Science.gov

Sample records for proton form factor

  1. OLYMPUS and the proton form factor puzzle

    NASA Astrophysics Data System (ADS)

    Ice, Lauren; Alarcon, Ricardo; Olympus Collaboration

    2012-02-01

    Recent measurements of the proton electric to magnetic form factor ratio using polarization techniques reveal a large discrepancy with measurements found using the Rosenbluth separation technique. It has been proposed that this discrepancy is due to a non-negligible multiple photon exchange contribution in the electron-proton elastic scattering cross section. The OLYMPUS experiment will measure the multiple photon exchange contribution by finding the cross section ratio of positron-proton to electron-proton scattering within 1%. The experiment will be carried out at the DESY laboratory in Hamburg Germany using the electron and positron storage ring DORIS and an internal unpolarized hydrogen gas target. The scattered particles will be detected using the Bates Large Acceptance Spectrometer Toroid (BLAST).

  2. The Proton Form Factor Ratio Measurements at Jefferson Lab

    SciTech Connect

    Punjabi, Vina A.; Perdrisat, Charles F.

    2014-03-01

    The ratio of the proton form factors, G{sub Ep}/G{sub Mp}, has been measured from Q{sup 2} of 0.5 GeV{sup 2} to 8.5 GeV{sup 2}, at the Jefferson Laboratory, using the polarization transfer method. This ratio is extracted directly from the measured ratio of the transverse and longitudinal polarization components of the recoiling proton in elastic electron-proton scattering. The discovery that the proton form factor ratio measured in these experiments decreases approximately linearly with four-momentum transfer, Q{sup 2}, for values above ~1 GeV{sup 2}, is one of the most significant results to come out of JLab. These results have had a large impact on progress in hadronic physics; and have required a significant rethinking of nucleon structure. The increasingly common use of the double-polarization technique to measure the nucleon form factors, in the last 15 years, has resulted in a dramatic improvement of the quality of all four nucleon electromagnetic form factors, G{sub Ep}, G{sub Mp}, G{sub En} and G{sub Mn}. There is an approved experiment at JLab, GEP(V), to continue the ratio measurements to 12 GeV{sup 2}. A dedicated experimental setup, the Super Bigbite Spectrometer (SBS), will be built for this purpose. It will be equipped with a focal plane polarimeter to measure the polarization of the recoil protons. The scattered electrons will be detected in an electromagnetic calorimeter. In this presentation, I will review the status of the proton elastic electromagnetic form factors and discuss a number of theoretical approaches to describe nucleon form factors.

  3. Reanalysis of Rosenbluth measurements of the proton form factors

    NASA Astrophysics Data System (ADS)

    Gramolin, Alexander; Nikolenko, Dmitry

    2017-01-01

    We have reanalyzed the elastic electron-proton scattering data from SLAC experiments E140 and NE11. This work was motivated by recent progress in calculating the corresponding radiative corrections and by the apparent discrepancy between the Rosenbluth and polarization transfer measurements of the proton electromagnetic form factors. New, corrected values for the scattering cross sections are presented, as well as a new form factor fit in the Q2 range from 1 to 8 . 83GeV2 . Our reanalysis brings the combined results of the SLAC experiments into better agreement with the polarization transfer data, but a significant discrepancy remains for Q2 > 3GeV2 .

  4. Reanalysis of Rosenbluth measurements of the proton form factors

    NASA Astrophysics Data System (ADS)

    Gramolin, A. V.; Nikolenko, D. M.

    2016-05-01

    We present a reanalysis of the data from Stanford Linear Accelerator Center (SLAC) experiments E140 [R. C. Walker et al., Phys. Rev. D 49, 5671 (1994), 10.1103/PhysRevD.49.5671] and NE11 [L. Andivahis et al., Phys. Rev. D 50, 5491 (1994), 10.1103/PhysRevD.50.5491] on elastic electron-proton scattering. This work is motivated by recent progress in calculating the corresponding radiative corrections and by the apparent discrepancy between the Rosenbluth and polarization transfer measurements of the proton electromagnetic form factors. New, corrected values for the scattering cross sections are presented, as well as a new form factor fit in the Q2 range from 1 to 8.83 GeV2. We also provide a complete set of revised formulas to account for radiative corrections in single-arm measurements of unpolarized elastic electron-proton scattering.

  5. Proton Elastic Form Factor Ratio: the JLab Polarization Experiments

    SciTech Connect

    Charles Perdrisat; Vina Punjabi

    2003-07-30

    The ratio of the electric and magnetic proton form factors, G{sub Ep}/G{sub Mp}, has been obtained in two Hall A experiments, from measurements of the longitudinal and transverse polarization of the recoil proton, P{sub l} and P{sub t}, respectively, in the elastic scattering of polarized electrons, {rvec e}p {yields} e{rvec p}. Together these experiments cover the Q{sup 2}-range 0.5 to 5.6 GeV{sup 2}. A new experiment is currently being prepared, to extend the Q{sup 2}-range to 9 GeV{sup 2} in Hall C.

  6. Precision Rosenbluth measurement of the proton elastic form factors

    SciTech Connect

    I. A. Qattan; J. Arrington; R. E. Segel; X. Zheng; K. Aniol; O. K. Baker; R. Beams; E. J. Brash; J. Calarco; A. Camsonne; J.-P. Chen; M. E. Christy; D. Dutta; R. Ent; S. Frullani; D. Gaskell; O. Gayou; R. Gilman; C. Glashausser; K. Hafidi; J.-O. Hansen; D. W. Higinbotham; W. Hinton; R. J. Holt; G. M. Huber; H. Ibrahim; L. Jisonna; M. K. Jones; C. E. Keppel; E. Kinney; G. J. Kumbartzki; A. Lung; D. J. Margaziotis; K. McCormick; D. Meekins; R. Michaels; P. Monaghan; P. Moussiegt; L. Pentchev; C. Perdrisat; V. Punjabi; R. Ransome; J. Reinhold; B. Reitz; A. Saha; A. Sarty; E. C. Schulte; K. Slifer; P. Solvignon; V. Sulkosky; K. Wijesooriya; B. Zeidman

    2004-10-01

    We report the results of a new Rosenbluth measurement of the proton form factors at Q{sup 2} values of 2.64, 3.20 and 4.10 GeV{sup 2}. Cross sections were determined by detecting the recoiling proton in contrast to previous measurements in which the scattered electron was detected. At each Q{sup 2}, relative cross sections were determined to better than 1%. The measurement focused on the extraction of G{sub E}/G{sub M} which was determined to 4-8% and found to approximate form factor scaling, i.e. {mu}{sub p}G{sub E} {approx} G{sub M}. These results are consistent with and much more precise than previous Rosenbluth extractions. However, they are inconsistent with recent polarization transfer measurements of comparable precision, implying a systematic difference between the two techniques.

  7. Proton Form Factors Measurements in the Time-Like Region

    SciTech Connect

    Anulli, F.; /Frascati

    2007-10-22

    I present an overview of the measurement of the proton form factors in the time-like region. BABAR has recently measured with great accuracy the e{sup +}e{sup -} {yields} p{bar p} reaction from production threshold up to an energy of {approx} 4.5 GeV, finding evidence for a ratio of the electric to magnetic form factor greater than unity, contrary to expectation. In agreement with previous measurements, BABAR confirmed the steep rise of the magnetic form factor close to the p{bar p} mass threshold, suggesting the possible presence of an under-threshold N{bar N} vector state. These and other open questions related to the nucleon form factors both in the time-like and space-like region, wait for more data with different experimental techniques to be possibly solved.

  8. Helicity non-conserving form factor of the proton

    SciTech Connect

    Voutier, E.; Furget, C.; Knox, S.

    1994-04-01

    The study of the hadron structure in the high Q{sup 2} range contributes to the understanding of the mechanisms responsible for the confinement of quarks and gluons. Among the numerous experimental candidates sensitive to these mechanisms, the helicity non-conserving form factor of the proton is a privileged observable since it is controlled by non-perturbative effects. The authors investigate here the feasibility of high Q{sup 2} measurements of this form factor by means of the recoil polarization method in the context of the CEBAF 8 GeV facility. For that purpose, they discuss the development of a high energy proton polarimeter, based on the H({rvec p},pp) elastic scattering, to be placed at the focal plane of a new hadron spectrometer. It is shown that this experimental method significantly improves the knowledge of the helicity non-conserving form factor of the proton up to 10 GeV{sup 2}/c{sup 2}.

  9. Medium modification of the proton form-factor

    SciTech Connect

    Steffen Strauch

    2004-02-01

    I argue that the double ratio of proton-recoil polarization-transfer coefficients, P{prime}{sub x} and P{prime}{sub z}, of the quasielastic {sup 4}He(e,e{prime}p){sup 3}H reaction with respect to the elastic {sup 1}H(e,e{prime}p) reaction is sensitive to possible medium modifications of the proton form factor in {sup 4}He. Recent measurements at both Mainz and Jefferson Lab of this double ratio at four-momentum transfers squared between 0.4 (GeV/c){sup 2} and 2.6 (GeV/c){sup 2} are discussed. I show that the data challenge state-of-the-art conventional meson-nucleon calculations, as these are unable to describe the results. The data hint at the need to include medium modifications of the proton form factor, as predicted by a quark-meson-coupling model, in the calculations. A recently approved follow-up experiment at a Q{sup 2} of 0.8 (GeV/c){sup 2} and 1.3 (GeV/c){sup 2} with unprecedented precision will provide one of the most stringent tests of the applicability of various calculations.

  10. Proton Form Factor Measurements Using Polarization Method: Beyond Born Approximation

    SciTech Connect

    Pentchev, Lubomir

    2008-10-13

    Significant theoretical and experimental efforts have been made over the past 7 years aiming to explain the discrepancy between the proton form factor ratio data obtained at JLab using the polarization method and the previous Rosenbluth measurements. Preliminary results from the first high precision polarization experiment dedicated to study effects beyond Born approximation will be presented. The ratio of the transferred polarization components and, separately, the longitudinal polarization in ep elastic scattering have been measured at a fixed Q{sup 2} of 2.5 GeV{sup 2} over a wide kinematic range. The two quantities impose constraints on the real part of the ep elastic amplitudes.

  11. Precision Measurements of the Proton Elastic Form Factor Ratio

    SciTech Connect

    Douglas Higinbotham

    2010-08-01

    New high precision polarization measurements of the proton elastic form factor ratio in the Q^2 from 0.3 to 0.7 [GeV/c]^2 have been made. These elastic H(e,e'p) measurementswere done in Jefferson Lab's Hall A using 80% longitudinally polarized electrons and recoil polarimetry. For Q^2 greater than 1 [GeV/c]^2, previous polarization data indicated a strong deviation of the form factor ratio from unity which sparked renewed theoretical and experimental interest in how two-photon diagrams have been taken into account. The new high precision data indicate that the deviation from unity, while small, persists even at Q^2 less than 1 [GeV/c]^2.

  12. Proton form factors and two-photon exchange in elastic electron-proton scattering

    SciTech Connect

    Nikolenko, D. M.; Arrington, J.; Barkov, L. M.; Vries, H. de; Gauzshtein, V. V.; Golovin, R. A.; Gramolin, A. V.; Dmitriev, V. F.; Zhilich, V. N.; Zevakov, S. A.; Kaminsky, V. V.; Lazarenko, B. A.; Mishnev, S. I.; Muchnoi, N. Yu.; Neufeld, V. V.; Rachek, I. A.; Sadykov, R. Sh.; Stibunov, V. N.; Toporkov, D. K.; Holt, R. J.; and others

    2015-05-15

    Proton electromagnetic form factors are among the most important sources of information about the internal structure of the proton. Two different methods for measuring these form factors, the method proposed by Rosenbluth and the polarization-transfer method, yield contradictory results. It is assumed that this contradiction can be removed upon taking into account the hard part of the contribution of two-photon exchange to the cross section for elastic electron-proton scattering. This contribution can measured experimentally via a precision comparison of the cross sections for the elastic scattering of positrons and electrons on protons. Such a measurement, performed at the VEPP-3 storage ring in Novosibirsk at the beam energies of 1.6 and 1.0 GeV for positron (electron) scattering angles in the ranges of θ{sub e} = 15°–25° and 55°–75° in the first case and in the range of θ{sub e} = 65°–105° in the second case is described in the present article. Preliminary results of this experiment and their comparison with theoretical predictions are described.

  13. Measurement of the Neutral Weak Form Factors of the Proton

    SciTech Connect

    Deur, Alexandre; Fleck, Andre; Saha, Arunava; Gasparian, Ashot; Frois, Bernard; Wojtsekhowski, Bogdan; Vlahovic, Branislav; Perdrisat, Charles; Cavata, Christian; Jutier, Christophe; De Jager, Cornelis; Neyret, Damien; Dale, Daniel; Armstrong, David; Lhuillier, David; Prout, David; Margaziotis, Demetrius; Kim, Donghee; Burtin, Etienne; Chudakov, Eugene; Hersman, F.; Garibaldi, Franco; Marie, Frederic; Miller, Greg; Rutledge, Gary; Gerstner, George; Petratos, Gerassimos; Quemener, Gilles; Cates, Gordon; Thompson, J.; Martino, Jacques; Gomez, Javier; Jorda, Jean-Paul; Hansen, Jens-Ole; Chen, Jian-Ping; Jardillier, Johann; Calarco, John; LeRose, John; Price, John; Gao, Juncai; McIntyre, Justin; McCormick, Kathy; Fissum, Kevin; Kramer, Kevin; Aniol, Konrad; Kumar, Krishna; Wijesooriya, Krishni; Ewell, Lars; Todor, Luminita; Spradlin, Marcus; Jones, Mark; Leuschner, Mark; Epstein, Martin; Baylac, Maud; Holtrop, Maurik; Finn, Michael; Kuss, Michael; Kim, Min; Falletto, Nicolas; Liyanage, Nilanga; Glamazdin, Oleksandr; Rutt, Paul; Souder, Paul; Ulmer, Paul; Mastromarino, Peter; Djawotho, Pibero; Wilson, Richard; Suleiman, Riad; Holmes, Richard; Madey, Richard; Lourie, Robert; Michaels, Robert; Pomatsalyuk, Roman; Gilman, Ronald; Incerti, Sebastien; Escoffier, Stephanie; Pussieux, Thierry; Humensky, Thomas; Gorbenko, Viktor; Punjabi, Vina; Kahl, William; Meziani, Zein-Eddine

    1999-02-01

    We have measured the parity-violating electroweak asymmetry in the elastic scattering of polarized electrons from the proton. The kinematic point [(Thetalab) = 12.3r and (Q2) = 0.48 (GeV/c)2] is chosen to provide sensitivity, at a level that is of theoretical interest, to the strange electric form factor GsE. The result, A = - 14.5 + or - 2.2 ppm, is consistent with the electroweak standard model and no additional contributions from strange quarks. In particular, the measurement implies GsE + 0.39GsM = 0.023 + or - 0.034(stat) + or - 0.022(syst) + or - 0.026(delta-GnE), where the last uncertainty arises from the estimated uncertainty in the neutron electric form factor.

  14. Low-Q2 measurements of the proton form factor ratio μpGE/GM

    NASA Astrophysics Data System (ADS)

    Ron, G.; Zhan, X.; Glister, J.; Lee, B.; Allada, K.; Armstrong, W.; Arrington, J.; Beck, A.; Benmokhtar, F.; Berman, B. L.; Boeglin, W.; Brash, E.; Camsonne, A.; Calarco, J.; Chen, J. P.; Choi, Seonho; Chudakov, E.; Coman, L.; Craver, B.; Cusanno, F.; Dumas, J.; Dutta, C.; Feuerbach, R.; Freyberger, A.; Frullani, S.; Garibaldi, F.; Gilman, R.; Hansen, O.; Higinbotham, D. W.; Holmstrom, T.; Hyde, C. E.; Ibrahim, H.; Ilieva, Y.; de Jager, C. W.; Jiang, X.; Jones, M.; Kelleher, A.; Khrosinkova, E.; Kuchina, E.; Kumbartzki, G.; Lerose, J. J.; Lindgren, R.; Markowitz, P.; Beck, S. May-Tal; McCullough, E.; Meziane, M.; Meziani, Z.-E.; Michaels, R.; Moffit, B.; Norum, B. E.; Oh, Y.; Olson, M.; Paolone, M.; Paschke, K.; Perdrisat, C. F.; Piasetzky, E.; Potokar, M.; Pomatsalyuk, R.; Pomerantz, I.; Puckett, A. J. R.; Punjabi, V.; Qian, X.; Qiang, Y.; Ransome, R.; Reyhan, M.; Roche, J.; Rousseau, Y.; Saha, A.; Sarty, A. J.; Sawatzky, B.; Schulte, E.; Shabestari, M.; Shahinyan, A.; Shneor, R.; Širca, S.; Slifer, K.; Solvignon, P.; Song, J.; Sparks, R.; Subedi, R.; Strauch, S.; Urciuoli, G. M.; Wang, K.; Wojtsekhowski, B.; Yan, X.; Yao, H.; Zhu, X.

    2011-11-01

    We present an updated extraction of the proton electromagnetic form factor ratio, μpGE/GM, at low Q2. The form factors are sensitive to the spatial distribution of the proton, and precise measurements can be used to constrain models of the proton. An improved selection of the elastic events and reduced background contributions yielded a small systematic reduction in the ratio μpGE/GM compared to the original analysis.

  15. Measurement of the ratio of the proton's electric to magnetic form factors by recoil polarization

    SciTech Connect

    Mark K. Jones; Hall A Collaboration

    1999-03-01

    The longitudinal and transverse polarizations of the outgoing proton were measured for the reaction {sup 1}H(e,e' p) at four-momentum transfer squared of 0.5 to 3.5 GeV{sup 2}. The ratio of the electric to magnetic form factors of the proton is proportional to the ratio of the transverse to longitudinal polarizations.

  16. Recoil polarization measurements of the proton electromagnetic form factor ratio at high momentum transfer

    SciTech Connect

    Andrew Puckett

    2009-12-01

    Electromagnetic form factors are fundamental properties of the nucleon that describe the effect of its internal quark structure on the cross section and spin observables in elastic lepton-nucleon scattering. Double-polarization experiments have become the preferred technique to measure the proton and neutron electric form factors at high momentum transfers. The recently completed GEp-III experiment at the Thomas Jefferson National Accelerator Facility used the recoil polarization method to extend the knowledge of the proton electromagnetic form factor ratio GpE/GpM to Q2 = 8.5 GeV2. In this paper we present the preliminary results of the experiment.

  17. Measurement of the Proton Electromagnetic Form Factors via the Spin Transfer Reaction

    SciTech Connect

    Gilles Quemener; Mark K. Jones; Charles F. Perdrisat; Vina Punjabi

    1999-08-01

    The ratio of the electromagnetic form factors of the proton has been measured at the Jefferson Laboratory at Q{sup 2} values ranging from 0.5 GeV{sup 2} up to 3.5 GeV{sup 2}. The experiment used the recently commissioned Hall A Focal Plane Polarimeter (FPP) to measure the polarization of the recoiling proton in elastic scattering of longitudinally polarized electrons on a liquid hydrogen target.

  18. Proton electromagnetic form factors: present status and future perspectives at PANDA

    NASA Astrophysics Data System (ADS)

    Tomasi-Gustafsson, E.

    2015-05-01

    Data and models on electromagnetic proton form factors are reviewed, highlighting the contribution foreseen by the PANDA collaboration. Electromagnetic hadron form factors contain essential information on the internal structure of hadrons. Precise and surprising data have been obtained at electron accelerators, applying the polarization method in electron-proton elastic scattering. At electron-positron colliders, using initial state radiation, BABAR measured proton time-like form factors in a wide time-like kinematical region and the BESIII collaboration will measure very precisely proton and neutron form factors in the threshold region. In the next future an antiproton beam with momentum up to 15 GeV/c will be available at FAIR (Darmstadt). Measurements of the reaction p̅ + p → e+ + e- by the PANDA collaboration will contribute to the individual determination of electric and magnetic form factors in the time-like region of momentum transfer squared, as well as to their first determination in the unphysical region (below the kinematical threshold), through the reaction p̅ + p → e+ + e- + π0. From the discussion on feasibility studies at PANDA, we focus on the consequences of such measurements in view of an unified description of form factors in the full kinematical region. We present models which have the necessary analytical requirements and apply to the data in the whole kinematical region.

  19. Feasibility studies of time-like proton electromagnetic form factors at overlinePANDA at FAIR

    NASA Astrophysics Data System (ADS)

    Singh, B.; Erni, W.; Krusche, B.; Steinacher, M.; Walford, N.; Liu, B.; Liu, H.; Liu, Z.; Shen, X.; Wang, C.; Zhao, J.; Albrecht, M.; Erlen, T.; Fink, M.; Heinsius, F.; Held, T.; Holtmann, T.; Jasper, S.; Keshk, I.; Koch, H.; Kopf, B.; Kuhlmann, M.; Kümmel, M.; Leiber, S.; Mikirtychyants, M.; Musiol, P.; Mustafa, A.; Pelizäus, M.; Pychy, J.; Richter, M.; Schnier, C.; Schröder, T.; Sowa, C.; Steinke, M.; Triffterer, T.; Wiedner, U.; Ball, M.; Beck, R.; Hammann, C.; Ketzer, B.; Kube, M.; Mahlberg, P.; Rossbach, M.; Schmidt, C.; Schmitz, R.; Thoma, U.; Urban, M.; Walther, D.; Wendel, C.; Wilson, A.; Bianconi, A.; Bragadireanu, M.; Caprini, M.; Pantea, D.; Patel, B.; Czyzycki, W.; Domagala, M.; Filo, G.; Jaworowski, J.; Krawczyk, M.; Lisowski, F.; Lisowski, E.; Michałek, M.; Poznański, P.; Płażek, J.; Korcyl, K.; Kozela, A.; Kulessa, P.; Lebiedowicz, P.; Pysz, K.; Schäfer, W.; Szczurek, A.; Fiutowski, T.; Idzik, M.; Mindur, B.; Przyborowski, D.; Swientek, K.; Biernat, J.; Kamys, B.; Kistryn, S.; Korcyl, G.; Krzemien, W.; Magiera, A.; Moskal, P.; Pyszniak, A.; Rudy, Z.; Salabura, P.; Smyrski, J.; Strzempek, P.; Wronska, A.; Augustin, I.; Böhm, R.; Lehmann, I.; Nicmorus Marinescu, D.; Schmitt, L.; Varentsov, V.; Al-Turany, M.; Belias, A.; Deppe, H.; Dzhygadlo, R.; Ehret, A.; Flemming, H.; Gerhardt, A.; Götzen, K.; Gromliuk, A.; Gruber, L.; Karabowicz, R.; Kliemt, R.; Krebs, M.; Kurilla, U.; Lehmann, D.; Löchner, S.; Lühning, J.; Lynen, U.; Orth, H.; Patsyuk, M.; Peters, K.; Saito, T.; Schepers, G.; Schmidt, C. J.; Schwarz, C.; Schwiening, J.; Täschner, A.; Traxler, M.; Ugur, C.; Voss, B.; Wieczorek, P.; Wilms, A.; Zühlsdorf, M.; Abazov, V.; Alexeev, G.; Arefiev, V. A.; Astakhov, V.; Barabanov, M. Yu.; Batyunya, B. V.; Davydov, Y.; Dodokhov, V. Kh.; Efremov, A.; Fechtchenko, A.; Fedunov, A. G.; Galoyan, A.; Grigoryan, S.; Koshurnikov, E. K.; Lobanov, Y. Yu.; Lobanov, V. I.; Makarov, A. F.; Malinina, L. V.; Malyshev, V.; Olshevskiy, A. G.; Perevalova, E.; Piskun, A. A.; Pocheptsov, T.; Pontecorvo, G.; Rodionov, V.; Rogov, Y.; Salmin, R.; Samartsev, A.; Sapozhnikov, M. G.; Shabratova, G.; Skachkov, N. B.; Skachkova, A. N.; Strokovsky, E. A.; Suleimanov, M.; Teshev, R.; Tokmenin, V.; Uzhinsky, V.; Vodopianov, A.; Zaporozhets, S. A.; Zhuravlev, N. I.; Zorin, A. G.; Branford, D.; Glazier, D.; Watts, D.; Böhm, M.; Britting, A.; Eyrich, W.; Lehmann, A.; Pfaffinger, M.; Uhlig, F.; Dobbs, S.; Seth, K.; Tomaradze, A.; Xiao, T.; Bettoni, D.; Carassiti, V.; Cotta Ramusino, A.; Dalpiaz, P.; Drago, A.; Fioravanti, E.; Garzia, I.; Savrie, M.; Akishina, V.; Kisel, I.; Kozlov, G.; Pugach, M.; Zyzak, M.; Gianotti, P.; Guaraldo, C.; Lucherini, V.; Bersani, A.; Bracco, G.; Macri, M.; Parodi, R. F.; Biguenko, K.; Brinkmann, K.; Di Pietro, V.; Diehl, S.; Dormenev, V.; Drexler, P.; Düren, M.; Etzelmüller, E.; Galuska, M.; Gutz, E.; Hahn, C.; Hayrapetyan, A.; Kesselkaul, M.; Kühn, W.; Kuske, T.; Lange, J. S.; Liang, Y.; Metag, V.; Nanova, M.; Nazarenko, S.; Novotny, R.; Quagli, T.; Reiter, S.; Rieke, J.; Rosenbaum, C.; Schmidt, M.; Schnell, R.; Stenzel, H.; Thöring, U.; Ullrich, M.; Wagner, M. N.; Wasem, T.; Wohlfahrt, B.; Zaunick, H.; Ireland, D.; Rosner, G.; Seitz, B.; Deepak, P. N.; Kulkarni, A.; Apostolou, A.; Babai, M.; Kavatsyuk, M.; Lemmens, P. J.; Lindemulder, M.; Loehner, H.; Messchendorp, J.; Schakel, P.; Smit, H.; Tiemens, M.; van der Weele, J. C.; Veenstra, R.; Vejdani, S.; Dutta, K.; Kalita, K.; Kumar, A.; Roy, A.; Sohlbach, H.; Bai, M.; Bianchi, L.; Büscher, M.; Cao, L.; Cebulla, A.; Dosdall, R.; Gillitzer, A.; Goldenbaum, F.; Grunwald, D.; Herten, A.; Hu, Q.; Kemmerling, G.; Kleines, H.; Lehrach, A.; Nellen, R.; Ohm, H.; Orfanitski, S.; Prasuhn, D.; Prencipe, E.; Pütz, J.; Ritman, J.; Schadmand, S.; Sefzick, T.; Serdyuk, V.; Sterzenbach, G.; Stockmanns, T.; Wintz, P.; Wüstner, P.; Xu, H.; Zambanini, A.; Li, S.; Li, Z.; Sun, Z.; Xu, H.; Rigato, V.; Isaksson, L.; Achenbach, P.; Corell, O.; Denig, A.; Distler, M.; Hoek, M.; Karavdina, A.; Lauth, W.; Liu, Z.; Merkel, H.; Müller, U.; Pochodzalla, J.; Sanchez, S.; Schlimme, S.; Sfienti, C.; Thiel, M.; Ahmadi, H.; Ahmed, S.; Bleser, S.; Capozza, L.; Cardinali, M.; Dbeyssi, A.; Deiseroth, M.; Feldbauer, F.; Fritsch, M.; Fröhlich, B.; Jasinski, P.; Kang, D.; Khaneft, D.; Klasen, R.; Leithoff, H. H.; Lin, D.; Maas, F.; Maldaner, S.; Martínez, M.; Michel, M.; Mora Espí, M. C.; Morales Morales, C.; Motzko, C.; Nerling, F.; Noll, O.; Pflüger, S.; Pitka, A.; Rodríguez Piñeiro, D.; Sanchez-Lorente, A.; Steinen, M.; Valente, R.; Weber, T.; Zambrana, M.; Zimmermann, I.; Fedorov, A.; Korjik, M.; Missevitch, O.; Boukharov, A.; Malyshev, O.; Marishev, I.; Balanutsa, V.; Balanutsa, P.; Chernetsky, V.; Demekhin, A.; Dolgolenko, A.; Fedorets, P.; Gerasimov, A.; Goryachev, V.; Chandratre, V.; Datar, V.; Dutta, D.; Jha, V.; Kumawat, H.; Mohanty, A. K.; Parmar, A.; Roy, B.; Sonika, G.; Fritzsch, C.; Grieser, S.; Hergemöller, A.; Hetz, B.; Hüsken, N.; Khoukaz, A.; Wessels, J. P.; Khosonthongkee, K.; Kobdaj, C.; Limphirat, A.; Srisawad, P.; Yan, Y.; Barnyakov, M.; Barnyakov, A. Yu.; Beloborodov, K.; Blinov, A. E.; Blinov, V. E.; Bobrovnikov, V. S.; Kononov, S.; Kravchenko, E. A.; Kuyanov, I. A.; Martin, K.; Onuchin, A. P.; Serednyakov, S.; Sokolov, A.; Tikhonov, Y.; Atomssa, E.; Kunne, R.; Marchand, D.; Ramstein, B.; van de Wiele, J.; Wang, Y.; Boca, G.; Costanza, S.; Genova, P.; Montagna, P.; Rotondi, A.; Abramov, V.; Belikov, N.; Bukreeva, S.; Davidenko, A.; Derevschikov, A.; Goncharenko, Y.; Grishin, V.; Kachanov, V.; Kormilitsin, V.; Levin, A.; Melnik, Y.; Minaev, N.; Mochalov, V.; Morozov, D.; Nogach, L.; Poslavskiy, S.; Ryazantsev, A.; Ryzhikov, S.; Semenov, P.; Shein, I.; Uzunian, A.; Vasiliev, A.; Yakutin, A.; Tomasi-Gustafsson, E.; Roy, U.; Yabsley, B.; Belostotski, S.; Gavrilov, G.; Izotov, A.; Manaenkov, S.; Miklukho, O.; Veretennikov, D.; Zhdanov, A.; Makonyi, K.; Preston, M.; Tegner, P.; Wölbing, D.; Bäck, T.; Cederwall, B.; Rai, A. K.; Godre, S.; Calvo, D.; Coli, S.; De Remigis, P.; Filippi, A.; Giraudo, G.; Lusso, S.; Mazza, G.; Mignone, M.; Rivetti, A.; Wheadon, R.; Balestra, F.; Iazzi, F.; Introzzi, R.; Lavagno, A.; Olave, J.; Amoroso, A.; Bussa, M. P.; Busso, L.; De Mori, F.; Destefanis, M.; Fava, L.; Ferrero, L.; Greco, M.; Hu, J.; Lavezzi, L.; Maggiora, M.; Maniscalco, G.; Marcello, S.; Sosio, S.; Spataro, S.; Birsa, R.; Bradamante, F.; Bressan, A.; Martin, A.; Calen, H.; Ikegami Andersson, W.; Johansson, T.; Kupsc, A.; Marciniewski, P.; Papenbrock, M.; Pettersson, J.; Schönning, K.; Wolke, M.; Galnander, B.; Diaz, J.; Pothodi Chackara, V.; Chlopik, A.; Kesik, G.; Melnychuk, D.; Slowinski, B.; Trzcinski, A.; Wojciechowski, M.; Wronka, S.; Zwieglinski, B.; Bühler, P.; Marton, J.; Steinschaden, D.; Suzuki, K.; Widmann, E.; Zmeskal, J.

    2016-10-01

    Simulation results for future measurements of electromagnetic proton form factors at overlinePANDA (FAIR) within the PandaRoot software framework are reported. The statistical precision with which the proton form factors can be determined is estimated. The signal channel bar{p}p→ e+e- is studied on the basis of two different but consistent procedures. The suppression of the main background channel, i.e. bar{p}p→ π+π-, is studied. Furthermore, the background versus signal efficiency, statistical and systematical uncertainties on the extracted proton form factors are evaluated using two different procedures. The results are consistent with those of a previous simulation study using an older, simplified framework. However, a slightly better precision is achieved in the PandaRoot study in a large range of momentum transfer, assuming the nominal beam conditions and detector performance.

  20. High Precision Measurement of the Proton Elastic Form Factor Ratio at Low Q2

    SciTech Connect

    Xiaohui Zhan

    2009-12-01

    A high precision measurement of the proton elastic form factor ratio µpGEp/GMp in the range Q2 = 0.3–0.7 GeV2/c2 was performed using recoil polarimetry in Jefferson Lab Hall A. In this low Q2 range, previous data from LEDEX [5] along with many fits and calculations [2, 3, 4] indicate substantial deviations of the ratio from unity. In this new measurement, with 80% polarized electron beam for 24 days, we are able to achieve <1% statistical uncertainty. Preliminary results are a few percent lower than expected from previous world data and fits, indicating a smaller GEp at this region. Beyond the intrinsic interest in nucleon structure, the improved form factor measurements also have implications for DVCS, determinations of the proton Zemach radius and strangeness form factors through parity violation experiments.

  1. Fourth dimension of the nucleon structure: Spacetime analysis of the timelike electromagnetic proton form factors

    NASA Astrophysics Data System (ADS)

    Bianconi, Andrea; Tomasi-Gustafsson, Egle

    2017-01-01

    As is well known, spacelike proton form factors expressed in the Breit frame may be interpreted as the Fourier transform of static space distributions of electric charge and current. In particular, the electric form factor is simply the Fourier transform of the charge distribution F (q ) =∫ei q ⃗.r ⃗ρ (r ) d3r . We do not have an intuitive interpretation of the same level of simplicity for the proton timelike form factor appearing in the reactions e+e-↔p ¯p . However, one may suggest that, in the center-of-mass frame, where qμxμ=q t , a timelike electric form factor is the Fourier transform F (q ) =∫ei q tR (t ) d t of a function R (t ) expressing how the electric properties of the forming (or annihilating) proton-antiproton pair evolve in time. Here we analyze in depth this idea and show that the functions ρ (r ) and R (t ) can be formally written as the time and space integrals of a unique correlation function depending on both time and space coordinates.

  2. Global analysis of proton elastic form factor data with two-photon exchange corrections

    SciTech Connect

    J. Arrington; W. Melnitchouk; J. A. Tjon

    2007-09-01

    We use the world's data on elastic electron-proton scattering and calculations of two-photon exchange effects to extract corrected values of the proton's electric and magnetic form factors over the full Q^2 range of the existing data. Our analysis combines the corrected Rosenbluth cross section and polarization transfer data, and is the first extraction of G_Ep and G_Mp including explicit two-photon exchange corrections and their associated uncertainties. In addition, we examine the angular dependence of the corrected cross sections, and discuss the possible nonlinearities of the cross section as a function of epsilon.

  3. The time-like electromagnetic form factors of proton and charged kaon at high energies

    NASA Astrophysics Data System (ADS)

    Anulli, Fabio

    2016-05-01

    The Initial State Radiation method in the BABAR experiment has been used to measure the time-like electromagnetic form factors at the momentum transfer from 9 to 42 (GeV/c)2 for proton and from 7 to 56 (GeV/c)2 for charged kaon. The obtained data show the tendency to approach the QCD asymptotic prediction for kaons and space-like form factor values for proton. The BABAR data have been used together with data from other experiments, to perform a model-independent determination of the relative phases between the single-photon and the three-gluon amplitudes in ψ → KK ¯ decays. The values of the branching fractions measured in the reaction e+e- → K+ K- are shifted due to interference of resonant and nonresonant amplitudes. We have determined the absolute values of the shifts to be 5% for J/ψ and 15% for ψ(2S) decays.

  4. Towards a Resolution of the Proton Form Factor Problem: New Electron and Positron Scattering Data

    DOE PAGES

    Adikaram, D.; Rimal, D.; Weinstein, L. B.; ...

    2015-02-10

    There is a significant discrepancy between the values of the proton electric form factor, GpE, extracted using unpolarized and polarized electron scattering. Calculations predict that small two-photon exchange (TPE) contributions can significantly affect the extraction of GpE from the unpolarized electron-proton cross sections. We determined the TPE contribution by measuring the ratio of positron-proton to electron-proton elastic scattering cross sections using a simultaneous, tertiary electron-positron beam incident on a liquid hydrogen target and detecting the scattered particles in the Jefferson Lab CLAS detector. This novel technique allowed us to cover a wide range in virtual photon polarization (epsilon) and momentummore » transfer (Q2) simultaneously, as well as to cancel luminosity-related systematic errors. The cross section ratio increases with decreasing ε at Q2=1.45 GeV2. This measurement is consistent with the size of the form factor discrepancy at Q2≈1.75 GeV2 and with hadronic calculations including nucleon and Delta intermediate states, which have been shown to resolve the discrepancy up to 2-3 GeV2.« less

  5. Towards a Resolution of the Proton Form Factor Problem: New Electron and Positron Scattering Data

    SciTech Connect

    Adikaram, D.; Rimal, D.; Weinstein, L. B.; Raue, B.; Khetarpal, P.; Bennett, R.; Arrington, J.; Brooks, W.; Adhikari, K.; Afanasev, A.; Amaryan, M.; Anderson, M.; Anefalos Pereira, S.; Avakian, H.; Ball, J.; Battaglieri, M.; Bedlinskiy, I.; Biselli, A.; Bono, J.; Boiarinov, S.; Briscoe, W.; Burkert, V.; Carman, D.; Careccia, S.; Celentano, A.; Chandavar, S.; Charles, G.; Colaneri, L.; Cole, P.; Contalbrigo, M.; Crede, V.; D'Angelo, A.; Dashyan, N.; De Vita, R.; De Sanctis, E.; Deur, A.; Djalali, C.; Dodge, G.; Dupre, R.; Egiyan, H.; El Alaoui, A.; El Fassi, L.; Elouadrhiri, L.; Eugenio, P.; Fedotov, G.; Fegan, S.; Filippi, A.; Fleming, J.; Fradi, A.; Garillon, B.; Gilfoyle, G.; Giovanetti, K.; Girod, F.; Goetz, J.; Gohn, W.; Golovatch, E.; Gothe, R.; Griffioen, K.; Guegan, B.; Guidal, M.; Guo, L.; Hafidi, K.; Hakobyan, H.; Hanretty, C.; Harrison, N.; Hattawy, M.; Hicks, K.; Holtrop, M.; Hughes, S.; Hyde, C. E.; Ilieva, Y.; Ireland, D.; Ishkhanov, B.; Jenkins, D.; Jiang, H.; Jo, H.; Joo, K.; Joosten, S.; Kalantarians, N.; Keller, D.; Khandaker, M.; Kim, A.; Kim, W.; Klein, A.; Klein, F.; Koirala, S.; Kubarovsky, V.; Kuhn, S.; Livingston, K.; Lu, H.; MacGregor, I.; Markov, N.; Mattione, P.; Mayer, M.; McKinnon, B.; Mestayer, M.; Meyer, C.; Mirazita, M.; Mokeev, V.; Montgomery, R.; Moody, C.; Moutarde, H.; Movsisyan, A.; Camacho, C. Munoz; Nadel-Turonski, P.; Niccolai, S.; Niculescu, G.; Osipenko, M.; Ostrovidov, A.; Park, K.; Pasyuk, E.; Pisano, S.; Pogorelko, O.; Price, J.; Procureur, S.; Prok, Y.; Protopopescu, D.; Puckett, A.; Ripani, M.; Rizzo, A.; Rosner, G.; Rossi, P.; Roy, P.; Sabati, F.; Salgado, C.; Schott, D.; Schumacher, R.; Seder, E.; Sharabian, Y.; Simonyan, A.; Skorodumina, I.; Smith, E.; Smith, G.; Sober, D.; Sokhan, D.; Sparveris, N.; Stepanyan, S.; Stoler, P.; Strauch, S.; Sytnik, V.; Taiuti, M.; Tian, Ye; Trivedi, A.; Ungaro, M.; Voskanyan, H.; Voutier, E.; Walford, N.; Watts, D.; Wei, X.; Wood, M.; Zachariou, N.; Zana, L.; Zhang, J.; Zhao, Z.; Zonta, I.

    2015-02-10

    There is a significant discrepancy between the values of the proton electric form factor, GpE, extracted using unpolarized and polarized electron scattering. Calculations predict that small two-photon exchange (TPE) contributions can significantly affect the extraction of GpE from the unpolarized electron-proton cross sections. We determined the TPE contribution by measuring the ratio of positron-proton to electron-proton elastic scattering cross sections using a simultaneous, tertiary electron-positron beam incident on a liquid hydrogen target and detecting the scattered particles in the Jefferson Lab CLAS detector. This novel technique allowed us to cover a wide range in virtual photon polarization (epsilon) and momentum transfer (Q2) simultaneously, as well as to cancel luminosity-related systematic errors. The cross section ratio increases with decreasing ε at Q2=1.45 GeV2. This measurement is consistent with the size of the form factor discrepancy at Q2≈1.75 GeV2 and with hadronic calculations including nucleon and Delta intermediate states, which have been shown to resolve the discrepancy up to 2-3 GeV2.

  6. Towards a resolution of the proton form factor problem: new electron and positron scattering data.

    PubMed

    Adikaram, D; Rimal, D; Weinstein, L B; Raue, B; Khetarpal, P; Bennett, R P; Arrington, J; Brooks, W K; Adhikari, K P; Afanasev, A V; Amaryan, M J; Anderson, M D; Anefalos Pereira, S; Avakian, H; Ball, J; Battaglieri, M; Bedlinskiy, I; Biselli, A S; Bono, J; Boiarinov, S; Briscoe, W J; Burkert, V D; Carman, D S; Careccia, S; Celentano, A; Chandavar, S; Charles, G; Colaneri, L; Cole, P L; Contalbrigo, M; Crede, V; D'Angelo, A; Dashyan, N; De Vita, R; De Sanctis, E; Deur, A; Djalali, C; Dodge, G E; Dupre, R; Egiyan, H; El Alaoui, A; El Fassi, L; Elouadrhiri, L; Eugenio, P; Fedotov, G; Fegan, S; Filippi, A; Fleming, J A; Fradi, A; Garillon, B; Gilfoyle, G P; Giovanetti, K L; Girod, F X; Goetz, J T; Gohn, W; Golovatch, E; Gothe, R W; Griffioen, K A; Guegan, B; Guidal, M; Guo, L; Hafidi, K; Hakobyan, H; Hanretty, C; Harrison, N; Hattawy, M; Hicks, K; Holtrop, M; Hughes, S M; Hyde, C E; Ilieva, Y; Ireland, D G; Ishkhanov, B S; Jenkins, D; Jiang, H; Jo, H S; Joo, K; Joosten, S; Kalantarians, N; Keller, D; Khandaker, M; Kim, A; Kim, W; Klein, A; Klein, F J; Koirala, S; Kubarovsky, V; Kuhn, S E; Livingston, K; Lu, H Y; MacGregor, I J D; Markov, N; Mattione, P; Mayer, M; McKinnon, B; Mestayer, M D; Meyer, C A; Mirazita, M; Mokeev, V; Montgomery, R A; Moody, C I; Moutarde, H; Movsisyan, A; Camacho, C Munoz; Nadel-Turonski, P; Niccolai, S; Niculescu, G; Osipenko, M; Ostrovidov, A I; Park, K; Pasyuk, E; Peña, C; Pisano, S; Pogorelko, O; Price, J W; Procureur, S; Prok, Y; Protopopescu, D; Puckett, A J R; Ripani, M; Rizzo, A; Rosner, G; Rossi, P; Roy, P; Sabatié, F; Salgado, C; Schott, D; Schumacher, R A; Seder, E; Sharabian, Y G; Simonyan, A; Skorodumina, I; Smith, E S; Smith, G D; Sober, D I; Sokhan, D; Sparveris, N; Stepanyan, S; Stoler, P; Strauch, S; Sytnik, V; Taiuti, M; Tian, Ye; Trivedi, A; Ungaro, M; Voskanyan, H; Voutier, E; Walford, N K; Watts, D P; Wei, X; Wood, M H; Zachariou, N; Zana, L; Zhang, J; Zhao, Z W; Zonta, I

    2015-02-13

    There is a significant discrepancy between the values of the proton electric form factor, G(E)(p), extracted using unpolarized and polarized electron scattering. Calculations predict that small two-photon exchange (TPE) contributions can significantly affect the extraction of G(E)(p) from the unpolarized electron-proton cross sections. We determined the TPE contribution by measuring the ratio of positron-proton to electron-proton elastic scattering cross sections using a simultaneous, tertiary electron-positron beam incident on a liquid hydrogen target and detecting the scattered particles in the Jefferson Lab CLAS detector. This novel technique allowed us to cover a wide range in virtual photon polarization (ϵ) and momentum transfer (Q(2)) simultaneously, as well as to cancel luminosity-related systematic errors. The cross section ratio increases with decreasing ϵ at Q(2)=1.45  GeV(2). This measurement is consistent with the size of the form factor discrepancy at Q(2)≈1.75  GeV(2) and with hadronic calculations including nucleon and Δ intermediate states, which have been shown to resolve the discrepancy up to 2-3  GeV(2).

  7. Towards a Resolution of the Proton Form Factor Problem: New Electron and Positron Scattering Data

    NASA Astrophysics Data System (ADS)

    Adikaram, D.; Rimal, D.; Weinstein, L. B.; Raue, B.; Khetarpal, P.; Bennett, R. P.; Arrington, J.; Brooks, W. K.; Adhikari, K. P.; Afanasev, A. V.; Amaryan, M. J.; Anderson, M. D.; Anefalos Pereira, S.; Avakian, H.; Ball, J.; Battaglieri, M.; Bedlinskiy, I.; Biselli, A. S.; Bono, J.; Boiarinov, S.; Briscoe, W. J.; Burkert, V. D.; Carman, D. S.; Careccia, S.; Celentano, A.; Chandavar, S.; Charles, G.; Colaneri, L.; Cole, P. L.; Contalbrigo, M.; Crede, V.; D'Angelo, A.; Dashyan, N.; De Vita, R.; De Sanctis, E.; Deur, A.; Djalali, C.; Dodge, G. E.; Dupre, R.; Egiyan, H.; El Alaoui, A.; El Fassi, L.; Elouadrhiri, L.; Eugenio, P.; Fedotov, G.; Fegan, S.; Filippi, A.; Fleming, J. A.; Fradi, A.; Garillon, B.; Gilfoyle, G. P.; Giovanetti, K. L.; Girod, F. X.; Goetz, J. T.; Gohn, W.; Golovatch, E.; Gothe, R. W.; Griffioen, K. A.; Guegan, B.; Guidal, M.; Guo, L.; Hafidi, K.; Hakobyan, H.; Hanretty, C.; Harrison, N.; Hattawy, M.; Hicks, K.; Holtrop, M.; Hughes, S. M.; Hyde, C. E.; Ilieva, Y.; Ireland, D. G.; Ishkhanov, B. S.; Jenkins, D.; Jiang, H.; Jo, H. S.; Joo, K.; Joosten, S.; Kalantarians, N.; Keller, D.; Khandaker, M.; Kim, A.; Kim, W.; Klein, A.; Klein, F. J.; Koirala, S.; Kubarovsky, V.; Kuhn, S. E.; Livingston, K.; Lu, H. Y.; MacGregor, I. J. D.; Markov, N.; Mattione, P.; Mayer, M.; McKinnon, B.; Mestayer, M. D.; Meyer, C. A.; Mirazita, M.; Mokeev, V.; Montgomery, R. A.; Moody, C. I.; Moutarde, H.; Movsisyan, A.; Camacho, C. Munoz; Nadel-Turonski, P.; Niccolai, S.; Niculescu, G.; Osipenko, M.; Ostrovidov, A. I.; Park, K.; Pasyuk, E.; Peña, C.; Pisano, S.; Pogorelko, O.; Price, J. W.; Procureur, S.; Prok, Y.; Protopopescu, D.; Puckett, A. J. R.; Ripani, M.; Rizzo, A.; Rosner, G.; Rossi, P.; Roy, P.; Sabatié, F.; Salgado, C.; Schott, D.; Schumacher, R. A.; Seder, E.; Sharabian, Y. G.; Simonyan, A.; Skorodumina, I.; Smith, E. S.; Smith, G. D.; Sober, D. I.; Sokhan, D.; Sparveris, N.; Stepanyan, S.; Stoler, P.; Strauch, S.; Sytnik, V.; Taiuti, M.; Tian, Ye; Trivedi, A.; Ungaro, M.; Voskanyan, H.; Voutier, E.; Walford, N. K.; Watts, D. P.; Wei, X.; Wood, M. H.; Zachariou, N.; Zana, L.; Zhang, J.; Zhao, Z. W.; Zonta, I.; CLAS Collaboration

    2015-02-01

    There is a significant discrepancy between the values of the proton electric form factor, GEp, extracted using unpolarized and polarized electron scattering. Calculations predict that small two-photon exchange (TPE) contributions can significantly affect the extraction of GEp from the unpolarized electron-proton cross sections. We determined the TPE contribution by measuring the ratio of positron-proton to electron-proton elastic scattering cross sections using a simultaneous, tertiary electron-positron beam incident on a liquid hydrogen target and detecting the scattered particles in the Jefferson Lab CLAS detector. This novel technique allowed us to cover a wide range in virtual photon polarization (ɛ ) and momentum transfer (Q2) simultaneously, as well as to cancel luminosity-related systematic errors. The cross section ratio increases with decreasing ɛ at Q2=1.45 GeV2 . This measurement is consistent with the size of the form factor discrepancy at Q2≈1.75 GeV2 and with hadronic calculations including nucleon and Δ intermediate states, which have been shown to resolve the discrepancy up to 2 - 3 GeV2 .

  8. On the ππ continuum in the nucleon form factors and the proton radius puzzle

    NASA Astrophysics Data System (ADS)

    Hoferichter, M.; Kubis, B.; Ruiz de Elvira, J.; Hammer, H.-W.; Meißner, U.-G.

    2016-11-01

    We present an improved determination of the ππ continuum contribution to the isovector spectral functions of the nucleon electromagnetic form factors. Our analysis includes the most up-to-date results for the ππ→bar{N} N partial waves extracted from Roy-Steiner equations, consistent input for the pion vector form factor, and a thorough discussion of isospin-violating effects and uncertainty estimates. As an application, we consider the ππ contribution to the isovector electric and magnetic radii by means of sum rules, which, in combination with the accurately known neutron electric radius, are found to slightly prefer a small proton charge radius.

  9. New Precision Limit on the Strange Vector Form Factors of the Proton

    SciTech Connect

    Ahmed, Z.; Allada, K.; Aniol, K. A.; Armstrong, D. S.; Arrington, J.; Baturin, P.; Bellini, V.; Benesch, J.; Beminiwattha, R.; Benmokhtar, F.; Canan, M.; Camsonne, A.; Cates, G. D.; Chen, J. -P.; Chudakov, E.; Cisbani, E.; Dalton, M. M.; de Jager, C. W.; De Leo, R.; Deconinck, W.; Decowski, P.; Deng, X.; Deur, A.; Dutta, C.; Franklin, G. B.; Friend, M.; Frullani, S.; Garibaldi, F.; Giusa, A.; Glamazdin, A.; Golge, S.; Grimm, K.; Hansen, O.; Higinbotham, D. W.; Holmes, R.; Holmstrom, T.; Huang, J.; Huang, M.; Hyde, C. E.; Jen, C. M.; Jin, G.; Jones, D.; Kang, H.; King, P.; Kowalski, S.; Kumar, K. S.; Lee, J. H.; LeRose, J. J.; Liyanage, N.; Long, E.; McNulty, D.; Margaziotis, D.; Meddi, F.; Meekins, D. G.; Mercado, L.; Meziani, Z. -E.; Michaels, R.; Muñoz-Camacho, C.; Mihovilovic, M.; Muangma, N.; Myers, K. E.; Nanda, S.; Narayan, A.; Nelyubin, V.; Nuruzzaman, None; Oh, Y.; Pan, K.; Parno, D.; Paschke, K. D.; Phillips, S. K.; Qian, X.; Qiang, Y.; Quinn, B.; Rakhman, A.; Reimer, P. E.; Rider, K.; Riordan, S.; Roche, J.; Rubin, J.; Russo, G.; Saenboonruang, K.; Saha, A.; Sawatzky, B.; Silwal, R.; Sirca, S.; Souder, P. A.; Sperduto, M.; Subedi, R.; Suleiman, R.; Sulkosky, V.; Sutera, C. M.; Tobias, W. A.; Urciuoli, G. M.; Waidyawansa, B.; Wang, D.; Wexler, J.; Wilson, R.; Wojtsekhowski, B.; Zhan, X.; Yan, X.; Yao, H.; Ye, L.; Zhao, B.; Zheng, X.

    2012-03-01

    The parity-violating cross-section asymmetry in the elastic scattering of polarized electrons from unpolarized protons has been measured at a four-momentum transfer squared Q2 = 0.624 GeV2 and beam energy Eb = 3.48 GeV to be APV = -23.80 ± 0.78 (stat) ± 0.36 (syst) parts per million. This result is consistent with zero contribution of strange quarks to the combination of electric and magnetic form factors GEs + 0.517 GMs = 0.003 ± 0.010 (stat) ± 0.004 (syst) ± 0.009 (ff), where the third error is due to the limits of precision on the electromagnetic form factors and radiative corrections. With this measurement, the world data on strange contributions to nucleon form factors are seen to be consistent with zero and not more than a few percent of the proton form factors.

  10. New Precision Limit on the Strange Vector Form Factors of the Proton

    DOE PAGES

    Ahmed, Z.; Allada, K.; Aniol, K. A.; ...

    2012-03-01

    The parity-violating cross-section asymmetry in the elastic scattering of polarized electrons from unpolarized protons has been measured at a four-momentum transfer squared Q2 = 0.624 GeV2 and beam energy Eb = 3.48 GeV to be APV = -23.80 ± 0.78 (stat) ± 0.36 (syst) parts per million. This result is consistent with zero contribution of strange quarks to the combination of electric and magnetic form factors GEs + 0.517 GMs = 0.003 ± 0.010 (stat) ± 0.004 (syst) ± 0.009 (ff), where the third error is due to the limits of precision on the electromagnetic form factors and radiative corrections.more » With this measurement, the world data on strange contributions to nucleon form factors are seen to be consistent with zero and not more than a few percent of the proton form factors.« less

  11. The Proton Coulomb Form Factor from Polarized Inclusive e-p Scattering

    SciTech Connect

    Harris, Christopher Matthew

    2001-05-01

    The proton form factors provide information on the fundamental properties of the proton and provide a test for models based on QCD. In 1998 at Jefferson Lab (JLAB) in Newport News, VA, experiment E93026 measured the inclusive e-p scattering cross section from a polarized ammonia (15NH3) target at a four momentum transfer squared of Q2 = 0.5 (GeV/c)2. Longitudinally polarized electrons were scattered from the polarized target and the scattered electron was detected. Data has been analyzed to obtain the asymmetry from elastically scattered electrons from hydrogen in 15NH3. The asymmetry, Ap, has been used to determine the proton elastic form factor GEp. The result is consistent with the dipole model and data from previous experiments. However, due to the choice of kinematics, the uncertainty in the measurement is large.

  12. Feasibility studies on time-like proton electromagnetic form factors at PANDA-FAIR

    NASA Astrophysics Data System (ADS)

    Zimmermann, Iris; Dbeyssi, Alaa; Khaneft, Dmitry

    2016-05-01

    This contribution reports on the latest status of the feasibility studies for the measurement of time-like proton electromagnetic form factors (FF's) at the PANDA experiment [1] at FAIR (Germany). Electromagnetic FF's are fundamental quantities parameterizing the electric and magnetic structure of hadrons. In the time-like region proton FF's can be accessed experimentally through the annihilation processes p ¯p → l+l- (l = e, μ), assuming that the interaction takes place through the exchange of one virtual photon. Due to the low luminosity available at colliders in the past, an individual determination of the time-like electric and magnetic proton FF's was not feasible. The statistical precision, at which the proton FF's will be determined at PANDA, is estimated for both signal processes p ¯p → l+l- (l = e, μ) using the PandaRoot software, which encompasses full detector simulation and event reconstruction. The signal identification and suppression of the main background process (p ¯p → π+π-) is studied. Different methods have been used to generate and analyze the processes of interest. The results from the different analyses show that time-like electromagnetic FF's can be measured at PANDA with unprecedented statistical accuracy.

  13. The proton form factor measurements at Jefferson Lab, past and future

    SciTech Connect

    Punjabi, Vina A.

    2014-01-01

    Use of the double-polarization technique to obtain the elastic nucleon form factors has resulted in a dramatic improvement of the quality of two of the four nucleon electromagnetic form factors, G{sub Ep} and G{sub En}. It has also changed our understanding of the proton structure, having resulted in a distinctly different Q 2-dependence for both G{sub Ep} and G{sub Mp}, contradicting the prevailing wisdom of the 1990’s based on cross section measurements, namely that G{sub Ep} and G{sub Mp} obey a “scaling” relation {mu}G{sub Ep} ~ G{sub Mp}. A related consequence of the faster decrease of G{sub Ep} revealed by the Jefferson Lab (Jlab) polarization results was the disappearance of the early scaling F{sub 2}/F{sub 1} ~ 1/Q{sup 2} predicted by perturbative QCD. In three experiments, Gep(1), Gep(2) and Gep(3), in Halls A and C at Jlab, the ratio of the proton’s electromagnetic elastic form factors, G{sub Ep} /G{sub Mp} , was measured up to four momentum transfer Q{sup 2} of 8.5 GeV{sup 2} with high precision, using the recoil polarization technique. The initial discovery that the proton form factor ratio measured in these three experiments decreases approximately linearly with four-momentum transfer, Q{sup 2}, for values above ~ 1 GeV{sup 2}, was modified by the Gep(3) results, which suggests a slowing down of this decrease. There is an approved experiment, Gep(5), to continue these measurements to 15 GeV{sup 2}. A dedicated experimental setup, the super bigbite spectrometer (SBS), will be built for this purpose. It will be equipped with a new focal plane polarimeter to measure the polarization of the recoil protons. In this presentation, I will review the status of the proton elastic electromagnetic form factors, mention succinctly a number of theoretical approaches to describe results and show some features required for the future Gep(5) experiment.

  14. Phenomenological analysis of near-threshold periodic modulations of the proton timelike form factor

    NASA Astrophysics Data System (ADS)

    Bianconi, A.; Tomasi-Gustafsson, E.

    2016-03-01

    We have recently highlighted the presence of a periodically oscillating 10% modulation in the BABAR Collaboration data on the proton timelike form factors, expressing the deviations from the pointlike behavior of the proton-antiproton electromagnetic current in the reaction e++e-→p ¯+p . Here we deepen our previous data analysis and confirm that in the case of several standard parametrizations it is possible to write the form factor in the form F0+Fosc , where F0 is a parametrization expressing the long-range trend of the form factor (for q2 ranging from the p ¯p threshold to 36 GeV2), and Fosc is a function of the form exp(-B p )cos(C p ) , where p is the relative momentum of the final p ¯p pair. Error bars allow for a clean identification of the main features of this modulation for q2<10 GeV2 . Assuming this oscillatory modulation to be an effect of final-state interactions between the forming proton and the antiproton, we propose a phenomenological model based on a double-layer imaginary optical potential. This potential is flux absorbing when the distance between the proton and antiproton centers of mass is ≳1.7 - 1.8 fm and flux generating when it is ≲1.7 - 1.8 fm. The main features of the oscillations may be reproduced with some freedom in the potential parameters, but the transition between the two layers must be sudden (0-0.2 fm) to get the correct oscillation period. The flux-absorbing part of the p ¯p interaction is well known in the phenomenology of small-energy antiproton interactions and is due to the annihilation of p ¯p pairs into multimeson states. We interpret the flux-creating part of the potential as due to the creation of a 1 /q -ranged state when the virtual photon decays into a set of current quarks and antiquarks. This short-lived compact state may be expressed as a sum of several hadronic states including the ones with large mass Qn≫q , that may exist for a time t ˜1 /(Qn-q ) . The decay of these large-mass states leads to an

  15. Electromagnetic proton form factors in dual large-Nc QCD: An update

    NASA Astrophysics Data System (ADS)

    Bisschoff, B.; Dominguez, C. A.; Hernandez, L. A.

    2017-02-01

    An updated determination is presented of the electric and magnetic form factors of the proton, in the framework of a dual-model realization of quantum chromodynamics (QCD) in the limit of an infinite number of colors. Very good agreement with data is obtained in the space-like region up to q2 ≃‑30GeV2. In particular, the ratio μPGE(q2)/G M(q2) is predicted in very good agreement with recoil polarization measurements from Jefferson Lab, up to q2 ≃‑8.5GeV2.

  16. First measurement of proton's charge form factor at very low Q2 with initial state radiation

    NASA Astrophysics Data System (ADS)

    Mihovilovič, M.; Weber, A. B.; Achenbach, P.; Beranek, T.; Beričič, J.; Bernauer, J. C.; Böhm, R.; Bosnar, D.; Cardinali, M.; Correa, L.; Debenjak, L.; Denig, A.; Distler, M. O.; Esser, A.; Ferretti Bondy, M. I.; Fonvieille, H.; Friedrich, J. M.; Friščić, I.; Griffioen, K.; Hoek, M.; Kegel, S.; Kohl, Y.; Merkel, H.; Middleton, D. G.; Müller, U.; Nungesser, L.; Pochodzalla, J.; Rohrbeck, M.; Sánchez Majos, S.; Schlimme, B. S.; Schoth, M.; Schulz, F.; Sfienti, C.; Širca, S.; Štajner, S.; Thiel, M.; Tyukin, A.; Vanderhaeghen, M.; Weinriefer, M.

    2017-08-01

    We report on a new experimental method based on initial-state radiation (ISR) in e-p scattering, which exploits the radiative tail of the elastic peak to study the properties of electromagnetic processes and to extract the proton charge form factor (GEp) at extremely small Q2. The ISR technique was implemented in an experiment at the three-spectrometer facility of the Mainz Microtron (MAMI). This led to a precise validation of radiative corrections far away from elastic line and provided first measurements of GEp for 0.001 ≤Q2 ≤ 0.004(GeV / c) 2.

  17. Proton Form Factor Puzzle and the CEBAF Large Acceptance Spectrometer (CLAS) two-photon exchange experiment

    NASA Astrophysics Data System (ADS)

    Rimal, Dipak

    The electromagnetic form factors are the most fundamental observables that encode information about the internal structure of the nucleon. The electric (GE) and the magnetic ( GM) form factors contain information about the spatial distribution of the charge and magnetization inside the nucleon. A significant discrepancy exists between the Rosenbluth and the polarization transfer measurements of the electromagnetic form factors of the proton. One possible explanation for the discrepancy is the contributions of two-photon exchange (TPE) effects. Theoretical calculations estimating the magnitude of the TPE effect are highly model dependent, and limited experimental evidence for such effects exists. Experimentally, the TPE effect can be measured by comparing the ratio of positron-proton elastic scattering cross section to that of the electron-proton [R = sigma(e +p)/sigma(e+p)]. The ratio R was measured over a wide range of kinematics, utilizing a 5.6 GeV primary electron beam produced by the Continuous Electron Beam Accelerator Facility (CEBAF) at Jefferson Lab. This dissertation explored dependence of R on kinematic variables such as squared four-momentum transfer (Q2) and the virtual photon polarization parameter (epsilon). A mixed electron-positron beam was produced from the primary electron beam in experimental Hall B. The mixed beam was scattered from a liquid hydrogen (LH2) target. Both the scattered lepton and the recoil proton were detected by the CEBAF Large Acceptance Spectrometer (CLAS). The elastic events were then identified by using elastic scattering kinematics. This work extracted the Q2 dependence of R at high epsilon(epsilon > 0.8) and the $epsilon dependence of R at approx 0.85 GeV2. In these kinematics, our data confirm the validity of the hadronic calculations of the TPE effect by Blunden, Melnitchouk, and Tjon. This hadronic TPE effect, with additional corrections contributed by higher excitations of the intermediate state nucleon, largely

  18. A search of an ɛ dependence of the proton form factor ratio using recoil polarization technique

    NASA Astrophysics Data System (ADS)

    Meziane, Mehdi

    2010-11-01

    Intensive theoretical and experimental efforts have been made over the past decade aiming at explaining the discrepancy between the data for the proton form factor ratio, GEp/GMp, obtained at Jefferson Lab using polarization transfer technique, and the world data obtained by the Rosenbluth method based on cross section measurements. One possible explanation for this difference is a two-photon exchange contribution, where both photons share the momentum transfer about equally. In the Born approximation for a fixed Q^2, the form factors do not depend upon the energy of the incident electron. We will report the results of the Jlab Hall-C GEp-2γ experiment which was designed to measure a possible kinematical variation of the ratio GEp/GMp with statistical uncertainties of ±0.01 at Q^2=2.5 GeV^2, using the recoil polarization technique. Three kinematics were chosen, corresponding to values of the kinematic factor ɛ=0.15, 0.63 and 0.77. We will describe the new detectors built for both GEp-2γ and GEp-III experiments, the electromagnetic calorimeter BigCal which detected the scattered electron, and the focal plane polarimeter (FPP) which measured the polarization of the recoil proton.

  19. Proton Magnetic Form Factor from Existing Elastic e-p Cross Section Data

    NASA Astrophysics Data System (ADS)

    Ou, Longwu; Christy, Eric; Gilad, Shalev; Keppel, Cynthia; Schmookler, Barak; Wojtsekhowski, Bogdan

    2015-04-01

    The proton magnetic form factor GMp, in addition to being an important benchmark for all cross section measurements in hadron physics, provides critical information on proton structure. Extraction of GMp from e-p cross section data is complicated by two-photon exchange (TPE) effects, where available calculations still have large theoretical uncertainties. Studies of TPE contributions to e-p scattering have observed no nonlinear effects in Rosenbluth separations. Recent theoretical investigations show that the TPE correction goes to 0 when ɛ approaches 1, where ɛ is the virtual photon polarization parameter. In this talk, existing e-p elastic cross section data are reanalyzed by extrapolating the reduced cross section for ɛ approaching 1. Existing polarization transfer data, which is supposed to be relatively immune to TPE effects, are used to produce a ratio of electric and magnetic form factors. The extrapolated reduced cross section and polarization transfer ratio are then used to calculate GEp and GMp at different Q2 values.

  20. Strange magnetic form factor of the proton at $Q^2 = 0.23$ GeV$^2$

    SciTech Connect

    Wang, Ping; Leinweber, Derek; Thomas, Anthony; Young, Ross

    2009-06-01

    We determine the $u$ and $d$ quark contributions to the proton magnetic form factor at finite momentum transfer by applying chiral corrections to quenched lattice data. Heavy baryon chiral perturbation theory is applied at next to leading order in the quenched, and full QCD cases for the valence sector using finite range regularization. Under the assumption of charge symmetry these values can be combined with the experimental values of the proton and neutron magnetic form factors to deduce a relatively accurate value for the strange magnetic form factor at $Q^2=0.23$ GeV$^2$, namely $G_M^s=-0.034 \\pm 0.021$ $\\mu_N$.

  1. Antiproton-nucleus electromagnetic annihilation as a way to access the proton timelike form factors

    NASA Astrophysics Data System (ADS)

    Fonvieille, H.; Karmanov, V. A.

    2009-11-01

    Contrary to the reaction bar{{p}} p rightarrow e + e - with a high-momentum incident antiproton on a free target proton at rest, in which the invariant mass M of the e + e - pair is necessarily much larger than the bar{{p}} p mass 2 m , in the reaction bar{{p}} d rightarrow e + e - n the value of M can take values near or below the bar{{p}} p mass. In the antiproton-deuteron electromagnetic annihilation, this allows to access the proton electromagnetic form factors in the timelike region of q2 near the bar{{p}} p threshold. We estimate the cross-section dσ _{bar pd to e^ + e^ - n} /dmathcal{M} for an antiproton beam momentum of 1.5GeV/ c. We find that near the bar{{p}} p threshold this cross-section is about 1pb/MeV. The case of heavy-nuclei target is also discussed. Elements of experimental feasibility are presented for the process bar{{p}} d rightarrow e + e - n in the context of the overline{{P}} ANDA project.

  2. Feasibility studies of time-like proton electromagnetic form factors at $\\overline{\\rm P}$ANDA at FAIR

    SciTech Connect

    Singh, B.; Erni, W.; Krusche, B.; Steinacher, M.; Walford, N.; Liu, B.; Liu, H.; Liu, Z.; Shen, X.; Wang, C.; Zhao, J.; Albrecht, M.; Erlen, T.; Fink, M.; Heinsius, F.; Held, T.; Holtmann, T.; Jasper, S.; Keshk, I.; Koch, H.; Kopf, B.; Kuhlmann, M.; Kümmel, M.; Leiber, S.; Mikirtychyants, M.; Musiol, P.; Mustafa, A.; Pelizäus, M.; Pychy, J.; Richter, M.; Schnier, C.; Schröder, T.; Sowa, C.; Steinke, M.; Triffterer, T.; Wiedner, U.; Ball, M.; Beck, R.; Hammann, C.; Ketzer, B.; Kube, M.; Mahlberg, P.; Rossbach, M.; Schmidt, C.; Schmitz, R.; Thoma, U.; Urban, M.; Walther, D.; Wendel, C.; Wilson, A.; Bianconi, A.; Bragadireanu, M.; Caprini, M.; Pantea, D.; Patel, B.; Czyzycki, W.; Domagala, M.; Filo, G.; Jaworowski, J.; Krawczyk, M.; Lisowski, F.; Lisowski, E.; Michałek, M.; Poznański, P.; Płażek, J.; Korcyl, K.; Kozela, A.; Kulessa, P.; Lebiedowicz, P.; Pysz, K.; Schäfer, W.; Szczurek, A.; Fiutowski, T.; Idzik, M.; Mindur, B.; Przyborowski, D.; Swientek, K.; Biernat, J.; Kamys, B.; Kistryn, S.; Korcyl, G.; Krzemien, W.; Magiera, A.; Moskal, P.; Pyszniak, A.; Rudy, Z.; Salabura, P.; Smyrski, J.; Strzempek, P.; Wronska, A.; Augustin, I.; Böhm, R.; Lehmann, I.; Nicmorus Marinescu, D.; Schmitt, L.; Varentsov, V.; Al-Turany, M.; Belias, A.; Deppe, H.; Dzhygadlo, R.; Ehret, A.; Flemming, H.; Gerhardt, A.; Götzen, K.; Gromliuk, A.; Gruber, L.; Karabowicz, R.; Kliemt, R.; Krebs, M.; Kurilla, U.; Lehmann, D.; Löchner, S.; Lühning, J.; Lynen, U.; Orth, H.; Patsyuk, M.; Peters, K.; Saito, T.; Schepers, G.; Schmidt, C. J.; Schwarz, C.; Schwiening, J.; Täschner, A.; Traxler, M.; Ugur, C.; Voss, B.; Wieczorek, P.; Wilms, A.; Zühlsdorf, M.; Abazov, V.; Alexeev, G.; Arefiev, V. A.; Astakhov, V.; Barabanov, M. Yu.; Batyunya, B. V.; Davydov, Y.; Dodokhov, V. Kh.; Efremov, A.; Fechtchenko, A.; Fedunov, A. G.; Galoyan, A.; Grigoryan, S.; Koshurnikov, E. K.; Lobanov, Y. Yu.; Lobanov, V. I.; Makarov, A. F.; Malinina, L. V.; Malyshev, V.; Olshevskiy, A. G.; Perevalova, E.; Piskun, A. A.; Pocheptsov, T.; Pontecorvo, G.; Rodionov, V.; Rogov, Y.; Salmin, R.; Samartsev, A.; Sapozhnikov, M. G.; Shabratova, G.; Skachkov, N. B.; Skachkova, A. N.; Strokovsky, E. A.; Suleimanov, M.; Teshev, R.; Tokmenin, V.; Uzhinsky, V.; Vodopianov, A.; Zaporozhets, S. A.; Zhuravlev, N. I.; Zorin, A. G.; Branford, D.; Glazier, D.; Watts, D.; Böhm, M.; Britting, A.; Eyrich, W.; Lehmann, A.; Pfaffinger, M.; Uhlig, F.; Dobbs, S.; Seth, K.; Tomaradze, A.; Xiao, T.; Bettoni, D.; Carassiti, V.; Cotta Ramusino, A.; Dalpiaz, P.; Drago, A.; Fioravanti, E.; Garzia, I.; Savrie, M.; Akishina, V.; Kisel, I.; Kozlov, G.; Pugach, M.; Zyzak, M.; Gianotti, P.; Guaraldo, C.; Lucherini, V.; Bersani, A.; Bracco, G.; Macri, M.; Parodi, R. F.; Biguenko, K.; Brinkmann, K.; Di Pietro, V.; Diehl, S.; Dormenev, V.; Drexler, P.; Düren, M.; Etzelmüller, E.; Galuska, M.; Gutz, E.; Hahn, C.; Hayrapetyan, A.; Kesselkaul, M.; Kühn, W.; Kuske, T.; Lange, J. S.; Liang, Y.; Metag, V.; Nanova, M.; Nazarenko, S.; Novotny, R.; Quagli, T.; Reiter, S.; Rieke, J.; Rosenbaum, C.; Schmidt, M.; Schnell, R.; Stenzel, H.; Thöring, U.; Ullrich, M.; Wagner, M. N.; Wasem, T.; Wohlfahrt, B.; Zaunick, H.; Ireland, D.; Rosner, G.; Seitz, B.; Deepak, P. N.; Kulkarni, A.; Apostolou, A.; Babai, M.; Kavatsyuk, M.; Lemmens, P. J.; Lindemulder, M.; Loehner, H.; Messchendorp, J.; Schakel, P.; Smit, H.; Tiemens, M.; van der Weele, J. C.; Veenstra, R.; Vejdani, S.; Dutta, K.; Kalita, K.; Kumar, A.; Roy, A.; Sohlbach, H.; Bai, M.; Bianchi, L.; Büscher, M.; Cao, L.; Cebulla, A.; Dosdall, R.; Gillitzer, A.; Goldenbaum, F.; Grunwald, D.; Herten, A.; Hu, Q.; Kemmerling, G.; Kleines, H.; Lehrach, A.; Nellen, R.; Ohm, H.; Orfanitski, S.; Prasuhn, D.; Prencipe, E.; Pütz, J.; Ritman, J.; Schadmand, S.; Sefzick, T.; Serdyuk, V.; Sterzenbach, G.; Stockmanns, T.; Wintz, P.; Wüstner, P.; Xu, H.; Zambanini, A.; Li, S.; Li, Z.; Sun, Z.; Xu, H.; Rigato, V.; Isaksson, L.; Achenbach, P.; Corell, O.; Denig, A.; Distler, M.; Hoek, M.; Karavdina, A.; Lauth, W.; Liu, Z.; Merkel, H.; Müller, U.; Pochodzalla, J.; Sanchez, S.; Schlimme, S.; Sfienti, C.; Thiel, M.; Ahmadi, H.; Ahmed, S.; Bleser, S.; Capozza, L.; Cardinali, M.; Dbeyssi, A.; Deiseroth, M.; Feldbauer, F.; Fritsch, M.; Fröhlich, B.; Jasinski, P.; Kang, D.; Khaneft, D.; Klasen, R.; Leithoff, H. H.; Lin, D.; Maas, F.; Maldaner, S.; Martínez, M.; Michel, M.; Mora Espí, M. C.; Morales Morales, C.; Motzko, C.; Nerling, F.; Noll, O.; Pflüger, S.; Pitka, A.; Rodríguez Piñeiro, D.; Sanchez-Lorente, A.; Steinen, M.; Valente, R.; Weber, T.; Zambrana, M.; Zimmermann, I.; Fedorov, A.; Korjik, M.; Missevitch, O.; Boukharov, A.; Malyshev, O.; Marishev, I.; Balanutsa, V.; Balanutsa, P.; Chernetsky, V.; Demekhin, A.; Dolgolenko, A.; Fedorets, P.; Gerasimov, A.; Goryachev, V.; Chandratre, V.; Datar, V.; Dutta, D.; Jha, V.; Kumawat, H.; Mohanty, A. K.; Parmar, A.; Roy, B.; Sonika, G.; Fritzsch, C.; Grieser, S.; Hergemöller, A.; Hetz, B.; Hüsken, N.; Khoukaz, A.; Wessels, J. P.; Khosonthongkee, K.; Kobdaj, C.; Limphirat, A.; Srisawad, P.; Yan, Y.; Barnyakov, M.; Barnyakov, A. Yu.; Beloborodov, K.; Blinov, A. E.; Blinov, V. E.; Bobrovnikov, V. S.; Kononov, S.; Kravchenko, E. A.; Kuyanov, I. A.; Martin, K.; Onuchin, A. P.; Serednyakov, S.; Sokolov, A.; Tikhonov, Y.; Atomssa, E.; Kunne, R.; Marchand, D.; Ramstein, B.; van de Wiele, J.; Wang, Y.; Boca, G.; Costanza, S.; Genova, P.; Montagna, P.; Rotondi, A.; Abramov, V.; Belikov, N.; Bukreeva, S.; Davidenko, A.; Derevschikov, A.; Goncharenko, Y.; Grishin, V.; Kachanov, V.; Kormilitsin, V.; Levin, A.; Melnik, Y.; Minaev, N.; Mochalov, V.; Morozov, D.; Nogach, L.; Poslavskiy, S.; Ryazantsev, A.; Ryzhikov, S.; Semenov, P.; Shein, I.; Uzunian, A.; Vasiliev, A.; Yakutin, A.; Tomasi-Gustafsson, E.; Roy, U.; Yabsley, B.; Belostotski, S.; Gavrilov, G.; Izotov, A.; Manaenkov, S.; Miklukho, O.; Veretennikov, D.; Zhdanov, A.; Makonyi, K.; Preston, M.; Tegner, P.; Wölbing, D.; Bäck, T.; Cederwall, B.; Rai, A. K.; Godre, S.; Calvo, D.; Coli, S.; De Remigis, P.; Filippi, A.; Giraudo, G.; Lusso, S.; Mazza, G.; Mignone, M.; Rivetti, A.; Wheadon, R.; Balestra, F.; Iazzi, F.; Introzzi, R.; Lavagno, A.; Olave, J.; Amoroso, A.; Bussa, M. P.; Busso, L.; De Mori, F.; Destefanis, M.; Fava, L.; Ferrero, L.; Greco, M.; Hu, J.; Lavezzi, L.; Maggiora, M.; Maniscalco, G.; Marcello, S.; Sosio, S.; Spataro, S.; Birsa, R.; Bradamante, F.; Bressan, A.; Martin, A.; Calen, H.; Ikegami Andersson, W.; Johansson, T.; Kupsc, A.; Marciniewski, P.; Papenbrock, M.; Pettersson, J.; Schönning, K.; Wolke, M.; Galnander, B.; Diaz, J.; Pothodi Chackara, V.; Chlopik, A.; Kesik, G.; Melnychuk, D.; Slowinski, B.; Trzcinski, A.; Wojciechowski, M.; Wronka, S.; Zwieglinski, B.; Bühler, P.; Marton, J.; Steinschaden, D.; Suzuki, K.; Widmann, E.; Zmeskal, J.

    2016-10-28

    Simulation results for future measurements of electromagnetic proton form factors at $\\overline{\\rm P}$ANDA (FAIR) within the PandaRoot software framework are reported. The statistical precision with which the proton form factors can be determined is estimated. The signal channel p¯p → e+e is studied on the basis of two different but consistent procedures. The suppression of the main background channel, i.e. p¯p → π+π, is studied. Furthermore, the background versus signal efficiency, statistical and systematical uncertainties on the extracted proton form factors are evaluated using two different procedures. The results are consistent with those of a previous simulation study using an older, simplified framework. Furthermore, a slightly better precision is achieved in the PandaRoot study in a large range of momentum transfer, assuming the nominal beam conditions and detector performance.

  3. Feasibility studies of time-like proton electromagnetic form factors at $$\\overline{\\rm P}$$ANDA at FAIR

    DOE PAGES

    Singh, B.; Erni, W.; Krusche, B.; ...

    2016-10-28

    Simulation results for future measurements of electromagnetic proton form factors atmore » $$\\overline{\\rm P}$$ANDA (FAIR) within the PandaRoot software framework are reported. The statistical precision with which the proton form factors can be determined is estimated. The signal channel p¯p → e+e– is studied on the basis of two different but consistent procedures. The suppression of the main background channel, i.e. p¯p → π+π–, is studied. Furthermore, the background versus signal efficiency, statistical and systematical uncertainties on the extracted proton form factors are evaluated using two different procedures. The results are consistent with those of a previous simulation study using an older, simplified framework. Furthermore, a slightly better precision is achieved in the PandaRoot study in a large range of momentum transfer, assuming the nominal beam conditions and detector performance.« less

  4. Recoil Polarization Measurements of the Proton Electromagnetic Form Factor Ratio to Q^2 = 8.5 GeV^2

    SciTech Connect

    Puckett, A J.R.; Jones, M K; Luo, W; Meziane, M; Pentchev, L; Perdrisat, C F; Punjabi, V; Wesselmann, F R; Ahmidouch, A; Albayrak, I; Aniol, K A; Arrington, J; Asaturyan, A; Baghdasaryan, H; Benmokhtar, F; Bertozzi, W; Bimbot, L; Bosted, P; Boeglin, W; Butuceanu, C; Carter, P; Chernenko, S; Christy, E; Commisso, M; Cornejo, J C; Covrig, S; Danagoulian, S; Daniel, A; Davidenko, A; Day, D; Dhamija, S; Dutta, D; Ent, R; Frullani, S; Fenker, H; Frlez, E; Garibaldi, F; Gaskell, D; Gilad, S; Gilman, R; Goncharenko, Y; Hafidi, K; Hamilton, D; Higinbotham, D W; Hinton, W; Horn, T; Hu, B; Huang, J; Huber, G M; Jensen, E; Keppel, C; Khandaker, M; King, P; Kirillov, D; Kohl, M; Kravtsov, V; Kumbartzki, G; Li, Y; Mamyan, V; Margaziotis, D J; Marsh, A; Matulenko, Y; Maxwell, J; Mbianda, G; Meekins, D; Melnik, Y; Miller, J; Mkrtchyan, A; Mkrtchyan, H; Moffit, B; Moreno, O; Mulholland, J; Narayan, A; Nedev, S; Nuruzzaman,; Piasetzky, E; Pierce, W; Piskunov, N M; Prok, Y; Ransome, R D; Razin, D S; Reimer, P; Reinhold, J; Rondon, O; Shabestari, M; Shahinyan, A; Shestermanov, K; Sirca, S; Sitnik, I; Smykov, L; Smith, G; Solovyev, L; Solvingnon, P; Subedi, R; Tomasi-Gustafsson, E; Vasiliev, A; Veilleux, M; Wojtsekhowski, B B; Wood, S; Ye, Z; Zanevsky, Y; Zhang, X; Zhang, Y; Zheng, X; Zhu, L

    2010-06-01

    Among the most fundamental observables of nucleon structure, electromagnetic form factors are a crucial benchmark for modern calculations describing the strong interaction dynamics of the nucleon’s quark constituents; indeed, recent proton data have attracted intense theoretical interest. In this Letter, we report new measurements of the proton electromagnetic form factor ratio using the recoil polarization method, at momentum transfers Q2=5.2, 6.7, and 8.5  GeV2. By extending the range of Q2 for which GEp is accurately determined by more than 50%, these measurements will provide significant constraints on models of nucleon structure in the nonperturbative regime.

  5. High-precision measurement of the proton elastic form factor ratio μpGE/GM at low Q2

    DOE PAGES

    Zhan, X.; Allada, K.; Armstrong, D. S.; ...

    2011-10-06

    Here, we report a new high precision measurement of the proton elastic form factor ratio μpGE/GM for the four-momentum transfer squared Q2 = 0.3-0.7 (GeV/c)2. The measurement was performed at Jefferson Lab (JLab) in Hall A using recoil polarimetry. With the achieved ~1% total uncertainty, the new data clearly show that the deviation of the ratio μpGE/GM from unity observed in previous polarization measurements at high Q2 continues down to the lowest Q2 value of this measurement. The updated global fit that includes the new results yields in this Q2 range an electric (magnetic) form factor ~2% smaller (~1% larger)more » than the previous global fit. We obtain new extractions of the proton electric and magnetic radii, which are (rE2)1/2 = 0.875 ± 0.010 fm and (rM2)1/2 = 0.867 ± 0.020 fm. Moreover, the charge radius is consistent with other recent extractions based on the electron-proton interaction, including the atomic hydrogen Lamb shift measruements, which suggests a missing correction in the comparison of measurements of the proton charge radius using electron probes and the recent extraction from the muonic hydrogen Lamb shift.« less

  6. High Precision Measurement of the Proton Elastic Form Factor Ratio at Low Q2

    SciTech Connect

    Zhan, Xiaohui

    2010-01-01

    Experiment E08-007 measured the proton elastic form factor ratio μpGE/GM in the range of Q2 = 0.3-0.7(GeV/c)2 by recoil polarimetry. Data were taken in 2008 at the Thomas Jefferson National Accelerator Facility in Virginia, USA. A 1.2 GeV polarized electron beam was scattered off a cryogenic hydrogen target. The recoil proton was detected in the left HRS in coincidence with the elasticly scattered electrons tagged by the BigBite spectrometer. The proton polarization was measured by the focal plane polarimeter (FPP). In this low Q2 region, previous measurement from Jefferson Lab Hall A (LEDEX) along with various fits and calculations indicate substantial deviations of the ratio from unity. For this new measurement, the proposed statistical uncertainty (< 1%) was achieved. These new results are a few percent lower than expected from previous world data and fits, which indicate a smaller GEp at this region. Beyond the intrinsic interest in nucleon structure, the new results also have implications in determining the proton Zemach radius and the strangeness form factors from parity violation experiments.

  7. Measurements of the Proton Elastic-Form-Factor Ratio μpGEp/GMp at Low Momentum Transfer

    NASA Astrophysics Data System (ADS)

    Ron, G.; Glister, J.; Lee, B.; Allada, K.; Armstrong, W.; Arrington, J.; Beck, A.; Benmokhtar, F.; Berman, B. L.; Boeglin, W.; Brash, E.; Camsonne, A.; Calarco, J.; Chen, J. P.; Choi, Seonho; Chudakov, E.; Coman, L.; Craver, B.; Cusanno, F.; Dumas, J.; Dutta, C.; Feuerbach, R.; Freyberger, A.; Frullani, S.; Garibaldi, F.; Gilman, R.; Hansen, O.; Higinbotham, D. W.; Holmstrom, T.; Hyde, C. E.; Ibrahim, H.; Ilieva, Y.; de Jager, C. W.; Jiang, X.; Jones, M. K.; Kang, H.; Kelleher, A.; Khrosinkova, E.; Kuchina, E.; Kumbartzki, G.; Lerose, J. J.; Lindgren, R.; Markowitz, P.; May-Tal Beck, S.; McCullough, E.; Meekins, D.; Meziane, M.; Meziani, Z.-E.; Michaels, R.; Moffit, B.; Norum, B. E.; Oh, Y.; Olson, M.; Paolone, M.; Paschke, K.; Perdrisat, C. F.; Piasetzky, E.; Potokar, M.; Pomatsalyuk, R.; Pomerantz, I.; Puckett, A.; Punjabi, V.; Qian, X.; Qiang, Y.; Ransome, R.; Reyhan, M.; Roche, J.; Rousseau, Y.; Saha, A.; Sarty, A. J.; Sawatzky, B.; Schulte, E.; Shabestari, M.; Shahinyan, A.; Shneor, R.; Širca, S.; Slifer, K.; Solvignon, P.; Song, J.; Sparks, R.; Subedi, R.; Strauch, S.; Urciuoli, G. M.; Wang, K.; Wojtsekhowski, B.; Yan, X.; Yao, H.; Zhan, X.; Zhu, X.

    2007-11-01

    High-precision measurements of the proton elastic form-factor ratio, μpGEp/GMp, have been made at four-momentum transfer, Q2, values between 0.2 and 0.5GeV2. The new data, while consistent with previous results, clearly show a ratio less than unity and significant differences from the central values of several recent phenomenological fits. By combining the new form-factor ratio data with an existing cross-section measurement, one finds that in this Q2 range the deviation from unity is primarily due to GEp being smaller than expected.

  8. The Proton Elastic Form Factor Ratio mu(p) G**p(E)/G**p(M) at Low Momentum Transfer

    SciTech Connect

    G. Ron; J. Glister; B. Lee; K. Allada; W. Armstrong; J. Arrington; A. Beck; F. Benmokhtar; B.L. Berman; W. Boeglin; E. Brash; A. Camsonne; J. Calarco; J. P. Chen; Seonho Choi; E. Chudakov; L. Coman; B. Craver; F. Cusanno; J. Dumas; C. Dutta; R. Feuerbach; A. Freyberger; S. Frullani; F. Garibaldi; R. Gilman; O. Hansen; D. W. Higinbotham; T. Holmstrom; C.E. Hyde; H. Ibrahim; Y. Ilieva; C. W. de Jager; X. Jiang; M. K. Jones; A. Kelleher; E. Khrosinkova; E. Kuchina; G. Kumbartzki; J. J. LeRose; R. Lindgren; P. Markowitz; S. May-Tal Beck; E. McCullough; D. Meekins; M. Meziane; Z.-E. Meziani; R. Michaels; B. Moffit; B.E. Norum; Y. Oh; M. Olson; M. Paolone; K. Paschke; C. F. Perdrisat; E. Piasetzky; M. Potokar; R. Pomatsalyuk; I. Pomerantz; A. Puckett; V. Punjabi; X. Qian; Y. Qiang; R. Ransome; M. Reyhan; J. Roche; Y. Rousseau; A. Saha; A.J. Sarty; B. Sawatzky; E. Schulte; M. Shabestari; A. Shahinyan; R. Shneor; S. ˇ Sirca; K. Slifer; P. Solvignon; J. Song; R. Sparks; R. Subedi; S. Strauch; G. M. Urciuoli; K. Wang; B. Wojtsekhowski; X. Yan; H. Yao; X. Zhan; X. Zhu

    2007-11-01

    High precision measurements of the proton elastic form factor ratio have been made at four-momentum transfers, Q^2, between 0.2 and 0.5 GeV^2. The new data, while consistent with previous results, clearly show a ratio less than unity and significant differences from the central values of several recent phenomenological fits. By combining the new form-factor ratio data with an existing cross-section measurement, one finds that in this Q^2 range the deviation from unity is primarily due to GEp being smaller than the dipole parameterization.

  9. Proton Form Factor Puzzle and the CEBAF Large Acceptance Spectrometer (CLAS) Two-Photon Exchange Experiment

    SciTech Connect

    Rimal, Dipak

    2014-05-01

    The electromagnetic form factors are the most fundamental observables that encode information about the internal structure of the nucleon. This dissertation explored dependence of R on kinematic variables such as squared four-momentum transfer (Q2) and the virtual photon polarization parameter (ε).

  10. New Measurement of Parity Violation in Elastic Electron-Proton Scattering and Implications for Strange Form Factors

    SciTech Connect

    Konrad Aniol; David Armstrong; Todd Averett; Maud Baylac; Etienne Burtin; John Calarco; Gordon Cates; Christian Cavata; Zhengwei Chai; C. Chang; Jian-Ping Chen; Eugene Chudakov; Evaristo Cisbani; Marius Coman; Daniel Dale; Alexandre Deur; Pibero Djawotho; Martin Epstein; Stephanie Escoffier; Lars Ewell; Nicolas Falletto; John Finn; A. Fleck; Bernard Frois; Salvatore Frullani; Juncai Gao; Franco Garibaldi; Ashot Gasparian; G. M. Gerstner; Ronald Gilman; Oleksandr Glamazdin; Javier Gomez; Viktor Gorbenko; Jens-ole Hansen; F. Hersman; Douglas Higinbotham; Richard Holmes; Maurik Holtrop; Thomas Humensky; Sebastien Incerti; Mauro Iodice; Cornelis De Jager; Johann Jardillier; Xiaodong Jiang; Mark Jones; J. Jorda; Christophe Jutier; W. Kahl; James Kelly; Donghee Kim; M. -J. Kim; Minsuk Kim; Ioannis Kominis; Edgar Kooijman; Kevin Kramer; Krishna Kumar; Michael Kuss; John LeRose; Raffaele De Leo; M. Leuschner; David Lhuillier; Meihua Liang; Nilanga Liyanage; R. Lourie; Richard Madey; Sergey Malov; Demetrius Margaziotis; Frederic Marie; Pete Markowitz; Jacques Martino; Peter Mastromarino; Kathy McCormick; Justin McIntyre; Zein-Eddine Meziani; Robert Michaels; Brian Milbrath; Gerald Miller; Joseph Mitchell; Ludyvine Morand; Damien Neyret; Gerassimos Petratos; Roman Pomatsalyuk; John Price; David Prout; Thierry Pussieux; Gilles Quemener; Ronald Ransome; David Relyea; Yves Roblin; Julie Roche; Gary Rutledge; Paul Rutt; Marat Rvachev; Franck Sabatie; Arunava Saha; Paul Souder; Marcus Spradlin; Steffen Strauch; Riad Suleiman; Jeffrey Templon; T. Teresawa; James Thompson; Raphael Tieulent; Luminita Todor; Baris Tonguc; Paul Ulmer; Guido Urciuoli; Branislav Vlahovic; Krishni Wijesooriya; R. Wilson; Bogdan Wojtsekhowski; Rhett Woo; Wang Xu; Imran Younus; C. Zhang

    2001-06-01

    We have measured the parity-violating electroweak asymmetry in the elastic scattering of polarized electrons from the proton. The result is A = -15.05 +- 0.98(stat) {+-} 0.56(syst) ppm at the kinematic point theta{sub lab} = 12.3 degrees and Q{sup 2} = 0.477 (GeV/c){sup 2}. The measurement implies that the value for the strange form factor (G{sub E}{sup s} + 0.392 G{sub M}{sup s})/(G{sub M}{sup p} {mu}{sub p}) = 0.069 +- 0.056 +- 0.039, where the first error is experimental and the second arises from the uncertainties in electromagnetic form factors. This measurement is the first fixed-target parity violation experiment that used either a ''strained'' GaAs photocathode to produce highly polarized electrons or a Compton polarimeter to continuously monitor the electron beam polarization.

  11. Proton electromagnetic form factor ratio at high momentum transfer via recoil polarization in Hall C at Jefferson Lab

    NASA Astrophysics Data System (ADS)

    Puckett, Andrew

    2008-10-01

    Experiment E04-108 in Hall C at Jefferson Lab measured the ratio of the proton's electric (GE) and magnetic (GM) form factors using the recoil polarization technique at three different values of squared four-momentum transfer Q^2--5.2, 6.8, and 8.5 GeV^2. Data taking was completed in June 2008, and analysis of the data is underway. Two new detectors were built by the collaboration to carry out this experiment. A large solid-angle electromagnetic calorimeter was used to detect elastically scattered electrons in coincidence with scattered protons detected by the Hall C High Momentum Spectrometer (HMS). The calorimeter allowed a clean rejection of the significant inelastic backgrounds present at such high Q^2. A new Focal Plane Polarimeter (FPP) was installed in the HMS detector hut to measure the polarization of the scattered proton. After a brief overview of the experiment, the present status of the analysis will be discussed.

  12. Parity-Violating Electron Deuteron Scattering and the Proton's Neutral Weak Axial Vector Form Factor

    SciTech Connect

    Ito, Takeyasu; Averett, Todd; Barkhuff, David; Batigne, Guillaume; Beck, Douglas; Beise, Elizabeth; Blake, A.; Breuer, Herbert; Carr, Robert; Clasie, Benjamin; Covrig, Silviu; Danagoulian, Areg; Dodson, George; Dow, Karen; Dutta, Dipangkar; Farkhondeh, Manouchehr; Filippone, Bradley; FRANKLIN, W.; Furget, Christophe; Gao, Haiyan; Gao, Juncai; Gustafsson, Kenneth; Hannelius, Lars; Hasty, R.; Allen, Alice; Herda, M.C.; Jones, CE; King, Paul; Korsch, Wolfgang; Kowalski, Stanley; Kox, Serge; Kramer, Kevin; Lee, P.; Liu, Jinghua; Martin, Jeffery; McKeown, Robert; Mueller, B.; Pitt, Mark; Plaster, Bradley; Quemener, Gilles; Real, Jean-Sebastien; Ritter, J.; Roche, Julie; Savu, V.; Schiavilla, Rocco; Seely, Charles; Spayde, Damon; Suleiman, Riad; Taylor, S.; Tieulent, Raphael; Tipton, Bryan; Tsentalovich, E.; Wells, Steven; Yang, Bin; Yuan, Jing; Yun, Junho; Zwart, Townsend

    2004-03-01

    We report on a new measurement of the parity-violating asymmetry in quasielastic electron scattering from the deuteron at backward angles at Q2 = 0.038 (GeV/c)2. This quantity provides a determination of the neutral weak axial vector form factor of the nucleon, which can potentially receive large electroweak corrections. The measured asymmetry A = z3.51±0.57 (stat)±0.58 (syst) ppm is consistent with theoretical predictions. We also report on updated results of the previous experiment at Q2 = 0.091 (GeV/c)2, which are also consistent with theoretical predictions.

  13. Feasibility studies of the time-like proton electromagnetic form factor measurements with overline{{P}}ANDA at FAIR

    NASA Astrophysics Data System (ADS)

    Sudoł, M.; Mora Espí, M. C.; Becheva, E.; Boucher, J.; Hennino, T.; Kunne, R.; Marchand, D.; Ong, S.; Ramstein, B.; van de Wiele, J.; Zerguerras, T.; Maas, F.; Kopf, B.; Pelizaeus, M.; Steinke, M.; Zhong, J.; Tomasi-Gustafsson, E.

    2010-06-01

    The possibility of measuring the proton electromagnetic form factors in the time-like region at FAIR with the overline{{P}}ANDA detector is discussed. Detailed simulations on signal efficiency for the annihilation of bar{{p}} + p into a lepton pair as well as for the most important background channels have been performed. It is shown that precise measurements of the differential cross-section of the reaction bar{{p}} + p rightarrow e - + e + can be obtained in a wide kinematical range. The determination of the ratio R of the moduli of the electric and magnetic proton form factors will be possible up to a value of momentum transfer squared of q 2 ≃ 14 (GeV/ c)^2 with absolute precision from 0.01 to 0.5 (for R ˜ 1 . The total bar{{p}} + p rightarrow e - + e + cross-section will be measured up to q 2 ≃ 28 (GeV/ c)^2. The results obtained from simulated events are compared to the existing data. Sensitivity to the two-photon exchange mechanism is also investigated.

  14. Meson exchange effects in elastic ep scattering at loop level and the electromagnetic form factors of the proton

    NASA Astrophysics Data System (ADS)

    Chen, Hong-Yu; Zhou, Hai-Qing

    2014-10-01

    A new form of two-photon exchange (TPE) effect is studied to explain the discrepancy between unpolarized and polarized experimental data in elastic ep scattering. The mechanism is based on a simple idea that apart from the usual TPE effects from box and crossed-box diagrams, the mesons may also be exchanged in elastic ep scattering by two-photon coupling at loop level. The detailed study shows such contributions to reduced unpolarized cross section (σun) and polarized observables (Pt,Pl) at fixed Q2 are only dependent on proton's electromagnetic form factors GE ,M and a new unknown universal parameter g. After combining this contribution with the usual TPE contributions from box and crossed-box diagrams, the ratio μpGE/GM extracted from the recent precise unpolarized and polarized experimental data can be described consistently.

  15. Recoil polarization measurements of the proton form factor ratio GE^p/GM^p to high Q^2 in Hall C at Jefferson Lab

    NASA Astrophysics Data System (ADS)

    Puckett, Andrew

    2009-05-01

    Experiment E04-108 in Hall C at Jefferson Lab measured the ratio of the proton's electric (GE) and magnetic (GM) form factors using the recoil polarization technique at three different values of squared four-momentum transfer Q^2--5.2, 6.8, and 8.5 GeV^2. Data taking was completed in June 2008. Two new detectors were built by the collaboration to carry out this experiment. A large solid-angle electromagnetic calorimeter was used to detect elastically scattered electrons in coincidence with scattered protons detected by the Hall C High Momentum Spectrometer (HMS). The calorimeter allowed a clean rejection of the significant inelastic backgrounds present at such high Q^2. A new Focal Plane Polarimeter (FPP) was installed in the HMS detector hut to measure the polarization of the scattered proton. Following a discussion of the data analysis method, preliminary results will be reported.

  16. Recoil Polarization Measurements of the Proton Electromagnetic Form Factor Ratio to Q{sup 2}=8.5 GeV{sup 2}

    SciTech Connect

    Puckett, A. J. R.; Bertozzi, W.; Gilad, S.; Huang, J.; Moffit, B.; Zhu, L.; Brash, E. J.; Jones, M. K.; Bosted, P.; Covrig, S.; Ent, R.; Fenker, H.; Gaskell, D.; Higinbotham, D. W.; Horn, T.; Meekins, D.; Smith, G.; Wojtsekhowski, B. B.; Wood, S.; Luo, W.

    2010-06-18

    Among the most fundamental observables of nucleon structure, electromagnetic form factors are a crucial benchmark for modern calculations describing the strong interaction dynamics of the nucleon's quark constituents; indeed, recent proton data have attracted intense theoretical interest. In this Letter, we report new measurements of the proton electromagnetic form factor ratio using the recoil polarization method, at momentum transfers Q{sup 2}=5.2, 6.7, and 8.5 GeV{sup 2}. By extending the range of Q{sup 2} for which G{sub E}{sup p} is accurately determined by more than 50%, these measurements will provide significant constraints on models of nucleon structure in the nonperturbative regime.

  17. Measurements of the proton elastic-form-factor ratio mu pG p E/G p M at low momentum transfer.

    PubMed

    Ron, G; Glister, J; Lee, B; Allada, K; Armstrong, W; Arrington, J; Beck, A; Benmokhtar, F; Berman, B L; Boeglin, W; Brash, E; Camsonne, A; Calarco, J; Chen, J P; Choi, Seonho; Chudakov, E; Coman, L; Craver, B; Cusanno, F; Dumas, J; Dutta, C; Feuerbach, R; Freyberger, A; Frullani, S; Garibaldi, F; Gilman, R; Hansen, O; Higinbotham, D W; Holmstrom, T; Hyde, C E; Ibrahim, H; Ilieva, Y; de Jager, C W; Jiang, X; Jones, M K; Kang, H; Kelleher, A; Khrosinkova, E; Kuchina, E; Kumbartzki, G; LeRose, J J; Lindgren, R; Markowitz, P; May-Tal Beck, S; McCullough, E; Meekins, D; Meziane, M; Meziani, Z-E; Michaels, R; Moffit, B; Norum, B E; Oh, Y; Olson, M; Paolone, M; Paschke, K; Perdrisat, C F; Piasetzky, E; Potokar, M; Pomatsalyuk, R; Pomerantz, I; Puckett, A; Punjabi, V; Qian, X; Qiang, Y; Ransome, R; Reyhan, M; Roche, J; Rousseau, Y; Saha, A; Sarty, A J; Sawatzky, B; Schulte, E; Shabestari, M; Shahinyan, A; Shneor, R; Sirca, S; Slifer, K; Solvignon, P; Song, J; Sparks, R; Subedi, R; Strauch, S; Urciuoli, G M; Wang, K; Wojtsekhowski, B; Yan, X; Yao, H; Zhan, X; Zhu, X

    2007-11-16

    High-precision measurements of the proton elastic form-factor ratio, mu pG p E/G p M, have been made at four-momentum transfer, Q2, values between 0.2 and 0.5 GeV2. The new data, while consistent with previous results, clearly show a ratio less than unity and significant differences from the central values of several recent phenomenological fits. By combining the new form-factor ratio data with an existing cross-section measurement, one finds that in this Q2 range the deviation from unity is primarily due to G p E being smaller than expected.

  18. Strange nucleon form-factors

    NASA Astrophysics Data System (ADS)

    Maas, F. E.; Paschke, K. D.

    2017-07-01

    A broad program measuring parity-violation in electron-nuclear scattering has now provided a large set of precision data on the weak-neutral-current form-factors of the proton. Under comparison with well-measured electromagnetic nucleon form-factors, these measurements reveal the role of the strange quark sea on the low-energy interactions of the proton through the strange-quark-flavor vector form-factors. This review will describe the experimental program and the implications of the global data for the strange-quark vector form-factors. We present here a new fit to the world data.

  19. Precision Measurement of the proton neutral weak form factors at Q2 ~ 0.1 GeV2

    SciTech Connect

    Kaufman, Lisa J.

    2007-02-01

    This thesis reports the HAPPEX measurement of the parity-violating asymmetry for longitudinally polarized electrons elastically scattered from protons in a liquid hydrogen target. The measurement was carried out in Hall A at Thomas Jefferson National Accelerator Facility using a beam energy E = 3 GeV and scattering angle <θ{sub lab}> = 6°. The asymmetry is sensitive to the weak neutral form factors from which we extract the strange quark electric and magnetic form factors (G$s\\atop{E}$ and G$s\\atop{M}$) of the proton. The measurement was conducted during two data-taking periods in 2004 and 2005. This thesis describes the methods for controlling the helicity-correlated beam asymmetries and the analysis of the raw asymmetry. The parity-violating asymmetry has been measured to be APV = -1.14± 0.24 (stat)±0.06 (syst) ppm at 2> = 0.099 GeV2 (2004), and APV = -1.58±0.12 (stat)±0.04 (syst) ppm at 2> = 0.109 GeV2 (2005). The strange quark form factors extracted from the asymmetry are G$s\\atop{E}$ + 0.080G$s\\atop{M}$ = 0.030 ± 0.025 (stat) ± 0.006 (syst) ± 0.012 (FF) (2004) and G$s\\atop{E}$ +0.088G$s\\atop{M}$ = 0.007±0.011 (stat)±0.004 (syst)±0.005 (FF) (2005). These results place the most precise constraints on the strange quark form factors and indicate little strange dynamics in the proton.

  20. Nucleon Electromagnetic Form Factors

    SciTech Connect

    Marc Vanderhaeghen; Charles Perdrisat; Vina Punjabi

    2007-10-01

    There has been much activity in the measurement of the elastic electromagnetic proton and neutron form factors in the last decade, and the quality of the data has greatly improved by performing double polarization experiments, in comparison with previous unpolarized data. Here we review the experimental data base in view of the new results for the proton, and neutron, obtained at JLab, MAMI, and MIT-Bates. The rapid evolution of phenomenological models triggered by these high-precision experiments will be discussed, including the recent progress in the determination of the valence quark generalized parton distributions of the nucleon, as well as the steady rate of improvements made in the lattice QCD calculations.

  1. Nucleon Electromagnetic Form Factors

    SciTech Connect

    Kees de Jager

    2004-08-01

    Although nucleons account for nearly all the visible mass in the universe, they have a complicated structure that is still incompletely understood. The first indication that nucleons have an internal structure, was the measurement of the proton magnetic moment by Frisch and Stern (1933) which revealed a large deviation from the value expected for a point-like Dirac particle. The investigation of the spatial structure of the nucleon, resulting in the first quantitative measurement of the proton charge radius, was initiated by the HEPL (Stanford) experiments in the 1950s, for which Hofstadter was awarded the 1961 Nobel prize. The first indication of a non-zero neutron charge distribution was obtained by scattering thermal neutrons off atomic electrons. The recent revival of its experimental study through the operational implementation of novel instrumentation has instigated a strong theoretical interest. Nucleon electro-magnetic form factors (EMFFs) are optimally studied through the exchange of a virtual photon, in elastic electron-nucleon scattering. The momentum transferred to the nucleon by the virtual photon can be selected to probe different scales of the nucleon, from integral properties such as the charge radius to scaling properties of its internal constituents. Polarization instrumentation, polarized beams and targets, and the measurement of the polarization of the recoiling nucleon have been essential in the accurate separation of the charge and magnetic form factors and in studies of the elusive neutron charge form factor.

  2. Proton elastic form factor ratios to Q{sup 2} = 3.5 GeV{sup 2} by polarization transfer

    SciTech Connect

    V. Punjabi; C.F. Perdrisat; et al

    2005-01-01

    The ratio of the proton elastic electromagnetic form factors, G{sub E{sub p}}/G{sub M{sub p}}, was obtained by measuring P{sub t} and P{sub {ell}}, the transverse and longitudinal recoil proton polarization components, respectively, for the elastic {rvec e}p {yields} e{rvec p} reaction in the four-momentum transfer squared range of 0.5 to 3.5 GeV{sup 2}. In the single-photon exchange approximation, the ratio G{sub E{sub p}}/G{sub M{sub p}} is directly proportional to the ratio P{sub t}/P{sub {ell}}. The simultaneous measurement of P{sub t} and P{sub {ell}} in a polarimeter reduces systematic uncertainties. The results for the ratio G{sub E{sub p}}/G{sub M{sub p}} show a systematic decrease with increasing Q{sup 2}, indicating for the first time a definite difference in the distribution of charge and magnetization in the proton. The data have been re-analyzed and systematic uncertainties have become significantly smaller than previously published results.

  3. Proton elastic form factor ratios to Q{sup 2}=3.5 GeV{sup 2} by polarization transfer

    SciTech Connect

    Punjabi, V.; Perdrisat, C.F.; Gerstner, G.; Pentchev, L.; Rutledge, G.; Strauch, S.; Wijesooriya, K.; Aniol, K.A.; Epstein, M.B.; Margaziotis, D.J.; Baker, F.T.; Templon, J.A.; Berthot, J.; Bertin, P.Y.; Besson, A.; Fonvieille, H.; Jaminion, S.; Laveissiere, G.

    2005-05-01

    The ratio of the proton elastic electromagnetic form factors, G{sub Ep}/G{sub Mp}, was obtained by measuring P{sub t} and P{sub l}, the transverse and longitudinal recoil proton polarization components, respectively, for the elastic e{sup {yields}}p{yields}ep{sup {yields}}reaction in the four-momentum transfer squared range of 0.5 to 3.5 GeV{sup 2}. In the single-photon exchange approximation, G{sub Ep}/G{sub Mp} is directly proportional to P{sub t}/P{sub l}. The simultaneous measurement of P{sub t} and P{sub l} in a polarimeter reduces systematic uncertainties. The results for G{sub Ep}/G{sub Mp} show a systematic decrease with increasing Q{sup 2}, indicating for the first time a definite difference in the distribution of charge and magnetization in the proton. The data have been reanalyzed and their systematic uncertainties have become significantly smaller than those reported previously.

  4. Proton form factor ratio, μpGEP/GMP from double spin asymmetry

    SciTech Connect

    Habarakada Liyanage, Anusha Pushpakumari

    2013-08-01

    The form factors are fundamental properties of the nucleon representing the effect of its structure on its response to electromagnetic probes such as electrons. They are functions of the four-momentum transfer squared Q2 between the electron and the proton. This thesis reports the results of a new measurement of the ratio of the electric and magnetic form factors of the proton up to Q2 = 5.66 (GeV/c)2 using the double spin asymmetry with a polarized beam and target. Experiment E07-003 (SANE, Spin Asymmetries of the Nucleon Experiment) was carried out in Hall C at Jefferson Lab in 2009 to study the proton spin structure functions with a dynamically polarized ammonia target and longitudinally polarized electron beam. By detecting elastically scattered protons in the High-Momentum Spectrometer (HMS) in coincidence with the electrons in the Big Electron Telescope Array (BETA), elastic measurements were carried out in parallel. The elastic double spin asymmetry allows one to extract the proton electric to magnetic form factor ratio GpE/GpM at high-momentum transfer, Q2= 5.66 (GeV/c)2. In addition to the coincidence data, inclusively scattered electrons from the polarized ammonia target were detected by HMS, which allows to measure the beam-target asymmetry in the elastic region with the target spin nearly perpendicular to the momentum transfer, and to extract GpE/GpM at low Q2= 2.06 (GeV/c)2. This alternative measurement of GpE/GpM has verified and confirmed the dramatic discrepancy at high Q2 between the Rosenbluth and the recoil-polarization-transfer iv method with a different measurement technique and systematic uncertainties uncorrelated to those of the recoil-polarization measurements. The measurement of the form factor ratio at Q2 = 2

  5. Final analysis of proton form factor ratio data at Q2 = 4.0, 4.8, and 5.6 GeV2

    DOE PAGES

    Puckett, A. J. R.; Brash, E. J.; Gayou, O.; ...

    2012-04-11

    Recently published measurements of the proton electromagnetic form factor ratio R = μp GEp/GMp at momentum transfers Q2 up to 8.5 GeV2 in Jefferson Lab Hall C deviate from the linear trend of previous measurements in Jefferson Lab Hall A, favoring a slower rate of decrease of R with Q2. While statistically compatible in the region of overlap with Hall A, the Hall C data hint at a systematic difference between the two experiments. This possibility was investigated in a reanalysis of the Hall A data. We find that the original analysis underestimated the background in the selection of elasticmore » events. The application of an additional cut to further suppress the background increases the results for R, improving the consistency between Halls A and C.« less

  6. A Precise Measurement of the Proton Elastic Form Factors for 1.75 <= Q**2 <= 8.83 (GeV/c)**2

    SciTech Connect

    Clogher, L.

    2004-06-02

    The proton elastic electric and magnetic form factors, G{sub E{sub p}}(Q{sup 2}) and G{sub M{sub p}}(Q{sup 2}), have been separated out to Q{sup 2} of 8.83 (GeV/c){sup 2}, more than doubling the Q{sup 2} range of previous data. The results for G{sub M{sub p}}(Q{sup 2})/{micro}{sub p}G{sub D}(Q{sup 2}) decrease smoothly from 1.05 to 0.92, while G{sub E{sub p}}(Q{sup 2})/G{sub D}(Q{sup 2}) is consistent with unity. Comparisons are made to QCD Sum Rule, diquark, constituent quark, and VMD models, none of which agree with all of the new data. The ratio Q{sup 2}F{sub 2}/F{sub 1} approaches a constant value for Q{sup 2} > 3 (GeV/c){sup 2}.

  7. The Form Factors of the Nucleons

    SciTech Connect

    Perdrisat, Charles F.

    2013-11-01

    There has been much activity in the measurement of the elastic electromagnetic proton and neutron form factors in the last decade, and the quality of the data has been greatly improved by performing double-polarization experiments, in comparison with with pre-vious unpolarized cross section data. Here we will review the experimental data base in view of the new results for the proton and the neutron, obtained at MIT-Bates, JLab and MAMI. The rapid evolution of phenomenological models triggered by these high- precision experiments will be discussed. In particular, the possibility that the proton is non-spherical in its ground state, and that the transverse charge density are model in- dependently defined in the infinite momentum frame. Likewise, flavor decomposition of the nucleon form factors into dressed u and d quark form factors, may give information about the quark-diquark structure of the nucleon. The current proton radius "crisis" will also be discussed.

  8. The form factors of the nucleons

    NASA Astrophysics Data System (ADS)

    Perdrisat, C. F.

    2013-11-01

    There has been much activity in the measurement of the elastic electromagnetic proton and neutron form factors in the last decade, and the quality of the data has been greatly improved by performing double-polarization experiments, in comparison with with previous unpolarized cross section data. Here we will review the experimental data base in view of the new results for the proton and the neutron, obtained at MIT-Bates, JLab and MAMI. The rapid evolution of phenomenological models triggered by these high-precision experiments will be discussed. In particular, the possibility that the proton is non-spherical in its ground state, and that the transverse charge density are model independently defined in the infinite momentum frame. Likewise, flavor decomposition of the nucleon form factors into dressed u and d quark form factors, may give information about the quark-diquark structure of the nucleon. The current proton radius "crisis" will also be discussed.

  9. Measurement of the proton form factors ratio GE/GM to Q2 = 5.6 GeV2 by recoil polarimetry

    SciTech Connect

    Gayou, Olivier

    2002-01-01

    In this thesis, we present the results of the experiment E99-007, which measured the ratio of the electric to magnetic form factors of the proton to the four momentum transfer square Q2 = 5.6 GeV2, by recoil polarimetry. Data were taken in 2000 at the Thomas Jefferson National Accelerator Facility in Virginia, USA. A 4.6 GeV polarized electron beam was scattered off a cryogenic hydrogen target. The polarization of the recoil proton was measured in the Focal Plane Polarimeter, located after one of the two High Resolution Spectrometers in the hall. The ratio of the transverse to longitudinal components of the recoil proton polarization is proportional to the ratio of the form factors. Elastic events were selected by detecting the scattered electron in a large acceptance lead-glass calorimeter. The main result of this experiment is the linear decrease of the form factor ratio with increasing Q2, corresponding to different spatial distributions of the electric charge and the magnetization. Numerous theoretical calculations show that relativistic effects, such as mixing of spin states due to Lorentz boosts, are important to account for the observed data in this critical intermediate kinematic region.

  10. Electromagnetic nucleon form factors

    SciTech Connect

    Bender, A.; Roberts, C.D.; Frank, M.R.

    1995-08-01

    The Dyson-Schwinger equation framework is employed to obtain expressions for the electromagnetic nucleon form factor. In generalized impulse approximation the form factor depends on the dressed quark propagator, the dressed quark-photon vertex, which is crucial to ensuring current conservation, and the nucleon Faddeev amplitude. The approach manifestly incorporates the large space-like-q{sup 2} renormalization group properties of QCD and allows a realistic extrapolation to small space-like-q{sup 2}. This extrapolation allows one to relate experimental data to the form of the quark-quark interaction at small space-like-q{sup 2}, which is presently unknown. The approach provides a means of unifying, within a single framework, the treatment of the perturbative and nonperturbative regimes of QCD. The wealth of experimental nucleon form factor data, over a large range of q{sup 2}, ensures that this application will provide an excellent environment to test, improve and extend our approach.

  11. Nucleon Form Factors - A Jefferson Lab Perspective

    SciTech Connect

    John Arrington, Kees de Jager, Charles F. Perdrisat

    2011-06-01

    The charge and magnetization distributions of the proton and neutron are encoded in their elastic electromagnetic form factors, which can be measured in elastic electron--nucleon scattering. By measuring the form factors, we probe the spatial distribution of the proton charge and magnetization, providing the most direct connection to the spatial distribution of quarks inside the proton. For decades, the form factors were probed through measurements of unpolarized elastic electron scattering, but by the 1980s, progress slowed dramatically due to the intrinsic limitations of the unpolarized measurements. Early measurements at several laboratories demonstrated the feasibility and power of measurements using polarization degrees of freedom to probe the spatial structure of the nucleon. A program of polarization measurements at Jefferson Lab led to a renaissance in the field of study, and significant new insight into the structure of matter.

  12. Precision Rosenbluth Measurement of the Proton Elastic Electromagnetic Form Factors and Their Ratio at Q2=2.64, 3.20, and 4.10 GeV2

    SciTech Connect

    Qattan, Issam A.

    2005-12-01

    Due to the inconsistency in the results of the mupGEp/GMp ratio of the proton, as extracted from the Rosenbluth and recoil polarization techniques, high precision measurements of the e-p elastic scattering cross sections were made at Q2 = 2.64, 3.20, and 4.10 GeV2. Protons were detected, in contrast to previous measurements where the scattered electrons were detected, which dramatically decreased-dependent systematic uncertainties and corrections. A single spectrometer measured the scattered protons of interest while simultaneous measurements at Q2 = 0.5 GeV2 were carried out using another spectrometer which served as a luminosity monitor in order to remove any uncertainties due to beam charge and target density fluctuations. The absolute uncertainty in the measured cross sections is ~3% for both spectrometers and with relative uncertainties, random and slope, below 1% for the higher Q2 protons, and below 1% random and 6% slope for the monitor spectrometer. The extracted electric and magnetic form factors were determined to 4%-7% for GEp and 1.5% for GMp. The ratio mupGEp/GMp was determined to 4%-7% and showed mupGEp/GMp ~ 1.0. The results of this work are in agreement with the previous Rosenbluth data and inconsistent with high-Q2 recoil polarization results, implying a systematic difference between the two techniques.

  13. Analytic pion form factor

    NASA Astrophysics Data System (ADS)

    Lomon, Earle L.; Pacetti, Simone

    2016-09-01

    The pion electromagnetic form factor and two-pion production in electron-positron collisions are simultaneously fitted by a vector dominance model evolving to perturbative QCD at large momentum transfer. This model was previously successful in simultaneously fitting the nucleon electromagnetic form factors (spacelike region) and the electromagnetic production of nucleon-antinucleon pairs (timelike region). For this pion case dispersion relations are used to produce the analytic connection of the spacelike and timelike regions. The fit to all the data is good, especially for the newer sets of timelike data. The description of high-q2 data, in the timelike region, requires one more meson with ρ quantum numbers than listed in the 2014 Particle Data Group review.

  14. Electromagnetic pion form factor

    SciTech Connect

    Roberts, C.D.

    1995-08-01

    A phenomenological Dyson-Schwinger/Bethe-Salpeter equation approach to QCD, formalized in terms of a QCD-based model field theory, the Global Color-symmetry Model (GCM), was used to calculate the generalized impulse approximation contribution to the electromagnetic pion form factor at space-like q{sup 2} on the domain [0,10] GeV{sup 2}. In effective field theories this form factor is sometimes understood as simply being due to Vector Meson Dominance (VMD) but this does not allow for a simple connection with QCD where the VMD contribution is of higher order than that of the quark core. In the GCM the pion is treated as a composite bound state of a confined quark and antiquark interacting via the exchange of colored vector-bosons. A direct study of the quark core contribution is made, using a quark propagator that manifests the large space-like-q{sup 2} properties of QCD, parameterizes the infrared behavior and incorporates confinement. It is shown that the few parameters which characterize the infrared form of the quark propagator may be chosen so as to yield excellent agreement with the available data. In doing this one directly relates experimental observables to properties of QCD at small space-like-q{sup 2}. The incorporation of confinement eliminates endpoint and pinch singularities in the calculation of F{sub {pi}}(q{sup 2}). With asymptotic freedom manifest in the dressed quark propagator the calculation yields q{sup 4}F{sub {pi}}(q{sup 2}) = constant, up to [q{sup 2}]- corrections, for space-like-q{sup 2} {approx_gt} 35 GeV{sup 2}, which indicates that soft, nonperturbative contributions dominate the form factor at presently accessible q{sup 2}. This means that the often-used factorization Ansatz fails in this exclusive process. A paper describing this work was submitted for publication. In addition, these results formed the basis for an invited presentation at a workshop on chiral dynamics and will be published in the proceedings.

  15. Pion form factor

    SciTech Connect

    Ryong Ji, C.; Pang, A.; Szczepaniak, A.

    1994-04-01

    It is pointed out that the correct criterion to define the legal PQCD contribution to the exclusive processes in the lightcone perturbative expansion should be based on the large off-shellness of the lightcone energy in the intermediate states. In the lightcone perturbative QCD calculation of the pion form factor, the authors find that the legal PQCD contribution defined by the lightcone energy cut saturates in the smaller Q{sup 2} region compared to that defined by the gluon four-momentum square cut. This is due to the contribution by the highly off-energy-shell gluons in the end point regions of the phase space, indicating that the gluon four-momentum-square cut may have cut too much to define the legal PQCD.

  16. Survey of nucleon electromagnetic form factors

    SciTech Connect

    Perdrisat, Charles F.; Punjabi, Vina A.

    2011-09-20

    There has been much activity in the measurement of the elastic electromagnetic proton and neutron form factors in the last decade, and the quality of the data has been greatly improved by performing double polarization experiments, in compar- ison with previous unpolarized data. Here we review the experimental data base in view of the new results for the proton, and neutron, obtained at MIT-Bates, MAMI, and JLab. The rapid evolution of phenomenological models triggered by these high-precision experiments will be discussed.

  17. Protonated Forms of Monoclinic Zirconia: A Theoretical Study

    SciTech Connect

    Mantz, Yves A.; Gemmen, Randall S.

    2010-05-06

    In various materials applications of zirconia, protonated forms of monoclinic zirconia may be formed, motivating their study within the framework of density-functional theory. Using the HCTH/120 exchange-correlation functional, the equations of state of yttria and of the three low-pressure zirconia polymorphs are computed, to verify our approach. Next, the favored charge state of a hydrogen atom in monoclinic zirconia is shown to be positive for all Fermilevel energies in the band gap, by the computation of defect formation energies.This result is consistent with a single previous theoretical prediction at midgap as well as muonium spectroscopy experiments. For the formally positively (+1e) charged system of a proton in monoclinic zirconia (with a homogeneous neutralizing background charge densityimplicitly included), modeled using up to a 3 x 3 x 3 arrangement of unit cells, different stable and metastable structures are identified. They are similar to those structures previously proposed for the neutral system of hydrogen-doedmonoclinic zirconia, at a similar level of theory. As predicted using the HCTH/120 functional, the lowest energy structure of the proton bonded to one of the two available oxygen atom types, O1, is favored by 0.39 eV compared to that of the proton bonded to O2. The rate of proton transfer between O1 ions is slower than that for hydrogen-dopedmonoclinic zirconia, whose transition-state structures may be lowered in energy by the extra electron.

  18. Transition Form Factor from CLAS

    NASA Astrophysics Data System (ADS)

    Park, K.

    2009-01-01

    The excitation of nucleon resonances in electromagnetic interaction has long been studied. The study of resonances helps us to understand the long- and short- range structures of the nucleon and its excited states in terms of quark confinement. While the existing data of the low-lying resonances are consistent with the well-studied SU(6) ⊗ O(3) constituent quark model classification, many open questions still remain. Exclusive electro-production is one of the best ways to investigate nucleon resonances. The exclusive electro-production process e→p→enπ was measured in the photon virtuality range Q2 = 1.7 - 4.5 GeV 2 and the invariant mass range for the n π+ system of W = 1.15 - 1.7 GeV using the CEBAF Large Acceptance Spectrometer. For the first time, these kinematics are probed in exclusive π+ production from protons with nearly full coverage in the azimuthal and polar angles of the n π+ center-of-mass system. The n π+ channel has particular sensitivity to the isospin 1/2 > excited nucleon states, and together with the p π0 final state will serve to determine the transition form factors of a large number of resonances. The largest discrepancy between these results and present modes was seen in the σ structure function. Thanks to a large volume of data (31,295 cross section and 4,184 asymmetry data points), a reduced set of structure functions and Legendre polynomial moments are presented which are obtained in model-independent fits to the differential cross sections. In this paper, I will discuss the transition form factors of the nucleon resonances in terms of helicity amplitudes.

  19. Final analysis of proton form factor ratio data at Q2 = 4.0, 4.8, and 5.6 GeV2

    SciTech Connect

    Puckett, A. J. R.; Brash, E. J.; Gayou, O.; Jones, M. K.; Pentchev, L.; Perdrisat, C. F.; Punjabi, V.; Aniol, K. A.; Averett, T.; Benmokhtar, F.; Bertozzi, W.; Bimbot, L.; Calarco, J. R.; Cavata, C.; Chai, Z.; Chang, C. -C.; Chang, T.; Chen, J. P.; Chudakov, E.; De Leo, R.; Dieterich, S.; Endres, R.; Epstein, M. B.; Escoffier, S.; Fissum, K. G.; Fonvieille, H.; Frullani, S.; Gao, J.; Garibaldi, F.; Gilad, S.; Gilman, R.; Glamazdin, A.; Glashausser, C.; Gomez, J.; Hansen, J. -O.; Higinbotham, D.; Huber, G. M.; Iodice, M.; de Jager, C. W.; Jiang, X.; Khandaker, M.; Kozlov, S.; Kramer, K. M.; Kumbartzki, G.; LeRose, J. J.; Lhuillier, D.; Lindgren, R. A.; Liyanage, N.; Lolos, G. J.; Margaziotis, D. J.; Marie, F.; Markowitz, P.; McCormick, K.; Michaels, R.; Milbrath, B. D.; Nanda, S. K.; Neyret, D.; Piskunov, N. M.; Ransome, R. D.; Raue, B. A.; Roché, R.; Rvachev, M.; Salgado, C.; Sirca, S.; Sitnik, I.; Strauch, S.; Todor, L.; Tomasi-Gustafsson, E.; Urciuoli, G. M.; Voskanyan, H.; Wijesooriya, K.; Wojtsekhowski, B. B.; Zheng, X.; Zhu, L.

    2012-04-11

    Recently published measurements of the proton electromagnetic form factor ratio R = μp GEp/GMp at momentum transfers Q2 up to 8.5 GeV2 in Jefferson Lab Hall C deviate from the linear trend of previous measurements in Jefferson Lab Hall A, favoring a slower rate of decrease of R with Q2. While statistically compatible in the region of overlap with Hall A, the Hall C data hint at a systematic difference between the two experiments. This possibility was investigated in a reanalysis of the Hall A data. We find that the original analysis underestimated the background in the selection of elastic events. The application of an additional cut to further suppress the background increases the results for R, improving the consistency between Halls A and C.

  20. Elastic form factors at higher CEBAF energies

    SciTech Connect

    Petratos, G.G.

    1994-04-01

    The prospects for elastic scattering from few body systems with higher beam energies at CEBAF is presented. The deuteron and{sup 3}He elastic structure functions A(Q{sup 2}) can be measured at sufficiently high momentum transfers to study the transition between the conventional meson-nucleon and the constituent quark-gluon descriptions. Possible improvements in the proton magnetic form factor data are also presented.

  1. Electromagnetic Hadronic Form-Factors

    SciTech Connect

    Robert Edwards

    2004-06-01

    We present a calculation of the nucleon electromagnetic form-factors as well as the pion and rho to pion transition form-factors in a hybrid calculation with domain wall valence quarks and improved staggered (Asqtad) sea quarks.

  2. Probing non polar interstellar molecules through their protonated form: Detection of protonated cyanogen (NCCNH(+)).

    PubMed

    Agúndez, M; Cernicharo, J; de Vicente, P; Marcelino, N; Roueff, E; Fuente, A; Gerin, M; Guélin, M; Albo, C; Barcia, A; Barbas, L; Bolaño, R; Colomer, F; Diez, M C; Gallego, J D; Gómez-González, J; López-Fernández, I; López-Fernández, J A; López-Pérez, J A; Malo, I; Serna, J M; Tercero, F

    2015-07-01

    Cyanogen (NCCN) is the simplest member of the series of dicyanopolyynes. It has been hypothesized that this family of molecules can be important constituents of interstellar and circumstellar media, although the lack of a permanent electric dipole moment prevents its detection through radioastronomical techniques. Here we present the first solid evidence of the presence of cyanogen in interstellar clouds through the detection of its protonated form toward the cold dark clouds TMC-1 and L483. Protonated cyanogen (NCCNH(+)) has been identified through the J = 5 - 4 and J = 10 - 9 rotational transitions using the 40m radiotelescope of Yebes and the IRAM 30m telescope. We derive beam averaged column densities for NCCNH(+) of (8.6 ± 4.4) × 10(10) cm(-2) in TMC-1 and (3.9 ± 1.8) × 10(10) cm(-2) in L483, which translate to fairly low fractional abundances relative to H2, in the range (1-10) × 10(-12). The chemistry of protonated molecules in dark clouds is discussed, and it is found that, in general terms, the abundance ratio between the protonated and non protonated forms of a molecule increases with increasing proton affinity. Our chemical model predicts an abundance ratio NCCNH(+)/NCCN of ~ 10(-4), which implies that the abundance of cyanogen in dark clouds could be as high as (1-10) × 10(-8) relative to H2, i.e., comparable to that of other abundant nitriles such as HCN, HNC, and HC3N.

  3. Probing non polar interstellar molecules through their protonated form: Detection of protonated cyanogen (NCCNH+)★

    PubMed Central

    Agúndez, M.; Cernicharo, J.; de Vicente, P.; Marcelino, N.; Roueff, E.; Fuente, A.; Gerin, M.; Guélin, M.; Albo, C.; Barcia, A.; Barbas, L.; Bolaño, R.; Colomer, F.; Diez, M. C.; Gallego, J. D.; Gómez-González, J.; López-Fernández, I.; López-Fernández, J. A.; López-Pérez, J. A.; Malo, I.; Serna, J. M.; Tercero, F.

    2015-01-01

    Cyanogen (NCCN) is the simplest member of the series of dicyanopolyynes. It has been hypothesized that this family of molecules can be important constituents of interstellar and circumstellar media, although the lack of a permanent electric dipole moment prevents its detection through radioastronomical techniques. Here we present the first solid evidence of the presence of cyanogen in interstellar clouds through the detection of its protonated form toward the cold dark clouds TMC-1 and L483. Protonated cyanogen (NCCNH+) has been identified through the J = 5 – 4 and J = 10 – 9 rotational transitions using the 40m radiotelescope of Yebes and the IRAM 30m telescope. We derive beam averaged column densities for NCCNH+ of (8.6 ± 4.4) × 1010 cm−2 in TMC-1 and (3.9 ± 1.8) × 1010 cm−2 in L483, which translate to fairly low fractional abundances relative to H2, in the range (1-10) × 10−12. The chemistry of protonated molecules in dark clouds is discussed, and it is found that, in general terms, the abundance ratio between the protonated and non protonated forms of a molecule increases with increasing proton affinity. Our chemical model predicts an abundance ratio NCCNH+/NCCN of ~ 10−4, which implies that the abundance of cyanogen in dark clouds could be as high as (1-10) × 10−8 relative to H2, i.e., comparable to that of other abundant nitriles such as HCN, HNC, and HC3N. PMID:26543239

  4. Study of Baryon Form Factor at BESIII

    NASA Astrophysics Data System (ADS)

    Zhang, Bingxin

    Using data samples collected with BESIII detector at BEPCII collider, we measure Born cross section of e+e- → pbar{p} at center of mass energies √{s} from 2232.4 to 3671.0 MeV. The effective electromagnetic form factor of the proton is deduced with assumption that electric and magnetic form factors are equal GE = GM . For e+e- → Λ bar{Λ }, the Born cross sections and effective form factors are measured at √{s} = 2.2324, 2.40, 2.80, and 3.08 GeV. It is the first time that e+e- → Λ bar{Λ } process is studied closed to Λ bar{Λ } production threshold, and measured cross section is much larger than phase space expectations, which suggests that something more is at play beyond expected phase space behavior.

  5. Hadronic form factors in kaon photoproduction

    SciTech Connect

    Syukurilla, L. Mart, T.

    2014-09-25

    We have revisited the effect of hadronic form factors in kaon photoproduction process by utilizing an isobaric model developed for kaon photoproduction off the proton. The model is able to reproduce the available experimental data nicely as well as to reveal the origin of the second peak in the total cross section, which was the main source of confusion for decades. Different from our previous study, in the present work we explore the possibility of using different hadronic form factors in each of the KΛN vertices. The use of different hadronic form factors, e.g. dipole, Gaussian, and generalized dipole, has been found to produce a more flexible isobar model, which can provide a significant improvement in the model.

  6. The structure of the nucleon: Elastic electromagnetic form factors

    SciTech Connect

    Punjabi, V.; Perdrisat, C. F.; Jones, M. K.; Brash, E. J.; Carlson, C. E.

    2015-07-10

    Precise proton and neutron form factor measurements at Jefferson Lab, using spin observables, have recently made a significant contribution to the unraveling of the internal structure of the nucleon. Accurate experimental measurements of the nucleon form factors are a test-bed for understanding how the nucleon's static properties and dynamical behavior emerge from QCD, the theory of the strong interactions between quarks. There has been enormous theoretical progress, since the publication of the Jefferson Lab proton form factor ratio data, aiming at reevaluating the picture of the nucleon. We will review the experimental and theoretical developments in this field and discuss the outlook for the future.

  7. Extracting nucleon strange and anapole form factors from data

    SciTech Connect

    R.D. Young; J. Roche; R.D. Carlini; A.W. Thomas

    2006-04-14

    Using the complete world set of parity violating electron scattering data up to Q{sup 2} {approx} 0.3 GeV{sup 2}, we extract the current best determination of the strange electric and magnetic form factors of the proton, as well as the weak axial form factors of the proton and neutron at Q{sup 2} = 0.1 GeV{sup 2}. The results are consistent with state of the art calculations of all four form factors, with the latter including the anapole contribution.

  8. Protonated Form: The Potent Form of Potassium-Competitive Acid Blockers

    PubMed Central

    Luo, Hua-Jun; Deng, Wei-Qiao; Zou, Kun

    2014-01-01

    Potassium-competitive acid blockers (P-CABs) are highly safe and active drugs targeting H+,K+-ATPase to cure acid-related gastric diseases. In this study, we for the first time investigate the interaction mechanism between the protonated form of P-CABs and human H+,K+-ATPase using homology modeling, molecular docking, molecular dynamics and binding free energy calculation methods. The results explain why P-CABs have higher activities with higher pKa values or at lower pH. With positive charge, the protonated forms of P-CABs have more competitive advantage to block potassium ion into luminal channel and to bind with H+,K+-ATPase via electrostatic interactions. The binding affinity of the protonated form is more favorable than that of the neutral P-CABs. In particular, Asp139 should be a very important binding site for the protonated form of P-CABs through hydrogen bonds and electrostatic interactions. These findings could promote the rational design of novel P-CABs. PMID:24845980

  9. Anion binding by protonated forms of the tripodal ligand tren.

    PubMed

    Bazzicalupi, Carla; Bencini, Andrea; Bianchi, Antonio; Danesi, Andrea; Giorgi, Claudia; Valtancoli, Barbara

    2009-03-16

    The interaction of the protonated forms of tris(2-aminoethyl)amine (tren) with NO(3)(-), SO(4)(2-), TsO(-), PO(4)(3-), P(2)O(7)(4-), and P(3)O(10)(5-) was studied by means of potentiometric and microcalorimetric measurements in a 0.10 M NMe(4)Cl aqueous solution at 298.1 +/- 0.1 K, affording stability constants and the relevant energetic terms DeltaH degrees and TDeltaS degrees of complexation. Thermodynamic data show that these anion complexation processes are mainly controlled by electrostatic forces, although hydrogen-bond interactions and solvation effects also contribute to complex stability, leading, in some cases, to special DeltaH degrees and TDeltaS degrees contributions. The crystal structures of [H(3)L][NO(3)](3) and [H(3)L][TsO](3) evidence a preferred tridentate coordination mode of the triprotonated ligands in the solid state. Accordingly, the H(3)L(3+) receptor binds a single oxygen atom of both NO(3)(-) and TsO(-) by means of its three protonated fingers, although in the crystal structure of [H(3)L][TsO](3), one conformer displaying bidentate coordination was also found. Modeling studies performed on the [H(3)L(NO(3))](2+) complex suggested that the tridentate binding mode is the preferred one in aqueous solution, while in the gas phase, a different complex conformation in which the receptor interacts with all three oxygen atoms of NO(3)(-) is more stable.

  10. Flavor decomposition of the nucleon electromagnetic form factors at low Q2

    NASA Astrophysics Data System (ADS)

    Qattan, I. A.; Arrington, J.; Alsaad, A.

    2015-06-01

    Background: The spatial distribution of charge and magnetization within the proton is encoded in the elastic form factors. These have been precisely measured in elastic electron scattering, and the combination of proton and neutron form factors allows for the separation of the up- and down-quark contributions. Purpose: In this work, we extract the proton and neutron form factors from worldwide data with an emphasis on precise new data covering the low-momentum region, which is sensitive to the large-scale structure of the nucleon. From these, we separate the up- and down-quark contributions to the proton form factors. Method: We combine cross section and polarization measurements of elastic electron-proton scattering to separate the proton form factors and two-photon exchange (TPE) contributions. We combine the proton form factors with parametrization of the neutron form factor data and uncertainties to separate the up- and down-quark contributions to the proton's charge and magnetic form factors. Results: The extracted TPE corrections are compared to previous phenomenological extractions, TPE calculations, and direct measurements from the comparison of electron and positron scattering. The flavor-separated form factors are extracted and compared to models of the nucleon structure. Conclusions: With the inclusion of the precise new data, the extracted TPE contributions show a clear change of sign at low Q2, which is necessary to explain the high-Q2 form factor discrepancy while being consistent with the known Q2→0 limit. We find that the new Mainz data yield a significantly different result for the proton magnetic form factor and its flavor-separated contributions. We also observe that the rms radius of both the up- and down-quark distributions are smaller than the rms charge radius of the proton.

  11. The structure of the nucleon: Elastic electromagnetic form factors

    DOE PAGES

    Punjabi, V.; Perdrisat, C. F.; Jones, M. K.; ...

    2015-07-10

    Precise proton and neutron form factor measurements at Jefferson Lab, using spin observables, have recently made a significant contribution to the unraveling of the internal structure of the nucleon. Accurate experimental measurements of the nucleon form factors are a test-bed for understanding how the nucleon's static properties and dynamical behavior emerge from QCD, the theory of the strong interactions between quarks. There has been enormous theoretical progress, since the publication of the Jefferson Lab proton form factor ratio data, aiming at reevaluating the picture of the nucleon. We will review the experimental and theoretical developments in this field and discussmore » the outlook for the future.« less

  12. Measuring Form Factors and Structure Functions with CLAS

    SciTech Connect

    G.P. Gilfoyle

    2007-09-10

    The physics program at the Thomas Jefferson National Accelerator Facility includes a strong effort to measure form factors and structure functions to probe the structure of hadronic matter, reveal the nature of confinement, and develop an understanding of atomic nuclei using quark-gluon degrees of freedom. The CLAS detector is a large acceptance device occupying one of the end stations. We discuss here two programs that use CLAS; measuring the magnetic form factor of the neutron and the virtual photon asymmetry of the proton. The form factor has been measured with unprecedented kinematic coverage and precision up to Q2=4.7 GeV2 and is consistent within 5%-10% of the dipole parameterization. The proton virtual photon asymmetry has been measured across a wide range in Bjorken x. The data exceed the SU(6)-symmetric quark prediction and show evidence of a smooth approach to the scaling limit prescribed by perturbative QCD.

  13. Form factors from lattice QCD

    SciTech Connect

    Dru Renner

    2012-04-01

    Precision computation of hadronic physics with lattice QCD is becoming feasible. The last decade has seen precent-level calculations of many simple properties of mesons, and the last few years have seen calculations of baryon masses, including the nucleon mass, accurate to a few percent. As computational power increases and algorithms advance, the precise calculation of a variety of more demanding hadronic properties will become realistic. With this in mind, I discuss the current lattice QCD calculations of generalized parton distributions with an emphasis on the prospects for well-controlled calculations for these observables as well. I will do this by way of several examples: the pion and nucleon form factors and moments of the nucleon parton and generalized-parton distributions.

  14. Isomers and conformational barriers of gas phase nicotine, nornicotine and their protonated forms

    SciTech Connect

    Yoshida, Tomoki; Farone, William A.; Xantheas, Sotiris S.

    2014-07-17

    We report extensive conformational searches of the neutral nicotine, nornicotine and their protonated analogs that are based on ab-initio second order Møller-Plesset perturbation (MP2) electronic structure calculations. Initial searches were performed with the 6-31G(d,p) and the energetics of the most important structures were further refined from geometry optimizations with the aug-cc-pVTZ basis set. Based on the calculated free energies at T=298 K for the gas phase molecules, neutral nicotine has two dominant trans conformers, whereas neutral nornicotine is a mixture of several conformers. For nicotine, the protonation on both the pyridine and the pyrrolidine sites is energetically competitive, whereas nornicotine prefers protonation on the pyridine nitrogen. The protonated form of nicotine is mainly a mixture of two pyridine-protonated trans conformers and two pyrrolidine-protonated trans conformers, whereas the protonated form of nornicotine is a mixture of four pyridine-protonated trans conformers. Nornicotine is conformationally more flexible than nicotine, however it is less protonated at the biologically important pyrrolidine nitrogen site. The lowest energy isomers for each case were found to interconvert via low (< 6 kcal/mol) rotational barriers around the pyridine-pyrrolidine bond.

  15. A study of Two Photon Decays of Charmonium Resonances Formed in Proton Anti-Proton Annihilations

    SciTech Connect

    Pedlar, Todd Kristofer

    1999-06-01

    In this dissertation we describe the results of an investigation of the production of charmonium states (ηc, η'c, χ0 and χ2) in Fermilab experiment E835 via antiproton-proton annihilation and their detection via their decay into two photons.

  16. Physical and biological factors determining the effective proton range.

    PubMed

    Grün, Rebecca; Friedrich, Thomas; Krämer, Michael; Zink, Klemens; Durante, Marco; Engenhart-Cabillic, Rita; Scholz, Michael

    2013-11-01

    Proton radiotherapy is rapidly becoming a standard treatment option for cancer. However, even though experimental data show an increase of the relative biological effectiveness (RBE) with depth, particularly at the distal end of the treatment field, a generic RBE of 1.1 is currently used in proton radiotherapy. This discrepancy might affect the effective penetration depth of the proton beam and thus the dose to the surrounding tissue and organs at risk. The purpose of this study was thus to analyze the impact of a tissue and dose dependent RBE of protons on the effective range of the proton beam in comparison to the range based on a generic RBE of 1.1. Factors influencing the biologically effective proton range were systematically analyzed by means of treatment planning studies using the Local Effect Model (LEM IV) and the treatment planning software TRiP98. Special emphasis was put on the comparison of passive and active range modulation techniques. Beam energy, tissue type, and dose level significantly affected the biological extension of the treatment field at the distal edge. Up to 4 mm increased penetration depth as compared to the depth based on a constant RBE of 1.1. The extension of the biologically effective range strongly depends on the initial proton energy used for the most distal layer of the field and correlates with the width of the distal penumbra. Thus, the range extension, in general, was more pronounced for passive as compared to active range modulation systems, whereas the maximum RBE was higher for active systems. The analysis showed that the physical characteristics of the proton beam in terms of the width of the distal penumbra have a great impact on the RBE gradient and thus also the biologically effective penetration depth of the beam.

  17. Proton imaging of an electrostatic field structure formed in laser-produced counter-streaming plasmas

    NASA Astrophysics Data System (ADS)

    Morita, T.; Kugland, N. L.; Wan, W.; Crowston, R.; Drake, R. P.; Fiuza, F.; Gregori, G.; Huntington, C.; Ishikawa, T.; Koenig, M.; Kuranz, C.; Levy, M. C.; Martinez, D.; Meinecke, J.; Miniati, F.; Murphy, C. D.; Pelka, A.; Plechaty, C.; Presura, R.; Quirós, N.; Remington, B. A.; Reville, B.; Ross, J. S.; Ryutov, D. D.; Sakawa, Y.; Steele, L.; Takabe, H.; Yamaura, Y.; Woolsey, N.; Park, H.-S.

    2016-03-01

    We report the measurements of electrostatic field structures associated with an electrostatic shock formed in laser-produced counter-streaming plasmas with proton imaging. The thickness of the electrostatic structure is estimated from proton images with different proton kinetic energies from 4.7 MeV to 10.7 MeV. The width of the transition region is characterized by electron scale length in the laser-produced plasma, suggesting that the field structure is formed due to a collisionless electrostatic shock.

  18. Photocycle in the M-form in bacteriorhodopsin mutants devoid of primary proton acceptor Asp-85.

    PubMed

    Lukashev, E P; Kolodner, P

    2001-01-01

    Photoinduced changes in absorption of the deprotonated M-form in the mutant bacteriorhodopsin without primary proton acceptor Asp-85 were studied and additional evidence in support of the complete transmembrane proton transfer in photocycle was obtained. Measurements of the absorption spectrum were carried out at various pH, temperature, and humidity. The direction of proton transfer was the same as in the normal photocycle of the wild-type bacteriorhodopsin: from the internal to the external side of the membrane. The effect on this process of a terminal acceptor Glu-204 was shown.

  19. Bonner Prize: The Elastic Form Factors of the Nucleon

    NASA Astrophysics Data System (ADS)

    Perdrisat, Charles F.

    2017-01-01

    A series of experiments initiated in 1998 at the then new Continuous Electron Beam Accelerator, or CEBAF in Newport News Virginia, resulted in unexpected results, changing significantly our understanding of the structure of the proton. These experiments used a relatively new technique to obtain the ratio of the two form factors of the proton, namely polarization. An intense beam of highly polarized electrons with energy up to 6 GeV was made to interact elastically with un-polarized protons in a hydrogen target. The polarization of the recoiling protons, with energies up to 5 GeV, was measured from a second interaction in a polarimeter consisting of blocs of graphite or CH2 and tracking wire chambers. The scattered electrons were detected in an electromagnetic lead-glass calorimeter, to select elastically scattered events. After a short introduction describing the path which brought me from the University of Geneva to the College of William and Mary in 1966, I will introduce the subject of elastic electron scattering, describe some of the apparatus required for such experiments, and show the results which were unexpected at the time. These results demonstrated unequivocally that the two form factors required to describe elastic ep scattering, electric GE and magnetic GM in the Born approximation, had a drastically different dependence upon the four-momentum squared q2 = q2 -ω2 with q the momentum, and ω the energy transferred in the reaction. The finding, in flagrant disagreement with the data available at the time, which had been obtained dominantly from cross section measurements of the type first used by Nobel Prize R. Hofstadter 60 years ago, have led to a reexamination of the information provided by form factors on the structure of the nucleon, in particular its quark-gluon content. The conclusion will then be a brief outline of several theoretical considerations to put the results in a proper perspective.

  20. High energy behaviour of form factors

    NASA Astrophysics Data System (ADS)

    Ahmed, Taushif; Henn, Johannes M.; Steinhauser, Matthias

    2017-06-01

    We solve renormalization group equations that govern infrared divergences of massless and massive form factors. By comparing to recent results for planar massive three-loop and massless four-loop form factors in QCD, we give predictions for the high-energy limit of massive form factors at the four- and for the massless form factor at five-loop order. Furthermore, we discuss the relation which connects infrared divergences regularized dimensionally and via a small quark mass and extend results present in the literature to higher order.

  1. Measurements of the elastic electromagnetic form factor ratio {mu}pGEp/GMp via polarization transfer

    SciTech Connect

    Olivier Gayou; Oleksandr Glamazdin; Andrei Afanasev; Arunava Saha; Brendan Fox; Bogdan Wojtsekhowski; C. Chang; Cathleen Jones; Charles Glashausser; Charles Perdrisat; D. Crovelli; Daniel Simon; David Meekins; Demetrius Margaziotis; Dipangkar Dutta; Edgar Kooijman; Elaine Schulte; Edward Brash; Edward Kinney; Eugene Chudakov; Feng Xiong; Franco Garibaldi; Garth Huber; Gerfried Kumbartzki; Guido Urciuoli; Haiyan Gao; Jordan Hovdebo; James Kelly; Javier Gomez; Jens-Ole Hansen; Jian-Ping Chen; John Calarco; John LeRose; Joseph Mitchell; Juncai Gao; Konrad Aniol; Kamal Benslama; Kathy McCormick; Cornelis De Jager; Cornelis de Jager; Kevin Fissum; Krishni Wijesooriya; Louis Bimbot; Ludyvine Morand; Luminita Todor; Moskov Amarian; Marat Rvachev; Mark Jones; Martin Epstein; Meihua Liang; Michael Kuss; Nilanga Liyanage; Adam Sarty; Paul Ulmer; Pete Markowitz; Peter Bosted; R. Holt; Riad Suleiman; Richard Lindgren; Rikki Roche; Robert Michaels; Roman Pomatsalyuk; Ronald Gilman; Ronald Ransome; Stephen Becher; Scott Dumalski; Salvatore Frullani; Seonho Choi; Sergey Malov; Sonja Dieterich; Steffen Strauch; Steve Churchwell; Ting Chang; Viktor Gorbenko; Vina Punjabi; Wang Xu; Xiangdong Ji; Zein-Eddine Meziani; Zhengwei Chai

    2001-09-01

    We present measurements of the ratio of the proton elastic electromagnetic form factors, {mu}pGEp/GMp. The Jefferson Lab Hall A Focal Plane Polarimeter was used to determine the longitudinal and transverse components of the recoil proton polarization in ep elastic scattering; the ratio of these polarization components is proportional to the ratio of the two form factors. These data reproduce the observation of Jones et al. [Phys. Rev. Lett. 84, 1398 (2000)], that the form factor ratio decreases significantly from unity above Q2 = 1 GeV2.

  2. Jet acollinearity and quark form factors

    SciTech Connect

    Stirling, W.J.

    1980-01-01

    Perturbative Quantum Chromodynamic corrections involving the emission of gluons which are both soft and collinear are discussed for both hadronic production of lepton pairs and e/sup +/e/sup -/ annihilation. The result is an exponential, double logarithmic quark form factor. The effect of sub-leading corrections and the possible experimental observation of the form factor are discussed.

  3. Future Perspectives on Baryon Form Factor Measurements with BES III

    NASA Astrophysics Data System (ADS)

    Schönning, Karin; Li, Cui

    2017-03-01

    The electromagnetic structure of hadrons, parameterised in terms of electromagnetic form factors, EMFF's, provide a key to the strong interaction. Nucleon EMFF's have been studied rigorously for more than 60 years but the new techniques and larger data samples available at modern facilities have given rise to a renewed interest for the field. Recently, the access to hyperon structure by hyperon time-like EMFF provides an additional dimension. The BEijing Spectrometer (BES III) at the Beijing Electron Positron Collider (BEPC-II) in China is the only running experiment where time-like baryon EMFF's can be studied in the e+e- → BB̅ reaction. The BES III detector is an excellent tool for baryon form factor measurements thanks to its near 4π coverage, precise tracking, PID and calorimetry. All hyperons in the SU(3) spin 1/2 octet and spin 3/2 decuplet are energetically accessible within the BEPC-II energy range. Recent data on proton and Λ hyperon form factors will be presented. Furthermore, a world-leading data sample was collected in 2014-2015 for precision measurements of baryon form factors. In particular, the data will enable a measurement of the relative phase between the electric and the magnetic form factors for Λ and Λc+ and hyperons. The modulus of the phase can be extracted from the hyperon polarisation, which in turn is experimentally accessible via the weak, parity violating decay. Furthermore, from the spin correlation between the outgoing hyperon and antihyperon, the sign of the phase can be extracted. This means that the time-like form factors can be completely determined for the first time. The methods will be outlined and the prospects of the BES III form factor measurements will be given. We will also present a planned upgrade of the BES III detector which is expected to improve future form factor measurements.

  4. Form factors in the radiative pion decay

    NASA Astrophysics Data System (ADS)

    Mateu, V.; Portolés, J.

    2007-10-01

    We perform an analysis of the form factors that rule the structure-dependent amplitude in radiative pion decay. The resonance contributions to π→eνeγ decays are computed through the proper construction of the vector and axial-vector form factors by setting the QCD driven asymptotic properties of the three-point Green functions and , and by demanding the smoothening of the form factors at high transfer of momentum. A comparison between theoretical and experimental determination of the form factors is also carried out. We also consider and evaluate the role played by a non-standard tensor form factor. We conclude that, at present and due to the hadronic uncertainties, the search for new physics in this process is not feasible.

  5. Spectroscopic factor and proton formation probability for the d3/2 proton emitter 151mLu

    NASA Astrophysics Data System (ADS)

    Wang, F.; Sun, B. H.; Liu, Z.; Page, R. D.; Qi, C.; Scholey, C.; Ashley, S. F.; Bianco, L.; Cullen, I. J.; Darby, I. G.; Eeckhaudt, S.; Garnsworthy, A. B.; Gelletly, W.; Gomez-Hornillos, M. B.; Grahn, T.; Greenlees, P. T.; Jenkins, D. G.; Jones, G. A.; Jones, P.; Joss, D. T.; Julin, R.; Juutinen, S.; Ketelhut, S.; Khan, S.; Kishada, A.; Leino, M.; Niikura, M.; Nyman, M.; Pakarinen, J.; Pietri, S.; Podolyak, Z.; Rahkila, P.; Rigby, S.; Saren, J.; Shizuma, T.; Sorri, J.; Steer, S.; Thomson, J.; Thompson, N. J.; Uusitalo, J.; Walker, P. M.; Williams, S.; Zhang, H. F.; Zhang, W. Q.; Zhu, L. H.

    2017-07-01

    The quenching of the experimental spectroscopic factor for proton emission from the short-lived d3/2 isomeric state in 151mLu was a long-standing problem. In the present work, proton emission from this isomer has been reinvestigated in an experiment at the Accelerator Laboratory of the University of Jyväskylä. The proton-decay energy and half-life of this isomer were measured to be 1295(5) keV and 15.4(8) μs, respectively, in agreement with another recent study. These new experimental data can resolve the discrepancy in the spectroscopic factor calculated using the spherical WKB approximation. Using the R-matrix approach it is found that the proton formation probability indicates no significant hindrance for the proton decay of 151mLu.

  6. Nanostructured proton conductors formed via in situ polymerization of ionic liquid crystals.

    PubMed

    Lu, Fei; Gao, Xinpei; Dong, Bin; Sun, Panpan; Sun, Nan; Xie, Shuting; Zheng, Liqiang

    2014-12-24

    Ionic liquid crystals (ILCs) with hexagonal and lamellar phases were successfully fabricated by the self-assembly of a polymerizable amphiphilic zwitterion, which is formed by 3-(1-vinyl-3-imidazolio)propanesulfonate (VIPS) and 4-dodecyl benzenesulfonic acid (DBSA) based on intermolecular electrostatic interactions. The microstructures and phase behaviors of ILCs were studied by polarized microscope (POM) and small-angle X-ray scattering (SAXS). The ILC topological structures can be considered as proton pathways and further fixed by photopolymerization to prepare nanostructured proton-conductive films. The introduction of highly ordered and well-defined ILC structures into these polymeric films radically improves the ionic conductivities.

  7. Flavor Analysis of Nucleon, Δ , and Hyperon Electromagnetic Form Factors

    NASA Astrophysics Data System (ADS)

    Rohrmoser, Martin; Choi, Ki-Seok; Plessas, Willibald

    2017-03-01

    By the analysis of the world data base of elastic electron scattering on the proton and the neutron (for the latter, in fact, on ^2H and ^3He) important experimental insights have recently been gained into the flavor compositions of nucleon electromagnetic form factors. We report on testing the Graz Goldstone-boson-exchange relativistic constituent-quark model in comparison to the flavor contents in low-energy nucleons, as revealed from electron-scattering phenomenology. It is found that a satisfactory agreement is achieved between theory and experiment for momentum transfers up to Q^2˜ 4 GeV^2, relying on three-quark configurations only. Analogous studies have been extended to the Δ and the hyperon electromagnetic form factors. For them we here show only some sample results in comparison to data from lattice quantum chromodynamics.

  8. Electromagnetic nucleon form factors in instant and point form

    SciTech Connect

    Melde, T.; Berger, K.; Plessas, W.; Wagenbrunn, R. F.; Canton, L.

    2007-10-01

    We present a study of the electromagnetic structure of the nucleons with constituent quark models in the framework of relativistic quantum mechanics. In particular, we address the construction of spectator-model currents in the instant and point forms. Corresponding results for the elastic nucleon electromagnetic form factors as well as charge radii and magnetic moments are presented. We also compare results obtained by different realistic nucleon wave functions stemming from alternative constituent quark models. Finally, we discuss the theoretical uncertainties that reside in the construction of spectator-model transition operators.

  9. Electromagnetic Form Factors of Hadrons in Quantum Field Theories

    SciTech Connect

    Dominguez, C. A.

    2008-10-13

    In this talk, recent results are presented of calculations of electromagnetic form factors of hadrons in the framework of two quantum field theories (QFT), (a) Dual-Large N{sub c} QCD (Dual-QCD{sub {infinity}}) for the pion, proton, and {delta}(1236), and (b) the Kroll-Lee-Zumino (KLZ) fully renormalizable Abelian QFT for the pion form factor. Both theories provide a QFT platform to improve on naive (tree-level) Vector Meson Dominance (VMD). Dual-QCD{sub {infinity}} provides a tree-level improvement by incorporating an infinite number of zero-width resonances, which can be subsequently shifted from the real axis to account for the time-like behaviour of the form factors. The renormalizable KLZ model provides a QFT improvement of VMD in the framework of perturbation theory. Due to the relative mildness of the {rho}{pi}{pi} coupling, and the size of loop suppression factors, the perturbative expansion is well defined in spite of this being a strong coupling theory. Both approaches lead to considerable improvements of VMD predictions for electromagnetic form factors, in excellent agreement with data.

  10. Measurements of baryon form factors at BESIII

    NASA Astrophysics Data System (ADS)

    Li, Cui

    2016-08-01

    The momentum transfer dependence of the electromagnetic form factors is an important probe of the structure of hadrons at different scales. Using data samples collected with the BESIII detector at the BEPCII collider, we study the process of e+e- → pp¯ at 12 c.m. energies from 2232.4 to 3671.0 MeV. The Born cross section at these energy points are measured as well as the corresponding effective electromagnetic form factors. Furthermore, the ratio of electric to magnetic form factors, |GE/GM | and |GM | are measured at the c.m. energies where the data samples are the largest. We also report preliminary results of e+e- → ˄˄̅, which is analysed with the same method. Moreover, future prospects of the measurement of baryon electromagnetic form factors from a unique high luminosity data scan by BESIII, are given.

  11. Strangeness contributions to nucleon form factors

    SciTech Connect

    Ross Young

    2006-09-11

    We review a recent theoretical determination of the strange quark content of the electromagnetic form factors of the nucleon. These are compared with a global analysis of current experimental measurements in parity-violating electron scattering.

  12. Experimental validation of beam quality correction factors for proton beams.

    PubMed

    Gomà, Carles; Hofstetter-Boillat, Bénédicte; Safai, Sairos; Vörös, Sándor

    2015-04-21

    This paper presents a method to experimentally validate the beam quality correction factors (kQ) tabulated in IAEA TRS-398 for proton beams and to determine the kQ of non-tabulated ionization chambers (based on the already tabulated values). The method is based exclusively on ionometry and it consists in comparing the reading of two ionization chambers under the same reference conditions in a proton beam quality Q and a reference beam quality (60)Co. This allows one to experimentally determine the ratio between the kQ of the two ionization chambers. In this work, 7 different ionization chamber models were irradiated under the IAEA TRS-398 reference conditions for (60)Co beams and proton beams. For the latter, the reference conditions for both modulated beams (spread-out Bragg peak field) and monoenergetic beams (pseudo-monoenergetic field) were studied. For monoenergetic beams, it was found that the experimental kQ values obtained for plane-parallel chambers are consistent with the values tabulated in IAEA TRS-398; whereas the kQ values obtained for cylindrical chambers are not consistent--being higher than the tabulated values. These results support the suggestion (of previous publications) that the IAEA TRS-398 reference conditions for monoenergetic proton beams should be revised so that the effective point of measurement of cylindrical ionization chambers is taken into account when positioning the reference point of the chamber at the reference depth. For modulated proton beams, the tabulated kQ values of all the ionization chambers studied in this work were found to be consistent with each other--except for the IBA FC65-G, whose experimental kQ value was found to be 0.6% lower than the tabulated one. The kQ of the PTW Advanced Markus chamber, which is not tabulated in IAEA TRS-398, was found to be 0.997 ± 0.042 (k = 2), based on the tabulated value of the PTW Markus chamber.

  13. Deuteron electromagnetic form factors with the light-front approach

    NASA Astrophysics Data System (ADS)

    Sun, Bao-dong; Dong, Yu-bing

    2017-01-01

    The electromagnetic form factors and low-energy observables of the deuteron are studied with the help of the light-front approach, where the deuteron is regarded as a weakly bound state of a proton and a neutron. Both the S and D wave interacting vertexes among the deuteron, proton, and neutron are taken into account. Moreover, the regularization functions are also introduced. In our calculations, the vertex and the regularization functions are employed to simulate the momentum distribution inside the deuteron. Our numerical results show that the light-front approach can roughly reproduce the deuteron electromagnetic form factors, like charge G 0, magnetic G 1, and quadrupole G 2, in the low Q 2 region. The important effect of the D wave vertex on G 2 is also addressed. Supported by National Natural Science Foundation of China (10975146, 11475192), The fund provided by the Sino-German CRC 110 “Symmetries and the Emergence of Structure in QCD" project is also appreciated, YBD thanks FAPESP grant 2011/11973-4 for funding his visit to ICTP-SAIFR

  14. Magnetic form factors of the trinucleons

    SciTech Connect

    Schiavilla, R; Pandharipande, V R; Riska, Dan-Olof

    1989-11-01

    The magnetic form factors of 3H and 3He are calculated with the Monte Carlo method from variational ground-state wave functions obtained for the Argonne and Urbana two- and three-nucleon interactions. The electromagnetic current operator contains one- and two-body terms that are constructed so as to satisfy the continuity equation with the two-nucleon potential in the Hamiltonian. The results obtained with the Argonne two-nucleon interaction are in overall agreement with the empirical values. It appears that the remaining theoretical uncertainty, in the calculation of these form factors from a given interaction model, is dominated by that in the electromagnetic form factors of the nucleon. It is found that the isovector magnetic form factors are rather sensitive to the details of the isospin-dependent tensor force, and they are much better reproduced with the Argonne than the Urbana potential. The isoscalar magnetic form factors appear to be sensitive to the spin-orbit interactions, and are better reproduced with the Urbana potential. The Argonne potential has a stronger τ1∙τ2 tensor force, while the Urbana one has a shorter-range spin-orbit interaction.

  15. Form factor effects in the direct detection of isospin-violating dark matter

    SciTech Connect

    Zheng, Hao; Zhang, Zhen; Chen, Lie-Wen E-mail: malkuth@sjtu.edu.cn

    2014-08-01

    Isospin-violating dark matter (IVDM) provides a possible mechanism to ameliorate the tension among recent direct detection experiments. For IVDM, we demonstrate that the results of direct detection experiments based on neutron-rich target nuclei may depend strongly on the density dependence of the symmetry energy which is presently largely unknown and controls the neutron skin thickness that reflects the relative difference of neutron and proton form factors in the neutron-rich nuclei. In particular, using the neutron and proton form factors obtained from Skyrme-Hartree-Fock calculations by varying the symmetry energy within the uncertainty region set by the latest model-independent measurement of the neutron skin thickness of {sup 208}Pb from PREX experiment at JLab, we find that, for IVDM with neutron-to-proton coupling ratio fixed to f{sub n}/f{sub p}=-0.7, the form factor effect may enhance the sensitivity of Xe-based detectors (e.g., XENON100 and LUX) to the DM-proton cross section by a factor of 3 in the DM mass region constrained by CMDS-II(Si) and even by more than an order of magnitude for heavy DM with mass larger than 80 GeV, compared with the results using the empirical Helm form factor. Our results further indicate that the form factor effect can significantly modify the recoil spectrum of Xe-based detectors for heavy IVDM with f{sub n}/f{sub p}=-0.7.

  16. Form factor effects in the direct detection of isospin-violating dark matter

    NASA Astrophysics Data System (ADS)

    Zheng, Hao; Zhang, Zhen; Chen, Lie-Wen

    2014-08-01

    Isospin-violating dark matter (IVDM) provides a possible mechanism to ameliorate the tension among recent direct detection experiments. For IVDM, we demonstrate that the results of direct detection experiments based on neutron-rich target nuclei may depend strongly on the density dependence of the symmetry energy which is presently largely unknown and controls the neutron skin thickness that reflects the relative difference of neutron and proton form factors in the neutron-rich nuclei. In particular, using the neutron and proton form factors obtained from Skyrme-Hartree-Fock calculations by varying the symmetry energy within the uncertainty region set by the latest model-independent measurement of the neutron skin thickness of 208Pb from PREX experiment at JLab, we find that, for IVDM with neutron-to-proton coupling ratio fixed to fn/fp=-0.7, the form factor effect may enhance the sensitivity of Xe-based detectors (e.g., XENON100 and LUX) to the DM-proton cross section by a factor of 3 in the DM mass region constrained by CMDS-II(Si) and even by more than an order of magnitude for heavy DM with mass larger than 80 GeV, compared with the results using the empirical Helm form factor. Our results further indicate that the form factor effect can significantly modify the recoil spectrum of Xe-based detectors for heavy IVDM with fn/fp=-0.7.

  17. Alpha-helical hydrophobic polypeptides form proton-selective channels in lipid bilayers

    NASA Technical Reports Server (NTRS)

    Oliver, A. E.; Deamer, D. W.

    1994-01-01

    Proton translocation is important in membrane-mediated processes such as ATP-dependent proton pumps, ATP synthesis, bacteriorhodopsin, and cytochrome oxidase function. The fundamental mechanism, however, is poorly understood. To test the theoretical possibility that bundles of hydrophobic alpha-helices could provide a low energy pathway for ion translocation through the lipid bilayer, polyamino acids were incorporated into extruded liposomes and planar lipid membranes, and proton translocation was measured. Liposomes with incorporated long-chain poly-L-alanine or poly-L-leucine were found to have proton permeability coefficients 5 to 7 times greater than control liposomes, whereas short-chain polyamino acids had relatively little effect. Potassium permeability was not increased markedly by any of the polyamino acids tested. Analytical thin layer chromatography measurements of lipid content and a fluorescamine assay for amino acids showed that there were approximately 135 polyleucine or 65 polyalanine molecules associated with each liposome. Fourier transform infrared spectroscopy indicated that a major fraction of the long-chain hydrophobic peptides existed in an alpha-helical conformation. Single-channel recording in both 0.1 N HCl and 0.1 M KCl was also used to determine whether proton-conducting channels formed in planar lipid membranes (phosphatidylcholine/phosphatidylethanolamine, 1:1). Poly-L-leucine and poly-L-alanine in HCl caused a 10- to 30-fold increase in frequency of conductive events compared to that seen in KCl or by the other polyamino acids in either solution. This finding correlates well with the liposome observations in which these two polyamino acids caused the largest increase in membrane proton permeability but had little effect on potassium permeability. Poly-L-leucine was considerably more conductive than poly-L-alanine due primarily to larger event amplitudes and, to a lesser extent, a higher event frequency. Poly-L-leucine caused two

  18. Alpha-helical hydrophobic polypeptides form proton-selective channels in lipid bilayers

    NASA Technical Reports Server (NTRS)

    Oliver, A. E.; Deamer, D. W.

    1994-01-01

    Proton translocation is important in membrane-mediated processes such as ATP-dependent proton pumps, ATP synthesis, bacteriorhodopsin, and cytochrome oxidase function. The fundamental mechanism, however, is poorly understood. To test the theoretical possibility that bundles of hydrophobic alpha-helices could provide a low energy pathway for ion translocation through the lipid bilayer, polyamino acids were incorporated into extruded liposomes and planar lipid membranes, and proton translocation was measured. Liposomes with incorporated long-chain poly-L-alanine or poly-L-leucine were found to have proton permeability coefficients 5 to 7 times greater than control liposomes, whereas short-chain polyamino acids had relatively little effect. Potassium permeability was not increased markedly by any of the polyamino acids tested. Analytical thin layer chromatography measurements of lipid content and a fluorescamine assay for amino acids showed that there were approximately 135 polyleucine or 65 polyalanine molecules associated with each liposome. Fourier transform infrared spectroscopy indicated that a major fraction of the long-chain hydrophobic peptides existed in an alpha-helical conformation. Single-channel recording in both 0.1 N HCl and 0.1 M KCl was also used to determine whether proton-conducting channels formed in planar lipid membranes (phosphatidylcholine/phosphatidylethanolamine, 1:1). Poly-L-leucine and poly-L-alanine in HCl caused a 10- to 30-fold increase in frequency of conductive events compared to that seen in KCl or by the other polyamino acids in either solution. This finding correlates well with the liposome observations in which these two polyamino acids caused the largest increase in membrane proton permeability but had little effect on potassium permeability. Poly-L-leucine was considerably more conductive than poly-L-alanine due primarily to larger event amplitudes and, to a lesser extent, a higher event frequency. Poly-L-leucine caused two

  19. Charm form factors in hadronic interactions

    SciTech Connect

    Bracco, M. E.; Navarra, F. S.; Nielsen, M.; Chiapparini, M.

    2010-12-28

    We calculate the form factors and the coupling constants in vertices with charm mesons, such as {rho}D*D*, in the framework of QCD sum rules. We first discuss the applications of these form factors in heavy ion collisions and in B decays. We then present an introduction to the method of QCD sum rules and describe how to work with the three-point function. We give special attention to the procedure employed to extrapolate results obtained in the deep euclidean region to the poles of the particles, located in the time-like region. Finally we present a table of ready-to-use parametrizations of all the form factors, which are relevant for the processes mentioned in the introduction. We also give the coupling constants.

  20. The form factors of the nucleons

    SciTech Connect

    Petratos, G.G.

    1993-12-01

    The study of the electromagnetic form factors of the nucleons are of fundamental importance in understanding nucleon structure. The form factors contain all the information about the deviation from pointlike structure of the charge and magnetization current distributions of the nucleons. The hope is that measurements at sufficiently large momentum transfers can provide a microscopic understanding of the nucleon wave functions in terms of their constituent quark amplitudes. Recent measurements of the electric G{sub E}(Q{sup 2}) and magnetic G{sub M}(Q{sup 2}) form factors of the nucleons are reviewed and compared to theoretical calculations based on non-perturbative QCD sum rules, diquark, relativistic constituent quark, and vector meson dominance (VMD) models. A short summary of ongoing and future measurements is also presented.

  1. Proton transfer in guanine-cytosine radical anion embedded in B-form DNA.

    PubMed

    Chen, Hsing-Yin; Kao, Chai-Lin; Hsu, Sodio C N

    2009-11-04

    The electron-attachment-induced proton transfer in the guanine-cytosine (G:C) base pair is thought to be relevant to the issues of charge transport and radiation damage in DNA. However, our understanding on the reaction mainly comes from the data of isolated bases and base pairs, and the behavior of the reaction in the DNA duplex is not clear. In the present study, the proton-transfer reaction in reduced G:C stacks is investigated by quantum mechanical calculations with the aim to clarify how each environmental factor affects the proton transfer in G:C(*-). The calculations show that while the proton transfer in isolated G:C(*-) is exothermic with a small energetic barrier, it becomes endothermic with a considerably enhanced energetic barrier in G:C stacks. The substantial effect of G:C stacking is proved to originate from the electrostatic interactions between the dipole moments of outer G:C base pairs and the middle G:C(*-) base-pair radical anion; the extent of charge delocalization is very small and plays little role in affecting the proton transfer in G:C(*-). On the basis of the electrostatic model, the sequence dependence of the proton transfer in the ionized G:C base pair is predicted. In addition, the water molecules in the first hydration shell around G:C(*-) display a pronounced effect that facilitates the proton-transfer reaction; further consideration of bulk hydration only slightly lowers the energetic barrier and reaction energy. We also notice that the water arrangement around an embedded G:C(*-) is different from that around an isolated G:C(*-), which could result in a very different solvent effect on the energetics of the proton transfer. In contrast to the important influences of base stacking and hydration, the effects of sugar-phosphate backbone and counterions are found to be minor. Our calculations also reveal that a G:C base pair embedded in DNA is capable of accommodating two excess electrons only in bulk hydration; the resultant G(N1-H

  2. Form Factors and Radii of Light Nuclei

    SciTech Connect

    Sick, Ingo

    2015-09-15

    We discuss the determination of electromagnetic form factors from the world data on electron–nucleus scattering for nuclei Z ≤ 3, with particular emphasis on the derivation of the moments required for comparison with measurements from electronic/muonic atoms and isotope shifts.

  3. Electromagnetic charged and neutral kaon form factors

    SciTech Connect

    Roberts, C.D.; Burden, C.J.; Thomson, M.J.

    1995-08-01

    The electromagnetic form factor of the charged and neutral kaon is calculated using the approach applied in the successful study of the pion form factor, described above. The charged kaon form factor will be measured in forthcoming experiments at CEBAF. Our calculation involves the dressed strange quark propagator, to which F{sub {pi}}(q{sup 2}) is not sensitive, and hence it provides us with constraints on the strange-quark sector of QCD. Our preliminary results are encouraging. We find that the strange and up/down quark propagators are not too different, once the change in the current-quark-mass is accounted for. However, the difference that remains is important since it allows {l_angle}{bar s}s{r_angle}<{l_angle}{bar u}u{r_angle}. This calculation is the first to yield a value of f{sub K}/f{sub {pi}} that is in good agreement with experiment and also yields r{sub K+}/r{sub {pi}} in good agreement with experiment. Our calculated charged kaon form factor provides a prediction that will be tested in the forthcoming CEBAF experiments. Our studies also show that K{sup 0} has a negative charge radius, as is to be expected. Our calculated value will be compared with that measured in K{sub s}{sup 0} regeneration from electrons.

  4. Meson-photon transition form factors

    SciTech Connect

    Balakireva, Irina; Lucha, Wolfgang; Melikhov, Dmitri

    2012-10-23

    We present the results of our recent analysis of the meson-photon transition form factors F{sub P{gamma}}(Q{sup 2}) for the pseudoscalar mesons P {pi}{sup 0},{eta},{eta} Prime ,{eta}{sub c}, using the local-duality version of QCD sum rules.

  5. Nucleon and Deuteron Form Factors from BLAST

    SciTech Connect

    Hasell, D. K.

    2009-12-17

    The BLAST experiment was designed to study in a systematic manner the spin-dependent, electromagnetic interaction on hydrogen and deuterium. Measuring only asymmetries in electron scattering with respect to the beam helicity, target spin, or both; the BLAST experiment was able to extract information on nucleon and deuteron form factors independent of beam intensity or target density. By further forming 'super-ratios' of asymmetries, measurements were possible independent of beam and target polarization thus reducing uncertainties due to these quantities as well. Some of the form factor results from BLAST will be briefly presented here. Also, in response to observed discrepancies between polarization measurements and those obtained using traditional Rosenbluth separation techniques a proposed experiment, OLYMPUS, which will use the BLAST detector to measure the two photon contribution to elastic electron scattering will also be presented.

  6. High duty factor plasma generator for CERN's Superconducting Proton Linac.

    PubMed

    Lettry, J; Kronberger, M; Scrivens, R; Chaudet, E; Faircloth, D; Favre, G; Geisser, J-M; Küchler, D; Mathot, S; Midttun, O; Paoluzzi, M; Schmitzer, C; Steyaert, D

    2010-02-01

    CERN's Linac4 is a 160 MeV linear accelerator currently under construction. It will inject negatively charged hydrogen ions into CERN's PS-Booster. Its ion source is a noncesiated rf driven H(-) volume source directly inspired from the one of DESY and is aimed to deliver pulses of 80 mA of H(-) during 0.4 ms at a 2 Hz repetition rate. The Superconducting Proton Linac (SPL) project is part of the luminosity upgrade of the Large Hadron Collider. It consists of an extension of Linac4 up to 5 GeV and is foreseen to deliver protons to a future 50 GeV synchrotron (PS2). For the SPL high power option (HP-SPL), the ion source would deliver pulses of 80 mA of H(-) during 1.2 ms and operate at a 50 Hz repetition rate. This significant upgrade motivates the design of the new water cooled plasma generator presented in this paper. Its engineering is based on the results of a finite element thermal study of the Linac4 H(-) plasma generator that identified critical components and thermal barriers. A cooling system is proposed which achieves the required heat dissipation and maintains the original functionality. Materials with higher thermal conductivity are selected and, wherever possible, thermal barriers resulting from low pressure contacts are removed by brazing metals on insulators. The AlN plasma chamber cooling circuit is inspired from the approach chosen for the cesiated high duty factor rf H(-) source operating at SNS.

  7. Longitudinal electron scattering form factors for 54,56Fe

    NASA Astrophysics Data System (ADS)

    Salman, A. D.; Kadhim, D. R.

    2014-09-01

    In this paper, inelastic longitudinal electron scattering form factors for C2 transition have been studied in 54Fe and 56Fe with the aid of shell model calculations. The GX1 effective interaction for the fp-shell is used with the nucleon-nucleon realistic interaction Michigan three-range Yukawa and Modified surface delta interaction as a two-body interactions. The core polarization effects is taken into account through the first-order perturbation theory with the effective charge, which is taken to the proton and the neutron. The effective charge along with the core effects up to 6 ℏw enhanced the calculation very well and improving good agreement with the experimental data.

  8. Form factors for Russian doll droplet models

    NASA Astrophysics Data System (ADS)

    Wilemski, G.; Obeidat, A.; Hrahsheh, F.

    2013-05-01

    Molecular dynamics (MD) simulations of nanodroplets containing water and nonane show them to be nonspherical and strongly phase separated. A simple, but realistic model for these "Russian doll" structures is a spherical nonane lens that partially wets a spherical water droplet. This document contains an analytical calculation of the particle form factor P(q) needed to analyze experimental measurements of small angle neutron and x-ray scattering from aerosols of particles with this type of structure. In addition, an exact formulation of the particle form factor is developed for cylindrically symmetric droplets with otherwise arbitrary scattering length density functions. This result will be useful to calculate P(q) directly from MD simulation results. We compare results using both formulations and find excellent agreement between them.

  9. Baryon transition form factors at the pole

    SciTech Connect

    Tiator, L.; Döring, M.; Workman, R. L.; Hadžimehmedović, M.; Osmanović, H.; Omerović, R.; Stahov, J.; Švarc, A.

    2016-12-01

    Electromagnetic resonance properties are uniquely defined at the pole and do not depend on the separation of the resonance from background or the decay channel. Photon-nucleon branching ratios are nowadays often quoted at the pole, and we generalize the considerations to the case of virtual photons. We derive and compare relations for nucleon to baryon transition form factors both for the Breit-Wigner and the pole positions. Using the MAID2007 and SAID SM08 partial wave analyses of pion electroproduction data, we compare the $G_M$, $G_E$, and $G_C$ form factors for the $\\Delta(1232)$ resonance excitation at the Breit-Wigner resonance and pole positions up to $Q^2=5$ GeV$^2$. We also explore the $E/M$ and $S/M$ ratios as functions of $Q^2$. For pole and residue extraction, we apply the Laurent + Pietarinen method.

  10. Baryon transition form factors at the pole

    NASA Astrophysics Data System (ADS)

    Tiator, L.; Döring, M.; Workman, R. L.; Hadžimehmedović, M.; Osmanović, H.; Omerović, R.; Stahov, J.; Švarc, A.

    2016-12-01

    Electromagnetic resonance properties are uniquely defined at the pole and do not depend on the separation of the resonance from background or the decay channel. Photon-nucleon branching ratios are nowadays often quoted at the pole, and we generalize the considerations to the case of virtual photons. We derive and compare relations for nucleon to baryon transition form factors both for the Breit-Wigner and the pole positions. Using the MAID2007 and SAID SM08 partial wave analyses of pion electroproduction data, we compare the GM, GE, and GC form factors for the Δ (1232 ) resonance excitation at the Breit-Wigner resonance and pole positions up to Q2=5 GeV2 . We also explore the E /M and S /M ratios as functions of Q2. For pole and residue extraction, we apply the Laurent + Pietarinen method.

  11. A new approach for Delta form factors

    SciTech Connect

    C. Aubin, K. Orginos

    2011-10-01

    We discuss a new approach to reducing excited state contributions from two- and three-point correlation functions in lattice simulations. For the purposes of this talk, we focus on the Delta(1232) resonance and discuss how this new method reduces excited state contamination from two-point functions and mention how this will be applied to three-point functions to extract hadronic form factors.

  12. Heavy to light baryon transition form factors

    SciTech Connect

    Guo, X. |; Huang, T. |; Li, Z.

    1996-05-01

    Recently, Stech found form factor relations for heavy to light transitions based on two simple dynamical assumptions for a spectator particle. In this paper we generalize his approach to the case of baryons and find that for {Lambda}{sub {ital Q}}{r_arrow}{Lambda} ({ital Q}={ital b} or {ital c}) only one independent form factor remains in the limit {ital m}{sub {ital Q}}{r_arrow}{infinity}. Furthermore, combining with the model of Guo and Kroll we determine both of the two form factors for {Lambda}{sub {ital Q}}{r_arrow}{Lambda} in the heavy quark limit. The results are applied to {Lambda}{sub {ital b}}{r_arrow}{Lambda}+{ital J}/{psi} which is not clarified both theoretically and experimentally. It is found that the branching ratio of {Lambda}{sub {ital b}}{r_arrow}{Lambda}+{ital J}/{psi} is of order 10{sup {minus}5}. {copyright} {ital 1996 The American Physical Society.}

  13. Proton tissue dose for the blood forming organ in human geometry: Isotropic radiation

    NASA Technical Reports Server (NTRS)

    Khandelwal, G. S.; Wilson, J. W.

    1974-01-01

    A computer program is described which calculates doses averaged within five major segments of the blood forming organ in the human body taking into account selfshielding of the detailed body geometry and nuclear star effects for proton radiation of arbitrary energy spectrum (energy less than 1 GeV) and isotropic angular distribution. The dose calculation includes the first term of an asymptotic series expansion of transport theory which is known to converge rapidly for most points in the human body. The result is always a conservative estimate of dose and is given as physical dose (rad) and dose equivalent (rem).

  14. Structure of olefin-imidacloprid and gas-phase fragmentation chemistry of its protonated form.

    PubMed

    Fusetto, Roberto; White, Jonathan M; Hutton, Craig A; O'Hair, Richard A J

    2016-02-07

    One of the major insect metabolites of the widely used neonicotinoid insecticide imidacloprid, 1 (1-[(6-chloro-3-pyridinyl)methyl]-N-nitro-1H-imidazol-2-amine), is the olefin 2. To better understand how the structure of olefin 2 relates to the gas-phase fragmentation of its protonated form, 2H(+), X-ray crystallography, tandem mass spectrometry experiments and DFT calculations were carried out. Olefin 2 was found to be in a tautomeric form where the proton is on the N(1) position of the imidazole ring and forms a hydrogen bond to one of the oxygen atoms of the coplanar nitroamine group. Under conditions of low-energy collision-induced dissociation (CID) in a linear ion trap, 2H(+), formed via electrospray ionization (ESI), fragments via a major loss of water, together with minor competing losses of HNO2 and NO2•.This contrasts with 1H+, which mainly undergoes bond homolysis via NO2• loss. Thus, installation of the double bond in 2 plays a key role in facilitating the loss of water. DFT calculations, carried out using the B3LYP/6-311G++(d,p) level of theory, revealed that loss of water was energetically more favourable compared to HNO2 and NO2• loss. Three multistep, energetically accessible mechanisms were identified for loss of water from 2H(+), and these have the following barriers: (I) direct proton transfer from N(5) of the pyridine to O(1) on the NO2 group (119 kJ mol(-1)); (II) rotation of the N(2)-N(4) bond (117 kJ mol(-1)); (III) 1,3-intramolecular proton transfer between the two oxygen atoms of the NO2 group (145 kJ mol(-1)). Given that the lowest barrier for the losses of HNO2 and NO2• is 156 kJ mol(-1), it is likely that all three water loss mechanisms occur concurrently.

  15. DFT study of sulfur derivatives of cumulenes and their protonated forms of interstellar interest and calculations of dissociation energies of protonated forms (SC(CH)C(n-2)S)(+) (n = 3-8).

    PubMed

    Benmensour, Mohamed Ali; Djennane-Bousmaha, Sema; Boucekkine, Abdou

    2014-07-01

    A theoretical study of the sulfur cumulenes SCnS (n = 3-8), CnS ( n = 1-8) and of their protonated forms (SCnS)H(+) and (CnS)H(+) that might exist in the interstellar environment, has been carried out by means of the standard B3LYP/6-311G** method. The geometries and relative energies of singlet and triplet states according to the number of carbons have been computed. Like neutral species, we have found that the ground state of the most stable protonated forms (SC(CH)Cn-2S)(+) and ((HC)Cn-1S)(+), alternates between a triplet state for the even series and a singlet state for the odd series. We provided the data needed to simulate infrared and microwave spectra (vibration frequencies, dipole moments, and rotational constants) for each protonated species (SCnS)H(+) and (CnS)H(+) and for each neutral CnS species. The computing of dissociation energies of the most stable protonated forms (SC(CH)Cn-2S)(+) (n = 3-8) has shown that the lowest values are obtained for the dissociation of compounds with an even number of carbons, in their triplet state, which produce the observed fragments CS and C3S. The dissociation of even protonated forms requires less energy than for the odd protonated forms.

  16. Lattice Calculations of Nucleon Form Factors

    SciTech Connect

    Syritsyn, S. N.

    2011-10-24

    We present recent results of calculation of the isovector electromagnetic and axial form factors of the nucleon using lattice QCD with three different lattice actions and pion masses down to m{sub {pi}} > or approx. 300 MeV. Because of the precision of our high-statistics calculations, we can test predictions of baryon chiral perturbation theory for the charge and axial radii of the nucleon. We find that currently available baryon ChPT calculations disagree with our data, indicating that the corresponding effective theory approximations are not valid above m{sub {pi}{approx_equal}3}00 MeV.

  17. Neutron electric form factor via recoil polarimetry

    SciTech Connect

    Madey, Richard; Semenov, Andrei; Taylor, Simon; Aghalaryan, Aram; Crouse, Erick; MacLachlan, Glen; Plaster, Bradley; Tajima, Shigeyuki; Tireman, William; Yan, Chenyu; Ahmidouch, Abdellah; Anderson, Brian; Asaturyan, Razmik; Baker, O; Baldwin, Alan; Breuer, Herbert; Carlini, Roger; Christy, Michael; Churchwell, Steve; Cole, Leon; Danagoulian, Samuel; Day, Donal; Elaasar, Mostafa; Ent, Rolf; Farkhondeh, Manouchehr; Fenker, Howard; Finn, John; Gan, Liping; Garrow, Kenneth; Gueye, Paul; Howell, Calvin; Hu, Bitao; Jones, Mark; Kelly, James; Keppel, Cynthia; Khandaker, Mahbubul; Kim, Wooyoung; Kowalski, Stanley; Lung, Allison; Mack, David; Manley, D; Markowitz, Pete; Mitchell, Joseph; Mkrtchyan, Hamlet; Opper, Allena; Perdrisat, Charles; Punjabi, Vina; Raue, Brian; Reichelt, Tilmann; Reinhold, Joerg; Roche, Julie; Sato, Yoshinori; Seo, Wonick; Simicevic, Neven; Smith, Gregory; Stepanyan, Samuel; Tadevosyan, Vardan; Tang, Liguang; Ulmer, Paul; Vulcan, William; Watson, John; Wells, Steven; Wesselmann, Frank; Wood, Stephen; Yan, Chen; Yang, Seunghoon; Yuan, Lulin; Zhang, Wei-Ming; Zhu, Hong Guo; Zhu, Xiaofeng

    2003-05-01

    The ratio of the electric to the magnetic form factor of the neutron, G_En/G_Mn, was measured via recoil polarimetry from the quasielastic d({pol-e},e'{pol-n)p reaction at three values of Q^2 [viz., 0.45, 1.15 and 1.47 (GeV/c)^2] in Hall C of the Thomas Jefferson National Accelerator Facility. Preliminary data indicate that G_En follows the Galster parameterization up to Q^2 = 1.15 (GeV/c)^2 and appears to rise above the Galster parameterization at Q^2 = 1.47 (GeV/c)^2.

  18. Recent Studies of Nucleon Electromagnetic Form Factors

    NASA Astrophysics Data System (ADS)

    Gilad, Shalev

    2010-08-01

    The electromagnetic form factors of nucleons are fundamental quantities in nucleon structure. As such, they have been studied extensively both theoretically and experimentally. Significant progress has been made with new measurements at Jlab, MAMI and MIT-Bates, with emphases on expanding the momentum-transfer range and on higher precision. In this paper, we describe the status of this field and present new results from measurements at both low and high momentum transfers. We also compare the experimental data to model predictions, and mention possible implications of the new results to other fields.

  19. Transverse electromagnetic form factor in 12C

    NASA Astrophysics Data System (ADS)

    Cha, D.

    1980-04-01

    We calculate the contribution from the convection current to the recently measured transverse form factor of the 12C 2+ level at 4.44 MeV. The convection current dominates for small momentum transfer and is determined by the B(E 2). In this region, theory agrees with experiment. At intermediate momentum transfer, agreement with experiment is only possible assuming a coherent sum of the convection current and magnetization density contributions. NUCLEAR STRUCTURE 12C, E=4.44 MeV; calculated FT2.

  20. Pion form factor from a contact interaction

    SciTech Connect

    Gutierrez-Guerrero, L. X.; Bashir, A.; Cloeet, I. C.; Roberts, C. D.

    2010-06-15

    In a Poincare-covariant vector-boson-exchange theory, the pion possesses components of pseudovector origin, which materially influence its observable properties. For a range of such quantities, we explore the consequences of a momentum-independent interaction, regularized in a symmetry-preserving manner. The contact interaction, while capable of describing pion static properties, produces a form factor whose evolution for Q{sup 2}>0.17 GeV{sup 2} disagrees markedly with experiment and whose asymptotic power-law behavior conflicts strongly with perturbative QCD.

  1. TCP transcription factors: architectures of plant form.

    PubMed

    Manassero, Nora G Uberti; Viola, Ivana L; Welchen, Elina; Gonzalez, Daniel H

    2013-04-01

    After its initial definition in 1999, the TCP family of transcription factors has become the focus of a multiplicity of studies related with plant development at the cellular, organ, and tissue levels. Evidence has accumulated indicating that TCP transcription factors are the main regulators of plant form and architecture and constitute a tool through which evolution shapes plant diversity. The TCP transcription factors act in a multiplicity of pathways related with cell proliferation and hormone responses. In recent years, the molecular pathways of TCP protein action and biochemical studies on their mode of interaction with DNA have begun to shed light on their mechanism of action. However, the available information is fragmented and a unifying view of TCP protein action is lacking, as well as detailed structural studies of the TCP-DNA complex. Also important, the possible role of TCP proteins as integrators of plant developmental responses to the environment has deserved little attention. In this review, we summarize the current knowledge about the structure and functions of TCP transcription factors and analyze future perspectives for the study of the role of these proteins and their use to modify plant development.

  2. Electromagnetic Transition Form Factors of Nucleon Resonances

    SciTech Connect

    Burkert, Volker D.

    2008-10-13

    Recent measurements of nucleon resonance transition form factors with CLAS at Jefferson Lab are discussed. The new data resolve a long-standing puzzle of the nature of the Roper resonance, and confirm the assertion of the symmetric constituent quark model of the Roper as the first radial excitation of the nucleon. The data on high Q{sup 2} n{pi}{sup +} production confirm the slow fall off of the S{sub 11}(1535) transition form factor with Q{sup 2}, and better constrain the branching ratios {beta}{sub N{pi}} = 0.50 and {beta}{sub N{eta}} = 0.45. For the first time, the longitudinal transition amplitude to the S{sub 11}(1535) was extracted from the n{pi}{sup +} data. Also, new results on the transition amplitudes for the D{sub 13}(1520) resonance are presented showing a rapid transition from helicity 3/2 dominance seen at the real photon point to helicty 1/2 dominance at higher Q{sup 2}.

  3. Helium Compton Form Factor Measurements at CLAS

    SciTech Connect

    Voutier, Eric J.-M.

    2013-07-01

    The distribution of the parton content of nuclei, as encoded via the generalized parton distributions (GPDs), can be accessed via the deeply virtual Compton scattering (DVCS) process contributing to the cross section for leptoproduction of real photons. Similarly to the scattering of light by a material, DVCS provides information about the dynamics and the spatial structure of hadrons. The sensitivity of this process to the lepton beam polarization allows to single-out the DVCS amplitude in terms of Compton form factors that contain GPDs information. The beam spin asymmetry of the $^4$He($\\vec {\\mathrm e}$,e$' \\gamma ^4$He) process was measured in the experimental Hall B of the Jefferson Laboratory to extract the real and imaginary parts of the twist-2 Compton form factor of the $^4$He nucleus. The experimental results reported here demonstrate the relevance of this method for such a goal, and suggest the dominance of the Bethe-Heitler amplitude to the unpolarized process in the kinematic range explored by the experiment.

  4. Measurements of hadron form factors at BESIII

    NASA Astrophysics Data System (ADS)

    Morales, Cristina Morales

    2016-05-01

    BEPCII is a symmetric e+e--collider located in Beijing running at center-of-mass energies between 2.0 and 4.6 GeV. This energy range allows the BESIII-experiment to measure hadron form factors both from direct e+e--annihilation and from initial state radiation processes. In this paper, results on e+e- → p p ¯ based on data collected by BESIII in 2011 and 2012 are presented. We also present preliminary results on e+e- → Λ Λ ¯ based on the same data samples at 4 center-of-mass energies. BESIII results obtained from e+e- → π+π- using the initial state radiation technique at the center-of-mass energy of 3.773 GeV are also summarized. Finally, expectations on the measurement of baryon electromagnetic form factors from the BESIII high luminosity energy scan in 2015 and from initial state radiation processes at different center-of-mass energies are also explained.

  5. Spectroscopic properties of neuroleptics: IR and Raman spectra of Risperidone (Risperdal) and of its mono- and di-protonated forms

    NASA Astrophysics Data System (ADS)

    Alparone, Andrea

    2011-10-01

    Structures and IR and Raman spectra of Risperidone in its neutral, mono- and di-protonated forms were calculated in gas phase by DFT-B3LYP/6-31G* level. Mono-protonation occurs at the nitrogen atom of the piperidine ring, while nitrogen atom of the pyrimidine ring is the preferred site for the second protonation. The lowest-energy structure of the mono-protonated Risperidone is characterized by formation of a strong seven-membered O(pyrimidine ring)⋯ +H-N(piperidine ring) intramolecular hydrogen-bonded cycle. In the high-energy spectral region (3500-2500 cm -1), the bands of the N-H + stretches and the changes in wavenumbers and IR intensities of the C-H stretches near to the piperidine nitrogen atom (Bohlmann effect) are potentially useful to discriminate conformations and protonation states. Di-protonated structures can be identified by the presence of an isolated absorption peak located in the low-energy IR region (660-690 cm -1), attributed to the out-of-plane N-H +(pyrimidine ring) bending deformation. The most intense Raman band of neutral Risperidone placed at ca. 1500 cm -1, assigned to C dbnd C(pyrimidine ring) stretch + C dbnd N(pyrimidine ring) stretch, can be a useful vibrational marker to distinguish the neutral from the protonated forms.

  6. Socioeconomic factors affect the selection of proton radiation therapy for children.

    PubMed

    Shen, Colette J; Hu, Chen; Ladra, Matthew M; Narang, Amol K; Pollack, Craig E; Terezakis, Stephanie A

    2017-10-15

    Proton radiotherapy remains a limited resource despite its clear potential for reducing radiation doses to normal tissues and late effects in children in comparison with photon therapy. This study examined the impact of race and socioeconomic factors on the use of proton therapy in children with solid malignancies. This study evaluated 12,101 children (age ≤ 21 years) in the National Cancer Data Base who had been diagnosed with a solid malignancy between 2004 and 2013 and had received photon- or proton-based radiotherapy. Logistic regression analysis was used to evaluate patient, tumor, and socioeconomic variables affecting treatment with proton radiotherapy versus photon radiotherapy. Eight percent of the patients in the entire cohort received proton radiotherapy, and this proportion increased between 2004 (1.7%) and 2013 (17.5%). Proton therapy was more frequently used in younger patients (age ≤ 10 years; odds ratio [OR], 1.9; 95% confidence interval [CI], 1.6-2.2) and in patients with bone/joint primaries and ependymoma, medulloblastoma, and rhabdomyosarcoma histologies (P < .05). Patients with metastatic disease were less likely to receive proton therapy (OR, 0.4; 95% CI, 0.3-0.6). Patients with private/managed care were more likely than patients with Medicaid or no insurance to receive proton therapy (P < .0001). A higher median household income and educational attainment were also associated with increased proton use (P < .001). Patients treated with proton therapy versus photon therapy were more likely to travel more than 200 miles (13% vs 5%; P < .0001). Socioeconomic factors affect the use of proton radiotherapy in children. Whether this disparity is related to differences in the referral patterns, the knowledge of treatment modalities, or the ability to travel for therapy needs to be further clarified. Improving access to proton therapy in underserved pediatric populations is essential. Cancer 2017;123:4048-56. © 2017 American Cancer Society. © 2017

  7. Neutron-Proton Asymmetry Dependence of Spectroscopic Factors in Ar Isotopes

    SciTech Connect

    Lee, Jenny; Tsang, Betty; Shapira, Dan

    2010-01-01

    Spectroscopic factors have been extracted for proton-rich 34Ar and neutron-rich 46Ar using the (p, d) neutron transfer reaction. The experimental results show little reduction of the ground state neutron spectroscopic factor of the proton-rich nucleus 34Ar compared to that of 46Ar. The results suggest that correlations, which generally reduce such spectroscopic factors, do not depend strongly on the neutron-proton asymmetry of the nucleus in this isotopic region as was reported in knockout reactions. The present results are consistent with results from systematic studies of transfer reactions but inconsistent with the trends observed in knockout reaction measurements.

  8. Physical Nucleon Form Factors from Lattice QCD

    SciTech Connect

    Hrayr Matevosyan; Anthony W. Thomas; Gerald A. Miller

    2005-10-25

    We explore the possibility of extrapolating state of the art lattice QCD calculations of nucleon form factors to the physical regime. We find that the lattice results can be reproduced using the Light Front Cloudy Bag Model and the Extended Gari-Krmpelmann Model by letting their parameters be analytic functions of the quark mass. We then use the models to extend the lattice calculations to large values of Q{sup 2} of interest to current and planned experiments. These functions for the first model are also used to define extrapolations to the physical value of the pion mass, thereby allowing us to study how the predicted zero in G{sub E}(Q{sup 2})/G{sub M}(Q{sup 2}) varies as a function of quark mass.

  9. Nucleon Structure and Hyperon Form Factors from Lattice QCD.

    SciTech Connect

    Lin,H.W.

    2007-06-11

    In this work, I report the latest lattice QCD calculations of nucleon and hyperon structure from chiral fermions in 2+1-flavor dynamical simulations. All calculations are done with a chirally symmetric fermion action, domain-wall fermions, for valence quarks. I begin with the latest lattice results on the nucleon structure, focusing on results from RBC/UKQCD using 2+1-flavor chiral fermion actions. We find the chiral-extrapolated axial coupling constant at physical pion mass point. to be 1.23(5), consistent with experimental value. The renormalization constants for the structure functions are obtained from RI/MOM-scheme non-perturbative renormalization. We find first moments of the polarized and unpolarized nucleon structure functions at zero transfer momentum to be 0.133(13) and 0.203(23) respectively, using continuum chiral extrapolation. These are consistent with the experimental values, unlike previous calculations which have been 50% larger. We also have a prediction for the transversity, which we find to be 0.56(4). The twist-3 matrix element is consistent with zero which agrees with the prediction of the Wandzura-Wilczek relation. In the second half of this work, I report an indirect dynamical estimation of the strangeness proton magnetic moments using mixed actions. With the analysis of hyperon form factors and using charge symmetry, the strangeness of proton is found to be -0.066(2G), consistent with the Adelaide-JLab Collaboration's result. The hyperon {Sigma} and {Xi} axial coupling constants are also performed for the first time in a lattice calculation, g{sub {Sigma}{Sigma}} = 0.441(14) and g{sub {Xi}{Xi}} = -0.277(11).

  10. Nucleon Structure and hyperon form factors from lattice QCD

    SciTech Connect

    Lin, Huey-Wen

    2007-06-11

    In this work, I report the latest lattice QCD calculations of nucleon and hyperon structure from chiral fermions in 2+1-flavor dynamical simulations. All calculations are done with a chirally symmetric fermion action, domain-wall fermions, for valence quarks. I begin with the latest lattice results on the nucleon structure, focusing on results from RBC/UKQCD using 2+1-flavor chiral fermion actions. We find the chiral-extrapolated axial coupling constant at physical pion mass point to be 1.23(5), consistant with experimental value. The renormalization constants for the structure functions are obtained from RI/MOM-scheme non-perturbative renormalization. We find first moments of the polarized and unpolarized nucleon structure functions at zero transfer momentum to be 0.133(13) and 0.203(23) respectively, using continuum chiral extrapolation. These are consistent with the experimental values, unlike previous calculations which have been 50% larger. We also have a prediction for the transversity, which we find to be 0.56(4). The twist-3 matrix element is consistent with zero which agrees with the prediction of the Wandzura-Wilczek relation. In the second half of this work, I report an indirect dynamical estimation of the strangeness proton magnetic moments using mixed actions. With the analysis of hyperon form factors and using charge symmetry, the strangeness of proton is found to be -0.066(26), consistent with the Adelaide-JLab Collaboration's result. The hyperon Sigma and Xi axial coupling constants are also performed for the first time in a lattice calculation, g_SigmaSigma = 0.441(14) and g_XiXi = -0.277(11).

  11. Analysis of nucleon electromagnetic form factors from light-front holographic QCD: The spacelike region

    NASA Astrophysics Data System (ADS)

    Sufian, Raza Sabbir; de Téramond, Guy F.; Brodsky, Stanley J.; Deur, Alexandre; Dosch, Hans Günter

    2017-01-01

    We present a comprehensive analysis of the spacelike nucleon electromagnetic form factors and their flavor decomposition within the framework of light-front (LF) holographic QCD (LFHQCD) We show that the inclusion of the higher Fock components |q q q q q ¯ ⟩ has a significant effect on the spin-flip elastic Pauli form factor and almost zero effect on the spin-conserving Dirac form factor. We present light-front holographic QCD results for the proton and neutron form factors at any momentum transfer range, including asymptotic predictions, and show that our results agree with the available experimental data with high accuracy. In order to correctly describe the Pauli form factor we need an admixture of a five quark state of about 30% in the proton and about 40% in the neutron. We also extract the nucleon charge and magnetic radii and perform a flavor decomposition of the nucleon electromagnetic form factors. The free parameters needed to describe the experimental nucleon form factors are very few: two parameters for the probabilities of higher Fock states for the spin-flip form factor and a phenomenological parameter r , required to account for possible SU(6) spin-flavor symmetry breaking effects in the neutron, whereas the Pauli form factors are normalized to the experimental values of the anomalous magnetic moments. The covariant spin structure for the Dirac and Pauli nucleon form factors prescribed by AdS5 semiclassical gravity incorporates the correct twist scaling behavior from hard scattering and also leads to vector dominance at low energy.

  12. Analysis of nucleon electromagnetic form factors from light-front holographic QCD: The spacelike region

    DOE PAGES

    Sufian, Raza Sabbir; de Teramond, Guy F.; Brodsky, Stanley J.; ...

    2017-01-10

    We present a comprehensive analysis of the space-like nucleon electromagnetic form factors and their flavor decomposition within the framework of light-front holographic QCD. We show that the inclusion of the higher Fock componentsmore » $$|{qqqq\\bar{q}}$$ has a significant effect on the spin-flip elastic Pauli form factor and almost zero effect on the spin-conserving Dirac form factor. We present light-front holographic QCD results for the proton and neutron form factors at any momentum transfer range, including asymptotic predictions, and show that our results agree with the available experimental data with high accuracy. In order to correctly describe the Pauli form factor we need an admixture of a five quark state of about 30$$\\%$$ in the proton and about 40$$\\%$$ in the neutron. We also extract the nucleon charge and magnetic radii and perform a flavor decomposition of the nucleon electromagnetic form factors. The free parameters needed to describe the experimental nucleon form factors are very few: two parameters for the probabilities of higher Fock states for the spin-flip form factor and a phenomenological parameter $r$, required to account for possible SU(6) spin-flavor symmetry breaking effects in the neutron, whereas the Pauli form factors are normalized to the experimental values of the anomalous magnetic moments. As a result, the covariant spin structure for the Dirac and Pauli nucleon form factors prescribed by AdS$$_5$$ semiclassical gravity incorporates the correct twist scaling behavior from hard scattering and also leads to vector dominance at low energy.« less

  13. First X-ray diffraction and quantum chemical study of proton-acceptor and proton-donor forms of 5-carboxylcytosine, the last-discovered nucleobase

    NASA Astrophysics Data System (ADS)

    Irrera, Simona; Portalone, Gustavo

    2013-10-01

    The recently-discovered nucleobase 5-carboxylcytosine (caC) is the final product of oxidative attack on the 5 position of cytosine. It can exist in solution in an equilibrium of different protonated and unprotonated forms within a range of pH, although only the zwitterionic caC± and the anionic caC- species have been detected in the liquid phase. In this work, four proton-transfer compounds of caC have been prepared by varying chemical reagents to ensure different pH during crystallization, and then determined by X-ray crystallography: 5-carboxylcytosinium chloride, bromide and nitrate and 5-carboxylcytosinate phenylbiguanidium. Both cationic and anionic species of caC exist in the solid state as canonical aminooxo tautomers. In caCH+-containing compounds, site protonation always occurs at N3 imino atom. Structural changes in the heterocyclic ring of cationic and anionic forms of caC can be interpreted, in terms of valence bond theory, as an increase in the contribution of different polar canonical forms. Quantum chemical calculations on unionized 5-carboxylcytosine, as well as on the zwitterionic and the anionic species, are also reported in order to estimate the relative energies of the possible tautomeric forms. Theoretical calculations confirm the existence in the isolated molecules of the strong intramolecular hydrogen bond found in the crystal between the adjacent amino and carboxyl groups.

  14. Delayed release film coating applications on oral solid dosage forms of proton pump inhibitors: case studies.

    PubMed

    Missaghi, Shahrzad; Young, Cara; Fegely, Kurt; Rajabi-Siahboomi, Ali R

    2010-02-01

    Formulation of proton pump inhibitors (PPIs) into oral solid dosage forms is challenging because the drug molecules are acid-labile. The aim of this study is to evaluate different formulation strategies (monolithic and multiparticulates) for three PPI drugs, that is, rabeprazole sodium, lansoprazole, and esomeprazole magnesium, using delayed release film coating applications. The core tablets of rabeprazole sodium were prepared using organic wet granulation method. Multiparticulates of lansoprazole and esomeprazole magnesium were prepared through drug layering of sugar spheres, using powder layering and suspension layering methods, respectively. Tablets and drug-layered multiparticulates were seal-coated, followed by delayed release film coating application, using Acryl-EZE(R), aqueous acrylic enteric system. Multiparticulates were then filled into capsules. The final dosage forms were evaluated for physical properties, as well as in vitro dissolution testing in both compendial acid phase, 0.1N HCl (pH 1.2), and intermediate pH, acetate buffer (pH 4.5), followed by phosphate buffer, pH 6.8. The stability of the delayed release dosage forms was evaluated upon storage in accelerated conditions [40 degrees C/75% relative humidity] for 3 months. All dosage forms demonstrated excellent enteric protection in the acid phase, followed by rapid release in their respective buffer media. Moreover, the delayed release dosage forms remained stable under accelerated stability conditions for 3 months. Results showed that Acryl-EZE enteric coating systems provide excellent performance in both media (0.1N HCl and acetate buffer pH 4.5) for monolithic and multiparticulate dosage forms.

  15. Neutrons in proton pencil beam scanning: parameterization of energy, quality factors and RBE

    NASA Astrophysics Data System (ADS)

    Schneider, Uwe; Hälg, Roger A.; Baiocco, Giorgio; Lomax, Tony

    2016-08-01

    The biological effectiveness of neutrons produced during proton therapy in inducing cancer is unknown, but potentially large. In particular, since neutron biological effectiveness is energy dependent, it is necessary to estimate, besides the dose, also the energy spectra, in order to obtain quantities which could be a measure of the biological effectiveness and test current models and new approaches against epidemiological studies on cancer induction after proton therapy. For patients treated with proton pencil beam scanning, this work aims to predict the spatially localized neutron energies, the effective quality factor, the weighting factor according to ICRP, and two RBE values, the first obtained from the saturation corrected dose mean lineal energy and the second from DSB cluster induction. A proton pencil beam was Monte Carlo simulated using GEANT. Based on the simulated neutron spectra for three different proton beam energies a parameterization of energy, quality factors and RBE was calculated. The pencil beam algorithm used for treatment planning at PSI has been extended using the developed parameterizations in order to calculate the spatially localized neutron energy, quality factors and RBE for each treated patient. The parameterization represents the simple quantification of neutron energy in two energy bins and the quality factors and RBE with a satisfying precision up to 85 cm away from the proton pencil beam when compared to the results based on 3D Monte Carlo simulations. The root mean square error of the energy estimate between Monte Carlo simulation based results and the parameterization is 3.9%. For the quality factors and RBE estimates it is smaller than 0.9%. The model was successfully integrated into the PSI treatment planning system. It was found that the parameterizations for neutron energy, quality factors and RBE were independent of proton energy in the investigated energy range of interest for proton therapy. The pencil beam algorithm has

  16. Neutrons in proton pencil beam scanning: parameterization of energy, quality factors and RBE.

    PubMed

    Schneider, Uwe; Hälg, Roger A; Baiocco, Giorgio; Lomax, Tony

    2016-08-21

    The biological effectiveness of neutrons produced during proton therapy in inducing cancer is unknown, but potentially large. In particular, since neutron biological effectiveness is energy dependent, it is necessary to estimate, besides the dose, also the energy spectra, in order to obtain quantities which could be a measure of the biological effectiveness and test current models and new approaches against epidemiological studies on cancer induction after proton therapy. For patients treated with proton pencil beam scanning, this work aims to predict the spatially localized neutron energies, the effective quality factor, the weighting factor according to ICRP, and two RBE values, the first obtained from the saturation corrected dose mean lineal energy and the second from DSB cluster induction. A proton pencil beam was Monte Carlo simulated using GEANT. Based on the simulated neutron spectra for three different proton beam energies a parameterization of energy, quality factors and RBE was calculated. The pencil beam algorithm used for treatment planning at PSI has been extended using the developed parameterizations in order to calculate the spatially localized neutron energy, quality factors and RBE for each treated patient. The parameterization represents the simple quantification of neutron energy in two energy bins and the quality factors and RBE with a satisfying precision up to 85 cm away from the proton pencil beam when compared to the results based on 3D Monte Carlo simulations. The root mean square error of the energy estimate between Monte Carlo simulation based results and the parameterization is 3.9%. For the quality factors and RBE estimates it is smaller than 0.9%. The model was successfully integrated into the PSI treatment planning system. It was found that the parameterizations for neutron energy, quality factors and RBE were independent of proton energy in the investigated energy range of interest for proton therapy. The pencil beam algorithm has

  17. Nucleon electromagnetic form factors using lattice simulations at the physical point

    NASA Astrophysics Data System (ADS)

    Alexandrou, C.; Constantinou, M.; Hadjiyiannakou, K.; Jansen, K.; Kallidonis, Ch.; Koutsou, G.; Vaquero Aviles-Casco, A.

    2017-08-01

    We present results for the nucleon electromagnetic form factors using an ensemble of maximally twisted mass clover-improved fermions with pion mass of about 130 MeV. We use multiple sink-source separations and three analysis methods to probe ground-state dominance. We evaluate both the connected and disconnected contributions to the nucleon matrix elements. We find that the disconnected quark loop contributions to the isoscalar matrix elements are small, giving an upper bound of up to 2% of the connected and smaller than its statistical error. We present results for the isovector and isoscalar electric and magnetic Sachs form factors and the corresponding proton and neutron form factors. By fitting the momentum dependence of the form factors to a dipole form or to the z expansion, we extract the nucleon electric and magnetic radii, as well as the magnetic moment. We compare our results to experiment as well as to other recent lattice QCD calculations.

  18. Vector and Axial Vector Pion Form Factors

    NASA Astrophysics Data System (ADS)

    Vitz, Michael; PEN Collaboration

    2015-04-01

    Radiative pion decay π+ -->e+ νγ (RPD) provides critical input to chiral perturbation theory (χPT). Aside from the uninteresting ``inner bremsstrahlung'' contribution from QED, the RPD rate contains ``structure dependent'' terms given by FV and FA, the vector and axial-vector pion form factors, respectively. The two appear in the decay rate in combinations FV -FA and FV +FA , i.e., in the so-called SD- and SD+ terms, respectively. The latter has been measured to high precision by the PIBETA collaboration. We report on the analysis of new data, measured by the PEN collaboration in runs between 2008 and 2010 at the Paul Scherrer Institute, Switzerland. We particularly focus on the possibility of improvement in the determination of the SD- term. Precise determinations of FV and FA test the validity of the CVC hypothesis, provide numerical input for the l9 +l10 terms in the χPT lagrangian, and constrain potential non-(V - A) terms, such as a possible tensor term FT. NSF grants PHY-0970013, 1307328, and others.

  19. The {Delta}(1232) resonance transition form factor

    SciTech Connect

    Staurt, L.M. |; Bosted, P.E.; Lung, A.

    1993-08-01

    Old and new measurements of inclusive e--p cross sections in the {Delta}(1232) resonance region have been combined, and a global data fit has been made. Using this fit to parameterize the nonresonant background, the transition form factors have been extracted out to a four-momentum transfer, Q{sup 2}, of 9.8 (GeV/c){sup 2}. The results are systematically higher than those from a previous analysis, but agree within errors. A similar analysis has been done with e--d cross sections, and {sigma}{sub n}/{sigma}{sub p} in the {Delta}(1232) resonance region has been extracted out to a Q{sup 2} of 7.9 (GeV/c){sup 2}. {sigma}{sub n}/{sigma}{sub p} for {Delta}(1232) production is consistent with unity, while {sigma}{sub n}/{sigma}{sub p} for the nonresonant background is constant with Q{sup 2} at approximately 0.4.

  20. On the accessibility to conical intersections in purines: hypoxanthine and its singly protonated and deprotonated forms.

    PubMed

    Villabona-Monsalve, Juan P; Noria, Raquel; Matsika, Spiridoula; Peón, Jorge

    2012-05-09

    The dynamics following electronic excitation of hypoxanthine and its nucleoside inosine were studied by femtosecond fluorescence up-conversion. Our objective was to explore variants of the purinic DNA bases in order to determine the molecular parameters that increase or reduce the accessibility to ground state conical intersections. From experiments in water and methanol solution we conclude that both dominant neutral tautomers of hypoxanthine exhibit ultrashort excited state lifetimes (τ < 0.2 ps), which are significantly shorter than in the related nucleobase guanine. This points to a more accessible conical intersection for the fluorescent state upon removal of the amino group, present in guanine but absent in hypoxanthine. The excited state dynamics of singly protonated hypoxanthine were also studied, showing biexponential decays with a 1.1 ps component (5%) besides a sub-0.2 ps ultrafast component. On the other hand, the S(1) lifetimes of the singly deprotonated forms of hypoxanthine and inosine show drastic differences, where the latter remains ultrafast but the singly deprotonated hypoxanthine shows a much longer lifetime of 19 ps. This significant variation is related to the different deprotonation sites in hypoxanthine versus inosine, which gives rise to significantly different resonance structures. In our study we also include multireference perturbation theory (MRMP2) excited state calculations in order to determine the nature of the initial electronic excitation in our experiments and clarify the ordering of the states in the singlet manifold at the ground state geometry. In addition, we performed multireference configuration interaction calculations (MR-CIS) that identify the presence of low-lying conical intersections for both prominent neutral tautomers of hypoxanthine. In both cases, the surface crossings occur at geometries reached by out of plane opposite motions of C2 and N3. The study of this simpler purine gives several insights into how small

  1. The energy spectra of solar energetic protons in the large energy range: their functional form and parameters.

    NASA Astrophysics Data System (ADS)

    Nymmik, Rikho; Pervaia, Taisia

    2016-07-01

    Experimental data on the fluxes of protons of solar energetic particles (SEP) are analyzed. It is known that above energies of 2-45 MeV (averaging 27-30 MeV), the proton spectra are a power-law function of the energy (at relativistic energies - from the momentum) of the particles. At lower energies, the spectra become harder, with the high-energy part of the spectra forming the "knee". This report is devoted to the determination of the parameters of the SEP spectra, having the form of a "double power-law shape", to ascertain the reliability of the parameters of the approximations of the experimental data.

  2. How Rhodopsin Tunes the Equilibrium between Protonated and Deprotonated Forms of the Retinal Chromophore.

    PubMed

    van Keulen, Siri C; Solano, Alicia; Rothlisberger, Ursula

    2017-09-12

    Rhodopsin is a photoactive G-protein-coupled receptor (GPCR) that converts dim light into a signal for the brain, leading to eyesight. Full activation of this GPCR is achieved after passing through several steps of the protein's photoactivation pathway. Key events of rhodopsin activation are the initial cis-trans photoisomerization of the covalently bound retinal moiety followed by conformational rearrangements and deprotonation of the chromophore's protonated Schiff base (PSB), which ultimately lead to full activation in the meta II state. PSB deprotonation is crucial for achieving full activation of rhodopsin; however, the specific structural rearrangements that have to take place to induce this pKa shift are not well understood. Classical molecular dynamics (MD) simulations were employed to identify intermediate states after the cis-trans isomerization of rhodopsin's retinal moiety. In order to select the intermediate state in which PSB deprotonation is experimentally known to occur, the validity of the intermediate configurations was checked through an evaluation of the optical properties in comparison with experiment. Subsequently, the selected state was used to investigate the molecular factors that enable PSB deprotonation at body temperature to obtain a better understanding of the difference between the protonated and the deprotonated state of the chromophore. To this end, the deprotonation reaction has been investigated by applying QM/MM MD simulations in combination with thermodynamic integration. The study shows that, compared to the inactive 11-cis-retinal case, trans-retinal rhodopsin is able to undergo PSB deprotonation due to a change in the conformation of the retinal and a consequent alteration in the hydrogen-bond (HB) network in which PSB and the counterion Glu113 are embedded. Besides the retinal moiety and Glu113, also two water molecules as well as Thr94 and Gly90 that are related to congenital night blindness are part of this essential HB

  3. Proton beam shaped by "particle lens" formed by laser-driven hot electrons

    NASA Astrophysics Data System (ADS)

    Zhai, S. H.; Shen, B. F.; Wang, W. P.; Zhang, H.; He, S. K.; Lu, F.; Zhang, F. Q.; Deng, Z. G.; Dong, K. G.; Wang, S. Y.; Zhou, K. N.; Xie, N.; Wang, X. D.; Zhang, L. G.; Huang, S.; Liu, H. J.; Zhao, Z. Q.; Gu, Y. Q.; Zhang, B. H.; Xu, Z. Z.

    2016-05-01

    Two-dimensional tailoring of a proton beam is realized by a "particle lens" in our experiment. A large quantity of electrons, generated by an intense femtosecond laser irradiating a polymer target, produces an electric field strong enough to change the trajectory and distribution of energetic protons flying through the electron area. The experiment shows that a strip pattern of the proton beam appears when hot electrons initially converge inside the plastic plate. Then the shape of the proton beam changes to a "fountain-like" pattern when these hot electrons diffuse after propagating a distance.

  4. Proton beam shaped by “particle lens” formed by laser-driven hot electrons

    SciTech Connect

    Zhai, S. H.; Shen, B. F. E-mail: wwpvin@hotmail.com Wang, W. P. E-mail: wwpvin@hotmail.com Zhang, H.; Zhang, L. G.; Huang, S.; Xu, Z. Z.; He, S. K.; Lu, F.; Zhang, F. Q.; Deng, Z. G.; Dong, K. G.; Wang, S. Y.; Zhou, K. N.; Xie, N.; Wang, X. D.; Liu, H. J.; Zhao, Z. Q.; Gu, Y. Q. E-mail: wwpvin@hotmail.com Zhang, B. H.

    2016-05-23

    Two-dimensional tailoring of a proton beam is realized by a “particle lens” in our experiment. A large quantity of electrons, generated by an intense femtosecond laser irradiating a polymer target, produces an electric field strong enough to change the trajectory and distribution of energetic protons flying through the electron area. The experiment shows that a strip pattern of the proton beam appears when hot electrons initially converge inside the plastic plate. Then the shape of the proton beam changes to a “fountain-like” pattern when these hot electrons diffuse after propagating a distance.

  5. Matter density distributions and elastic form factors of some two-neutron halo nuclei

    NASA Astrophysics Data System (ADS)

    Abdullah, Ahmed N.

    2017-09-01

    The Skyrme-Hartree-Fock (SHF) method with MSK7 Skyrme parameter has been used to investigate the ground-state properties for two-neutron halo nuclei 6He, ^{11}Li, ^{12}Be and ^{14}Be. These ground-state properties include the proton, neutron and matter density distributions, the corresponding rms radii, the binding energy per nucleon and the charge form factors. These calculations clearly reveal the long tail characterizing the halo nuclei as a distinctive feature.

  6. Energetics and chemical bonding of the 1,3,5-tridehydrobenzene triradical and its protonated form

    NASA Astrophysics Data System (ADS)

    Nguyen, Hue Minh Thi; Höltzl, Tibor; Gopakumar, G.; Veszprémi, Tamás; Peeters, Jozef; Nguyen, Minh Tho

    2005-09-01

    Quantum chemical calculations were applied to investigate the electronic structure of the parent 1,3,5-tridehydrobenzene triradical (C 6H 3, TDB) and its anion (C6H3-), cation (C6H3+) and protonated form (C6H4+). Our results obtained using the state-averaged complete active space self-consistent-field (CASSCF) followed by second-order multi-state multi-configuration perturbation theory, MS-CASPT2, and MRMP2 in conjunction with the large ANO-L and 6-311++G(3df,2p) basis set, confirm and reveal the followings: (i) TDB has a doublet 2A 1 ground state with a 4B 2- 2A 1 energy gap of 29 kcal/mol, (ii) the ground state of the C6H3- anion in the triplet 3B 2 being 4 kcal/mol below the 1A 1 state. (iii) the electron affinity (EA), ionization energy (IE) and proton affinity (PA) are computed to be: EA = 1.6 eV, IE = 7.2 eV, PA = 227 kcal/mol using UB3LYP/6-311++G(3df,2p) + ZPE; standard heat of formation Δ Hf(298 K, 1 atm) (TDB) = 179 ± 2 kcal/mol was calculated with CBS-QB3 method. An atoms-in-molecules (AIM) analysis of the structure reveals that the topology of the electron density is similar in all compounds: hydrogens connect to a six-membered ring, except for the case of the 2A 2 state of C6H4+ (MBZ +) which is bicyclic with fused five- and three-membered rings. Properties of the chemical bonds were characterized with Electron Localization Function (ELF) analysis, as well as Wiberg indices, Laplacian and spin density maps. We found that the radicals form separate monosynaptic basins on the ELF space, however its pair character remains high. In the 2A 1 state of TDB, the radical center is mainly localized on the C1 atom, while in the 2B 2 state it is equally distributed between the C3 and C5 atoms and, due to the symmetry, in the 4B 2 state the C1, C2 and C3 atoms have the same radical character. There is no C3-C5 bond in the 2A 1 state of TDB, but the interaction between these atoms is strong. The ground state of cation C6H3+ (DHP), 1A 1, is not a diradical and has

  7. Time-like nucleon form factor measurements at overline{textbf{P}}textbf{ANDA}

    NASA Astrophysics Data System (ADS)

    Sudoł, Małgorzata

    2009-11-01

    The electromagnetic probe is an excellent tool to investigate the structure of the nucleon. The nearly 4 π detector PANDA, to be installed on the FAIR accelerator complex at Darmstadt, will allow to make a precise determination of the electromagnetic form factors of the proton in the time-like (TL) region with unprecedented precision. In the framework of the one-photon exchange, the center of mass unpolarized differential cross section of the reaction overline{p} p rightarrow e^+ e^- is a linear combination of the squared moduli of the electric Gp_E and magnetic Gp_M proton form factors. The precise measurement of the angular distribution over almost full angular range then directly gives these quantities. Only two experiments have provided the ratio R = {|Gp_E|/|Gp_M|} but with very large statistical uncertainties. Within PANDA, there is a unique opportunity to measure separately the moduli of these two proton form factors Gp_E and Gp_M in good conditions, up to around q 2 = 14 GeV2.

  8. Quantification of radiation dose from short-lived positron emitters formed in human tissue under proton therapy conditions

    NASA Astrophysics Data System (ADS)

    Kettern, K.; Coenen, H. H.; Qaim, S. M.

    2009-06-01

    The dose distribution in proton therapy is mainly due to primary particles and secondary electrons. The contribution of short-lived β + emitters formed in the interactions of protons with the light mass elements C, N and O has hitherto not been considered. We estimated the formation of 11C, 13N and 15O in irradiation of tissue with 200 MeV protons. The integral yields at 150 MeV were compared with a literature phantom measurement. The results for 11C and 15O agreed very well; for 13N, however, appreciable deviation was observed. The activities were also calculated in the region around the Bragg peak as well as over the path length after entrance of the beam. Dose calculations were then done using the medical internal radiation dose (MIRD) formalism. Furthermore, a dose calculation was simulated for a 150 MeV proton beam (2 nA, 2 min) in a brain tumour. The dose deposited by the positron emitters in the Bragg peak region was found to be about 1.5 mGy, i.e. less than 1% of the dose estimated from the electronic interactions of protons. The absorbed dose in the whole brain amounted to 5.5 mGy.

  9. Hydrogen forms in water by proton transfer to a distorted electron.

    PubMed

    Marsalek, Ondrej; Frigato, Tomaso; VandeVondele, Joost; Bradforth, Stephen E; Schmidt, Burkhard; Schütte, Christof; Jungwirth, Pavel

    2010-01-21

    Solvated electrons are ubiquitous intermediates in radiation-induced processes, with their lifetime being determined by quenching processes, such as the direct reaction with protons under acidic conditions. Ab initio molecular dynamics simulations allow us to unravel with molecular resolution the ultrafast reaction mechanism by which the electron and proton react in water. The path to a successful reaction involves a distortion and contraction of the hydrated electron and a rapid proton motion along a chain of hydrogen bonds, terminating on the water molecule most protruding into the electron cloud. This fundamental reaction is thus decidedly shown to be of a proton-transfer rather than electron-transfer character. Due to the desolvation penalty connected with breaking of the hydration shells of these charged particles, the reaction is, however, not diffusion-limited, in agreement with the interpretation of kinetics measurements.

  10. Nickel phlorin intermediate formed by proton-coupled electron transfer in hydrogen evolution mechanism

    PubMed Central

    Solis, Brian H.; Maher, Andrew G.; Dogutan, Dilek K.; Nocera, Daniel G.; Hammes-Schiffer, Sharon

    2016-01-01

    The development of more effective energy conversion processes is critical for global energy sustainability. The design of molecular electrocatalysts for the hydrogen evolution reaction is an important component of these efforts. Proton-coupled electron transfer (PCET) reactions, in which electron transfer is coupled to proton transfer, play an important role in these processes and can be enhanced by incorporating proton relays into the molecular electrocatalysts. Herein nickel porphyrin electrocatalysts with and without an internal proton relay are investigated to elucidate the hydrogen evolution mechanisms and thereby enable the design of more effective catalysts. Density functional theory calculations indicate that electrochemical reduction leads to dearomatization of the porphyrin conjugated system, thereby favoring protonation at the meso carbon of the porphyrin ring to produce a phlorin intermediate. A key step in the proposed mechanisms is a thermodynamically favorable PCET reaction composed of intramolecular electron transfer from the nickel to the porphyrin and proton transfer from a carboxylic acid hanging group or an external acid to the meso carbon of the porphyrin. The C–H bond of the active phlorin acts similarly to the more traditional metal-hydride by reacting with acid to produce H2. Support for the theoretically predicted mechanism is provided by the agreement between simulated and experimental cyclic voltammograms in weak and strong acid and by the detection of a phlorin intermediate through spectroelectrochemical measurements. These results suggest that phlorin species have the potential to perform unique chemistry that could prove useful in designing more effective electrocatalysts. PMID:26655344

  11. Studies of Nucleon Form Factors with 12 GeV CEBAF and SuperBigBite

    SciTech Connect

    Hansen, Jens-Ole

    2012-04-01

    The elastic electromagnetic form factors are among the most fundamental quantities that describe the ground-state structure of the proton and neutron. Precision data of the form factors over a wide kinematical range provide a powerful test of current theories of hadron structure. A number of experiments aiming to measure the electric and magnetic elastic form factors of the neutron, G{sub E}{sup n} and G{sub M}{sup n}, and proton, G{sub E}{sup p}, at very high momentum transfer, up to the range of Q{sup 2} = 10-14 (GeV/c){sup 2}, are planned to be carried out with the future 11 GeV electron beam of the upgraded CEBAF at Jefferson Lab. These experiments will determine the nucleon form factors with unprecedented precision to Q{sup 2}-values up to three times higher than those of existing data. We review the approved proposals and the conceptual design of a new spectrometer, SuperBigBite, that will be used in these and other future experiments at Jefferson Lab.

  12. Electromagnetic Transition Form Factor of the η meson with WASA-at-COSY

    NASA Astrophysics Data System (ADS)

    Goswami, A.

    2016-11-01

    In this work we present a study of the Dalitz decay η → γe+e-. The aim of this work is to measure the transition form factor of the η meson. The transition form factor of the η meson describes the electromagnetic structure of the meson. The study of the Dalitz decay helps to calculate the transition form factor of the η meson. When a particle is point-like it's decay rate can be calculated within QED. However, the complex structure of the meson modifies its decay rate. The transition form factor is determined by comparing the lepton-antilepton invariant mass distribution with QED. For this study data on proton-proton reaction at a beam energy of 1.4 GeV has been collected with WASA-at-COSY detector at Forschungszentrum Juelich, Germany. In the higher invariant mass region recent theoretical calculations slightly deviate from the fit to the data. We expect better results in the higher invariant mass region than previous measurements. The preliminary results of the analysis will be presented.

  13. The three loop slope of the Dirac form factor and the S Lamb shift in hydrogen

    SciTech Connect

    Melnikov, K.

    1999-12-08

    The last unknown contribution to hydrogen energy levels at order malpha{sup 7}, due to the slope of the Dirac form factor at three loops, is evaluated in a closed analytical form. The resulting shift of the hydrogen nS energy level is found to be 3.016/n{sup 3} kHz. Using the QED calculations of the 1S Lamb shift, the authors extract a precise value of the proton charge radius r{sub p} = 0.883{+-}0.014 fm.

  14. Virtuality Distributions and Pion Transition Form Factor

    DOE PAGES

    Radyushkin, Anatoly V.

    2015-03-01

    Using the example of hard exclusive transition process γ*γ → π0 at the handbag level, we outline basics of a new approach to transverse momentum dependence in hard processes. In coordinate representation, matrix elements of operators (in the simplest case, bilocal O(0,z)) describing a hadron with momentum p, are functions of (pz) and z2 parametrized through virtuality distribution amplitudes (VDA) Φ(x, σ), with x being Fourier-conjugate to (pz) and σ Laplace-conjugate to z2. For intervals with z+=0, we introduce the transverse momentum distribution amplitude (TMDA) Ψ(x, k_perp), and write it in terms of VDA Φ(x,σ). We propose models for softmore » VDAs/TMDAs, and use them for comparison of handbag results with experimental (BaBar and BELLE) data. We also discuss the generation of hard tails of TMDAs from initially soft forms.« less

  15. Electromagnetic structure of the proton within the CP-violation hypothesis

    SciTech Connect

    Krutov, A. F. Kudinov, M. Yu.

    2013-11-15

    The so-called non-Rosenbluth behavior of the proton electromagnetic form factors can be explained within the hypothesis of CP violation in electromagnetic processes involving composite systems of strongly interacting particles. It is shown that this hypothesis leads to the appearance of an additional, anapole, form factor of the proton. The proton electromagnetic form factors, including the anapole form factor, are estimated on the basis of experimental data on elastic electron-proton scattering.

  16. Factor Structure of the Personality Research Form-E: A Maximum Likelihood Analysis.

    ERIC Educational Resources Information Center

    Fowler, Patrick C.

    1985-01-01

    Presents a five-factor, structural model of the Personality Research Form-E for 140 university undergraduates. All factors demonstrated an excellent level of similarity to those previously reported for other forms of the PRF, as well as to the conceptual scheme developed by Jackson (1974). (Author/JAC)

  17. Ab initio study of the molecular structure and vibrational spectrum of nitric acid and its protonated forms

    NASA Technical Reports Server (NTRS)

    Lee, Timothy J.; Rice, Julia E.

    1992-01-01

    The equilibrium structures, harmonic vibrational frequencies, IR intensities, and relative energetics of HNO3 and its protonated form H2NO3+ were investigated using double-zeta plus polarization and triple-zeta plus polarization basis sets in conjunction with high-level ab initio methods. The latter include second-order Moller-Plesset perturbation theory, the single and double excitation coupled cluster (CCSD) methods, a perturbational estimate of the effects of connected triple excitations (CCSD(T)), and the self-consistent field. To determine accurate energy differences CCSD(T) energies were computed using large atomic natural orbital basis sets. Four different isomers of H2NO3+ were considered. The lowest energy form of protonated nitric acid was found to correspond to a complex between H2O and NO2+, which is consistent with earlier theoretical and experimental studies.

  18. Ab initio study of the molecular structure and vibrational spectrum of nitric acid and its protonated forms

    NASA Technical Reports Server (NTRS)

    Lee, Timothy J.; Rice, Julia E.

    1992-01-01

    The equilibrium structures, harmonic vibrational frequencies, IR intensities, and relative energetics of HNO3 and its protonated form H2NO3+ were investigated using double-zeta plus polarization and triple-zeta plus polarization basis sets in conjunction with high-level ab initio methods. The latter include second-order Moller-Plesset perturbation theory, the single and double excitation coupled cluster (CCSD) methods, a perturbational estimate of the effects of connected triple excitations (CCSD(T)), and the self-consistent field. To determine accurate energy differences CCSD(T) energies were computed using large atomic natural orbital basis sets. Four different isomers of H2NO3+ were considered. The lowest energy form of protonated nitric acid was found to correspond to a complex between H2O and NO2+, which is consistent with earlier theoretical and experimental studies.

  19. Progress in the Calculation of Nucleon Transition form Factors

    NASA Astrophysics Data System (ADS)

    Eichmann, Gernot

    2016-10-01

    We give a brief account of the Dyson-Schwinger and Faddeev-equation approach and its application to nucleon resonances and their transition form factors. We compare the three-body with the quark-diquark approach and present a quark-diquark calculation for the low-lying nucleon resonances including scalar, axialvector, pseudoscalar and vector diquarks. We also discuss the timelike structure of transition form factors and highlight the advantages of form factors over helicity amplitudes.

  20. The form factor of H-comb polymers

    NASA Astrophysics Data System (ADS)

    Zweier, Steven; Bishop, Marvin

    2009-12-01

    A Monte Carlo pivot algorithm is employed to investigate the form factor of continuum, tangent hard sphere H-comb polymers in both the ideal and excluded volume regimes. The simulated form factors for 241 and 931 "bead" ideal H-combs are essentially the same. The results for these polymers are in excellent agreement with the theoretical prediction. There is only a slight difference in the form factor between the ideal and excluded volume regimes at larger values of distance.

  1. Analytical evaluation of atomic form factors: Application to Rayleigh scattering

    SciTech Connect

    Safari, L.; Santos, J. P.; Amaro, P.; Jänkälä, K.; Fratini, F.

    2015-05-15

    Atomic form factors are widely used for the characterization of targets and specimens, from crystallography to biology. By using recent mathematical results, here we derive an analytical expression for the atomic form factor within the independent particle model constructed from nonrelativistic screened hydrogenic wave functions. The range of validity of this analytical expression is checked by comparing the analytically obtained form factors with the ones obtained within the Hartee-Fock method. As an example, we apply our analytical expression for the atomic form factor to evaluate the differential cross section for Rayleigh scattering off neutral atoms.

  2. Analytical evaluation of atomic form factors: Application to Rayleigh scattering

    NASA Astrophysics Data System (ADS)

    Safari, L.; Santos, J. P.; Amaro, P.; Jänkälä, K.; Fratini, F.

    2015-05-01

    Atomic form factors are widely used for the characterization of targets and specimens, from crystallography to biology. By using recent mathematical results, here we derive an analytical expression for the atomic form factor within the independent particle model constructed from nonrelativistic screened hydrogenic wave functions. The range of validity of this analytical expression is checked by comparing the analytically obtained form factors with the ones obtained within the Hartee-Fock method. As an example, we apply our analytical expression for the atomic form factor to evaluate the differential cross section for Rayleigh scattering off neutral atoms.

  3. The structures and vibrational frequencies of the NNO analogs NPO and PNO and their protonated forms

    NASA Astrophysics Data System (ADS)

    Davy, Randall D.; Schaefer, Henry F., III

    1990-05-01

    The surprising relative stability of PNO compared to NPO cannot be explained by a single configuration molecular orbital (MO) model. However the MO model can be used to understand the pattern of stability among the protonated isomers HPNO+, PNOH+, HNPO+, and NPOH+, and perhaps to explain important aspects of the general chemistry of multiple bonds between first and second row atoms.

  4. The roles of STOP1-like transcription factors in aluminum and proton tolerance.

    PubMed

    Fan, Wei; Lou, He Qiang; Yang, Jian Li; Zheng, Shao Jian

    2016-01-01

    Aluminum (Al) and proton (H(+)) are 2 coexisting rhizotoxicities limiting plant growth in acid soils. Sensitive to Proton Rhizotoxicity (STOP) 1-like zinc finger transcription factors play important roles in regulating expression of downstream genes involved in tolerance mechanism of either stress. In this mini-review, we summarized recent advances in characterizing STOP1-like proteins with respect to plant Al and H(+) tolerance. The possible involvement of structure-function of STOP1-like proteins in differential regulation of Al and H(+) tolerance are discussed. In addition, we also direct research in this area to protein phosphorylation.

  5. X-Ray Form Factor, Attenuation and Scattering Tables

    National Institute of Standards and Technology Data Gateway

    SRD 66 X-Ray Form Factor, Attenuation and Scattering Tables (Web, free access)   This database collects tables and graphs of the form factors, the photoabsorption cross section, and the total attenuation coefficient for any element (Z <= 92).

  6. Nucleon Form Factors experiments with 12 GeV CEBAF

    SciTech Connect

    Wojtsekhowski, B.

    2008-10-13

    A number of precision form factor experiments at high momentum transfer will be performed with the 11 GeV electron beam of CEBAF. We review the approved proposals and the conceptual schemes of several new suggestions. Form factor data will serve as a major input for the construction of a tomographic image of the nucleon.

  7. Orthopositronium decay form factors and two-photon correlations

    SciTech Connect

    Adkins, Gregory S.; Droz, Daniel R.; Rastawicki, Dominik; Fell, Richard N.

    2010-04-15

    We give results for the orthopositronium decay form factors through one-loop order. We use the form factors to calculate momentum correlations of the final-state photons and , including one-loop corrections, for ensembles of initial orthopositronium atoms having arbitrary polarization.

  8. Relativistic quark model for the Omega- electromagnetic form factors

    SciTech Connect

    G. Ramalho, K. Tsushima, Franz Gross

    2009-08-01

    We compute the Omega- electromagnetic form factors and the decuplet baryon magnetic moments using a quark model application of the Covariant Spectator Theory. Our predictions for the Omega- electromagnetic form factors can be tested in the future by lattice QCD simulations at the physical strange quark mass.

  9. Lorentz contracted proton

    NASA Astrophysics Data System (ADS)

    Bedoya Fierro, D.; Kelkar, N. G.; Nowakowski, M.

    2015-09-01

    The proton charge and magnetization density distributions can be related to the well known Sachs electromagnetic form factors G E, M ( q 2) through Fourier transforms, only in the Breit frame. The Breit frame however moves with relativistic velocities in the Lab and a Lorentz boost must be applied before extracting the static properties of the proton from the corresponding densities. Apart from this, the Fourier transform relating the densities and form factors is inherently a non-relativistic expression. We show that the relativistic corrections to it can be obtained by extending the standard Breit equation to higher orders in its 1 /c 2 expansion. We find that the inclusion of the above corrections reduces the size of the proton as determined from electron proton scattering data by about 4%.

  10. Three-loop slope of the dirac form factor and the 1S lamb shift in hydrogen

    PubMed

    Melnikov; van Ritbergen T

    2000-02-21

    The last unknown contribution to hydrogen energy levels at order malpha(7), due to the slope of the Dirac form factor at three loops, is evaluated in a closed analytical form. The resulting shift of the hydrogen nS energy level is found to be 3.016/n(3) kHz. Using the QED calculations of the 1S Lamb shift, we extract a precise value of the proton charge radius r(p) = 0.883+/-0.014 fm.

  11. Relationship Domain of Form Six Teachers Thinking in Teaching with External Factors of Form Six Teachers

    ERIC Educational Resources Information Center

    bin Pet, Mokhtar; Sihes, Ahmad Johari Hj

    2015-01-01

    This study aims to examine the external factors of form six teachers who can influence thinking domain form six teachers in their teaching. This study was conducted using a quantitative approach using questionnaires. A total of 300 form six teacher schools in Johor were chosen as respondents. The findings were obtained as student background…

  12. Prediction of output factor, range, and spread-out bragg peak for proton therapy.

    PubMed

    Kim, Dong Wook; Lim, Young Kyung; Ahn, Sung Hwan; Shin, Jungwook; Shin, Dongho; Yoon, Myongguen; Lee, Se Byeong; Kim, Dae Yong; Park, Sung Yong

    2011-01-01

    In proton therapy, patient quality assurance (QA) requires measuring the beam range, spread-out Bragg peak (SOBP), and output factor. If these values can be predicted by using sampling measurements or previous QA data to find the correlation between beam setup parameters and measured data, efforts expended on patient QA can be reduced. Using sampling data, we predicted the range, SOBP, and output factor of the proton beam. To obtain sampling data, we measured the range, SOBP, and output factor for 14 data points at each of 24-beam range options, from 4-28 cm. Prediction conformity was evaluated by the difference between predicted and measured patient QA data. Results indicated that for 60% of patients, the values could be predicted within 3% of dose uncertainty.

  13. Axial transition form factors and pion decay of baryon resonances

    SciTech Connect

    Julia-Diaz, B.; Riska, D.O.; Coester, F.

    2004-10-01

    The pion decay constants of the lowest orbitally excited states of the nucleon and the {delta}(1232) along with the corresponding axial transition form factors are calculated with Poincare covariant constituent-quark models with instant, point, and front forms of relativistic kinematics. The model wave functions are chosen such that the calculated electromagnetic and axial form factors of the nucleon represent the empirical values in all three forms of kinematics, when calculated with single-constituent currents. The pion decay widths calculated with the three forms of kinematics are smaller than the empirical values. Front and instant form kinematics provide a similar description, with a slight preference for front form, while the point form values are significantly smaller in the case of the lowest positive parity resonances.

  14. Kinetics and Mechanism of Deoxygenation Reactions over Proton-Form and Molybdenum-Modified Zeolite Catalysts

    NASA Astrophysics Data System (ADS)

    Bedard, Jeremy William

    The depletion of fossil fuel resources and the environmental consequences of their use have dictated the development of new sources of energy that are both sustainable and economical. Biomass has emerged as a renewable carbon feedstock that can be used to produce chemicals and fuels traditionally obtained from petroleum. The oxygen content of biomass prohibits its use without modification because oxygenated hydrocarbons are non-volatile and have lower energy content. Chemical processes that eliminate oxygen and keep the carbon backbone intact are required for the development of biomass as a viable chemical feedstock. This dissertation reports on the kinetic and mechanistic studies conducted on high and low temperature catalytic processes for deoxygenation of biomass precursors to produce high-value chemicals and fuels. Low temperature, steady state reaction studies of acetic acid and ethanol were used to identify co-adsorbed acetic acid/ethanol dimers as surface intermediates within specific elementary steps involved in the esterification of acetic acid with ethanol on zeolites. A reaction mechanism involving two dominating surface species, an inactive ethanol dimeric species adsorbed on Bronsted sites inhibiting ester formation and a co-adsorbed complex of acetic acid and ethanol on the active site reacting to produce ethyl acetate, is shown to describe the reaction rate as a function of temperature (323 -- 383 K), acetic acid (0.5 -- 6.0 kPa), and ethanol (5.0 -- 13.0 kPa) partial pressure on proton-form BEA, FER, MFI, and MOR zeolites. Measured differences in rates as a function of zeolite structure and the rigorous interpretation of these differences in terms of esterification rate and equilibrium constants is presented to show that the intrinsic rate constant for the activation of the co-adsorbed complex increases in the order FER < MOR < MFI < BEA. High temperature co-processing of acetic acid, formic acid, or carbon dioxide with methane (CH3COOH/CH4 = 0

  15. Are protons nonidentical fermions?

    SciTech Connect

    Mart, T.

    2014-09-25

    We briefly review the progress of our investigation on the electric (charge) radius of the proton. In order to explain the recently measured proton radius, which is significantly smaller than the standard CODATA value, we assume that the real protons radii are not identical, they are randomly distributed in a certain range. To obtain the measured radius we average the radii and fit both the mean radius and the range. By using an averaged dipole form factor we obtain the charge radius r{sub E} = 0.8333 fm, in accordance with the recent measurement of the Lamb shift in muonic hydrogen.

  16. Strange quark contribution to the nucleon form factor

    NASA Astrophysics Data System (ADS)

    Baunack, S.

    PoS(Confinement8)078 According to QCD, the nucleon is made up of valence quarks, sea quarks and gluons. Concern- ing the quark sea, also strange quarks can contribute to the nucleon properties. Parity violating electron scattering offers a tool to investigate the strange quark contribution to the nucleon form factors parameterized by the strange form factors GE and Gs . The theoretical framework to ac- s M cess these strange form factors is outlined here and an overview of the existing world data is given. The measurements performed by the A4 collaboration at the electron accelerator facility MAMI are described here in more details and preliminary results are reported.

  17. Light-Cone Sum Rule Approach for Baryon Form Factors

    NASA Astrophysics Data System (ADS)

    Offen, Nils

    2016-10-01

    We present the state-of-the-art of the light-cone sum rule approach to Baryon form factors. The essence of this approach is that soft Feynman contributions are calculated in terms of small transverse distance quantities using dispersion relations and duality. The form factors are thus expressed in terms of nucleon wave functions at small transverse separations, called distribution amplitudes, without any additional parameters. The distribution amplitudes, therefore, can be extracted from the comparison with the experimental data on form factors and compared to the results of lattice QCD simulations.

  18. SU-E-T-577: Obliquity Factor and Surface Dose in Proton Beam Therapy

    SciTech Connect

    Das, I; Andersen, A; Coutinho, L

    2015-06-15

    Purpose: The advantage of lower skin dose in proton beam may be diminished creating radiation related sequalae usually seen with photon and electron beams. This study evaluates the surface dose as a complex function of beam parameters but more importantly the effect of beam angle. Methods: Surface dose in proton beam depends on the beam energy, source to surface distance, the air gap between snout and surface, field size, material thickness in front of surface, atomic number of the medium, beam angle and type of nozzle (ie double scattering, (DS), uniform scanning (US) or pencil beam scanning (PBS). Obliquity factor (OF) is defined as ratio of surface dose in 0° to beam angle Θ. Measurements were made in water phantom at various beam angles using very small microdiamond that has shown favorable beam characteristics for high, medium and low proton energy. Depth dose measurements were performed in the central axis of the beam in each respective gantry angle. Results: It is observed that surface dose is energy dependent but more predominantly on the SOBP. It is found that as SSD increases, surface dose decreases. In general, SSD, and air gap has limited impact in clinical proton range. High energy has higher surface dose and so the beam angle. The OF rises with beam angle. Compared to OF of 1.0 at 0° beam angle, the value is 1.5, 1.6, 1,7 for small, medium and large range respectively for 60 degree angle. Conclusion: It is advised that just like range and SOBP, surface dose should be clearly understood and a method to reduce the surface dose should be employed. Obliquity factor is a critical parameter that should be accounted in proton beam therapy and a perpendicular beam should be used to reduce surface dose.

  19. Proton Spectroscopic Factors Deduced from Helium-3 Global Phenomenological and Microscopic Optical Model Potentials

    NASA Astrophysics Data System (ADS)

    Jenny, Lee; Pang, Dan-Yang; Han, Yin-Lu; B. Tsang, M.

    2014-09-01

    Global phenomenological GDP08 and microscopic helium-3 optical model potentials have been recently derived. We evaluate these two potential sets by comparing the elastic scattering data of 25 MeV 3He on 16O, 18O, 19F, 23Na, 24Mg, 25Mg, 26Mg, 27Al, 28Si, 30Si, 31P, 32S, 34S, 35Cl, 37Cl, and 39K isotopes. Using the deuteron angular distributions calculated with the distorted wave Born approximation model, we extract the ground-state proton spectroscopic factors from (3He, d) reactions on the same set of nuclei. The extracted proton spectroscopic factors are compared with the large-basis shell-model calculations.

  20. Renormalization versus strong form factors for one-boson-exchange potentials

    NASA Astrophysics Data System (ADS)

    Calle Cordón, A.; Ruiz Arriola, E.

    2010-04-01

    We analyze the one-boson-exchange potential from the point of view of renormalization theory. We show that the nucleon-meson Lagrangian, while predicting the NN force, does not predict the NN scattering matrix nor the deuteron properties unambiguously due to the appearance of short distance singularities. While the problem has traditionally been circumvented by introducing vertex functions via phenomenological strong form factors, we propose to impose physical renormalization conditions on the scattering amplitude at low energies. Working in the large Nc approximation with π, σ, ρ, and ω mesons we show that, once these conditions are applied, results for low-energy phases of proton-neutron scattering as well as deuteron properties become largely insensitive to the form factors and to the vector mesons yielding reasonable agreement with the data and for realistic values of the coupling constants.

  1. High-precision calculation of the strange nucleon electromagnetic form factors

    SciTech Connect

    Green, Jeremy; Meinel, Stefan; Engelhardt, Michael G.; Krieg, Stefan; Laeuchli, Jesse; Negele, John W.; Orginos, Kostas; Pochinsky, Andrew; Syritsyn, Sergey

    2015-08-26

    We report a direct lattice QCD calculation of the strange nucleon electromagnetic form factors GsE and GsM in the kinematic range 0 ≤ Q2 ≤ 1.2GeV2. For the first time, both GsE and GsM are shown to be nonzero with high significance. This work uses closer-to-physical lattice parameters than previous calculations, and achieves an unprecented statistical precision by implementing a recently proposed variance reduction technique called hierarchical probing. We perform model-independent fits of the form factor shapes using the z-expansion and determine the strange electric and magnetic radii and magnetic moment. As a result, we compare our results to parity-violating electron-proton scattering data and to other theoretical studies.

  2. Near-threshold neutral pion electroproduction at high momentum transfers and generalized form factors

    NASA Astrophysics Data System (ADS)

    Khetarpal, P.; Stoler, P.; Aznauryan, I. G.; Kubarovsky, V.; Adhikari, K. P.; Adikaram, D.; Aghasyan, M.; Amaryan, M. J.; Anderson, M. D.; Anefalos Pereira, S.; Anghinolfi, M.; Avakian, H.; Baghdasaryan, H.; Ball, J.; Baltzell, N. A.; Battaglieri, M.; Batourine, V.; Bedlinskiy, I.; Biselli, A. S.; Bono, J.; Boiarinov, S.; Briscoe, W. J.; Brooks, W. K.; Burkert, V. D.; Carman, D. S.; Celentano, A.; Charles, G.; Cole, P. L.; Contalbrigo, M.; Crede, V.; D'Angelo, A.; Dashyan, N.; De Vita, R.; De Sanctis, E.; Deur, A.; Djalali, C.; Doughty, D.; Dugger, M.; Dupre, R.; Egiyan, H.; El Alaoui, A.; El Fassi, L.; Eugenio, P.; Fedotov, G.; Fegan, S.; Fersch, R.; Fleming, J. A.; Fradi, A.; Gabrielyan, M. Y.; Garçon, M.; Gevorgyan, N.; Gilfoyle, G. P.; Giovanetti, K. L.; Girod, F. X.; Goetz, J. T.; Gohn, W.; Golovatch, E.; Gothe, R. W.; Griffioen, K. A.; Guegan, B.; Guidal, M.; Guo, L.; Hafidi, K.; Hakobyan, H.; Hanretty, C.; Harrison, N.; Hicks, K.; Ho, D.; Holtrop, M.; Hyde, C. E.; Ilieva, Y.; Ireland, D. G.; Ishkhanov, B. S.; Isupov, E. L.; Jo, H. S.; Joo, K.; Keller, D.; Khandaker, M.; Kim, A.; Kim, W.; Klein, F. J.; Koirala, S.; Kubarovsky, A.; Kuleshov, S. V.; Kvaltine, N. D.; Lewis, S.; Livingston, K.; Lu, H. Y.; MacGregor, I. J. D.; Mao, Y.; Martinez, D.; Mayer, M.; McKinnon, B.; Meyer, C. A.; Mineeva, T.; Mirazita, M.; Mokeev, V.; Montgomery, R. A.; Moutarde, H.; Munevar, E.; Munoz Camacho, C.; Nadel-Turonski, P.; Nasseripour, R.; Niccolai, S.; Niculescu, G.; Niculescu, I.; Osipenko, M.; Ostrovidov, A. I.; Pappalardo, L. L.; Paremuzyan, R.; Park, K.; Park, S.; Pasyuk, E.; Phelps, E.; Phillips, J. J.; Pisano, S.; Pogorelko, O.; Pozdniakov, S.; Price, J. W.; Procureur, S.; Protopopescu, D.; Puckett, A. J. R.; Raue, B. A.; Ricco, G.; Rimal, D.; Ripani, M.; Rosner, G.; Rossi, P.; Sabatié, F.; Saini, M. S.; Salgado, C.; Saylor, N. A.; Schott, D.; Schumacher, R. A.; Seder, E.; Seraydaryan, H.; Sharabian, Y. G.; Smith, G. D.; Sober, D. I.; Sokhan, D.; Stepanyan, S. S.; Stepanyan, S.; Strakovsky, I. I.; Strauch, S.; Taiuti, M.; Tang, W.; Taylor, C. E.; Tkachenko, S.; Ungaro, M.; Vernarsky, B.; Voskanyan, H.; Voutier, E.; Walford, N. K.; Weinstein, L. B.; Weygand, D. P.; Wood, M. H.; Zachariou, N.; Zhang, J.; Zhao, Z. W.; Zonta, I.

    2013-04-01

    We report the measurement of near-threshold neutral pion electroproduction cross sections and the extraction of the associated structure functions on the proton in the kinematic range Q2 from 2 to 4.5 GeV2 and W from 1.08 to 1.16 GeV. These measurements allow us to access the dominant pion-nucleon s-wave multipoles E0+ and S0+ in the near-threshold region. In the light-cone sum-rule framework (LCSR), these multipoles are related to the generalized form factors G1π0p(Q2) and G2π0p(Q2). The data are compared to these generalized form factors and the results for G1π0p(Q2) are found to be in good agreement with the LCSR predictions, but the level of agreement with G2π0p(Q2) is poor.

  3. Atomic form factor for twisted vortex photons interacting with atoms

    NASA Astrophysics Data System (ADS)

    Guthrey, Pierson; Kaplan, Lev; McGuire, J. H.

    2014-04-01

    The relatively new atomic form factor for twisted (vortex) beams, which carry orbital angular momentum (OAM), is considered and compared to the conventional atomic form factor for plane-wave beams that carry only spin angular momentum. Since the vortex symmetry of a twisted photon is more complex that that of a plane wave, evaluation of the atomic form factor is also more complex for twisted photons. On the other hand, the twisted photon has additional parameters, including the OAM quantum number, ℓ, the nodal radial number, p, and the Rayleigh range, zR, which determine the cone angle of the vortex. This Rayleigh range may be used as a variable parameter to control the interaction of twisted photons with matter. Here we address (i) normalization of the vortex atomic form factor, (ii) displacement of target atoms away from the center of the beam vortex, and (iii) formulation of transition probabilities for a variety of photon-atom processes. We attend to features related to experiments that can test the range of validity and accuracy of calculations of these variations of the atomic form factor. Using the absolute square of the form factor for vortex beams, we introduce a vortex factor that can be directly measured.

  4. Protonated paramagnetic redox forms of di-o-quinone bridged with p-phenylene-extended TTF: A EPR spectroscopy study

    PubMed Central

    Chalkov, Nikolay O; Cherkasov, Vladimir K; Abakumov, Gleb A; Starikov, Andrey G

    2016-01-01

    The chemical oxidation and reduction processes of deprotonated, direduced o-quinone-exTTF-o-quinone in protic solvents were studied by EPR spectroscopy. The formation of relatively stable paramagnetic protonated redox forms of the parent triad was very surprising. The character of spin-density distribution in the semiquinone–quinone and semiquinone–catechol redox forms indicates that the p-phenylene-extended tetrathiafulvalene connector provides a quite effective electronic communication channel between dioxolene coordination sites. It was found that the deprotonated, direduced o-quinone-exTTF-o-quinone is capable to reduction of the metal copper in solution. The radical anion species formed in this reaction exists in solution as a solvent-separated ion pair with a copper cation. A character of spin-density distribution in a radical anion species leads to the conclusion that the ligand corresponds to type III of the Robin–Day classification. PMID:28144312

  5. Consistency in quality correction factors for ionization chamber dosimetry in scanned proton beam therapy.

    PubMed

    Sorriaux, Jefferson; Testa, Mauro; Paganetti, Harald; Bertrand, Damien; Lee, John Aldo; Palmans, Hugo; Vynckier, Stefaan; Sterpin, Edmond

    2017-09-01

    The IAEA TRS-398 code of practice details the reference conditions for reference dosimetry of proton beams using ionization chambers and the required beam quality correction factors (kQ ). Pencil beam scanning (PBS) systems cannot approximate reference conditions using a single spot. However, dose distributions requested in TRS-398 can be reproduced with PBS using a combination of spots. This study aims to demonstrate, using Monte Carlo (MC) simulations, that kQ factors computed/measured for broad beams can be used with scanned beams for similar reference dose distributions with no additional significant uncertainty. We consider the Alfonso formalism(13) usually employed for nonstandard photon beams. To approach reference conditions similar as IAEA TRS-398 and the associated dose distributions, PBS must combine many pencil beams with range or energy modulation and shaping techniques that differ from those used in passive systems (broad beams). In order to evaluate the impact of these differences on kQ factors, ionization chamber responses are computed with MC (Geant4 9.6) in three different proton beams, with their corresponding quality factors (Q), producing a 10 × 10 cm(2) field with a flat dose distribution for (a) a dedicated scanned pencil beam (Qpbs ), (b) a hypothetical proton source (Qhyp ), and (c) a double-scattering beam (Qds ). The tested ionization chamber cavities are a 2 × 2 × 0.2 mm³ air cavity, a Roos-type ionization chamber, and a Farmer-type ionization chamber. Ranges of Qpbs , Qhyp , and Qds are consistent within 0.4 mm. Flatnesses of dose distributions are better than 0.5%. Calculated kQpbs,Qhypfpbs,fref is 0.999 ± 0.002 for the air cavity and the Farmer-type ionization chamber and 1.001 ± 0.002 for the Roos-type ionization chamber. The quality correction factors kQpbs,Qdsfpbs,fref is 0.999 ± 0.002 for the Farmer-type and Roos-type ionization chambers and 1.001 ± 0.001 for the Roos-type ionization chamber. The Alfonso formalism was

  6. Classical limit of diagonal form factors and HHL correlators

    NASA Astrophysics Data System (ADS)

    Bajnok, Zoltan; Janik, Romuald A.

    2017-01-01

    We propose an expression for the classical limit of diagonal form factors in which we integrate the corresponding observable over the moduli space of classical solutions. In infinite volume the integral has to be regularized by proper subtractions and we present the one, which corresponds to the classical limit of the connected diagonal form factors. In finite volume the integral is finite and can be expressed in terms of the classical infinite volume diagonal form factors and subvolumes of the moduli space. We analyze carefully the periodicity properties of the finite volume moduli space and found a classical analogue of the Bethe-Yang equations. By applying the results to the heavy-heavy-light three point functions we can express their strong coupling limit in terms of the classical limit of the sine-Gordon diagonal form factors.

  7. Hadronic Form Factors in Asymptotically Free Field Theories

    DOE R&D Accomplishments Database

    Gross, D. J.; Treiman, S. B.

    1974-01-01

    The breakdown of Bjorken scaling in asymptotically free gauge theories of the strong interactions is explored for its implications on the large q{sup 2} behavior of nucleon form factors. Duality arguments of Bloom and Gilman suggest a connection between the form factors and the threshold properties of the deep inelastic structure functions. The latter are addressed directly in an analysis of asymptotically free theories; and through the duality connection we are then led to statements about the form factors. For very large q{sup 2} the form factors are predicted to fall faster than any inverse power of q{sup 2}. For the more modest range of q{sup 2} reached in existing experiments the agreement with data is fairly good, though this may well be fortuitous. Extrapolations beyond this range are presented.

  8. Pion form factor in the NLC QCD SR approach

    SciTech Connect

    Bakulev, A. P. Pimikov, A. V.; Stefanis, N. G.

    2010-06-15

    We present results of a calculation of the electromagnetic pion form factor within the framework of QCD sum rules with nonlocal condensates and using a perturbative spectral density which includes O({alpha}{sub s}) contributions.

  9. nf2 contributions to fermionic four-loop form factors

    NASA Astrophysics Data System (ADS)

    Lee, Roman N.; Smirnov, Alexander V.; Smirnov, Vladimir A.; Steinhauser, Matthias

    2017-07-01

    We compute the four-loop contributions to the photon quark and Higgs quark form factors involving two closed fermion loops. We present analytical results for all nonplanar master integrals of the two nonplanar integral families which enter our calculation.

  10. Personality Research Form: Factor Structure and Response Style Involvement

    ERIC Educational Resources Information Center

    Stricker, Lawrence J.

    1974-01-01

    Explores factor structure of the Personality Research Form (PRF) and examines the inventory's relations with response styles. In general, the PRF content scales correlate moderately with each other and with measures of acquiescence, social desirability, and defensiveness response biases. (Author)

  11. Flavor decomposition of the elastic nucleon electromagnetic form factors

    SciTech Connect

    C.D. Cates, C.W. Jager, S. Riordan, B. Wojtsekhowski

    2011-06-01

    The u- and d-quark contributions to the elastic nucleon electromagnetic form factors have been determined using experimental data on GEn , GMn , GpE , and GpM . Such a flavor separation of the form factors became possible up to 3.4 GeV2 with recent data on GEn from Hall A at JLab. At a negative four-momentum transfer squared Q2 above 1 GeV2, for both the u- and d-quark components, the ratio of the Pauli form factor to the Dirac form factor, F2/F1, was found to be almost constant, and for each of F2 and F1 individually, the d-quark component drops continuously with increasing Q2.

  12. Charm and bottom hadronic form factors with QCD sum rules

    SciTech Connect

    Bracco, M. E.; Rodrigues, B. O.; Cerqueira, A. Jr.

    2013-03-25

    We present a brief review of some calculations of form factors and coupling constants in vertices with charm and bottom mesons in the framework of QCD sum rules. We first discuss the motivation for this work, describing possible applications of these form factors to charm and bottom decays processes. We first make a summarize of the QCD sum rules method. We give special attention to the uncertainties of the method introducing by the intrinsic variation of the parameters. Finally we conclude.

  13. Strange form factors of octet and decuplet baryons

    SciTech Connect

    Hong, Soon-Tae

    1999-11-22

    The strange form factors of baryon octet are evaluated, in the chiral models with the general chiral SU(3) group structure, to yield the theoretical predictions comparable to the recent experimental data of SAMPLE Collaboration and to study the spin symmetries. Other model predictions are also briefly reviewed to compare with our results and then the strange form factors of baryon octet and decuplet are predicted.

  14. From quarks and gluons to baryon form factors.

    PubMed

    Eichmann, Gernot

    2012-04-01

    I briefly summarize recent results for nucleon and [Formula: see text] electromagnetic, axial and transition form factors in the Dyson-Schwinger approach. The calculation of the current diagrams from the quark-gluon level enables a transparent discussion of common features such as: the implications of dynamical chiral symmetry breaking and quark orbital angular momentum, the timelike structure of the form factors, and their interpretation in terms of missing pion-cloud effects.

  15. From quarks and gluons to baryon form factors

    PubMed Central

    Eichmann, Gernot

    2012-01-01

    I briefly summarize recent results for nucleon and Δ(1232) electromagnetic, axial and transition form factors in the Dyson–Schwinger approach. The calculation of the current diagrams from the quark–gluon level enables a transparent discussion of common features such as: the implications of dynamical chiral symmetry breaking and quark orbital angular momentum, the timelike structure of the form factors, and their interpretation in terms of missing pion-cloud effects. PMID:26766879

  16. Vector Meson Form Factors and Wave Functions from Holographic QCD

    SciTech Connect

    Hovhannes Grigoryan; Anatoly Radyushkin

    2007-10-10

    Based on the holographic dual model of QCD, we study 2- and 3-point functions of vector currents and derive form factors as well as wave functions for the vector mesons. As a result, generalized vector-meson dominance representation for form factors is obtained with a very specific VMD pattern. The calculated electric radius of the rho-meson is shown to be in a good agreement with predictions from lattice QCD.

  17. Proton Conductive Nanosheets Formed by Alignment of Metallo-Supramolecular Polymers.

    PubMed

    Pandey, Rakesh K; Rana, Utpal; Chakraborty, Chanchal; Moriyama, Satoshi; Higuchi, Masayoshi

    2016-06-01

    Linear Fe(II)-based metallo-supramolecular polymer chains were precisely aligned by the simple replacement of the counteranion with an N,N'-bis(4-benzosulfonic acid)perylene-3,4,9,10-tetracarboxylbisimide (PSA) dianion, which linked the polymer chains strongly. A parallel alignment of the polymer chains promoted by the PSA dianions yielded nanosheets formation. The nanosheets' structure was analyzed with FESEM, HRTEM, UV-vis, and XRD in detail. The nanosheets showed more than 5 times higher proton conductivity than the original polymer due to the smooth ionic conduction through the aligned polymer chains. The complex impedance plot with two semicircles also suggested the presence of grain boundaries in the polymer nanosheets.

  18. [Featuring pathogenicity factors in biofilm-forming and no-biofilm forming strains of Staphylococcus epidermidis].

    PubMed

    Sidashenko, O I; Voronkova, O S; Sirokvasha, O A; Vinnikov, A I

    2015-01-01

    A comparative study of the manifestation of pathogenicity factors: hemolytic, lipase, letsytinase activity and ability to adhere in 20 film-forming and 17 non-film-forming strains of S. epidermidis. Studying pathogenicity factors of the film-forming strains it was found that complete hemolysis and lipase activity shown was by all the film-forming strains of S. epidermidis, letsytinase activity was observed in 80%. Among the non-film-forming strains complete hemolysis and lipase activity were observed in 89% and letsytinase - 71%. Researched non-film-forming and film-forming strains of S. epidermidis showed the ability to adhere to buccal epithelial cells of humans. Found that all the film-forming strains of S. epidermidis were hight level adgesion, the highest IAM was equal to 11,84. It was found that among non-film-forming strains of S. epidermidis were low-, medium- and hight level adgesion. IAM of non-film-forming strains of S. epidermidis is 3 times lower compared to the IAM of the film-forming strains of human epithelial cells and was 3.2.

  19. Solvent Effects on the Absorption Spectra of the para-Coumaric Acid Chromophore in Its Different Protonation Forms.

    PubMed

    García-Prieto, Francisco F; Galván, Ignacio Fdez; Muñoz-Losa, Aurora; Aguilar, Manuel A; Martín, M Elena

    2013-10-08

    The effects of the solvent and protonation state on the electronic absorption spectrum of the para-coumaric acid (pCA), a model of the photoactive yellow protein (PYP), have been studied using the ASEP/MD (averaged solvent electrostatic potential from molecular dynamics) method. Even though, in the protein, the chromophore is assumed to be in its phenolate monoanionic form, when it is found in water solution pH control can favor neutral, monoanionic, and dianionic species. As the pCA has two hydrogens susceptible of deprotonation, both carboxylate and phenolate monoanions are possible. Their relative stabilities are strongly dependent on the medium. In gas phase, the most stable isomer is the phenolate while in aqueous solution it is the carboxylate, although the population of the phenolate form is not negligible. The s-cis, s-trans, syn, and anti conformers have also been included in the study. Electronic excited states of the chromophore have been characterized by SA-CAS(14,12)-PT2/cc-pVDZ level of theory. The bright state corresponds, in all the cases, to a π → π* transition involving a charge displacement in the system. The magnitude and direction of this displacement depends on the protonation state and on the environment (gas phase or solution). In the same way, the calculated solvatochromic shift of the absorption maximum depends on the studied form, being a red shift for the neutral, carboxylate monoanion, and dianionic chromophores and a blue shift for the phenolate monoanion. Finally, the contribution that the solvent electronic polarizability has on the solvent shift was analyzed. It represents a very important part of the total solvent shift in the neutral form, but its contribution is completly negligible in the mono- and dianionic forms.

  20. Measuring the neutral weak form factors in e-N scattering: the G^0 Expriment

    NASA Astrophysics Data System (ADS)

    King, Paul

    2001-10-01

    The G^0 experiment(JLab experiment E00-006, D.H. Beck, spokesperson.) will measure the parity-violating asymmetries in elastic electron-nucleon scattering. The experiment will be performed in Hall C at Jefferson Lab using a dedicated apparatus, with the first running period planned to begin in the summer of 2002. Using measurements of the electron-proton asymmetries at forward and backward angles and the electron-deuteron asymmetries at backward angles over the momentum transfer range of 0.1 - 1.0 GeV^2/c^2, the vector neutral weak form factors, G_E^Z and G_M^Z, and the effective axial current of the nucleon, G_A^e, will be extracted. Combining the neutral weak and the known electromagnetic form factors allows one to experimentally extract the contributions of u, d, and s quarks to the proton's charge and magnetization distributions. An overview of the physics of the G^0 experiment will be presented.

  1. Online Soil Science Lesson 3: Soil Forming Factors

    USDA-ARS?s Scientific Manuscript database

    This lesson explores the five major factors of soil formation, namely: 1) climate; 2) organisms; 3) time; 4) topography; and 5) parent material and their influence in forming soil. The distinction between active and passive factors, moisture and temperature regimes, organism and topographic influen...

  2. Analytic results for massless three-loop form factors

    NASA Astrophysics Data System (ADS)

    Lee, R. N.; Smirnov, A. V.; Smirnov, V. A.

    2010-04-01

    We evaluate, exactly in d, the master integrals contributing to massless threeloop QCD form factors. The calculation is based on a combination of a method recently suggested by one of the authors (R.L.) with other techniques: sector decomposition implemented in FIESTA, the method of Mellin-Barnes representation, and the PSLQ algorithm. Using our results for the master integrals we obtain analytical expressions for two missing constants in the γ-expansion of the two most complicated master integrals and present the form factors in a completely analytic form.

  3. SU-E-T-595: Output Factor Calculation for a Uniform Scanning Proton Therapy System

    SciTech Connect

    Hecksel, D; Stauffer, N; DeFillippo, G; Edwards, J; Pankuch, M

    2015-06-15

    Purpose: To develop an analytical model that predicts dose output factors for patient treatment fields in a uniform scanning proton therapy system. Methods: A model to predict output factors for patient specific treatment fields was produced based on the methods developed by Kooy et al. (2003). The Kooy model predicts the output factor based on the ratio of the entrance dose under calibration conditions to that for a given range and modulation corrected for the inverse square effect. Field specific output factors were plotted as a function of a single parameter r, where r = (Range-Modulation)/Modulation. The model targeted user range 1 sub-span 3 through user range 2 sup-span 2 of the IBA uniform scanning proton therapy system. The data set included points measured using the 10 cm and 18 cm snout sizes to eliminate stem effects on the monitor unit chambers. The data was fit using equation 15 from Kooy et al. (2003), and the resulting model was tested against measurements that were not included in the original data set. Results: For the range and sub span investigated, 120 data points were tested against the model prediction. The model predicted the output factor within 2% for 96% of the points tested and within 2.5% for 99% of the points tested. All points were within 3% of the predicted values. Conclusion: Monitor units for patient treatment fields with proton ranges that fall within the tested interval can be predicted using a model based on the methods developed at MGH. With further evaluation, it will be possible to model all user ranges and sub-spans of the IBA system. Further testing is also needed to predict output factors using a 25 cm snout which introduces variable scanning pattern sizes and stem effects on the monitor unit chambers.

  4. Determination of the quenching correction factors for plastic scintillation detectors in therapeutic high-energy proton beams

    PubMed Central

    Wang, L L W; Perles, L A; Archambault, L; Sahoo, N; Mirkovic, D; Beddar, S

    2013-01-01

    The plastic scintillation detectors (PSD) have many advantages over other detectors in small field dosimetry due to its high spatial resolution, excellent water equivalence and instantaneous readout. However, in proton beams, the PSDs will undergo a quenching effect which makes the signal level reduced significantly when the detector is close to Bragg peak where the linear energy transfer (LET) for protons is very high. This study measures the quenching correction factor (QCF) for a PSD in clinical passive-scattering proton beams and investigates the feasibility of using PSDs in depth-dose measurements in proton beams. A polystyrene based PSD (BCF-12, ϕ0.5mm×4mm) was used to measure the depth-dose curves in a water phantom for monoenergetic unmodulated proton beams of nominal energies 100, 180 and 250 MeV. A Markus plane-parallel ion chamber was also used to get the dose distributions for the same proton beams. From these results, the QCF as a function of depth was derived for these proton beams. Next, the LET depth distributions for these proton beams were calculated by using the MCNPX Monte Carlo code, based on the experimentally validated nozzle models for these passive-scattering proton beams. Then the relationship between the QCF and the proton LET could be derived as an empirical formula. Finally, the obtained empirical formula was applied to the PSD measurements to get the corrected depth-dose curves and they were compared to the ion chamber measurements. A linear relationship between QCF and LET, i.e. Birks' formula, was obtained for the proton beams studied. The result is in agreement with the literature. The PSD measurements after the quenching corrections agree with ion chamber measurements within 5%. PSDs are good dosimeters for proton beam measurement if the quenching effect is corrected appropriately. PMID:23128412

  5. Deuterium Solvent Isotope Effect and Proton Inventory Studies of Factor Xa-catalyzed Reactions†

    PubMed Central

    Zhang, Daoning; Kovach, Ildiko M.

    2008-01-01

    Kinetic solvent isotope effects (KSIE) for the Factor Xa (FXa)-catalyzed activation of prothrombin in the presence and absence of Factor Va (FVa) and 5.0 ×10−5 M phospholipid vesicles, are slightly inverse, 0.82−0.93, when substrate concentrations are at 0.2 Km. This is consistent with rate-determining association of the enzyme-prothrombin assembly, rather than rate-limiting chemical transformation. FVa is known to effect a major conformational change to expose the first scissile bond in prothrombin, which is the likely event triggering a major solvent rearrangement. At prothrombin concentrations >5 Km the KSIE is 1.6 ± 0.3, when FXa is in 1 : 1 ratio with FVa, but becomes increasingly inverse, 0.30 ± 0.05 and 0.19 ± 0.04, when FXa : FVa 1:4, with increasing FXa concentration and substrate concentration. The rate-determining step changes with the conditions, but the chemical step is not limiting under any circumstance. This corroborates the proposed predominance of the meizothrombin pathway when FXa is well saturated with the prothrombin complex. In contrast, the FXa-catalyzed hydrolysis of N-α-Z-D-Arg-Gly-Arg-pNA·2HCl (S-2765) and H-D-Ile-L-Pro-L-Arg-pNA.HCl (S-2288) is most consistent with two-proton bridges forming at the transition state between Ser195 OγH and His57 Nε2 and His57 Nδ1 and Asp102 COOβ- at the active site, with transition state fractionation factors of ϕ1 = ϕ2 = 0.57 ± 0.07 and ϕS = 0.78 ± 0.16 for solvent rearrangement for S-2765, and ϕ1 = ϕ2 = 0.674 ± 0.001 for S-2288 under enzyme saturation with substrate at pH 8.40 and 25.0 ± 0.1 °C. The rate-determining step(s) in these reactions is most likely the cleavage of the C-N bond and departure of the leaving group. PMID:17115712

  6. A study of two-photon decays of charmonium resonances formed in proton-antiproton annihilations

    NASA Astrophysics Data System (ADS)

    Pedlar, Todd Kristofer

    1999-12-01

    In this dissertation we describe the results of an investigation of the production of charmonium states (hc,h' c,c0and c2) in Fermilab experiment E835 via antiproton-proton annihilation and their detection via their decay into two photons. The hc resonance parameters were determined to be M(hc)=2982.4+2.3- 2.2 MeV, G(hc) =26.9+10.8-9.5 MeV and G(hc-->gg )=5.7+2.9+2.9-2.3- 1.4 keV. For the c2 resonance, a partial width G(c2-->gg )=0.343+0.053+00.43-0.051 -0.038 keV was measured. No evidence in the gg decay mode for either c0 (near s~=3415 MeV) or h'c (in the region s=3575- 3660 = 3575-3660 MeV) regions was found. 90% confidence upper limits were established at G(c0-->gg )<=1.3 keV, and B(h'c-->overline poverlinep)×B(h 'c-->gg) <=5.9×10-8.

  7. Dirac and Pauli form factors based on consideration of the gluon effect in light-cone wave functions

    NASA Astrophysics Data System (ADS)

    Shojaei, Mohammad Reza; Nikkhoo, Negin Sattary

    2015-11-01

    We discuss Dirac and Pauli form factors based on a generalized parton distribution framework in the range of high momentum transfers of t < 30 GeV2 and calculate the electromagnetic form factors, GE and GM, for the proton. In previous work, Gaussian parameterization has been used in wave functions for calculating electromagnetic form factors at intermediate-high momentum transfers of 1 GeV2 < t < 10 GeV2; in this paper, by considering an improved Gaussian ansatz, we not only calculate the electromagnetic form factors at moderately high momentum transfers t but also can calculate these quantities at high momentum transfers, achieving reasonable agreement with experimental data and other previous work.

  8. Measurements of the Helium Form Factors at JLab

    SciTech Connect

    Khrosinkova, Elena

    2007-10-26

    An experiment to measure elastic electron scattering off {sup 3}He and {sup 4}He at large momentum transfers is presented. The experiment was carried out in the Hall A Facility of Jefferson Lab. Elastic electron scattering off {sup 3}He was measured at forward and backward electron scattering angles to extract the isotope's charge and magnetic form factors. The charge form factor of {sup 4}He will be extracted from forward-angle electron scattering angle measurements. The data are expected to significantly extend and improve the existing measurements of the three- and four-body form factors. The results will be crucial for the establishment of a canonical standard model for the few-body nuclear systems and for testing predictions of quark dimensional scaling and hybrid nucleon-quark models.

  9. Two-loop SL(2) form factors and maximal transcendentality

    NASA Astrophysics Data System (ADS)

    Loebbert, Florian; Sieg, Christoph; Wilhelm, Matthias; Yang, Gang

    2016-12-01

    Form factors of composite operators in the SL(2) sector of N = 4 SYM theory are studied up to two loops via the on-shell unitarity method. The non-compactness of this subsector implies the novel feature and technical challenge of an unlimited number of loop momenta in the integrand's numerator. At one loop, we derive the full minimal form factor to all orders in the dimensional regularisation parameter. At two loops, we construct the complete integrand for composite operators with an arbitrary number of covariant derivatives, and we obtain the remainder functions as well as the dilatation operator for composite operators with up to three covariant derivatives. The remainder functions reveal curious patterns suggesting a hidden maximal uniform transcendentality for the full form factor. Finally, we speculate about an extension of these patterns to QCD.

  10. Nucleon electromagnetic form factors from the covariant Faddeev equation

    NASA Astrophysics Data System (ADS)

    Eichmann, G.

    2011-07-01

    We compute the electromagnetic form factors of the nucleon in the Poincaré-covariant Faddeev framework based on the Dyson-Schwinger equations of QCD. The general expression for a baryon’s electromagnetic current in terms of three interacting dressed quarks is derived. Upon employing a rainbow-ladder gluon-exchange kernel for the quark-quark interaction, the nucleon’s Faddeev amplitude and electromagnetic form factors are computed without any further truncations or model assumptions. The form-factor results show clear evidence of missing pion-cloud effects below a photon momentum transfer of ˜2GeV2 and in the chiral region, whereas they agree well with experimental data at higher photon momenta. Thus, the approach reflects the properties of the nucleon’s quark core.

  11. Visible and near-infrared waveguides formed by double-energy proton implantation in magneto-optical glasses

    NASA Astrophysics Data System (ADS)

    Liu, Chun-Xiao; Shen, Xiao-Liang; Zheng, Rui-Lin; Guo, Hai-Tao; Li, Wei-Nan; Wei, Wei

    2017-02-01

    Ion implantation is one of the most competitive methods for the fabrication of optical waveguide structures in optoelectronic materials. Tb3+-doped aluminum borosilicate glass has been demonstrated to be a type of magneto-optical glass with high Verdet constant. In this work, the proton implantation technique with energies of (500 + 550) keV and fluences of (1.0 + 2.0) × 1016 ions/cm2 is performed to form planar waveguides in the Tb3+-doped aluminum borosilicate glass. The guiding modes of the fabricated waveguide were measured by the prism-coupling method at wavelengths of 632.8 and 1539 nm. The near-field light intensity distribution was measured by the end-face coupling method at the wavelength of 632.8 nm and calculated by the finite-difference beam propagation method at both 632.8 and 1539 nm. The optical properties of the double-energy proton-implanted magneto-optical glass waveguides show promise for use as multi-functional integrated optical devices in the visible and near-infrared bands.

  12. Comparative proton nuclear magnetic resonance studies of amantadine complexes formed in aqueous solutions with three major cyclodextrins.

    PubMed

    Lis-Cieplak, Agnieszka; Sitkowski, Jerzy; Kolodziejski, Waclaw

    2014-01-01

    Host-guest complexes of alpha-, beta-, and gamma-cyclodextrins (α-CD, β-CD, and γ-CD, respectively) with amantadine (1-aminoadamantane, AMA; an antiviral agent) were characterized in aqueous solutions using proton nuclear magnetic resonance (NMR) spectroscopy. Host-guest molecular interactions were manifested by changes in the chemical shifts of AMA protons. NMR Job's plots showed that the stoichiometry of all the studied complexes was 1:1. Two-dimensional T-ROESY experiments demonstrated that the complexes were formed by different degrees of incorporation of the adamantyl group of AMA into the CD cavity. The mode of AMA binding was proposed. The AMA molecule came into the α-CD cavity (the smallest size) or β-CD cavity (the intermediate size) through its wide entrance to become shallowly or deeply accommodated, respectively. In the complex of AMA with γ-CD (the largest cavity size), the adamantyl group was also quite deeply inserted into the CD cavity, but it arrived there through the narrow cavity entrance. It was found that the adamantyl group of AMA was best accommodated by the β-CD cavity. The binding constants Kaa of the studied complexes (in M(-1) ), determined from DOSY NMR, were fairly high; their values in an ascending order were: α-CD (183) < γ-CD (306) ≪ β-CD (5150).

  13. Elastic and transition form factors of the Δ(1232)

    DOE PAGES

    Segovia, Jorge; Chen, Chen; Cloet, Ian C.; ...

    2013-12-10

    Predictions obtained with a confining, symmetry-preserving treatment of a vector Ⓧ vector contact interaction at leading-order in a widely used truncation of QCD’s Dyson–Schwinger equations are presented for Δ and Ω baryon elastic form factors and the γN → Δ transition form factors. This simple framework produces results that are practically indistinguishable from the best otherwise available, an outcome which highlights that the key to describing many features of baryons and unifying them with the properties of mesons is a veracious expression of dynamical chiral symmetry breaking in the hadron bound-state problem. The following specific results are of particular interest.more » The Δ elastic form factors are very sensitive to mΔ. Hence, given that the parameters which define extant simulations of lattice-regularised QCD produce Δ-resonance masses that are very large, the form factors obtained therewith are a poor guide to properties of the Δ(1232). Considering the Δ-baryon’s quadrupole moment, whilst all computations produce a negative value, the conflict between theoretical predictions entails that it is currently impossible to reach a sound conclusion on the nature of the Δ-baryon’s deformation in the infinite momentum frame. Furthermore, results for analogous properties of the Ω baryon are less contentious. In connection with the N → Δ transition, the Ash-convention magnetic transition form factor falls faster than the neutron’s magnetic form factor and nonzero values for the associated quadrupole ratios reveal the impact of quark orbital angular momentum within the nucleon and Δ; and, furthermore, these quadrupole ratios do slowly approach their anticipated asymptotic limits.« less

  14. Elastic and transition form factors of the Δ(1232)

    SciTech Connect

    Segovia, Jorge; Chen, Chen; Cloet, Ian C.; Roberts, Craig D.; Schmidt, Sebastian M.; Wan, Shaolong

    2013-12-10

    Predictions obtained with a confining, symmetry-preserving treatment of a vector Ⓧ vector contact interaction at leading-order in a widely used truncation of QCD’s Dyson–Schwinger equations are presented for Δ and Ω baryon elastic form factors and the γN → Δ transition form factors. This simple framework produces results that are practically indistinguishable from the best otherwise available, an outcome which highlights that the key to describing many features of baryons and unifying them with the properties of mesons is a veracious expression of dynamical chiral symmetry breaking in the hadron bound-state problem. The following specific results are of particular interest. The Δ elastic form factors are very sensitive to mΔ. Hence, given that the parameters which define extant simulations of lattice-regularised QCD produce Δ-resonance masses that are very large, the form factors obtained therewith are a poor guide to properties of the Δ(1232). Considering the Δ-baryon’s quadrupole moment, whilst all computations produce a negative value, the conflict between theoretical predictions entails that it is currently impossible to reach a sound conclusion on the nature of the Δ-baryon’s deformation in the infinite momentum frame. Furthermore, results for analogous properties of the Ω baryon are less contentious. In connection with the N → Δ transition, the Ash-convention magnetic transition form factor falls faster than the neutron’s magnetic form factor and nonzero values for the associated quadrupole ratios reveal the impact of quark orbital angular momentum within the nucleon and Δ; and, furthermore, these quadrupole ratios do slowly approach their anticipated asymptotic limits.

  15. Master integrals for the four-loop Sudakov form factor

    NASA Astrophysics Data System (ADS)

    Boels, Rutger H.; Kniehl, Bernd A.; Yang, Gang

    2016-01-01

    The light-like cusp anomalous dimension is a universal function in the analysis of infrared divergences. In maximally (N = 4) supersymmetric Yang-Mills theory (SYM) in the planar limit, it is known, in principle, to all loop orders. The non-planar corrections are not known in any theory, with the first appearing at the four-loop order. The simplest quantity which contains this correction is the four-loop two-point form factor of the stress tensor multiplet. This form factor was largely obtained in integrand form in a previous work for N = 4 SYM, up to a free parameter. In this work, a reduction of the appearing integrals obtained by solving integration-by-parts (IBP) identities using a modified version of Reduze is reported. The form factor is shown to be independent of the remaining parameter at integrand level due to an intricate pattern of cancellations after IBP reduction. Moreover, two of the integral topologies vanish after reduction. The appearing master integrals are cross-checked using independent algebraic-geometry techniques explored in the Mint package. The latter results provide the basis of master integrals applicable to generic form factors, including those in Quantum Chromodynamics. Discrepancies between explicitly solving the IBP relations and the MINT approach are highlighted. Remaining bottlenecks to completing the computation of the four-loop non-planar cusp anomalous dimension in N = 4 SYM and beyond are identified.

  16. Measurement of the Charged Pion Electromagnetic Form Factor

    SciTech Connect

    J. Volmer; David Abbott; H. Anklin; Chris Armstrong; John Arrington; K. Assamagan; Steven Avery; Oliver K. Baker; Henk Blok; C. Bochna; Ed Brash; Herbert Breuer; Nicholas Chant; Jim Dunne; Tom Eden; Rolf Ent; David Gaskell; Ron Gilman; Kenneth Gustafsson; Wendy Hinton; Garth Huber; Hal Jackson; Mark K. Jones; Cynthia Keppel; P.H. Kim; Wooyoung Kim; Andi Klein; Doug Koltenuk; Meme Liang; George Lolos; Allison Lung; David Mack; D. McKee; David Meekins; Joseph Mitchell; H. Mkrtchian; B. Mueller; Gabriel Niculescu; Ioana Niculescu; D. Pitz; D. Potterveld; Liming Qin; Juerg Reinhold; I.K. Shin; Stepan Stepanyan; V. Tadevosian; L.G. Tang; R.L.J. van der Meer; K. Vansyoc; D. Van Westrum; Bill Vulcan; Stephen Wood; Chen Yan; W.X. Zhao; Beni Zihlmann

    2001-02-26

    Separated longitudinal and transverse structure functions for the reaction 1H(e,eprime pi+)n were measured in the momentum transfer region Q2=0.6-1.6 (GeV/c)**2 at a value of the invariant mass W=1.95 GeV. New values for the pion charge form factor were extracted from the longitudinal cross section by using a recently developed Regge model. The results indicate that the pion form factor in this region is larger than previously assumed and is consistent with a monopole parameterization fitted to very low Q2 elastic data.

  17. Pion transition form factor through Dyson-Schwinger equations

    NASA Astrophysics Data System (ADS)

    Raya, Khépani

    2016-10-01

    In the framework of Dyson-Schwinger equations (DSE), we compute the γ*γ→π0 transition form factor, G(Q2). For the first time, in a continuum approach to quantun chromodynamics (QCD), it was possible to compute G(Q2) on the whole domain of space-like momenta. Our result agrees with CELLO, CLEO and Belle collaborations and, with the well- known asymptotic QCD limit, 2ƒπ. Our analysis unifies this prediction with that of the pion's valence-quark parton distribution amplitude (PDA) and elastic electromagnetic form factor.

  18. Electromagnetic form factors of the Δ with D-waves

    SciTech Connect

    Ramalho, Gilberto T.F.; Pena, Maria Teresa; Gross, Franz L.

    2010-06-01

    The electromagnetic form factors of the Δ baryon are evaluated within the framework of a covariant spectator quark model, where S and D-states are included in the Δ wave function. We predict all the four Δ multipole form factors: the electric charge GE0, the magnetic dipole GM1, the electric quadrupole GE2 and the magnetic octupole GM3. We compare our predictions with other theoretical calculations. Our results are compatible with the available experimental data and recent lattice QCD data.

  19. Protonation state of Asp (Glu)-85 regulates the purple-to-blue transition in bacteriorhodopsin mutants Arg-82----Ala and Asp-85----Glu: The blue form is inactive in proton translocation

    SciTech Connect

    Subramaniam, S.; Marti, T.; Khorana, H.G. )

    1990-02-01

    Previous studies with site-specific mutants of bacteriorhodopsin have demonstrated that replacement of Asp-85 or Arg-82 affects the absorption spectrum. Between pH 5.5 and 7, the Asp-85----Glu and Arg-82----Ala mutants exist in a pH-dependent equilibrium between purple (lambda max approximately 550/540 nm) and blue (lambda max approximately 600/590 nm) forms of the pigment. Measurement of proton transport as a function of wavelength in reconstituted vesicles shows that proton-pumping activities for the above mutants reside exclusively in their respective purple species. For both mutants, formation of the blue form with decreasing pH is accompanied by loss of proton transport activity. The Asp-85----Asn mutant displays a blue chromophore (lambda max approximately 588 nm), is inactive in proton translocation from pH 5 to 7.5, and shows no transition to the purple form. In contrast, the Asp-212----Asn mutant is purple (lambda max approximately 555 nm) and shows no transition to a blue chromophore with decreasing pH. The experiments suggest that (i) the pKa of the purple-to-blue transition is directly influenced by the pKa of the carboxylate at residue 85 and (ii) the relative strengths of interaction between the protonated Schiff base, Asp-85, Asp-212, and Arg-82 make a major contribution to the regulation of color and function of bacteriorhodopsin.

  20. Protonation state of Asp (Glu)-85 regulates the purple-to-blue transition in bacteriorhodopsin mutants Arg-82----Ala and Asp-85----Glu: the blue form is inactive in proton translocation.

    PubMed

    Subramaniam, S; Marti, T; Khorana, H G

    1990-02-01

    Previous studies with site-specific mutants of bacteriorhodopsin have demonstrated that replacement of Asp-85 or Arg-82 affects the absorption spectrum. Between pH 5.5 and 7, the Asp-85----Glu and Arg-82----Ala mutants exist in a pH-dependent equilibrium between purple (lambda max approximately 550/540 nm) and blue (lambda max approximately 600/590 nm) forms of the pigment. Measurement of proton transport as a function of wavelength in reconstituted vesicles shows that proton-pumping activities for the above mutants reside exclusively in their respective purple species. For both mutants, formation of the blue form with decreasing pH is accompanied by loss of proton transport activity. The Asp-85----Asn mutant displays a blue chromophore (lambda max approximately 588 nm), is inactive in proton translocation from pH 5 to 7.5, and shows no transition to the purple form. In contrast, the Asp-212----Asn mutant is purple (lambda max approximately 555 nm) and shows no transition to a blue chromophore with decreasing pH. The experiments suggest that (i) the pKa of the purple-to-blue transition is directly influenced by the pKa of the carboxylate at residue 85 and (ii) the relative strengths of interaction between the protonated Schiff base, Asp-85, Asp-212, and Arg-82 make a major contribution to the regulation of color and function of bacteriorhodopsin.

  1. Pion Electromagnetic Form Factor in Virtuality Distribution Formalism

    SciTech Connect

    Radyushkin, Anatoly V.

    2016-01-01

    We discuss two applications of the {\\it Virtuality Distribution Amplitudes} (VDA) formalism developed in our recent papers. We start with an overview of the main properties of the pion distribution amplitude emphasizing the quantitative measures of its width, and possibility to access them through the pion transition form factor studies. We formulate the basic concepts of the VDA approach and introduce the pion {\\it transverse momentum distribution amplitude} (TMDA) which plays, in a covariant Lagrangian formulation, a role similar to that of the pion wave function in the 3-dimensional Hamiltonian light-front approach. We propose simple factorized models for soft TMDAs, and use them to describe existing data on the pion transition form factor, thus fixing the scale determining the size of the transverse-momentum effects. Finally, we apply the VDA approach to the one-gluon exchange contribution for the pion electromagnetic form factor. We observe a very late $Q^2 \\gtrsim 20$ GeV$^2$ onset of transition to the asymptotic pQCD predictions and show that in the $Q^2 \\lesssim 10$ GeV$^2$ region there is essentially no sensitivity to the shape of the pion distribution amplitude. Furthermore, the magnitude of the one-gluon exchange contribution in this region is estimated to be an order of magnitude below the Jefferson Lab data, thus leaving the Feynman mechanism as the only one relevant to the pion electromagnetic form factor behavior for accessible $Q^2$.

  2. The effect of pH on the exchangeability with deuterium of protons coupled to molybdenum(V) in the active and the desulpho forms of xanthine oxidase.

    PubMed Central

    Malthouse, J P; Bray, R C

    1983-01-01

    The effect of pH variation on the exchangeability with deuterium of protons strongly coupled to Mo(V) in the active and desulpho forms of xanthine oxidase was studied by e.p.r. and rapid freezing, in extension of the work of Gutteridge, Tanner & Bray [Biochem. J. (1978) 175, 887-897]. Above neutrality, exchange rates increased with increasing pH. Detailed studies were made on the desulpho enzyme under a variety of conditions, and exchange rate constants at 22 degrees C ranged from 0.16s -1 at pH 6.6 to 1.6s -1 at pH 11.3. The mechanism of proton exchange in the enzyme is discussed. The interpretation by the above workers that the strongly coupled proton of the active enzyme is on sulphur and that of the desulpho enzyme is on oxygen remains valid (and is in agreement with other work), as do their proposals for the structures of the protonated and deprotonated species. However, pK values cannot be calculated from the exchange data. It is likely that the relatively low rates of exchange observed are due to the difference of structure between the protonated and the deprotonated forms. In the case of the desulpho enzyme, an exchange mechanism, which involves the proton exchanging both as such and along with oxygen in the form of a hydroxyl ion, is discussed. PMID:6312970

  3. Quantitative investigation of physical factors contributing to gold nanoparticle-mediated proton dose enhancement

    NASA Astrophysics Data System (ADS)

    Cho, Jongmin; Gonzalez-Lepera, Carlos; Manohar, Nivedh; Kerr, Matthew; Krishnan, Sunil; Cho, Sang Hyun

    2016-03-01

    Some investigators have shown tumor cell killing enhancement in vitro and tumor regression in mice associated with the loading of gold nanoparticles (GNPs) before proton treatments. Several Monte Carlo (MC) investigations have also demonstrated GNP-mediated proton dose enhancement. However, further studies need to be done to quantify the individual physical factors that contribute to the dose enhancement or cell-kill enhancement (or radiosensitization). Thus, the current study investigated the contributions of particle-induced x-ray emission (PIXE), particle-induced gamma-ray emission (PIGE), Auger and secondary electrons, and activation products towards the total dose enhancement. Specifically, GNP-mediated dose enhancement was measured using strips of radiochromic film that were inserted into vials of cylindrical GNPs, i.e. gold nanorods (GNRs), dispersed in a saline solution (0.3 mg of GNRs/g or 0.03% of GNRs by weight), as well as vials containing water only, before proton irradiation. MC simulations were also performed with the tool for particle simulation code using the film measurement setup. Additionally, a high-purity germanium detector system was used to measure the photon spectrum originating from activation products created from the interaction of protons and spherical GNPs present in a saline solution (20 mg of GNPs/g or 2% of GNPs by weight). The dose enhancement due to PIXE/PIGE recorded on the films in the GNR-loaded saline solution was less than the experimental uncertainty of the film dosimetry (<2%). MC simulations showed highly localized dose enhancement (up to a factor 17) in the immediate vicinity (<100 nm) of GNRs, compared with hypothetical water nanorods (WNRs), mostly due to GNR-originated Auger/secondary electrons; however, the average dose enhancement over the entire GNR-loaded vial was found to be minimal (0.1%). The dose enhancement due to the activation products from GNPs was minimal (<0.1%) as well. In conclusion, under the

  4. Quantitative investigation of physical factors contributing to gold nanoparticle-mediated proton dose enhancement.

    PubMed

    Cho, Jongmin; Gonzalez-Lepera, Carlos; Manohar, Nivedh; Kerr, Matthew; Krishnan, Sunil; Cho, Sang Hyun

    2016-03-21

    Some investigators have shown tumor cell killing enhancement in vitro and tumor regression in mice associated with the loading of gold nanoparticles (GNPs) before proton treatments. Several Monte Carlo (MC) investigations have also demonstrated GNP-mediated proton dose enhancement. However, further studies need to be done to quantify the individual physical factors that contribute to the dose enhancement or cell-kill enhancement (or radiosensitization). Thus, the current study investigated the contributions of particle-induced x-ray emission (PIXE), particle-induced gamma-ray emission (PIGE), Auger and secondary electrons, and activation products towards the total dose enhancement. Specifically, GNP-mediated dose enhancement was measured using strips of radiochromic film that were inserted into vials of cylindrical GNPs, i.e. gold nanorods (GNRs), dispersed in a saline solution (0.3 mg of GNRs/g or 0.03% of GNRs by weight), as well as vials containing water only, before proton irradiation. MC simulations were also performed with the tool for particle simulation code using the film measurement setup. Additionally, a high-purity germanium detector system was used to measure the photon spectrum originating from activation products created from the interaction of protons and spherical GNPs present in a saline solution (20 mg of GNPs/g or 2% of GNPs by weight). The dose enhancement due to PIXE/PIGE recorded on the films in the GNR-loaded saline solution was less than the experimental uncertainty of the film dosimetry (<2%). MC simulations showed highly localized dose enhancement (up to a factor 17) in the immediate vicinity (<100 nm) of GNRs, compared with hypothetical water nanorods (WNRs), mostly due to GNR-originated Auger/secondary electrons; however, the average dose enhancement over the entire GNR-loaded vial was found to be minimal (0.1%). The dose enhancement due to the activation products from GNPs was minimal (<0.1%) as well. In conclusion, under the currently

  5. Computational study of some triazole derivatives (un- and protonated forms) and their copper complexes in corrosion inhibition process

    NASA Astrophysics Data System (ADS)

    El Ibrahimi, Brahim; Soumoue, Aziza; Jmiai, Aziz; Bourzi, Hassan; Oukhrib, Rachid; El Mouaden, Khadija; El Issami, Souad; Bazzi, Lahcen

    2016-12-01

    Three triazoles compounds used as corrosion inhibitors for copper in acidic medium, namely: 1,2,4 triazole (TR), 3-amino 1,2,4 triazole (3 ATR) and 3,5-diamino 1,2,4 triazole (3,5 DATR) have been studied theoretically in aim to investigate the correlation between its molecular reactivity indicators and the corresponding inhibition efficiency. All quantum chemical calculations at the B3LYP/6-31+G(d,p) method were performed with and without solvent effect. In the present paper, not only the neutral inhibitors has been studied, but also the first and the second protonation forms. A good correlation between theoretical and experimental data has been obtained both in gas and aqueous phases, notably for unprotonated inhibitors. Also, the interaction energy between inhibitors and copper has been calculated.

  6. The Proton Radius Puzzle

    NASA Astrophysics Data System (ADS)

    Downie, E. J.

    2016-03-01

    The proton radius puzzle is the difference between the proton radius as measured with electron scattering and in the excitation spectrum of atomic hydrogen, and that measured with muonic hydrogen spectroscopy. Since the inception of the proton radius puzzle in 2010 by the measurement of Pohl et al.[1], many possible resolutions to the puzzle have been postulated, but, to date, none has been generally accepted. New data are therefore necessary to resolve the issue. We briefly review the puzzle, the proposed solutions, and the new electron scattering and spectroscopy experiments planned and underway. We then introduce the MUSE experiment, which seeks to resolve the puzzle by simultaneously measuring elastic electron and muon scattering on the proton, in both charge states, thereby providing new information to the puzzle. MUSE addresses issues of two-photon effects, lepton universality and, possibly, new physics, while providing simultaneous form factor, and therefore radius, measurements with both muons and electrons.

  7. Perturbative corrections to B → D form factors in QCD

    NASA Astrophysics Data System (ADS)

    Wang, Yu-Ming; Wei, Yan-Bing; Shen, Yue-Long; Lü, Cai-Dian

    2017-06-01

    We compute perturbative QCD corrections to B → D form factors at leading power in Λ/ m b , at large hadronic recoil, from the light-cone sum rules (LCSR) with B-meson distribution amplitudes in HQET. QCD factorization for the vacuum-to- B-meson correlation function with an interpolating current for the D-meson is demonstrated explicitly at one loop with the power counting scheme {m}_c˜ O(√{Λ {m}_b}) . The jet functions encoding information of the hard-collinear dynamics in the above-mentioned correlation function are complicated by the appearance of an additional hard-collinear scale m c , compared to the counterparts entering the factorization formula of the vacuum-to- B-meson correction function for the construction of B → π from factors. Inspecting the next-to-leading-logarithmic sum rules for the form factors of B → Dℓν indicates that perturbative corrections to the hard-collinear functions are more profound than that for the hard functions, with the default theory inputs, in the physical kinematic region. We further compute the subleading power correction induced by the three-particle quark-gluon distribution amplitudes of the B-meson at tree level employing the background gluon field approach. The LCSR predictions for the semileptonic B → Dℓν form factors are then extrapolated to the entire kinematic region with the z-series parametrization. Phenomenological implications of our determinations for the form factors f BD +,0 ( q 2) are explored by investigating the (differential) branching fractions and the R( D) ratio of B → Dℓν and by determining the CKM matrix element |V cb | from the total decay rate of B → Dμν μ .

  8. Nucleon form factors program with SBS at JLAB

    SciTech Connect

    Wojtsekhowski, Bogdan B.

    2014-12-01

    The physics of the nucleon form factors is the basic part of the Jefferson Laboratory program. We review the achievements of the 6-GeV era and the program with the 12- GeV beam with the SBS spectrometer in Hall A, with a focus on the nucleon ground state properties.

  9. Determination of Transverse Charge Density from Kaon Form Factor Data

    NASA Astrophysics Data System (ADS)

    Mejia-Ott, Johann; Horn, Tanja; Pegg, Ian; Mecholski, Nicholas; Carmignotto, Marco; Ali, Salina

    2016-09-01

    At the level of nucleons making up atomic nuclei, among subatomic particles made up of quarks, K-mesons or kaons represent the most simple hadronic system including the heavier strange quark, having a relatively elementary bound state of a quark and an anti-quark as its valence structure. Its electromagnetic structure is then parametrized by a single, dimensionless quantity known as the form factor, the two-dimensional Fourier transform of which yields the quantity of transverse charge density. Transverse charge density, in turn, provides a needed framework for the interpretation of form factors in terms of physical charge and magnetization, both with respect to the propagation of a fast-moving nucleon. To this is added the value of strange quarks in ultimately presenting a universal, process-independent description of nucleons, further augmenting the importance of studying the kaon's internal structure. The pressing character of such research questions directs the present paper, describing the first extraction of transverse charge density from electromagnetic kaon form factor data. The extraction is notably extended to form factor data at recently acquired higher energy levels, whose evaluation could permit more complete phenomenological models for kaon behavior to be proposed. This work was supported in part by NSF Grant PHY-1306227.

  10. Quark and Gluon Form Factors to Three Loops

    SciTech Connect

    Baikov, P. A.; Smirnov, V. A.; Chetyrkin, K. G.; Smirnov, A. V.; Steinhauser, M.

    2009-05-29

    We compute the form factors of the photon-quark-anti-quark vertex and the effective vertex of a Higgs-boson and two gluons to three-loop order within massless perturbative quantum chromodynamics. These results provide building blocks for many third-order cross sections. Furthermore, this is the first calculation of complete three-loop vertex corrections.

  11. The Super Bigbite Project: A Study of Nucleon Form Factors

    SciTech Connect

    Jager, Kees de

    2010-06-01

    A proposed set of instrumentation, collectively referred to as the Super Bigbite project, is presented. Used in three different con figurations it will allow measurements of three nucleon electromagnetic form factors GEn, GEp, and GMn with unprecedented precision to Q2-values up to three times higher than existing data.

  12. Spin-2 form factors at three loop in QCD

    NASA Astrophysics Data System (ADS)

    Ahmed, Taushif; Das, Goutam; Mathews, Prakash; Rana, Narayan; Ravindran, V.

    2015-12-01

    Spin-2 fields are often candidates in physics beyond the Standard Model namely the models with extra-dimensions where spin-2 Kaluza-Klein gravitons couple to the fields of the Standard Model. Also, in the context of Higgs searches, spin-2 fields have been studied as an alternative to the scalar Higgs boson. In this article, we present the complete three loop QCD radiative corrections to the spin-2 quark-antiquark and spin-2 gluon-gluon form factors in SU(N) gauge theory with n f light flavors. These form factors contribute to both quark-antiquark and gluon-gluon initiated processes involving spin-2 particle in the hadronic reactions at the LHC. We have studied the structure of infrared singularities in these form factors up to three loop level using Sudakov integro-differential equation and found that the anomalous dimensions originating from soft and collinear regions of the loop integrals coincide with those of the electroweak vector boson and Higgs form factors confirming the universality of the infrared singularities in QCD amplitudes.

  13. Personality Research Form: Factor Structure and Response Style Involvement.

    ERIC Educational Resources Information Center

    Stricker, Lawrence J.

    The aims of this study were (1) to explore the factor structure of the Personality Research Form (PRF) and (2) to examine the inventory's relations with response styles. In general the PRF content scales correlated moderately with each other and with measures of acquiesence, social desirability, and defensiveness response Biases. Six oblique…

  14. Measurement of the pion form factor at higher energies

    SciTech Connect

    Mack, D.J.

    1994-04-01

    One of the strongest arguments for increasing the nominal CEBAF beam energy to equal or exceed 6 GeV is that one would be able to make quality high Q{sup 2} measurements of the charged pion form factor.

  15. Measurements of Form Factors with the BaBar Experiment

    SciTech Connect

    Li, Selina Z.; /SLAC

    2011-08-25

    Selected recent results on measurements of form factors by the BaBar Collaboration are reviewed, including e{sup +}e{sup -} {yields} {eta}{prime}{gamma}, leptonic and semileptonic charm decays from data collected at or near the {Upsilon}(4S) resonance.

  16. Electromagnetic form factors of heavy flavored vector mesons

    NASA Astrophysics Data System (ADS)

    Priyadarsini, M.; Dash, P. C.; Kar, Susmita; Patra, Sweta P.; Barik, N.

    2016-12-01

    We study the electromagnetic form factors of heavy flavored vector mesons such as (D*,Ds*,J /Ψ ) , (B*,Bs*,ϒ ) via one photon radiative decays (V →P γ ) in the relativistic independent quark (RIQ) model based on a flavor independent average interaction potential in the scalar vector harmonic form. The momentum dependent spacelike (q2<0 ) form factors calculated in this model are analytically continued to the physical timelike region 0 ≤q2≤(MV-MP)2 . The predicted coupling constant gV P γ=FV P(q2=0 ) for real photon case in the limit q2→0 and decay widths Γ (V →P γ ) are found in reasonable agreement with experimental data and other model predictions.

  17. Lattice calculation of electric dipole moments and form factors of the nucleon

    NASA Astrophysics Data System (ADS)

    Abramczyk, M.; Aoki, S.; Blum, T.; Izubuchi, T.; Ohki, H.; Syritsyn, S.

    2017-07-01

    We analyze commonly used expressions for computing the nucleon electric dipole form factors (EDFF) F3 and moments (EDM) on a lattice and find that they lead to spurious contributions from the Pauli form factor F2 due to inadequate definition of these form factors when parity mixing of lattice nucleon fields is involved. Using chirally symmetric domain wall fermions, we calculate the proton and the neutron EDFF induced by the C P -violating quark chromo-EDM interaction using the corrected expression. In addition, we calculate the electric dipole moment of the neutron using a background electric field that respects time translation invariance and boundary conditions, and we find that it decidedly agrees with the new formula but not the old formula for F3. Finally, we analyze some selected lattice results for the nucleon EDM and observe that after the correction is applied, they either agree with zero or are substantially reduced in magnitude, thus reconciling their difference from phenomenological estimates of the nucleon EDM.

  18. Accessing the Elastic Form-Factors of the $Delta(1232)$ Using the Beam-Normal Asymmetry

    SciTech Connect

    Dalton, Mark M.

    2016-08-01

    The beam-normal single-spin asymmetry, $B_n$, exists in the scattering of high energy electrons, polarized transverse to their direction of motion, from nuclear targets. To first order, this asymmetry is caused by the interference of the one-photon exchange amplitude with the imaginary part of the two-photon exchange amplitude. Measurements of $B_n$, for the production of a $\\Delta(1232)$ resonance from a proton target, will soon become available from the Qweak experiment at Jefferson Lab and the A4 experiment at Mainz. The imaginary part of two-photon exchange allows only intermediate states that are on-shell, including the $\\Delta$ itself. Therefore such data is sensitive to $\\gamma\\Delta\\Delta$, the elastic form-factors of the $\\Delta$. This article will introduce the form-factors of the $\\Delta$, discuss what might be learned about the elastic form-factors from these new data, describe ongoing efforts in calculation and measurement, and outline the possibility of future measurements.

  19. Local Recurrence After Primary Proton Beam Therapy in Uveal Melanoma: Risk Factors, Retreatment Approaches, and Outcome.

    PubMed

    Seibel, Ira; Cordini, Dino; Rehak, Matus; Hager, Annette; Riechardt, Aline I; Böker, Alexander; Heufelder, Jens; Weber, Andreas; Gollrad, Johannes; Besserer, Angela; Joussen, Antonia M

    2015-10-01

    To evaluate the risk factors, recurrence rates, retreatments, and long-term patient outcomes following proton beam therapy for uveal melanoma. Retrospective interventional case series. All patients treated with primary proton beam therapy for uveal melanoma at the oncology service at Charité-Berlin and Helmholtz-Zentrum-Berlin between May 1998 and December 2008 were reviewed for local recurrence. Of 982 patients, 982 eyes matched the inclusion criteria. The data were obtained from electronic health records, operative reports, discharge letters, and radiation planning. Comparisons of fundus photographs and ultrasound measurements were performed to assess the growth pattern of the tumor and to determine the success of retreatment, in the case that a globe-retaining therapy was undertaken. Of 982 patients, 35 patients (3.6%) developed local recurrence. The median follow-up was 60.7 months (6.0-170.4 months). Local control rate was 96.4% and the overall eye retention rate was 95.0% in this cohort. Local recurrence was correlated with a higher risk for metastasis and reduced survival. Largest tumor diameter was identified as the sole statistically significant risk factor for local recurrence (P = .00001). All globe-retaining retreatment approaches for local recurrence, including proton beam therapy, brachytherapy, and transpupillary thermotherapy used for recurrences at the tumor margins, showed good local tumor control and similar metastasis-free survivals. This study showed that each globe-retaining retreatment approach can result in satisfying local tumor control. In case of early detection of local recurrence, preservation of the globe can be warranted. Therefore, regularly performed follow-ups should be ensured. Copyright © 2015 Elsevier Inc. All rights reserved.

  20. Astrophysical S factors for radiative proton capture by {sup 3}H and {sup 7}Li nuclei

    SciTech Connect

    Dubovichenko, S. B.

    2011-03-15

    Within the potential cluster model where orbital states are classified according to Young diagrams and isospin, astrophysical S factors are considered for radiative proton capture by {sup 3}H and {sup 7}Li nuclei at energies of up to 1 and 10 keV, respectively. It is shown that the approach used, which takes into account only the E1 transition for the p{sup 3}H capture process, makes it possible to describe well the most recent experimental data at c.m. energies in the range from 50 keV to 5MeV. In the case of proton capture by {sup 7}Li nuclei, an M1 processwas taken into account in addition to the E1 transition, and a general behavior and the magnitude of the experimental S factor could be correctly reproduced owing to this at astrophysical energies, including the region around the resonance at 0.441 MeV (in the laboratory frame).

  1. The structure of light-front wavefunctions and constraints on hadronic form factors

    SciTech Connect

    S. J. Brodsky; J. R. Hiller; D. S. Hwang; V. A. Karmanov

    2003-11-17

    We study the analytic structure of light-front wave functions (LFWFs) and its consequences for hadron form factors using an explicitly Lorentz-invariant formulation of the front form. The normal to the light front is specified by a general null vector {omega}{sup {mu}}. The LFWFs with definite total angular momentum are eigenstates of a kinematic angular momentum operator and satisfy all Lorentz symmetries. They are analytic functions of the invariant mass squared of the constituents M{sub 0}{sup 2} = ({Sigma} k{sup {mu}}){sup 2} and the light-cone momentum fractions x{sub i} = k{sub i} {center_dot} {omega}/p {center_dot} {omega} multiplied by invariants constructed from the spin matrices, polarization vectors, and {omega}{sup {mu}}. These properties are illustrated using known nonperturbative eigensolutions of the Wick-Cutkosky model. We analyze the LFWFs introduced by Chung and Coester to describe static and low momentum properties of the nucleons. They correspond to the spin-locking of a quark with the spin of its parent nucleon, tog ether with a positive-energy projection constraint. These extra constraints lead to anomalous dependence of form factors on Q rather than Q{sup 2}. In contrast, the dependence of LFWFs on M{sub 0}{sup 2} implies that hadron form factors are analytic functions of Q{sup 2} in agreement with dispersion theory and perturbative QCD. We show that a model incorporating the leading-twist perturbative QCD prediction is consistent with recent data for the ratio of proton Pauli and Dirac form factors.

  2. Structural, thermal, morphological and biological studies of proton-transfer complexes formed from 4-aminoantipyrine with quinol and picric acid

    NASA Astrophysics Data System (ADS)

    Adam, Abdel Majid A.

    2013-03-01

    4-Aminoantipyrine (4AAP) is widely used in the pharmaceutical industry, biochemical experiments and environmental monitoring. However, residual amounts of 4AAP in the environment may pose a threat to human health. To provide basic data that can be used to extract or eliminate 4AAP from the environment, the proton-transfer complexes of 4AAP with quinol (QL) and picric acid (PA) were synthesized and spectroscopically investigated. The interactions afforded two new proton-transfer salts named 1,5-dimethyl-3-oxo-2-phenyl-2,3-dihydro-1H-pyrazol-4-aminium-4-hydroxyphenolate and 1,5-dimethyl-3-oxo-2-phenyl-2,3-dihydro-1H-pyrazol-4-aminium-2,4,6-trinitrophenolate for QL and PA, respectively, via a 1:1 stoichiometry. Elemental analysis (CHN), electronic absorption, spectrophotometric titration, IR, Raman, 1H NMR and X-ray diffraction were used to characterize the new products. The thermal stability of the synthesized CT complexes was investigated using thermogravimetric (TG) analyses, and the morphology and particle size of these complexes were obtained from scanning electron microscopy (SEM). It was found that PA and 4AAP immediately formed a yellow precipitate with a remarkable sponge-like morphology and good thermal stability up to 180 °C. Finally, the biological activities of the newly synthesized CT complexes were tested for their antibacterial and antifungal activities. The results indicated that the [(4AAP)(QL)] complex exhibited strong antimicrobial activities against various bacterial and fungal strains compared with standard drugs.

  3. Born-Oppenheimer Molecular Dynamics Study on Proton Dynamics of Strong Hydrogen Bonds in Aspirin Crystals, with Emphasis on Differences between Two Crystal Forms.

    PubMed

    Brela, Mateusz Z; Wójcik, Marek J; Witek, Łukasz J; Boczar, Marek; Wrona, Ewa; Hashim, Rauzah; Ozaki, Yukihiro

    2016-04-28

    In this study, the proton dynamics of hydrogen bonds for two forms of crystalline aspirin was investigated by the Born-Oppenheimer molecular dynamics (BOMD) method. Analysis of the geometrical parameters of hydrogen bonds using BOMD reveals significant differences in hydrogen bonding between the two crystalline forms of aspirin, Form I and Form II. Analysis of the trajectory for Form I shows spontaneous proton transfer in cyclic dimers, which is absent in Form II. Quantization of the O-H stretching modes allows a detailed discussion on the strength of hydrogen-bonding interactions. The focal point of our study is examination of the hydrogen bond characteristics in the crystal structure and clarification of the influence of hydrogen bonding on the presence of the two crystalline forms of aspirin. In the BOMD method, thermal motions were taken into account. Solving the Schrödinger equation for the snapshots of 2D proton potentials, extracted from MD, gives the best agreement with IR spectra. The character of medium-strong hydrogen bonds in Form I of aspirin was compared with that of weaker hydrogen bonds in aspirin Form II. Two proton minima are present in the potential function for the hydrogen bonds in Form I. The band contours, calculated by using one- and two-dimensional O-H quantization, reflect the differences in the hydrogen bond strengths between the two crystalline forms of aspirin, as well as the strong hydrogen bonding in the cyclic dimers of Form I and the medium-strong hydrogen bonding in Form II.

  4. Three-Loop Slope of the Dirac Form Factor and the 1S Lamb Shift in Hydrogen

    SciTech Connect

    Melnikov, Kirill; Ritbergen, Timo van

    2000-02-21

    The last unknown contribution to hydrogen energy levels at order m{alpha}{sup 7} , due to the slope of the Dirac form factor at three loops, is evaluated in a closed analytical form. The resulting shift of the hydrogen nS energy level is found to be 3.016/n{sup 3} kHz . Using the QED calculations of the 1S Lamb shift, we extract a precise value of the proton charge radius r{sub p}=0.883{+-}0.014 fm . (c) 2000 The American Physical Society.

  5. Three-Loop Slope of the Dirac Form Factor and the 1S Lamb Shift in Hydrogen.

    PubMed

    Melnikov, K; van Ritbergen, T

    2000-02-21

    The last unknown contribution to hydrogen energy levels at order mα^{7}, due to the slope of the Dirac form factor at three loops, is evaluated in a closed analytical form. The resulting shift of the hydrogen nS energy level is found to be 3.016/n^{3} kHz. Using the QED calculations of the 1S Lamb shift, we extract a precise value of the proton charge radius r_{p}=0.883±0.014 fm.

  6. Octet Baryon Electromagnetic Form Factors in a Relativistic Quark Model

    SciTech Connect

    Gilberto Ramalho, Kazuo Tsushima

    2011-09-01

    We study the octet baryon electromagnetic properties by applying the covariant spectator quark model, and provide covariant parametrization that can be used to study baryon electromagnetic reactions. While we use the lattice QCD data in the large pion mass regime (small pion cloud effects) to determine the parameters of the model in the valence quark sector, we use the nucleon physical and octet baryon magnetic moment data to parameterize the pion cloud contributions. The valence quark contributions for the octet baryon electromagnetic form factors are estimated by extrapolating the lattice parametrization in the large pion mass regime to the physical regime. As for the pion cloud contributions, we parameterize them in a covariant, phenomenological manner, combined with SU(3) symmetry. We also discuss the impact of the pion cloud effects on the octet baryon electromagnetic form factors and their radii.

  7. η' transition form factor from space- and timelike experimental data

    NASA Astrophysics Data System (ADS)

    Escribano, R.; Gonzàlez-Solís, S.; Masjuan, P.; Sanchez-Puertas, P.

    2016-09-01

    The η' transition form factor is reanalyzed in view of the recent first observation by BESIII of the Dalitz decay η'→γ e+e- in both space- and timelike regions at low and intermediate energies using the Padé approximants method. The present analysis provides a suitable parametrization for reproducing the measured form factor in the whole energy region and allows one to extract the corresponding low-energy parameters together with a prediction of their values at the origin, related to Γη'→γ γ , and the asymptotic limit. The η - η' mixing is reassessed within a mixing scheme compatible with the large-Nc chiral perturbation theory at next-to-leading order, with particular attention to the Okubo-Zweig-Iizuka-rule-violating parameters. The J /ψ , Z →η(')γ decays are also considered and predictions are reported.

  8. Dirac and Pauli form factors from lattice QCD

    SciTech Connect

    Collins, S.; Goeckeler, M.; Nobile, A.; Schaefer, A.; Haegler, Ph.; Horsley, R.; Winter, F.; Zanotti, J. M.; Nakamura, Y.; Pleiter, D.; Rakow, P. E. L.; Schierholz, G.; Schroers, W.; Stueben, H.

    2011-10-01

    We present a comprehensive analysis of the electromagnetic form factors of the nucleon from a lattice simulation with two flavors of dynamical O(a)-improved Wilson fermions. A key feature of our calculation is that we make use of an extensive ensemble of lattice gauge field configurations with four different lattice spacings, multiple volumes, and pion masses down to m{sub {pi}{approx}1}80 MeV. We find that by employing Kelly-inspired parametrizations for the Q{sup 2} dependence of the form factors, we are able to obtain stable fits over our complete ensemble. Dirac and Pauli radii and the anomalous magnetic moments of the nucleon are extracted and results at light quark masses provide evidence for chiral nonanalytic behavior in these fundamental observables.

  9. Two-photon transition form factor of c ¯ quarkonia

    NASA Astrophysics Data System (ADS)

    Chen, Jing; Ding, Minghui; Chang, Lei; Liu, Yu-xin

    2017-01-01

    The two-photon transition of c ¯c quarkonia are studied within a covariant approach based on the consistent truncation scheme of the quantum chromodynamics Dyson-Schwinger equation for the quark propagator and the Bethe-Salpeter equation for the mesons. We find the decay widths of ηc→γ γ and χc 0 ,2→γ γ in good agreement with experimental data. The obtained transition form factor of ηc→γ γ* for a wide range of spacelike photon-momentum-transfer squared is also in agreement with the experimental findings of the BABAR experiment. As a by-product, the decay widths of ηb,χb 0 ,2→γ γ and the transition form factor of ηb,χc 0 ,b 0→γ γ* are predicted, which await experimental testing.

  10. Stackable Form-Factor Peripheral Component Interconnect Device and Assembly

    NASA Technical Reports Server (NTRS)

    Somervill, Kevin M. (Inventor); Ng, Tak-kwong (Inventor); Torres-Pomales, Wilfredo (Inventor); Malekpour, Mahyar R. (Inventor)

    2013-01-01

    A stackable form-factor Peripheral Component Interconnect (PCI) device can be configured as a host controller or a master/target for use on a PCI assembly. PCI device may comprise a multiple-input switch coupled to a PCI bus, a multiplexor coupled to the switch, and a reconfigurable device coupled to one of the switch and multiplexor. The PCI device is configured to support functionality from power-up, and either control function or add-in card function.

  11. Two-photon exchange corrections to the pion form factor

    DOE PAGES

    Peter G. Blunden; Melnitchouk, Wally; Tjon, John A.

    2010-01-06

    Here, we compute two-photon exchange corrections to the electromagnetic form factor of the pion, taking into account the finite size of the pion. Compared to the soft-photon approximation for the infrared divergent contribution which neglects hadron structure effects, the corrections are found to be ≲ 1% for small Q2 (Q2 < 0.1 GeV2), but increase to several percent for Q2 ≳ 1 GeV2 at extreme backward angles.

  12. Convergent and discriminant validity of the Five Factor Form.

    PubMed

    Rojas, Stephanie L; Widiger, Thomas A

    2014-04-01

    The current study tests the convergent and discriminant validity of a modified version of the Five Factor Model Rating Form (FFMRF), a one-page, brief measure of the five-factor model. The Five Factor Form (FFF) explicitly identifies maladaptive variants for both poles of each of the 30 facets of the FFMRF. The purpose of the current study was to test empirically whether this modified version still provides a valid assessment of the FFM, as well as to compare its validity as a measure of the FFM to other brief FFM measures. Two independent samples of 510 and 330 community adults were sampled, one third of whom had a history of some form of mental health treatment. The FFF was compared with three abbreviated and/or brief measures of the FFM (i.e., the FFMRF, the Ten Item Personality Inventory, and the Big Five Inventory), a more extended measure (i.e., International Personality Item Pool-NEO), an alternative measure of general personality (i.e., the HEXACO-Personality Inventory-Revised), and a measure of maladaptive personality functioning (i.e., the Personality Inventory for Diagnostic and Statistical Manual of Mental Disorders, 5th edition). The results of the current study demonstrated convergent and discriminant validity, even at the single-item facet level. © The Author(s) 2013.

  13. Strange vector form factors from parity-violating electron scattering

    SciTech Connect

    Kent Paschke, Anthony Thomas, Robert Michaels, David Armstrong

    2011-06-01

    The simplest models might describe the nucleon as 3 light quarks, but this description would be incomplete without inclusion of the sea of glue and qbar q pairs which binds it. Early indications of a particularly large contribution from strange quarks in this sea to the spin and mass of the nucleon motivated an experimental program examining the role of these strange quarks in the nucleon vector form factors. The strangeness form factors can be extracted from the well-studied electromagnetic structure of the nucleon using parity-violation in electron-nuclear scattering to isolate the effect of the weak interaction. With high luminosity and polarization, and a very stable beam due to its superconducting RF cavities, CEBAF at Jefferson Lab is a precision instrument uniquely well suited to the challenge of measurements of the small parity-violating asymmetries. The techniques and results of the two major Jefferson Lab experimental efforts in parity-violation studies, HAPPEX and G0, as well as efforts to describe the strange form factors in QCD, will be reviewed.

  14. Meson Transition Form Factors in Light-Front Holographic QCD

    SciTech Connect

    Brodsky, Stanley J.; Cao, Fu-Guang; de Teramond, Guy F.; /Costa Rica U.

    2011-06-22

    We study the photon-to-meson transition form factors (TFFs) F{sub M{gamma}}(Q{sup 2}) for {gamma}{gamma}* {yields} M using light-front holographic methods. The Chern-Simons action, which is a natural form in 5-dimensional anti-de Sitter (AdS) space, leads directly to an expression for the photon-to-pion TFF for a class of confining models. Remarkably, the predicted pion TFF is identical to the leading order QCD result where the distribution amplitude has asymptotic form. The Chern-Simons form is local in AdS space and is thus somewhat limited in its predictability. It only retains the q{bar q} component of the pion wavefunction, and further, it projects out only the asymptotic form of the meson distribution amplitude. It is found that in order to describe simultaneously the decay process {pi}{sup 0} {yields} {gamma}{gamma} and the pion TFF at the asymptotic limit, a probability for the q{bar q} component of the pion wavefunction P{sub q{bar q}} = 0.5 is required; thus giving indication that the contributions from higher Fock states in the pion light-front wavefunction need to be included in the analysis. The probability for the Fock state containing four quarks (anti-quarks) which follows from analyzing the hadron matrix elements, P{sub q{bar q}q{bar q}} {approx} 10%, agrees with the analysis of the pion elastic form factor using light-front holography including higher Fock components in the pion wavefunction. The results for the TFFs for the {eta} and {eta}{prime} mesons are also presented. The rapid growth of the pion TFF exhibited by the BABAR data at high Q{sup 2} is not compatible with the models discussed in this article, whereas the theoretical calculations are in agreement with the experimental data for the {eta} and {eta}{prime} TFFs.

  15. Meson transition form factors in light-front holographic QCD

    NASA Astrophysics Data System (ADS)

    Brodsky, Stanley J.; Cao, Fu-Guang; de Téramond, Guy F.

    2011-10-01

    We study the photon-to-meson transition form factors (TFFs) FMγ(Q2) for γγ*→M using light-front holographic methods. The Chern-Simons action, which is a natural form in five-dimensional anti-de Sitter (AdS) space, is required to describe the anomalous coupling of mesons to photons using holographic methods and leads directly to an expression for the photon-to-pion TFF for a class of confining models. Remarkably, the predicted pion TFF is identical to the leading order QCD result where the distribution amplitude has asymptotic form. The Chern-Simons form is local in AdS space and is thus somewhat limited in its predictability. It only retains the qq¯ component of the pion wave function, and further, it projects out only the asymptotic form of the meson distribution amplitude. It is found that in order to describe simultaneously the decay process π0→γγ and the pion TFF at the asymptotic limit, a probability for the qq¯ component of the pion wave function Pqq¯=0.5 is required, thus giving indication that the contributions from higher Fock states in the pion light-front wave function need to be included in the analysis. The probability for the Fock state containing four quarks Pqq¯qq¯˜10%, which follows from analyzing the hadron matrix elements for a dressed current model, agrees with the analysis of the pion elastic form factor using light-front holography including higher Fock components in the pion wave function. The results for the TFFs for the η and η' mesons are also presented. The rapid growth of the pion TFF exhibited by the BABAR data at high Q2 is not compatible with the models discussed in this article, whereas the theoretical calculations are in agreement with the experimental data for the η and η' TFFs.

  16. Proton charge extensions

    NASA Astrophysics Data System (ADS)

    Stryker, Jesse R.; Miller, Gerald A.

    2016-01-01

    We examine how corrections to S -state energy levels En S in hydrogenic atoms due to the finite proton size are affected by moments of the proton charge distribution. The corrections to En S are computed moment by moment. The results demonstrate that the next-to-leading order term in the expansion is of order rp/aB times the size of the leading order term. Our analysis thus dispels any concern that the larger relative size of this term for muonic hydrogen versus electronic hydrogen might account for the current discrepancy of proton radius measurements extracted from the two systems. Furthermore, the next-to-leading order term in powers of rp/aB that we derive from a dipole proton form factor is proportional to , rather than , as would be expected from the scalar nature of the form factor. The dependence of the finite-size correction on and higher odd-power moments is shown to be a general result for any spherically symmetric proton charge distribution. A method for computing the moment expansion of the finite-size correction to arbitrary order is introduced and the results are tabulated for principal quantum numbers up to n =7 .

  17. Neutron charge radius and the neutron electric form factor

    SciTech Connect

    Gentile, T. R.; Crawford, C. B.

    2011-05-15

    For nearly forty years, the Galster parametrization has been employed to fit existing data for the neutron electric form factor, G{sub E}{sup n}, vs the square of the four-momentum transfer, Q{sup 2}. Typically this parametrization is constrained to be consistent with experimental data for the neutron charge radius. However, we find that the Galster form does not have sufficient freedom to accommodate reasonable values of the radius without constraining or compromising the fit. In addition, the G{sub E}{sup n} data are now at sufficient precision to motivate a two-parameter fit (or three parameters if we include thermal neutron data). Here we present a modified form of a two-dipole parametrization that allows this freedom and fits both G{sub E}{sup n} (including recent data at both low and high four-momentum transfer) and the charge radius well with simple, well-defined parameters. Analysis reveals that the Galster form is essentially a two-parameter approximation to the two-dipole form but becomes degenerate if we try to extend it naturally to three parameters.

  18. Mechanistic insights into protonation state as a critical factor in hFPPS enzyme inhibition

    NASA Astrophysics Data System (ADS)

    Fernández, David; Ortega-Castro, Joaquin; Mariño, Laura; Perelló, Joan; Frau, Juan

    2015-07-01

    Zoledronate and risedronate are the most powerful available nitrogen-containing bisphosphonates used in the treatment of bone-resorption disorders. Knowledge about inhibition mechanisms of these molecules is based on available crystallographic structures of human farnesyl pyrophosphate synthase (hFPPS). However, there is a lack of information explaining the inhibition potency of these two molecules compared to the natural substrate, dimethylallyl pyrophosphate. We carried out a molecular dynamics study that shown: (1) that NBPs potency is related to higher electrostatic interactions with the metallic cluster of the active site than to the natural substrate, and (2) the protonation of the R2 side chain is a critical factor to stabilize the NBPs into a closely irreversible ternary complex with the hFPPS.

  19. Influence of various carbon nano-forms as supports for Pt catalyst on proton exchange membrane fuel cell performance

    NASA Astrophysics Data System (ADS)

    Bharti, Abha; Cheruvally, Gouri

    2017-08-01

    In this study, we discuss the influence of various carbon supports for Pt on proton exchange membrane (PEM) fuel cell performance. Here, Pt supported on various carbon nano-forms [Pt/carbon black (Pt/CB), Pt/single-walled carbon nanotubes (Pt/SWCNT), Pt/multi-walled carbon nanotubes (Pt/MWCNT) and Pt/graphene (Pt/G)] are synthesized by a facile, single step, microwave-assisted, modified chemical reduction route. Their physical, chemical and electrochemical characteristics pertaining to oxygen reduction reaction (ORR) catalytic activity and stability in PEM fuel cell are studied in detail by various techniques and compared. The study shows that the different carbon supports does not significantly affect the Pt particle size during synthesis, but leads to different amount of defective sites in the carbon framework which influence both the availability of active metal nano-catalysts and metal-support interaction. In-situ electrochemical investigations reveal that the different carbon supports influence both ORR catalytic activity and stability of the catalyst. This is further corroborated by the demonstration of varying polarization characteristics on PEM fuel cell performance by different carbon supported Pt catalysts. This study reveals MWCNT as the most suitable carbon support for Pt catalyst, exhibiting high activity and stability for ORR in PEM fuel cell.

  20. Proton Gradients as a Key Physical Factor in the Evolution of the Forced Transport Mechanism Across the Lipid Membrane.

    PubMed

    Strbak, Oliver; Kanuchova, Zuzana; Krafcik, Andrej

    2016-11-01

    A critical phase in the transition from prebiotic chemistry to biological evolution was apparently an asymmetric ion flow across the lipid membrane. Due to imbalance in the ion flow, the early lipid vesicles could selectively take the necessary molecules from the environment, and release the side-products from the vesicle. Natural proton gradients played a definitively crucial role in this process, since they remain the basis of energy transfer in the present-day cells. On the basis of this supposition, and the premise of the early vesicle membrane's impermeability to protons, we have shown that the emergence of the proton gradient in the lipid vesicle could be a key physical factor in the evolution of the forced transport mechanism (pore formation and active transport) across the lipid bilayer. This driven flow of protons across the membrane is the result of the electrochemical proton gradient and osmotic pressures on the integrity of the lipid vesicle. At a critical number of new lipid molecules incorporated into the vesicle, the energies associated with the creation of the proton gradient exceed the bending stiffness of the lipid membrane, and overlap the free energy of the lipid bilayer pore formation.

  1. Effects of a granulocyte colony stimulating factor, Neulasta, in mini pigs exposed to total body proton irradiation

    PubMed Central

    Sanzari, Jenine K.; Krigsfeld, Gabriel S.; Shuman, Anne L.; Diener, Antonia K.; Lin, Liyong; Mai, Wilfried; Kennedy, Ann R.

    2015-01-01

    Astronauts could be exposed to solar particle event (SPE) radiation, which is comprised mostly of proton radiation. Proton radiation is also a treatment option for certain cancers. Both astronauts and clinical patients exposed to ionizing radiation are at risk for white blood cell (WBC) loss, which are the body’s main defense against infection. In this report, the effect of Neulasta treatment, a granulocyte colony stimulating factor, after proton radiation exposure is discussed. Mini pigs exposed to total body proton irradiation at a dose of 2 Gy received 4 treatments of either Neulasta or saline injections. Peripheral blood cell counts and thromboelastography parameters were recorded up to 30 days post-irradiation. Neulasta significantly improved white blood cell (WBC), specifically neutrophil, loss in irradiated animals by approximately 60% three days after the first injection, compared to the saline treated irradiated animals. Blood cell counts quickly decreased after the last Neulasta injection, suggesting a transient effect on WBC stimulation. Statistically significant changes in hemostasis parameters were observed after proton radiation exposure in both the saline and Neulasta treated irradiated groups, as well internal organ complications such as pulmonary changes. In conclusion, Neulasta treatment temporarily alleviates proton radiation-induced WBC loss, but has no effect on altered hemostatic responses. PMID:25909052

  2. Proton Gradients as a Key Physical Factor in the Evolution of the Forced Transport Mechanism Across the Lipid Membrane

    NASA Astrophysics Data System (ADS)

    Strbak, Oliver; Kanuchova, Zuzana; Krafcik, Andrej

    2016-11-01

    A critical phase in the transition from prebiotic chemistry to biological evolution was apparently an asymmetric ion flow across the lipid membrane. Due to imbalance in the ion flow, the early lipid vesicles could selectively take the necessary molecules from the environment, and release the side-products from the vesicle. Natural proton gradients played a definitively crucial role in this process, since they remain the basis of energy transfer in the present-day cells. On the basis of this supposition, and the premise of the early vesicle membrane's impermeability to protons, we have shown that the emergence of the proton gradient in the lipid vesicle could be a key physical factor in the evolution of the forced transport mechanism (pore formation and active transport) across the lipid bilayer. This driven flow of protons across the membrane is the result of the electrochemical proton gradient and osmotic pressures on the integrity of the lipid vesicle. At a critical number of new lipid molecules incorporated into the vesicle, the energies associated with the creation of the proton gradient exceed the bending stiffness of the lipid membrane, and overlap the free energy of the lipid bilayer pore formation.

  3. Effects of a granulocyte colony stimulating factor, Neulasta, in mini pigs exposed to total body proton irradiation

    NASA Astrophysics Data System (ADS)

    Sanzari, Jenine K.; Krigsfeld, Gabriel S.; Shuman, Anne L.; Diener, Antonia K.; Lin, Liyong; Mai, Wilfried; Kennedy, Ann R.

    2015-04-01

    Astronauts could be exposed to solar particle event (SPE) radiation, which is comprised mostly of proton radiation. Proton radiation is also a treatment option for certain cancers. Both astronauts and clinical patients exposed to ionizing radiation are at risk for loss of white blood cells (WBCs), which are the body's main defense against infection. In this report, the effect of Neulasta treatment, a granulocyte colony stimulating factor, after proton radiation exposure is discussed. Mini pigs exposed to total body proton irradiation at a dose of 2 Gy received 4 treatments of either Neulasta or saline injections. Peripheral blood cell counts and thromboelastography parameters were recorded up to 30 days post-irradiation. Neulasta significantly improved WBC loss, specifically neutrophils, in irradiated animals by approximately 60% three days after the first injection, compared to the saline treated, irradiated animals. Blood cell counts quickly decreased after the last Neulasta injection, suggesting a transient effect on WBC stimulation. Statistically significant changes in hemostasis parameters were observed after proton radiation exposure in both the saline and Neulasta treated irradiated groups, as well as internal organ complications such as pulmonary changes. In conclusion, Neulasta treatment temporarily alleviates proton radiation-induced WBC loss, but has no effect on altered hemostatic responses.

  4. Delirium in the geriatric unit: proton-pump inhibitors and other risk factors

    PubMed Central

    Otremba, Iwona; Wilczyński, Krzysztof; Szewieczek, Jan

    2016-01-01

    Background Delirium remains a major nosocomial complication of hospitalized elderly. Predictive models for delirium may be useful for identification of high-risk patients for implementation of preventive strategies. Objective Evaluate specific factors for development of delirium in a geriatric ward setting. Methods Prospective cross-sectional study comprised 675 consecutive patients aged 79.2±7.7 years (66% women and 34% men), admitted to the subacute geriatric ward of a multiprofile university hospital after exclusion of 113 patients treated with antipsychotic medication because of behavioral disorders before admission. Comprehensive geriatric assessments including a structured interview, physical examination, geriatric functional assessment, blood sampling, ECG, abdominal ultrasound, chest X-ray, Confusion Assessment Method for diagnosis of delirium, Delirium-O-Meter to assess delirium severity, Richmond Agitation-Sedation Scale to assess sedation or agitation, visual analog scale and Doloplus-2 scale to assess pain level were performed. Results Multivariate logistic regression analysis revealed five independent factors associated with development of delirium in geriatric inpatients: transfer between hospital wards (odds ratio [OR] =2.78; confidence interval [CI] =1.54–5.01; P=0.001), preexisting dementia (OR =2.29; CI =1.44–3.65; P<0.001), previous delirium incidents (OR =2.23; CI =1.47–3.38; P<0.001), previous fall incidents (OR =1.76; CI =1.17–2.64; P=0.006), and use of proton-pump inhibitors (OR =1.67; CI =1.11–2.53; P=0.014). Conclusion Transfer between hospital wards, preexisting dementia, previous delirium incidents, previous fall incidents, and use of proton-pump inhibitors are predictive of development of delirium in the geriatric inpatient setting. PMID:27103793

  5. Dispersive analysis of the scalar form factor of the nucleon

    NASA Astrophysics Data System (ADS)

    Hoferichter, M.; Ditsche, C.; Kubis, B.; Meißner, U.-G.

    2012-06-01

    Based on the recently proposed Roy-Steiner equations for pion-nucleon ( πN) scattering [1], we derive a system of coupled integral equations for the π π to overline N N and overline K K to overline N N S-waves. These equations take the form of a two-channel Muskhelishvili-Omnès problem, whose solution in the presence of a finite matching point is discussed. We use these results to update the dispersive analysis of the scalar form factor of the nucleon fully including overline K K intermediate states. In particular, we determine the correction {Δ_{σ }} = σ ( {2M_{π }^2} ) - {σ_{{π N}}} , which is needed for the extraction of the pion-nucleon σ term from πN scattering, as a function of pion-nucleon subthreshold parameters and the πN coupling constant.

  6. Measurement of the π0 electromagnetic transition form factor slope

    NASA Astrophysics Data System (ADS)

    Lazzeroni, C.; Lurkin, N.; Romano, A.; Blazek, T.; Koval, M.; Ceccucci, A.; Danielsson, H.; Falaleev, V.; Gatignon, L.; Goy Lopez, S.; Hallgren, B.; Maier, A.; Peters, A.; Piccini, M.; Riedler, P.; Frabetti, P. L.; Gersabeck, E.; Kekelidze, V.; Madigozhin, D.; Misheva, M.; Molokanova, N.; Movchan, S.; Potrebenikov, Yu.; Shkarovskiy, S.; Zinchenko, A.; Rubin, P.; Baldini, W.; Cotta Ramusino, A.; Dalpiaz, P.; Fiorini, M.; Gianoli, A.; Norton, A.; Petrucci, F.; Savrié, M.; Wahl, H.; Bizzeti, A.; Bucci, F.; Iacopini, E.; Lenti, M.; Veltri, M.; Antonelli, A.; Moulson, M.; Raggi, M.; Spadaro, T.; Eppard, K.; Hita-Hochgesand, M.; Kleinknecht, K.; Renk, B.; Wanke, R.; Winhart, A.; Winston, R.; Bolotov, V.; Duk, V.; Gushchin, E.; Ambrosino, F.; Di Filippo, D.; Massarotti, P.; Napolitano, M.; Palladino, V.; Saracino, G.; Anzivino, G.; Imbergamo, E.; Piandani, R.; Sergi, A.; Cenci, P.; Pepe, M.; Costantini, F.; Doble, N.; Giudici, S.; Pierazzini, G.; Sozzi, M.; Venditti, S.; Balev, S.; Collazuol, G.; DiLella, L.; Gallorini, S.; Goudzovski, E.; Lamanna, G.; Mannelli, I.; Ruggiero, G.; Cerri, C.; Fantechi, R.; Kholodenko, S.; Kurshetsov, V.; Obraztsov, V.; Semenov, V.; Yushchenko, O.; D'Agostini, G.; Leonardi, E.; Serra, M.; Valente, P.; Fucci, A.; Salamon, A.; Bloch-Devaux, B.; Peyaud, B.; Engelfried, J.; Coward, D.; Kozhuharov, V.; Litov, L.; Arcidiacono, R.; Bifani, S.; Biino, C.; Dellacasa, G.; Marchetto, F.; Numao, T.; Retière, F.

    2017-05-01

    The NA62 experiment collected a large sample of charged kaon decays in 2007 with a highly efficient trigger for decays into electrons. A measurement of the π0 electromagnetic transition form factor slope parameter from 1.11 ×106 fully reconstructed K± →π± πD0, πD0 →e+e- γ events is reported. The measured value a = (3.68 ± 0.57) ×10-2 is in good agreement with theoretical expectations and previous measurements, and represents the most precise experimental determination of the slope in the time-like momentum transfer region.

  7. Neutral pion form factor measurement by the NA62 experiment

    NASA Astrophysics Data System (ADS)

    Zamkovsky, Michal; Ambrosino, F.; Antonelli, A.; Anzivino, G.; Arcidiacono, R.; Baldini, W.; Balev, S.; Batley, J. R.; Behler, M.; Bifani, S.; Biino, C.; Bizzeti, A.; Blazek, T.; Bloch-Devaux, B.; Bocquet, G.; Bolotov, V.; Bucci, F.; Cabibbo, N.; Calvetti, M.; Cartiglia, N.; Ceccucci, A.; Cenci, P.; Cerri, C.; Cheshkov, C.; Chze, J. B.; Clemencic, M.; Collazuol, G.; Costantini, F.; Cotta Ramusino, A.; Coward, D.; Cundy, D.; Dabrowski, A.; DAgostini, G.; Dalpiaz, P.; Damiani, C.; Danielsson, H.; De Beer, M.; Dellacasa, G.; Derr, J.; Dibon, H.; Di Filippo, D.; DiLella, L.; Doble, N.; Duk, V.; Engelfried, J.; Eppard, K.; Falaleev, V.; Fantechi, R.; Fidecaro, M.; Fiorini, L.; Fiorini, M.; Fonseca Martin, T.; Frabetti, P. L.; Fucci, A.; Gallorini, S.; Gatignon, L.; Gersabeck, E.; Gianoli, A.; Giudici, S.; Gonidec, A.; Goudzovski, E.; Goy Lopez, S.; Gushchin, E.; Hallgren, B.; Hita-Hochgesand, M.; Holder, M.; Hristov, P.; Iacopini, E.; Imbergamo, E.; Jeitler, M.; Kalmus, G.; Kekelidze, V.; Kleinknecht, K.; Koval, M.; Kozhuharov, V.; Kubischta, W.; Kurshetsov, V.; Lamanna, G.; Lazzeroni, C.; Lenti, M.; Leonardi, E.; Litov, L.; Lurkin, N.; Madigozhin, D.; Maier, A.; Mannelli, I.; Marchetto, F.; Marel, G.; Markytan, M.; Marouelli, P.; Martini, M.; Masetti, L.; Massarotti, P.; Mazzucato, E.; Michetti, A.; Mikulec, I.; Misheva, M.; Molokanova, N.; Monnier, E.; Moosbrugger, U.; Morales Morales, C.; Moulson, M.; Movchan, S.; Munday, D. J.; Napolitano, M.; Nappi, A.; Neuhofer, G.; Norton, A.; Numao, T.; Obraztsov, V.; Palladino, V.; Patel, M.; Pepe, M.; Peters, A.; Petrucci, F.; Petrucci, M. C.; Peyaud, B.; Piandani, R.; Piccini, M.; Pierazzini, G.; Polenkevich, I.; Popov, I.; Potrebenikov, Y.; Raggi, M.; Renk, B.; Retire, F.; Riedler, P.; Romano, A.; Rubin, P.; Ruggiero, G.; Salamon, A.; Saracino, G.; Savri, M.; Scarpa, M.; Semenov, V.; Sergi, A.; Serra, M.; Shieh, M.; Shkarovskiy, S.; Slater, M. W.; Sozzi, M.; Spadaro, T.; Stoynev, S.; Swallow, E.; Szleper, M.; Valdata-Nappi, M.; Valente, P.; Vallage, B.; Velasco, M.; Veltri, M.; Venditti, S.; Wache, M.; Wahl, H.; Walker, A.; Wanke, R.; Widhalm, L.; Winhart, A.; Winston, R.; Wood, M. D.; Wotton, S. A.; Yushchenko, O.; Zinchenko, A.; Ziolkowski, M.

    2017-07-01

    The NA62 experiment at CERN collected a large sample of charged kaon decays with a highly efficient trigger for decays into electrons in 2007. The kaon beam represents a source of tagged neutral pion decays in vacuum. A measurement of the electromagnetic transition form factor slope of the neutral pion in the time-like region from ∼1 million fully reconstructed π 0 Dalitz decay is presented. The limits on dark photon production in π 0 decays from the earlier kaon experiment at CERN, NA48/2, are also reported.

  8. Neutral pion form factor measurement by the NA62 experiment

    NASA Astrophysics Data System (ADS)

    Pepe, Monica

    2017-03-01

    The NA62 experiment at CERN collected a large sample of charged kaon decays with a highly efficient trigger for decays into electrons in 2007. A measurement of the electromagnetic transition form factor slope of the neutral pion in the time-like region from about one million fully reconstructed π0 Dalitz decays is presented. The limits on dark photon production from a sample of about 1.7 × 107 π0 Dalitz decays collected in 2003-2004 by the earlier kaon experiment at CERN NA48/2 are also reported.

  9. Two-photon exchange corrections to the pion form factor

    SciTech Connect

    Peter G. Blunden; Melnitchouk, Wally; Tjon, John A.

    2010-01-06

    Here, we compute two-photon exchange corrections to the electromagnetic form factor of the pion, taking into account the finite size of the pion. Compared to the soft-photon approximation for the infrared divergent contribution which neglects hadron structure effects, the corrections are found to be ≲ 1% for small Q2 (Q2 < 0.1 GeV2), but increase to several percent for Q2 ≳ 1 GeV2 at extreme backward angles.

  10. CEBAF at higher energies and the kaon electromagnetic form factor

    SciTech Connect

    Baker, O.K.

    1994-04-01

    The electromagnetic production of strangeness, the physics of exciting systems having strangeness degrees of freedom (production of hadrons with one or more strange constituent quarks) using electromagnetic probes (real or virtual photons), is one of the frontier areas of research which will be investigated at the Continuous Electron Beam Accelerator Facility (CEBAF) when it becomes operational. CEBAF is expected to have an important impact upon this field of research using its specialized set of detection instruments and high quality electron beam. This paper focusses upon one aspect of the associated production of strangeness - the determination of the kaon electromagnetic form factor at high squared momentum transfers.

  11. Introducing soil forming factors with mini campus field trips

    NASA Astrophysics Data System (ADS)

    Quinton, John; Haygarth, Phil

    2013-04-01

    Students like field work, yet the proportion of time spent in the field during many soil science courses is small. Here we describe an introductory lecture on the soil forming factors based around a mini field trip in which we spend 45 minutes exploring these factors on the Lancaster University campus. In the 'trip' we visit some woodland to consider the effects of organic matter , vegetation and time on soil development and then take in a football pitch to examine the effects of landscape position, parent material and climate. Student responses are overwhelmingly positive and we suggest that more use can be made of our often mundane surroundings to explore soil formation. Soil functions and soil processes.

  12. Constraints on the nucleon strange form factors at Q˜0.1 GeV

    NASA Astrophysics Data System (ADS)

    Happex Collaboration; Aniol, K. A.; Armstrong, D. S.; Averett, T.; Benaoum, H.; Bertin, P. Y.; Burtin, E.; Cahoon, J.; Cates, G. D.; Chang, C. C.; Chao, Y.-C.; Chen, J. P.; Choi, Seonho; Chudakov, E.; Craver, B.; Cusanno, F.; Decowski, P.; Deepa, D.; Ferdi, C.; Feuerbach, R. J.; Finn, J. M.; Frullani, S.; Fuoti, K.; Garibaldi, F.; Gilman, R.; Glamazdin, A.; Gorbenko, V.; Grames, J. M.; Hansknecht, J.; Higinbotham, D. W.; Holmes, R.; Holmstrom, T.; Humensky, T. B.; Ibrahim, H.; de Jager, C. W.; Jiang, X.; Kaufman, L. J.; Kelleher, A.; Kolarkar, A.; Kowalski, S.; Kumar, K. S.; Lambert, D.; Laviolette, P.; Lerose, J.; Lhuillier, D.; Liyanage, N.; Margaziotis, D. J.; Mazouz, M.; McCormick, K.; Meekins, D. G.; Meziani, Z.-E.; Michaels, R.; Moffit, B.; Monaghan, P.; Munoz-Camacho, C.; Nanda, S.; Nelyubin, V.; Neyret, D.; Paschke, K. D.; Poelker, M.; Pomatsalyuk, R.; Qiang, Y.; Reitz, B.; Roche, J.; Saha, A.; Singh, J.; Snyder, R.; Souder, P. A.; Stutzman, M.; Subedi, R.; Suleiman, R.; Sulkosky, V.; Tobias, W. A.; Urciuoli, G. M.; Vacheret, A.; Voutier, E.; Wang, K.; Wilson, R.; Wojtsekhowski, B.; Zheng, X.

    2006-04-01

    We report the most precise measurement to date of a parity-violating asymmetry in elastic electron proton scattering. The measurement was carried out with a beam energy of 3.03 GeV and a scattering angle <θ>=6.0, with the result A=(-1.14±0.24(stat)±0.06(syst))×10. From this we extract, at Q=0.099 GeV, the strange form factor combination GEs+0.080GMs=0.030±0.025(stat)±0.006(syst)±0.012(FF) where the first two errors are experimental and the last error is due to the uncertainty in the neutron electromagnetic form factor. This result significantly improves current knowledge of GEs and GMs at Q˜0.1 GeV. A consistent picture emerges when several measurements at about the same Q value are combined: GEs is consistent with zero while positive values are favored for GMs, though GEs=GMs=0 is compatible with the data at 95% C.L.

  13. The impact of s-bar{s} asymmetry on the strange electromagnetic form factor

    NASA Astrophysics Data System (ADS)

    Ghasempour Nesheli, Ali

    2016-09-01

    The existence of the strange quark asymmetry in the nucleon sea has been indicated by both the experimental and theoretical analyses. Although it is well known that the s-bar{{s}} asymmetry is important for some processes in high-energy hadron collisions, it has also been indicated that it can be related to the strange Dirac form factor F 1 s. In this work, we have studied the impact of s- bar{{s}} asymmetry and its uncertainty from various modern parton distribution functions (PDFs) on F 1 s and compared the obtained results with the available experimental information. As a result, we found that the uncertainty in F 1 s( t) due to the s( x) - bar{s}( x) distribution is rather large so that it dominates the model uncertainty at all values of the squared momentum transfer t. However, taking into account the uncertainties, the theoretical predictions of F 1 s( t) are fully compatible with the estimate extracted from experiment. We concluded that the future accurate experimental data of the strange Dirac form factor might be used to put direct constraints on the strange content of the proton and reduce its uncertainty that has always been a challenge.

  14. Meson transition form factors in light-front holographic QCD

    SciTech Connect

    Brodsky, Stanley J.; Cao Fuguang; de Teramond, Guy F.

    2011-10-01

    We study the photon-to-meson transition form factors (TFFs) F{sub M}{gamma}(Q{sup 2}) for {gamma}{gamma}{sup *}{yields}M using light-front holographic methods. The Chern-Simons action, which is a natural form in five-dimensional anti-de Sitter (AdS) space, is required to describe the anomalous coupling of mesons to photons using holographic methods and leads directly to an expression for the photon-to-pion TFF for a class of confining models. Remarkably, the predicted pion TFF is identical to the leading order QCD result where the distribution amplitude has asymptotic form. The Chern-Simons form is local in AdS space and is thus somewhat limited in its predictability. It only retains the qq component of the pion wave function, and further, it projects out only the asymptotic form of the meson distribution amplitude. It is found that in order to describe simultaneously the decay process {pi}{sup 0}{yields}{gamma}{gamma} and the pion TFF at the asymptotic limit, a probability for the qq component of the pion wave function P{sub qq}=0.5 is required, thus giving indication that the contributions from higher Fock states in the pion light-front wave function need to be included in the analysis. The probability for the Fock state containing four quarks P{sub qqqq}{approx}10%, which follows from analyzing the hadron matrix elements for a dressed current model, agrees with the analysis of the pion elastic form factor using light-front holography including higher Fock components in the pion wave function. The results for the TFFs for the {eta} and {eta}{sup '} mesons are also presented. The rapid growth of the pion TFF exhibited by the BABAR data at high Q{sup 2} is not compatible with the models discussed in this article, whereas the theoretical calculations are in agreement with the experimental data for the {eta} and {eta}{sup '} TFFs.

  15. Polymer waveguide technology: optical connectivity for small form factor applications

    NASA Astrophysics Data System (ADS)

    Lizotte, Todd

    2010-08-01

    Planar polymer waveguides provide opportunities for small form factor distribution of laser light for communication, energy transfer and triggering devices used in the field of optically initiated arming, safing, fusing and firing. The two primary methods or classes of polymer waveguide technology use photolithographic processes both mask and maskless techniques. A waveguide is a device that controls the propagation of an electromagnetic wave so that the wave is forced to follow a path defined by the physical structure of the guide. Fabrication takes the form of both a ridge technology (ridge or trench formed by an embossing or etching method) and the second fabrication technique and the subject of this paper is termed Diffusion Technology [1]. This method includes the formation of a high refractive index waveguide by monomer diffusion into the light-exposed guide forming region with no mechanical or chemical etching contact. An essential process feature here is the photomask-defined light exposure of a mobile monomer waveguide forming region in a polymer matrix that converts the monomer to a polymer. The process of continued monomer diffusion into the surrounding guide imaged region increases the density. The addition of other laminated monomer/polymer diffusing layers with the typical three-plus layer configuration is completely photopolymerized after diffusion is complete. The essential steps include a light induced imaging reaction, a total polymerization light fixing for the entire film, and final cure, all using pre-coated dry materials without waveguide side wall contact. Light and molecular diffusion determine the guide walls [1]. This paper will provide testing results and information on the state of polymer waveguides, the methods of fabrication and the general conditions that these waveguides can operate under. The use of polymer waveguides for connectivity has sufficiently advanced, is practical and available for consideration in near term application

  16. Measurement of the Λb0 decay form factor

    NASA Astrophysics Data System (ADS)

    Abdallah, J.; Abreu, P.; Adam, W.; Adzic, P.; Albrecht, T.; Alderweireld, T.; Alemany-Fernandez, R.; Allmendinger, T.; Allport, P. P.; Amaldi, U.; Amapane, N.; Amato, S.; Anashkin, E.; Andreazza, A.; Andringa, S.; Anjos, N.; Antilogus, P.; Apel, W.-D.; Arnoud, Y.; Ask, S.; Asman, B.; Augustin, J. E.; Augustinus, A.; Baillon, P.; Ballestrero, A.; Bambade, P.; Barbier, R.; Bardin, D.; Barker, G.; Baroncelli, A.; Battaglia, M.; Baubillier, M.; Becks, K.-H.; Begalli, M.; Behrmann, A.; Ben-Haim, E.; Benekos, N.; Benvenuti, A.; Berat, C.; Berggren, M.; Berntzon, L.; Bertrand, D.; Besancon, M.; Besson, N.; Bloch, D.; Blom, M.; Bluj, M.; Bonesini, M.; Boonekamp, M.; Booth, P. S. L.; Borisov, G.; Botner, O.; Bouquet, B.; Bowcock, T. J. V.; Boyko, I.; Bracko, M.; Brenner, R.; Brodet, E.; Bruckman, P.; Brunet, J. M.; Bugge, L.; Buschmann, P.; Calvi, M.; Camporesi, T.; Canale, V.; Carena, F.; Castro, N.; Cavallo, F.; Chapkin, M.; Charpentier, Ph.; Checchia, P.; Chierici, R.; Chliapnikov, P.; Chudoba, J.; Chung, S. U.; Cieslik, K.; Collins, P.; Contri, R.; Cosme, G.; Cossutti, F.; Costa, M. J.; Crawley, B.; Crennell, D.; Cuevas, J.; D'Hondt, J.; Dalmau, J.; da Silva, T.; da Silva, W.; Della Ricca, G.; de Angelis, A.; de Boer, W.; de Clercq, C.; de Lotto, B.; de Maria, N.; de Min, A.; de Paula, L.; di Ciaccio, L.; di Simone, A.; Doroba, K.; Drees, J.; Dris, M.; Eigen, G.; Ekelof, T.; Ellert, M.; Elsing, M.; Espirito Santo, M. C.; Fanourakis, G.; Fassouliotis, D.; Feindt, M.; Fernandez, J.; Ferrer, A.; Ferro, F.; Flagmeyer, U.; Foeth, H.; Fokitis, E.; Fulda-Quenzer, F.; Fuster, J.; Gandelman, M.; Garcia, C.; Gavillet, Ph.; Gazis, E.; Gokieli, R.; Golob, B.; Gomez-Ceballos, G.; Goncalves, P.; Graziani, E.; Grosdidier, G.; Grzelak, K.; Guy, J.; Haag, C.; Hallgren, A.; Hamacher, K.; Hamilton, K.; Haug, S.; Hauler, F.; Hedberg, V.; Hennecke, M.; Herr, H.; Hoffman, J.; Holmgren, S.-O.; Holt, P. J.; Houlden, M. A.; Hultqvist, K.; Jackson, J. N.; Jarlskog, G.; Jarry, P.; Jeans, D.; Johansson, E. K.; Johansson, P. D.; Jonsson, P.; Joram, C.; Jungermann, L.; Kapusta, F.; Katsanevas, S.; Katsoufis, E.; Kernel, G.; Kersevan, B. P.; Kerzel, U.; Kiiskinen, A.; King, B. T.; Kjaer, N. J.; Kluit, P.; Kokkinias, P.; Kourkoumelis, C.; Kouznetsov, O.; Krumstein, Z.; Kucharczyk, M.; Lamsa, J.; Leder, G.; Ledroit, F.; Leinonen, L.; Leitner, R.; Lemonne, J.; Lepeltier, V.; Lesiak, T.; Liebig, W.; Liko, D.; Lipniacka, A.; Lopes, J. H.; Lopez, J. M.; Loukas, D.; Lutz, P.; Lyons, L.; MacNaughton, J.; Malek, A.; Maltezos, S.; Mandl, F.; Marco, J.; Marco, R.; Marechal, B.; Margoni, M.; Marin, J.-C.; Mariotti, C.; Markou, A.; Martinez-Rivero, C.; Masik, J.; Mastroyiannopoulos, N.; Matorras, F.; Matteuzzi, C.; Mazzucato, F.; Mazzucato, M.; McNulty, R.; Meroni, C.; Meyer, W. T.; Miagkov, A.; Migliore, E.; Mitaroff, W.; Mjoernmark, U.; Moa, T.; Moch, M.; Moenig, K.; Monge, R.; Montenegro, J.; Moraes, D.; Moreno, S.; Morettini, P.; Mueller, U.; Muenich, K.; Mulders, M.; Mundim, L.; Murray, W.; Muryn, B.; Myatt, G.; Myklebust, T.; Nassiakou, M.; Navarria, F.; Nawrocki, K.; Nicolaidou, R.; Nikolenko, M.; Oblakowska-Mucha, A.; Obraztsov, V.; Olshevski, A.; Onofre, A.; Orava, R.; Osterberg, K.; Ouraou, A.; Oyanguren, A.; Paganoni, M.; Paiano, S.; Palacios, J. P.; Palka, H.; Papadopoulou, Th. D.; Pape, L.; Parkes, C.; Parodi, F.; Parzefall, U.; Passeri, A.; Passon, O.; Peralta, L.; Perepelitsa, V.; Perrotta, A.; Petrolini, A.; Piedra, J.; Pieri, L.; Pierre, F.; Pimenta, M.; Piotto, E.; Podobnik, T.; Poireau, V.; Pol, M. E.; Polok, G.; Poropat, P.; Pozdniakov, V.; Pukhaeva, N.; Pullia, A.; Rames, J.; Ramler, L.; Read, A.; Rebecchi, P.; Rehn, J.; Reid, D.; Reinhardt, R.; Renton, P.; Richard, F.; Ridky, J.; Rivero, M.; Rodriguez, D.; Romero, A.; Ronchese, P.; Rosenberg, E.; Roudeau, P.; Rovelli, T.; Ruhlmann-Kleider, V.; Ryabtchikov, D.; Sadovsky, A.; Salmi, L.; Salt, J.; Savoy-Navarro, A.; Schwickerath, U.; Segar, A.; Sekulin, R.; Siebel, M.; Sisakian, A.; Smadja, G.; Smirnova, O.; Sokolov, A.; Sopczak, A.; Sosnowski, R.; Spassov, T.; Stanitzki, M.; Stocchi, A.; Strauss, J.; Stugu, B.; Szczekowski, M.; Szeptycka, M.; Szumlak, T.; Tabarelli, T.; Taffard, A. C.; Tegenfeldt, F.; Timmermans, J.; Tkatchev, L.; Tobin, M.; Todorovova, S.; Tome, B.; Tonazzo, A.; Tortosa, P.; Travnicek, P.; Treille, D.; Tristram, G.; Trochimczuk, M.; Troncon, C.; Turluer, M.-L.; Tyapkin, I. A.; Tyapkin, P.; Tzamarias, S.; Uvarov, V.; Valenti, G.; van Dam, P.; van Eldik, J.; van Lysebetten, A.; van Remortel, N.; van Vulpen, I.; Vegni, G.; Veloso, F.; Venus, W.; Verdier, P.; Verzi, V.; Vilanova, D.; Vitale, L.; Vrba, V.; Wahlen, H.; Washbrook, A. J.; Weiser, C.; Wicke, D.; Wickens, J.; Wilkinson, G.; Winter, M.; Witek, M.; Yushchenko, O.; Zalewska, A.; Zalewski, P.; Zavrtanik, D.; Zhuravlov, V.; Zimin, N. I.; Zintchenko, A.; Zupan, M.; Delphi Collaboration

    2004-04-01

    The form factor of Λb0 baryons is estimated using 3.46×106 hadronic Z decays collected by the DELPHI experiment between 1992 and 1995. Charmed Λc+ baryons fully reconstructed in the pK-π+, pK0S, and Λπ+π+π- modes, are associated to a lepton with opposite charge in order to select Λb0→Λc+l-ν¯l decays. From a combined likelihood and event rate fit to the distribution of the Isgur-Wise variable w, and using the Heavy Quark Effective Theory (HQET), the slope of the b-baryon form factor is measured to be ρ̂2=2.03±0.46(stat)+0.72-1.00(syst). The exclusive semileptonic branching fraction Br(Λb0→Λc+l-ν¯l) can be derived from ρ̂2 and is found to be (5.0+1.1-0.8(stat)+1.6-1.2(syst))%. Limits on other branching fractions are also obtained.

  17. Small form factor optical fiber connector evaluation for harsh environments

    NASA Astrophysics Data System (ADS)

    Ott, Melanie N.; Thomes, W. Joe, Jr.; Chuska, Richard F.; Switzer, Robert; Blair, Diana E.

    2011-09-01

    For the past decade NASA programs have utilized the Diamond AVIM connector for optical fiber assemblies on space flight instrumentation. These connectors have been used in communications, sensing and LIDAR systems where repeatability and high performance are required. Recently Diamond has released a smaller form factor optical fiber connector called the "Mini-AVIM" which although more compact still includes the tight tolerances and the ratcheting feature of the heritage AVIM. NASA Goddard Space Flight Center Photonics Group in the Parts, Packaging and Assembly Technologies Office has been performing evaluations of this connector to determine how it compares to the performance of the AVIM connector and to assess its feasibility for harsh environmental applications. Vibration and thermal testing were performed on the Mini-AVIM with both multi-mode and single-mode optical fiber using insitu optical transmission monitoring. Random vibration testing was performed using typical launch condition profiles for most NASA missions but extended to 35 Grms, which is much higher than most requirements. Thermal testing was performed incrementally up to a range of -55°C to +125°C. The test results include both unjacketed fiber and cabled assembly evaluations. The data presented here indicate that the Mini-AVIM provides a viable option for small form factor applications that require a high performance optical fiber connector.

  18. Energy transport mechanism in the form of proton soliton in a one-dimensional hydrogen-bonded polypeptide chain.

    PubMed

    Kavitha, L; Priya, R; Ayyappan, N; Gopi, D; Jayanthi, S

    2016-01-01

    The dynamics of protons in a one-dimensional hydrogen-bonded (HB) polypeptide chain (PC) is investigated theoretically. A new Hamiltonian is formulated with the inclusion of higher-order molecular interactions between peptide groups (PGs). The wave function of the excitation state of a single particle is replaced by a new wave function of a two-quanta quasi-coherent state. The dynamics is governed by a higher-order nonlinear Schrödinger equation and the energy transport is performed by the proton soliton. A nonlinear multiple-scale perturbation analysis has been performed and the evolution of soliton parameters such as velocity and amplitude is explored numerically. The proton soliton is thermally stable and very robust against these perturbations. The energy transport by the proton soliton is more appropriate to understand the mechanism of energy transfer in biological processes such as muscle contraction, DNA replication, and neuro-electric pulse transfer on biomembranes.

  19. An experiment for the direct determination of the g-factor of a single proton in a Penning trap

    NASA Astrophysics Data System (ADS)

    Rodegheri, C. C.; Blaum, K.; Kracke, H.; Kreim, S.; Mooser, A.; Quint, W.; Ulmer, S.; Walz, J.

    2012-06-01

    A new apparatus has been designed that aims at a direct precision measurement of the g-factor of a single isolated proton or antiproton in a Penning trap. We present a thorough discussion on the trap design and a method for the experimental trap optimization using a single stored proton. A first attempt at the g-factor determination has been made in a section of the trap with a magnetic bottle. The Larmor frequency of the proton has been measured with a relative uncertainty of 1.8 × 10-6 and the magnetic moment has been determined with a relative uncertainty of 8.9 × 10-6. A g-factor of 5.585 696(50) has been obtained, which is in excellent agreement with previous measurements and predictions. Future experiments shall drive the spin-flip transition in a section of the trap with a homogeneous magnetic field. This has the potential to improve the precision of the measured g-factor of the proton and the antiproton by several orders of magnitude.

  20. Third Zemach moment of the proton

    SciTech Connect

    Ian C. Cloet, Gerald A. Miller

    2011-01-01

    Modern electron scattering experiments have determined the proton electric form factor, G_{Ep}(Q^2), to high precision. We utilize this data, represented by the different form factor parametrizations, to compute the third Zemach moment of the proton charge distribution. We find that existing data rule out a value of the third Zemach moment large enough to explain the current puzzle with the proton charge radius determined from the Lamb shift in muonic hydrogen. This is in contrast with the recent claim of De Rujula [arXiv:1008.3861].

  1. Proton Transport

    NASA Technical Reports Server (NTRS)

    Pohorille, Andrew; DeVincenzi, Donald L. (Technical Monitor)

    2001-01-01

    The transport of protons across membranes is an essential process for both bioenergetics of modern cells and the origins of cellular life. All living systems make use of proton gradients across cell walls to convert environmental energy into a high-energy chemical compound, adenosine triphosphate (ATP), synthesized from adenosine diphosphate. ATP, in turn, is used as a source of energy to drive many cellular reactions. The ubiquity of this process in biology suggests that even the earliest cellular systems were relying on proton gradient for harvesting environmental energy needed to support their survival and growth. In contemporary cells, proton transfer is assisted by large, complex proteins embedded in membranes. The issue addressed in this Study was: how the same process can be accomplished with the aid of similar but much simpler molecules that could have existed in the protobiological milieu? The model system used in the study contained a bilayer membrane made of phospholipid, dimyristoylphosphatidylcholine (DMPC) which is a good model of the biological membranes forming cellular boundaries. Both sides of the bilayer were surrounded by water which simulated the environment inside and outside the cell. Embedded in the membrane was a fragment of the Influenza-A M$_2$ protein and enough sodium counterions to maintain system neutrality. This protein has been shown to exhibit remarkably high rates of proton transport and, therefore, is an excellent model to study the formation of proton gradients across membranes. The Influenza M$_2$ protein is 97 amino acids in length, but a fragment 25 amino acids long. which contains a transmembrane domain of 19 amino acids flanked by three amino acids on each side. is sufficient to transport protons. Four identical protein fragments, each folded into a helix, aggregate to form small channels spanning the membrane. Protons are conducted through a narrow pore in the middle of the channel in response to applied voltage. This

  2. Assignment of selected hyperfine proton NMR resonances in the met forms of Glycera dibranchiata monomer hemoglobins and comparisons with sperm whale metmyoglobin

    SciTech Connect

    Constantinidis, I.; Satterlee, J.D.; Pandey, R.K.; Leung, H.K.; Smith, K.M.

    1988-04-19

    This work indicates a high degree of purity for our preparations of all three of the primary Glycera dibranchiata monomer hemoglobins and details assignments of the heme methyl and vinyl protons in the hyperfine shift region of the ferric (aquo.) protein forms. The assignments were carried out by reconstituting the apoproteins of each component with selectively deuteriated hemes. The results indicate that even though the individual component preparations consist of essentially a single protein, the proton NMR spectra indicate spectroscopic heterogeneity. Evidence is presented for identification and classification of major and minor protein forms that are present in solutions of each component. Finally, in contrast to previous results, a detailed analysis of the proton hyperfine shift patterns of the major and minor forms of each component, in comparison to the major and minor forms of metmyoglobin, leads to the conclusions that the corresponding forms of the proteins from each species have strikingly similar heme-globin contacts and display nearly identical heme electronic structures and coordination numbers.

  3. The G0 experiment at Jefferson laboratory : Measurement of the weak neutral form factors of the nucleon

    SciTech Connect

    C. Furget

    2005-05-01

    The G0 experiment aims to measure parity-violating asymmetries in elastic electron-proton and quasi-elastic electron-deuteron scattering. This experimental program allows to perform the separation of the electric and magnetic weak neutral and axial form factors for three different momentum transfers 0.3, 0.5 and 0.8 (GeV/c)2. The first part of the experiment has been performed in Hall C of Jefferson Laboratory with a commissioned setup. A preliminary analysis of the data has provided a first estimate of the main systematic uncertainties. The analysis to determine the actual physics asymmetries is proceeding.

  4. Lattice calculation of composite dark matter form factors

    NASA Astrophysics Data System (ADS)

    Appelquist, T.; Brower, R. C.; Buchoff, M. I.; Cheng, M.; Cohen, S. D.; Fleming, G. T.; Kiskis, J.; Lin, M. F.; Neil, E. T.; Osborn, J. C.; Rebbi, C.; Schaich, D.; Schroeder, C.; Syritsyn, S.; Voronov, G.; Vranas, P.; Wasem, J.

    2013-07-01

    Composite dark matter candidates, which can arise from new strongly-coupled sectors, are well-motivated and phenomenologically interesting, particularly in the context of asymmetric generation of the relic density. In this work, we employ lattice calculations to study the electromagnetic form factors of electroweak-neutral dark-matter baryons for a three-color, QCD-like theory with Nf=2 and 6 degenerate fermions in the fundamental representation. We calculate the (connected) charge radius and anomalous magnetic moment, both of which can play a significant role for direct detection of composite dark matter. We find minimal Nf dependence in these quantities. We generate mass-dependent cross sections for dark matter-nucleon interactions and use them in conjunction with experimental results from XENON100, excluding dark matter candidates of this type with masses below 10 TeV.

  5. Exposing strangeness: Projections for kaon electromagnetic form factors

    DOE PAGES

    Gao, Fei; Chang, Lei; Liu, Yu -Xin; ...

    2017-08-28

    A continuum approach to the kaon and pion bound-state problems is used to reveal their electromagnetic structure. For both systems, when used with parton distribution amplitudes appropriate to the scale of the experiment, Standard Model hard-scattering formulas are accurate to within 25% at momentum transfers Q2 ≈ 8 GeV2. There are measurable differences between the distribution of strange and normal matter within the kaons, e.g. the ratio of their separate contributions reaches a peak value of 1.5 at Q2 ≈ 6 GeV2. Its subsequent Q2 evolution is accurately described by the hard scattering formulas. Projections for the ratio of kaonmore » and pion form factors at timelike momenta beyond the resonance region are also presented. In conclusion, these results and projections should prove useful in planning next-generation experiments.« less

  6. The Spectral Form Factor Is Not Self-Averaging

    SciTech Connect

    Prange, R.

    1997-03-01

    The form factor, k(t), is the spectral statistic which best displays nonuniversal quasiclassical deviations from random matrix theory. Recent estimations of k(t) for a single spectrum found interesting new effects of this type. It was supposed that k(t) is {ital self-averaging} and thus did not require an ensemble average. We here argue that this supposition sometimes fails and that for many important systems an ensemble average is essential to see detailed properties of k(t). In other systems, notably the nontrivial zeros of Riemann zeta function, it will be possible to see the nonuniversal properties by an analysis of a single spectrum. {copyright} {ital 1997} {ital The American Physical Society}

  7. Exposing strangeness: Projections for kaon electromagnetic form factors

    NASA Astrophysics Data System (ADS)

    Gao, Fei; Chang, Lei; Liu, Yu-Xin; Roberts, Craig D.; Tandy, Peter C.

    2017-08-01

    A continuum approach to the kaon and pion bound-state problems is used to reveal their electromagnetic structure. For both systems, when used with parton distribution amplitudes appropriate to the scale of the experiment, Standard Model hard-scattering formulas are accurate to within 25% at momentum transfers Q2≈8 GeV2. There are measurable differences between the distribution of strange and normal matter within the kaons, e.g. the ratio of their separate contributions reaches a peak value of 1.5 at Q2≈6 GeV2. Its subsequent Q2 evolution is accurately described by the hard scattering formulas. Projections for the ratio of kaon and pion form factors at timelike momenta beyond the resonance region are also presented. These results and projections should prove useful in planning next-generation experiments.

  8. Meson Form Factors and Deep Exclusive Meson Production Experiments

    NASA Astrophysics Data System (ADS)

    Horn, Tanja

    2017-03-01

    Pion and kaon electroproduction data play a unique role in Nature and our understanding of them is essential for explaining hadron structure. Precision longitudinaltransverse separated pion and kaon cross sections are of particular interest. They allow for the extraction of meson form factors and validation of understanding of hard exclusive and semi-inclusive reactions (π+, K+, π0, γ) towards 3D hadron imaging and potential future flavor decomposition. We review recent data and present prospects for deep exclusive pion and kaon electroproduction at the 12 GeV Jefferson Lab including the prospects to use projected charged- and neutral pion data to further determine the spin, charge-parity and flavor of GPDs, including the helicity-flip GPDs.

  9. PCMCIA-like ultrasmall form-factor optical drive

    NASA Astrophysics Data System (ADS)

    Kim, Sookyung; Lee, Jungkyu; Park, Jinmoo; Park, Gunsoon; Lee, Jeonguk; Lee, Choongwoo; Son, Do-Hyeon; Kim, Jin-Yong; Kim, Seong-hyok; Yee, Youngjoo

    2003-09-01

    A prototype of ultra small optical drive was studied and developed in order to see the feasibility of mobile application, which is targeted to be attachable into the PCMCIA II slot in small mobile devices. A new design and fabrication technology of optical flying head (OFH) for first surface MO recording was studied, and an effective OFH precisely equipped with high NA lens and MO coil was developed based on miniaturization technology. Design consideration of small form factor optical drive is discussed. Some technical issues and barriers in designing and manufacturing the OFH are introduced. Head-disk interface for reliability and flying stability on plastic disk media was tested and evaluated. Basic tracking and read-write performances in a test bed system were tested.

  10. Form factors and related quantities in clothed-particle representation

    NASA Astrophysics Data System (ADS)

    Shebeko, Alexander; Arslanaliev, Adam

    2017-03-01

    We show new applications of the notion of clothed particles in quantum field theory. Its realization by means of the clothing procedure put forward by Greenberg and Schweber allows one to express the total Hamiltonian H and other generators of the Poincaré group for a given system of interacting fields through the creation (annihilation) operators for the so-called clothed particles with physical (observed) properties. Here such a clothed particle representation is used to calculate the matrix elements (shortly, form factors) of the corresponding Nöther current operators sandwiched between the H eigenstates. Our calculations are performed with help of an iterative technique suggested by us earlier when constructing the NN → πNN transition operators. As an illustration, we outline some application of our approach in the spinor quantum electrodynamics.

  11. Thin and small form factor cells : simulated behavior.

    SciTech Connect

    Clews, Peggy Jane; Pluym, Tammy; Grubbs, Robert K.; Cruz-Campa, Jose Luis; Zubia, David; Young, Ralph Watson; Okandan, Murat; Gupta, Vipin P.; Nielson, Gregory N.; Resnick, Paul James

    2010-07-01

    Thin and small form factor cells have been researched lately by several research groups around the world due to possible lower assembly costs and reduced material consumption with higher efficiencies. Given the popularity of these devices, it is important to have detailed information about the behavior of these devices. Simulation of fabrication processes and device performance reveals some of the advantages and behavior of solar cells that are thin and small. Three main effects were studied: the effect of surface recombination on the optimum thickness, efficiency, and current density, the effect of contact distance on the efficiency for thin cells, and lastly the effect of surface recombination on the grams per Watt-peak. Results show that high efficiency can be obtained in thin devices if they are well-passivated and the distance between contacts is short. Furthermore, the ratio of grams per Watt-peak is greatly reduced as the device is thinned.

  12. Algebraic approach to form factors in the complex sinh-Gordon theory

    NASA Astrophysics Data System (ADS)

    Lashkevich, Michael; Pugai, Yaroslav

    2017-01-01

    We study form factors of the quantum complex sinh-Gordon theory in the algebraic approach. In the case of exponential fields the form factors can be obtained from the known form factors of the ZN-symmetric Ising model. The algebraic construction also provides an Ansatz for form factors of descendant operators. We obtain generating functions of such form factors and establish their main properties: the cluster factorization and reflection equations.

  13. Factors Governing Surface Form Accuracy In Diamond Machined Components

    NASA Astrophysics Data System (ADS)

    Myler, J. K.; Page, D. A.

    1988-10-01

    simple spheres. It is important however to realise that a diamond turning process will possess a new set of criteria which limit the accuracy of the surface profile created corresponding to a completely new set of specifications. The most important factors are:- tool centring accuracy, surface waviness, conical form error, and other rotationally symmetric non spherical errors. The fixturing of the workpiece is very different from that of a conventional lap, since in many cases the diamond machine resembles a conventional lathe geometry where the workpiece rotates at a few thousand R.P.M. Substrates must be held rigidly for rotation at such speeds as compared with more delicate mounting methods for conventional laps. Consequently the workpiece may suffer from other forms of deformation which are non-rotationally symmetric due to mounting stresses (static deformation) and stresses induced at the speed of rotation (dynamic deformation). The magnitude of each of these contributions to overall form error will be a function of the type of machine, the material, substrate, and testing design. The following sections describe each of these effects in more detail based on experience obtained on a Pneumo Precision MSG325 XY CNC machine. Certain in-process measurement techniques have been devised to minimise and quantify each contribution.

  14. Semi-analytical model for output factor calculations in proton beam therapy with consideration for the collimator aperture edge.

    PubMed

    Kase, Yuki; Yamashita, Haruo; Sakama, Makoto; Mizota, Manabu; Maeda, Yoshikazu; Tameshige, Yuji; Murayama, Shigeyuki

    2015-08-07

    In the development of an external radiotherapy treatment planning system, the output factor (OPF) is an important value for the monitor unit calculations. We developed a proton OPF calculation model with consideration for the collimator aperture edge to account for the dependence of the OPF on the collimator aperture and distance in proton beam therapy. Five parameters in the model were obtained by fitting with OPFs measured by a pinpoint chamber with the circular radiation fields of various field radii and collimator distances. The OPF model calculation using the fitted model parameters could explain the measurement results to within 1.6% error in typical proton treatment beams with 6- and 12 cm SOBP widths through a range shifter and a circular aperture more than 10.6 mm in radius. The calibration depth dependences of the model parameters were approximated by linear or quadratic functions. The semi-analytical OPF model calculation was tested with various MLC aperture shapes that included circles of various sizes as well as a rectangle, parallelogram, and L-shape for an intermediate proton treatment beam condition. The pre-calculated OPFs agreed well with the measured values, to within 2.7% error up to 620 mm in the collimator distance, though the maximum difference was 5.1% in the case of the largest collimator distance of 740 mm. The OPF calculation model would allow more accurate monitor unit calculations for therapeutic proton beams within the expected range of collimator conditions in clinical use.

  15. Medium effect on the nuclear modification factor of protons and pions in intermediate-energy heavy ion collisions

    NASA Astrophysics Data System (ADS)

    Lv, M.; Ma, Y. G.; Chen, J. H.; Fang, D. Q.; Zhang, G. Q.

    2017-02-01

    Nuclear modification factors Rcp of protons and pions are investigated by simulating Au+Au collisions from 0.8 A to 1.8 A GeV in a framework of an isospin-dependent quantum molecular dynamics (IQMD) model. The Rcp of protons rise with an increase in the transverse particle momentum pT at different beam energies owing to radial flow and the multiple-collision effect. The rate of increase of Rcp is suppressed at higher beam energies. While the Rcp of pions display weaker pT dependence. By changing the in-medium nucleon-nucleon cross section, the Rcp of protons change a lot, while the Rcp of pions do not. In addition, by deactivating the N Δ →N N and π N →Δ channels, the Rcp of protons change slightly in their increasing rates compared with the "original" case (with these two channels). However, the Rcp of pions is shifted down for the "no N Δ →N N " case and has an inverse trend for the "no π N →Δ " case. Based on these observations, we argue that the observable Rcp is a suitable tool to better distinguish in-medium effects of protons and pions.

  16. Ir-Uv Double Resonance Spectroscopy of a Cold Protonated Fibril-Forming Peptide: NNQQNY\\cdotH+

    NASA Astrophysics Data System (ADS)

    DeBlase, Andrew F.; Harrilal, Christopher P.; Walsh, Patrick S.; McLuckey, Scott A.; Zwier, Timothy S.

    2016-06-01

    Protein aggregation to form amyloid-like fibrils is a purported molecular manifestation that leads to Alzheimer's, Huntington's, and other neurodegenerative diseases. The propensity for a protein to aggregate is often driven by the presence of glutamine (Q) and asparagine (N) rich tracts within the primary sequence. For example, Eisenberg and coworkers [Nature 2006, 435, 773] have shown by X-ray crystallography that the peptides NNQQNY and GNNQQNY aggregate into a parallel β-sheet configuration with side chains that intercalate into a "steric zipper". These sequences are commonly found at the N-terminus of the prion-determining domain in the yeast protein Sup35, a typical fibril-forming protein. Herein, we invoke recent advances in cold ion spectroscopy to explore the nascent conformational preferences of the protonated peptides that are generated by electrospray ionization. Towards this aim, we have used UV and IR spectroscopy to record conformation-specific photofragment action spectra of the NNQQNY monomer cryogenically cooled in an octopole ion trap. This short peptide contains 20 hydride stretch oscillators, leading to a rich infrared spectrum with at least 18 resolved transitions in the 2800-3800 cm-1 region. The infrared spectrum suggests the presence of both a free acid OH moiety and an H-bonded tyrosine OH group. We compare our results with resonant ion dip infrared spectra (RIDIRS) of the acyl/NH-benzyl capped neutral glutamine amino acid and its corresponding dipeptide: Ac-Q-NHBn and Ac-QQ-NHBn, respectively. These comparisons bring empirical insight to the NH stretching region of the spectrum, which contains contributions from free and singly H-bonded NH2 side-chain groups, and from peptide backbone amide NH groups. We further compare our spectrum to harmonic calculations at the M05-2X/6-31+G* level of theory, which were performed on low energy structures obtained from Monte Carlo conformational searches using the Amber* and OPLS force fields to assess

  17. Spontaneous electromagnetic fluctuations in unmagnetized plasmas. IV. Relativistic form factors of aperiodic Lorentzian modes

    SciTech Connect

    Felten, T.; Schlickeiser, R.

    2013-08-15

    Closed analytical expressions for the electromagnetic fluctuation spectra in unmagnetized plasmas are derived using fully relativistic dispersion functions and form factors for the important class of isotropic form-invariant Lorentzian plasma particle distribution functions. Such distribution functions occur frequently in cosmic plasmas due to the presence of suprathermal charged particles and energetic cosmic ray particles. The results are illustrated for the important special case of aperiodic fluctuations. The collective, transverse, damped aperiodic mode, discovered before in nonrelativistic Maxwellian particle distributions, also exists in Lorentzian electron-proton particle distributions, now with the damping rate γ∝−k{sup 3} for all wavenumber values, resulting from the presence of relativistic particles in the tail of the Lorentzian distribution. For longitudinal electric field, fluctuations no damped or growing aperiodic collective mode exists in Lorentzian plasmas. The existence of a damped, collective, transverse, aperiodic mode is not in conflict with earlier general instability studies excluding the existence of growing aperiodic collective modes in isotropic plasmas.

  18. Measurement of the generalized form factors near threshold via γ*p→nπ+ at high Q2

    NASA Astrophysics Data System (ADS)

    Park, K.; Gothe, R. W.; Adhikari, K. P.; Adikaram, D.; Anghinolfi, M.; Baghdasaryan, H.; Ball, J.; Battaglieri, M.; Batourine, V.; Bedlinskiy, I.; Bennett, R. P.; Biselli, A. S.; Bookwalter, C.; Boiarinov, S.; Branford, D.; Briscoe, W. J.; Brooks, W. K.; Burkert, V. D.; Carman, D. S.; Celentano, A.; Chandavar, S.; Charles, G.; Cole, P. L.; Contalbrigo, M.; Crede, V.; D'Angelo, A.; Daniel, A.; Dashyan, N.; De Vita, R.; De Sanctis, E.; Deur, A.; Djalali, C.; Doughty, D.; Dupre, R.; El Alaoui, A.; El Fassi, L.; Eugenio, P.; Fedotov, G.; Fradi, A.; Gabrielyan, M. Y.; Gevorgyan, N.; Gilfoyle, G. P.; Giovanetti, K. L.; Girod, F. X.; Goetz, J. T.; Gohn, W.; Golovatch, E.; Graham, L.; Griffioen, K. A.; Guidal, M.; Guo, L.; Hafidi, K.; Hakobyan, H.; Hanretty, C.; Heddle, D.; Hicks, K.; Holtrop, M.; Hyde, C. E.; Ilieva, Y.; Ireland, D. G.; Ishkhanov, B. S.; Isupov, E. L.; Jenkins, D.; Jo, H. S.; Joo, K.; Kalantarians, N.; Khandaker, M.; Khetarpal, P.; Kim, A.; Kim, W.; Klein, A.; Klein, F. J.; Kubarovsky, A.; Kubarovsky, V.; Kuhn, S. E.; Kuleshov, S. V.; Kvaltine, N. D.; Livingston, K.; Lu, H. Y.; MacGregor, I. J. D.; Markov, N.; Mayer, M.; McKinnon, B.; Mestayer, M. D.; Meyer, C. A.; Mineeva, T.; Mirazita, M.; Mokeev, V.; Moutarde, H.; Munevar, E.; Nadel-Turonski, P.; Nasseripour, R.; Niccolai, S.; Niculescu, G.; Niculescu, I.; Osipenko, M.; Ostrovidov, A. I.; Paolone, M.; Pappalardo, L.; Paremuzyan, R.; Park, S.; Pereira, S. Anefalos; Phelps, E.; Pisano, S.; Pogorelko, O.; Pozdniakov, S.; Price, J. W.; Procureur, S.; Prok, Y.; Ricco, G.; Rimal, D.; Ripani, M.; Ritchie, B. G.; Rosner, G.; Rossi, P.; Sabatié, F.; Saini, M. S.; Salgado, C.; Schott, D.; Schumacher, R. A.; Seraydaryan, H.; Sharabian, Y. G.; Smith, E. S.; Smith, G. D.; Sober, D. I.; Sokhan, D.; Stepanyan, S. S.; Stepanyan, S.; Stoler, P.; Strakovsky, I. I.; Strauch, S.; Taiuti, M.; Tang, W.; Taylor, C. E.; Tian, Y.; Tkachenko, S.; Trivedi, A.; Ungaro, M.; Vernarsky, B.; Vlassov, A. V.; Voutier, E.; Watts, D. P.; Weygand, D. P.; Wood, M. H.; Zachariou, N.; Zhao, B.; Zhao, Z. W.

    2012-03-01

    We report the first extraction of the pion-nucleon multipoles near the production threshold for the nπ+ channel at relatively high momentum transfer (Q2 up to 4.2 GeV2). The dominance of the s-wave transverse multipole (E0+), expected in this region, allowed us to access the generalized form factor G1 within the light-cone sum-rule (LCSR) framework as well as the axial form factor GA. The data analyzed in this work were collected by the nearly 4π CEBAF Large Acceptance Spectrometer (CLAS) using a 5.754-GeV electron beam on a proton target. The differential cross section and the π-N multipole E0+/GD were measured using two different methods, the LCSR and a direct multipole fit. The results from the two methods are found to be consistent and almost Q2 independent.

  19. Measurement of the generalized form factors near threshold via γ*p → nπ+ at high Q2

    DOE PAGES

    Park, K.; Adhikari, K. P.; Adikaram, D.; ...

    2012-03-26

    We report the first extraction of the pion-nucleon multipoles near the production threshold for the nπ+ channel at relatively high momentum transfer (Q2 up to 4.2 GeV2). The dominance of the s-wave transverse multipole (E0+), expected in this region, allowed us to access the generalized form factor G1 within the light-cone sum rule (LCSR) framework as well as the axial form factor GA. The data analyzed in this work were collected by the nearly 4π CEBAF Large Acceptance Spectrometer (CLAS) using a 5.754-GeV electron beam on a proton target. The differential cross section and the π-N multipole E0+/GD were measuredmore » using two different methods, the LCSR and a direct multipole fit. The results from the two methods are found to be consistent and almost Q2 independent.« less

  20. Determination of the energy of the proton beam formed in a solar flare on the basis of spectropolarimetric data

    SciTech Connect

    Kazantsev, S.A.; Firstova, N.M.; Bulatov, A.V.

    1995-05-01

    Energy contributions of proton beams to the chromospheric region of a solar flare are determined by the spectropolarimetry technique under the assumption of an impact character of the observed H{sub {alpha}} hydrogen line emission. 10 refs., 6 figs., 3 tabs.

  1. Predictive Factors of Response to Proton Pump Inhibitors in Korean Patients With Gastroesophageal Reflux Disease

    PubMed Central

    Kim, Sung Eun; Kim, Nayoung; Oh, Sooyeon; Kim, Hee Man; Park, Moo In; Lee, Dong Ho; Jung, Hyun Chae

    2015-01-01

    Background/Aims Proton pump inhibitors (PPIs) are widely used in the treatment of gastroesophageal reflux disease (GERD). However, some patients fail to respond to PPI therapy. We investigated the efficacy of response to PPI therapy in patients with GERD symptoms. Methods A total of 179 subjects with GERD symptoms were prospectively enrolled and diagnosed with non-erosive reflux disease (NERD, n = 100) and erosive reflux disease (n = 79) by gastroscopy and Bernstein test and/or 24-hour esophageal pH testing. Subjects then received a standard dose of daily PPI therapy for at least 4 weeks. PPI therapy response was evaluated using questionnaires including questions about demographics, GERD symptoms, GERD impact scale, Epworth sleepiness scale, Pittsburgh sleep quality index (PSQI), hospital anxiety and depression scale, and abbreviated version of the World Health Organization quality of life scale. Results The rates of complete (≥ 80%), satisfactory (≥ 50%), partial (< 50%), and refractory response in the 179 participants were 41.3%, 30.2%, 18.4%, and 10.1%, respectively. Thus, overall response rate (complete and satisfactory responses) was 71.5%. Multivariate analysis showed body mass index < 23 kg/m2 (OR, 2.20; 95% CI, 1.12–4.34), higher total PSQI score (OR, 1.20; 95% CI, 1.05–1.35), history of psychotherapy or neuropsychiatric medication (OR, 2.44; 95% CI, 1.23–4.85), and NERD (OR, 3.30; 95% CI, 1.54–7.11) were associated with poor response to PPI therapy. Conclusions Psychological factors, sleep dysfunction, body mass index < 23 kg/m2, and NERD seem to be the major factors that lead to a poor response to PPI treatment in patients with GERD symptoms. PMID:25537676

  2. Factors associated with residual gastroesophageal reflux disease symptoms in patients receiving proton pump inhibitor maintenance therapy

    PubMed Central

    Kawara, Fumiaki; Fujita, Tsuyoshi; Morita, Yoshinori; Uda, Atsushi; Masuda, Atsuhiro; Saito, Masaya; Ooi, Makoto; Ishida, Tsukasa; Kondo, Yasuyuki; Yoshida, Shiei; Okuno, Tatsuya; Yano, Yoshihiko; Yoshida, Masaru; Kutsumi, Hiromu; Hayakumo, Takanobu; Yamashita, Kazuhiko; Hirano, Takeshi; Hirai, Midori; Azuma, Takeshi

    2017-01-01

    AIM To elucidate the factors associated with residual gastroesophageal reflux disease (GERD) symptoms in patients receiving proton pump inhibitor (PPI) maintenance therapy in clinical practice. METHODS The study included 39 GERD patients receiving maintenance PPI therapy. Residual symptoms were assessed using the Frequency Scale for Symptoms of GERD (FSSG) questionnaire and the Gastrointestinal Symptom Rating Scale (GSRS). The relationships between the FSSG score and patient background factors, including the CYP2C19 genotype, were analyzed. RESULTS The FSSG scores ranged from 1 to 28 points (median score: 7.5 points), and 19 patients (48.7%) had a score of 8 points or more. The patients’ GSRS scores were significantly correlated with their FSSG scores (correlation coefficient = 0.47, P < 0.005). In erosive esophagitis patients, the FSSG scores of the CYP2C19 rapid metabolizers (RMs) were significantly higher than the scores of the poor metabolizers and intermediate metabolizers (total scores: 16.7 ± 8.6 vs 7.8 ± 5.4, P < 0.05; acid reflux-related symptom scores: 12 ± 1.9 vs 2.5 ± 0.8, P < 0.005). In contrast, the FSSG scores of the CYP2C19 RMs in the non-erosive reflux disease patients were significantly lower than those of the other patients (total scores: 5.5 ± 1.0 vs 11.8 ± 6.3, P < 0.05; dysmotility symptom-related scores: 1.0 ± 0.4 vs 6.0 ± 0.8, P < 0.01). CONCLUSION Approximately half of the GERD patients receiving maintenance PPI therapy had residual symptoms associated with a lower quality of life, and the CYP2C19 genotype appeared to be associated with these residual symptoms. PMID:28373773

  3. Dressed Quark Mass Dependence of Pion and Kaon Form Factors

    SciTech Connect

    Ninomiya, Y.; Bentz, W.; Cloet, I. C.

    2015-02-04

    The structure of hadrons is described well by the Nambu-Jona-Lasinio (NJL) model, which is a chiral effective quark theory of QCD. In this work we explore the electromagnetic structure of the pion and kaon using the three-flavor NJL model in the proper-time regularization scheme, including effects of the pion cloud at the quark level. In the calculation there is only one free parameter, which we take as the dressed light quark (u and d) mass. In the regime where the dressed light quark mass is approximately 0.25 GeV we find that the calculated values of the kaon decay constant, current quark masses, and quark condensates are consistent with experiment- and QCD-based analyses. We also investigate the dressed light quark mass dependence of the pion and kaon electromagnetic form factors, where comparison with empirical data and QCD predictions also favors a dressed light quark mass near 0.25 GeV.

  4. B meson semileptonic form factors from unquenched lattice QCD

    SciTech Connect

    Gulez, Emel; Gray, Alan; Shigemitsu, Junko; Wingate, Matthew; Davies, Christine T. H.; Lepage, G. Peter

    2006-04-01

    The semileptonic process, B{yields}{pi}l{nu}, is studied via full QCD lattice simulations. We use unquenched gauge configurations generated by the MILC Collaboration. These include the effect of vacuum polarization from three quark flavors: the s quark and two very light flavors (u/d) of variable mass allowing extrapolations to the physical chiral limit. We employ nonrelativistic QCD to simulate the b quark and a highly improved staggered quark action for the light sea and valence quarks. We calculate the form factors f{sub +}(q{sup 2}) and f{sub 0}(q{sup 2}) in the chiral limit for the range 16 GeV{sup 2}{<=}q{sup 2}

  5. Nucleon form factors and hidden symmetry in holographic QCD

    SciTech Connect

    Hong, Deog Ki; Rho, Mannque; Yee, Ho-Ung; Yi, Piljin

    2008-01-01

    The vector dominance of the electromagnetic form factors both for mesons and baryons arises naturally in holographic QCD, where both the number of colors and the 't Hooft coupling are taken to be very large, offering a bona-fide derivation of the notion of vector dominance. The crucial ingredient for this is the infinite tower of vector mesons in the approximations made which share features that are characteristic of the quenched approximation in lattice QCD. We approximate the infinite sum by contributions from the lowest four vector mesons of the tower which turn out to saturate the charge and magnetic moment sum rules within a few percent and compute them totally free of unknown parameters for momentum transfers Q{sup 2} < or approx. 1 GeV{sup 2}. We identify certain observables that can be reliably computed within the approximations and others that are not, and discuss how the improvement of the latter can enable one to bring holographic QCD closer to QCD proper.

  6. Scrambling the spectral form factor: Unitarity constraints and exact results

    NASA Astrophysics Data System (ADS)

    del Campo, A.; Molina-Vilaplana, J.; Sonner, J.

    2017-06-01

    Quantum speed limits set an upper bound to the rate at which a quantum system can evolve, and as such can be used to analyze the scrambling of information. To this end, we consider the survival probability of a thermofield double state under unitary time evolution which is related to the analytic continuation of the partition function. We provide an exponential lower bound to the survival probability with a rate governed by the inverse of the energy fluctuations of the initial state. Further, we elucidate universal features of the nonexponential behavior at short and long times of evolution that follow from the analytic properties of the survival probability and its Fourier transform, both for systems with a continuous and for systems with a discrete energy spectrum. We find the spectral form factor in a number of illustrative models; notably, we obtain the exact answer in the Gaussian unitary ensemble for any N with excellent agreement with recent numerical studies. We also discuss the relationship of our findings to models of black hole information loss, such as the Sachdev-Ye-Kitaev model dual to AdS2 , as well as higher-dimensional versions of AdS/CFT.

  7. The Magnetic Form Factor of the Neutron, G

    NASA Astrophysics Data System (ADS)

    Markowitz, Pete Edward Christopher

    We measured the d(e,e^' n)p cross-section at three values of Q^2 : 0.255, 0.176 and 0.109 (GeV/c)^2 . The electrons were detected with the OHIPS magnetic spectrometer, and the neutrons were detected in a liquid mineral oil scintillator array. The measurement were made at a fixed neutron angle of theta_ {n} = 57^circ; the Q^2 values were obtained by varying the incident electron energy and the scattering angle. These cross sections are sensitive primarily to the neutron magnetic form factor at these quasifree kinematics. The efficiency of the neutron detector was determined by the associated particle technique with the d(gamma ,pn) reaction for each of the three neutron kinetic energies. The value of G_sp{M} {n} extracted from the cross sections are consistent with the dipole parametrization at the two higher momentum transfers; at the lowest momentum transfer the value of G_sp{M}{n} is 10% higher than the dipole model. This enhancement at low momentum transfer is consistent with previous measurements.

  8. Weak charge form factor and radius of 208Pb through parity violation in electron scattering

    DOE PAGES

    Horowitz, C. J.; Ahmed, Z.; Jen, C. -M.; ...

    2012-03-26

    We use distorted wave electron scattering calculations to extract the weak charge form factor FW(more » $$\\bar{q}$$), the weak charge radius RW, and the point neutron radius Rn, of 208Pb from the PREX parity violating asymmetry measurement. The form factor is the Fourier transform of the weak charge density at the average momentum transfer $$\\bar{q}$$ = 0.475 fm-1. We find FW($$\\bar{q}$$) = 0.204 ± 0.028(exp) ± 0.001(model). We use the Helm model to infer the weak radius from FW($$\\bar{q}$$). We find RW = 5.826 ± 0.181(exp) ± 0.027(model) fm. Here the exp error includes PREX statistical and systematic errors, while the model error describes the uncertainty in RW from uncertainties in the surface thickness σ of the weak charge density. The weak radius is larger than the charge radius, implying a 'weak charge skin' where the surface region is relatively enriched in weak charges compared to (electromagnetic) charges. We extract the point neutron radius Rn = 5.751 ± 0.175 (exp) ± 0.026(model) ± 0.005(strange) fm, from RW. Here there is only a very small error (strange) from possible strange quark contributions. We find Rn to be slightly smaller than RW because of the nucleon's size. As a result, we find a neutron skin thickness of Rn-Rp = 0.302 ± 0.175 (exp) ± 0.026 (model) ± 0.005 (strange) fm, where Rp is the point proton radius.« less

  9. Overview of high-Q2 nucleon form factor program with Super BigBite Spectrometer in JLab's Hall A

    NASA Astrophysics Data System (ADS)

    Puckett, Andrew; Jefferson Lab Hall A; Super BigBite Spectrometer Collaboration

    2017-01-01

    The elastic electromagnetic form factors (EMFFs) of the nucleon describe the impact-parameter-space distributions of electric charge and magnetization in the nucleon in the infinite momentum frame. The form factors are among the simplest and most fundamental measurable dynamical quantities describing the nucleon's structure. Precision measurements of the nucleon form factors provide stringent benchmarks testing the most sophisticated theoretical models of the nucleon, as well as ab initio calculations in lattice QCD and continuum non-perturbative QCD calculations based on the Dyson-Schwinger equations. Measurements at momentum transfers Q in the few-GeV range probe the theoretically challenging region of transition between the non-perturbative and perturbative regimes of QCD. The recent upgrade of the Continuous Electron Beam Accelerator Facility (CEBAF) to a maximum electron beam energy of 11 GeV will facilitate the measurement of the nucleon helicity-conserving (F1) and helicity-flip (F2) form factors of both proton and neutron to Q2 > 10 GeV2, In this talk, I will present an overview of the Super BigBite Spectrometer, currently under construction in CEBAF's experimental Hall A, and its physics program of high-Q2 nucleon EMFF measurements. Supported by US DOE award DE-SC0014230.

  10. Nucleon Form Factors above 6 GeV

    DOE R&D Accomplishments Database

    Taylor, R. E.

    1967-09-01

    This report describes the results from a preliminary analysis of an elastic electron-proton scattering experiment... . We have measured cross sections for e-p scattering in the range of q{sup 2} from 0.7 to 25.0 (GeV/c){sup 2}, providing a large region of overlap with previous measurements. In this experiment we measure the cross section by observing electrons scattered from a beam passing through a liquid hydrogen target. The scattered particles are momentum analyzed by a magnetic spectrometer and identified as electrons in a total absorption shower counter. Data have been obtained with primary electron energies from 4.0 to 17.9 GeV and at scattering angles from 12.5 to 35.0 degrees. In general, only one measurement of a cross section has been made at each momentum transfer.

  11. A human factors approach to waste form design

    SciTech Connect

    Rodriguez, M.A.

    1994-04-01

    The current study consist of two experiments and an example of a revised waste form to demonstrate the necessity of careful form design and provide guidance in obtaining accurate information through written solicitation of any kind. In Experiment 1, two differently designed forms were used to solicit the same list of specific information. The data suggest that the more clearly designed form significantly produced more of the specific information required than the form that just listed the questions. Experiment 2, which is to be conducted during the spring semester 1994, is designed to address three specific aspects of form design. The results of this Experiment 2 will be interpreted and presented at the 1994 International High-Level Radioactive Waste Management Conference, May 22--26. Guidelines and examples of form design are given.

  12. Overview of nucleon form factor experiments with 12 GeV at Jefferson Lab

    NASA Astrophysics Data System (ADS)

    Cisbani, Evaristo

    2014-06-01

    Since the R. Hofstadter pioneering experiments in the '50s, the measurements of the electromagnetic space-like nucleon form factors (FF's) have been a precious source of information for the understanding of the internal structure of the nucleons. In the last 15 years, the polarization transfer experiments at the Thomas Jefferson National Accelerator Facility (JLab) have undermined our view of the mechanism of the electron scattering and renewed critical interest in the FF measurements. In the coming years, JLab, with its upgraded 12 GeV polarized, high intensity, electron beam combined to new targets and readout equipments, will offer unprecedented opportunities to extend the current proton and neutron FF's measurements to higher momentum transfer Q2 and to improve statistical and uncertainties at lower Q2, where the nucleon size can be accurately investigated. The measurements at high Q2 will provide also new insights on the elusive quark orbital angular momenta, will contribute to constraint two of the nucleon Generalized Parton Distributions that are expected to describe more consistently the nucleon structure, and in general will test the validity of quite a few fundamental nucleon models in a region of transition between perturbative and non perturbative regimes. A selection of the relevant properties of the FF's, and the main results of JLab are shortly reviewed; the new proposed and approved experiments on FF's at JLab are presented addressing some key details, the expected experimental achievements and the new equipment designed for them.

  13. 3D Anhydrous proton-transporting nanochannels formed by self-assembly of liquid crystals composed of a sulfobetaine and a sulfonic acid.

    PubMed

    Soberats, Bartolome; Yoshio, Masafumi; Ichikawa, Takahiro; Taguchi, Satomi; Ohno, Hiroyuki; Kato, Takashi

    2013-10-16

    Herein we describe anhydrous proton transportation through 3D interconnected pathways formed by self-assembled molecular complexes. A thermotropic bicontinuous cubic (Cub(bi)) phase has been successfully obtained by mixing a wedge-shaped sulfobetaine with benzenesulfonic acid in different ratios. These ionic complexes exhibit the Cub(bi) phase in a wide range of temperatures, while the single zwitterionic compound shows only a columnar hexagonal phase, and benzenesulfonic acid is nonmesomorphic. Anhydrous proton conduction on the order of 10(-4) S cm(-1) has been achieved for the mixture in the Cub(bi) phase over 100 °C, which can be useful for the development of new electrolytes for the next generation of fuel cells.

  14. STERIC FACTORS MODERATE CONFORMATIONAL FLUIDITY AND CONTRIBUTE TO THE HIGH PROTON SENSITIVITY OF ROOT EFFECT HEMOGLOBINS

    PubMed Central

    Bonaventura, Celia; Henkens, Robert; Friedman, Joel; Siburt, Claire J. Parker; Kraiter, Daniel; Crumbliss, Alvin L.

    2011-01-01

    The structural basis of the extreme pH dependence of oxygen binding to Root effect Hbs is a long-standing puzzle in the field of protein chemistry. A previously unappreciated role of steric factors in the Root effect was revealed by a comparison of pH effects on oxygenation and oxidation processes in human Hb relative to Spot (Leiostomus xanthurus) and Carp (Cyprinodon carpio) Hbs. The Root effect confers five-fold increased pH sensitivity to oxygenation of Spot and Carp Hbs relative to Hb A0 in the absence of anionic effectors, and even larger relative elevations of pH sensitivity of oxygenation in the presence of 0.2 M phosphate. Remarkably, the Root effect was not evident in the oxidation of the Root effect Hbs. This finding rules out pH-dependent alterations in the thermodynamic properties of the heme iron, measured in the anaerobic oxidation reaction, as the basis of the Root effect. The alternative explanation supported by these results is that the elevated pH sensitivity of oxygenation of Root effect Hbs is attributable to globin-dependent steric effects that alter oxygen affinity by constraining conformational fluidity, but which have little influence on electron exchange via the heme edge. This elegant mode of allosteric control can regulate oxygen affinity within a given quaternary state, in addition to modifying the T-R equilibrium. Evolution of Hb sequences that result in proton-linked steric barriers to heme oxygenation could provide a general mechanism to account for the appearance of the Root effect in the structurally diverse Hbs of many species. PMID:21745602

  15. Concerted O atom-proton transfer in the O-O bond forming step in water oxidation.

    PubMed

    Chen, Zuofeng; Concepcion, Javier J; Hu, Xiangqian; Yang, Weitao; Hoertz, Paul G; Meyer, Thomas J

    2010-04-20

    As the terminal step in photosystem II, and a potential half-reaction for artificial photosynthesis, water oxidation (2H(2)O --> O(2) + 4e(-) + 4H(+)) is key, but it imposes a significant mechanistic challenge with requirements for both 4e(-)/4H(+) loss and O-O bond formation. Significant progress in water oxidation catalysis has been achieved recently by use of single-site Ru metal complex catalysts such as [Ru(Mebimpy)(bpy)(OH(2))](2+) [Mebimpy = 2,6-bis(1-methylbenzimidazol-2-yl)pyridine; bpy = 2,2'-bipyridine]. When oxidized from to Ru(V) = O(3+), these complexes undergo O-O bond formation by O-atom attack on a H(2)O molecule, which is often the rate-limiting step. Microscopic details of O-O bond formation have been explored by quantum mechanical/molecular mechanical (QM/MM) simulations the results of which provide detailed insight into mechanism and a strategy for enhancing catalytic rates. It utilizes added bases as proton acceptors and concerted atom-proton transfer (APT) with O-atom transfer to the O atom of a water molecule in concert with proton transfer to the base (B). Base catalyzed APT reactivity in water oxidation is observed both in solution and on the surfaces of oxide electrodes derivatized by attached phosphonated metal complex catalysts. These results have important implications for catalytic, electrocatalytic, and photoelectrocatalytic water oxidation.

  16. Factors for converting dose measured in polystyrene phantoms to dose reported in water phantoms for incident proton beams.

    PubMed

    Moyers, M F; Vatnitsky, A S; Vatnitsky, S M

    2011-10-01

    Previous dosimetry protocols allowed calibrations of proton beamline dose monitors to be performed in plastic phantoms. Nevertheless, dose determinations were referenced to absorbed dose-to-muscle or absorbed dose-to-water. The IAEA Code of Practice TRS 398 recommended that dose calibrations be performed with ionization chambers only in water phantoms because plastic-to-water dose conversion factors were not available with sufficient accuracy at the time of its writing. These factors are necessary, however, to evaluate the difference in doses delivered to patients if switching from calibration in plastic to a protocol that only allows calibration in water. This work measured polystyrene-to-water dose conversion factors for this purpose. Uncertainties in the results due to temperature, geometry, and chamber effects were minimized by using special experimental set-up procedures. The measurements were validated by Monte Carlo simulations. At the peak of non-range-modulated beams, measured polystyrene-to-water factors ranged from 1.015 to 1.024 for beams with ranges from 36 to 315 mm. For beams with the same ranges and medium sized modulations, the factors ranged from 1.005 to 1.019. The measured results were used to generate tables of polystyrene-to-water dose conversion factors. The dose conversion factors can be used at clinical proton facilities to support beamline and patient specific dose per monitor unit calibrations performed in polystyrene phantoms.

  17. Factors for converting dose measured in polystyrene phantoms to dose reported in water phantoms for incident proton beams

    SciTech Connect

    Moyers, M. F.; Vatnitsky, A. S.; Vatnitsky, S. M.

    2011-10-15

    Purpose: Previous dosimetry protocols allowed calibrations of proton beamline dose monitors to be performed in plastic phantoms. Nevertheless, dose determinations were referenced to absorbed dose-to-muscle or absorbed dose-to-water. The IAEA Code of Practice TRS 398 recommended that dose calibrations be performed with ionization chambers only in water phantoms because plastic-to-water dose conversion factors were not available with sufficient accuracy at the time of its writing. These factors are necessary, however, to evaluate the difference in doses delivered to patients if switching from calibration in plastic to a protocol that only allows calibration in water. Methods: This work measured polystyrene-to-water dose conversion factors for this purpose. Uncertainties in the results due to temperature, geometry, and chamber effects were minimized by using special experimental set-up procedures. The measurements were validated by Monte Carlo simulations. Results: At the peak of non-range-modulated beams, measured polystyrene-to-water factors ranged from 1.015 to 1.024 for beams with ranges from 36 to 315 mm. For beams with the same ranges and medium sized modulations, the factors ranged from 1.005 to 1.019. The measured results were used to generate tables of polystyrene-to-water dose conversion factors. Conclusions: The dose conversion factors can be used at clinical proton facilities to support beamline and patient specific dose per monitor unit calibrations performed in polystyrene phantoms.

  18. Proton solvates, H +· nH 2O· mL, formed by diphosphine dioxides with chlorinated cobalt(III) dicarbollide acid

    NASA Astrophysics Data System (ADS)

    Stoyanov, Evgenii S.; Smirnov, Igor'V.

    2005-04-01

    Interaction of hydrated proton, H 5O 2+·(H 2O) 4, in dichloroethane solutions with diphosphine dioxides (L) having methyl (Ph 4Me), ethyl (Ph 4Et) and polyoxyethylene chains (Ph 4PEG) linking two diphenyl phosphine oxide groups has been investigated. A bulky counter ion: chlorinated cobalt(III) bis(dicarbollide), [Co(C 2B 9H 8Cl 3) 2] -, minimizes perturbation of the cation. At low concentrations, Ph 4Et and Ph 4PEG form anhydrous 1:1 complexes with (P dbnd6 )O-H +-O( dbnd6 P) fragment having very strong symmetrical H-bonds. At these conditions Ph 4Me form another compound, H 5O 2+·L(H 2O) 2, due to lower P dbnd6 O basicity and optimal geometry of the chelate cycle. At higher concentrations, Ph 4Me and Ph 4Et form isostructural complexes H 5O 2+·L 2, whereas Ph 4PEG forms only a 1:1 complex with proton dihydrate, H 3O +·H 2O. In excess of free Ph 4Me and Ph 4Et a water molecule is introduced to the first coordination sphere of H 5O 2+ and the average molar ratio L/H 5O 2+ of the complexes exceeds 2. The composition of these complexes as a function of L and its concentration is discussed.

  19. Next-to-leading-order correction to pion form factor in k{sub T} factorization

    SciTech Connect

    Li Hsiangnan; Shen Yuelong; Wang Yuming; Zou Hao

    2011-03-01

    We calculate the next-to-leading-order (NLO) correction to the pion electromagnetic form factor at leading twist in the k{sub T} factorization theorem. Partons off-shell by k{sub T}{sup 2} are considered in both quark diagrams and effective diagrams for the transverse-momentum-dependent pion wave function. The light-cone singularities in the transverse-momentum-dependent pion wave function are regularized by rotating the Wilson lines away from the light cone. The soft divergences from gluon exchanges among initial- and fal-state partons cancel exactly. We derive the infrared-finite k{sub T}-dependent NLO hard kernel for the pion electromagnetic form factor by taking the difference of the above two sets of diagrams. Varying the renormalization and factorization scales, we find that the NLO correction is smaller, when both the scales are set to the invariant masses of internal particles: it becomes lower than 40% of the leading-order contribution for momentum transfer squared Q{sup 2}>7 GeV{sup 2}. It is observed that the NLO leading-twist correction does not play an essential role in explaining the experimental data, but the leading-order higher-twist contribution does.

  20. Concerted O atom–proton transfer in the O—O bond forming step in water oxidation

    PubMed Central

    Chen, Zuofeng; Concepcion, Javier J.; Hu, Xiangqian; Yang, Weitao; Hoertz, Paul G.; Meyer, Thomas J.

    2010-01-01

    As the terminal step in photosystem II, and a potential half-reaction for artificial photosynthesis, water oxidation (2H2O → O2 + 4e- + 4H+) is key, but it imposes a significant mechanistic challenge with requirements for both 4e-/4H+ loss and O—O bond formation. Significant progress in water oxidation catalysis has been achieved recently by use of single-site Ru metal complex catalysts such as [Ru(Mebimpy)(bpy)(OH2)]2+ [Mebimpy = 2,6-bis(1-methylbenzimidazol-2-yl)pyridine; bpy = 2,2′-bipyridine]. When oxidized from to RuV = O3+, these complexes undergo O—O bond formation by O-atom attack on a H2O molecule, which is often the rate-limiting step. Microscopic details of O—O bond formation have been explored by quantum mechanical/molecular mechanical (QM/MM) simulations the results of which provide detailed insight into mechanism and a strategy for enhancing catalytic rates. It utilizes added bases as proton acceptors and concerted atom–proton transfer (APT) with O-atom transfer to the O atom of a water molecule in concert with proton transfer to the base (B). Base catalyzed APT reactivity in water oxidation is observed both in solution and on the surfaces of oxide electrodes derivatized by attached phosphonated metal complex catalysts. These results have important implications for catalytic, electrocatalytic, and photoelectrocatalytic water oxidation. PMID:20360565

  1. Concerted O atom-proton transfer in the O—O bond forming step in water oxidation

    SciTech Connect

    Chen, Zuofeng; Concepcion, Javier C.; Hu, Xiangqian; Yang, Weitao; Hoertz, Paul G.; Meyer, Thomas J

    2010-04-20

    As the terminal step in photosystem II, and a potential half-reaction for artificial photosynthesis, water oxidation (2H2O → O2 + 4e- + 4H+) is key, but it imposes a significant mechanistic challenge with requirements for both 4e-/4H- loss and O—O bond formation. Significant progress in water oxidation catalysis has been achieved recently by use of single-site Ru metal complex catalysts such as [Ru(Mebimpy)(bpy)(OH2)]2+ [Mebimpy = 2,6-bis(1-methylbenzimidazol-2-yl)pyridine; bpy = 2,2'-bipyridine]. When oxidized from RuII-OH22+ to RuV = O3+, these complexes undergo O—O bond formation by O-atom attack on a H2O molecule, which is often the rate-limiting step. Microscopic details of O—O bond formation have been explored by quantum mechanical/molecular mechanical (QM/MM) simulations the results of which provide detailed insight into mechanism and a strategy for enhancing catalytic rates. It utilizes added bases as proton acceptors and concerted atom–proton transfer (APT) with O-atom transfer to the O atom of a water molecule in concert with proton transfer to the base (B). Base catalyzed APT reactivity in water oxidation is observed both in solution and on the surfaces of oxide electrodes derivatized by attached phosphonated metal complex catalysts. These results have important implications for catalytic, electrocatalytic, and photoelectrocatalytic water oxidation.

  2. A quantum-chemical insight into the tunable fluorescence color and distinct photoisomerization mechanisms between a novel ESIPT fluorophore and its protonated form

    NASA Astrophysics Data System (ADS)

    Yuan, Huijuan; Feng, Songyan; Wen, Keke; Zhu, Qiuling; An, Beibei; Guo, Xugeng; Zhang, Jinglai

    2017-08-01

    Enol-keto proton tautomerization and cis-trans isomerization reactions of a novel excited-state intramolecular proton transfer (ESIPT) fluorophore of BTImP and its protonated form (BTImP+) were explored using density functional theory/time-dependent density functional theory (DFT/TD-DFT) computational methods with a B3LYP hybrid functional and the 6-31 + G(d,p) basis set. In addition, the absorption and fluorescence spectra were calculated at the TD-B3LYP/6-31 + G(d,p) level of theory. Our results reveal that both BTImP and BTImP+ can undergo an ultrafast ESIPT reaction, giving rise to the single fluorescence emission with different fluorescence colors, which are nicely consistent with the experimental findings. Calculations also show that following the ultrafast ESIPT, BTImP and BTImP+ can experience the distinctly different cis-trans isomerization processes. The intersystem crossing between the first excited singlet S1 state and triplet T1 state is found to play an important role in the photoisomerization process of BTImP+. In addition, the energy barrier of the trans-keto → cis-keto isomerization in the ground state of BTImP+ is calculated to be 10.49 kcal mol- 1, which implies that there may exist a long-lived trans-keto species in the ground state for BTImP+.

  3. Iso-vector form factors of the delta and nucleon in QCD sum rules

    SciTech Connect

    Ozpineci, A.

    2012-10-23

    Form factors are important non-perturbative properties of hadrons. They give information about the internal structure of the hadrons. In this work, iso-vector axial-vector and iso-vector tensor form factors of the nucleon and the iso-vector axial-vector {Delta}{yields}N transition form factor calculations in QCD Sum Rules are presented.

  4. Electrochemical studies of protonated and deprotonated forms of heteroleptic and homoleptic europium{sup (III)} and dysprosium{sup (III)} porphyrin double-deckers

    SciTech Connect

    Spyroulias, G.A.; Coutsolelos, A.G.; Montauzon, D. de; Poilblanc, R.

    1996-12-31

    Lanthanide {open_quotes}sandwich{close_quotes}-type porphyrins are those with double-decker or triple-decker structures of the form M(por){sub 2} or M{sub 2}(por){sub 3} where (por) is the dianion of the porphyrin ring. The cyclic voltammetric oxidation, of heteroleptic and homoleptic lanthanide porphyrin double-deckers demonstrates the presence of equilibrium protonated/deprotonated species present in CH{sub 2}Cl{sub 2}, DMF, and THF. 20 refs., 3 figs., 2 tabs.

  5. Third Zemach moment of the proton

    SciTech Connect

    Cloeet, Ian C.; Miller, Gerald A.

    2011-01-15

    Modern electron scattering experiments have determined the proton electric form factor G{sub Ep}(Q{sup 2}) to high precision. We utilize this data, represented by the different empirical form-factor parametrizations, to compute the third Zemach moment of the proton charge distribution. We find that existing data rule out a value of the third Zemach moment large enough to explain the current puzzle with the proton charge radius, determined from the Lamb shift in muonic hydrogen. This is in contrast to the recent paper of De Rujula. We also demonstrate that the size of the third Zemach moment is largely governed by the fourth moment of the conventional charge distributions , which enables us to obtain a rigorous upper bound on the magnitude of the third Zemach moment of the proton.

  6. Bs → f0(980) Transition Form Factors Within the kT Factorization Approach

    NASA Astrophysics Data System (ADS)

    Zeng, Dai-Min; Fang, Zhen-Yun

    2013-04-01

    In the paper, we apply the kT factorization approach to deal with the Bs → f0 (980) transition form factors in the large recoil regions, i.e. the small q2 regions. For the purpose, we adopt the B-meson wave-functions ΦB, and δ that include the three-Fock states contributions to do our discussion. Although the scalar meson f0(980) is widely perceived as the 4-quark bound state (scenario 2), but the distribution amplitudes of 4-quark states are still unknown to us, so we adopt 2-quark model (scenario 1) for scalar meson f0(980) in our discussion. By varying the B-meson wave-function parameters within their reasonable regions, we obtain F0(0) = F+(0) = 0.20 ± 0.02, FT(0) = 0.24 ± 0.02. Our present results for these form factors are consistent with the light-cone sum rule results obtained in the literature.

  7. Box products in nilpotent normal form theory: The factoring method

    NASA Astrophysics Data System (ADS)

    Murdock, James

    2016-01-01

    Let N be a nilpotent matrix and consider vector fields x ˙ = Nx + v (x) in normal form. Then v is equivariant under the flow eN*t for the inner product normal form or eMt for the sl2 normal form. These vector equivariants can be found by finding the scalar invariants for the Jordan blocks in N* or M; taking the box product of these to obtain the invariants for N* or M itself; and then boosting the invariants to equivariants by another box product. These methods, developed by Murdock and Sanders in 2007, are here given a self-contained exposition with new foundations and new algorithms yielding improved (simpler) Stanley decompositions for the invariants and equivariants. Ideas used include transvectants (from classical invariant theory), Stanley decompositions (from commutative algebra), and integer cones (from integer programming). This approach can be extended to covariants of sl2k for k > 1, known as SLOCC in quantum computing.

  8. Factors influencing the accuracy of beam range estimation in proton therapy using prompt gamma emission

    NASA Astrophysics Data System (ADS)

    Janssen, FMFC; Landry, G.; Cambraia Lopes, P.; Dedes, G.; Smeets, J.; Schaart, D. R.; Parodi, K.; Verhaegen, F.

    2014-08-01

    In-vivo imaging is a strategy to monitor the range of protons inside the patient during radiation treatment. A possible method of in-vivo imaging is detection of secondary ‘prompt’ gamma (PG) photons outside the body, which are produced by inelastic proton-nuclear interactions inside the patient. In this paper, important parameters influencing the relationship between the PG profile and percentage depth dose (PDD) in a uniform cylindrical phantom are explored. Monte Carlo simulations are performed with the new Geant4 based code TOPAS for mono-energetic proton pencil beams (range: 100-250 MeV) and an idealized PG detector. PG depth profiles are evaluated using the inflection point on a sigmoid fit in the fall-off region of the profile. A strong correlation between the inflection point and the proton range determined from the PDD is found for all conditions. Variations between 1.5 mm and 2.7 mm in the distance between the proton range and the inflection point are found when either the mass density, phantom diameter, or detector acceptance angle is changed. A change in cut-off energy of the detector could induce a range difference of maximum 4 mm. Applying time-of-flight discrimination during detection, changing the primary energy of the beam or changing the elemental composition of the tissue affects the accuracy of the range prediction by less than 1 mm. The results indicate that the PG signal is rather robust to many parameter variations, but millimetre accurate range monitoring requires all medium and detector properties to be carefully taken into account.

  9. SU-E-T-491: Importance of Energy Dependent Protons Per MU Calibration Factors in IMPT Dose Calculations Using Monte Carlo Technique

    SciTech Connect

    Randeniya, S; Mirkovic, D; Titt, U; Guan, F; Mohan, R

    2014-06-01

    Purpose: In intensity modulated proton therapy (IMPT), energy dependent, protons per monitor unit (MU) calibration factors are important parameters that determine absolute dose values from energy deposition data obtained from Monte Carlo (MC) simulations. Purpose of this study was to assess the sensitivity of MC-computed absolute dose distributions to the protons/MU calibration factors in IMPT. Methods: A “verification plan” (i.e., treatment beams applied individually to water phantom) of a head and neck patient plan was calculated using MC technique. The patient plan had three beams; one posterior-anterior (PA); two anterior oblique. Dose prescription was 66 Gy in 30 fractions. Of the total MUs, 58% was delivered in PA beam, 25% and 17% in other two. Energy deposition data obtained from the MC simulation were converted to Gy using energy dependent protons/MU calibrations factors obtained from two methods. First method is based on experimental measurements and MC simulations. Second is based on hand calculations, based on how many ion pairs were produced per proton in the dose monitor and how many ion pairs is equal to 1 MU (vendor recommended method). Dose distributions obtained from method one was compared with those from method two. Results: Average difference of 8% in protons/MU calibration factors between method one and two converted into 27 % difference in absolute dose values for PA beam; although dose distributions preserved the shape of 3D dose distribution qualitatively, they were different quantitatively. For two oblique beams, significant difference in absolute dose was not observed. Conclusion: Results demonstrate that protons/MU calibration factors can have a significant impact on absolute dose values in IMPT depending on the fraction of MUs delivered. When number of MUs increases the effect due to the calibration factors amplify. In determining protons/MU calibration factors, experimental method should be preferred in MC dose calculations

  10. Interstellar protonated molecular species

    NASA Astrophysics Data System (ADS)

    Etim, Emmanuel E.; Gorai, Prasanta; Das, Ankan; Arunan, Elangannan

    2017-08-01

    Majority of the known interstellar cations are protonated species believed to be the natural precursors for their corresponding neutral analogues formed via the dissociative recombination process. The protonation of a neutral species can occur in more than one position on the molecular structure thus resulting in more than one proton binding energy value and different protonated species for the same neutral species. In the present work, ab initio quantum calculations are employed to calculate accurate proton binding energies for over 100 neutral interstellar molecules of which majority of the neutral molecules are protonated in more than one position. From the results, protonated species resulting from a high proton binding energy prefers to remain protonated rather than transferring a proton and returning to its neutral form as compared to its analogue that gives rise to a lower proton binding energy (PBE) from the same neutral species. For two protonated species resulting from the same neutral molecule, the one that results in a higher PBE is more stable as compared to its counterpart that is responsible for the lower PBE for the same neutral species. Here, the most stable species are highlighted for all the systems considered.

  11. Two-Photon Exchange in Elastic Electron-Proton Scattering: A QCD Factorization Approach

    SciTech Connect

    Kivel, Nikolai; Vanderhaeghen, Marc

    2009-08-28

    We estimate the two-photon exchange contribution to elastic electron-proton scattering at large momentum transfer Q{sup 2}. It is shown that the leading two-photon exchange amplitude behaves as 1/Q{sup 4}, and can be expressed in a model independent way in terms of the leading twist nucleon distribution amplitudes. Using several models for the nucleon distribution amplitudes, we provide estimates for existing data and for ongoing experiments.

  12. A New EM CKM Matrix: Implications of the Nucleon Strange Quark Content, Anomalous Magnetic Moments of Nucleons and Electric and Magnetic Nucleon Form Factors

    NASA Astrophysics Data System (ADS)

    Ward, Thomas

    2013-10-01

    A new electromagnetic neutral-current quark mixing matrix, analog to the well-known Cabibbo-Kobayashi-Maskawa (CKM) weak charge-current matrix, is proposed to account for the strange quark content of the neutron and proton and part of the anomalous axial vector magnetic moments. The EM-CKM matrix is shown to be equivalent to the weak-CKM matrix following an EM to weak gauge symmetry transformation, demonstrating the universality of the Standard Model (SM) CKM quark mixing matrix. The electric and magnetic form factors are reformulated using a new QCD three quark nucleon gyromagnetic factor, Dirac and Pauli form factors and anomalous kappa factors. The old 1943 Jauch form factors which have been systematically used and developed for many years is shown to be in stark disagreement with the new global set of experimental polarized electron-proton scattering data whereas the reformulated SM parameter set of this study is shown to agree very well, lending strong support for this new EM SM approach.

  13. Fluence correction factors for graphite calorimetry in a low-energy clinical proton beam: I. Analytical and Monte Carlo simulations.

    PubMed

    Palmans, H; Al-Sulaiti, L; Andreo, P; Shipley, D; Lühr, A; Bassler, N; Martinkovič, J; Dobrovodský, J; Rossomme, S; Thomas, R A S; Kacperek, A

    2013-05-21

    The conversion of absorbed dose-to-graphite in a graphite phantom to absorbed dose-to-water in a water phantom is performed by water to graphite stopping power ratios. If, however, the charged particle fluence is not equal at equivalent depths in graphite and water, a fluence correction factor, kfl, is required as well. This is particularly relevant to the derivation of absorbed dose-to-water, the quantity of interest in radiotherapy, from a measurement of absorbed dose-to-graphite obtained with a graphite calorimeter. In this work, fluence correction factors for the conversion from dose-to-graphite in a graphite phantom to dose-to-water in a water phantom for 60 MeV mono-energetic protons were calculated using an analytical model and five different Monte Carlo codes (Geant4, FLUKA, MCNPX, SHIELD-HIT and McPTRAN.MEDIA). In general the fluence correction factors are found to be close to unity and the analytical and Monte Carlo codes give consistent values when considering the differences in secondary particle transport. When considering only protons the fluence correction factors are unity at the surface and increase with depth by 0.5% to 1.5% depending on the code. When the fluence of all charged particles is considered, the fluence correction factor is about 0.5% lower than unity at shallow depths predominantly due to the contributions from alpha particles and increases to values above unity near the Bragg peak. Fluence correction factors directly derived from the fluence distributions differential in energy at equivalent depths in water and graphite can be described by kfl = 0.9964 + 0.0024·zw-eq with a relative standard uncertainty of 0.2%. Fluence correction factors derived from a ratio of calculated doses at equivalent depths in water and graphite can be described by kfl = 0.9947 + 0.0024·zw-eq with a relative standard uncertainty of 0.3%. These results are of direct relevance to graphite calorimetry in low-energy protons but given that the fluence

  14. Monte Carlo simulations of neutron spectral fluence, radiation weighting factor and ambient dose equivalent for a passively scattered proton therapy unit

    NASA Astrophysics Data System (ADS)

    Zheng, Yuanshui; Fontenot, Jonas; Taddei, Phil; Mirkovic, Dragan; Newhauser, Wayne

    2008-01-01

    Stray neutron exposures pose a potential risk for the development of secondary cancer in patients receiving proton therapy. However, the behavior of the ambient dose equivalent is not fully understood, including dependences on neutron spectral fluence, radiation weighting factor and proton treatment beam characteristics. The objective of this work, therefore, was to estimate neutron exposures resulting from the use of a passively scattered proton treatment unit. In particular, we studied the characteristics of the neutron spectral fluence, radiation weighting factor and ambient dose equivalent with Monte Carlo simulations. The neutron spectral fluence contained two pronounced peaks, one a low-energy peak with a mode around 1 MeV and one a high-energy peak that ranged from about 10 MeV up to the proton energy. The mean radiation weighting factors varied only slightly, from 8.8 to 10.3, with proton energy and location for a closed-aperture configuration. For unmodulated proton beams stopped in a closed aperture, the ambient dose equivalent from neutrons per therapeutic absorbed dose (H*(10)/D) calculated free-in-air ranged from about 0.3 mSv/Gy for a small scattered field of 100 MeV proton energy to 19 mSv/Gy for a large scattered field of 250 MeV proton energy, revealing strong dependences on proton energy and field size. Comparisons of in-air calculations with in-phantom calculations indicated that the in-air method yielded a conservative estimation of stray neutron radiation exposure for a prostate cancer patient.

  15. Proton Therapy - Accelerating Protons to Save Lives

    SciTech Connect

    Keppel, Cynthia

    2011-10-25

    In 1946, physicist Robert Wilson first suggested that protons could be used as a form of radiation therapy in the treatment of cancer because of the sharp drop-off that occurs on the distal edge of the radiation dose. Research soon confirmed that high-energy protons were particularly suitable for treating tumors near critical structures, such as the heart and spinal column. The precision with which protons can be delivered means that more radiation can be deposited into the tumor while the surrounding healthy tissue receives substantially less or, in some cases, no radiation. Since these times, particle accelerators have continuously been used in cancer therapy and today new facilities specifically designed for proton therapy are being built in many countries. Proton therapy has been hailed as a revolutionary cancer treatment, with higher cure rates and fewer side effects than traditional X-ray photon radiation therapy. Proton therapy is the modality of choice for treating certain small tumors of the eye, head or neck. Because it exposes less of the tissue surrounding a tumor to the dosage, proton therapy lowers the risk of secondary cancers later in life - especially important for young children. To date, over 80,000 patients worldwide have been treated with protons. Currently, there are nine proton radiation therapy facilities operating in the United States, one at the Hampton University Proton Therapy Institute. An overview of the treatment technology and this new center will be presented.

  16. Proton Transfer Dynamics at the Membrane/Water Interface: Dependence on the Fixed and Mobile pH Buffers, on the Size and Form of Membrane Particles, and on the Interfacial Potential Barrier

    PubMed Central

    Cherepanov, Dmitry A.; Junge, Wolfgang; Mulkidjanian, Armen Y.

    2004-01-01

    Crossing the membrane/water interface is an indispensable step in the transmembrane proton transfer. Elsewhere we have shown that the low dielectric permittivity of the surface water gives rise to a potential barrier for ions, so that the surface pH can deviate from that in the bulk water at steady operation of proton pumps. Here we addressed the retardation in the pulsed proton transfer across the interface as observed when light-triggered membrane proton pumps ejected or captured protons. By solving the system of diffusion equations we analyzed how the proton relaxation depends on the concentration of mobile pH buffers, on the surface buffer capacity, on the form and size of membrane particles, and on the height of the potential barrier. The fit of experimental data on proton relaxation in chromatophore vesicles from phototropic bacteria and in bacteriorhodopsin-containing membranes yielded estimates for the interfacial potential barrier for H+/OH− ions of ∼120 meV. We analyzed published data on the acceleration of proton equilibration by anionic pH buffers and found that the height of the interfacial barrier correlated with their electric charge ranging from 90 to 120 meV for the singly charged species to >360 meV for the tetra-charged pyranine. PMID:14747306

  17. [Forms and factors of the variability of paranasal sinuses].

    PubMed

    Nikitiuk, D B

    1983-09-01

    The form, structural variations, sex variations (connected with zygosityz), right and left positions of the sinuses were studied according to the data obtained while measuring the contours of the frontal, sphenoid and maxillary sinuses in the cranial roentgenograms made in the frontal and sagittal projections. By means of the twin method, relationship of the hereditary and environmental influences on the sinus formation was estimated. The data obtained in 111 Ukrainians (30--60 years of age), inhabitants of Vinnitsa region, mono- and dizygote twins of both sex were used. Greater dimensions in the male sinuses and a high variability of their size not connected with sex were stated. Among women the dizygote twin had larger dimensions than the monozygote ones. The sinus size is characterized by a predominant right-sided asymmetry. The hereditary effect is clearly seen in the sinus paranasales formation. A decreasing hereditary influence noted in the maxillary sinus is considered as a dependence of its dimensions on the state of the masticatory apparatus.

  18. Resource Form Factor and Installation of GFA Controllers

    SciTech Connect

    DeSteese, John G.; Hammerstrom, Donald J.

    2009-11-15

    The focus of this task is to optimize the form and placement of a controller comprising the Grid Friendly™ appliance (GFA) controller, power supply and power relay (and/or a solid-state power electronic switch) that would command a domestic water heater to shed its load in response to stress on the electric power grid. The GFA controller would disconnect the water heater from its supply circuit whenever it senses a low voltage signal or other indicators of system stress communicated via the electric power distribution system. Power would be reconnected to the appliance when the GFA controller senses the absence of these signals. This project has also considered more frequent cycling of this controller’s relay switch to perform demand-side frequency regulation. The principal criteria considered in this optimization are reliability, cost and life expectancy of the GFA components. The alternative embodiments of the GFA equipment under consideration are: Option 1- installation inside the insulation space of the water heater between the tank and jacket Option 2 containment in a separate nearby electrical enclosure Option 3 - as a modification or adjunct to the distribution panel housing and/or the breaker that protects the water heater supply circuit.

  19. Highly Efficient Small Form Factor LED Retrofit Lamp

    SciTech Connect

    Steven Allen; Fred Palmer; Ming Li

    2011-09-11

    This report summarizes work to develop a high efficiency LED-based MR16 lamp downlight at OSRAM SYLVANIA under US Department of Energy contract DE-EE0000611. A new multichip LED package, electronic driver, and reflector optic were developed for these lamps. At steady-state, the lamp luminous flux was 409 lumens (lm), luminous efficacy of 87 lumens per watt (LPW), CRI (Ra) of 87, and R9 of 85 at a correlated color temperature (CCT) of 3285K. The LED alone achieved 120 lumens per watt efficacy and 600 lumen flux output at 25 C. The driver had 90% electrical conversion efficiency while maintaining excellent power quality with power factor >0.90 at a power of only 5 watts. Compared to similar existing MR16 lamps using LED sources, these lamps had much higher efficacy and color quality. The objective of this work was to demonstrate a LED-based MR16 retrofit lamp for replacement of 35W halogen MR16 lamps having (1) luminous flux of 500 lumens, (2) luminous efficacy of 100 lumens per watt, (3) beam angle less than 40{sup o} and center beam candlepower of at least 1000 candelas, and (4) excellent color quality.

  20. SU-F-BRD-15: Quality Correction Factors in Scanned Or Broad Proton Therapy Beams Are Indistinguishable

    SciTech Connect

    Sorriaux, J; Lee, J; Testa, M; Paganetti, H; Bertrand, D; Orban de Xivry, J; Palmans, H; Vynckier, S; Sterpin, E

    2015-06-15

    Purpose: The IAEA TRS-398 code of practice details the reference conditions for reference dosimetry of proton beams using ionization chambers and the required beam quality correction factors (kQ). Pencil beam scanning (PBS) requires multiple spots to reproduce the reference conditions. The objective is to demonstrate, using Monte Carlo (MC) calculations, that kQ factors for broad beams can be used for scanned beams under the same reference conditions with no significant additional uncertainty. We consider hereafter the general Alfonso formalism (Alfonso et al, 2008) for non-standard beam. Methods: To approach the reference conditions and the associated dose distributions, PBS must combine many pencil beams with range modulation and shaping techniques different than those used in passive systems (broad beams). This might lead to a different energy spectrum at the measurement point. In order to evaluate the impact of these differences on kQ factors, ion chamber responses are computed with MC (Geant4 9.6) in a dedicated scanned pencil beam (Q-pcsr) producing a 10×10cm2 composite field with a flat dose distribution from 10 to 16 cm depth. Ion chamber responses are also computed by MC in a broad beam with quality Q-ds (double scattering). The dose distribution of Q -pcsr matches the dose distribution of Q-ds. k-(Q-pcsr,Q-ds) is computed for a 2×2×0.2cm{sup 3} idealized air cavity and a realistic plane-parallel ion chamber (IC). Results: Under reference conditions, quality correction factors for a scanned composite field versus a broad beam are the same for air cavity dose response, k-(Q-pcsr,Q-ds) =1.001±0.001 and for a Roos IC, k-(Q-pcsr,Q-ds) =0.999±0.005. Conclusion: Quality correction factors for ion chamber response in scanned and broad proton therapy beams are identical under reference conditions within the calculation uncertainties. The results indicate that quality correction factors published in IAEA TRS-398 can be used for scanned beams in the SOBP of a

  1. Bethe ansatz and exact form factors of the O(6) Gross Neveu-model

    NASA Astrophysics Data System (ADS)

    Babujian, Hrachya M.; Foerster, Angela; Karowski, Michael

    2017-08-01

    The isomorphism SU(4)≃ O(6) is used to construct the form factors of the O(6) Gross-Neveu model as bound state form factors of the SU(4) chiral Gross-Neveu model. This technique is generalized and is then applied to use the O(6) as the starting point of the nesting procedure to obtain the O(N) form factors for general even N. Dedicated to the memory of Petr Petrovich Kulish.

  2. SU-E-T-464: On the Equivalence of the Quality Correction Factor for Pencil Beam Scanning Proton Therapy

    SciTech Connect

    Sorriaux, J; Paganetti, H; Testa, M; Giantsoudi, D; Schuemann, J; Bertrand, D; Orban de Xivry, J.; Lee, J; Palmans, H; Vynckier, S; Sterpin, E

    2014-06-01

    Purpose: In current practice, most proton therapy centers apply IAEA TRS-398 reference dosimetry protocol. Quality correction factors (kQ) take into account in the dose determination process the differences in beam qualities used for calibration unit and for treatment unit. These quality correction factors are valid for specific reference conditions. TRS-398 reference conditions should be achievable in both scattered proton beams (i.e. DS) and scanned proton beams (i.e. PBS). However, it is not a priori clear if TRS-398 kQ data, which are based on Monte Carlo (MC) calculations in scattered beams, can be used for scanned beams. Using TOPAS-Geant4 MC simulations, the study aims to determine whether broad beam quality correction factors calculated in TRS-398 can be directly applied to PBS delivery modality. Methods: As reference conditions, we consider a 10×10×10 cm{sup 3} homogeneous dose distribution delivered by PBS system in a water phantom (32/10 cm range/modulation) and an air cavity placed at the center of the spread-out-Bragg-peak. In order to isolate beam differences, a hypothetical broad beam is simulated. This hypothetical beam reproduces exactly the same range modulation, and uses the same energy layers than the PBS field. Ion chamber responses are computed for the PBS and hypothetical beams and then compared. Results: For an air cavity of 2×2×0.2 cm{sup 3}, the ratio of ion chamber responses for the PBS and hypothetical beam qualities is 0.9991 ± 0.0016. Conclusion: Quality correction factors are insensitive to the delivery pattern of the beam (broad beam or PBS), as long as similar dose distributions are achieved. This investigation, for an air cavity, suggests that broad beam quality correction factors published in TRS-398 can be applied for scanned beams. J. Sorriaux is financially supported by a public-private partnership involving the company Ion Beam Applications (IBA)

  3. Calculation of the Nucleon Axial Form Factor Using Staggered Lattice QCD

    SciTech Connect

    Meyer, Aaron S.; Hill, Richard J.; Kronfeld, Andreas S.; Li, Ruizi; Simone, James N.

    2016-10-14

    The nucleon axial form factor is a dominant contribution to errors in neutrino oscillation studies. Lattice QCD calculations can help control theory errors by providing first-principles information on nucleon form factors. In these proceedings, we present preliminary results on a blinded calculation of $g_A$ and the axial form factor using HISQ staggered baryons with 2+1+1 flavors of sea quarks. Calculations are done using physical light quark masses and are absolutely normalized. We discuss fitting form factor data with the model-independent $z$ expansion parametrization.

  4. Difficulty in determining the pion form factor at high Q2

    NASA Astrophysics Data System (ADS)

    Carlson, C. E.; Milana, Joseph

    1990-10-01

    We reexamine the determination of the pion form factor at large spacelike Q2 via the reaction ep-->enπ+ and find that, because of the magnitude of the pion-nucleon form factor and the existence of competing hitherto uncalculated processes in QCD, the pion electromagnetic form factor is not sufficiently well determined at higher Q2 to compare with the expected scaling prediction of QCD. Instead, we conclude that the best way to get information about the pion electromagnetic form factor is to study π0 production.

  5. Up- and Down-Quark Contributions to the Nucleon Form Factors

    NASA Astrophysics Data System (ADS)

    Qattan, I. A.; Arrington, J.

    2014-03-01

    Recent measurements of the neutron s electric to magnetic form factors ratio, Rn = µnGnE/GnM, up to 3.4 (GeV/c)2 combined with existing Rp = µpGpE/GpM measurements in the same Q2 range allowed, for the first time, a separation of the up- and downquark contributions to the form factors at high Q2, as presented by Cates, et al.. Our analysis expands on the original work by including additional form factor data, applying two-photon exchange (TPE) corrections, and accounting for the uncertainties associated with all of the form factor measurements.

  6. Model Independent Constraints on Hadron Form Factors at Large Q2 in Light-Front QCD

    NASA Astrophysics Data System (ADS)

    Ji, Chueng-Ryong

    2014-01-01

    Among the three forms of relativistic Hamiltonian dynamics proposed by Dirac in 1949, the front form has the largest number of kinematic generators. This distinction provides useful consequences in the analysis of physical observables in hadron physics. We discuss a rationale for using the front form dynamics, known nowadays as the light-front dynamics (LFD), and present a few explicit examples of hadron phenomenology that the front form uniquely can offer from the first principle QCD. In particular, model independent constraints are provided for the analyses of deuteron form factors and the NΔ transition form factors at large momentum transfer square Q2.

  7. Factor Structure and Construct Validity of the Counselor Skills Personal Development Rating Form.

    ERIC Educational Resources Information Center

    Torres-Rivera, Edil; Wilbur, Michael P.; Maddux, Cleborne D.; Smaby, Marlowe H.; Phan, Loan T.; Roberts-Wilbur, Janice

    2002-01-01

    Presents an exploratory factor analysis of the scores of 248 counselors-in-training on the Counselor Skills Personal Development Rating Form (CSPD-RF). Authors of the test hypothesized that the CPSD-RF measured 2 factors, personal development and skills development. Factor analysis revealed 4 factors accounting for 58.4% of the total variance,…

  8. UV-activated conversion of Hoechst 33258, DAPI, and Vybrant DyeCycle fluorescent dyes into blue-excited, green-emitting protonated forms.

    PubMed

    Zurek-Biesiada, Dominika; Kędracka-Krok, Sylwia; Dobrucki, Jurek W

    2013-05-01

    Hoechst 33258, DAPI and Vybrant DyeCycle are commonly known DNA fluorescent dyes that are excited by UV and emit in the blue region of the spectrum of visible light. Conveniently, they leave the reminder of the spectrum for microscopy detection of other cellular targets labeled with probes emitting in green, yellow or red. However, an exposure of these dyes to UV induces their photoconversion and results in production of the forms of these dyes that are excited by blue light and show fluoresce maxima in green and a detectable fluorescence in yellow and orange regions of the spectrum. Photoconversion of Hoechst 33258 and DAPI is reversible and independent of the dye concentration or the presence of DNA. Spectrofluorimetry and mass spectrometry analyses indicate that exposure to UV induces protonation of Hoechst 33258 and DAPI.

  9. Positron-proton to electron-proton elastic cross section ratios from CLAS

    NASA Astrophysics Data System (ADS)

    Adikaram, Dasuni; Rimal, Dipak; Weinstein, Larry; Raue, Brian

    2014-03-01

    There is a significant discrepancy between the ratio of the electromagnetic form factors of the proton measured by the Rosenbluth and the polarization transfer technique. The most likely explanation of this discrepancy is the inclusion of two-photon exchange (TPE) amplitude contributions to the elastic electron-proton cross section. The CLAS TPE experiment measured the TPE contribution in the wide range of Q2 and ɛ range using a comparison of positron-proton to electron-proton elastic cross sections (R = σ (e+ p) / σ (e- p)). Preliminary results will be presented, along with the estimations of systematic uncertainties. A detailed comparison of new results with previous R measurements and theoretical calculations will be presented. Implications of the CLAS TPE measurements on the elastic electron-proton cross section will be also discussed.

  10. Evidence for a Proton Transfer Network and a Required Persulfide-Bond-Forming Cysteine Residue in Ni-Containing Carbon Monoxide Dehydrogenases

    SciTech Connect

    Eun Jin Kim; Jian Feng; Matthew R. Bramlett; Paul A. Lindahl

    2004-05-18

    OAK-B135 Carbon monoxide dehydrogenase from Moorella thermoacetica catalyzes the reversible oxidation of CO to CO2 at a nickel-iron-sulfur active-site called the C-cluster. Mutants of a proposed proton transfer pathway and of a cysteine residue recently found to form a persulfide bond with the C-cluster were characterized. Four semi-conserved histidine residues were individually mutated to alanine. His116 and His122 were essential to catalysis, while His113 and His119 attenuated catalysis but were not essential. Significant activity was ''rescued'' by a double mutant where His116 was replaced by Ala and His was also introduced at position 115. Activity was also rescued in double mutants where His122 was replaced by Ala and His was simultaneously introduced at either position 121 or 123. Activity was also ''rescued'' by replacing His with Cys at position 116. Mutation of conserved Lys587 near the C-cluster attenuated activity but did not eliminate it. Activity was virtually abolished in a double mutant where Lys587 and His113 were both changed to Ala. Mutations of conserved Asn284 also attenuated activity. These effects suggest the presence of a network of amino acid residues responsible for proton transfer rather than a single linear pathway. The Ser mutant of the persulfide-forming Cys316 was essentially inactive and displayed no EPR signals originating from the C-cluster. Electronic absorption and metal analysis suggests that the C-cluster is absent in this mutant. The persulfide bond appears to be essential for either the assembly or stability of the C-cluster, and/or for eliciting the redox chemistry of the C-cluster required for catalytic activity.

  11. Internal Dynamics and Ionization States of the Macrophage Migration Inhibitory Factor: Comparison Between Wild-Type and Mutant Forms

    SciTech Connect

    Soares, Thereza A.; Lins, Roberto D.; Straatsma, TP; Briggs, J. M.

    2002-11-15

    The macrophage migration inhibitory factor (MIF) is a cytokine which shares a common structural architecture and catalytic strategy with three isomerases: 4-oxalocrotonate tautomerase, 5-carboxymethyl-2-hydroxymuconate isomerase and D-dopachrome tautomerase. A highly conserved N-terminal proline acts as a base\\acid during the proton transfer reaction catalyzed by these enzymes. Such unusual catalytic strategy appears to be possible only due to the N-terminal proline pKa be shifted to 5.0-6.0 units. Mutations of this residue result in a significant decrease of the catalytic activity of MIF. Two hypotheses have been proposed to explain the catalytic inefficiency of MIF: the lower basicity of primary amines with regard to secondary ones and the increased flexibility resulting from the replacement of a proline by residues like glycine. To investigate that, we have performed molecular dynamics simulations of MIF-wt and its mutant P1G as well as calculated the protonation properties of several mutant forms. It has been found that the N-terminal glycine does not show larger fluctuations compared to proline, but the former residue is more exposed to the solvent throughout the simulations. The apparent pKa of these residues displays very little change (as expected from the structural rigidity of MIF) and is not significantly affected by the surrounding ionizable residues. Instead, the hydrophobic character of the active site seems to be the main factor in determining the pKa of the N-terminal residue and the catalytic efficiency of MIF.

  12. Quark and gluon form factors to four-loop order in QCD: The Nf3 contributions

    NASA Astrophysics Data System (ADS)

    von Manteuffel, Andreas; Schabinger, Robert M.

    2017-02-01

    We calculate the four-loop massless QCD corrections with three closed quark lines to quark and gluon form factors. We apply a novel integration by parts algorithm based on modular arithmetic and compute all relevant master integrals for arbitrary values of the space-time dimension. This is the first calculation of a gluon form factor at this perturbative order in QCD.

  13. Nucleon form factors from high statistics mixed-action calculations with 2+1 flavors

    SciTech Connect

    Schroers, Wolfram; Edwards, Robert G; Engelhardt, Michael; Fleming, George Taminga; Hagler, Philipp; Lin, Huey-Wen; Lin, Mei-Feng; Meyer, Harvey B; Musch, Bernhard; Negele, John W; Orginos, Kostas; Pochinsky, Andrew V; Procura, Massimiliano; Renner, Dru B; Richards, David G; Syritsyn, Sergey N; Walker-Loud, Andre P

    2009-12-01

    We present new high-statistics results for nucleon form factors at pion masses of approximately 290, 350, 500, and 600 MeV using a mixed action of domain wall valence quarks on an improved staggered sea. We perform chiral fits to both vector and axial form factors and compare our results to experiment.

  14. Form factors in quantum integrable models with GL(3)-invariant R-matrix

    NASA Astrophysics Data System (ADS)

    Pakuliak, S.; Ragoucy, E.; Slavnov, N. A.

    2014-04-01

    We study integrable models solvable by the nested algebraic Bethe ansatz and possessing GL(3)-invariant R-matrix. We obtain determinant representations for form factors of off-diagonal entries of the monodromy matrix. These representations can be used for the calculation of form factors and correlation functions of the XXX SU(3)-invariant Heisenberg chain.

  15. Measurement of the deuteron electric and magnetic form factors at Jefferson Lab

    SciTech Connect

    Gerassimos G. Petratos

    1998-06-01

    The results from an experiment to measure the electric, A(Q{sup 2}), and magnetic, B(Q{sup 2}), form factors of the deuteron at large momentum transfers at the Jefferson Laboratory (JLAB) will be reported. The experiment performed elastic electron scattering from deuterium in coincidence; it has improved the quality of the existing data in the range of overlap and has significantly extended the Q{sup 2} range of the previous A(Q{sup 2}) SLAC data. The range in the squared four-momentum transfer, Q{sup 2}, is 0.7 to 6.0 (GeV/c){sup 2} for the A(Q{sup 2}) measurements and 0.7 to 1.4 (GeV/c){sup 2} for the B(Q{sup 2}) measurements. The measurements used the Continuous Electron Beam Accelerator and Hall-A Facilities of JLAB. Incident electron beams of energy 0.5 to 4.4 GeV and current 10 to 120{mu}A were scattered off a high power (500W) cryogenic deuterium/hydrogen target. Scattered electrons and recoiling deuterons were detected in coincidence using the two 4 GeV/c High Resolution Spectrometers (HRS) in Hall-A. Both HRS's used two planes of scintillators for triggering and timing and a drift chamber system for particle tracking. The electron HRS was also equipped with a gas Cherenkov counter and a lead-glass calorimeter for electron identification. Elastic electron-proton scattering in coincidence was used to calibrate the entire double-arm system. The results will be compared to conventional meson-nucleon physics calculations based on the impulse approximation with the inclusion of meson-exchange-currents, and to predictions of dimensional scaling quark models and perturbative quantum chromodynamics. They are expected to provide a crucial test of nuclear chromodynamics ideas and insights into the transition from the meson-nucleon to quark-gluon descriptions of the two-body nuclear structure.

  16. 48 CFR 247.372 - DD Form 1654, Evaluation of Transportation Cost Factors.

    Code of Federal Regulations, 2010 CFR

    2010-10-01

    ... 48 Federal Acquisition Regulations System 3 2010-10-01 2010-10-01 false DD Form 1654, Evaluation... Transportation in Supply Contracts 247.372 DD Form 1654, Evaluation of Transportation Cost Factors. Contracting personnel may use the DD Form 1654 to furnish information to the transportation office for development...

  17. 48 CFR 247.372 - DD Form 1654, Evaluation of Transportation Cost Factors.

    Code of Federal Regulations, 2011 CFR

    2011-10-01

    ... 48 Federal Acquisition Regulations System 3 2011-10-01 2011-10-01 false DD Form 1654, Evaluation... Transportation in Supply Contracts 247.372 DD Form 1654, Evaluation of Transportation Cost Factors. Contracting personnel may use the DD Form 1654 to furnish information to the transportation office for development...

  18. Indirect approaches to constraining the best estimate of the astrophysical S-factor for proton radiative capture on nitrogen-14

    NASA Astrophysics Data System (ADS)

    Bertone, Peter Felix

    states in the compound nucleus. Proton elastic scattering data on 15O exist, but nearly all are more than five decades old. In addition, such scattering data have never been included in the analysis of the radiative capture data. Therefore, the results reported here are the new measurements of proton elastic scattering on 15 O, the width of the Ex = 6793-keV sub-threshold level in 15O, the effect of these quantities on the best estimate for the 14N( p, gamma)15O S-factor, and the resulting astrophysical consequences.

  19. An Unexpected Effect of Proton Pump Inhibitors: Elevation of the Cardiovascular Risk Factor ADMA

    PubMed Central

    Ghebremariam, Yohannes T.; LePendu, Paea; Lee, Jerry C.; Erlanson, Daniel A.; Slaviero, Anna; Shah, Nigam H.; Leiper, James; Cooke, John P.

    2013-01-01

    Background Proton pump inhibitors (PPIs) are gastric acid suppressing agents widely prescribed for the treatment of gastro-esophageal reflux disease (GERD). Recently, several studies in patients with acute coronary syndrome (ACS) have raised the concern that use of PPIs in these patients may increase their risk of major adverse cardiovascular events (MACE). The mechanism of this possible adverse effect is not known. Whether the general population might also be at risk has not been addressed. Methods and Results Plasma ADMA is an endogenous inhibitor of nitric oxide synthase (NOS). Elevated plasma ADMA is associated with increased risk for cardiovascular disease, likely due to its attenuation of the vasoprotective effects of endothelial NOS. We find that PPIs elevate plasma asymmetric dimethylarginine (ADMA) level and reduce nitric oxide (NO) levels and endothelium-dependent vasodilation in a murine model and ex vivo human tissues. PPIs increase ADMA because they bind to, and inhibit dimethylarginine dimethylaminohydrolase (DDAH), the enzyme that degrades ADMA. Conclusions We present a plausible biological mechanism to explain the association of PPIs with increased MACE in patients with unstable coronary syndromes. Of concern, this adverse mechanism is also likely to extend to the general population using PPIs. This finding compels additional clinical investigations and pharmacovigilance directed toward understanding the cardiovascular risk associated with use of the PPIs in the general population. PMID:23825361

  20. The neutron electric form factor to Q² = 1.45 (GeV/c)²

    SciTech Connect

    Plaster, Bradley

    2004-02-01

    The nucleon elastic electromagnetic form factors are fundamental quantities needed for an understanding of nucleon and nuclear electromagnetic structure. The evolution of the Sachs electric and magnetic form factors with Q2, the square of the four-momentum transfer, is related to the distribution of charge and magnetization within the nucleon. High precision measurements of the nucleon form factors are essential for stringent tests of our current theoretical understanding of confinement within the nucleon. Measurements of the neutron form factors, in particular, those of the neutron electric form factor, have been notoriously difficult due to the lack of a free neutron target and the vanishing integral charge of the neutron. Indeed, a precise measurement of the neutron electric form factor has eluded experimentalists for decades; however, with the advent of high duty-factor polarized electron beam facilities, experiments employing polarization degrees of freedom have finally yielded the first precise measurements of this fundamental quantity. Following a general overview of the experimental and theoretical status of the nucleon form factors, a detailed description of an experiment designed to extract the neutron electric form factor from measurements of the neutron's recoil polarization in quasielastic 2H(e, e')1H scattering is presented. The experiment described here employed the Thomas Jefferson National Accelerator Facility's longitudinally polarized electron beam, a magnetic spectrometer for detection of the scattered electron, and a neutron polarimeter designed specifically for this experiment. Measurements were conducted at three Q2 values of 0.45, 1.13, and 1.45 (GeV/c)2, and the final results extracted from an analysis of the data acquired in this experiment are reported and compared with recent theoretical predictions for the nucleon form factors.

  1. A Factor Analytic Study of the Coopersmith Self-Esteem Inventory Adult Short Form.

    ERIC Educational Resources Information Center

    Haines, Janet; Wilson, George V.

    1988-01-01

    A factor analysis was conducted on the Coopersmith Self-Esteem Inventory-Adult Short Form using 237 college students and 43 female office workers in Australia. Factors were found corresponding with three of the four subscales: general self, social self-peers, and home-parents (family). No factor related to the school-academic (work) subscale. (SLD)

  2. Soft spectator scattering in the nucleon form factors at large Q{sup 2} within the soft collinear effective theory approach

    SciTech Connect

    Kivel, Nikolai; Vanderhaeghen, Marc

    2011-05-01

    The proton form factors at large momentum transfer are dominated by two contributions which are associated with the hard and soft rescattering, respectively. Motivated by a very active experimental form factor program at intermediate values of momentum transfers, Q{sup 2}{approx}5-15 GeV{sup 2}, where an understanding in terms of only a hard rescattering mechanism cannot yet be expected, we investigate in this work the soft rescattering contribution using soft collinear effective theory (SCET). Within such a description, the form factor is characterized, besides the hard scale Q{sup 2}, by a hard-collinear scale Q{Lambda}, which arises due to the presence of soft spectators, with virtuality {Lambda}{sup 2} ({Lambda}{approx}0.5 GeV), such that Q{sup 2}>>Q{Lambda}>>{Lambda}{sup 2}. We show that in this case a two-step factorization can be successfully carried out using the SCET approach. In a first step (SCET{sub I}), we perform the leading-order matching of the QCD electromagnetic current onto the relevant SCET{sub I} operators and perform a resummation of large logarithms using renormalization group equations. We then discuss the further matching onto a SCET{sub II} framework, and propose the factorization formula (accurate to leading logarithmic approximation) for the Dirac form factor, accounting for both hard and soft contributions. We also present a qualitative discussion of the phenomenological consequences of this new framework.

  3. Liquid chromatography-mass spectrometry and proton nuclear magnetic resonance characterization of trace level condensation products formed between lactose and the amine-containing diuretic hydrochlorothiazide.

    PubMed

    Harmon, P A; Yin, W; Bowen, W E; Tyrrell, R J; Reed, R A

    2000-07-01

    Trace levels of condensation products between lactose and the amine-containing diuretic hydrochlorothiazide are formed when a mixture of the two solids containing 30% weight water is heated at 60 degrees C for 2 weeks. The two most abundant condensation products were characterized by liquid chromatography-mass spectrometry (LC-MS) and proton nuclear magnetic resonance ((1)H NMR) spectroscopy. Under these relatively mild conditions of formation, the amine-lactose reaction products are limited to those involving the elimination of only a single molecule of water, rather than the multiple-water eliminations associated with later stages of the Maillard reaction. The spectroscopic data clearly show that the primary condensation products are cyclic N-substituted glycosylamines rather than Schiff base, 1,2-enolic forms, or Amadori rearrangement products of identical mass. In solution, the two most abundant N-substituted glycosylamines are shown to be in a kinetically slow equilibrium with each other, most likely through a mutarotation involving the intermediate formation of the acyclic Schiff base.

  4. Potential Energy Landscape of the Electronic States of the GFP Chromophore in Different Protonation Forms: Electronic Transition Energies and Conical Intersections.

    PubMed

    Polyakov, I V; Grigorenko, B L; Epifanovsky, E M; Krylov, A I; Nemukhin, A V

    2010-08-10

    We present the results of quantum chemical calculations of the transition energies and conical intersection points for the two lowest singlet electronic states of the green fluorescent protein chromophore, 4'-hydroxybenzylidene-2,3-dimethylimidazolinone, in the vicinity of its cis conformation in the gas phase. Four protonation states of the chromophore, i.e., anionic, neutral, cationic, and zwitterionic, were considered. Energy differences were computed by the perturbatively corrected complete active space self-consistent field (CASSCF)-based approaches at the corresponding potential energy minima optimized by density functional theory and CASSCF (for the ground and excited states, respectively). We also report the EOM-CCSD and SOS-CIS(D) results for the excitation energies. The minimum energy S0/S1 conical intersection points were located using analytic state-specific CASSCF gradients. The results reproduce essential features of previous ab initio calculations of the anionic form of the chromophore and provide an extension for the neutral, cationic, and zwitterionic forms, which are important in the protein environment. The S1 PES of the anion is fairly flat, and the barrier separating the planar bright conformation from the dark twisted one as well as the conical intersection point with the S0 surface is very small (less than 2 kcal/mol). On the cationic surface, the barrier is considerably higher (∼13 kcal/mol). The PES of the S1 state of the zwitterionic form does not have a planar minimum in the Franck-Condon region. The S1 surface of the neutral form possesses a bright planar minimum; the energy barrier of about 9 kcal/mol separates it from the dark twisted conformation as well as from the conical intersection point leading to the cis-trans chromophore isomerization.

  5. Protons are one of the limiting factors in determining sensitivity of nano surface-assisted (+)-mode LDI MS analyses.

    PubMed

    Cho, Eunji; Ahn, Miri; Kim, Young Hwan; Kim, Jongwon; Kim, Sunghwan

    2013-10-01

    A proton source employing a nanostructured gold surface for use in (+)-mode laser desorption ionization mass spectrometry (LDI-MS) was evaluated. Analysis of perdeuterated polyaromatic hydrocarbon compound dissolved in regular toluene, perdeuterated toluene, and deuterated methanol all showed that protonated ions were generated irregardless of solvent system. Therefore, it was concluded that residual water on the surface of the LDI plate was the major source of protons. The fact that residual water remaining after vacuum drying was the source of protons suggests that protons may be the limiting reagent in the LDI process and that overall ionization efficiency can be improved by incorporating an additional proton source. When extra proton sources, such as thiolate compounds and/or citric acid, were added to a nanostructured gold surface, the protonated signal abundance increased. These data show that protons are one of the limiting components in (+)-mode LDI MS analyses employing nanostructured gold surfaces. Therefore, it has been suggested that additional efforts are required to identify compounds that can act as proton donors without generating peaks that interfere with mass spectral interpretation.

  6. Protons are One of the Limiting Factors in Determining Sensitivity of Nano Surface-Assisted (+)-Mode LDI MS Analyses

    NASA Astrophysics Data System (ADS)

    Cho, Eunji; Ahn, Miri; Kim, Young Hwan; Kim, Jongwon; Kim, Sunghwan

    2013-10-01

    A proton source employing a nanostructured gold surface for use in (+)-mode laser desorption ionization mass spectrometry (LDI-MS) was evaluated. Analysis of perdeuterated polyaromatic hydrocarbon compound dissolved in regular toluene, perdeuterated toluene, and deuterated methanol all showed that protonated ions were generated irregardless of solvent system. Therefore, it was concluded that residual water on the surface of the LDI plate was the major source of protons. The fact that residual water remaining after vacuum drying was the source of protons suggests that protons may be the limiting reagent in the LDI process and that overall ionization efficiency can be improved by incorporating an additional proton source. When extra proton sources, such as thiolate compounds and/or citric acid, were added to a nanostructured gold surface, the protonated signal abundance increased. These data show that protons are one of the limiting components in (+)-mode LDI MS analyses employing nanostructured gold surfaces. Therefore, it has been suggested that additional efforts are required to identify compounds that can act as proton donors without generating peaks that interfere with mass spectral interpretation.

  7. Threshold pion production from proton-proton collisions

    SciTech Connect

    Lee, T.S.H.

    1995-08-01

    We showed that the threshold production of {pi}{sup 0}pp, {pi}{sup +}np, and {pi}{sup +}d from proton-proton collisions can be consistently described by a model consisting of pion s-wave rescattering and N{bar N} pair-terms of heavy-meson exchanges. The large difference between {sigma}{sup tot}(pp {yields} {pi}{sup +}d) and {sigma}{sup tot}(pp {yields} {pi}{sup +}np) is understood from the orthogonality of the deuteron and the np scattering wave functions. In a calculation using the Paris potential, we find that the data can be reproduced best by using a soft {pi}NN form factor with {Delta} = 650 MeV for a monopole form. This is consistent with our earlier studies of pion production in the A-excitation region. A paper describing this result was submitted for publication.

  8. Can Nonrelativistic QCD Explain the γγ^{*}→η_{c} Transition Form Factor Data?

    PubMed

    Feng, Feng; Jia, Yu; Sang, Wen-Long

    2015-11-27

    Unlike the bewildering situation in the γγ^{*}→π form factor, a widespread view is that perturbative QCD can decently account for the recent BABAR measurement of the γγ^{*}→η_{c} transition form factor. The next-to-next-to-leading-order perturbative correction to the γγ^{*}→η_{c,b} form factor, is investigated in the nonrelativistic QCD (NRQCD) factorization framework for the first time. As a byproduct, we obtain, by far, the most precise order-α_{s}^{2} NRQCD matching coefficient for the η_{c,b}→γγ process. After including the substantial negative order-α_{s}^{2} correction, the good agreement between NRQCD prediction and the measured γγ^{*}→η_{c} form factor is completely ruined over a wide range of momentum transfer squared. This eminent discrepancy casts some doubts on the applicability of the NRQCD approach to hard exclusive reactions involving charmonium.

  9. An experimental survey of the factors that affect leaching from low-level radioactive waste forms

    SciTech Connect

    Dougherty, D.R.; Pietrzak, R.F.; Fuhrmann, M.; Colombo, P.

    1988-09-01

    This report represents the results of an experimental survey of the factors that affect leaching from several types of solidified low-level radioactive waste forms. The goal of these investigations was to determine those factors that accelerate leaching without changing its mechanism(s). Typically, although not in every case,the accelerating factors include: increased temperature, increased waste loading (i.e., increased waste to binder ratio), and decreased size (i.e., decreased waste form volume to surface area ratio). Additional factors that were studied were: increased leachant volume to waste form surface area ratio, pH, leachant composition (groundwaters, natural and synthetic chelating agents), leachant flow rate or replacement frequency and waste form porosity and surface condition. Other potential factors, including the radiation environment and pressure, were omitted based on a survey of the literature. 82 refs., 236 figs., 13 tabs.

  10. Parity-Violating Electron Scattering and the Electric and Magnetic Strange Form Factors of the Nucleon

    SciTech Connect

    Armstrong, David S.; McKeown, Robert

    2012-11-01

    Measurement of the neutral weak vector form factors of the nucleon provides unique access to the strange quark content of the nucleon. These form factors can be studied using parity-violating electron scattering. A comprehensive program of experiments has been performed at three accelerator laboratories to determine the role of strange quarks in the electromagnetic form factors of the nucleon. This article reviews the remarkable technical progress associated with this program, describes the various methods used in the different experiments, and summarizes the physics results along with recent theoretical calculations.

  11. Pion Form Factor in Chiral Limit of Hard-Wall AdS/QCD Model

    SciTech Connect

    Anatoly Radyushkin; Hovhannes Grigoryan

    2007-12-01

    We develop a formalism to calculate form factor and charge density distribution of pion in the chiral limit using the holographic dual model of QCD with hard-wall cutoff. We introduce two conjugate pion wave functions and present analytic expressions for these functions and for the pion form factor. They allow to relate such observables as the pion decay constant and the pion charge electric radius to the values of chiral condensate and hard-wall cutoff scale. The evolution of the pion form factor to large values of the momentum transfer is discussed, and results are compared to existing experimental data.

  12. The Charge Form Factors of the Three- and Four-Body Nuclei

    SciTech Connect

    R. Schiavilla; V.R. Pandharipande; D.O. Riska

    1990-01-01

    The charge form factors of 3H, 3He, and 4He are calculated using the Monte Carlo method and variational ground-state wave functions obtained for the Argonne two-nucleon and Urbana-VII three-nucleon interactions. The model for the charge density operator contains the two-body exchange contributions of longest range. With some spread due to the uncertainty in the electromagnetic form factors of the nucleon the calculated charge form factors are in good agreement with the empirical values over the whole experimentally covered range of momentum transfer.

  13. Delta and Omega electromagnetic form factors in a Dyson-Schwinger/Bethe-Salpeter approach

    SciTech Connect

    Diana Nicmorus, Gernot Eichmann, Reinhard Alkofer

    2010-12-01

    We investigate the electromagnetic form factors of the Delta and the Omega baryons within the Poincare-covariant framework of Dyson-Schwinger and Bethe-Salpeter equations. The three-quark core contributions of the form factors are evaluated by employing a quark-diquark approximation. We use a consistent setup for the quark-gluon dressing, the quark-quark bound-state kernel and the quark-photon interaction. Our predictions for the multipole form factors are compatible with available experimental data and quark-model estimates. The current-quark mass evolution of the static electromagnetic properties agrees with results provided by lattice calculations.

  14. Symmetry Relations for Heavy-to-Light Meson Form Factors at Large Recoil

    SciTech Connect

    Hill, R.

    2004-11-10

    The description of large-recoil heavy-to-light meson form factors is reviewed in the framework of soft-collinear effective theory. At leading power in the heavy-quark expansion, three classes of approximate symmetry relations arise. The relations are compared to experimental data for D {yields} K* and D{sub s} {yields} {phi} form factors, and to light-cone QCD sum rule predictions for B {yields} {pi} and B {yields} {rho} form factors. Implications for the extraction of |V{sub ub}| from semileptonic B {yields} {rho} decays are discussed.

  15. An Investigation of the Factor Structure and Convergent and Discriminant Validity of the Five-Factor Model Rating Form

    ERIC Educational Resources Information Center

    Samuel, Douglas B.; Mullins-Sweatt, Stephanie N.; Widiger, Thomas A.

    2013-01-01

    The Five-Factor Model Rating Form (FFMRF) is a one-page measure designed to provide an efficient assessment of the higher order domains of the Five Factor Model (FFM) as well as the more specific, lower order facets proposed by McCrae and Costa. Although previous research has suggested that the FFMRF's assessment of the lower order facets converge…

  16. An Investigation of the Factor Structure and Convergent and Discriminant Validity of the Five-Factor Model Rating Form

    ERIC Educational Resources Information Center

    Samuel, Douglas B.; Mullins-Sweatt, Stephanie N.; Widiger, Thomas A.

    2013-01-01

    The Five-Factor Model Rating Form (FFMRF) is a one-page measure designed to provide an efficient assessment of the higher order domains of the Five Factor Model (FFM) as well as the more specific, lower order facets proposed by McCrae and Costa. Although previous research has suggested that the FFMRF's assessment of the lower order facets converge…

  17. CGC factorization for forward particle production in proton-nucleus collisions at next-to-leading order

    NASA Astrophysics Data System (ADS)

    Iancu, E.; Mueller, A. H.; Triantafyllopoulos, D. N.

    2016-12-01

    Within the Color Glass Condensate effective theory, we reconsider the next-to-leading order (NLO) calculation of the single inclusive particle production at forward rapidities in proton-nucleus collisions at high energy. Focusing on quark production for definiteness, we establish a new factorization scheme, perturbatively correct through NLO, in which there is no `rapidity subtraction'. That is, the NLO correction to the impact factor is not explicitly separated from the high-energy evolution. Our construction exploits the skeleton structure of the (NLO) Balitsky-Kovchegov equation, in which the first step of the evolution is explicitly singled out. The NLO impact factor is included by computing this first emission with the exact kinematics for the emitted gluon, rather than by using the eikonal approximation. This particular calculation has already been presented in the literature [1, 2], but the reorganization of the perturbation theory that we propose is new. As compared to the proposal in [1, 2], our scheme is free of the fine-tuning inherent in the rapidity subtraction, which might be the origin of the negativity of the NLO cross-section observed in previous studies.

  18. CGC factorization for forward particle production in proton-nucleus collisions at next-to-leading order

    DOE PAGES

    Iancu, E.; Mueller, A. H.; Triantafyllopoulos, D. N.

    2016-12-13

    Within the Color Glass Condensate effective theory, we reconsider the next-to-leading order (NLO) calculation of the single inclusive particle production at forward rapidities in proton-nucleus collisions at high energy. Focusing on quark production for definiteness, we establish a new factorization scheme, perturbatively correct through NLO, in which there is no ‘rapidity subtraction’. That is, the NLO correction to the impact factor is not explicitly separated from the high-energy evolution. Our construction exploits the skeleton structure of the (NLO) Balitsky-Kovchegov equation, in which the first step of the evolution is explicitly singled out. The NLO impact factor is included by computingmore » this first emission with the exact kinematics for the emitted gluon, rather than by using the eikonal approximation. This particular calculation has already been presented in the literature, but the reorganization of the perturbation theory that we propose is new. As compared to the proposal in, our scheme is free of the fine-tuning inherent in the rapidity subtraction, which might be the origin of the negativity of the NLO cross-section observed in previous studies.« less

  19. CGC factorization for forward particle production in proton-nucleus collisions at next-to-leading order

    SciTech Connect

    Iancu, E.; Mueller, A. H.; Triantafyllopoulos, D. N.

    2016-12-13

    Within the Color Glass Condensate effective theory, we reconsider the next-to-leading order (NLO) calculation of the single inclusive particle production at forward rapidities in proton-nucleus collisions at high energy. Focusing on quark production for definiteness, we establish a new factorization scheme, perturbatively correct through NLO, in which there is no ‘rapidity subtraction’. That is, the NLO correction to the impact factor is not explicitly separated from the high-energy evolution. Our construction exploits the skeleton structure of the (NLO) Balitsky-Kovchegov equation, in which the first step of the evolution is explicitly singled out. The NLO impact factor is included by computing this first emission with the exact kinematics for the emitted gluon, rather than by using the eikonal approximation. This particular calculation has already been presented in the literature, but the reorganization of the perturbation theory that we propose is new. As compared to the proposal in, our scheme is free of the fine-tuning inherent in the rapidity subtraction, which might be the origin of the negativity of the NLO cross-section observed in previous studies.

  20. Interaction between droplets in a ternary microemulsion evaluated by the relative form factor method

    SciTech Connect

    Nagao, Michihiro; Seto, Hideki; Yamada, Norifumi L.

    2007-06-15

    This paper describes the concentration dependence of the interaction between water droplets coated by a surfactant monolayer using the contrast variation small-angle neutron scattering technique. In the first part, we explain the idea of how to extract a relatively model free structure factor from the scattering data, which is called the relative form factor method. In the second part, the experimental results for the shape of the droplets (form factor) are described. In the third part the relatively model free structure factor is shown, and finally the concentration dependence of the interaction potential between droplets is discussed. The result indicates the validity of the relative form factor method, and the importance of the estimation of the model free structure factor to discuss the nature of structure formation in microemulsion systems.

  1. Form factors of the transitions {gamma}{sup *}{pi}{sup 0} {r_arrow} {gamma} and {gamma}{sup *}{eta}{r_arrow}{gamma}

    SciTech Connect

    Afanasev, A.

    1994-04-01

    The author discusses possibilities to study {gamma}*{pi}{sup 0} and {gamma}*{eta} {r_arrow} {gamma} transition form factors at CEBAF energies. The author shows that for 4 GeV electron beam, these form factors can be measured at CEBAF for the 4-momentum transfers Q{sup 2} {le} 2.5 (GeV/c){sup 2} using virtual Compton scattering on the proton and nuclear target in the kinematic regime of low momentum transfers to the target. These measurements can be extended to Q{sup 2} {le} 4.0 (GeV/c){sup 2} using the electron beam with the energy 6 GeV.

  2. SU-E-T-586: Field Size Dependence of Output Factor for Uniform Scanning Proton Beams: A Comparison of TPS Calculation, Measurement and Monte Carlo Simulation

    SciTech Connect

    Zheng, Y; Singh, H; Islam, M

    2014-06-01

    Purpose: Output dependence on field size for uniform scanning beams, and the accuracy of treatment planning system (TPS) calculation are not well studied. The purpose of this work is to investigate the dependence of output on field size for uniform scanning beams and compare it among TPS calculation, measurements and Monte Carlo simulations. Methods: Field size dependence was studied using various field sizes between 2.5 cm diameter to 10 cm diameter. The field size factor was studied for a number of proton range and modulation combinations based on output at the center of spread out Bragg peak normalized to a 10 cm diameter field. Three methods were used and compared in this study: 1) TPS calculation, 2) ionization chamber measurement, and 3) Monte Carlos simulation. The XiO TPS (Electa, St. Louis) was used to calculate the output factor using a pencil beam algorithm; a pinpoint ionization chamber was used for measurements; and the Fluka code was used for Monte Carlo simulations. Results: The field size factor varied with proton beam parameters, such as range, modulation, and calibration depth, and could decrease over 10% from a 10 cm to 3 cm diameter field for a large range proton beam. The XiO TPS predicted the field size factor relatively well at large field size, but could differ from measurements by 5% or more for small field and large range beams. Monte Carlo simulations predicted the field size factor within 1.5% of measurements. Conclusion: Output factor can vary largely with field size, and needs to be accounted for accurate proton beam delivery. This is especially important for small field beams such as in stereotactic proton therapy, where the field size dependence is large and TPS calculation is inaccurate. Measurements or Monte Carlo simulations are recommended for output determination for such cases.

  3. Electromagnetic form factors of Λb in the Bethe-Salpeter equation approach

    NASA Astrophysics Data System (ADS)

    Liu, Liang-Liang; Wang, Chao; Liu, Ying; Guo, Xin-Heng

    2017-03-01

    The heavy baryon Λb is regarded as composed of a heavy quark and a scalar diquark which has good spin and isospin quantum numbers. In this picture, we calculate the electromagnetic form factors of Λb in the Bethe-Salpeter equation approach in the spacelike region. We find that the shapes of the electromagnetic form factors of Λb are similar to those of Λ , with a peak at ω =1 (for the magnetic form factor) and ω ≃1.1 (for the electric form factor)(ω =v'.v is the velocity transfer between the initial state (with velocity v ) and the final state (with velocity v') of Λb), but the amplitudes are much smaller than those of Λ .

  4. Improving the phenomenology of K{sub l3} form factors with analyticity and unitarity

    SciTech Connect

    Abbas, Gauhar; Ananthanarayan, B.; Imsong, I. Sentitemsu; Caprini, Irinel

    2010-11-01

    The shape of the vector and scalar K{sub l3} form factors is investigated by exploiting analyticity and unitarity in a model-independent formalism. The method uses as input dispersion relations for certain correlators computed in perturbative QCD in the deep Euclidean region, soft-meson theorems, and experimental information on the phase and modulus of the form factors along the elastic part of the unitarity cut. We derive constraints on the coefficients of the parameterizations valid in the semileptonic range and on the truncation error. The method also predicts low-energy domains in the complex t plane where zeros of the form factors are excluded. The results are useful for K{sub l3} data analyses and provide theoretical underpinning for recent phenomenological dispersive representations for the form factors.

  5. The spin-dependent neutralino-nucleus form factor for {sup 127}I

    SciTech Connect

    Ressell, M.T.; Dean, D.J.

    1996-12-01

    We present the results of detailed shell model calculations of the spin-dependent elastic form factor for the nucleus {sup 127}I. the calculations were performed in extremely large model spaces which adequately describe the configuration mixing in this nucleus. Good agreement between the calculated and experimental values of the magnetic moment are found. Other nuclear observables are also compared to experiment. The dependence of the form factor upon the model space and effective interaction is discussed.

  6. Form factors with q 2 = 0 and Grassmannians in N = 4 Sym theory

    NASA Astrophysics Data System (ADS)

    Bork, L. V.; Onishchenko, A. I.

    2017-09-01

    In this note we consider tree level form factors of operators from stress tensor supermultiplet with light like operator momentum q 2 = 0. The presentation of form factors in terms of the regulated integral over Grassmannian is given. The conjectured formula is verified by successfully reproducing known answers in the MHV and N k-2MHV, k ≥ 3 sectors as well as appropriate soft limit behavior.

  7. Interpreting the neutron's electric form factor: Rest frame charge distribution or foldy term?

    SciTech Connect

    Nathan Isgur

    1998-12-01

    The neutron's electric form factor contains vital information on nucleon structure, but its interpretation within many models has been obscured by relativistic effects. The author demonstrates that, to leading order in the relativistic expansion of a constituent quark model, the Foldy term cancels exactly against a contribution to the Dirac form factor F{sub 1} to leave intact the naive interpretation of G{sup n}{sub E} as arising from the neutron's rest frame charge distribution.

  8. Nucleon-to-{delta} axial transition form factors in relativistic baryon chiral perturbation theory

    SciTech Connect

    Geng, L. S.; Camalich, J. Martin; Alvarez-Ruso, L.; Vacas, M. J. Vicente

    2008-07-01

    We report a theoretical study of the axial nucleon-to-delta (1232) (N{yields}{delta}) transition form factors up to one-loop order in relativistic baryon chiral perturbation theory. We adopt a formalism in which the {delta} couplings obey the spin-3/2 gauge symmetry and, therefore, decouple the unphysical spin-1/2 fields. We compare the results with phenomenological form factors obtained from neutrino bubble-chamber data and in quark models.

  9. Deuteron electromagnetic form factors in a renormalizable formulation of chiral effective field theory

    NASA Astrophysics Data System (ADS)

    Epelbaum, E.; Gasparyan, A. M.; Gegelia, J.; Schindler, M. R.

    2014-03-01

    We calculate the deuteron electromagnetic form factors in a modified version of Weinberg's chiral effective field theory approach to the two-nucleon system. We derive renormalizable integral equations for the deuteron without partial wave decomposition. Deuteron form factors are extracted by applying the Lehmann-Symanzik-Zimmermann reduction formalism to the three-point correlation function of deuteron interpolating fields and the electromagnetic current operator. Numerical results of a leading-order calculation with removed cutoff regularization agree well with experimental data.

  10. $$B\\to Kl^+l^-$$ decay form factors from three-flavor lattice QCD

    DOE PAGES

    Bailey, Jon A.

    2016-01-27

    We compute the form factors for the B → Kl+l- semileptonic decay process in lattice QCD using gauge-field ensembles with 2+1 flavors of sea quark, generated by the MILC Collaboration. The ensembles span lattice spacings from 0.12 to 0.045 fm and have multiple sea-quark masses to help control the chiral extrapolation. The asqtad improved staggered action is used for the light valence and sea quarks, and the clover action with the Fermilab interpretation is used for the heavy b quark. We present results for the form factors f+(q2), f0(q2), and fT(q2), where q2 is the momentum transfer, together with a comprehensivemore » examination of systematic errors. Lattice QCD determines the form factors for a limited range of q2, and we use the model-independent z expansion to cover the whole kinematically allowed range. We present our final form-factor results as coefficients of the z expansion and the correlations between them, where the errors on the coefficients include statistical and all systematic uncertainties. Lastly, we use this complete description of the form factors to test QCD predictions of the form factors at high and low q2.« less

  11. Effects of core deformations and collective rotational currents on electron-nucleus magnetic form factors

    SciTech Connect

    Lin, C.K.

    1983-01-01

    The collective model H/sub int/ + H/sub coll/ is used to study the magnetic form factors. For the intrinsic Hamiltonian, we use the Nilsson model to generate the intrinsic state. For the collective Hamiltonian, two models are considered, the rigid body model and the liquid soap model. We use the particle-rotor model to derive the collective operators and their reduced matrix elements, and then apply this model to the elastic M1 form factor of /sup 13/C. One sees clearly the interplay of the intrinsic form factor and the collective form factor. Since the form factor is essentially a Fourier transform of the current density operator, one also sees the effects of the collective current density distribution due to all the particles in addition to that of the intrinsic current due to the unpaired nucleons. The effects of core deformation are explored. This includes discussions on the difference between the variation before projection and the variation after projection. Analytic results are obtained in the case of weak deformations. The collective model focuses on the effects of the quadrupole deformation on the M1 form factor of /sup 13/C, whereas the calculation involving core polarization stresses the monopole effects. By introducing a quenching of the isovector g/sub s/, the fits by the collective models are very comparable to the fit by the core polarization, although the justification for this procedure in light nuclei is questionable.

  12. Mixed-state form factors of U(1) twist fields in the Dirac theory

    NASA Astrophysics Data System (ADS)

    Chen, Yixiong

    2016-08-01

    Using the ‘Liouville space’ (the space of operators) of the massive Dirac theory, we define mixed-state form factors of U(1) twist fields. We consider mixed states with density matrices diagonal in the asymptotic particle basis. This includes the thermal Gibbs state as well as all generalized Gibbs ensembles of the Dirac theory. When the mixed state is specialized to a thermal Gibbs state, using a Riemann-Hilbert problem and low-temperature expansion, we obtain finite-temperature form factors of U(1) twist fields. We then propose the expression for form factors of U(1) twist fields in general diagonal mixed states. We verify that these form factors satisfy a system of nonlinear functional differential equations, which is derived from the trace definition of mixed-state form factors. At last, under weak analytic conditions on the eigenvalues of the density matrix, we write down the large distance form factor expansions of two-point correlation functions of these twist fields. Using the relation between the Dirac and Ising models, this provides the large-distance expansion of the Rényi entropy (for integer Rényi parameter) in the Ising model in diagonal mixed states.

  13. $B\\to Kl^+l^-$ decay form factors from three-flavor lattice QCD

    SciTech Connect

    Bailey, Jon A.

    2016-01-27

    We compute the form factors for the B → Kl+l- semileptonic decay process in lattice QCD using gauge-field ensembles with 2+1 flavors of sea quark, generated by the MILC Collaboration. The ensembles span lattice spacings from 0.12 to 0.045 fm and have multiple sea-quark masses to help control the chiral extrapolation. The asqtad improved staggered action is used for the light valence and sea quarks, and the clover action with the Fermilab interpretation is used for the heavy b quark. We present results for the form factors f+(q2), f0(q2), and fT(q2), where q2 is the momentum transfer, together with a comprehensive examination of systematic errors. Lattice QCD determines the form factors for a limited range of q2, and we use the model-independent z expansion to cover the whole kinematically allowed range. We present our final form-factor results as coefficients of the z expansion and the correlations between them, where the errors on the coefficients include statistical and all systematic uncertainties. Lastly, we use this complete description of the form factors to test QCD predictions of the form factors at high and low q2.

  14. 77 FR 4227 - Implantation or Injectable Dosage Form New Animal Drugs; Gonadotropin Releasing Factor Analog...

    Federal Register 2010, 2011, 2012, 2013, 2014

    2012-01-27

    ... HUMAN SERVICES Food and Drug Administration 21 CFR Part 522 Implantation or Injectable Dosage Form New... gonadotropin releasing factor analog-diphtheria toxoid conjugate injectable solution. DATES: This rule is...: PART 522--IMPLANTATION OR INJECTABLE DOSAGE FORM NEW ANIMAL DRUGS 0 1. The authority citation for...

  15. Coupled-cluster based approach for core-level states in condensed phase: Theory and application to different protonated forms of aqueous glycine

    NASA Astrophysics Data System (ADS)

    Sadybekov, Arman; Krylov, Anna I.

    2017-07-01

    A theoretical approach for calculating core-level states in condensed phase is presented. The approach is based on the equation-of-motion coupled-cluster (EOM-CC) theory and effective fragment potential (EFP) method. By introducing approximate treatment of double excitations in the EOM-CC with single and double substitutions ansatz, we address poor convergence issues that are encountered for the core-level states and significantly reduce computational costs. While the approximations introduce relatively large errors in the absolute values of transition energies, the errors are systematic. Consequently, chemical shifts, changes in ionization energies relative to reference systems, are reproduced reasonably well. By using different protonation forms of solvated glycine as a benchmark system, we show that our protocol is capable of reproducing the experimental chemical shifts with a quantitative accuracy. The results demonstrate that chemical shifts are very sensitive to the solvent interactions and that explicit treatment of a solvent, such as within EFP framework, is essential for achieving quantitative accuracy.

  16. Form and structure factors for impedance and reflection from periodic layers.

    PubMed

    Pan, Janet L

    2007-01-20

    In an exact treatment of the Maxwell equations, we derive form and structure factors for reflection from periodic layers, and we show that these factors are significantly different from their analogs in kinematic x-ray diffraction. Quite generally, we show that reflection and impedance can be written precisely as the sum of an additive form factor and the product of a structure factor and a second form factor. This additive form factor does not have an analog in kinematic x-ray diffraction. It is demonstrated that the form factors are found by analytic continuation to an arbitrary wavelength of expressions for the impedance both at long wavelengths and at quarter wavelengths. A correction to the Bragg law relating fringe spacing to the total structure thickness is derived. We go beyond previous numerical work by deriving simple analytic exact expressions for reflection and impedance of periodic layers for all frequencies within the reflection passband, and for an arbitrary number of periods in the structure, an arbitrary index profile within each period, arbitrary layer thicknesses (not just quarter-wave layers), and for arbitrary sizes of the refractive index differences.

  17. Pure sea-quark contributions to the magnetic form factors of Σ baryons

    NASA Astrophysics Data System (ADS)

    Wang, P.; Leinweber, D. B.; Thomas, A. W.

    2015-08-01

    We propose the pure sea-quark contributions to the magnetic form factors of Σ baryons, GΣ-u and GΣ+d,as priority observables for the examination of sea-quark contributions to baryon structure, both in present lattice QCD simulations and possible future experimental measurement. GΣ-u, the u -quark contribution to the magnetic form factor of Σ-,and GΣ+d, the d -quark contribution to the magnetic form factor of Σ+,are similar to the strange-quark contribution to the magnetic form factor of the nucleon, but promise to be larger by an order of magnitude. We explore the size of this quantity within chiral effective field theory, including both octet and decuplet intermediate states. The finite range regularization approach is applied to deal with ultraviolet divergences. Drawing on an established connection between quenched and full QCD, this approach makes it possible to predict the sea-quark contribution to the magnetic form factor purely from the meson loop. In the familiar convention where the quark charge is set to unity GΣ-u=GΣ+d. We find a value of -0.38-0.17+0.16 μN , which is about seven times larger than the strange magnetic moment of the nucleon found in the same approach. Including quark charge factors, the u -quark contribution to the Σ- magnetic moment exceeds the strange-quark contribution to the nucleon magnetic moment by a factor of 14.

  18. Human transforming growth factor. beta. -. cap alpha. /sub 2/-macroglobulin complex is a latent form of transforming growth factor. beta

    SciTech Connect

    Huang, S.S.; O'Grady, P.; Huang, J.S.

    1987-05-01

    Human platelet-derived transforming growth factor ..beta.. (TGF..beta..) has been shown to be present as a high molecular weight latent form in human serum. Appearance of transforming growth factor activity, along with the change from high molecular weight form to low molecular weight form, was observed following treatment of the latent form of TGF..beta.. with acid or urea, suggesting that the latent form of TGF..beta.. is a complex of TGF..beta.. and a high molecular weight binding protein. Human ..cap alpha../sub 2/-M has been found to be a plasma binding protein for platelet-derived growth factor (PDGF) in serum or plasma. TGF..beta.. and PDGF share similar properties. They, therefore, investigated the interaction between /sup 125/I-TGF..beta.. and ..cap alpha../sub 2/M. /sup 125/I-TGF..beta.. and purified human ..cap alpha../sub 2/M formed a complex as demonstrated by polyacrylamide gel electrophoresis. Most of the /sup 125/I-TGF..beta..-..cap alpha../sub 2/M complex could be dissociated by acid or urea treatment. These results suggest that ..cap alpha../sub 2/M is a binding protein for TGF..beta.. and that TGF..beta..-..cap alpha../sub 2/M complex may be the latent form of TGF..beta.. in serum.

  19. Charged pion form factor between $Q^2$=0.60 and 2.45 GeV$^2$. II. Determination of, and results for, the pion form factor

    SciTech Connect

    Huber, Garth; Blok, Henk; Horn, Tanja; Beise, Elizabeth; Gaskell, David; Mack, David; Tadevosyan, Vardan; Volmer, Jochen; Abbott, David; Aniol, Konrad; Anklin, Heinz; Armstrong, Christopher; Arrington, John; Assamagan, Ketevi; Avery, Steven; Baker, O.; Barrett, Robert; Bochna, Christopher; Boeglin, Werner; Brash, Edward; Breuer, Herbert; Chang, C.; Chang, C.C.; Chant, Nicholas; Christy, Michael; Dunne, James; Eden, Thomas; Ent, Rolf; Fenker, Benjamin; Gibson, Edward; Gilman, Ronald; Gustafsson, Kenneth; Hinton, Wendy; Holt, Roy; Jackson, Harold; uk Jin, Seong; Jones, Mark; Keppel, Cynthia; Kim, pyunghun; Kim, Wooyoung; King, Paul; Klein, Andreas; Koltenuk, Douglas; Kovaltchouk, Vitali; Liang, Meihua; Liu, Jinghua; Lolos, George; Lung, Allison; Margaziotis, Demetrius; Markowitz, Pete; Matsumura, Akihiko; McKee, David; Meekins, David; Mitchell, Joseph; Miyoshi, Toshinobu; Mkrtchyan, Hamlet; Mueller, Robert; Niculescu, Gabriel; Niculescu, Maria-Ioana; Okayasu, Yuichi; Pentchev, Lubomir; Perdrisat, Charles; Pitz, David; Potterveld, David; Punjabi, Vina; Qin, Liming; Reimer, Paul; Reinhold, Joerg; Roche, Julie; Roos, Philip; Sarty, Adam; Shin, Ilkyoung; Smith, Gregory; Stepanyan, Stepan; Tang, Liguang; Tvaskis, Vladas; van der Meer, Rob; Vansyoc, Kelley; Van Westrum, Derek; Vidakovic, Sandra; Vulcan, William; Warren, Glen; Wood, Stephen; Xu, Chen; Yan, Chen; Zhao, Wenxia; Zheng, Xiaochao; Zihlmann, Benedikt

    2008-10-01

    DOI: http://dx.doi.org/10.1103/PhysRevC.78.045203
    The charged pion form factor, Fpi(Q2), is an important quantity that can be used to advance our knowledge of hadronic structure. However, the extraction of Fpi from data requires a model of the 1H(e,e'pi+)n reaction and thus is inherently model dependent. Therefore, a detailed description of the extraction of the charged pion form factor from electroproduction data obtained recently at Jefferson Lab is presented, with particular focus given to the dominant uncertainties in this procedure. Results for Fpi are presented for Q2=0.60-2.45 GeV2. Above Q2=1.5 GeV2, the Fpi values are systematically below the monopole parametrization that describes the low Q2 data used to determine the pion charge radius. The pion form factor can be calculated in a wide variety of theoretical approaches, and the experimental results are compared to a number of calculations. This comparison is helpful in understanding the role of soft versus hard c

  20. Differences between poliovirus empty capsids formed in vivo and those formed in vitro: a role for the morphopoietic factor.

    PubMed Central

    Putnak, J R; Phillips, B A

    1981-01-01

    Empty capsid species formed from the self- and extract-mediated assembly of poliovirus type 1 14S particles in vitro and procapsids isolated from virus-infected cells were subjected to isoelectric focusing in charge-free agarose gels. The empty capsid formed in the self-assembly reaction had an isoelectric point (pI) of 5.0, whereas procapsids and extract-assembled empty capsids focused at pH 6.8. Unreacted 14S particles focused at pH 4.8 to 5.0. The sedimentation coefficient (s20,w) and density of the empty capsid species were also determined. Procapsids had a density in CsCl of 1.31 g/cm3, whereas empty capsids formed by self- or extract-mediated assembly had a density of 1.29 g/cm3. Both extract-assembled empty capsids and procapsids had an s20,w of 75S, whereas self-assembled empty capsids had an s20,w of 71S. Self-assembled empty capsids were not converted to pI 6.8 empty capsids by incubation with poliovirus-infected HeLa cell extracts. The dissociated polypeptides of self-assembled empty capsids (pI 5.0) and procapsids (pI 6.8) behaved identically when analyzed by isoelectric focusing in the presence of 9 M urea and by polyacrylamide gel electrophoresis in the presence of sodium dodecyl sulfate. These results suggest that infected cell extracts possess a factor that influences the final conformation of the empty shell (pI 6.8, 75S) formed from 14S particles and that this influences is exerted at the initiation step or during the polymerization reaction. A small amount of this activity (less than or equal to 20% of infected extracts) was detected in uninfected cells; the significance of this remains unknown. Images PMID:6270373

  1. Multilevel Confirmatory Factor Analysis of the Teacher My Class Inventory-Short Form

    ERIC Educational Resources Information Center

    Villares, Elizabeth; Mariani, Melissa; Sink, Christopher A.; Colvin, Kimberly

    2016-01-01

    Researchers analyzed data from elementary teachers (N = 233) to further establish the psychometric soundness of the Teacher My Class Inventory-Short Form. Supporting previous psychometric research, confirmatory factor analyses findings supported the factorial validity of the hypothesized five-factor solution. Internal reliability estimates were…

  2. Factor Structure and Psychometric Properties of the Young Schema Questionnaire (Short Form) in Chinese Undergraduate Students

    ERIC Educational Resources Information Center

    Cui, Lixia; Lin, Wenwen; Oei, Tian P. S.

    2011-01-01

    This study investigated cross-cultural differences in the factor structure and psychometric properties of the Young Schema Questionnaire (short form; YSQ-SF). The participants were 712 Chinese undergraduate students. The total sample was randomly divided into two sub-samples. Exploratory Factor Analysis (EFA) was conducted on questionnaire results…

  3. Factor Structure and Validity of the Parenting Stress Index-Short Form

    ERIC Educational Resources Information Center

    Haskett, Mary E.; Ahern, Lisa S.; Ward, Caryn S.; Allaire, Jason C.

    2006-01-01

    The psychometric properties of the Parenting Stress Index-Short Form (PSI-SF) were examined in a sample of 185 mothers and fathers. Factor analysis revealed 2 reasonably distinct factors involving parental distress and dysfunctional parent-child interactions. Both scales were internally consistent, and these scales were correlated with measures of…

  4. Multilevel Confirmatory Factor Analysis of the Teacher My Class Inventory-Short Form

    ERIC Educational Resources Information Center

    Villares, Elizabeth; Mariani, Melissa; Sink, Christopher A.; Colvin, Kimberly

    2016-01-01

    Researchers analyzed data from elementary teachers (N = 233) to further establish the psychometric soundness of the Teacher My Class Inventory-Short Form. Supporting previous psychometric research, confirmatory factor analyses findings supported the factorial validity of the hypothesized five-factor solution. Internal reliability estimates were…

  5. Forms, Factors and Consequences of Cheating in University Examinations: Insight from Open and Distance Learning Students

    ERIC Educational Resources Information Center

    Mokula, Lebeloane Lazarus Donald; Lovemore, Nyaumwe

    2014-01-01

    The present study narrated the forms, factors and consequences of cheating in university examinations by UNISA Open and Distance learning students from anecdotal data. The results showed that the perpetrators mostly used crib materials on paper, ruler and calculator cover. The factors that influenced examination cheating were gender, age range and…

  6. Weak charge form factor and radius of 208Pb through parity violation in electron scattering

    SciTech Connect

    Horowitz, C. J.; Ahmed, Z.; Jen, C. -M.; Rakhman, A.; Souder, P. A.; Dalton, M. M.; Liyanage, N.; Paschke, K. D.; Saenboonruang, K.; Silwal, R.; Franklin, G. B.; Friend, M.; Quinn, B.; Kumar, K. S.; McNulty, D.; Mercado, L.; Riordan, S.; Wexler, J.; Michaels, R. W.; Urciuoli, G. M.

    2012-03-26

    We use distorted wave electron scattering calculations to extract the weak charge form factor FW($\\bar{q}$), the weak charge radius RW, and the point neutron radius Rn, of 208Pb from the PREX parity violating asymmetry measurement. The form factor is the Fourier transform of the weak charge density at the average momentum transfer $\\bar{q}$ = 0.475 fm-1. We find FW($\\bar{q}$) = 0.204 ± 0.028(exp) ± 0.001(model). We use the Helm model to infer the weak radius from FW($\\bar{q}$). We find RW = 5.826 ± 0.181(exp) ± 0.027(model) fm. Here the exp error includes PREX statistical and systematic errors, while the model error describes the uncertainty in RW from uncertainties in the surface thickness σ of the weak charge density. The weak radius is larger than the charge radius, implying a 'weak charge skin' where the surface region is relatively enriched in weak charges compared to (electromagnetic) charges. We extract the point neutron radius Rn = 5.751 ± 0.175 (exp) ± 0.026(model) ± 0.005(strange) fm, from RW. Here there is only a very small error (strange) from possible strange quark contributions. We find Rn to be slightly smaller than RW because of the nucleon's size. As a result, we find a neutron skin thickness of Rn-Rp = 0.302 ± 0.175 (exp) ± 0.026 (model) ± 0.005 (strange) fm, where Rp is the point proton radius.

  7. Density form factors of the 1D Bose gas for finite entropy states

    NASA Astrophysics Data System (ADS)

    De Nardis, J.; Panfil, M.

    2015-02-01

    We consider the Lieb-Liniger model for a gas of bosonic δ-interacting particles. Using Algebraic Bethe Ansatz results we compute the thermodynamic limit of the form factors of the density operator between finite entropy eigenstates such as finite temperature states or generic non-equilibrium highly excited states. These form factors are crucial building blocks to obtain the thermodynamic exact dynamic correlation functions of such physically relevant states. As a proof of principle we compute an approximated dynamic structure factor by including only the simplest types of particle-hole excitations and show the agreement with known results.

  8. B to tensor meson form factors in the perturbative QCD approach

    SciTech Connect

    Wang Wei

    2011-01-01

    We calculate the B{sub u,d,s}{yields}T form factors within the framework of the perturbative QCD approach, where T denotes a light tensor meson with J{sup P}=2{sup +}. Because of the similarities between the wave functions of a vector and a tensor meson, the factorization formulas of B{yields}T form factors can be obtained from the B{yields}V transition through a replacement rule. As a consequence, we find that these two sets of form factors have the same signs and correlated q{sup 2}-dependence behaviors. At q{sup 2}=0 point, the B{yields}T form factors are smaller than the B{yields}V ones, in accordance with the experimental data of radiative B decays. In addition, we use our results for the form factors to explore semilteptonic B{yields}Tl{nu}{sub l} decays and the branching fractions can reach the order 10{sup -4}.

  9. A study of the γ ^*-f0(980) transition form factors

    NASA Astrophysics Data System (ADS)

    Kroll, P.

    2017-02-01

    The γ ^*-f0(980) transition form factors are calculated within the QCD factorization framework. The f_0-meson is assumed to be mainly generated through its sbar{s} Fock component. The corresponding spin wave function of the f0(980) meson is constructed and, combined with a model light-cone wave function for this Fock component, used in the calculation of the form factors. In the real-photon limit the results for the transverse form factor are compared to the large momentum-transfer data measured by the BELLE collaboration recently. It turns out that, for the momentum-transfer range explored by BELLE, the collinear approximation does not suffice, power corrections to it, modeled as quark transverse moment effects, seem to be needed. Mixing of the f_0 with the σ (500) is also briefly discussed.

  10. Factor structure of the BASC-2 Behavioral and Emotional Screening System Student Form.

    PubMed

    Dowdy, Erin; Twyford, Jennifer M; Chin, Jenna K; DiStefano, Christine A; Kamphaus, Randy W; Mays, Kristen L

    2011-06-01

    The BASC-2 Behavioral and Emotional Screening System (BESS) Student Form (Kamphaus & Reynolds, 2007) is a recently developed youth self-report rating scale designed to identify students at risk for behavioral and emotional problems. The BESS Student Form was derived from the Behavior Assessment System for Children-Second Edition Self-Report of Personality (BASC-2 SRP; Reynolds & Kamphaus, 2004) using principal component analytic procedures and theoretical considerations. Using 3 samples, the authors conducted exploratory factor analyses (EFA) and confirmatory factor analyses (CFA) to understand the underlying factor structure of the BESS Student Form. The results of the EFA suggested that the SRP contained a 4-factor (i.e., Personal Adjustment, Inattention/Hyperactivity, Internalizing, School Problems) emergent structure, which was supported by CFA in 2 additional samples. Practical and research implications are discussed.

  11. Regularization of multi-soliton form factors in sine-Gordon model

    NASA Astrophysics Data System (ADS)

    Pálmai, T.

    2012-08-01

    A general and systematic regularization is developed for the exact solitonic form factors of exponential operators in the (1+1)-dimensional sine-Gordon model by analytical continuation of their integral representations. The procedure is implemented in Mathematica. Test results are shown for four- and six-soliton form factors. Catalogue identifier: AEMG_v1_0 Program summary URL:http://cpc.cs.qub.ac.uk/summaries/AEMG_v1_0.html Program obtainable from: CPC Program Library, Queen's University, Belfast, N. Ireland Licensing provisions: Standard CPC licence, http://cpc.cs.qub.ac.uk/licence/licence.html No. of lines in distributed program, including test data, etc.: 1462 No. of bytes in distributed program, including test data, etc.: 15 488 Distribution format: tar.gz Programming language: Mathematica [1] Computer: PC Operating system: Cross-platform Classification: 7.7, 11.1, 23 Nature of problem: The multi-soliton form factors of the sine-Gordon model (relevant in two-dimensional physics) were given only by highly non-trivial integral representation with a limited domain of convergence. Practical applications of the form factors, e.g. calculation of correlation functions in two-dimensional condensed matter systems, were not possible in general. Solution method: Using analytic continuation techniques an efficient algorithm is found and implemented in Mathematica, which provides a general and systematic way to calculate multi-soliton form factors in the sine-Gordon model. The package contains routines to compute the two-, four- and six-soliton form factors. Running time: Strongly dependent on the desired accuracy and the number of solitons. For physical rapidities after an initialization of about 30 s, the calculation of the two-, four- and six-soliton form factors at a single point takes approximately 0.5 s, 2.5 s and 8 s, respectively. Wolfram Research, Inc., Mathematica Edition: Version 7.0, Wolfram Research, Inc., Champaign, Illinois, 2008.

  12. Deciphering the Positional Influence of the Hydroxyl Group in the Cinnamoyl Part of 3-Hydroxy Flavonoids for Structural Modification and Their Interaction with the Protonated and B Form of Calf Thymus DNA Using Spectroscopic and Molecular Modeling Studies.

    PubMed

    Pradhan, Ankur Bikash; Haque, Lucy; Bhuiya, Sutanwi; Ganguly, Aniruddha; Das, Suman

    2015-06-11

    Studies on the interaction of naturally occurring flavonoids with different polymorphic forms of nucleic acid are helpful for understanding the molecular aspects of binding mode and providing direction for the use and design of new efficient therapeutic agents. However, much less information is available on the interactions of these compounds with different polymorphic forms of DNA at the molecular level. In this report we investigated the interaction of two widely abundant dietary flavonoids quercetin (Q) and morin (M) with calf thymus (CT) DNA. Spectrophotometric, spectropolarimetric, viscosity measurement, and molecular docking simulation methods are used as tools to delineate the binding mode and probable location of the flavonoids and their effects on the stability and conformation of DNA. It is observed that in the presence of the protonated form of DNA the dual fluorescence of Q and M resulting from the excited-state intramolecular proton transfer (ESIPT) is modified significantly. Structural analysis showed Q and M binds weakly to the B form (groove binding) compared to the protonated form of CT DNA (electrostatic interaction). In both cases, Q binds strongly to both forms of DNA compared to M.

  13. Proton Therapy

    MedlinePlus

    ... Proton Therapy Alternative & Integrative Medicine Clinical Trials GBM AGILE TTFields – Optune™ Brain Tumor Treatment Locations Treatment Side ... Proton Therapy Alternative & Integrative Medicine Clinical Trials GBM AGILE TTFields – Optune™ Brain Tumor Treatment Locations Treatment Side ...

  14. Analysis of approximations used in calculations of radiative corrections to electron-proton scattering cross section

    NASA Astrophysics Data System (ADS)

    Gerasimov, R. E.; Fadin, V. S.

    2015-01-01

    An analysis of approximations used in calculations of radiative corrections to electron-proton scattering cross section is presented. We investigate the difference between the relatively recent Maximon and Tjon result and the Mo and Tsai result, which was used in the analysis of experimental data. We also discuss the proton form factors ratio dependence on the way we take into account radiative corrections.

  15. Analysis of approximations used in calculations of radiative corrections to electron-proton scattering cross section

    SciTech Connect

    Gerasimov, R. E. Fadin, V. S.

    2015-01-15

    An analysis of approximations used in calculations of radiative corrections to electron-proton scattering cross section is presented. We investigate the difference between the relatively recent Maximon and Tjon result and the Mo and Tsai result, which was used in the analysis of experimental data. We also discuss the proton form factors ratio dependence on the way we take into account radiative corrections.

  16. Enantioselective Protonation

    PubMed Central

    Mohr, Justin T.; Hong, Allen Y.; Stoltz, Brian M.

    2010-01-01

    Enantioselective protonation is a common process in biosynthetic sequences. The decarboxylase and esterase enzymes that effect this valuable transformation are able to control both the steric environment around the proton acceptor (typically an enolate) and the proton donor (typically a thiol). Recently, several chemical methods to achieve enantioselective protonation have been developed by exploiting various means of enantiocontrol in different mechanisms. These laboratory transformations have proven useful for the preparation of a number of valuable organic compounds. PMID:20428461

  17. Helicobacter pylori virulence factors affecting gastric proton pump expression and acid secretion.

    PubMed

    Hammond, Charles E; Beeson, Craig; Suarez, Giovanni; Peek, Richard M; Backert, Steffen; Smolka, Adam J

    2015-08-01

    Acute Helicobacter pylori infection of gastric epithelial cells and human gastric biopsies represses H,K-ATPase α subunit (HKα) gene expression and inhibits acid secretion, causing transient hypochlorhydria and supporting gastric H. pylori colonization. Infection by H. pylori strains deficient in the cag pathogenicity island (cag PAI) genes cagL, cagE, or cagM, which do not transfer CagA into host cells or induce interleukin-8 secretion, does not inhibit HKα expression, nor does a cagA-deficient strain that induces IL-8. To test the hypothesis that virulence factors other than those mediating CagA translocation or IL-8 induction participate in HKα repression by activating NF-κB, AGS cells transfected with HKα promoter-Luc reporter constructs containing an intact or mutated NF-κB binding site were infected with wild-type H. pylori strain 7.13, isogenic mutants lacking cag PAI genes responsible for CagA translocation and/or IL-8 induction (cagA, cagζ, cagε, cagZ, and cagβ), or deficient in genes encoding two peptidoglycan hydrolases (slt and cagγ). H. pylori-induced AGS cell HKα promoter activities, translocated CagA, and IL-8 secretion were measured by luminometry, immunoblotting, and ELISA, respectively. Human gastric biopsy acid secretion was measured by microphysiometry. Taken together, the data showed that HKα repression is independent of IL-8 expression, and that CagA translocation together with H. pylori transglycosylases encoded by slt and cagγ participate in NF-κB-dependent HKα repression and acid inhibition. The findings are significant because H. pylori factors other than CagA and IL-8 secretion are now implicated in transient hypochlorhydria which facilitates gastric colonization and potential triggering of epithelial progression to neoplasia.

  18. Flavor dependence of the pion and kaon form factors and parton distribution functions

    DOE PAGES

    Hutauruk, Parada T. P.; Cloët, Ian C.; Thomas, Anthony W.

    2016-09-01

    The separate quark flavor contributions to the pion and kaon valence quark distribution functions are studied, along with the corresponding electromagnetic form factors in the space-like region. The calculations are made using the solution of the Bethe-Salpeter equation for the model of Nambu and Jona-Lasinio with proper-time regularization. Both the pion and kaon form factors and the valence quark distribution functions reproduce many features of the available empirical data. The larger mass of the strange quark naturally explains the empirical fact that the ratio u(K) + (x)/u(pi) + (x) drops below unity at large x, with a value of approximately Mmore » $$2\\atop{u}$$/Ms$$2\\atop{s}$$ as x → 1. With regard to the elastic form factors we report a large flavor dependence, with the u-quark contribution to the kaon form factor being an order of magnitude smaller than that of the s-quark at large Q2, which may be a sensitive measure of confinement effects in QCD. Surprisingly though, the total K+ and π+ form factors differ by only 10%. Lastly, in general we find that flavor breaking effects are typically around 20%.« less

  19. Flavor dependence of the pion and kaon form factors and parton distribution functions

    SciTech Connect

    Hutauruk, Parada T. P.; Cloët, Ian C.; Thomas, Anthony W.

    2016-09-01

    The separate quark flavor contributions to the pion and kaon valence quark distribution functions are studied, along with the corresponding electromagnetic form factors in the space-like region. The calculations are made using the solution of the Bethe-Salpeter equation for the model of Nambu and Jona-Lasinio with proper-time regularization. Both the pion and kaon form factors and the valence quark distribution functions reproduce many features of the available empirical data. The larger mass of the strange quark naturally explains the empirical fact that the ratio u(K) + (x)/u(pi) + (x) drops below unity at large x, with a value of approximately M$2\\atop{u}$/Ms$2\\atop{s}$ as x → 1. With regard to the elastic form factors we report a large flavor dependence, with the u-quark contribution to the kaon form factor being an order of magnitude smaller than that of the s-quark at large Q2, which may be a sensitive measure of confinement effects in QCD. Surprisingly though, the total K+ and π+ form factors differ by only 10%. Lastly, in general we find that flavor breaking effects are typically around 20%.

  20. The puzzle of the π → γ γ* transition form factor

    NASA Astrophysics Data System (ADS)

    Lucha, Wolfgang; Melikhov, Dmitri

    2012-04-01

    We study the P → γ γ* (P = π0, η, η‧) transition form factors by means of the local-duality (LD) version of QCD sum rules. For the case of η and η‧, the conventional LD model provides a good description of the existing data. However, for the pion form factor we find a disagreement with recent BaBar results for high Q2, even though the accuracy of the LD approximation is expected to increase with Q2. It remains mysterious why both η and η‧ form factors to virtual photons, on the one hand, and the π0 form factor, on the other hand, show a qualitatively different behaviour, corresponding to a violation of LD that rises with Q2 in the pion case. In a quantum-mechanical example, we show that, for a bound-state size of about 1 fm, the LD sum rule provides an accurate prediction for the form factor for Q2 larger than a few GeV2.

  1. Mechanism of activation of elongation factor Tu by ribosome: catalytic histidine activates GTP by protonation.

    PubMed

    Aleksandrov, Alexey; Field, Martin

    2013-09-01

    Elongation factor Tu (EF-Tu) is central to prokaryotic protein synthesis as it has the role of delivering amino-acylated tRNAs to the ribosome. Release of EF-Tu, after correct binding of the EF-Tu:aa-tRNA complex to the ribosome, is initiated by GTP hydrolysis. This reaction, whose mechanism is uncertain, is catalyzed by EF-Tu, but requires activation by the ribosome. There have been a number of mechanistic proposals, including those spurred by a recent X-ray crystallographic analysis of a ribosome:EF-Tu:aa-tRNA:GTP-analog complex. In this work, we have investigated these and alternative hypotheses, using high-level quantum chemical/molecular mechanical simulations for the wild-type protein and its His85Gln mutant. For both proteins, we find previously unsuggested mechanisms as being preferred, in which residue 85, either His or Gln, directly assists in the reaction. Analysis shows that the RNA has a minor catalytic effect in the wild-type reaction, but plays a significant role in the mutant by greatly stabilizing the reaction's transition state. Given the similarity between EF-Tu and other members of the translational G-protein family, it is likely that these mechanisms of ribosome-activated GTP hydrolysis are pertinent to all of these proteins.

  2. Risk factors associated with gastroesophageal reflux disease relapse in primary care patients successfully treated with a proton pump inhibitor.

    PubMed

    López-Colombo, A; Pacio-Quiterio, M S; Jesús-Mejenes, L Y; Rodríguez-Aguilar, J E G; López-Guevara, M; Montiel-Jarquín, A J; López-Alvarenga, J C; Morales-Hernández, E R; Ortiz-Juárez, V R; Ávila-Jiménez, L

    There are no studies on the factors associated with gastroesophageal reflux disease (GERD) relapse in primary care patients. To identify the risk factors associated with GERD relapse in primary care patients that responded adequately to short-term treatment with a proton pump inhibitor. A cohort study was conducted that included GERD incident cases. The patients received treatment with omeprazole for 4 weeks. The ReQuest questionnaire and a risk factor questionnaire were applied. The therapeutic success rate and relapse rate were determined at 4 and 12 weeks after treatment suspension. A logistic regression analysis of the possible risk factors for GERD relapse was carried out. Of the 83 patient total, 74 (89.16%) responded to treatment. Symptoms recurred in 36 patients (48.64%) at 4 weeks and in 13 patients (17.57%) at 12 weeks, with an overall relapse rate of 66.21%. The OR multivariate analysis (95% CI) showed the increases in the possibility of GERD relapse for the following factors at 12 weeks after treatment suspension: basic educational level or lower, 24.95 (1.92-323.79); overweight, 1.76 (0.22-13.64); obesity, 0.25 (0.01-3.46); smoking, 0.51 (0.06-3.88); and the consumption of 4-12 cups of coffee per month, 1.00 (0.12-7.84); citrus fruits, 14.76 (1.90-114.57); NSAIDs, 27.77 (1.12-686.11); chocolate, 0.86 (0.18-4.06); ASA 1.63 (0.12-21.63); carbonated beverages, 4.24 (0.32-55.05); spicy food 7-16 times/month, 1.39 (0.17-11.17); and spicy food ≥ 20 times/month, 4.06 (0.47-34.59). The relapse rate after short-term treatment with omeprazole was high. The consumption of citrus fruits and NSAIDs increased the possibility of GERD relapse. Copyright © 2016 Asociación Mexicana de Gastroenterología. Publicado por Masson Doyma México S.A. All rights reserved.

  3. Identification and characterisation of a G-quadruplex forming sequence in the promoter region of nuclear factor (erythroid-derived 2)-like 2 (Nrf2)

    SciTech Connect

    Waller, Zoë A.E. Howell, Lesley A.; MacDonald, Colin J.; O’Connell, Maria A.; Searcey, Mark

    2014-04-25

    Highlights: • Discovery of a G-quadruplex forming sequence in the promoter sequence of Nrf2. • Characterisation of the G-quadruplex by UV, CD and NMR. • Conformational switching of G-quadruplex induced by 9-aminoacridine. - Abstract: The transcription factor nuclear factor (erythroid-derived 2)-like 2 (Nrf2) regulates multiple antioxidants, Phase II detoxification enzymes and other cytoprotective enzymes in cells. Activation of Nrf2 is recognised as being of potential therapeutic benefit in inflammatory-diseases whereas more recently, it has become clear that the inhibition of Nrf2 may have benefit in the alleviation of resistance in some tumour types. A potential G-quadruplex forming sequence was identified in the promoter region of Nrf2, close to a number of putative transcription factor binding sites. Characterisation of the sequence 5’-d[GGGAAGGGAGCAAGGGCGGGAGGG]-3’ using CD spectroscopy, imino proton NMR resonances and UV melting experiments demonstrated the formation of a parallel intramolecular G-quadruplex in the presence of K{sup +} ions. Incubation with 9-aminoacridine ligands induced a switch from antiparallel to parallel forms. The presence of a G-quadruplex forming sequence in the promoter region of Nrf2 suggests an approach to targeting the production of the protein through stabilisation of the structure, thereby avoiding resistance to antitumour drugs.

  4. Form Factors and Wave Functions of Vector Mesons in Holographic QCD

    SciTech Connect

    Hovhannes R. Grigoryan; Anatoly V. Radyushkin

    2007-07-01

    Within the framework of a holographic dual model of QCD, we develop a formalism for calculating form factors of vector mesons. We show that the holographic bound states can be described not only in terms of eigenfunctions of the equation of motion, but also in terms of conjugate wave functions that are close analogues of quantum-mechanical bound state wave functions. We derive a generalized VMD representation for form factors, and find a very specific VMD pattern, in which form factors are essentially given by contributions due to the first two bound states in the Q^2-channel. We calculate electric radius of the \\rho-meson, finding the value < r_\\rho^2>_C = 0.53 fm^2.

  5. $D$ semileptonic form factors and $|V_{cs(d)}|$ from 2+1 flavor lattice QCD

    SciTech Connect

    Bailey, Jon A.; Bazavov, A.; El-Khadra, A.X.; Gottlieb, Steven; Jain, R.D.; Kronfeld, A.S.; Van de Water, R.S.; Zhou, R.

    2011-11-01

    The measured partial widths of the semileptonic decays D {yields} K{ell}{nu} and D {yields} {pi}{ell}{nu} can be combined with the form factors calculated on the lattice to extract the CKM matrix elements |V{sub cs}| and |V{sub cd}|. The lattice calculations can be checked by comparing the form factor shapes from the lattice and experiment. We have generated a sizable data set by using heavy clover quarks with the Fermilab interpretation for charm and asqtad staggered light quarks on 2+1 flavor MILC ensembles with lattice spacings of approximately 0.12, 0.09, 0.06, and 0.045 fm. Preliminary fits to staggered chiral perturbation theory suggest that we can reduce the uncertainties in the form factors at q{sup 2} = 0 to below 5%.

  6. Electromagnetic form factors of the {Omega}{sup -} in lattice QCD

    SciTech Connect

    Alexandrou, C.; Korzec, T.; Koutsou, G.; Negele, J. W.; Proestos, Y.

    2010-08-01

    We present results on the omega baryon ({Omega}{sup -}) electromagnetic form factors using N{sub f}=2+1 domain-wall fermion configurations for three pion masses in the range of about 350 to 300 MeV. We compare results obtained using domain-wall fermions with those of a mixed-action (hybrid) approach, which combines domain-wall valence quarks on staggered sea quarks, for a pion mass of about 350 MeV. We pay particular attention in the evaluation of the subdominant electric quadrupole form factor to sufficient accuracy to exclude a zero value, by constructing a sequential source that isolates it from the dominant form factors. The {Omega}{sup -} magnetic moment, {mu}{sub {Omega}}{sup -}, and the electric charge and magnetic radius, , are extracted for these pion masses. The electric quadrupole moment is determined for the first time using dynamical quarks.

  7. Structure of the GTP Form of Elongation Factor 4 (EF4) Bound to the Ribosome*

    PubMed Central

    Kumar, Veerendra; Ero, Rya; Ahmed, Tofayel; Goh, Kwok Jian; Zhan, Yin; Bhushan, Shashi; Gao, Yong-Gui

    2016-01-01

    Elongation factor 4 (EF4) is a member of the family of ribosome-dependent translational GTPase factors, along with elongation factor G and BPI-inducible protein A. Although EF4 is highly conserved in bacterial, mitochondrial, and chloroplast genomes, its exact biological function remains controversial. Here we present the cryo-EM reconstitution of the GTP form of EF4 bound to the ribosome with P and E site tRNAs at 3.8-Å resolution. Interestingly, our structure reveals an unrotated ribosome rather than a clockwise-rotated ribosome, as observed in the presence of EF4-GDP and P site tRNA. In addition, we also observed a counterclockwise-rotated form of the above complex at 5.7-Å resolution. Taken together, our results shed light on the interactions formed between EF4, the ribosome, and the P site tRNA and illuminate the GTPase activation mechanism at previously unresolved detail. PMID:27137929

  8. Semiclassical form factor for spectral and matrix element fluctuations of multidimensional chaotic systems.

    PubMed

    Turek, Marko; Spehner, Dominique; Müller, Sebastian; Richter, Klaus

    2005-01-01

    We present a semiclassical calculation of the generalized form factor Kab(tau) which characterizes the fluctuations of matrix elements of the operators a and b in the eigenbasis of the Hamiltonian of a chaotic system. Our approach is based on some recently developed techniques for the spectral form factor of systems with hyperbolic and ergodic underlying classical dynamics and f = 2 degrees of freedom, that allow us to go beyond the diagonal approximation. First we extend these techniques to systems with f > 2. Then we use these results to calculate Kab(tau). We show that the dependence on the rescaled time tau (time in units of the Heisenberg time) is universal for both the spectral and the generalized form factor. Furthermore, we derive a relation between Kab(tau) and the classical time-correlation function of the Weyl symbols of a and b.

  9. Research on design method of the full form ship with minimum thrust deduction factor

    NASA Astrophysics Data System (ADS)

    Zhang, Bao-ji; Miao, Ai-qin; Zhang, Zhu-xin

    2015-04-01

    In the preliminary design stage of the full form ships, in order to obtain a hull form with low resistance and maximum propulsion efficiency, an optimization design program for a full form ship with the minimum thrust deduction factor has been developed, which combined the potential flow theory and boundary layer theory with the optimization technique. In the optimization process, the Sequential Unconstrained Minimization Technique (SUMT) interior point method of Nonlinear Programming (NLP) was proposed with the minimum thrust deduction factor as the objective function. An appropriate displacement is a basic constraint condition, and the boundary layer separation is an additional one. The parameters of the hull form modification function are used as design variables. At last, the numerical optimization example for lines of after-body of 50000 DWT product oil tanker was provided, which indicated that the propulsion efficiency was improved distinctly by this optimal design method.

  10. Master Integrals for Fermionic Contributions to Massless Three-Loop Form Factors

    SciTech Connect

    Heinrich, G.; Huber, T.; Maitre, D.

    2007-11-28

    In this letter we continue the calculation of master integrals for massless three-loop form factors by giving analytical results for those diagrams which are relevant for the fermionic contributions proportional to N{sub F}{sup 2}, N{sub F} {center_dot} N, and N{sub F}/N. Working in dimensional regularization, we express one of the diagrams in a closed form which is exact to all orders in {epsilon}, containing {Lambda}-functions and hypergeometric functions of unit argument. In all other cases we derive multiple Mellin-Barnes representations from which the coefficients of the Laurent expansion in {epsilon} are extracted in an analytical form. To obtain the finite part of the three-loop quark and gluon form factors, all coefficients through transcendentality six in the Riemann {zeta}-function have to be included.

  11. Analysis of the Neutron Electric Form Factor at Q2 = 1.4 GeV2 using the reaction 3 H->e (e-> ,e' n) pp

    NASA Astrophysics Data System (ADS)

    Obrecht, Richard; Super Bigbite Collaboration

    2016-09-01

    The Jefferson Lab Hall A experiment E02-013 extracted the neutron electric form factor GEn by measuring the beam-target asymmetry in quasi-elastically scattering of longitudinally polarized electrons from a polarized 3He target via the semi-exclusive reaction3 H->e (e-> ,e' n) pp . The experiment measured the electric form factor at a spacelike four-momentum transfer squared Q2 = 1.4, 1.7, 2.7, and 3.4 GeV2, but only the latter three points were published by S. Riordan et al. (Phys. Rev. Lett. 105, 262302). The goal of this talk is to present the analysis chain necessary to extract the form factor from a neutron asymmetry that arises by periodically changing the sign of the beam helicity. The analysis includes selecting quasi-elastic events in a high noise environment, and correcting for various factors that dilute the signal such as false proton asymmetries and final state interactions within the target. Jefferson Lab Hall A.

  12. Constraints on the ωπ Form Factor from Analyticity and Unitarity

    NASA Astrophysics Data System (ADS)

    Ananthanarayan, B.; Caprini, Irinel; Kubis, Bastian

    Form factors are important low-energy quantities and an accurate knowledge of these sheds light on the strong interactions. A variety of methods based on general principles have been developed to use information known in different energy regimes to constrain them in regions where experimental information needs to be tested precisely. Here we review our recent work on the electromagnetic ωπ form factor in a model-independent framework known as the method of unitarity bounds, partly motivated by the discre-pancies noted recently between the theoretical calculations of the form factor based on dispersion relations and certain experimental data measured from the decay ω → π0γ*. We have applied a modified dispersive formalism, which uses as input the discontinuity of the ωπ form factor calculated by unitarity below the ωπ threshold and an integral constraint on the square of its modulus above this threshold. The latter constraint was obtained by exploiting unitarity and the positivity of the spectral function of a QCD correlator, computed on the spacelike axis by operator product expansion and perturbative QCD. An alternative constraint is obtained by using data available at higher energies for evaluating an integral of the modulus squared with a suitable weight function. From these conditions we derived upper and lower bounds on the modulus of the ωπ form factor in the region below the ωπ threshold. The results confirm the existence of a disagreement between dispersion theory and experimental data on the ωπ form factor around 0:6 GeV, including those from NA60 published in 2016.

  13. Urban form and psychosocial factors: do they interact for leisure-time walking?

    PubMed

    Beenackers, Mariëlle A; Kamphuis, Carlijn B M; Prins, Richard G; Mackenbach, Johan P; Burdorf, Alex; van Lenthe, Frank J

    2014-02-01

    This cross-sectional study uses an adaptation of a social-ecological model on the hierarchy of walking needs to explore direct associations and interactions of urban-form characteristics and individual psychosocial factors for leisure-time walking. Questionnaire data (n = 736) from adults (25-74 yr) and systematic field observations within 14 neighborhoods in Eindhoven (the Netherlands) were used. Multilevel logistic regression models were used to relate the urban-form characteristics (accessibility, safety, comfort, and pleasurability) and individual psychosocial factors (attitude, self-efficacy, social influence, and intention) to two definitions of leisure-time walking, that is, any leisure-time walking and sufficient leisure-time walking according to the Dutch physical activity norm and to explore their interactions. Leisure-time walking was associated with psychosocial factors but not with characteristics of the urban environment. For sufficient leisure-time walking, interactions between attitude and several urban-form characteristics were found, indicating that positive urban-form characteristics contributed toward leisure-time walking only in residents with a less positive attitude toward physical activity. In contrast, living in a neighborhood that was accessible for walking was stronger associated with leisure-time walking among residents who experienced a positive social influence to engage in physical activity compared with those who reported less social influence. This study showed some evidence for an interaction between the neighborhood environment and the individual psychosocial factors in explaining leisure-time walking. The specific mechanism of interaction may depend on the specific combination of psychosocial factor and environmental factor. The lack of association between urban form and leisure-time walking could be partly due to the little variation in urban-form characteristics between neighborhoods.

  14. An Evaluation of the Factor Structure of the HRM Survey, Forms 9 and 11

    DTIC Science & Technology

    1976-07-01

    Climate, Satisfaction with the Navy, and Equal Opportunity , emerged in both surveys, although in a slightly dif- ferent order. The first three of these...survey (Form 9) and the second, from 477 naval personnel on the shore survey (Form 11). Five factors emerged on both surveys, namely (1) Supervisory...Leadership, (2) Work Group Processes, (3) Command Climate, (4) Satisfaction with the Navy as an Occupation, and (5) Equal Opportunity . In addition

  15. SU-E-T-72: Commissioning of a Standardized SRS Cone Set: Determination of the Bolus Gap Factors in a Passively Scattered Proton Beam

    SciTech Connect

    Simpson, R; Gordon, I; Ghebremedhin, A; Wroe, A; Schulte, R; Bush, D; Slater, J; Patyal, B

    2014-06-01

    Purpose: To determine the proton output factors for an SRS cone set using standardized apertures and varied range compensators (bolus blanks); specifically, to determine the best method for modeling the bolus gap factor (BGF) and eliminate the need for patient specific calibrations. Methods: A Standard Imaging A-16 chamber was placed in a Plastic Water phantom to measure the change in dose/MU with different treatment combinations for a proton SRS cone, using standardized apertures and range compensators. Measurements were made with all apertures in the SRS cone set, with four different range compensator thicknesses and five different air gaps between the end of the SRS cone and the surface of the phantom. The chamber was located at iso-center and maintained at a constant depth at the center of modulation for all measurements. Each aperture was placed in the cone to measure the change in MU needed to maintain constant dose at the chamber, as the air gap was increased with different thicknesses of bolus. Results: The dose/MU varied significantly with decreasing aperture size, increasing bolus thickness, or increasing air gap. The measured data was fitted with the lowest order polynomials that accurately described the data, to create a model for determining the change in output for any potential combination of devices used to treat a patient. For a given standardized aperture, the BGF could be described by its constituent factors: the bolus thickness factor (BTF) and the nozzle extension factor (NEF). Conclusion: The methods used to model the dose at the calibration point could be used to accurately predict the change in output for SRS proton beams due to the BGF, eliminating the need for patient specific calibrations. This method for modeling SRS treatments could also be applied to model other treatments using passively scattered proton beams.

  16. A method for measuring D* electromagnetic form factors in e+ e‑ annihilation

    NASA Astrophysics Data System (ADS)

    Guo, Han; Zhang, Zi-Ping

    2017-09-01

    We describe a method for measuring the electromagnetic form factors of the D* meson at time-like momentum transfer in e+ e‑ annihilation. This is to study the joint angular distribution of the e+e‑→γ*→D*+D*‑, D*+→D0π+, and D*‑→D̅0 π‑ processes. The magnitudes and relative phases of the charge, magnetic and quadrupole form factors can be determined. The method can also be applied to other vector particles. Supported by National Natural Science Foundation of China (11675166)

  17. JLab measurement of the 4He charge form factor at large momentum transfers.

    PubMed

    Camsonne, A; Katramatou, A T; Olson, M; Sparveris, N; Acha, A; Allada, K; Anderson, B D; Arrington, J; Baldwin, A; Chen, J-P; Choi, S; Chudakov, E; Cisbani, E; Craver, B; Decowski, P; Dutta, C; Folts, E; Frullani, S; Garibaldi, F; Gilman, R; Gomez, J; Hahn, B; Hansen, J-O; Higinbotham, D W; Holmstrom, T; Huang, J; Iodice, M; Jiang, X; Kelleher, A; Khrosinkova, E; Kievsky, A; Kuchina, E; Kumbartzki, G; Lee, B; LeRose, J J; Lindgren, R A; Lott, G; Lu, H; Marcucci, L E; Margaziotis, D J; Markowitz, P; Marrone, S; Meekins, D; Meziani, Z-E; Michaels, R; Moffit, B; Norum, B; Petratos, G G; Puckett, A; Qian, X; Rondon, O; Saha, A; Sawatzky, B; Segal, J; Shabestari, M; Shahinyan, A; Solvignon, P; Subedi, R R; Suleiman, R; Sulkosky, V; Urciuoli, G M; Viviani, M; Wang, Y; Wojtsekhowski, B B; Yan, X; Yao, H; Zhang, W-M; Zheng, X; Zhu, L

    2014-04-04

    The charge form factor of 4He has been extracted in the range 29  fm(-2) ≤ Q2 ≤ 77  fm(-2) from elastic electron scattering, detecting 4He recoil nuclei and electrons in coincidence with the high resolution spectrometers of the Hall A Facility of Jefferson Lab. The measurements have uncovered a second diffraction minimum for the form factor, which was predicted in the Q2 range of this experiment. The data are in qualitative agreement with theoretical calculations based on realistic interactions and accurate methods to solve the few-body problem.

  18. JLab Measurement of the He4 Charge Form Factor at Large Momentum Transfers

    NASA Astrophysics Data System (ADS)

    Camsonne, A.; Katramatou, A. T.; Olson, M.; Sparveris, N.; Acha, A.; Allada, K.; Anderson, B. D.; Arrington, J.; Baldwin, A.; Chen, J.-P.; Choi, S.; Chudakov, E.; Cisbani, E.; Craver, B.; Decowski, P.; Dutta, C.; Folts, E.; Frullani, S.; Garibaldi, F.; Gilman, R.; Gomez, J.; Hahn, B.; Hansen, J.-O.; Higinbotham, D. W.; Holmstrom, T.; Huang, J.; Iodice, M.; Jiang, X.; Kelleher, A.; Khrosinkova, E.; Kievsky, A.; Kuchina, E.; Kumbartzki, G.; Lee, B.; LeRose, J. J.; Lindgren, R. A.; Lott, G.; Lu, H.; Marcucci, L. E.; Margaziotis, D. J.; Markowitz, P.; Marrone, S.; Meekins, D.; Meziani, Z.-E.; Michaels, R.; Moffit, B.; Norum, B.; Petratos, G. G.; Puckett, A.; Qian, X.; Rondon, O.; Saha, A.; Sawatzky, B.; Segal, J.; Shabestari, M.; Shahinyan, A.; Solvignon, P.; Subedi, R. R.; Suleiman, R.; Sulkosky, V.; Urciuoli, G. M.; Viviani, M.; Wang, Y.; Wojtsekhowski, B. B.; Yan, X.; Yao, H.; Zhang, W.-M.; Zheng, X.; Zhu, L.; Jefferson Lab Hall A Collaboration

    2014-04-01

    The charge form factor of He4 has been extracted in the range 29 fm-2≤Q2≤77 fm-2 from elastic electron scattering, detecting He4 recoil nuclei and electrons in coincidence with the high resolution spectrometers of the Hall A Facility of Jefferson Lab. The measurements have uncovered a second diffraction minimum for the form factor, which was predicted in the Q2 range of this experiment. The data are in qualitative agreement with theoretical calculations based on realistic interactions and accurate methods to solve the few-body problem.

  19. Light Cone Sum Rules for gamma*N ->Delta Transition Form Factors

    SciTech Connect

    V.M. Braun; A. Lenz; G. Peters; A. Radyushkin

    2006-02-01

    A theoretical framework is suggested for the calculation of {gamma}* N {yields} {Delta} transition form factors using the light-cone sum rule approach. Leading-order sum rules are derived and compared with the existing experimental data. We find that the transition form factors in a several GeV region are dominated by the ''soft'' contributions that can be thought of as overlap integrals of the valence components of the hadron wave functions. The ''minus'' components of the quark fields contribute significantly to the result, which can be reinterpreted as large contributions of the quark orbital angular momentum.

  20. Heavy-quark form factors in the large β _0 limit

    NASA Astrophysics Data System (ADS)

    Grozin, Andrey G.

    2017-07-01

    Heavy-quark form factors are calculated at β _0 α _s ˜ 1 to all orders in α _s at the first order in 1/β _0. Using the inversion relation generalized to vertex functions, we reduce the massive on-shell Feynman integral to the HQET one. This HQET vertex integral can be expressed via a {}_2F_1 function; the nth term of its ɛ expansion is explicitly known. We confirm existing results for n_l^{L-1} α _s^L terms in the form factors (up to L=3), and we present results for higher L.

  1. Computation of form factors in massless QCD with finite master integrals

    NASA Astrophysics Data System (ADS)

    von Manteuffel, Andreas; Panzer, Erik; Schabinger, Robert M.

    2016-06-01

    We present the bare one-, two-, and three-loop form factors in massless quantum chromodynamics as linear combinations of finite master integrals. Using symbolic integration, we compute their ɛ expansions and thereby reproduce all known results with an independent method. Remarkably, in our finite basis, only integrals with a less-than-maximal number of propagators contribute to the cusp anomalous dimensions. We report on indications of this phenomenon at four loops, including the result for a finite, irreducible, twelve-propagator form factor integral. Together with this article, we provide our automated software setup for the computation of finite master integrals.

  2. Generalized heavy-to-light form factors in light-cone sum rules

    NASA Astrophysics Data System (ADS)

    Meißner, Ulf-G.; Wang, Wei

    2014-03-01

    We study the form factors for a heavy meson into the S-wave Kπ/ππ system with an invariant mass below 1 GeV. The mesonic final state interactions are described in terms of the scalar form factors, which are obtained from unitarized chiral perturbation theory. Employing generalized light-cone distribution amplitudes, we compute the heavy-to-light transition using light-cone sum rules. Our approach simultaneously respects constraints from analyticity and unitarity, and also takes advantage of the power expansion in the 1/mb and the strong coupling constant.

  3. Charge form factors of two-neutron halo nuclei in halo EFT

    NASA Astrophysics Data System (ADS)

    Hagen, P.; Hammer, H.-W.; Platter, L.

    2013-09-01

    We set up a formalism to calculate the charge form factors of two-neutron halo nuclei with S -wave neutron-core interactions in the framework of the halo effective field theory. The method is applied to some known and suspected halo nuclei. In particular, we calculate the form factors and charge radii relative to the core to leading order in the halo EFT and compare to experiments where they are available. Moreover, we investigate the general dependence of the charge radius on the core mass and the one- and two-neutron separation energies.

  4. A form-factor method for determining the structure of distorted stars

    NASA Technical Reports Server (NTRS)

    Wolfe, R. H., Jr.; Kern, J. W.

    1979-01-01

    The equilibrium equations of a uniformly rotating and tidally distorted star are reduced to the same form as for a spherical star except for the inclusion of two form factors. One factor, expressing the buoyancy effects of centrifugal force, is determined directly from the integrated structure variables. The other factor, expressing the deviation from spherical shape, is shown to be relatively insensitive to errors in the assumed shape, so that accurate solutions are obtained in spite of the use of an a priori shape. The method is employed by adding computations for the factors to an existing spherical model program. Upper Main Sequence models determined by this method compare closely with results from the double approximation method even for critical rotation and tidal distortion.

  5. Factor analysis of the Nisonger Child Behavior Rating Form in children with autism spectrum disorders.

    PubMed

    Lecavalier, Luc; Aman, Michael G; Hammer, David; Stoica, Wendy; Mathews, Gregory L

    2004-12-01

    The Nisonger Child Behavior Rating Form (NCBRF) is a behavior rating scale designed for children and adolescents with mental retardation. The purpose of this study was to explore the psychometric properties of the NCBRF in a sample of 330 children and adolescents with autism spectrum disorders (ASDs). Parent and teacher ratings were independently submitted to both exploratory and confirmatory factor analysis. As reported with the original validation study, parent and teacher versions shared similar but somewhat different factor structures. Social competence items showed more similarity with the original solutions than did problem behavior items. Problem behavior items were distributed into a somewhat simpler five-factor solution for both rating forms. Self-injurious and stereotypic items loaded on two distinct subscales for the teacher form, but not on the parent form. Factor loadings and internal consistencies were generally lower than those reported for the original versions but still within the acceptable range. Confirmatory factor analyses indicated good fits for the social competence items and acceptable fits for the problem behavior items. Overall, results supported the construct validity of the NCBRF in children and adolescents with ASDs.

  6. Model-independent constraints on hadronic form factors with above-threshold poles

    NASA Astrophysics Data System (ADS)

    Caprini, Irinel; Grinstein, Benjamín; Lebed, Richard F.

    2017-08-01

    Model-independent constraints on hadronic form factors, in particular those describing exclusive semileptonic decays, can be derived from the knowledge of field correlators calculated in perturbative QCD, using analyticity and unitarity. The location of poles corresponding to below-threshold resonances, i.e., stable states that cannot decay into a pair of hadrons from the crossed channel of the form factor, must be known a priori, and their effect, accounted for through the use of Blaschke factors, is to reduce the strength of the constraints in the semileptonic region. By contrast, above-threshold resonances appear as poles on unphysical Riemann sheets, and their presence does not affect the original model-independent constraints. We discuss the possibility that the above-threshold poles can provide indirect information on the form factors on the first Riemann sheet, either through information from their residues or by constraining the discontinuity function. The bounds on form factors can be improved by imposing, in an exact way, the additional information in the extremal problem. The semileptonic K →π ℓν and D →π ℓν decays are considered as illustrations.

  7. X-ray coherent scattering form factors of tissues, water and plastics using energy dispersion

    NASA Astrophysics Data System (ADS)

    King, B. W.; Landheer, K. A.; Johns, P. C.

    2011-07-01

    A key requirement for the development of the field of medical x-ray scatter imaging is accurate characterization of the differential scattering cross sections of tissues and phantom materials. The coherent x-ray scattering form factors of five tissues (fat, muscle, liver, kidney, and bone) obtained from butcher shops, four plastics (polyethylene, polystyrene, lexan (polycarbonate), nylon), and water have been measured using an energy-dispersive technique. The energy-dispersive technique has several improvements over traditional diffractometer measurements. Most notably, the form factor is measured on an absolute scale with no need for scaling factors. Form factors are reported in terms of the quantity x = λ-1sin (θ/2) over the range 0.363-9.25 nm-1. The coherent form factors of muscle, liver, and kidney resemble those of water, while fat has a narrower peak at lower x, and bone is more structured. The linear attenuation coefficients of the ten materials have also been measured over the range 30-110 keV and parameterized using the dual-material approach with the basis functions being the linear attenuation coefficients of polymethylmethacrylate and aluminum.

  8. Structure and initial validation of a short form of the therapeutic factors inventory.

    PubMed

    Macnair-Semands, Rebecca R; Ogrodniczuk, John S; Joyce, Anthony S

    2010-04-01

    This study examined the factor structure and validity of the Therapeutic Factors Inventory-Short Form (TFI-S), a measure originally developed to assess Yalom's eleven conceptually derived therapeutic factors. Patients in a group-oriented day treatment program (n = 174) completed the TFI-S and other measures to assess concurrent and predictive validity. Four broad therapeutic factors were identified: Instillation of Hope, Secure Emotional Expression, Awareness of Interpersonal Impact, and Social Learning. Alpha coefficients ranged from .71 to .91. Significant correlations between the TFI-S factors and Group Climate Questionnaire subscales provided preliminary evidence for the concurrent validity of the TFI S. Significant relationships were also identified between the TFI-S factors and improvement in symptoms, quality of life, and interpersonal distress at the end of treatment, suggesting that the TFI-S may have predictive validity.

  9. Unraveling the mechanism of proton translocation in the extracellular half-channel of bacteriorhodopsin.

    PubMed

    Ge, Xiaoxia; Gunner, M R

    2016-05-01

    Bacteriorhodopsin, a light activated protein that creates a proton gradient in halobacteria, has long served as a simple model of proton pumps. Within bacteriorhodopsin, several key sites undergo protonation changes during the photocycle, moving protons from the higher pH cytoplasm to the lower pH extracellular side. The mechanism underlying the long-range proton translocation between the central (the retinal Schiff base SB216, D85, and D212) and exit clusters (E194 and E204) remains elusive. To obtain a dynamic view of the key factors controlling proton translocation, a systematic study using molecular dynamics simulation was performed for eight bacteriorhodopsin models varying in retinal isomer and protonation states of the SB216, D85, D212, and E204. The side-chain orientation of R82 is determined primarily by the protonation states of the residues in the EC. The side-chain reorientation of R82 modulates the hydrogen-bond network and consequently possible pathways of proton transfer. Quantum mechanical intrinsic reaction coordinate calculations of proton-transfer in the methyl guanidinium-hydronium-hydroxide model system show that proton transfer via a guanidinium group requires an initial geometry permitting proton donation and acceptance by the same amine. In all the bacteriorhodopsin models, R82 can form proton wires with both the CC and the EC connected by the same amine. Alternatively, rare proton wires for proton transfer from the CC to the EC without involving R82 were found in an O' state where the proton on D85 is transferred to D212.

  10. Nucleon form factors with 2+1 flavor dynamical domain-wall fermions

    SciTech Connect

    Takeshi Yamazaki; Aoki, Yasumichi; Blum, Tom; Lin, Huey-Wen; Ohta, Shigemi; Sasaki, Shoichi; Tweedie, Robert; Zanotti, James

    2009-06-01

    We report our numerical lattice QCD calculations of the isovector nucleon form factors for the vector and axialvector currents: the vector, induced tensor, axialvector, and induced pseudoscalar form factors. The calculation is carried out with the gauge configurations generated with N{sub f} = 2+1 dynamical domain wall fermions and Iwasaki gauge actions at {beta} = 2.13, corresponding to a cutoff a{sup -1} = 1.73 GeV, and a spatial volume of (2.7 fm){sup 3}. The up and down quark masses are varied so the pion mass lies between 0.33 and 0.67 GeV while the strange quark mass is about 12% heavier than the physical one. We calculate the form factors in the range of momentum transfers, 0.2 < q{sup 2} < 0.75 GeV{sup 2}. The vector and induced tensor form factors are well described by the conventional dipole forms and result in significant underestimation of the Dirac and Pauli mean-squared radii and the anomalous magnetic moment compared to the respective experimental values. We show that the axial-vector form factor is significantly affected by the finite spatial volume of the lattice. In particular in the axial charge, g{sub A}/g{sub V}, the finite volume effect scales with a single dimensionless quantity, m{sub {pi}}L, the product of the calculated pion mass and the spatial lattice extent. Our results indicate that for this quantity, m{sub {pi}} L > 6 is required to ensure that finite volume effects are below 1%.

  11. Clean measurements of the nucleon axial-vector and free-neutron magnetic form factors

    SciTech Connect

    Deur, A.

    2013-11-07

    We discuss the feasibility of a weak charged current experiment using a low energy electron beam. A first goal is to measure the Q{sup 2} dependence of the axial-vector form factor g{sub a}(Q{sup 2}). It can be measured model-independently and as robustly as for electromagnetic form factors from typical electron scattering experiments, in contrast to the methods used so far to measure g{sub a}(Q{sup 2}). If g{sub a}(Q{sup 2}) follows a dipole form, the axial mass can be extracted with a better accuracy than the world data altogether. The most important detection equipment would be a segmented neutron detector with good momentum and angular resolution that is symmetric about the beam direction, and covers a moderate angular range. A high intensity beam (100 uA) is necessary. Beam polarization is highly desirable as it provides a clean measurement of the backgrounds. Beam energies between 70 and 110 MeV are ideal. This range would provide a Q{sup 2} mapping of g{sub a} between 0.01 form factor G{sub M}{sup n}. The experiment employs the usual techniques of electron-nucleon scattering and presents no special difficulty. Higher energy extensions are possible. They could yield measurements of g{sub a}(Q{sup 2}) up to Q{sup 2}=3 GeV{sup 2} and the possibility to access other form factors, such as the almost unknown pseudoscalar form factor g{sub P}. However, the experiments become much more challenging as soon as beam energies pass the pion production threshold.

  12. Form factor dispersion at La M5,4 edges and average density of resonant atoms.

    PubMed

    Smadici, S; Lee, J C T; Logvenov, G; Bozovic, I; Abbamonte, P

    2014-01-15

    Resonant soft x-ray scattering on complex oxide superlattices shows very large variations in the superlattice reflection position and intensity near La M5,4 edges. Resonant dispersion of the La x-ray form factor describes the observations well. We determine the average density of resonant La atoms and the thickness of superlattice layers.

  13. The electromagnetic Sigma-to-Lambda hyperon transition form factors at low energies

    DOE PAGES

    Granados, Carlos; Leupold, Stefan; Perotti, Elisabetta

    2017-06-09

    Using dispersion theory the low-energy electromagnetic form factors for the transition of a Sigma to a Lambda hyperon are related to the pion vector form factor. The additionally required input, i.e. the two-pion-Sigma-Lambda amplitudes are determined from relativistic next-to-leading-order (NLO) baryon chiral perturbation theory including the baryons from the octet and optionally from the decuplet. Pion rescattering is again taken into account by dispersion theory. It turns out that the inclusion of decuplet baryons is not an option but a necessity to obtain reasonable results. The electric transition form factor remains very small in the whole low-energy region. The magneticmore » transition form factor depends strongly on one not very well determined low-energy constant of the NLO Lagrangian. Furthermore, one obtains reasonable predictive power if this low-energy constant is determined from a measurement of the magnetic transition radius. Such a measurement can be performed at the future Facility for Antiproton and Ion Research (FAIR).« less

  14. A small-form-factor piezoelectric vibration energy harvester using a resonant frequency-down conversion

    SciTech Connect

    Sun, Kyung Ho; Kim, Young-Cheol; Kim, Jae Eun

    2014-10-15

    While environmental vibrations are usually in the range of a few hundred Hertz, small-form-factor piezoelectric vibration energy harvesters will have higher resonant frequencies due to the structural size effect. To address this issue, we propose a resonant frequency-down conversion based on the theory of dynamic vibration absorber for the design of a small-form-factor piezoelectric vibration energy harvester. The proposed energy harvester consists of two frequency-tuned elastic components for lowering the first resonant frequency of an integrated system but is so configured that an energy harvesting beam component is inverted with respect to the other supporting beam component for a small form factor. Furthermore, in order to change the unwanted modal characteristic of small separation of resonant frequencies, as is the case with an inverted configuration, a proof mass on the supporting beam component is slightly shifted toward a second proof mass on the tip of the energy harvesting beam component. The proposed small-form-factor design capability was experimentally verified using a fabricated prototype with an occupation volume of 20 × 39 × 6.9 mm{sup 3}, which was designed for a target frequency of as low as 100 Hz.

  15. Relativistic corrections to the form factors of Bc into S -wave charmonium

    NASA Astrophysics Data System (ADS)

    Zhu, Ruilin; Ma, Yan; Han, Xin-Ling; Xiao, Zhen-Jun

    2017-05-01

    We investigate the form factors of Bc meson into S -wave charmonium within the nonrelativistic QCD effective theory and obtain the next-to-leading order relativistic corrections to the form factors, where both the Bc meson and the charmonium are treated as the nonrelativistic bound states. Treating the charm quark as a light quark in the limit mc/mb→0 , some form factors are identical at the maximum recoil point, which are consistent with the predictions in the heavy-quark effective theory and the large-energy effective theory. Considering that the branching ratios of Bc+→J /ψ Ds+ and Bc+→J /ψ Ds*+ have been measured by the LHCb and ATLAS Collaborations recently, we employ the form factors of Bc meson into S -wave charmonium at the next-to-leading order accuracy to these two decay channels and obtain more precise predictions of their decay rates. Numerical results indicate that the factorizable diagrams dominate the contribution in these two channels, while the color-suppressed and the annihilation diagrams contribute less than 10 percent. Our results are consistent with the LHCb and ATLAS data.

  16. The charge form factor of pseudoscalar mesons in a relativistic constituent quark model

    SciTech Connect

    Cardarelli, F.; Pace, E.; Grach, I.L.

    1994-04-01

    The charge form factor of pseudoscalar mesons has been investigated in the light-cone formalism, up to Q{sup 2} relevant to CEBAF energies. The consequences of adopting the meson wave functions generated through the Godfrey-Isgur q{bar q} potential, which reproduces the mass spectra, are discussed.

  17. Nuclear longitudinal form factors for axially deformed charge distributions expanded by nonorthogonal basis functions

    NASA Astrophysics Data System (ADS)

    Liu, Jian; Zhang, Jinjuan; Xu, Chang; Ren, Zhongzhou

    2017-05-01

    In this paper, the nuclear longitudinal form factors are systematically studied from the intrinsic charge multipoles. For axially deformed nuclei, two different types of density profiles are used to describe their charge distributions. For the same charge distributions expanded with different basis functions, the corresponding longitudinal form factors are derived and compared with each other. Results show the multipoles Cλ of longitudinal form factors are independent of the basis functions of charge distributions. Further numerical calculations of longitudinal form factors of 12C indicates that the C 0 multipole reflects the contributions of spherical components of all nonorthogonal basis functions. For deformed nuclei, their charge RMS radii can also be determined accurately by the C 0 measurement. The studies in this paper examine the model-independent properties of electron scattering, which are useful for interpreting electron scattering experiments on exotic deformed nuclei. Supported by National Natural Science Foundation of China (11505292, 11175085, 11575082, 11235001, 11275138, and 11447226), by Shandong Provincial Natural Science Foundation, China (BS2014SF007), Fundamental Research Funds for Central Universities (15CX02072A).

  18. A small-form-factor piezoelectric vibration energy harvester using a resonant frequency-down conversion

    NASA Astrophysics Data System (ADS)

    Sun, Kyung Ho; Kim, Young-Cheol; Kim, Jae Eun

    2014-10-01

    While environmental vibrations are usually in the range of a few hundred Hertz, small-form-factor piezoelectric vibration energy harvesters will have higher resonant frequencies due to the structural size effect. To address this issue, we propose a resonant frequency-down conversion based on the theory of dynamic vibration absorber for the design of a small-form-factor piezoelectric vibration energy harvester. The proposed energy harvester consists of two frequency-tuned elastic components for lowering the first resonant frequency of an integrated system but is so configured that an energy harvesting beam component is inverted with respect to the other supporting beam component for a small form factor. Furthermore, in order to change the unwanted modal characteristic of small separation of resonant frequencies, as is the case with an inverted configuration, a proof mass on the supporting beam component is slightly shifted toward a second proof mass on the tip of the energy harvesting beam component. The proposed small-form-factor design capability was experimentally verified using a fabricated prototype with an occupation volume of 20 × 39 × 6.9 mm3, which was designed for a target frequency of as low as 100 Hz.

  19. Factor Structure and Short Form of the Miville-Guzman Universality-Diversity Scale.

    ERIC Educational Resources Information Center

    Fuertes, Jairo N.; Miville, Marie L.; Mohr, Jonathan J.; Sedlacek, William E.; Gretchen, Denise

    2000-01-01

    Examines the factor structure of the Miville-Guzman Universality-Diversity Scale (M-GUDS) and presents a short form of the scale (M-GUDS-S). Findings suggest that the M-GUDS-S measures Universal-Diverse Orientation as a multidimensional construct with three distinct domains: behavioral, emotional, and cognitive. (Contains 21 references and 3…

  20. Measuring the axial form factor of {sup 3}He using weak capture of polarized electrons

    SciTech Connect

    Dutta, D.

    2013-11-07

    A low energy, high intensity polarized electron beam could enable the extraction of the A=3 weak axial form factors F{sub A} using the reaction →e+{sup 3}He→{sup 3}H+ν. These form factors have never been measured before. We discuss the feasibility of such an experiment using a small toroidal magnet and a radial low energy recoil detector to tag the recoil tritons. A moderately high intensity polarized electron beam (>500 μA) with beam energies between 50 - 150 MeV is necessary for the cross section measurement and to provides a free clean measurement of the background. Moreover, in addition to the cross section, by measuring the electron spin and recoil triton correlation coefficient it may be possible to search for second class currents and to extract the ratio of the axial to the vector form factor of the nucleon. Such novel electron scattering based measurements would have a completely different set of systematic uncertainties compared to polarized neutron beta decay, neutrino scattering and muon capture experiments which are typically used to extract the weak form-factors.

  1. Elastic Form Factors of 3,4He up to Large Q2

    SciTech Connect

    Kees De Jager

    2007-09-10

    Elastic electron scattering off $^3$He and $^4$He has recently been studied at forward and backward scattering angles in Hall A at JLab. The results will provide accurate data on the elastic form factors, charge and magnetic for $^3$He and charge only for $^4$He, up to squared momentum transfer $Q^2$-values of 3.2 GeV$^2$.

  2. Lattice QCD results for the B --> D(*) l nu form factors: F(1) and G(1)

    SciTech Connect

    Van de Water, R.S.; /Fermilab

    2007-01-01

    I review the current status of lattice QCD calculations of the B {yields} D and B {yields} D* form factors and discuss prospects for their improvement. Successful calculations within the quenched approximation demonstrate the power of lattice methods for calculating F(1) and G(1), and the unquenched calculations in progress should soon allow for a 2-3% exclusive determination of |Vcb|.

  3. The electromagnetic Sigma-to-Lambda hyperon transition form factors at low energies

    NASA Astrophysics Data System (ADS)

    Granados, Carlos; Leupold, Stefan; Perotti, Elisabetta

    2017-06-01

    Using dispersion theory the low-energy electromagnetic form factors for the transition of a Sigma to a Lambda hyperon are related to the pion vector form factor. The additionally required input, i.e. the two-pion-Sigma-Lambda amplitudes are determined from relativistic next-to-leading-order (NLO) baryon chiral perturbation theory including the baryons from the octet and optionally from the decuplet. Pion rescattering is again taken into account by dispersion theory. It turns out that the inclusion of decuplet baryons is not an option but a necessity to obtain reasonable results. The electric transition form factor remains very small in the whole low-energy region. The magnetic transition form factor depends strongly on one not very well determined low-energy constant of the NLO Lagrangian. One obtains reasonable predictive power if this low-energy constant is determined from a measurement of the magnetic transition radius. Such a measurement can be performed at the future Facility for Antiproton and Ion Research (FAIR).

  4. Strangeness Vector and Axial-Vector Form Factors of the Nucleon

    NASA Astrophysics Data System (ADS)

    Pate, Stephen; Trujillo, Dennis

    2014-03-01

    A revised global fit of electroweak ep and vp elastic scattering data has been performed, with the goal of determining the strange quark contribution to the vector and axial-vector form factors of the nucleon in the momentum-transfer range 0 < Q2 < 1 GeV2. The two vector (electric and magnetic) form factors GsE(Q2) and GsM(Q2) are strongly constrained by ep elastic scattering data, while the major source of information on the axial-vector form factor GsA(Q2) is vp scattering data. Combining the two kinds of data into a single global fit makes possible additional precision in the determination of these form factors, and provides a unique way to determine the strange quark contribution to the nucleon spin, ΔS , independently of leptonic deep-inelastic scattering. The fit makes use of data from the BNL-E734, SAMPLE, HAPPEx, G0, and PVA4 experiments; we will also compare the result of the fit with recent data from MiniBooNE, and anticipate how this fit can be improved when new data from MicroBooNE become available.

  5. Strangeness Vector and Axial-Vector Form Factors of the Nucleon

    NASA Astrophysics Data System (ADS)

    Trujillo, Dennis; Pate, Stephen

    2013-04-01

    A revised global fit of electroweak ep and νp elastic scattering data has been performed, with the goal of determining the strange quark contribution to the vector and axial-vector form factors of the nucleon in the momentum-transfer range 0form factors GE^s(Q^2) and GM^s(Q^2) are strongly constrained by ep elastic scattering data, while the major source of information on the axial-vector form factor GA^s(Q^2) is νp scattering data. Combining the two kinds of data into a single global fit makes possible additional precision in the determination of these form factors. The fit makes use of data from the BNL-E734, SAMPLE, HAPPEx, G0, and PVA4 experiments; we will also compare the result of the fit with recent data from MiniBooNE, and anticipate how this fit can be improved when new data from MicroBooNE become available.

  6. The Short Form of the Five-Factor Narcissism Inventory: Psychometric Equivalence of the Turkish Version

    ERIC Educational Resources Information Center

    Eksi, Füsun

    2016-01-01

    This study intends to examine the psychometric properties of the Turkish version of the short form of the Five-Factor Narcissism Inventory (FFNI-SF). The study group consists of a total of 526 university students (54% were female) whose ages range from 18 to 32. In the translational equivalence study made over a two-week interval, the FFNI-SF…

  7. Bound state structure and electromagnetic form factor beyond the ladder approximation

    NASA Astrophysics Data System (ADS)

    Gigante, V.; Nogueira, J. H. Alvarenga; Ydrefors, E.; Gutierrez, C.; Karmanov, V. A.; Frederico, T.

    2017-03-01

    We investigate the response of the bound state structure of a two-boson system, within a Yukawa model with a scalar boson exchange, to the inclusion of the cross-ladder contribution to the ladder kernel of the Bethe-Salpeter equation. The equation is solved by means of the Nakanishi integral representation and light-front projection. The valence light-front wave function and electromagnetic form factor, considering both ladder and ladder plus cross-ladder kernels, are studied in detail. Their asymptotic forms are found to be quite independent of the inclusion of the cross-ladder kernel, for a given binding energy. The asymptotic decrease of form factor agrees with the counting rules. This analysis can be generalized to fermionic systems, with a wide application in the study of the meson structure.

  8. Radiative corrections to polarization observables in electron-proton scattering

    NASA Astrophysics Data System (ADS)

    Borisyuk, Dmitry; Kobushkin, Alexander

    2014-08-01

    We consider radiative corrections to polarization observables in elastic electron-proton scattering, in particular, for the polarization transfer measurements of the proton form factor ratio μGE/GM. The corrections are of two types: two-photon exchange (TPE) and bremsstrahlung (BS); in the present work we pay special attention to the latter. Assuming small missing energy or missing mass cutoff, the correction can be represented in a model-independent form, with both electron and proton radiation taken into account. Numerical calculations show that the contribution of the proton radiation is not negligible. Overall, at high Q2 and energies, the total correction to μGE/GM grows, but is dominated by TPE. At low energies both TPE and BS may be significant; the latter amounts to ˜0.01 for some reasonable cut-off choices.

  9. Measurement of the isovector axial form factor at Q{sup 2} = 0.23 (GeV/c){sup 2}

    SciTech Connect

    Ríos, D. Balaguer; Baunack, S.; Glaser, B.; Maas, F.; Imai, Y.

    2013-11-07

    We present the preliminary value of the measurement of the parity violating asymmetry in the cross section of quasi-elastic scattering of longitudinally polarized electrons on deuteron at backward angles at Q{sup 2} = 0.23. The preliminary asymmetry is A{sub PV}{sup d}(Q{sup 2} = 0.23) = (−20.77±0.84{sub stat}±1.23{sub syst})10{sup −6}. From this value a preliminary linear combination of the G{sub M}{sup s} and the isovector axial form factor G{sub A} can be extracted G{sub A}{sup T = 1}+0.59G{sub M}{sup s} = −0.53±0.37±0.02. Combining this preliminary linear combination with that extracted from the measurement of the parity violating asymmetry on proton, already publish, it is possible to disentagle the form factors and thus we can obtain a preliminary experimental determination of the isovector axial form factor G{sub A}{sup T = 1} = −0.43±0.46.

  10. Generalized Chou-Yang Model and Meson-Proton Elastic Scattering at High Energies

    NASA Astrophysics Data System (ADS)

    Saleem, Mohammad; Aleem, Fazal-E.; Rashid, Haris

    The various characteristics of meson-proton elastic scattering at high energies are explained by using the generalized Chou-Yang model which takes into consideration the anisotropic scattering of objects constituting pions(kaons) and protons. A new parametrization of the proton form factor consistent with the recent experimental data is proposed. It is then shown that all the data for meson-proton elastic scattering at 200 and 250 GeV/c are in agreement with theoretical computations. The physical picture of generalized Chou-Yang model which is based on multiple scattering theory is given in detail.

  11. Induced drag ideal efficiency factor of arbitrary lateral-vertical wing forms

    NASA Technical Reports Server (NTRS)

    Deyoung, J.

    1980-01-01

    A relatively simple equation is presented for estimating the induced drag ideal efficiency factor e for arbitrary cross sectional wing forms. This equation is based on eight basic but varied wing configurations which have exact solutions. The e function which relates the basic wings is developed statistically and is a continuous function of configuration geometry. The basic wing configurations include boxwings shaped as a rectangle, ellipse, and diamond; the V-wing; end-plate wing; 90 degree cruciform; circle dumbbell; and biplane. Example applications of the e equations are made to many wing forms such as wings with struts which form partial span rectangle dumbbell wings; bowtie, cruciform, winglet, and fan wings; and multiwings. Derivations are presented in the appendices of exact closed form solutions found of e for the V-wing and 90 degree cruciform wing and for an asymptotic solution for multiwings.

  12. Rpf Proteins Are the Factors of Reactivation of the Dormant Forms of Actinobacteria.

    PubMed

    Nikitushkin, V D; Demina, G R; Kaprelyants, A S

    2016-12-01

    As the response to unfavorable growth conditions, nonsporulating mycobacteria transform into the dormant state with the concomitant formation of the specialized dormant forms characterized by low metabolic activity and resistance to antibiotics. Such dormant cells can be reactivated under the influence of several factors including proteins of Rpf (Resuscitation promoting factor) family, which possess peptidoglycan hydrolase activity and were considered to belong to the group of the autocrine growth factors of the bacteria. Remarkable interest toward Rpf family is determined by its participation in resuscitation of the dormant forms of Mycobacterium tuberculosis, what in turn is the key element in resuscitation of the latent tuberculosis - an infectious disease that affects one third of the World's population. Experiments with Rpf mutant forms and with strains deleted in these proteins revealed a relationship between the enzymatic activity of this protein and its ability to resuscitate mycobacteria both in vitro and in vivo. This review discusses possible mechanisms of Rpf action including those related to possible participation of the products of mycobacterial Rpf-mediated cell wall hydrolysis (muropeptides) as signaling molecules. The unique ability of Rpf proteins to resuscitate the dormant forms of mycobacteria and to stimulate their proliferation would allow these proteins to occupy their niche in medicine - in diagnostics and in creation of antituberculosis subunit vaccines.

  13. Up, down, and strange nucleon axial form factors from lattice QCD

    DOE PAGES

    Green, Jeremy; Hasan, Nesreen; Meinel, Stefan; ...

    2017-06-14

    Here, we report a calculation of the nucleon axial form factorsmore » $$G_A^q(Q^2)$$ and $$G_P^q(Q^2)$$ for all three light quark flavors $$q\\in\\{u,d,s\\}$$ in the range $$0\\leq Q^2\\lesssim 1.2\\text{ GeV}^2$$ using lattice QCD. Our work was done using a single ensemble with pion mass 317 MeV and made use of the hierarchical probing technique to efficiently evaluate the required disconnected loops. We perform nonperturbative renormalization of the axial current, including a nonperturbative treatment of the mixing between light and strange currents due to the singlet-nonsinglet difference caused by the axial anomaly. The form factor shapes are fit using the model-independent $z$ expansion. From $$G_A^q(Q^2)$$, we determine the quark contributions to the nucleon spin and axial radii. By extrapolating the isovector $$G_P^{u-d}(Q^2)$$, we obtain the induced pseudoscalar coupling relevant for ordinary muon capture and the pion-nucleon coupling constant. We also found that the disconnected contributions to $$G_P$$ form factors are large, and give an interpretation based on the dominant influence of the pseudoscalar poles in these form factors.« less

  14. Form factors of descendant operators: reduction to perturbed M (2 , 2 s + 1) models

    NASA Astrophysics Data System (ADS)

    Lashkevich, Michael; Pugai, Yaroslav

    2015-04-01

    In the framework of the algebraic approach to form factors in two-dimensional integrable models of quantum field theory we consider the reduction of the sine-Gordon model to the Φ13-perturbation of minimal conformal models of the M (2 , 2 s + 1) series. We find in an algebraic form the condition of compatibility of local operators with the reduction. We propose a construction that make it possible to obtain reduction compatible local operators in terms of screening currents. As an application we obtain exact multiparticle form factors for the compatible with the reduction conserved currents T ±2 k , Θ±(2 k-2), which correspond to the spin ±(2 k - 1) integrals of motion, for any positive integer k. Furthermore, we obtain all form factors of the operators T 2 k T -2 l , which generalize the famous operator. The construction is analytic in the s parameter and, therefore, makes sense in the sine-Gordon theory.

  15. Sudakov Resummation for Subleading SCET Currents and Heavy-to-Light Form Factors

    SciTech Connect

    Hill, R J

    2004-04-25

    The hard-scattering contributions to heavy-to-light form factors at large recoil are studied systematically in soft-collinear effective theory (SCET). Large logarithms arising from multiple energy scales are resummed by matching QCD onto SCET in two stages via an intermediate effective theory. Anomalous dimensions in the intermediate theory are computed, and their form is shown to be constrained by conformal symmetry. Renormalization-group evolution equations are solved to give a complete leading-order analysis of the hard-scattering contributions, in which all single and double logarithms are resummed. In two cases, spin-symmetry relations for the soft-overlap contributions to form factors are shown not to be broken at any order in perturbation theory by hard-scattering corrections. One-loop matching calculations in the two effective theories are performed in sample cases, for which the relative importance of renormalization-group evolution and matching corrections is investigated. The asymptotic behavior of Sudakov logarithms appearing in the coefficient functions of the soft-overlap and hard-scattering contributions to form factors is analyzed.

  16. The Role of Nerve Growth Factor (NGF) and Its Precursor Forms in Oral Wound Healing.

    PubMed

    Schenck, Karl; Schreurs, Olav; Hayashi, Katsuhiko; Helgeland, Kristen

    2017-02-11

    Nerve growth factor (NGF) and its different precursor forms are secreted into human saliva by salivary glands and are also produced by an array of cells in the tissues of the oral cavity. The major forms of NGF in human saliva are forms of pro-nerve growth factor (pro-NGF) and not mature NGF. The NGF receptors tropomyosin-related kinase A (TrkA) and p75 neurotrophin receptor (p75(NTR)) are widely expressed on cells in the soft tissues of the human oral cavity, including keratinocytes, endothelial cells, fibroblasts and leukocytes, and in ductal and acinar cells of all types of salivary glands. In vitro models show that NGF can contribute at most stages in the oral wound healing process: restitution, cell survival, apoptosis, cellular proliferation, inflammation, angiogenesis and tissue remodeling. NGF may therefore take part in the effective wound healing in the oral cavity that occurs with little scarring. As pro-NGF forms appear to be the major form of NGF in human saliva, efforts should be made to study its function, specifically in the process of wound healing. In addition, animal and clinical studies should be initiated to examine if topical application of pro-NGF or NGF can be a therapy for chronic oral ulcerations and wounds.

  17. Forming factors of gas hydrate chimney in the Ulleung Basin, East Sea

    NASA Astrophysics Data System (ADS)

    Kang, Dong-Hyo; Chun, Jong-Hwa; Koo, Nam-Hyng; Kim, Won-Sik; Lee, Ho-Young; Lee, Joo-Yong

    2016-04-01

    Seismic chimneys ranging in width from 200 m to 1,000 m are observed in the seismic sections obtained in the Ulleung Basin, East Sea. In consequence of Ulleung Basin Gas Hydrate Expedition 1 and 2, concentrations of gas hydrates were identified. Especially, 6 chimney sites were drilled and the occurrence of gas hydrate was identified at all wells. Through the interpreting seismic section, three factors affect the formation of gas hydrate chimney; mass transport deposit, fault, igneous intrusion. These three factors result in three case of forming gas hydrate chimney. Firstly, gas hydrate chimney appears predominantly in the fault zone. Deep-rooted fault reach to mass transport deposit and gas hydrate chimney which is mostly rooted in mass transport deposit is formed. Secondly, Gas hydrate chimney appears linked to igneous intrusion. Igneous intrusion result in forming fault in overlying strata. Similar to first case, this fault traverses mass transport deposit and gas hydrate chimney rooted in mass transport deposit is created. Thirdly, gas hydrate chimney is formed at thick mass transport deposit without fault. In this case, chimney is not reach to seabed in contrast with first and second case. The thickness of mass transport deposit is 0.2 second in two-way travel times. Overburden load cause to pressure at the upper part of mass transport deposit. This leads to fracture in overlying sediments and form gas hydrate chimney.

  18. The Role of Nerve Growth Factor (NGF) and Its Precursor Forms in Oral Wound Healing

    PubMed Central

    Schenck, Karl; Schreurs, Olav; Hayashi, Katsuhiko; Helgeland, Kristen

    2017-01-01

    Nerve growth factor (NGF) and its different precursor forms are secreted into human saliva by salivary glands and are also produced by an array of cells in the tissues of the oral cavity. The major forms of NGF in human saliva are forms of pro-nerve growth factor (pro-NGF) and not mature NGF. The NGF receptors tropomyosin-related kinase A (TrkA) and p75 neurotrophin receptor (p75NTR) are widely expressed on cells in the soft tissues of the human oral cavity, including keratinocytes, endothelial cells, fibroblasts and leukocytes, and in ductal and acinar cells of all types of salivary glands. In vitro models show that NGF can contribute at most stages in the oral wound healing process: restitution, cell survival, apoptosis, cellular proliferation, inflammation, angiogenesis and tissue remodeling. NGF may therefore take part in the effective wound healing in the oral cavity that occurs with little scarring. As pro-NGF forms appear to be the major form of NGF in human saliva, efforts should be made to study its function, specifically in the process of wound healing. In addition, animal and clinical studies should be initiated to examine if topical application of pro-NGF or NGF can be a therapy for chronic oral ulcerations and wounds. PMID:28208669

  19. Development of a Short Form of the Five-Factor Narcissism Inventory: the FFNI-SF.

    PubMed

    Sherman, Emily D; Miller, Joshua D; Few, Lauren R; Campbell, W Keith; Widiger, Thomas A; Crego, Cristina; Lynam, Donald R

    2015-09-01

    The Five-Factor Narcissism Inventory (FFNI; Glover, Miller, Lynam, Crego, & Widiger, 2012) is a 148-item self-report inventory of 15 traits designed to assess the basic elements of narcissism from the perspective of a 5-factor model. The FFNI assesses both vulnerable (i.e., cynicism/distrust, need for admiration, reactive anger, and shame) and grandiose (i.e., acclaim seeking, arrogance, authoritativeness, entitlement, exhibitionism, exploitativeness, grandiose fantasies, indifference, lack of empathy, manipulativeness, and thrill seeking) variants of narcissism. The present study reports the development of a short-form version of the FFNI in 4 diverse samples (i.e., 2 undergraduate samples, a sample recruited from MTurk, and a clinical community sample) using item response theory. The validity of the resultant 60-item short form was compared against the validity of the full scale in the 4 samples at both the subscale level and the level of the grandiose and vulnerable composites. Results indicated that the 15 subscales remain relatively reliable, possess a factor structure identical to the structure of the long-form scales, and manifest correlational profiles highly similar to those of the long-form scales in relation to a variety of criterion measures, including basic personality dimensions, other measures of grandiose and vulnerable narcissism, and indicators of externalizing and internalizing psychopathology. Grandiose and vulnerable composites also behave almost identically across the short- and long-form versions. It is concluded that the FFNI-Short Form (FFNI-SF) offers a well-articulated assessment of the basic traits comprising grandiose and vulnerable narcissism, particularly when assessment time is limited.

  20. Measurement of the form factor ratios in semileptonic decays of charm mesons

    SciTech Connect

    Zaliznyak, Renata

    1998-05-01

    I have measured the form factor ratios r2 = A2 (0)/A1 (0) and rV = V (0)/A1 (0) in the semileptonic charm meson decay D+ → $\\bar{K}$*0 e+ve from data collected by the Fermilab E791 collaboration. Form factors are introduced in the calculation of the hadronic current in semileptonic decays of strange, charm, or bottom mesons, such as D+ → $\\bar{K}$*0 e+ ve . Semileptonic decays provide insight into quark coupling to the W boson since the leptonic and hadronic amplitudes in the Feynman diagram for the decay are completely separate. There are no strong interactions between the final state leptons and quarks. A number of theoretical models predict the values of the form factors for D+ → $\\bar{K}$*0 e+ ve , though there is a large range of predictions. E791 is a hadroproduction experiment that recorded over 20 billion interactions with a 500 GeV π- beam incident on five thin targets during the 1991-92 Fermilab fixed-target run. Approximately 3000 D+ → $\\bar{K}$*0 e+ ve decays are fully reconstructed. In order to extract the form factor ratios from the data, I implement a multidimensional unbinned maximum likelihood fit with a large sample of simulated (Monte Carlo) D+ → $\\bar{K}$*0 e+ve events. The large E791 data sample provides the most precise measurement of the form factor ratios to date. The measured values for the form factor ratios are r2 = 0.71 ± 0.08 ± 0.09 and rV = 1.84 ± 0.11 ±} 0.08. These results are in good agreement with some Lattice Gauge calculations. However the agreement with quark model predictions is not as good.