetic form factors at $$\\overline{\\rm P}$$ANDA at FAIR

    DOE PAGES

    Singh, B.; Erni, W.; Krusche, B.; ...

    2016-10-28

    Simulation results for future measurements of electromagnetic proton form factors atmore » $$\\overline{\\rm P}$$ANDA (FAIR) within the PandaRoot software framework are reported. The statistical precision with which the proton form factors can be determined is estimated. The signal channel p¯p → e+e– is studied on the basis of two different but consistent procedures. The suppression of the main background channel, i.e. p¯p → π+π–, is studied. Furthermore, the background versus signal efficiency, statistical and systematical uncertainties on the extracted proton form factors are evaluated using two different procedures. The results are consistent with those of a previous simulation study using an older, simplified framework. Furthermore, a slightly better precision is achieved in the PandaRoot study in a large range of momentum transfer, assuming the nominal beam conditions and detector performance.« less

  18. Feasibility studies of time-like proton electromagnetic form factors at $\\overline{\\rm P}$ANDA at FAIR

    SciTech Connect

    Singh, B.; Erni, W.; Krusche, B.; Steinacher, M.; Walford, N.; Liu, B.; Liu, H.; Liu, Z.; Shen, X.; Wang, C.; Zhao, J.; Albrecht, M.; Erlen, T.; Fink, M.; Heinsius, F.; Held, T.; Holtmann, T.; Jasper, S.; Keshk, I.; Koch, H.; Kopf, B.; Kuhlmann, M.; Kümmel, M.; Leiber, S.; Mikirtychyants, M.; Musiol, P.; Mustafa, A.; Pelizäus, M.; Pychy, J.; Richter, M.; Schnier, C.; Schröder, T.; Sowa, C.; Steinke, M.; Triffterer, T.; Wiedner, U.; Ball, M.; Beck, R.; Hammann, C.; Ketzer, B.; Kube, M.; Mahlberg, P.; Rossbach, M.; Schmidt, C.; Schmitz, R.; Thoma, U.; Urban, M.; Walther, D.; Wendel, C.; Wilson, A.; Bianconi, A.; Bragadireanu, M.; Caprini, M.; Pantea, D.; Patel, B.; Czyzycki, W.; Domagala, M.; Filo, G.; Jaworowski, J.; Krawczyk, M.; Lisowski, F.; Lisowski, E.; Michałek, M.; Poznański, P.; Płażek, J.; Korcyl, K.; Kozela, A.; Kulessa, P.; Lebiedowicz, P.; Pysz, K.; Schäfer, W.; Szczurek, A.; Fiutowski, T.; Idzik, M.; Mindur, B.; Przyborowski, D.; Swientek, K.; Biernat, J.; Kamys, B.; Kistryn, S.; Korcyl, G.; Krzemien, W.; Magiera, A.; Moskal, P.; Pyszniak, A.; Rudy, Z.; Salabura, P.; Smyrski, J.; Strzempek, P.; Wronska, A.; Augustin, I.; Böhm, R.; Lehmann, I.; Nicmorus Marinescu, D.; Schmitt, L.; Varentsov, V.; Al-Turany, M.; Belias, A.; Deppe, H.; Dzhygadlo, R.; Ehret, A.; Flemming, H.; Gerhardt, A.; Götzen, K.; Gromliuk, A.; Gruber, L.; Karabowicz, R.; Kliemt, R.; Krebs, M.; Kurilla, U.; Lehmann, D.; Löchner, S.; Lühning, J.; Lynen, U.; Orth, H.; Patsyuk, M.; Peters, K.; Saito, T.; Schepers, G.; Schmidt, C. J.; Schwarz, C.; Schwiening, J.; Täschner, A.; Traxler, M.; Ugur, C.; Voss, B.; Wieczorek, P.; Wilms, A.; Zühlsdorf, M.; Abazov, V.; Alexeev, G.; Arefiev, V. A.; Astakhov, V.; Barabanov, M. Yu.; Batyunya, B. V.; Davydov, Y.; Dodokhov, V. Kh.; Efremov, A.; Fechtchenko, A.; Fedunov, A. G.; Galoyan, A.; Grigoryan, S.; Koshurnikov, E. K.; Lobanov, Y. Yu.; Lobanov, V. I.; Makarov, A. F.; Malinina, L. V.; Malyshev, V.; Olshevskiy, A. G.; Perevalova, E.; Piskun, A. A.; Pocheptsov, T.; Pontecorvo, G.; Rodionov, V.; Rogov, Y.; Salmin, R.; Samartsev, A.; Sapozhnikov, M. G.; Shabratova, G.; Skachkov, N. B.; Skachkova, A. N.; Strokovsky, E. A.; Suleimanov, M.; Teshev, R.; Tokmenin, V.; Uzhinsky, V.; Vodopianov, A.; Zaporozhets, S. A.; Zhuravlev, N. I.; Zorin, A. G.; Branford, D.; Glazier, D.; Watts, D.; Böhm, M.; Britting, A.; Eyrich, W.; Lehmann, A.; Pfaffinger, M.; Uhlig, F.; Dobbs, S.; Seth, K.; Tomaradze, A.; Xiao, T.; Bettoni, D.; Carassiti, V.; Cotta Ramusino, A.; Dalpiaz, P.; Drago, A.; Fioravanti, E.; Garzia, I.; Savrie, M.; Akishina, V.; Kisel, I.; Kozlov, G.; Pugach, M.; Zyzak, M.; Gianotti, P.; Guaraldo, C.; Lucherini, V.; Bersani, A.; Bracco, G.; Macri, M.; Parodi, R. F.; Biguenko, K.; Brinkmann, K.; Di Pietro, V.; Diehl, S.; Dormenev, V.; Drexler, P.; Düren, M.; Etzelmüller, E.; Galuska, M.; Gutz, E.; Hahn, C.; Hayrapetyan, A.; Kesselkaul, M.; Kühn, W.; Kuske, T.; Lange, J. S.; Liang, Y.; Metag, V.; Nanova, M.; Nazarenko, S.; Novotny, R.; Quagli, T.; Reiter, S.; Rieke, J.; Rosenbaum, C.; Schmidt, M.; Schnell, R.; Stenzel, H.; Thöring, U.; Ullrich, M.; Wagner, M. N.; Wasem, T.; Wohlfahrt, B.; Zaunick, H.; Ireland, D.; Rosner, G.; Seitz, B.; Deepak, P. N.; Kulkarni, A.; Apostolou, A.; Babai, M.; Kavatsyuk, M.; Lemmens, P. J.; Lindemulder, M.; Loehner, H.; Messchendorp, J.; Schakel, P.; Smit, H.; Tiemens, M.; van der Weele, J. C.; Veenstra, R.; Vejdani, S.; Dutta, K.; Kalita, K.; Kumar, A.; Roy, A.; Sohlbach, H.; Bai, M.; Bianchi, L.; Büscher, M.; Cao, L.; Cebulla, A.; Dosdall, R.; Gillitzer, A.; Goldenbaum, F.; Grunwald, D.; Herten, A.; Hu, Q.; Kemmerling, G.; Kleines, H.; Lehrach, A.; Nellen, R.; Ohm, H.; Orfanitski, S.; Prasuhn, D.; Prencipe, E.; Pütz, J.; Ritman, J.; Schadmand, S.; Sefzick, T.; Serdyuk, V.; Sterzenbach, G.; Stockmanns, T.; Wintz, P.; Wüstner, P.; Xu, H.; Zambanini, A.; Li, S.; Li, Z.; Sun, Z.; Xu, H.; Rigato, V.; Isaksson, L.; Achenbach, P.; Corell, O.; Denig, A.; Distler, M.; Hoek, M.; Karavdina, A.; Lauth, W.; Liu, Z.; Merkel, H.; Müller, U.; Pochodzalla, J.; Sanchez, S.; Schlimme, S.; Sfienti, C.; Thiel, M.; Ahmadi, H.; Ahmed, S.; Bleser, S.; Capozza, L.; Cardinali, M.; Dbeyssi, A.; Deiseroth, M.; Feldbauer, F.; Fritsch, M.; Fröhlich, B.; Jasinski, P.; Kang, D.; Khaneft, D.; Klasen, R.; Leithoff, H. H.; Lin, D.; Maas, F.; Maldaner, S.; Martínez, M.; Michel, M.; Mora Espí, M. C.; Morales Morales, C.; Motzko, C.; Nerling, F.; Noll, O.; Pflüger, S.; Pitka, A.; Rodríguez Piñeiro, D.; Sanchez-Lorente, A.; Steinen, M.; Valente, R.; Weber, T.; Zambrana, M.; Zimmermann, I.; Fedorov, A.; Korjik, M.; Missevitch, O.; Boukharov, A.; Malyshev, O.; Marishev, I.; Balanutsa, V.; Balanutsa, P.; Chernetsky, V.; Demekhin, A.; Dolgolenko, A.; Fedorets, P.; Gerasimov, A.; Goryachev, V.; Chandratre, V.; Datar, V.; Dutta, D.; Jha, V.; Kumawat, H.; Mohanty, A. K.; Parmar, A.; Roy, B.; Sonika, G.; Fritzsch, C.; Grieser, S.; Hergemöller, A.; Hetz, B.; Hüsken, N.; Khoukaz, A.; Wessels, J. P.; Khosonthongkee, K.; Kobdaj, C.; Limphirat, A.; Srisawad, P.; Yan, Y.; Barnyakov, M.; Barnyakov, A. Yu.; Beloborodov, K.; Blinov, A. E.; Blinov, V. E.; Bobrovnikov, V. S.; Kononov, S.; Kravchenko, E. A.; Kuyanov, I. A.; Martin, K.; Onuchin, A. P.; Serednyakov, S.; Sokolov, A.; Tikhonov, Y.; Atomssa, E.; Kunne, R.; Marchand, D.; Ramstein, B.; van de Wiele, J.; Wang, Y.; Boca, G.; Costanza, S.; Genova, P.; Montagna, P.; Rotondi, A.; Abramov, V.; Belikov, N.; Bukreeva, S.; Davidenko, A.; Derevschikov, A.; Goncharenko, Y.; Grishin, V.; Kachanov, V.; Kormilitsin, V.; Levin, A.; Melnik, Y.; Minaev, N.; Mochalov, V.; Morozov, D.; Nogach, L.; Poslavskiy, S.; Ryazantsev, A.; Ryzhikov, S.; Semenov, P.; Shein, I.; Uzunian, A.; Vasiliev, A.; Yakutin, A.; Tomasi-Gustafsson, E.; Roy, U.; Yabsley, B.; Belostotski, S.; Gavrilov, G.; Izotov, A.; Manaenkov, S.; Miklukho, O.; Veretennikov, D.; Zhdanov, A.; Makonyi, K.; Preston, M.; Tegner, P.; Wölbing, D.; Bäck, T.; Cederwall, B.; Rai, A. K.; Godre, S.; Calvo, D.; Coli, S.; De Remigis, P.; Filippi, A.; Giraudo, G.; Lusso, S.; Mazza, G.; Mignone, M.; Rivetti, A.; Wheadon, R.; Balestra, F.; Iazzi, F.; Introzzi, R.; Lavagno, A.; Olave, J.; Amoroso, A.; Bussa, M. P.; Busso, L.; De Mori, F.; Destefanis, M.; Fava, L.; Ferrero, L.; Greco, M.; Hu, J.; Lavezzi, L.; Maggiora, M.; Maniscalco, G.; Marcello, S.; Sosio, S.; Spataro, S.; Birsa, R.; Bradamante, F.; Bressan, A.; Martin, A.; Calen, H.; Ikegami Andersson, W.; Johansson, T.; Kupsc, A.; Marciniewski, P.; Papenbrock, M.; Pettersson, J.; Schönning, K.; Wolke, M.; Galnander, B.; Diaz, J.; Pothodi Chackara, V.; Chlopik, A.; Kesik, G.; Melnychuk, D.; Slowinski, B.; Trzcinski, A.; Wojciechowski, M.; Wronka, S.; Zwieglinski, B.; Bühler, P.; Marton, J.; Steinschaden, D.; Suzuki, K.; Widmann, E.; Zmeskal, J.

    2016-10-28

    Simulation results for future measurements of electromagnetic proton form factors at $\\overline{\\rm P}$ANDA (FAIR) within the PandaRoot software framework are reported. The statistical precision with which the proton form factors can be determined is estimated. The signal channel p¯p → e+e is studied on the basis of two different but consistent procedures. The suppression of the main background channel, i.e. p¯p → π+π, is studied. Furthermore, the background versus signal efficiency, statistical and systematical uncertainties on the extracted proton form factors are evaluated using two different procedures. The results are consistent with those of a previous simulation study using an older, simplified framework. Furthermore, a slightly better precision is achieved in the PandaRoot study in a large range of momentum transfer, assuming the nominal beam conditions and detector performance.

  19. Recoil Polarization Measurements of the Proton Electromagnetic Form Factor Ratio to Q^2 = 8.5 GeV^2

    SciTech Connect

    Puckett, A J.R.; Jones, M K; Luo, W; Meziane, M; Pentchev, L; Perdrisat, C F; Punjabi, V; Wesselmann, F R; Ahmidouch, A; Albayrak, I; Aniol, K A; Arrington, J; Asaturyan, A; Baghdasaryan, H; Benmokhtar, F; Bertozzi, W; Bimbot, L; Bosted, P; Boeglin, W; Butuceanu, C; Carter, P; Chernenko, S; Christy, E; Commisso, M; Cornejo, J C; Covrig, S; Danagoulian, S; Daniel, A; Davidenko, A; Day, D; Dhamija, S; Dutta, D; Ent, R; Frullani, S; Fenker, H; Frlez, E; Garibaldi, F; Gaskell, D; Gilad, S; Gilman, R; Goncharenko, Y; Hafidi, K; Hamilton, D; Higinbotham, D W; Hinton, W; Horn, T; Hu, B; Huang, J; Huber, G M; Jensen, E; Keppel, C; Khandaker, M; King, P; Kirillov, D; Kohl, M; Kravtsov, V; Kumbartzki, G; Li, Y; Mamyan, V; Margaziotis, D J; Marsh, A; Matulenko, Y; Maxwell, J; Mbianda, G; Meekins, D; Melnik, Y; Miller, J; Mkrtchyan, A; Mkrtchyan, H; Moffit, B; Moreno, O; Mulholland, J; Narayan, A; Nedev, S; Nuruzzaman,; Piasetzky, E; Pierce, W; Piskunov, N M; Prok, Y; Ransome, R D; Razin, D S; Reimer, P; Reinhold, J; Rondon, O; Shabestari, M; Shahinyan, A; Shestermanov, K; Sirca, S; Sitnik, I; Smykov, L; Smith, G; Solovyev, L; Solvingnon, P; Subedi, R; Tomasi-Gustafsson, E; Vasiliev, A; Veilleux, M; Wojtsekhowski, B B; Wood, S; Ye, Z; Zanevsky, Y; Zhang, X; Zhang, Y; Zheng, X; Zhu, L

    2010-06-01

    Among the most fundamental observables of nucleon structure, electromagnetic form factors are a crucial benchmark for modern calculations describing the strong interaction dynamics of the nucleon’s quark constituents; indeed, recent proton data have attracted intense theoretical interest. In this Letter, we report new measurements of the proton electromagnetic form factor ratio using the recoil polarization method, at momentum transfers Q2=5.2, 6.7, and 8.5  GeV2. By extending the range of Q2 for which GEp is accurately determined by more than 50%, these measurements will provide significant constraints on models of nucleon structure in the nonperturbative regime.

  20. High Precision Measurement of the Proton Elastic Form Factor Ratio at Low Q2

    SciTech Connect

    Zhan, Xiaohui

    2010-01-01

    Experiment E08-007 measured the proton elastic form factor ratio μpGE/GM in the range of Q2 = 0.3-0.7(GeV/c)2 by recoil polarimetry. Data were taken in 2008 at the Thomas Jefferson National Accelerator Facility in Virginia, USA. A 1.2 GeV polarized electron beam was scattered off a cryogenic hydrogen target. The recoil proton was detected in the left HRS in coincidence with the elasticly scattered electrons tagged by the BigBite spectrometer. The proton polarization was measured by the focal plane polarimeter (FPP). In this low Q2 region, previous measurement from Jefferson Lab Hall A (LEDEX) along with various fits and calculations indicate substantial deviations of the ratio from unity. For this new measurement, the proposed statistical uncertainty (< 1%) was achieved. These new results are a few percent lower than expected from previous world data and fits, which indicate a smaller GEp at this region. Beyond the intrinsic interest in nucleon structure, the new results also have implications in determining the proton Zemach radius and the strangeness form factors from parity violation experiments.

  1. High-precision measurement of the proton elastic form factor ratio μpGE/GM at low Q2

    DOE PAGES

    Zhan, X.; Allada, K.; Armstrong, D. S.; ...

    2011-10-06

    Here, we report a new high precision measurement of the proton elastic form factor ratio μpGE/GM for the four-momentum transfer squared Q2 = 0.3-0.7 (GeV/c)2. The measurement was performed at Jefferson Lab (JLab) in Hall A using recoil polarimetry. With the achieved ~1% total uncertainty, the new data clearly show that the deviation of the ratio μpGE/GM from unity observed in previous polarization measurements at high Q2 continues down to the lowest Q2 value of this measurement. The updated global fit that includes the new results yields in this Q2 range an electric (magnetic) form factor ~2% smaller (~1% larger)more » than the previous global fit. We obtain new extractions of the proton electric and magnetic radii, which are (rE2)1/2 = 0.875 ± 0.010 fm and (rM2)1/2 = 0.867 ± 0.020 fm. Moreover, the charge radius is consistent with other recent extractions based on the electron-proton interaction, including the atomic hydrogen Lamb shift measruements, which suggests a missing correction in the comparison of measurements of the proton charge radius using electron probes and the recent extraction from the muonic hydrogen Lamb shift.« less

  2. Proton Form Factor Puzzle and the CEBAF Large Acceptance Spectrometer (CLAS) Two-Photon Exchange Experiment

    SciTech Connect

    Rimal, Dipak

    2014-05-01

    The electromagnetic form factors are the most fundamental observables that encode information about the internal structure of the nucleon. This dissertation explored dependence of R on kinematic variables such as squared four-momentum transfer (Q2) and the virtual photon polarization parameter (ε).

  3. New Measurement of Parity Violation in Elastic Electron-Proton Scattering and Implications for Strange Form Factors

    SciTech Connect

    Konrad Aniol; David Armstrong; Todd Averett; Maud Baylac; Etienne Burtin; John Calarco; Gordon Cates; Christian Cavata; Zhengwei Chai; C. Chang; Jian-Ping Chen; Eugene Chudakov; Evaristo Cisbani; Marius Coman; Daniel Dale; Alexandre Deur; Pibero Djawotho; Martin Epstein; Stephanie Escoffier; Lars Ewell; Nicolas Falletto; John Finn; A. Fleck; Bernard Frois; Salvatore Frullani; Juncai Gao; Franco Garibaldi; Ashot Gasparian; G. M. Gerstner; Ronald Gilman; Oleksandr Glamazdin; Javier Gomez; Viktor Gorbenko; Jens-ole Hansen; F. Hersman; Douglas Higinbotham; Richard Holmes; Maurik Holtrop; Thomas Humensky; Sebastien Incerti; Mauro Iodice; Cornelis De Jager; Johann Jardillier; Xiaodong Jiang; Mark Jones; J. Jorda; Christophe Jutier; W. Kahl; James Kelly; Donghee Kim; M. -J. Kim; Minsuk Kim; Ioannis Kominis; Edgar Kooijman; Kevin Kramer; Krishna Kumar; Michael Kuss; John LeRose; Raffaele De Leo; M. Leuschner; David Lhuillier; Meihua Liang; Nilanga Liyanage; R. Lourie; Richard Madey; Sergey Malov; Demetrius Margaziotis; Frederic Marie; Pete Markowitz; Jacques Martino; Peter Mastromarino; Kathy McCormick; Justin McIntyre; Zein-Eddine Meziani; Robert Michaels; Brian Milbrath; Gerald Miller; Joseph Mitchell; Ludyvine Morand; Damien Neyret; Gerassimos Petratos; Roman Pomatsalyuk; John Price; David Prout; Thierry Pussieux; Gilles Quemener; Ronald Ransome; David Relyea; Yves Roblin; Julie Roche; Gary Rutledge; Paul Rutt; Marat Rvachev; Franck Sabatie; Arunava Saha; Paul Souder; Marcus Spradlin; Steffen Strauch; Riad Suleiman; Jeffrey Templon; T. Teresawa; James Thompson; Raphael Tieulent; Luminita Todor; Baris Tonguc; Paul Ulmer; Guido Urciuoli; Branislav Vlahovic; Krishni Wijesooriya; R. Wilson; Bogdan Wojtsekhowski; Rhett Woo; Wang Xu; Imran Younus; C. Zhang

    2001-06-01

    We have measured the parity-violating electroweak asymmetry in the elastic scattering of polarized electrons from the proton. The result is A = -15.05 +- 0.98(stat) {+-} 0.56(syst) ppm at the kinematic point theta{sub lab} = 12.3 degrees and Q{sup 2} = 0.477 (GeV/c){sup 2}. The measurement implies that the value for the strange form factor (G{sub E}{sup s} + 0.392 G{sub M}{sup s})/(G{sub M}{sup p} {mu}{sub p}) = 0.069 +- 0.056 +- 0.039, where the first error is experimental and the second arises from the uncertainties in electromagnetic form factors. This measurement is the first fixed-target parity violation experiment that used either a ''strained'' GaAs photocathode to produce highly polarized electrons or a Compton polarimeter to continuously monitor the electron beam polarization.

  4. Parity-Violating Electron Deuteron Scattering and the Proton's Neutral Weak Axial Vector Form Factor

    SciTech Connect

    Ito, Takeyasu; Averett, Todd; Barkhuff, David; Batigne, Guillaume; Beck, Douglas; Beise, Elizabeth; Blake, A.; Breuer, Herbert; Carr, Robert; Clasie, Benjamin; Covrig, Silviu; Danagoulian, Areg; Dodson, George; Dow, Karen; Dutta, Dipangkar; Farkhondeh, Manouchehr; Filippone, Bradley; FRANKLIN, W.; Furget, Christophe; Gao, Haiyan; Gao, Juncai; Gustafsson, Kenneth; Hannelius, Lars; Hasty, R.; Allen, Alice; Herda, M.C.; Jones, CE; King, Paul; Korsch, Wolfgang; Kowalski, Stanley; Kox, Serge; Kramer, Kevin; Lee, P.; Liu, Jinghua; Martin, Jeffery; McKeown, Robert; Mueller, B.; Pitt, Mark; Plaster, Bradley; Quemener, Gilles; Real, Jean-Sebastien; Ritter, J.; Roche, Julie; Savu, V.; Schiavilla, Rocco; Seely, Charles; Spayde, Damon; Suleiman, Riad; Taylor, S.; Tieulent, Raphael; Tipton, Bryan; Tsentalovich, E.; Wells, Steven; Yang, Bin; Yuan, Jing; Yun, Junho; Zwart, Townsend

    2004-03-01

    We report on a new measurement of the parity-violating asymmetry in quasielastic electron scattering from the deuteron at backward angles at Q2 = 0.038 (GeV/c)2. This quantity provides a determination of the neutral weak axial vector form factor of the nucleon, which can potentially receive large electroweak corrections. The measured asymmetry A = z3.51±0.57 (stat)±0.58 (syst) ppm is consistent with theoretical predictions. We also report on updated results of the previous experiment at Q2 = 0.091 (GeV/c)2, which are also consistent with theoretical predictions.

  5. Feasibility studies of the time-like proton electromagnetic form factor measurements with overline{{P}}ANDA at FAIR

    NASA Astrophysics Data System (ADS)

    Sudoł, M.; Mora Espí, M. C.; Becheva, E.; Boucher, J.; Hennino, T.; Kunne, R.; Marchand, D.; Ong, S.; Ramstein, B.; van de Wiele, J.; Zerguerras, T.; Maas, F.; Kopf, B.; Pelizaeus, M.; Steinke, M.; Zhong, J.; Tomasi-Gustafsson, E.

    2010-06-01

    The possibility of measuring the proton electromagnetic form factors in the time-like region at FAIR with the overline{{P}}ANDA detector is discussed. Detailed simulations on signal efficiency for the annihilation of bar{{p}} + p into a lepton pair as well as for the most important background channels have been performed. It is shown that precise measurements of the differential cross-section of the reaction bar{{p}} + p rightarrow e - + e + can be obtained in a wide kinematical range. The determination of the ratio R of the moduli of the electric and magnetic proton form factors will be possible up to a value of momentum transfer squared of q 2 ≃ 14 (GeV/ c)^2 with absolute precision from 0.01 to 0.5 (for R ˜ 1 . The total bar{{p}} + p rightarrow e - + e + cross-section will be measured up to q 2 ≃ 28 (GeV/ c)^2. The results obtained from simulated events are compared to the existing data. Sensitivity to the two-photon exchange mechanism is also investigated.

  6. Meson exchange effects in elastic ep scattering at loop level and the electromagnetic form factors of the proton

    NASA Astrophysics Data System (ADS)

    Chen, Hong-Yu; Zhou, Hai-Qing

    2014-10-01

    A new form of two-photon exchange (TPE) effect is studied to explain the discrepancy between unpolarized and polarized experimental data in elastic ep scattering. The mechanism is based on a simple idea that apart from the usual TPE effects from box and crossed-box diagrams, the mesons may also be exchanged in elastic ep scattering by two-photon coupling at loop level. The detailed study shows such contributions to reduced unpolarized cross section (σun) and polarized observables (Pt,Pl) at fixed Q2 are only dependent on proton's electromagnetic form factors GE ,M and a new unknown universal parameter g. After combining this contribution with the usual TPE contributions from box and crossed-box diagrams, the ratio μpGE/GM extracted from the recent precise unpolarized and polarized experimental data can be described consistently.

  7. Recoil Polarization Measurements of the Proton Electromagnetic Form Factor Ratio to Q{sup 2}=8.5 GeV{sup 2}

    SciTech Connect

    Puckett, A. J. R.; Bertozzi, W.; Gilad, S.; Huang, J.; Moffit, B.; Zhu, L.; Brash, E. J.; Jones, M. K.; Bosted, P.; Covrig, S.; Ent, R.; Fenker, H.; Gaskell, D.; Higinbotham, D. W.; Horn, T.; Meekins, D.; Smith, G.; Wojtsekhowski, B. B.; Wood, S.; Luo, W.

    2010-06-18

    Among the most fundamental observables of nucleon structure, electromagnetic form factors are a crucial benchmark for modern calculations describing the strong interaction dynamics of the nucleon's quark constituents; indeed, recent proton data have attracted intense theoretical interest. In this Letter, we report new measurements of the proton electromagnetic form factor ratio using the recoil polarization method, at momentum transfers Q{sup 2}=5.2, 6.7, and 8.5 GeV{sup 2}. By extending the range of Q{sup 2} for which G{sub E}{sup p} is accurately determined by more than 50%, these measurements will provide significant constraints on models of nucleon structure in the nonperturbative regime.

  8. Precision Measurement of the proton neutral weak form factors at Q2 ~ 0.1 GeV2

    SciTech Connect

    Kaufman, Lisa J.

    2007-02-01

    This thesis reports the HAPPEX measurement of the parity-violating asymmetry for longitudinally polarized electrons elastically scattered from protons in a liquid hydrogen target. The measurement was carried out in Hall A at Thomas Jefferson National Accelerator Facility using a beam energy E = 3 GeV and scattering angle <θ{sub lab}> = 6°. The asymmetry is sensitive to the weak neutral form factors from which we extract the strange quark electric and magnetic form factors (G$s\\atop{E}$ and G$s\\atop{M}$) of the proton. The measurement was conducted during two data-taking periods in 2004 and 2005. This thesis describes the methods for controlling the helicity-correlated beam asymmetries and the analysis of the raw asymmetry. The parity-violating asymmetry has been measured to be APV = -1.14± 0.24 (stat)±0.06 (syst) ppm at 2> = 0.099 GeV2 (2004), and APV = -1.58±0.12 (stat)±0.04 (syst) ppm at 2> = 0.109 GeV2 (2005). The strange quark form factors extracted from the asymmetry are G$s\\atop{E}$ + 0.080G$s\\atop{M}$ = 0.030 ± 0.025 (stat) ± 0.006 (syst) ± 0.012 (FF) (2004) and G$s\\atop{E}$ +0.088G$s\\atop{M}$ = 0.007±0.011 (stat)±0.004 (syst)±0.005 (FF) (2005). These results place the most precise constraints on the strange quark form factors and indicate little strange dynamics in the proton.

  9. Nucleon Electromagnetic Form Factors

    SciTech Connect

    Marc Vanderhaeghen; Charles Perdrisat; Vina Punjabi

    2007-10-01

    There has been much activity in the measurement of the elastic electromagnetic proton and neutron form factors in the last decade, and the quality of the data has greatly improved by performing double polarization experiments, in comparison with previous unpolarized data. Here we review the experimental data base in view of the new results for the proton, and neutron, obtained at JLab, MAMI, and MIT-Bates. The rapid evolution of phenomenological models triggered by these high-precision experiments will be discussed, including the recent progress in the determination of the valence quark generalized parton distributions of the nucleon, as well as the steady rate of improvements made in the lattice QCD calculations.

  10. Nucleon Electromagnetic Form Factors

    SciTech Connect

    Kees de Jager

    2004-08-01

    Although nucleons account for nearly all the visible mass in the universe, they have a complicated structure that is still incompletely understood. The first indication that nucleons have an internal structure, was the measurement of the proton magnetic moment by Frisch and Stern (1933) which revealed a large deviation from the value expected for a point-like Dirac particle. The investigation of the spatial structure of the nucleon, resulting in the first quantitative measurement of the proton charge radius, was initiated by the HEPL (Stanford) experiments in the 1950s, for which Hofstadter was awarded the 1961 Nobel prize. The first indication of a non-zero neutron charge distribution was obtained by scattering thermal neutrons off atomic electrons. The recent revival of its experimental study through the operational implementation of novel instrumentation has instigated a strong theoretical interest. Nucleon electro-magnetic form factors (EMFFs) are optimally studied through the exchange of a virtual photon, in elastic electron-nucleon scattering. The momentum transferred to the nucleon by the virtual photon can be selected to probe different scales of the nucleon, from integral properties such as the charge radius to scaling properties of its internal constituents. Polarization instrumentation, polarized beams and targets, and the measurement of the polarization of the recoiling nucleon have been essential in the accurate separation of the charge and magnetic form factors and in studies of the elusive neutron charge form factor.

  11. Proton elastic form factor ratios to Q{sup 2} = 3.5 GeV{sup 2} by polarization transfer

    SciTech Connect

    V. Punjabi; C.F. Perdrisat; et al

    2005-01-01

    The ratio of the proton elastic electromagnetic form factors, G{sub E{sub p}}/G{sub M{sub p}}, was obtained by measuring P{sub t} and P{sub {ell}}, the transverse and longitudinal recoil proton polarization components, respectively, for the elastic {rvec e}p {yields} e{rvec p} reaction in the four-momentum transfer squared range of 0.5 to 3.5 GeV{sup 2}. In the single-photon exchange approximation, the ratio G{sub E{sub p}}/G{sub M{sub p}} is directly proportional to the ratio P{sub t}/P{sub {ell}}. The simultaneous measurement of P{sub t} and P{sub {ell}} in a polarimeter reduces systematic uncertainties. The results for the ratio G{sub E{sub p}}/G{sub M{sub p}} show a systematic decrease with increasing Q{sup 2}, indicating for the first time a definite difference in the distribution of charge and magnetization in the proton. The data have been re-analyzed and systematic uncertainties have become significantly smaller than previously published results.

  12. Proton elastic form factor ratios to Q{sup 2}=3.5 GeV{sup 2} by polarization transfer

    SciTech Connect

    Punjabi, V.; Perdrisat, C.F.; Gerstner, G.; Pentchev, L.; Rutledge, G.; Strauch, S.; Wijesooriya, K.; Aniol, K.A.; Epstein, M.B.; Margaziotis, D.J.; Baker, F.T.; Templon, J.A.; Berthot, J.; Bertin, P.Y.; Besson, A.; Fonvieille, H.; Jaminion, S.; Laveissiere, G.

    2005-05-01

    The ratio of the proton elastic electromagnetic form factors, G{sub Ep}/G{sub Mp}, was obtained by measuring P{sub t} and P{sub l}, the transverse and longitudinal recoil proton polarization components, respectively, for the elastic e{sup {yields}}p{yields}ep{sup {yields}}reaction in the four-momentum transfer squared range of 0.5 to 3.5 GeV{sup 2}. In the single-photon exchange approximation, G{sub Ep}/G{sub Mp} is directly proportional to P{sub t}/P{sub l}. The simultaneous measurement of P{sub t} and P{sub l} in a polarimeter reduces systematic uncertainties. The results for G{sub Ep}/G{sub Mp} show a systematic decrease with increasing Q{sup 2}, indicating for the first time a definite difference in the distribution of charge and magnetization in the proton. The data have been reanalyzed and their systematic uncertainties have become significantly smaller than those reported previously.

  13. Proton form factor ratio, μpGEP/GMP from double spin asymmetry

    SciTech Connect

    Habarakada Liyanage, Anusha Pushpakumari

    2013-08-01

    The form factors are fundamental properties of the nucleon representing the effect of its structure on its response to electromagnetic probes such as electrons. They are functions of the four-momentum transfer squared Q2 between the electron and the proton. This thesis reports the results of a new measurement of the ratio of the electric and magnetic form factors of the proton up to Q2 = 5.66 (GeV/c)2 using the double spin asymmetry with a polarized beam and target. Experiment E07-003 (SANE, Spin Asymmetries of the Nucleon Experiment) was carried out in Hall C at Jefferson Lab in 2009 to study the proton spin structure functions with a dynamically polarized ammonia target and longitudinally polarized electron beam. By detecting elastically scattered protons in the High-Momentum Spectrometer (HMS) in coincidence with the electrons in the Big Electron Telescope Array (BETA), elastic measurements were carried out in parallel. The elastic double spin asymmetry allows one to extract the proton electric to magnetic form factor ratio GpE/GpM at high-momentum transfer, Q2= 5.66 (GeV/c)2. In addition to the coincidence data, inclusively scattered electrons from the polarized ammonia target were detected by HMS, which allows to measure the beam-target asymmetry in the elastic region with the target spin nearly perpendicular to the momentum transfer, and to extract GpE/GpM at low Q2= 2.06 (GeV/c)2. This alternative measurement of GpE/GpM has verified and confirmed the dramatic discrepancy at high Q2 between the Rosenbluth and the recoil-polarization-transfer iv method with a different measurement technique and systematic uncertainties uncorrelated to those of the recoil-polarization measurements. The measurement of the form factor ratio at Q2 = 2

  14. Final analysis of proton form factor ratio data at Q2 = 4.0, 4.8, and 5.6 GeV2

    DOE PAGES

    Puckett, A. J. R.; Brash, E. J.; Gayou, O.; ...

    2012-04-11

    Recently published measurements of the proton electromagnetic form factor ratio R = μp GEp/GMp at momentum transfers Q2 up to 8.5 GeV2 in Jefferson Lab Hall C deviate from the linear trend of previous measurements in Jefferson Lab Hall A, favoring a slower rate of decrease of R with Q2. While statistically compatible in the region of overlap with Hall A, the Hall C data hint at a systematic difference between the two experiments. This possibility was investigated in a reanalysis of the Hall A data. We find that the original analysis underestimated the background in the selection of elasticmore » events. The application of an additional cut to further suppress the background increases the results for R, improving the consistency between Halls A and C.« less

  15. The form factors of the nucleons

    NASA Astrophysics Data System (ADS)

    Perdrisat, C. F.

    2013-11-01

    There has been much activity in the measurement of the elastic electromagnetic proton and neutron form factors in the last decade, and the quality of the data has been greatly improved by performing double-polarization experiments, in comparison with with previous unpolarized cross section data. Here we will review the experimental data base in view of the new results for the proton and the neutron, obtained at MIT-Bates, JLab and MAMI. The rapid evolution of phenomenological models triggered by these high-precision experiments will be discussed. In particular, the possibility that the proton is non-spherical in its ground state, and that the transverse charge density are model independently defined in the infinite momentum frame. Likewise, flavor decomposition of the nucleon form factors into dressed u and d quark form factors, may give information about the quark-diquark structure of the nucleon. The current proton radius "crisis" will also be discussed.

  16. The Form Factors of the Nucleons

    SciTech Connect

    Perdrisat, Charles F.

    2013-11-01

    There has been much activity in the measurement of the elastic electromagnetic proton and neutron form factors in the last decade, and the quality of the data has been greatly improved by performing double-polarization experiments, in comparison with with pre-vious unpolarized cross section data. Here we will review the experimental data base in view of the new results for the proton and the neutron, obtained at MIT-Bates, JLab and MAMI. The rapid evolution of phenomenological models triggered by these high- precision experiments will be discussed. In particular, the possibility that the proton is non-spherical in its ground state, and that the transverse charge density are model in- dependently defined in the infinite momentum frame. Likewise, flavor decomposition of the nucleon form factors into dressed u and d quark form factors, may give information about the quark-diquark structure of the nucleon. The current proton radius "crisis" will also be discussed.

  17. Measurement of the proton form factors ratio GE/GM to Q2 = 5.6 GeV2 by recoil polarimetry

    SciTech Connect

    Gayou, Olivier

    2002-01-01

    In this thesis, we present the results of the experiment E99-007, which measured the ratio of the electric to magnetic form factors of the proton to the four momentum transfer square Q2 = 5.6 GeV2, by recoil polarimetry. Data were taken in 2000 at the Thomas Jefferson National Accelerator Facility in Virginia, USA. A 4.6 GeV polarized electron beam was scattered off a cryogenic hydrogen target. The polarization of the recoil proton was measured in the Focal Plane Polarimeter, located after one of the two High Resolution Spectrometers in the hall. The ratio of the transverse to longitudinal components of the recoil proton polarization is proportional to the ratio of the form factors. Elastic events were selected by detecting the scattered electron in a large acceptance lead-glass calorimeter. The main result of this experiment is the linear decrease of the form factor ratio with increasing Q2, corresponding to different spatial distributions of the electric charge and the magnetization. Numerous theoretical calculations show that relativistic effects, such as mixing of spin states due to Lorentz boosts, are important to account for the observed data in this critical intermediate kinematic region.

  18. Electromagnetic nucleon form factors

    SciTech Connect

    Bender, A.; Roberts, C.D.; Frank, M.R.

    1995-08-01

    The Dyson-Schwinger equation framework is employed to obtain expressions for the electromagnetic nucleon form factor. In generalized impulse approximation the form factor depends on the dressed quark propagator, the dressed quark-photon vertex, which is crucial to ensuring current conservation, and the nucleon Faddeev amplitude. The approach manifestly incorporates the large space-like-q{sup 2} renormalization group properties of QCD and allows a realistic extrapolation to small space-like-q{sup 2}. This extrapolation allows one to relate experimental data to the form of the quark-quark interaction at small space-like-q{sup 2}, which is presently unknown. The approach provides a means of unifying, within a single framework, the treatment of the perturbative and nonperturbative regimes of QCD. The wealth of experimental nucleon form factor data, over a large range of q{sup 2}, ensures that this application will provide an excellent environment to test, improve and extend our approach.

  19. Nucleon Form Factors - A Jefferson Lab Perspective

    SciTech Connect

    John Arrington, Kees de Jager, Charles F. Perdrisat

    2011-06-01

    The charge and magnetization distributions of the proton and neutron are encoded in their elastic electromagnetic form factors, which can be measured in elastic electron--nucleon scattering. By measuring the form factors, we probe the spatial distribution of the proton charge and magnetization, providing the most direct connection to the spatial distribution of quarks inside the proton. For decades, the form factors were probed through measurements of unpolarized elastic electron scattering, but by the 1980s, progress slowed dramatically due to the intrinsic limitations of the unpolarized measurements. Early measurements at several laboratories demonstrated the feasibility and power of measurements using polarization degrees of freedom to probe the spatial structure of the nucleon. A program of polarization measurements at Jefferson Lab led to a renaissance in the field of study, and significant new insight into the structure of matter.

  20. Nucleon electromagnetic form factors

    SciTech Connect

    Kees de Jager

    2000-01-01

    A review of data on the nucleon electromagnetic form factors in the space-like region is presented. Recent results from experiments using polarized beams and polarized targets or nucleon recoil polarimeters have yielded a significant improvement on the precision of the data obtained with the traditional Rosenbluth separation. Future plans for extended measurements are outlined.

  1. Nucleon Magnetic Form Factors

    SciTech Connect

    Kees de Jager

    2001-12-01

    A review of data on the nucleon electromagnetic form factors in the space-like region is presented. Recent results from experiments using polarized beams and polarized targets or nucleon recoil polarimeters have yielded a significant improvement on the precision of the data obtained with the traditional Rosenbluth separation. Future plans for extended measurements are outlined.

  2. Nucleon Form Factors

    SciTech Connect

    Kees de Jager

    2002-10-01

    A review of data on the nucleon electro-weak form factors in the space-like region is presented. Recent results from experiments using polarized beams and either polarized targets or nucleon recoil polarimeters have yielded a significant improvement on the precision of the electromagnetic data obtained with the traditional Rosenbluth separation. An outlook is presented of planned experiments.

  3. Precision Rosenbluth Measurement of the Proton Elastic Electromagnetic Form Factors and Their Ratio at Q2=2.64, 3.20, and 4.10 GeV2

    SciTech Connect

    Qattan, Issam A.

    2005-12-01

    Due to the inconsistency in the results of the mupGEp/GMp ratio of the proton, as extracted from the Rosenbluth and recoil polarization techniques, high precision measurements of the e-p elastic scattering cross sections were made at Q2 = 2.64, 3.20, and 4.10 GeV2. Protons were detected, in contrast to previous measurements where the scattered electrons were detected, which dramatically decreased-dependent systematic uncertainties and corrections. A single spectrometer measured the scattered protons of interest while simultaneous measurements at Q2 = 0.5 GeV2 were carried out using another spectrometer which served as a luminosity monitor in order to remove any uncertainties due to beam charge and target density fluctuations. The absolute uncertainty in the measured cross sections is ~3% for both spectrometers and with relative uncertainties, random and slope, below 1% for the higher Q2 protons, and below 1% random and 6% slope for the monitor spectrometer. The extracted electric and magnetic form factors were determined to 4%-7% for GEp and 1.5% for GMp. The ratio mupGEp/GMp was determined to 4%-7% and showed mupGEp/GMp ~ 1.0. The results of this work are in agreement with the previous Rosenbluth data and inconsistent with high-Q2 recoil polarization results, implying a systematic difference between the two techniques.

  4. Analytic pion form factor

    NASA Astrophysics Data System (ADS)

    Lomon, Earle L.; Pacetti, Simone

    2016-09-01

    The pion electromagnetic form factor and two-pion production in electron-positron collisions are simultaneously fitted by a vector dominance model evolving to perturbative QCD at large momentum transfer. This model was previously successful in simultaneously fitting the nucleon electromagnetic form factors (spacelike region) and the electromagnetic production of nucleon-antinucleon pairs (timelike region). For this pion case dispersion relations are used to produce the analytic connection of the spacelike and timelike regions. The fit to all the data is good, especially for the newer sets of timelike data. The description of high-q2 data, in the timelike region, requires one more meson with ρ quantum numbers than listed in the 2014 Particle Data Group review.

  5. Electromagnetic pion form factor

    SciTech Connect

    Roberts, C.D.

    1995-08-01

    A phenomenological Dyson-Schwinger/Bethe-Salpeter equation approach to QCD, formalized in terms of a QCD-based model field theory, the Global Color-symmetry Model (GCM), was used to calculate the generalized impulse approximation contribution to the electromagnetic pion form factor at space-like q{sup 2} on the domain [0,10] GeV{sup 2}. In effective field theories this form factor is sometimes understood as simply being due to Vector Meson Dominance (VMD) but this does not allow for a simple connection with QCD where the VMD contribution is of higher order than that of the quark core. In the GCM the pion is treated as a composite bound state of a confined quark and antiquark interacting via the exchange of colored vector-bosons. A direct study of the quark core contribution is made, using a quark propagator that manifests the large space-like-q{sup 2} properties of QCD, parameterizes the infrared behavior and incorporates confinement. It is shown that the few parameters which characterize the infrared form of the quark propagator may be chosen so as to yield excellent agreement with the available data. In doing this one directly relates experimental observables to properties of QCD at small space-like-q{sup 2}. The incorporation of confinement eliminates endpoint and pinch singularities in the calculation of F{sub {pi}}(q{sup 2}). With asymptotic freedom manifest in the dressed quark propagator the calculation yields q{sup 4}F{sub {pi}}(q{sup 2}) = constant, up to [q{sup 2}]- corrections, for space-like-q{sup 2} {approx_gt} 35 GeV{sup 2}, which indicates that soft, nonperturbative contributions dominate the form factor at presently accessible q{sup 2}. This means that the often-used factorization Ansatz fails in this exclusive process. A paper describing this work was submitted for publication. In addition, these results formed the basis for an invited presentation at a workshop on chiral dynamics and will be published in the proceedings.

  6. Nucleon form factors '99

    SciTech Connect

    Kees de Jager; B. Pire

    1999-06-01

    The authors review recent progress in the experimental knowledge of and theoretical speculations about nucleon form factors, with special emphasis on the large Q{sup 2} region. There is now a long history of continuous progress in the understanding of electromagnetic form factors at large momentum transfer. After the pioneering works leading to the celebrated quark counting rules, the understanding of hard scattering exclusive processes has been solidly founded. A perturbative QCD subprocess is factorized from a wave function-like distribution amplitude {var_phi}(x{sub i},Q{sup 2}) (x{sub i} being the light cone fractions of momentum carried by valence quarks), the Q{sup 2} dependence of which is analyzed in the renormalization group approach. Although an asymptotic expression emerges from this analysis for the x dependence of the distribution, it was quickly understood that the evolution to the asymptotic Q{sub 2} is very slow and that indeed some non perturbative input is required to get reliable estimates of this distribution amplitude at measurable Q{sup 2}.

  7. Pion form factor

    SciTech Connect

    Ryong Ji, C.; Pang, A.; Szczepaniak, A.

    1994-04-01

    It is pointed out that the correct criterion to define the legal PQCD contribution to the exclusive processes in the lightcone perturbative expansion should be based on the large off-shellness of the lightcone energy in the intermediate states. In the lightcone perturbative QCD calculation of the pion form factor, the authors find that the legal PQCD contribution defined by the lightcone energy cut saturates in the smaller Q{sup 2} region compared to that defined by the gluon four-momentum square cut. This is due to the contribution by the highly off-energy-shell gluons in the end point regions of the phase space, indicating that the gluon four-momentum-square cut may have cut too much to define the legal PQCD.

  8. Survey of nucleon electromagnetic form factors

    SciTech Connect

    Perdrisat, Charles F.; Punjabi, Vina A.

    2011-09-20

    There has been much activity in the measurement of the elastic electromagnetic proton and neutron form factors in the last decade, and the quality of the data has been greatly improved by performing double polarization experiments, in compar- ison with previous unpolarized data. Here we review the experimental data base in view of the new results for the proton, and neutron, obtained at MIT-Bates, MAMI, and JLab. The rapid evolution of phenomenological models triggered by these high-precision experiments will be discussed.

  9. Elastic form factors at higher CEBAF energies

    SciTech Connect

    Petratos, G.G.

    1994-04-01

    The prospects for elastic scattering from few body systems with higher beam energies at CEBAF is presented. The deuteron and{sup 3}He elastic structure functions A(Q{sup 2}) can be measured at sufficiently high momentum transfers to study the transition between the conventional meson-nucleon and the constituent quark-gluon descriptions. Possible improvements in the proton magnetic form factor data are also presented.

  10. Final analysis of proton form factor ratio data at Q2 = 4.0, 4.8, and 5.6 GeV2

    SciTech Connect

    Puckett, A. J. R.; Brash, E. J.; Gayou, O.; Jones, M. K.; Pentchev, L.; Perdrisat, C. F.; Punjabi, V.; Aniol, K. A.; Averett, T.; Benmokhtar, F.; Bertozzi, W.; Bimbot, L.; Calarco, J. R.; Cavata, C.; Chai, Z.; Chang, C. -C.; Chang, T.; Chen, J. P.; Chudakov, E.; De Leo, R.; Dieterich, S.; Endres, R.; Epstein, M. B.; Escoffier, S.; Fissum, K. G.; Fonvieille, H.; Frullani, S.; Gao, J.; Garibaldi, F.; Gilad, S.; Gilman, R.; Glamazdin, A.; Glashausser, C.; Gomez, J.; Hansen, J. -O.; Higinbotham, D.; Huber, G. M.; Iodice, M.; de Jager, C. W.; Jiang, X.; Khandaker, M.; Kozlov, S.; Kramer, K. M.; Kumbartzki, G.; LeRose, J. J.; Lhuillier, D.; Lindgren, R. A.; Liyanage, N.; Lolos, G. J.; Margaziotis, D. J.; Marie, F.; Markowitz, P.; McCormick, K.; Michaels, R.; Milbrath, B. D.; Nanda, S. K.; Neyret, D.; Piskunov, N. M.; Ransome, R. D.; Raue, B. A.; Roché, R.; Rvachev, M.; Salgado, C.; Sirca, S.; Sitnik, I.; Strauch, S.; Todor, L.; Tomasi-Gustafsson, E.; Urciuoli, G. M.; Voskanyan, H.; Wijesooriya, K.; Wojtsekhowski, B. B.; Zheng, X.; Zhu, L.

    2012-04-11

    Recently published measurements of the proton electromagnetic form factor ratio R = μp GEp/GMp at momentum transfers Q2 up to 8.5 GeV2 in Jefferson Lab Hall C deviate from the linear trend of previous measurements in Jefferson Lab Hall A, favoring a slower rate of decrease of R with Q2. While statistically compatible in the region of overlap with Hall A, the Hall C data hint at a systematic difference between the two experiments. This possibility was investigated in a reanalysis of the Hall A data. We find that the original analysis underestimated the background in the selection of elastic events. The application of an additional cut to further suppress the background increases the results for R, improving the consistency between Halls A and C.

  11. Protonated Forms of Monoclinic Zirconia: A Theoretical Study

    SciTech Connect

    Mantz, Yves A.; Gemmen, Randall S.

    2010-05-06

    In various materials applications of zirconia, protonated forms of monoclinic zirconia may be formed, motivating their study within the framework of density-functional theory. Using the HCTH/120 exchange-correlation functional, the equations of state of yttria and of the three low-pressure zirconia polymorphs are computed, to verify our approach. Next, the favored charge state of a hydrogen atom in monoclinic zirconia is shown to be positive for all Fermilevel energies in the band gap, by the computation of defect formation energies.This result is consistent with a single previous theoretical prediction at midgap as well as muonium spectroscopy experiments. For the formally positively (+1e) charged system of a proton in monoclinic zirconia (with a homogeneous neutralizing background charge densityimplicitly included), modeled using up to a 3 x 3 x 3 arrangement of unit cells, different stable and metastable structures are identified. They are similar to those structures previously proposed for the neutral system of hydrogen-doedmonoclinic zirconia, at a similar level of theory. As predicted using the HCTH/120 functional, the lowest energy structure of the proton bonded to one of the two available oxygen atom types, O1, is favored by 0.39 eV compared to that of the proton bonded to O2. The rate of proton transfer between O1 ions is slower than that for hydrogen-dopedmonoclinic zirconia, whose transition-state structures may be lowered in energy by the extra electron.

  12. Study of Baryon Form Factor at BESIII

    NASA Astrophysics Data System (ADS)

    Zhang, Bingxin

    Using data samples collected with BESIII detector at BEPCII collider, we measure Born cross section of e+e- → pbar{p} at center of mass energies √{s} from 2232.4 to 3671.0 MeV. The effective electromagnetic form factor of the proton is deduced with assumption that electric and magnetic form factors are equal GE = GM . For e+e- → Λ bar{Λ }, the Born cross sections and effective form factors are measured at √{s} = 2.2324, 2.40, 2.80, and 3.08 GeV. It is the first time that e+e- → Λ bar{Λ } process is studied closed to Λ bar{Λ } production threshold, and measured cross section is much larger than phase space expectations, which suggests that something more is at play beyond expected phase space behavior.

  13. Hadronic form factors in kaon photoproduction

    SciTech Connect

    Syukurilla, L. Mart, T.

    2014-09-25

    We have revisited the effect of hadronic form factors in kaon photoproduction process by utilizing an isobaric model developed for kaon photoproduction off the proton. The model is able to reproduce the available experimental data nicely as well as to reveal the origin of the second peak in the total cross section, which was the main source of confusion for decades. Different from our previous study, in the present work we explore the possibility of using different hadronic form factors in each of the KΛN vertices. The use of different hadronic form factors, e.g. dipole, Gaussian, and generalized dipole, has been found to produce a more flexible isobar model, which can provide a significant improvement in the model.

  14. Probing non polar interstellar molecules through their protonated form: Detection of protonated cyanogen (NCCNH(+)).

    PubMed

    Agúndez, M; Cernicharo, J; de Vicente, P; Marcelino, N; Roueff, E; Fuente, A; Gerin, M; Guélin, M; Albo, C; Barcia, A; Barbas, L; Bolaño, R; Colomer, F; Diez, M C; Gallego, J D; Gómez-González, J; López-Fernández, I; López-Fernández, J A; López-Pérez, J A; Malo, I; Serna, J M; Tercero, F

    2015-07-01

    Cyanogen (NCCN) is the simplest member of the series of dicyanopolyynes. It has been hypothesized that this family of molecules can be important constituents of interstellar and circumstellar media, although the lack of a permanent electric dipole moment prevents its detection through radioastronomical techniques. Here we present the first solid evidence of the presence of cyanogen in interstellar clouds through the detection of its protonated form toward the cold dark clouds TMC-1 and L483. Protonated cyanogen (NCCNH(+)) has been identified through the J = 5 - 4 and J = 10 - 9 rotational transitions using the 40m radiotelescope of Yebes and the IRAM 30m telescope. We derive beam averaged column densities for NCCNH(+) of (8.6 ± 4.4) × 10(10) cm(-2) in TMC-1 and (3.9 ± 1.8) × 10(10) cm(-2) in L483, which translate to fairly low fractional abundances relative to H2, in the range (1-10) × 10(-12). The chemistry of protonated molecules in dark clouds is discussed, and it is found that, in general terms, the abundance ratio between the protonated and non protonated forms of a molecule increases with increasing proton affinity. Our chemical model predicts an abundance ratio NCCNH(+)/NCCN of ~ 10(-4), which implies that the abundance of cyanogen in dark clouds could be as high as (1-10) × 10(-8) relative to H2, i.e., comparable to that of other abundant nitriles such as HCN, HNC, and HC3N.

  15. Probing non polar interstellar molecules through their protonated form: Detection of protonated cyanogen (NCCNH+)★

    PubMed Central

    Agúndez, M.; Cernicharo, J.; de Vicente, P.; Marcelino, N.; Roueff, E.; Fuente, A.; Gerin, M.; Guélin, M.; Albo, C.; Barcia, A.; Barbas, L.; Bolaño, R.; Colomer, F.; Diez, M. C.; Gallego, J. D.; Gómez-González, J.; López-Fernández, I.; López-Fernández, J. A.; López-Pérez, J. A.; Malo, I.; Serna, J. M.; Tercero, F.

    2015-01-01

    Cyanogen (NCCN) is the simplest member of the series of dicyanopolyynes. It has been hypothesized that this family of molecules can be important constituents of interstellar and circumstellar media, although the lack of a permanent electric dipole moment prevents its detection through radioastronomical techniques. Here we present the first solid evidence of the presence of cyanogen in interstellar clouds through the detection of its protonated form toward the cold dark clouds TMC-1 and L483. Protonated cyanogen (NCCNH+) has been identified through the J = 5 – 4 and J = 10 – 9 rotational transitions using the 40m radiotelescope of Yebes and the IRAM 30m telescope. We derive beam averaged column densities for NCCNH+ of (8.6 ± 4.4) × 1010 cm−2 in TMC-1 and (3.9 ± 1.8) × 1010 cm−2 in L483, which translate to fairly low fractional abundances relative to H2, in the range (1-10) × 10−12. The chemistry of protonated molecules in dark clouds is discussed, and it is found that, in general terms, the abundance ratio between the protonated and non protonated forms of a molecule increases with increasing proton affinity. Our chemical model predicts an abundance ratio NCCNH+/NCCN of ~ 10−4, which implies that the abundance of cyanogen in dark clouds could be as high as (1-10) × 10−8 relative to H2, i.e., comparable to that of other abundant nitriles such as HCN, HNC, and HC3N. PMID:26543239

  16. The structure of the nucleon: Elastic electromagnetic form factors

    SciTech Connect

    Punjabi, V.; Perdrisat, C. F.; Jones, M. K.; Brash, E. J.; Carlson, C. E.

    2015-07-10

    Precise proton and neutron form factor measurements at Jefferson Lab, using spin observables, have recently made a significant contribution to the unraveling of the internal structure of the nucleon. Accurate experimental measurements of the nucleon form factors are a test-bed for understanding how the nucleon's static properties and dynamical behavior emerge from QCD, the theory of the strong interactions between quarks. There has been enormous theoretical progress, since the publication of the Jefferson Lab proton form factor ratio data, aiming at reevaluating the picture of the nucleon. We will review the experimental and theoretical developments in this field and discuss the outlook for the future.

  17. Extracting nucleon strange and anapole form factors from data

    SciTech Connect

    R.D. Young; J. Roche; R.D. Carlini; A.W. Thomas

    2006-04-14

    Using the complete world set of parity violating electron scattering data up to Q{sup 2} {approx} 0.3 GeV{sup 2}, we extract the current best determination of the strange electric and magnetic form factors of the proton, as well as the weak axial form factors of the proton and neutron at Q{sup 2} = 0.1 GeV{sup 2}. The results are consistent with state of the art calculations of all four form factors, with the latter including the anapole contribution.

  18. Flavor decomposition of the nucleon electromagnetic form factors at low Q2

    NASA Astrophysics Data System (ADS)

    Qattan, I. A.; Arrington, J.; Alsaad, A.

    2015-06-01

    Background: The spatial distribution of charge and magnetization within the proton is encoded in the elastic form factors. These have been precisely measured in elastic electron scattering, and the combination of proton and neutron form factors allows for the separation of the up- and down-quark contributions. Purpose: In this work, we extract the proton and neutron form factors from worldwide data with an emphasis on precise new data covering the low-momentum region, which is sensitive to the large-scale structure of the nucleon. From these, we separate the up- and down-quark contributions to the proton form factors. Method: We combine cross section and polarization measurements of elastic electron-proton scattering to separate the proton form factors and two-photon exchange (TPE) contributions. We combine the proton form factors with parametrization of the neutron form factor data and uncertainties to separate the up- and down-quark contributions to the proton's charge and magnetic form factors. Results: The extracted TPE corrections are compared to previous phenomenological extractions, TPE calculations, and direct measurements from the comparison of electron and positron scattering. The flavor-separated form factors are extracted and compared to models of the nucleon structure. Conclusions: With the inclusion of the precise new data, the extracted TPE contributions show a clear change of sign at low Q2, which is necessary to explain the high-Q2 form factor discrepancy while being consistent with the known Q2→0 limit. We find that the new Mainz data yield a significantly different result for the proton magnetic form factor and its flavor-separated contributions. We also observe that the rms radius of both the up- and down-quark distributions are smaller than the rms charge radius of the proton.

  19. Anion binding by protonated forms of the tripodal ligand tren.

    PubMed

    Bazzicalupi, Carla; Bencini, Andrea; Bianchi, Antonio; Danesi, Andrea; Giorgi, Claudia; Valtancoli, Barbara

    2009-03-16

    The interaction of the protonated forms of tris(2-aminoethyl)amine (tren) with NO(3)(-), SO(4)(2-), TsO(-), PO(4)(3-), P(2)O(7)(4-), and P(3)O(10)(5-) was studied by means of potentiometric and microcalorimetric measurements in a 0.10 M NMe(4)Cl aqueous solution at 298.1 +/- 0.1 K, affording stability constants and the relevant energetic terms DeltaH degrees and TDeltaS degrees of complexation. Thermodynamic data show that these anion complexation processes are mainly controlled by electrostatic forces, although hydrogen-bond interactions and solvation effects also contribute to complex stability, leading, in some cases, to special DeltaH degrees and TDeltaS degrees contributions. The crystal structures of [H(3)L][NO(3)](3) and [H(3)L][TsO](3) evidence a preferred tridentate coordination mode of the triprotonated ligands in the solid state. Accordingly, the H(3)L(3+) receptor binds a single oxygen atom of both NO(3)(-) and TsO(-) by means of its three protonated fingers, although in the crystal structure of [H(3)L][TsO](3), one conformer displaying bidentate coordination was also found. Modeling studies performed on the [H(3)L(NO(3))](2+) complex suggested that the tridentate binding mode is the preferred one in aqueous solution, while in the gas phase, a different complex conformation in which the receptor interacts with all three oxygen atoms of NO(3)(-) is more stable.

  20. Electromagnetic Form Factors of the Nucleon in Chiral Soliton Models

    NASA Astrophysics Data System (ADS)

    Holzwarth, Gottfried

    The ratio of electric to magnetic proton form factors {G_E^P}/{G_M^P} as measured in polarization transfer experiments shows a characteristic linear decrease with increasing momentum transfer Q2(< 10 (GeV/c)2). We present a simple argument how such a decrease arises naturally in chiral soliton models. For a detailed comparison of model results with experimentally determined form factors it is necessary to employ a boost from the soliton rest frame to the Breit frame. To enforce asymptotic counting rules for form factors, the model must be supplemented by suitably chosen interpolating powers n in the boost prescription. Within the minimal π-ϱ-ω soliton model, with the same n for both, electric and magnetic form factors, it is possible to obtain a very satisfactory fit to all available proton data for the magnetic form factor and to the recent polarization results for the ratio {G_E^P}/{G_M^P}. At the same time the small and very sensitive neutron electric form factor is reasonably well reproduced. The results show a systematic discrepancy with presently available data for the neutron magnetic form factor {G_M^n } for Q2 > 1 (GeV/c)2 for Q2 > 1 (GeV/c)2. We additionally comment on the possibility to extract information about the form factors in the time-like region and on two-photon exchange contributions to unpolarized elastic scattering which specifically arise in soliton models.

  1. The structure of the nucleon: Elastic electromagnetic form factors

    DOE PAGES

    Punjabi, V.; Perdrisat, C. F.; Jones, M. K.; ...

    2015-07-10

    Precise proton and neutron form factor measurements at Jefferson Lab, using spin observables, have recently made a significant contribution to the unraveling of the internal structure of the nucleon. Accurate experimental measurements of the nucleon form factors are a test-bed for understanding how the nucleon's static properties and dynamical behavior emerge from QCD, the theory of the strong interactions between quarks. There has been enormous theoretical progress, since the publication of the Jefferson Lab proton form factor ratio data, aiming at reevaluating the picture of the nucleon. We will review the experimental and theoretical developments in this field and discussmore » the outlook for the future.« less

  2. Measuring Form Factors and Structure Functions with CLAS

    SciTech Connect

    G.P. Gilfoyle

    2007-09-10

    The physics program at the Thomas Jefferson National Accelerator Facility includes a strong effort to measure form factors and structure functions to probe the structure of hadronic matter, reveal the nature of confinement, and develop an understanding of atomic nuclei using quark-gluon degrees of freedom. The CLAS detector is a large acceptance device occupying one of the end stations. We discuss here two programs that use CLAS; measuring the magnetic form factor of the neutron and the virtual photon asymmetry of the proton. The form factor has been measured with unprecedented kinematic coverage and precision up to Q2=4.7 GeV2 and is consistent within 5%-10% of the dipole parameterization. The proton virtual photon asymmetry has been measured across a wide range in Bjorken x. The data exceed the SU(6)-symmetric quark prediction and show evidence of a smooth approach to the scaling limit prescribed by perturbative QCD.

  3. Form factors from lattice QCD

    SciTech Connect

    Dru Renner

    2012-04-01

    Precision computation of hadronic physics with lattice QCD is becoming feasible. The last decade has seen precent-level calculations of many simple properties of mesons, and the last few years have seen calculations of baryon masses, including the nucleon mass, accurate to a few percent. As computational power increases and algorithms advance, the precise calculation of a variety of more demanding hadronic properties will become realistic. With this in mind, I discuss the current lattice QCD calculations of generalized parton distributions with an emphasis on the prospects for well-controlled calculations for these observables as well. I will do this by way of several examples: the pion and nucleon form factors and moments of the nucleon parton and generalized-parton distributions.

  4. Isomers and conformational barriers of gas phase nicotine, nornicotine and their protonated forms

    SciTech Connect

    Yoshida, Tomoki; Farone, William A.; Xantheas, Sotiris S.

    2014-07-17

    We report extensive conformational searches of the neutral nicotine, nornicotine and their protonated analogs that are based on ab-initio second order Møller-Plesset perturbation (MP2) electronic structure calculations. Initial searches were performed with the 6-31G(d,p) and the energetics of the most important structures were further refined from geometry optimizations with the aug-cc-pVTZ basis set. Based on the calculated free energies at T=298 K for the gas phase molecules, neutral nicotine has two dominant trans conformers, whereas neutral nornicotine is a mixture of several conformers. For nicotine, the protonation on both the pyridine and the pyrrolidine sites is energetically competitive, whereas nornicotine prefers protonation on the pyridine nitrogen. The protonated form of nicotine is mainly a mixture of two pyridine-protonated trans conformers and two pyrrolidine-protonated trans conformers, whereas the protonated form of nornicotine is a mixture of four pyridine-protonated trans conformers. Nornicotine is conformationally more flexible than nicotine, however it is less protonated at the biologically important pyrrolidine nitrogen site. The lowest energy isomers for each case were found to interconvert via low (< 6 kcal/mol) rotational barriers around the pyridine-pyrrolidine bond.

  5. Proton imaging of an electrostatic field structure formed in laser-produced counter-streaming plasmas

    NASA Astrophysics Data System (ADS)

    Morita, T.; Kugland, N. L.; Wan, W.; Crowston, R.; Drake, R. P.; Fiuza, F.; Gregori, G.; Huntington, C.; Ishikawa, T.; Koenig, M.; Kuranz, C.; Levy, M. C.; Martinez, D.; Meinecke, J.; Miniati, F.; Murphy, C. D.; Pelka, A.; Plechaty, C.; Presura, R.; Quirós, N.; Remington, B. A.; Reville, B.; Ross, J. S.; Ryutov, D. D.; Sakawa, Y.; Steele, L.; Takabe, H.; Yamaura, Y.; Woolsey, N.; Park, H.-S.

    2016-03-01

    We report the measurements of electrostatic field structures associated with an electrostatic shock formed in laser-produced counter-streaming plasmas with proton imaging. The thickness of the electrostatic structure is estimated from proton images with different proton kinetic energies from 4.7 MeV to 10.7 MeV. The width of the transition region is characterized by electron scale length in the laser-produced plasma, suggesting that the field structure is formed due to a collisionless electrostatic shock.

  6. Bonner Prize: The Elastic Form Factors of the Nucleon

    NASA Astrophysics Data System (ADS)

    Perdrisat, Charles F.

    2017-01-01

    A series of experiments initiated in 1998 at the then new Continuous Electron Beam Accelerator, or CEBAF in Newport News Virginia, resulted in unexpected results, changing significantly our understanding of the structure of the proton. These experiments used a relatively new technique to obtain the ratio of the two form factors of the proton, namely polarization. An intense beam of highly polarized electrons with energy up to 6 GeV was made to interact elastically with un-polarized protons in a hydrogen target. The polarization of the recoiling protons, with energies up to 5 GeV, was measured from a second interaction in a polarimeter consisting of blocs of graphite or CH2 and tracking wire chambers. The scattered electrons were detected in an electromagnetic lead-glass calorimeter, to select elastically scattered events. After a short introduction describing the path which brought me from the University of Geneva to the College of William and Mary in 1966, I will introduce the subject of elastic electron scattering, describe some of the apparatus required for such experiments, and show the results which were unexpected at the time. These results demonstrated unequivocally that the two form factors required to describe elastic ep scattering, electric GE and magnetic GM in the Born approximation, had a drastically different dependence upon the four-momentum squared q2 = q2 -ω2 with q the momentum, and ω the energy transferred in the reaction. The finding, in flagrant disagreement with the data available at the time, which had been obtained dominantly from cross section measurements of the type first used by Nobel Prize R. Hofstadter 60 years ago, have led to a reexamination of the information provided by form factors on the structure of the nucleon, in particular its quark-gluon content. The conclusion will then be a brief outline of several theoretical considerations to put the results in a proper perspective.

  7. Measurements of the elastic electromagnetic form factor ratio {mu}pGEp/GMp via polarization transfer

    SciTech Connect

    Olivier Gayou; Oleksandr Glamazdin; Andrei Afanasev; Arunava Saha; Brendan Fox; Bogdan Wojtsekhowski; C. Chang; Cathleen Jones; Charles Glashausser; Charles Perdrisat; D. Crovelli; Daniel Simon; David Meekins; Demetrius Margaziotis; Dipangkar Dutta; Edgar Kooijman; Elaine Schulte; Edward Brash; Edward Kinney; Eugene Chudakov; Feng Xiong; Franco Garibaldi; Garth Huber; Gerfried Kumbartzki; Guido Urciuoli; Haiyan Gao; Jordan Hovdebo; James Kelly; Javier Gomez; Jens-Ole Hansen; Jian-Ping Chen; John Calarco; John LeRose; Joseph Mitchell; Juncai Gao; Konrad Aniol; Kamal Benslama; Kathy McCormick; Cornelis De Jager; Cornelis de Jager; Kevin Fissum; Krishni Wijesooriya; Louis Bimbot; Ludyvine Morand; Luminita Todor; Moskov Amarian; Marat Rvachev; Mark Jones; Martin Epstein; Meihua Liang; Michael Kuss; Nilanga Liyanage; Adam Sarty; Paul Ulmer; Pete Markowitz; Peter Bosted; R. Holt; Riad Suleiman; Richard Lindgren; Rikki Roche; Robert Michaels; Roman Pomatsalyuk; Ronald Gilman; Ronald Ransome; Stephen Becher; Scott Dumalski; Salvatore Frullani; Seonho Choi; Sergey Malov; Sonja Dieterich; Steffen Strauch; Steve Churchwell; Ting Chang; Viktor Gorbenko; Vina Punjabi; Wang Xu; Xiangdong Ji; Zein-Eddine Meziani; Zhengwei Chai

    2001-09-01

    We present measurements of the ratio of the proton elastic electromagnetic form factors, {mu}pGEp/GMp. The Jefferson Lab Hall A Focal Plane Polarimeter was used to determine the longitudinal and transverse components of the recoil proton polarization in ep elastic scattering; the ratio of these polarization components is proportional to the ratio of the two form factors. These data reproduce the observation of Jones et al. [Phys. Rev. Lett. 84, 1398 (2000)], that the form factor ratio decreases significantly from unity above Q2 = 1 GeV2.

  8. Form factors in the radiative pion decay

    NASA Astrophysics Data System (ADS)

    Mateu, V.; Portolés, J.

    2007-10-01

    We perform an analysis of the form factors that rule the structure-dependent amplitude in radiative pion decay. The resonance contributions to π→eνeγ decays are computed through the proper construction of the vector and axial-vector form factors by setting the QCD driven asymptotic properties of the three-point Green functions and , and by demanding the smoothening of the form factors at high transfer of momentum. A comparison between theoretical and experimental determination of the form factors is also carried out. We also consider and evaluate the role played by a non-standard tensor form factor. We conclude that, at present and due to the hadronic uncertainties, the search for new physics in this process is not feasible.

  9. Future Perspectives on Baryon Form Factor Measurements with BES III

    NASA Astrophysics Data System (ADS)

    Schönning, Karin; Li, Cui

    2017-03-01

    The electromagnetic structure of hadrons, parameterised in terms of electromagnetic form factors, EMFF's, provide a key to the strong interaction. Nucleon EMFF's have been studied rigorously for more than 60 years but the new techniques and larger data samples available at modern facilities have given rise to a renewed interest for the field. Recently, the access to hyperon structure by hyperon time-like EMFF provides an additional dimension. The BEijing Spectrometer (BES III) at the Beijing Electron Positron Collider (BEPC-II) in China is the only running experiment where time-like baryon EMFF's can be studied in the e+e- → BB̅ reaction. The BES III detector is an excellent tool for baryon form factor measurements thanks to its near 4π coverage, precise tracking, PID and calorimetry. All hyperons in the SU(3) spin 1/2 octet and spin 3/2 decuplet are energetically accessible within the BEPC-II energy range. Recent data on proton and Λ hyperon form factors will be presented. Furthermore, a world-leading data sample was collected in 2014-2015 for precision measurements of baryon form factors. In particular, the data will enable a measurement of the relative phase between the electric and the magnetic form factors for Λ and Λc+ and hyperons. The modulus of the phase can be extracted from the hyperon polarisation, which in turn is experimentally accessible via the weak, parity violating decay. Furthermore, from the spin correlation between the outgoing hyperon and antihyperon, the sign of the phase can be extracted. This means that the time-like form factors can be completely determined for the first time. The methods will be outlined and the prospects of the BES III form factor measurements will be given. We will also present a planned upgrade of the BES III detector which is expected to improve future form factor measurements.

  10. Flavor Analysis of Nucleon, Δ , and Hyperon Electromagnetic Form Factors

    NASA Astrophysics Data System (ADS)

    Rohrmoser, Martin; Choi, Ki-Seok; Plessas, Willibald

    2017-03-01

    By the analysis of the world data base of elastic electron scattering on the proton and the neutron (for the latter, in fact, on ^2H and ^3He) important experimental insights have recently been gained into the flavor compositions of nucleon electromagnetic form factors. We report on testing the Graz Goldstone-boson-exchange relativistic constituent-quark model in comparison to the flavor contents in low-energy nucleons, as revealed from electron-scattering phenomenology. It is found that a satisfactory agreement is achieved between theory and experiment for momentum transfers up to Q^2˜ 4 GeV^2, relying on three-quark configurations only. Analogous studies have been extended to the Δ and the hyperon electromagnetic form factors. For them we here show only some sample results in comparison to data from lattice quantum chromodynamics.

  11. Electromagnetic Form Factors of Hadrons in Quantum Field Theories

    SciTech Connect

    Dominguez, C. A.

    2008-10-13

    In this talk, recent results are presented of calculations of electromagnetic form factors of hadrons in the framework of two quantum field theories (QFT), (a) Dual-Large N{sub c} QCD (Dual-QCD{sub {infinity}}) for the pion, proton, and {delta}(1236), and (b) the Kroll-Lee-Zumino (KLZ) fully renormalizable Abelian QFT for the pion form factor. Both theories provide a QFT platform to improve on naive (tree-level) Vector Meson Dominance (VMD). Dual-QCD{sub {infinity}} provides a tree-level improvement by incorporating an infinite number of zero-width resonances, which can be subsequently shifted from the real axis to account for the time-like behaviour of the form factors. The renormalizable KLZ model provides a QFT improvement of VMD in the framework of perturbation theory. Due to the relative mildness of the {rho}{pi}{pi} coupling, and the size of loop suppression factors, the perturbative expansion is well defined in spite of this being a strong coupling theory. Both approaches lead to considerable improvements of VMD predictions for electromagnetic form factors, in excellent agreement with data.

  12. Measurements of baryon form factors at BESIII

    NASA Astrophysics Data System (ADS)

    Li, Cui

    2016-08-01

    The momentum transfer dependence of the electromagnetic form factors is an important probe of the structure of hadrons at different scales. Using data samples collected with the BESIII detector at the BEPCII collider, we study the process of e+e- → pp¯ at 12 c.m. energies from 2232.4 to 3671.0 MeV. The Born cross section at these energy points are measured as well as the corresponding effective electromagnetic form factors. Furthermore, the ratio of electric to magnetic form factors, |GE/GM | and |GM | are measured at the c.m. energies where the data samples are the largest. We also report preliminary results of e+e- → ˄˄̅, which is analysed with the same method. Moreover, future prospects of the measurement of baryon electromagnetic form factors from a unique high luminosity data scan by BESIII, are given.

  13. Strangeness contributions to nucleon form factors

    SciTech Connect

    Ross Young

    2006-09-11

    We review a recent theoretical determination of the strange quark content of the electromagnetic form factors of the nucleon. These are compared with a global analysis of current experimental measurements in parity-violating electron scattering.

  14. Electromagnetic nucleon form factors in instant and point form

    SciTech Connect

    Melde, T.; Berger, K.; Plessas, W.; Wagenbrunn, R. F.; Canton, L.

    2007-10-01

    We present a study of the electromagnetic structure of the nucleons with constituent quark models in the framework of relativistic quantum mechanics. In particular, we address the construction of spectator-model currents in the instant and point forms. Corresponding results for the elastic nucleon electromagnetic form factors as well as charge radii and magnetic moments are presented. We also compare results obtained by different realistic nucleon wave functions stemming from alternative constituent quark models. Finally, we discuss the theoretical uncertainties that reside in the construction of spectator-model transition operators.

  15. Deuteron electromagnetic form factors with the light-front approach

    NASA Astrophysics Data System (ADS)

    Sun, Bao-dong; Dong, Yu-bing

    2017-01-01

    The electromagnetic form factors and low-energy observables of the deuteron are studied with the help of the light-front approach, where the deuteron is regarded as a weakly bound state of a proton and a neutron. Both the S and D wave interacting vertexes among the deuteron, proton, and neutron are taken into account. Moreover, the regularization functions are also introduced. In our calculations, the vertex and the regularization functions are employed to simulate the momentum distribution inside the deuteron. Our numerical results show that the light-front approach can roughly reproduce the deuteron electromagnetic form factors, like charge G 0, magnetic G 1, and quadrupole G 2, in the low Q 2 region. The important effect of the D wave vertex on G 2 is also addressed. Supported by National Natural Science Foundation of China (10975146, 11475192), The fund provided by the Sino-German CRC 110 “Symmetries and the Emergence of Structure in QCD" project is also appreciated, YBD thanks FAPESP grant 2011/11973-4 for funding his visit to ICTP-SAIFR

  16. Nanostructured proton conductors formed via in situ polymerization of ionic liquid crystals.

    PubMed

    Lu, Fei; Gao, Xinpei; Dong, Bin; Sun, Panpan; Sun, Nan; Xie, Shuting; Zheng, Liqiang

    2014-12-24

    Ionic liquid crystals (ILCs) with hexagonal and lamellar phases were successfully fabricated by the self-assembly of a polymerizable amphiphilic zwitterion, which is formed by 3-(1-vinyl-3-imidazolio)propanesulfonate (VIPS) and 4-dodecyl benzenesulfonic acid (DBSA) based on intermolecular electrostatic interactions. The microstructures and phase behaviors of ILCs were studied by polarized microscope (POM) and small-angle X-ray scattering (SAXS). The ILC topological structures can be considered as proton pathways and further fixed by photopolymerization to prepare nanostructured proton-conductive films. The introduction of highly ordered and well-defined ILC structures into these polymeric films radically improves the ionic conductivities.

  17. Form factor effects in the direct detection of isospin-violating dark matter

    SciTech Connect

    Zheng, Hao; Zhang, Zhen; Chen, Lie-Wen E-mail: malkuth@sjtu.edu.cn

    2014-08-01

    Isospin-violating dark matter (IVDM) provides a possible mechanism to ameliorate the tension among recent direct detection experiments. For IVDM, we demonstrate that the results of direct detection experiments based on neutron-rich target nuclei may depend strongly on the density dependence of the symmetry energy which is presently largely unknown and controls the neutron skin thickness that reflects the relative difference of neutron and proton form factors in the neutron-rich nuclei. In particular, using the neutron and proton form factors obtained from Skyrme-Hartree-Fock calculations by varying the symmetry energy within the uncertainty region set by the latest model-independent measurement of the neutron skin thickness of {sup 208}Pb from PREX experiment at JLab, we find that, for IVDM with neutron-to-proton coupling ratio fixed to f{sub n}/f{sub p}=-0.7, the form factor effect may enhance the sensitivity of Xe-based detectors (e.g., XENON100 and LUX) to the DM-proton cross section by a factor of 3 in the DM mass region constrained by CMDS-II(Si) and even by more than an order of magnitude for heavy DM with mass larger than 80 GeV, compared with the results using the empirical Helm form factor. Our results further indicate that the form factor effect can significantly modify the recoil spectrum of Xe-based detectors for heavy IVDM with f{sub n}/f{sub p}=-0.7.

  18. Form factor effects in the direct detection of isospin-violating dark matter

    NASA Astrophysics Data System (ADS)

    Zheng, Hao; Zhang, Zhen; Chen, Lie-Wen

    2014-08-01

    Isospin-violating dark matter (IVDM) provides a possible mechanism to ameliorate the tension among recent direct detection experiments. For IVDM, we demonstrate that the results of direct detection experiments based on neutron-rich target nuclei may depend strongly on the density dependence of the symmetry energy which is presently largely unknown and controls the neutron skin thickness that reflects the relative difference of neutron and proton form factors in the neutron-rich nuclei. In particular, using the neutron and proton form factors obtained from Skyrme-Hartree-Fock calculations by varying the symmetry energy within the uncertainty region set by the latest model-independent measurement of the neutron skin thickness of 208Pb from PREX experiment at JLab, we find that, for IVDM with neutron-to-proton coupling ratio fixed to fn/fp=-0.7, the form factor effect may enhance the sensitivity of Xe-based detectors (e.g., XENON100 and LUX) to the DM-proton cross section by a factor of 3 in the DM mass region constrained by CMDS-II(Si) and even by more than an order of magnitude for heavy DM with mass larger than 80 GeV, compared with the results using the empirical Helm form factor. Our results further indicate that the form factor effect can significantly modify the recoil spectrum of Xe-based detectors for heavy IVDM with fn/fp=-0.7.

  19. The form factors of the nucleons

    SciTech Connect

    Petratos, G.G.

    1993-12-01

    The study of the electromagnetic form factors of the nucleons are of fundamental importance in understanding nucleon structure. The form factors contain all the information about the deviation from pointlike structure of the charge and magnetization current distributions of the nucleons. The hope is that measurements at sufficiently large momentum transfers can provide a microscopic understanding of the nucleon wave functions in terms of their constituent quark amplitudes. Recent measurements of the electric G{sub E}(Q{sup 2}) and magnetic G{sub M}(Q{sup 2}) form factors of the nucleons are reviewed and compared to theoretical calculations based on non-perturbative QCD sum rules, diquark, relativistic constituent quark, and vector meson dominance (VMD) models. A short summary of ongoing and future measurements is also presented.

  20. Charm form factors in hadronic interactions

    SciTech Connect

    Bracco, M. E.; Navarra, F. S.; Nielsen, M.; Chiapparini, M.

    2010-12-28

    We calculate the form factors and the coupling constants in vertices with charm mesons, such as {rho}D*D*, in the framework of QCD sum rules. We first discuss the applications of these form factors in heavy ion collisions and in B decays. We then present an introduction to the method of QCD sum rules and describe how to work with the three-point function. We give special attention to the procedure employed to extrapolate results obtained in the deep euclidean region to the poles of the particles, located in the time-like region. Finally we present a table of ready-to-use parametrizations of all the form factors, which are relevant for the processes mentioned in the introduction. We also give the coupling constants.

  1. Form Factors and Radii of Light Nuclei

    SciTech Connect

    Sick, Ingo

    2015-09-15

    We discuss the determination of electromagnetic form factors from the world data on electron–nucleus scattering for nuclei Z ≤ 3, with particular emphasis on the derivation of the moments required for comparison with measurements from electronic/muonic atoms and isotope shifts.

  2. Meson-photon transition form factors

    SciTech Connect

    Balakireva, Irina; Lucha, Wolfgang; Melikhov, Dmitri

    2012-10-23

    We present the results of our recent analysis of the meson-photon transition form factors F{sub P{gamma}}(Q{sup 2}) for the pseudoscalar mesons P {pi}{sup 0},{eta},{eta} Prime ,{eta}{sub c}, using the local-duality version of QCD sum rules.

  3. Electromagnetic charged and neutral kaon form factors

    SciTech Connect

    Roberts, C.D.; Burden, C.J.; Thomson, M.J.

    1995-08-01

    The electromagnetic form factor of the charged and neutral kaon is calculated using the approach applied in the successful study of the pion form factor, described above. The charged kaon form factor will be measured in forthcoming experiments at CEBAF. Our calculation involves the dressed strange quark propagator, to which F{sub {pi}}(q{sup 2}) is not sensitive, and hence it provides us with constraints on the strange-quark sector of QCD. Our preliminary results are encouraging. We find that the strange and up/down quark propagators are not too different, once the change in the current-quark-mass is accounted for. However, the difference that remains is important since it allows {l_angle}{bar s}s{r_angle}<{l_angle}{bar u}u{r_angle}. This calculation is the first to yield a value of f{sub K}/f{sub {pi}} that is in good agreement with experiment and also yields r{sub K+}/r{sub {pi}} in good agreement with experiment. Our calculated charged kaon form factor provides a prediction that will be tested in the forthcoming CEBAF experiments. Our studies also show that K{sup 0} has a negative charge radius, as is to be expected. Our calculated value will be compared with that measured in K{sub s}{sup 0} regeneration from electrons.

  4. Nucleon and Deuteron Form Factors from BLAST

    SciTech Connect

    Hasell, D. K.

    2009-12-17

    The BLAST experiment was designed to study in a systematic manner the spin-dependent, electromagnetic interaction on hydrogen and deuterium. Measuring only asymmetries in electron scattering with respect to the beam helicity, target spin, or both; the BLAST experiment was able to extract information on nucleon and deuteron form factors independent of beam intensity or target density. By further forming 'super-ratios' of asymmetries, measurements were possible independent of beam and target polarization thus reducing uncertainties due to these quantities as well. Some of the form factor results from BLAST will be briefly presented here. Also, in response to observed discrepancies between polarization measurements and those obtained using traditional Rosenbluth separation techniques a proposed experiment, OLYMPUS, which will use the BLAST detector to measure the two photon contribution to elastic electron scattering will also be presented.

  5. Alpha-helical hydrophobic polypeptides form proton-selective channels in lipid bilayers

    NASA Technical Reports Server (NTRS)

    Oliver, A. E.; Deamer, D. W.

    1994-01-01

    Proton translocation is important in membrane-mediated processes such as ATP-dependent proton pumps, ATP synthesis, bacteriorhodopsin, and cytochrome oxidase function. The fundamental mechanism, however, is poorly understood. To test the theoretical possibility that bundles of hydrophobic alpha-helices could provide a low energy pathway for ion translocation through the lipid bilayer, polyamino acids were incorporated into extruded liposomes and planar lipid membranes, and proton translocation was measured. Liposomes with incorporated long-chain poly-L-alanine or poly-L-leucine were found to have proton permeability coefficients 5 to 7 times greater than control liposomes, whereas short-chain polyamino acids had relatively little effect. Potassium permeability was not increased markedly by any of the polyamino acids tested. Analytical thin layer chromatography measurements of lipid content and a fluorescamine assay for amino acids showed that there were approximately 135 polyleucine or 65 polyalanine molecules associated with each liposome. Fourier transform infrared spectroscopy indicated that a major fraction of the long-chain hydrophobic peptides existed in an alpha-helical conformation. Single-channel recording in both 0.1 N HCl and 0.1 M KCl was also used to determine whether proton-conducting channels formed in planar lipid membranes (phosphatidylcholine/phosphatidylethanolamine, 1:1). Poly-L-leucine and poly-L-alanine in HCl caused a 10- to 30-fold increase in frequency of conductive events compared to that seen in KCl or by the other polyamino acids in either solution. This finding correlates well with the liposome observations in which these two polyamino acids caused the largest increase in membrane proton permeability but had little effect on potassium permeability. Poly-L-leucine was considerably more conductive than poly-L-alanine due primarily to larger event amplitudes and, to a lesser extent, a higher event frequency. Poly-L-leucine caused two

  6. High duty factor plasma generator for CERN's Superconducting Proton Linac.

    PubMed

    Lettry, J; Kronberger, M; Scrivens, R; Chaudet, E; Faircloth, D; Favre, G; Geisser, J-M; Küchler, D; Mathot, S; Midttun, O; Paoluzzi, M; Schmitzer, C; Steyaert, D

    2010-02-01

    CERN's Linac4 is a 160 MeV linear accelerator currently under construction. It will inject negatively charged hydrogen ions into CERN's PS-Booster. Its ion source is a noncesiated rf driven H(-) volume source directly inspired from the one of DESY and is aimed to deliver pulses of 80 mA of H(-) during 0.4 ms at a 2 Hz repetition rate. The Superconducting Proton Linac (SPL) project is part of the luminosity upgrade of the Large Hadron Collider. It consists of an extension of Linac4 up to 5 GeV and is foreseen to deliver protons to a future 50 GeV synchrotron (PS2). For the SPL high power option (HP-SPL), the ion source would deliver pulses of 80 mA of H(-) during 1.2 ms and operate at a 50 Hz repetition rate. This significant upgrade motivates the design of the new water cooled plasma generator presented in this paper. Its engineering is based on the results of a finite element thermal study of the Linac4 H(-) plasma generator that identified critical components and thermal barriers. A cooling system is proposed which achieves the required heat dissipation and maintains the original functionality. Materials with higher thermal conductivity are selected and, wherever possible, thermal barriers resulting from low pressure contacts are removed by brazing metals on insulators. The AlN plasma chamber cooling circuit is inspired from the approach chosen for the cesiated high duty factor rf H(-) source operating at SNS.

  7. Proton transfer in guanine-cytosine radical anion embedded in B-form DNA.

    PubMed

    Chen, Hsing-Yin; Kao, Chai-Lin; Hsu, Sodio C N

    2009-11-04

    The electron-attachment-induced proton transfer in the guanine-cytosine (G:C) base pair is thought to be relevant to the issues of charge transport and radiation damage in DNA. However, our understanding on the reaction mainly comes from the data of isolated bases and base pairs, and the behavior of the reaction in the DNA duplex is not clear. In the present study, the proton-transfer reaction in reduced G:C stacks is investigated by quantum mechanical calculations with the aim to clarify how each environmental factor affects the proton transfer in G:C(*-). The calculations show that while the proton transfer in isolated G:C(*-) is exothermic with a small energetic barrier, it becomes endothermic with a considerably enhanced energetic barrier in G:C stacks. The substantial effect of G:C stacking is proved to originate from the electrostatic interactions between the dipole moments of outer G:C base pairs and the middle G:C(*-) base-pair radical anion; the extent of charge delocalization is very small and plays little role in affecting the proton transfer in G:C(*-). On the basis of the electrostatic model, the sequence dependence of the proton transfer in the ionized G:C base pair is predicted. In addition, the water molecules in the first hydration shell around G:C(*-) display a pronounced effect that facilitates the proton-transfer reaction; further consideration of bulk hydration only slightly lowers the energetic barrier and reaction energy. We also notice that the water arrangement around an embedded G:C(*-) is different from that around an isolated G:C(*-), which could result in a very different solvent effect on the energetics of the proton transfer. In contrast to the important influences of base stacking and hydration, the effects of sugar-phosphate backbone and counterions are found to be minor. Our calculations also reveal that a G:C base pair embedded in DNA is capable of accommodating two excess electrons only in bulk hydration; the resultant G(N1-H

  8. Baryon transition form factors at the pole

    NASA Astrophysics Data System (ADS)

    Tiator, L.; Döring, M.; Workman, R. L.; Hadžimehmedović, M.; Osmanović, H.; Omerović, R.; Stahov, J.; Švarc, A.

    2016-12-01

    Electromagnetic resonance properties are uniquely defined at the pole and do not depend on the separation of the resonance from background or the decay channel. Photon-nucleon branching ratios are nowadays often quoted at the pole, and we generalize the considerations to the case of virtual photons. We derive and compare relations for nucleon to baryon transition form factors both for the Breit-Wigner and the pole positions. Using the MAID2007 and SAID SM08 partial wave analyses of pion electroproduction data, we compare the GM, GE, and GC form factors for the Δ (1232 ) resonance excitation at the Breit-Wigner resonance and pole positions up to Q2=5 GeV2 . We also explore the E /M and S /M ratios as functions of Q2. For pole and residue extraction, we apply the Laurent + Pietarinen method.

  9. Baryon transition form factors at the pole

    SciTech Connect

    Tiator, L.; Döring, M.; Workman, R. L.; Hadžimehmedović, M.; Osmanović, H.; Omerović, R.; Stahov, J.; Švarc, A.

    2016-12-01

    Electromagnetic resonance properties are uniquely defined at the pole and do not depend on the separation of the resonance from background or the decay channel. Photon-nucleon branching ratios are nowadays often quoted at the pole, and we generalize the considerations to the case of virtual photons. We derive and compare relations for nucleon to baryon transition form factors both for the Breit-Wigner and the pole positions. Using the MAID2007 and SAID SM08 partial wave analyses of pion electroproduction data, we compare the $G_M$, $G_E$, and $G_C$ form factors for the $\\Delta(1232)$ resonance excitation at the Breit-Wigner resonance and pole positions up to $Q^2=5$ GeV$^2$. We also explore the $E/M$ and $S/M$ ratios as functions of $Q^2$. For pole and residue extraction, we apply the Laurent + Pietarinen method.

  10. Form factors for Russian doll droplet models

    NASA Astrophysics Data System (ADS)

    Wilemski, G.; Obeidat, A.; Hrahsheh, F.

    2013-05-01

    Molecular dynamics (MD) simulations of nanodroplets containing water and nonane show them to be nonspherical and strongly phase separated. A simple, but realistic model for these "Russian doll" structures is a spherical nonane lens that partially wets a spherical water droplet. This document contains an analytical calculation of the particle form factor P(q) needed to analyze experimental measurements of small angle neutron and x-ray scattering from aerosols of particles with this type of structure. In addition, an exact formulation of the particle form factor is developed for cylindrically symmetric droplets with otherwise arbitrary scattering length density functions. This result will be useful to calculate P(q) directly from MD simulation results. We compare results using both formulations and find excellent agreement between them.

  11. A new approach for Delta form factors

    SciTech Connect

    C. Aubin, K. Orginos

    2011-10-01

    We discuss a new approach to reducing excited state contributions from two- and three-point correlation functions in lattice simulations. For the purposes of this talk, we focus on the Delta(1232) resonance and discuss how this new method reduces excited state contamination from two-point functions and mention how this will be applied to three-point functions to extract hadronic form factors.

  12. Heavy to light baryon transition form factors

    SciTech Connect

    Guo, X. |; Huang, T. |; Li, Z.

    1996-05-01

    Recently, Stech found form factor relations for heavy to light transitions based on two simple dynamical assumptions for a spectator particle. In this paper we generalize his approach to the case of baryons and find that for {Lambda}{sub {ital Q}}{r_arrow}{Lambda} ({ital Q}={ital b} or {ital c}) only one independent form factor remains in the limit {ital m}{sub {ital Q}}{r_arrow}{infinity}. Furthermore, combining with the model of Guo and Kroll we determine both of the two form factors for {Lambda}{sub {ital Q}}{r_arrow}{Lambda} in the heavy quark limit. The results are applied to {Lambda}{sub {ital b}}{r_arrow}{Lambda}+{ital J}/{psi} which is not clarified both theoretically and experimentally. It is found that the branching ratio of {Lambda}{sub {ital b}}{r_arrow}{Lambda}+{ital J}/{psi} is of order 10{sup {minus}5}. {copyright} {ital 1996 The American Physical Society.}

  13. Recent Studies of Nucleon Electromagnetic Form Factors

    NASA Astrophysics Data System (ADS)

    Gilad, Shalev

    2010-08-01

    The electromagnetic form factors of nucleons are fundamental quantities in nucleon structure. As such, they have been studied extensively both theoretically and experimentally. Significant progress has been made with new measurements at Jlab, MAMI and MIT-Bates, with emphases on expanding the momentum-transfer range and on higher precision. In this paper, we describe the status of this field and present new results from measurements at both low and high momentum transfers. We also compare the experimental data to model predictions, and mention possible implications of the new results to other fields.

  14. Lattice Calculations of Nucleon Form Factors

    SciTech Connect

    Syritsyn, S. N.

    2011-10-24

    We present recent results of calculation of the isovector electromagnetic and axial form factors of the nucleon using lattice QCD with three different lattice actions and pion masses down to m{sub {pi}} > or approx. 300 MeV. Because of the precision of our high-statistics calculations, we can test predictions of baryon chiral perturbation theory for the charge and axial radii of the nucleon. We find that currently available baryon ChPT calculations disagree with our data, indicating that the corresponding effective theory approximations are not valid above m{sub {pi}{approx_equal}3}00 MeV.

  15. Neutron electric form factor via recoil polarimetry

    SciTech Connect

    Madey, Richard; Semenov, Andrei; Taylor, Simon; Aghalaryan, Aram; Crouse, Erick; MacLachlan, Glen; Plaster, Bradley; Tajima, Shigeyuki; Tireman, William; Yan, Chenyu; Ahmidouch, Abdellah; Anderson, Brian; Asaturyan, Razmik; Baker, O; Baldwin, Alan; Breuer, Herbert; Carlini, Roger; Christy, Michael; Churchwell, Steve; Cole, Leon; Danagoulian, Samuel; Day, Donal; Elaasar, Mostafa; Ent, Rolf; Farkhondeh, Manouchehr; Fenker, Howard; Finn, John; Gan, Liping; Garrow, Kenneth; Gueye, Paul; Howell, Calvin; Hu, Bitao; Jones, Mark; Kelly, James; Keppel, Cynthia; Khandaker, Mahbubul; Kim, Wooyoung; Kowalski, Stanley; Lung, Allison; Mack, David; Manley, D; Markowitz, Pete; Mitchell, Joseph; Mkrtchyan, Hamlet; Opper, Allena; Perdrisat, Charles; Punjabi, Vina; Raue, Brian; Reichelt, Tilmann; Reinhold, Joerg; Roche, Julie; Sato, Yoshinori; Seo, Wonick; Simicevic, Neven; Smith, Gregory; Stepanyan, Samuel; Tadevosyan, Vardan; Tang, Liguang; Ulmer, Paul; Vulcan, William; Watson, John; Wells, Steven; Wesselmann, Frank; Wood, Stephen; Yan, Chen; Yang, Seunghoon; Yuan, Lulin; Zhang, Wei-Ming; Zhu, Hong Guo; Zhu, Xiaofeng

    2003-05-01

    The ratio of the electric to the magnetic form factor of the neutron, G_En/G_Mn, was measured via recoil polarimetry from the quasielastic d({pol-e},e'{pol-n)p reaction at three values of Q^2 [viz., 0.45, 1.15 and 1.47 (GeV/c)^2] in Hall C of the Thomas Jefferson National Accelerator Facility. Preliminary data indicate that G_En follows the Galster parameterization up to Q^2 = 1.15 (GeV/c)^2 and appears to rise above the Galster parameterization at Q^2 = 1.47 (GeV/c)^2.

  16. Pion form factor from a contact interaction

    SciTech Connect

    Gutierrez-Guerrero, L. X.; Bashir, A.; Cloeet, I. C.; Roberts, C. D.

    2010-06-15

    In a Poincare-covariant vector-boson-exchange theory, the pion possesses components of pseudovector origin, which materially influence its observable properties. For a range of such quantities, we explore the consequences of a momentum-independent interaction, regularized in a symmetry-preserving manner. The contact interaction, while capable of describing pion static properties, produces a form factor whose evolution for Q{sup 2}>0.17 GeV{sup 2} disagrees markedly with experiment and whose asymptotic power-law behavior conflicts strongly with perturbative QCD.

  17. TCP transcription factors: architectures of plant form.

    PubMed

    Manassero, Nora G Uberti; Viola, Ivana L; Welchen, Elina; Gonzalez, Daniel H

    2013-04-01

    After its initial definition in 1999, the TCP family of transcription factors has become the focus of a multiplicity of studies related with plant development at the cellular, organ, and tissue levels. Evidence has accumulated indicating that TCP transcription factors are the main regulators of plant form and architecture and constitute a tool through which evolution shapes plant diversity. The TCP transcription factors act in a multiplicity of pathways related with cell proliferation and hormone responses. In recent years, the molecular pathways of TCP protein action and biochemical studies on their mode of interaction with DNA have begun to shed light on their mechanism of action. However, the available information is fragmented and a unifying view of TCP protein action is lacking, as well as detailed structural studies of the TCP-DNA complex. Also important, the possible role of TCP proteins as integrators of plant developmental responses to the environment has deserved little attention. In this review, we summarize the current knowledge about the structure and functions of TCP transcription factors and analyze future perspectives for the study of the role of these proteins and their use to modify plant development.

  18. Helium Compton Form Factor Measurements at CLAS

    SciTech Connect

    Voutier, Eric J.-M.

    2013-07-01

    The distribution of the parton content of nuclei, as encoded via the generalized parton distributions (GPDs), can be accessed via the deeply virtual Compton scattering (DVCS) process contributing to the cross section for leptoproduction of real photons. Similarly to the scattering of light by a material, DVCS provides information about the dynamics and the spatial structure of hadrons. The sensitivity of this process to the lepton beam polarization allows to single-out the DVCS amplitude in terms of Compton form factors that contain GPDs information. The beam spin asymmetry of the $^4$He($\\vec {\\mathrm e}$,e$' \\gamma ^4$He) process was measured in the experimental Hall B of the Jefferson Laboratory to extract the real and imaginary parts of the twist-2 Compton form factor of the $^4$He nucleus. The experimental results reported here demonstrate the relevance of this method for such a goal, and suggest the dominance of the Bethe-Heitler amplitude to the unpolarized process in the kinematic range explored by the experiment.

  19. Measurements of hadron form factors at BESIII

    NASA Astrophysics Data System (ADS)

    Morales, Cristina Morales

    2016-05-01

    BEPCII is a symmetric e+e--collider located in Beijing running at center-of-mass energies between 2.0 and 4.6 GeV. This energy range allows the BESIII-experiment to measure hadron form factors both from direct e+e--annihilation and from initial state radiation processes. In this paper, results on e+e- → p p ¯ based on data collected by BESIII in 2011 and 2012 are presented. We also present preliminary results on e+e- → Λ Λ ¯ based on the same data samples at 4 center-of-mass energies. BESIII results obtained from e+e- → π+π- using the initial state radiation technique at the center-of-mass energy of 3.773 GeV are also summarized. Finally, expectations on the measurement of baryon electromagnetic form factors from the BESIII high luminosity energy scan in 2015 and from initial state radiation processes at different center-of-mass energies are also explained.

  20. Electromagnetic Transition Form Factors of Nucleon Resonances

    SciTech Connect

    Burkert, Volker D.

    2008-10-13

    Recent measurements of nucleon resonance transition form factors with CLAS at Jefferson Lab are discussed. The new data resolve a long-standing puzzle of the nature of the Roper resonance, and confirm the assertion of the symmetric constituent quark model of the Roper as the first radial excitation of the nucleon. The data on high Q{sup 2} n{pi}{sup +} production confirm the slow fall off of the S{sub 11}(1535) transition form factor with Q{sup 2}, and better constrain the branching ratios {beta}{sub N{pi}} = 0.50 and {beta}{sub N{eta}} = 0.45. For the first time, the longitudinal transition amplitude to the S{sub 11}(1535) was extracted from the n{pi}{sup +} data. Also, new results on the transition amplitudes for the D{sub 13}(1520) resonance are presented showing a rapid transition from helicity 3/2 dominance seen at the real photon point to helicty 1/2 dominance at higher Q{sup 2}.

  1. Structure of olefin-imidacloprid and gas-phase fragmentation chemistry of its protonated form.

    PubMed

    Fusetto, Roberto; White, Jonathan M; Hutton, Craig A; O'Hair, Richard A J

    2016-02-07

    One of the major insect metabolites of the widely used neonicotinoid insecticide imidacloprid, 1 (1-[(6-chloro-3-pyridinyl)methyl]-N-nitro-1H-imidazol-2-amine), is the olefin 2. To better understand how the structure of olefin 2 relates to the gas-phase fragmentation of its protonated form, 2H(+), X-ray crystallography, tandem mass spectrometry experiments and DFT calculations were carried out. Olefin 2 was found to be in a tautomeric form where the proton is on the N(1) position of the imidazole ring and forms a hydrogen bond to one of the oxygen atoms of the coplanar nitroamine group. Under conditions of low-energy collision-induced dissociation (CID) in a linear ion trap, 2H(+), formed via electrospray ionization (ESI), fragments via a major loss of water, together with minor competing losses of HNO2 and NO2•.This contrasts with 1H+, which mainly undergoes bond homolysis via NO2• loss. Thus, installation of the double bond in 2 plays a key role in facilitating the loss of water. DFT calculations, carried out using the B3LYP/6-311G++(d,p) level of theory, revealed that loss of water was energetically more favourable compared to HNO2 and NO2• loss. Three multistep, energetically accessible mechanisms were identified for loss of water from 2H(+), and these have the following barriers: (I) direct proton transfer from N(5) of the pyridine to O(1) on the NO2 group (119 kJ mol(-1)); (II) rotation of the N(2)-N(4) bond (117 kJ mol(-1)); (III) 1,3-intramolecular proton transfer between the two oxygen atoms of the NO2 group (145 kJ mol(-1)). Given that the lowest barrier for the losses of HNO2 and NO2• is 156 kJ mol(-1), it is likely that all three water loss mechanisms occur concurrently.

  2. Proton tissue dose for the blood forming organ in human geometry: Isotropic radiation

    NASA Technical Reports Server (NTRS)

    Khandelwal, G. S.; Wilson, J. W.

    1974-01-01

    A computer program is described which calculates doses averaged within five major segments of the blood forming organ in the human body taking into account selfshielding of the detailed body geometry and nuclear star effects for proton radiation of arbitrary energy spectrum (energy less than 1 GeV) and isotropic angular distribution. The dose calculation includes the first term of an asymptotic series expansion of transport theory which is known to converge rapidly for most points in the human body. The result is always a conservative estimate of dose and is given as physical dose (rad) and dose equivalent (rem).

  3. DFT study of sulfur derivatives of cumulenes and their protonated forms of interstellar interest and calculations of dissociation energies of protonated forms (SC(CH)C(n-2)S)(+) (n = 3-8).

    PubMed

    Benmensour, Mohamed Ali; Djennane-Bousmaha, Sema; Boucekkine, Abdou

    2014-07-01

    A theoretical study of the sulfur cumulenes SCnS (n = 3-8), CnS ( n = 1-8) and of their protonated forms (SCnS)H(+) and (CnS)H(+) that might exist in the interstellar environment, has been carried out by means of the standard B3LYP/6-311G** method. The geometries and relative energies of singlet and triplet states according to the number of carbons have been computed. Like neutral species, we have found that the ground state of the most stable protonated forms (SC(CH)Cn-2S)(+) and ((HC)Cn-1S)(+), alternates between a triplet state for the even series and a singlet state for the odd series. We provided the data needed to simulate infrared and microwave spectra (vibration frequencies, dipole moments, and rotational constants) for each protonated species (SCnS)H(+) and (CnS)H(+) and for each neutral CnS species. The computing of dissociation energies of the most stable protonated forms (SC(CH)Cn-2S)(+) (n = 3-8) has shown that the lowest values are obtained for the dissociation of compounds with an even number of carbons, in their triplet state, which produce the observed fragments CS and C3S. The dissociation of even protonated forms requires less energy than for the odd protonated forms.

  4. Neutron-Proton Asymmetry Dependence of Spectroscopic Factors in Ar Isotopes

    SciTech Connect

    Lee, Jenny; Tsang, Betty; Shapira, Dan

    2010-01-01

    Spectroscopic factors have been extracted for proton-rich 34Ar and neutron-rich 46Ar using the (p, d) neutron transfer reaction. The experimental results show little reduction of the ground state neutron spectroscopic factor of the proton-rich nucleus 34Ar compared to that of 46Ar. The results suggest that correlations, which generally reduce such spectroscopic factors, do not depend strongly on the neutron-proton asymmetry of the nucleus in this isotopic region as was reported in knockout reactions. The present results are consistent with results from systematic studies of transfer reactions but inconsistent with the trends observed in knockout reaction measurements.

  5. Physical Nucleon Form Factors from Lattice QCD

    SciTech Connect

    Hrayr Matevosyan; Anthony W. Thomas; Gerald A. Miller

    2005-10-25

    We explore the possibility of extrapolating state of the art lattice QCD calculations of nucleon form factors to the physical regime. We find that the lattice results can be reproduced using the Light Front Cloudy Bag Model and the Extended Gari-Krmpelmann Model by letting their parameters be analytic functions of the quark mass. We then use the models to extend the lattice calculations to large values of Q{sup 2} of interest to current and planned experiments. These functions for the first model are also used to define extrapolations to the physical value of the pion mass, thereby allowing us to study how the predicted zero in G{sub E}(Q{sup 2})/G{sub M}(Q{sup 2}) varies as a function of quark mass.

  6. Analysis of nucleon electromagnetic form factors from light-front holographic QCD: The spacelike region

    DOE PAGES

    Sufian, Raza Sabbir; de Teramond, Guy F.; Brodsky, Stanley J.; ...

    2017-01-10

    We present a comprehensive analysis of the space-like nucleon electromagnetic form factors and their flavor decomposition within the framework of light-front holographic QCD. We show that the inclusion of the higher Fock componentsmore » $$|{qqqq\\bar{q}}$$ has a significant effect on the spin-flip elastic Pauli form factor and almost zero effect on the spin-conserving Dirac form factor. We present light-front holographic QCD results for the proton and neutron form factors at any momentum transfer range, including asymptotic predictions, and show that our results agree with the available experimental data with high accuracy. In order to correctly describe the Pauli form factor we need an admixture of a five quark state of about 30$$\\%$$ in the proton and about 40$$\\%$$ in the neutron. We also extract the nucleon charge and magnetic radii and perform a flavor decomposition of the nucleon electromagnetic form factors. The free parameters needed to describe the experimental nucleon form factors are very few: two parameters for the probabilities of higher Fock states for the spin-flip form factor and a phenomenological parameter $r$, required to account for possible SU(6) spin-flavor symmetry breaking effects in the neutron, whereas the Pauli form factors are normalized to the experimental values of the anomalous magnetic moments. As a result, the covariant spin structure for the Dirac and Pauli nucleon form factors prescribed by AdS$$_5$$ semiclassical gravity incorporates the correct twist scaling behavior from hard scattering and also leads to vector dominance at low energy.« less

  7. Analysis of nucleon electromagnetic form factors from light-front holographic QCD: The spacelike region

    NASA Astrophysics Data System (ADS)

    Sufian, Raza Sabbir; de Téramond, Guy F.; Brodsky, Stanley J.; Deur, Alexandre; Dosch, Hans Günter

    2017-01-01

    We present a comprehensive analysis of the spacelike nucleon electromagnetic form factors and their flavor decomposition within the framework of light-front (LF) holographic QCD (LFHQCD) We show that the inclusion of the higher Fock components |q q q q q ¯ ⟩ has a significant effect on the spin-flip elastic Pauli form factor and almost zero effect on the spin-conserving Dirac form factor. We present light-front holographic QCD results for the proton and neutron form factors at any momentum transfer range, including asymptotic predictions, and show that our results agree with the available experimental data with high accuracy. In order to correctly describe the Pauli form factor we need an admixture of a five quark state of about 30% in the proton and about 40% in the neutron. We also extract the nucleon charge and magnetic radii and perform a flavor decomposition of the nucleon electromagnetic form factors. The free parameters needed to describe the experimental nucleon form factors are very few: two parameters for the probabilities of higher Fock states for the spin-flip form factor and a phenomenological parameter r , required to account for possible SU(6) spin-flavor symmetry breaking effects in the neutron, whereas the Pauli form factors are normalized to the experimental values of the anomalous magnetic moments. The covariant spin structure for the Dirac and Pauli nucleon form factors prescribed by AdS5 semiclassical gravity incorporates the correct twist scaling behavior from hard scattering and also leads to vector dominance at low energy.

  8. Nucleon Structure and Hyperon Form Factors from Lattice QCD.

    SciTech Connect

    Lin,H.W.

    2007-06-11

    In this work, I report the latest lattice QCD calculations of nucleon and hyperon structure from chiral fermions in 2+1-flavor dynamical simulations. All calculations are done with a chirally symmetric fermion action, domain-wall fermions, for valence quarks. I begin with the latest lattice results on the nucleon structure, focusing on results from RBC/UKQCD using 2+1-flavor chiral fermion actions. We find the chiral-extrapolated axial coupling constant at physical pion mass point. to be 1.23(5), consistent with experimental value. The renormalization constants for the structure functions are obtained from RI/MOM-scheme non-perturbative renormalization. We find first moments of the polarized and unpolarized nucleon structure functions at zero transfer momentum to be 0.133(13) and 0.203(23) respectively, using continuum chiral extrapolation. These are consistent with the experimental values, unlike previous calculations which have been 50% larger. We also have a prediction for the transversity, which we find to be 0.56(4). The twist-3 matrix element is consistent with zero which agrees with the prediction of the Wandzura-Wilczek relation. In the second half of this work, I report an indirect dynamical estimation of the strangeness proton magnetic moments using mixed actions. With the analysis of hyperon form factors and using charge symmetry, the strangeness of proton is found to be -0.066(2G), consistent with the Adelaide-JLab Collaboration's result. The hyperon {Sigma} and {Xi} axial coupling constants are also performed for the first time in a lattice calculation, g{sub {Sigma}{Sigma}} = 0.441(14) and g{sub {Xi}{Xi}} = -0.277(11).

  9. Nucleon Structure and hyperon form factors from lattice QCD

    SciTech Connect

    Lin, Huey-Wen

    2007-06-11

    In this work, I report the latest lattice QCD calculations of nucleon and hyperon structure from chiral fermions in 2+1-flavor dynamical simulations. All calculations are done with a chirally symmetric fermion action, domain-wall fermions, for valence quarks. I begin with the latest lattice results on the nucleon structure, focusing on results from RBC/UKQCD using 2+1-flavor chiral fermion actions. We find the chiral-extrapolated axial coupling constant at physical pion mass point to be 1.23(5), consistant with experimental value. The renormalization constants for the structure functions are obtained from RI/MOM-scheme non-perturbative renormalization. We find first moments of the polarized and unpolarized nucleon structure functions at zero transfer momentum to be 0.133(13) and 0.203(23) respectively, using continuum chiral extrapolation. These are consistent with the experimental values, unlike previous calculations which have been 50% larger. We also have a prediction for the transversity, which we find to be 0.56(4). The twist-3 matrix element is consistent with zero which agrees with the prediction of the Wandzura-Wilczek relation. In the second half of this work, I report an indirect dynamical estimation of the strangeness proton magnetic moments using mixed actions. With the analysis of hyperon form factors and using charge symmetry, the strangeness of proton is found to be -0.066(26), consistent with the Adelaide-JLab Collaboration's result. The hyperon Sigma and Xi axial coupling constants are also performed for the first time in a lattice calculation, g_SigmaSigma = 0.441(14) and g_XiXi = -0.277(11).

  10. Neutrons in proton pencil beam scanning: parameterization of energy, quality factors and RBE

    NASA Astrophysics Data System (ADS)

    Schneider, Uwe; Hälg, Roger A.; Baiocco, Giorgio; Lomax, Tony

    2016-08-01

    The biological effectiveness of neutrons produced during proton therapy in inducing cancer is unknown, but potentially large. In particular, since neutron biological effectiveness is energy dependent, it is necessary to estimate, besides the dose, also the energy spectra, in order to obtain quantities which could be a measure of the biological effectiveness and test current models and new approaches against epidemiological studies on cancer induction after proton therapy. For patients treated with proton pencil beam scanning, this work aims to predict the spatially localized neutron energies, the effective quality factor, the weighting factor according to ICRP, and two RBE values, the first obtained from the saturation corrected dose mean lineal energy and the second from DSB cluster induction. A proton pencil beam was Monte Carlo simulated using GEANT. Based on the simulated neutron spectra for three different proton beam energies a parameterization of energy, quality factors and RBE was calculated. The pencil beam algorithm used for treatment planning at PSI has been extended using the developed parameterizations in order to calculate the spatially localized neutron energy, quality factors and RBE for each treated patient. The parameterization represents the simple quantification of neutron energy in two energy bins and the quality factors and RBE with a satisfying precision up to 85 cm away from the proton pencil beam when compared to the results based on 3D Monte Carlo simulations. The root mean square error of the energy estimate between Monte Carlo simulation based results and the parameterization is 3.9%. For the quality factors and RBE estimates it is smaller than 0.9%. The model was successfully integrated into the PSI treatment planning system. It was found that the parameterizations for neutron energy, quality factors and RBE were independent of proton energy in the investigated energy range of interest for proton therapy. The pencil beam algorithm has

  11. The {Delta}(1232) resonance transition form factor

    SciTech Connect

    Staurt, L.M. |; Bosted, P.E.; Lung, A.

    1993-08-01

    Old and new measurements of inclusive e--p cross sections in the {Delta}(1232) resonance region have been combined, and a global data fit has been made. Using this fit to parameterize the nonresonant background, the transition form factors have been extracted out to a four-momentum transfer, Q{sup 2}, of 9.8 (GeV/c){sup 2}. The results are systematically higher than those from a previous analysis, but agree within errors. A similar analysis has been done with e--d cross sections, and {sigma}{sub n}/{sigma}{sub p} in the {Delta}(1232) resonance region has been extracted out to a Q{sup 2} of 7.9 (GeV/c){sup 2}. {sigma}{sub n}/{sigma}{sub p} for {Delta}(1232) production is consistent with unity, while {sigma}{sub n}/{sigma}{sub p} for the nonresonant background is constant with Q{sup 2} at approximately 0.4.

  12. Vector and Axial Vector Pion Form Factors

    NASA Astrophysics Data System (ADS)

    Vitz, Michael; PEN Collaboration

    2015-04-01

    Radiative pion decay π+ -->e+ νγ (RPD) provides critical input to chiral perturbation theory (χPT). Aside from the uninteresting ``inner bremsstrahlung'' contribution from QED, the RPD rate contains ``structure dependent'' terms given by FV and FA, the vector and axial-vector pion form factors, respectively. The two appear in the decay rate in combinations FV -FA and FV +FA , i.e., in the so-called SD- and SD+ terms, respectively. The latter has been measured to high precision by the PIBETA collaboration. We report on the analysis of new data, measured by the PEN collaboration in runs between 2008 and 2010 at the Paul Scherrer Institute, Switzerland. We particularly focus on the possibility of improvement in the determination of the SD- term. Precise determinations of FV and FA test the validity of the CVC hypothesis, provide numerical input for the l9 +l10 terms in the χPT lagrangian, and constrain potential non-(V - A) terms, such as a possible tensor term FT. NSF grants PHY-0970013, 1307328, and others.

  13. Time-like nucleon form factor measurements at overline{textbf{P}}textbf{ANDA}

    NASA Astrophysics Data System (ADS)

    Sudoł, Małgorzata

    2009-11-01

    The electromagnetic probe is an excellent tool to investigate the structure of the nucleon. The nearly 4 π detector PANDA, to be installed on the FAIR accelerator complex at Darmstadt, will allow to make a precise determination of the electromagnetic form factors of the proton in the time-like (TL) region with unprecedented precision. In the framework of the one-photon exchange, the center of mass unpolarized differential cross section of the reaction overline{p} p rightarrow e^+ e^- is a linear combination of the squared moduli of the electric Gp_E and magnetic Gp_M proton form factors. The precise measurement of the angular distribution over almost full angular range then directly gives these quantities. Only two experiments have provided the ratio R = {|Gp_E|/|Gp_M|} but with very large statistical uncertainties. Within PANDA, there is a unique opportunity to measure separately the moduli of these two proton form factors Gp_E and Gp_M in good conditions, up to around q 2 = 14 GeV2.

  14. On the accessibility to conical intersections in purines: hypoxanthine and its singly protonated and deprotonated forms.

    PubMed

    Villabona-Monsalve, Juan P; Noria, Raquel; Matsika, Spiridoula; Peón, Jorge

    2012-05-09

    The dynamics following electronic excitation of hypoxanthine and its nucleoside inosine were studied by femtosecond fluorescence up-conversion. Our objective was to explore variants of the purinic DNA bases in order to determine the molecular parameters that increase or reduce the accessibility to ground state conical intersections. From experiments in water and methanol solution we conclude that both dominant neutral tautomers of hypoxanthine exhibit ultrashort excited state lifetimes (τ < 0.2 ps), which are significantly shorter than in the related nucleobase guanine. This points to a more accessible conical intersection for the fluorescent state upon removal of the amino group, present in guanine but absent in hypoxanthine. The excited state dynamics of singly protonated hypoxanthine were also studied, showing biexponential decays with a 1.1 ps component (5%) besides a sub-0.2 ps ultrafast component. On the other hand, the S(1) lifetimes of the singly deprotonated forms of hypoxanthine and inosine show drastic differences, where the latter remains ultrafast but the singly deprotonated hypoxanthine shows a much longer lifetime of 19 ps. This significant variation is related to the different deprotonation sites in hypoxanthine versus inosine, which gives rise to significantly different resonance structures. In our study we also include multireference perturbation theory (MRMP2) excited state calculations in order to determine the nature of the initial electronic excitation in our experiments and clarify the ordering of the states in the singlet manifold at the ground state geometry. In addition, we performed multireference configuration interaction calculations (MR-CIS) that identify the presence of low-lying conical intersections for both prominent neutral tautomers of hypoxanthine. In both cases, the surface crossings occur at geometries reached by out of plane opposite motions of C2 and N3. The study of this simpler purine gives several insights into how small

  15. The energy spectra of solar energetic protons in the large energy range: their functional form and parameters.

    NASA Astrophysics Data System (ADS)

    Nymmik, Rikho; Pervaia, Taisia

    2016-07-01

    Experimental data on the fluxes of protons of solar energetic particles (SEP) are analyzed. It is known that above energies of 2-45 MeV (averaging 27-30 MeV), the proton spectra are a power-law function of the energy (at relativistic energies - from the momentum) of the particles. At lower energies, the spectra become harder, with the high-energy part of the spectra forming the "knee". This report is devoted to the determination of the parameters of the SEP spectra, having the form of a "double power-law shape", to ascertain the reliability of the parameters of the approximations of the experimental data.

  16. Proton beam shaped by "particle lens" formed by laser-driven hot electrons

    NASA Astrophysics Data System (ADS)

    Zhai, S. H.; Shen, B. F.; Wang, W. P.; Zhang, H.; He, S. K.; Lu, F.; Zhang, F. Q.; Deng, Z. G.; Dong, K. G.; Wang, S. Y.; Zhou, K. N.; Xie, N.; Wang, X. D.; Zhang, L. G.; Huang, S.; Liu, H. J.; Zhao, Z. Q.; Gu, Y. Q.; Zhang, B. H.; Xu, Z. Z.

    2016-05-01

    Two-dimensional tailoring of a proton beam is realized by a "particle lens" in our experiment. A large quantity of electrons, generated by an intense femtosecond laser irradiating a polymer target, produces an electric field strong enough to change the trajectory and distribution of energetic protons flying through the electron area. The experiment shows that a strip pattern of the proton beam appears when hot electrons initially converge inside the plastic plate. Then the shape of the proton beam changes to a "fountain-like" pattern when these hot electrons diffuse after propagating a distance.

  17. Energetics and chemical bonding of the 1,3,5-tridehydrobenzene triradical and its protonated form

    NASA Astrophysics Data System (ADS)

    Nguyen, Hue Minh Thi; Höltzl, Tibor; Gopakumar, G.; Veszprémi, Tamás; Peeters, Jozef; Nguyen, Minh Tho

    2005-09-01

    Quantum chemical calculations were applied to investigate the electronic structure of the parent 1,3,5-tridehydrobenzene triradical (C 6H 3, TDB) and its anion (C6H3-), cation (C6H3+) and protonated form (C6H4+). Our results obtained using the state-averaged complete active space self-consistent-field (CASSCF) followed by second-order multi-state multi-configuration perturbation theory, MS-CASPT2, and MRMP2 in conjunction with the large ANO-L and 6-311++G(3df,2p) basis set, confirm and reveal the followings: (i) TDB has a doublet 2A 1 ground state with a 4B 2- 2A 1 energy gap of 29 kcal/mol, (ii) the ground state of the C6H3- anion in the triplet 3B 2 being 4 kcal/mol below the 1A 1 state. (iii) the electron affinity (EA), ionization energy (IE) and proton affinity (PA) are computed to be: EA = 1.6 eV, IE = 7.2 eV, PA = 227 kcal/mol using UB3LYP/6-311++G(3df,2p) + ZPE; standard heat of formation Δ Hf(298 K, 1 atm) (TDB) = 179 ± 2 kcal/mol was calculated with CBS-QB3 method. An atoms-in-molecules (AIM) analysis of the structure reveals that the topology of the electron density is similar in all compounds: hydrogens connect to a six-membered ring, except for the case of the 2A 2 state of C6H4+ (MBZ +) which is bicyclic with fused five- and three-membered rings. Properties of the chemical bonds were characterized with Electron Localization Function (ELF) analysis, as well as Wiberg indices, Laplacian and spin density maps. We found that the radicals form separate monosynaptic basins on the ELF space, however its pair character remains high. In the 2A 1 state of TDB, the radical center is mainly localized on the C1 atom, while in the 2B 2 state it is equally distributed between the C3 and C5 atoms and, due to the symmetry, in the 4B 2 state the C1, C2 and C3 atoms have the same radical character. There is no C3-C5 bond in the 2A 1 state of TDB, but the interaction between these atoms is strong. The ground state of cation C6H3+ (DHP), 1A 1, is not a diradical and has

  18. Studies of Nucleon Form Factors with 12 GeV CEBAF and SuperBigBite

    SciTech Connect

    Hansen, Jens-Ole

    2012-04-01

    The elastic electromagnetic form factors are among the most fundamental quantities that describe the ground-state structure of the proton and neutron. Precision data of the form factors over a wide kinematical range provide a powerful test of current theories of hadron structure. A number of experiments aiming to measure the electric and magnetic elastic form factors of the neutron, G{sub E}{sup n} and G{sub M}{sup n}, and proton, G{sub E}{sup p}, at very high momentum transfer, up to the range of Q{sup 2} = 10-14 (GeV/c){sup 2}, are planned to be carried out with the future 11 GeV electron beam of the upgraded CEBAF at Jefferson Lab. These experiments will determine the nucleon form factors with unprecedented precision to Q{sup 2}-values up to three times higher than those of existing data. We review the approved proposals and the conceptual design of a new spectrometer, SuperBigBite, that will be used in these and other future experiments at Jefferson Lab.

  19. Electromagnetic Transition Form Factor of the η meson with WASA-at-COSY

    NASA Astrophysics Data System (ADS)

    Goswami, A.

    2016-11-01

    In this work we present a study of the Dalitz decay η → γe+e-. The aim of this work is to measure the transition form factor of the η meson. The transition form factor of the η meson describes the electromagnetic structure of the meson. The study of the Dalitz decay helps to calculate the transition form factor of the η meson. When a particle is point-like it's decay rate can be calculated within QED. However, the complex structure of the meson modifies its decay rate. The transition form factor is determined by comparing the lepton-antilepton invariant mass distribution with QED. For this study data on proton-proton reaction at a beam energy of 1.4 GeV has been collected with WASA-at-COSY detector at Forschungszentrum Juelich, Germany. In the higher invariant mass region recent theoretical calculations slightly deviate from the fit to the data. We expect better results in the higher invariant mass region than previous measurements. The preliminary results of the analysis will be presented.

  20. The three loop slope of the Dirac form factor and the S Lamb shift in hydrogen

    SciTech Connect

    Melnikov, K.

    1999-12-08

    The last unknown contribution to hydrogen energy levels at order malpha{sup 7}, due to the slope of the Dirac form factor at three loops, is evaluated in a closed analytical form. The resulting shift of the hydrogen nS energy level is found to be 3.016/n{sup 3} kHz. Using the QED calculations of the 1S Lamb shift, the authors extract a precise value of the proton charge radius r{sub p} = 0.883{+-}0.014 fm.

  1. Hydrogen forms in water by proton transfer to a distorted electron.

    PubMed

    Marsalek, Ondrej; Frigato, Tomaso; VandeVondele, Joost; Bradforth, Stephen E; Schmidt, Burkhard; Schütte, Christof; Jungwirth, Pavel

    2010-01-21

    Solvated electrons are ubiquitous intermediates in radiation-induced processes, with their lifetime being determined by quenching processes, such as the direct reaction with protons under acidic conditions. Ab initio molecular dynamics simulations allow us to unravel with molecular resolution the ultrafast reaction mechanism by which the electron and proton react in water. The path to a successful reaction involves a distortion and contraction of the hydrated electron and a rapid proton motion along a chain of hydrogen bonds, terminating on the water molecule most protruding into the electron cloud. This fundamental reaction is thus decidedly shown to be of a proton-transfer rather than electron-transfer character. Due to the desolvation penalty connected with breaking of the hydration shells of these charged particles, the reaction is, however, not diffusion-limited, in agreement with the interpretation of kinetics measurements.

  2. Progress in the Calculation of Nucleon Transition form Factors

    NASA Astrophysics Data System (ADS)

    Eichmann, Gernot

    2016-10-01

    We give a brief account of the Dyson-Schwinger and Faddeev-equation approach and its application to nucleon resonances and their transition form factors. We compare the three-body with the quark-diquark approach and present a quark-diquark calculation for the low-lying nucleon resonances including scalar, axialvector, pseudoscalar and vector diquarks. We also discuss the timelike structure of transition form factors and highlight the advantages of form factors over helicity amplitudes.

  3. The form factor of H-comb polymers

    NASA Astrophysics Data System (ADS)

    Zweier, Steven; Bishop, Marvin

    2009-12-01

    A Monte Carlo pivot algorithm is employed to investigate the form factor of continuum, tangent hard sphere H-comb polymers in both the ideal and excluded volume regimes. The simulated form factors for 241 and 931 "bead" ideal H-combs are essentially the same. The results for these polymers are in excellent agreement with the theoretical prediction. There is only a slight difference in the form factor between the ideal and excluded volume regimes at larger values of distance.

  4. Nickel phlorin intermediate formed by proton-coupled electron transfer in hydrogen evolution mechanism

    PubMed Central

    Solis, Brian H.; Maher, Andrew G.; Dogutan, Dilek K.; Nocera, Daniel G.; Hammes-Schiffer, Sharon

    2016-01-01

    The development of more effective energy conversion processes is critical for global energy sustainability. The design of molecular electrocatalysts for the hydrogen evolution reaction is an important component of these efforts. Proton-coupled electron transfer (PCET) reactions, in which electron transfer is coupled to proton transfer, play an important role in these processes and can be enhanced by incorporating proton relays into the molecular electrocatalysts. Herein nickel porphyrin electrocatalysts with and without an internal proton relay are investigated to elucidate the hydrogen evolution mechanisms and thereby enable the design of more effective catalysts. Density functional theory calculations indicate that electrochemical reduction leads to dearomatization of the porphyrin conjugated system, thereby favoring protonation at the meso carbon of the porphyrin ring to produce a phlorin intermediate. A key step in the proposed mechanisms is a thermodynamically favorable PCET reaction composed of intramolecular electron transfer from the nickel to the porphyrin and proton transfer from a carboxylic acid hanging group or an external acid to the meso carbon of the porphyrin. The C–H bond of the active phlorin acts similarly to the more traditional metal-hydride by reacting with acid to produce H2. Support for the theoretically predicted mechanism is provided by the agreement between simulated and experimental cyclic voltammograms in weak and strong acid and by the detection of a phlorin intermediate through spectroelectrochemical measurements. These results suggest that phlorin species have the potential to perform unique chemistry that could prove useful in designing more effective electrocatalysts. PMID:26655344

  5. Electromagnetic structure of the proton within the CP-violation hypothesis

    SciTech Connect

    Krutov, A. F. Kudinov, M. Yu.

    2013-11-15

    The so-called non-Rosenbluth behavior of the proton electromagnetic form factors can be explained within the hypothesis of CP violation in electromagnetic processes involving composite systems of strongly interacting particles. It is shown that this hypothesis leads to the appearance of an additional, anapole, form factor of the proton. The proton electromagnetic form factors, including the anapole form factor, are estimated on the basis of experimental data on elastic electron-proton scattering.

  6. Analytical evaluation of atomic form factors: Application to Rayleigh scattering

    SciTech Connect

    Safari, L.; Santos, J. P.; Amaro, P.; Jänkälä, K.; Fratini, F.

    2015-05-15

    Atomic form factors are widely used for the characterization of targets and specimens, from crystallography to biology. By using recent mathematical results, here we derive an analytical expression for the atomic form factor within the independent particle model constructed from nonrelativistic screened hydrogenic wave functions. The range of validity of this analytical expression is checked by comparing the analytically obtained form factors with the ones obtained within the Hartee-Fock method. As an example, we apply our analytical expression for the atomic form factor to evaluate the differential cross section for Rayleigh scattering off neutral atoms.

  7. Analytical evaluation of atomic form factors: Application to Rayleigh scattering

    NASA Astrophysics Data System (ADS)

    Safari, L.; Santos, J. P.; Amaro, P.; Jänkälä, K.; Fratini, F.

    2015-05-01

    Atomic form factors are widely used for the characterization of targets and specimens, from crystallography to biology. By using recent mathematical results, here we derive an analytical expression for the atomic form factor within the independent particle model constructed from nonrelativistic screened hydrogenic wave functions. The range of validity of this analytical expression is checked by comparing the analytically obtained form factors with the ones obtained within the Hartee-Fock method. As an example, we apply our analytical expression for the atomic form factor to evaluate the differential cross section for Rayleigh scattering off neutral atoms.

  8. X-Ray Form Factor, Attenuation and Scattering Tables

    National Institute of Standards and Technology Data Gateway

    SRD 66 X-Ray Form Factor, Attenuation and Scattering Tables (Web, free access)   This database collects tables and graphs of the form factors, the photoabsorption cross section, and the total attenuation coefficient for any element (Z <= 92).

  9. Nucleon Form Factors experiments with 12 GeV CEBAF

    SciTech Connect

    Wojtsekhowski, B.

    2008-10-13

    A number of precision form factor experiments at high momentum transfer will be performed with the 11 GeV electron beam of CEBAF. We review the approved proposals and the conceptual schemes of several new suggestions. Form factor data will serve as a major input for the construction of a tomographic image of the nucleon.

  10. Orthopositronium decay form factors and two-photon correlations

    SciTech Connect

    Adkins, Gregory S.; Droz, Daniel R.; Rastawicki, Dominik; Fell, Richard N.

    2010-04-15

    We give results for the orthopositronium decay form factors through one-loop order. We use the form factors to calculate momentum correlations of the final-state photons and , including one-loop corrections, for ensembles of initial orthopositronium atoms having arbitrary polarization.

  11. Ab initio study of the molecular structure and vibrational spectrum of nitric acid and its protonated forms

    NASA Technical Reports Server (NTRS)

    Lee, Timothy J.; Rice, Julia E.

    1992-01-01

    The equilibrium structures, harmonic vibrational frequencies, IR intensities, and relative energetics of HNO3 and its protonated form H2NO3+ were investigated using double-zeta plus polarization and triple-zeta plus polarization basis sets in conjunction with high-level ab initio methods. The latter include second-order Moller-Plesset perturbation theory, the single and double excitation coupled cluster (CCSD) methods, a perturbational estimate of the effects of connected triple excitations (CCSD(T)), and the self-consistent field. To determine accurate energy differences CCSD(T) energies were computed using large atomic natural orbital basis sets. Four different isomers of H2NO3+ were considered. The lowest energy form of protonated nitric acid was found to correspond to a complex between H2O and NO2+, which is consistent with earlier theoretical and experimental studies.

  12. Prediction of output factor, range, and spread-out bragg peak for proton therapy.

    PubMed

    Kim, Dong Wook; Lim, Young Kyung; Ahn, Sung Hwan; Shin, Jungwook; Shin, Dongho; Yoon, Myongguen; Lee, Se Byeong; Kim, Dae Yong; Park, Sung Yong

    2011-01-01

    In proton therapy, patient quality assurance (QA) requires measuring the beam range, spread-out Bragg peak (SOBP), and output factor. If these values can be predicted by using sampling measurements or previous QA data to find the correlation between beam setup parameters and measured data, efforts expended on patient QA can be reduced. Using sampling data, we predicted the range, SOBP, and output factor of the proton beam. To obtain sampling data, we measured the range, SOBP, and output factor for 14 data points at each of 24-beam range options, from 4-28 cm. Prediction conformity was evaluated by the difference between predicted and measured patient QA data. Results indicated that for 60% of patients, the values could be predicted within 3% of dose uncertainty.

  13. Three-loop slope of the dirac form factor and the 1S lamb shift in hydrogen

    PubMed

    Melnikov; van Ritbergen T

    2000-02-21

    The last unknown contribution to hydrogen energy levels at order malpha(7), due to the slope of the Dirac form factor at three loops, is evaluated in a closed analytical form. The resulting shift of the hydrogen nS energy level is found to be 3.016/n(3) kHz. Using the QED calculations of the 1S Lamb shift, we extract a precise value of the proton charge radius r(p) = 0.883+/-0.014 fm.

  14. Relationship Domain of Form Six Teachers Thinking in Teaching with External Factors of Form Six Teachers

    ERIC Educational Resources Information Center

    bin Pet, Mokhtar; Sihes, Ahmad Johari Hj

    2015-01-01

    This study aims to examine the external factors of form six teachers who can influence thinking domain form six teachers in their teaching. This study was conducted using a quantitative approach using questionnaires. A total of 300 form six teacher schools in Johor were chosen as respondents. The findings were obtained as student background…

  15. The structures and vibrational frequencies of the NNO analogs NPO and PNO and their protonated forms

    NASA Astrophysics Data System (ADS)

    Davy, Randall D.; Schaefer, Henry F., III

    1990-05-01

    The surprising relative stability of PNO compared to NPO cannot be explained by a single configuration molecular orbital (MO) model. However the MO model can be used to understand the pattern of stability among the protonated isomers HPNO+, PNOH+, HNPO+, and NPOH+, and perhaps to explain important aspects of the general chemistry of multiple bonds between first and second row atoms.

  16. Axial transition form factors and pion decay of baryon resonances

    SciTech Connect

    Julia-Diaz, B.; Riska, D.O.; Coester, F.

    2004-10-01

    The pion decay constants of the lowest orbitally excited states of the nucleon and the {delta}(1232) along with the corresponding axial transition form factors are calculated with Poincare covariant constituent-quark models with instant, point, and front forms of relativistic kinematics. The model wave functions are chosen such that the calculated electromagnetic and axial form factors of the nucleon represent the empirical values in all three forms of kinematics, when calculated with single-constituent currents. The pion decay widths calculated with the three forms of kinematics are smaller than the empirical values. Front and instant form kinematics provide a similar description, with a slight preference for front form, while the point form values are significantly smaller in the case of the lowest positive parity resonances.

  17. Light-Cone Sum Rule Approach for Baryon Form Factors

    NASA Astrophysics Data System (ADS)

    Offen, Nils

    2016-10-01

    We present the state-of-the-art of the light-cone sum rule approach to Baryon form factors. The essence of this approach is that soft Feynman contributions are calculated in terms of small transverse distance quantities using dispersion relations and duality. The form factors are thus expressed in terms of nucleon wave functions at small transverse separations, called distribution amplitudes, without any additional parameters. The distribution amplitudes, therefore, can be extracted from the comparison with the experimental data on form factors and compared to the results of lattice QCD simulations.

  18. SU-E-T-577: Obliquity Factor and Surface Dose in Proton Beam Therapy

    SciTech Connect

    Das, I; Andersen, A; Coutinho, L

    2015-06-15

    Purpose: The advantage of lower skin dose in proton beam may be diminished creating radiation related sequalae usually seen with photon and electron beams. This study evaluates the surface dose as a complex function of beam parameters but more importantly the effect of beam angle. Methods: Surface dose in proton beam depends on the beam energy, source to surface distance, the air gap between snout and surface, field size, material thickness in front of surface, atomic number of the medium, beam angle and type of nozzle (ie double scattering, (DS), uniform scanning (US) or pencil beam scanning (PBS). Obliquity factor (OF) is defined as ratio of surface dose in 0° to beam angle Θ. Measurements were made in water phantom at various beam angles using very small microdiamond that has shown favorable beam characteristics for high, medium and low proton energy. Depth dose measurements were performed in the central axis of the beam in each respective gantry angle. Results: It is observed that surface dose is energy dependent but more predominantly on the SOBP. It is found that as SSD increases, surface dose decreases. In general, SSD, and air gap has limited impact in clinical proton range. High energy has higher surface dose and so the beam angle. The OF rises with beam angle. Compared to OF of 1.0 at 0° beam angle, the value is 1.5, 1.6, 1,7 for small, medium and large range respectively for 60 degree angle. Conclusion: It is advised that just like range and SOBP, surface dose should be clearly understood and a method to reduce the surface dose should be employed. Obliquity factor is a critical parameter that should be accounted in proton beam therapy and a perpendicular beam should be used to reduce surface dose.

  19. Proton Spectroscopic Factors Deduced from Helium-3 Global Phenomenological and Microscopic Optical Model Potentials

    NASA Astrophysics Data System (ADS)

    Jenny, Lee; Pang, Dan-Yang; Han, Yin-Lu; B. Tsang, M.

    2014-09-01

    Global phenomenological GDP08 and microscopic helium-3 optical model potentials have been recently derived. We evaluate these two potential sets by comparing the elastic scattering data of 25 MeV 3He on 16O, 18O, 19F, 23Na, 24Mg, 25Mg, 26Mg, 27Al, 28Si, 30Si, 31P, 32S, 34S, 35Cl, 37Cl, and 39K isotopes. Using the deuteron angular distributions calculated with the distorted wave Born approximation model, we extract the ground-state proton spectroscopic factors from (3He, d) reactions on the same set of nuclei. The extracted proton spectroscopic factors are compared with the large-basis shell-model calculations.

  20. Atomic form factor for twisted vortex photons interacting with atoms

    NASA Astrophysics Data System (ADS)

    Guthrey, Pierson; Kaplan, Lev; McGuire, J. H.

    2014-04-01

    The relatively new atomic form factor for twisted (vortex) beams, which carry orbital angular momentum (OAM), is considered and compared to the conventional atomic form factor for plane-wave beams that carry only spin angular momentum. Since the vortex symmetry of a twisted photon is more complex that that of a plane wave, evaluation of the atomic form factor is also more complex for twisted photons. On the other hand, the twisted photon has additional parameters, including the OAM quantum number, ℓ, the nodal radial number, p, and the Rayleigh range, zR, which determine the cone angle of the vortex. This Rayleigh range may be used as a variable parameter to control the interaction of twisted photons with matter. Here we address (i) normalization of the vortex atomic form factor, (ii) displacement of target atoms away from the center of the beam vortex, and (iii) formulation of transition probabilities for a variety of photon-atom processes. We attend to features related to experiments that can test the range of validity and accuracy of calculations of these variations of the atomic form factor. Using the absolute square of the form factor for vortex beams, we introduce a vortex factor that can be directly measured.

  1. Renormalization versus strong form factors for one-boson-exchange potentials

    NASA Astrophysics Data System (ADS)

    Calle Cordón, A.; Ruiz Arriola, E.

    2010-04-01

    We analyze the one-boson-exchange potential from the point of view of renormalization theory. We show that the nucleon-meson Lagrangian, while predicting the NN force, does not predict the NN scattering matrix nor the deuteron properties unambiguously due to the appearance of short distance singularities. While the problem has traditionally been circumvented by introducing vertex functions via phenomenological strong form factors, we propose to impose physical renormalization conditions on the scattering amplitude at low energies. Working in the large Nc approximation with π, σ, ρ, and ω mesons we show that, once these conditions are applied, results for low-energy phases of proton-neutron scattering as well as deuteron properties become largely insensitive to the form factors and to the vector mesons yielding reasonable agreement with the data and for realistic values of the coupling constants.

  2. High-precision calculation of the strange nucleon electromagnetic form factors

    SciTech Connect

    Green, Jeremy; Meinel, Stefan; Engelhardt, Michael G.; Krieg, Stefan; Laeuchli, Jesse; Negele, John W.; Orginos, Kostas; Pochinsky, Andrew; Syritsyn, Sergey

    2015-08-26

    We report a direct lattice QCD calculation of the strange nucleon electromagnetic form factors GsE and GsM in the kinematic range 0 ≤ Q2 ≤ 1.2GeV2. For the first time, both GsE and GsM are shown to be nonzero with high significance. This work uses closer-to-physical lattice parameters than previous calculations, and achieves an unprecented statistical precision by implementing a recently proposed variance reduction technique called hierarchical probing. We perform model-independent fits of the form factor shapes using the z-expansion and determine the strange electric and magnetic radii and magnetic moment. As a result, we compare our results to parity-violating electron-proton scattering data and to other theoretical studies.

  3. Classical limit of diagonal form factors and HHL correlators

    NASA Astrophysics Data System (ADS)

    Bajnok, Zoltan; Janik, Romuald A.

    2017-01-01

    We propose an expression for the classical limit of diagonal form factors in which we integrate the corresponding observable over the moduli space of classical solutions. In infinite volume the integral has to be regularized by proper subtractions and we present the one, which corresponds to the classical limit of the connected diagonal form factors. In finite volume the integral is finite and can be expressed in terms of the classical infinite volume diagonal form factors and subvolumes of the moduli space. We analyze carefully the periodicity properties of the finite volume moduli space and found a classical analogue of the Bethe-Yang equations. By applying the results to the heavy-heavy-light three point functions we can express their strong coupling limit in terms of the classical limit of the sine-Gordon diagonal form factors.

  4. Pion form factor in the NLC QCD SR approach

    SciTech Connect

    Bakulev, A. P. Pimikov, A. V.; Stefanis, N. G.

    2010-06-15

    We present results of a calculation of the electromagnetic pion form factor within the framework of QCD sum rules with nonlocal condensates and using a perturbative spectral density which includes O({alpha}{sub s}) contributions.

  5. Hadronic Form Factors in Asymptotically Free Field Theories

    DOE R&D Accomplishments Database

    Gross, D. J.; Treiman, S. B.

    1974-01-01

    The breakdown of Bjorken scaling in asymptotically free gauge theories of the strong interactions is explored for its implications on the large q{sup 2} behavior of nucleon form factors. Duality arguments of Bloom and Gilman suggest a connection between the form factors and the threshold properties of the deep inelastic structure functions. The latter are addressed directly in an analysis of asymptotically free theories; and through the duality connection we are then led to statements about the form factors. For very large q{sup 2} the form factors are predicted to fall faster than any inverse power of q{sup 2}. For the more modest range of q{sup 2} reached in existing experiments the agreement with data is fairly good, though this may well be fortuitous. Extrapolations beyond this range are presented.

  6. Flavor decomposition of the elastic nucleon electromagnetic form factors

    SciTech Connect

    C.D. Cates, C.W. Jager, S. Riordan, B. Wojtsekhowski

    2011-06-01

    The u- and d-quark contributions to the elastic nucleon electromagnetic form factors have been determined using experimental data on GEn , GMn , GpE , and GpM . Such a flavor separation of the form factors became possible up to 3.4 GeV2 with recent data on GEn from Hall A at JLab. At a negative four-momentum transfer squared Q2 above 1 GeV2, for both the u- and d-quark components, the ratio of the Pauli form factor to the Dirac form factor, F2/F1, was found to be almost constant, and for each of F2 and F1 individually, the d-quark component drops continuously with increasing Q2.

  7. Vector Meson Form Factors and Wave Functions from Holographic QCD

    SciTech Connect

    Hovhannes Grigoryan; Anatoly Radyushkin

    2007-10-10

    Based on the holographic dual model of QCD, we study 2- and 3-point functions of vector currents and derive form factors as well as wave functions for the vector mesons. As a result, generalized vector-meson dominance representation for form factors is obtained with a very specific VMD pattern. The calculated electric radius of the rho-meson is shown to be in a good agreement with predictions from lattice QCD.

  8. Charm and bottom hadronic form factors with QCD sum rules

    SciTech Connect

    Bracco, M. E.; Rodrigues, B. O.; Cerqueira, A. Jr.

    2013-03-25

    We present a brief review of some calculations of form factors and coupling constants in vertices with charm and bottom mesons in the framework of QCD sum rules. We first discuss the motivation for this work, describing possible applications of these form factors to charm and bottom decays processes. We first make a summarize of the QCD sum rules method. We give special attention to the uncertainties of the method introducing by the intrinsic variation of the parameters. Finally we conclude.

  9. Strange form factors of octet and decuplet baryons

    SciTech Connect

    Hong, Soon-Tae

    1999-11-22

    The strange form factors of baryon octet are evaluated, in the chiral models with the general chiral SU(3) group structure, to yield the theoretical predictions comparable to the recent experimental data of SAMPLE Collaboration and to study the spin symmetries. Other model predictions are also briefly reviewed to compare with our results and then the strange form factors of baryon octet and decuplet are predicted.

  10. Are protons nonidentical fermions?

    SciTech Connect

    Mart, T.

    2014-09-25

    We briefly review the progress of our investigation on the electric (charge) radius of the proton. In order to explain the recently measured proton radius, which is significantly smaller than the standard CODATA value, we assume that the real protons radii are not identical, they are randomly distributed in a certain range. To obtain the measured radius we average the radii and fit both the mean radius and the range. By using an averaged dipole form factor we obtain the charge radius r{sub E} = 0.8333 fm, in accordance with the recent measurement of the Lamb shift in muonic hydrogen.

  11. Online Soil Science Lesson 3: Soil Forming Factors

    Technology Transfer Automated Retrieval System (TEKTRAN)

    This lesson explores the five major factors of soil formation, namely: 1) climate; 2) organisms; 3) time; 4) topography; and 5) parent material and their influence in forming soil. The distinction between active and passive factors, moisture and temperature regimes, organism and topographic influen...

  12. SU-E-T-595: Output Factor Calculation for a Uniform Scanning Proton Therapy System

    SciTech Connect

    Hecksel, D; Stauffer, N; DeFillippo, G; Edwards, J; Pankuch, M

    2015-06-15

    Purpose: To develop an analytical model that predicts dose output factors for patient treatment fields in a uniform scanning proton therapy system. Methods: A model to predict output factors for patient specific treatment fields was produced based on the methods developed by Kooy et al. (2003). The Kooy model predicts the output factor based on the ratio of the entrance dose under calibration conditions to that for a given range and modulation corrected for the inverse square effect. Field specific output factors were plotted as a function of a single parameter r, where r = (Range-Modulation)/Modulation. The model targeted user range 1 sub-span 3 through user range 2 sup-span 2 of the IBA uniform scanning proton therapy system. The data set included points measured using the 10 cm and 18 cm snout sizes to eliminate stem effects on the monitor unit chambers. The data was fit using equation 15 from Kooy et al. (2003), and the resulting model was tested against measurements that were not included in the original data set. Results: For the range and sub span investigated, 120 data points were tested against the model prediction. The model predicted the output factor within 2% for 96% of the points tested and within 2.5% for 99% of the points tested. All points were within 3% of the predicted values. Conclusion: Monitor units for patient treatment fields with proton ranges that fall within the tested interval can be predicted using a model based on the methods developed at MGH. With further evaluation, it will be possible to model all user ranges and sub-spans of the IBA system. Further testing is also needed to predict output factors using a 25 cm snout which introduces variable scanning pattern sizes and stem effects on the monitor unit chambers.

  13. Analytic results for massless three-loop form factors

    NASA Astrophysics Data System (ADS)

    Lee, R. N.; Smirnov, A. V.; Smirnov, V. A.

    2010-04-01

    We evaluate, exactly in d, the master integrals contributing to massless threeloop QCD form factors. The calculation is based on a combination of a method recently suggested by one of the authors (R.L.) with other techniques: sector decomposition implemented in FIESTA, the method of Mellin-Barnes representation, and the PSLQ algorithm. Using our results for the master integrals we obtain analytical expressions for two missing constants in the γ-expansion of the two most complicated master integrals and present the form factors in a completely analytic form.

  14. [Featuring pathogenicity factors in biofilm-forming and no-biofilm forming strains of Staphylococcus epidermidis].

    PubMed

    Sidashenko, O I; Voronkova, O S; Sirokvasha, O A; Vinnikov, A I

    2015-01-01

    A comparative study of the manifestation of pathogenicity factors: hemolytic, lipase, letsytinase activity and ability to adhere in 20 film-forming and 17 non-film-forming strains of S. epidermidis. Studying pathogenicity factors of the film-forming strains it was found that complete hemolysis and lipase activity shown was by all the film-forming strains of S. epidermidis, letsytinase activity was observed in 80%. Among the non-film-forming strains complete hemolysis and lipase activity were observed in 89% and letsytinase - 71%. Researched non-film-forming and film-forming strains of S. epidermidis showed the ability to adhere to buccal epithelial cells of humans. Found that all the film-forming strains of S. epidermidis were hight level adgesion, the highest IAM was equal to 11,84. It was found that among non-film-forming strains of S. epidermidis were low-, medium- and hight level adgesion. IAM of non-film-forming strains of S. epidermidis is 3 times lower compared to the IAM of the film-forming strains of human epithelial cells and was 3.2.

  15. Kinetics and Mechanism of Deoxygenation Reactions over Proton-Form and Molybdenum-Modified Zeolite Catalysts

    NASA Astrophysics Data System (ADS)

    Bedard, Jeremy William

    The depletion of fossil fuel resources and the environmental consequences of their use have dictated the development of new sources of energy that are both sustainable and economical. Biomass has emerged as a renewable carbon feedstock that can be used to produce chemicals and fuels traditionally obtained from petroleum. The oxygen content of biomass prohibits its use without modification because oxygenated hydrocarbons are non-volatile and have lower energy content. Chemical processes that eliminate oxygen and keep the carbon backbone intact are required for the development of biomass as a viable chemical feedstock. This dissertation reports on the kinetic and mechanistic studies conducted on high and low temperature catalytic processes for deoxygenation of biomass precursors to produce high-value chemicals and fuels. Low temperature, steady state reaction studies of acetic acid and ethanol were used to identify co-adsorbed acetic acid/ethanol dimers as surface intermediates within specific elementary steps involved in the esterification of acetic acid with ethanol on zeolites. A reaction mechanism involving two dominating surface species, an inactive ethanol dimeric species adsorbed on Bronsted sites inhibiting ester formation and a co-adsorbed complex of acetic acid and ethanol on the active site reacting to produce ethyl acetate, is shown to describe the reaction rate as a function of temperature (323 -- 383 K), acetic acid (0.5 -- 6.0 kPa), and ethanol (5.0 -- 13.0 kPa) partial pressure on proton-form BEA, FER, MFI, and MOR zeolites. Measured differences in rates as a function of zeolite structure and the rigorous interpretation of these differences in terms of esterification rate and equilibrium constants is presented to show that the intrinsic rate constant for the activation of the co-adsorbed complex increases in the order FER < MOR < MFI < BEA. High temperature co-processing of acetic acid, formic acid, or carbon dioxide with methane (CH3COOH/CH4 = 0

  16. Measuring the neutral weak form factors in e-N scattering: the G^0 Expriment

    NASA Astrophysics Data System (ADS)

    King, Paul

    2001-10-01

    The G^0 experiment(JLab experiment E00-006, D.H. Beck, spokesperson.) will measure the parity-violating asymmetries in elastic electron-nucleon scattering. The experiment will be performed in Hall C at Jefferson Lab using a dedicated apparatus, with the first running period planned to begin in the summer of 2002. Using measurements of the electron-proton asymmetries at forward and backward angles and the electron-deuteron asymmetries at backward angles over the momentum transfer range of 0.1 - 1.0 GeV^2/c^2, the vector neutral weak form factors, G_E^Z and G_M^Z, and the effective axial current of the nucleon, G_A^e, will be extracted. Combining the neutral weak and the known electromagnetic form factors allows one to experimentally extract the contributions of u, d, and s quarks to the proton's charge and magnetization distributions. An overview of the physics of the G^0 experiment will be presented.

  17. Protonated paramagnetic redox forms of di-o-quinone bridged with p-phenylene-extended TTF: A EPR spectroscopy study

    PubMed Central

    Chalkov, Nikolay O; Cherkasov, Vladimir K; Abakumov, Gleb A; Starikov, Andrey G

    2016-01-01

    The chemical oxidation and reduction processes of deprotonated, direduced o-quinone-exTTF-o-quinone in protic solvents were studied by EPR spectroscopy. The formation of relatively stable paramagnetic protonated redox forms of the parent triad was very surprising. The character of spin-density distribution in the semiquinone–quinone and semiquinone–catechol redox forms indicates that the p-phenylene-extended tetrathiafulvalene connector provides a quite effective electronic communication channel between dioxolene coordination sites. It was found that the deprotonated, direduced o-quinone-exTTF-o-quinone is capable to reduction of the metal copper in solution. The radical anion species formed in this reaction exists in solution as a solvent-separated ion pair with a copper cation. A character of spin-density distribution in a radical anion species leads to the conclusion that the ligand corresponds to type III of the Robin–Day classification. PMID:28144312

  18. Dirac and Pauli form factors based on consideration of the gluon effect in light-cone wave functions

    NASA Astrophysics Data System (ADS)

    Shojaei, Mohammad Reza; Nikkhoo, Negin Sattary

    2015-11-01

    We discuss Dirac and Pauli form factors based on a generalized parton distribution framework in the range of high momentum transfers of t < 30 GeV2 and calculate the electromagnetic form factors, GE and GM, for the proton. In previous work, Gaussian parameterization has been used in wave functions for calculating electromagnetic form factors at intermediate-high momentum transfers of 1 GeV2 < t < 10 GeV2; in this paper, by considering an improved Gaussian ansatz, we not only calculate the electromagnetic form factors at moderately high momentum transfers t but also can calculate these quantities at high momentum transfers, achieving reasonable agreement with experimental data and other previous work.

  19. Measurements of the Helium Form Factors at JLab

    SciTech Connect

    Khrosinkova, Elena

    2007-10-26

    An experiment to measure elastic electron scattering off {sup 3}He and {sup 4}He at large momentum transfers is presented. The experiment was carried out in the Hall A Facility of Jefferson Lab. Elastic electron scattering off {sup 3}He was measured at forward and backward electron scattering angles to extract the isotope's charge and magnetic form factors. The charge form factor of {sup 4}He will be extracted from forward-angle electron scattering angle measurements. The data are expected to significantly extend and improve the existing measurements of the three- and four-body form factors. The results will be crucial for the establishment of a canonical standard model for the few-body nuclear systems and for testing predictions of quark dimensional scaling and hybrid nucleon-quark models.

  20. Two-loop SL(2) form factors and maximal transcendentality

    NASA Astrophysics Data System (ADS)

    Loebbert, Florian; Sieg, Christoph; Wilhelm, Matthias; Yang, Gang

    2016-12-01

    Form factors of composite operators in the SL(2) sector of N = 4 SYM theory are studied up to two loops via the on-shell unitarity method. The non-compactness of this subsector implies the novel feature and technical challenge of an unlimited number of loop momenta in the integrand's numerator. At one loop, we derive the full minimal form factor to all orders in the dimensional regularisation parameter. At two loops, we construct the complete integrand for composite operators with an arbitrary number of covariant derivatives, and we obtain the remainder functions as well as the dilatation operator for composite operators with up to three covariant derivatives. The remainder functions reveal curious patterns suggesting a hidden maximal uniform transcendentality for the full form factor. Finally, we speculate about an extension of these patterns to QCD.

  1. Proton Conductive Nanosheets Formed by Alignment of Metallo-Supramolecular Polymers.

    PubMed

    Pandey, Rakesh K; Rana, Utpal; Chakraborty, Chanchal; Moriyama, Satoshi; Higuchi, Masayoshi

    2016-06-01

    Linear Fe(II)-based metallo-supramolecular polymer chains were precisely aligned by the simple replacement of the counteranion with an N,N'-bis(4-benzosulfonic acid)perylene-3,4,9,10-tetracarboxylbisimide (PSA) dianion, which linked the polymer chains strongly. A parallel alignment of the polymer chains promoted by the PSA dianions yielded nanosheets formation. The nanosheets' structure was analyzed with FESEM, HRTEM, UV-vis, and XRD in detail. The nanosheets showed more than 5 times higher proton conductivity than the original polymer due to the smooth ionic conduction through the aligned polymer chains. The complex impedance plot with two semicircles also suggested the presence of grain boundaries in the polymer nanosheets.

  2. Solvent Effects on the Absorption Spectra of the para-Coumaric Acid Chromophore in Its Different Protonation Forms.

    PubMed

    García-Prieto, Francisco F; Galván, Ignacio Fdez; Muñoz-Losa, Aurora; Aguilar, Manuel A; Martín, M Elena

    2013-10-08

    The effects of the solvent and protonation state on the electronic absorption spectrum of the para-coumaric acid (pCA), a model of the photoactive yellow protein (PYP), have been studied using the ASEP/MD (averaged solvent electrostatic potential from molecular dynamics) method. Even though, in the protein, the chromophore is assumed to be in its phenolate monoanionic form, when it is found in water solution pH control can favor neutral, monoanionic, and dianionic species. As the pCA has two hydrogens susceptible of deprotonation, both carboxylate and phenolate monoanions are possible. Their relative stabilities are strongly dependent on the medium. In gas phase, the most stable isomer is the phenolate while in aqueous solution it is the carboxylate, although the population of the phenolate form is not negligible. The s-cis, s-trans, syn, and anti conformers have also been included in the study. Electronic excited states of the chromophore have been characterized by SA-CAS(14,12)-PT2/cc-pVDZ level of theory. The bright state corresponds, in all the cases, to a π → π* transition involving a charge displacement in the system. The magnitude and direction of this displacement depends on the protonation state and on the environment (gas phase or solution). In the same way, the calculated solvatochromic shift of the absorption maximum depends on the studied form, being a red shift for the neutral, carboxylate monoanion, and dianionic chromophores and a blue shift for the phenolate monoanion. Finally, the contribution that the solvent electronic polarizability has on the solvent shift was analyzed. It represents a very important part of the total solvent shift in the neutral form, but its contribution is completly negligible in the mono- and dianionic forms.

  3. Master integrals for the four-loop Sudakov form factor

    NASA Astrophysics Data System (ADS)

    Boels, Rutger H.; Kniehl, Bernd A.; Yang, Gang

    2016-01-01

    The light-like cusp anomalous dimension is a universal function in the analysis of infrared divergences. In maximally (N = 4) supersymmetric Yang-Mills theory (SYM) in the planar limit, it is known, in principle, to all loop orders. The non-planar corrections are not known in any theory, with the first appearing at the four-loop order. The simplest quantity which contains this correction is the four-loop two-point form factor of the stress tensor multiplet. This form factor was largely obtained in integrand form in a previous work for N = 4 SYM, up to a free parameter. In this work, a reduction of the appearing integrals obtained by solving integration-by-parts (IBP) identities using a modified version of Reduze is reported. The form factor is shown to be independent of the remaining parameter at integrand level due to an intricate pattern of cancellations after IBP reduction. Moreover, two of the integral topologies vanish after reduction. The appearing master integrals are cross-checked using independent algebraic-geometry techniques explored in the Mint package. The latter results provide the basis of master integrals applicable to generic form factors, including those in Quantum Chromodynamics. Discrepancies between explicitly solving the IBP relations and the MINT approach are highlighted. Remaining bottlenecks to completing the computation of the four-loop non-planar cusp anomalous dimension in N = 4 SYM and beyond are identified.

  4. Pion transition form factor through Dyson-Schwinger equations

    NASA Astrophysics Data System (ADS)

    Raya, Khépani

    2016-10-01

    In the framework of Dyson-Schwinger equations (DSE), we compute the γ*γ→π0 transition form factor, G(Q2). For the first time, in a continuum approach to quantun chromodynamics (QCD), it was possible to compute G(Q2) on the whole domain of space-like momenta. Our result agrees with CELLO, CLEO and Belle collaborations and, with the well- known asymptotic QCD limit, 2ƒπ. Our analysis unifies this prediction with that of the pion's valence-quark parton distribution amplitude (PDA) and elastic electromagnetic form factor.

  5. Measurement of the Charged Pion Electromagnetic Form Factor

    SciTech Connect

    J. Volmer; David Abbott; H. Anklin; Chris Armstrong; John Arrington; K. Assamagan; Steven Avery; Oliver K. Baker; Henk Blok; C. Bochna; Ed Brash; Herbert Breuer; Nicholas Chant; Jim Dunne; Tom Eden; Rolf Ent; David Gaskell; Ron Gilman; Kenneth Gustafsson; Wendy Hinton; Garth Huber; Hal Jackson; Mark K. Jones; Cynthia Keppel; P.H. Kim; Wooyoung Kim; Andi Klein; Doug Koltenuk; Meme Liang; George Lolos; Allison Lung; David Mack; D. McKee; David Meekins; Joseph Mitchell; H. Mkrtchian; B. Mueller; Gabriel Niculescu; Ioana Niculescu; D. Pitz; D. Potterveld; Liming Qin; Juerg Reinhold; I.K. Shin; Stepan Stepanyan; V. Tadevosian; L.G. Tang; R.L.J. van der Meer; K. Vansyoc; D. Van Westrum; Bill Vulcan; Stephen Wood; Chen Yan; W.X. Zhao; Beni Zihlmann

    2001-02-26

    Separated longitudinal and transverse structure functions for the reaction 1H(e,eprime pi+)n were measured in the momentum transfer region Q2=0.6-1.6 (GeV/c)**2 at a value of the invariant mass W=1.95 GeV. New values for the pion charge form factor were extracted from the longitudinal cross section by using a recently developed Regge model. The results indicate that the pion form factor in this region is larger than previously assumed and is consistent with a monopole parameterization fitted to very low Q2 elastic data.

  6. Pion Electromagnetic Form Factor in Virtuality Distribution Formalism

    SciTech Connect

    Radyushkin, Anatoly V.

    2016-01-01

    We discuss two applications of the {\\it Virtuality Distribution Amplitudes} (VDA) formalism developed in our recent papers. We start with an overview of the main properties of the pion distribution amplitude emphasizing the quantitative measures of its width, and possibility to access them through the pion transition form factor studies. We formulate the basic concepts of the VDA approach and introduce the pion {\\it transverse momentum distribution amplitude} (TMDA) which plays, in a covariant Lagrangian formulation, a role similar to that of the pion wave function in the 3-dimensional Hamiltonian light-front approach. We propose simple factorized models for soft TMDAs, and use them to describe existing data on the pion transition form factor, thus fixing the scale determining the size of the transverse-momentum effects. Finally, we apply the VDA approach to the one-gluon exchange contribution for the pion electromagnetic form factor. We observe a very late $Q^2 \\gtrsim 20$ GeV$^2$ onset of transition to the asymptotic pQCD predictions and show that in the $Q^2 \\lesssim 10$ GeV$^2$ region there is essentially no sensitivity to the shape of the pion distribution amplitude. Furthermore, the magnitude of the one-gluon exchange contribution in this region is estimated to be an order of magnitude below the Jefferson Lab data, thus leaving the Feynman mechanism as the only one relevant to the pion electromagnetic form factor behavior for accessible $Q^2$.

  7. Quantitative investigation of physical factors contributing to gold nanoparticle-mediated proton dose enhancement

    NASA Astrophysics Data System (ADS)

    Cho, Jongmin; Gonzalez-Lepera, Carlos; Manohar, Nivedh; Kerr, Matthew; Krishnan, Sunil; Cho, Sang Hyun

    2016-03-01

    Some investigators have shown tumor cell killing enhancement in vitro and tumor regression in mice associated with the loading of gold nanoparticles (GNPs) before proton treatments. Several Monte Carlo (MC) investigations have also demonstrated GNP-mediated proton dose enhancement. However, further studies need to be done to quantify the individual physical factors that contribute to the dose enhancement or cell-kill enhancement (or radiosensitization). Thus, the current study investigated the contributions of particle-induced x-ray emission (PIXE), particle-induced gamma-ray emission (PIGE), Auger and secondary electrons, and activation products towards the total dose enhancement. Specifically, GNP-mediated dose enhancement was measured using strips of radiochromic film that were inserted into vials of cylindrical GNPs, i.e. gold nanorods (GNRs), dispersed in a saline solution (0.3 mg of GNRs/g or 0.03% of GNRs by weight), as well as vials containing water only, before proton irradiation. MC simulations were also performed with the tool for particle simulation code using the film measurement setup. Additionally, a high-purity germanium detector system was used to measure the photon spectrum originating from activation products created from the interaction of protons and spherical GNPs present in a saline solution (20 mg of GNPs/g or 2% of GNPs by weight). The dose enhancement due to PIXE/PIGE recorded on the films in the GNR-loaded saline solution was less than the experimental uncertainty of the film dosimetry (<2%). MC simulations showed highly localized dose enhancement (up to a factor 17) in the immediate vicinity (<100 nm) of GNRs, compared with hypothetical water nanorods (WNRs), mostly due to GNR-originated Auger/secondary electrons; however, the average dose enhancement over the entire GNR-loaded vial was found to be minimal (0.1%). The dose enhancement due to the activation products from GNPs was minimal (<0.1%) as well. In conclusion, under the

  8. Quantitative investigation of physical factors contributing to gold nanoparticle-mediated proton dose enhancement.

    PubMed

    Cho, Jongmin; Gonzalez-Lepera, Carlos; Manohar, Nivedh; Kerr, Matthew; Krishnan, Sunil; Cho, Sang Hyun

    2016-03-21

    Some investigators have shown tumor cell killing enhancement in vitro and tumor regression in mice associated with the loading of gold nanoparticles (GNPs) before proton treatments. Several Monte Carlo (MC) investigations have also demonstrated GNP-mediated proton dose enhancement. However, further studies need to be done to quantify the individual physical factors that contribute to the dose enhancement or cell-kill enhancement (or radiosensitization). Thus, the current study investigated the contributions of particle-induced x-ray emission (PIXE), particle-induced gamma-ray emission (PIGE), Auger and secondary electrons, and activation products towards the total dose enhancement. Specifically, GNP-mediated dose enhancement was measured using strips of radiochromic film that were inserted into vials of cylindrical GNPs, i.e. gold nanorods (GNRs), dispersed in a saline solution (0.3 mg of GNRs/g or 0.03% of GNRs by weight), as well as vials containing water only, before proton irradiation. MC simulations were also performed with the tool for particle simulation code using the film measurement setup. Additionally, a high-purity germanium detector system was used to measure the photon spectrum originating from activation products created from the interaction of protons and spherical GNPs present in a saline solution (20 mg of GNPs/g or 2% of GNPs by weight). The dose enhancement due to PIXE/PIGE recorded on the films in the GNR-loaded saline solution was less than the experimental uncertainty of the film dosimetry (<2%). MC simulations showed highly localized dose enhancement (up to a factor 17) in the immediate vicinity (<100 nm) of GNRs, compared with hypothetical water nanorods (WNRs), mostly due to GNR-originated Auger/secondary electrons; however, the average dose enhancement over the entire GNR-loaded vial was found to be minimal (0.1%). The dose enhancement due to the activation products from GNPs was minimal (<0.1%) as well. In conclusion, under the currently

  9. Spin-2 form factors at three loop in QCD

    NASA Astrophysics Data System (ADS)

    Ahmed, Taushif; Das, Goutam; Mathews, Prakash; Rana, Narayan; Ravindran, V.

    2015-12-01

    Spin-2 fields are often candidates in physics beyond the Standard Model namely the models with extra-dimensions where spin-2 Kaluza-Klein gravitons couple to the fields of the Standard Model. Also, in the context of Higgs searches, spin-2 fields have been studied as an alternative to the scalar Higgs boson. In this article, we present the complete three loop QCD radiative corrections to the spin-2 quark-antiquark and spin-2 gluon-gluon form factors in SU(N) gauge theory with n f light flavors. These form factors contribute to both quark-antiquark and gluon-gluon initiated processes involving spin-2 particle in the hadronic reactions at the LHC. We have studied the structure of infrared singularities in these form factors up to three loop level using Sudakov integro-differential equation and found that the anomalous dimensions originating from soft and collinear regions of the loop integrals coincide with those of the electroweak vector boson and Higgs form factors confirming the universality of the infrared singularities in QCD amplitudes.

  10. Measurement of the pion form factor at higher energies

    SciTech Connect

    Mack, D.J.

    1994-04-01

    One of the strongest arguments for increasing the nominal CEBAF beam energy to equal or exceed 6 GeV is that one would be able to make quality high Q{sup 2} measurements of the charged pion form factor.

  11. Nucleon form factors program with SBS at JLAB

    SciTech Connect

    Wojtsekhowski, Bogdan B.

    2014-12-01

    The physics of the nucleon form factors is the basic part of the Jefferson Laboratory program. We review the achievements of the 6-GeV era and the program with the 12- GeV beam with the SBS spectrometer in Hall A, with a focus on the nucleon ground state properties.

  12. The Super Bigbite Project: A Study of Nucleon Form Factors

    SciTech Connect

    Jager, Kees de

    2010-06-01

    A proposed set of instrumentation, collectively referred to as the Super Bigbite project, is presented. Used in three different con figurations it will allow measurements of three nucleon electromagnetic form factors GEn, GEp, and GMn with unprecedented precision to Q2-values up to three times higher than existing data.

  13. Determination of Transverse Charge Density from Kaon Form Factor Data

    NASA Astrophysics Data System (ADS)

    Mejia-Ott, Johann; Horn, Tanja; Pegg, Ian; Mecholski, Nicholas; Carmignotto, Marco; Ali, Salina

    2016-09-01

    At the level of nucleons making up atomic nuclei, among subatomic particles made up of quarks, K-mesons or kaons represent the most simple hadronic system including the heavier strange quark, having a relatively elementary bound state of a quark and an anti-quark as its valence structure. Its electromagnetic structure is then parametrized by a single, dimensionless quantity known as the form factor, the two-dimensional Fourier transform of which yields the quantity of transverse charge density. Transverse charge density, in turn, provides a needed framework for the interpretation of form factors in terms of physical charge and magnetization, both with respect to the propagation of a fast-moving nucleon. To this is added the value of strange quarks in ultimately presenting a universal, process-independent description of nucleons, further augmenting the importance of studying the kaon's internal structure. The pressing character of such research questions directs the present paper, describing the first extraction of transverse charge density from electromagnetic kaon form factor data. The extraction is notably extended to form factor data at recently acquired higher energy levels, whose evaluation could permit more complete phenomenological models for kaon behavior to be proposed. This work was supported in part by NSF Grant PHY-1306227.

  14. Measurements of Form Factors with the BaBar Experiment

    SciTech Connect

    Li, Selina Z.; /SLAC

    2011-08-25

    Selected recent results on measurements of form factors by the BaBar Collaboration are reviewed, including e{sup +}e{sup -} {yields} {eta}{prime}{gamma}, leptonic and semileptonic charm decays from data collected at or near the {Upsilon}(4S) resonance.

  15. Electromagnetic form factors of heavy flavored vector mesons

    NASA Astrophysics Data System (ADS)

    Priyadarsini, M.; Dash, P. C.; Kar, Susmita; Patra, Sweta P.; Barik, N.

    2016-12-01

    We study the electromagnetic form factors of heavy flavored vector mesons such as (D*,Ds*,J /Ψ ) , (B*,Bs*,ϒ ) via one photon radiative decays (V →P γ ) in the relativistic independent quark (RIQ) model based on a flavor independent average interaction potential in the scalar vector harmonic form. The momentum dependent spacelike (q2<0 ) form factors calculated in this model are analytically continued to the physical timelike region 0 ≤q2≤(MV-MP)2 . The predicted coupling constant gV P γ=FV P(q2=0 ) for real photon case in the limit q2→0 and decay widths Γ (V →P γ ) are found in reasonable agreement with experimental data and other model predictions.

  16. Accessing the Elastic Form-Factors of the $Delta(1232)$ Using the Beam-Normal Asymmetry

    SciTech Connect

    Dalton, Mark M.

    2016-08-01

    The beam-normal single-spin asymmetry, $B_n$, exists in the scattering of high energy electrons, polarized transverse to their direction of motion, from nuclear targets. To first order, this asymmetry is caused by the interference of the one-photon exchange amplitude with the imaginary part of the two-photon exchange amplitude. Measurements of $B_n$, for the production of a $\\Delta(1232)$ resonance from a proton target, will soon become available from the Qweak experiment at Jefferson Lab and the A4 experiment at Mainz. The imaginary part of two-photon exchange allows only intermediate states that are on-shell, including the $\\Delta$ itself. Therefore such data is sensitive to $\\gamma\\Delta\\Delta$, the elastic form-factors of the $\\Delta$. This article will introduce the form-factors of the $\\Delta$, discuss what might be learned about the elastic form-factors from these new data, describe ongoing efforts in calculation and measurement, and outline the possibility of future measurements.

  17. Visible and near-infrared waveguides formed by double-energy proton implantation in magneto-optical glasses

    NASA Astrophysics Data System (ADS)

    Liu, Chun-Xiao; Shen, Xiao-Liang; Zheng, Rui-Lin; Guo, Hai-Tao; Li, Wei-Nan; Wei, Wei

    2017-02-01

    Ion implantation is one of the most competitive methods for the fabrication of optical waveguide structures in optoelectronic materials. Tb3+-doped aluminum borosilicate glass has been demonstrated to be a type of magneto-optical glass with high Verdet constant. In this work, the proton implantation technique with energies of (500 + 550) keV and fluences of (1.0 + 2.0) × 1016 ions/cm2 is performed to form planar waveguides in the Tb3+-doped aluminum borosilicate glass. The guiding modes of the fabricated waveguide were measured by the prism-coupling method at wavelengths of 632.8 and 1539 nm. The near-field light intensity distribution was measured by the end-face coupling method at the wavelength of 632.8 nm and calculated by the finite-difference beam propagation method at both 632.8 and 1539 nm. The optical properties of the double-energy proton-implanted magneto-optical glass waveguides show promise for use as multi-functional integrated optical devices in the visible and near-infrared bands.

  18. Comparative proton nuclear magnetic resonance studies of amantadine complexes formed in aqueous solutions with three major cyclodextrins.

    PubMed

    Lis-Cieplak, Agnieszka; Sitkowski, Jerzy; Kolodziejski, Waclaw

    2014-01-01

    Host-guest complexes of alpha-, beta-, and gamma-cyclodextrins (α-CD, β-CD, and γ-CD, respectively) with amantadine (1-aminoadamantane, AMA; an antiviral agent) were characterized in aqueous solutions using proton nuclear magnetic resonance (NMR) spectroscopy. Host-guest molecular interactions were manifested by changes in the chemical shifts of AMA protons. NMR Job's plots showed that the stoichiometry of all the studied complexes was 1:1. Two-dimensional T-ROESY experiments demonstrated that the complexes were formed by different degrees of incorporation of the adamantyl group of AMA into the CD cavity. The mode of AMA binding was proposed. The AMA molecule came into the α-CD cavity (the smallest size) or β-CD cavity (the intermediate size) through its wide entrance to become shallowly or deeply accommodated, respectively. In the complex of AMA with γ-CD (the largest cavity size), the adamantyl group was also quite deeply inserted into the CD cavity, but it arrived there through the narrow cavity entrance. It was found that the adamantyl group of AMA was best accommodated by the β-CD cavity. The binding constants Kaa of the studied complexes (in M(-1) ), determined from DOSY NMR, were fairly high; their values in an ascending order were: α-CD (183) < γ-CD (306) ≪ β-CD (5150).

  19. The structure of light-front wavefunctions and constraints on hadronic form factors

    SciTech Connect

    S. J. Brodsky; J. R. Hiller; D. S. Hwang; V. A. Karmanov

    2003-11-17

    We study the analytic structure of light-front wave functions (LFWFs) and its consequences for hadron form factors using an explicitly Lorentz-invariant formulation of the front form. The normal to the light front is specified by a general null vector {omega}{sup {mu}}. The LFWFs with definite total angular momentum are eigenstates of a kinematic angular momentum operator and satisfy all Lorentz symmetries. They are analytic functions of the invariant mass squared of the constituents M{sub 0}{sup 2} = ({Sigma} k{sup {mu}}){sup 2} and the light-cone momentum fractions x{sub i} = k{sub i} {center_dot} {omega}/p {center_dot} {omega} multiplied by invariants constructed from the spin matrices, polarization vectors, and {omega}{sup {mu}}. These properties are illustrated using known nonperturbative eigensolutions of the Wick-Cutkosky model. We analyze the LFWFs introduced by Chung and Coester to describe static and low momentum properties of the nucleons. They correspond to the spin-locking of a quark with the spin of its parent nucleon, tog ether with a positive-energy projection constraint. These extra constraints lead to anomalous dependence of form factors on Q rather than Q{sup 2}. In contrast, the dependence of LFWFs on M{sub 0}{sup 2} implies that hadron form factors are analytic functions of Q{sup 2} in agreement with dispersion theory and perturbative QCD. We show that a model incorporating the leading-twist perturbative QCD prediction is consistent with recent data for the ratio of proton Pauli and Dirac form factors.

  20. The effect of pH on the exchangeability with deuterium of protons coupled to molybdenum(V) in the active and the desulpho forms of xanthine oxidase.

    PubMed Central

    Malthouse, J P; Bray, R C

    1983-01-01

    The effect of pH variation on the exchangeability with deuterium of protons strongly coupled to Mo(V) in the active and desulpho forms of xanthine oxidase was studied by e.p.r. and rapid freezing, in extension of the work of Gutteridge, Tanner & Bray [Biochem. J. (1978) 175, 887-897]. Above neutrality, exchange rates increased with increasing pH. Detailed studies were made on the desulpho enzyme under a variety of conditions, and exchange rate constants at 22 degrees C ranged from 0.16s -1 at pH 6.6 to 1.6s -1 at pH 11.3. The mechanism of proton exchange in the enzyme is discussed. The interpretation by the above workers that the strongly coupled proton of the active enzyme is on sulphur and that of the desulpho enzyme is on oxygen remains valid (and is in agreement with other work), as do their proposals for the structures of the protonated and deprotonated species. However, pK values cannot be calculated from the exchange data. It is likely that the relatively low rates of exchange observed are due to the difference of structure between the protonated and the deprotonated forms. In the case of the desulpho enzyme, an exchange mechanism, which involves the proton exchanging both as such and along with oxygen in the form of a hydroxyl ion, is discussed. PMID:6312970

  1. The Proton Radius Puzzle

    NASA Astrophysics Data System (ADS)

    Downie, E. J.

    2016-03-01

    The proton radius puzzle is the difference between the proton radius as measured with electron scattering and in the excitation spectrum of atomic hydrogen, and that measured with muonic hydrogen spectroscopy. Since the inception of the proton radius puzzle in 2010 by the measurement of Pohl et al.[1], many possible resolutions to the puzzle have been postulated, but, to date, none has been generally accepted. New data are therefore necessary to resolve the issue. We briefly review the puzzle, the proposed solutions, and the new electron scattering and spectroscopy experiments planned and underway. We then introduce the MUSE experiment, which seeks to resolve the puzzle by simultaneously measuring elastic electron and muon scattering on the proton, in both charge states, thereby providing new information to the puzzle. MUSE addresses issues of two-photon effects, lepton universality and, possibly, new physics, while providing simultaneous form factor, and therefore radius, measurements with both muons and electrons.

  2. Computational study of some triazole derivatives (un- and protonated forms) and their copper complexes in corrosion inhibition process

    NASA Astrophysics Data System (ADS)

    El Ibrahimi, Brahim; Soumoue, Aziza; Jmiai, Aziz; Bourzi, Hassan; Oukhrib, Rachid; El Mouaden, Khadija; El Issami, Souad; Bazzi, Lahcen

    2016-12-01

    Three triazoles compounds used as corrosion inhibitors for copper in acidic medium, namely: 1,2,4 triazole (TR), 3-amino 1,2,4 triazole (3 ATR) and 3,5-diamino 1,2,4 triazole (3,5 DATR) have been studied theoretically in aim to investigate the correlation between its molecular reactivity indicators and the corresponding inhibition efficiency. All quantum chemical calculations at the B3LYP/6-31+G(d,p) method were performed with and without solvent effect. In the present paper, not only the neutral inhibitors has been studied, but also the first and the second protonation forms. A good correlation between theoretical and experimental data has been obtained both in gas and aqueous phases, notably for unprotonated inhibitors. Also, the interaction energy between inhibitors and copper has been calculated.

  3. Two-photon transition form factor of c ¯ quarkonia

    NASA Astrophysics Data System (ADS)

    Chen, Jing; Ding, Minghui; Chang, Lei; Liu, Yu-xin

    2017-01-01

    The two-photon transition of c ¯c quarkonia are studied within a covariant approach based on the consistent truncation scheme of the quantum chromodynamics Dyson-Schwinger equation for the quark propagator and the Bethe-Salpeter equation for the mesons. We find the decay widths of ηc→γ γ and χc 0 ,2→γ γ in good agreement with experimental data. The obtained transition form factor of ηc→γ γ* for a wide range of spacelike photon-momentum-transfer squared is also in agreement with the experimental findings of the BABAR experiment. As a by-product, the decay widths of ηb,χb 0 ,2→γ γ and the transition form factor of ηb,χc 0 ,b 0→γ γ* are predicted, which await experimental testing.

  4. Octet Baryon Electromagnetic Form Factors in a Relativistic Quark Model

    SciTech Connect

    Gilberto Ramalho, Kazuo Tsushima

    2011-09-01

    We study the octet baryon electromagnetic properties by applying the covariant spectator quark model, and provide covariant parametrization that can be used to study baryon electromagnetic reactions. While we use the lattice QCD data in the large pion mass regime (small pion cloud effects) to determine the parameters of the model in the valence quark sector, we use the nucleon physical and octet baryon magnetic moment data to parameterize the pion cloud contributions. The valence quark contributions for the octet baryon electromagnetic form factors are estimated by extrapolating the lattice parametrization in the large pion mass regime to the physical regime. As for the pion cloud contributions, we parameterize them in a covariant, phenomenological manner, combined with SU(3) symmetry. We also discuss the impact of the pion cloud effects on the octet baryon electromagnetic form factors and their radii.

  5. η' transition form factor from space- and timelike experimental data

    NASA Astrophysics Data System (ADS)

    Escribano, R.; Gonzàlez-Solís, S.; Masjuan, P.; Sanchez-Puertas, P.

    2016-09-01

    The η' transition form factor is reanalyzed in view of the recent first observation by BESIII of the Dalitz decay η'→γ e+e- in both space- and timelike regions at low and intermediate energies using the Padé approximants method. The present analysis provides a suitable parametrization for reproducing the measured form factor in the whole energy region and allows one to extract the corresponding low-energy parameters together with a prediction of their values at the origin, related to Γη'→γ γ , and the asymptotic limit. The η - η' mixing is reassessed within a mixing scheme compatible with the large-Nc chiral perturbation theory at next-to-leading order, with particular attention to the Okubo-Zweig-Iizuka-rule-violating parameters. The J /ψ , Z →η(')γ decays are also considered and predictions are reported.

  6. Two-photon exchange corrections to the pion form factor

    DOE PAGES

    Peter G. Blunden; Melnitchouk, Wally; Tjon, John A.

    2010-01-06

    Here, we compute two-photon exchange corrections to the electromagnetic form factor of the pion, taking into account the finite size of the pion. Compared to the soft-photon approximation for the infrared divergent contribution which neglects hadron structure effects, the corrections are found to be ≲ 1% for small Q2 (Q2 < 0.1 GeV2), but increase to several percent for Q2 ≳ 1 GeV2 at extreme backward angles.

  7. Stackable Form-Factor Peripheral Component Interconnect Device and Assembly

    NASA Technical Reports Server (NTRS)

    Somervill, Kevin M. (Inventor); Ng, Tak-kwong (Inventor); Torres-Pomales, Wilfredo (Inventor); Malekpour, Mahyar R. (Inventor)

    2013-01-01

    A stackable form-factor Peripheral Component Interconnect (PCI) device can be configured as a host controller or a master/target for use on a PCI assembly. PCI device may comprise a multiple-input switch coupled to a PCI bus, a multiplexor coupled to the switch, and a reconfigurable device coupled to one of the switch and multiplexor. The PCI device is configured to support functionality from power-up, and either control function or add-in card function.

  8. Strange vector form factors from parity-violating electron scattering

    SciTech Connect

    Kent Paschke, Anthony Thomas, Robert Michaels, David Armstrong

    2011-06-01

    The simplest models might describe the nucleon as 3 light quarks, but this description would be incomplete without inclusion of the sea of glue and qbar q pairs which binds it. Early indications of a particularly large contribution from strange quarks in this sea to the spin and mass of the nucleon motivated an experimental program examining the role of these strange quarks in the nucleon vector form factors. The strangeness form factors can be extracted from the well-studied electromagnetic structure of the nucleon using parity-violation in electron-nuclear scattering to isolate the effect of the weak interaction. With high luminosity and polarization, and a very stable beam due to its superconducting RF cavities, CEBAF at Jefferson Lab is a precision instrument uniquely well suited to the challenge of measurements of the small parity-violating asymmetries. The techniques and results of the two major Jefferson Lab experimental efforts in parity-violation studies, HAPPEX and G0, as well as efforts to describe the strange form factors in QCD, will be reviewed.

  9. Three-Loop Slope of the Dirac Form Factor and the 1S Lamb Shift in Hydrogen

    SciTech Connect

    Melnikov, Kirill; Ritbergen, Timo van

    2000-02-21

    The last unknown contribution to hydrogen energy levels at order m{alpha}{sup 7} , due to the slope of the Dirac form factor at three loops, is evaluated in a closed analytical form. The resulting shift of the hydrogen nS energy level is found to be 3.016/n{sup 3} kHz . Using the QED calculations of the 1S Lamb shift, we extract a precise value of the proton charge radius r{sub p}=0.883{+-}0.014 fm . (c) 2000 The American Physical Society.

  10. Three-Loop Slope of the Dirac Form Factor and the 1S Lamb Shift in Hydrogen.

    PubMed

    Melnikov, K; van Ritbergen, T

    2000-02-21

    The last unknown contribution to hydrogen energy levels at order mα^{7}, due to the slope of the Dirac form factor at three loops, is evaluated in a closed analytical form. The resulting shift of the hydrogen nS energy level is found to be 3.016/n^{3} kHz. Using the QED calculations of the 1S Lamb shift, we extract a precise value of the proton charge radius r_{p}=0.883±0.014 fm.

  11. Meson Transition Form Factors in Light-Front Holographic QCD

    SciTech Connect

    Brodsky, Stanley J.; Cao, Fu-Guang; de Teramond, Guy F.; /Costa Rica U.

    2011-06-22

    We study the photon-to-meson transition form factors (TFFs) F{sub M{gamma}}(Q{sup 2}) for {gamma}{gamma}* {yields} M using light-front holographic methods. The Chern-Simons action, which is a natural form in 5-dimensional anti-de Sitter (AdS) space, leads directly to an expression for the photon-to-pion TFF for a class of confining models. Remarkably, the predicted pion TFF is identical to the leading order QCD result where the distribution amplitude has asymptotic form. The Chern-Simons form is local in AdS space and is thus somewhat limited in its predictability. It only retains the q{bar q} component of the pion wavefunction, and further, it projects out only the asymptotic form of the meson distribution amplitude. It is found that in order to describe simultaneously the decay process {pi}{sup 0} {yields} {gamma}{gamma} and the pion TFF at the asymptotic limit, a probability for the q{bar q} component of the pion wavefunction P{sub q{bar q}} = 0.5 is required; thus giving indication that the contributions from higher Fock states in the pion light-front wavefunction need to be included in the analysis. The probability for the Fock state containing four quarks (anti-quarks) which follows from analyzing the hadron matrix elements, P{sub q{bar q}q{bar q}} {approx} 10%, agrees with the analysis of the pion elastic form factor using light-front holography including higher Fock components in the pion wavefunction. The results for the TFFs for the {eta} and {eta}{prime} mesons are also presented. The rapid growth of the pion TFF exhibited by the BABAR data at high Q{sup 2} is not compatible with the models discussed in this article, whereas the theoretical calculations are in agreement with the experimental data for the {eta} and {eta}{prime} TFFs.

  12. Neutron charge radius and the neutron electric form factor

    SciTech Connect

    Gentile, T. R.; Crawford, C. B.

    2011-05-15

    For nearly forty years, the Galster parametrization has been employed to fit existing data for the neutron electric form factor, G{sub E}{sup n}, vs the square of the four-momentum transfer, Q{sup 2}. Typically this parametrization is constrained to be consistent with experimental data for the neutron charge radius. However, we find that the Galster form does not have sufficient freedom to accommodate reasonable values of the radius without constraining or compromising the fit. In addition, the G{sub E}{sup n} data are now at sufficient precision to motivate a two-parameter fit (or three parameters if we include thermal neutron data). Here we present a modified form of a two-dipole parametrization that allows this freedom and fits both G{sub E}{sup n} (including recent data at both low and high four-momentum transfer) and the charge radius well with simple, well-defined parameters. Analysis reveals that the Galster form is essentially a two-parameter approximation to the two-dipole form but becomes degenerate if we try to extend it naturally to three parameters.

  13. Mechanistic insights into protonation state as a critical factor in hFPPS enzyme inhibition

    NASA Astrophysics Data System (ADS)

    Fernández, David; Ortega-Castro, Joaquin; Mariño, Laura; Perelló, Joan; Frau, Juan

    2015-07-01

    Zoledronate and risedronate are the most powerful available nitrogen-containing bisphosphonates used in the treatment of bone-resorption disorders. Knowledge about inhibition mechanisms of these molecules is based on available crystallographic structures of human farnesyl pyrophosphate synthase (hFPPS). However, there is a lack of information explaining the inhibition potency of these two molecules compared to the natural substrate, dimethylallyl pyrophosphate. We carried out a molecular dynamics study that shown: (1) that NBPs potency is related to higher electrostatic interactions with the metallic cluster of the active site than to the natural substrate, and (2) the protonation of the R2 side chain is a critical factor to stabilize the NBPs into a closely irreversible ternary complex with the hFPPS.

  14. Delirium in the geriatric unit: proton-pump inhibitors and other risk factors

    PubMed Central

    Otremba, Iwona; Wilczyński, Krzysztof; Szewieczek, Jan

    2016-01-01

    Background Delirium remains a major nosocomial complication of hospitalized elderly. Predictive models for delirium may be useful for identification of high-risk patients for implementation of preventive strategies. Objective Evaluate specific factors for development of delirium in a geriatric ward setting. Methods Prospective cross-sectional study comprised 675 consecutive patients aged 79.2±7.7 years (66% women and 34% men), admitted to the subacute geriatric ward of a multiprofile university hospital after exclusion of 113 patients treated with antipsychotic medication because of behavioral disorders before admission. Comprehensive geriatric assessments including a structured interview, physical examination, geriatric functional assessment, blood sampling, ECG, abdominal ultrasound, chest X-ray, Confusion Assessment Method for diagnosis of delirium, Delirium-O-Meter to assess delirium severity, Richmond Agitation-Sedation Scale to assess sedation or agitation, visual analog scale and Doloplus-2 scale to assess pain level were performed. Results Multivariate logistic regression analysis revealed five independent factors associated with development of delirium in geriatric inpatients: transfer between hospital wards (odds ratio [OR] =2.78; confidence interval [CI] =1.54–5.01; P=0.001), preexisting dementia (OR =2.29; CI =1.44–3.65; P<0.001), previous delirium incidents (OR =2.23; CI =1.47–3.38; P<0.001), previous fall incidents (OR =1.76; CI =1.17–2.64; P=0.006), and use of proton-pump inhibitors (OR =1.67; CI =1.11–2.53; P=0.014). Conclusion Transfer between hospital wards, preexisting dementia, previous delirium incidents, previous fall incidents, and use of proton-pump inhibitors are predictive of development of delirium in the geriatric inpatient setting. PMID:27103793

  15. Clostridial pore-forming toxins: powerful virulence factors.

    PubMed

    Popoff, Michel R

    2014-12-01

    Pore formation is a common mechanism of action for many bacterial toxins. More than one third of clostridial toxins are pore-forming toxins (PFTs) belonging to the β-PFT class. They are secreted as soluble monomers rich in β-strands, which recognize a specific receptor on target cells and assemble in oligomers. Then, they undergo a conformational change leading to the formation of a β-barrel, which inserts into the lipid bilayer forming functional pore. According to their structure, clostridial β-PFTs are divided into several families. Clostridial cholesterol-dependent cytolysins form large pores, which disrupt the plasma membrane integrity. They are potent virulence factors mainly involved in myonecrosis. Clostridial heptameric β-PFTs (aerolysin family and staphylococcal α-hemolysin family) induce small pores which trigger signaling cascades leading to different cell responses according to the cell types and toxins. They are mainly responsible for intestinal diseases, like necrotic enteritis, or systemic diseases/toxic shock from intestinal origin. Clostridial intracellularly active toxins exploit pore formation through the endosomal membrane to translocate the enzymatic component or domain into the cytosol. Single chain protein toxins, like botulinum and tetanus neurotoxins, use hydrophobic α-helices to form pores, whereas clostridial binary toxins encompass binding components, which are structurally and functionally related to β-PFTs, but which have acquired the specific activity to internalize their corresponding enzymatic components. Structural analysis suggests that β-PFTs and binding components share a common evolutionary origin.

  16. Dispersive analysis of the scalar form factor of the nucleon

    NASA Astrophysics Data System (ADS)

    Hoferichter, M.; Ditsche, C.; Kubis, B.; Meißner, U.-G.

    2012-06-01

    Based on the recently proposed Roy-Steiner equations for pion-nucleon ( πN) scattering [1], we derive a system of coupled integral equations for the π π to overline N N and overline K K to overline N N S-waves. These equations take the form of a two-channel Muskhelishvili-Omnès problem, whose solution in the presence of a finite matching point is discussed. We use these results to update the dispersive analysis of the scalar form factor of the nucleon fully including overline K K intermediate states. In particular, we determine the correction {Δ_{σ }} = σ ( {2M_{π }^2} ) - {σ_{{π N}}} , which is needed for the extraction of the pion-nucleon σ term from πN scattering, as a function of pion-nucleon subthreshold parameters and the πN coupling constant.

  17. Proton Gradients as a Key Physical Factor in the Evolution of the Forced Transport Mechanism Across the Lipid Membrane.

    PubMed

    Strbak, Oliver; Kanuchova, Zuzana; Krafcik, Andrej

    2016-11-01

    A critical phase in the transition from prebiotic chemistry to biological evolution was apparently an asymmetric ion flow across the lipid membrane. Due to imbalance in the ion flow, the early lipid vesicles could selectively take the necessary molecules from the environment, and release the side-products from the vesicle. Natural proton gradients played a definitively crucial role in this process, since they remain the basis of energy transfer in the present-day cells. On the basis of this supposition, and the premise of the early vesicle membrane's impermeability to protons, we have shown that the emergence of the proton gradient in the lipid vesicle could be a key physical factor in the evolution of the forced transport mechanism (pore formation and active transport) across the lipid bilayer. This driven flow of protons across the membrane is the result of the electrochemical proton gradient and osmotic pressures on the integrity of the lipid vesicle. At a critical number of new lipid molecules incorporated into the vesicle, the energies associated with the creation of the proton gradient exceed the bending stiffness of the lipid membrane, and overlap the free energy of the lipid bilayer pore formation.

  18. Effects of a granulocyte colony stimulating factor, Neulasta, in mini pigs exposed to total body proton irradiation

    PubMed Central

    Sanzari, Jenine K.; Krigsfeld, Gabriel S.; Shuman, Anne L.; Diener, Antonia K.; Lin, Liyong; Mai, Wilfried; Kennedy, Ann R.

    2015-01-01

    Astronauts could be exposed to solar particle event (SPE) radiation, which is comprised mostly of proton radiation. Proton radiation is also a treatment option for certain cancers. Both astronauts and clinical patients exposed to ionizing radiation are at risk for white blood cell (WBC) loss, which are the body’s main defense against infection. In this report, the effect of Neulasta treatment, a granulocyte colony stimulating factor, after proton radiation exposure is discussed. Mini pigs exposed to total body proton irradiation at a dose of 2 Gy received 4 treatments of either Neulasta or saline injections. Peripheral blood cell counts and thromboelastography parameters were recorded up to 30 days post-irradiation. Neulasta significantly improved white blood cell (WBC), specifically neutrophil, loss in irradiated animals by approximately 60% three days after the first injection, compared to the saline treated irradiated animals. Blood cell counts quickly decreased after the last Neulasta injection, suggesting a transient effect on WBC stimulation. Statistically significant changes in hemostasis parameters were observed after proton radiation exposure in both the saline and Neulasta treated irradiated groups, as well internal organ complications such as pulmonary changes. In conclusion, Neulasta treatment temporarily alleviates proton radiation-induced WBC loss, but has no effect on altered hemostatic responses. PMID:25909052

  19. Proton Gradients as a Key Physical Factor in the Evolution of the Forced Transport Mechanism Across the Lipid Membrane

    NASA Astrophysics Data System (ADS)

    Strbak, Oliver; Kanuchova, Zuzana; Krafcik, Andrej

    2016-11-01

    A critical phase in the transition from prebiotic chemistry to biological evolution was apparently an asymmetric ion flow across the lipid membrane. Due to imbalance in the ion flow, the early lipid vesicles could selectively take the necessary molecules from the environment, and release the side-products from the vesicle. Natural proton gradients played a definitively crucial role in this process, since they remain the basis of energy transfer in the present-day cells. On the basis of this supposition, and the premise of the early vesicle membrane's impermeability to protons, we have shown that the emergence of the proton gradient in the lipid vesicle could be a key physical factor in the evolution of the forced transport mechanism (pore formation and active transport) across the lipid bilayer. This driven flow of protons across the membrane is the result of the electrochemical proton gradient and osmotic pressures on the integrity of the lipid vesicle. At a critical number of new lipid molecules incorporated into the vesicle, the energies associated with the creation of the proton gradient exceed the bending stiffness of the lipid membrane, and overlap the free energy of the lipid bilayer pore formation.

  20. Effects of a granulocyte colony stimulating factor, Neulasta, in mini pigs exposed to total body proton irradiation

    NASA Astrophysics Data System (ADS)

    Sanzari, Jenine K.; Krigsfeld, Gabriel S.; Shuman, Anne L.; Diener, Antonia K.; Lin, Liyong; Mai, Wilfried; Kennedy, Ann R.

    2015-04-01

    Astronauts could be exposed to solar particle event (SPE) radiation, which is comprised mostly of proton radiation. Proton radiation is also a treatment option for certain cancers. Both astronauts and clinical patients exposed to ionizing radiation are at risk for loss of white blood cells (WBCs), which are the body's main defense against infection. In this report, the effect of Neulasta treatment, a granulocyte colony stimulating factor, after proton radiation exposure is discussed. Mini pigs exposed to total body proton irradiation at a dose of 2 Gy received 4 treatments of either Neulasta or saline injections. Peripheral blood cell counts and thromboelastography parameters were recorded up to 30 days post-irradiation. Neulasta significantly improved WBC loss, specifically neutrophils, in irradiated animals by approximately 60% three days after the first injection, compared to the saline treated, irradiated animals. Blood cell counts quickly decreased after the last Neulasta injection, suggesting a transient effect on WBC stimulation. Statistically significant changes in hemostasis parameters were observed after proton radiation exposure in both the saline and Neulasta treated irradiated groups, as well as internal organ complications such as pulmonary changes. In conclusion, Neulasta treatment temporarily alleviates proton radiation-induced WBC loss, but has no effect on altered hemostatic responses.

  1. Two-photon exchange corrections to the pion form factor

    SciTech Connect

    Peter G. Blunden; Melnitchouk, Wally; Tjon, John A.

    2010-01-06

    Here, we compute two-photon exchange corrections to the electromagnetic form factor of the pion, taking into account the finite size of the pion. Compared to the soft-photon approximation for the infrared divergent contribution which neglects hadron structure effects, the corrections are found to be ≲ 1% for small Q2 (Q2 < 0.1 GeV2), but increase to several percent for Q2 ≳ 1 GeV2 at extreme backward angles.

  2. Neutral pion form factor measurement by the NA62 experiment

    NASA Astrophysics Data System (ADS)

    Pepe, Monica

    2017-03-01

    The NA62 experiment at CERN collected a large sample of charged kaon decays with a highly efficient trigger for decays into electrons in 2007. A measurement of the electromagnetic transition form factor slope of the neutral pion in the time-like region from about one million fully reconstructed π0 Dalitz decays is presented. The limits on dark photon production from a sample of about 1.7 × 107 π0 Dalitz decays collected in 2003-2004 by the earlier kaon experiment at CERN NA48/2 are also reported.

  3. CEBAF at higher energies and the kaon electromagnetic form factor

    SciTech Connect

    Baker, O.K.

    1994-04-01

    The electromagnetic production of strangeness, the physics of exciting systems having strangeness degrees of freedom (production of hadrons with one or more strange constituent quarks) using electromagnetic probes (real or virtual photons), is one of the frontier areas of research which will be investigated at the Continuous Electron Beam Accelerator Facility (CEBAF) when it becomes operational. CEBAF is expected to have an important impact upon this field of research using its specialized set of detection instruments and high quality electron beam. This paper focusses upon one aspect of the associated production of strangeness - the determination of the kaon electromagnetic form factor at high squared momentum transfers.

  4. The impact of s-bar{s} asymmetry on the strange electromagnetic form factor

    NASA Astrophysics Data System (ADS)

    Ghasempour Nesheli, Ali

    2016-09-01

    The existence of the strange quark asymmetry in the nucleon sea has been indicated by both the experimental and theoretical analyses. Although it is well known that the s-bar{{s}} asymmetry is important for some processes in high-energy hadron collisions, it has also been indicated that it can be related to the strange Dirac form factor F 1 s. In this work, we have studied the impact of s- bar{{s}} asymmetry and its uncertainty from various modern parton distribution functions (PDFs) on F 1 s and compared the obtained results with the available experimental information. As a result, we found that the uncertainty in F 1 s( t) due to the s( x) - bar{s}( x) distribution is rather large so that it dominates the model uncertainty at all values of the squared momentum transfer t. However, taking into account the uncertainties, the theoretical predictions of F 1 s( t) are fully compatible with the estimate extracted from experiment. We concluded that the future accurate experimental data of the strange Dirac form factor might be used to put direct constraints on the strange content of the proton and reduce its uncertainty that has always been a challenge.

  5. Measurement of the Λb0 decay form factor

    NASA Astrophysics Data System (ADS)

    Abdallah, J.; Abreu, P.; Adam, W.; Adzic, P.; Albrecht, T.; Alderweireld, T.; Alemany-Fernandez, R.; Allmendinger, T.; Allport, P. P.; Amaldi, U.; Amapane, N.; Amato, S.; Anashkin, E.; Andreazza, A.; Andringa, S.; Anjos, N.; Antilogus, P.; Apel, W.-D.; Arnoud, Y.; Ask, S.; Asman, B.; Augustin, J. E.; Augustinus, A.; Baillon, P.; Ballestrero, A.; Bambade, P.; Barbier, R.; Bardin, D.; Barker, G.; Baroncelli, A.; Battaglia, M.; Baubillier, M.; Becks, K.-H.; Begalli, M.; Behrmann, A.; Ben-Haim, E.; Benekos, N.; Benvenuti, A.; Berat, C.; Berggren, M.; Berntzon, L.; Bertrand, D.; Besancon, M.; Besson, N.; Bloch, D.; Blom, M.; Bluj, M.; Bonesini, M.; Boonekamp, M.; Booth, P. S. L.; Borisov, G.; Botner, O.; Bouquet, B.; Bowcock, T. J. V.; Boyko, I.; Bracko, M.; Brenner, R.; Brodet, E.; Bruckman, P.; Brunet, J. M.; Bugge, L.; Buschmann, P.; Calvi, M.; Camporesi, T.; Canale, V.; Carena, F.; Castro, N.; Cavallo, F.; Chapkin, M.; Charpentier, Ph.; Checchia, P.; Chierici, R.; Chliapnikov, P.; Chudoba, J.; Chung, S. U.; Cieslik, K.; Collins, P.; Contri, R.; Cosme, G.; Cossutti, F.; Costa, M. J.; Crawley, B.; Crennell, D.; Cuevas, J.; D'Hondt, J.; Dalmau, J.; da Silva, T.; da Silva, W.; Della Ricca, G.; de Angelis, A.; de Boer, W.; de Clercq, C.; de Lotto, B.; de Maria, N.; de Min, A.; de Paula, L.; di Ciaccio, L.; di Simone, A.; Doroba, K.; Drees, J.; Dris, M.; Eigen, G.; Ekelof, T.; Ellert, M.; Elsing, M.; Espirito Santo, M. C.; Fanourakis, G.; Fassouliotis, D.; Feindt, M.; Fernandez, J.; Ferrer, A.; Ferro, F.; Flagmeyer, U.; Foeth, H.; Fokitis, E.; Fulda-Quenzer, F.; Fuster, J.; Gandelman, M.; Garcia, C.; Gavillet, Ph.; Gazis, E.; Gokieli, R.; Golob, B.; Gomez-Ceballos, G.; Goncalves, P.; Graziani, E.; Grosdidier, G.; Grzelak, K.; Guy, J.; Haag, C.; Hallgren, A.; Hamacher, K.; Hamilton, K.; Haug, S.; Hauler, F.; Hedberg, V.; Hennecke, M.; Herr, H.; Hoffman, J.; Holmgren, S.-O.; Holt, P. J.; Houlden, M. A.; Hultqvist, K.; Jackson, J. N.; Jarlskog, G.; Jarry, P.; Jeans, D.; Johansson, E. K.; Johansson, P. D.; Jonsson, P.; Joram, C.; Jungermann, L.; Kapusta, F.; Katsanevas, S.; Katsoufis, E.; Kernel, G.; Kersevan, B. P.; Kerzel, U.; Kiiskinen, A.; King, B. T.; Kjaer, N. J.; Kluit, P.; Kokkinias, P.; Kourkoumelis, C.; Kouznetsov, O.; Krumstein, Z.; Kucharczyk, M.; Lamsa, J.; Leder, G.; Ledroit, F.; Leinonen, L.; Leitner, R.; Lemonne, J.; Lepeltier, V.; Lesiak, T.; Liebig, W.; Liko, D.; Lipniacka, A.; Lopes, J. H.; Lopez, J. M.; Loukas, D.; Lutz, P.; Lyons, L.; MacNaughton, J.; Malek, A.; Maltezos, S.; Mandl, F.; Marco, J.; Marco, R.; Marechal, B.; Margoni, M.; Marin, J.-C.; Mariotti, C.; Markou, A.; Martinez-Rivero, C.; Masik, J.; Mastroyiannopoulos, N.; Matorras, F.; Matteuzzi, C.; Mazzucato, F.; Mazzucato, M.; McNulty, R.; Meroni, C.; Meyer, W. T.; Miagkov, A.; Migliore, E.; Mitaroff, W.; Mjoernmark, U.; Moa, T.; Moch, M.; Moenig, K.; Monge, R.; Montenegro, J.; Moraes, D.; Moreno, S.; Morettini, P.; Mueller, U.; Muenich, K.; Mulders, M.; Mundim, L.; Murray, W.; Muryn, B.; Myatt, G.; Myklebust, T.; Nassiakou, M.; Navarria, F.; Nawrocki, K.; Nicolaidou, R.; Nikolenko, M.; Oblakowska-Mucha, A.; Obraztsov, V.; Olshevski, A.; Onofre, A.; Orava, R.; Osterberg, K.; Ouraou, A.; Oyanguren, A.; Paganoni, M.; Paiano, S.; Palacios, J. P.; Palka, H.; Papadopoulou, Th. D.; Pape, L.; Parkes, C.; Parodi, F.; Parzefall, U.; Passeri, A.; Passon, O.; Peralta, L.; Perepelitsa, V.; Perrotta, A.; Petrolini, A.; Piedra, J.; Pieri, L.; Pierre, F.; Pimenta, M.; Piotto, E.; Podobnik, T.; Poireau, V.; Pol, M. E.; Polok, G.; Poropat, P.; Pozdniakov, V.; Pukhaeva, N.; Pullia, A.; Rames, J.; Ramler, L.; Read, A.; Rebecchi, P.; Rehn, J.; Reid, D.; Reinhardt, R.; Renton, P.; Richard, F.; Ridky, J.; Rivero, M.; Rodriguez, D.; Romero, A.; Ronchese, P.; Rosenberg, E.; Roudeau, P.; Rovelli, T.; Ruhlmann-Kleider, V.; Ryabtchikov, D.; Sadovsky, A.; Salmi, L.; Salt, J.; Savoy-Navarro, A.; Schwickerath, U.; Segar, A.; Sekulin, R.; Siebel, M.; Sisakian, A.; Smadja, G.; Smirnova, O.; Sokolov, A.; Sopczak, A.; Sosnowski, R.; Spassov, T.; Stanitzki, M.; Stocchi, A.; Strauss, J.; Stugu, B.; Szczekowski, M.; Szeptycka, M.; Szumlak, T.; Tabarelli, T.; Taffard, A. C.; Tegenfeldt, F.; Timmermans, J.; Tkatchev, L.; Tobin, M.; Todorovova, S.; Tome, B.; Tonazzo, A.; Tortosa, P.; Travnicek, P.; Treille, D.; Tristram, G.; Trochimczuk, M.; Troncon, C.; Turluer, M.-L.; Tyapkin, I. A.; Tyapkin, P.; Tzamarias, S.; Uvarov, V.; Valenti, G.; van Dam, P.; van Eldik, J.; van Lysebetten, A.; van Remortel, N.; van Vulpen, I.; Vegni, G.; Veloso, F.; Venus, W.; Verdier, P.; Verzi, V.; Vilanova, D.; Vitale, L.; Vrba, V.; Wahlen, H.; Washbrook, A. J.; Weiser, C.; Wicke, D.; Wickens, J.; Wilkinson, G.; Winter, M.; Witek, M.; Yushchenko, O.; Zalewska, A.; Zalewski, P.; Zavrtanik, D.; Zhuravlov, V.; Zimin, N. I.; Zintchenko, A.; Zupan, M.; Delphi Collaboration

    2004-04-01

    The form factor of Λb0 baryons is estimated using 3.46×106 hadronic Z decays collected by the DELPHI experiment between 1992 and 1995. Charmed Λc+ baryons fully reconstructed in the pK-π+, pK0S, and Λπ+π+π- modes, are associated to a lepton with opposite charge in order to select Λb0→Λc+l-ν¯l decays. From a combined likelihood and event rate fit to the distribution of the Isgur-Wise variable w, and using the Heavy Quark Effective Theory (HQET), the slope of the b-baryon form factor is measured to be ρ̂2=2.03±0.46(stat)+0.72-1.00(syst). The exclusive semileptonic branching fraction Br(Λb0→Λc+l-ν¯l) can be derived from ρ̂2 and is found to be (5.0+1.1-0.8(stat)+1.6-1.2(syst))%. Limits on other branching fractions are also obtained.

  6. An experiment for the direct determination of the g-factor of a single proton in a Penning trap

    NASA Astrophysics Data System (ADS)

    Rodegheri, C. C.; Blaum, K.; Kracke, H.; Kreim, S.; Mooser, A.; Quint, W.; Ulmer, S.; Walz, J.

    2012-06-01

    A new apparatus has been designed that aims at a direct precision measurement of the g-factor of a single isolated proton or antiproton in a Penning trap. We present a thorough discussion on the trap design and a method for the experimental trap optimization using a single stored proton. A first attempt at the g-factor determination has been made in a section of the trap with a magnetic bottle. The Larmor frequency of the proton has been measured with a relative uncertainty of 1.8 × 10-6 and the magnetic moment has been determined with a relative uncertainty of 8.9 × 10-6. A g-factor of 5.585 696(50) has been obtained, which is in excellent agreement with previous measurements and predictions. Future experiments shall drive the spin-flip transition in a section of the trap with a homogeneous magnetic field. This has the potential to improve the precision of the measured g-factor of the proton and the antiproton by several orders of magnitude.

  7. Algebraic approach to form factors in the complex sinh-Gordon theory

    NASA Astrophysics Data System (ADS)

    Lashkevich, Michael; Pugai, Yaroslav

    2017-01-01

    We study form factors of the quantum complex sinh-Gordon theory in the algebraic approach. In the case of exponential fields the form factors can be obtained from the known form factors of the ZN-symmetric Ising model. The algebraic construction also provides an Ansatz for form factors of descendant operators. We obtain generating functions of such form factors and establish their main properties: the cluster factorization and reflection equations.

  8. Lattice calculation of composite dark matter form factors

    NASA Astrophysics Data System (ADS)

    Appelquist, T.; Brower, R. C.; Buchoff, M. I.; Cheng, M.; Cohen, S. D.; Fleming, G. T.; Kiskis, J.; Lin, M. F.; Neil, E. T.; Osborn, J. C.; Rebbi, C.; Schaich, D.; Schroeder, C.; Syritsyn, S.; Voronov, G.; Vranas, P.; Wasem, J.

    2013-07-01

    Composite dark matter candidates, which can arise from new strongly-coupled sectors, are well-motivated and phenomenologically interesting, particularly in the context of asymmetric generation of the relic density. In this work, we employ lattice calculations to study the electromagnetic form factors of electroweak-neutral dark-matter baryons for a three-color, QCD-like theory with Nf=2 and 6 degenerate fermions in the fundamental representation. We calculate the (connected) charge radius and anomalous magnetic moment, both of which can play a significant role for direct detection of composite dark matter. We find minimal Nf dependence in these quantities. We generate mass-dependent cross sections for dark matter-nucleon interactions and use them in conjunction with experimental results from XENON100, excluding dark matter candidates of this type with masses below 10 TeV.

  9. The Spectral Form Factor Is Not Self-Averaging

    SciTech Connect

    Prange, R.

    1997-03-01

    The form factor, k(t), is the spectral statistic which best displays nonuniversal quasiclassical deviations from random matrix theory. Recent estimations of k(t) for a single spectrum found interesting new effects of this type. It was supposed that k(t) is {ital self-averaging} and thus did not require an ensemble average. We here argue that this supposition sometimes fails and that for many important systems an ensemble average is essential to see detailed properties of k(t). In other systems, notably the nontrivial zeros of Riemann zeta function, it will be possible to see the nonuniversal properties by an analysis of a single spectrum. {copyright} {ital 1997} {ital The American Physical Society}

  10. Meson Form Factors and Deep Exclusive Meson Production Experiments

    NASA Astrophysics Data System (ADS)

    Horn, Tanja

    2017-03-01

    Pion and kaon electroproduction data play a unique role in Nature and our understanding of them is essential for explaining hadron structure. Precision longitudinaltransverse separated pion and kaon cross sections are of particular interest. They allow for the extraction of meson form factors and validation of understanding of hard exclusive and semi-inclusive reactions (π+, K+, π0, γ) towards 3D hadron imaging and potential future flavor decomposition. We review recent data and present prospects for deep exclusive pion and kaon electroproduction at the 12 GeV Jefferson Lab including the prospects to use projected charged- and neutral pion data to further determine the spin, charge-parity and flavor of GPDs, including the helicity-flip GPDs.

  11. PCMCIA-like ultrasmall form-factor optical drive

    NASA Astrophysics Data System (ADS)

    Kim, Sookyung; Lee, Jungkyu; Park, Jinmoo; Park, Gunsoon; Lee, Jeonguk; Lee, Choongwoo; Son, Do-Hyeon; Kim, Jin-Yong; Kim, Seong-hyok; Yee, Youngjoo

    2003-09-01

    A prototype of ultra small optical drive was studied and developed in order to see the feasibility of mobile application, which is targeted to be attachable into the PCMCIA II slot in small mobile devices. A new design and fabrication technology of optical flying head (OFH) for first surface MO recording was studied, and an effective OFH precisely equipped with high NA lens and MO coil was developed based on miniaturization technology. Design consideration of small form factor optical drive is discussed. Some technical issues and barriers in designing and manufacturing the OFH are introduced. Head-disk interface for reliability and flying stability on plastic disk media was tested and evaluated. Basic tracking and read-write performances in a test bed system were tested.

  12. Thin and small form factor cells : simulated behavior.

    SciTech Connect

    Clews, Peggy Jane; Pluym, Tammy; Grubbs, Robert K.; Cruz-Campa, Jose Luis; Zubia, David; Young, Ralph Watson; Okandan, Murat; Gupta, Vipin P.; Nielson, Gregory N.; Resnick, Paul James

    2010-07-01

    Thin and small form factor cells have been researched lately by several research groups around the world due to possible lower assembly costs and reduced material consumption with higher efficiencies. Given the popularity of these devices, it is important to have detailed information about the behavior of these devices. Simulation of fabrication processes and device performance reveals some of the advantages and behavior of solar cells that are thin and small. Three main effects were studied: the effect of surface recombination on the optimum thickness, efficiency, and current density, the effect of contact distance on the efficiency for thin cells, and lastly the effect of surface recombination on the grams per Watt-peak. Results show that high efficiency can be obtained in thin devices if they are well-passivated and the distance between contacts is short. Furthermore, the ratio of grams per Watt-peak is greatly reduced as the device is thinned.

  13. Semi-analytical model for output factor calculations in proton beam therapy with consideration for the collimator aperture edge.

    PubMed

    Kase, Yuki; Yamashita, Haruo; Sakama, Makoto; Mizota, Manabu; Maeda, Yoshikazu; Tameshige, Yuji; Murayama, Shigeyuki

    2015-08-07

    In the development of an external radiotherapy treatment planning system, the output factor (OPF) is an important value for the monitor unit calculations. We developed a proton OPF calculation model with consideration for the collimator aperture edge to account for the dependence of the OPF on the collimator aperture and distance in proton beam therapy. Five parameters in the model were obtained by fitting with OPFs measured by a pinpoint chamber with the circular radiation fields of various field radii and collimator distances. The OPF model calculation using the fitted model parameters could explain the measurement results to within 1.6% error in typical proton treatment beams with 6- and 12 cm SOBP widths through a range shifter and a circular aperture more than 10.6 mm in radius. The calibration depth dependences of the model parameters were approximated by linear or quadratic functions. The semi-analytical OPF model calculation was tested with various MLC aperture shapes that included circles of various sizes as well as a rectangle, parallelogram, and L-shape for an intermediate proton treatment beam condition. The pre-calculated OPFs agreed well with the measured values, to within 2.7% error up to 620 mm in the collimator distance, though the maximum difference was 5.1% in the case of the largest collimator distance of 740 mm. The OPF calculation model would allow more accurate monitor unit calculations for therapeutic proton beams within the expected range of collimator conditions in clinical use.

  14. Medium effect on the nuclear modification factor of protons and pions in intermediate-energy heavy ion collisions

    NASA Astrophysics Data System (ADS)

    Lv, M.; Ma, Y. G.; Chen, J. H.; Fang, D. Q.; Zhang, G. Q.

    2017-02-01

    Nuclear modification factors Rcp of protons and pions are investigated by simulating Au+Au collisions from 0.8 A to 1.8 A GeV in a framework of an isospin-dependent quantum molecular dynamics (IQMD) model. The Rcp of protons rise with an increase in the transverse particle momentum pT at different beam energies owing to radial flow and the multiple-collision effect. The rate of increase of Rcp is suppressed at higher beam energies. While the Rcp of pions display weaker pT dependence. By changing the in-medium nucleon-nucleon cross section, the Rcp of protons change a lot, while the Rcp of pions do not. In addition, by deactivating the N Δ →N N and π N →Δ channels, the Rcp of protons change slightly in their increasing rates compared with the "original" case (with these two channels). However, the Rcp of pions is shifted down for the "no N Δ →N N " case and has an inverse trend for the "no π N →Δ " case. Based on these observations, we argue that the observable Rcp is a suitable tool to better distinguish in-medium effects of protons and pions.

  15. Third Zemach moment of the proton

    SciTech Connect

    Ian C. Cloet, Gerald A. Miller

    2011-01-01

    Modern electron scattering experiments have determined the proton electric form factor, G_{Ep}(Q^2), to high precision. We utilize this data, represented by the different form factor parametrizations, to compute the third Zemach moment of the proton charge distribution. We find that existing data rule out a value of the third Zemach moment large enough to explain the current puzzle with the proton charge radius determined from the Lamb shift in muonic hydrogen. This is in contrast with the recent claim of De Rujula [arXiv:1008.3861].

  16. Spontaneous electromagnetic fluctuations in unmagnetized plasmas. IV. Relativistic form factors of aperiodic Lorentzian modes

    SciTech Connect

    Felten, T.; Schlickeiser, R.

    2013-08-15

    Closed analytical expressions for the electromagnetic fluctuation spectra in unmagnetized plasmas are derived using fully relativistic dispersion functions and form factors for the important class of isotropic form-invariant Lorentzian plasma particle distribution functions. Such distribution functions occur frequently in cosmic plasmas due to the presence of suprathermal charged particles and energetic cosmic ray particles. The results are illustrated for the important special case of aperiodic fluctuations. The collective, transverse, damped aperiodic mode, discovered before in nonrelativistic Maxwellian particle distributions, also exists in Lorentzian electron-proton particle distributions, now with the damping rate γ∝−k{sup 3} for all wavenumber values, resulting from the presence of relativistic particles in the tail of the Lorentzian distribution. For longitudinal electric field, fluctuations no damped or growing aperiodic collective mode exists in Lorentzian plasmas. The existence of a damped, collective, transverse, aperiodic mode is not in conflict with earlier general instability studies excluding the existence of growing aperiodic collective modes in isotropic plasmas.

  17. Energy transport mechanism in the form of proton soliton in a one-dimensional hydrogen-bonded polypeptide chain.

    PubMed

    Kavitha, L; Priya, R; Ayyappan, N; Gopi, D; Jayanthi, S

    2016-01-01

    The dynamics of protons in a one-dimensional hydrogen-bonded (HB) polypeptide chain (PC) is investigated theoretically. A new Hamiltonian is formulated with the inclusion of higher-order molecular interactions between peptide groups (PGs). The wave function of the excitation state of a single particle is replaced by a new wave function of a two-quanta quasi-coherent state. The dynamics is governed by a higher-order nonlinear Schrödinger equation and the energy transport is performed by the proton soliton. A nonlinear multiple-scale perturbation analysis has been performed and the evolution of soliton parameters such as velocity and amplitude is explored numerically. The proton soliton is thermally stable and very robust against these perturbations. The energy transport by the proton soliton is more appropriate to understand the mechanism of energy transfer in biological processes such as muscle contraction, DNA replication, and neuro-electric pulse transfer on biomembranes.

  18. Proton Transport

    NASA Technical Reports Server (NTRS)

    Pohorille, Andrew; DeVincenzi, Donald L. (Technical Monitor)

    2001-01-01

    The transport of protons across membranes is an essential process for both bioenergetics of modern cells and the origins of cellular life. All living systems make use of proton gradients across cell walls to convert environmental energy into a high-energy chemical compound, adenosine triphosphate (ATP), synthesized from adenosine diphosphate. ATP, in turn, is used as a source of energy to drive many cellular reactions. The ubiquity of this process in biology suggests that even the earliest cellular systems were relying on proton gradient for harvesting environmental energy needed to support their survival and growth. In contemporary cells, proton transfer is assisted by large, complex proteins embedded in membranes. The issue addressed in this Study was: how the same process can be accomplished with the aid of similar but much simpler molecules that could have existed in the protobiological milieu? The model system used in the study contained a bilayer membrane made of phospholipid, dimyristoylphosphatidylcholine (DMPC) which is a good model of the biological membranes forming cellular boundaries. Both sides of the bilayer were surrounded by water which simulated the environment inside and outside the cell. Embedded in the membrane was a fragment of the Influenza-A M$_2$ protein and enough sodium counterions to maintain system neutrality. This protein has been shown to exhibit remarkably high rates of proton transport and, therefore, is an excellent model to study the formation of proton gradients across membranes. The Influenza M$_2$ protein is 97 amino acids in length, but a fragment 25 amino acids long. which contains a transmembrane domain of 19 amino acids flanked by three amino acids on each side. is sufficient to transport protons. Four identical protein fragments, each folded into a helix, aggregate to form small channels spanning the membrane. Protons are conducted through a narrow pore in the middle of the channel in response to applied voltage. This

  19. Measurement of the generalized form factors near threshold via γ*p→nπ+ at high Q2

    NASA Astrophysics Data System (ADS)

    Park, K.; Gothe, R. W.; Adhikari, K. P.; Adikaram, D.; Anghinolfi, M.; Baghdasaryan, H.; Ball, J.; Battaglieri, M.; Batourine, V.; Bedlinskiy, I.; Bennett, R. P.; Biselli, A. S.; Bookwalter, C.; Boiarinov, S.; Branford, D.; Briscoe, W. J.; Brooks, W. K.; Burkert, V. D.; Carman, D. S.; Celentano, A.; Chandavar, S.; Charles, G.; Cole, P. L.; Contalbrigo, M.; Crede, V.; D'Angelo, A.; Daniel, A.; Dashyan, N.; De Vita, R.; De Sanctis, E.; Deur, A.; Djalali, C.; Doughty, D.; Dupre, R.; El Alaoui, A.; El Fassi, L.; Eugenio, P.; Fedotov, G.; Fradi, A.; Gabrielyan, M. Y.; Gevorgyan, N.; Gilfoyle, G. P.; Giovanetti, K. L.; Girod, F. X.; Goetz, J. T.; Gohn, W.; Golovatch, E.; Graham, L.; Griffioen, K. A.; Guidal, M.; Guo, L.; Hafidi, K.; Hakobyan, H.; Hanretty, C.; Heddle, D.; Hicks, K.; Holtrop, M.; Hyde, C. E.; Ilieva, Y.; Ireland, D. G.; Ishkhanov, B. S.; Isupov, E. L.; Jenkins, D.; Jo, H. S.; Joo, K.; Kalantarians, N.; Khandaker, M.; Khetarpal, P.; Kim, A.; Kim, W.; Klein, A.; Klein, F. J.; Kubarovsky, A.; Kubarovsky, V.; Kuhn, S. E.; Kuleshov, S. V.; Kvaltine, N. D.; Livingston, K.; Lu, H. Y.; MacGregor, I. J. D.; Markov, N.; Mayer, M.; McKinnon, B.; Mestayer, M. D.; Meyer, C. A.; Mineeva, T.; Mirazita, M.; Mokeev, V.; Moutarde, H.; Munevar, E.; Nadel-Turonski, P.; Nasseripour, R.; Niccolai, S.; Niculescu, G.; Niculescu, I.; Osipenko, M.; Ostrovidov, A. I.; Paolone, M.; Pappalardo, L.; Paremuzyan, R.; Park, S.; Pereira, S. Anefalos; Phelps, E.; Pisano, S.; Pogorelko, O.; Pozdniakov, S.; Price, J. W.; Procureur, S.; Prok, Y.; Ricco, G.; Rimal, D.; Ripani, M.; Ritchie, B. G.; Rosner, G.; Rossi, P.; Sabatié, F.; Saini, M. S.; Salgado, C.; Schott, D.; Schumacher, R. A.; Seraydaryan, H.; Sharabian, Y. G.; Smith, E. S.; Smith, G. D.; Sober, D. I.; Sokhan, D.; Stepanyan, S. S.; Stepanyan, S.; Stoler, P.; Strakovsky, I. I.; Strauch, S.; Taiuti, M.; Tang, W.; Taylor, C. E.; Tian, Y.; Tkachenko, S.; Trivedi, A.; Ungaro, M.; Vernarsky, B.; Vlassov, A. V.; Voutier, E.; Watts, D. P.; Weygand, D. P.; Wood, M. H.; Zachariou, N.; Zhao, B.; Zhao, Z. W.

    2012-03-01

    We report the first extraction of the pion-nucleon multipoles near the production threshold for the nπ+ channel at relatively high momentum transfer (Q2 up to 4.2 GeV2). The dominance of the s-wave transverse multipole (E0+), expected in this region, allowed us to access the generalized form factor G1 within the light-cone sum-rule (LCSR) framework as well as the axial form factor GA. The data analyzed in this work were collected by the nearly 4π CEBAF Large Acceptance Spectrometer (CLAS) using a 5.754-GeV electron beam on a proton target. The differential cross section and the π-N multipole E0+/GD were measured using two different methods, the LCSR and a direct multipole fit. The results from the two methods are found to be consistent and almost Q2 independent.

  20. Measurement of the generalized form factors near threshold via γ*p → nπ+ at high Q2

    DOE PAGES

    Park, K.; Adhikari, K. P.; Adikaram, D.; ...

    2012-03-26

    We report the first extraction of the pion-nucleon multipoles near the production threshold for the nπ+ channel at relatively high momentum transfer (Q2 up to 4.2 GeV2). The dominance of the s-wave transverse multipole (E0+), expected in this region, allowed us to access the generalized form factor G1 within the light-cone sum rule (LCSR) framework as well as the axial form factor GA. The data analyzed in this work were collected by the nearly 4π CEBAF Large Acceptance Spectrometer (CLAS) using a 5.754-GeV electron beam on a proton target. The differential cross section and the π-N multipole E0+/GD were measuredmore » using two different methods, the LCSR and a direct multipole fit. The results from the two methods are found to be consistent and almost Q2 independent.« less

  1. Assignment of selected hyperfine proton NMR resonances in the met forms of Glycera dibranchiata monomer hemoglobins and comparisons with sperm whale metmyoglobin

    SciTech Connect

    Constantinidis, I.; Satterlee, J.D.; Pandey, R.K.; Leung, H.K.; Smith, K.M.

    1988-04-19

    This work indicates a high degree of purity for our preparations of all three of the primary Glycera dibranchiata monomer hemoglobins and details assignments of the heme methyl and vinyl protons in the hyperfine shift region of the ferric (aquo.) protein forms. The assignments were carried out by reconstituting the apoproteins of each component with selectively deuteriated hemes. The results indicate that even though the individual component preparations consist of essentially a single protein, the proton NMR spectra indicate spectroscopic heterogeneity. Evidence is presented for identification and classification of major and minor protein forms that are present in solutions of each component. Finally, in contrast to previous results, a detailed analysis of the proton hyperfine shift patterns of the major and minor forms of each component, in comparison to the major and minor forms of metmyoglobin, leads to the conclusions that the corresponding forms of the proteins from each species have strikingly similar heme-globin contacts and display nearly identical heme electronic structures and coordination numbers.

  2. Factors associated with residual gastroesophageal reflux disease symptoms in patients receiving proton pump inhibitor maintenance therapy

    PubMed Central

    Kawara, Fumiaki; Fujita, Tsuyoshi; Morita, Yoshinori; Uda, Atsushi; Masuda, Atsuhiro; Saito, Masaya; Ooi, Makoto; Ishida, Tsukasa; Kondo, Yasuyuki; Yoshida, Shiei; Okuno, Tatsuya; Yano, Yoshihiko; Yoshida, Masaru; Kutsumi, Hiromu; Hayakumo, Takanobu; Yamashita, Kazuhiko; Hirano, Takeshi; Hirai, Midori; Azuma, Takeshi

    2017-01-01

    AIM To elucidate the factors associated with residual gastroesophageal reflux disease (GERD) symptoms in patients receiving proton pump inhibitor (PPI) maintenance therapy in clinical practice. METHODS The study included 39 GERD patients receiving maintenance PPI therapy. Residual symptoms were assessed using the Frequency Scale for Symptoms of GERD (FSSG) questionnaire and the Gastrointestinal Symptom Rating Scale (GSRS). The relationships between the FSSG score and patient background factors, including the CYP2C19 genotype, were analyzed. RESULTS The FSSG scores ranged from 1 to 28 points (median score: 7.5 points), and 19 patients (48.7%) had a score of 8 points or more. The patients’ GSRS scores were significantly correlated with their FSSG scores (correlation coefficient = 0.47, P < 0.005). In erosive esophagitis patients, the FSSG scores of the CYP2C19 rapid metabolizers (RMs) were significantly higher than the scores of the poor metabolizers and intermediate metabolizers (total scores: 16.7 ± 8.6 vs 7.8 ± 5.4, P < 0.05; acid reflux-related symptom scores: 12 ± 1.9 vs 2.5 ± 0.8, P < 0.005). In contrast, the FSSG scores of the CYP2C19 RMs in the non-erosive reflux disease patients were significantly lower than those of the other patients (total scores: 5.5 ± 1.0 vs 11.8 ± 6.3, P < 0.05; dysmotility symptom-related scores: 1.0 ± 0.4 vs 6.0 ± 0.8, P < 0.01). CONCLUSION Approximately half of the GERD patients receiving maintenance PPI therapy had residual symptoms associated with a lower quality of life, and the CYP2C19 genotype appeared to be associated with these residual symptoms. PMID:28373773

  3. Predictive Factors of Response to Proton Pump Inhibitors in Korean Patients With Gastroesophageal Reflux Disease

    PubMed Central

    Kim, Sung Eun; Kim, Nayoung; Oh, Sooyeon; Kim, Hee Man; Park, Moo In; Lee, Dong Ho; Jung, Hyun Chae

    2015-01-01

    Background/Aims Proton pump inhibitors (PPIs) are widely used in the treatment of gastroesophageal reflux disease (GERD). However, some patients fail to respond to PPI therapy. We investigated the efficacy of response to PPI therapy in patients with GERD symptoms. Methods A total of 179 subjects with GERD symptoms were prospectively enrolled and diagnosed with non-erosive reflux disease (NERD, n = 100) and erosive reflux disease (n = 79) by gastroscopy and Bernstein test and/or 24-hour esophageal pH testing. Subjects then received a standard dose of daily PPI therapy for at least 4 weeks. PPI therapy response was evaluated using questionnaires including questions about demographics, GERD symptoms, GERD impact scale, Epworth sleepiness scale, Pittsburgh sleep quality index (PSQI), hospital anxiety and depression scale, and abbreviated version of the World Health Organization quality of life scale. Results The rates of complete (≥ 80%), satisfactory (≥ 50%), partial (< 50%), and refractory response in the 179 participants were 41.3%, 30.2%, 18.4%, and 10.1%, respectively. Thus, overall response rate (complete and satisfactory responses) was 71.5%. Multivariate analysis showed body mass index < 23 kg/m2 (OR, 2.20; 95% CI, 1.12–4.34), higher total PSQI score (OR, 1.20; 95% CI, 1.05–1.35), history of psychotherapy or neuropsychiatric medication (OR, 2.44; 95% CI, 1.23–4.85), and NERD (OR, 3.30; 95% CI, 1.54–7.11) were associated with poor response to PPI therapy. Conclusions Psychological factors, sleep dysfunction, body mass index < 23 kg/m2, and NERD seem to be the major factors that lead to a poor response to PPI treatment in patients with GERD symptoms. PMID:25537676

  4. The Magnetic Form Factor of the Neutron, G

    NASA Astrophysics Data System (ADS)

    Markowitz, Pete Edward Christopher

    We measured the d(e,e^' n)p cross-section at three values of Q^2 : 0.255, 0.176 and 0.109 (GeV/c)^2 . The electrons were detected with the OHIPS magnetic spectrometer, and the neutrons were detected in a liquid mineral oil scintillator array. The measurement were made at a fixed neutron angle of theta_ {n} = 57^circ; the Q^2 values were obtained by varying the incident electron energy and the scattering angle. These cross sections are sensitive primarily to the neutron magnetic form factor at these quasifree kinematics. The efficiency of the neutron detector was determined by the associated particle technique with the d(gamma ,pn) reaction for each of the three neutron kinetic energies. The value of G_sp{M} {n} extracted from the cross sections are consistent with the dipole parametrization at the two higher momentum transfers; at the lowest momentum transfer the value of G_sp{M}{n} is 10% higher than the dipole model. This enhancement at low momentum transfer is consistent with previous measurements.

  5. Nucleon form factors and hidden symmetry in holographic QCD

    SciTech Connect

    Hong, Deog Ki; Rho, Mannque; Yee, Ho-Ung; Yi, Piljin

    2008-01-01

    The vector dominance of the electromagnetic form factors both for mesons and baryons arises naturally in holographic QCD, where both the number of colors and the 't Hooft coupling are taken to be very large, offering a bona-fide derivation of the notion of vector dominance. The crucial ingredient for this is the infinite tower of vector mesons in the approximations made which share features that are characteristic of the quenched approximation in lattice QCD. We approximate the infinite sum by contributions from the lowest four vector mesons of the tower which turn out to saturate the charge and magnetic moment sum rules within a few percent and compute them totally free of unknown parameters for momentum transfers Q{sup 2} < or approx. 1 GeV{sup 2}. We identify certain observables that can be reliably computed within the approximations and others that are not, and discuss how the improvement of the latter can enable one to bring holographic QCD closer to QCD proper.

  6. Ir-Uv Double Resonance Spectroscopy of a Cold Protonated Fibril-Forming Peptide: NNQQNY\\cdotH+

    NASA Astrophysics Data System (ADS)

    DeBlase, Andrew F.; Harrilal, Christopher P.; Walsh, Patrick S.; McLuckey, Scott A.; Zwier, Timothy S.

    2016-06-01

    Protein aggregation to form amyloid-like fibrils is a purported molecular manifestation that leads to Alzheimer's, Huntington's, and other neurodegenerative diseases. The propensity for a protein to aggregate is often driven by the presence of glutamine (Q) and asparagine (N) rich tracts within the primary sequence. For example, Eisenberg and coworkers [Nature 2006, 435, 773] have shown by X-ray crystallography that the peptides NNQQNY and GNNQQNY aggregate into a parallel β-sheet configuration with side chains that intercalate into a "steric zipper". These sequences are commonly found at the N-terminus of the prion-determining domain in the yeast protein Sup35, a typical fibril-forming protein. Herein, we invoke recent advances in cold ion spectroscopy to explore the nascent conformational preferences of the protonated peptides that are generated by electrospray ionization. Towards this aim, we have used UV and IR spectroscopy to record conformation-specific photofragment action spectra of the NNQQNY monomer cryogenically cooled in an octopole ion trap. This short peptide contains 20 hydride stretch oscillators, leading to a rich infrared spectrum with at least 18 resolved transitions in the 2800-3800 cm-1 region. The infrared spectrum suggests the presence of both a free acid OH moiety and an H-bonded tyrosine OH group. We compare our results with resonant ion dip infrared spectra (RIDIRS) of the acyl/NH-benzyl capped neutral glutamine amino acid and its corresponding dipeptide: Ac-Q-NHBn and Ac-QQ-NHBn, respectively. These comparisons bring empirical insight to the NH stretching region of the spectrum, which contains contributions from free and singly H-bonded NH2 side-chain groups, and from peptide backbone amide NH groups. We further compare our spectrum to harmonic calculations at the M05-2X/6-31+G* level of theory, which were performed on low energy structures obtained from Monte Carlo conformational searches using the Amber* and OPLS force fields to assess

  7. Overview of high-Q2 nucleon form factor program with Super BigBite Spectrometer in JLab's Hall A

    NASA Astrophysics Data System (ADS)

    Puckett, Andrew; Jefferson Lab Hall A; Super BigBite Spectrometer Collaboration

    2017-01-01

    The elastic electromagnetic form factors (EMFFs) of the nucleon describe the impact-parameter-space distributions of electric charge and magnetization in the nucleon in the infinite momentum frame. The form factors are among the simplest and most fundamental measurable dynamical quantities describing the nucleon's structure. Precision measurements of the nucleon form factors provide stringent benchmarks testing the most sophisticated theoretical models of the nucleon, as well as ab initio calculations in lattice QCD and continuum non-perturbative QCD calculations based on the Dyson-Schwinger equations. Measurements at momentum transfers Q in the few-GeV range probe the theoretically challenging region of transition between the non-perturbative and perturbative regimes of QCD. The recent upgrade of the Continuous Electron Beam Accelerator Facility (CEBAF) to a maximum electron beam energy of 11 GeV will facilitate the measurement of the nucleon helicity-conserving (F1) and helicity-flip (F2) form factors of both proton and neutron to Q2 > 10 GeV2, In this talk, I will present an overview of the Super BigBite Spectrometer, currently under construction in CEBAF's experimental Hall A, and its physics program of high-Q2 nucleon EMFF measurements. Supported by US DOE award DE-SC0014230.

  8. Weak charge form factor and radius of 208Pb through parity violation in electron scattering

    DOE PAGES

    Horowitz, C. J.; Ahmed, Z.; Jen, C. -M.; ...

    2012-03-26

    We use distorted wave electron scattering calculations to extract the weak charge form factor FW(more » $$\\bar{q}$$), the weak charge radius RW, and the point neutron radius Rn, of 208Pb from the PREX parity violating asymmetry measurement. The form factor is the Fourier transform of the weak charge density at the average momentum transfer $$\\bar{q}$$ = 0.475 fm-1. We find FW($$\\bar{q}$$) = 0.204 ± 0.028(exp) ± 0.001(model). We use the Helm model to infer the weak radius from FW($$\\bar{q}$$). We find RW = 5.826 ± 0.181(exp) ± 0.027(model) fm. Here the exp error includes PREX statistical and systematic errors, while the model error describes the uncertainty in RW from uncertainties in the surface thickness σ of the weak charge density. The weak radius is larger than the charge radius, implying a 'weak charge skin' where the surface region is relatively enriched in weak charges compared to (electromagnetic) charges. We extract the point neutron radius Rn = 5.751 ± 0.175 (exp) ± 0.026(model) ± 0.005(strange) fm, from RW. Here there is only a very small error (strange) from possible strange quark contributions. We find Rn to be slightly smaller than RW because of the nucleon's size. As a result, we find a neutron skin thickness of Rn-Rp = 0.302 ± 0.175 (exp) ± 0.026 (model) ± 0.005 (strange) fm, where Rp is the point proton radius.« less

  9. Nucleon Form Factors above 6 GeV

    DOE R&D Accomplishments Database

    Taylor, R. E.

    1967-09-01

    This report describes the results from a preliminary analysis of an elastic electron-proton scattering experiment... . We have measured cross sections for e-p scattering in the range of q{sup 2} from 0.7 to 25.0 (GeV/c){sup 2}, providing a large region of overlap with previous measurements. In this experiment we measure the cross section by observing electrons scattered from a beam passing through a liquid hydrogen target. The scattered particles are momentum analyzed by a magnetic spectrometer and identified as electrons in a total absorption shower counter. Data have been obtained with primary electron energies from 4.0 to 17.9 GeV and at scattering angles from 12.5 to 35.0 degrees. In general, only one measurement of a cross section has been made at each momentum transfer.

  10. Overview of nucleon form factor experiments with 12 GeV at Jefferson Lab

    NASA Astrophysics Data System (ADS)

    Cisbani, Evaristo

    2014-06-01

    Since the R. Hofstadter pioneering experiments in the '50s, the measurements of the electromagnetic space-like nucleon form factors (FF's) have been a precious source of information for the understanding of the internal structure of the nucleons. In the last 15 years, the polarization transfer experiments at the Thomas Jefferson National Accelerator Facility (JLab) have undermined our view of the mechanism of the electron scattering and renewed critical interest in the FF measurements. In the coming years, JLab, with its upgraded 12 GeV polarized, high intensity, electron beam combined to new targets and readout equipments, will offer unprecedented opportunities to extend the current proton and neutron FF's measurements to higher momentum transfer Q2 and to improve statistical and uncertainties at lower Q2, where the nucleon size can be accurately investigated. The measurements at high Q2 will provide also new insights on the elusive quark orbital angular momenta, will contribute to constraint two of the nucleon Generalized Parton Distributions that are expected to describe more consistently the nucleon structure, and in general will test the validity of quite a few fundamental nucleon models in a region of transition between perturbative and non perturbative regimes. A selection of the relevant properties of the FF's, and the main results of JLab are shortly reviewed; the new proposed and approved experiments on FF's at JLab are presented addressing some key details, the expected experimental achievements and the new equipment designed for them.

  11. Factors for converting dose measured in polystyrene phantoms to dose reported in water phantoms for incident proton beams

    SciTech Connect

    Moyers, M. F.; Vatnitsky, A. S.; Vatnitsky, S. M.

    2011-10-15

    Purpose: Previous dosimetry protocols allowed calibrations of proton beamline dose monitors to be performed in plastic phantoms. Nevertheless, dose determinations were referenced to absorbed dose-to-muscle or absorbed dose-to-water. The IAEA Code of Practice TRS 398 recommended that dose calibrations be performed with ionization chambers only in water phantoms because plastic-to-water dose conversion factors were not available with sufficient accuracy at the time of its writing. These factors are necessary, however, to evaluate the difference in doses delivered to patients if switching from calibration in plastic to a protocol that only allows calibration in water. Methods: This work measured polystyrene-to-water dose conversion factors for this purpose. Uncertainties in the results due to temperature, geometry, and chamber effects were minimized by using special experimental set-up procedures. The measurements were validated by Monte Carlo simulations. Results: At the peak of non-range-modulated beams, measured polystyrene-to-water factors ranged from 1.015 to 1.024 for beams with ranges from 36 to 315 mm. For beams with the same ranges and medium sized modulations, the factors ranged from 1.005 to 1.019. The measured results were used to generate tables of polystyrene-to-water dose conversion factors. Conclusions: The dose conversion factors can be used at clinical proton facilities to support beamline and patient specific dose per monitor unit calibrations performed in polystyrene phantoms.

  12. Iso-vector form factors of the delta and nucleon in QCD sum rules

    SciTech Connect

    Ozpineci, A.

    2012-10-23

    Form factors are important non-perturbative properties of hadrons. They give information about the internal structure of the hadrons. In this work, iso-vector axial-vector and iso-vector tensor form factors of the nucleon and the iso-vector axial-vector {Delta}{yields}N transition form factor calculations in QCD Sum Rules are presented.

  13. 8 CFR 204.309 - Factors requiring denial of a Form I-800A or Form I-800.

    Code of Federal Regulations, 2013 CFR

    2013-01-01

    ... 8 Aliens and Nationality 1 2013-01-01 2013-01-01 false Factors requiring denial of a Form I-800A or Form I-800. 204.309 Section 204.309 Aliens and Nationality DEPARTMENT OF HOMELAND SECURITY IMMIGRATION REGULATIONS IMMIGRANT PETITIONS Intercountry Adoption of a Convention Adoptee § 204.309...

  14. 8 CFR 204.309 - Factors requiring denial of a Form I-800A or Form I-800.

    Code of Federal Regulations, 2011 CFR

    2011-01-01

    ... 8 Aliens and Nationality 1 2011-01-01 2011-01-01 false Factors requiring denial of a Form I-800A or Form I-800. 204.309 Section 204.309 Aliens and Nationality DEPARTMENT OF HOMELAND SECURITY IMMIGRATION REGULATIONS IMMIGRANT PETITIONS Intercountry Adoption of a Convention Adoptee § 204.309...

  15. 8 CFR 204.309 - Factors requiring denial of a Form I-800A or Form I-800.

    Code of Federal Regulations, 2014 CFR

    2014-01-01

    ... 8 Aliens and Nationality 1 2014-01-01 2014-01-01 false Factors requiring denial of a Form I-800A or Form I-800. 204.309 Section 204.309 Aliens and Nationality DEPARTMENT OF HOMELAND SECURITY IMMIGRATION REGULATIONS IMMIGRANT PETITIONS Intercountry Adoption of a Convention Adoptee § 204.309...

  16. 3D Anhydrous proton-transporting nanochannels formed by self-assembly of liquid crystals composed of a sulfobetaine and a sulfonic acid.

    PubMed

    Soberats, Bartolome; Yoshio, Masafumi; Ichikawa, Takahiro; Taguchi, Satomi; Ohno, Hiroyuki; Kato, Takashi

    2013-10-16

    Herein we describe anhydrous proton transportation through 3D interconnected pathways formed by self-assembled molecular complexes. A thermotropic bicontinuous cubic (Cub(bi)) phase has been successfully obtained by mixing a wedge-shaped sulfobetaine with benzenesulfonic acid in different ratios. These ionic complexes exhibit the Cub(bi) phase in a wide range of temperatures, while the single zwitterionic compound shows only a columnar hexagonal phase, and benzenesulfonic acid is nonmesomorphic. Anhydrous proton conduction on the order of 10(-4) S cm(-1) has been achieved for the mixture in the Cub(bi) phase over 100 °C, which can be useful for the development of new electrolytes for the next generation of fuel cells.

  17. Factors influencing the accuracy of beam range estimation in proton therapy using prompt gamma emission

    NASA Astrophysics Data System (ADS)

    Janssen, FMFC; Landry, G.; Cambraia Lopes, P.; Dedes, G.; Smeets, J.; Schaart, D. R.; Parodi, K.; Verhaegen, F.

    2014-08-01

    In-vivo imaging is a strategy to monitor the range of protons inside the patient during radiation treatment. A possible method of in-vivo imaging is detection of secondary ‘prompt’ gamma (PG) photons outside the body, which are produced by inelastic proton-nuclear interactions inside the patient. In this paper, important parameters influencing the relationship between the PG profile and percentage depth dose (PDD) in a uniform cylindrical phantom are explored. Monte Carlo simulations are performed with the new Geant4 based code TOPAS for mono-energetic proton pencil beams (range: 100-250 MeV) and an idealized PG detector. PG depth profiles are evaluated using the inflection point on a sigmoid fit in the fall-off region of the profile. A strong correlation between the inflection point and the proton range determined from the PDD is found for all conditions. Variations between 1.5 mm and 2.7 mm in the distance between the proton range and the inflection point are found when either the mass density, phantom diameter, or detector acceptance angle is changed. A change in cut-off energy of the detector could induce a range difference of maximum 4 mm. Applying time-of-flight discrimination during detection, changing the primary energy of the beam or changing the elemental composition of the tissue affects the accuracy of the range prediction by less than 1 mm. The results indicate that the PG signal is rather robust to many parameter variations, but millimetre accurate range monitoring requires all medium and detector properties to be carefully taken into account.

  18. Box products in nilpotent normal form theory: The factoring method

    NASA Astrophysics Data System (ADS)

    Murdock, James

    2016-01-01

    Let N be a nilpotent matrix and consider vector fields x ˙ = Nx + v (x) in normal form. Then v is equivariant under the flow eN*t for the inner product normal form or eMt for the sl2 normal form. These vector equivariants can be found by finding the scalar invariants for the Jordan blocks in N* or M; taking the box product of these to obtain the invariants for N* or M itself; and then boosting the invariants to equivariants by another box product. These methods, developed by Murdock and Sanders in 2007, are here given a self-contained exposition with new foundations and new algorithms yielding improved (simpler) Stanley decompositions for the invariants and equivariants. Ideas used include transvectants (from classical invariant theory), Stanley decompositions (from commutative algebra), and integer cones (from integer programming). This approach can be extended to covariants of sl2k for k > 1, known as SLOCC in quantum computing.

  19. SU-E-T-491: Importance of Energy Dependent Protons Per MU Calibration Factors in IMPT Dose Calculations Using Monte Carlo Technique

    SciTech Connect

    Randeniya, S; Mirkovic, D; Titt, U; Guan, F; Mohan, R

    2014-06-01

    Purpose: In intensity modulated proton therapy (IMPT), energy dependent, protons per monitor unit (MU) calibration factors are important parameters that determine absolute dose values from energy deposition data obtained from Monte Carlo (MC) simulations. Purpose of this study was to assess the sensitivity of MC-computed absolute dose distributions to the protons/MU calibration factors in IMPT. Methods: A “verification plan” (i.e., treatment beams applied individually to water phantom) of a head and neck patient plan was calculated using MC technique. The patient plan had three beams; one posterior-anterior (PA); two anterior oblique. Dose prescription was 66 Gy in 30 fractions. Of the total MUs, 58% was delivered in PA beam, 25% and 17% in other two. Energy deposition data obtained from the MC simulation were converted to Gy using energy dependent protons/MU calibrations factors obtained from two methods. First method is based on experimental measurements and MC simulations. Second is based on hand calculations, based on how many ion pairs were produced per proton in the dose monitor and how many ion pairs is equal to 1 MU (vendor recommended method). Dose distributions obtained from method one was compared with those from method two. Results: Average difference of 8% in protons/MU calibration factors between method one and two converted into 27 % difference in absolute dose values for PA beam; although dose distributions preserved the shape of 3D dose distribution qualitatively, they were different quantitatively. For two oblique beams, significant difference in absolute dose was not observed. Conclusion: Results demonstrate that protons/MU calibration factors can have a significant impact on absolute dose values in IMPT depending on the fraction of MUs delivered. When number of MUs increases the effect due to the calibration factors amplify. In determining protons/MU calibration factors, experimental method should be preferred in MC dose calculations

  20. Proton solvates, H +· nH 2O· mL, formed by diphosphine dioxides with chlorinated cobalt(III) dicarbollide acid

    NASA Astrophysics Data System (ADS)

    Stoyanov, Evgenii S.; Smirnov, Igor'V.

    2005-04-01

    Interaction of hydrated proton, H 5O 2+·(H 2O) 4, in dichloroethane solutions with diphosphine dioxides (L) having methyl (Ph 4Me), ethyl (Ph 4Et) and polyoxyethylene chains (Ph 4PEG) linking two diphenyl phosphine oxide groups has been investigated. A bulky counter ion: chlorinated cobalt(III) bis(dicarbollide), [Co(C 2B 9H 8Cl 3) 2] -, minimizes perturbation of the cation. At low concentrations, Ph 4Et and Ph 4PEG form anhydrous 1:1 complexes with (P dbnd6 )O-H +-O( dbnd6 P) fragment having very strong symmetrical H-bonds. At these conditions Ph 4Me form another compound, H 5O 2+·L(H 2O) 2, due to lower P dbnd6 O basicity and optimal geometry of the chelate cycle. At higher concentrations, Ph 4Me and Ph 4Et form isostructural complexes H 5O 2+·L 2, whereas Ph 4PEG forms only a 1:1 complex with proton dihydrate, H 3O +·H 2O. In excess of free Ph 4Me and Ph 4Et a water molecule is introduced to the first coordination sphere of H 5O 2+ and the average molar ratio L/H 5O 2+ of the complexes exceeds 2. The composition of these complexes as a function of L and its concentration is discussed.

  1. Third Zemach moment of the proton

    SciTech Connect

    Cloeet, Ian C.; Miller, Gerald A.

    2011-01-15

    Modern electron scattering experiments have determined the proton electric form factor G{sub Ep}(Q{sup 2}) to high precision. We utilize this data, represented by the different empirical form-factor parametrizations, to compute the third Zemach moment of the proton charge distribution. We find that existing data rule out a value of the third Zemach moment large enough to explain the current puzzle with the proton charge radius, determined from the Lamb shift in muonic hydrogen. This is in contrast to the recent paper of De Rujula. We also demonstrate that the size of the third Zemach moment is largely governed by the fourth moment of the conventional charge distributions , which enables us to obtain a rigorous upper bound on the magnitude of the third Zemach moment of the proton.

  2. Concerted O atom–proton transfer in the O—O bond forming step in water oxidation

    PubMed Central

    Chen, Zuofeng; Concepcion, Javier J.; Hu, Xiangqian; Yang, Weitao; Hoertz, Paul G.; Meyer, Thomas J.

    2010-01-01

    As the terminal step in photosystem II, and a potential half-reaction for artificial photosynthesis, water oxidation (2H2O → O2 + 4e- + 4H+) is key, but it imposes a significant mechanistic challenge with requirements for both 4e-/4H+ loss and O—O bond formation. Significant progress in water oxidation catalysis has been achieved recently by use of single-site Ru metal complex catalysts such as [Ru(Mebimpy)(bpy)(OH2)]2+ [Mebimpy = 2,6-bis(1-methylbenzimidazol-2-yl)pyridine; bpy = 2,2′-bipyridine]. When oxidized from to RuV = O3+, these complexes undergo O—O bond formation by O-atom attack on a H2O molecule, which is often the rate-limiting step. Microscopic details of O—O bond formation have been explored by quantum mechanical/molecular mechanical (QM/MM) simulations the results of which provide detailed insight into mechanism and a strategy for enhancing catalytic rates. It utilizes added bases as proton acceptors and concerted atom–proton transfer (APT) with O-atom transfer to the O atom of a water molecule in concert with proton transfer to the base (B). Base catalyzed APT reactivity in water oxidation is observed both in solution and on the surfaces of oxide electrodes derivatized by attached phosphonated metal complex catalysts. These results have important implications for catalytic, electrocatalytic, and photoelectrocatalytic water oxidation. PMID:20360565

  3. Concerted O atom-proton transfer in the O—O bond forming step in water oxidation

    SciTech Connect

    Chen, Zuofeng; Concepcion, Javier C.; Hu, Xiangqian; Yang, Weitao; Hoertz, Paul G.; Meyer, Thomas J

    2010-04-20

    As the terminal step in photosystem II, and a potential half-reaction for artificial photosynthesis, water oxidation (2H2O → O2 + 4e- + 4H+) is key, but it imposes a significant mechanistic challenge with requirements for both 4e-/4H- loss and O—O bond formation. Significant progress in water oxidation catalysis has been achieved recently by use of single-site Ru metal complex catalysts such as [Ru(Mebimpy)(bpy)(OH2)]2+ [Mebimpy = 2,6-bis(1-methylbenzimidazol-2-yl)pyridine; bpy = 2,2'-bipyridine]. When oxidized from RuII-OH22+ to RuV = O3+, these complexes undergo O—O bond formation by O-atom attack on a H2O molecule, which is often the rate-limiting step. Microscopic details of O—O bond formation have been explored by quantum mechanical/molecular mechanical (QM/MM) simulations the results of which provide detailed insight into mechanism and a strategy for enhancing catalytic rates. It utilizes added bases as proton acceptors and concerted atom–proton transfer (APT) with O-atom transfer to the O atom of a water molecule in concert with proton transfer to the base (B). Base catalyzed APT reactivity in water oxidation is observed both in solution and on the surfaces of oxide electrodes derivatized by attached phosphonated metal complex catalysts. These results have important implications for catalytic, electrocatalytic, and photoelectrocatalytic water oxidation.

  4. Two-Photon Exchange in Elastic Electron-Proton Scattering: A QCD Factorization Approach

    SciTech Connect

    Kivel, Nikolai; Vanderhaeghen, Marc

    2009-08-28

    We estimate the two-photon exchange contribution to elastic electron-proton scattering at large momentum transfer Q{sup 2}. It is shown that the leading two-photon exchange amplitude behaves as 1/Q{sup 4}, and can be expressed in a model independent way in terms of the leading twist nucleon distribution amplitudes. Using several models for the nucleon distribution amplitudes, we provide estimates for existing data and for ongoing experiments.

  5. Fluence correction factors for graphite calorimetry in a low-energy clinical proton beam: I. Analytical and Monte Carlo simulations.

    PubMed

    Palmans, H; Al-Sulaiti, L; Andreo, P; Shipley, D; Lühr, A; Bassler, N; Martinkovič, J; Dobrovodský, J; Rossomme, S; Thomas, R A S; Kacperek, A

    2013-05-21

    The conversion of absorbed dose-to-graphite in a graphite phantom to absorbed dose-to-water in a water phantom is performed by water to graphite stopping power ratios. If, however, the charged particle fluence is not equal at equivalent depths in graphite and water, a fluence correction factor, kfl, is required as well. This is particularly relevant to the derivation of absorbed dose-to-water, the quantity of interest in radiotherapy, from a measurement of absorbed dose-to-graphite obtained with a graphite calorimeter. In this work, fluence correction factors for the conversion from dose-to-graphite in a graphite phantom to dose-to-water in a water phantom for 60 MeV mono-energetic protons were calculated using an analytical model and five different Monte Carlo codes (Geant4, FLUKA, MCNPX, SHIELD-HIT and McPTRAN.MEDIA). In general the fluence correction factors are found to be close to unity and the analytical and Monte Carlo codes give consistent values when considering the differences in secondary particle transport. When considering only protons the fluence correction factors are unity at the surface and increase with depth by 0.5% to 1.5% depending on the code. When the fluence of all charged particles is considered, the fluence correction factor is about 0.5% lower than unity at shallow depths predominantly due to the contributions from alpha particles and increases to values above unity near the Bragg peak. Fluence correction factors directly derived from the fluence distributions differential in energy at equivalent depths in water and graphite can be described by kfl = 0.9964 + 0.0024·zw-eq with a relative standard uncertainty of 0.2%. Fluence correction factors derived from a ratio of calculated doses at equivalent depths in water and graphite can be described by kfl = 0.9947 + 0.0024·zw-eq with a relative standard uncertainty of 0.3%. These results are of direct relevance to graphite calorimetry in low-energy protons but given that the fluence

  6. A New EM CKM Matrix: Implications of the Nucleon Strange Quark Content, Anomalous Magnetic Moments of Nucleons and Electric and Magnetic Nucleon Form Factors

    NASA Astrophysics Data System (ADS)

    Ward, Thomas

    2013-10-01

    A new electromagnetic neutral-current quark mixing matrix, analog to the well-known Cabibbo-Kobayashi-Maskawa (CKM) weak charge-current matrix, is proposed to account for the strange quark content of the neutron and proton and part of the anomalous axial vector magnetic moments. The EM-CKM matrix is shown to be equivalent to the weak-CKM matrix following an EM to weak gauge symmetry transformation, demonstrating the universality of the Standard Model (SM) CKM quark mixing matrix. The electric and magnetic form factors are reformulated using a new QCD three quark nucleon gyromagnetic factor, Dirac and Pauli form factors and anomalous kappa factors. The old 1943 Jauch form factors which have been systematically used and developed for many years is shown to be in stark disagreement with the new global set of experimental polarized electron-proton scattering data whereas the reformulated SM parameter set of this study is shown to agree very well, lending strong support for this new EM SM approach.

  7. Monte Carlo simulations of neutron spectral fluence, radiation weighting factor and ambient dose equivalent for a passively scattered proton therapy unit

    NASA Astrophysics Data System (ADS)

    Zheng, Yuanshui; Fontenot, Jonas; Taddei, Phil; Mirkovic, Dragan; Newhauser, Wayne

    2008-01-01

    Stray neutron exposures pose a potential risk for the development of secondary cancer in patients receiving proton therapy. However, the behavior of the ambient dose equivalent is not fully understood, including dependences on neutron spectral fluence, radiation weighting factor and proton treatment beam characteristics. The objective of this work, therefore, was to estimate neutron exposures resulting from the use of a passively scattered proton treatment unit. In particular, we studied the characteristics of the neutron spectral fluence, radiation weighting factor and ambient dose equivalent with Monte Carlo simulations. The neutron spectral fluence contained two pronounced peaks, one a low-energy peak with a mode around 1 MeV and one a high-energy peak that ranged from about 10 MeV up to the proton energy. The mean radiation weighting factors varied only slightly, from 8.8 to 10.3, with proton energy and location for a closed-aperture configuration. For unmodulated proton beams stopped in a closed aperture, the ambient dose equivalent from neutrons per therapeutic absorbed dose (H*(10)/D) calculated free-in-air ranged from about 0.3 mSv/Gy for a small scattered field of 100 MeV proton energy to 19 mSv/Gy for a large scattered field of 250 MeV proton energy, revealing strong dependences on proton energy and field size. Comparisons of in-air calculations with in-phantom calculations indicated that the in-air method yielded a conservative estimation of stray neutron radiation exposure for a prostate cancer patient.

  8. Resource Form Factor and Installation of GFA Controllers

    SciTech Connect

    DeSteese, John G.; Hammerstrom, Donald J.

    2009-11-15

    The focus of this task is to optimize the form and placement of a controller comprising the Grid Friendly™ appliance (GFA) controller, power supply and power relay (and/or a solid-state power electronic switch) that would command a domestic water heater to shed its load in response to stress on the electric power grid. The GFA controller would disconnect the water heater from its supply circuit whenever it senses a low voltage signal or other indicators of system stress communicated via the electric power distribution system. Power would be reconnected to the appliance when the GFA controller senses the absence of these signals. This project has also considered more frequent cycling of this controller’s relay switch to perform demand-side frequency regulation. The principal criteria considered in this optimization are reliability, cost and life expectancy of the GFA components. The alternative embodiments of the GFA equipment under consideration are: Option 1- installation inside the insulation space of the water heater between the tank and jacket Option 2 containment in a separate nearby electrical enclosure Option 3 - as a modification or adjunct to the distribution panel housing and/or the breaker that protects the water heater supply circuit.

  9. SU-F-BRD-15: Quality Correction Factors in Scanned Or Broad Proton Therapy Beams Are Indistinguishable

    SciTech Connect

    Sorriaux, J; Lee, J; Testa, M; Paganetti, H; Bertrand, D; Orban de Xivry, J; Palmans, H; Vynckier, S; Sterpin, E

    2015-06-15

    Purpose: The IAEA TRS-398 code of practice details the reference conditions for reference dosimetry of proton beams using ionization chambers and the required beam quality correction factors (kQ). Pencil beam scanning (PBS) requires multiple spots to reproduce the reference conditions. The objective is to demonstrate, using Monte Carlo (MC) calculations, that kQ factors for broad beams can be used for scanned beams under the same reference conditions with no significant additional uncertainty. We consider hereafter the general Alfonso formalism (Alfonso et al, 2008) for non-standard beam. Methods: To approach the reference conditions and the associated dose distributions, PBS must combine many pencil beams with range modulation and shaping techniques different than those used in passive systems (broad beams). This might lead to a different energy spectrum at the measurement point. In order to evaluate the impact of these differences on kQ factors, ion chamber responses are computed with MC (Geant4 9.6) in a dedicated scanned pencil beam (Q-pcsr) producing a 10×10cm2 composite field with a flat dose distribution from 10 to 16 cm depth. Ion chamber responses are also computed by MC in a broad beam with quality Q-ds (double scattering). The dose distribution of Q -pcsr matches the dose distribution of Q-ds. k-(Q-pcsr,Q-ds) is computed for a 2×2×0.2cm{sup 3} idealized air cavity and a realistic plane-parallel ion chamber (IC). Results: Under reference conditions, quality correction factors for a scanned composite field versus a broad beam are the same for air cavity dose response, k-(Q-pcsr,Q-ds) =1.001±0.001 and for a Roos IC, k-(Q-pcsr,Q-ds) =0.999±0.005. Conclusion: Quality correction factors for ion chamber response in scanned and broad proton therapy beams are identical under reference conditions within the calculation uncertainties. The results indicate that quality correction factors published in IAEA TRS-398 can be used for scanned beams in the SOBP of a

  10. Highly Efficient Small Form Factor LED Retrofit Lamp

    SciTech Connect

    Steven Allen; Fred Palmer; Ming Li

    2011-09-11

    This report summarizes work to develop a high efficiency LED-based MR16 lamp downlight at OSRAM SYLVANIA under US Department of Energy contract DE-EE0000611. A new multichip LED package, electronic driver, and reflector optic were developed for these lamps. At steady-state, the lamp luminous flux was 409 lumens (lm), luminous efficacy of 87 lumens per watt (LPW), CRI (Ra) of 87, and R9 of 85 at a correlated color temperature (CCT) of 3285K. The LED alone achieved 120 lumens per watt efficacy and 600 lumen flux output at 25 C. The driver had 90% electrical conversion efficiency while maintaining excellent power quality with power factor >0.90 at a power of only 5 watts. Compared to similar existing MR16 lamps using LED sources, these lamps had much higher efficacy and color quality. The objective of this work was to demonstrate a LED-based MR16 retrofit lamp for replacement of 35W halogen MR16 lamps having (1) luminous flux of 500 lumens, (2) luminous efficacy of 100 lumens per watt, (3) beam angle less than 40{sup o} and center beam candlepower of at least 1000 candelas, and (4) excellent color quality.

  11. SU-E-T-464: On the Equivalence of the Quality Correction Factor for Pencil Beam Scanning Proton Therapy

    SciTech Connect

    Sorriaux, J; Paganetti, H; Testa, M; Giantsoudi, D; Schuemann, J; Bertrand, D; Orban de Xivry, J.; Lee, J; Palmans, H; Vynckier, S; Sterpin, E

    2014-06-01

    Purpose: In current practice, most proton therapy centers apply IAEA TRS-398 reference dosimetry protocol. Quality correction factors (kQ) take into account in the dose determination process the differences in beam qualities used for calibration unit and for treatment unit. These quality correction factors are valid for specific reference conditions. TRS-398 reference conditions should be achievable in both scattered proton beams (i.e. DS) and scanned proton beams (i.e. PBS). However, it is not a priori clear if TRS-398 kQ data, which are based on Monte Carlo (MC) calculations in scattered beams, can be used for scanned beams. Using TOPAS-Geant4 MC simulations, the study aims to determine whether broad beam quality correction factors calculated in TRS-398 can be directly applied to PBS delivery modality. Methods: As reference conditions, we consider a 10×10×10 cm{sup 3} homogeneous dose distribution delivered by PBS system in a water phantom (32/10 cm range/modulation) and an air cavity placed at the center of the spread-out-Bragg-peak. In order to isolate beam differences, a hypothetical broad beam is simulated. This hypothetical beam reproduces exactly the same range modulation, and uses the same energy layers than the PBS field. Ion chamber responses are computed for the PBS and hypothetical beams and then compared. Results: For an air cavity of 2×2×0.2 cm{sup 3}, the ratio of ion chamber responses for the PBS and hypothetical beam qualities is 0.9991 ± 0.0016. Conclusion: Quality correction factors are insensitive to the delivery pattern of the beam (broad beam or PBS), as long as similar dose distributions are achieved. This investigation, for an air cavity, suggests that broad beam quality correction factors published in TRS-398 can be applied for scanned beams. J. Sorriaux is financially supported by a public-private partnership involving the company Ion Beam Applications (IBA)

  12. Up- and Down-Quark Contributions to the Nucleon Form Factors

    NASA Astrophysics Data System (ADS)

    Qattan, I. A.; Arrington, J.

    2014-03-01

    Recent measurements of the neutron s electric to magnetic form factors ratio, Rn = µnGnE/GnM, up to 3.4 (GeV/c)2 combined with existing Rp = µpGpE/GpM measurements in the same Q2 range allowed, for the first time, a separation of the up- and downquark contributions to the form factors at high Q2, as presented by Cates, et al.. Our analysis expands on the original work by including additional form factor data, applying two-photon exchange (TPE) corrections, and accounting for the uncertainties associated with all of the form factor measurements.

  13. Calculation of the Nucleon Axial Form Factor Using Staggered Lattice QCD

    SciTech Connect

    Meyer, Aaron S.; Hill, Richard J.; Kronfeld, Andreas S.; Li, Ruizi; Simone, James N.

    2016-10-14

    The nucleon axial form factor is a dominant contribution to errors in neutrino oscillation studies. Lattice QCD calculations can help control theory errors by providing first-principles information on nucleon form factors. In these proceedings, we present preliminary results on a blinded calculation of $g_A$ and the axial form factor using HISQ staggered baryons with 2+1+1 flavors of sea quarks. Calculations are done using physical light quark masses and are absolutely normalized. We discuss fitting form factor data with the model-independent $z$ expansion parametrization.

  14. Proton Therapy - Accelerating Protons to Save Lives

    SciTech Connect

    Keppel, Cynthia

    2011-10-25

    In 1946, physicist Robert Wilson first suggested that protons could be used as a form of radiation therapy in the treatment of cancer because of the sharp drop-off that occurs on the distal edge of the radiation dose. Research soon confirmed that high-energy protons were particularly suitable for treating tumors near critical structures, such as the heart and spinal column. The precision with which protons can be delivered means that more radiation can be deposited into the tumor while the surrounding healthy tissue receives substantially less or, in some cases, no radiation. Since these times, particle accelerators have continuously been used in cancer therapy and today new facilities specifically designed for proton therapy are being built in many countries. Proton therapy has been hailed as a revolutionary cancer treatment, with higher cure rates and fewer side effects than traditional X-ray photon radiation therapy. Proton therapy is the modality of choice for treating certain small tumors of the eye, head or neck. Because it exposes less of the tissue surrounding a tumor to the dosage, proton therapy lowers the risk of secondary cancers later in life - especially important for young children. To date, over 80,000 patients worldwide have been treated with protons. Currently, there are nine proton radiation therapy facilities operating in the United States, one at the Hampton University Proton Therapy Institute. An overview of the treatment technology and this new center will be presented.

  15. Factor Structure and Construct Validity of the Counselor Skills Personal Development Rating Form.

    ERIC Educational Resources Information Center

    Torres-Rivera, Edil; Wilbur, Michael P.; Maddux, Cleborne D.; Smaby, Marlowe H.; Phan, Loan T.; Roberts-Wilbur, Janice

    2002-01-01

    Presents an exploratory factor analysis of the scores of 248 counselors-in-training on the Counselor Skills Personal Development Rating Form (CSPD-RF). Authors of the test hypothesized that the CPSD-RF measured 2 factors, personal development and skills development. Factor analysis revealed 4 factors accounting for 58.4% of the total variance,…

  16. Internal Dynamics and Ionization States of the Macrophage Migration Inhibitory Factor: Comparison Between Wild-Type and Mutant Forms

    SciTech Connect

    Soares, Thereza A.; Lins, Roberto D.; Straatsma, TP; Briggs, J. M.

    2002-11-15

    The macrophage migration inhibitory factor (MIF) is a cytokine which shares a common structural architecture and catalytic strategy with three isomerases: 4-oxalocrotonate tautomerase, 5-carboxymethyl-2-hydroxymuconate isomerase and D-dopachrome tautomerase. A highly conserved N-terminal proline acts as a base\\acid during the proton transfer reaction catalyzed by these enzymes. Such unusual catalytic strategy appears to be possible only due to the N-terminal proline pKa be shifted to 5.0-6.0 units. Mutations of this residue result in a significant decrease of the catalytic activity of MIF. Two hypotheses have been proposed to explain the catalytic inefficiency of MIF: the lower basicity of primary amines with regard to secondary ones and the increased flexibility resulting from the replacement of a proline by residues like glycine. To investigate that, we have performed molecular dynamics simulations of MIF-wt and its mutant P1G as well as calculated the protonation properties of several mutant forms. It has been found that the N-terminal glycine does not show larger fluctuations compared to proline, but the former residue is more exposed to the solvent throughout the simulations. The apparent pKa of these residues displays very little change (as expected from the structural rigidity of MIF) and is not significantly affected by the surrounding ionizable residues. Instead, the hydrophobic character of the active site seems to be the main factor in determining the pKa of the N-terminal residue and the catalytic efficiency of MIF.

  17. Nucleon form factors from high statistics mixed-action calculations with 2+1 flavors

    SciTech Connect

    Schroers, Wolfram; Edwards, Robert G; Engelhardt, Michael; Fleming, George Taminga; Hagler, Philipp; Lin, Huey-Wen; Lin, Mei-Feng; Meyer, Harvey B; Musch, Bernhard; Negele, John W; Orginos, Kostas; Pochinsky, Andrew V; Procura, Massimiliano; Renner, Dru B; Richards, David G; Syritsyn, Sergey N; Walker-Loud, Andre P

    2009-12-01

    We present new high-statistics results for nucleon form factors at pion masses of approximately 290, 350, 500, and 600 MeV using a mixed action of domain wall valence quarks on an improved staggered sea. We perform chiral fits to both vector and axial form factors and compare our results to experiment.

  18. Form factors in quantum integrable models with GL(3)-invariant R-matrix

    NASA Astrophysics Data System (ADS)

    Pakuliak, S.; Ragoucy, E.; Slavnov, N. A.

    2014-04-01

    We study integrable models solvable by the nested algebraic Bethe ansatz and possessing GL(3)-invariant R-matrix. We obtain determinant representations for form factors of off-diagonal entries of the monodromy matrix. These representations can be used for the calculation of form factors and correlation functions of the XXX SU(3)-invariant Heisenberg chain.

  19. Quark and gluon form factors to four-loop order in QCD: The Nf3 contributions

    NASA Astrophysics Data System (ADS)

    von Manteuffel, Andreas; Schabinger, Robert M.

    2017-02-01

    We calculate the four-loop massless QCD corrections with three closed quark lines to quark and gluon form factors. We apply a novel integration by parts algorithm based on modular arithmetic and compute all relevant master integrals for arbitrary values of the space-time dimension. This is the first calculation of a gluon form factor at this perturbative order in QCD.

  20. 48 CFR 247.372 - DD Form 1654, Evaluation of Transportation Cost Factors.

    Code of Federal Regulations, 2010 CFR

    2010-10-01

    ... 48 Federal Acquisition Regulations System 3 2010-10-01 2010-10-01 false DD Form 1654, Evaluation... Transportation in Supply Contracts 247.372 DD Form 1654, Evaluation of Transportation Cost Factors. Contracting personnel may use the DD Form 1654 to furnish information to the transportation office for development...

  1. 48 CFR 247.372 - DD Form 1654, Evaluation of Transportation Cost Factors.

    Code of Federal Regulations, 2011 CFR

    2011-10-01

    ... 48 Federal Acquisition Regulations System 3 2011-10-01 2011-10-01 false DD Form 1654, Evaluation... Transportation in Supply Contracts 247.372 DD Form 1654, Evaluation of Transportation Cost Factors. Contracting personnel may use the DD Form 1654 to furnish information to the transportation office for development...

  2. Positron-proton to electron-proton elastic cross section ratios from CLAS

    NASA Astrophysics Data System (ADS)

    Adikaram, Dasuni; Rimal, Dipak; Weinstein, Larry; Raue, Brian

    2014-03-01

    There is a significant discrepancy between the ratio of the electromagnetic form factors of the proton measured by the Rosenbluth and the polarization transfer technique. The most likely explanation of this discrepancy is the inclusion of two-photon exchange (TPE) amplitude contributions to the elastic electron-proton cross section. The CLAS TPE experiment measured the TPE contribution in the wide range of Q2 and ɛ range using a comparison of positron-proton to electron-proton elastic cross sections (R = σ (e+ p) / σ (e- p)). Preliminary results will be presented, along with the estimations of systematic uncertainties. A detailed comparison of new results with previous R measurements and theoretical calculations will be presented. Implications of the CLAS TPE measurements on the elastic electron-proton cross section will be also discussed.

  3. Measurement of the deuteron electric and magnetic form factors at Jefferson Lab

    SciTech Connect

    Gerassimos G. Petratos

    1998-06-01

    The results from an experiment to measure the electric, A(Q{sup 2}), and magnetic, B(Q{sup 2}), form factors of the deuteron at large momentum transfers at the Jefferson Laboratory (JLAB) will be reported. The experiment performed elastic electron scattering from deuterium in coincidence; it has improved the quality of the existing data in the range of overlap and has significantly extended the Q{sup 2} range of the previous A(Q{sup 2}) SLAC data. The range in the squared four-momentum transfer, Q{sup 2}, is 0.7 to 6.0 (GeV/c){sup 2} for the A(Q{sup 2}) measurements and 0.7 to 1.4 (GeV/c){sup 2} for the B(Q{sup 2}) measurements. The measurements used the Continuous Electron Beam Accelerator and Hall-A Facilities of JLAB. Incident electron beams of energy 0.5 to 4.4 GeV and current 10 to 120{mu}A were scattered off a high power (500W) cryogenic deuterium/hydrogen target. Scattered electrons and recoiling deuterons were detected in coincidence using the two 4 GeV/c High Resolution Spectrometers (HRS) in Hall-A. Both HRS's used two planes of scintillators for triggering and timing and a drift chamber system for particle tracking. The electron HRS was also equipped with a gas Cherenkov counter and a lead-glass calorimeter for electron identification. Elastic electron-proton scattering in coincidence was used to calibrate the entire double-arm system. The results will be compared to conventional meson-nucleon physics calculations based on the impulse approximation with the inclusion of meson-exchange-currents, and to predictions of dimensional scaling quark models and perturbative quantum chromodynamics. They are expected to provide a crucial test of nuclear chromodynamics ideas and insights into the transition from the meson-nucleon to quark-gluon descriptions of the two-body nuclear structure.

  4. The neutron electric form factor to Q² = 1.45 (GeV/c)²

    SciTech Connect

    Plaster, Bradley

    2004-02-01

    The nucleon elastic electromagnetic form factors are fundamental quantities needed for an understanding of nucleon and nuclear electromagnetic structure. The evolution of the Sachs electric and magnetic form factors with Q2, the square of the four-momentum transfer, is related to the distribution of charge and magnetization within the nucleon. High precision measurements of the nucleon form factors are essential for stringent tests of our current theoretical understanding of confinement within the nucleon. Measurements of the neutron form factors, in particular, those of the neutron electric form factor, have been notoriously difficult due to the lack of a free neutron target and the vanishing integral charge of the neutron. Indeed, a precise measurement of the neutron electric form factor has eluded experimentalists for decades; however, with the advent of high duty-factor polarized electron beam facilities, experiments employing polarization degrees of freedom have finally yielded the first precise measurements of this fundamental quantity. Following a general overview of the experimental and theoretical status of the nucleon form factors, a detailed description of an experiment designed to extract the neutron electric form factor from measurements of the neutron's recoil polarization in quasielastic 2H(e, e')1H scattering is presented. The experiment described here employed the Thomas Jefferson National Accelerator Facility's longitudinally polarized electron beam, a magnetic spectrometer for detection of the scattered electron, and a neutron polarimeter designed specifically for this experiment. Measurements were conducted at three Q2 values of 0.45, 1.13, and 1.45 (GeV/c)2, and the final results extracted from an analysis of the data acquired in this experiment are reported and compared with recent theoretical predictions for the nucleon form factors.

  5. UV-activated conversion of Hoechst 33258, DAPI, and Vybrant DyeCycle fluorescent dyes into blue-excited, green-emitting protonated forms.

    PubMed

    Zurek-Biesiada, Dominika; Kędracka-Krok, Sylwia; Dobrucki, Jurek W

    2013-05-01

    Hoechst 33258, DAPI and Vybrant DyeCycle are commonly known DNA fluorescent dyes that are excited by UV and emit in the blue region of the spectrum of visible light. Conveniently, they leave the reminder of the spectrum for microscopy detection of other cellular targets labeled with probes emitting in green, yellow or red. However, an exposure of these dyes to UV induces their photoconversion and results in production of the forms of these dyes that are excited by blue light and show fluoresce maxima in green and a detectable fluorescence in yellow and orange regions of the spectrum. Photoconversion of Hoechst 33258 and DAPI is reversible and independent of the dye concentration or the presence of DNA. Spectrofluorimetry and mass spectrometry analyses indicate that exposure to UV induces protonation of Hoechst 33258 and DAPI.

  6. Evidence for a Proton Transfer Network and a Required Persulfide-Bond-Forming Cysteine Residue in Ni-Containing Carbon Monoxide Dehydrogenases

    SciTech Connect

    Eun Jin Kim; Jian Feng; Matthew R. Bramlett; Paul A. Lindahl

    2004-05-18

    OAK-B135 Carbon monoxide dehydrogenase from Moorella thermoacetica catalyzes the reversible oxidation of CO to CO2 at a nickel-iron-sulfur active-site called the C-cluster. Mutants of a proposed proton transfer pathway and of a cysteine residue recently found to form a persulfide bond with the C-cluster were characterized. Four semi-conserved histidine residues were individually mutated to alanine. His116 and His122 were essential to catalysis, while His113 and His119 attenuated catalysis but were not essential. Significant activity was ''rescued'' by a double mutant where His116 was replaced by Ala and His was also introduced at position 115. Activity was also rescued in double mutants where His122 was replaced by Ala and His was simultaneously introduced at either position 121 or 123. Activity was also ''rescued'' by replacing His with Cys at position 116. Mutation of conserved Lys587 near the C-cluster attenuated activity but did not eliminate it. Activity was virtually abolished in a double mutant where Lys587 and His113 were both changed to Ala. Mutations of conserved Asn284 also attenuated activity. These effects suggest the presence of a network of amino acid residues responsible for proton transfer rather than a single linear pathway. The Ser mutant of the persulfide-forming Cys316 was essentially inactive and displayed no EPR signals originating from the C-cluster. Electronic absorption and metal analysis suggests that the C-cluster is absent in this mutant. The persulfide bond appears to be essential for either the assembly or stability of the C-cluster, and/or for eliciting the redox chemistry of the C-cluster required for catalytic activity.

  7. Soft spectator scattering in the nucleon form factors at large Q{sup 2} within the soft collinear effective theory approach

    SciTech Connect

    Kivel, Nikolai; Vanderhaeghen, Marc

    2011-05-01

    The proton form factors at large momentum transfer are dominated by two contributions which are associated with the hard and soft rescattering, respectively. Motivated by a very active experimental form factor program at intermediate values of momentum transfers, Q{sup 2}{approx}5-15 GeV{sup 2}, where an understanding in terms of only a hard rescattering mechanism cannot yet be expected, we investigate in this work the soft rescattering contribution using soft collinear effective theory (SCET). Within such a description, the form factor is characterized, besides the hard scale Q{sup 2}, by a hard-collinear scale Q{Lambda}, which arises due to the presence of soft spectators, with virtuality {Lambda}{sup 2} ({Lambda}{approx}0.5 GeV), such that Q{sup 2}>>Q{Lambda}>>{Lambda}{sup 2}. We show that in this case a two-step factorization can be successfully carried out using the SCET approach. In a first step (SCET{sub I}), we perform the leading-order matching of the QCD electromagnetic current onto the relevant SCET{sub I} operators and perform a resummation of large logarithms using renormalization group equations. We then discuss the further matching onto a SCET{sub II} framework, and propose the factorization formula (accurate to leading logarithmic approximation) for the Dirac form factor, accounting for both hard and soft contributions. We also present a qualitative discussion of the phenomenological consequences of this new framework.

  8. An Investigation of the Factor Structure and Convergent and Discriminant Validity of the Five-Factor Model Rating Form

    ERIC Educational Resources Information Center

    Samuel, Douglas B.; Mullins-Sweatt, Stephanie N.; Widiger, Thomas A.

    2013-01-01

    The Five-Factor Model Rating Form (FFMRF) is a one-page measure designed to provide an efficient assessment of the higher order domains of the Five Factor Model (FFM) as well as the more specific, lower order facets proposed by McCrae and Costa. Although previous research has suggested that the FFMRF's assessment of the lower order facets converge…

  9. Can Nonrelativistic QCD Explain the γγ^{*}→η_{c} Transition Form Factor Data?

    PubMed

    Feng, Feng; Jia, Yu; Sang, Wen-Long

    2015-11-27

    Unlike the bewildering situation in the γγ^{*}→π form factor, a widespread view is that perturbative QCD can decently account for the recent BABAR measurement of the γγ^{*}→η_{c} transition form factor. The next-to-next-to-leading-order perturbative correction to the γγ^{*}→η_{c,b} form factor, is investigated in the nonrelativistic QCD (NRQCD) factorization framework for the first time. As a byproduct, we obtain, by far, the most precise order-α_{s}^{2} NRQCD matching coefficient for the η_{c,b}→γγ process. After including the substantial negative order-α_{s}^{2} correction, the good agreement between NRQCD prediction and the measured γγ^{*}→η_{c} form factor is completely ruined over a wide range of momentum transfer squared. This eminent discrepancy casts some doubts on the applicability of the NRQCD approach to hard exclusive reactions involving charmonium.

  10. Protons are one of the limiting factors in determining sensitivity of nano surface-assisted (+)-mode LDI MS analyses.

    PubMed

    Cho, Eunji; Ahn, Miri; Kim, Young Hwan; Kim, Jongwon; Kim, Sunghwan

    2013-10-01

    A proton source employing a nanostructured gold surface for use in (+)-mode laser desorption ionization mass spectrometry (LDI-MS) was evaluated. Analysis of perdeuterated polyaromatic hydrocarbon compound dissolved in regular toluene, perdeuterated toluene, and deuterated methanol all showed that protonated ions were generated irregardless of solvent system. Therefore, it was concluded that residual water on the surface of the LDI plate was the major source of protons. The fact that residual water remaining after vacuum drying was the source of protons suggests that protons may be the limiting reagent in the LDI process and that overall ionization efficiency can be improved by incorporating an additional proton source. When extra proton sources, such as thiolate compounds and/or citric acid, were added to a nanostructured gold surface, the protonated signal abundance increased. These data show that protons are one of the limiting components in (+)-mode LDI MS analyses employing nanostructured gold surfaces. Therefore, it has been suggested that additional efforts are required to identify compounds that can act as proton donors without generating peaks that interfere with mass spectral interpretation.

  11. Protons are One of the Limiting Factors in Determining Sensitivity of Nano Surface-Assisted (+)-Mode LDI MS Analyses

    NASA Astrophysics Data System (ADS)

    Cho, Eunji; Ahn, Miri; Kim, Young Hwan; Kim, Jongwon; Kim, Sunghwan

    2013-10-01

    A proton source employing a nanostructured gold surface for use in (+)-mode laser desorption ionization mass spectrometry (LDI-MS) was evaluated. Analysis of perdeuterated polyaromatic hydrocarbon compound dissolved in regular toluene, perdeuterated toluene, and deuterated methanol all showed that protonated ions were generated irregardless of solvent system. Therefore, it was concluded that residual water on the surface of the LDI plate was the major source of protons. The fact that residual water remaining after vacuum drying was the source of protons suggests that protons may be the limiting reagent in the LDI process and that overall ionization efficiency can be improved by incorporating an additional proton source. When extra proton sources, such as thiolate compounds and/or citric acid, were added to a nanostructured gold surface, the protonated signal abundance increased. These data show that protons are one of the limiting components in (+)-mode LDI MS analyses employing nanostructured gold surfaces. Therefore, it has been suggested that additional efforts are required to identify compounds that can act as proton donors without generating peaks that interfere with mass spectral interpretation.

  12. CGC factorization for forward particle production in proton-nucleus collisions at next-to-leading order

    NASA Astrophysics Data System (ADS)

    Iancu, E.; Mueller, A. H.; Triantafyllopoulos, D. N.

    2016-12-01

    Within the Color Glass Condensate effective theory, we reconsider the next-to-leading order (NLO) calculation of the single inclusive particle production at forward rapidities in proton-nucleus collisions at high energy. Focusing on quark production for definiteness, we establish a new factorization scheme, perturbatively correct through NLO, in which there is no `rapidity subtraction'. That is, the NLO correction to the impact factor is not explicitly separated from the high-energy evolution. Our construction exploits the skeleton structure of the (NLO) Balitsky-Kovchegov equation, in which the first step of the evolution is explicitly singled out. The NLO impact factor is included by computing this first emission with the exact kinematics for the emitted gluon, rather than by using the eikonal approximation. This particular calculation has already been presented in the literature [1, 2], but the reorganization of the perturbation theory that we propose is new. As compared to the proposal in [1, 2], our scheme is free of the fine-tuning inherent in the rapidity subtraction, which might be the origin of the negativity of the NLO cross-section observed in previous studies.

  13. Delta and Omega electromagnetic form factors in a Dyson-Schwinger/Bethe-Salpeter approach

    SciTech Connect

    Diana Nicmorus, Gernot Eichmann, Reinhard Alkofer

    2010-12-01

    We investigate the electromagnetic form factors of the Delta and the Omega baryons within the Poincare-covariant framework of Dyson-Schwinger and Bethe-Salpeter equations. The three-quark core contributions of the form factors are evaluated by employing a quark-diquark approximation. We use a consistent setup for the quark-gluon dressing, the quark-quark bound-state kernel and the quark-photon interaction. Our predictions for the multipole form factors are compatible with available experimental data and quark-model estimates. The current-quark mass evolution of the static electromagnetic properties agrees with results provided by lattice calculations.

  14. Pion Form Factor in Chiral Limit of Hard-Wall AdS/QCD Model

    SciTech Connect

    Anatoly Radyushkin; Hovhannes Grigoryan

    2007-12-01

    We develop a formalism to calculate form factor and charge density distribution of pion in the chiral limit using the holographic dual model of QCD with hard-wall cutoff. We introduce two conjugate pion wave functions and present analytic expressions for these functions and for the pion form factor. They allow to relate such observables as the pion decay constant and the pion charge electric radius to the values of chiral condensate and hard-wall cutoff scale. The evolution of the pion form factor to large values of the momentum transfer is discussed, and results are compared to existing experimental data.

  15. Parity-Violating Electron Scattering and the Electric and Magnetic Strange Form Factors of the Nucleon

    SciTech Connect

    Armstrong, David S.; McKeown, Robert

    2012-11-01

    Measurement of the neutral weak vector form factors of the nucleon provides unique access to the strange quark content of the nucleon. These form factors can be studied using parity-violating electron scattering. A comprehensive program of experiments has been performed at three accelerator laboratories to determine the role of strange quarks in the electromagnetic form factors of the nucleon. This article reviews the remarkable technical progress associated with this program, describes the various methods used in the different experiments, and summarizes the physics results along with recent theoretical calculations.

  16. Interaction between droplets in a ternary microemulsion evaluated by the relative form factor method

    SciTech Connect

    Nagao, Michihiro; Seto, Hideki; Yamada, Norifumi L.

    2007-06-15

    This paper describes the concentration dependence of the interaction between water droplets coated by a surfactant monolayer using the contrast variation small-angle neutron scattering technique. In the first part, we explain the idea of how to extract a relatively model free structure factor from the scattering data, which is called the relative form factor method. In the second part, the experimental results for the shape of the droplets (form factor) are described. In the third part the relatively model free structure factor is shown, and finally the concentration dependence of the interaction potential between droplets is discussed. The result indicates the validity of the relative form factor method, and the importance of the estimation of the model free structure factor to discuss the nature of structure formation in microemulsion systems.

  17. Form factors of the transitions {gamma}{sup *}{pi}{sup 0} {r_arrow} {gamma} and {gamma}{sup *}{eta}{r_arrow}{gamma}

    SciTech Connect

    Afanasev, A.

    1994-04-01

    The author discusses possibilities to study {gamma}*{pi}{sup 0} and {gamma}*{eta} {r_arrow} {gamma} transition form factors at CEBAF energies. The author shows that for 4 GeV electron beam, these form factors can be measured at CEBAF for the 4-momentum transfers Q{sup 2} {le} 2.5 (GeV/c){sup 2} using virtual Compton scattering on the proton and nuclear target in the kinematic regime of low momentum transfers to the target. These measurements can be extended to Q{sup 2} {le} 4.0 (GeV/c){sup 2} using the electron beam with the energy 6 GeV.

  18. SU-E-T-586: Field Size Dependence of Output Factor for Uniform Scanning Proton Beams: A Comparison of TPS Calculation, Measurement and Monte Carlo Simulation

    SciTech Connect

    Zheng, Y; Singh, H; Islam, M

    2014-06-01

    Purpose: Output dependence on field size for uniform scanning beams, and the accuracy of treatment planning system (TPS) calculation are not well studied. The purpose of this work is to investigate the dependence of output on field size for uniform scanning beams and compare it among TPS calculation, measurements and Monte Carlo simulations. Methods: Field size dependence was studied using various field sizes between 2.5 cm diameter to 10 cm diameter. The field size factor was studied for a number of proton range and modulation combinations based on output at the center of spread out Bragg peak normalized to a 10 cm diameter field. Three methods were used and compared in this study: 1) TPS calculation, 2) ionization chamber measurement, and 3) Monte Carlos simulation. The XiO TPS (Electa, St. Louis) was used to calculate the output factor using a pencil beam algorithm; a pinpoint ionization chamber was used for measurements; and the Fluka code was used for Monte Carlo simulations. Results: The field size factor varied with proton beam parameters, such as range, modulation, and calibration depth, and could decrease over 10% from a 10 cm to 3 cm diameter field for a large range proton beam. The XiO TPS predicted the field size factor relatively well at large field size, but could differ from measurements by 5% or more for small field and large range beams. Monte Carlo simulations predicted the field size factor within 1.5% of measurements. Conclusion: Output factor can vary largely with field size, and needs to be accounted for accurate proton beam delivery. This is especially important for small field beams such as in stereotactic proton therapy, where the field size dependence is large and TPS calculation is inaccurate. Measurements or Monte Carlo simulations are recommended for output determination for such cases.

  19. Electromagnetic form factors of Λb in the Bethe-Salpeter equation approach

    NASA Astrophysics Data System (ADS)

    Liu, Liang-Liang; Wang, Chao; Liu, Ying; Guo, Xin-Heng

    2017-03-01

    The heavy baryon Λb is regarded as composed of a heavy quark and a scalar diquark which has good spin and isospin quantum numbers. In this picture, we calculate the electromagnetic form factors of Λb in the Bethe-Salpeter equation approach in the spacelike region. We find that the shapes of the electromagnetic form factors of Λb are similar to those of Λ , with a peak at ω =1 (for the magnetic form factor) and ω ≃1.1 (for the electric form factor)(ω =v'.v is the velocity transfer between the initial state (with velocity v ) and the final state (with velocity v') of Λb), but the amplitudes are much smaller than those of Λ .

  20. Nucleon-to-{delta} axial transition form factors in relativistic baryon chiral perturbation theory

    SciTech Connect

    Geng, L. S.; Camalich, J. Martin; Alvarez-Ruso, L.; Vacas, M. J. Vicente

    2008-07-01

    We report a theoretical study of the axial nucleon-to-delta (1232) (N{yields}{delta}) transition form factors up to one-loop order in relativistic baryon chiral perturbation theory. We adopt a formalism in which the {delta} couplings obey the spin-3/2 gauge symmetry and, therefore, decouple the unphysical spin-1/2 fields. We compare the results with phenomenological form factors obtained from neutrino bubble-chamber data and in quark models.

  1. Interpreting the neutron's electric form factor: Rest frame charge distribution or foldy term?

    SciTech Connect

    Nathan Isgur

    1998-12-01

    The neutron's electric form factor contains vital information on nucleon structure, but its interpretation within many models has been obscured by relativistic effects. The author demonstrates that, to leading order in the relativistic expansion of a constituent quark model, the Foldy term cancels exactly against a contribution to the Dirac form factor F{sub 1} to leave intact the naive interpretation of G{sup n}{sub E} as arising from the neutron's rest frame charge distribution.

  2. The spin-dependent neutralino-nucleus form factor for {sup 127}I

    SciTech Connect

    Ressell, M.T.; Dean, D.J.

    1996-12-01

    We present the results of detailed shell model calculations of the spin-dependent elastic form factor for the nucleus {sup 127}I. the calculations were performed in extremely large model spaces which adequately describe the configuration mixing in this nucleus. Good agreement between the calculated and experimental values of the magnetic moment are found. Other nuclear observables are also compared to experiment. The dependence of the form factor upon the model space and effective interaction is discussed.

  3. Threshold pion production from proton-proton collisions

    SciTech Connect

    Lee, T.S.H.

    1995-08-01

    We showed that the threshold production of {pi}{sup 0}pp, {pi}{sup +}np, and {pi}{sup +}d from proton-proton collisions can be consistently described by a model consisting of pion s-wave rescattering and N{bar N} pair-terms of heavy-meson exchanges. The large difference between {sigma}{sup tot}(pp {yields} {pi}{sup +}d) and {sigma}{sup tot}(pp {yields} {pi}{sup +}np) is understood from the orthogonality of the deuteron and the np scattering wave functions. In a calculation using the Paris potential, we find that the data can be reproduced best by using a soft {pi}NN form factor with {Delta} = 650 MeV for a monopole form. This is consistent with our earlier studies of pion production in the A-excitation region. A paper describing this result was submitted for publication.

  4. Human transforming growth factor. beta. -. cap alpha. /sub 2/-macroglobulin complex is a latent form of transforming growth factor. beta

    SciTech Connect

    Huang, S.S.; O'Grady, P.; Huang, J.S.

    1987-05-01

    Human platelet-derived transforming growth factor ..beta.. (TGF..beta..) has been shown to be present as a high molecular weight latent form in human serum. Appearance of transforming growth factor activity, along with the change from high molecular weight form to low molecular weight form, was observed following treatment of the latent form of TGF..beta.. with acid or urea, suggesting that the latent form of TGF..beta.. is a complex of TGF..beta.. and a high molecular weight binding protein. Human ..cap alpha../sub 2/-M has been found to be a plasma binding protein for platelet-derived growth factor (PDGF) in serum or plasma. TGF..beta.. and PDGF share similar properties. They, therefore, investigated the interaction between /sup 125/I-TGF..beta.. and ..cap alpha../sub 2/M. /sup 125/I-TGF..beta.. and purified human ..cap alpha../sub 2/M formed a complex as demonstrated by polyacrylamide gel electrophoresis. Most of the /sup 125/I-TGF..beta..-..cap alpha../sub 2/M complex could be dissociated by acid or urea treatment. These results suggest that ..cap alpha../sub 2/M is a binding protein for TGF..beta.. and that TGF..beta..-..cap alpha../sub 2/M complex may be the latent form of TGF..beta.. in serum.

  5. Effects of core deformations and collective rotational currents on electron-nucleus magnetic form factors

    SciTech Connect

    Lin, C.K.

    1983-01-01

    The collective model H/sub int/ + H/sub coll/ is used to study the magnetic form factors. For the intrinsic Hamiltonian, we use the Nilsson model to generate the intrinsic state. For the collective Hamiltonian, two models are considered, the rigid body model and the liquid soap model. We use the particle-rotor model to derive the collective operators and their reduced matrix elements, and then apply this model to the elastic M1 form factor of /sup 13/C. One sees clearly the interplay of the intrinsic form factor and the collective form factor. Since the form factor is essentially a Fourier transform of the current density operator, one also sees the effects of the collective current density distribution due to all the particles in addition to that of the intrinsic current due to the unpaired nucleons. The effects of core deformation are explored. This includes discussions on the difference between the variation before projection and the variation after projection. Analytic results are obtained in the case of weak deformations. The collective model focuses on the effects of the quadrupole deformation on the M1 form factor of /sup 13/C, whereas the calculation involving core polarization stresses the monopole effects. By introducing a quenching of the isovector g/sub s/, the fits by the collective models are very comparable to the fit by the core polarization, although the justification for this procedure in light nuclei is questionable.

  6. Mixed-state form factors of U(1) twist fields in the Dirac theory

    NASA Astrophysics Data System (ADS)

    Chen, Yixiong

    2016-08-01

    Using the ‘Liouville space’ (the space of operators) of the massive Dirac theory, we define mixed-state form factors of U(1) twist fields. We consider mixed states with density matrices diagonal in the asymptotic particle basis. This includes the thermal Gibbs state as well as all generalized Gibbs ensembles of the Dirac theory. When the mixed state is specialized to a thermal Gibbs state, using a Riemann-Hilbert problem and low-temperature expansion, we obtain finite-temperature form factors of U(1) twist fields. We then propose the expression for form factors of U(1) twist fields in general diagonal mixed states. We verify that these form factors satisfy a system of nonlinear functional differential equations, which is derived from the trace definition of mixed-state form factors. At last, under weak analytic conditions on the eigenvalues of the density matrix, we write down the large distance form factor expansions of two-point correlation functions of these twist fields. Using the relation between the Dirac and Ising models, this provides the large-distance expansion of the Rényi entropy (for integer Rényi parameter) in the Ising model in diagonal mixed states.

  7. $$B\\to Kl^+l^-$$ decay form factors from three-flavor lattice QCD

    DOE PAGES

    Bailey, Jon A.

    2016-01-27

    We compute the form factors for the B → Kl+l- semileptonic decay process in lattice QCD using gauge-field ensembles with 2+1 flavors of sea quark, generated by the MILC Collaboration. The ensembles span lattice spacings from 0.12 to 0.045 fm and have multiple sea-quark masses to help control the chiral extrapolation. The asqtad improved staggered action is used for the light valence and sea quarks, and the clover action with the Fermilab interpretation is used for the heavy b quark. We present results for the form factors f+(q2), f0(q2), and fT(q2), where q2 is the momentum transfer, together with a comprehensivemore » examination of systematic errors. Lattice QCD determines the form factors for a limited range of q2, and we use the model-independent z expansion to cover the whole kinematically allowed range. We present our final form-factor results as coefficients of the z expansion and the correlations between them, where the errors on the coefficients include statistical and all systematic uncertainties. Lastly, we use this complete description of the form factors to test QCD predictions of the form factors at high and low q2.« less

  8. $B\\to Kl^+l^-$ decay form factors from three-flavor lattice QCD

    SciTech Connect

    Bailey, Jon A.

    2016-01-27

    We compute the form factors for the B → Kl+l- semileptonic decay process in lattice QCD using gauge-field ensembles with 2+1 flavors of sea quark, generated by the MILC Collaboration. The ensembles span lattice spacings from 0.12 to 0.045 fm and have multiple sea-quark masses to help control the chiral extrapolation. The asqtad improved staggered action is used for the light valence and sea quarks, and the clover action with the Fermilab interpretation is used for the heavy b quark. We present results for the form factors f+(q2), f0(q2), and fT(q2), where q2 is the momentum transfer, together with a comprehensive examination of systematic errors. Lattice QCD determines the form factors for a limited range of q2, and we use the model-independent z expansion to cover the whole kinematically allowed range. We present our final form-factor results as coefficients of the z expansion and the correlations between them, where the errors on the coefficients include statistical and all systematic uncertainties. Lastly, we use this complete description of the form factors to test QCD predictions of the form factors at high and low q2.

  9. Form and structure factors for impedance and reflection from periodic layers.

    PubMed

    Pan, Janet L

    2007-01-20

    In an exact treatment of the Maxwell equations, we derive form and structure factors for reflection from periodic layers, and we show that these factors are significantly different from their analogs in kinematic x-ray diffraction. Quite generally, we show that reflection and impedance can be written precisely as the sum of an additive form factor and the product of a structure factor and a second form factor. This additive form factor does not have an analog in kinematic x-ray diffraction. It is demonstrated that the form factors are found by analytic continuation to an arbitrary wavelength of expressions for the impedance both at long wavelengths and at quarter wavelengths. A correction to the Bragg law relating fringe spacing to the total structure thickness is derived. We go beyond previous numerical work by deriving simple analytic exact expressions for reflection and impedance of periodic layers for all frequencies within the reflection passband, and for an arbitrary number of periods in the structure, an arbitrary index profile within each period, arbitrary layer thicknesses (not just quarter-wave layers), and for arbitrary sizes of the refractive index differences.

  10. 77 FR 4227 - Implantation or Injectable Dosage Form New Animal Drugs; Gonadotropin Releasing Factor Analog...

    Federal Register 2010, 2011, 2012, 2013, 2014

    2012-01-27

    ... HUMAN SERVICES Food and Drug Administration 21 CFR Part 522 Implantation or Injectable Dosage Form New... gonadotropin releasing factor analog-diphtheria toxoid conjugate injectable solution. DATES: This rule is...: PART 522--IMPLANTATION OR INJECTABLE DOSAGE FORM NEW ANIMAL DRUGS 0 1. The authority citation for...

  11. Charged pion form factor between $Q^2$=0.60 and 2.45 GeV$^2$. II. Determination of, and results for, the pion form factor

    SciTech Connect

    Huber, Garth; Blok, Henk; Horn, Tanja; Beise, Elizabeth; Gaskell, David; Mack, David; Tadevosyan, Vardan; Volmer, Jochen; Abbott, David; Aniol, Konrad; Anklin, Heinz; Armstrong, Christopher; Arrington, John; Assamagan, Ketevi; Avery, Steven; Baker, O.; Barrett, Robert; Bochna, Christopher; Boeglin, Werner; Brash, Edward; Breuer, Herbert; Chang, C.; Chang, C.C.; Chant, Nicholas; Christy, Michael; Dunne, James; Eden, Thomas; Ent, Rolf; Fenker, Benjamin; Gibson, Edward; Gilman, Ronald; Gustafsson, Kenneth; Hinton, Wendy; Holt, Roy; Jackson, Harold; uk Jin, Seong; Jones, Mark; Keppel, Cynthia; Kim, pyunghun; Kim, Wooyoung; King, Paul; Klein, Andreas; Koltenuk, Douglas; Kovaltchouk, Vitali; Liang, Meihua; Liu, Jinghua; Lolos, George; Lung, Allison; Margaziotis, Demetrius; Markowitz, Pete; Matsumura, Akihiko; McKee, David; Meekins, David; Mitchell, Joseph; Miyoshi, Toshinobu; Mkrtchyan, Hamlet; Mueller, Robert; Niculescu, Gabriel; Niculescu, Maria-Ioana; Okayasu, Yuichi; Pentchev, Lubomir; Perdrisat, Charles; Pitz, David; Potterveld, David; Punjabi, Vina; Qin, Liming; Reimer, Paul; Reinhold, Joerg; Roche, Julie; Roos, Philip; Sarty, Adam; Shin, Ilkyoung; Smith, Gregory; Stepanyan, Stepan; Tang, Liguang; Tvaskis, Vladas; van der Meer, Rob; Vansyoc, Kelley; Van Westrum, Derek; Vidakovic, Sandra; Vulcan, William; Warren, Glen; Wood, Stephen; Xu, Chen; Yan, Chen; Zhao, Wenxia; Zheng, Xiaochao; Zihlmann, Benedikt

    2008-10-01

    DOI: http://dx.doi.org/10.1103/PhysRevC.78.045203
    The charged pion form factor, Fpi(Q2), is an important quantity that can be used to advance our knowledge of hadronic structure. However, the extraction of Fpi from data requires a model of the 1H(e,e'pi+)n reaction and thus is inherently model dependent. Therefore, a detailed description of the extraction of the charged pion form factor from electroproduction data obtained recently at Jefferson Lab is presented, with particular focus given to the dominant uncertainties in this procedure. Results for Fpi are presented for Q2=0.60-2.45 GeV2. Above Q2=1.5 GeV2, the Fpi values are systematically below the monopole parametrization that describes the low Q2 data used to determine the pion charge radius. The pion form factor can be calculated in a wide variety of theoretical approaches, and the experimental results are compared to a number of calculations. This comparison is helpful in understanding the role of soft versus hard c

  12. Liquid chromatography-mass spectrometry and proton nuclear magnetic resonance characterization of trace level condensation products formed between lactose and the amine-containing diuretic hydrochlorothiazide.

    PubMed

    Harmon, P A; Yin, W; Bowen, W E; Tyrrell, R J; Reed, R A

    2000-07-01

    Trace levels of condensation products between lactose and the amine-containing diuretic hydrochlorothiazide are formed when a mixture of the two solids containing 30% weight water is heated at 60 degrees C for 2 weeks. The two most abundant condensation products were characterized by liquid chromatography-mass spectrometry (LC-MS) and proton nuclear magnetic resonance ((1)H NMR) spectroscopy. Under these relatively mild conditions of formation, the amine-lactose reaction products are limited to those involving the elimination of only a single molecule of water, rather than the multiple-water eliminations associated with later stages of the Maillard reaction. The spectroscopic data clearly show that the primary condensation products are cyclic N-substituted glycosylamines rather than Schiff base, 1,2-enolic forms, or Amadori rearrangement products of identical mass. In solution, the two most abundant N-substituted glycosylamines are shown to be in a kinetically slow equilibrium with each other, most likely through a mutarotation involving the intermediate formation of the acyclic Schiff base.

  13. Potential Energy Landscape of the Electronic States of the GFP Chromophore in Different Protonation Forms: Electronic Transition Energies and Conical Intersections.

    PubMed

    Polyakov, I V; Grigorenko, B L; Epifanovsky, E M; Krylov, A I; Nemukhin, A V

    2010-08-10

    We present the results of quantum chemical calculations of the transition energies and conical intersection points for the two lowest singlet electronic states of the green fluorescent protein chromophore, 4'-hydroxybenzylidene-2,3-dimethylimidazolinone, in the vicinity of its cis conformation in the gas phase. Four protonation states of the chromophore, i.e., anionic, neutral, cationic, and zwitterionic, were considered. Energy differences were computed by the perturbatively corrected complete active space self-consistent field (CASSCF)-based approaches at the corresponding potential energy minima optimized by density functional theory and CASSCF (for the ground and excited states, respectively). We also report the EOM-CCSD and SOS-CIS(D) results for the excitation energies. The minimum energy S0/S1 conical intersection points were located using analytic state-specific CASSCF gradients. The results reproduce essential features of previous ab initio calculations of the anionic form of the chromophore and provide an extension for the neutral, cationic, and zwitterionic forms, which are important in the protein environment. The S1 PES of the anion is fairly flat, and the barrier separating the planar bright conformation from the dark twisted one as well as the conical intersection point with the S0 surface is very small (less than 2 kcal/mol). On the cationic surface, the barrier is considerably higher (∼13 kcal/mol). The PES of the S1 state of the zwitterionic form does not have a planar minimum in the Franck-Condon region. The S1 surface of the neutral form possesses a bright planar minimum; the energy barrier of about 9 kcal/mol separates it from the dark twisted conformation as well as from the conical intersection point leading to the cis-trans chromophore isomerization.

  14. Factor Structure and Validity of the Parenting Stress Index-Short Form

    ERIC Educational Resources Information Center

    Haskett, Mary E.; Ahern, Lisa S.; Ward, Caryn S.; Allaire, Jason C.

    2006-01-01

    The psychometric properties of the Parenting Stress Index-Short Form (PSI-SF) were examined in a sample of 185 mothers and fathers. Factor analysis revealed 2 reasonably distinct factors involving parental distress and dysfunctional parent-child interactions. Both scales were internally consistent, and these scales were correlated with measures of…

  15. Forms, Factors and Consequences of Cheating in University Examinations: Insight from Open and Distance Learning Students

    ERIC Educational Resources Information Center

    Mokula, Lebeloane Lazarus Donald; Lovemore, Nyaumwe

    2014-01-01

    The present study narrated the forms, factors and consequences of cheating in university examinations by UNISA Open and Distance learning students from anecdotal data. The results showed that the perpetrators mostly used crib materials on paper, ruler and calculator cover. The factors that influenced examination cheating were gender, age range and…

  16. Factor Structure and Psychometric Properties of the Young Schema Questionnaire (Short Form) in Chinese Undergraduate Students

    ERIC Educational Resources Information Center

    Cui, Lixia; Lin, Wenwen; Oei, Tian P. S.

    2011-01-01

    This study investigated cross-cultural differences in the factor structure and psychometric properties of the Young Schema Questionnaire (short form; YSQ-SF). The participants were 712 Chinese undergraduate students. The total sample was randomly divided into two sub-samples. Exploratory Factor Analysis (EFA) was conducted on questionnaire results…

  17. Multilevel Confirmatory Factor Analysis of the Teacher My Class Inventory-Short Form

    ERIC Educational Resources Information Center

    Villares, Elizabeth; Mariani, Melissa; Sink, Christopher A.; Colvin, Kimberly

    2016-01-01

    Researchers analyzed data from elementary teachers (N = 233) to further establish the psychometric soundness of the Teacher My Class Inventory-Short Form. Supporting previous psychometric research, confirmatory factor analyses findings supported the factorial validity of the hypothesized five-factor solution. Internal reliability estimates were…

  18. Density form factors of the 1D Bose gas for finite entropy states

    NASA Astrophysics Data System (ADS)

    De Nardis, J.; Panfil, M.

    2015-02-01

    We consider the Lieb-Liniger model for a gas of bosonic δ-interacting particles. Using Algebraic Bethe Ansatz results we compute the thermodynamic limit of the form factors of the density operator between finite entropy eigenstates such as finite temperature states or generic non-equilibrium highly excited states. These form factors are crucial building blocks to obtain the thermodynamic exact dynamic correlation functions of such physically relevant states. As a proof of principle we compute an approximated dynamic structure factor by including only the simplest types of particle-hole excitations and show the agreement with known results.

  19. Weak charge form factor and radius of 208Pb through parity violation in electron scattering

    SciTech Connect

    Horowitz, C. J.; Ahmed, Z.; Jen, C. -M.; Rakhman, A.; Souder, P. A.; Dalton, M. M.; Liyanage, N.; Paschke, K. D.; Saenboonruang, K.; Silwal, R.; Franklin, G. B.; Friend, M.; Quinn, B.; Kumar, K. S.; McNulty, D.; Mercado, L.; Riordan, S.; Wexler, J.; Michaels, R. W.; Urciuoli, G. M.

    2012-03-26

    We use distorted wave electron scattering calculations to extract the weak charge form factor FW($\\bar{q}$), the weak charge radius RW, and the point neutron radius Rn, of 208Pb from the PREX parity violating asymmetry measurement. The form factor is the Fourier transform of the weak charge density at the average momentum transfer $\\bar{q}$ = 0.475 fm-1. We find FW($\\bar{q}$) = 0.204 ± 0.028(exp) ± 0.001(model). We use the Helm model to infer the weak radius from FW($\\bar{q}$). We find RW = 5.826 ± 0.181(exp) ± 0.027(model) fm. Here the exp error includes PREX statistical and systematic errors, while the model error describes the uncertainty in RW from uncertainties in the surface thickness σ of the weak charge density. The weak radius is larger than the charge radius, implying a 'weak charge skin' where the surface region is relatively enriched in weak charges compared to (electromagnetic) charges. We extract the point neutron radius Rn = 5.751 ± 0.175 (exp) ± 0.026(model) ± 0.005(strange) fm, from RW. Here there is only a very small error (strange) from possible strange quark contributions. We find Rn to be slightly smaller than RW because of the nucleon's size. As a result, we find a neutron skin thickness of Rn-Rp = 0.302 ± 0.175 (exp) ± 0.026 (model) ± 0.005 (strange) fm, where Rp is the point proton radius.

  20. A study of the γ ^*-f0(980) transition form factors

    NASA Astrophysics Data System (ADS)

    Kroll, P.

    2017-02-01

    The γ ^*-f0(980) transition form factors are calculated within the QCD factorization framework. The f_0-meson is assumed to be mainly generated through its sbar{s} Fock component. The corresponding spin wave function of the f0(980) meson is constructed and, combined with a model light-cone wave function for this Fock component, used in the calculation of the form factors. In the real-photon limit the results for the transverse form factor are compared to the large momentum-transfer data measured by the BELLE collaboration recently. It turns out that, for the momentum-transfer range explored by BELLE, the collinear approximation does not suffice, power corrections to it, modeled as quark transverse moment effects, seem to be needed. Mixing of the f_0 with the σ (500) is also briefly discussed.

  1. Factor structure of the BASC-2 Behavioral and Emotional Screening System Student Form.

    PubMed

    Dowdy, Erin; Twyford, Jennifer M; Chin, Jenna K; DiStefano, Christine A; Kamphaus, Randy W; Mays, Kristen L

    2011-06-01

    The BASC-2 Behavioral and Emotional Screening System (BESS) Student Form (Kamphaus & Reynolds, 2007) is a recently developed youth self-report rating scale designed to identify students at risk for behavioral and emotional problems. The BESS Student Form was derived from the Behavior Assessment System for Children-Second Edition Self-Report of Personality (BASC-2 SRP; Reynolds & Kamphaus, 2004) using principal component analytic procedures and theoretical considerations. Using 3 samples, the authors conducted exploratory factor analyses (EFA) and confirmatory factor analyses (CFA) to understand the underlying factor structure of the BESS Student Form. The results of the EFA suggested that the SRP contained a 4-factor (i.e., Personal Adjustment, Inattention/Hyperactivity, Internalizing, School Problems) emergent structure, which was supported by CFA in 2 additional samples. Practical and research implications are discussed.

  2. Regularization of multi-soliton form factors in sine-Gordon model

    NASA Astrophysics Data System (ADS)

    Pálmai, T.

    2012-08-01

    A general and systematic regularization is developed for the exact solitonic form factors of exponential operators in the (1+1)-dimensional sine-Gordon model by analytical continuation of their integral representations. The procedure is implemented in Mathematica. Test results are shown for four- and six-soliton form factors. Catalogue identifier: AEMG_v1_0 Program summary URL:http://cpc.cs.qub.ac.uk/summaries/AEMG_v1_0.html Program obtainable from: CPC Program Library, Queen's University, Belfast, N. Ireland Licensing provisions: Standard CPC licence, http://cpc.cs.qub.ac.uk/licence/licence.html No. of lines in distributed program, including test data, etc.: 1462 No. of bytes in distributed program, including test data, etc.: 15 488 Distribution format: tar.gz Programming language: Mathematica [1] Computer: PC Operating system: Cross-platform Classification: 7.7, 11.1, 23 Nature of problem: The multi-soliton form factors of the sine-Gordon model (relevant in two-dimensional physics) were given only by highly non-trivial integral representation with a limited domain of convergence. Practical applications of the form factors, e.g. calculation of correlation functions in two-dimensional condensed matter systems, were not possible in general. Solution method: Using analytic continuation techniques an efficient algorithm is found and implemented in Mathematica, which provides a general and systematic way to calculate multi-soliton form factors in the sine-Gordon model. The package contains routines to compute the two-, four- and six-soliton form factors. Running time: Strongly dependent on the desired accuracy and the number of solitons. For physical rapidities after an initialization of about 30 s, the calculation of the two-, four- and six-soliton form factors at a single point takes approximately 0.5 s, 2.5 s and 8 s, respectively. Wolfram Research, Inc., Mathematica Edition: Version 7.0, Wolfram Research, Inc., Champaign, Illinois, 2008.

  3. Helicobacter pylori virulence factors affecting gastric proton pump expression and acid secretion.

    PubMed

    Hammond, Charles E; Beeson, Craig; Suarez, Giovanni; Peek, Richard M; Backert, Steffen; Smolka, Adam J

    2015-08-01

    Acute Helicobacter pylori infection of gastric epithelial cells and human gastric biopsies represses H,K-ATPase α subunit (HKα) gene expression and inhibits acid secretion, causing transient hypochlorhydria and supporting gastric H. pylori colonization. Infection by H. pylori strains deficient in the cag pathogenicity island (cag PAI) genes cagL, cagE, or cagM, which do not transfer CagA into host cells or induce interleukin-8 secretion, does not inhibit HKα expression, nor does a cagA-deficient strain that induces IL-8. To test the hypothesis that virulence factors other than those mediating CagA translocation or IL-8 induction participate in HKα repression by activating NF-κB, AGS cells transfected with HKα promoter-Luc reporter constructs containing an intact or mutated NF-κB binding site were infected with wild-type H. pylori strain 7.13, isogenic mutants lacking cag PAI genes responsible for CagA translocation and/or IL-8 induction (cagA, cagζ, cagε, cagZ, and cagβ), or deficient in genes encoding two peptidoglycan hydrolases (slt and cagγ). H. pylori-induced AGS cell HKα promoter activities, translocated CagA, and IL-8 secretion were measured by luminometry, immunoblotting, and ELISA, respectively. Human gastric biopsy acid secretion was measured by microphysiometry. Taken together, the data showed that HKα repression is independent of IL-8 expression, and that CagA translocation together with H. pylori transglycosylases encoded by slt and cagγ participate in NF-κB-dependent HKα repression and acid inhibition. The findings are significant because H. pylori factors other than CagA and IL-8 secretion are now implicated in transient hypochlorhydria which facilitates gastric colonization and potential triggering of epithelial progression to neoplasia.

  4. The puzzle of the π → γ γ* transition form factor

    NASA Astrophysics Data System (ADS)

    Lucha, Wolfgang; Melikhov, Dmitri

    2012-04-01

    We study the P → γ γ* (P = π0, η, η‧) transition form factors by means of the local-duality (LD) version of QCD sum rules. For the case of η and η‧, the conventional LD model provides a good description of the existing data. However, for the pion form factor we find a disagreement with recent BaBar results for high Q2, even though the accuracy of the LD approximation is expected to increase with Q2. It remains mysterious why both η and η‧ form factors to virtual photons, on the one hand, and the π0 form factor, on the other hand, show a qualitatively different behaviour, corresponding to a violation of LD that rises with Q2 in the pion case. In a quantum-mechanical example, we show that, for a bound-state size of about 1 fm, the LD sum rule provides an accurate prediction for the form factor for Q2 larger than a few GeV2.

  5. Mechanism of activation of elongation factor Tu by ribosome: catalytic histidine activates GTP by protonation.

    PubMed

    Aleksandrov, Alexey; Field, Martin

    2013-09-01

    Elongation factor Tu (EF-Tu) is central to prokaryotic protein synthesis as it has the role of delivering amino-acylated tRNAs to the ribosome. Release of EF-Tu, after correct binding of the EF-Tu:aa-tRNA complex to the ribosome, is initiated by GTP hydrolysis. This reaction, whose mechanism is uncertain, is catalyzed by EF-Tu, but requires activation by the ribosome. There have been a number of mechanistic proposals, including those spurred by a recent X-ray crystallographic analysis of a ribosome:EF-Tu:aa-tRNA:GTP-analog complex. In this work, we have investigated these and alternative hypotheses, using high-level quantum chemical/molecular mechanical simulations for the wild-type protein and its His85Gln mutant. For both proteins, we find previously unsuggested mechanisms as being preferred, in which residue 85, either His or Gln, directly assists in the reaction. Analysis shows that the RNA has a minor catalytic effect in the wild-type reaction, but plays a significant role in the mutant by greatly stabilizing the reaction's transition state. Given the similarity between EF-Tu and other members of the translational G-protein family, it is likely that these mechanisms of ribosome-activated GTP hydrolysis are pertinent to all of these proteins.

  6. $D$ semileptonic form factors and $|V_{cs(d)}|$ from 2+1 flavor lattice QCD

    SciTech Connect

    Bailey, Jon A.; Bazavov, A.; El-Khadra, A.X.; Gottlieb, Steven; Jain, R.D.; Kronfeld, A.S.; Van de Water, R.S.; Zhou, R.

    2011-11-01

    The measured partial widths of the semileptonic decays D {yields} K{ell}{nu} and D {yields} {pi}{ell}{nu} can be combined with the form factors calculated on the lattice to extract the CKM matrix elements |V{sub cs}| and |V{sub cd}|. The lattice calculations can be checked by comparing the form factor shapes from the lattice and experiment. We have generated a sizable data set by using heavy clover quarks with the Fermilab interpretation for charm and asqtad staggered light quarks on 2+1 flavor MILC ensembles with lattice spacings of approximately 0.12, 0.09, 0.06, and 0.045 fm. Preliminary fits to staggered chiral perturbation theory suggest that we can reduce the uncertainties in the form factors at q{sup 2} = 0 to below 5%.

  7. Electromagnetic form factors of the {Omega}{sup -} in lattice QCD

    SciTech Connect

    Alexandrou, C.; Korzec, T.; Koutsou, G.; Negele, J. W.; Proestos, Y.

    2010-08-01

    We present results on the omega baryon ({Omega}{sup -}) electromagnetic form factors using N{sub f}=2+1 domain-wall fermion configurations for three pion masses in the range of about 350 to 300 MeV. We compare results obtained using domain-wall fermions with those of a mixed-action (hybrid) approach, which combines domain-wall valence quarks on staggered sea quarks, for a pion mass of about 350 MeV. We pay particular attention in the evaluation of the subdominant electric quadrupole form factor to sufficient accuracy to exclude a zero value, by constructing a sequential source that isolates it from the dominant form factors. The {Omega}{sup -} magnetic moment, {mu}{sub {Omega}}{sup -}, and the electric charge and magnetic radius, , are extracted for these pion masses. The electric quadrupole moment is determined for the first time using dynamical quarks.

  8. Semiclassical form factor for spectral and matrix element fluctuations of multidimensional chaotic systems.

    PubMed

    Turek, Marko; Spehner, Dominique; Müller, Sebastian; Richter, Klaus

    2005-01-01

    We present a semiclassical calculation of the generalized form factor Kab(tau) which characterizes the fluctuations of matrix elements of the operators a and b in the eigenbasis of the Hamiltonian of a chaotic system. Our approach is based on some recently developed techniques for the spectral form factor of systems with hyperbolic and ergodic underlying classical dynamics and f = 2 degrees of freedom, that allow us to go beyond the diagonal approximation. First we extend these techniques to systems with f > 2. Then we use these results to calculate Kab(tau). We show that the dependence on the rescaled time tau (time in units of the Heisenberg time) is universal for both the spectral and the generalized form factor. Furthermore, we derive a relation between Kab(tau) and the classical time-correlation function of the Weyl symbols of a and b.

  9. Master Integrals for Fermionic Contributions to Massless Three-Loop Form Factors

    SciTech Connect

    Heinrich, G.; Huber, T.; Maitre, D.

    2007-11-28

    In this letter we continue the calculation of master integrals for massless three-loop form factors by giving analytical results for those diagrams which are relevant for the fermionic contributions proportional to N{sub F}{sup 2}, N{sub F} {center_dot} N, and N{sub F}/N. Working in dimensional regularization, we express one of the diagrams in a closed form which is exact to all orders in {epsilon}, containing {Lambda}-functions and hypergeometric functions of unit argument. In all other cases we derive multiple Mellin-Barnes representations from which the coefficients of the Laurent expansion in {epsilon} are extracted in an analytical form. To obtain the finite part of the three-loop quark and gluon form factors, all coefficients through transcendentality six in the Riemann {zeta}-function have to be included.

  10. Analysis of approximations used in calculations of radiative corrections to electron-proton scattering cross section

    NASA Astrophysics Data System (ADS)

    Gerasimov, R. E.; Fadin, V. S.

    2015-01-01

    An analysis of approximations used in calculations of radiative corrections to electron-proton scattering cross section is presented. We investigate the difference between the relatively recent Maximon and Tjon result and the Mo and Tsai result, which was used in the analysis of experimental data. We also discuss the proton form factors ratio dependence on the way we take into account radiative corrections.

  11. Analysis of approximations used in calculations of radiative corrections to electron-proton scattering cross section

    SciTech Connect

    Gerasimov, R. E. Fadin, V. S.

    2015-01-15

    An analysis of approximations used in calculations of radiative corrections to electron-proton scattering cross section is presented. We investigate the difference between the relatively recent Maximon and Tjon result and the Mo and Tsai result, which was used in the analysis of experimental data. We also discuss the proton form factors ratio dependence on the way we take into account radiative corrections.

  12. Constraints on the ωπ Form Factor from Analyticity and Unitarity

    NASA Astrophysics Data System (ADS)

    Ananthanarayan, B.; Caprini, Irinel; Kubis, Bastian

    Form factors are important low-energy quantities and an accurate knowledge of these sheds light on the strong interactions. A variety of methods based on general principles have been developed to use information known in different energy regimes to constrain them in regions where experimental information needs to be tested precisely. Here we review our recent work on the electromagnetic ωπ form factor in a model-independent framework known as the method of unitarity bounds, partly motivated by the discre-pancies noted recently between the theoretical calculations of the form factor based on dispersion relations and certain experimental data measured from the decay ω → π0γ*. We have applied a modified dispersive formalism, which uses as input the discontinuity of the ωπ form factor calculated by unitarity below the ωπ threshold and an integral constraint on the square of its modulus above this threshold. The latter constraint was obtained by exploiting unitarity and the positivity of the spectral function of a QCD correlator, computed on the spacelike axis by operator product expansion and perturbative QCD. An alternative constraint is obtained by using data available at higher energies for evaluating an integral of the modulus squared with a suitable weight function. From these conditions we derived upper and lower bounds on the modulus of the ωπ form factor in the region below the ωπ threshold. The results confirm the existence of a disagreement between dispersion theory and experimental data on the ωπ form factor around 0:6 GeV, including those from NA60 published in 2016.

  13. Identification and characterisation of a G-quadruplex forming sequence in the promoter region of nuclear factor (erythroid-derived 2)-like 2 (Nrf2)

    SciTech Connect

    Waller, Zoë A.E. Howell, Lesley A.; MacDonald, Colin J.; O’Connell, Maria A.; Searcey, Mark

    2014-04-25

    Highlights: • Discovery of a G-quadruplex forming sequence in the promoter sequence of Nrf2. • Characterisation of the G-quadruplex by UV, CD and NMR. • Conformational switching of G-quadruplex induced by 9-aminoacridine. - Abstract: The transcription factor nuclear factor (erythroid-derived 2)-like 2 (Nrf2) regulates multiple antioxidants, Phase II detoxification enzymes and other cytoprotective enzymes in cells. Activation of Nrf2 is recognised as being of potential therapeutic benefit in inflammatory-diseases whereas more recently, it has become clear that the inhibition of Nrf2 may have benefit in the alleviation of resistance in some tumour types. A potential G-quadruplex forming sequence was identified in the promoter region of Nrf2, close to a number of putative transcription factor binding sites. Characterisation of the sequence 5’-d[GGGAAGGGAGCAAGGGCGGGAGGG]-3’ using CD spectroscopy, imino proton NMR resonances and UV melting experiments demonstrated the formation of a parallel intramolecular G-quadruplex in the presence of K{sup +} ions. Incubation with 9-aminoacridine ligands induced a switch from antiparallel to parallel forms. The presence of a G-quadruplex forming sequence in the promoter region of Nrf2 suggests an approach to targeting the production of the protein through stabilisation of the structure, thereby avoiding resistance to antitumour drugs.

  14. SU-E-T-72: Commissioning of a Standardized SRS Cone Set: Determination of the Bolus Gap Factors in a Passively Scattered Proton Beam

    SciTech Connect

    Simpson, R; Gordon, I; Ghebremedhin, A; Wroe, A; Schulte, R; Bush, D; Slater, J; Patyal, B

    2014-06-01

    Purpose: To determine the proton output factors for an SRS cone set using standardized apertures and varied range compensators (bolus blanks); specifically, to determine the best method for modeling the bolus gap factor (BGF) and eliminate the need for patient specific calibrations. Methods: A Standard Imaging A-16 chamber was placed in a Plastic Water phantom to measure the change in dose/MU with different treatment combinations for a proton SRS cone, using standardized apertures and range compensators. Measurements were made with all apertures in the SRS cone set, with four different range compensator thicknesses and five different air gaps between the end of the SRS cone and the surface of the phantom. The chamber was located at iso-center and maintained at a constant depth at the center of modulation for all measurements. Each aperture was placed in the cone to measure the change in MU needed to maintain constant dose at the chamber, as the air gap was increased with different thicknesses of bolus. Results: The dose/MU varied significantly with decreasing aperture size, increasing bolus thickness, or increasing air gap. The measured data was fitted with the lowest order polynomials that accurately described the data, to create a model for determining the change in output for any potential combination of devices used to treat a patient. For a given standardized aperture, the BGF could be described by its constituent factors: the bolus thickness factor (BTF) and the nozzle extension factor (NEF). Conclusion: The methods used to model the dose at the calibration point could be used to accurately predict the change in output for SRS proton beams due to the BGF, eliminating the need for patient specific calibrations. This method for modeling SRS treatments could also be applied to model other treatments using passively scattered proton beams.

  15. Analysis of the Neutron Electric Form Factor at Q2 = 1.4 GeV2 using the reaction 3 H->e (e-> ,e' n) pp

    NASA Astrophysics Data System (ADS)

    Obrecht, Richard; Super Bigbite Collaboration

    2016-09-01

    The Jefferson Lab Hall A experiment E02-013 extracted the neutron electric form factor GEn by measuring the beam-target asymmetry in quasi-elastically scattering of longitudinally polarized electrons from a polarized 3He target via the semi-exclusive reaction3 H->e (e-> ,e' n) pp . The experiment measured the electric form factor at a spacelike four-momentum transfer squared Q2 = 1.4, 1.7, 2.7, and 3.4 GeV2, but only the latter three points were published by S. Riordan et al. (Phys. Rev. Lett. 105, 262302). The goal of this talk is to present the analysis chain necessary to extract the form factor from a neutron asymmetry that arises by periodically changing the sign of the beam helicity. The analysis includes selecting quasi-elastic events in a high noise environment, and correcting for various factors that dilute the signal such as false proton asymmetries and final state interactions within the target. Jefferson Lab Hall A.

  16. Matching lightcone and anomaly-sum-rule predictions for the pion-photon transition form factor

    NASA Astrophysics Data System (ADS)

    Oganesian, A. G.; Pimikov, A. V.; Stefanis, N. G.; Teryaev, O. V.

    2016-03-01

    The pion-photon transition form factor is studied by employing two types of sum rules: light cone sum rules (LCSR) and anomaly sum rules (ASR). By comparing the predictions for the pion-photon transition form factor, obtained from these two approaches, the applicability limit of the LCSRs at low momenta is determined. Reciprocally, the ASR threshold dependence on the momentum was extracted using our LCSR-based method in combination with two different types of pion distribution amplitudes and found that at higher Q2 it approaches a constant.

  17. Generalized heavy-to-light form factors in light-cone sum rules

    NASA Astrophysics Data System (ADS)

    Meißner, Ulf-G.; Wang, Wei

    2014-03-01

    We study the form factors for a heavy meson into the S-wave Kπ/ππ system with an invariant mass below 1 GeV. The mesonic final state interactions are described in terms of the scalar form factors, which are obtained from unitarized chiral perturbation theory. Employing generalized light-cone distribution amplitudes, we compute the heavy-to-light transition using light-cone sum rules. Our approach simultaneously respects constraints from analyticity and unitarity, and also takes advantage of the power expansion in the 1/mb and the strong coupling constant.

  18. Computation of form factors in massless QCD with finite master integrals

    NASA Astrophysics Data System (ADS)

    von Manteuffel, Andreas; Panzer, Erik; Schabinger, Robert M.

    2016-06-01

    We present the bare one-, two-, and three-loop form factors in massless quantum chromodynamics as linear combinations of finite master integrals. Using symbolic integration, we compute their ɛ expansions and thereby reproduce all known results with an independent method. Remarkably, in our finite basis, only integrals with a less-than-maximal number of propagators contribute to the cusp anomalous dimensions. We report on indications of this phenomenon at four loops, including the result for a finite, irreducible, twelve-propagator form factor integral. Together with this article, we provide our automated software setup for the computation of finite master integrals.

  19. JLab measurement of the 4He charge form factor at large momentum transfers.

    PubMed

    Camsonne, A; Katramatou, A T; Olson, M; Sparveris, N; Acha, A; Allada, K; Anderson, B D; Arrington, J; Baldwin, A; Chen, J-P; Choi, S; Chudakov, E; Cisbani, E; Craver, B; Decowski, P; Dutta, C; Folts, E; Frullani, S; Garibaldi, F; Gilman, R; Gomez, J; Hahn, B; Hansen, J-O; Higinbotham, D W; Holmstrom, T; Huang, J; Iodice, M; Jiang, X; Kelleher, A; Khrosinkova, E; Kievsky, A; Kuchina, E; Kumbartzki, G; Lee, B; LeRose, J J; Lindgren, R A; Lott, G; Lu, H; Marcucci, L E; Margaziotis, D J; Markowitz, P; Marrone, S; Meekins, D; Meziani, Z-E; Michaels, R; Moffit, B; Norum, B; Petratos, G G; Puckett, A; Qian, X; Rondon, O; Saha, A; Sawatzky, B; Segal, J; Shabestari, M; Shahinyan, A; Solvignon, P; Subedi, R R; Suleiman, R; Sulkosky, V; Urciuoli, G M; Viviani, M; Wang, Y; Wojtsekhowski, B B; Yan, X; Yao, H; Zhang, W-M; Zheng, X; Zhu, L

    2014-04-04

    The charge form factor of 4He has been extracted in the range 29  fm(-2) ≤ Q2 ≤ 77  fm(-2) from elastic electron scattering, detecting 4He recoil nuclei and electrons in coincidence with the high resolution spectrometers of the Hall A Facility of Jefferson Lab. The measurements have uncovered a second diffraction minimum for the form factor, which was predicted in the Q2 range of this experiment. The data are in qualitative agreement with theoretical calculations based on realistic interactions and accurate methods to solve the few-body problem.

  20. Light Cone Sum Rules for gamma*N ->Delta Transition Form Factors

    SciTech Connect

    V.M. Braun; A. Lenz; G. Peters; A. Radyushkin

    2006-02-01

    A theoretical framework is suggested for the calculation of {gamma}* N {yields} {Delta} transition form factors using the light-cone sum rule approach. Leading-order sum rules are derived and compared with the existing experimental data. We find that the transition form factors in a several GeV region are dominated by the ''soft'' contributions that can be thought of as overlap integrals of the valence components of the hadron wave functions. The ''minus'' components of the quark fields contribute significantly to the result, which can be reinterpreted as large contributions of the quark orbital angular momentum.

  1. Charge form factors of two-neutron halo nuclei in halo EFT

    NASA Astrophysics Data System (ADS)

    Hagen, P.; Hammer, H.-W.; Platter, L.

    2013-09-01

    We set up a formalism to calculate the charge form factors of two-neutron halo nuclei with S -wave neutron-core interactions in the framework of the halo effective field theory. The method is applied to some known and suspected halo nuclei. In particular, we calculate the form factors and charge radii relative to the core to leading order in the halo EFT and compare to experiments where they are available. Moreover, we investigate the general dependence of the charge radius on the core mass and the one- and two-neutron separation energies.

  2. A form-factor method for determining the structure of distorted stars

    NASA Technical Reports Server (NTRS)

    Wolfe, R. H., Jr.; Kern, J. W.

    1979-01-01

    The equilibrium equations of a uniformly rotating and tidally distorted star are reduced to the same form as for a spherical star except for the inclusion of two form factors. One factor, expressing the buoyancy effects of centrifugal force, is determined directly from the integrated structure variables. The other factor, expressing the deviation from spherical shape, is shown to be relatively insensitive to errors in the assumed shape, so that accurate solutions are obtained in spite of the use of an a priori shape. The method is employed by adding computations for the factors to an existing spherical model program. Upper Main Sequence models determined by this method compare closely with results from the double approximation method even for critical rotation and tidal distortion.

  3. X-ray coherent scattering form factors of tissues, water and plastics using energy dispersion

    NASA Astrophysics Data System (ADS)

    King, B. W.; Landheer, K. A.; Johns, P. C.

    2011-07-01

    A key requirement for the development of the field of medical x-ray scatter imaging is accurate characterization of the differential scattering cross sections of tissues and phantom materials. The coherent x-ray scattering form factors of five tissues (fat, muscle, liver, kidney, and bone) obtained from butcher shops, four plastics (polyethylene, polystyrene, lexan (polycarbonate), nylon), and water have been measured using an energy-dispersive technique. The energy-dispersive technique has several improvements over traditional diffractometer measurements. Most notably, the form factor is measured on an absolute scale with no need for scaling factors. Form factors are reported in terms of the quantity x = λ-1sin (θ/2) over the range 0.363-9.25 nm-1. The coherent form factors of muscle, liver, and kidney resemble those of water, while fat has a narrower peak at lower x, and bone is more structured. The linear attenuation coefficients of the ten materials have also been measured over the range 30-110 keV and parameterized using the dual-material approach with the basis functions being the linear attenuation coefficients of polymethylmethacrylate and aluminum.

  4. Factor analysis of the Nisonger Child Behavior Rating Form in children with autism spectrum disorders.

    PubMed

    Lecavalier, Luc; Aman, Michael G; Hammer, David; Stoica, Wendy; Mathews, Gregory L

    2004-12-01

    The Nisonger Child Behavior Rating Form (NCBRF) is a behavior rating scale designed for children and adolescents with mental retardation. The purpose of this study was to explore the psychometric properties of the NCBRF in a sample of 330 children and adolescents with autism spectrum disorders (ASDs). Parent and teacher ratings were independently submitted to both exploratory and confirmatory factor analysis. As reported with the original validation study, parent and teacher versions shared similar but somewhat different factor structures. Social competence items showed more similarity with the original solutions than did problem behavior items. Problem behavior items were distributed into a somewhat simpler five-factor solution for both rating forms. Self-injurious and stereotypic items loaded on two distinct subscales for the teacher form, but not on the parent form. Factor loadings and internal consistencies were generally lower than those reported for the original versions but still within the acceptable range. Confirmatory factor analyses indicated good fits for the social competence items and acceptable fits for the problem behavior items. Overall, results supported the construct validity of the NCBRF in children and adolescents with ASDs.

  5. Proton Therapy

    MedlinePlus

    ... for e-updates Please leave this field empty Proton Therapy SHARE Home > Treatment and Care > Treatments Listen ... a nucleus, which holds two types of particles—protons and neutrons. The nucleus is surrounded by electrons. ...

  6. Deciphering the Positional Influence of the Hydroxyl Group in the Cinnamoyl Part of 3-Hydroxy Flavonoids for Structural Modification and Their Interaction with the Protonated and B Form of Calf Thymus DNA Using Spectroscopic and Molecular Modeling Studies.

    PubMed

    Pradhan, Ankur Bikash; Haque, Lucy; Bhuiya, Sutanwi; Ganguly, Aniruddha; Das, Suman

    2015-06-11

    Studies on the interaction of naturally occurring flavonoids with different polymorphic forms of nucleic acid are helpful for understanding the molecular aspects of binding mode and providing direction for the use and design of new efficient therapeutic agents. However, much less information is available on the interactions of these compounds with different polymorphic forms of DNA at the molecular level. In this report we investigated the interaction of two widely abundant dietary flavonoids quercetin (Q) and morin (M) with calf thymus (CT) DNA. Spectrophotometric, spectropolarimetric, viscosity measurement, and molecular docking simulation methods are used as tools to delineate the binding mode and probable location of the flavonoids and their effects on the stability and conformation of DNA. It is observed that in the presence of the protonated form of DNA the dual fluorescence of Q and M resulting from the excited-state intramolecular proton transfer (ESIPT) is modified significantly. Structural analysis showed Q and M binds weakly to the B form (groove binding) compared to the protonated form of CT DNA (electrostatic interaction). In both cases, Q binds strongly to both forms of DNA compared to M.

  7. Enantioselective Protonation

    PubMed Central

    Mohr, Justin T.; Hong, Allen Y.; Stoltz, Brian M.

    2010-01-01

    Enantioselective protonation is a common process in biosynthetic sequences. The decarboxylase and esterase enzymes that effect this valuable transformation are able to control both the steric environment around the proton acceptor (typically an enolate) and the proton donor (typically a thiol). Recently, several chemical methods to achieve enantioselective protonation have been developed by exploiting various means of enantiocontrol in different mechanisms. These laboratory transformations have proven useful for the preparation of a number of valuable organic compounds. PMID:20428461

  8. Clean measurements of the nucleon axial-vector and free-neutron magnetic form factors

    SciTech Connect

    Deur, A.

    2013-11-07

    We discuss the feasibility of a weak charged current experiment using a low energy electron beam. A first goal is to measure the Q{sup 2} dependence of the axial-vector form factor g{sub a}(Q{sup 2}). It can be measured model-independently and as robustly as for electromagnetic form factors from typical electron scattering experiments, in contrast to the methods used so far to measure g{sub a}(Q{sup 2}). If g{sub a}(Q{sup 2}) follows a dipole form, the axial mass can be extracted with a better accuracy than the world data altogether. The most important detection equipment would be a segmented neutron detector with good momentum and angular resolution that is symmetric about the beam direction, and covers a moderate angular range. A high intensity beam (100 uA) is necessary. Beam polarization is highly desirable as it provides a clean measurement of the backgrounds. Beam energies between 70 and 110 MeV are ideal. This range would provide a Q{sup 2} mapping of g{sub a} between 0.01 form factor G{sub M}{sup n}. The experiment employs the usual techniques of electron-nucleon scattering and presents no special difficulty. Higher energy extensions are possible. They could yield measurements of g{sub a}(Q{sup 2}) up to Q{sup 2}=3 GeV{sup 2} and the possibility to access other form factors, such as the almost unknown pseudoscalar form factor g{sub P}. However, the experiments become much more challenging as soon as beam energies pass the pion production threshold.

  9. Nucleon form factors with 2+1 flavor dynamical domain-wall fermions

    SciTech Connect

    Takeshi Yamazaki; Aoki, Yasumichi; Blum, Tom; Lin, Huey-Wen; Ohta, Shigemi; Sasaki, Shoichi; Tweedie, Robert; Zanotti, James

    2009-06-01

    We report our numerical lattice QCD calculations of the isovector nucleon form factors for the vector and axialvector currents: the vector, induced tensor, axialvector, and induced pseudoscalar form factors. The calculation is carried out with the gauge configurations generated with N{sub f} = 2+1 dynamical domain wall fermions and Iwasaki gauge actions at {beta} = 2.13, corresponding to a cutoff a{sup -1} = 1.73 GeV, and a spatial volume of (2.7 fm){sup 3}. The up and down quark masses are varied so the pion mass lies between 0.33 and 0.67 GeV while the strange quark mass is about 12% heavier than the physical one. We calculate the form factors in the range of momentum transfers, 0.2 < q{sup 2} < 0.75 GeV{sup 2}. The vector and induced tensor form factors are well described by the conventional dipole forms and result in significant underestimation of the Dirac and Pauli mean-squared radii and the anomalous magnetic moment compared to the respective experimental values. We show that the axial-vector form factor is significantly affected by the finite spatial volume of the lattice. In particular in the axial charge, g{sub A}/g{sub V}, the finite volume effect scales with a single dimensionless quantity, m{sub {pi}}L, the product of the calculated pion mass and the spatial lattice extent. Our results indicate that for this quantity, m{sub {pi}} L > 6 is required to ensure that finite volume effects are below 1%.

  10. A small-form-factor piezoelectric vibration energy harvester using a resonant frequency-down conversion

    SciTech Connect

    Sun, Kyung Ho; Kim, Young-Cheol; Kim, Jae Eun

    2014-10-15

    While environmental vibrations are usually in the range of a few hundred Hertz, small-form-factor piezoelectric vibration energy harvesters will have higher resonant frequencies due to the structural size effect. To address this issue, we propose a resonant frequency-down conversion based on the theory of dynamic vibration absorber for the design of a small-form-factor piezoelectric vibration energy harvester. The proposed energy harvester consists of two frequency-tuned elastic components for lowering the first resonant frequency of an integrated system but is so configured that an energy harvesting beam component is inverted with respect to the other supporting beam component for a small form factor. Furthermore, in order to change the unwanted modal characteristic of small separation of resonant frequencies, as is the case with an inverted configuration, a proof mass on the supporting beam component is slightly shifted toward a second proof mass on the tip of the energy harvesting beam component. The proposed small-form-factor design capability was experimentally verified using a fabricated prototype with an occupation volume of 20 × 39 × 6.9 mm{sup 3}, which was designed for a target frequency of as low as 100 Hz.

  11. The charge form factor of pseudoscalar mesons in a relativistic constituent quark model

    SciTech Connect

    Cardarelli, F.; Pace, E.; Grach, I.L.

    1994-04-01

    The charge form factor of pseudoscalar mesons has been investigated in the light-cone formalism, up to Q{sup 2} relevant to CEBAF energies. The consequences of adopting the meson wave functions generated through the Godfrey-Isgur q{bar q} potential, which reproduces the mass spectra, are discussed.

  12. The Short Form of the Five-Factor Narcissism Inventory: Psychometric Equivalence of the Turkish Version

    ERIC Educational Resources Information Center

    Eksi, Füsun

    2016-01-01

    This study intends to examine the psychometric properties of the Turkish version of the short form of the Five-Factor Narcissism Inventory (FFNI-SF). The study group consists of a total of 526 university students (54% were female) whose ages range from 18 to 32. In the translational equivalence study made over a two-week interval, the FFNI-SF…

  13. A small-form-factor piezoelectric vibration energy harvester using a resonant frequency-down conversion

    NASA Astrophysics Data System (ADS)

    Sun, Kyung Ho; Kim, Young-Cheol; Kim, Jae Eun

    2014-10-01

    While environmental vibrations are usually in the range of a few hundred Hertz, small-form-factor piezoelectric vibration energy harvesters will have higher resonant frequencies due to the structural size effect. To address this issue, we propose a resonant frequency-down conversion based on the theory of dynamic vibration absorber for the design of a small-form-factor piezoelectric vibration energy harvester. The proposed energy harvester consists of two frequency-tuned elastic components for lowering the first resonant frequency of an integrated system but is so configured that an energy harvesting beam component is inverted with respect to the other supporting beam component for a small form factor. Furthermore, in order to change the unwanted modal characteristic of small separation of resonant frequencies, as is the case with an inverted configuration, a proof mass on the supporting beam component is slightly shifted toward a second proof mass on the tip of the energy harvesting beam component. The proposed small-form-factor design capability was experimentally verified using a fabricated prototype with an occupation volume of 20 × 39 × 6.9 mm3, which was designed for a target frequency of as low as 100 Hz.

  14. Elastic Form Factors of 3,4He up to Large Q2

    SciTech Connect

    Kees De Jager

    2007-09-10

    Elastic electron scattering off $^3$He and $^4$He has recently been studied at forward and backward scattering angles in Hall A at JLab. The results will provide accurate data on the elastic form factors, charge and magnetic for $^3$He and charge only for $^4$He, up to squared momentum transfer $Q^2$-values of 3.2 GeV$^2$.

  15. Measuring the axial form factor of {sup 3}He using weak capture of polarized electrons

    SciTech Connect

    Dutta, D.

    2013-11-07

    A low energy, high intensity polarized electron beam could enable the extraction of the A=3 weak axial form factors F{sub A} using the reaction →e+{sup 3}He→{sup 3}H+ν. These form factors have never been measured before. We discuss the feasibility of such an experiment using a small toroidal magnet and a radial low energy recoil detector to tag the recoil tritons. A moderately high intensity polarized electron beam (>500 μA) with beam energies between 50 - 150 MeV is necessary for the cross section measurement and to provides a free clean measurement of the background. Moreover, in addition to the cross section, by measuring the electron spin and recoil triton correlation coefficient it may be possible to search for second class currents and to extract the ratio of the axial to the vector form factor of the nucleon. Such novel electron scattering based measurements would have a completely different set of systematic uncertainties compared to polarized neutron beta decay, neutrino scattering and muon capture experiments which are typically used to extract the weak form-factors.

  16. Strangeness Vector and Axial-Vector Form Factors of the Nucleon

    NASA Astrophysics Data System (ADS)

    Pate, Stephen; Trujillo, Dennis

    2014-03-01

    A revised global fit of electroweak ep and vp elastic scattering data has been performed, with the goal of determining the strange quark contribution to the vector and axial-vector form factors of the nucleon in the momentum-transfer range 0 < Q2 < 1 GeV2. The two vector (electric and magnetic) form factors GsE(Q2) and GsM(Q2) are strongly constrained by ep elastic scattering data, while the major source of information on the axial-vector form factor GsA(Q2) is vp scattering data. Combining the two kinds of data into a single global fit makes possible additional precision in the determination of these form factors, and provides a unique way to determine the strange quark contribution to the nucleon spin, ΔS , independently of leptonic deep-inelastic scattering. The fit makes use of data from the BNL-E734, SAMPLE, HAPPEx, G0, and PVA4 experiments; we will also compare the result of the fit with recent data from MiniBooNE, and anticipate how this fit can be improved when new data from MicroBooNE become available.

  17. Strangeness Vector and Axial-Vector Form Factors of the Nucleon

    NASA Astrophysics Data System (ADS)

    Trujillo, Dennis; Pate, Stephen

    2013-04-01

    A revised global fit of electroweak ep and νp elastic scattering data has been performed, with the goal of determining the strange quark contribution to the vector and axial-vector form factors of the nucleon in the momentum-transfer range 0form factors GE^s(Q^2) and GM^s(Q^2) are strongly constrained by ep elastic scattering data, while the major source of information on the axial-vector form factor GA^s(Q^2) is νp scattering data. Combining the two kinds of data into a single global fit makes possible additional precision in the determination of these form factors. The fit makes use of data from the BNL-E734, SAMPLE, HAPPEx, G0, and PVA4 experiments; we will also compare the result of the fit with recent data from MiniBooNE, and anticipate how this fit can be improved when new data from MicroBooNE become available.

  18. Bound state structure and electromagnetic form factor beyond the ladder approximation

    NASA Astrophysics Data System (ADS)

    Gigante, V.; Nogueira, J. H. Alvarenga; Ydrefors, E.; Gutierrez, C.; Karmanov, V. A.; Frederico, T.

    2017-03-01

    We investigate the response of the bound state structure of a two-boson system, within a Yukawa model with a scalar boson exchange, to the inclusion of the cross-ladder contribution to the ladder kernel of the Bethe-Salpeter equation. The equation is solved by means of the Nakanishi integral representation and light-front projection. The valence light-front wave function and electromagnetic form factor, considering both ladder and ladder plus cross-ladder kernels, are studied in detail. Their asymptotic forms are found to be quite independent of the inclusion of the cross-ladder kernel, for a given binding energy. The asymptotic decrease of form factor agrees with the counting rules. This analysis can be generalized to fermionic systems, with a wide application in the study of the meson structure.

  19. Measurement of the isovector axial form factor at Q{sup 2} = 0.23 (GeV/c){sup 2}

    SciTech Connect

    Ríos, D. Balaguer; Baunack, S.; Glaser, B.; Maas, F.; Imai, Y.

    2013-11-07

    We present the preliminary value of the measurement of the parity violating asymmetry in the cross section of quasi-elastic scattering of longitudinally polarized electrons on deuteron at backward angles at Q{sup 2} = 0.23. The preliminary asymmetry is A{sub PV}{sup d}(Q{sup 2} = 0.23) = (−20.77±0.84{sub stat}±1.23{sub syst})10{sup −6}. From this value a preliminary linear combination of the G{sub M}{sup s} and the isovector axial form factor G{sub A} can be extracted G{sub A}{sup T = 1}+0.59G{sub M}{sup s} = −0.53±0.37±0.02. Combining this preliminary linear combination with that extracted from the measurement of the parity violating asymmetry on proton, already publish, it is possible to disentagle the form factors and thus we can obtain a preliminary experimental determination of the isovector axial form factor G{sub A}{sup T = 1} = −0.43±0.46.

  20. Unraveling the mechanism of proton translocation in the extracellular half-channel of bacteriorhodopsin.

    PubMed

    Ge, Xiaoxia; Gunner, M R

    2016-05-01

    Bacteriorhodopsin, a light activated protein that creates a proton gradient in halobacteria, has long served as a simple model of proton pumps. Within bacteriorhodopsin, several key sites undergo protonation changes during the photocycle, moving protons from the higher pH cytoplasm to the lower pH extracellular side. The mechanism underlying the long-range proton translocation between the central (the retinal Schiff base SB216, D85, and D212) and exit clusters (E194 and E204) remains elusive. To obtain a dynamic view of the key factors controlling proton translocation, a systematic study using molecular dynamics simulation was performed for eight bacteriorhodopsin models varying in retinal isomer and protonation states of the SB216, D85, D212, and E204. The side-chain orientation of R82 is determined primarily by the protonation states of the residues in the EC. The side-chain reorientation of R82 modulates the hydrogen-bond network and consequently possible pathways of proton transfer. Quantum mechanical intrinsic reaction coordinate calculations of proton-transfer in the methyl guanidinium-hydronium-hydroxide model system show that proton transfer via a guanidinium group requires an initial geometry permitting proton donation and acceptance by the same amine. In all the bacteriorhodopsin models, R82 can form proton wires with both the CC and the EC connected by the same amine. Alternatively, rare proton wires for proton transfer from the CC to the EC without involving R82 were found in an O' state where the proton on D85 is transferred to D212.

  1. Induced drag ideal efficiency factor of arbitrary lateral-vertical wing forms

    NASA Technical Reports Server (NTRS)

    Deyoung, J.

    1980-01-01

    A relatively simple equation is presented for estimating the induced drag ideal efficiency factor e for arbitrary cross sectional wing forms. This equation is based on eight basic but varied wing configurations which have exact solutions. The e function which relates the basic wings is developed statistically and is a continuous function of configuration geometry. The basic wing configurations include boxwings shaped as a rectangle, ellipse, and diamond; the V-wing; end-plate wing; 90 degree cruciform; circle dumbbell; and biplane. Example applications of the e equations are made to many wing forms such as wings with struts which form partial span rectangle dumbbell wings; bowtie, cruciform, winglet, and fan wings; and multiwings. Derivations are presented in the appendices of exact closed form solutions found of e for the V-wing and 90 degree cruciform wing and for an asymptotic solution for multiwings.

  2. Form factors of descendant operators: reduction to perturbed M (2 , 2 s + 1) models

    NASA Astrophysics Data System (ADS)

    Lashkevich, Michael; Pugai, Yaroslav

    2015-04-01

    In the framework of the algebraic approach to form factors in two-dimensional integrable models of quantum field theory we consider the reduction of the sine-Gordon model to the Φ13-perturbation of minimal conformal models of the M (2 , 2 s + 1) series. We find in an algebraic form the condition of compatibility of local operators with the reduction. We propose a construction that make it possible to obtain reduction compatible local operators in terms of screening currents. As an application we obtain exact multiparticle form factors for the compatible with the reduction conserved currents T ±2 k , Θ±(2 k-2), which correspond to the spin ±(2 k - 1) integrals of motion, for any positive integer k. Furthermore, we obtain all form factors of the operators T 2 k T -2 l , which generalize the famous operator. The construction is analytic in the s parameter and, therefore, makes sense in the sine-Gordon theory.

  3. Rpf Proteins Are the Factors of Reactivation of the Dormant Forms of Actinobacteria.

    PubMed

    Nikitushkin, V D; Demina, G R; Kaprelyants, A S

    2016-12-01

    As the response to unfavorable growth conditions, nonsporulating mycobacteria transform into the dormant state with the concomitant formation of the specialized dormant forms characterized by low metabolic activity and resistance to antibiotics. Such dormant cells can be reactivated under the influence of several factors including proteins of Rpf (Resuscitation promoting factor) family, which possess peptidoglycan hydrolase activity and were considered to belong to the group of the autocrine growth factors of the bacteria. Remarkable interest toward Rpf family is determined by its participation in resuscitation of the dormant forms of Mycobacterium tuberculosis, what in turn is the key element in resuscitation of the latent tuberculosis - an infectious disease that affects one third of the World's population. Experiments with Rpf mutant forms and with strains deleted in these proteins revealed a relationship between the enzymatic activity of this protein and its ability to resuscitate mycobacteria both in vitro and in vivo. This review discusses possible mechanisms of Rpf action including those related to possible participation of the products of mycobacterial Rpf-mediated cell wall hydrolysis (muropeptides) as signaling molecules. The unique ability of Rpf proteins to resuscitate the dormant forms of mycobacteria and to stimulate their proliferation would allow these proteins to occupy their niche in medicine - in diagnostics and in creation of antituberculosis subunit vaccines.

  4. Development of a Short Form of the Five-Factor Narcissism Inventory: the FFNI-SF.

    PubMed

    Sherman, Emily D; Miller, Joshua D; Few, Lauren R; Campbell, W Keith; Widiger, Thomas A; Crego, Cristina; Lynam, Donald R

    2015-09-01

    The Five-Factor Narcissism Inventory (FFNI; Glover, Miller, Lynam, Crego, & Widiger, 2012) is a 148-item self-report inventory of 15 traits designed to assess the basic elements of narcissism from the perspective of a 5-factor model. The FFNI assesses both vulnerable (i.e., cynicism/distrust, need for admiration, reactive anger, and shame) and grandiose (i.e., acclaim seeking, arrogance, authoritativeness, entitlement, exhibitionism, exploitativeness, grandiose fantasies, indifference, lack of empathy, manipulativeness, and thrill seeking) variants of narcissism. The present study reports the development of a short-form version of the FFNI in 4 diverse samples (i.e., 2 undergraduate samples, a sample recruited from MTurk, and a clinical community sample) using item response theory. The validity of the resultant 60-item short form was compared against the validity of the full scale in the 4 samples at both the subscale level and the level of the grandiose and vulnerable composites. Results indicated that the 15 subscales remain relatively reliable, possess a factor structure identical to the structure of the long-form scales, and manifest correlational profiles highly similar to those of the long-form scales in relation to a variety of criterion measures, including basic personality dimensions, other measures of grandiose and vulnerable narcissism, and indicators of externalizing and internalizing psychopathology. Grandiose and vulnerable composites also behave almost identically across the short- and long-form versions. It is concluded that the FFNI-Short Form (FFNI-SF) offers a well-articulated assessment of the basic traits comprising grandiose and vulnerable narcissism, particularly when assessment time is limited.

  5. The Role of Nerve Growth Factor (NGF) and Its Precursor Forms in Oral Wound Healing

    PubMed Central

    Schenck, Karl; Schreurs, Olav; Hayashi, Katsuhiko; Helgeland, Kristen

    2017-01-01

    Nerve growth factor (NGF) and its different precursor forms are secreted into human saliva by salivary glands and are also produced by an array of cells in the tissues of the oral cavity. The major forms of NGF in human saliva are forms of pro-nerve growth factor (pro-NGF) and not mature NGF. The NGF receptors tropomyosin-related kinase A (TrkA) and p75 neurotrophin receptor (p75NTR) are widely expressed on cells in the soft tissues of the human oral cavity, including keratinocytes, endothelial cells, fibroblasts and leukocytes, and in ductal and acinar cells of all types of salivary glands. In vitro models show that NGF can contribute at most stages in the oral wound healing process: restitution, cell survival, apoptosis, cellular proliferation, inflammation, angiogenesis and tissue remodeling. NGF may therefore take part in the effective wound healing in the oral cavity that occurs with little scarring. As pro-NGF forms appear to be the major form of NGF in human saliva, efforts should be made to study its function, specifically in the process of wound healing. In addition, animal and clinical studies should be initiated to examine if topical application of pro-NGF or NGF can be a therapy for chronic oral ulcerations and wounds. PMID:28208669

  6. Forming factors of gas hydrate chimney in the Ulleung Basin, East Sea

    NASA Astrophysics Data System (ADS)

    Kang, Dong-Hyo; Chun, Jong-Hwa; Koo, Nam-Hyng; Kim, Won-Sik; Lee, Ho-Young; Lee, Joo-Yong

    2016-04-01

    Seismic chimneys ranging in width from 200 m to 1,000 m are observed in the seismic sections obtained in the Ulleung Basin, East Sea. In consequence of Ulleung Basin Gas Hydrate Expedition 1 and 2, concentrations of gas hydrates were identified. Especially, 6 chimney sites were drilled and the occurrence of gas hydrate was identified at all wells. Through the interpreting seismic section, three factors affect the formation of gas hydrate chimney; mass transport deposit, fault, igneous intrusion. These three factors result in three case of forming gas hydrate chimney. Firstly, gas hydrate chimney appears predominantly in the fault zone. Deep-rooted fault reach to mass transport deposit and gas hydrate chimney which is mostly rooted in mass transport deposit is formed. Secondly, Gas hydrate chimney appears linked to igneous intrusion. Igneous intrusion result in forming fault in overlying strata. Similar to first case, this fault traverses mass transport deposit and gas hydrate chimney rooted in mass transport deposit is created. Thirdly, gas hydrate chimney is formed at thick mass transport deposit without fault. In this case, chimney is not reach to seabed in contrast with first and second case. The thickness of mass transport deposit is 0.2 second in two-way travel times. Overburden load cause to pressure at the upper part of mass transport deposit. This leads to fracture in overlying sediments and form gas hydrate chimney.

  7. Factor structure and differential item functioning of the BASC-2 BESS Spanish Language Parent Form.

    PubMed

    Dever, Bridget V; Raines, Tara C; Dowdy, Erin

    2016-06-01

    Given the steady increase of students from diverse backgrounds in the U.S. educational system, in particular immigrant and Latino students, it is important to consider how to best support all students within our schools. The present study focuses on the Behavior Assessment System for Children-Second Edition (BASC-2) Behavioral and Emotional Screening System (BESS) Parent Spanish form, which is a promising assessment tool for those who are interested in screening for behavioral and emotional risk among Spanish-speaking populations. The present study included 725 students of Latino descent in Grades K-6 in an urban school district and their parents or legal guardians, who served as the informants. All parents completed the BESS language form (English or Spanish) of their choice. A confirmatory factor analysis (CFA) supported a 4-factor structure (Externalizing, Internalizing, Inattention, and Adaptive Skills) similar to that of the BESS Parent English form: χ2(77) = 248.06, p < .001; CFI = 0.903; TLI = 0.940. However, differential item functioning (DIF) analyses revealed 5 items (16.7%) demonstrated significant levels of DIF, with 4 of the 5 being easier to endorse in English. This study provides preliminary evidence of partial invariance of the BESS Parent across language forms. Although some evidence of invariance across language forms at the structural and item levels exists, more research is necessary to determine whether the DIF found in the present study results in any perceptible test bias. (PsycINFO Database Record

  8. The Role of Nerve Growth Factor (NGF) and Its Precursor Forms in Oral Wound Healing.

    PubMed

    Schenck, Karl; Schreurs, Olav; Hayashi, Katsuhiko; Helgeland, Kristen

    2017-02-11

    Nerve growth factor (NGF) and its different precursor forms are secreted into human saliva by salivary glands and are also produced by an array of cells in the tissues of the oral cavity. The major forms of NGF in human saliva are forms of pro-nerve growth factor (pro-NGF) and not mature NGF. The NGF receptors tropomyosin-related kinase A (TrkA) and p75 neurotrophin receptor (p75(NTR)) are widely expressed on cells in the soft tissues of the human oral cavity, including keratinocytes, endothelial cells, fibroblasts and leukocytes, and in ductal and acinar cells of all types of salivary glands. In vitro models show that NGF can contribute at most stages in the oral wound healing process: restitution, cell survival, apoptosis, cellular proliferation, inflammation, angiogenesis and tissue remodeling. NGF may therefore take part in the effective wound healing in the oral cavity that occurs with little scarring. As pro-NGF forms appear to be the major form of NGF in human saliva, efforts should be made to study its function, specifically in the process of wound healing. In addition, animal and clinical studies should be initiated to examine if topical application of pro-NGF or NGF can be a therapy for chronic oral ulcerations and wounds.

  9. Measurement of the form factor ratios in semileptonic decays of charm mesons

    SciTech Connect

    Zaliznyak, Renata

    1998-05-01

    I have measured the form factor ratios r2 = A2 (0)/A1 (0) and rV = V (0)/A1 (0) in the semileptonic charm meson decay D+ → $\\bar{K}$*0 e+ve from data collected by the Fermilab E791 collaboration. Form factors are introduced in the calculation of the hadronic current in semileptonic decays of strange, charm, or bottom mesons, such as D+ → $\\bar{K}$*0 e+ ve . Semileptonic decays provide insight into quark coupling to the W boson since the leptonic and hadronic amplitudes in the Feynman diagram for the decay are completely separate. There are no strong interactions between the final state leptons and quarks. A number of theoretical models predict the values of the form factors for D+ → $\\bar{K}$*0 e+ ve , though there is a large range of predictions. E791 is a hadroproduction experiment that recorded over 20 billion interactions with a 500 GeV π- beam incident on five thin targets during the 1991-92 Fermilab fixed-target run. Approximately 3000 D+ → $\\bar{K}$*0 e+ ve decays are fully reconstructed. In order to extract the form factor ratios from the data, I implement a multidimensional unbinned maximum likelihood fit with a large sample of simulated (Monte Carlo) D+ → $\\bar{K}$*0 e+ve events. The large E791 data sample provides the most precise measurement of the form factor ratios to date. The measured values for the form factor ratios are r2 = 0.71 ± 0.08 ± 0.09 and rV = 1.84 ± 0.11 ±} 0.08. These results are in good agreement with some Lattice Gauge calculations. However the agreement with quark model predictions is not as good.

  10. Radiative corrections to polarization observables in electron-proton scattering

    NASA Astrophysics Data System (ADS)

    Borisyuk, Dmitry; Kobushkin, Alexander

    2014-08-01

    We consider radiative corrections to polarization observables in elastic electron-proton scattering, in particular, for the polarization transfer measurements of the proton form factor ratio μGE/GM. The corrections are of two types: two-photon exchange (TPE) and bremsstrahlung (BS); in the present work we pay special attention to the latter. Assuming small missing energy or missing mass cutoff, the correction can be represented in a model-independent form, with both electron and proton radiation taken into account. Numerical calculations show that the contribution of the proton radiation is not negligible. Overall, at high Q2 and energies, the total correction to μGE/GM grows, but is dominated by TPE. At low energies both TPE and BS may be significant; the latter amounts to ˜0.01 for some reasonable cut-off choices.

  11. High-throughput spectrometer designs in a compact form-factor: principles and applications

    NASA Astrophysics Data System (ADS)

    Norton, S. M.

    2013-05-01

    Many compact, portable Raman spectrometers have entered the market in the past few years with applications in narcotics and hazardous material identification, as well as verification applications in pharmaceuticals and security screening. Often, the required compact form-factor has forced designers to sacrifice throughput and sensitivity for portability and low-cost. We will show that a volume phase holographic (VPH)-based spectrometer design can achieve superior throughput and thus sensitivity over conventional Czerny-Turner reflective designs. We will look in depth at the factors influencing throughput and sensitivity and illustrate specific VPH-based spectrometer examples that highlight these design principles.

  12. Factor structure and validity of the parenting stress index-short form.

    PubMed

    Haskett, Mary E; Ahern, Lisa S; Ward, Caryn S; Allaire, Jason C

    2006-06-01

    The psychometric properties of the Parenting Stress Index-Short Form (PSI-SF) were examined in a sample of 185 mothers and fathers. Factor analysis revealed 2 reasonably distinct factors involving parental distress and dysfunctional parent-child interactions. Both scales were internally consistent, and these scales were correlated with measures of parent psychopathology, parental perceptions of child adjustment, and observed parent and child behavior. PSI-SF scores were related to parent reports of child behavior 1 year later, and the Childrearing Stress subscale was a significant predictor of a parental history of abuse.

  13. Prospects for using coherent elastic neutrino-nucleus scattering to measure the nuclear neutron form factor

    NASA Astrophysics Data System (ADS)

    Patton, Kelly; McLaughlin, Gail; Scholberg, Kate; Engel, Jon; Schunck, Nicolas

    2017-01-01

    Coherent elastic neutrino-nucleus scattering is a potential probe of nuclear neutron form factors. We show that the neutron root-mean-square (RMS) radius can be measured with tonne-scale detectors of argon, germanium, or xenon. In addition, the fourth moment of the neutron distribution can be studied experimentally using this method. The impacts of both detector size and detector shape uncertainty on such a measurement were considered. The important limiting factor was found to be the detector shape uncertainty. In order to measure the neutron RMS radius to 5%, comparable to current experimental uncertainties, the detector shape uncertainty needs to be known to 1% or better.

  14. Dose-rate effects of protons on in vivo activation of nuclear factor-kappa B and cytokines in mouse bone marrow cells

    SciTech Connect

    Rithidech, K.N.; Rusek, A.; Reungpatthanaphong, P.; Honikel, L.; Simon, S.R.

    2010-05-28

    The objective of this study was to determine the kinetics of nuclear factor-kappa B (NF-{kappa}B) activation and cytokine expression in bone marrow (BM) cells of exposed mice as a function of the dose rate of protons. The cytokines included in this study are pro-inflammatory [i.e., tumor necrosis factor-alpha (TNF-{alpha}), interleukin-1beta (IL-1{beta}), and IL-6] and anti-inflammatory cytokines (i.e., IL-4 and IL-10). We gave male BALB/cJ mice a whole-body exposure to 0 (sham-controls) or 1.0 Gy of 100 MeV protons, delivered at 5 or 10 mGy min{sup -1}, the dose and dose rates found during solar particle events in space. As a reference radiation, groups of mice were exposed to 0 (sham-controls) or 1 Gy of {sup 137}Cs {gamma} rays (10 mGy min{sup -1}). After irradiation, BM cells were collected at 1.5, 3, 24 h, and 1 month for analyses (five mice per treatment group per harvest time). The results indicated that the in vivo time course of effects induced by a single dose of 1 Gy of 100 MeV protons or {sup 137}Cs {gamma} rays, delivered at 10 mGy min{sup -1}, was similar. Although statistically significant levels of NF-{kappa}B activation and pro-inflammatory cytokines in BM cells of exposed mice when compared to those in the corresponding sham controls (Student's t-test, p < 0.05 or < 0.01) were induced by either dose rate, these levels varied over time for each protein. Further, only a dose rate of 5 mGy min{sup -1} induced significant levels of anti-inflammatory cytokines. The results indicate dose-rate effects of protons.

  15. The electromagnetic form factors of the Λ in the timelike region

    NASA Astrophysics Data System (ADS)

    Haidenbauer, J.; Meißner, U.-G.

    2016-10-01

    The reaction e+e- → Λ bar Λ is investigated for energies close to the threshold. Specific emphasis is put on the role played by the interaction in the final Λ bar Λ system which is taken into account rigorously. For that interaction a variety of Λ bar Λ potential models is employed that have been constructed for the analysis of the reaction p bar p → Λ bar Λ in the past. The enhancement of the effective form factor for energies close to the Λ bar Λ threshold, seen in pertinent experiments, is reproduced. Predictions for the Λ electromagnetic form factors GM and GE in the timelike region and for spin-dependent observables such as spin-correlation parameters are presented.

  16. Shock Response of the Clamped Disk in Small Form Factor Hard Disk Drive

    NASA Astrophysics Data System (ADS)

    Gu, Bin; Shu, Dongwei; Shi, Baojun; Lu, Guoxing

    As small form factor (one-inch and smaller) hard disk drives are widely used in portable consumer appliances and gadgets, their mechanical robustness is of greater concern. In the previous work, it is found that when the disk is more tightly clamped, it helps to decrease the shock response of the disk and then avoid the head slap. In this paper, the real boundary condition of the disk for a small form factor hard disk drive from Seagate is investigated numerically. The disk is clamped between the clamp and the hub. The shock response of the disk under a half-sine acceleration pulse is simulated by using the finite element method. In the finite element model, both contact between disk and clamp and contact between disk and hub are considered. According to the simulation results, how to decrease the shock response of the disk is suggested.

  17. B→πll Form Factors for New Physics Searches from Lattice QCD.

    PubMed

    Bailey, Jon A; Bazavov, A; Bernard, C; Bouchard, C M; DeTar, C; Du, Daping; El-Khadra, A X; Freeland, E D; Gámiz, E; Gottlieb, Steven; Heller, U M; Kronfeld, A S; Laiho, J; Levkova, L; Liu, Yuzhi; Lunghi, E; Mackenzie, P B; Meurice, Y; Neil, E; Qiu, Si-Wei; Simone, J N; Sugar, R; Toussaint, D; Van de Water, R S; Zhou, Ran

    2015-10-09

    The rare decay B→πℓ^{+}ℓ^{-} arises from b→d flavor-changing neutral currents and could be sensitive to physics beyond the standard model. Here, we present the first ab initio QCD calculation of the B→π tensor form factor f_{T}. Together with the vector and scalar form factors f_{+} and f_{0} from our companion work [J. A. Bailey et al., Phys. Rev. D 92, 014024 (2015)], these parametrize the hadronic contribution to B→π semileptonic decays in any extension of the standard model. We obtain the total branching ratio BR(B^{+}→π^{+}μ^{+}μ^{-})=20.4(2.1)×10^{-9} in the standard model, which is the most precise theoretical determination to date, and agrees with the recent measurement from the LHCb experiment [R. Aaij et al., J. High Energy Phys. 12 (2012) 125].

  18. CFD-based method of determining form factor k for different ship types and different drafts

    NASA Astrophysics Data System (ADS)

    Wang, Jinbao; Yu, Hai; Zhang, Yuefeng; Xiong, Xiaoqing

    2016-09-01

    The value of form factor k at different drafts is important in predicting full-scale total resistance and speed for different types of ships. In the ITTC community, most organizations predict form factor k using a low-speed model test. However, this method is problematic for ships with bulbous bows and transom. In this article, a Computational Fluid Dynamics (CFD)-based method is introduced to obtain k for different type of ships at different drafts, and a comparison is made between the CFD method and the model test. The results show that the CFD method produces reasonable k values. A grid generating method and turbulence model are briefly discussed in the context of obtaining a consistent k using CFD.

  19. η -γ and η'-γ transition form factors in a nonlocal NJL model

    NASA Astrophysics Data System (ADS)

    Gómez Dumm, D.; Noguera, S.; Scoccola, N. N.

    2017-03-01

    We study the η and η' distribution amplitudes (DAs) in the context of a nonlocal SU(3 ) L⊗SU(3 ) R chiral quark model. The corresponding Lagrangian allows us to reproduce the phenomenological values of pseudoscalar meson masses and decay constants, as well as the momentum dependence of the quark propagator arising from lattice calculations. It is found that the obtained DAs have two symmetric maxima, which arise from new contributions generated by the nonlocal character of the interactions. These DAs are then applied to the calculation of the η -γ and η'-γ transition form factors. Implications of our results regarding higher twist corrections and/or contributions to the transition form factors originated by gluon-gluon components in the η and η' mesons are discussed.

  20. The [Formula: see text] transition form factor from space- and time-like experimental data.

    PubMed

    Escribano, R; Masjuan, P; Sanchez-Puertas, P

    The [Formula: see text] transition form factor is analyzed for the first time in both space- and time-like regions at low and intermediate energies in a model-independent approach through the use of rational approximants. The [Formula: see text] experimental data provided by the A2 Collaboration in the very low-energy region of the dielectron invariant mass distribution allows for the extraction of the most precise up-to-date slope and curvature parameters of the form factors as well as their values at zero and infinity. The impact of these new results on the mixing parameters of the [Formula: see text]-[Formula: see text] system, together with the role played by renormalization dependent effects, and on the determination of the [Formula: see text] couplings from [Formula: see text] and [Formula: see text] radiative decays is also discussed.

  1. $$B\\to\\pi\\ell\\ell$$ Form Factors for New-Physics Searches from Lattice QCD

    DOE PAGES

    Bailey, Jon A.

    2015-10-07

    The rare decay B→πℓ+ℓ- arises from b→d flavor-changing neutral currents and could be sensitive to physics beyond the standard model. Here, we present the first ab initio QCD calculation of the B→π tensor form factor fT. Together with the vector and scalar form factors f+ and f0 from our companion work [J. A. Bailey et al., Phys. Rev. D 92, 014024 (2015)], these parametrize the hadronic contribution to B→π semileptonic decays in any extension of the standard model. We obtain the total branching ratio BR(B+→π+μ+μ-)=20.4(2.1)×10-9 in the standard model, which is the most precise theoretical determination to date, and agreesmore » with the recent measurement from the LHCb experiment [R. Aaij et al., J. High Energy Phys. 12 (2012) 125].« less

  2. Covariant spectator theory for the electromagnetic three-nucleon form factors: Complete impulse approximation

    SciTech Connect

    Pinto, Sergio Alexandre; Stadler, Alfred; Gross, Franz

    2009-05-15

    We present the first calculations of the electromagnetic form factors of {sup 3}He and {sup 3}H within the framework of the Covariant Spectator Theory (CST). This first exploratory study concentrates on the sensitivity of the form factors to the strength of the scalar meson-nucleon off-shell coupling, known from previous studies to have a strong influence on the three-body binding energy. Results presented here were obtained using the complete impulse approximation (CIA), which includes contributions of relativistic origin that appear as two-body corrections in a nonrelativistic framework, such as 'Z-graphs', but omits other two and three-body currents. We compare our results to nonrelativistic calculations augmented by relativistic corrections of O(v/c){sup 2}.

  3. Covariant spectator theory for the electromagnetic three-nucleon form factors: Complete impulse approximation

    SciTech Connect

    Pinto, Sérgio Alexandre; Stadler, Alfred; Gross, Franz

    2009-05-01

    We present the first calculations of the electromagnetic form factors of 3He and 3H within the framework of the Covariant Spectator Theory (CST). This first exploratory study concentrates on the sensitivity of the form factors to the strength of the scalar meson-nucleon off-shell coupling, known from previous studies to have a strong influence on the three-body binding energy. Results presented here were obtained using the complete impulse approximation (CIA), which includes contributions of relativistic origin that appear as two-body corrections in a non-relativistic framework, such as "Z-graphs," but omits other two and three-body currents. Finally, we compare our results to non-relativistic calculations augmented by relativistic corrections of O(v/c)2.

  4. Covariant spectator theory for the electromagnetic three-nucleon form factors: Complete impulse approximation

    SciTech Connect

    Alexandre Pinto, SÂ ergio; Stadler, Alfred; Gross, Franz

    2009-01-01

    We present the first calculations of the electromagnetic form factors of 3He and 3H within the framework of the Covariant Spectator Theory (CST). This first exploratory study concentrates on the sensitivity of the form factors to the strength of the scalar meson-nucleon off-shell coupling, known from previous studies to have a strong influence on the three-body binding energy. Results presented here were obtained using the complete impulse approximation (CIA), which includes contributions of relativistic origin that appear as two-body corrections in a non-relativistic framework, such as ?Z-graphs?, but omits other two and three-body currents. We compare our results to non-relativistic calculations augmented by relativistic corrections of O(v/c)2.

  5. A study of the N to Delta transition form factors in full QCD

    SciTech Connect

    Constantia Alexandrou; Robert Edwards; Giannis Koutsou; Theodoros Leontiou; Hartmut Neff; John W. Negele; Wolfram Schroers; Antonios Tsapalis

    2005-07-01

    The N to Delta transition form factors GM1, GE2 and GC2 are evaluated using dynamical MILC configurations and valence domain wall fermions at three values of quark mass corresponding to pion mass 606 MeV, 502 MeV and 364 MeV on lattices of spatial size 20{sup 3} and 28{sup 3}. The unquenched results are compared to those obtained at similar pion mass in the quenched theory.

  6. Measurement of the neutron electric form factor GEn in quasielastic scattering

    SciTech Connect

    Donal Day

    2003-07-15

    We have measured the electric form factor of the neutron, GEn, at two momentum transfers (Q2= 0.5 and Q2= 1.0 GeV/c2) through quasielastic scattering in Jefferson Lab's Hall C. Longitudinally polarized electrons scattered from polarized deuterated ammonia and GEn was extracted from the beam-target asymmetry AVed which, in quasielastic kinematics, is particularly sensitive to GEn and insensitive to MEC and FSI.

  7. Analytic results for planar three-loop integrals for massive form factors

    NASA Astrophysics Data System (ADS)

    Henn, Johannes M.; Smirnov, Alexander V.; Smirnov, Vladimir A.

    2016-12-01

    We use the method of differential equations to analytically evaluate all planar three-loop Feynman integrals relevant for form factor calculations involving massive particles. Our results for ninety master integrals at general q 2 are expressed in terms of multiple polylogarithms, and results for fiftyone master integrals at the threshold q 2 = 4 m 2 are expressed in terms of multiple polylogarithms of argument one, with indices equal to zero or to a sixth root of unity.

  8. Exploring universality of transversity in proton-proton collisions

    NASA Astrophysics Data System (ADS)

    Radici, Marco; Ricci, Alessandro M.; Bacchetta, Alessandro; Mukherjee, Asmita

    2016-08-01

    We consider the azimuthal correlations of charged hadron pairs with large total transverse momentum and small relative momentum, produced in proton-proton collisions with one transversely polarized proton. One of these correlations directly probes the chiral-odd transversity parton distribution in connection with a chiral-odd interference fragmentation function. We present predictions for this observable based on previous extractions of transversity (from charged pion pair production in semi-inclusive deep-inelastic scattering) and of the interference fragmentation function (from the production of back-to-back charged pion pairs in electron-positron annihilations). All analyses are performed in the framework of collinear factorization. We compare our predictions to the recent data on proton-proton collisions released by the STAR Collaboration at RHIC, and we find them reasonably compatible. This comparison confirms for the first time the predicted role of transversity in proton-proton collisions, and it allows us to test its universality.

  9. Λb→pl⁻ν¯l form factors from lattice QCD with static b quarks

    DOE PAGES

    Detmold, William; Lin, C.-J. David; Meinel, Stefan; ...

    2013-07-23

    We present a lattice QCD calculation of form factors for the decay Λb→pμ⁻ν¯μ, which is a promising channel for determining the Cabibbo-Kobayashi-Maskawa matrix element |Vub| at the Large Hadron Collider. In this initial study we work in the limit of static b quarks, where the number of independent form factors reduces to two. We use dynamical domain-wall fermions for the light quarks, and perform the calculation at two different lattice spacings and at multiple values of the light-quark masses in a single large volume. Using our form factor results, we calculate the Λb→pμ⁻ν¯μ differential decay rate in the range 14more » GeV²≤q²≤q²max, and obtain the integral ∫q²max 14 GeV²[dΓ/dq²]dq²/|Vub|²=15.3±4.2 ps⁻¹. Combined with future experimental data, this will give a novel determination of |Vub| with about 15% theoretical uncertainty. The uncertainty is dominated by the use of the static approximation for the b quark, and can be reduced further by performing the lattice calculation with a more sophisticated heavy-quark action.« less

  10. γ*N →N*(1520 ) form factors in the timelike regime

    NASA Astrophysics Data System (ADS)

    Ramalho, G.; Peña, M. T.

    2017-01-01

    The covariant spectator quark model, tested before in a variety of electromagnetic baryon excitations, is applied here to the γ*N →N*(1520 ) reaction in the timelike regime. The transition form factors are first parametrized in the spacelike region in terms of a valence quark core model together with a parametrization of the meson cloud contribution. The form factor behavior in the timelike region is then predicted, as well as the N*(1520 )→γ N decay width and the N*(1520 ) Dalitz decay, N*(1520 )→e+e-N . Our results may help in the interpretation of dielectron production from elementary p p collisions and from the new generation of HADES results using a pion beam. In the q2=0 - 1 GeV2 range, we conclude that the QED approximation (a q2 independent form factor model) underestimates the electromagnetic coupling of the N*(1520 ) from 1 up to 2 orders of magnitude. We conclude also that the N*(1520 ) and Δ (1232 ) Dalitz decay widths are comparable.

  11. Measurement of the Hadronic Form Factors in Ds to phi e nu Decays

    SciTech Connect

    Serrano, J

    2006-09-26

    Based on the measured four-dimensional rate for D{sub s}{sup +} {yields} {phi}e{sup +}{nu}{sub e} decays, they have determined the ratios of the three hadronic form factors, {tau}{sub V} = V(0)/A{sub 1}(0) = 1.636 {+-} 0.067 {+-} 0.038 and {tau}{sub 2} = A{sub 2}(0)/A{sub 1}(0) = 0.705 {+-} 0.056 {+-} 0.029, using a simple pole ansatz for the q{sup 2} dependence, with fixed values of the pole masses for both the vector and axial form factors. By a separate fit to the same data, they have also extracted the pole mass for the axial form factors, m{sub A}: {tau}{sub V} = V(0)/A{sub 1}(0) = 1.633 {+-} 0.081 {+-} 0.068, {tau}{sub 2} = A{sub 2}(0)/A{sub 1}(0) = 0.711 {+-} 0.111 {+-} 0.096 and m{sub A} = (2.53{sub -0.35}{sup +0.54} {+-} 0.54)GeV/c{sup 2}.

  12. Nonperturbative relativistic approach to pion form factors: Predictions for future JLab experiments

    SciTech Connect

    Krutov, A. F.; Troitsky, V. E.; Tsirova, N. A.

    2009-11-15

    Some predictions concerning possible results of the future experiments at the Thomas Jefferson National Accelerator Facility (JLab) on the pion form factor F{sub {pi}}(Q{sup 2}) are made. The calculations exploit the method proposed previously by the authors and based on the instant-form Poincare invariant approach to pions, considered as quark-antiquark systems. This model has predicted with surprising accuracy the values of F{sub {pi}}(Q{sup 2}), which were measured later in JLab experiments. The results are almost independent from the form of wave function. The pion mean square radius and the decay constant f{sub {pi}} also agree with experimental values. The model gives powerlike asymptotic behavior of F{sub {pi}}(Q{sup 2}) at high momentum transfer in agreement with QCD predictions.

  13. Diastereo-specific conformational properties of neutral, protonated and radical cation forms of (1R,2S)-cis- and (1R,2R)-trans-amino-indanol by gas phase spectroscopy.

    PubMed

    Bouchet, Aude; Klyne, Johanna; Piani, Giovanni; Dopfer, Otto; Zehnacker, Anne

    2015-10-21

    Chirality effects on the intramolecular interactions strongly depend on the charge and protonation states. Here, the influence of chirality on the structure of the neutral, protonated, and radical cation forms of (1R,2S)-cis- and (1R,2R)-trans-1-amino-2-indanol diastereomers, prototypical molecules with two chiral centers, is investigated in a molecular beam by laser spectroscopy coupled with quantum chemical calculations. The neutral systems are structurally characterised by double resonance IR-UV spectroscopy, while IR-induced dissociation spectroscopy is employed for the charged molecules. The sterical constraints due to the cyclic nature of the molecule emphasise the chirality effects, which manifest themselves by the formation of an intramolecular hydrogen bond in neutral or protonated (1R,2S)-cis-amino-indanol. In contrast, this interaction is not possible in (1R,2R)-trans-amino-indanol. In the protonated species, chirality also influences the spectroscopic probes in the NH/OH stretch range by fine-tuning subtle effects such as the hyperconjugation between the σ(OH) orbital and σ* orbitals localised on the alicyclic ring. The radical cation undergoes opening of the alicyclic ring, which results in an ionisation-induced loss of the chirality effects.

  14. Persistent activation of nuclear factor-kappa B and expression of pro-inflammatory cytokines in bone marrow cells after exposure of mice to protons

    NASA Astrophysics Data System (ADS)

    Rithidech, Kanokporn; Reungpatthanaphong, Paiboon; Honikel, Louise; Whorton, Elbert

    Protons are the most abundant component of solar particle events (SPEs) in space. Information is limited on early-and late-occurring in vivo biological effects of exposure to protons at doses and dose rates that are similar to what astronauts encounter in space. We conducted a study series to fill this knowledge gap. We focused on the biological effects of 100 MeV/n protons, which are one of the most abundant types of protons induced during SPEs. We gave BALB/cJ mice a whole-body exposure to 0.5 or 1.0 Gy of 100 MeV/n protons, delivered at 0.5 or 1.0 cGy/min. These doses and dose rates of protons were selected because they are comparable to those of SPEs taking place in space. For each dose and dose rate of 100 MeV/n protons, mice exposed to 0 Gy of protons served as sham controls. Mice included in this study were also part of a study series conducted to examine the extent and the mechanisms involved in in vivo induction of genomic instability (expressed as late-occurring chromosome instability) by 100 MeV/n protons. Bone marrow (BM) cells were collected from groups of mice for analyses at different times post-exposure, i.e. early time-points (1.5, 3, and 24 hr) and late time-points (1 and 6 months). At each harvest time, there were five mice per treatment group. Several endpoints were used to investigate the biological effects of 100 MeV/n protons in BM cells from irradiated and sham control mice. The scope of this study was to determine the dose-rate effects of 0.5 Gy of 100 MeV/n protons in BM cells on the kinetics of nuclear factor-kappa B (NF-kappa B) activation and the expression of selected NF-kappa B target proteins known to be involved in inflammatory response, i.e. pro-inflammatory cytokines (TNF-alpha, IL-1 beta, and IL-6). Significantly high levels (p values ranging from p¡0.01 and p¡0.05) of activated NF-kappa B were observed in BM cells collected from irradiated mice, relative to those obtained from the corresponding sham controls, at all time

  15. {gamma}*{gamma}*{yields}{pi}{sup 0} form factor from anti-de Sitter-space/QCD correspondence

    SciTech Connect

    Stoffers, Alexander; Zahed, Ismail

    2011-08-15

    The recently measured {gamma}*{gamma}*{yields}{pi}{sup 0} anomalous form factor is analyzed using the D4/D8D8 holographic approach to QCD. The half-on-shell transition form factor is vector meson dominated and is shown to exactly tie to the charged-pion form factor. The holographic result compares well with the data for the lowest vector resonance.

  16. Factors influencing the energetics of electron and proton transfers in proteins. What can be learned from calculations?

    PubMed Central

    Gunner, M.R.; Mao, Junjun; Song, Yifan; Kim, Jinrang

    2009-01-01

    A protein structure should provide the information needed to understand its observed properties. Significant progress has been made in developing accurate calculations of acid/base and oxidation/reduction reactions in proteins. Current methods and their strengths and weaknesses are discussed. The distribution and calculated ionization states in a survey of proteins is described, showing that a significant minority of acidic and basic residues are buried in the protein and that most of these remain ionized. The electrochemistry of heme and quinones are considered. Proton transfers in bacteriorhodopsin and coupled electron and proton transfers in photosynthetic reaction centers, 5-coordinate heme binding proteins and cytochrome c oxidase are highlighted as systems where calculations have provided insight into the reaction mechanism. PMID:16905113

  17. Biochemical and proton NMR characterization of the isolated functional beta-subunit of coupling factor one from spinach chloroplasts

    SciTech Connect

    Roux-Fromy, M.; Neumann, J.M.; Andre, F.; Berger, G.; Girault, G.; Galmiche, J.M.; Remy, R.

    1987-04-29

    Beta subunits have been dissociated from CF1 of spinach chloroplasts, purified by HPLC and characterized by two-dimensional electrophoresis and fluorescence emission. The solutions of isolated beta subunits are able to hydrolyze MgATP; this ATPase activity is an intrinsic property of the beta molecule. From proton NMR at 300 and 500 MHz, it is shown that the preparations are fully reproducible and that beta subunits remain monomeric with 75% aliphatic protons associated with rigid parts of the molecule. The other 25% give rise to separate resonances and belong to mobile side-chains and/or to flexible regions. The measurement of the transverse relaxation times T2 has permitted a detailed characterization of the molecular dynamics of the isolated beta subunits.

  18. Clean measurements of the nucleon axial-vector and free-neutron magnetic form factors

    SciTech Connect

    Deur, Alexandre P.

    2013-11-01

    We discuss the feasibility of a weak charged current experiment using a low energy electron beam. A first goal is to measure the Q^2 dependence of the axial-vector form factor g_a(Q^2). It can be measured model-independently and as robustly as for electromagnetic form factors from typical electron scattering experiments, in contrast to the methods used so far to measure g_a(Q^2). If g_a(Q^2) follows a dipole form, the axial mass can be extracted with a better accuracy than the world data altogether. The most important detection equipment would be a segmented neutron detector with good momentum and angular resolution that is symmetric about the beam direction, and covers a moderate angular range. A high intensity beam (100 uA) is necessary. Beam polarization is highly desirable as it provides a clean measurement of the backgrounds. Beam energies between 70 and 110 MeV are ideal. This range would provide a Q^2 mapping of g_a between 0.01

  19. An uncleavable form of pro–scatter factor suppresses tumor growth and dissemination in mice

    PubMed Central

    Mazzone, Massimiliano; Basilico, Cristina; Cavassa, Silvia; Pennacchietti, Selma; Risio, Mauro; Naldini, Luigi; Comoglio, Paolo M.; Michieli, Paolo

    2004-01-01

    Scatter factor (SF), also known as hepatocyte growth factor, is ubiquitously present in the extracellular matrix of tissues in the form of an inactive precursor (pro-SF). In order to acquire biological activity, pro-SF must be cleaved by specific proteases present on the cell surface. The mature form of SF controls invasive cues in both physiological and pathological processes through activation of its receptor, the Met tyrosine kinase. By substituting a single amino acid in the proteolytic site, we engineered an unprocessable form of pro-SF (uncleavable SF). Using lentivirus vector technology, we achieved local or systemic delivery of uncleavable SF in mice. We provide evidence that (a) uncleavable SF inhibits both protease-mediated pro-SF conversion and active SF–induced Met activation; (b) local expression of uncleavable SF in tumors suppresses tumor growth, impairs tumor angiogenesis, and prevents metastatic dissemination; and (c) systemic expression of uncleavable SF dramatically inhibits the growth of transplanted tumors and abolishes the formation of spontaneous metastases without perturbing vital physiological functions. These data show that proteolytic activation of pro-SF is a limiting step in tumor progression, thus suggesting a new strategy for the treatment or prevention of the malignant conversion of neoplastic lesions. PMID:15545993

  20. An uncleavable form of pro-scatter factor suppresses tumor growth and dissemination in mice.

    PubMed

    Mazzone, Massimiliano; Basilico, Cristina; Cavassa, Silvia; Pennacchietti, Selma; Risio, Mauro; Naldini, Luigi; Comoglio, Paolo M; Michieli, Paolo

    2004-11-01

    Scatter factor (SF), also known as hepatocyte growth factor, is ubiquitously present in the extracellular matrix of tissues in the form of an inactive precursor (pro-SF). In order to acquire biological activity, pro-SF must be cleaved by specific proteases present on the cell surface. The mature form of SF controls invasive cues in both physiological and pathological processes through activation of its receptor, the Met tyrosine kinase. By substituting a single amino acid in the proteolytic site, we engineered an unprocessable form of pro-SF (uncleavable SF). Using lentivirus vector technology, we achieved local or systemic delivery of uncleavable SF in mice. We provide evidence that (a) uncleavable SF inhibits both protease-mediated pro-SF conversion and active SF-induced Met activation; (b) local expression of uncleavable SF in tumors suppresses tumor growth, impairs tumor angiogenesis, and prevents metastatic dissemination; and (c) systemic expression of uncleavable SF dramatically inhibits the growth of transplanted tumors and abolishes the formation of spontaneous metastases without perturbing vital physiological functions. These data show that proteolytic activation of pro-SF is a limiting step in tumor progression, thus suggesting a new strategy for the treatment or prevention of the malignant conversion of neoplastic lesions.

  1. Nematicidal spore-forming Bacilli share similar virulence factors and mechanisms

    PubMed Central

    Zheng, Ziqiang; Zheng, Jinshui; Zhang, Zhengming; Peng, Donghai; Sun, Ming

    2016-01-01

    In the soil environment, Bacilli can affect nematode development, fecundity and survival. However, although many Bacillus species can kill nematodes, the virulence mechanisms Bacilli utilize remain unknown. In this study, we collected 120 strains comprising 30 species across the Bacillaceae and Paenibacillaceae families of the Bacillales order and measured their nematicidal activities in vitro. Comparison of these strains’ nematicidal capacities revealed that nine species, including Bacillus thuringiensis, B. cereus, B. subtilis, B. pumilus, B. firmus, B. toyonensis, Lysinibacillus sphaericus, Brevibacillus laterosporus and B. brevis, were highly nematicidal, the first of which showed the highest activity. Genome sequencing and analysis identified many potential virulence factors, which grouped into five types. At least four possible mechanisms were deduced on the basis of the combination of these factors and the bacterial nematicidal activity, including a pore-forming mechanism of crystal proteins, an inhibition-like mechanism of thuringiensin and a degradation mechanism of proteases and/or chitinases. Our results demonstrate that 120 spore-forming Bacilli across different families share virulence factors that may contribute to their nematicidal capacity. PMID:27539267

  2. Nematicidal spore-forming Bacilli share similar virulence factors and mechanisms.

    PubMed

    Zheng, Ziqiang; Zheng, Jinshui; Zhang, Zhengming; Peng, Donghai; Sun, Ming

    2016-08-19

    In the soil environment, Bacilli can affect nematode development, fecundity and survival. However, although many Bacillus species can kill nematodes, the virulence mechanisms Bacilli utilize remain unknown. In this study, we collected 120 strains comprising 30 species across the Bacillaceae and Paenibacillaceae families of the Bacillales order and measured their nematicidal activities in vitro. Comparison of these strains' nematicidal capacities revealed that nine species, including Bacillus thuringiensis, B. cereus, B. subtilis, B. pumilus, B. firmus, B. toyonensis, Lysinibacillus sphaericus, Brevibacillus laterosporus and B. brevis, were highly nematicidal, the first of which showed the highest activity. Genome sequencing and analysis identified many potential virulence factors, which grouped into five types. At least four possible mechanisms were deduced on the basis of the combination of these factors and the bacterial nematicidal activity, including a pore-forming mechanism of crystal proteins, an inhibition-like mechanism of thuringiensin and a degradation mechanism of proteases and/or chitinases. Our results demonstrate that 120 spore-forming Bacilli across different families share virulence factors that may contribute to their nematicidal capacity.

  3. Structure in the Proton and the Neutron

    DOE R&D Accomplishments Database

    Hofstadter, R.

    1958-06-01

    A survey of the recent work on the structures of the proton and the neutron carried out by high-energy electron-scattering methods is presented. Early work established finite size effects in the proton and led to information about the charge and magnetic density distributions in the proton. The rms size was established to be close to (0.77 plus or minus 0.10) x 10{sup -13} cm, and the density distributions of charge and anomalous magnetic moment were shown to be approximately of the same shape. The form factors could be described in terms of several alternative models given, for example, by an exponential, gaussian, hollow exponential, hollow gaussian, etc., distribution of densities. Many other shapes were excluded by the experimental data. Recent work by Bumiller and Hofstadter now fixes one among these models that is appropriate to the proton and provides an extremely good fit at all angles between energies of 200 and 650 Mev. The new evidence clearly favors the exponential model with rms radius (0.80 plus or minus 0.04) 10{sup -13} cm. Recent studies of the proton have attempted to answer the question: how closely similar are the charge and magnetic form factors? This work now shows that the distributions have the same sizes and shapes to within 10 per cent, and each distribution is given very closely by the exponential model described above with radius (0.80 plus or minus 0.04) x 10{sup -13}. Certain other similar models will be discussed. Early work on the inelastic continuum in the deuteron established that the neutron's magnetic structure was extended and not a point. It was further shown that the neutron's size was approximately the same as that of the proton. This work has recently been extended by Yearian and Hofstadter to a determination of the variation of the neutron's magnetic form factor over the range where the proton's form factor is known. The new results show: (1) the neutron is not a point, (2) the neutron's magnetic structure has a size lying

  4. (Mechanism of proton pumping by bacteriorhodopsin)

    SciTech Connect

    Ebrey, T.G.

    1987-01-01

    Two methods were used to test the hypothesis that proteolysis of the C-terminal tail of bacteriorhodopsin affects the quantum efficiency of proton pumping. An apparent good correlation was found between the amount of the slowly decaying forms of the M intermediate and the number of protons pumped. This also suggests that the photocycle may contain M (fast) and M (slow) in different branches. Using artificial analogues of bacteriorhodopsin, the ring portion of the retinal was shown not to be an important factor in determining the photochemical and proton pumping properties of the artificial pigments, but that modification of the chain is. At least four double bonds along the chain are necessary for efficient proton pumping. The purple membrane normally contains several different cations tightly bound and it was shown that removal of these cations changes the color of the membrane from purple to blue. We proposed that cations acted by modulation of the surface potential and hence the local proton concentration near the membrane. A new intermediate was found in the bacteriorhodopsin photocycle, R. This new intermediate can explain several quite perplexing observations that have been made about the photocycle. The conformation of the retinal of the third rhodopsin-like pigment in Halobacteria, sensory rhodopsin, is all-trans and that light isomerizes the chromophore to the 13-cis conformation. 26 refs.

  5. K(13) FORM FACTOR WITH TWO FLAVORS OF DYNAMICAL DOMAIN WALL QUARKS.

    SciTech Connect

    SONI, A.; DAWSON, T.; IZUBUCHI, T.; KANEKO, T.; SASAKI, S.

    2005-07-25

    We report on our calculation of K {yields} {pi} vector form factor by numerical simulations of two-flavor QCD on a 16{sup 3} x 32 x 12 lattice at a {approx_equal} 0.12 fm using domain-wall quarks and DBW2 glue. Our preliminary result at a single sea quark mass corresponding to m{sub PS}/m{sub V} {approx_equal} 0.53 shows a good agreement with previous estimate in quenched QCD and that from a phenomenological model.

  6. Measurement of the gamma gamma* --> eta and gamma gamma* --> eta' transition form factors

    SciTech Connect

    del Amo Sanchez et al, P.

    2011-02-07

    We study the reactions e{sup +}e{sup -} {yields} e{sup +}e{sup -} {eta}{sup (/)} in the single-tag mode and measure the {gamma}{gamma}* {yields} {eta}{sup (/)} transition form factors in the momentum transfer range from 4 to 40 GeV{sup 2}. The analysis is based on 469 fb{sup -1} of integrated luminosity collected at PEP-II with the BABAR detector at e{sup +}e{sup -} center-of-mass energies near 10.6 GeV.

  7. Form Factors for $B$ to $Kll$ Semileptonic Decay from Three-Flavor Lattice QCD

    SciTech Connect

    Zhou, Ran; Bailey, Jon A.; Bazavov, Alexei; El-Khadra, Aida X.; Gottlieb, Steven; Jain, Rajendra D.; Kronfeld, Andreas S.; Van de Water, Ruth S.; /Brookhaven

    2011-11-01

    We study the B {yields} Kl{sup +}l{sup -} semileptonic decay process in three-flavor lattice QCD. We analyze several ensembles generated by theMILC collaboration at different lattice spacings and sea-quark masses. We use the asqtad improved staggered action for the light quarks and the clover action with the Fermilab interpretation for the heavy b quark. We present preliminary results for the vector current induced form factors for a range of kaon energies. Our analysis includes chiral and continuum extrapolations based on SU(2) staggered {chi}PT.

  8. Trinucleon Electromagnetic Form Factors and the Light-Front Hamiltonian Dynamics

    SciTech Connect

    Baroncini, F.; Kievsky, A.; Pace, E.; Salme, G.

    2008-10-13

    This contribution briefly illustrates preliminary calculations of the electromagnetic form factors of {sup 3}He and {sup 3}H, obtained within the Light-front Relativistic Hamiltonian Dynamics, adopting i) a Poincare covariant current operator, without dynamical two-body currents, and ii) realistic nuclear bound states with S, P and D waves. The kinematical region of few (GeV/c){sup 2}, relevant for forthcoming TJLAB experiments, has been investigated, obtaining possible signatures of relativistic effects for Q{sup 2}>2.5(GeV/c){sup 2}.

  9. Extraction of the Compton Form Factor H from DVCS Measurements in the Quark Sector

    SciTech Connect

    H. Moutarde

    2011-10-01

    Working at twist 2 accuracy and assuming the dominance of the Generalized Parton Distribution H we study the helicity-dependent and independent cross sections measured in Hall A, the beam spin asymmetries measured in Hall B at Jefferson Laboratory and beam charge, beam spin and target spin asymmetries measured by Hermes. We extract the real and imaginary parts of the Compton Form Factor H, the latter being obtained with a 20-50% uncertainty. We pay extra attention to the estimation of systematic errors on the extraction of H. We discuss our results and compare to other extractions as well as to the popular VGG model.

  10. Precise Determination of the Neutron Magnetic Form Factor to Higher Q{sup 2}

    SciTech Connect

    William K. Brooks; Jeffery D. Lachniet

    2004-10-01

    The neutron elastic magnetic form factor G{sub M}{sup n} has been extracted from quasielastic scattering from deuterium in the CEBAF Large Acceptance Spectrometer, CLAS. The kinematic coverage of the measurement is continuous over a broad range, extending from below 1 GeV{sup 2} to nearly 5 GeV{sup 2} in four-momentum transfer squared. High precision is achieved by employing a ratio technique in which most uncertainties cancel, and by a simultaneous in-situ calibration of the neutron detection efficiency, the largest correction to the data. Preliminary results are shown with statistical errors only.

  11. Confirmatory Factor Analysis of the Patient Version of the Working Alliance Inventory--Short Form Revised.

    PubMed

    Falkenström, Fredrik; Hatcher, Robert L; Holmqvist, Rolf

    2015-10-01

    The working alliance concerns the quality of collaboration between patient and therapist in psychotherapy. One of the most widely used scales for measuring the working alliance is the Working Alliance Inventory (WAI). For the patient-rated version, the short form developed by Hatcher and Gillaspy (WAI-SR) has shown the best psychometric properties. In two confirmatory factor analyses of the WAI-SR, approximate fit indices were within commonly accepted norms, but the likelihood ratio chi-square test showed significant ill-fit. The present study used Bayesian structural equations modeling with zero mean and small variance priors to test the factor structure of the WAI-SR in three different samples (one American and two Swedish; N = 235, 634, and 234). Results indicated that maximum likelihood confirmatory factor analysis showed poor model fit because of the assumption of exactly zero residual correlations. When residual correlations were estimated using small variance priors, model fit was excellent. A two-factor model had the best psychometric properties. Strong measurement invariance was shown between the two Swedish samples and weak factorial invariance between the Swedish and American samples. The most important limitation concerns the limited knowledge on when the assumption of residual correlations being small enough to be considered trivial is violated.

  12. Prevalence and factors associated with smoking among form four students in Petaling District, Selangor, Malaysia.

    PubMed

    Lim, K H; Sumarni, M G; Kee, C C; Christopher, V M; Noruiza Hana, M; Lim, K K; Amal, N M

    2010-12-01

    A cross-sectional study was conducted among form four students of secondary schools in the District of Petaling, Selangor, Malaysia from February 2008 to June 2008 with the aim of quantifying the prevalence of smoking and identifying the psychosocial factors related to smoking among adolescents in this district. A two-stage stratified sampling strategy was used to obtain a sample of 1300 students based on an estimated prevalence of 10%. The response rate was 80.5% (1045 out of 1298 students). Results showed that prevalence of smoking was higher among male students (22.3%) compared to females (5.5%) and the median age at smoking initiation was lower among males compared to female smokers (14 years old vs 15 years old). Modifiable risk factors associated with smoking were "percentage of friends who smoke" (OR 2.94, 95% CI [1.71- 5.06]) and "having a brother who smokes" (OR 1.97, 95% CI [1.20-3.31]). There was also a correlation between smoking prevalence and the number of risk factors present. Intensification of health education and anti-smoking programmes and modification of external factors in early adolescence are recommended to prevent smoking initiation.

  13. Accurate measurement of the x-ray coherent scattering form factors of tissues

    NASA Astrophysics Data System (ADS)

    King, Brian W.

    The material dependent x-ray scattering properties of tissues are determined by their scattering form factors, measured as a function of the momentum transfer argument, x. Incoherent scattering form factors, Finc, are calculable for all values of x while coherent scattering form factors, Fcoh, cannot be calculated except at large C because of their dependence on long range order. As a result, measuring Fcoh is very important to the developing field of x-ray scatter imaging. Previous measurements of Fcoh, based on crystallographic techniques, have shown significant variability, as these methods are not optimal for amorphous materials. Two methods of measuring F coh, designed with amorphous materials in mind, are developed in this thesis. An angle-dispersive technique is developed that uses a polychromatic x-ray beam and a large area, energy-insensitive detector. It is shown that Fcoh can be measured in this system if the incident x-ray spectrum is known. The problem is ill-conditioned for typical x-ray spectra and two numerical methods of dealing with the poor conditioning are explored. It is shown that these techniques work best with K-edge filters to limit the spectral width and that the accuracy degrades for strongly ordered materials. Measurements of width Fcoh for water samples are made using 50, 70 and 92 kVp spectra. The average absolute relative difference in Fcoh between our results and the literature for water is approximately 10-15%. Similar measurements for fat samples were made and found to be qualitatively similar to results in the literature, although there is very large variation between the literature values in this case. The angle-dispersive measurement is limited to low resolution measurements of the coherent scattering form factor although it is more accessible than traditional measurements because of the relatively commonplace equipment requirements. An energy-dispersive technique is also developed that uses a polychromatic x-ray beam and an

  14. Measurement of the parity violating asymmetry in the quasielastic electron-deuteron scattering and improved determination of the magnetic strange form factor and the isovector anapole radiative correction

    NASA Astrophysics Data System (ADS)

    Balaguer Ríos, D.; Aulenbacher, K.; Baunack, S.; Diefenbach, J.; Gläser, B.; von Harrach, D.; Imai, Y.; Kabuß, E.-M.; Kothe, R.; Lee, J. H.; Merkel, H.; Mora Espí, M. C.; Müller, U.; Schilling, E.; Weinrich, C.; Capozza, L.; Maas, F. E.; Arvieux, J.; El-Yakoubi, M. A.; Frascaria, R.; Kunne, R. A.; Ong, S.; van de Wiele, J.; Kowalski, S.; Prok, Y.

    2016-09-01

    A new measurement of the parity-violating asymmetry in the electron-deuteron quasielastic scattering for backward angles at ⟨Q2⟩ =0.224 (GeV/c ) 2 , obtained in the A4 experiment at the Mainz Microtron accelerator (MAMI) facility, is presented. The measured asymmetry is APV d=(-20.11 ±0.8 7stat±1.0 3sys)×10-6. A combination of these data with the proton measurements of the parity-violating asymmetry in the A4 experiment yields a value for the effective isovector axial-vector form factor of GAe ,(T =1 )=-0.19 ±0.43 and RA(T =1 ),anap=-0.41 ±0.35 for the anapole radiative correction. When combined with a reanalysis of measurements obtained in the G0 experiment at the Thomas Jefferson National Accelerator Facility, the uncertainties are further reduced to GMs=0.17 ±0.11 for the magnetic strange form factors, and RA(T =1 ),anap=-0.54 ±0.26 .

  15. Measurement of the generalized form factors near threshold via γ*p → nπ+ at high Q2

    SciTech Connect

    Park, K.; Adhikari, K. P.; Adikaram, D.; Anghinolfi, M.; Baghdasaryan, H.; Ball, J.; Battaglieri, M.; Batourine, V.; Bedlinskiy, I.; Bennett, R. P.; Biselli, A. S.; Bookwalter, C.; Boiarinov, S.; Branford, D.; Briscoe, W. J.; Brooks, W. K.; Burkert, V. D.; Carman, D. S.; Celentano, A.; Chandavar, S.; Charles, G.; Cole, P. L.; Contalbrigo, M.; Crede, V.; D'Angelo, A.; Daniel, A.; Dashyan, N.; De Vita, R.; De Sanctis, E.; Deur, A.; Djalali, C.; Doughty, D.; Dupre, R.; El Alaoui, A.; El Fassi, L.; Euginio, P.; Fedotov, G.; Fradi, A.; Gabrielyan, M. Y.; Gevorgyan, N.; Gilfoyle, G. P.; Giovanetti, K. L.; Girod, F. X.; Goetz, J. T.; Gohn, W.; Golovatch, E.; Graham, L.; Griffioen, K. A.; Guidal, M.; Guo, L.; Hafidi, K.; Hakobyan, H.; Hanretty, C.; Heddle, D.; Hicks, K.; Holtrop, M.; Ilieva, Y.; Ireland, D. G.; Ishkhanov, B. S.; Isupov, E. L.; Jenkins, D.; Jo, H. S.; Joo, K.; Khandaker, M.; Khertarpal, P.; Kim, A.; Kim, W.; Klein, F. J.; Kubarovsky, A.; Kubarovsky, V.; Kuhn, S. E.; Kuleshov, S. V.; Kvaltine, N. D.; Livingston, K.; Lu, H. Y.; MacGregor, J. D.; Markov, N.; Mayer, M.; McKinnon, B.; Mestayer, M. D.; Meyer, C. A.; Mineeva, T.; Mirazita, M.; Mokeev, V.; Moutarde, H.; Munevar, E.; Nadel-Turonski, P.; Nasseripour, R.; Niccolai, S.; Niculescu, G.; Niculescu, I.; Osipenko, M.; Ostrovidov, A. I; Paolone, M.; Pappalardo, L.; Paremuzyan, R.; Park, S.; Anefalos Pereira, S.; Phelps, E.; Pisano, S.; Pogorelko, O.; Pozdniakov, S.; Price, J. W.; Procureur, S.; Prok, Y.; Ricco, G.; Rimal, D.; Ripani, M.; Ritchie, B. G.; Rosner, G.; Rossi, P.; Sabati ee, F.; Saini, M. S.; Salgado, C.; Schott, D.; Schumacher, R. A.; Seraydaryan, H.; Sharabian, Y. G.; Smith, E. S.; Smith, G. D.; Sober, D. I.; Sokhan, D.; Stepanyan, S. S.; Stepanyan, S.; Stoler, P.; Strakovsky, I. I.; Strauch, S.; Taiuti, M.; Tang, W.; Taylor, C. E.; Tian, Y.; Tkachenko, S.; Trivedi, A.; Ungaro, M.; Vernarsky, B.; Vlassov, A. V.; Voutier, E.; Watts, D. P.; Weygand, D. P.; Wood, M. H.; Zachariou, N.; Zhao, B.; Zhao, Z. W.

    2012-03-26

    We report the first extraction of the pion-nucleon multipoles near the production threshold for the nπ+ channel at relatively high momentum transfer (Q2 up to 4.2 GeV2). The dominance of the s-wave transverse multipole (E0+), expected in this region, allowed us to access the generalized form factor G1 within the light-cone sum rule (LCSR) framework as well as the axial form factor GA. The data analyzed in this work were collected by the nearly 4π CEBAF Large Acceptance Spectrometer (CLAS) using a 5.754-GeV electron beam on a proton target. The differential cross section and the π-N multipole E0+/GD were measured using two different methods, the LCSR and a direct multipole fit. The results from the two methods are found to be consistent and almost Q2 independent.

  16. Power of two: Assessing the impact of a second measurement of the weak-charge form factor of 208Pb

    NASA Astrophysics Data System (ADS)

    Piekarewicz, J.; Linero, A. R.; Giuliani, P.; Chicken, E.

    2016-09-01

    Background: Besides its intrinsic value as a fundamental nuclear-structure observable, the weak-charge density of 208Pb—a quantity that is closely related to its neutron distribution—is of fundamental importance in constraining the equation of state of neutron-rich matter. Purpose: To assess the impact that a second electroweak measurement of the weak-charge form factor of 208Pb may have on the determination of its overall weak-charge density. Methods: Using the two putative experimental values of the form factor, together with a simple implementation of Bayes' theorem, we calibrate a theoretically sound—yet surprisingly little known—symmetrized Fermi function, that is characterized by a density and form factor that are both known exactly in closed form. Results: Using the charge form factor of 208Pb as a proxy for its weak-charge form factor, we demonstrate that using only two experimental points to calibrate the symmetrized Fermi function is sufficient to accurately reproduce the experimental charge form factor over a significant range of momentum transfers. Conclusions: It is demonstrated that a second measurement of the weak-charge form factor of 208Pb supplemented by a robust theoretical input in the form of the symmetrized Fermi function would place significant constraints on the neutron distribution of 208Pb. In turn, such constraints will become vital in the interpretation of hadronic experiments that will probe the neutron-rich skin of exotic nuclei at future radioactive beam facilities.

  17. Determination of the Axial Nucleon Form Factor from the MiniBooNE Data

    SciTech Connect

    Butkevich, A. V.; Perevalov, D.

    2014-03-26

    Both neutrino and antineutrino charged-current quasi-elastic scattering on a carbon target are studied to investigate the nuclear effect on the determination of the axial form factor F_A(Q^2). A method for extraction of F_A(Q^2) from the flux-integrated $d\\sigma/dQ^2$ cross section of (anti)neutrino scattering on nuclei is presented. Data from the MiniBooNE experiment are analyzed in the relativistic distorted-wave impulse approximation, Fermi gas model, and in the Fermi gas model with enhancements in the transverse cross section. We found that the values of the axial form factor, extracted in the impulse approximation and predicted by the dipole approximation with the axial mass M_A~1.37 GeV are in good agreement. On the other hand, the Q^2-dependence of F_A extracted in the approach with the transverse enhancement is found to differ significantly from the dipole approximation.

  18. $B\\to\\pi\\ell\\ell$ Form Factors for New-Physics Searches from Lattice QCD

    SciTech Connect

    Bailey, Jon A.

    2015-10-07

    The rare decay B→πℓ+- arises from b→d flavor-changing neutral currents and could be sensitive to physics beyond the standard model. Here, we present the first ab initio QCD calculation of the B→π tensor form factor fT. Together with the vector and scalar form factors f+ and f0 from our companion work [J. A. Bailey et al., Phys. Rev. D 92, 014024 (2015)], these parametrize the hadronic contribution to B→π semileptonic decays in any extension of the standard model. We obtain the total branching ratio BR(B+→π+μ+μ-)=20.4(2.1)×10-9 in the standard model, which is the most precise theoretical determination to date, and agrees with the recent measurement from the LHCb experiment [R. Aaij et al., J. High Energy Phys. 12 (2012) 125].

  19. Extraction of Electromagnetic Transition Form Factors for Nucleon Resonances within a Dynamical Coupled-Channels Model

    SciTech Connect

    N. Suzuki, T. Sato, T.-S. H. Lee

    2010-10-01

    We explain the application of a recently developed analytic continuation method to extract the electromagnetic transition form factors for the nucleon resonances ($N^*$) within a dynamical coupled-channel model of meson-baryon reactions.Illustrative results of the obtained $N^*\\rightarrow \\gamma N$ transition form factors, defined at the resonance pole positions on the complex energy plane, for the well isolated $P_{33}$ and $D_{13}$, and the complicated $P_{11}$ resonances are presented. A formula has been developed to give an unified representation of the effects due to the first two $P_{11}$ poles, which are near the $\\pi\\Delta$ threshold, but are on different Riemann sheets. We also find that a simple formula, with its parameters determined in the Laurent expansions of $\\pi N \\rightarrow \\pi N$ and $\\gamma N \\rightarrow\\pi N$ amplitudes, can reproduce to a very large extent the exact solutions of the considered model at energies near the real parts of the extracted resonance positions. We indicate the differences between our results and those extracted from the approaches using the Breit-Wigner parametrization of resonant amplitudes to fit the data.

  20. Measurement of the Hadronic Form factor in D0 to K- e+ nu_e Decays

    SciTech Connect

    Aubert, B.; Bona, M.; Boutigny, D.; Karyotakis, Y.; Lees, J.P.; Poireau, V.; Prudent, X.; Tisserand, V.; Zghiche, A.; Garra Tico, J.; Grauges, E.; Lopez, L.; Palano, A.; Eigen, G.; Stugu, B.; Sun, L.; Abrams, G.S.; Battaglia, M.; Brown, D.N.; Button-Shafer, J.; Cahn, R.N.; /Energy Sci. Network /Birmingham U. /Ruhr U., Bochum /Bristol U. /British Columbia U. /Brunel U. /Novosibirsk, IYF /UC, Irvine /UCLA /UC, Riverside /UC, San Diego /UC, Santa Barbara /UC, Santa Cruz /Caltech /Cincinnati U. /Colorado U. /Colorado State U. /Dortmund U. /Leipzig, Tech. Hochsch. /Ecole Polytechnique /Edinburgh U. /Ferrara U. /Frascati /Genoa U. /Harvard U. /Heidelberg U. /Imperial Coll., London /Iowa U. /Iowa State U. /Johns Hopkins U. /Karlsruhe U. /Paris U., VI-VII /LLNL, Livermore /Liverpool U. /Queen Mary, U. of London /Royal Holloway, U. of London /Louisville U. /Manchester U. /Maryland U. /Massachusetts U., Amherst /MIT, LNS /McGill U. /Milan U. /Mississippi U. /Concordia U., Montreal /Mt. Holyoke Coll. /Naples U. /NIKHEF, Amsterdam /Notre Dame U. /Ohio State U. /Oregon U. /Padua U. /Paris U., VI-VII /Pennsylvania U. /Perugia U. /Pisa U. /Prairie View A-M /Princeton U. /INFN, Rome /Rostock U. /Rutherford /DSM, DAPNIA, Saclay /South Carolina U. /SLAC /Stanford U., Phys. Dept. /SUNY, Albany /Tennessee U. /Texas U. /Texas U., Dallas /Turin U. /Trieste U. /Valencia U., IFIC /Victoria U. /Warwick U. /Wisconsin U., Madison /Yale U.

    2007-04-09

    The shape of the hadronic form factor f{sub +} (q{sup 2}) in the decay D{sup 0} {yields} K{sup -} e{sup +}{nu}{sub e} has been measured in a model independent analysis and compared with theoretical calculations. They use 75 fb{sup -1} of data recorded by the BABAR detector at the PEPII electron-positron collider. The corresponding decay branching fraction, relative to the decay D{sup 0} {yields} K{sup -} {pi}{sup +}, has also been measured to be R{sub D} = BR(D{sup 0} {yields} K{sup -}e{sup +}{nu}{sub e})/BR(D{sup 0} {yields} K{sup -}{pi}{sup +}) = 0.927 {+-} 0.007 {+-} 0.012. From these results, and using the present world average value for BR(D{sup 0} {yields} K{sup -}{pi}{sup +}), the normalization of the form factor at q{sup 2} = 0 is determined to be f{sub +}(0) = 0.727 {+-} 0.007 {+-} 0.005 {+-} 0.007 where the uncertainties are statistical, systematic, and from external inputs, respectively.

  1. Electron- and positron-proton elastic scattering in CLAS

    SciTech Connect

    Weinstein, L. B.

    2009-09-02

    There is a significant disagreement between measurements of the proton electric form factor, G{sup p}{sub E}, using Rosenbluth separations and polarization transfer. This disagreement, if not explained, could pose a fundamental challenge to our understanding of electron scattering or proton structure. Two-photon exchange (TPE) processes, although not fully calculable, are the most likely explanation of this disagreement. We will definitively test this assertion by comparing the electron-proton and positron-proton elastic scattering cross section in the Jefferson Lab CLAS. We will make a mixed identical electron and positron tertiary beam by passing a 5.5 GeV primary electron beam through a radiator to make a photon beam and then passing the photon beam through a converter to make electron-positron pairs. Measuring the elastic cross sections simultaneously using identical lepton beams should significantly reduce systematic uncertainties.

  2. Electron- and positron-proton elastic scattering in CLAS

    SciTech Connect

    L.B. Weinstein

    2009-08-01

    There is a significant disagreement between measurements of the proton electric form factor, G{sup p}{sub E}, using Rosenbluth separations and polarization transfer. This disagreement, if not explained, could pose a fundamental challenge to our understanding of electron scattering or proton structure. Two-photon exchange (TPE) processes, although not fully calculable, are the most likely explanation of this disagreement. We will definitively test this assertion by comparing the electron-proton and positron-proton elastic scattering cross section in the Jefferson Lab CLAS. We will make a mixed identical electron and positron tertiary beam by passing a 5.5 GeV primary electron beam through a radiator to make a photon beam and then passing the photon beam through a converter to make electron-positron pairs. Measuring the elastic cross sections simultaneously using identical lepton beams should significantly reduce systematic uncertainties.

  3. Applying Occam's Razor To The Proton Radius Puzzle

    NASA Astrophysics Data System (ADS)

    Higinbotham, Douglas

    2016-09-01

    Over the past five decades, ever more complex mathematical functions have been used to extract the radius of the proton from electron scattering data. For example, in 1963 the proton radius was extracted with linear and quadratic fits of low Q2 data (< 3 fm-2) and by 2014 a non-linear regression of two tenth order power series functions with thirty-one normalization parameters and data out to 25 fm-2 was used. But for electron scattering, the radius of the proton is determined by extracting the slope of the charge form factor at a Q2 of zero. By using higher precision data than was available in 1963 and focusing on the low Q2 data from 1974 to today, we find extrapolating functions consistently produce a proton radius of around 0.84 fm. A result that is in agreement with modern Lamb shift measurements.

  4. A novel secreted form of immune suppressor factor with high homology to vacuolar ATPases identified by a forward genetic approach of functional screening based on cell proliferation.

    PubMed

    Tulin, E E; Onoda, N; Maeda, M; Hasegawa, M; Nosaka, T; Nomura, H; Asano, S; Kitamura, T

    2001-07-20

    In the search for stromal-derived growth factors, we have identified a novel secreted short form of immune suppressor factor (ISF) using a combination of a genetic approach and retrovirus-mediated functional screening. This protein, which we termed ShIF, was isolated based on its ability to support proliferation of a mutant clone S21, which was established from Ba/F3 cells that are usually interleukin-3-dependent but became dependent on a stroma cell line ST2 after chemical mutagenesis. ISF, a membrane protein harboring six transmembrane domains, was reported to have immunosuppressive functions. The coding region of ShIF started from the third transmembrane domain of ISF. Biochemical analysis demonstrated that ShIF was expressed in both the secreted and membrane-bound forms of 27-kDa protein, which was supposed to have an internal ATG present in the third transmembrane domain of ISF as a start codon. In addition to the full-length form of ISF, a major protein with a molecular size of 27 kDa was also expressed through the proteolytic process of ISF. ShIF resembles this naturally occurring short form of ISF (sISF). Deletion analysis of the major domains of ISF cDNA revealed that ShIF is an active functional domain of ISF with a capability to support proliferation of S21 cells. Enforced expression of ShIF in MS10 cells, bone marrow stroma cells that do not express endogenous ShIF or ISF, conferred on the cells an ability to support the growth of S21 cells as well as bone marrow cells. Interestingly, ShIF shows a high sequence homology to the C-terminal part of a 95-kDa yeast vacuolar H (+)-ATPase subunit, Vph1p (39%), and a 116-kDa proton pump (VPP1) (54%) of the rat and bovine synaptic vesicle. Therefore, it is possible that ShIF also acts as a proton pump and somehow prevents the cells from undergoing apoptosis.

  5. Supra­molecular hydrogen-bonding patterns in the N(9)—H protonated and N(7)—H tautomeric form of an N6-benzoyl­adenine salt: N 6-benzoyl­adeninium nitrate

    PubMed Central

    Karthikeyan, Ammasai; Jeeva Jasmine, Nithianantham; Thomas Muthiah, Packianathan; Perdih, Franc

    2016-01-01

    In the title molecular salt, C12H10N5O+·NO3 −, the adenine unit has an N 9-protonated N(7)—H tautomeric form with non-protonated N1 and N3 atoms. The dihedral angle between the adenine ring system and the phenyl ring is 51.10 (10)°. The typical intra­molecular N7—H⋯O hydrogen bond with an S(7) graph-set motif is also present. The benzoyl­adeninium cations also form base pairs through N—H⋯O and C—H⋯N hydrogen bonds involving the Watson–Crick face of the adenine ring and the C and O atoms of the benzoyl ring of an adjacent cation, forming a supra­molecular ribbon with R 2 2(9) rings. Benzoyl­adeninum cations are also bridged by one of the oxygen atoms of the nitrate anion, which acts as a double acceptor, forming a pair of N—H⋯O hydrogen bonds to generate a second ribbon motif. These ribbons together with π–π stacking inter­actions between the phenyl ring and the five- and six-membered adenine rings of adjacent mol­ecules generate a three-dimensional supra­molecular architecture. PMID:26958373

  6. The sugar beet gene encoding the sodium/proton exchanger 1 (BvNHX1) is regulated by a MYB transcription factor.

    PubMed

    Adler, Guy; Blumwald, Eduardo; Bar-Zvi, Dudy

    2010-06-01

    Sodium/proton exchangers (NHX) are key players in the plant response to salinity and have a central role in establishing ion homeostasis. NHXs can be localized in the tonoplast or plasma membranes, where they exchange sodium ions for protons, resulting in sodium ions being removed from the cytosol into the vacuole or extracellular space. The expression of most plant NHX genes is modulated by exposure of the organisms to salt stress or water stress. We explored the regulation of the vacuolar NHX1 gene from the salt-tolerant sugar beet plant (BvNHX1) using Arabidopsis plants transformed with an array of constructs of BvHNX1::GUS, and the expression patterns were characterized using histological and quantitative assays. The 5 UTR of BvNHX1, including its intron, does not modulate the activity of the promoter. Serial deletions show that a 337 bp promoter fragment sufficed for driving activity that indistinguishable from that of the full-length (2,464 bp) promoter. Mutating four putative cis-acting elements within the 337 bp promoter fragment revealed that MYB transcription factor(s) are involved in the activation of the expression of BvNHX1 upon exposure to salt and water stresses. Gel mobility shift assay confirmed that the WT but not the mutated MYB binding site is bound by nuclear protein extracted from salt-stressed Beta vulgaris leaves.

  7. Direct CP Violation, Branching Ratios and Form Factors B --> pi, B --> K in B decays

    SciTech Connect

    O. Leitner; X.-H. Guo; A.W. Thomas

    2004-11-01

    The B {yields} {pi} and B {yields} K transitions involved in hadronic B decays are investigated in a phenomenological way through the framework of QCD factorization. By comparing our results with experimental branching ratios from the BELLE, BABAR and CLEO collaborations for all the B decays including either a pion or a kaon, we propose boundaries for the transition form factors B {yields} {pi} and B {yields} K depending on the CKM matrix element parameters {rho} and {eta}. From this analysis, the form factors required to reproduce the experimental data for branching ratios are F{sup B {yields} {pi}} = 0.31 {+-} 0.12 and F{sup B {yields} K} = 0.37 {+-} 0.13. We calculate the direct CP violating asymmetry parameter, a{sub CP}, for B {yields} {pi}{sup +}{pi}{sup -}{pi} and B {yields} {pi}{sup +}{pi}{sup -} K decays, in the case where {rho} - {omega} mixing effects are taken into account. Based on these results, we find that the direct CP asymmetry for B{sup -} {yields} {pi}{sup +}{pi}{sup -}{pi}{sup -}, {bar B}{sup 0} {yields} {pi}{sup +}{pi}{sup -}{pi}{sup 0}, B{sup -} {yields} {pi}{sup +}{pi}{sup -}K{sup -}, and {bar B}{sup 0} {yields} {pi}{sup +}{pi}{sup -} {bar K}{sup 0}, reaches its maximum when the invariant mass {pi}{sup +}{pi}{sup -} is in the vicinity of the {omega} meson mass. The inclusion of {rho} - {omega} mixing provides an opportunity to erase, without ambiguity, the phase uncertainty mod{pi} in the determination of th CKM angles {alpha} in case of b {yields} u and {gamma} in case of b {yields} s.

  8. Proton Therapy

    MedlinePlus

    ... effects of the treatment. top of page What equipment is used? Proton beam therapy uses special machines, ... tumor cells. top of page Who operates the equipment? With backgrounds in mechanical, electrical, software, hardware and ...

  9. Form factors and complete spectrum of XXX antiperiodic higher spin chains by quantum separation of variables

    SciTech Connect

    Niccoli, G.

    2013-05-15

    The antiperiodic transfer matrices associated to higher spin representations of the rational 6-vertex Yang-Baxter algebra are analyzed by generalizing the approach introduced recently in the framework of Sklyanin's quantum separation of variables (SOV) for cyclic representations, spin-1/2 highest weight representations, and also for spin-1/2 representations of the 6-vertex reflection algebra. Such SOV approach allow us to derive exactly results which represent complicate tasks for more traditional methods based on Bethe ansatz and Baxter Q-operator. In particular, we both prove the completeness of the SOV characterization of the transfer matrix spectrum and its simplicity. Then, the derived characterization of local operators by Sklyanin's quantum separate variables and the expression of the scalar products of separate states by determinant formulae allow us to compute the form factors of the local spin operators by one determinant formulae similar to those of the scalar products.

  10. Construction of the pion scalar form factor from few poles and zero

    NASA Astrophysics Data System (ADS)

    Kamiński, Robert; Dubnicka, Stanislav; Dubnickova, Zuzana; Liptaj, Andrej

    2016-11-01

    Construction and analysis of the pion scalar-isoscalar form factor in the elastic region is presented. Precise S-wave ππ scattering phase shifts generated by dispersive analysis of experimental data with imposed crossing symmetry condition are used. Final result for values of the f0(500) meson mass and width, mσ = (487 ± 31) MeV; Γσ = (542 ± 60) MeV is compatible with the results from dispersive analyses of the Bern and Madrid-Kraków groups to be considered now as the most reliable values of the f0(500) scalar meson parameters. Parameters of the f0(980), although lying almost on the KK¯ threshold also agree with values predicted by these two groups.

  11. Pion mass dependence of the K l3 semileptonic scalar form factor within finite volume

    NASA Astrophysics Data System (ADS)

    Ghorbani, K.; Yazdanpanah, M. M.; Mirjalili, A.

    2011-06-01

    We calculate the scalar semileptonic kaon decay in finite volume at the momentum transfer t m =( m K - m π )2, using chiral perturbation theory. At first we obtain the hadronic matrix element to be calculated in finite volume. We then evaluate the finite size effects for two volumes with L=1.83 fm and L=2.73 fm and find that the difference between the finite volume corrections of the two volumes are larger than the difference as quoted in Boyle et al. (Phys. Rev. Lett. 100:141601, 2008). It appears then that the pion masses used for the scalar form factor in ChPT are large which result in large finite volume corrections. If appropriate values for pion mass are used, we believe that the finite size effects estimated in this paper can be useful for lattice data to extrapolate at large lattice size.

  12. The ρ-meson time-like form factors in sub-leading pQCD

    NASA Astrophysics Data System (ADS)

    de Melo, J. P. B. C.; Ji, Chueng-Ryong; Frederico, T.

    2016-12-01

    The annihilation/production process e+ +e- →ρ+ +ρ- is studied with respect to the universal perturbative QCD (pQCD) predictions. Sub-leading contributions are considered together with the universal leading pQCD amplitudes such that the matrix elements of the ρ-meson electromagnetic current satisfy the constraint from the light-front angular condition. The data from the BaBar collaboration for the time-like ρ-meson form factors at √{ s} = 10.58 GeV puts a stringent test to the onset of asymptotic pQCD behavior. The e+ +e- →ρ+ +ρ- cross-section for s between 60 GeV2 and 160 GeV2 is predicted where the sub-leading contributions are still considerable.

  13. Meson form factors and P→γγ physics at BESIII

    NASA Astrophysics Data System (ADS)

    Pettersson, J.

    2016-08-01

    Using data consisting of 2.93 fb-1 integrated luminosity at the centre of mass energy √s = 3773 MeV, recorded with the BESIII detector at BEPCII, the cross section and form factor |Fπ|2 was extracted in the energy range 600-900 MeV, using the method of radiative return. The cross section is used as input to calculate the leading-order vacuum polarisation contribution of the e+e-→π+π- channel to (g - 2)μ as aμ ππ,LO(600 — 900 MeV) = (368.2±2.5stat ±3.3sys) • 10-10. This result is compatible with corresponding values using KLOE data, but disagrees whit BaBar. The ongoing search for e+e-→ηc at BESIII is also discussed.

  14. Structural properties of reciprocal form factor in neutral atoms and singly charged ions.

    PubMed

    Romera, E; Angulo, J C

    2004-04-22

    Structural characteristics of the spherically averaged internally folded density or reciprocal form factor Br are studied within the Hartree-Fock framework for 103 neutral atoms, 54 singly charged cations, and 43 anions in their ground state. The function Br is classified throughout the Periodic Table into three types: (i) monotonic decrease from the origin, (ii) maximum at r=0 and a negative minimum at r>0, and (iii) a local maximum at r=0 and a pair maximum-minimum out of the origin. A detailed study of the corresponding properties for individual subshells as well as their relative weight for the total Br is also carried out. For completeness, the analytical Br for hydrogenlike atoms in both ground and excited states is also analyzed.

  15. JLab Measurement of the 4He Charge Form Factor at Large Momentum Transfers

    SciTech Connect

    Camsonne, Alexandre; Katramatou, A. T.; Olson, M.; Sparveris, Nikolaos; Acha, Armando; Allada, Kalyan; Anderson, Bryon; Arrington, John; Baldwin, Alan; Chen, Jian-Ping; Choi, Seonho; Chudakov, Eugene; Cisbani, Evaristo; Craver, Brandon; Decowski, Piotr; Dutta, Chiranjib; Folts, Edward; Frullani, Salvatore; Garibaldi, Franco; Gilman, Ronald; Gomez, Javier; Hahn, Brian; Hansen, Jens-Ole; Higinbotham, Douglas; Holmstrom, Timothy; Huang, Jian; Iodice, Mauro; Kelleher, Aidan; Khrosinkova, Elena; Kievsky, A.; Kuchina, Elena; Kumbartzki, Gerfried; Lee, Byungwuek; LeRose, John; Lindgren, Richard; Lott, Gordon; Lu, H.; Marcucci, Laura; Margaziotis, Demetrius; Markowitz, Pete; Marrone, Stefano; Meekins, David; Meziani, Zein-Eddine; Michaels, Robert; Moffit, Bryan; Norum, Blaine; Petratos, Gerassimos; Puckett, Andrew; Qian, Xin; Rondon-Aramayo, Oscar; Saha, Arunava; Sawatzky, Bradley; Segal, John; Hashemi, Mitra; Shahinyan, Albert; Solvignon-Slifer, Patricia; Subedi, Ramesh; Suleiman, Riad; Sulkosky, Vincent; Urciuoli, Guido; Viviani, Michele; Wang, Y.; Wojtsekhowski, Bogdan; Yan, X.; Yao, H.; Zhang, W. -M.; Zheng, X.; Zhu, L.

    2014-04-01

    The charge form factor of 4He has been extracted in the range 29 fm-2 <= Q2 <= 77 fm-2 from elastic electron scattering, detecting 4He nuclei and electrons in coincidence with the High Resolution Spectrometers of the Hall A Facility of Jefferson Lab. The results are in qualitative agreement with realistic meson-nucleon theoretical calculations. The data have uncovered a second diffraction minimum, which was predicted in the Q2 range of this experiment, and rule out conclusively long-standing predictions of dimensional scaling of high-energy amplitudes using quark counting.

  16. Scattering from phase-separated vesicles. I. An analytical form factor for multiple static domains

    SciTech Connect

    Heberle, Frederick A.; Anghel, Vinicius N. P.; Katsaras, John

    2015-08-18

    This is the first in a series of studies considering elastic scattering from laterally heterogeneous lipid vesicles containing multiple domains. Unique among biophysical tools, small-angle neutron scattering can in principle give detailed information about the size, shape and spatial arrangement of domains. A general theory for scattering from laterally heterogeneous vesicles is presented, and the analytical form factor for static domains with arbitrary spatial configuration is derived, including a simplification for uniformly sized round domains. The validity of the model, including series truncation effects, is assessed by comparison with simulated data obtained from a Monte Carlo method. Several aspects of the analytical solution for scattering intensity are discussed in the context of small-angle neutron scattering data, including the effect of varying domain size and number, as well as solvent contrast. Finally, the analysis indicates that effects of domain formation are most pronounced when the vesicle's average scattering length density matches that of the surrounding solvent.

  17. Scaling study of the pion electroproduction cross sections and the pion form factor

    SciTech Connect

    Tanja Horn; Xin Qian; John Arrington; Razmik Asaturyan; Fatiha Benmokthar; Werner Boeglin; Peter Bosted; Antje Bruell; Eric Christy; Eugene Chudakov; Ben Clasie; Mark Dalton; AJI Daniel; Donal Day; Dipangkar Dutta; Lamiaa El Fassi; Rolf Ent; Howard Fenker; J. Ferrer; Nadia Fomin; H. Gao; K Garrow; Dave Gaskell; C Gray; G. Huber; M. Jones; N Kalantarians; C. Keppel; K Kramer; Y Li; Y Liang; A. Lung; S Malace; P. Markowitz; A. Matsumura; D. Meekins; T Mertens; T Miyoshi; H. Mykrtchyan; R. Monson; T. Navasardyan; G. Niculescu; I. Niculescu; Y. Okayasu; A. Opper; C Perdrisat; V. Punjabi; A. Rauf; V. Rodriguez; D. Rohe; J Seely; E Segbefia; G. Smith; M. Sumihama; V. Tadevoyan; L Tang; V. Tvaskis; A. Villano; W. Vulcan; F. Wesselmann; S. Wood; L. Yuan; X. Zheng

    2007-07-12

    The $^{1}$H($e,e^\\prime \\pi^+$)n cross section was measured for a range of four-momentum transfer up to $Q^2$=3.91 GeV$^2$ at values of the invariant mass, $W$, above the resonance region. The $Q^2$-dependence of the longitudinal component is consistent with the $Q^2$-scaling prediction for hard exclusive processes. This suggests that perturbative QCD concepts are applicable at rather low values of $Q^2$. Pion form factor results, while consistent with the $Q^2$-scaling prediction, are inconsistent in magnitude with perturbative QCD calculations. The extraction of Generalized Parton Distributions from hard exclusive processes assumes the dominance of the longitudinal term. However, transverse contributions to the cross section are still significant at $Q^2$=3.91 GeV$^2$.

  18. Transition Form Factors: A Unique Opportunity to Connect Non-Perturbative Strong Interactions to QCD

    SciTech Connect

    Gothe, Ralf W.

    2014-01-01

    Meson-photoproduction measurements and their reaction-amplitude analyses can establish more sensitively, and in some cases in an almost model-independent way, nucleon excitations and non-resonant reaction amplitudes. However, to investigate the strong interaction from explored — where meson-cloud degrees of freedom contribute substantially to the baryon structure — to still unexplored distance scales — where quark degrees of freedom dominate and the transition from dressed to current quarks occurs — we depend on experiments that allow us to measure observables that are probing this evolving non-perturbative QCD regime over its full range. Elastic and transition form factors are uniquely suited to trace this evolution by measuring elastic electron scattering and exclusive single-meson and double-pion electroproduction cross sections off the nucleon. These exclusive measurements will be extended to higher momentum transfers with the energy-upgraded CEBAF beam at JLab to study the quark degrees of freedom, where their strong interaction is responsible for the ground and excited nucleon state formations. After establishing unprecedented high-precision data, the imminent next challenge is a high-quality analysis to extract these relevant electrocoupling parameters for various resonances that then can be compared to state-of-the-art models and QCD-based calculations. Recent results will demonstrate the status of the analysis and of their theoretical descriptions, and an experimental and theoretical outlook will highlight what shall and may be achieved in the new era of the 12-GeV upgraded transition form factor program.

  19. Universal behavior of the γ⁎γ→(π0,η,η′) transition form factors

    PubMed Central

    Melikhov, Dmitri; Stech, Berthold

    2012-01-01

    The photon transition form factors of π, η and η′ are discussed in view of recent measurements. It is shown that the exact axial anomaly sum rule allows a precise comparison of all three form factors at high-Q2 independent of the different structures and distribution amplitudes of the participating pseudoscalar mesons. We conclude: (i) The πγ form factor reported by Belle is in excellent agreement with the nonstrange I=0 component of the η and η′ form factors obtained from the BaBar measurements. (ii) Within errors, the πγ form factor from Belle is compatible with the asymptotic pQCD behavior, similar to the η and η′ form factors from BaBar. Still, the best fits to the data sets of πγ, ηγ, and η′γ form factors favor a universal small logarithmic rise Q2FPγ(Q2)∼log(Q2). PMID:23226917

  20. Endothelial colony forming cells ameliorate endothelial dysfunction via secreted factors following ischemia-reperfusion injury.

    PubMed

    Collett, Jason A; Mehrotra, Purvi; Crone, Allison; Shelley, W Christopher; Yoder, Mervin C; Basile, David P

    2017-02-22

    Damage to endothelial cells contributes to acute kidney injury (AKI) by leading to impaired perfusion. Endothelial colony-forming cells (ECFCs) are endothelial precursor cells with high proliferative capacity, pro-angiogenic activity, and in vivo vessel forming potential. We hypothesized that ECFCs may ameliorate the degree of AKI and/or promote repair of the renal vasculature following ischemia/reperfusion (I/R). Rat pulmonary microvascular ECs (PMVEC) with high proliferative potential were compared with pulmonary artery ECs (PAEC) with low proliferative potential in rats subjected to renal I/R. PMVEC administration reduced renal injury and hastened recovery as indicated by serum creatinine and tubular injury scores, while PAEC did not. Vehicle-treated control animals showed consistent reductions in renal medullary blood flow (MBF) within 2 hours of reperfusion, while PMVEC protected against loss in MBF as measured by laser Doppler. Interestingly, PMVEC mediated protection occurred in the absence of homing to the kidney. Conditioned medium (CM) from human cultured cord blood ECFC also conveyed beneficial effects against I/R injury and loss of MBF. Moreover, ECFC-CM significantly reduced the expression of adhesion molecules such as ICAM-1 and p-selectin, and decreased the number of differentiated lymphocytes typically recruited into the kidney following renal ischemia. Taken together, these data suggest that ECFC secrete factors that preserve renal function post ischemia, in part, by preserving microvascular function.

  1. Form factors of the isovector scalar current and the [Formula: see text] scattering phase shifts.

    PubMed

    Albaladejo, M; Moussallam, B

    A model for S-wave [Formula: see text] scattering is proposed which could be realistic in an energy range from threshold up to above 1 GeV, where inelasticity is dominated by the [Formula: see text] channel. The T-matrix, satisfying two-channel unitarity, is given in a form which matches the chiral expansion results at order [Formula: see text] exactly for the [Formula: see text], [Formula: see text] amplitudes and approximately for [Formula: see text]. It contains six phenomenological parameters. Asymptotic conditions are imposed which ensure a minimal solution of the Muskhelishvili-Omnès problem, thus allowing one to compute the [Formula: see text] and [Formula: see text] form factor matrix elements of the [Formula: see text] scalar current from the T-matrix. The phenomenological parameters are determined such as to reproduce the experimental properties of the [Formula: see text], [Formula: see text] resonances, as well as the chiral results of the [Formula: see text] and [Formula: see text] scalar radii, which are predicted to be remarkably small at [Formula: see text]. This T-matrix model could be used for a unified treatment of the [Formula: see text] final-state interaction problem in processes such as [Formula: see text], [Formula: see text], or the [Formula: see text] initial-state interaction in [Formula: see text].

  2. Baculovirus per os infectivity factors form a complex on the surface of occlusion-derived virus.

    PubMed

    Peng, Ke; van Oers, Monique M; Hu, Zhihong; van Lent, Jan W M; Vlak, Just M

    2010-09-01

    Five highly conserved per os infectivity factors, PIF1, PIF2, PIF3, PIF4, and P74, have been reported to be essential for oral infectivity of baculovirus occlusion-derived virus (ODV) in insect larvae. Three of these proteins, P74, PIF1, and PIF2, were thought to function in virus binding to insect midgut cells. In this paper evidence is provided that PIF1, PIF2, and PIF3 form a stable complex on the surface of ODV particles of the baculovirus Autographa californica multinucleocapsid nucleopolyhedrovirus (AcMNPV). The complex could withstand 2% SDS-5% beta-mercaptoethanol with heating at 50 degrees C for 5 min. The complex was not formed when any of the genes for PIF1, PIF2, or PIF3 was deleted, while reinsertion of these genes into AcMNPV restored the complex. Coimmunoprecipitation analysis independently confirmed the interactions of the three PIF proteins and revealed in addition that P74 is also associated with this complex. However, deletion of the p74 gene did not affect formation of the PIF1-PIF2-PIF3 complex. Electron microscopy analysis showed that PIF1 and PIF2 are localized on the surface of the ODV with a scattered distribution. This distribution did not change for PIF1 or PIF2 when the gene for PIF2 or PIF1 protein was deleted. We propose that PIF1, PIF2, PIF3, and P74 form an evolutionarily conserved complex on the ODV surface, which has an essential function in the initial stages of baculovirus oral infection.

  3. Factors limiting the establishment of canopy-forming algae on artificial structures

    NASA Astrophysics Data System (ADS)

    Cacabelos, Eva; Martins, Gustavo M.; Thompson, Richard; Prestes, Afonso C. L.; Azevedo, José Manuel N.; Neto, Ana I.

    2016-11-01

    Macroalgal canopies are important ecosystem engineers, contributing to coastal productivity and supporting a rich assemblage of associated flora and fauna. However, they are often absent from infrastructures such as coastal defences and there has been a worldwide decline in their distribution in urbanised coastal areas. The macroalga Fucus spiralis is the only high-shore canopy forming species present in the Azores. It is widely distributed in the archipelago but is never found on coastal infrastructures. Here we evaluate factors that may potentially limit its establishment on artificial structures. A number of observational and manipulative experiments were used to test the hypotheses that: (i) limited-dispersal ability limits the colonisation of new plants onto artificial structures, (ii) vertical substratum slope negatively influences the survivorship of recruits, and (iii) vertical substratum slope also negatively influences the survivorship and fitness of adults. Results showed that the limited dispersal from adult plants may be a more important factor than slope in limiting the species ability to colonise coastal infrastructures, since the vertical substratum slope does not affect its fitness or survivorship.

  4. On the key factors of angular correlations in complex-forming elementary reactions

    NASA Astrophysics Data System (ADS)

    Bonnet, L.; Rayez, J. C.

    2006-04-01

    In the mid-seventies, Case and Herschbach argued that for complex-forming three-atom reactions governed by long-range forces and performed in supersonic molecular beam experiments, vectorial properties are determined by a single parameter Λ' = , L' and j' being respectively the moduli of the orbital and rotational angular momenta of the products. A simple mathematical relation between vectorial properties and Λ' was then proposed. However, Λ' must be determined beforehand by phase space theory calculations. Besides, we have recently shown that scalar properties are mainly controled by two factors ρ'1 and ρ'2 respectively called angular excitation and diatomic inertial contribution. We show here that these factors control also vectorial properties. Moreover, the way they control them is summarized in a set of four figures. The advantage of our method is that ρ'1 and ρ'2 are related to the mechanical parameters of the reaction by very simple formulas, contrary to Λ'. Last by not least, our parameters appear to be mostly independent, so that vectorial properties cannot be said to strictly depend on Λ'. Nevertheless, it turns out that the rule proposed by Case and Herschbach is reasonable in many realistic situations.

  5. Crystal Structure of a Translation Termination Complex Formed With Release Factor RF2

    SciTech Connect

    Korostelev, A.; Asahara, H.; Lancaster, L.; Laurberg, M.; Hirschi, A.; Zhu, J.; Trakhanov, S.; Scott, W.G.; Noller, H.F.

    2009-05-20

    We report the crystal structure of a translation termination complex formed by the Thermus thermophilus 70S ribosome bound with release factor RF2, in response to a UAA stop codon, solved at 3 {angstrom} resolution. The backbone of helix -5 and the side chain of serine of the conserved SPF motif of RF2 recognize U1 and A2 of the stop codon, respectively. A3 is unstacked from the first 2 bases, contacting Thr-216 and Val-203 of RF2 and stacking on G530 of 16S rRNA. The structure of the RF2 complex supports our previous proposal that conformational changes in the ribosome in response to recognition of the stop codon stabilize rearrangement of the switch loop of the release factor, resulting in docking of the universally conserved GGQ motif in the PTC of the 50S subunit. As seen for the RF1 complex, the main-chain amide nitrogen of glutamine in the GGQ motif is positioned to contribute directly to catalysis of peptidyl-tRNA hydrolysis, consistent with mutational studies, which show that most side-chain substitutions of the conserved glutamine have little effect. We show that when the H-bonding capability of the main-chain N-H of the conserved glutamine is eliminated by substitution with proline, peptidyl-tRNA esterase activity is abolished, consistent with its proposed role in catalysis.

  6. A pre-formed Pyrogenic Factor Released by Lipopolysaccharide Stimulated Macrophages

    PubMed Central

    Zampronio, A. R.; Melo, M. C. C.; Silva, C. A. A.; Pelá, I. R.; Hopkins, S. J.

    1994-01-01

    The aim of this study was to investigate the pyrogenic activity of factor(s) released by rat peritoneal macrophages following a brief stimulation with LPS. The effect of this factor on the number of circulating leukocytes and serum Fe, Cu and Zn levels, was also evaluated. The possibility that the content of interleukin (IL)-1β, IL-6 and tumour necrosis factor (TNF) in the supernatant could explain the observations was investigated. Supernatant produced over a period of 1 h by peritoneal macrophages, following a 30 min incubation with LPS at 37°C, was ultrafiltered through a 10 000 MW cut-off Amicon membrane, sterilized, and concentrated 2.5, 5, 10 and 20 times. The intravenous (i.v.) injection of this supernatant induced a concentration-dependent fever in rats with a maximal response at 2 h. The pyrogenic activity was produced by macrophages elicited with thioglycollate and by resident cells. The supernatants also induced neutrophilia and reduction in Fe and Zn 6 h after the injection. Absence of activity in boiled supernatants, or supernatants from macrophages incubated at 4°C with LPS, indicates that LPS was not responsible for the activity. In vitro treatment with indomethacin (Indo), dexamethasone (Dex), or cycloheximide (Chx) did not modify the release of pyrogenic activity into the supernatant or its effects on the reduction in serum metal levels. Although Chx abolished the production of mediator(s) inducing neutrophilia, and Dex reduced the induction of IL-1β, TNF and IL-6, injection of the highest concentration of these cytokines detected in the supernatants did not induce fever. In vivo treatment with Dex, but not Indo, abolished the fever induced by the supernatant. These results suggest that macrophages contain pre-formed pyrogenic mediator(s), not related to IL-1β, IL-6 or TNF, that acts indirectly and independently of prostaglandtn. It also seems likely that the pyrogenic activity is related to the factor responsible for the reduction of serum Fe

  7. ω→π0γ* and ϕ→π0γ* transition form factors in dispersion theory

    NASA Astrophysics Data System (ADS)

    Schneider, Sebastian P.; Kubis, Bastian; Niecknig, Franz

    2012-09-01

    We calculate the ω→π0γ* and ϕ→π0γ* electromagnetic transition form factors based on dispersion theory, relying solely on a previous dispersive analysis of the corresponding three-pion decays and the pion vector form factor. We compare our findings to recent measurements of the ω→π0μ+μ- decay spectrum by the NA60 collaboration, and strongly encourage experimental investigation of the Okubo-Zweig-Iizuka forbidden ϕ→π0ℓ+ℓ- decays in order to understand the strong deviations from vector-meson dominance found in these transition form factors.

  8. A Non-parametric approach to the D+ ---> anti-K*0 mu+ nu form-factors

    SciTech Connect

    Link, J.M.; Yager, P.M.; Anjos, J.C.; Bediaga, I.; Castromonte, C.; Machado, A.A.; Magnin, J.; Massafferri, A.; de Miranda, J.M.; Pepe, I.M.; Polycarpo, E.; dos Reis, A.C.; Carrillo, S.; Casimiro, E.; Cuautle, E.; Sanchez-Hernandez, A.; Uribe, C.; Vazquez, F.; Agostino, L.; Cinquini, L.; Cumalat, J.P.; /Colorado U. /Fermilab /Frascati /Guanajuato U. /Illinois U., Urbana /Indiana U. /Korea U. /Kyungpook Natl. U. /INFN, Milan /Milan U. /North Carolina U. /Pavia U. /INFN, Pavia /Rio de Janeiro, Pont. U. Catol. /Puerto Rico U., Mayaguez /South Carolina U. /Tennessee U. /Vanderbilt U. /Wisconsin U., Madison

    2005-09-01

    Using a large sample of D{sup +} {yields} K{sup -} {pi}{sup +} {mu}{sup +}{nu} decays collected by the FOCUS photo-production experiment at Fermilab, we present the first measurements of the helicity basis form factors free from the assumption of spectroscopic pole dominance. We also present the first information on the form factor that controls the s-wave interference discussed in a previous paper by the FOCUS collaboration. We find reasonable agreement with the usual assumption of spectroscopic pole dominance and measured form factor ratios.

  9. Extracellular acidification induces connective tissue growth factor production through proton-sensing receptor OGR1 in human airway smooth muscle cells

    SciTech Connect

    Matsuzaki, Shinichi; Ishizuka, Tamotsu; Yamada, Hidenori; Kamide, Yosuke; Hisada, Takeshi; Ichimonji, Isao; Aoki, Haruka; Yatomi, Masakiyo; Komachi, Mayumi; Tsurumaki, Hiroaki; Ono, Akihiro; Koga, Yasuhiko; Dobashi, Kunio; Mogi, Chihiro; Sato, Koichi; Tomura, Hideaki; Mori, Masatomo; Okajima, Fumikazu

    2011-10-07

    Highlights: {yields} The involvement of extracellular acidification in airway remodeling was investigated. {yields} Extracellular acidification alone induced CTGF production in human ASMCs. {yields} Extracellular acidification enhanced TGF-{beta}-induced CTGF production in human ASMCs. {yields} Proton-sensing receptor OGR1 was involved in acidic pH-stimulated CTGF production. {yields} OGR1 may play an important role in airway remodeling in asthma. -- Abstract: Asthma is characterized by airway inflammation, hyper-responsiveness and remodeling. Extracellular acidification is known to be associated with severe asthma; however, the role of extracellular acidification in airway remodeling remains elusive. In the present study, the effects of acidification on the expression of connective tissue growth factor (CTGF), a critical factor involved in the formation of extracellular matrix proteins and hence airway remodeling, were examined in human airway smooth muscle cells (ASMCs). Acidic pH alone induced a substantial production of CTGF, and enhanced transforming growth factor (TGF)-{beta}-induced CTGF mRNA and protein expression. The extracellular acidic pH-induced effects were inhibited by knockdown of a proton-sensing ovarian cancer G-protein-coupled receptor (OGR1) with its specific small interfering RNA and by addition of the G{sub q/11} protein-specific inhibitor, YM-254890, or the inositol-1,4,5-trisphosphate (IP{sub 3}) receptor antagonist, 2-APB. In conclusion, extracellular acidification induces CTGF production through the OGR1/G{sub q/11} protein and inositol-1,4,5-trisphosphate-induced Ca{sup 2+} mobilization in human ASMCs.

  10. Proton Pair Production Cross Sections at BESIII

    NASA Astrophysics Data System (ADS)

    Zhou, Xiaorong

    Using data samples collected with the BESIII detector at the BEPCII collider, the Born cross section of e + e - to pbar{p} at 12 center-of-mass energies from 2232.4 to 3671.0 MeV is provided. The corresponding effective electromagnetic form factor of the proton is deduced under the assumption that the electric and magnetic form factors are equal. In addition, the ratio of electric to magnetic form factors are extracted for the data samples with larger statistics. The measured cross sections are in agreement with recent results from BaBar, improving the overall uncertainty by about 30%. The |GE/GM| ratios are close to unity and consistent with BaBar results in the same q2 region.

  11. Blackbody Infrared Radiative Dissociation of Protonated Oligosaccharides

    NASA Astrophysics Data System (ADS)

    Fentabil, Messele A.; Daneshfar, Rambod; Kitova, Elena N.; Klassen, John S.

    2011-12-01

    The dissociation pathways, kinetics, and energetics of protonated oligosaccharides in the gas phase were investigated using blackbody infrared radiative dissociation (BIRD). Time-resolved BIRD measurements were performed on singly protonated ions of cellohexaose (Cel6), which is composed of β-(1 → 4)-linked glucopyranose rings, and five malto-oligosaccharides (Malx, where x = 4-8), which are composed of α-(1 → 4)-linked glucopyranose units. At the temperatures investigated (85-160 °C), the oligosaccharides dissociate at the glycosidic linkages or by the loss of a water molecule to produce B- or Y-type ions. The Y ions dissociate to smaller Y or B ions, while the B ions yield exclusively smaller B ions. The sequential loss of water molecules from the smallest B ions (B1 and B2) also occurs. Rate constants for dissociation of the protonated oligosaccharides and the corresponding Arrhenius activation parameters (Ea and A) were determined. The Ea and A-factors measured for protonated Malx (x > 4) are indistinguishable within error (~19 kcal mol-1, 1010 s-1), which is consistent with the ions being in the rapid energy exchange limit. In contrast, the Arrhenius parameters for protonated Cel6 (24 kcal mol-1, 1012 s-1) are significantly larger. These results indicate that both the energy and entropy changes associated with the glycosidic bond cleavage are sensitive to the anomeric configuration. Based on the results of this study, it is proposed that formation of B and Y ions occurs through a common dissociation mechanism, with the position of the proton establishing whether a B or Y ion is formed upon glycosidic bond cleavage.

  12. Topological description of the bond-breaking and bond-forming processes of the alkene protonation reaction in zeolite chemistry: an AIM study.

    PubMed

    Zalazar, María Fernanda; Peruchena, Nélida Maria

    2011-10-01

    Density functional theory and atoms in molecules theory were used to study bond breakage and bond formation in the trans-2-butene protonation reaction in an acidic zeolitic cluster. The progress of this reaction along the intrinsic reaction coordinate, in terms of several topological properties of relevant bond critical points and atomic properties of the key atoms involved in these concerted mechanisms, were analyzed in depth. At B3LYP/6-31++G(d,p)//B3LYP/6-31G(d,p) level, the results explained the electron density redistributions associated with the progressive bond breakage and bond formation of the reaction under study, as well as the profiles of the electronic flow between the different atomic basins involved in these electron reorganization processes. In addition, we found a useful set of topological indicators that are useful to show what is happening in each bond/atom involved in the reaction site as the reaction progresses.

  13. Proton dynamics in cancer

    PubMed Central

    2010-01-01

    Cancer remains a leading cause of death in the world today. Despite decades of research to identify novel therapeutic approaches, durable regressions of metastatic disease are still scanty and survival benefits often negligible. While the current strategy is mostly converging on target-therapies aimed at selectively affecting altered molecular pathways in tumor cells, evidences are in parallel pointing to cell metabolism as a potential Achilles' heel of cancer, to be disrupted for achieving therapeutic benefit. Critical differences in the metabolism of tumor versus normal cells, which include abnormal glycolysis, high lactic acid production, protons accumulation and reversed intra-extracellular pH gradients, make tumor site a hostile microenvironment where only cancer cells can proliferate and survive. Inhibiting these pathways by blocking proton pumps and transporters may deprive cancer cells of a key mechanism of detoxification and thus represent a novel strategy for a pleiotropic and multifaceted suppression of cancer cell growth. Research groups scattered all over the world have recently started to investigate various aspects of proton dynamics in cancer cells with quite encouraging preliminary results. The intent of unifying investigators involved in this research line led to the formation of the "International Society for Proton Dynamics in Cancer" (ISPDC) in January 2010. This is the manifesto of the newly formed society where both basic and clinical investigators are called to foster translational research and stimulate interdisciplinary collaboration for the development of more specific and less toxic therapeutic strategies based on proton dynamics in tumor cell biology. PMID:20550689

  14. Characterization of the clotting activities of structurally different forms of activated factor IX. Enzymatic properties of normal human factor IXa alpha, factor IXa beta, and activated factor IX Chapel Hill.

    PubMed Central

    Griffith, M J; Breitkreutz, L; Trapp, H; Briet, E; Noyes, C M; Lundblad, R L; Roberts, H R

    1985-01-01

    Two structurally different forms of activated human Factor IX (Factor IXa alpha and IXa beta) have been previously reported to have essentially identical clotting activity in vitro. Although it has been shown that activated Factor IX Chapel Hill, an abnormal Factor IX isolated from the plasma of a patient with mild hemophilia B, and normal Factor IXa alpha are structurally very similar, the clotting activity of activated Factor IX Chapel Hill is much lower (approximately fivefold) than that of normal Factor IXa beta. In the present study we have prepared activated Factor IX by incubating human Factor IX with calcium and Russell's viper venom covalently bound to agarose. Fractionation of the activated Factor IX by high-performance liquid chromatography demonstrated the presence of both Factors IXa alpha and IXa beta. On the basis of active site concentration, determined by titration with antithrombin III, the clotting activities of activated Factor IX Chapel Hill and IXa alpha were similar, but both activities were less than 20% of the clotting activity of Factor IXa beta. Activated Factor IX activity was also measured in the absence of calcium, phospholipid, and Factor VIII, by determination of the rate of Factor X activation in the presence of polylysine. In the presence of polylysine, the rates of Factor X activation by activated Factor IX Chapel Hill, Factor IXa alpha, and Factor IXa beta were essentially identical. We conclude that the clotting activity of activated Factor IX Chapel Hill is reduced when compared with that of Factor IXa beta but essentially normal when compared with that of Factor IXa alpha. PMID:3871202

  15. g factor of the J/sup. pi. / = 25/2/sup +/ isomer in /sup 205/Tl and the anomalous orbital magnetism of the proton

    SciTech Connect

    Maier, K.H.; Becker, J.A.; Carlson, J.B.; Lanier, R.G.; Mann, L.G.; Struble, G.L.; Nail, T.; Sheline, R.K.; Stoeffl, W.; Ussery, L.

    1982-02-15

    The nuclear gyromagnetic ratio of the 3291-keV J/sup ..pi../ = 25/2/sup +/ /sup 205/Tl level has been measured with use of ..gamma..-ray perturbed angular distribution techniques with the result g = 0.544 +- 0.008. The state was populated with the reaction /sup 204/Hg(t,2n)/sup 205/Tl. With use of the known quantities g(/sup 206/Pb 7/sup -/; E/sub x/ = 2200 keV) and g(/sup 209/Bi 9/2/sup +/; E/sub x/ = 0 keV) the proton orbital magnetic g factor for the 1h orbital was deduced to be g/sub 1/ = 1.115 +- 0.02. This result has been corrected for wave-function admixtures and core polarization effects.

  16. Uncertainty estimates for proton-proton fusion

    NASA Astrophysics Data System (ADS)

    Acharya, Bijaya

    2017-01-01

    We calculate the proton-proton fusion cross section using chiral effective field theory (χEFT) and perform a rigorous analysis of the associated uncertainties. The statistical errors in the low-energy constants, which are fitted too scattering and bound-state observables in the pion-nucleon, nucleon-nucleon, and few-nucleon sectors, are propagated to the calculated cross section. We also investigate the sensitivity of the fusion cross section to the high-momentum cutoff of the χEFT. We extract a value for the zero-energy S-factor using a polynomial extrapolant and analyze the errors associated with this procedure. Our result is compared to that of another χEFT calculation in which the wave functions were represented in a truncated Hilbert space with discrete basis states. Supported by the NSF under Grant Nos. PHY-1516077 and PHY- 1555030.

  17. Characterization of the Native Form of Anthrax Lethal Factor for Use in the Toxin Neutralization Assay

    PubMed Central

    Lu, Hang; Catania, Jason; Baranji, Katalin; Feng, Jie; Gu, Mili; Lathey, Janet; Sweeny, Diane; Sanford, Hannah; Sapru, Kavita; Patamawenu, Terry; Chen, June-Home; Ng, Alan; Fesseha, Zenbework; Kluepfel-Stahl, Stefanie; Minang, Jacob

    2013-01-01

    The cell-based anthrax toxin neutralization assay (TNA) is used to determine functional antibody titers of sera from animals and humans immunized with anthrax vaccines. The anthrax lethal toxin is a critical reagent of the TNA composed of protective antigen (PA) and lethal factor (LF), which are neutralization targets of serum antibodies. Cytotoxic potency of recombinant LF (rLF) lots can vary substantially, causing a challenge in producing a renewable supply of this reagent for validated TNAs. To address this issue, we characterized a more potent rLF variant (rLF-A) with the exact native LF amino acid sequence that lacks the additional N-terminal histidine and methionine residues present on the commonly used form of rLF (rLF-HMA) as a consequence of the expression vector. rLF-A can be used at 4 to 6 ng/ml (in contrast to 40 ng/ml rLF-HMA) with 50 ng/ml recombinant PA (rPA) to achieve 95 to 99% cytotoxicity. In the presence of 50 ng/ml rPA, both rLF-A and rLF-HMA allowed for similar potencies (50% effective dilution) among immune sera in the TNA. rPA, but not rLF, was the dominant factor in determining potency of serum samples containing anti-PA antibodies only or an excess of anti-PA relative to anti-rLF antibodies. Such anti-PA content is reflected in immune sera derived from most anthrax vaccines in development. These results support that 7- to 10-fold less rLF-A can be used in place of rLF-HMA without changing TNA serum dilution curve parameters, thus extending the use of a single rLF lot and a consistent, renewable supply. PMID:23637044

  18. Kaon photoproduction off proton

    NASA Astrophysics Data System (ADS)

    Skoupil, Dalibor; Bydžovský, Petr

    2016-11-01

    We have recently constructed our version of the Regge-plus-resonance (RPR) model and two variants of an isobar model for photoproduction of kaons on the proton, utilizing new experimental data from CLAS, LEPS, and GRAAL collaborations for adjusting free parameters of the models. Higher-spin nucleon (3/2 and 5/2) and hyperon (3/2) resonances were included using the consistent formalism by Pascalutsa and found to play an important role in data description. The set of chosen nucleon resonances in our new isobar models agrees well with the set of the most probable contributing states determined in the Bayesian analysis with the RPR model whilst only 6 out of 10 N*'s selected in the RPR fit of ours overlap with the nucleon resonant states in the Bayesian analysis. Results of two versions of the isobar model are compared to the new version of the RPR model and experimental data in the third-resonance region and their properties are discussed. We place an emphasis on the choice of resonances, the predictions in the forward- and backward-angle region as well as the choice of the hadron form factor.

  19. SU-E-T-246: MU Model Implementation for a Passively Scattered Proton Beam: Inclusion of the Bolus Gap and Nozzle Extension Factors

    SciTech Connect

    Simpson, R; Ghebremedhin, A; Gordon, I; Patyal, B; Piskulich, F.; LeMaster, Brett

    2014-06-01

    Purpose: To develop and implement an MU model for a passively scattered proton beam, and eliminate the need for patient specific calibrations for field sizes from 3cm to 15cm. This would enable consistent and timely calibrations for a wide variety of patient portals, streamlining the treatment process. Methods: Measurements were initially made using a Standard Imaging A-16 ion chamber and a modified water tank to determine the bolus gap factors (BGF) for multiple combinations of aperture size, bolus thickness, and air gap. The BGF was then separated into two component factors: the bolus thickness factor (BTF) and the nozzle extension factor (NEF). Polynomial curves were generated using the measured data to produce BTF tables for air gaps from 0cm to 30cm and for bolus thicknesses from 0cm to 10cm, and NEF tables for the full range of clinically used nozzle extensions. Additionally, data tables were created for every factor that affects beam output in the MU model. The MUs were then modeled for 487 patient portals and retrospectively compared to the MUs generated from the physical calibrations previously performed. Results: Of the 487 patient portals tested, 100% of the portals used for the comparison were within 2.5% from the MUs generated using a physical calibration, and 95.9% of the MU model portals tested were within 2%. The patient portals tested had field sizes ranging from 2.1cm to 10.1cm, with air gaps from 2cm to 25cm. Output factors for field sizes below 3cm with irregularly shaped fields demonstrated inconsistent results and will be further studied. Conclusion: The most problematic output factor, the BGF, was modeled accurately and consistently using the lowest order polynomial curve fits and interpolation between measured data. The study results demonstrate the robustness of the MU model and the potential for saving valuable personnel and beam time.

  20. Emission of neutron-proton and proton-proton pairs in neutrino scattering

    NASA Astrophysics Data System (ADS)

    Ruiz Simo, I.; Amaro, J. E.; Barbaro, M. B.; De Pace, A.; Caballero, J. A.; Megias, G. D.; Donnelly, T. W.

    2016-11-01

    We use a recently developed model of relativistic meson-exchange currents to compute the neutron-proton and proton-proton yields in (νμ ,μ-) scattering from 12C in the 2p-2h channel. We compute the response functions and cross sections with the relativistic Fermi gas model for different kinematics from intermediate to high momentum transfers. We find a large contribution of neutron-proton configurations in the initial state, as compared to proton-proton pairs. In the case of charge-changing neutrino scattering the 2p-2h cross section of proton-proton emission (i.e., np in the initial state) is much larger than for neutron-proton emission (i.e., two neutrons in the initial state) by a (ω , q)-dependent factor. The different emission probabilities of distinct species of nucleon pairs are produced in our model only by meson-exchange currents, mainly by the Δ isobar current. We also analyze other effects including exchange contributions and the effect of the axial and vector currents.

  1. Covariant Spectator Theory of np scattering: Deuteron magnetic moment and form factors

    SciTech Connect

    Gross, Franz L.

    2014-06-01

    The deuteron magnetic moment is calculated using two model wave functions obtained from 2007 high precision fits to $np$ scattering data. Included in the calculation are a new class of isoscalar $np$ interaction currents which are automatically generated by the nuclear force model used in these fits. After normalizing the wave functions, nearly identical predictions are obtained: model WJC-1, with larger relativistic P-state components, gives 0.863(2), while model WJC-2 with very small $P$-state components gives 0.864(2) These are about 1\\% larger than the measured value of the moment, 0.857 n.m., giving a new prediction for the size of the $\\rho\\pi\\gamma$ exchange, and other purely transverse interaction currents that are largely unconstrained by the nuclear dynamics. The physical significance of these results is discussed, and general formulae for the deuteron form factors, expressed in terms of deuteron wave functions and a new class of interaction current wave functions, are given.

  2. Scalar K{pi} form factor and light-quark masses

    SciTech Connect

    Jamin, Matthias; Oller, Jose Antonio; Pich, Antonio

    2006-10-01

    Recent experimental improvements on K-decay data allow for a precise extraction of the strangeness-changing scalar K{pi} form factor and the related strange scalar spectral function. On the basis of this scalar as well as the corresponding pseudoscalar spectral function, the strange quark mass is determined to be m{sub s}(2 GeV)=92{+-}9 MeV. Further taking into account chiral perturbation theory mass ratios, the light up and down quark masses turn out to be m{sub u}(2 GeV)=2.7{+-}0.4 MeV as well as m{sub d}(2 GeV)=4.8{+-}0.5 MeV. As a by-product, we also find a value for the Cabibbo angle |V{sub us}|=0.2236(29) and the ratio of meson decay constants F{sub K}/F{sub {pi}}=1.203(16). Performing a global average of the strange mass by including extractions from other channels as well as lattice QCD results yields m{sub s}(2 GeV)=94{+-}6 MeV.

  3. Small Form Factor Information Storage Devices for Mobile Applications in Korea

    NASA Astrophysics Data System (ADS)

    Park, Young-Pil; Park, No-Cheol; Kim, Chul-Jin

    Recently, the ubiquitous environment in which anybody can reach a lot of information data without any limitations on the place and time has become an important social issue. There are two basic requirements in the field of information storage devices which have to be satisfied; the first is the demand for the improvement of memory capacity to manage the increased data capacity in personal and official purposes. The second is the demand for new development of information storage devices small enough to be applied to mobile multimedia digital electronics, including digital camera, PDA and mobile phones. To summarize, for the sake of mobile applications, it is necessary to develop information storage devices which have simultaneously a large capacity and a small size. Korea possesses the necessary infrastructure for developing such small sized information storage devices. It has a good digital market, major digital companies, and various research institutes. Nowadays, many companies and research institutes including university cooperate together in the research on small sized information storage devices. Thus, it is expected that small form factor optical disk drives will be commercialized in the very near future in Korea.

  4. ηc elastic and transition form factors: Contact interaction and algebraic model

    NASA Astrophysics Data System (ADS)

    Bedolla, Marco A.; Raya, Khépani; Cobos-Martínez, J. J.; Bashir, Adnan

    2016-05-01

    For the flavor-singlet heavy-quark system of charmonia in the pseudoscalar [ηc(1 S ) ] channel, we calculate the elastic (EFF) and transition form factors (TFFs) [ηc(1 S )→γ γ* ] for a wide range of photon momentum transfer squared (Q2). The framework for this analysis is provided by a symmetry-preserving Schwinger-Dyson equation and Bethe-Salpeter equation treatment of a vector×vector contact interaction. We also employ an algebraic model, developed earlier to describe the light-quark systems. It correctly correlates infrared and ultraviolet dynamics of quantum chromodynamics (QCD). The contact interaction results agree with the lattice data for low Q2. For Q2≥Q02 , the results start deviating from the lattice results by more than 20%. Q02≈2.5 GeV2 for the EFF, and ≈25 GeV2 for the TFF. We also present the results for the EFF, TFF, and ηc(1 S ) parton distribution amplitude for the algebraic model. Wherever the comparison is possible, these results are in excellent agreement with the lattice, perturbative QCD, results obtained through a Schwinger-Dyson equation-Bethe-Salpeter equation study, employing refined truncations, and the experimental findings of the BABAR experiment.

  5. Measurement of the weak magnetism form factor in 6He decay

    NASA Astrophysics Data System (ADS)

    Naviliat-Cuncic, Oscar; Huyan, Xueying; Bazin, Daniel; Gade, Alexandra; Hughes, Maximilian; Liddick, Sean; Minamisono, Kei; Noji, Shumpei; Paulauskas, Stanley; Simon, Anna; Voytas, Paul; Weisshaar, Dirk

    2016-09-01

    The Fierz interference terms constitutes a very sensitive probe to searches for exotic scalar and tensor couplings in beta decay. It can directly be determined through measurements of the beta spectrum shape. To this end, the 6He decay happens to have a similar kinematic sensitivity than neutron decay despite its end-point is 4.5 larger; the electromagnetic and radiative corrections can be calculated accurately and, since the 6He ground state is member of an isospin triplet, hadronic contributions to the weak currents can be calculated using CVC. In this contribution we describe an experiment, performed at the National Superconducting Cyclotron Laboratory, which measures the shape of the beta energy spectrum in 6He decay. The technique is based on the implantation of the nuclei of interest in suitable detectors, eliminating thereby the major systematic effect in such measurements related to the back-scattering of beta particles in surrounding matter and detectors. The first goal is to measure the weak magnetism form factor, which has never been measured in 6He decay, and which will provide a sensitivity test of the technique. The status of the data analysis will be presented.

  6. Measurement of the gamma gamma* to eta_c transition form factor

    SciTech Connect

    Lees, J.P.; Poireau, V.; Prencipe, E.; Tisserand, V.; Garra Tico, J.; Grauges, E.; Martinelli, M.; Palano, A.; Pappagallo, M.; Eigen, G.; Stugu, B.; Sun, L.; Battaglia, M.; Brown, D.N.; Hooberman, B.; Kerth, L.T.; Kolomensky, Yu.G.; Lynch, G.; Osipenkov, I.L.; Tanabe, T.; Hawkes, C.M.; /Birmingham U. /Ruhr U., Bochum /British Columbia U. /Brunel U. /Novosibirsk, IYF /UC, Irvine /UC, Riverside /UC, San Diego /UC, Santa Barbara /UC, Santa Cruz /Caltech /Cincinnati U. /Colorado U. /Colorado State U. /Dortmund U. /Dresden, Tech. U. /Ecole Polytechnique /Edinburgh U. /INFN, Ferrara /Ferrara U. /INFN, Ferrara /INFN, Ferrara /Ferrara U. /INFN, Ferrara /INFN, Ferrara /Ferrara U. /Frascati /INFN, Genoa /Genoa U. /INFN, Genoa /INFN, Genoa /Genoa U. /INFN, Genoa /INFN, Genoa /Genoa U. /Indian Inst. Tech., Guwahati /Harvard U. /Heidelberg U. /Humboldt U., Berlin /Imperial Coll., London /Iowa State U. /Iowa State U. /Johns Hopkins U. /Orsay, LAL /LLNL, Livermore /Liverpool U. /Queen Mary, U. of London /Royal Holloway, U. of London /Louisville U. /Mainz U., Inst. Kernphys. /Manchester U. /Maryland U. /Massachusetts U., Amherst /MIT /McGill U. /INFN, Milan /Milan U. /INFN, Milan /INFN, Milan /Milan U. /Mississippi U. /Montreal U. /INFN, Naples /Naples U. /NIKHEF, Amsterdam /NIKHEF, Amsterdam /Notre Dame U. /Ohio State U. /Oregon U. /INFN, Padua /Padua U. /INFN, Padua /INFN, Padua /Padua U. /Paris U., VI-VII /INFN, Perugia /Perugia U. /INFN, Pisa /Pisa U. /INFN, Pisa /Pisa, Scuola Normale Superiore /INFN, Pisa /Pisa U. /INFN, Pisa /Princeton U. /INFN, Rome /INFN, Rome /Rome U. /INFN, Rome /INFN, Rome /Rome U. /INFN, Rome /INFN, Rome /Rome U. /INFN, Rome /INFN, Rome /Rome U. /Rostock U. /Rutherford /DAPNIA, Saclay /SLAC /South Carolina U. /Stanford U., Phys. Dept. /SUNY, Albany /Tel Aviv U. /Tennessee U. /Texas Nuclear Corp., Austin /Texas U., Dallas /INFN, Turin /Turin U. /INFN, Trieste /Trieste U. /Valencia U. /Victoria U. /Warwick U. /Wisconsin U., Madison

    2010-04-28

    The authors study the reaction e{sup +}e{sup -} {yields} e{sup +}e{sup -} {eta}{sub c}, {eta}{sub c} {yields} K{sub S}K{sup {+-}}{pi}{sup {-+}} and obtain {eta}{sub c} mass and width values 2982.2 {+-} 0.4 {+-} 1.6 MeV/c{sup 2} and 31.7 {+-} 1.2 {+-} 0.8 MeV, respectively. They find {Lambda}({eta}{sub c} {yields} {gamma}{gamma}){Beta}({eta}{sub c} {yields} K{bar K}{pi}) = 0.374 {+-} 0.009 {+-} 0.031 keV, and measure the {gamma}{gamma}* {yields} {eta}{sub c} transition form factor in the momentum transfer range from 2 to 50 GeV{sup 2}. The analysis is based on 469 fb{sup -1} of integrated luminosity collected at PEP-II with the BABAR detector at e{sup +}e{sup -} center-of-mass energies near 10.6 GeV.

  7. A versatile small form factor twisted-pair TFC FMC for MTCA AMCs

    NASA Astrophysics Data System (ADS)

    Meder, L.; Lebedev, J.; Becker, J.

    2017-03-01

    In continuous readout systems of particle physics experiments, the provision of a common clock and time reference and the distribution of critical low latency messages to the processing and fronted layers of the readout are crucial tasks. In the context of the Compressed Baryonic Matter (CBM) experiment, a versatile small form factor Timing and Fast-Control (TFC) interfacing FPGA Mezzanine Card (FMC) was developed, offering bidirectional twisted-pair (TP) links for the communication between TFC nodes. Also a versatile clocking including voltage controlled oscillators and a connection to the telecommunication clock lines of mTCA crates are available. Being designed for both TFC Master and Slaves, the card allows rapid system developments without additional Slave hardware circuits. Measurements show that it is possible to transmit over cable lengths of 25 m at a rate of 240 Mbit/s for all data channels simultaneously. A TFC Master-Slave system using two of these cards can be synchronized with a precision of ±10 ps to an user-defined phase setpoint.

  8. Virtuality Distributions in application to gamma gamma* to pi^0 Transition Form Factor at Handbag Level

    SciTech Connect

    Radyushkin, Anatoly V.

    2014-07-01

    We outline basics of a new approach to transverse momentum dependence in hard processes. As an illustration, we consider hard exclusive transition process gamma*gamma -> to pi^0 at the handbag level. Our starting point is coordinate representation for matrix elements of operators (in the simplest case, bilocal O(0,z)) describing a hadron with momentum p. Treated as functions of (pz) and z^2, they are parametrized through a virtuality distribution amplitude (VDA) Phi (x, sigma), with x being Fourier-conjugate to (pz) and sigma Laplace-conjugate to z^2. For intervals with z^+=0, we introduce transverse momentum distribution amplitude (TMDA) Psi (x, k_\\perp), and write it in terms of VDA Phi (x, \\sigma). The results of covariant calculations, written in terms of Phi (x sigma) are converted into expressions involving Psi (x, k_\\perp. Starting with scalar toy models, we extend the analysis onto the case of spin-1/2 quarks and QCD. We propose simple models for soft VDAs/TMDAs, and use them for comparison of handbag results with experimental (BaBar and BELLE) data on the pion transition form factor. We also discuss how one can generate high-k_\\perp tails from primordial soft distributions.

  9. Scattering from phase-separated vesicles. I. An analytical form factor for multiple static domains

    DOE PAGES

    Heberle, Frederick A.; Anghel, Vinicius N. P.; Katsaras, John

    2015-08-18

    This is the first in a series of studies considering elastic scattering from laterally heterogeneous lipid vesicles containing multiple domains. Unique among biophysical tools, small-angle neutron scattering can in principle give detailed information about the size, shape and spatial arrangement of domains. A general theory for scattering from laterally heterogeneous vesicles is presented, and the analytical form factor for static domains with arbitrary spatial configuration is derived, including a simplification for uniformly sized round domains. The validity of the model, including series truncation effects, is assessed by comparison with simulated data obtained from a Monte Carlo method. Several aspects ofmore » the analytical solution for scattering intensity are discussed in the context of small-angle neutron scattering data, including the effect of varying domain size and number, as well as solvent contrast. Finally, the analysis indicates that effects of domain formation are most pronounced when the vesicle's average scattering length density matches that of the surrounding solvent.« less

  10. Lattice calculation of the pion transition form factor π0→γ*γ*

    NASA Astrophysics Data System (ADS)

    Gérardin, Antoine; Meyer, Harvey B.; Nyffeler, Andreas

    2016-10-01

    We calculate the π0→γ*γ* transition form factor Fπ0γ*γ*(q12,q22) in lattice QCD with two flavors of quarks. Our main motivation is to provide the input to calculate the π0-pole contribution to hadronic light-by-light scattering in the muon (g -2 ), aμHLbL ;π0 . We therefore focus on the region where both photons are spacelike up to virtualities of about 1.5 GeV2, which has so far not been experimentally accessible. Results are obtained in the continuum at the physical pion mass by a combined extrapolation. We reproduce the prediction of the chiral anomaly for real photons with an accuracy of about 8-9%. We also compare to various recently proposed models and find reasonable agreement for the parameters of some of these models with their phenomenological values. Finally, we use the parametrization of our lattice data by these models to calculate aμHLbL ;π0 .

  11. ES1 is a mitochondrial enlarging factor contributing to form mega-mitochondria in zebrafish cones.

    PubMed

    Masuda, Takamasa; Wada, Yasutaka; Kawamura, Satoru

    2016-03-01

    Total mass of mitochondria increases during cell proliferation and differentiation through mitochondrial biogenesis, which includes mitochondrial proliferation and growth. During the mitochondrial growth, individual mitochondria have been considered to be enlarged independently of mitochondrial fusion. However, molecular basis for this enlarging process has been poorly understood. Cone photoreceptor cells in the retina possess large mitochondria, so-called mega-mitochondria that have been considered to arise via the enlarging process. Here we show that ES1 is a novel mitochondria-enlarging factor contributing to form mega-mitochondria in cones. ES1 is specifically expressed in cones and localized to mitochondria including mega-mitochondria. Knockdown of ES1 markedly reduced the mitochondrial size in cones. In contrast, ectopic expression of ES1 in rods significantly increased both the size of individual mitochondria and the total mass of the mitochondrial cluster without changing the number of them. RNA-seq analysis showed that ERRα and its downstream mitochondrial genes were significantly up-regulated in the ES1-expressing rods, suggesting facilitation of mitochondrial enlargement via ERRα-dependent processes. Furthermore, higher energy state was detected in the ES1-expressing rods, indicating that the enlarged mitochondria by ES1 are capable of producing high energy. ES1 is the mitochondrial protein that is first found to promote enlargement of individual mitochondria.

  12. Measurement of the gπNN(t) Form Factor

    SciTech Connect

    Vansyoc, Kelley Gene

    2001-08-01

    Cross sections were measured for the reaction 1H(e, e' π+ )n at the energy W = 1.95 GeV and momentum transfer Q 2 = 0.6 (GeV/c) 2 . At this W and Q 2 , the longitudinal cross section is dominated by t-channel production, giving a unique opportunity to examine the strong coupling form factor g πNN(t). The measured cross sections were separated using a method similar to a Rosenbluth separation. For the extraction of g πNN (t), the Actor and Korner model [42] and a parameterization of the MAID2000 model [3] were employed to fit the longitudinal cross section. Three parameterizations gπNN(π) were used in both models. These fits resulted in a strong coupling constant gπNN(m$2\\atop{2}$) that is consistent with theoretical predictions. However, this coupling constant leads to a cutoff parameter that is less than 1 GeV.

  13. Assessment of Factors Affecting Adolescent Patients’ Compliance with Hawley and Vacuum Formed Retainers

    PubMed Central

    Mirzakouchaki, Behnam; Sharghi, Reza; Shirazi, Samaneh

    2016-01-01

    Introduction Success of orthodontic retention with removable retainers almost entirely depends on patients’ compliance. Aim This study was carried out to investigate the relationship between adolescent orthodontic patients’ compliance and various clinical and social factors. Materials and Methods The data were collected from 77 orthodontic patients aged 7-11 years old who had finished the full fixed appliance therapy. Hawley’s retainers were used in 34 patients and 43 patients used Vacuum Formed Retainers (VFRs). The subjects completed a questionnaire including several identifiers allowing the respondents to be classified into subgroups. They were also asked to indicate how long they wore their retainers during the day, by writing the number of hours in the report-card for the next three months. Comparison of the results was performed by one-way ANOVA and independent sample-t tests. Results No significant differences were found between males and females. Type of the retainer, patients’ grade of study, mothers’ occupation, clinicians’ and parents’ attitudes and filling the report cards had significant effect on mean wear hours per day. When compliance of the patients was assessed according to treatment location, Living place, parents’ educational degrees and ethnicity, no significant differences could be found. Conclusion The adolescent patients’ compliance was greater with VFRs than with Hawley’s retainers. Parental attitude and doctor-patient relationship had a great impact on adolescent patients’ compliance. PMID:27504404

  14. Hadronic form factor models and spectroscopy within the gauge/gravity correspondence

    SciTech Connect

    de Teramond, Guy F.; Brodsky, Stanley J.; /SLAC

    2012-03-20

    We show that the nonperturbative light-front dynamics of relativistic hadronic bound states has a dual semiclassical gravity description on a higher dimensional warped AdS space in the limit of zero quark masses. This mapping of AdS gravity theory to the boundary quantum field theory, quantized at fixed light-front time, allows one to establish a precise relation between holographic wave functions in AdS space and the light-front wavefunctions describing the internal structure of hadrons. The resulting AdS/QCD model gives a remarkably good accounting of the spectrum, elastic and transition form factors of the light-quark hadrons in terms of one parameter, the QCD gap scale. The light-front holographic approach described here thus provides a frame-independent first approximation to the light-front Hamiltonian problem for QCD. This article is based on lectures at the Niccolo Cabeo International School of Hadronic Physics, Ferrara, Italy, May 2011.

  15. Proton Therapy

    MedlinePlus

    ... Liver Breast Esophagus Rectum Skull base sarcomas Pediatric brain tumors Head and neck - see the Head and Neck Cancer page Eye ... Intensity-Modulated Radiation Therapy (IMRT) Brain Tumor Treatment Brain Tumors Prostate Cancer Lung Cancer ... related to Proton Therapy Videos related ...

  16. Proton Radiobiology

    PubMed Central

    Tommasino, Francesco; Durante, Marco

    2015-01-01

    In addition to the physical advantages (Bragg peak), the use of charged particles in cancer therapy can be associated with distinct biological effects compared to X-rays. While heavy ions (densely ionizing radiation) are known to have an energy- and charge-dependent increased Relative Biological Effectiveness (RBE), protons should not be very different from sparsely ionizing photons. A slightly increased biological effectiveness is taken into account in proton treatment planning by assuming a fixed RBE of 1.1 for the whole radiation field. However, data emerging from recent studies suggest that, for several end points of clinical relevance, the biological response is differentially modulated by protons compared to photons. In parallel, research in the field of medical physics highlighted how variations in RBE that are currently neglected might actually result in deposition of significant doses in healthy organs. This seems to be relevant in particular for normal tissues in the entrance region and for organs at risk close behind the tumor. All these aspects will be considered and discussed in this review, highlighting how a re-discussion of the role of a variable RBE in proton therapy might be well-timed. PMID:25686476

  17. A Confirmatory Test of the Factor Structure of the Short Form of the Career Decision Self-Efficacy Scale

    ERIC Educational Resources Information Center

    Miller, Matthew J.; Roy, Kerrin Sendrowitz; Brown, Steven D.; Thomas, James; McDaniel, Cyndi

    2009-01-01

    The present study tested a number of theoretically and empirically derived measurement models of the Career Decision Self-Efficacy Scale-Short Form (CDSES-SF) using confirmatory factor analysis. Betz's five-factor model of the CDSES-SF, along with a number of alternative models, demonstrated adequate model fit in two independent samples. Based on…

  18. Factor Structure of the Torrance Tests of Creative Thinking Verbal Form B in a Spanish-Speaking Population

    ERIC Educational Resources Information Center

    Krumm, Gabriela; Aranguren, María; Arán Filippetti, Vanessa; Lemos, Viviana

    2016-01-01

    The objective of this study was to compare, through a Confirmatory Factor Analysis, two different theoretical models that explain the operationalized creativity construct with the Verbal Torrance Tests of Creative Thinking (TTCT), Form B. Model 1 is represented by six factors which correspond to each activity and its respective indicators while…

  19. Two distinct forms of Factor VIII coagulant protein in human plasma. Cleavage by thrombin, and differences in coagulant activity and association with von Willebrand factor.

    PubMed Central

    Weinstein, M J; Chute, L E

    1984-01-01

    We have characterized Factor VIII coagulant protein, present in normal human plasma, that reacts with a specific human 125I-labeled anti-human VIII:C antigen Fab antibody fragment. Two major Factor VIII coagulant antigen populations were present. The first, approximately 85% of the total antigen, was bound to von Willebrand factor and when tested in a standard one-stage assay had Factor VIII coagulant activity. The second antigenic population, eluting near fibrinogen when plasma was gel filtered, was not bound to von Willebrand protein, did not have Factor VIII coagulant activity unless activated, but did block anti-VIII:C Fab neutralization of clotting activity. The two antigenic populations were separable by cryoprecipitation and agarose gel electrophoresis. Although the two antigenic populations differed in their Factor VIII coagulant activity and in their binding to von Willebrand factor, the principal member of both populations is of mol wt 2.4 X 10(5). Both antigens, when proteolyzed by thrombin, were quickly converted to a 1 X 10(5)-mol wt form in association with the appearance of VIII:C activity. The 1 X 10(5)-mol wt antigen was further slowly degraded to an 8 X 10(4)-mol wt form while Factor VIII coagulant activity declined. These results demonstrate the presence of an inactive Factor VIII coagulant protein in plasma, not associated with von Willebrand factor, that can react with thrombin to yield Factor VIII coagulant activity. Images PMID:6421875

  20. Weak charge of the proton: loop corrections to parity-violating electron scattering

    SciTech Connect

    Wally Melnitchouk

    2011-05-01

    I review the role of two-boson exchange corrections to parity-violating elastic electron–proton scattering. Direct calculations of contributions from nucleon and Delta intermediate states show generally small, [script O](1–2%), effects over the range of kinematics relevant for proton strangeness form factor measurements. For the forward angle Qweak experiment at Jefferson Lab, which aims to measure the weak charge of the proton, corrections from the gammaZ box diagram are computed within a dispersive approach and found to be sizable at the E~1 GeV energy scale of the experiment.

  1. Phenomenology of Semileptonic B-Meson Decays with Form Factors from Lattice QCD

    SciTech Connect

    Du, Daping; El-Khadra, A. X.; Gottlieb, Steven; Kronfeld, A. S.; Laiho, J.; Lunghi, E.; Van de Water, R. S.; Zhou, Ran

    2016-02-03

    We study the exclusive semileptonic B-meson decays B→K(π)ℓ+-, B→K(π)νν¯, and B→πτν, computing observables in the Standard model using the recent lattice-QCD results for the underlying form factors from the Fermilab Lattice and MILC Collaborations. These processes provide theoretically clean windows into physics beyond the Standard Model because the hadronic uncertainties are now under good control. The resulting partially-integrated branching fractions for B→πμ+μ- and B→Kμ+μ- outside the charmonium resonance region are 1-2σ higher than the LHCb Collaboration's recent measurements, where the theoretical and experimental errors are commensurate. The combined tension is 1.7σ. Combining the Standard-Model rates with LHCb's measurements yields values for the Cabibbo-Kobayashi-Maskawa (CKM) matrix elements |Vtd|=7.45(69)×10-3, |Vts|=35.7(1.5)×10-3, and |Vtd/Vts|=0.201(20), which are compatible with the values obtained from neutral B(s)-meson oscillations and have competitive uncertainties. Alternatively, taking the CKM matrix elements from unitarity, we constrain new-physics contributions at the electroweak scale. Furthermore, the constraints on the Wilson coefficients Re(C9) and Re(C10) from B→πμ+μ- and B→Kμ+μ- are competitive with those from B→K*μ+μ-, and display a 2.0σ tension with the Standard Model. Our predictions for B→K(π)νν¯ and B→πτν are close to the current experimental limits.

  2. Phenomenology of Semileptonic B-Meson Decays with Form Factors from Lattice QCD

    DOE PAGES

    Du, Daping; El-Khadra, A. X.; Gottlieb, Steven; ...

    2016-02-03

    We study the exclusive semileptonic B-meson decays B→K(π)ℓ+ℓ-, B→K(π)νν¯, and B→πτν, computing observables in the Standard model using the recent lattice-QCD results for the underlying form factors from the Fermilab Lattice and MILC Collaborations. These processes provide theoretically clean windows into physics beyond the Standard Model because the hadronic uncertainties are now under good control. The resulting partially-integrated branching fractions for B→πμ+μ- and B→Kμ+μ- outside the charmonium resonance region are 1-2σ higher than the LHCb Collaboration's recent measurements, where the theoretical and experimental errors are commensurate. The combined tension is 1.7σ. Combining the Standard-Model rates with LHCb's measurements yields valuesmore » for the Cabibbo-Kobayashi-Maskawa (CKM) matrix elements |Vtd|=7.45(69)×10-3, |Vts|=35.7(1.5)×10-3, and |Vtd/Vts|=0.201(20), which are compatible with the values obtained from neutral B(s)-meson oscillations and have competitive uncertainties. Alternatively, taking the CKM matrix elements from unitarity, we constrain new-physics contributions at the electroweak scale. Furthermore, the constraints on the Wilson coefficients Re(C9) and Re(C10) from B→πμ+μ- and B→Kμ+μ- are competitive with those from B→K*μ+μ-, and display a 2.0σ tension with the Standard Model. Our predictions for B→K(π)νν¯ and B→πτν are close to the current experimental limits.« less

  3. Atomic-scale electronic structure of the cuprate d-symmetry form factor density wave state

    SciTech Connect

    M. H. Hamidian; Kim, Chung Koo; Edkins, S. D.; Davis, J. C.; Mackenzie, A. P.; Eisaki, H.; Uchida, S.; Lawler, M. J.; Kim, E. -A.; Sachdev, S.; Fujita, K.

    2015-10-26

    Research on high-temperature superconducting cuprates is at present focused on identifying the relationship between the classic ‘pseudogap’ phenomenon1, 2 and the more recently investigated density wave state3–13. This state is generally characterized by a wavevector Q parallel to the planar Cu–O–Cu bonds 4–13 along with a predominantly d-symmetry form factor 14–17 (dFF-DW). To identify the microscopic mechanism giving rise to this state 18–30, one must identify the momentum-space states contributing to the dFF-DW spectral weight, determine their particle–hole phase relationship about the Fermi energy, establish whether they exhibit a characteristic energy gap, and understand the evolution of all these phenomena throughout the phase diagram. Here we use energy-resolved sublattice visualization14 of electronic structure and reveal that the characteristic energy of the dFF-DW modulations is actually the ‘pseudogap’ energy Δ1. Moreover, we demonstrate that the dFF-DW modulations at E = –Δ1 (filled states) occur with relative phase π compared to those at E = Δ1 (empty states). Lastly, we show that the conventionally defined dFF-DW Q corresponds to scattering between the ‘hot frontier’ regions of momentum-space beyond which Bogoliubov quasiparticles cease to exist30–32. These data indicate that the cuprate dFF-DW state involves particle–hole interactions focused at the pseudogap energy scale and between the four pairs of ‘hot frontier’ regions in momentum space where the pseudogap opens.

  4. Atomic-scale electronic structure of the cuprate d-symmetry form factor density wave state

    DOE PAGES

    M. H. Hamidian; Kim, Chung Koo; Edkins, S. D.; ...

    2015-10-26

    Research on high-temperature superconducting cuprates is at present focused on identifying the relationship between the classic ‘pseudogap’ phenomenon1, 2 and the more recently investigated density wave state3–13. This state is generally characterized by a wavevector Q parallel to the planar Cu–O–Cu bonds 4–13 along with a predominantly d-symmetry form factor 14–17 (dFF-DW). To identify the microscopic mechanism giving rise to this state 18–30, one must identify the momentum-space states contributing to the dFF-DW spectral weight, determine their particle–hole phase relationship about the Fermi energy, establish whether they exhibit a characteristic energy gap, and understand the evolution of all these phenomenamore » throughout the phase diagram. Here we use energy-resolved sublattice visualization14 of electronic structure and reveal that the characteristic energy of the dFF-DW modulations is actually the ‘pseudogap’ energy Δ1. Moreover, we demonstrate that the dFF-DW modulations at E = –Δ1 (filled states) occur with relative phase π compared to those at E = Δ1 (empty states). Lastly, we show that the conventionally defined dFF-DW Q corresponds to scattering between the ‘hot frontier’ regions of momentum-space beyond which Bogoliubov quasiparticles cease to exist30–32. These data indicate that the cuprate dFF-DW state involves particle–hole interactions focused at the pseudogap energy scale and between the four pairs of ‘hot frontier’ regions in momentum space where the pseudogap opens.« less

  5. Novel enhancement of thin-form-factor galvanic cells: Probing halogenated organic oxidizers and metal anodes

    NASA Astrophysics Data System (ADS)

    Cardenas-Valencia, Andres M.; Adornato, Lori; Short, R. Timothy; Langebrake, Larry

    The work reported herein demonstrates a novel method to improve the overall performance of thin-form-factor galvanic cells, fabricated via micro-electromechanical systems (MEMS) processes. Use of solid, low cost, cyclic-halogenated, organic catholyte materials permits water activation of cells consisting of metal anode and catalytic platinum positive electrodes. Similar cells, employing aluminum and zinc anodes, have been activated using sodium hypochlorite (NaClO) solutions, i.e. bleach, in the past. The oxidizers chosen for this study (bromo-, chloro- and iodo-succinimides, and sodium dichloroisocyanuric acid) supply the cathode's oxy-halogenated ions when in contact with water. Zinc, magnesium and aluminum anodes are utilized to fabricate galvanic cells. A comparison between these anodes, coupled with various oxidizers, is included herein. Results using aluminum anode cells show that, even though the utilization efficiency of the catholyte reagents is low (faradic efficiencies between 16 and 19%), the performance of the new water-activated cells (6 cm × 6 cm × 0.25 cm) is superior when compared to those activated with bleach. For instance, operational lives of 6 h (activation with 10% NaClO solution) increase to more than 30 h using the new approach, with a 100-ohm-load. It is also shown that specific energies of 90-110 Wh kg -1 (calculated to include both reagent and packaging mass) could be obtained using the described approach with current draws between 10 and 20 mA. The specific energies obtained suggest that novel MEMS-type cells could have much broader application than low-current, bleach-activated cells.

  6. Deducing the molecular properties of zwitterionic, protonated, deprotonated, and double-deprotonated forms of L-cysteine from vibrational spectroscopy (IR, Raman, VCD) and quantum chemical calculations.

    PubMed

    Quesada-Moreno, María Mar; Avilés-Moreno, Juan Ramón; Márquez-García, A A; López-González, Juan Jesús

    2014-06-01

    The behavior of L-cysteine (C3H7NO2S, (2R)-2-amino-3-sulfanylpropanoic acid) in water at different pH values was analyzed both experimentally and theoretically. The behavior was studied at pH values of 5.21 (at this pH, L-cysteine is a zwitterionic species), 1.00 (protonated species), 8.84 (monodeprotonated species), and 13.00 (dideprotonated species). We carried out a vibrational study using nonchiroptical (IR-Raman) and chiroptical (VCD) techniques complemented by quantum chemical calculations. We adopted a dual strategy, as follows. (i) The hybrid density functionals B3LYP and M062X and the ab initio MP2 method were employed, with the same 6-311++G (d,p) basis set, in order to characterize the relative energies and structures of an extensive set of conformers of L-cysteine. The presence of water was included by utilizing the IEF-PCM implicit solvation model. (ii) The vibrational analysis was made using a chirality-sensitive using a chirality-sensitive technique (VCD) and chirality-insensitive techniques (IR, including MIR and FIR, and Raman), especially in aqueous solution. The results obtained theoretically and experimentally were compared in order to deduce the most stable structures at each pH. Moreover, for the first time, the monodeprotonated anion of L-cysteine was detected in aqueous solution by means of IR, Raman and vibrational circular dichroism (VCD). Finally, analysis of the low-frequency region using the IR and Raman techniques was shown to be a very important way to understanding the conformational preference of the zwitterionic species.

  7. Long-term outcomes and prognostic factors of skull-base chondrosarcoma patients treated with pencil-beam scanning proton therapy at the Paul Scherrer Institute

    PubMed Central

    Weber, Damien C.; Badiyan, Shahed; Malyapa, Robert; Albertini, Francesca; Bolsi, Alessandra; Lomax, Antony J.; Schneider, Ralf

    2016-01-01

    Background Skull-base chondrosarcoma (ChSa) is a rare disease, and the prognostication of this disease entity is ill defined. Methods We assessed the long-term local control (LC) results, overall survival (OS), and prognostic factors of skull-base ChSa patients treated with pencil beam scanning proton therapy (PBS PT). Seventy-seven (male, 35; 46%) patients with histologically confirmed ChSa were treated at the Paul Scherrer Institute. Median age was 38.9 years (range, 10.2–70.0y). Median delivered dose was 70.0 GyRBE (range, 64.0–76.0 GyRBE). LC, OS, and toxicity-free survival (TFS) rates were calculated using the Kaplan Meier method. Results After a mean follow-up of 69.2 months (range, 4.6–190.8 mo), 6 local (7.8%) failures were observed, 2 of which were late failures. Five (6.5%) patients died. The actuarial 8-year LC and OS were 89.7% and 93.5%, respectively. Tumor volume > 25 cm3 (P = .02), brainstem/optic apparatus compression at the time of PT (P = .04) and age >30 years (P = .08) were associated with lower rates of LC. High-grade (≥3) radiation-induced toxicity was observed in 6 (7.8%) patients. The 8-year high-grade TFS was 90.8%. A higher rate of high-grade toxicity was observed for older patients (P = .073), those with larger tumor volume (P = .069), and those treated with 5 weekly fractions (P = .069). Conclusions This is the largest PT series reporting the outcome of patients with low-grade ChSa of the skull base treated with PBS only. Our data indicate that protons are both safe and effective. Tumor volume, brainstem/optic apparatus compression, and age were prognosticators of local failures. PMID:26323608

  8. MCNP5 for proton radiography.

    SciTech Connect

    Hughes, H. G.; Brown, F. B.; Bull, J. S.; Goorley, J. T.; Little, R. C.; Liu, L. C.; Mashnik, S. G.; Prael, R. E.; Selcow, Elizabeth Carol,; Sierk, A. J.; Sweezy, J. E.; Zumbro, J. D.; Mokhov, N. V.; Striganov, S.; Gudima, K. K.

    2004-01-01

    The developmental version of MCNPS has recently been extended to provide for continuous-energy transport of high-energy protons. This enhancement involves the incorporation of several significant new physics models into the code. Multiple Coulomb scattering is treated with an advanced model that takes account of projectile and nuclear target form factors. In the next version, this model will provide a coupled sampling of both angular deflection and collisional energy loss, including straggling. The proton elastic scattering model is also new, based on recent theoretical work. Charged particle transport in the presence of magnetic fields is accomplished either by using transfer maps from the COSY INFINITY code (in void regions) or by using an algorithm adapted from the MARS code (in void regions or in scattering materials). Work is underway to validate and implement the latest versions of the Cascade-Exciton Model and the Los Alamos Quark-Gluon-String Model, which will process inelastic nuclear interactions and generate secondary particles.

  9. Proton maser

    NASA Astrophysics Data System (ADS)

    Ensley, D. L.

    1988-01-01

    New calculations are reported which confirm the ability of an a priori random, initial-phase proton beam to drive a simple, single-stage microwave cavity maser or transit-time oscillator (TTO) to saturation conversion efficiencies of about 11 percent. The required initial TE(011) mode field can be provided from beam ramp-up bandwidth of excitation to a low level from an external source. A saturation field of 45 tesla and output power of 0.2 TW are calculated using an electron insulation field of 10 tesla and a 3 MeV, 400 Ka/sq cm beam. Results are compared to those for an electron beam of the same energy and geometry, and it is shown that proton beams potentially can provide a three order of magnitude increase in overall microwave power production density over that obtainable from electron beam TTOs.

  10. Low Earth orbit assessment of proton anisotropy using AP8 and AP9 trapped proton models.

    PubMed

    Badavi, Francis F; Walker, Steven A; Santos Koos, Lindsey M

    2015-04-01

    The completion of the International Space Station (ISS) in 2011 has provided the space research community with an ideal evaluation and testing facility for future long duration human activities in space. Ionized and secondary neutral particles radiation measurements inside ISS form the ideal tool for validation of radiation environmental models, nuclear reaction cross sections and transport codes. Studies using thermo-luminescent detectors (TLD), tissue equivalent proportional counter (TPEC), and computer aided design (CAD) models of early ISS configurations confirmed that, as input, computational dosimetry at low Earth orbit (LEO) requires an environmental model with directional (anisotropic) capability to properly describe the exposure of trapped protons within ISS. At LEO, ISS encounters exposure from trapped electrons, protons and geomagnetically attenuated galactic cosmic rays (GCR). For short duration studies at LEO, one can ignore trapped electrons and ever present GCR exposure contributions during quiet times. However, within the trapped proton field, a challenge arises from properly estimating the amount of proton exposure acquired. There exist a number of models to define the intensity of trapped particles. Among the established trapped models are the historic AE8/AP8, dating back to the 1980s and the recently released AE9/AP9/SPM. Since at LEO electrons have minimal exposure contribution to ISS, this work ignores the AE8 and AE9 components of the models and couples a measurement derived anisotropic trapped proton formalism to omnidirectional output from the AP8 and AP9 models, allowing the assessment of the differences between the two proton models. The assessment is done at a target point within the ISS-11A configuration (circa 2003) crew quarter (CQ) of Russian Zvezda service module (SM), during its ascending and descending nodes passes through the south Atlantic anomaly (SAA). The anisotropic formalism incorporates the contributions of proton narrow

  11. Low Earth orbit assessment of proton anisotropy using AP8 and AP9 trapped proton models

    NASA Astrophysics Data System (ADS)

    Badavi, Francis F.; Walker, Steven A.; Santos Koos, Lindsey M.

    2015-04-01

    The completion of the International Space Station (ISS) in 2011 has provided the space research community with an ideal evaluation and testing facility for future long duration human activities in space. Ionized and secondary neutral particles radiation measurements inside ISS form the ideal tool for validation of radiation environmental models, nuclear reaction cross sections and transport codes. Studies using thermo-luminescent detectors (TLD), tissue equivalent proportional counter (TPEC), and computer aided design (CAD) models of early ISS configurations confirmed that, as input, computational dosimetry at low Earth orbit (LEO) requires an environmental model with directional (anisotropic) capability to properly describe the exposure of trapped protons within ISS. At LEO, ISS encounters exposure from trapped electrons, protons and geomagnetically attenuated galactic cosmic rays (GCR). For short duration studies at LEO, one can ignore trapped electrons and ever present GCR exposure contributions during quiet times. However, within the trapped proton field, a challenge arises from properly estimating the amount of proton exposure acquired. There exist a number of models to define the intensity of trapped particles. Among the established trapped models are the historic AE8/AP8, dating back to the 1980s and the recently released AE9/AP9/SPM. Since at LEO electrons have minimal exposure contribution to ISS, this work ignores the AE8 and AE9 components of the models and couples a measurement derived anisotropic trapped proton formalism to omnidirectional output from the AP8 and AP9 models, allowing the assessment of the differences between the two proton models. The assessment is done at a target point within the ISS-11A configuration (circa 2003) crew quarter (CQ) of Russian Zvezda service module (SM), during its ascending and descending nodes passes through the south Atlantic anomaly (SAA). The anisotropic formalism incorporates the contributions of proton narrow

  12. Fractionation factors and activation energies for exchange of the low barrier hydrogen bonding proton in peptidyl trifluoromethyl ketone complexes of chymotrypsin.

    PubMed

    Lin, J; Westler, W M; Cleland, W W; Markley, J L; Frey, P A

    1998-12-08

    NMR investigations have been carried out of complexes between bovine chymotrypsin Aalpha and a series of four peptidyl trifluoromethyl ketones, listed here in order of increasing affinity for chymotrypsin: N-Acetyl-L-Phe-CF3, N-Acetyl-Gly-L-Phe-CF3, N-Acetyl-L-Val-L-Phe-CF3, and N-Acetyl-L-Leu-L-Phe-CF3. The D/H fractionation factors (phi) for the hydrogen in the H-bond between His 57 and Asp 102 (His 57-Hdelta1) in these four complexes at 5 degreesC were in the range phi = 0.32-0.43, expected for a low-barrier hydrogen bond. For this series of complexes, measurements also were made of the chemical shifts of His 57-Hepsilon1 (delta2,2-dimethylsilapentane-5-sulfonic acid 8.97-9. 18), the exchange rate of the His 57-Hdelta1 proton with bulk water protons (284-12.4 s-1), and the activation enthalpies for this hydrogen exchange (14.7-19.4 kcal.mol-1). It was found that the previously noted correlations between the inhibition constants (Ki 170-1.2 microM) and the chemical shifts of His 57-Hdelta1 (delta2, 2-dimethylsilapentane-5-sulfonic acid 18.61-18.95) for this series of peptidyl trifluoromethyl ketones with chymotrypsin [Lin, J., Cassidy, C. S. & Frey, P. A. (1998) Biochemistry 37, 11940-11948] could be extended to include the fractionation factors, hydrogen exchange rates, and hydrogen exchange activation enthalpies. The results support the proposal of low barrier hydrogen bond-facilitated general base catalysis in the addition of Ser 195 to the peptidyl carbonyl group of substrates in the mechanism of chymotrypsin-catalyzed peptide hydrolysis. Trends in the enthalpies for hydrogen exchange and the fractionation factors are consistent with a strong, double-minimum or single-well potential hydrogen bond in the strongest complexes. The lifetimes of His 57-Hdelta1, which is solvent shielded in these complexes, track the strength of the hydrogen bond. Because these lifetimes are orders of magnitude shorter than those of the complexes themselves, the enzyme must have a

  13. Proton pump inhibitor is a risk factor for recurrence of common bile duct stones after endoscopic sphincterotomy – propensity score matching analysis

    PubMed Central

    Fukuba, Nobuhiko; Ishihara, Shunji; Sonoyama, Hiroki; Yamashita, Noritsugu; Aimi, Masahito; Mishima, Yoshiyuki; Mishiro, Tsuyoshi; Tobita, Hiroshi; Shibagaki, Koutarou; Oshima, Naoki; Moriyama, Ichiro; Kawashima, Kousaku; Miyake, Tatsuya; Ishimura, Norihisa; Sato, Shuichi; Kinoshita, Yoshikazu

    2017-01-01

    Background and study aims Recurrence of common bile duct stones (CBDS) in patients treated with endoscopic sphincterotomy (ES) can lead to deterioration in their quality of life. Although the pathology and related factors are unclear, we speculated that proton pump inhibiter (PPI) administration increases the risk of CBDS recurrence by altering the bacterial mixture in the bile duct. Patients and methods The primary endpoint of this retrospective study was recurrence-free period. Several independent variables considered to have a relationship with CBDS recurrence including PPI use were analyzed using a COX proportional hazard model, with potential risk factors then evaluated by propensity score matching analysis. Results A total of 219 patients were analyzed, with CBDS recurrence found in 44. Analysis of variables using a COX proportional hazard model demonstrated that use of PPIs and ursodeoxycholic acid (UDCA), as well as the presence of periampullary diverticula (PD) each had a hazard ratio (HR) value greater than 1 (HR 2.2, P = 0.007; HR 2.0, P = 0.02; HR 1.9, P = 0.07; respectively). Furthermore, propensity score matching analysis revealed that the mean recurrence-free period in the oral PPI cohort was significantly shorter as compared with the non-PPI cohort (1613 vs. 2587 days, P = 0.014). In contrast, neither UDCA administration nor PD presence was found to be a significant factor in that analysis (1557 vs. 1654 days, P = 0.508; 1169 vs. 2011 days, P = 0.121; respectively). Conclusion Our results showed that oral PPI administration is a risk factor for CBDS recurrence in patients who undergo ES. PMID:28382327

  14. High-precision measurement of the proton elastic form factor ratio μpGE/GM at low Q2

    SciTech Connect

    Zhan, X.; Allada, K.; Armstrong, D. S.; Arrington, J.; Bertozzi, W.; Boeglin, W.; Chen, J. -P.; Chirapatpimol, K.; Choi, S.; Chudakov, E.; Cisbani, E.; Decowski, P.; Dutta, C.; Frullani, S.; Fuchey, E.; Garibaldi, F.; Gilad, S.; Gilman, R.; Glister, J.; Hafidi, K.; Hahn, B.; Hansen, J. -O.; Higinbotham, D. W.; Holmstrom, T.; Holt, R. J.; Huang, J.; Huber, G. M.; Itard, F.; de Jager, C. W.; Jiang, X.; Johnson, M.; Katich, J.; de Leo, R.; LeRose, J. J.; Lindgren, R.; Long, E.; Margaziotis, D. J.; May-Tal Beck, S.; Meekins, D.; Michaels, R.; Moffit, B.; Norum, B. E.; Olson, M.; Piasetzky, E.; Pomerantz, I.; Protopopescu, D.; Qian, X.; Qiang, Y.; Rakhman, A.; Ransome, R. D.; Reimer, P. E.; Reinhold, J.; Riordan, S.; Ron, G.; Saha, A.; Sarty, A. J.; Sawatzky, B.; Schulte, E. C.; Shabestari, M.; Shahinyan, A.; Shneor, R.; Širca, S.; Solvignon, P.; Sparveris, N. F.; Strauch, S.; Subedi, R.; Sulkosky, V.; Vilardi, I.; Wang, Y.; Wojtsekhowski, B.; Ye, Z.; Zhang, Y.

    2011-10-06

    Here, we report a new high precision measurement of the proton elastic form factor ratio μpGE/GM for the four-momentum transfer squared Q2 = 0.3-0.7 (GeV/c)2. The measurement was performed at Jefferson Lab (JLab) in Hall A using recoil polarimetry. With the achieved ~1% total uncertainty, the new data clearly show that the deviation of the ratio μpGE/GM from unity observed in previous polarization measurements at high Q2 continues down to the lowest Q2 value of this measurement. The updated global fit that includes the new results yields in this Q2 range an electric (magnetic) form factor ~2% smaller (~1% larger) than the previous global fit. We obtain new extractions of the proton electric and magnetic radii, which are (rE2)1/2 = 0.875 ± 0.010 fm and (rM2)1/2 = 0.867 ± 0.020 fm. Moreover, the charge radius is consistent with other recent extractions based on the electron-proton interaction, including the atomic hydrogen Lamb shift measruements, which suggests a missing correction in the comparison of measurements of the proton charge radius using electron probes and the recent extraction from the muonic hydrogen Lamb shift.

  15. First results for electromagnetic three-nucleon form factors from high-precision two-nucleon interactions

    SciTech Connect

    Sergio Alexandre Pinto; Stadler, Alfred; Gross, Franz L.

    2010-01-01

    The electromagnetic form factors of the three-nucleon bound states were calculated in Complete Impulse Approximation in the framework of the Covariant Spectator Theory for the new high-precision two-nucleon interaction models WJC-1 and WJC-2. The calculations use an approximation for the three-nucleon vertex functions with two nucleons off mass shell. The form factors with WJC-2 are close to the ones obtained with the older model W16 and to nonrelativistic potential calculations with lowest-order relativistic corrections, while the form factors with the most precise two-nucleon model WJC-1 exhibit larger differences. These results can be understood when the effect of the different types of pion-nucleon coupling used in the various models is examined.

  16. Factor Structure of the BASC-2 Behavioral and Emotional Screening System Student Form

    ERIC Educational Resources Information Center

    Dowdy, Erin; Twyford, Jennifer M.; Chin, Jenna K.; DiStefano, Christine A.; Kamphaus, Randy W.; Mays, Kristen L.

    2011-01-01

    The BASC-2 Behavioral and Emotional Screening System (BESS) Student Form (Kamphaus & Reynolds, 2007) is a recently developed youth self-report rating scale designed to identify students at risk for behavioral and emotional problems. The BESS Student Form was derived from the Behavior Assessment System for Children-Second Edition Self-Report of…

  17. Proton therapy - Present and future.

    PubMed

    Mohan, Radhe; Grosshans, David

    2017-01-15

    evaluation of PSPT and IMPT require special considerations compared to the processes used for photon treatment planning. The differences in techniques arise from the unique physical properties of protons but are also necessary because of the greater vulnerability of protons to uncertainties, especially from inter- and intra-fractional variations in anatomy. These factors must be considered in designing as well as evaluating treatment plans. In addition to anatomy variations, other sources of uncertainty in dose delivered to the patient include the approximations and assumptions of models used for computing dose distributions for planning of treatments. Furthermore, the relative biological effectiveness (RBE) of protons is simplistically assumed to have a constant value of 1.1. In reality, the RBE is variable and a complex function of the energy of protons, dose per fraction, tissue and cell type, end point, etc. These uncertainties, approximations and current technological limitations of proton therapy may limit the achievement of its true potential. Ongoing research is aimed at better understanding the consequences of the various uncertainties on proton therapy and reducing the uncertainties through image-guidance, adaptive radiotherapy, further study of biological properties of protons and the development of novel dose computation and optimization methods. However, residual uncertainties will remain in spite of the best efforts. To increase the resilience of dose distributions in the face of uncertainties and improve our confidence in dose distributions seen on treatment plans, robust optimization techniques are being developed and implemented. We assert that, with such research, proton therapy will be a commonly applied radiotherapy modality for most types of solid cancers in the near future.

  18. On determinant representations of scalar products and form factors in the SoV approach: the XXX case

    NASA Astrophysics Data System (ADS)

    Kitanine, N.; Maillet, J. M.; Niccoli, G.; Terras, V.

    2016-03-01

    In the present article we study the form factors of quantum integrable lattice models solvable by the separation of variables (SoVs) method. It was recently shown that these models admit universal determinant representations for the scalar products of the so-called separate states (a class which includes in particular all the eigenstates of the transfer matrix). These results permit to obtain simple expressions for the matrix elements of local operators (form factors). However, these representations have been obtained up to now only for the completely inhomogeneous versions of the lattice models considered. In this article we give a simple algebraic procedure to rewrite the scalar products (and hence the form factors) for the SoV related models as Izergin or Slavnov type determinants. This new form leads to simple expressions for the form factors in the homogeneous and thermodynamic limits. To make the presentation of our method clear, we have chosen to explain it first for the simple case of the XXX Heisenberg chain with anti-periodic boundary conditions. We would nevertheless like to stress that the approach presented in this article applies as well to a wide range of models solved in the SoV framework.

  19. A Global Analysis of the Strange Vector and Axial Form Factors of the Nucleon and their Uncertainties

    SciTech Connect

    Schaub, John

    2010-07-01

    We studied the strange contributions to the elastic vector and axial form factors of the nucleon using all available elastic electroweak scattering data. Specifically, we combine elastic nu-p and nubar-p scattering cross-section data from the Brookhaven E734 experiment with elastic ep and quasi-elastic ed and e-4He scattering parity-violating asymmetry data from the SAMPLE, HAPPEx, PVA4 and G0 experiments. We not only determined these form factors at individual values of momentum-transfer (Q2), as other groups have done recently, but also fit the Q2-dependence of these form factors using simple functional forms. I present an overview of the G0 backward-angle experiment as well as the results of these fits using existing data, along with some expectations of how we can improve our knowledge of these form factors if the MicroBooNE collaboration completes their experiment.

  20. Inelastic electron scattering form factors involving the second excited 2+ levels in the nuclei 48Ti and 50Cr

    NASA Astrophysics Data System (ADS)

    Mukherjee, G.; Sharma, S. K.

    1985-02-01

    A microscopic description of the recent data on the Coulomb form factors for the 0g.s.+-->2+2 transitions in the nuclei 48Ti and 50Cr is attempted in terms of the prolate and oblate intrinsic states resulting from realistic effective interactions operating in the 2p-1f shell. The results for the higher momentum-transfer region show significant improvements compared to the form factor estimates obtained in some recent shell model calculations involving the fn7/2+fn-17/2p3/2 configurations.