Chen, Qi; Thomas, Joseph T; Giménez-Lirola, Luis G; Hardham, John M; Gao, Qinshan; Gerber, Priscilla F; Opriessnig, Tanja; Zheng, Ying; Li, Ganwu; Gauger, Phillip C; Madson, Darin M; Magstadt, Drew R; Zhang, Jianqiang
2016-04-05
At least two genetically different porcine epidemic diarrhea virus (PEDV) strains have been identified in the United States (U.S. PEDV prototype and S-INDEL-variant strains). The current serological assays offered at veterinary diagnostic laboratories for detection of PEDV-specific antibody are based on the U.S. PEDV prototype strain. The objectives of this study were: 1) isolate the U.S. PEDV S-INDEL-variant strain in cell culture; 2) generate antisera against the U.S. PEDV prototype and S-INDEL-variant strains by experimentally infecting weaned pigs; 3) determine if the various PEDV serological assays could detect antibodies against the U.S. PEDV S-INDEL-variant strain and vice versa. A U.S. PEDV S-INDEL-variant strain was isolated in cell culture in this study. Three groups of PEDV-negative, 3-week-old pigs (five pigs per group) were inoculated orally with a U.S. PEDV prototype isolate (previously isolated in our lab), an S-INDEL-variant isolate or virus-negative culture medium. Serum samples collected at 0, 7, 14, 21 and 28 days post inoculation were evaluated by the following PEDV serological assays: 1) indirect fluorescent antibody (IFA) assays using the prototype and S-INDEL-variant strains as indicator viruses; 2) virus neutralization (VN) tests against the prototype and S-INDEL-variant viruses; 3) PEDV prototype strain whole virus based ELISA; 4) PEDV prototype strain S1-based ELISA; and 5) PEDV S-INDEL-variant strain S1-based ELISA. The positive antisera against the prototype strain reacted to and neutralized both prototype and S-INDEL-variant viruses, and the positive antisera against the S-INDEL-variant strain also reacted to and neutralized both prototype and S-INDEL-variant viruses, as examined by IFA antibody assays and VN tests. Antibodies against the two PEDV strains could be detected by all three ELISAs although detection rates varied to some degree. These data indicate that the antibodies against U.S. PEDV prototype and S-INDEL-variant strains cross-reacted and cross-neutralized both strains in vitro. The current serological assays based on U.S. PEDV prototype strain can detect antibodies against both U.S. PEDV strains.
Chen, Qi; Gauger, Phillip C; Stafne, Molly R; Thomas, Joseph T; Madson, Darin M; Huang, Haiyan; Zheng, Ying; Li, Ganwu; Zhang, Jianqiang
2016-05-01
At least two genetically different porcine epidemic diarrhoea virus (PEDV) strains have been identified in the USA: US PEDV prototype and S-INDEL-variant strains. The objective of this study was to compare the pathogenicity differences of the US PEDV prototype and S-INDEL-variant strains in conventional neonatal piglets under experimental infections. Fifty PEDV-negative 5-day-old pigs were divided into five groups of ten pigs each and were inoculated orogastrically with three US PEDV prototype isolates (IN19338/2013, NC35140/2013 and NC49469/2013), an S-INDEL-variant isolate (IL20697/2014), and virus-negative culture medium, respectively, with virus titres of 104 TCID50 ml- 1, 10 ml per pig. All three PEDV prototype isolates tested in this study, regardless of their phylogenetic clades, had similar pathogenicity and caused severe enteric disease in 5-day-old pigs as evidenced by clinical signs, faecal virus shedding, and gross and histopathological lesions. Compared with pigs inoculated with the three US PEDV prototype isolates, pigs inoculated with the S-INDEL-variant isolate had significantly diminished clinical signs, virus shedding in faeces, gross lesions in small intestines, caeca and colons, histopathological lesions in small intestines, and immunohistochemistry staining in ileum. However, the US PEDV prototype and the S-INDEL-variant strains induced similar viraemia levels in inoculated pigs. Whole genome sequences of the PEDV prototype and S-INDEL-variant strains were determined, but the molecular basis of virulence differences between these PEDV strains remains to be elucidated using a reverse genetics approach.
Billam, P; LeRoith, T; Pudupakam, R S; Pierson, F W; Duncan, R B; Meng, X J
2009-11-18
Avian hepatitis E virus (avian HEV) is the primary causative agent of Hepatitis-Splenomegaly (HS) syndrome in chickens. Recently, a genetically unique strain of avian HEV, designated avian HEV-VA, was recovered from healthy chickens in Virginia. The objective of this study was to experimentally compare the pathogenicity of the prototype strain recovered from a chicken with HS syndrome and the avian HEV-VA strain in specific-pathogen-free chickens. An infectious stock of the avian HEV-VA strain was first generated and its infectivity titer determined in chickens. For the comparative pathogenesis study, 54 chickens of 6-week-old were assigned to 3 groups of 18 chickens each. The group 1 chickens were each intravenously inoculated with 5x10(2.5) 50% chicken infectious dose of the prototype strain. The group 2 received the same dose of the avian HEV-VA strain, and the group 3 served as negative controls. Six chickens from each group were necropsied at 2, 3 and 4 weeks post-inoculation (wpi). Most chickens in both inoculated groups seroconverted by 3wpi, and the mean anti-avian HEV antibody titers were higher for the prototype strain group than the avian HEV-VA strain group. There was no significant difference in the patterns of viremia and fecal virus shedding. Blood analyte profiles did not differ between treatment groups except for serum creatine phosphokinase levels which were higher for prototype avian HEV group than avian HEV-VA group. The hepatic lesion score was higher for the prototype strain group than the other two groups. The results indicated that the avian HEV-VA strain is only slightly attenuated compared to the prototype strain, suggesting that the full spectrum of HS syndrome is likely associated with other co-factors.
Purkayastha, Anjan; Su, Jing; McGraw, John; Ditty, Susan E; Hadfield, Ted L; Seto, Jason; Russell, Kevin L; Tibbetts, Clark; Seto, Donald
2005-07-01
Vaccine strains of human adenovirus serotypes 4 and 7 (HAdV-4vac and HAdV-7vac) have been used successfully to prevent adenovirus-related acute respiratory disease outbreaks. The genomes of these two vaccine strains have been sequenced, annotated, and compared with their prototype equivalents with the goals of understanding their genomes for molecular diagnostics applications, vaccine redevelopment, and HAdV pathoepidemiology. These reference genomes are archived in GenBank as HAdV-4vac (35,994 bp; AY594254) and HAdV-7vac (35,240 bp; AY594256). Bioinformatics and comparative whole-genome analyses with their recently reported and archived prototype genomes reveal six mismatches and four insertions-deletions (indels) between the HAdV-4 prototype and vaccine strains, in contrast to the 611 mismatches and 130 indels between the HAdV-7 prototype and vaccine strains. Annotation reveals that the HAdV-4vac and HAdV-7vac genomes contain 51 and 50 coding units, respectively. Neither vaccine strain appears to be attenuated for virulence based on bioinformatics analyses. There is evidence of genome recombination, as the inverted terminal repeat of HAdV-4vac is initially identical to that of species C whereas the prototype is identical to species B1. These vaccine reference sequences yield unique genome signatures for molecular diagnostics. As a molecular forensics application, these references identify the circulating and problematic 1950s era field strains as the original HAdV-4 prototype and the Greider prototype, from which the vaccines are derived. Thus, they are useful for genomic comparisons to current epidemic and reemerging field strains, as well as leading to an understanding of pathoepidemiology among the human adenoviruses.
Purkayastha, Anjan; Su, Jing; McGraw, John; Ditty, Susan E.; Hadfield, Ted L.; Seto, Jason; Russell, Kevin L.; Tibbetts, Clark; Seto, Donald
2005-01-01
Vaccine strains of human adenovirus serotypes 4 and 7 (HAdV-4vac and HAdV-7vac) have been used successfully to prevent adenovirus-related acute respiratory disease outbreaks. The genomes of these two vaccine strains have been sequenced, annotated, and compared with their prototype equivalents with the goals of understanding their genomes for molecular diagnostics applications, vaccine redevelopment, and HAdV pathoepidemiology. These reference genomes are archived in GenBank as HAdV-4vac (35,994 bp; AY594254) and HAdV-7vac (35,240 bp; AY594256). Bioinformatics and comparative whole-genome analyses with their recently reported and archived prototype genomes reveal six mismatches and four insertions-deletions (indels) between the HAdV-4 prototype and vaccine strains, in contrast to the 611 mismatches and 130 indels between the HAdV-7 prototype and vaccine strains. Annotation reveals that the HAdV-4vac and HAdV-7vac genomes contain 51 and 50 coding units, respectively. Neither vaccine strain appears to be attenuated for virulence based on bioinformatics analyses. There is evidence of genome recombination, as the inverted terminal repeat of HAdV-4vac is initially identical to that of species C whereas the prototype is identical to species B1. These vaccine reference sequences yield unique genome signatures for molecular diagnostics. As a molecular forensics application, these references identify the circulating and problematic 1950s era field strains as the original HAdV-4 prototype and the Greider prototype, from which the vaccines are derived. Thus, they are useful for genomic comparisons to current epidemic and reemerging field strains, as well as leading to an understanding of pathoepidemiology among the human adenoviruses. PMID:16000418
Novel Human Adenovirus Causing Nosocomial Epidemic Keratoconjunctivitis▿
Ishiko, Hiroaki; Shimada, Yasushi; Konno, Tsunetada; Hayashi, Akio; Ohguchi, Takeshi; Tagawa, Yoshitsugu; Aoki, Koki; Ohno, Shigeaki; Yamazaki, Shudo
2008-01-01
In 2000, we encountered cases of nosocomial infections with epidemic keratoconjunctivitis (EKC) at a university hospital in Kobe, in the western part of Japan. Two human adenovirus (HAdV) strains, Kobe-H and Kobe-S, were isolated from patients with nosocomial EKC infection. They were untypeable by existing neutralizing antisera; however, the isolate was neutralized with homologous antisera. We then encountered several cases of EKC due to nosocomial infections in eye clinics in different parts of Japan. A total of 80 HAdVs were isolated from patients with EKC at eight different hospitals. The partial hexon gene sequences of the isolates were determined and compared to those of the prototype strains of 51 serotypes. All isolates had identical partial hexon nucleotide sequences. Phylogenetic analysis classified these isolates into species of HAdV-D. The isolates showed 93.9 to 96.7% nucleotide identity with HAdV-D prototype strains, while all 32 HAdV-D prototype strains ranged from 93.2 to 99.2% identity. The sequences of the loop 2 and fiber knob regions from the representative strain, Kobe-H, were dissimilar in all prototype strains of 51 serotypes. We believe that this virus is a novel serotype of HAdV that causes EKC. PMID:18385435
Molecular Insights Into the Evolutionary Pathway of Vibrio cholerae O1 Atypical El Tor Variants
Kim, Eun Jin; Lee, Dokyung; Moon, Se Hoon; Lee, Chan Hee; Kim, Sang Jun; Lee, Jae Hyun; Kim, Jae Ouk; Song, Manki; Das, Bhabatosh; Clemens, John D.; Pape, Jean William; Nair, G. Balakrish; Kim, Dong Wook
2014-01-01
Pandemic V. cholerae strains in the O1 serogroup have 2 biotypes: classical and El Tor. The classical biotype strains of the sixth pandemic, which encode the classical type cholera toxin (CT), have been replaced by El Tor biotype strains of the seventh pandemic. The prototype El Tor strains that produce biotype-specific cholera toxin are being replaced by atypical El Tor variants that harbor classical cholera toxin. Atypical El Tor strains are categorized into 2 groups, Wave 2 and Wave 3 strains, based on genomic variations and the CTX phage that they harbor. Whole-genome analysis of V. cholerae strains in the seventh cholera pandemic has demonstrated gradual changes in the genome of prototype and atypical El Tor strains, indicating that atypical strains arose from the prototype strains by replacing the CTX phages. We examined the molecular mechanisms that effected the emergence of El Tor strains with classical cholera toxin-carrying phage. We isolated an intermediary V. cholerae strain that carried two different CTX phages that encode El Tor and classical cholera toxin, respectively. We show here that the intermediary strain can be converted into various Wave 2 strains and can act as the source of the novel mosaic CTX phages. These results imply that the Wave 2 and Wave 3 strains may have been generated from such intermediary strains in nature. Prototype El Tor strains can become Wave 3 strains by excision of CTX-1 and re-equipping with the new CTX phages. Our data suggest that inter-chromosomal recombination between 2 types of CTX phages is possible when a host bacterial cell is infected by multiple CTX phages. Our study also provides molecular insights into population changes in V. cholerae in the absence of significant changes to the genome but by replacement of the CTX prophage that they harbor. PMID:25233006
Characterization of virulent West Nile virus Kunjin strain, Australia, 2011.
Frost, Melinda J; Zhang, Jing; Edmonds, Judith H; Prow, Natalie A; Gu, Xingnian; Davis, Rodney; Hornitzky, Christine; Arzey, Kathleen E; Finlaison, Deborah; Hick, Paul; Read, Andrew; Hobson-Peters, Jody; May, Fiona J; Doggett, Stephen L; Haniotis, John; Russell, Richard C; Hall, Roy A; Khromykh, Alexander A; Kirkland, Peter D
2012-05-01
To determine the cause of an unprecedented outbreak of encephalitis among horses in New South Wales, Australia, in 2011, we performed genomic sequencing of viruses isolated from affected horses and mosquitoes. Results showed that most of the cases were caused by a variant West Nile virus (WNV) strain, WNV(NSW2011), that is most closely related to WNV Kunjin (WNV(KUN)), the indigenous WNV strain in Australia. Studies in mouse models for WNV pathogenesis showed that WNV(NSW2011) is substantially more neuroinvasive than the prototype WNV(KUN) strain. In WNV(NSW2011), this apparent increase in virulence over that of the prototype strain correlated with at least 2 known markers of WNV virulence that are not found in WNV(KUN). Additional studies are needed to determine the relationship of the WNV(NSW2011) strain to currently and previously circulating WNV(KUN) strains and to confirm the cause of the increased virulence of this emerging WNV strain.
Greek Goat Encephalitis Virus Strain Isolated from Ixodes ricinus, Greece
Pavlidou, Vasiliki; Antoniadis, Antonis
2008-01-01
A strain of Greek goat encephaltitis virus was isolated from engorged Ixodes ricinus ticks that had fed on goats in northern Greece. The strain was almost identical to the prototype strain isolated 35 years ago. PMID:18258134
Kwon, Hyuk Moo; LeRoith, Tanya; Pudupakam, R S; Pierson, F William; Huang, Yao-Wei; Dryman, Barbara A; Meng, Xiang-Jin
2011-01-27
A genetically distinct strain of avian hepatitis E virus (avian HEV-VA strain) was isolated from a healthy chicken in Virginia, and thus it is important to characterize and compare its pathogenicity with the prototype strain (avian HEV-prototype) isolated from a diseased chicken. Here we first constructed an infectious clone of the avian HEV-VA strain. Capped RNA transcripts from the avian HEV-VA clone were replication-competent after transfection of LMH chicken liver cells. Chickens inoculated intrahepatically with RNA transcripts of avian HEV-VA clone developed active infection as evidenced by fecal virus shedding, viremia, and seroconversion. To characterize the pathogenicity, RNA transcripts of both avian HEV-VA and avian HEV-prototype clones were intrahepatically inoculated into the livers of chickens. Avian HEV RNA was detected in feces, serum and bile samples from 10/10 avian HEV-VA-inoculated and 9/9 avian HEV-prototype-inoculated chickens although seroconversion occurred only in some chickens during the experimental period. The histopathological lesion scores were lower for avian HEV-VA group than avian HEV-prototype group in the liver at 3 and 5 weeks post-inoculation (wpi) and in the spleen at 3 wpi, although the differences were not statistically significant. The liver/body weight ratio, indicative of liver enlargement, of both avian HEV-VA and avian HEV-prototype groups were significantly higher than that of the control group at 5 wpi. Overall, the avian HEV-VA strain still induces histological liver lesions even though it was isolated from a healthy chicken. The results also showed that intrahepatic inoculation of chickens with RNA transcripts of avian HEV infectious clone may serve as an alternative for live virus in animal pathogenicity studies. Copyright © 2010 Elsevier B.V. All rights reserved.
Maguari Virus Associated with Human Disease
Groseth, Allison; Vine, Veronica; Weisend, Carla; Guevara, Carolina; Watts, Douglas; Russell, Brandy; Tesh, Robert B.
2017-01-01
Despite the lack of evidence for symptomatic human infection with Maguari virus (MAGV), its close relation to Cache Valley virus (CVV), which does infect humans, remains a concern. We sequenced the complete genome of a MAGV-like isolate (OBS6657) obtained from a febrile patient in Pucallpa, Ucayali, Peru, in 1998. To facilitate its classification, we generated additional full-length sequences for the MAGV prototype strain, 3 additional MAGV-like isolates, and the closely related CVV (7 strains), Tlacotalpan (1 strain), Playas (3 strains), and Fort Sherman (1 strain) viruses. The OBS6657 isolate is similar to the MAGV prototype, whereas 2 of the other MAGV-like isolates are located on a distinct branch and most likely warrant classification as a separate virus species and 1 is, in fact, a misclassified CVV strain. Our findings provide clear evidence that MAGV can cause human disease. PMID:28726602
Definition of human rotavirus serotypes by plaque reduction assay.
Wyatt, R G; Greenberg, H B; James, W D; Pittman, A L; Kalica, A R; Flores, J; Chanock, R M; Kapikian, A Z
1982-01-01
Twenty different human rotavirus reassortants were characterized serologically by a plaque reduction assay as belonging to one of three distinct serotypes. Fourteen were similar if not identical to our prototype Wa strain; two were like the prototype DS-1 strain, and four belonged to a third serotype for which a prototype has not yet been selected. Hyperimmune sera raised against the three serotypes were required to distinguish among them, since postinfection sera had lower titers and were more cross-reactive than hyperimmune sera. These results confirmed the ability of a qualitative cytopathic neutralization test to predict correctly the Wa or DS-1 serotype. A strain of rhesus rotavirus (MMU 18006) was identified as belonging to the newly defined third serotype. Finally, an attempt was made to correlate previously published serotype analysis by neutralization of fluorescent cell-forming units with the results determined by the plaque reduction neutralization assay. PMID:6286487
Complete Genome Analysis of an Enterovirus EV-B83 Isolated in China.
Tang, Jingjing; Li, Qiongfen; Tian, Bingjun; Zhang, Jie; Li, Kai; Ding, Zhengrong; Lu, Lin
2016-07-12
Enterovirus B83 (EV-B83) is a recently identified member of enterovirus species B. It is a rarely reported serotype and up to date, only the complete genome sequence of the prototype strain from the United States is available. In this study, we describe the complete genomic characterization of an EV-B83 strain 246/YN/CHN/08HC isolated from a healthy child living in border region of Yunnan Province, China in 2008. Compared with the prototype strain, it had 79.6% similarity in the complete genome and 78.9% similarity in the VP1 coding region, reflecting the great genetic divergence among them. VP1-coding region alignment revealed it had 77.2-91.3% with other EV-B83 sequences available in GenBank. Similarity plot analysis revealed it had higher identity with several other EV-B serotypes than the EV-B83 prototype strain in the P2 and P3 coding region, suggesting multiple recombination events might have occurred. The great genetic divergence with previously isolated strains and the extremely rare isolation suggest this serotype has circulated at a low epidemic strength for many years. This is the first report of complete genome of EV-B83 in China.
Côrtes, Marina Farrel; Costa, Maiana OC; Lima, Nicholas CB; Souza, Rangel C; Almeida, Luiz GP; Guedes, Luciane Prioli Ciapina; Vasconcelos, Ana TR; Nicolás, Marisa F; Figueiredo, Agnes MS
2017-01-01
Staphylococcus aureus subsp. aureus, commonly referred as S. aureus, is an important bacterial pathogen frequently involved in hospital- and community-acquired infections in humans, ranging from skin infections to more severe diseases such as pneumonia, bacteraemia, endocarditis, osteomyelitis, and disseminated infections. Here, we report the complete closed genome sequence of a community-acquired methicillin-resistant S. aureus strain, USA400-0051, which is a prototype of the USA400 clone. PMID:29091141
Smart Textiles for Strengthening of Structures
NASA Astrophysics Data System (ADS)
Górski, Marcin; Krzywoń, Rafał; Dawczyński, Szymon; Szojda, Leszek; Salvado, Rita; Lopes, Catarina; Araujo, Pedro; Velez, Fernando Jose; Castro-Gomes, Joao
2016-11-01
This paper presents results of mechanical tests on a prototype of an innovative structural strengthening in form of self-monitoring fabric. Smart textile employs carbon fibers conductivity for measuring strains while monitoring changes of electric resistance under increasing load. A general solution was tested in a series of calibrating tests on strengthening of small size concrete slabs. Promising results of simple specimen, has encouraged the research team to perform the next tests using mastered carbon fibre reinforced fabric. Main tests were performed on natural scale RC beam. Smart textile proved its efficiency in both: strengthening and monitoring of strains during load increase. New strengthening proposal was given 10% increase of loading capacity and the readings of strain changes were similar to those obtained in classical methods. In order to calibrate the prototype and to define range limits of solution usability, textile sensor was tested in areas of large deformations (timber beam) and aswell as very small strains (bridge bearing block). In both cases, the prototype demonstrated excellent performance in the range of importance for structural engineering. This paper also presents an example of use of the smart strengthening in situ, in a real life conditions.
Oguntimein, Gbekeloluwa B; Rodriguez, Miguel; Dumitrache, Alexandru; Shollenberger, Todd; Decker, Stephen R; Davison, Brian H; Brown, Steven D
2018-02-01
To develop and prototype a high-throughput microplate assay to assess anaerobic microorganisms and lignocellulosic biomasses in a rapid, cost-effective screen for consolidated bioprocessing potential. Clostridium thermocellum parent Δhpt strain deconstructed Avicel to cellobiose, glucose, and generated lactic acid, formic acid, acetic acid and ethanol as fermentation products in titers and ratios similar to larger scale fermentations confirming the suitability of a plate-based method for C. thermocellum growth studies. C. thermocellum strain LL1210, with gene deletions in the key central metabolic pathways, produced higher ethanol titers in the Consolidated Bioprocessing (CBP) plate assay for both Avicel and switchgrass fermentations when compared to the Δhpt strain. A prototype microplate assay system is developed that will facilitate high-throughput bioprospecting for new lignocellulosic biomass types, genetic variants and new microbial strains for bioethanol production.
A Novel Recombinant Enterovirus Type EV-A89 with Low Epidemic Strength in Xinjiang, China
Fan, Qin; Zhang, Yong; Hu, Lan; Sun, Qiang; Cui, Hui; Yan, Dongmei; Sikandaner, Huerxidan; Tang, Haishu; Wang, Dongyan; Zhu, Zhen; Zhu, Shuangli; Xu, Wenbo
2015-01-01
Enterovirus A89 (EV-A89) is a novel member of the EV-A species. To date, only one full-length genome sequence (the prototype strain) has been published. Here, we report the molecular identification and genomic characterization of a Chinese EV-A89 strain, KSYPH-TRMH22F/XJ/CHN/2011, isolated in 2011 from a contact of an acute flaccid paralysis (AFP) patient during AFP case surveillance in Xinjiang China. This was the first report of EV-A89 in China. The VP1 coding sequence of this strain demonstrated 93.2% nucleotide and 99.3% amino acid identity with the EV-A89 prototype strain. In the P2 and P3 regions, the Chinese EV-A89 strain demonstrated markedly higher identity than the prototype strains of EV-A76, EV-A90, and EV-A91, indicating that one or more recombination events between EV-A89 and these EV-A types might have occurred. Long-term evolution of these EV types originated from the same ancestor provides the spatial and temporal circumstances for recombination to occur. An antibody sero-prevalence survey against EV-A89 in two Xinjiang prefectures demonstrated low positive rates and low titres of EV-A89 neutralization antibody, suggesting limited range of transmission and exposure to the population. This study provides a solid foundation for further studies on the biological and pathogenic properties of EV-A89. PMID:26685900
A Novel Recombinant Enterovirus Type EV-A89 with Low Epidemic Strength in Xinjiang, China.
Fan, Qin; Zhang, Yong; Hu, Lan; Sun, Qiang; Cui, Hui; Yan, Dongmei; Sikandaner, Huerxidan; Tang, Haishu; Wang, Dongyan; Zhu, Zhen; Zhu, Shuangli; Xu, Wenbo
2015-12-21
Enterovirus A89 (EV-A89) is a novel member of the EV-A species. To date, only one full-length genome sequence (the prototype strain) has been published. Here, we report the molecular identification and genomic characterization of a Chinese EV-A89 strain, KSYPH-TRMH22F/XJ/CHN/2011, isolated in 2011 from a contact of an acute flaccid paralysis (AFP) patient during AFP case surveillance in Xinjiang China. This was the first report of EV-A89 in China. The VP1 coding sequence of this strain demonstrated 93.2% nucleotide and 99.3% amino acid identity with the EV-A89 prototype strain. In the P2 and P3 regions, the Chinese EV-A89 strain demonstrated markedly higher identity than the prototype strains of EV-A76, EV-A90, and EV-A91, indicating that one or more recombination events between EV-A89 and these EV-A types might have occurred. Long-term evolution of these EV types originated from the same ancestor provides the spatial and temporal circumstances for recombination to occur. An antibody sero-prevalence survey against EV-A89 in two Xinjiang prefectures demonstrated low positive rates and low titres of EV-A89 neutralization antibody, suggesting limited range of transmission and exposure to the population. This study provides a solid foundation for further studies on the biological and pathogenic properties of EV-A89.
Campbell, Jacquelyn A.; Schelling, Pierre; Wetzel, J. Denise; Johnson, Elizabeth M.; Forrest, J. Craig; Wilson, Greame A. R.; Aurrand-Lions, Michel; Imhof, Beat A.; Stehle, Thilo; Dermody, Terence S.
2005-01-01
Reovirus infections are initiated by the binding of viral attachment protein σ1 to receptors on the surface of host cells. The σ1 protein is an elongated fiber comprised of an N-terminal tail that inserts into the virion and a C-terminal head that extends from the virion surface. The prototype reovirus strains type 1 Lang/53 (T1L/53) and type 3 Dearing/55 (T3D/55) use junctional adhesion molecule A (JAM-A) as a receptor. The C-terminal half of the T3D/55 σ1 protein interacts directly with JAM-A, but the determinants of receptor-binding specificity have not been identified. In this study, we investigated whether JAM-A also mediates the attachment of the prototype reovirus strain type 2 Jones/55 (T2J/55) and a panel of field-isolate strains representing each of the three serotypes. Antibodies specific for JAM-A were capable of inhibiting infections of HeLa cells by T1L/53, T2J/55, and T3D/55, demonstrating that strains of all three serotypes use JAM-A as a receptor. To corroborate these findings, we introduced JAM-A or the structurally related JAM family members JAM-B and JAM-C into Chinese hamster ovary cells, which are poorly permissive for reovirus infection. Both prototype and field-isolate reovirus strains were capable of infecting cells transfected with JAM-A but not those transfected with JAM-B or JAM-C. A sequence analysis of the σ1-encoding S1 gene segment of the strains chosen for study revealed little conservation in the deduced σ1 amino acid sequences among the three serotypes. This contrasts markedly with the observed sequence variability within each serotype, which is confined to a small number of amino acids. Mapping of these residues onto the crystal structure of σ1 identified regions of conservation and variability, suggesting a likely mode of JAM-A binding via a conserved surface at the base of the σ1 head domain. PMID:15956543
Oguntimein, Gbekeloluwa B.; Rodriguez, Jr., Miguel; Dumitrache, Alexandru; ...
2017-11-09
Here, to develop and prototype a high-throughput microplate assay to assess anaerobic microorganisms and lignocellulosic biomasses in a rapid, cost-effective screen for consolidated bioprocessing potential. Clostridium thermocellum parent Δ hpt strain deconstructed Avicel to cellobiose, glucose, and generated lactic acid, formic acid, acetic acid and ethanol as fermentation products in titers and ratios similar to larger scale fermentations confirming the suitability of a plate-based method for C. thermocellum growth studies. C. thermocellum strain LL1210, with gene deletions in the key central metabolic pathways, produced higher ethanol titers in the Consolidated Bioprocessing (CBP) plate assay for both Avicel and switchgrass fermentationsmore » when compared to the Δ hpt strain. A prototype microplate assay system is developed that will facilitate high-throughput bioprospecting for new lignocellulosic biomass types, genetic variants and new microbial strains for bioethanol production.« less
DOE Office of Scientific and Technical Information (OSTI.GOV)
Oguntimein, Gbekeloluwa B.; Rodriguez, Jr., Miguel; Dumitrache, Alexandru
Here, to develop and prototype a high-throughput microplate assay to assess anaerobic microorganisms and lignocellulosic biomasses in a rapid, cost-effective screen for consolidated bioprocessing potential. Clostridium thermocellum parent Δ hpt strain deconstructed Avicel to cellobiose, glucose, and generated lactic acid, formic acid, acetic acid and ethanol as fermentation products in titers and ratios similar to larger scale fermentations confirming the suitability of a plate-based method for C. thermocellum growth studies. C. thermocellum strain LL1210, with gene deletions in the key central metabolic pathways, produced higher ethanol titers in the Consolidated Bioprocessing (CBP) plate assay for both Avicel and switchgrass fermentationsmore » when compared to the Δ hpt strain. A prototype microplate assay system is developed that will facilitate high-throughput bioprospecting for new lignocellulosic biomass types, genetic variants and new microbial strains for bioethanol production.« less
Almahmoud, Safieh; Vahdati, Nader; Rostron, Paul
2018-01-01
A monitoring solution was developed for detection of material loss in metals such as carbon steel using the force generated by permanent magnets in addition to the optical strain sensing technology. The working principle of the sensing system is related to the change in thickness of a steel plate, which typically occurs due to corrosion. As thickness decreases, the magnetostatic force between the magnet and the steel structure also decreases. This, in turn, affects the strain measured using the optical fiber. The sensor prototype was designed and built after verifying its sensitivity using a numerical model. The prototype was tested on steel plates of different thicknesses to establish the relationship between the metal thickness and measured strain. The results of experiments and numerical models demonstrate a strong relationship between the metal thickness and the measured strain values. PMID:29518006
Prototype to measure bracket debonding force in vivo.
Tonus, Jéssika Lagni; Manfroi, Fernanda Borguetti; Borges, Gilberto Antonio; Grigolo, Eduardo Correa; Helegda, Sérgio; Spohr, Ana Maria
2017-02-01
Material biodegradation that occurs in the mouth may interfere in the bonding strength between the bracket and the enamel, causing lower bond strength values in vivo, in comparison with in vitro studies. To develop a prototype to measure bracket debonding force in vivo and to evaluate, in vitro, the bond strength obtained with the prototype. A original plier (3M Unitek) was modified by adding one strain gauge directly connected to its claw. An electronic circuit performed the reading of the strain gauge, and the software installed in a computer recorded the values of the bracket debonding force, in kgf. Orthodontic brackets were bonded to the facial surface of 30 bovine incisors with adhesive materials. In Group 1 (n = 15), debonding was carried out with the prototype, while tensile bond strength testing was performed in Group 2 (n = 15). A universal testing machine was used for the second group. The adhesive remnant index (ARI) was recorded. According to Student's t test (α = 0.05), Group 1 (2.96 MPa) and Group 2 (3.08 MPa) were not significantly different. ARI score of 3 was predominant in the two groups. The prototype proved to be reliable for obtaining in vivo bond strength values for orthodontic brackets.
Escherichia coli mastitis strains: In vitro phenotypes and severity of infection in vivo.
Roussel, Perrine; Porcherie, Adeline; Répérant-Ferter, Maryline; Cunha, Patricia; Gitton, Christophe; Rainard, Pascal; Germon, Pierre
2017-01-01
Mastitis remains a major infection of dairy cows and an important issue for dairy farmers and the dairy industry, in particular infections due to Escherichia coli strains. So far, properties specific to E. coli causing mastitis remain ill defined. In an attempt to better understand the properties required for E. coli to trigger mastitis, we used a range of in vitro assays to phenotypically characterize four E. coli strains, including the prototypical E. coli mastitis strain P4, possessing different relative abilities to cause mastitis in a mouse model. Our results indicate that a certain level of serum resistance might be required for colonization of the mammary gland. Resistance to neutrophil killing is also likely to contribute to a slower clearance of bacteria and higher chances to colonize the udder. In addition, we show that the four different strains do induce a pro-inflammatory response by mammary epithelial cells but with different intensities. Interestingly, the prototypical mastitis strain P4 actually induces the less intense response while it is responsible for the most severe infections in vivo. Altogether, our results suggest that different strategies can be used by E. coli strains to colonize the mammary gland and cause mastitis.
Whole-genome sequence of Escherichia coli serotype O157:H7 strain EDL932 (ATCC 43894)
USDA-ARS?s Scientific Manuscript database
Escherichia coli serotype O157:H7 EDL 933 is a ground beef isolate associated with a 1983 hemorrhagic colitis outbreak. Considered the prototype O157:H7 strain, its derived genome sequence is a standard reference strain for comparative genomic studies of Shiga toxin-producing E. coli (STEC). Here we...
Prototype to measure bracket debonding force in vivo
Tonus, Jéssika Lagni; Manfroi, Fernanda Borguetti; Borges, Gilberto Antonio; Grigolo, Eduardo Correa; Helegda, Sérgio; Spohr, Ana Maria
2017-01-01
ABSTRACT Introduction: Material biodegradation that occurs in the mouth may interfere in the bonding strength between the bracket and the enamel, causing lower bond strength values in vivo, in comparison with in vitro studies. Objective: To develop a prototype to measure bracket debonding force in vivo and to evaluate, in vitro, the bond strength obtained with the prototype. Methods: A original plier (3M Unitek) was modified by adding one strain gauge directly connected to its claw. An electronic circuit performed the reading of the strain gauge, and the software installed in a computer recorded the values of the bracket debonding force, in kgf. Orthodontic brackets were bonded to the facial surface of 30 bovine incisors with adhesive materials. In Group 1 (n = 15), debonding was carried out with the prototype, while tensile bond strength testing was performed in Group 2 (n = 15). A universal testing machine was used for the second group. The adhesive remnant index (ARI) was recorded. Results: According to Student’s t test (α = 0.05), Group 1 (2.96 MPa) and Group 2 (3.08 MPa) were not significantly different. ARI score of 3 was predominant in the two groups. Conclusion: The prototype proved to be reliable for obtaining in vivo bond strength values for orthodontic brackets. PMID:28444011
Hierholzer, J C; Pumarola, A
1976-01-01
An unusual variant of adenovirus (AV) 11 was isolated from throat and rectal swabs from six persons with upper respiratory illness in a Spanish military camp in March 1969. The same strain was serologically related to the upper respiratory illness of seven other men among 25 sample cases studied in detail. After strain purification, the virus was grouped as an AV by standard biological tests; it possessed the usual titers of group-specific hexon antigen but only low hemagglutinin titers (1:4 to 1:8) with erythrocytes from selected rhesus monkeys. The virus gave little reaction in hemagglutination inhibition (HI) tests with antisera to AV 1 through 35, but was neutralized to homologous titers by AV 11 antiserum. Reciprocally, rabbit and guinea pig antisera to the isolates possessed high HI antibody titers to prototype AV 14 and high serum neutralization (SN) antibody titers to prototype AV 11. On this basis, the variants were classified as AV 14-11 intermediates. Sequential serum specimens from the patients with and without positive cultures showed diagnostic rises in HI and SN antibody levels to the AV 14-11 intermediate and to prototype AV 11, but little response to AV 14. PMID:177365
Goldstone, Robert J.; Talbot, Richard; Schuberth, Hans-Joachim; Sandra, Olivier; Sheldon, I. Martin
2014-01-01
Specific Escherichia coli strains associated with bovine postpartum uterine infection have recently been described. Many recognized virulence factors are absent in these strains; therefore, to define a prototypic strain, we report here the genome sequence of E. coli isolate MS499 from a cow with the postpartum disease metritis. PMID:24994791
Yi, Yanjie; Isaacs, Stuart N.; Williams, Darlisha A.; Frank, Ian; Schols, Dominique; De Clercq, Erik; Kolson, Dennis L.; Collman, Ronald G.
1999-01-01
Dual-tropic human immunodeficiency virus type 1 (HIV-1) strains infect both primary macrophages and transformed T-cell lines. Prototype T-cell line-tropic (T-tropic) strains use CXCR4 as their principal entry coreceptor (X4 strains), while macrophagetropic (M-tropic) strains use CCR5 (R5 strains). Prototype dual tropic strains use both coreceptors (R5X4 strains). Recently, CXCR4 expressed on macrophages was found to support infection by certain HIV-1 isolates, including the dual-tropic R5X4 strain 89.6, but not by T-tropic X4 prototypes like 3B. To better understand the cellular basis for dual tropism, we analyzed the macrophage coreceptors used for Env-mediated cell-cell fusion as well as infection by several dual-tropic HIV-1 isolates. Like 89.6, the R5X4 strain DH12 fused with and infected both wild-type and CCR5-negative macrophages. The CXCR4-specific inhibitor AMD3100 blocked DH12 fusion and infection in macrophages that lacked CCR5 but not in wild-type macrophages. This finding indicates two independent entry pathways in macrophages for DH12, CCR5 and CXCR4. Three primary isolates that use CXCR4 but not CCR5 (tybe, UG021, and UG024) replicated efficiently in macrophages regardless of whether CCR5 was present, and AMD3100 blocking of CXCR4 prevented infection in both CCR5 negative and wild-type macrophages. Fusion mediated by UG021 and UG024 Envs in both wild-type and CCR5-deficient macrophages was also blocked by AMD3100. Therefore, these isolates use CXCR4 exclusively for entry into macrophages. These results confirm that macrophage CXCR4 can be used for fusion and infection by primary HIV-1 isolates and indicate that CXCR4 may be the sole macrophage coreceptor for some strains. Thus, dual tropism can result from two distinct mechanisms: utilization of both CCR5 and CXCR4 on macrophages and T-cell lines, respectively (dual-tropic R5X4), or the ability to efficiently utilize CXCR4 on both macrophages and T-cell lines (dual-tropic X4). PMID:10438797
USDA-ARS?s Scientific Manuscript database
Genomes from fifteen porcine reproductive and respiratory syndrome virus (PRRSV) isolates were derived simultaneously using 454 pyrosequencing technology. The viral isolates sequenced were from a recent swine study, in which engineered Type 2 prototype PRRSV strain VR-2332 mutants, with 87, 184, 200...
Finite Element Analysis of Elastomeric Seals for LIDS
NASA Technical Reports Server (NTRS)
Oswald, Jay J.; Daniels, Christopher C.
2007-01-01
Objective: Create a means of evaluating seals w/o prototypes. Motivation: Cost Prototype 54" seal approx.$100k per seal pair FEA license + high end workstation approx. $30k per year. Development time: 6 months lead time for a new seal design Many designs per day (solution time <1 minute) Understanding: Difficult to experimentally measure strains, contact pressure profile, stresses, displacements
The 987P fimbrial gene cluster of enterotoxigenic Escherichia coli is plasmid encoded.
Schifferli, D M; Beachey, E H; Taylor, R K
1990-01-01
A clone containing the 987P fimbrial gene cluster was selected from a cosmid library of total DNA of the prototype Escherichia coli strain 987 by using 987P-specific antiserum. A subclone of 12 kilobases containing all of the genes required for fimbrial expression on a nonfimbriated K-12 strain of E. coli and a DNA fragment internal to the fimbrial subunit gene were used to probe the prototype strain and various isolates of 987P-fimbriated enterotoxigenic E. coli. All strains had several plasmids, as shown by agarose gel electrophoresis, and each of five strains which expressed 987P fimbriae showed a plasmid of 35 to 40 megadaltons (MDa) hybridizing to both 987P-specific probes. Hybridization to restricted DNA of strain 987 supported a plasmid origin for the cloned 987P gene cluster. Moreover, an isogenic strain which had lost its 35-MDa plasmid was no longer capable of synthesizing fimbrial subunits, but regained fimbrial expression after reintroduction of the TnphoA (Tn5 IS50L::phoA)-tagged 35-MDa plasmid. Absence of fimbrial subunit synthesis in K-12 strains transformed with the 35-MDa plasmid alone suggested the requirement of regulatory elements existing in strain 987 but missing in K-12 strains. A probe for the heat-stable enterotoxin STIa hybridized in each of the 987P-fimbriated strains to the plasmid containing the 987P genes and in most of these strains to an additional plasmid which contained the gene for the heat-stable enterotoxin STII. Occurrence of the 987P and STIa genes on the same replicon correlates with epidemiological observations, STIa being the most prevalent toxin produced by 987P-fimbriated E. coli. Images PMID:1967167
McCarthy, Troy; Lebeck, Mark G.; Capuano, Ana W.; Schnurr, David P.; Gray, Gregory C.
2009-01-01
Background Epidemiological data suggest that clinical outcomes of human adenovirus (HAdV) infection may be influenced by virus serotype, coinfection with multiple strains, or infection with novel intermediate strains. In this report, we propose a clinical algorithm for detecting HAdV coinfection and intermediate strains. Study Design We PCR amplified and sequenced subregions of the hexon and fiber genes of 342 HAdV positive clinical specimens obtained from 14 surveillance laboratories. Sequences were then compared with those from 52 HAdV prototypic strains. HAdV positive specimens that showed nucleotide sequence identity with a corresponding prototype strain were designated as being of that strain. When hexon and fiber gene sequences disagreed, or sequence identity was low, the specimens were further characterized by viral culture, plaque purification, repeat PCR with sequencing, and genome restriction enzyme digest analysis. Results Of the 342 HAdV-positive clinical specimens, 328 (95.9%) were single HAdV strain infections, 12 (3.5%) were coinfections, and 2 (0.6%) had intermediate strains. Coinfected specimens and intermediate HAdV strains considered together were more likely to be associated with severe illness compared to other HAdv-positive specimens (OR=3.8; 95% CI = 1.2–11.9). Conclusions The majority of severe cases of HAdV illness cases occurred among immunocompromised patients. The analytic algorithm we describe here can be used to screen clinical specimens for evidence of HAdV coinfection and novel intermediate HAdV strains. This algorithm may be especially useful in investigating HAdV outbreaks and clusters of unusually severe HAdV disease. PMID:19577957
Thick film wireless and powerless strain sensor
NASA Astrophysics Data System (ADS)
Jia, Yi; Sun, Ke
2006-03-01
The development of an innovative wireless strain sensing technology has a great potential to extend its applications in manufacturing, civil engineering and aerospace industry. This paper presents a novel wireless and powerless strain sensor with a multi-layer thick film structure. The sensor employs a planar inductor (L) and capacitive transducer (C) resonant tank sensing circuit, and a strain sensitive material of a polarized polyvinylidene fluoride (PVDF) piezoelectric thick film to realize the wireless strain sensing by strain to frequency conversion and to receive radio frequency electromagnetic energy for powering the sensor. The prototype sensor was designed and fabricated. The results of calibration on a strain constant cantilever beam show a great linearity and sensitivity about 0.0013 in a strain range of 0-0.018.
Development of an Active Twist Rotor for Wind: Tunnel Testing (NLPN97-310
NASA Technical Reports Server (NTRS)
Cesnik, Carlos E. S.; Shin, SangJoon; Hagood, Nesbitt W., IV
1998-01-01
The development of the Active Twist Rotor prototype blade for hub vibration and noise reduction studies is presented in this report. Details of the modeling, design, and manufacturing are explored. The rotor blade is integrally twisted by direct strain actuation. This is accomplished by distributing embedded piezoelectric fiber composites along the span of the blade. The development of the analysis framework for this type of active blade is presented. The requirements for the prototype blade, along with the final design results are also presented. A detail discussion on the manufacturing aspects of the prototype blade is described. Experimental structural characteristics of the prototype blade compare well with design goals, and preliminary bench actuation tests show lower performance than originally predicted. Electrical difficulties with the actuators are also discussed. The presented prototype blade is leading to a complete fully articulated four-blade active twist rotor system for future wind tunnel tests.
Aoki, Koki; Ishiko, Hiroaki; Konno, Tsunetada; Shimada, Yasushi; Hayashi, Akio; Kaneko, Hisatoshi; Ohguchi, Takeshi; Tagawa, Yoshitsugu; Ohno, Shigeaki; Yamazaki, Shudo
2008-01-01
In a 2-month period in 2003, we encountered an outbreak of epidemic keratoconjunctivitis (EKC) in Japan. We detected 67 human adenoviruses (HAdVs) by PCR from eye swabs of patients with EKC at five eye clinics in different parts of Japan. Forty-one of the 67 HAdV DNAs from the swabs were identified as HAdV-37 by phylogenetic analysis using a partial hexon gene sequence. When the restriction patterns of these viral genomes were compared with that of the HAdV-37 prototype strain, one isolate showed a never-before-seen restriction pattern. Within 1 year, we encountered three more EKC cases caused by a genetically identical virus: two nosocomial infections at two different university hospitals and a sporadic infection at an eye clinic. We determined the nucleotide sequences of the full-length hexon and fiber genes of these isolates and compared them to those of the 51 prototype strains. Surprisingly, the sequence of the hexon (ɛ determinant) loop-1 and -2 regions showed the highest nucleotide identity with HAdV-22, a rare EKC isolate. However, the nucleotide sequence of the fiber gene was identical to that of the HAdV-8 prototype strain. 22 We propose that this virus is a new hexon-chimeric intermediate HAdV-22,37/H8, and may be an etiological agent of EKC. PMID:18701656
Detection and molecular characterization of J subgroup avian leukosis virus in wild ducks in China.
Zeng, Xiangwei; Liu, Lanlan; Hao, Ruijun; Han, Chunyan
2014-01-01
To assess the status of avian leukosis virus subgroup J (ALV-J) in wild ducks in China, we examined samples from 528 wild ducks, representing 17 species, which were collected in China over the past 3 years. Virus isolation and PCR showed that 7 ALV-J strains were isolated from wild ducks. The env genes and the 3'UTRs from these isolates were cloned and sequenced. The env genes of all 7 wild duck isolates were significantly different from those in the prototype strain HPRS-103, American strains, broiler ALV-J isolates and Chinese local chicken isolates, but showed close homology with those found in some layer chicken ALV-J isolates and belonged to the same group. The 3'UTRs of 7 ALV-J wild ducks isolates showed close homology with the prototype strain HPRS-103 and no obvious deletion was found in the 3'UTR except for a 1 bp deletion in the E element that introduced a binding site for c-Ets-1. Our study demonstrated the presence of ALV-J in wild ducks and investigated the molecular characterization of ALV-J in wild ducks isolates.
Probe Without Moving Parts Measures Flow Angle
NASA Technical Reports Server (NTRS)
Corda, Stephen; Vachon, M. Jake
2003-01-01
The measurement of local flow angle is critical in many fluid-dynamic applications, including the aerodynamic flight testing of new aircraft and flight systems. Flight researchers at NASA Dryden Flight Research Center have recently developed, flight-tested, and patented the force-based flow-angle probe (FLAP), a novel, force-based instrument for the measurement of local flow direction. Containing no moving parts, the FLAP may provide greater simplicity, improved accuracy, and increased measurement access, relative to conventional moving vane-type flow-angle probes. Forces in the FLAP can be measured by various techniques, including those that involve conventional strain gauges (based on electrical resistance) and those that involve more advanced strain gauges (based on optical fibers). A correlation is used to convert force-measurement data to the local flow angle. The use of fiber optics will enable the construction of a miniature FLAP, leading to the possibility of flow measurement in very small or confined regions. This may also enable the tufting of a surface with miniature FLAPs, capable of quantitative flow-angle measurements, similar to attaching yarn tufts for qualitative measurements. The prototype FLAP was a small, aerodynamically shaped, low-aspect-ratio fin about 2 in. (approximately equal to 5 cm) long, 1 in. (approximately equal to 2.5 cm) wide, and 0.125 in. (approximately equal to 0.3 cm) thick (see Figure 1). The prototype FLAP included simple electrical-resistance strain gauges for measuring forces. Four strain gauges were mounted on the FLAP; two on the upper surface and two on the lower surface. The gauges were connected to form a full Wheatstone bridge, configured as a bending bridge. In preparation for a flight test, the prototype FLAP was mounted on the airdata boom of a flight-test fixture (FTF) on the NASA Dryden F-15B flight research airplane.
Research pressure instrumentation for NASA Space Shuttle main engine
NASA Technical Reports Server (NTRS)
Anderson, P. J.; Nussbaum, P.; Gustafson, G.
1984-01-01
The development of prototype pressure transducers which are targeted to meet the Space Shuttle Main Engine SSME performance design goals is discussed. The fabrication, testing and delivery of 10 prototype units is examined. Silicon piezoresistive strain sensing technology is used to achieve the objectives of advanced state-of-the-art pressure sensors in terms of reliability, accuracy and ease of manufacture. Integration of multiple functions on a single chip is the key attribute of this technology.
Very High Load Capacity Air Bearing Spindle for Large Diamond Turning Machines
2010-06-08
testing and a surplus air bearing rotary table has been located. A prototype spindle has been designed to work with the table. 15. SUBJECT TERMS...MSFC) • PROTOTYPE SPINDLE DESIGN June 8, 2010Mirror Technology Workshop 3 Introduction • DT is a proven method of manufacturing aspheric off-axis... designed to hold in a strain-free condition. This spindle development is aimed at producing 3 meter diameter components. This requirement results in the
Autobalancing and FDIR for a space-based centrifuge prototype
NASA Technical Reports Server (NTRS)
Wilson, Edward; Mah, Robert W.
2005-01-01
This report summarizes centrifuge-related work performed at the Smart Systems Research Laboratory at NASA Ames Research Center's Computational Sciences Division from 1995 through 2003. The goal is to develop an automated system that will sense an imbalance (both static and dynamic3) in a centrifuge and issue control commands to drive counterweights to eliminate the effects of the imbalance. This autobalancing development began when the ISS centrifuge design was not yet finalized, and was designed to work with the SSRL Centrifuge laboratory prototype, constructed in 1993-1995. Significant differences between that prototype and the current International Space Station (ISS) Centrifuge design are that: the spin axis for the SSRL Centrifuge prototype can translate freely in x and y, but not wobble, whereas the ISS centrifuge spin axis has 3 translational and two rotational degrees of freedom, supported by a vibration 34. The imbalance sensors are strained gauges both in the rotor and the stator, measuring the imbalance forces, whereas the ISS centrifuge uses eddy current displacement sensors to measure the displacements resulting from imbalance. High fidelity autobalancing and FDIR systems (for both counterweights and strain gauges) are developed and tested in MATLAB simulation, for the SSRL Centrifuge configuration. Hardware implementation of the autobalancing technology was begun in 1996, but was terminated due to lack of funding. The project lay dormant until 2001-2002 when the FDIR capability was added.
Ravignani, Andrea; Olivera, Vicente Matellán; Gingras, Bruno; Hofer, Riccardo; Hernández, Carlos Rodríguez; Sonnweber, Ruth-Sophie; Fitch, W. Tecumseh
2013-01-01
The possibility of achieving experimentally controlled, non-vocal acoustic production in non-human primates is a key step to enable the testing of a number of hypotheses on primate behavior and cognition. However, no device or solution is currently available, with the use of sensors in non-human animals being almost exclusively devoted to applications in food industry and animal surveillance. Specifically, no device exists which simultaneously allows: (i) spontaneous production of sound or music by non-human animals via object manipulation, (ii) systematical recording of data sensed from these movements, (iii) the possibility to alter the acoustic feedback properties of the object using remote control. We present two prototypes we developed for application with chimpanzees (Pan troglodytes) which, while fulfilling the aforementioned requirements, allow to arbitrarily associate sounds to physical object movements. The prototypes differ in sensing technology, costs, intended use and construction requirements. One prototype uses four piezoelectric elements embedded between layers of Plexiglas and foam. Strain data is sent to a computer running Python through an Arduino board. A second prototype consists in a modified Wii Remote contained in a gum toy. Acceleration data is sent via Bluetooth to a computer running Max/MSP. We successfully pilot tested the first device with a group of chimpanzees. We foresee using these devices for a range of cognitive experiments. PMID:23912427
Ravignani, Andrea; Matellán Olivera, Vicente; Gingras, Bruno; Hofer, Riccardo; Rodríguez Hernández, Carlos; Sonnweber, Ruth-Sophie; Fitch, W Tecumseh
2013-07-31
The possibility of achieving experimentally controlled, non-vocal acoustic production in non-human primates is a key step to enable the testing of a number of hypotheses on primate behavior and cognition. However, no device or solution is currently available, with the use of sensors in non-human animals being almost exclusively devoted to applications in food industry and animal surveillance. Specifically, no device exists which simultaneously allows: (i) spontaneous production of sound or music by non-human animals via object manipulation, (ii) systematical recording of data sensed from these movements, (iii) the possibility to alter the acoustic feedback properties of the object using remote control. We present two prototypes we developed for application with chimpanzees (Pan troglodytes) which, while fulfilling the aforementioned requirements, allow to arbitrarily associate sounds to physical object movements. The prototypes differ in sensing technology, costs, intended use and construction requirements. One prototype uses four piezoelectric elements embedded between layers of Plexiglas and foam. Strain data is sent to a computer running Python through an Arduino board. A second prototype consists in a modified Wii Remote contained in a gum toy. Acceleration data is sent via Bluetooth to a computer running Max/MSP. We successfully pilot tested the first device with a group of chimpanzees. We foresee using these devices for a range of cognitive experiments.
USDA-ARS?s Scientific Manuscript database
An infectious clone of a highly pathogenic PRRSV strain from Vietnam (rSRV07) was prepared, analyzed and compared to Chinese highly pathogenic PRRSV rJXwn06 and US Type 2 prototype VR-2332 in order to examine the effects of virus phenotype and genotype on growth in MARC-145 cells, as well as the imp...
Li, Yi-Ping; Ramirez, Santseharay; Mikkelsen, Lotte; Bukh, Jens
2015-01-01
The first discovered and sequenced hepatitis C virus (HCV) genome and the first in vivo infectious HCV clones originated from the HCV prototype strains HCV-1 and H77, respectively, both widely used in research of this important human pathogen. In the present study, we developed efficient infectious cell culture systems for these genotype 1a strains by using the HCV-1/SF9_A and H77C in vivo infectious clones. We initially adapted a genome with the HCV-1 5'UTR-NS5A (where UTR stands for untranslated region) and the JFH1 NS5B-3'UTR (5-5A recombinant), including the genotype 2a-derived mutations F1464L/A1672S/D2979G (LSG), to grow efficiently in Huh7.5 cells, thus identifying the E2 mutation S399F. The combination of LSG/S399F and reported TNcc(1a)-adaptive mutations A1226G/Q1773H/N1927T/Y2981F/F2994S promoted adaptation of the full-length HCV-1 clone. An HCV-1 recombinant with 17 mutations (HCV1cc) replicated efficiently in Huh7.5 cells and produced supernatant infectivity titers of 10(4.0) focus-forming units (FFU)/ml. Eight of these mutations were identified from passaged HCV-1 viruses, and the A970T/I1312V/C2419R/A2919T mutations were essential for infectious particle production. Using CD81-deficient Huh7 cells, we further demonstrated the importance of A970T/I1312V/A2919T or A970T/C2419R/A2919T for virus assembly and that the I1312V/C2419R combination played a major role in virus release. Using a similar approach, we found that NS5B mutation F2994R, identified here from culture-adapted full-length TN viruses and a common NS3 helicase mutation (S1368P) derived from viable H77C and HCV-1 5-5A recombinants, initiated replication and culture adaptation of H77C containing LSG and TNcc(1a)-adaptive mutations. An H77C recombinant harboring 19 mutations (H77Ccc) replicated and spread efficiently after transfection and subsequent infection of naive Huh7.5 cells, reaching titers of 10(3.5) and 10(4.4) FFU/ml, respectively. Hepatitis C virus (HCV) was discovered in 1989 with the cloning of the prototype strain HCV-1 genome. In 1997, two molecular clones of H77, the other HCV prototype strain, were shown to be infectious in chimpanzees, but not in vitro. HCV research was hampered by a lack of infectious cell culture systems, which became available only in 2005 with the discovery of JFH1 (genotype 2a), a genome that could establish infection in Huh7.5 cells. Recently, we developed in vitro infectious clones for genotype 1a (TN), 2a (J6), and 2b (J8, DH8, and DH10) strains by identifying key adaptive mutations. Globally, genotype 1 is the most prevalent. Studies using HCV-1 and H77 prototype sequences have generated important knowledge on HCV. Thus, the in vitro infectious clones developed here for these 1a strains will be of particular value in advancing HCV research. Moreover, our findings open new avenues for the culture adaptation of HCV isolates of different genotypes. Copyright © 2015, American Society for Microbiology. All Rights Reserved.
Yamashita, Teruo; Ito, Miyabi; Tsuzuki, Hideaki; Sakae, Kenji; Minagawa, Hiroko
2010-04-01
Of 58 enterovirus strains isolated from Japanese travellers returning from Asian countries, eight were non-serotypable with existing antisera. By sequencing a part of the VP1 region, six of these strains were typed as echovirus 9, enterovirus (EV)-73, EV-79 or EV-97. The nucleotide identity of the VP1 region of isolate T92-1499 to all enterovirus prototypes was <70 %. The VP1 sequence of isolate TN94-0349 was closely related to coxsackievirus (CV)-A9 (73.3 % nucleotide identity), but the virus could not be neutralized with a serum raised against the prototype CV-A9 strain. On the basis of complete molecular comparisons, T92-1499 and TN94-0349 were identified as EV-98 and EV-107, respectively, by the ICTV Picornavirus Study Group. Serum neutralization tests of Japanese individuals revealed a seroprevalence rate of 11 % for EV-73, and even lower seroprevalence rates, 1.0-3.8 %, were found for the other new enteroviruses, suggesting that prior circulation of these viruses in Japan was unlikely.
Delayed Disease Progression in Cynomolgus Macaques Infected with Ebola Virus Makona Strain.
Marzi, Andrea; Feldmann, Friederike; Hanley, Patrick W; Scott, Dana P; Günther, Stephan; Feldmann, Heinz
2015-10-01
In late 2013, the largest documented outbreak of Ebola hemorrhagic fever started in Guinea and has since spread to neighboring countries, resulting in almost 27,000 cases and >11,000 deaths in humans. In March 2014, Ebola virus (EBOV) was identified as the causative agent. This study compares the pathogenesis of a new EBOV strain, Makona, which was isolated in Guinea in 2014 with the prototype strain from the 1976 EBOV outbreak in the former Zaire. Both strains cause lethal disease in cynomolgus macaques with similar pathologic changes and hallmark features of Ebola hemorrhagic fever. However, disease progression was delayed in EBOV-Makona-infected animals, suggesting decreased rather than increased virulence of this most recent EBOV strain.
Ergonomics of disposable handles for minimally invasive surgery.
Büchel, D; Mårvik, R; Hallabrin, B; Matern, U
2010-05-01
The ergonomic deficiencies of currently available minimally invasive surgery (MIS) instrument handles have been addressed in many studies. In this study, a new ergonomic pistol handle concept, realized as a prototype, and two disposable ring handles were investigated according to ergonomic properties set by new European standards. In this study, 25 volunteers performed four practical tasks to evaluate the ergonomics of the handles used in standard operating procedures (e.g., measuring a suture and cutting to length, precise maneuvering and targeting, and dissection of a gallbladder). Moreover, 20 participants underwent electromyography (EMG) tests to measure the muscle strain they experienced while carrying out the basic functions (grasp, rotate, and maneuver) in the x, y, and z axes. The data measured included the number of errors, the time required for task completion, perception of pressure areas, and EMG data. The values for usability in the test were effectiveness, efficiency, and user satisfaction. Surveys relating to the subjective rating were completed after each task for each of the three handles tested. Each handle except the new prototype caused pressure areas and pain. Extreme differences in muscle strain could not be observed for any of the three handles. Experienced surgeons worked more quickly with the prototype when measuring and cutting a suture (approximately 20%) and during precise maneuvering and targeting (approximately 20%). On the other hand, they completed the dissection task faster with the handle manufactured by Ethicon. Fewer errors were made with the prototype in dissection of the gallbladder. In contrast to the handles available on the market, the prototype was always rated as positive by the volunteers in the subjective surveys. None of the handles could fulfil all of the requirements with top scores. Each handle had its advantages and disadvantages. In contrast to the ring handles, the volunteers could fulfil most of the tasks more efficiently using the prototype handle without any remarkable pressure areas, cramps, or pain.
Overview of the experimental tests in prototype
NASA Astrophysics Data System (ADS)
Egusquiza, Eduard; Valentín, David; Presas, Alexandre; Valero, Carme
2017-04-01
Experimental tests in prototype are necessary to understand the dynamic behaviour of the machine during different operating points. Hydraulic phenomena as well as its effect on the structure need to be studied in order to avoid instabilities during operation and to extend the life-time of the different components. For this purpose, a complete experimental study of a large Francis turbine prototype has been performed installing several sensors along the machine. Pressure sensors were installed in the penstock, spiral case, runner and draft tube, strain gauges were installed in the runner, vibration sensors were used in the stationary parts and different electrical and operational parameters were also measured. All these signals were acquired simultaneously for different operating points of the turbine.
2010-01-01
We also compare the genome sequences of the recent isolates with those of the prototype HAdV-14 that circulated in Eurasia 30 years ago and the...closely related sequence of HAdV-11a, which has been circulating in southeast Asia. Conclusions: The data suggest that the currently circulating strain of...both mild and severe outbreaks. We also compare the genome sequences of the recent isolates with those of the prototype HAdV-14 that circulated in
2010-11-01
and Escherichia ferguso- . TABLE 2. General characteristics of the plasm ids from ETEC strains H10407 and E1392/75 Value in E. c·oli: Characteristic...0352). consetved proteins with unknown func- tions (CDSs 0673 to 0678), a flavoprotein electron transfer system (CDSs 1730 to 1734), the colanic...mediating diarrhea are not chromosomally encoded. indicating that the essential virulence factors are encoded on the plasm ids (61 ). Potentia l
Spring roll dielectric elastomer actuators for a portable force feedback glove
NASA Astrophysics Data System (ADS)
Zhang, Rui; Lochmatter, Patrick; Kunz, Andreas; Kovacs, Gabor
2006-03-01
Miniature spring roll dielectric elastomer actuators for a novel kinematic-free force feedback concept were manufactured and experimentally characterized. The actuators exhibited a maximum blocking force of 7.2 N and a displacement of 5 mm. The theoretical considerations based on the material's incompressibility were discussed in order to estimate the actuator behavior under blocked-strain activation and free-strain activation. One prototype was built for the demonstration of the proposed force feedback concept.
1983-09-01
17 adenovirus strains were found to be antigenically related to prototype Ad 15 by neutralization. No relationship to Ad 15, but to Ad 9 could be detected by hemagglutination-inhibition; we therefore named them Ad 15/H9 intermediate strains. After analysis of the genome by five different restriction enzymes, the fragment patterns obtained deviated widely from the prototype Ad 15, but only slightly from Ad 9. Differences could also be observed among the variants. After digestion by five restriction enzymes, altogether six genome types could be established among the 17 intermediate strains. To map the variations on the genome of the 15/H9 strains, two methods were employed: the double digestion of the DNA and DNA fragments together with the determination of the terminal fragments made it possible to construct a physical map. The second method depends on a particularity of adenoviruses: the DNA is covalently linked with a 55 kD protein at the 5' terminus. After digestion of the DNA, which does contain this protein, the terminal DNA fragments do not migrate into the agarose gel; after an additional digestion with pronase B, they do migrate into the gel. Thus the terminal fragments were determined by comparing the fragment patterns with and without previous pronase B treatment.
Molecular epidemiology of duck hepatitis a virus types 1 and 3 in China, 2010-2015.
Wen, X; Zhu, D; Cheng, A; Wang, M; Chen, S; Jia, R; Liu, M; Sun, K; Zhao, X; Yang, Q; Wu, Y; Chen, X
2018-02-01
Duck hepatitis A virus (DHAV) is the most common aetiologic agent of duck virus hepatitis (DVH), causing substantial economic losses in the duck industry worldwide. In China, officially approved DHAV-1 live-attenuated vaccines have been used widely to vaccinate breeder ducks since 2013. However, following the reports of DVH outbreaks, it has become necessary to assess the epidemiological situation of this virus in China. We conducted molecular epidemiological analyses of 32 DHAV field isolates while analysing the samples from ducks suspected of having hepatitis collected from commercial duck farms in China between May 2010 and December 2015. Considerable changes were observed in the epidemiology of DHAV-1 and DHAV-3 in China over time. A higher number of DHAV-1 strains were isolated during 2010-2012, coinciding with the widespread use of officially approved DHAV-1 live vaccine strains beginning in 2013. In contrast, a higher rate of DHAV-3 causing DHAV infections was observed between 2013 and 2015. Phylogenetic analyses based on the full-length VP1 gene were performed on these field isolates and using reference strains available in GenBank. DHAV-1 field isolates were evaluated in two groups: one group closely related to prototype strains and circulating in China between 2010 and 2012 and another group exhibiting genetic and serological differences from prototype strains. All DHAV-3 strains isolated in this study were grouped as monophyletic, which has become the predominant viral type, particularly in Shandong and Sichuan provinces, since 2013. In conclusion, these data provide updated information on the genetic and serological diversity of DHAV-1 and DHAV-3, and our findings may serve as a foundation for the prevention of, and vaccine development for, DHAV in China. © 2017 Blackwell Verlag GmbH.
High-sensitivity strain visualization using electroluminescence technologies
NASA Astrophysics Data System (ADS)
Xu, Jian; Jo, Hongki
2016-04-01
Visualizing mechanical strain/stress changes is an emerging area in structural health monitoring. Several ways are available for strain change visualization through the color/brightness change of the materials subjected to the mechanical stresses, for example, using mechanoluminescence (ML) materials and mechanoresponsive polymers (MRP). However, these approaches were not effectively applicable for civil engineering system yet, due to insufficient sensitivity to low-level strain of typical civil structures and limitation in measuring both static and dynamic strain. In this study, design and validation for high-sensitivity strain visualization using electroluminescence technologies are presented. A high-sensitivity Wheatstone bridge, of which bridge balance is precisely controllable circuits, is used with a gain-adjustable amplifier. The monochrome electroluminescence (EL) technology is employed to convert both static and dynamic strain change into brightness/color change of the EL materials, through either brightness change mode (BCM) or color alternation mode (CAM). A prototype has been made and calibrated in lab, the linearity between strain and brightness change has been investigated.
Strain Imaging of Nanoscale Semiconductor Heterostructures with X-Ray Bragg Projection Ptychography
NASA Astrophysics Data System (ADS)
Holt, Martin V.; Hruszkewycz, Stephan O.; Murray, Conal E.; Holt, Judson R.; Paskiewicz, Deborah M.; Fuoss, Paul H.
2014-04-01
We report the imaging of nanoscale distributions of lattice strain and rotation in complementary components of lithographically engineered epitaxial thin film semiconductor heterostructures using synchrotron x-ray Bragg projection ptychography (BPP). We introduce a new analysis method that enables lattice rotation and out-of-plane strain to be determined independently from a single BPP phase reconstruction, and we apply it to two laterally adjacent, multiaxially stressed materials in a prototype channel device. These results quantitatively agree with mechanical modeling and demonstrate the ability of BPP to map out-of-plane lattice dilatation, a parameter critical to the performance of electronic materials.
Continuously controlled optical band gap in oxide semiconductor thin films
Herklotz, Andreas; Rus, Stefania Florina; Ward, Thomas Zac
2016-02-02
The optical band gap of the prototypical semiconducting oxide SnO 2 is shown to be continuously controlled through single axis lattice expansion of nanometric films induced by low-energy helium implantation. While traditional epitaxy-induced strain results in Poisson driven multidirectional lattice changes shown to only allow discrete increases in bandgap, we find that a downward shift in the band gap can be linearly dictated as a function of out-of-plane lattice expansion. Our experimental observations closely match density functional theory that demonstrates that uniaxial strain provides a fundamentally different effect on the band structure than traditional epitaxy-induced multiaxes strain effects. In conclusion,more » charge density calculations further support these findings and provide evidence that uniaxial strain can be used to drive orbital hybridization inaccessible with traditional strain engineering techniques.« less
Enhancing the electron mobility of SrTiO3 with strain
NASA Astrophysics Data System (ADS)
Jalan, Bharat; Allen, S. James; Beltz, Glenn E.; Moetakef, Pouya; Stemmer, Susanne
2011-03-01
We demonstrate, using high-mobility SrTiO3 thin films grown by molecular beam epitaxy, that stress has a pronounced influence on the electron mobility in this prototype complex oxide. Moderate strains result in more than 300% increases in the electron mobilities with values exceeding 120 000 cm2/V s and no apparent saturation in the mobility gains. The results point to a range of opportunities to tailor high-mobility oxide heterostructure properties and open up ways to explore oxide physics.
The putative drug efflux systems of the Bacillus cereus group
Elbourne, Liam D. H.; Vörös, Aniko; Kroeger, Jasmin K.; Simm, Roger; Tourasse, Nicolas J.; Finke, Sarah; Henderson, Peter J. F.; Økstad, Ole Andreas; Paulsen, Ian T.; Kolstø, Anne-Brit
2017-01-01
The Bacillus cereus group of bacteria includes seven closely related species, three of which, B. anthracis, B. cereus and B. thuringiensis, are pathogens of humans, animals and/or insects. Preliminary investigations into the transport capabilities of different bacterial lineages suggested that genes encoding putative efflux systems were unusually abundant in the B. cereus group compared to other bacteria. To explore the drug efflux potential of the B. cereus group all putative efflux systems were identified in the genomes of prototypical strains of B. cereus, B. anthracis and B. thuringiensis using our Transporter Automated Annotation Pipeline. More than 90 putative drug efflux systems were found within each of these strains, accounting for up to 2.7% of their protein coding potential. Comparative analyses demonstrated that the efflux systems are highly conserved between these species; 70–80% of the putative efflux pumps were shared between all three strains studied. Furthermore, 82% of the putative efflux system proteins encoded by the prototypical B. cereus strain ATCC 14579 (type strain) were found to be conserved in at least 80% of 169 B. cereus group strains that have high quality genome sequences available. However, only a handful of these efflux pumps have been functionally characterized. Deletion of individual efflux pump genes from B. cereus typically had little impact to drug resistance phenotypes or the general fitness of the strains, possibly because of the large numbers of alternative efflux systems that may have overlapping substrate specificities. Therefore, to gain insight into the possible transport functions of efflux systems in B. cereus, we undertook large-scale qRT-PCR analyses of efflux pump gene expression following drug shocks and other stress treatments. Clustering of gene expression changes identified several groups of similarly regulated systems that may have overlapping drug resistance functions. In this article we review current knowledge of the small molecule efflux pumps encoded by the B. cereus group and suggest the likely functions of numerous uncharacterised pumps. PMID:28472044
Hover Testing of the NASA/Army/MIT Active Twist Rotor Prototype Blade
NASA Technical Reports Server (NTRS)
Wilbur, Matthew L.; Yeager, William T., Jr.; Wilkie, W. Keats; Cesnik, Carlos E. S.; Shin, Sangloon
2000-01-01
Helicopter rotor individual blade control promises to provide a mechanism for increased rotor performance and reduced rotorcraft vibrations and noise. Active material methods, such as piezoelectrically actuated trailing-edge flaps and strain-induced rotor blade twisting, provide a means of accomplishing individual blade control without the need for hydraulic power in the rotating system. Recent studies have indicated that controlled strain induced blade twisting can be attained using piezoelectric active fiber composite technology. In order to validate these findings experimentally, a cooperative effort between NASA Langley Research Center, the Army Research Laboratory, and the MIT Active Materials and Structures Laboratory has been developed. As a result of this collaboration an aeroelastically-scaled active-twist model rotor blade has been designed and fabricated for testing in the heavy gas environment of the Langley Transonic Dynamics Tunnel (TDT). The results of hover tests of the active-twist prototype blade are presented in this paper. Comparisons with applicable analytical predictions of active-twist frequency response in hovering flight are also presented.
The influence of strain rate and hydrogen on the plane-strain ductility of Zircaloy cladding
DOE Office of Scientific and Technical Information (OSTI.GOV)
Link, T.M.; Motta, A.T.; Koss, D.A.
1998-03-01
The authors studied the ductility of unirradiated Zircaloy-4 cladding under loading conditions prototypical of those found in reactivity-initiated accidents (RIA), i.e.: near plane-strain deformation in the hoop direction (transverse to the cladding axis) at room temperature and 300 C and high strain rates. To conduct these studies, they developed a specimen configuration in which near plane-strain deformation is achieved in the gage section, and a testing methodology that allows one to determine both the limit strain at the onset of localized necking and the fracture strain. The experiments indicate that there is little effect of strain rate (10{sup {minus}3} tomore » 10{sup 2} s{sup {minus}1}) on the ductility of unhydrided Zircaloy tubing deformed under near plane-strain conditions at either room temperature or 300 C. Preliminary experiments on cladding containing 190 ppm hydrogen show only a small loss of fracture strain but no clear effect on limit strain. The experiments also indicate that there is a significant loss of Zircaloy ductility when surface flaws are present in the form of thickness imperfections.« less
Kajon, Adriana E; Hang, Jun; Hawksworth, Anthony; Metzgar, David; Hage, Elias; Hansen, Christian J; Kuschner, Robert A; Blair, Patrick; Russell, Kevin L; Jarman, Richard G
2015-09-15
The circulation of human adenovirus type 21 (HAdV21) in the United States has been documented since the 1960s in association with outbreaks of febrile respiratory illness (FRI) in military boot camps and civilian cases of respiratory disease. To describe the molecular epidemiology of HAdV21 respiratory infections across the country, 150 clinical respiratory isolates obtained from continuous surveillance of military recruit FRI, and 23 respiratory isolates recovered from pediatric and adult civilian cases of acute respiratory infection were characterized to compile molecular typing data spanning 37 years (1978-2014). Restriction enzyme analysis and genomic sequencing identified 2 clusters of closely related genomic variants readily distinguishable from the prototype and designated 21a-like and 21b-like. A-like variants predominated until 1999. A shift to b-like variants was noticeable by 2007 after a 7-year period (2000-2006) of cocirculation of the 2 genome types. US strains are phylogenetically more closely related to European and Asian strains isolated over the last 4 decades than to the Saudi Arabian prototype strain AV-1645 isolated in 1956. Knowledge of circulating HAdV21 variants and their epidemic behavior will be of significant value to local and global FRI surveillance efforts. © The Author 2015. Published by Oxford University Press on behalf of the Infectious Diseases Society of America. All rights reserved. For Permissions, please e-mail: journals.permissions@oup.com.
Characterization of a prototype strain of hepatitis E virus.
Tsarev, S A; Emerson, S U; Reyes, G R; Tsareva, T S; Legters, L J; Malik, I A; Iqbal, M; Purcell, R H
1992-01-15
A strain of hepatitis E virus (SAR-55) implicated in an epidemic of enterically transmitted non-A, non-B hepatitis, now called hepatitis E, was characterized extensively. Six cynomolgus monkeys (Macaca fascicularis) were infected with a strain of hepatitis E virus from Pakistan. Reverse transcription-polymerase chain reaction was used to determine the pattern of virus shedding in feces, bile, and serum relative to hepatitis and induction of specific antibodies. Virtually the entire genome of SAR-55 (7195 nucleotides) was sequenced. Comparison of the sequence of SAR-55 with that of a Burmese strain revealed a high level of homology except for one region encoding 100 amino acids of a putative nonstructural polyprotein. Identification of this region as hypervariable was obtained by partial sequencing of a third isolate of hepatitis E virus from Kirgizia.
Attenuated CagA oncoprotein in Helicobacter pylori from Amerindians in Peruvian Amazon.
Suzuki, Masato; Kiga, Kotaro; Kersulyte, Dangeruta; Cok, Jaime; Hooper, Catherine C; Mimuro, Hitomi; Sanada, Takahito; Suzuki, Shiho; Oyama, Masaaki; Kozuka-Hata, Hiroko; Kamiya, Shigeru; Zou, Quan-Ming; Gilman, Robert H; Berg, Douglas E; Sasakawa, Chihiro
2011-08-26
Population genetic analyses of bacterial genes whose products interact with host tissues can give new understanding of infection and disease processes. Here we show that strains of the genetically diverse gastric pathogen Helicobacter pylori from Amerindians from the remote Peruvian Amazon contain novel alleles of cagA, a major virulence gene, and reveal distinctive properties of their encoded CagA proteins. CagA is injected into the gastric epithelium where it hijacks pleiotropic signaling pathways, helps Hp exploit its special gastric mucosal niche, and affects the risk that infection will result in overt gastroduodenal diseases including gastric cancer. The Amerindian CagA proteins contain unusual but functional tyrosine phosphorylation motifs and attenuated CRPIA motifs, which affect gastric epithelial proliferation, inflammation, and bacterial pathogenesis. Amerindian CagA proteins induced less production of IL-8 and cancer-associated Mucin 2 than did those of prototype Western or East Asian strains and behaved as dominant negative inhibitors of action of prototype CagA during mixed infection of Mongolian gerbils. We suggest that Amerindian cagA is of relatively low virulence, that this may have been selected in ancestral strains during infection of the people who migrated from Asia into the Americas many thousands of years ago, and that such attenuated CagA proteins could be useful therapeutically.
Simo Tchetgna, Huguette Dorine; Nakoune, Emmanuel; Selekon, Benjamin; Gessain, Antoine; Manuguerra, Jean-Claude; Kazanji, Mirdad; Berthet, Nicolas
2017-06-01
Rhabdoviridae is one of the most diversified families of RNA viruses whose members infect a wide range of plants, animals, and arthropods. The members of this family are classified into 13 genera and >150 unassigned viruses. Here, we sequenced the complete genome of a rhabdovirus belonging to the Hart Park serogroup, the Kamese virus (KAMV), isolated in 1977 from Culex pruina in the Central African Republic. The genomic sequence showed an organization typical of rhabdoviruses with additional genes in the P-M and G-L intergenic regions, as already reported for the Hart Park serogroup. Our Kamese strain (ArB9074) had 98% and 78.8% nucleotide sequence similarity with the prototypes of the KAMV and Mossuril virus isolated in Uganda and Mozambique in two different Culex species, respectively. Moreover, the protein sequences had 98-100% amino acid similarity with the prototype of the KAMV, except for an additional gene (U3) that showed a divergence of 6%. These molecular data show that our strain of the KAMV is genetically close to the Culex annuliorus strain that was circulating in Uganda in 1967. However, this study suggests the need to improve our knowledge of the KAMV to better understand its behavior, its life cycle, and its potential reservoirs.
NASA Astrophysics Data System (ADS)
Christopher, Jason; Vutukuru, Mounika; Kohler, Travis; Bishop, David; Swan, Anna; Goldberg, Bennett
2D materials can withstand an order of magnitude more strain than their bulk counterparts which can be used to dramatically change electrical, thermal and optical properties or even cause unconventional behavior such as generating pseudo-magnetic fields. Here we present micro-electromechanical systems (MEMS) as a platform for straining 2D materials to make such novel phenomena accessible. Unlike other strain techniques, MEMS are capable of precisely controlling the magnitude and orientation of the strain field and are readily integrated with current technology facilitating a path from lab bench to application. In this study, we use graphene as our prototypical 2D material, and determine strain via micro-Raman spectroscopy making extensive use of graphene's well-characterized phonon strain response. We report on the strength of various techniques for affixing graphene to MEMS, and investigate the role of surface morphology and chemistry in creating a high friction interface capable of inducing large strain. This work is supported by NSF DMR Grant 1411008, and author J. Christopher thanks the NDSEG program for its support.
Sensor Prototype to Evaluate the Contact Force in Measuring with Coordinate Measuring Arms
Cuesta, Eduardo; Telenti, Alejandro; Patiño, Hector; González-Madruga, Daniel; Martínez-Pellitero, Susana
2015-01-01
This paper describes the design, development and evaluation tests of an integrated force sensor prototype for portable Coordinate Measuring Arms (CMAs or AACMMs). The development is based on the use of strain gauges located on the surface of the CMAs’ hard probe. The strain gauges as well as their cables and connectors have been protected with a custom case, made by Additive Manufacturing techniques (Polyjet 3D). The same method has been selected to manufacture an ergonomic handle that includes trigger mechanics and the electronic components required for synchronizing the trigger signal when probing occurs. The paper also describes the monitoring software that reads the signals in real time, the calibration procedure of the prototype and the validation tests oriented towards increasing knowledge of the forces employed in manual probing. Several experiments read and record the force in real time comparing different ways of probing (discontinuous and continuous contact) and measuring different types of geometric features, from single planes to exterior cylinders, cones, or spheres, through interior features. The probing force is separated into two components allowing the influence of these strategies in probe deformation to be known. The final goal of this research is to improve the probing technique, for example by using an operator training programme, allowing extra-force peaks and bad contacts to be minimized or just to avoid bad measurements. PMID:26057038
Choi, Su-In; Park, Jihoon; Kim, Pil
2017-03-28
To investigate the potential applications of bacterial heme, aminolevulinic acid synthase (HemA) was expressed in a Corynebacterium glutamicum HA strain that had been adaptively evolved against oxidative stress. The red pigment from the constructed strain was extracted and it exhibited the typical heme absorbance at 408 nm from the spectrum. To investigate the potential of this strain as an iron additive for swine, a prototype feed additive was manufactured in pilot scale by culturing the strain in a 5 ton fermenter followed by spray-drying the biomass with flour as an excipient (biomass: flour = 1:10 (w/w)). The 10% prototype additive along with regular feed was supplied to a pig, resulting in a 1.1 kg greater increase in weight gain with no diarrhea in 3 weeks as compared with that in a control pig that was fed an additive containing only flour. To verify if C. glutamicum -synthesized heme is a potential electron carrier, lactic acid bacteria were cultured under aerobic conditions with the extracted heme. The biomasses of the aerobically grown Lactococcus lactis , Lactobacillus rhamosus , and Lactobacillus casei were 97%, 15%, and 4% greater, respectively, than those under fermentative growth conditions. As a potential preservative, cultures of the four strains of lactic acid bacteria were stored at 4°C with the extracted heme and living lactic acid bacterial cells were counted. There were more L. lactis and L. plantarum live cells when stored with heme, whereas L. rhamosus and L. casei showed no significant differences in live-cell numbers. The potential uses of the heme from C. glutamicum are further discussed.
Fitness of Pandemic H1N1 and Seasonal influenza A viruses during Co-infection
Perez, Daniel Roberto; Sorrell, Erin; Angel, Matthew; Ye, Jianqiang; Hickman, Danielle; Pena, Lindomar; Ramirez-Nieto, Gloria; Kimble, Brian; Araya, Yonas
2009-01-01
On June 11, 2009 the World Health Organization (WHO) declared a new H1N1 influenza pandemic. This pandemic strain is as transmissible as seasonal H1N1 and H3N2 influenza A viruses. Major concerns facing this pandemic are whether the new virus will replace, co-circulate and/or reassort with seasonal H1N1 and/or H3N2 human strains. Using the ferret model, we investigated which of these three possibilities were most likely favored. Our studies showed that the current pandemic virus is more transmissible than, and has a biological advantage over, prototypical seasonal H1 or H3 strains. PMID:20029606
Zhu, C; Feng, S; Yang, Z; Davis, K; Rios, H; Kaper, J B; Boedeker, E C
2007-02-26
We previously showed that single dose orogastric immunization with an attenuated regulatory Lee-encoded regulator (ler) mutant of the rabbit enteropathogenic Escherichia coli (REPEC) strain E22 (O103:H2) protected rabbits from fatal infection with the highly virulent parent strain. In the current study we assessed the degree of homologous (serotype-specific) and heterologous (cross-serotype) protection induced by immunization with REPEC ler mutant strains of differing serotypes, or with a prototype strain RDEC-1 (O15:H-) which expresses a full array of ler up-regulated proteins. We constructed an additional ler mutant using RDEC-1 thus, permitting immunization with a ler mutant of either serotype, O15 or O103, followed by challenge with a virulent REPEC strain of the same or different serotypes. Consistent with our previous data, the current study demonstrated that rabbits immunized with a RDEC-1 ler mutant were protected from challenge with virulent RDEC-H19A (RDEC-1 transduced with Shiga toxin-producing phage H19A) of the same serotype. Rabbits immunized with RDEC-1 or E22 derivative ler mutants demonstrated significant increase in serum antibody titers to the respective whole bacterial cells expressing O antigen but not to the LEE-encoded proteins. However, immunization with the ler mutants of either E22 or RDEC-1 failed to protect rabbits from infections with virulent organisms belonging to different serotypes. In contrast, rabbits immunized with the prototype RDEC-1 were cross protected against challenge with the heterologous E22 strain as shown by normal weight gain, and the absence of clinical signs of disease or characteristic attaching and effacing (A/E) lesions. Immunization with RDEC-1 induced significantly elevated serum IgG titers to LEE-encoded proteins. We thus, demonstrated homologous protection induced by the REPEC ler mutants and heterologous protection by RDEC-1. The observed correlation between elevated immune responses to the LEE-encoded proteins and the protection against challenge with heterologous virulent REPEC strain suggests that serotype-non-specific cross protection requires the expression of, and induction of antibody to, LEE-encoded virulence factors.
NASA Astrophysics Data System (ADS)
Zhao, Dongning; Rasool, Shafqat; Forde, Micheal; Weafer, Bryan; Archer, Edward; McIlhagger, Alistair; McLaughlin, James
2017-04-01
Recently, there has been increasing demand in developing low-cost, effective structure health monitoring system to be embedded into 3D-woven composite wind turbine blades to determine structural integrity and presence of defects. With measuring the strain and temperature inside composites at both in-situ blade resin curing and in-service stages, we are developing a novel scheme to embed a resistive-strain-based thin-metal-film sensory into the blade spar-cap that is made of composite laminates to determine structural integrity and presence of defects. Thus, with fiberglass, epoxy, and a thinmetal- film sensing element, a three-part, low-cost, smart composite laminate is developed. Embedded strain sensory inside composite laminate prototype survived after laminate curing process. The internal strain reading from embedded strain sensor under three-point-bending test standard is comparable. It proves that our proposed method will provide another SHM alternative to reduce sensing costs during the renewable green energy generation.
Spring-Based Helmet System Support Prototype to Address Aircrew Neck Strain
2014-06-01
Helicopter Squadron stationed at CFB Borden ALSE Personnel Flight Engineers Pilots 4.6 Discussion of Verification Results 4.6.1 Reduce the mass on the...the participant in the pilot’s posture. Figure 8. A simulation of Flight Engineers’ postures during landing and low flying maneuvres. Figure 9
Research pressure instrumentation for NASA space shuttle main engine
NASA Technical Reports Server (NTRS)
Anderson, P. J.; Nussbaum, P.; Gustafson, G.
1985-01-01
The breadboard feasibility model of a silicon piezoresistive pressure transducer suitable for space shuttle main engine (SSME) applications was demonstrated. The development of pressure instrumentation for the SSME was examined. The objective is to develop prototype pressure transducers which are targeted to meet the SSME performance design goals and to fabricate, test and deliver a total of 10 prototype units. Effective utilization of the many advantages of silicon piezoresistive strain sensing technology to achieve the objectives of advanced state-of-the-art pressure sensors for reliability, accuracy and ease of manufacture is analyzed. Integration of multiple functions on a single chip is the key attribute of the technology.
Setoh, Yin Xiang; Amarilla, Alberto A; Peng, Nias Y; Slonchak, Andrii; Periasamy, Parthiban; Figueiredo, Luiz T M; Aquino, Victor H; Khromykh, Alexander A
2018-01-01
Rocio virus (ROCV) is an arbovirus belonging to the genus Flavivirus, family Flaviviridae. We present an updated sequence of ROCV strain SPH 34675 (GenBank: AY632542.4), the only available full genome sequence prior to this study. Using next-generation sequencing of the entire genome, we reveal substantial sequence variation from the prototype sequence, with 30 nucleotide differences amounting to 14 amino acid changes, as well as significant changes to predicted 3'UTR RNA structures. Our results present an updated and corrected sequence of a potential emerging human-virulent flavivirus uniquely indigenous to Brazil (GenBank: MF461639).
Characterization of a prototype strain of hepatitis E virus.
Tsarev, S A; Emerson, S U; Reyes, G R; Tsareva, T S; Legters, L J; Malik, I A; Iqbal, M; Purcell, R H
1992-01-01
A strain of hepatitis E virus (SAR-55) implicated in an epidemic of enterically transmitted non-A, non-B hepatitis, now called hepatitis E, was characterized extensively. Six cynomolgus monkeys (Macaca fascicularis) were infected with a strain of hepatitis E virus from Pakistan. Reverse transcription-polymerase chain reaction was used to determine the pattern of virus shedding in feces, bile, and serum relative to hepatitis and induction of specific antibodies. Virtually the entire genome of SAR-55 (7195 nucleotides) was sequenced. Comparison of the sequence of SAR-55 with that of a Burmese strain revealed a high level of homology except for one region encoding 100 amino acids of a putative nonstructural polyprotein. Identification of this region as hypervariable was obtained by partial sequencing of a third isolate of hepatitis E virus from Kirgizia. Images PMID:1731327
Garcia-Pozuelo, Daniel; Yunta, Jorge; Olatunbosun, Oluremi; Yang, Xiaoguang; Diaz, Vicente
2017-04-16
Tires equipped with sensors, the so-called "intelligent tires", can provide vital information for control systems, drivers and external users. In this research, tire dynamic strain characteristics in cornering conditions are collected and analysed in relation to the variation of tire working conditions, such as inflation pressure, rolling speed, vertical load and slip angle. An experimental tire strain-based prototype and an indoor tire test rig are used to demonstrate the suitability of strain sensors to establish relations between strain data and lateral force. The results of experiments show that strain values drop sharply when lateral force is decreasing, which can be used to predict tire slip conditions. As a first approach to estimate some tire working conditions, such as the slip angle and vertical load, a fuzzy logic method has been developed. The simulation and test results confirm the feasibility of strain sensors and the proposed computational model to solve the non-linearity characteristics of the tires' parameters and turn tires into a source of useful information.
Garcia-Pozuelo, Daniel; Yunta, Jorge; Olatunbosun, Oluremi; Yang, Xiaoguang; Diaz, Vicente
2017-01-01
Tires equipped with sensors, the so-called “intelligent tires”, can provide vital information for control systems, drivers and external users. In this research, tire dynamic strain characteristics in cornering conditions are collected and analysed in relation to the variation of tire working conditions, such as inflation pressure, rolling speed, vertical load and slip angle. An experimental tire strain-based prototype and an indoor tire test rig are used to demonstrate the suitability of strain sensors to establish relations between strain data and lateral force. The results of experiments show that strain values drop sharply when lateral force is decreasing, which can be used to predict tire slip conditions. As a first approach to estimate some tire working conditions, such as the slip angle and vertical load, a fuzzy logic method has been developed. The simulation and test results confirm the feasibility of strain sensors and the proposed computational model to solve the non-linearity characteristics of the tires’ parameters and turn tires into a source of useful information. PMID:28420156
Gubler, D J; Nalim, S; Tan, R; Saipan, H; Sulianti Saroso, J
1979-11-01
The comparative susceptibility of 13 geographic strains of Aedes aegypti to oral infection with dengue viruses was studied by feeding the mosquitoes on a virus-erythrocyte-sugar suspension. Significant variation in susceptibility to four dengue serotypes was observed among the geographic strains tested. Mosquito strains which were more susceptible to one serotype were also more susceptible to the other serotypes, suggesting that the factors controlling susceptibility were the same for all types. The amount of virus required to infect mosquitoes orally varied inversely with the susceptibility of the geographic strain. Thresholds of infection were not the same for dengue types 1, 2, 3 and 4. There was no apparent difference in infectivity between prototype and recently isolated strains of dengue types 1 and 3. Crossing experimentibility as the resistant parent. No difference was observed between resistant and susceptible mosquito strains in the rate or the amount of viral replication after infection by the parenteral route, or in their ability to transmit dengue 2 virus after infection by the oral route.
[Electron microscopic study of the An-750 strain of Powassan virus isolated in the Soviet Union].
Sobolev, S G; Shestopalova, N M; Linev, M B; Rubin, S G
1978-01-01
Electron microscopic examinations of brains of white mice inoculated with the An 750 strain isolated for the first time from adult mosquitoes and with the prototype LB strain of Powassan virus were carried out. The method of combination of light and electron microscopy used in the study permitted to compare ultrastructural changes in one cell with the results of light microscopy. Sizes of virions and their localizations in the brain cells were determined. Virus particles were found in large and small neurons as well as in glial elements. Subcellular changes in neurons associated with virus multiplication are described. The causes of differences in sizes of virions measured in ultrathin sections are discussed.
NASA Astrophysics Data System (ADS)
Shmalenyuk, E. R.; Kochetkov, S. N.; Alexandrova, L. A.
2013-09-01
The review summarizes data on the synthesis and antituberculosis activity of pyrimidine nucleoside derivatives and their analogues. Enzymes from M. tuberculosis as promising targets for prototypes of new-generation drugs are considered. Nucleosides as inhibitors of drug-resistant M. tuberculosis strains are characterized. The bibliography includes 101 references.
USDA-ARS?s Scientific Manuscript database
New liquid fermentation techniques for the production of the bioinsecticidal fungus Metarhizium brunneum strain F-52 have resulted in the formation of microsclerotia (MS), a compact, melonized-hyphal structure capable of surviving desiccation and formulation as dry granules. When rehydrated, these M...
A simple pendulum borehole tiltmeter based on a triaxial optical-fibre displacement sensor
NASA Astrophysics Data System (ADS)
Chawah, P.; Chéry, J.; Boudin, F.; Cattoen, M.; Seat, H. C.; Plantier, G.; Lizion, F.; Sourice, A.; Bernard, P.; Brunet, C.; Boyer, D.; Gaffet, S.
2015-11-01
Sensitive instruments like strainmeters and tiltmeters are necessary for measuring slowly varying low amplitude Earth deformations. Nonetheless, laser and fibre interferometers are particularly suitable for interrogating such instruments due to their extreme precision and accuracy. In this paper, a practical design of a simple pendulum borehole tiltmeter based on laser fibre interferometric displacement sensors is presented. A prototype instrument has been constructed using welded borosilicate with a pendulum length of 0.85 m resulting in a main resonance frequency of 0.6 Hz. By implementing three coplanar extrinsic fibre Fabry-Perot interferometric probes and appropriate signal filtering, our instrument provides tilt measurements that are insensitive to parasitic deformations caused by temperature and pressure variations. This prototype has been installed in an underground facility (Rustrel, France) where results show accurate measurements of Earth strains derived from Earth and ocean tides, local hydrologic effects, as well as local and remote earthquakes. The large dynamic range and the high sensitivity of this tiltmeter render it an invaluable tool for numerous geophysical applications such as transient fault motion, volcanic strain and reservoir monitoring.
Astell, C R; Gardiner, E M; Tattersall, P
1986-02-01
The sequence of molecular clones of the genome of MVM(i), a lymphotropic variant of minute virus of mice, was determined and compared with that of MVM(p), the fibrotropic prototype strain. At the nucleotide level there are 163 base changes: 129 transitions and 34 transversions. Most nucleotide changes are silent, with only 27 amino acids changes predicted, of which 22 are conservative. Notable differences between the MVM(i) and MVM(p) genomes which may account for the cell specificities of these viruses occur within the 3' nontranslated regions. The differences discussed include the absence of a 65-base-pair direct in MVM(i), the presence of only two polyadenylation sites in MVM(i) compared with four in MVM(p), and sequences that bear a resemblance to enhancer sequences. Also included in this paper is an important correction to the MVM(p) sequence (C.R. Astell, M. Thomson, M. Merchlinsky, and D. C. Ward, Nucleic Acids Res. 11:999-1018, 1983).
NASA Technical Reports Server (NTRS)
Hedenstierna, K. O.; Lee, Y. H.; Yang, Y.; Fox, G. E.
1993-01-01
A prototype stable RNA identification cassette for monitoring genetically engineered plasmids carried by strains of Escherichia coli has been developed. The cassette consists of a Vibrio proteolyticus 5S ribosomal RNA (rRNA) gene surrounded by promoters and terminators from the rrnB operon of Escherischia coli. The identifier RNA is expressed and successfully processed so that approximately 30% of the 5S rRNA isolated from either whole cells or 70S ribosomes is of the V. proteolyticus type. Cells carrying the identifier are readily detectable by hybridization. Accurate measurements show that the identification cassette has little effect on fitness compared to a strain containing an analogous plasmid carrying wild type E. coli 5S rRNA, and the V. proteolyticus 5S rRNA gene is not inactivated after prolonged growth. These results demonstrate the feasibility of developing small standardized identification cassettes that can utilize already existing highly sensitive rRNA detection methods. Cassettes of this type could in principle be incorporated into either the engineered regions of recombinant plasmids or their hosts.
Electric field responsive origami structures using electrostriction-based active materials
NASA Astrophysics Data System (ADS)
Ahmed, Saad; Arrojado, Erika; Sigamani, Nirmal; Ounaies, Zoubeida
2015-04-01
The objective of origami engineering is to combine origami principles with advanced materials to yield active origami shapes, which fold and unfold in response to external stimuli. We are investigating the use of P(VDF-TrFE-CTFE), a relaxor ferroelectric terpolymer, to realize origami-inspired folding and unfolding of structures and to actuate so-called action origami structures. To accomplish these two objectives, we have explored different approaches to the P(VDF-TrFECTFE) polymer actuator construction, ranging from unimorph to multilayered stacks. Electromechanical characterization of the terpolymer-based actuators is conducted with a focus on free strain, force-displacement and blocked force. Moreover dynamic thickness strains of P(VDF-TrFE-CTFE) terpolymer at different frequencies ranging from 0.1Hz to 10Hz is also measured. Quantifying the performance of terpolymer-based actuators is important to the design of action origami structures. Following these studies, action origami prototypes based on catapult, flapping butterfly wings and barking fox are actuated and characterization of these prototypes are conducted by studying impact of various parameters such as electric field magnitude and frequency, number of active layers, and actuator dimensions.
Lee, Hee Suk; Sobsey, Mark D
2011-06-01
The potential use of specific somatic coliphage taxonomic groups as viral indicators based on their persistence and prevalence in water was investigated. Representative type strains of the 4 major somatic coliphage taxonomic groups were seeded into reagent water and an ambient surface water source of drinking water and the survival of the added phages was measured over 90 days at temperatures of 23-25 and 4 °C. Microviridae (type strain PhiX174), Siphoviridae (type strain Lambda), and Myoviridae (type strain T4) viruses were the most persistent in water at the temperatures tested. The Microviridae (type strain PhiX174) and the Siphoviridae (type strain Lambda) were the most resistant viruses to UV radiation and the Myoviridae (type strain T4) and the Microviridae (type strain PhiX174) were the most resistant viruses to heat. Based on their greater persistence in water over time and their relative resistance to heat and/or UV radiation, the Myoviridae (type strain T4), the Microviridae (type strain PhiX174), and the Siphoviridae (type strain Lambda) were the preferred candidate somatic coliphages as fecal indicator viruses in water, with the Microviridae (type strain PhiX174) the most resistant to these conditions overall. Copyright © 2011 Elsevier Ltd. All rights reserved.
Chaudhuri, Roy R.; Sebaihia, Mohammed; Hobman, Jon L.; Webber, Mark A.; Leyton, Denisse L.; Goldberg, Martin D.; Cunningham, Adam F.; Scott-Tucker, Anthony; Ferguson, Paul R.; Thomas, Christopher M.; Frankel, Gad; Tang, Christoph M.; Dudley, Edward G.; Roberts, Ian S.; Rasko, David A.; Pallen, Mark J.; Parkhill, Julian; Nataro, James P.; Thomson, Nicholas R.; Henderson, Ian R.
2010-01-01
Background Escherichia coli can experience a multifaceted life, in some cases acting as a commensal while in other cases causing intestinal and/or extraintestinal disease. Several studies suggest enteroaggregative E. coli are the predominant cause of E. coli-mediated diarrhea in the developed world and are second only to Campylobacter sp. as a cause of bacterial-mediated diarrhea. Furthermore, enteroaggregative E. coli are a predominant cause of persistent diarrhea in the developing world where infection has been associated with malnourishment and growth retardation. Methods In this study we determined the complete genomic sequence of E. coli 042, the prototypical member of the enteroaggregative E. coli, which has been shown to cause disease in volunteer studies. We performed genomic and phylogenetic comparisons with other E. coli strains revealing previously uncharacterised virulence factors including a variety of secreted proteins and a capsular polysaccharide biosynthetic locus. In addition, by using Biolog™ Phenotype Microarrays we have provided a full metabolic profiling of E. coli 042 and the non-pathogenic lab strain E. coli K-12. We have highlighted the genetic basis for many of the metabolic differences between E. coli 042 and E. coli K-12. Conclusion This study provides a genetic context for the vast amount of experimental and epidemiological data published thus far and provides a template for future diagnostic and intervention strategies. PMID:20098708
H13 influenza viruses in wild birds have undergone genetic and antigenic diversification in nature.
Wang, Zu-Jyun; Kikutani, Yuto; Nguyen, Lam Thanh; Hiono, Takahiro; Matsuno, Keita; Okamatsu, Masatoshi; Krauss, Scott; Webby, Richard; Lee, Youn-Jeong; Kida, Hiroshi; Sakoda, Yoshihiro
2018-05-23
Among 16 haemagglutinin (HA) subtypes of avian influenza viruses (AIVs), H13 AIVs have rarely been isolated in wild waterfowl. H13 AIVs cause asymptomatic infection and are maintained mainly in gull and tern populations; however, the recorded antigenic information relating to the viruses has been limited. In this study, 2 H13 AIVs, A/duck/Hokkaido/W345/2012 (H13N2) and A/duck/Hokkaido/WZ68/2012 (H13N2), isolated from the same area in the same year in our surveillance, were genetically and antigenically analyzed with 10 representative H13 strains including a prototype strain, A/gull/Maryland/704/1977 (H13N6). The HA genes of H13 AIVs were phylogenetically divided into 3 groups (I, II, and III). A/duck/Hokkaido/W345/2012 (H13N2) was genetically classified into Group III. This virus was distinct from a prototype strain, A/gull/Maryland/704/1977 (H13N6), and the virus, A/duck/Hokkaido/WZ68/2012 (H13N2), both belonging to Group I. Antigenic analysis indicated that the viruses of Group I were antigenically closely related to those of Group II, but distinct from those of Group III, including A/duck/Hokkaido/W345/2012 (H13N2). In summary, our study indicates that H13 AIVs have undergone antigenic diversification in nature.
Comparison of Fiber Optic Strain Demodulation Implementations
NASA Technical Reports Server (NTRS)
Quach, Cuong C.; Vazquez, Sixto L.
2005-01-01
NASA Langley Research Center is developing instrumentation based upon principles of Optical Frequency-Domain Reflectometry (OFDR) for the provision of large-scale, dense distribution of strain sensors using fiber optics embedded with Bragg gratings. Fiber Optic Bragg Grating technology enables the distribution of thousands of sensors immune to moisture and electromagnetic interference with negligible weight penalty. At Langley, this technology provides a key component for research and development relevant to comprehensive aerospace vehicle structural health monitoring. A prototype system is under development that includes hardware and software necessary for the acquisition of data from an optical network and conversion of the data into strain measurements. This report documents the steps taken to verify the software that implements the algorithm for calculating the fiber strain. Brief descriptions of the strain measurement system and the test article are given. The scope of this report is the verification of software implementations as compared to a reference model. The algorithm will be detailed along with comparison results.
NASA Astrophysics Data System (ADS)
Shimizu, Takayuki; Yari, Takashi; Nagai, Kanehiro; Takeda, Nobuo
2001-07-01
We conducted theoretical and experimental approaches for applying Brillouin optical time domain reflectometer (BOTDR) to aircraft and spacecraft structure health monitoring system. Firstly, distributed strain was measured by BOTDR under 3-point bending test and a spatial resolution was enhanced up to 0.5m using Brillouin spectrum analysis and processing though the device used in this experiment had a spatial resolution of 2m normally. Secondly, dynamic strain measurement was executed under cyclic loading conditions. Brillouin spectrum measured under dynamic conditions is equivalent to superposed spectrum using many spectra measured under static loading conditions. As the measured spectrum was decomposed into many spectra in static loading state, the strain amplitude and its ratio could be estimated. Thirdly, strain and temperature could be measured independently using combined system of BOTDR and fiber Bragg grating (FBG) with wavelength division multiplexing (WDM). Additionally, the application of BOTDR sensing system was shown for a prototype carbon fiber reinforced plastic (CFRP) liquid hydrogen (LH2) tank under cryogenic condition.
Iosipescu shear properties of graphite fabric/epoxy composite laminates
NASA Technical Reports Server (NTRS)
Walrath, D. E.; Adams, D. F.
1985-01-01
The Iosipescu shear test method is used to measure the in-plane and interlaminar shear properties of four T300 graphite fabric/934 epoxy composite materials. Different weave geometries tested include an Oxford weave, a 5-harness satin weave, an 8-harness satin weave, and a plain weave with auxiliary warp yarns. Both orthogonal and quasi-isotropic layup laminates were tested. In-plane and interlaminar shear properties are obtained for laminates of all four fabric types. Overall, little difference in shear properties attributable to the fabric weave pattern is observed. The auxiliary warp material is significantly weaker and less stiff in interlaminar shear parallel to its fill direction. A conventional strain gage extensometer is modified to measure shear strains for use with the Iosipescu shear test. While preliminary results are encouraging, several design iterations failed to produce a reliable shear transducer prototype. Strain gages are still the most reliable shear strain transducers for use with this test method.
Cajimat, Maria N. B.; Milazzo, Mary Louise; Borchert, Jeff N.; Abbott, Ken D.; Bradley, Robert D.; Fulhorst, Charles F.
2008-01-01
The results of analyses of glycoprotein precursor and nucleocapsid protein gene sequences indicated that an arenavirus isolated from a Mexican woodrat (Neotoma mexicana) captured in Arizona is a strain of a novel species (proposed name Skinner Tank virus) and that arenaviruses isolated from Mexican woodrats captured in Colorado, New Mexico, and Utah are strains of Whitewater Arroyo virus or species phylogenetically closely related to Whitewater Arroyo virus. Pairwise comparisons of glycoprotein precursor sequences and nucleocapsid protein sequences revealed a high level of divergence among the viruses isolated from the Mexican woodrats captured in Colorado, New Mexico, and Utah and the Whitewater Arroyo virus prototype strain AV 9310135, which originally was isolated from a white-throated woodrat (Neotoma albigula) captured in New Mexico. Conceptually, the viruses from Colorado, New Mexico, and Utah and strain AV 9310135 could be grouped together in a species complex in the family Arenaviridae, genus Arenavirus. PMID:18304671
NASA Astrophysics Data System (ADS)
Nica, Emilian M.; Franz, Marcel
2018-02-01
Motivated by recent work on strain-induced pseudomagnetic fields in Dirac and Weyl semimetals, we analyze the possibility of analogous fields in two-dimensional nodal superconductors. We consider the prototypical case of a d -wave superconductor, a representative of the cuprate family, and find that the presence of weak, spatially varying strain leads to pseudomagnetic fields and Landau quantization of Bogoliubov quasiparticles in the low-energy sector. A similar effect is induced by the presence of generic, weak doping gradients. In contrast to genuine magnetic fields in superconductors, the strain- and doping-gradient-induced pseudomagnetic fields couple in a way that preserves time-reversal symmetry and is not subject to the screening associated with the Meissner effect. These effects can be probed by tuning weak applied supercurrents which lead to shifts in the energies of the Landau levels and hence to quantum oscillations in thermodynamic and transport quantities.
Low-Cycle Fatigue Behavior of Die-Cast Mg Alloy AZ91
NASA Astrophysics Data System (ADS)
Rettberg, Luke; Anderson, Warwick; Jones, J. Wayne
An investigation has been conducted on the influence of microstructure and artificial aging response (T6) on the low-cycle fatigue behavior of super vacuum die-cast (SVDC) AZ91. Fatigue lifetimes were determined from total strain-controlled fatigue tests for strain amplitudes of 0.2%, 0.4% and 0.6%, under fully reversed loading at a frequency of 5 Hz. Cyclic stress-strain behavior was determined using incremental step test (IST) methods. Two locations in a prototype casting with different thicknesses and, therefore, solidification rates, microstructure and porosity, were examined. In general., at all total strain amplitudes fatigue life was unaffected by microstructure refinement and was attributed to significant levels of porosity. Cyclic softening and a subsequent increased cyclic hardening rate, compared to monotonic tests, were observed, independent of microstructure. These results, fractography and damage accumulation processes, determined from metallographic sectioning, are discussed.
First dengue haemorrhagic fever epidemic in the Americas, 1981: insights into the causative agent.
Rodriguez-Roche, Rosmari; Hinojosa, Yoandri; Guzman, Maria G
2014-12-01
Historical records describe a disease in North America that clinically resembled dengue haemorrhagic fever during the latter part of the slave-trading period. However, the dengue epidemic that occurred in Cuba in 1981 was the first laboratory-confirmed and clinically diagnosed outbreak of dengue haemorrhagic fever in the Americas. At that time, the presumed source of the dengue type 2 strain isolated during this epidemic was considered controversial, partly because of the limited sequence data and partly because the origin of the virus appeared to be southern Asia. Here, we present a molecular characterisation at the whole-genome level of the original strains isolated at different time points during the epidemic. Phylogenetic trees constructed using Bayesian methods indicated that 1981 Cuban strains group within the Asian 2 genotype. In addition, the study revealed that viral evolution occurred during the epidemic - a fact that could be related to the increasing severity from month to month. Moreover, the Cuban strains exhibited particular amino acid substitutions that differentiate them from the New Guinea C prototype strain as well as from dengue type 2 strains isolated globally.
Miniature Six-Axis Load Sensor for Robotic Fingertip
NASA Technical Reports Server (NTRS)
Diftler, Myron A.; Martin, Toby B.; Valvo, Michael C.; Rodriguez, Dagoberto; Chu, Mars W.
2009-01-01
A miniature load sensor has been developed as a prototype of tactile sensors that could fit within fingertips of anthropomorphic robot hands. The sensor includes a force-and-torque transducer in the form of a spring instrumented with at least six semiconductor strain gauges. The strain-gauge wires are secured to one side of an interface circuit board mounted at the base of the spring. This board protects the strain-gauge wires from damage that could otherwise occur as a result of finger motions. On the opposite side of the interface board, cables routed along the neutral axis of the finger route the strain-gauge output voltages to an analog-to-digital converter (A/D) board. The A/D board is mounted as close as possible to the strain gauges to minimize electromagnetic noise and other interference effects. The outputs of the A/D board are fed to a controller, wherein, by means of a predetermined calibration matrix, the digitized strain-gauge output voltages are converted to three vector components of force and three of torque exerted by or on the fingertip.
Knitted Strain Sensor Textiles of Highly Conductive All-Polymeric Fibers.
Seyedin, Shayan; Razal, Joselito M; Innis, Peter C; Jeiranikhameneh, Ali; Beirne, Stephen; Wallace, Gordon G
2015-09-30
A scaled-up fiber wet-spinning production of electrically conductive and highly stretchable PU/PEDOT:PSS fibers is demonstrated for the first time. The PU/PEDOT:PSS fibers possess the mechanical properties appropriate for knitting various textile structures. The knitted textiles exhibit strain sensing properties that were dependent upon the number of PU/PEDOT:PSS fibers used in knitting. The knitted textiles show sensitivity (as measured by the gauge factor) that increases with the number of PU/PEDOT:PSS fibers deployed. A highly stable sensor response was observed when four PU/PEDOT:PSS fibers were co-knitted with a commercial Spandex yarn. The knitted textile sensor can distinguish different magnitudes of applied strain with cyclically repeatable sensor responses at applied strains of up to 160%. When used in conjunction with a commercial wireless transmitter, the knitted textile responded well to the magnitude of bending deformations, demonstrating potential for remote strain sensing applications. The feasibility of an all-polymeric knitted textile wearable strain sensor was demonstrated in a knee sleeve prototype with application in personal training and rehabilitation following injury.
Yawsonde Tests for Prototypes of the 155mm Intermediate Volatility Agent Projectile
1982-07-01
velocities shown in the table have not been corrected back to the muzzle). Time-zero measurements were made using a strain gage attached to the tube...DRXSY-MP, H. Cohen Commander, USATECOM ATTN: DRSTE-TO-F PM SMOKE, Bldg. 324 ATTN: DRCPM- SMK Director, USACSL, EA Bldg. E3516 ATTN: DRDAR-CLB-PA (1 cy
Phase-locked telemetry system for rotary instrumentation of turbomachinery, phase 1
NASA Technical Reports Server (NTRS)
Adler, A.; Hoeks, B.
1978-01-01
A telemetry system for use in making strain and temperature measurements on the rotating components of high speed turbomachines employs phase locked transmitters, which offer greater measurement channel capacity and reliability than existing systems which employ L-C carrier oscillators. A prototype transmitter module was tested at 175 C combined with 40,000 g's acceleration.
Two Asian highly pathogenic strains of Type 2 PRRSV in United States swine
USDA-ARS?s Scientific Manuscript database
Highly pathogenic PRRSV (HP-PRRSV) has been circulating in Asia for 7 years. rJXwn06 and rSRV07 were rescued from infectious clones of two HP-PRRSV for investigation at the National Animal Disease Center. The clinical disease and viral replication kinetics of HP-PRRSV were compared to prototype stra...
Foil Strain Gauges Using Piezoresistive Carbon Nanotube Yarn: Fabrication and Calibration
Góngora-Rubio, Mário R.; Kiyono, César Y.; Mello, Luis A. M.; Cardoso, Valtemar F.; Rosa, Reinaldo L. S.; Kuebler, Derek A.; Brodeur, Grace E.; Alotaibi, Amani H.; Coene, Marisa P.; Coene, Lauren M.; Jean, Elizabeth; Santiago, Rafael C.; Oliveira, Francisco H. A.; Rangel, Ricardo; Thomas, Gilles P.; Belay, Kalayu; da Silva, Luciana W.; Moura, Rafael T.; Seabra, Antonio C.; Silva, Emílio C. N.
2018-01-01
Carbon nanotube yarns are micron-scale fibers comprised by tens of thousands of carbon nanotubes in their cross section and exhibiting piezoresistive characteristics that can be tapped to sense strain. This paper presents the details of novel foil strain gauge sensor configurations comprising carbon nanotube yarn as the piezoresistive sensing element. The foil strain gauge sensors are designed using the results of parametric studies that maximize the sensitivity of the sensors to mechanical loading. The fabrication details of the strain gauge sensors that exhibit the highest sensitivity, based on the modeling results, are described including the materials and procedures used in the first prototypes. Details of the calibration of the foil strain gauge sensors are also provided and discussed in the context of their electromechanical characterization when bonded to metallic specimens. This characterization included studying their response under monotonic and cyclic mechanical loading. It was shown that these foil strain gauge sensors comprising carbon nanotube yarn are sensitive enough to capture strain and can replicate the loading and unloading cycles. It was also observed that the loading rate affects their piezoresistive response and that the gauge factors were all above one order of magnitude higher than those of typical metallic foil strain gauges. Based on these calibration results on the initial sensor configurations, new foil strain gauge configurations will be designed and fabricated, to increase the strain gauge factors even more. PMID:29401745
Structural Anomaly Detection Using Fiber Optic Sensors and Inverse Finite Element Method
NASA Technical Reports Server (NTRS)
Quach, Cuong C.; Vazquez, Sixto L.; Tessler, Alex; Moore, Jason P.; Cooper, Eric G.; Spangler, Jan. L.
2005-01-01
NASA Langley Research Center is investigating a variety of techniques for mitigating aircraft accidents due to structural component failure. One technique under consideration combines distributed fiber optic strain sensing with an inverse finite element method for detecting and characterizing structural anomalies anomalies that may provide early indication of airframe structure degradation. The technique identifies structural anomalies that result in observable changes in localized strain but do not impact the overall surface shape. Surface shape information is provided by an Inverse Finite Element Method that computes full-field displacements and internal loads using strain data from in-situ fiberoptic sensors. This paper describes a prototype of such a system and reports results from a series of laboratory tests conducted on a test coupon subjected to increasing levels of damage.
Perez, Daniel Roberto; Sorrell, Erin; Angel, Matthew; Ye, Jianqiang; Hickman, Danielle; Pena, Lindomar; Ramirez-Nieto, Gloria; Kimble, Brian; Araya, Yonas
2009-08-24
On June 11, 2009 the World Health Organization (WHO) declared a new H1N1 influenza pandemic. This pandemic strain is as transmissible as seasonal H1N1 and H3N2 influenza A viruses. Major concerns facing this pandemic are whether the new virus will replace, co-circulate and/or reassort with seasonal H1N1 and/or H3N2 human strains. Using the ferret model, we investigated which of these three possibilities were most likely favored. Our studies showed that the current pandemic virus is more transmissible than, and has a biological advantage over, prototypical seasonal H1 or H3 strains.
Hyperbiofilm Formation by Bordetella pertussis Strains Correlates with Enhanced Virulence Traits
Cattelan, Natalia; Jennings-Gee, Jamie; Dubey, Purnima
2017-01-01
ABSTRACT Pertussis, or whooping cough, caused by the obligate human pathogen Bordetella pertussis is undergoing a worldwide resurgence. The majority of studies of this pathogen are conducted with laboratory-adapted strains which may not be representative of the species as a whole. Biofilm formation by B. pertussis plays an important role in pathogenesis. We conducted a side-by-side comparison of the biofilm-forming abilities of the prototype laboratory strains and the currently circulating isolates from two countries with different vaccination programs. Compared to the reference strain, all strains examined herein formed biofilms at high levels. Biofilm structural analyses revealed country-specific differences, with strains from the United States forming more structured biofilms. Bacterial hyperaggregation and reciprocal expression of biofilm-promoting and -inhibitory factors were observed in clinical isolates. An association of increased biofilm formation with augmented epithelial cell adhesion and higher levels of bacterial colonization in the mouse nose and trachea was detected. To our knowledge, this work links for the first time increased biofilm formation in bacteria with a colonization advantage in an animal model. We propose that the enhanced biofilm-forming capacity of currently circulating strains contributes to their persistence, transmission, and continued circulation. PMID:28893915
Genetic differentiation of methicillin-resistant Staphylococcus aureus strains from Korea and Japan.
Soo Ko, Kwan; Peck, Kyong Ran; Sup Oh, Won; Lee, Nam Yong; Hiramatsu, Keiichi; Song, Jae-Hoon
2005-01-01
In this study, we evaluated genetic differentiation between methicillin-resistant Staphylococcus aureus (MRSA) strains from Korea and Japan. Seventy-five MRSA strains, including 25 h VISA strains, were analyzed by molecular typing methods, including multilocus sequence typing (MLST), SCC mec typing, and spa typing. The most prevalent genotype of MRSA strains, in both Korea and Japan, was ST 5-MRSA-II with the DMGMK spa motif, characteristic of the New York/Japan MRSA clone. In spite of these common features in MRSA strains from Korea and Japan, we also observed some genotypic divergence in MRSA from the two countries. Several spa types might be differentiated from a prevalent prototype (TJMBMDMGMK) that is shared by the two countries, revealing a unique geographic distribution. SCC mec type II lacking pUB110, designated type IIA, was found more frequently in Korea than in Japan. The rate of gentamicin resistance was also dramatically different between the two countries: 87.2% (Korea) vs. 28.6% (Japan). These preliminary findings suggested that MRSA strains from Korea and Japan might have originated from a common ancestor, but then clearly differentiated according to locality. A further comprehensive study should be performed to document the hypotheses from this study.
Schachner, Anna; Marek, Ana; Grafl, Beatrice; Hess, Michael
2016-04-15
Forty-eight fowl aviadenoviruses (FAdVs) isolated from recent IBH outbreaks across Europe were investigated, by utilizing for the first time the two major adenoviral antigenic domains, hexon loop-1 and fiber, for compound molecular characterization of IBH-associated FAdVs. Successful target gene amplification, following virus isolation in cell culture or from FTA-card samples, demonstrated presence of FAdVs in all cases indicative for IBH. Based on hexon loop-1 analysis, 31 European field isolates exhibited highest nucleotide identity (>97.2%) to reference strains FAdV-2 or -11 representing FAdV-D, while 16 and one European isolates shared >96.0% nucleotide identity with FAdV-8a and -8b, or FAdV-7, the prototype strains representing FAdV-E. These results extend recognition of specific FAdV-D and FAdV-E affiliate genotypes as causative agents of IBH to the European continent. In all isolates, species specificity determined by fiber gene analysis correlated with hexon-based typing. A threshold of 72.0% intraspecies nucleotide identity between fibers from investigated prototype and field strains corresponded with demarcation criteria proposed for hexon, suggesting fiber-based analysis as a complementary tool for molecular FAdV typing. A limited number of strains exhibited inconsistencies between hexon and fiber subclustering, indicating potential constraints for single-gene based typing of those FAdVs. Within FAdV-D, field isolate fibers shared a high degree of nucleotide (>96.7%) and aa (>95.8%) identity, while FAdV-E field isolate fibers displayed greater nucleotide divergence of up to 22.6%, resulting in lower aa identities of >81.7%. Furthermore, comparison with FAdVs from IBH outbreaks outside Europe revealed close genetic relationship in the fiber, independent of the strains' geographic origin. Copyright © 2016 Elsevier B.V. All rights reserved.
Aligned Carbon Nanotube Tape for Sensor Applications
NASA Technical Reports Server (NTRS)
Tucker, Dennis S.
2013-01-01
For this effort, will concentrate on three applications: Vibration Gyroscope utilizes piezoelectric properties of the tape and Coriolis effect Accelerometer utilizes the piezoresistive property Strain Gauge utilizes piezoresistive property Accelerometer and Strain Gauge can also utilize piezoelectric effect Test piezoelectric properties using facilities at the Microfabrication Laboratory (AMRDEC) . Enhance piezoelectric effect using polyvinylidine fluoride and P(VDF ]TrFE) which is readily polarizable .Spray matrix solution while winding fiber; Sandwich of CNT tape and PVDF film (DOE .Two Level) . Construct and test prototype vibration gyroscope . Construct and test prototype accelerometer using cantilever design . Test strain sensitivity of CNT tape against industrial strain gauge . Embed CNT tape in composite samples as well as on surface and test to failure (4 ]point bend) A piezoelectric device exhibits an electrical response from a mechanical applied stress. . A piezoelectric device has both capacitance and resistance properties in which by applying an electric field from a waveform will exert a mechanical stress that can be monitored for a response. . The typical waveform applied is a sinusoidal waveform of a defined voltage for a defined period. The defined voltage is driven from 0 volts to the positive defined volts then back to 0 and driven to negative defined volts then back to 0. . Example. Vmax set to 10V and period set to 10 ms. . Voltage will start at zero, go to 10 volts, return to zero, go to ]10 volts and return to zero during 10 ms. . Applying this electrical field to a DUT, the capacitance response and resistance response can be observed. CNT tape is easier to manufacture and cheaper than micromachining silicon or other ceramic piezoelectric used in gyroscopes and accelerometers CNT tape properties can be modified during manufacture for specific application CNT tape has enhanced mechanical and thermal properties in addition to unique electrical properties CNT tape as a strain gauge in Structural Health Monitoring will provide an excellent material to embed within composite structures
Vibrio cholerae O1 epidemic variants in Angola: a retrospective study between 1992 and 2006.
Valia, Romy; Taviani, Elisa; Spagnoletti, Matteo; Ceccarelli, Daniela; Cappuccinelli, Piero; Colombo, Mauro M
2013-01-01
Cholera is still a major public health concern in many African countries. In Angola, after a decade of absence, cholera reemerged in 1987, spreading throughout the country until 1996, with outbreaks recurring in a seasonal pattern. In 2006 Angola was hit by one of the most severe outbreaks of the last decade, with ca. 240,000 cases reported. We analyzed 21 clinical strains isolated between 1992 and 2006 from several provinces throughout the country: Benguela, Bengo, Luanda, Cuando Cubango, and Cabinda. We used two multiplex PCR assays to investigate discriminatory mobile genetic elements (MGE) [Integrative Conjugative Elements (ICEs), VSP-II, GI12, GI14, GI15, K, and TLC phages] and we compared the profiles obtained with those of different reference V. cholerae O1 variants (prototypical, altered, and hybrid), responsible for the ongoing 7th pandemic. We also tested the strains for the presence of specific VSP-II variants and for the presence of a genomic island (GI) (WASA-1), correlated with the transmission of seventh pandemic cholera from Africa to South America. Based on the presence/absence of the analyzed genetic elements, five novel profiles were detected in the epidemic strains circulating in the 1990s. The most frequent profiles, F and G, were characterized by the absence of ICEs and the three GIs tested, and the presence of GI WASA-1 and the WASA variant of the VSP-II island. Our results identified unexpected variability within the 1990s epidemic, showing different rearrangements in a dynamic part of the genome not present in the prototypical V. cholerae O1 N16961. Moreover the 2006 strains differed from the current pandemic V. cholerae O1 strain. Taken together, our results highlight the role of horizontal gene transfer (HGT) in diversifying the genetic background of V. cholerae within a single epidemic.
NASA Astrophysics Data System (ADS)
Huang, Shieh-Kung; Loh, Kenneth J.
2015-04-01
The main goal of this study was to develop and validate the performance of a miniature and portable data acquisition (DAQ) system designed for interrogating carbon nanotube (CNT)-based thin films for real-time spatial structural sensing and damage detection. Previous research demonstrated that the electrical properties of CNT-based thin film strain sensors were linearly correlated with applied strains. When coupled with an electrical impedance tomography (EIT) algorithm, the detection and localization of damage was possible. In short, EIT required that the film or "sensing skin" be interrogated along its boundaries. Electrical current was injected across a pair of boundary electrodes, and voltage was simultaneously recorded along the remaining electrode pairs. This was performed multiple times to obtain a large dataset needed for solving the EIT spatial conductivity mapping inverse problem. However, one of the main limitations of this technique was the large amount of time required for data acquisition. In order to facilitate the adoption of this technology and for field implementation purposes, a miniature DAQ that could interrogate these CNT-based sensing skins at high sampling rates was designed and tested. The prototype DAQ featured a Howland current source that could generate stable and controlled direct current. Measurement of boundary electrode voltages and the switching of the input, output, and measurement channels were achieved using multiplexer units. The DAQ prototype was fabricated on a two-layer printed circuit board, and it was designed for integration with a prototype wireless sensing system, which is the next phase of this research.
Ba Abdullah, Mohammed M; Palermo, Richard D; Palser, Anne L; Grayson, Nicholas E; Kellam, Paul; Correia, Samantha; Szymula, Agnieszka; White, Robert E
2017-12-01
Epstein-Barr virus (EBV) is a ubiquitous pathogen of humans that can cause several types of lymphoma and carcinoma. Like other herpesviruses, EBV has diversified through both coevolution with its host and genetic exchange between virus strains. Sequence analysis of the EBV genome is unusually challenging because of the large number and lengths of repeat regions within the virus. Here we describe the sequence assembly and analysis of the large internal repeat 1 of EBV (IR1; also known as the BamW repeats) for more than 70 strains. The diversity of the latency protein EBV nuclear antigen leader protein (EBNA-LP) resides predominantly within the exons downstream of IR1. The integrity of the putative BWRF1 open reading frame (ORF) is retained in over 80% of strains, and deletions truncating IR1 always spare BWRF1. Conserved regions include the IR1 latency promoter (Wp) and one zone upstream of and two within BWRF1. IR1 is heterogeneous in 70% of strains, and this heterogeneity arises from sequence exchange between strains as well as from spontaneous mutation, with interstrain recombination being more common in tumor-derived viruses. This genetic exchange often incorporates regions of <1 kb, and allelic gene conversion changes the frequency of small regions within the repeat but not close to the flanks. These observations suggest that IR1-and, by extension, EBV-diversifies through both recombination and breakpoint repair, while concerted evolution of IR1 is driven by gene conversion of small regions. Finally, the prototype EBV strain B95-8 contains four nonconsensus variants within a single IR1 repeat unit, including a stop codon in the EBNA-LP gene. Repairing IR1 improves EBNA-LP levels and the quality of transformation by the B95-8 bacterial artificial chromosome (BAC). IMPORTANCE Epstein-Barr virus (EBV) infects the majority of the world population but causes illness in only a small minority of people. Nevertheless, over 1% of cancers worldwide are attributable to EBV. Recent sequencing projects investigating virus diversity to see if different strains have different disease impacts have excluded regions of repeating sequence, as they are more technically challenging. Here we analyze the sequence of the largest repeat in EBV (IR1). We first characterized the variations in protein sequences encoded across IR1. In studying variations within the repeat of each strain, we identified a mutation in the main laboratory strain of EBV that impairs virus function, and we suggest that tumor-associated viruses may be more likely to contain DNA mixed from two strains. The patterns of this mixing suggest that sequences can spread between strains (and also within the repeat) by copying sequence from another strain (or repeat unit) to repair DNA damage. Copyright © 2017 Ba abdullah et al.
Complete genome characterization of a novel enterovirus type EV-B106 isolated in China, 2012.
Tang, Jingjing; Tao, Zexin; Ding, Zhengrong; Zhang, Yong; Zhang, Jie; Tian, Bingjun; Zhao, Zhixian; Zhang, Lifen; Xu, Wenbo
2014-03-03
Human enterovirus B106 (EV-B106) is a recently identified member of enterovirus species B. In this study, we report the complete genomic characterization of an EV-B106 strain (148/YN/CHN/12) isolated from an acute flaccid paralysis patient in Yunnan Province, China. The new strain had 79.2-81.3% nucleotide and 89.1-94.8% amino acid similarity in the VP1 region with the other two EV-B106 strains from Bolivia and Pakistan. When compared with other EV serotypes, it had the highest (73.3%) VP1 nucleotide similarity with the EV-B77 prototype strain CF496-99. However, when aligned with all EV-B106 and EV-B77 sequences available from the GenBank database, two major frame shifts were observed in the VP1 coding region, which resulted in substantial (20.5%) VP1 amino acid divergence between the two serotypes. Phylogenetic analysis and similarity plot analysis revealed multiple recombination events in the genome of this strain. This is the first report of the complete genome of EV-B106.
Experimental encephalitis in monkeys caused by the Powassan virus.
Frolova, M P; Isachkova, L M; Shestopalova, N M; Pogodina, V V
1985-01-01
We have carried out a comparative study of the experimental infection of monkeys with the P-40 strain of the Powassen virus, isolated in the Primor'e Territory of the USSR, and with the Canadian prototype LB strain. The Powassan virus was found to be pathogenic for Macaca rhesus. The clinical and pathomorphological picture of the experimental encephalitis was studied, and the full identity of the infection produced in the monkeys by the P-40 strain and the Canadian LB strain of the Powassan virus was demonstrated. On electron microscopic examination of the central nervous system the virus was detected in the neurons, glial cells, and intercellular spaces. The virions of the strains studied have identical morphological parameters, being 37-45 nm in diameter and of spherical shape. The data obtained indicated a marked neurotropism of the virus. They will contribute to the elucidation of the role of the virus in the infection pathology of humans, i.e., in the differentiation of encephalitis cases not associated etiologically with the virus of the spring-summer tickborne encephalitis.
NASA Astrophysics Data System (ADS)
Tibbetts, Clark; Lichanska, Agnieszka M.; Borsuk, Lisa A.; Weslowski, Brian; Morris, Leah M.; Lorence, Matthew C.; Schafer, Klaus O.; Campos, Joseph; Sene, Mohamadou; Myers, Christopher A.; Faix, Dennis; Blair, Patrick J.; Brown, Jason; Metzgar, David
2010-04-01
High-density resequencing microarrays support simultaneous detection and identification of multiple viral and bacterial pathogens. Because detection and identification using RPM is based upon multiple specimen-specific target pathogen gene sequences generated in the individual test, the test results enable both a differential diagnostic analysis and epidemiological tracking of detected pathogen strains and variants from one specimen to the next. The RPM assay enables detection and identification of pathogen sequences that share as little as 80% sequence similarity to prototype target gene sequences represented as detector tiles on the array. This capability enables the RPM to detect and identify previously unknown strains and variants of a detected pathogen, as in sentinel cases associated with an infectious disease outbreak. We illustrate this capability using assay results from testing influenza A virus vaccines configured with strains that were first defined years after the design of the RPM microarray. Results are also presented from RPM-Flu testing of three specimens independently confirmed to the positive for the 2009 Novel H1N1 outbreak strain of influenza virus.
L'vov, D K; Al'khovskiĭ, S V; Shchelkanov, M Iu; Deriabin, P G; Gitel'man, A K; Botikov, A G; Aristova, V A
2014-01-01
The complete genomes of the three tick-borne flaviviruses (genus Flavivirus, fam. Bunyaviridae) were sequenced: Povassan virus (POWV, strain LEIV-3070Prm, isolated from Haemophysalis logicornis in Primorsky Krai, Russia in 1977), Alma-Arasan virus (AAV, strain LEIV-1380Kaz, isolated from Ixodes persulcatus ticks in Kazakhstan in 1977) and Malyshevo virus (isolated from a pool of Aedes vexans nipponii mosquitoes, in the Khabarovsk Krai, Russia in 1978). It is shown that AAV and Malyshevo virus are the strains of Tick-borne encephalitis virus (TBEV) and belong to Sibirian and Far-Eastern genotypes, respectively (GenBank ID: AAV KJ744033; strain Malyshevo KJ744034). Phylogenetically AAV is closest related (94,6% nt and 98,3% aa identity) to TBEV strains, isolated in Sibiria (Vasilchenko, Aino, Chita-653, Irkutsk-12). Malyshevo virus is closest related (96,4% nt and 98,3% nt identity) to strains of TBEV, isolated in Far Eastern part of Russia (1230, Spassk-72, Primorye-89). POWV LEIV-3070Prm has 99.7% identity with the prototype strain POWV LB, isolated in Canada and 99.5% of isolates with Far-Eastern strains of POWV (Spassk-9 and Nadezdinsk-1991).
New insight in magnetic saturation behavior of nickel hierarchical structures
NASA Astrophysics Data System (ADS)
Ma, Ji; Zhang, Jianxing; Liu, Chunting; Chen, Kezheng
2017-09-01
It is unanimously accepted that non-ferromagnetic inclusions in a ferromagnetic system will lower down total saturation magnetization in unit of emu/g. In this study, ;lattice strain; was found to be another key factor to have critical impact on magnetic saturation behavior of the system. The lattice strain determined assembling patterns of primary nanoparticles in hierarchical structures and was intimately related with the formation process of these architectures. Therefore, flower-necklace-like and cauliflower-like nickel hierarchical structures were used as prototype systems to evidence the relationship between assembling patterns of primary nanoparticles and magnetic saturation behaviors of these architectures. It was found that the influence of lattice strain on saturation magnetization outperformed that of non-ferromagnetic inclusions in these hierarchical structures. This will enable new insights into fundamental understanding of related magnetic effects.
Yamanaka, Atsushi; Oddgun, Duangjai; Chantawat, Nantarat; Okabayashi, Tamaki; Ramasoota, Pongrama; Churrotin, Siti; Kotaki, Tomohiro; Kameoka, Masanori; Soegijanto, Soegeng; Konishi, Eiji
2016-04-01
Dengue virus (DENV) infection-enhancing antibodies are a hypothetic factor to increase the dengue disease severity. In this study, we investigated the enhancing antibodies against Indonesian strains of DENV-1-4 in 50 healthy inhabitants of central Thailand (Bangkok and Uthai Thani). Indonesia and Thailand have seen the highest dengue incidence in Southeast Asia. The infection history of each subject was estimated by comparing his/her neutralizing antibody titers against prototype DENV-1-4 strains. To resolve the difficulty in obtaining foreign live viruses for use as assay antigens, we used a recombinant system to prepare single-round infectious dengue viral particles based on viral sequence information. Irrespective of the previously infecting serotype(s), most serum samples showed significantly higher enhancement titers against Indonesian DENV-2 strains than against Thai DENV-2 strains, whereas the opposite effect was observed for the DENV-3 strains. Equivalent enhancing activities were observed against both DENV-1 and DENV-4. These results suggest that the genotype has an impact on enhancing antibody activities against DENV-2 and DENV-3, because the predominant circulating genotypes of each serotype differ between Indonesia and Thailand. Copyright © 2015 Institut Pasteur. Published by Elsevier Masson SAS. All rights reserved.
[Experimental monkey encephalitis caused by Powassan virus].
Frolova, M P; Isachkova, L M; Shestopalova, N M; Pogodina, V V
1981-01-01
A comparative study of the experimental infection of monkeys caused by brain P-40 of Powassan virus isolated in the Primorye Territory of the USSR and by the prototype Canadian strain LB was carried out. Powassan virus was found to be pathogenic for Macaca rhesus. Clinical and pathomorphological picture of the experimental encephalitis was studied. Full identity of the infection caused in the monkeys by the strain P-40 and the Canadian strain LB of Powassan virus has been proved. On electronmicroscopic examination of the central nervous system the virus was detected in the neurons, glial cells and intercellular spaces. The virions of the strains studied have identical morphological parameters, being 37 to 45 nm in diameter and having spherical shape. The data obtained point to a marked neurotropism of the virus. They will contribute to elucidation of the virus role in the infectious pathology of man, and namely, in verification of encephalitis cases not associated etiologically with the virus of the spring-summer tick-borne encephalitis.
Qiu, Zhongyang; Gao, Qiuqiang; Bao, Jie
2017-12-01
Xylose-assimilating pathway was constructed in a d-lactic acid producing Pediococcus acidilactici strain and evolutionary adapted to yield a co-fermentation strain P. acidilactici ZY15 with 97.3g/L of d-lactic acid and xylose conversion of 92.6% obtained in the high solids content simultaneous saccharification and co-fermentation (SSCF) of dry dilute acid pretreated and biodetoxified corn stover feedstock. The heterologous genes encoding xylose isomerase (xylA) and xylulokinase (xylB) were screened and integrated into the P. acidilactici chromosome. The metabolic flux to acetic acid in phosphoketolase pathway was re-directed to pentose phosphate pathway by substituting the endogenous phosphoketolase gene (pkt) with the heterologous transketolase (tkt) and transaldolase (tal) genes. The xylose-assimilating ability of the newly constructed P. acidilactici strain was significantly improved by adaptive evolution. This study provided an important strain and process prototype for high titer d-lactic acid production from lignocellulose feedstock with efficient xylose assimilation. Copyright © 2017 Elsevier Ltd. All rights reserved.
Schauer, David B.; McCathey, Sonya N.; Daft, Barbara M.; Jha, Sharda S.; Tatterson, Lisa E.; Taylor, Nancy S.; Fox, James G.
1998-01-01
Both enteropathogenic Escherichia coli (EPEC) and an obligate intracellular bacterium, previously referred to as an intracellular Campylobacter-like organism and now designated Lawsonia intracellularis, have been reported as causes of enterocolitis in rabbits. An outbreak of enterocolitis in a group of rabbits, characterized by an unusually high rate of mortality, was found to be associated with dual infection with EPEC and L. intracellularis. The EPEC strain was found to have eaeA gene homology but was negative for afrA homology. The absence of the afrA gene, which encodes the structural subunit for the AF/R1 pilus, indicates that this rabbit EPEC strain is distinct from the prototypic RDEC-1 strain. This finding suggests that rabbit EPEC strains widely reported in Western Europe, which lack AF/R1 pili, are also present in rabbits in the United States. Dual infection with these two pathogens in rabbits has not been previously reported and may have contributed to the unusually high mortality observed in this outbreak. PMID:9620403
Lundgren, A; Leach, S; Tobias, J; Carlin, N; Gustafsson, B; Jertborn, M; Bourgeois, L; Walker, R; Holmgren, J; Svennerholm, A-M
2013-02-06
We have developed a new oral vaccine against enterotoxigenic Escherichia coli (ETEC) diarrhea containing killed recombinant E. coli bacteria expressing increased levels of ETEC colonization factors (CFs) and a recombinant protein (LCTBA), i.e. a hybrid between the binding subunits of E. coli heat labile toxin (LTB) and cholera toxin (CTB). We describe a randomized, comparator controlled, double-blind phase I trial in 60 adult Swedish volunteers of a prototype of this vaccine. The safety and immunogenicity of the prototype vaccine, containing LCTBA and an E. coli strain overexpressing the colonization factor CFA/I, was compared to a previously developed oral ETEC vaccine, consisting of CTB and inactivated wild type ETEC bacteria expressing CFA/I (reference vaccine). Groups of volunteers were given two oral doses of either the prototype or the reference vaccine; the prototype vaccine was administered at the same or a fourfold higher dosage than the reference vaccine. The prototype vaccine was found to be safe and equally well-tolerated as the reference vaccine at either dosage tested. The prototype vaccine induced mucosal IgA (fecal secretory IgA and intestine-derived IgA antibody secreting cell) responses to both LTB and CFA/I, as well as serum IgA and IgG antibody responses to LTB. Immunization with LCTBA resulted in about twofold higher mucosal and systemic IgA responses against LTB than a comparable dose of CTB. The higher dose of the prototype vaccine induced significantly higher fecal and systemic IgA responses to LTB and fecal IgA responses to CFA/I than the reference vaccine. These results demonstrate that CF over-expression and inclusion of the LCTBA hybrid protein in an oral inactivated ETEC vaccine does not change the safety profile when compared to a previous generation of such a vaccine and that the prototype vaccine induces significant dose dependent mucosal immune responses against CFA/I and LTB. Copyright © 2013 Elsevier Ltd. All rights reserved.
Pérez-Ramírez, Elisa; Llorente, Francisco; Del Amo, Javier; Fall, Gamou; Sall, Amadou Alpha; Lubisi, Alison; Lecollinet, Sylvie; Vázquez, Ana; Jiménez-Clavero, Miguel Ángel
2017-04-01
Rodent models have been used extensively to study West Nile virus (WNV) infection because they develop severe neurological symptoms similar to those observed in human WNV neuroinvasive disease. Most of this research has focused on old lineage (L) 1 strains, while information about pathogenicity is lacking for the most recent L1 and L2 strains, as well as for newly defined lineages. In this study, 4-week-old Swiss mice were inoculated with a collection of 12 WNV isolates, comprising 10 old and recent L1 and L2 strains, the putative L6 strain from Malaysia and the proposed L7 strain Koutango (KOU). The intraperitoneal inoculation of 10-fold dilutions of each strain allowed the characterization of the isolates in terms of LD50, median survival times, ID50, replication in neural and extraneural tissues and antibody production. Based on these results, we classified the isolates in three groups: high virulence (all L1a strains, recent L2 strains and KOU), moderate virulence (B956 strain) and low virulence (Kunjin and Malaysian isolates). We determined that the inoculation of a single dose of 1000 p.f.u. would be sufficient to classify WNV strains by pathotype. We confirmed the enhanced virulence of the KOU strain with a high capacity to cause rapid systemic infection. We also corroborated that differences in pathogenicity among strains do not correlate with phylogenetic lineage or geographic origin, and confirmed that recent European and African WNV strains belonging to L1 and L2 are highly virulent and do not differ in their pathotype profile compared to the prototype NY99 strain.
Accessible switching of electronic defect type in SrTi O3 via biaxial strain
NASA Astrophysics Data System (ADS)
Chi, Yen-Ting; Youssef, Mostafa; Sun, Lixin; Van Vliet, Krystyn J.; Yildiz, Bilge
2018-05-01
Elastic strain is used widely to alter the mobility of free electronic carriers in semiconductors, but a predictive relationship between elastic lattice strain and the extent of charge localization of electronic defects is still underdeveloped. Here we considered SrTi O3 , a prototypical perovskite as a model functional oxide for thin film electronic devices and nonvolatile memories. We assessed the effects of biaxial strain on the stability of electronic defects at finite temperature by combining density functional theory (DFT) and quasiharmonic approximation (QHA) calculations. We constructed a predominance diagram for free electrons and small electron polarons in this material, as a function of biaxial strain and temperature. We found that biaxial tensile strain in SrTi O3 can stabilize the small polaron, leading to a thermally activated and slower electronic transport, consistent with prior experimental observations on SrTi O3 and distinct from our prior theoretical assessment of the response of SrTi O3 to hydrostatic stress. These findings also resolved apparent conflicts between prior atomistic simulations and conductivity experiments for biaxially strained SrTi O3 thin films. Our computational approach can be extended to other functional oxides, and for the case of SrTi O3 our findings provide concrete guidance for conditions under which strain engineering can shift the electronic defect type and concentration to modulate electronic transport in thin films.
Belikov, Sergei I.; Kondratov, Ilya G.; Potapova, Ulyana V.; Leonova, Galina N.
2014-01-01
Tick-borne encephalitis virus (TBEV) is transmitted to vertebrates by taiga or forest ticks through bites, inducing disease of variable severity. The reasons underlying these differences in the severity of the disease are unknown. In order to identify genetic factors affecting the pathogenicity of virus strains, we have sequenced and compared the complete genomes of 34 Far-Eastern subtype (FE) TBEV strains isolated from patients with different disease severity (Primorye, the Russian Far East). We analyzed the complete genomes of 11 human pathogenic strains isolated from the brains of dead patients with the encephalitic form of the disease (Efd), 4 strains from the blood of patients with the febrile form of TBE (Ffd), and 19 strains from patients with the subclinical form of TBE (Sfd). On the phylogenetic tree, pathogenic Efd strains formed two clusters containing the prototype strains, Senzhang and Sofjin, respectively. Sfd strains formed a third separate cluster, including the Oshima strain. The strains that caused the febrile form of the disease did not form a separate cluster. In the viral proteins, we found 198 positions with at least one amino acid residue substitution, of which only 17 amino acid residue substitutions were correlated with the variable pathogenicity of these strains in humans and they authentically differed between the groups. We considered the role of each amino acid substitution and assumed that the deletion of 111 amino acids in the capsid protein in combination with the amino acid substitutions R16K and S45F in the NS3 protease may affect the budding process of viral particles. These changes may be the major reason for the diminished pathogenicity of TBEV strains. We recommend Sfd strains for testing as attenuation vaccine candidates. PMID:24740396
Sanabria, Carlos; Lee, Peter J.; Starch, William; ...
2015-06-22
Cables made with Nb 3Sn-based superconductor strands will provide the 13 T maximum peak magnetic field of the ITER Central Solenoid (CS) coils and they must survive up to 60,000 electromagnetic cycles. Accordingly, prototype designs of CS cable-in-conduit-conductors (CICC) were electromagnetically tested over multiple magnetic field cycles and warm-up-cool-down scenarios in the SULTAN facility at CRPP. We report here a post mortem metallographic analysis of two CS CICC prototypes which exhibited some rate of irreversible performance degradation during cycling. The standard ITER CS CICC cable design uses a combination of superconducting and Cu strands, and because the Lorentz force onmore » the strand is proportional to the transport current in the strand, removing the copper strands (while increasing the Cu:SC ratio of the superconducting strands) was proposed as one way of reducing the strand load. In this study we compare the two alternative CICCs, with and without Cu strands, keeping in mind that the degradation after SULTAN test was lower for the CICC without Cu strands. The post mortem metallographic evaluation revealed that the overall strand transverse movement was 20% lower in the CICC without Cu strands and that the tensile filament fractures found were less, both indications of an overall reduction in high tensile strain regions. Furthermore, it was interesting to see that the Cu strands in the mixed cable design (with higher degradation) helped reduce the contact stresses on the high pressure side of the CICC, but in either case, the strain reduction mechanisms were not enough to suppress cyclic degradation. Advantages and disadvantages of each conductor design are discussed here aimed to understand the sources of the degradation.« less
Evaluation of Microbolometer-Based Thermography for Gossamer Space Structures
NASA Technical Reports Server (NTRS)
Miles, Jonathan J.; Blandino, Joseph R.; Jenkins, Christopher H.; Pappa, Richard S.; Banik, Jeremy; Brown, Hunter; McEvoy, Kiley
2005-01-01
In August 2003, NASA's In-Space Propulsion Program contracted with our team to develop a prototype on-board Optical Diagnostics System (ODS) for solar sail flight tests. The ODS is intended to monitor sail deployment as well as structural and thermal behavior, and to validate computational models for use in designing future solar sail missions. This paper focuses on the thermography aspects of the ODS. A thermal model was developed to predict local sail temperature variations as a function of sail tilt to the sun, billow depth, and spectral optical properties of front and back sail surfaces. Temperature variations as small as 0.5 C can induce significant thermal strains that compare in magnitude to mechanical strains. These thermally induced strains may result in changes in shape and dynamics. The model also gave insight into the range and sensitivity required for in-flight thermal measurements and supported the development of an ABAQUS-coupled thermo-structural model. The paper also discusses three kinds of tests conducted to 1) determine the optical properties of candidate materials; 2) evaluate uncooled microbolometer-type infrared imagers; and 3) operate a prototype imager with the ODS baseline configuration. (Uncooled bolometers are less sensitive than cooled ones, but may be necessary because of restrictive ODS mass and power limits.) The team measured the spectral properties of several coated polymer samples at various angles of incidence. Two commercially available uncooled microbolometer imagers were compared, and it was found that reliable temperature measurements are feasible for both coated and uncoated sides of typical sail membrane materials.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Cheng, Daniel W.; Ambrosio, Giorgio; Anderssen, Eric C.
Here, the LHC accelerator research program (LARP), in collaboration with CERN and under the scope of the high luminosity upgrade of the Large Hadron Collider, is in the prototyping stage in the development of a 150 mm aperture high-field Nb 3Sn quadrupole magnet called MQXF. This magnet is mechanically supported using a shell-based support structure, which has been extensively demonstrated on several R&D models within LARP, as well as in the more recent short (1.2 m magnetic length) MQXF model program. The MQXFA magnets are each 4.2 m magnetic length, and the first mechanical long model, MQXFA1M (using aluminum surrogatemore » coils), and MQXFAP1 prototype magnet (the first prototype with Nb 3Sn coils) have been assembled at the LBNL. In this paper, we summarize the tooling and the assembly processes, and discuss the mechanical performance of these first two assemblies, comparing strain gauge data with finite element model analysis, as well as the near-term plans for the long MQXF magnet program.« less
Cheng, Daniel W.; Ambrosio, Giorgio; Anderssen, Eric C.; ...
2018-01-30
Here, the LHC accelerator research program (LARP), in collaboration with CERN and under the scope of the high luminosity upgrade of the Large Hadron Collider, is in the prototyping stage in the development of a 150 mm aperture high-field Nb 3Sn quadrupole magnet called MQXF. This magnet is mechanically supported using a shell-based support structure, which has been extensively demonstrated on several R&D models within LARP, as well as in the more recent short (1.2 m magnetic length) MQXF model program. The MQXFA magnets are each 4.2 m magnetic length, and the first mechanical long model, MQXFA1M (using aluminum surrogatemore » coils), and MQXFAP1 prototype magnet (the first prototype with Nb 3Sn coils) have been assembled at the LBNL. In this paper, we summarize the tooling and the assembly processes, and discuss the mechanical performance of these first two assemblies, comparing strain gauge data with finite element model analysis, as well as the near-term plans for the long MQXF magnet program.« less
[Bovine herpesvirus 4 (BoHV-4): general aspects of the biology and status in Argentina].
Morán, Pedro E; Pérez, Sandra E; Odeón, Anselmo C; Verna, Andrea E
2015-01-01
Bovine herpesvirus 4 (BoHV-4) has been isolated from cattle with respiratory infections, vulvovaginitis, mastitis, abortions, endometritis and from apparently healthy animals throughout the world. Although it has not yet been established as causal agent of a specific disease entity, it is primarily associated with reproductive disorders of cattle. This virus can infect a wide range of species, either in vivo or in vitro. Two groups of prototype strains were originated from the first isolates: the DN599-type strains (American group) and the Movar-type strains (European group). In Argentina, BoHV-4 was isolated and characterized in 2007 from vaginal discharge samples taken from cows that had aborted. So far, more than 40 isolates, mainly associated with aborting bovine females have been registered in our country. Copyright © 2014 Asociación Argentina de Microbiología. Publicado por Elsevier España, S.L.U. All rights reserved.
Mimicking biological stress-strain behaviour with synthetic elastomers
NASA Astrophysics Data System (ADS)
Vatankhah-Varnosfaderani, Mohammad; Daniel, William F. M.; Everhart, Matthew H.; Pandya, Ashish A.; Liang, Heyi; Matyjaszewski, Krzysztof; Dobrynin, Andrey V.; Sheiko, Sergei S.
2017-09-01
Despite the versatility of synthetic chemistry, certain combinations of mechanical softness, strength, and toughness can be difficult to achieve in a single material. These combinations are, however, commonplace in biological tissues, and are therefore needed for applications such as medical implants, tissue engineering, soft robotics, and wearable electronics. Present materials synthesis strategies are predominantly Edisonian, involving the empirical mixing of assorted monomers, crosslinking schemes, and occluded swelling agents, but this approach yields limited property control. Here we present a general strategy for mimicking the mechanical behaviour of biological materials by precisely encoding their stress-strain curves in solvent-free brush- and comb-like polymer networks (elastomers). The code consists of three independent architectural parameters—network strand length, side-chain length and grafting density. Using prototypical poly(dimethylsiloxane) elastomers, we illustrate how this parametric triplet enables the replication of the strain-stiffening characteristics of jellyfish, lung, and arterial tissues.
Bae, Chae-Wun; Lee, Joong-Bok; Park, Seung-Yong; Song, Chang-Seon; Lee, Nak-Hyung; Seo, Kun-Ho; Kang, Young-Sun; Park, Choi-Kyu; Choi, In-Soo
2013-08-01
Canine distemper virus (CDV) causes highly contagious respiratory, gastrointestinal, and neurological diseases in wild and domestic animal species. Despite a broad vaccination campaign, the disease is still a serious problem worldwide. In this study, six field CDV strains were isolated from three dogs, two raccoon dogs, and one badger in Korea. The full sequence of the genes encoding fusion (F) and hemagglutinin (H) proteins were compared with those of other CDVs including field and vaccine strains. The phylogenetic analysis for the F and H genes indicated that the two CDV strains isolated from dogs were most closely related to Chinese strains in the Asia-1 genotype. Another four strains were closely related to Japanese strains in the Asia-2 genotype. The six currently isolated strains shared 90.2-92.1% and 88.2-91.8% identities with eight commercial vaccine strains in their nucleotide and amino acid sequences of the F protein, respectively. They also showed 90.1-91.4% and 87.8-90.7% identities with the same vaccine strains in their nucleotide and deduced amino acid sequences of the H protein, respectively. Different N-linked glycosylation sites were identified in the F and H genes of the six isolates from the prototype vaccine strain Onderstepoort. Collectively, these results demonstrate that at least two different CDV genotypes currently exist in Korea. The considerable genetic differences between the vaccine strains and wild-type isolates would be a major factor of the incomplete protection of dogs from CDV infections.
Phototoxicity of strained Ru(ii) complexes: is it the metal complex or the dissociating ligand?
Azar, Daniel F; Audi, Hassib; Farhat, Stephanie; El-Sibai, Mirvat; Abi-Habib, Ralph J; Khnayzer, Rony S
2017-09-12
A photochemically dissociating ligand in Ru(bpy) 2 (dmphen)Cl 2 [bpy = 2,2'-bipyridine; dmphen = 2,9-dimethyl-1,10-phenanthroline] was found to be more cytotoxic on the ML-2 Acute Myeloid Leukemia cell line than Ru(bpy) 2 (H 2 O) 2 2+ and prototypical cisplatin. Our findings illustrate the potential potency of diimine ligands in photoactivatable Ru(ii) complexes.
All-nanotube stretchable supercapacitor with low equivalent series resistance.
Gilshteyn, Evgenia P; Amanbayev, Daler; Anisimov, Anton S; Kallio, Tanja; Nasibulin, Albert G
2017-12-12
We report high-performance, stable, low equivalent series resistance all-nanotube stretchable supercapacitor based on single-walled carbon nanotube film electrodes and a boron nitride nanotube separator. A layer of boron nitride nanotubes, fabricated by airbrushing from isopropanol dispersion, allows avoiding problem of high internal resistance and short-circuiting of supercapacitors. The device, fabricated in a two-electrode test cell configuration, demonstrates electrochemical double layer capacitance mechanism and retains 96% of its initial capacitance after 20 000 electrochemical charging/discharging cycles with the specific capacitance value of 82 F g -1 and low equivalent series resistance of 4.6 Ω. The stretchable supercapacitor prototype withstands at least 1000 cycles of 50% strain with a slight increase in the volumetric capacitance from 0.4 to 0.5 mF cm -3 and volumetric power density from 32 mW cm -3 to 40 mW cm -3 after stretching, which is higher than reported before. Moreover, a low resistance of 250 Ω for the as-fabricated stretchable prototype was obtained, which slightly decreased with the strain applied up to 200 Ω. Simple fabrication process of such devices can be easily extended making the all-nanotube stretchable supercapacitors, presented here, promising elements in future wearable devices.
Adler Sørensen, Camilla; Rosbjerg, Anne; Hebbelstrup Jensen, Betina; Krogfelt, Karen Angeliki; Garred, Peter
2018-01-01
Enteroaggregative Escherichia coli (EAEC) causes acute and persistent diarrhea worldwide. Still, the involvement of host factors in EAEC infections is unresolved. Binding of recognition molecules from the lectin pathway of complement to EAEC strains have been observed, but the importance is not known. Our aim was to uncover the involvement of these molecules in innate complement dependent immune protection toward EAEC. Binding of mannose-binding lectin, ficolin-1, -2, and -3 to four prototypic EAEC strains, and ficolin-2 binding to 56 clinical EAEC isolates were screened by a consumption-based ELISA method. Flow cytometry was used to determine deposition of C4b, C3b, and the bactericidal C5b-9 membrane attack complex (MAC) on the bacteria in combination with different complement inhibitors. In addition, the direct serum bactericidal effect was assessed. Screening of the prototypic EAEC strains revealed that ficolin-2 was the major binder among the lectin pathway recognition molecules. However, among the clinical EAEC isolates only a restricted number ( n = 5) of the isolates bound ficolin-2. Using the ficolin-2 binding isolate C322-17 as a model, we found that incubation with normal human serum led to deposition of C4b, C3b, and to MAC formation. No inhibition of complement deposition was observed when a C1q inhibitor was added, while partial inhibition was observed when ficolin-2 or factor D inhibitors were used separately. Combining the inhibitors against ficolin-2 and factor D led to virtually complete inhibition of complement deposition and protection against direct bacterial killing. These results demonstrate that ficolin-2 may play an important role in innate immune protection against EAEC when an appropriate ligand is exposed, but many EAEC strains evade lectin pathway recognition and may, therefore, circumvent this strategy of innate host immune protection.
Treviño-Quintanilla, Luis Gerardo; Escalante, Adelfo; Caro, Alma Delia; Martínez, Alfredo; González, Ricardo; Puente, José Luis; Bolívar, Francisco; Gosset, Guillermo
2007-01-01
The capacity to utilize sucrose as a carbon and energy source (Scr(+) phenotype) is a highly variable trait among Escherichia coli strains. In this study, seven enteropathogenic E. coli (EPEC) strains from different sources were studied for their capacity to grow using sucrose. Liquid media cultures showed that all analyzed strains have the Scr(+) phenotype and two distinct groups were defined: one of five and another of two strains displaying doubling times of 67 and 125 min, respectively. The genes conferring the Scr(+) phenotype in one of the fast-growing strains (T19) were cloned and sequenced. Comparative sequence analysis revealed that this strain possesses the scr regulon genes scrKYABR, encoding phosphoenolpyruvate:phosphotransferase system-dependent sucrose transport and utilization activities. Transcript level quantification revealed sucrose-dependent induction of scrK and scrR genes in fast-growing strains, whereas no transcripts were detected in slow-growing strains. Sequence comparison analysis revealed that the scr genes in strain T19 are almost identical to those present in the scr regulon of prototype EPEC E2348/69 and in both strains, the scr genes are inserted in the chromosomal intergenic region of hypothetical genes ygcE and ygcF. Comparison of the ygcE-ygcF intergenic region sequence of strains MG1655, enterohemorrhagic EDL933, uropathogenic ECFT073 and EPEC T19-E2348/69 revealed that the number of extragenic highly repeated iap sequences corresponded to nine, four, two and none, respectively. These results show that the iap sequence-containing chromosomal ygcE-ygcF intergenic region is highly variable in E. coli. Copyright (c) 2007 S. Karger AG, Basel.
Brown, Marissa D; Chambers, Delores H
2015-12-01
This research determined the sensory characteristics of currently available plain yogurts available in U.S. supermarkets and examined how 3 "more sustainable" prototypes compared. The prototypes, nonfat set-style yogurts pre-acidified after pasteurization with lemon juice or citric acid at 80 ppm to pH 6.2, had shorter fermentation times than the lab-made control. These reduced fermentation times could result in energy reductions and potentially substantiate a "sustainable" marketing claim, a concept gaining traction with consumers. Twenty-six commercial yogurts, varying in percent milk fat, milk source (organic or conventional), and processing (set-style, stirred, or strained/Greek-style), were also included. Using descriptive sensory analysis, a 6-person highly trained panel scored the intensity of 25 flavor and 10 texture attributes on a 15-point scale. Three replications were carried out, and all samples were tested at least 10 d prior to the end of their shelf-lives. The samples differed for 19 flavor and all 10 texture attributes. Cluster analysis indicated approximately 7 flavor and 5 texture clusters. The prototype pre-acidified with lemon juice was similar to category leaders nonfat yogurt varieties. The prototype pre-acidified with citric acid was similar in texture but was less sour. Although no legal definitions exist for "sustainable," the prototypes' sensory characteristics are comparable to those of popular yogurts indicating potential market viability. This research also demonstrates potential for making yogurt that is in line with growing consumer expectations for sustainability. Despite the current diversity, several combinations of flavor and texture were not represented. © 2015 Institute of Food Technologists®
Ravva, Subbarao V; Sarreal, Chester Z
2016-01-01
F+ RNA coliphages (FRNA) are used to source-track fecal contamination and as surrogates for enteric pathogen persistence in the environment. However, the environmental persistence of FRNA is not clearly understood and necessitates the evaluation of the survival of prototype and environmental isolates of FRNA representing all four genogroups in surface waters from the central coast of California. Water temperature played a significant role in persistence-all prototype and environmental strains survived significantly longer at 10 °C compared to 25 °C. Similarly, the availability of host bacterium was found to be critical in FRNA survival. In the absence of E. coli F(amp), all prototypes of FRNA disappeared rapidly with a D-value (days for one log reduction) of <1.2 d from water samples incubated at 25 °C; the longest surviving prototype was SP. However, in the presence of the host, the order of persistence at 25 °C was QB>MS2>SP>GA and at 10 °C it was QB = MS2>GA>SP. Significant differences in survival were observed between prototypes and environmental isolates of FRNA. While most environmental isolates disappeared rapidly at 25 °C and in the absence of the host, members of genogroups GIII and GI persisted longer with the host compared to members of GII and GIV. Consequentially, FRNA based source tracking methods can be used to detect phages from recent fecal contamination along with those that persist longer in the environment as a result of cooler temperatures and increased host presence.
Ravva, Subbarao V.; Sarreal, Chester Z.
2016-01-01
F+ RNA coliphages (FRNA) are used to source-track fecal contamination and as surrogates for enteric pathogen persistence in the environment. However, the environmental persistence of FRNA is not clearly understood and necessitates the evaluation of the survival of prototype and environmental isolates of FRNA representing all four genogroups in surface waters from the central coast of California. Water temperature played a significant role in persistence–all prototype and environmental strains survived significantly longer at 10°C compared to 25°C. Similarly, the availability of host bacterium was found to be critical in FRNA survival. In the absence of E. coli Famp, all prototypes of FRNA disappeared rapidly with a D-value (days for one log reduction) of <1.2 d from water samples incubated at 25°C; the longest surviving prototype was SP. However, in the presence of the host, the order of persistence at 25°C was QB>MS2>SP>GA and at 10°C it was QB = MS2>GA>SP. Significant differences in survival were observed between prototypes and environmental isolates of FRNA. While most environmental isolates disappeared rapidly at 25°C and in the absence of the host, members of genogroups GIII and GI persisted longer with the host compared to members of GII and GIV. Consequentially, FRNA based source tracking methods can be used to detect phages from recent fecal contamination along with those that persist longer in the environment as a result of cooler temperatures and increased host presence. PMID:26784030
Poly(caprolactone) based magnetic scaffolds for bone tissue engineering
NASA Astrophysics Data System (ADS)
Bañobre-López, M.; Piñeiro-Redondo, Y.; De Santis, R.; Gloria, A.; Ambrosio, L.; Tampieri, A.; Dediu, V.; Rivas, J.
2011-04-01
Synthetic scaffolds for tissue engineering coupled to stem cells represent a promising approach aiming to promote the regeneration of large defects of damaged tissues or organs. Magnetic nanocomposites formed by a biodegradable poly(caprolactone) (PCL) matrix and superparamagnetic iron doped hydroxyapatite (FeHA) nanoparticles at different PCL/FeHA compositions have been successfully prototyped, layer on layer, through 3D bioplotting. Magnetic measurements, mechanical testing, and imaging were carried out to calibrate both model and technological processing in the magnetized scaffold prototyping. An amount of 10% w/w of magnetic FeHA nanoparticles represents a reinforcement for PCL matrix, however, a reduction of strain at failure is also observed. Energy loss (absorption) measurements under a radio-frequency applied magnetic field were performed in the resulting magnetic scaffolds and very promising heating properties were observed, making them very useful for potential biomedical applications.
Salvador, Ellaine; Wagenlehner, Florian; Köhler, Christian-Daniel; Mellmann, Alexander; Hacker, Jörg; Svanborg, Catharina
2012-01-01
Asymptomatic bacteriuria (ABU) is a condition where bacteria stably colonize the urinary tract, in a manner closely resembling commensalism at other mucosal sites. The patients carry >105 CFU/ml for extended periods of time and rarely develop symptoms. Contrasting the properties of ABU strains to those of uropathogenic isolates causing symptomatic infection is therefore highly relevant to understand mechanisms of bacterial adaptation. The prototype ABU strain Escherichia coli 83972 has a smaller genome than uropathogenic E. coli (UPEC) strains with deletions or point mutations in several virulence genes, suggesting that ABU strains undergo a programmed reductive evolution within human hosts. This study addressed if these observations can be generalized. Strains causing ABU in outpatients or hospitalized patients after catheterization or other invasive procedures were compared to commensal E. coli isolates from the intestinal flora of healthy individuals. Notably, clonal complex 73 (CC73) was a prominent phylogenetic lineage dominated by ABU isolates. ABU isolates from outpatients and hospitalized patients had a similar overall virulence gene repertoire, which distinguished them from many commensals, but typical UPEC virulence genes were less frequently attenuated in hospital strains than in outpatient strains or commensals. The decreased virulence potential of outpatient ABU isolates relative to that of ABU strains from hospitalized patients supports the hypothesis that loss of expression or decay of virulence genes facilitates long-term carriage and adaptation to host environments. PMID:22104113
Krishnan, Subramanian; Chang, Alexander C; Hodges, Jacqueline; Couraud, Pierre-Olivier; Romero, Ignacio A; Weksler, Babette; Nicholson, Bryon A; Nolan, Lisa K; Prasadarao, Nemani V
2015-01-01
Neonatal meningitis Escherichia coli K1 (NMEC) are thought to be transmitted from mothers to newborns during delivery or by nosocomial infections. However, the source of E. coli K1 causing these infections is not clear. Avian pathogenic E. coli (APEC) have the potential to cause infection in humans while human E. coli have potential to cause colibacillosis in poultry, suggesting that these strains may lack host specificity. APEC strains are capable of causing meningitis in newborn rats; however, it is unclear whether these bacteria use similar mechanisms to that of NMEC to establish disease. Using four representative APEC and NMEC strains that belong to serotype O18, we demonstrate that these strains survive in human serum similar to that of the prototypic NMEC strain E44, a derivative of RS218. These bacteria also bind and enter both macrophages and human cerebral microvascular endothelial cells (HCMEC/D3) with similar frequency as that of E44. The amino acid sequences of the outer membrane protein A (OmpA), an important virulence factor in the pathogenesis of meningitis, are identical within these representative APEC and NMEC strains. Further, these strains also require FcγRI-α chain (CD64) and Ecgp96 as receptors for OmpA in macrophages and HCMEC/D3, respectively, to bind and enter these cells. APEC and NMEC strains induce meningitis in newborn mice with varying degree of pathology in the brains as assessed by neutrophil recruitment and neuronal apoptosis. Together, these results suggest that serotype O18 APEC strains utilize similar pathogenic mechanisms as those of NMEC strains in causing meningitis.
Design and Testing of an Active Core for Sandwich Panels
2008-03-01
some degrees of unimorph from the design. In the experiment, the current prototype, which is made of polycarbonate material and Nitinol spring...such as Nitinol , is chosen due to its greater shape memory strain (8.5%), practical fabrication technique, and is relatively in- expansive. 2.2... Nitinol and its volume fractions are 5%, 7.5%, and 10% of the total design domain. The artificial stiffness implemented at the top and bottom right hand
Pandemic Influenza: Domestic Preparedness Efforts
2005-11-10
three different strains of influenza.77 Only one ( sanofi pasteur78) of nine manufacturers of injectable flu vaccine is located in the United States...has awarded contracts to Aventis Pasteur (now sanofi pasteur) to develop prototype human vaccines against H5N1 flu, and to Chiron Corporation to develop...occur in the next several years, the U.S. response would be affected by the limited availability of a vaccine (the best preventive measure for flu), as
Compliant Robotic Structures. Part 2
1986-07-01
Nonaxially Homogeneous Stresses and Strains 44 Parametric Studies 52 % References 65 III. LARGE DEFLECTIONS OF CONTINUOUS ELASTIC ’- STRUCTURES 66...APPENDIX C: Computer Program for the Element String 133 -° SUMMARY This is the second year report which is a part of a three- year study on compliant...ratios as high as 10/1 for laboratory-scale models and up to 3/1 for full-scale prototype arms. The first two years of this study have involved the
Haemophilus ducreyi Outer Membrane Determinants, Including DsrA, Define Two Clonal Populations
White, Catherine Dinitra; Leduc, Isabelle; Olsen, Bonnie; Jeter, Chrystina; Harris, Chavala; Elkins, Christopher
2005-01-01
The Haemophilus ducreyi outer membrane component DsrA (for ducreyi serum resistance A) is necessary for complete resistance to normal human serum (NHS). When DsrA expression in 19 temporally and geographically diverse clinical isolates of H. ducreyi was examined by Western blotting, 5 of the strains expressed a different immunotype of the DsrA protein (DsrAII) than the well-characterized prototypical strain 35000HP (DsrAI). The predicted DsrA proteins expressed by the DsrAII strains were 100% identical to each other but only 48% identical to that of strain 35000HP. In addition to the DsrAII protein, class II strains also expressed variant forms of other outer membrane proteins (OMPs) including NcaA (necessary for collagen adhesion A), DltA (ducreyi lectin A), Hlp (H. ducreyi lipoprotein), major OMP, and/or OmpA2 (for OMP A2) and synthesized a distinct, faster-migrating lipooligosaccharide. Based on these data, strains expressing DsrAI were termed class I, and those expressing DsrAII were termed class II. Expression of dsrAII from strain CIP 542 ATCC in the class I dsrAI mutant FX517 (35000HP background), which does not express a DsrA protein, rendered this strain resistant to 50% NHS. This demonstrates that DsrAII protein is also critical to serum resistance. Taken together, these results indicate that there are two clonal populations of H. ducreyi. The implications of two classes of H. ducreyi strains differing in important antigenic outer membrane components are discussed. PMID:15784585
Blomqvist, Soile; Savolainen, Carita; Råman, Laura; Roivainen, Merja; Hovi, Tapani
2002-01-01
It has recently been reported that all but one of the 102 known serotypes of the genus Rhinovirus segregate into two genetic clusters (C. Savolainen, S. Blomqvist, M. N. Mulders, and T. Hovi, J. Gen. Virol. 83:333-340, 2002). The only exception is human rhinovirus 87 (HRV87). Here we demonstrate that HRV87 is genetically and antigenically highly similar to enterovirus 68 (EV68) and is related to EV70, the other member of human enterovirus group D. The partial nucleotide sequences of the 5′ untranslated region, capsid regions VP4/VP2 and VP1, and the 3D RNA polymerase gene of the HRV87 prototype strain F02-3607 Corn showed 97.3, 97.8, 95.2, and 95.9% identity to the corresponding regions of EV68 prototype strain Fermon. The amino acid identities were 100 and 98.1% for the products of the two capsid regions and 97.9% for 3D RNA polymerase. Antigenic cross-reaction between HRV87 and EV68 was indicated by microneutralization with monotypic antisera. Phylogenetic analysis showed definite clustering of HRV87 and EV68 with EV70 for all sequences examined. Both HRV87 and EV68 were shown to be acid sensitive by two different assays, while EV70 was acid resistant, which is typical of enteroviruses. The cytopathic effect induced by HRV87 or EV68 was inhibited by monoclonal antibodies to the decay-accelerating factor known to be the receptor of EV70. We conclude that HRV87 and EV68 are strains of the same picornavirus serotype presenting features of both rhinoviruses and enteroviruses. PMID:12409401
Portable Electronic Nose Based on Electrochemical Sensors for Food Quality Assessment
Dymerski, Tomasz; Gębicki, Jacek; Namieśnik, Jacek
2017-01-01
The steady increase in global consumption puts a strain on agriculture and might lead to a decrease in food quality. Currently used techniques of food analysis are often labour-intensive and time-consuming and require extensive sample preparation. For that reason, there is a demand for novel methods that could be used for rapid food quality assessment. A technique based on the use of an array of chemical sensors for holistic analysis of the sample’s headspace is called electronic olfaction. In this article, a prototype of a portable, modular electronic nose intended for food analysis is described. Using the SVM method, it was possible to classify samples of poultry meat based on shelf-life with 100% accuracy, and also samples of rapeseed oil based on the degree of thermal degradation with 100% accuracy. The prototype was also used to detect adulterations of extra virgin olive oil with rapeseed oil with 82% overall accuracy. Due to the modular design, the prototype offers the advantages of solutions targeted for analysis of specific food products, at the same time retaining the flexibility of application. Furthermore, its portability allows the device to be used at different stages of the production and distribution process. PMID:29186754
Development and Testing of a Post-Installable Deepwater Monitoring System Using Fiber-Optic Sensors
NASA Technical Reports Server (NTRS)
Seaman, Calvin H.; Brower, David V.; Le, Suy Q.; Tang, Henry H.
2015-01-01
This paper addresses the design and development of a fiber-optic monitoring system that can be deployed on existing deepwater risers and flowlines; and provides a summary of test article fabrication and the subsequent laboratory testing performed at the National Aeronautics and Space Administration-Johnson Space Center (NASA-JSC). A major challenge of a post-installed instrumentation system is to ensure adequate coupling between the instruments and the riser or flowline of interest. This work investigates the sensor coupling for pipelines that are suspended in a water column (from topside platform to seabed) using a fiber-optic sensor clamp and subsea bonding adhesive. The study involved the design, fabrication, and test of several prototype clamps that contained fiber-optic sensors. A mold was produced by NASA using 3-D printing methods that allowed the casting of polyurethane clamp test articles to accommodate 4-inch and 8-inch diameter pipes. The prototype clamps were installed with a subsea adhesive in a "wet" environment and then tested in the NASA Structures Test Laboratory (STL). The tension, compression, and bending test data showed that the prototype sensor clamps achieved good structural coupling, and could provide high quality strain measurement for active monitoring.
Design and laboratory testing of a prototype linear temperature sensor
NASA Astrophysics Data System (ADS)
Dube, C. M.; Nielsen, C. M.
1982-07-01
This report discusses the basic theory, design, and laboratory testing of a prototype linear temperature sensor (or "line sensor'), which is an instrument for measuring internal waves in the ocean. The operating principle of the line sensor consists of measuring the average resistance change of a vertically suspended wire (or coil of wire) induced by the passage of an internal wave in a thermocline. The advantage of the line sensor over conventional internal wave measurement techniques is that it is insensitive to thermal finestructure which contaminates point sensor measurements, and its output is approximately linearly proportional to the internal wave displacement. An approximately one-half scale prototype line sensor module was teste in the laboratory. The line sensor signal was linearly related to the actual fluid displacement to within 10%. Furthermore, the absolute output was well predicted (within 25%) from the theoretical model and the sensor material properties alone. Comparisons of the line sensor and a point sensor in a wavefield with superimposed turbulence (finestructure) revealed negligible distortion in the line sensor signal, while the point sensor signal was swamped by "turbulent noise'. The effects of internal wave strain were also found to be negligible.
Broiler genetic strain and sex effects on meat characteristics.
López, K P; Schilling, M W; Corzo, A
2011-05-01
A randomized complete block design within a factorial arrangement of treatments was used to evaluate the effect of strain and sex on carcass characteristics, meat quality, and sensory acceptability. Two broiler strains were reared: a commercially available strain (strain A) and a strain currently in the test phase (strain B) that has been genetically selected to maximize breast yield. Broilers were harvested in a pilot scale processing plant using commercial prototype equipment at 42 d of age. Carcasses were deboned at 4 h postmortem. The left half of each breast was evaluated for pH, color, cooking loss, shear force, and proximate analysis. The right side of each breast was used for consumer acceptability testing. Thigh meat was evaluated for proximate composition. No interactions were observed throughout the study. Male broilers had a higher (P < 0.05) live BW, carcass weight, and breast weight and lower (P < 0.05) dressing percentage and breast meat yield when compared with females. Broilers from strain B presented a higher (P < 0.05) breast yield and dressing percentage than those broilers corresponding to the commercially available broiler strain. At 24 h postmortem, female broilers presented a lower ultimate pH and higher Commission internationale de l'éclairage yellowness values (ventral side of the pectoralis major) when compared with male broilers. On average, no differences existed (P > 0.05) among treatments with respect to pH decline, cooking loss, shear values, and proximate composition. In addition, no differences (P > 0.05) existed among breast meat from the different strains with respect to consumer acceptability of appearance, texture, flavor, and overall acceptability, but breast meat from strain B was slightly preferred (P < 0.05) over that of strain A with respect to aroma. However, breast meat from both strains received scores in the range of "like slightly to like moderately." Overall data suggest that all treatments yielded high quality breast and thigh meat and strain cross did not present variability in terms of consumer acceptability.
Yan, Ju-Ying; Lu, Yi-Yu; Xu, Chang-Ping; Yu, Zhao; Gong, Li-Ming; Chen, Yin; Zhang, Yan-Jun
2011-09-01
In order to confirm the cause of the outbreak of aseptic meningitis in Zhejiang Province in 2002-2004, trace the pathogen and analyze the molecular characteristics, 271 cerebrospinal fluid (CSF) and faeces specimens were collected from suspected patients. The virus strains from the specimens were isolated with RD and Hep-2 cell lines. The VP1 and VP4/VP2 genes of the isolated viruses were sequenced, and their phylogenetic and homology trees were also constructed. Of the total 271 samples, 78 Echovirus type 30 (E30) strains were isolated. All of the complete VP1 genes in 31 sequenced virus isolates of E30 were composed of 876 nt without any insertion or deletion, encoding 292 amino acids (aa). The identity of nucleotide and amino acid in VP1 gene were 84.7%-86.3% and 92.1%-94.2% between the 31 Zhejiang strains and the prototype strain Bastianni of E30, and 87.1%-99.4% and 96.2%-100% among the 31 Zhejiang strains, respectively. The Zhejiang strains of E30 in the phylogenetic tree of the VP1 gene were attributed into two branches of the G and H genotype, respectively. In G genotype, the Shangdong and Jiangsu E30 strains in 2003 among domestic strains and Ukraine E30 strain in 1999 among overseas strains had maximum similarity with the Zhejiang strains, while H genotype had maximum similarity with the Korea E30 strains in 2008. The phylogenetic tree of the VP4/VP2 genes was similar to that of VP1 gene. The results indicated that the outbreak of aseptic meningitis in Zhejiang Provinec in 2002-2004 was caused by the G and H genotypes of E30 strains existing simultaneously. The H genotype was a new variant strain, which was first isolated in Zhejiang Province in 2002.
Fatigue analyses of the prototype Francis runners based on site measurements and simulations
NASA Astrophysics Data System (ADS)
Huang, X.; Chamberland-Lauzon, J.; Oram, C.; Klopfer, A.; Ruchonnet, N.
2014-03-01
With the increasing development of solar power and wind power which give an unstable output to the electrical grid, hydropower is required to give a rapid and flexible compensation, and the hydraulic turbines have to operate at off-design conditions frequently. Prototype Francis runners suffer from strong vibrations induced by high pressure pulsations at part load, low part load, speed-no-load and during start-stops and load rejections. Fatigue and damage may be caused by the alternating stress on the runner blades. Therefore, it becomes increasingly important to carry out fatigue analysis and life time assessment of the prototype Francis runners, especially at off-design conditions. This paper presents the fatigue analyses of the prototype Francis runners based on the strain gauge site measurements and numerical simulations. In the case of low part load, speed-no-load and transient events, since the Francis runners are subjected to complex hydraulic loading, which shows a stochastic characteristic, the rainflow counting method is used to obtain the number of cycles for various dynamic amplitude ranges. From middle load to full load, pressure pulsations caused by Rotor-stator- Interaction become the dominant hydraulic excitation of the runners. Forced response analysis is performed to calculate the maximum dynamic stress. The agreement between numerical and experimental stresses is evaluated using linear regression method. Taking into account the effect of the static stress on the S-N curve, the Miner's rule, a linear cumulative fatigue damage theory, is employed to calculate the damage factors of the prototype Francis runners at various operating conditions. The relative damage factors of the runners at different operating points are compared and discussed in detail.
Prototype Morphing Fan Nozzle Demonstrated
NASA Technical Reports Server (NTRS)
Lee, Ho-Jun; Song, Gang-Bing
2004-01-01
Ongoing research in NASA Glenn Research Center's Structural Mechanics and Dynamics Branch to develop smart materials technologies for aeropropulsion structural components has resulted in the design of the prototype morphing fan nozzle shown in the photograph. This prototype exploits the potential of smart materials to significantly improve the performance of existing aircraft engines by introducing new inherent capabilities for shape control, vibration damping, noise reduction, health monitoring, and flow manipulation. The novel design employs two different smart materials, a shape-memory alloy and magnetorheological fluids, to reduce the nozzle area by up to 30 percent. The prototype of the variable-area fan nozzle implements an overlapping spring leaf assembly to simplify the initial design and to provide ease of structural control. A single bundle of shape memory alloy wire actuators is used to reduce the nozzle geometry. The nozzle is subsequently held in the reduced-area configuration by using magnetorheological fluid brakes. This prototype uses the inherent advantages of shape memory alloys in providing large induced strains and of magnetorheological fluids in generating large resistive forces. In addition, the spring leaf design also functions as a return spring, once the magnetorheological fluid brakes are released, to help force the shape memory alloy wires to return to their original position. A computerized real-time control system uses the derivative-gain and proportional-gain algorithms to operate the system. This design represents a novel approach to the active control of high-bypass-ratio turbofan engines. Researchers have estimated that such engines will reduce thrust specific fuel consumption by 9 percent over that of fixed-geometry fan nozzles. This research was conducted under a cooperative agreement (NCC3-839) at the University of Akron.
Song, Jae-Hyoung; Park, Kwisung; Shim, Aeri; Kwon, Bo-Eun; Ahn, Jae-Hee; Choi, Young Jin; Kim, Jae Kyung; Yeo, Sang-Gu; Yoon, Kyungah; Ko, Hyun-Jeong
2015-01-01
Objectives Coxsackievirus A group 16 strain (CVA16) is one of the predominant causative agents of hand, foot, and mouth disease (HFMD). Methods Using a specimen from a male patient with HFMD, we isolated and performed sequencing of the Korean CVA16 strain and compared it with a G10 reference strain. Also, we were investigated the effects of medicinal plant extract on the cytopathic effects (CPE) by CPE reduction assay against Korean CVA16. Results Phylogenetic analysis showed that the Korean CVA16 isolate belonged to cluster B-1 and was closely related to the strain PM-15765-00 isolated in Malaysia in 2000. The Korean CVA16 isolate showed 73.2% nucleotide identity to the G10 prototype strain and 98.7% nucleotide identity to PM-15765-00. Next, we assessed whether the Korean CVA16 isolate could be used for in vitro screening of antiviral agents to treat HFMD infection. Vero cells infected with the Korean CVA16 isolate showed a cytopathic effect 2 days after the infection, and the treatment of cells with Cornus officinalis, Acer triflorum, Pulsatilla koreana, and Clematis heracleifolia var. davidiana Hemsl extracts exhibited strong antiviral activity against CVA16. Conclusion Collectively, our work provides potential candidates for the development of vaccine and novel drugs to treat the CVA16 strain isolated from a Korean patient. PMID:25737832
Song, Jae-Hyoung; Park, Kwisung; Shim, Aeri; Kwon, Bo-Eun; Ahn, Jae-Hee; Choi, Young Jin; Kim, Jae Kyung; Yeo, Sang-Gu; Yoon, Kyungah; Ko, Hyun-Jeong
2015-02-01
Coxsackievirus A group 16 strain (CVA16) is one of the predominant causative agents of hand, foot, and mouth disease (HFMD). Using a specimen from a male patient with HFMD, we isolated and performed sequencing of the Korean CVA16 strain and compared it with a G10 reference strain. Also, we were investigated the effects of medicinal plant extract on the cytopathic effects (CPE) by CPE reduction assay against Korean CVA16. Phylogenetic analysis showed that the Korean CVA16 isolate belonged to cluster B-1 and was closely related to the strain PM-15765-00 isolated in Malaysia in 2000. The Korean CVA16 isolate showed 73.2% nucleotide identity to the G10 prototype strain and 98.7% nucleotide identity to PM-15765-00. Next, we assessed whether the Korean CVA16 isolate could be used for in vitro screening of antiviral agents to treat HFMD infection. Vero cells infected with the Korean CVA16 isolate showed a cytopathic effect 2 days after the infection, and the treatment of cells with Cornus officinalis, Acer triflorum, Pulsatilla koreana, and Clematis heracleifolia var. davidiana Hemsl extracts exhibited strong antiviral activity against CVA16. Collectively, our work provides potential candidates for the development of vaccine and novel drugs to treat the CVA16 strain isolated from a Korean patient.
Bastías, Roberto; Higuera, Gastón; Sierralta, Walter; Espejo, Romilio T
2010-04-01
A clonal population of pathogenic Vibrio parahaemolyticus O3 : K6 serovar has spread in coastal waters, causing outbreaks worldwide since 1996. Bacteriophage infection is one of the main factors affecting bacterial strain concentration in the ocean. We studied the occurrence and properties of phages infecting this V. parahaemolyticus pandemic strain in coastal waters. Analysing 143 samples, phages were found in 13. All isolates clustered in a closely related group of podophages with at least 90% nucleotide sequence identity in three essential genes, despite distant geographical origins. These bacteriophages were able to multiply on the V. parahaemolyticus pandemic strain, but the impact on host concentration and subsequent growth was negligible. Infected bacteria continued producing the phage but were not lysogenized. The phage genome of prototype strain VP93 is 43 931 nucleotides and contains 337 bp direct terminal repeats at both ends. VP93 is the first non-Pseudomonas phage related to the PhiKMV-like subgroup of the T7 supergroup. The lack of a major effect on host growth suggests that these phages exert little control on the propagation of the pandemic strain in the environment. This form of phage growth can be modelled if phage-sensitive and -resistant cells that convert to each other with a high frequency are present in clonal cultures of pandemic V. parahaemolyticus.
Secore, Susan; Wang, Su; Doughtry, Julie; Xie, Jinfu; Miezeiewski, Matt; Rustandi, Richard R; Horton, Melanie; Xoconostle, Rachel; Wang, Bei; Lancaster, Catherine; Kristopeit, Adam; Wang, Sheng-Ching; Christanti, Sianny; Vitelli, Salvatore; Gentile, Marie-Pierre; Goerke, Aaron; Skinner, Julie; Strable, Erica; Thiriot, David S; Bodmer, Jean-Luc; Heinrichs, Jon H
2017-01-01
Clostridium difficile infections (CDI) are a leading cause of nosocomial diarrhea in the developed world. The main virulence factors of the bacterium are the large clostridial toxins (LCTs), TcdA and TcdB, which are largely responsible for the symptoms of the disease. Recent outbreaks of CDI have been associated with the emergence of hypervirulent strains, such as NAP1/BI/027, many strains of which also produce a third toxin, binary toxin (CDTa and CDTb). These hypervirulent strains have been associated with increased morbidity and higher mortality. Here we present pre-clinical data describing a novel tetravalent vaccine composed of attenuated forms of TcdA, TcdB and binary toxin components CDTa and CDTb. We demonstrate, using the Syrian golden hamster model of CDI, that the inclusion of binary toxin components CDTa and CDTb significantly improves the efficacy of the vaccine against challenge with NAP1 strains in comparison to vaccines containing only TcdA and TcdB antigens, while providing comparable efficacy against challenge with the prototypic, non-epidemic strain VPI10463. This combination vaccine elicits high neutralizing antibody titers against TcdA, TcdB and binary toxin in both hamsters and rhesus macaques. Finally we present data that binary toxin alone can act as a virulence factor in animal models. Taken together, these data strongly support the inclusion of binary toxin in a vaccine against CDI to provide enhanced protection from epidemic strains of C. difficile.
Wang, Su; Doughtry, Julie; Xie, Jinfu; Miezeiewski, Matt; Rustandi, Richard R.; Horton, Melanie; Xoconostle, Rachel; Wang, Bei; Lancaster, Catherine; Kristopeit, Adam; Wang, Sheng-Ching; Christanti, Sianny; Vitelli, Salvatore; Gentile, Marie-Pierre; Goerke, Aaron; Skinner, Julie; Strable, Erica; Thiriot, David S.; Bodmer, Jean-Luc; Heinrichs, Jon H.
2017-01-01
Clostridium difficile infections (CDI) are a leading cause of nosocomial diarrhea in the developed world. The main virulence factors of the bacterium are the large clostridial toxins (LCTs), TcdA and TcdB, which are largely responsible for the symptoms of the disease. Recent outbreaks of CDI have been associated with the emergence of hypervirulent strains, such as NAP1/BI/027, many strains of which also produce a third toxin, binary toxin (CDTa and CDTb). These hypervirulent strains have been associated with increased morbidity and higher mortality. Here we present pre-clinical data describing a novel tetravalent vaccine composed of attenuated forms of TcdA, TcdB and binary toxin components CDTa and CDTb. We demonstrate, using the Syrian golden hamster model of CDI, that the inclusion of binary toxin components CDTa and CDTb significantly improves the efficacy of the vaccine against challenge with NAP1 strains in comparison to vaccines containing only TcdA and TcdB antigens, while providing comparable efficacy against challenge with the prototypic, non-epidemic strain VPI10463. This combination vaccine elicits high neutralizing antibody titers against TcdA, TcdB and binary toxin in both hamsters and rhesus macaques. Finally we present data that binary toxin alone can act as a virulence factor in animal models. Taken together, these data strongly support the inclusion of binary toxin in a vaccine against CDI to provide enhanced protection from epidemic strains of C. difficile. PMID:28125650
Deliberate Establishment of Asymptomatic Bacteriuria-A Novel Strategy to Prevent Recurrent UTI.
Wullt, Björn; Svanborg, Catharina
2016-07-29
We have established a novel strategy to reduce the risk for recurrent urinary tract infection (UTI), where rapidly increasing antibiotic resistance poses a major threat. Epidemiologic studies have demonstrated that asymptomatic bacteriuria (ABU) protects the host against symptomatic infections with more virulent strains. To mimic this protective effect, we deliberately establish ABU in UTI-prone patients, who are refractory to conventional therapy. The patients are inoculated with Escherichia coli (E. coli) 83972, now widely used as a prototype ABU strain. Therapeutic efficacy has been demonstrated in a placebo-controlled trial, supporting the feasibility of using E. coli 83972 as a tool to prevent recurrent UTI and, potentially, to outcompete antibiotic-resistant strains from the human urinary tract. In addition, the human inoculation protocol offers unique opportunities to study host-parasite interaction in vivo in the human urinary tract. Here, we review the clinical evidence for protection using this approach as well as some molecular insights into the pathogenesis of UTI that have been gained during these studies.
A Thin Film Multifunction Sensor for Harsh Environments
NASA Technical Reports Server (NTRS)
Wrbanek, John D.; Fralick, Gustave C.; Martin, Lisa C.; Blaha, Charles A.
2001-01-01
The status of work at NASA Glenn Research Center to develop a minimally intrusive integrated sensor to provide realtime measurement of strain, heat flux and flow in high temperature environments is presented in this paper. The sensor can be beneficial as a single package to characterize multiple stress and strain modes simultaneously on materials and components during engine development and validation. A major technical challenge is to take existing individual gauge designs and modify them into one integrated thin film sensor. Ultimately, the goal is to develop the ability to deposit the sensors directly onto internal engine parts or on a small thin substrate that can be attached to engine components. Several prototype sensors constructed of platinum, platinum-rhodium alloy, and alumina on constant-strain alumina beams have been built and bench-tested. The technical challenges of the design. construction, and testing are discussed. Data from the preliminary testing of the sensor array is presented. The future direction for the sensor development is discussed as well.
Beardsley, Patrick M.; Shelton, Keith L.
2012-01-01
This unit describes the testing of rats in prime-, footshock- and cue-induced reinstatement procedures. Evaluating rats in these procedures enables the assessment of treatments on behavior thought to model drug relapse precipitated by re-contact with an abused drug (prime-induced), induced by stress (footshock-induced), or by stimuli previously associated with drug administration (cue-induced). For instance, levels of reinstatement under the effects of test compound administration could be compared to levels under vehicle administration to help identify potential treatments for drug relapse, or reinstatement levels of different rat strains could be compared to identify potential genetic determinants of perseverative drug-seeking behavior. Cocaine is used as a prototypical drug of abuse, and relapse to its use serves as the model in this unit, but other self-administered drugs could readily be substituted with little modification to the procedures. PMID:23093352
Resource Requirements Planning for Hospitals Treating Serious Infectious Disease Cases
DOE Office of Scientific and Technical Information (OSTI.GOV)
Vugrin, Eric D.; Verzi, Stephen Joseph; Finley, Patrick D.
This report presents a mathematical model of the way in which a hospital uses a variety of resources, utilities and consumables to provide care to a set of in-patients, and how that hospital might adapt to provide treatment to a few patients with a serious infectious disease, like the Ebola virus. The intended purpose of the model is to support requirements planning studies, so that hospitals may be better prepared for situations that are likely to strain their available resources. The current model is a prototype designed to present the basic structural elements of a requirements planning analysis. Some simplemore » illustrati ve experiments establish the mo del's general capabilities. With additional inve stment in model enhancement a nd calibration, this prototype could be developed into a useful planning tool for ho spital administrators and health care policy makers.« less
Research pressure instrumentation for NASA Space Shuttle main engine, modification no. 5
NASA Technical Reports Server (NTRS)
Anderson, P. J.; Nussbaum, P.; Gustafson, G.
1984-01-01
The purpose of Modification No. 5 of this contract is to expand the scope of work (Task C) of this research study effort to develop pressure instrumentation for the SSME. The objective of this contract (Task C) is to direct Honeywell's Solid State Electronics Division's (SSED) extensive experience and expertise in solid state sensor technology to develop prototype pressure transducers which are targeted to meet the SSME performance design goals and to fabricate, test and deliver a total of 10 prototype units. SSED's basic approach is to effectively utilize the many advantages of silicon piezoresistive strain sensing technology to achieve the objectives of advanced state-of-the-art pressure sensors in terms of reliability, accuracy and ease of manufacture. More specifically, integration of multiple functions on a single chip is the key attribute of this technology which will be exploited during this research study.
Allison, Andrew B.; Keel, M. Kevin; Philips, Jamie E.; Cartoceti, Andrew N.; Munk, Brandon A.; Nemeth, Nicole M.; Welsh, Trista I.; Thomas, Jesse M.; Crum, James M.; Lichtenwalner, Anne B.; Fadly, Aly M.; Zavala, Guillermo; Holmes, Edward C.; Brown, Justin D.
2014-01-01
Lymphoproliferative disease virus (LPDV) is an exogenous oncogenic retrovirus that induces lymphoid tumors in some galliform species of birds. Historically, outbreaks of LPDV have been reported from Europe and Israel. Although the virus has previously never been detected in North America, herein we describe the widespread distribution, genetic diversity, pathogenesis, and evolution of LPDV in the United States. Characterization of the provirus genome of the index LPDV case from North America demonstrated an 88% nucleotide identity to the Israeli prototype strain. Although phylogenetic analysis indicated that the majority of viruses fell into a single North American lineage, a small subset of viruses from South Carolina were most closely related to the Israeli prototype. These results suggest that LPDV was transferred between continents to initiate outbreaks of disease. However, the direction (New World to Old World or vice versa), mechanism, and time frame of the transcontinental spread currently remain unknown. PMID:24503062
Walter Reed Army Institute of Research Annual Progress Report Fiscal Year 1982.
1982-10-01
antibacterial activity . Fed. Proc. 4787, 1981. 11. Collins, H.H., D.F. Keren, P. Gemski, S.B. Formal, -.--| W.D. Zollinger, and G.H. Lowell...murlne myeloma cells. The fused cells will be subjected to specific selection by growth in selective media. The survivors from actively growing cell...prototype dengue virus strains. DEN-1 (Hawaiian), DEN-2 (New Guinea C), ÜEN-3 ( Philippines H-87), and DEN-4 ( Philippines H-241). Lymphocyte
Shape Memory Alloy Induced Wing Warping for a Small Unmanned Aerial Vehicle
2003-06-01
strained Nitinol wires are attached to the surface of the wing. When the resistively heated wires pass a transition temperature, a phase change occurs...testing of the Nitinol wire is conducted to determine its modulus of elasticity in both its martensite and austenite phases. In addition, cycle tests are...prototype wings with Nitinol wires attached to determine the actual performance of the actuator. Using epoxy to attach the Nitinol to the wing is
DOE Project 353: TAMS Prototype and production coupling alignment units
DOE Office of Scientific and Technical Information (OSTI.GOV)
Field, K.V.
1996-02-01
TAMS is an electronic measurement system used to determine the alignment of turbine-generator shafts at the coupling interface. The displacement transducer is a strain gage based sensor mounted in a portable probe. The measurement system was experiencing zero input drift and temperature induced drift. This project endeavored to determine the source of these problems and to revise a unit to be returned to a customer, Baltimore Gas and Electric (BGE), within a period of five weeks.
Bohls, Ryan L; Linares, Jose A; Gross, Shannon L; Ferro, Pam J; Silvy, Nova J; Collisson, Ellen W
2006-08-01
Reticuloendotheliosis virus infection, which typically causes systemic lymphomas and high mortality in the endangered Attwater's prairie chicken, has been described as a major obstacle in repopulation efforts of captive breeding facilities in Texas. Although antigenic relationships among reticuloendotheliosis virus (REV) strains have been previously determined, phylogenetic relationships have not been reported. The pol and env of REV proviral DNA from prairie chickens (PC-R92 and PC-2404), from poxvirus lesions in domestic chickens, the prototype poultry derived REV-A and chick syncytial virus (CSV), and duck derived spleen necrosis virus (SNV) were PCR amplified and sequenced. The 5032bp, that included the pol and most of env genes, of the PC-R92 and REV-A were 98% identical, and nucleotide sequence identities of smaller regions within the pol and env from REV strains examined ranged from 95 to 99% and 93 to 99%, respectively. The putative amino acid sequences were 97-99% identical in the polymerase and 90-98% in the envelope. Phylogenetic analyses of the nucleotide and amino acid sequences indicated the closest relationship among the recent fowl pox-associated chicken isolates, the prairie chicken isolates and the prototype CSV while only the SNV appeared to be distinctly divergent. While the origin of the naturally occurring viruses is not known, the avian poxvirus may be a critical component of transmission of these ubiquitous oncogenic viruses.
Ostasevicius, Vytautas; Janusas, Giedrius; Milasauskaite, Ieva; Zilys, Mindaugas; Kizauskiene, Laura
2015-05-28
This paper focuses on several aspects extending the dynamical efficiency of a cantilever beam vibrating in the third mode. A few ways of producing this mode stimulation, namely vibro-impact or forced excitation, as well as its application for energy harvesting devices are proposed. The paper presents numerical and experimental analyses of novel structural dynamics effects along with an optimal configuration of the cantilever beam. The peculiarities of a cantilever beam vibrating in the third mode are related to the significant increase of the level of deformations capable of extracting significant additional amounts of energy compared to the conventional harvester vibrating in the first mode. Two types of a piezoelectric vibrating energy harvester (PVEH) prototype are analysed in this paper: the first one without electrode segmentation, while the second is segmented using electrode segmentation at the strain nodes of the third vibration mode to achieve effective operation at the third resonant frequency. The results of this research revealed that the voltage generated by any segment of the segmented PVEH prototype excited at the third resonant frequency demonstrated a 3.4-4.8-fold increase in comparison with the non-segmented prototype. Simultaneously, the efficiency of the energy harvester prototype also increased at lower resonant frequencies from 16% to 90%. The insights presented in the paper may serve for the development and fabrication of advanced piezoelectric energy harvesters which would be able to generate a considerably increased amount of electrical energy independently of the frequency of kinematical excitation.
Strand Plasticity Governs Fatigue in Colloidal Gels
NASA Astrophysics Data System (ADS)
van Doorn, Jan Maarten; Verweij, Joanne E.; Sprakel, Joris; van der Gucht, Jasper
2018-05-01
The repeated loading of a solid leads to microstructural damage that ultimately results in catastrophic material failure. While posing a major threat to the stability of virtually all materials, the microscopic origins of fatigue, especially for soft solids, remain elusive. Here we explore fatigue in colloidal gels as prototypical inhomogeneous soft solids by combining experiments and computer simulations. Our results reveal how mechanical loading leads to irreversible strand stretching, which builds slack into the network that softens the solid at small strains and causes strain hardening at larger deformations. We thus find that microscopic plasticity governs fatigue at much larger scales. This gives rise to a new picture of fatigue in soft thermal solids and calls for new theoretical descriptions of soft gel mechanics in which local plasticity is taken into account.
High Energy Density Additives for Hybrid Fuel Rockets to Improve Performance and Enhance Safety
NASA Technical Reports Server (NTRS)
Jaffe, Richard L.
2014-01-01
We propose a conceptual study of prototype strained hydrocarbon molecules as high energy density additives for hybrid rocket fuels to boost the performance of these rockets without compromising safety and reliability. Use of these additives could extend the range of applications for which hybrid rockets become an attractive alternative to conventional solid or liquid fuel rockets. The objectives of the study were to confirm and quantify the high enthalpy of these strained molecules and to assess improvement in rocket performance that would be expected if these additives were blended with conventional fuels. We confirmed the chemical properties (including enthalpy) of these additives. However, the predicted improvement in rocket performance was too small to make this a useful strategy for boosting hybrid rocket performance.
Edge effects on band gap energy in bilayer 2H-MoS{sub 2} under uniaxial strain
DOE Office of Scientific and Technical Information (OSTI.GOV)
Dong, Liang; Wang, Jin; Dongare, Avinash M., E-mail: dongare@uconn.edu
2015-06-28
The potential of ultrathin MoS{sub 2} nanostructures for applications in electronic and optoelectronic devices requires a fundamental understanding in their electronic structure as a function of strain. Previous experimental and theoretical studies assume that an identical strain and/or stress state is always maintained in the top and bottom layers of a bilayer MoS{sub 2} film. In this study, a bilayer MoS{sub 2} supercell is constructed differently from the prototypical unit cell in order to investigate the layer-dependent electronic band gap energy in a bilayer MoS{sub 2} film under uniaxial mechanical deformations. The supercell contains an MoS{sub 2} bottom layer andmore » a relatively narrower top layer (nanoribbon with free edges) as a simplified model to simulate the as-grown bilayer MoS{sub 2} flakes with free edges observed experimentally. Our results show that the two layers have different band gap energies under a tensile uniaxial strain, although they remain mutually interacting by van der Waals interactions. The deviation in their band gap energies grows from 0 to 0.42 eV as the uniaxial strain increases from 0% to 6% under both uniaxial strain and stress conditions. The deviation, however, disappears if a compressive uniaxial strain is applied. These results demonstrate that tensile uniaxial strains applied to bilayer MoS{sub 2} films can result in distinct band gap energies in the bilayer structures. Such variations need to be accounted for when analyzing strain effects on electronic properties of bilayer or multilayered 2D materials using experimental methods or in continuum models.« less
Sensing sheets based on large area electronics for fatigue crack detection
NASA Astrophysics Data System (ADS)
Yao, Yao; Glisic, Branko
2015-03-01
Reliable early-stage damage detection requires continuous structural health monitoring (SHM) over large areas of structure, and with high spatial resolution of sensors. This paper presents the development stage of prototype strain sensing sheets based on Large Area Electronics (LAE), in which thin-film strain gauges and control circuits are integrated on the flexible electronics and deposited on a polyimide sheet that can cover large areas. These sensing sheets were applied for fatigue crack detection on small-scale steel plates. Two types of sensing-sheet interconnects were designed and manufactured, and dense arrays of strain gauge sensors were assembled onto the interconnects. In total, four (two for each design type) strain sensing sheets were created and tested, which were sensitive to strain at virtually every point over the whole sensing sheet area. The sensing sheets were bonded to small-scale steel plates, which had a notch on the boundary so that fatigue cracks could be generated under cyclic loading. The fatigue tests were carried out at the Carleton Laboratory of Columbia University, and the steel plates were attached through a fixture to the loading machine that applied cyclic fatigue load. Fatigue cracks then occurred and propagated across the steel plates, leading to the failure of these test samples. The strain sensor that was close to the notch successfully detected the initialization of fatigue crack and localized the damage on the plate. The strain sensor that was away from the crack successfully detected the propagation of fatigue crack based on the time history of measured strain. Overall, the results of the fatigue tests validated general principles of the strain sensing sheets for crack detection.
Eaves-Pyles, Tonyia; Allen, Christopher A; Taormina, Joanna; Swidsinski, Alexander; Tutt, Christopher B; Jezek, G Eric; Islas-Islas, Martha; Torres, Alfredo G
2008-07-01
Inflammatory diseases of the intestinal tract are a major health concern both in the United States and around the world. Evidence now suggests that a new category of Escherichia coli, designated Adherent Invasive E. coli (AIEC) is highly prevalent in Crohn's Disease (CD) patients. AIEC strains have been shown to colonize and adhere to intestinal epithelial cells (IEC). However, the role AIEC strains play in the induction of an inflammatory response is not known. Therefore, we examined several E. coli strains (designated LF82, O83:H1, 6604 and 6655) that were isolated from CD patients for their ability to induce inflammation in two IEC, Caco-2BBe and T-84 cells. Results showed that each strain had varying abilities to adhere to and invade IEC as well as induced cytokine secretion from polarized IEC. However, E. coli O83:H1 displayed the best characteristics of AIEC strains as compared to the prototype AIEC strain LF82, inducing cytokine secretion from IEC and promoting immune cell migration through IEC. Upon further analysis, E. coli O83:H1 did not harbor virulence genes present in known pathogenic intestinal organisms. Further characterization of E. coli O83:H1 virulence determinants showed that a non-flagellated O83:H1 strain significantly decreased the organism's ability to adhere to and invade both IEC and elicit IEC cytokine secretion compared to the wild type and complemented strains. These findings demonstrate that E. coli O83:H1 possesses the characteristics of the AIEC LF82 strain that may contribute to the low-grade, chronic inflammation observed in Crohn's disease.
Hamad, Mustafa; Amen, Omar; Mahmoud, Mohamed; Hassanin, Ola; Saif-Edin, Mostafa
2018-06-01
Avian influenza (AI) vaccines are widely used to control and eliminate the ongoing avian influenza virus epidemic in Egypt. A strict vaccination policy with inactivated AI vaccines has been widely applied, however the virus still circulating, evolving and causing great negative impact to the poultry sector in Egypt. Therefore, an updated poultry vaccination policy using different vaccine technologies might be valuable as an innovative additional control strategy of AIV in Egypt. In the present study, the effectiveness of different avian influenza (AI) vaccination schedules was evaluated in 300 commercial layer chicks (ISA White) using either the oil-emulsion baculovirus-H5-prototype vaccine (baculovirus-H5 prototype) or turkey herpesvirus (HVT) vector vaccine containing the hemagglutinin (HA) gene from H5N1 strain (rHVT-H5), applied alone or in combination and in different settings. Vaccination with either two injections of the baculovirus-H5 prototype, a single injection of rHVT-H5 or priming with rHVT-H5 at 1 day old followed by boosting with the baculovirus-H5 prototype induced AI-HI protective antibody responses starting as early as 3 to 4 weeks of age and lasting up to the end of the rearing period (16 weeks). A single vaccination with the baculovirus-H5 prototype did not generate a protective antibody titre for the entire rearing period. Furthermore, the present study elucidated that vaccination once or twice with the baculovirus-H5 vaccine prototype activated the chicken interferon-alpha (Ch-IFN-alpha) signalling pathway via transduction of antiviral components, e.g., Mx1 and IRF7. Birds immunized once with rHVT-H5 at 1 day old did not show activation of the Mx1 and IRF7 transcripts; however, following boosting with the baculovirus-H5 prototype vaccine, up-regulation of Mx1 and IRF7 was observed. Based on our findings, it can be concluded that either reinforcement with two injections of the baculovirus-H5 prototype or prime-boost vaccination (rHVT-H5 at 1 day old followed by the baculovirus-H5 prototype vaccine at 8 days old) is a successful strategy to induce both innate and humoral immune responses and could be recommended for the layer production sector over the entire rearing period, especially in AI-endemic areas.
2013-01-01
Background An unusually high incidence of aseptic meningitis caused by enteroviruses was noted in Alberta, Canada between March and October 2010. Sequence based typing was performed on the enterovirus positive samples to gain a better understanding of the molecular characteristics of the Coxsackie A9 (CVA-9) strain responsible for most cases in this outbreak. Methods Molecular typing was performed by amplification and sequencing of the VP2 region. The genomic sequence of one of the 2010 outbreak isolates was compared to a CVA-9 isolate from 2003 and the prototype sequence to study genetic drift and recombination. Results Of the 4323 samples tested, 213 were positive for enteroviruses (4.93%). The majority of the positives were detected in CSF samples (n = 157, 73.71%) and 81.94% of the sequenced isolates were typed as CVA-9. The sequenced CVA-9 positives were predominantly (94.16%) detected in patients ranging in age from 15 to 29 years and the peak months for detection were between March and October. Full genome sequence comparisons revealed that the CVA-9 viruses isolated in Alberta in 2003 and 2010 were highly homologous to the prototype CVA-9 in the structural VP1, VP2 and VP3 regions but divergent in the VP4, non-structural and non-coding regions. Conclusion The increase in cases of aseptic meningitis was associated with enterovirus CVA-9. Sequence divergence between the prototype strain of CVA-9 and the Alberta isolates suggests genetic drifting and/or recombination events, however the sequence was conserved in the antigenic regions determined by the VP1, VP2 and VP3 genes. These results suggest that the increase in CVA-9 cases likely did not result from the emergence of a radically different immune escape mutant. PMID:23521862
Deng, Ming-Chung; Chang, Chia-Yi; Huang, Tien-Shine; Tsai, Hsiang-Jung; Chang, Chieh; Wang, Fun-In; Huang, Yu-Liang
2015-11-01
Porcine reproductive and respiratory syndrome virus (PRRSV) was first identified in Taiwan in 1991, but the genetic diversity and evolution of PRRSV has not been thoroughly investigated over the past 20 years. The aim of this study was to bridge the gap in understanding of its molecular epidemiology. A total of 31 PRRSV strains were collected and sequenced. The sequences were aligned using the MUSCLE program, and phylogenetic analysis were performed by the maximum-likelihood method and the neighbor-joining method using MEGA 5.2 software. In the early 1990s, two prototype strains, WSV and MD001 of the North American genotype, were first identified. Over the years, both viruses evolved separately. The population dynamics of PRRSV revealed that the strains of the MD001 group were predominant in Taiwan. Evolution was manifested in changes in the nsp2 and ORF5 genes. In addition, a suspected newly invading exotic strain was recovered in 2013, suggesting that international spread is still taking place and that it is affecting the population dynamics. Overall, the results provide an important basis for vaccine development for the control and prevention of PRRS.
Hybrid & El Tor variant biotypes of Vibrio cholerae O1 in Thailand
Na-Ubol, M.; Srimanote, P.; Chongsa-nguan, M.; Indrawattana, N.; Sookrung, N.; Tapchaisri, P.; Yamazaki, S.; Bodhidatta, L.; Eampokalap, B.; Kurazono, H.; Hayashi, H.; Nair, G.B.; Takeda, Y.; Chaicumpa, W.
2011-01-01
Background & objectives: El Tor Vibrio cholerae O1 carrying ctxBC trait, so-called El Tor variant that causes more severe symptoms than the prototype El Tor strain, first detected in Bangladesh was later shown to have emerged in India in 1992. Subsequently, similar V. cholerae strains were isolated in other countries in Asia and Africa. Thus, it was of interest to investigate the characteristics of V. cholerae O1 strains isolated chronologically (from 1986 to 2009) in Thailand. Methods: A total of 330 V. cholerae O1 Thailand strains from hospitalized patients with cholera isolated during 1986 to 2009 were subjected to conventional biotyping i.e., susceptibility to polymyxin B, chicken erythrocyte agglutination (CCA) and Voges-Proskauer (VP) test. The presence of ctxA, ctxB, zot, ace, toxR, tcpAC, tcpAE, hlyAC and hlyAE were examined by PCR. Mismatch amplification mutation assay (MAMA) - and conventional- PCRs were used for differentiating ctxB and rstR alleles. Results: All 330 strains carried the El Tor virulence gene signature. Among these, 266 strains were typical El Tor (resistant to 50 units of polymyxin B and positive for CCA and VP test) while 64 had mixed classical and El Tor phenotypes (hybrid biotype). Combined MAMA-PCR and the conventional biotyping methods revealed that 36 strains of 1986-1992 were either typical El Tor, hybrid, El Tor variant or unclassified biotype. The hybrid strains were present during 1986-2004. El Tor variant strains were found in 1992, the same year when the typical El Tor strains disappeared. All 294 strains of 1993-2009 carried ctxBC ; 237 were El Tor variant and 57 were hybrid. Interpretation & conclusions: In Thailand, hybrid V. cholerae O1 (mixed biotypes), was found since 1986. Circulating strains, however, are predominantly El Tor variant (El Tor biotype with ctxBC). PMID:21537091
Silkworm cocoons inspire models for random fiber and particulate composites
DOE Office of Scientific and Technical Information (OSTI.GOV)
Chen Fujia; Porter, David; Vollrath, Fritz
The bioengineering design principles evolved in silkworm cocoons make them ideal natural prototypes and models for structural composites. Cocoons depend for their stiffness and strength on the connectivity of bonding between their constituent materials of silk fibers and sericin binder. Strain-activated mechanisms for loss of bonding connectivity in cocoons can be translated directly into a surprisingly simple yet universal set of physically realistic as well as predictive quantitative structure-property relations for a wide range of technologically important fiber and particulate composite materials.
Silkworm cocoons inspire models for random fiber and particulate composites
NASA Astrophysics Data System (ADS)
Chen, Fujia; Porter, David; Vollrath, Fritz
2010-10-01
The bioengineering design principles evolved in silkworm cocoons make them ideal natural prototypes and models for structural composites. Cocoons depend for their stiffness and strength on the connectivity of bonding between their constituent materials of silk fibers and sericin binder. Strain-activated mechanisms for loss of bonding connectivity in cocoons can be translated directly into a surprisingly simple yet universal set of physically realistic as well as predictive quantitative structure-property relations for a wide range of technologically important fiber and particulate composite materials.
1989-02-01
reverse if necessary and identify by block number) CIELD CPzOUP ISUB-GRO0UP Lyme disease; Borrelia spp. ; Treponema pallidumv ARSTRACTPatients...AD-A240 332 CC PUBLICATION REPORT O!t2 TAh 1583 By~ 65189-90 r ! tb ut I ui LYME DISEASE AGENT IN EGYPT? ’’ Ave Richard L. Habarberger’, Niel T...a dilution of Lyme disease agent in Egypt? 1:100 with the prototype strain B-31 ofB. burgdorferi. Results indicated that none of the 16 meningitis or
Optical Fiber Sensors for Infrasonic Wind Noise Reduction and Earth Strain Measurement
NASA Astrophysics Data System (ADS)
DeWolf, Scott
Fiber-based interferometers provide the means to sense very small displacements over long baselines, and have the advantage of being nearly completely passive in their operation, making them particularly well suited for geophysical applications. This work presents the development and results from four new systems: one in atmospheric acoustics and three in Earth strain. Turbulent pressure fluctuations (wind noise) are a significant limiting factor in low-frequency atmospheric acoustic measurements. The Optical Fiber Infrasound Sensor (OFIS) provides an alternative to traditional infrasonic wind noise reduction (WNR) techniques by providing an instantaneous average over a large spatial extent. This study shows that linear OFISs ranging in length from 30 to 270 m provide a WNR of up to 30 dB in winds up to 5 m/s, in good agreement with a new analytical model. Arrays of optical fiber strainmeters were deployed to measure sediment compaction at two sites in Bangladesh. One array at Jamalganj (in the north) consists of 20, 40, 60, and 100 m long strainmeters, while the second near Khulna (in the south) also includes lengths of 80 and 300 m. Two years of weekly measurements show a clear seasonal signal and subsidence at both sites that is in reasonable agreement with collocated GPS receivers. A new 250-meter, interferometric vertical borehole strainmeter has been developed based completely on passive optical components. Details of the prototyping, design, and deployment at the Pinon Flat Observatory (PFO) are presented. Power spectra show an intertidal noise level of -130 dB (re. 1 epsilon/Hz), consistent within 1-3 dB between redundant components. Examination of its response to Earth tides and earthquakes relative to the areal strain recorded by an orthogonal pair of collocated, 730 m horizontal laser strainmeters yield a Poisson's ratio of 0.26. Two prototype horizontal strainmeters were also developed to explore the use of similar interferometric optical fiber technology for near-surface, long baseline strain measurement. Both instruments are shown to faithfully record earthquakes and yield very good estimates of the M2 tidal constituent, despite unexplained 2-8% amplitude discrepancies between the 90 and 180 m long instruments relative to the collocated laser strainmeter and each other.
Arita, Minetaro; Ling, Hua; Yan, Dongmei; Nishimura, Yorihiro; Yoshida, Hiromu; Wakita, Takaji; Shimizu, Hiroyuki
2009-12-16
In the global eradication program for poliomyelitis, the laboratory diagnosis plays a critical role by isolating poliovirus (PV) from the stool samples of acute flaccid paralysis (AFP) cases. In this study, we developed a reverse transcription-loop-mediated isothermal amplification (RT-LAMP) system for a rapid and highly sensitive detection of enterovirus including PV to identify stool samples positive for enterovirus including PV. A primer set was designed for RT-LAMP to detect enterovirus preferably those with PV-like 5'NTRs of the viral genome. The sensitivity of RT-LAMP system was evaluated with prototype strains of enterovirus. Detection of enterovirus from stool extracts was examined by using RT-LAMP system. We detected at least 400 copies of the viral genomes of PV(Sabin) strains within 90 min by RT-LAMP with the primer set. This RT-LAMP system showed a preference for Human enterovirus species C (HEV-C) strains including PV, but exhibited less sensitivity to the prototype strains of HEV-A and HEV-B (detection limits of 7,400 to 28,000 copies). Stool extracts, from which PV, HEV-C, or HEV-A was isolated in the cell culture system, were mostly positive by RT-LAMP method (positive rates of 15/16 (= 94%), 13/14 (= 93%), and 4/4 (= 100%), respectively). The positive rate of this RT-LAMP system for stool extracts from which HEV-B was isolated was lower than that of HEV-C (positive rate of 11/21 (= 52%)). In the stool samples, which were negative for enterovirus isolation by the cell culture system, we found that two samples were positive for RT-LAMP (positive rates of 2/38 (= 5.3%)). In these samples, enterovirus 96 was identified by sequence analysis utilizing a seminested PCR system. RT-LAMP system developed in this study showed a high sensitivity comparable to that of the cell culture system for the detection of PV, HEV-A, and HEV-C, but less sensitivity to HEV-B. This RT-LAMP system would be useful for the direct detection of enterovirus from the stool extracts.
NASA Technical Reports Server (NTRS)
Bentley, Nicole L.; Brower, David V.; Le, Suy Q.; Seaman, Calvin H.; Tang, Henry H.
2017-01-01
This paper presents the design and development of a friction-based coupling device for a fiber-optic monitoring system capable of measuring pressure, strain, and temperature that can be deployed on existing subsea structures. A summary is provided of the design concept, prototype development, prototype performance testing, and subsequent design refinements of the device. The results of laboratory testing of the first prototype performed at the National Aeronautics and Space Administration (NASA) Johnson Space Center (JSC) are also included. Limitations of the initial concept were identified during testing and future design improvements were proposed and later implemented. These new features enhance the coupling of the sensor device and improve the monitoring system measurement capabilities. A major challenge of a post-installed instrumentation monitoring system is to ensure adequate coupling between the instruments and the structure of interest for reliable measurements. Friction-based devices have the potential to overcome coupling limitations caused by marine growth and soil contamination on flowlines, risers, and other subsea structures. The work described in this paper investigates the design and test of a friction-based coupling device (herein referred to as a friction clamp) which is suitable for pipelines and structures that are suspended in the water column as well as for those that are resting on the seabed. The monitoring elements consist of fiberoptic sensors that are bonded to a stainless steel clamshell assembly with a high-friction surface coating. The friction clamp incorporates a single hinge design to facilitate installation of the clamp and dual rows of opposing fasteners to distribute the clamping force along the structure. The friction clamp can be modified to be installed by commercial divers in shallow depths or by remotely operated vehicles in deep-water applications. NASA-JSC was involved in the selection and testing of the friction coating, and in the design and testing of the prototype clamp device. Four-inch diameter and eight-inch diameter sub-scale friction clamp prototypes were built and tested to evaluate the strain measuring capabilities of the design under different loading scenarios. The testing revealed some limitations of the initial design concept, and subsequent refinements were explored to improve the measurement performance of the system. This study was part of a collaboration between NASA-JSC and Astro Technology Inc. within a study called Clear Gulf. The primary objective of the Clear Gulf study is to develop advanced instrumentation technologies that will improve operational safety and reduce the risk of hydrocarbon spillage. NASA provided unique insights, expansive test facilities, and technical expertise to advance technologies that will benefit the environment, the public, and commercial industries.
Isolation of a novel Orientia species (O. chuto sp. nov.) from a patient infected in Dubai.
Izzard, Leonard; Fuller, Andrew; Blacksell, Stuart D; Paris, Daniel H; Richards, Allen L; Aukkanit, Nuntipa; Nguyen, Chelsea; Jiang, Ju; Fenwick, Stan; Day, Nicholas P J; Graves, Stephen; Stenos, John
2010-12-01
In July 2006, an Australian tourist returning from Dubai, in the United Arab Emirates (UAE), developed acute scrub typhus. Her signs and symptoms included fever, myalgia, headache, rash, and eschar. Orientia tsutsugamushi serology demonstrated a 4-fold rise in antibody titers in paired serum collections (1:512 to 1:8,192), with the sera reacting strongest against the Gilliam strain antigen. An Orientia species was isolated by the in vitro culture of the patient's acute blood taken prior to antibiotic treatment. The gene sequencing of the 16S rRNA gene (rrs), partial 56-kDa gene, and the full open reading frame 47-kDa gene was performed, and comparisons of this new Orientia sp. isolate to previously characterized strains demonstrated significant sequence diversity. The closest homology to the rrs sequence of the new Orientia sp. isolate was with three strains of O. tsutsugamushi (Ikeda, Kato, and Karp), with a nucleotide sequence similarity of 98.5%. The closest homology to the 47-kDa gene sequence was with O. tsutsugamushi strain Gilliam, with a nucleotide similarity of 82.3%, while the closest homology to the 56-kDa gene sequence was with O. tsutsugamushi strain TA686, with a nucleotide similarity of 53.1%. The molecular divergence and geographically unique origin lead us to believe that this organism should be considered a novel species. Therefore, we have proposed the name "Orientia chuto," and the prototype strain of this species is strain Dubai, named after the location in which the patient was infected.
Isolation of a Novel Orientia Species (O. chuto sp. nov.) from a Patient Infected in Dubai ▿
Izzard, Leonard; Fuller, Andrew; Blacksell, Stuart D.; Paris, Daniel H.; Richards, Allen L.; Aukkanit, Nuntipa; Nguyen, Chelsea; Jiang, Ju; Fenwick, Stan; Day, Nicholas P. J.; Graves, Stephen; Stenos, John
2010-01-01
In July 2006, an Australian tourist returning from Dubai, in the United Arab Emirates (UAE), developed acute scrub typhus. Her signs and symptoms included fever, myalgia, headache, rash, and eschar. Orientia tsutsugamushi serology demonstrated a 4-fold rise in antibody titers in paired serum collections (1:512 to 1:8,192), with the sera reacting strongest against the Gilliam strain antigen. An Orientia species was isolated by the in vitro culture of the patient's acute blood taken prior to antibiotic treatment. The gene sequencing of the 16S rRNA gene (rrs), partial 56-kDa gene, and the full open reading frame 47-kDa gene was performed, and comparisons of this new Orientia sp. isolate to previously characterized strains demonstrated significant sequence diversity. The closest homology to the rrs sequence of the new Orientia sp. isolate was with three strains of O. tsutsugamushi (Ikeda, Kato, and Karp), with a nucleotide sequence similarity of 98.5%. The closest homology to the 47-kDa gene sequence was with O. tsutsugamushi strain Gilliam, with a nucleotide similarity of 82.3%, while the closest homology to the 56-kDa gene sequence was with O. tsutsugamushi strain TA686, with a nucleotide similarity of 53.1%. The molecular divergence and geographically unique origin lead us to believe that this organism should be considered a novel species. Therefore, we have proposed the name “Orientia chuto,” and the prototype strain of this species is strain Dubai, named after the location in which the patient was infected. PMID:20926708
Ipe, Deepak S.; Ben Zakour, Nouri L.; Sullivan, Matthew J.; Beatson, Scott A.; Ulett, Kimberly B.; Benjamin, William H.; Davies, Mark R.; Dando, Samantha J.; King, Nathan P.; Cripps, Allan W.; Dougan, Gordon
2015-01-01
Streptococcus agalactiae causes both symptomatic cystitis and asymptomatic bacteriuria (ABU); however, growth characteristics of S. agalactiae in human urine have not previously been reported. Here, we describe a phenotype of robust growth in human urine observed in ABU-causing S. agalactiae (ABSA) that was not seen among uropathogenic S. agalactiae (UPSA) strains isolated from patients with acute cystitis. In direct competition assays using pooled human urine inoculated with equal numbers of a prototype ABSA strain, designated ABSA 1014, and any one of several UPSA strains, measurement of the percentage of each strain recovered over time showed a markedly superior fitness of ABSA 1014 for urine growth. Comparative phenotype profiling of ABSA 1014 and UPSA strain 807, isolated from a patient with acute cystitis, using metabolic arrays of >2,500 substrates and conditions revealed unique and specific l-malic acid catabolism in ABSA 1014 that was absent in UPSA 807. Whole-genome sequencing also revealed divergence in malic enzyme-encoding genes between the strains predicted to impact the activity of the malate metabolic pathway. Comparative growth assays in urine comparing wild-type ABSA and gene-deficient mutants that were functionally inactivated for the malic enzyme metabolic pathway by targeted disruption of the maeE or maeK gene in ABSA demonstrated attenuated growth of the mutants in normal human urine as well as synthetic human urine containing malic acid. We conclude that some S. agalactiae strains can grow in human urine, and this relates in part to malic acid metabolism, which may affect the persistence or progression of S. agalactiae ABU. PMID:26553467
Herwaldt, B L; Lew, J F; Moe, C L; Lewis, D C; Humphrey, C D; Monroe, S S; Pon, E W; Glass, R I
1994-01-01
A gastroenteritis outbreak affecting at least 217 (41%) of 527 passengers on a cruise ship was caused by a variant strain of Norwalk virus (NV) that is related to but distinct from the prototype NV strain. Consumption of fresh-cut fruit served at two buffets was significantly associated with illness (P < or = 0.01), and a significant dose-response relationship was evident between illness and the number of various fresh-cut fruit items eaten. Seven (58%) of 12 paired serum specimens from ill persons demonstrated at least fourfold rises in antibody response to recombinant NV capsid antigen. A 32-nm small round-structured virus was visualized by electron microscopy in 4 (29%) of 14 fecal specimens, but none of the 8 specimens that were examined by an enzyme immunoassay for NV antigen demonstrated antigen. Four (40%) of 10 fecal specimens were positive by reverse transcriptase-PCR by using primer pairs selected from the polymerase region of NV. In a 145-bp region, the PCR product shared only 72% nucleotide sequence identity with the reference NV strain and 77% nucleotide sequence identity with Southampton virus but shared 95% nucleotide sequence identity with UK2 virus, a United Kingdom reference virus strain. In addition, the outbreak virus was serotyped as UK2 virus by solid-phase immune electron microscopy. The genetic and antigenic divergence of the outbreak strain from the reference NV strain highlights the need for more broadly reactive diagnostic assays and for improved understanding of the relatedness of the NV group of agents. Images PMID:8027335
de Lencastre, Hermínia; Tomasz, Alexander
2017-01-01
ABSTRACT Most methicillin-resistant Staphylococcus aureus (MRSA) strains are resistant to beta-lactam antibiotics due to the presence of the mecA gene, encoding an extra penicillin-binding protein (PBP2A) that has low affinity for virtually all beta-lactam antibiotics. Recently, a new resistance determinant—the mecC gene—was identified in S. aureus isolates recovered from humans and dairy cattle. Although having typically low MICs to beta-lactam antibiotics, MRSA strains with the mecC determinant are also capable of expressing high levels of oxacillin resistance when in an optimal genetic background. In order to test the impact of extensive beta-lactam selection on the emergence of mecC-carrying strains with high levels of antibiotic resistance, we exposed the prototype mecC-carrying MRSA strain, LGA251, to increasing concentrations of oxacillin. LGA251 was able to rapidly adapt to high concentrations of oxacillin in growth medium. In such laboratory mutants with increased levels of oxacillin resistance, we identified mutations in genes with no relationship to the mecC regulatory system, indicating that the genetic background plays an important role in the establishment of the levels of oxacillin resistance. Our data also indicate that the stringent stress response plays a critical role in the beta-lactam antibiotic resistance phenotype of MRSA strains carrying the mecC determinant. PMID:28069659
Fiber Bragg grating strain sensors to monitor and study active volcanoes
NASA Astrophysics Data System (ADS)
Sorrentino, Fiodor; Beverini, Nicolò; Carbone, Daniele; Carelli, Giorgio; Francesconi, Francesco; Gambino, Salvo; Giacomelli, Umberto; Grassi, Renzo; Maccioni, Enrico; Morganti, Mauro
2016-04-01
Stress and strain changes are among the best indicators of impending volcanic activity. In volcano geodesy, borehole volumetric strain-meters are mostly utilized. However, they are not easy to install and involve high implementation costs. Advancements in opto-electronics have allowed the development of low-cost sensors, reliable, rugged and compact, thus particularly suitable for field application. In the framework of the EC FP7 MED-SUV project, we have developed strain sensors based on the fiber Bragg grating (FBG) technology. In comparison with previous implementation of the FBG technology to study rock deformations, we have designed a system that is expected to offer a significantly higher resolution and accuracy in static measurements and a smooth dynamic response up to 100 Hz, implying the possibility to observe seismic waves. The system performances are tailored to suit the requirements of volcano monitoring, with special attention to power consumption and to the trade-off between performance and cost. Preliminary field campaigns were carried out on Mt. Etna (Italy) using a prototypal single-axis FBG strain sensor, to check the system performances in out-of-the-lab conditions and in the harsh volcanic environment (lack of mains electricity for power, strong diurnal temperature changes, strong wind, erosive ash, snow and ice during the winter time). We also designed and built a FBG strain sensor featuring a multi-axial configuration which was tested and calibrated in the laboratory. This instrument is suitable for borehole installation and will be tested on Etna soon.
Stress and magnetism in LaCoO3 films
NASA Astrophysics Data System (ADS)
Demkov, Alex
2012-02-01
Cobaltates exhibit a wide variety of exciting electronic properties resulting from strong electron correlations; these include superconductivity, giant magnetoresistance, metal-insulator transition, and strong thermoelectric effects. This makes them an excellent platform to study correlated electron physics, as well as being useful for various applications in electronics and sensors. In the ground state in the bulk, the prototypical complex cobalt oxide LaCoO3 is in a spin-compensated low-spin state (t2g^6), which results in the ground state being nonmagnetic. In a recent experiment, Fuchs et al. (Phys. Rev. B 75, 144402 (2007)) have demonstrated that a ferromagnetic ground state could be stabilized by epitaxial tensile strain resulting in a Curie temperature (TC) of ˜90 K when LaCoO3 (LCO) is grown on SrTiO3 (STO) using pulsed laser deposition. In this talk I will discuss our recent successful attempt to integrate a LCO/STO heterostructure with Si (001) using molecular beam epitaxy. We have grown strained, epitaxial LaCoO3 on (100)-oriented silicon using a single crystal STO buffer (Appl.Phys. Lett. 98, 053104 (2011)). SQUID magnetization measurements confirm that the ground state of the strained LaCoO3 is ferromagnetic with a TC of 85 K. Our first-principles calculations of strained LaCoO3 using the LSDA+U method show that beyond biaxial tensile strain of 2.5% local magnetic moments, originating from the high spin state of Co^3+, emerge in a low spin Co^3+ matrix. Ferromagnetism found in tensile-strained LaCoO3 is tightly coupled to the material's orbital and structural response to applied strain. Theoretical calculations show how LaCoO3 accommodates tensile strain via spin state disproportionation, resulting in an unusual sublattice structure.
Winter, Linda E; Barenkamp, Stephen J
2017-10-01
Outer membrane vesicles (OMVs) produced by Gram-negative bacteria are enriched in several outer membrane components, including major and minor outer membrane proteins and lipooligosaccharide. We assessed the functional activity of nontypeable Haemophilus influenzae (NTHi) OMV-specific antisera and the protective ability of NTHi OMVs as vaccine antigens in the chinchilla otitis media model. OMVs were purified from three HMW1/HMW2-expressing NTHi strains, two of which were also engineered to overexpress Hia proteins. OMV-specific antisera raised in guinea pigs were assessed for their ability to mediate killing of representative NTHi in an opsonophagocytic assay. The three OMV-specific antisera mediated killing of 18 of 65, 24 of 65, and 30 of 65 unrelated HMW1/HMW2-expressing NTHi strains. Overall, they mediated killing of 39 of 65 HMW1/HMW2-expressing strains. The two Hia-expressing OMV-specific antisera mediated killing of 17 of 25 and 14 of 25 unrelated Hia-expressing NTHi strains. Overall, they mediated killing of 20 of 25 Hia-expressing strains. OMVs from prototype NTHi strain 12 were used to immunize chinchillas and the course of middle ear infection was monitored following intrabullar challenge with the homologous strain. All control animals developed culture-positive otitis media, as did two of three HMW1/HMW2-immunized animals. All OMV-immunized animals, with or without supplemental HMW1/HMW2 immunization, were completely protected against otitis media. NTHi OMVs are the first immunogens examined in this model that provided complete protection with sterile immunity after NTHi strain 12 challenge. These data suggest that NTHi OMVs hold significant potential as components of protective NTHi vaccines, possibly in combination with HMW1/HMW2 proteins. Copyright © 2017 American Society for Microbiology.
Paldurai, Anandan; Subbiah, Madhuri; Kumar, Sachin; Collins, Peter L.; Samal, Siba K.
2009-01-01
Complete consensus genome sequences were determined for avian paramyxovirus type 8 (APMV-8) strains goose/Delaware/1053/76 (prototype strain) and pintail/Wakuya/20/78. The genome of each strain is 15,342 nucleotides (nt) long, which follows the “rule of six”. The genome consists of six genes in the order of 3′-N-P/V/W-M-F-HN-L-5′. The genes are flanked on either side by conserved transcription start and stop signals, and have intergenic regions ranging from 1 to 30 nt. The genome contains a 55 nt leader region at the 3′-end and a 171 nt trailer region at the 5′-end. Comparison of sequences of strains Delaware and Wakuya showed nucleotide identity of 96.8% at the genome level and amino acid identities of 99.3%, 96.5%, 98.6%, 99.4%, 98.6% and 99.1% for the predicted N, P, M, F, HN and L proteins, respectively. Both strains grew in embryonated chicken eggs and in primary chicken embryo kidney cells, and 293T cells. Both strains contained only a single basic residue at the cleavage activation site of the F protein and their efficiency of replication in vitro depended on and was augmented by, the presence of exogenous protease in most cell lines. Sequence alignment and phylogenic analysis of the predicted amino acid sequence of APMV-8 strain Delaware proteins with the cognate proteins of other available APMV serotypes showed that APMV-8 is more closely related to APMV-2 and -6 than to APMV-1, -3 and -4. PMID:19341613
Roos, Viktoria; Ulett, Glen C; Schembri, Mark A; Klemm, Per
2006-01-01
Escherichia coli is the most common organism associated with asymptomatic bacteriuria (ABU). In contrast to uropathogenic E. coli (UPEC), which causes symptomatic urinary tract infections (UTI), very little is known about the mechanisms by which these strains colonize the human urinary tract. The prototype ABU E. coli strain 83972 was originally isolated from a girl who had carried it asymptomatically for 3 years. Deliberate colonization of UTI-susceptible individuals with E. coli 83972 has been used successfully as an alternative approach for the treatment of patients who are refractory to conventional therapy. Colonization with strain 83972 appears to prevent infection with UPEC strains in such patients despite the fact that this strain is unable to express the primary adhesins involved in UTI, viz. P and type 1 fimbriae. Here we investigated the growth characteristics of E. coli 83972 in human urine and show that it can outcompete a representative spectrum of UPEC strains for growth in urine. The unique ability of ABU E. coli 83972 to outcompete UPEC in urine was also demonstrated in a murine model of human UTI, confirming the selective advantage over UPEC in vivo. Comparison of global gene expression profiles of E. coli 83972 grown in lab medium and human urine revealed significant differences in expression levels in the two media; significant down-regulation of genes encoding virulence factors such as hemolysin, lipid A, and capsular polysaccharides was observed in cells grown in urine. Clearly, divergent abilities of ABU E. coli and UPEC to exploit human urine as a niche for persistence and survival suggest that these key differences may be exploited for preventative and/or therapeutic approaches.
Torsional actuator motor using solid freeform fabricated PZT ceramics
NASA Astrophysics Data System (ADS)
Kim, Chulho; Wu, Carl C. M.; Bender, Barry
2004-07-01
A torsional actuator has been developed at NRL utilizing the high piezoelectric shear coefficient, d15. This torsional actuator uses an even number of alternately poled segments of electroactive PZT. Under an applied electric field, the torsional actuator produces large angular displacement and a high torque. The solid freeform fabrication technique of the laminated object manufacturing (LOM) is used for rapid prototyping of torsional actuator with potential cost and time saving. First step to demonstrate the feasibility of the LOM technique for the torsional actuator device fabrication is to make near net shape segments. We report a prototype PZT torsional actuator using LOM prepared PZT-5A segments. Fabrication processes and test results are described. The torsional actuator PZT-5A tube has dimensions of 13 cm long, 2.54 cm OD and 1.9 cm ID. Although the piezoelectric strain is small, it may be converted into large displacement via accumulation of the small single cycle displacements over many cycles using AC driving voltage such as with a rotary 'inchworm' actuator or an ultrasonic rotary motor. A working prototype of a full-cycle motor driven by the piezoelectric torsional actuator has been achieved. The rotational speed is 1,200 rpm under 200 V/cm field at the resonant frequency of 4.5 kHz.
NASA Astrophysics Data System (ADS)
Yang, Nancy; Yee, J.; Zheng, B.; Gaiser, K.; Reynolds, T.; Clemon, L.; Lu, W. Y.; Schoenung, J. M.; Lavernia, E. J.
2017-04-01
We investigate the process-structure-property relationships for 316L stainless steel prototyping utilizing 3-D laser engineered net shaping (LENS), a commercial direct energy deposition additive manufacturing process. The study concluded that the resultant physical metallurgy of 3-D LENS 316L prototypes is dictated by the interactive metallurgical reactions, during instantaneous powder feeding/melting, molten metal flow and liquid metal solidification. The study also showed 3-D LENS manufacturing is capable of building high strength and ductile 316L prototypes due to its fine cellular spacing from fast solidification cooling, and the well-fused epitaxial interfaces at metal flow trails and interpass boundaries. However, without further LENS process control and optimization, the deposits are vulnerable to localized hardness variation attributed to heterogeneous microstructure, i.e., the interpass heat-affected zone (HAZ) from repetitive thermal heating during successive layer depositions. Most significantly, the current deposits exhibit anisotropic tensile behavior, i.e., lower strain and/or premature interpass delamination parallel to build direction (axial). This anisotropic behavior is attributed to the presence of interpass HAZ, which coexists with flying feedstock inclusions and porosity from incomplete molten metal fusion. The current observations and findings contribute to the scientific basis for future process control and optimization necessary for material property control and defect mitigation.
High Sensitivity MEMS Strain Sensor: Design and Simulation
Mohammed, Ahmed A. S.; Moussa, Walied A.; Lou, Edmond
2008-01-01
In this article, we report on the new design of a miniaturized strain microsensor. The proposed sensor utilizes the piezoresistive properties of doped single crystal silicon. Employing the Micro Electro Mechanical Systems (MEMS) technology, high sensor sensitivities and resolutions have been achieved. The current sensor design employs different levels of signal amplifications. These amplifications include geometric, material and electronic levels. The sensor and the electronic circuits can be integrated on a single chip, and packaged as a small functional unit. The sensor converts input strain to resistance change, which can be transformed to bridge imbalance voltage. An analog output that demonstrates high sensitivity (0.03mV/με), high absolute resolution (1με) and low power consumption (100μA) with a maximum range of ±4000με has been reported. These performance characteristics have been achieved with high signal stability over a wide temperature range (±50°C), which introduces the proposed MEMS strain sensor as a strong candidate for wireless strain sensing applications under harsh environmental conditions. Moreover, this sensor has been designed, verified and can be easily modified to measure other values such as force, torque…etc. In this work, the sensor design is achieved using Finite Element Method (FEM) with the application of the piezoresistivity theory. This design process and the microfabrication process flow to prototype the design have been presented. PMID:27879841
NASA Technical Reports Server (NTRS)
Diaz, J. O.
1985-01-01
Composites consisting of tungsten alloy wires in superalloy matrices are being studied because they offer the potential for increased strength compared to current materials used at temperatures up to at least 1093 C (2000F). Previous research at the NASA Lewis Research Center and at other laboratories in the U.S., Europe, and Japan has demonstrated laboratory feasibility for fiber reinforced superalloys (FRS). The data for the mechanical and physical properties used to evaluate candidate materials is limited and a need exists for a more detailed and complete data base. The focus of this work is to develop a test procedure to provide a more complete FRS data base to quantitatively evaluate the composite's potential for component applications. This paper will describe and discuss the equipment and procedures under development to obtain elevated temperature tensile stress-strain, strength and modulus data for the first generation of tungsten fiber reinforced superalloy composite (TFRS) materials. Tensile stress-strain tests are conducted using a constant crosshead speed tensile testing machine and a modified load-strain measuring apparatus. Elevated temperature tensile tests are performed using a resistance wound commercial furnace capable of heating test specimens up to 1093 C (2000 F). Tensile stress-strain data are obtained for hollow tubular stainless steel specimens serving as a prototype for future composite specimens.
Impact of surface strain on the spin dynamics of deposited Co nanowires
NASA Astrophysics Data System (ADS)
Polyakov, O. P.; Korobova, J. G.; Stepanyuk, O. V.; Bazhanov, D. I.
2017-01-01
Tailoring the magnetic properties at atomic-scale is essential in the engineering of modern spintronics devices. One of the main concerns in the novel nanostructured materials design is the decrease of the paid energy in the way of functioning, but allowing to switch between different magnetic states with a relative low-cost energy at the same time. Magnetic anisotropy (MA) energy defines the stability of a spin in the preferred direction and is a fundamental variable in magnetization switching processes. Transition-metal wires are known to develop large, stable spin and orbital magnetic moments together with MA energies that are orders of magnitude larger than in the corresponding solids. Different ways of controlling the MA have been exploited such as alloying, surface charging, and external electrical fields. Here we investigate from a first-principle approach together with dynamic calculations, the surface strain driven mechanism to tune the magnetic properties of deposited nanowires. We consider as a prototype system, the monoatomic Co wires deposited on strained Pt(111) and Au(111) surfaces. Our first-principles calculations reveal a monotonic increase/decrease of MA energy under compressive/tensile strain in supported Co wire. Moreover, the spin dynamics studies based on solving the Landau-Lifshitz-Gilbert equation show that the induced surface-strain leads to a substantial decrease of the required external magnetic field magnitude for magnetization switching in Co wire.
Watts, Rebecca E; Hancock, Viktoria; Ong, Cheryl-Lynn Y; Vejborg, Rebecca Munk; Mabbett, Amanda N; Totsika, Makrina; Looke, David F; Nimmo, Graeme R; Klemm, Per; Schembri, Mark A
2010-07-01
Urinary tract infections (UTIs) are among the most common infectious diseases of humans, with Escherichia coli being responsible for >80% of all cases. Asymptomatic bacteriuria (ABU) occurs when bacteria colonize the urinary tract without causing clinical symptoms and can affect both catheterized patients (catheter-associated ABU [CA-ABU]) and noncatheterized patients. Here, we compared the virulence properties of a collection of ABU and CA-ABU nosocomial E. coli isolates in terms of antibiotic resistance, phylogenetic grouping, specific UTI-associated virulence genes, hemagglutination characteristics, and biofilm formation. CA-ABU isolates were similar to ABU isolates with regard to the majority of these characteristics; exceptions were that CA-ABU isolates had a higher prevalence of the polysaccharide capsule marker genes kpsMT II and kpsMT K1, while more ABU strains were capable of mannose-resistant hemagglutination. To examine biofilm growth in detail, we performed a global gene expression analysis with two CA-ABU strains that formed a strong biofilm and that possessed a limited adhesin repertoire. The gene expression profile of the CA-ABU strains during biofilm growth showed considerable overlap with that previously described for the prototype ABU E. coli strain, 83972. This is the first global gene expression analysis of E. coli CA-ABU strains. Overall, our data suggest that nosocomial ABU and CA-ABU E. coli isolates possess similar virulence profiles.
Ostasevicius, Vytautas; Janusas, Giedrius; Milasauskaite, Ieva; Zilys, Mindaugas; Kizauskiene, Laura
2015-01-01
This paper focuses on several aspects extending the dynamical efficiency of a cantilever beam vibrating in the third mode. A few ways of producing this mode stimulation, namely vibro-impact or forced excitation, as well as its application for energy harvesting devices are proposed. The paper presents numerical and experimental analyses of novel structural dynamics effects along with an optimal configuration of the cantilever beam. The peculiarities of a cantilever beam vibrating in the third mode are related to the significant increase of the level of deformations capable of extracting significant additional amounts of energy compared to the conventional harvester vibrating in the first mode. Two types of a piezoelectric vibrating energy harvester (PVEH) prototype are analysed in this paper: the first one without electrode segmentation, while the second is segmented using electrode segmentation at the strain nodes of the third vibration mode to achieve effective operation at the third resonant frequency. The results of this research revealed that the voltage generated by any segment of the segmented PVEH prototype excited at the third resonant frequency demonstrated a 3.4–4.8-fold increase in comparison with the non-segmented prototype. Simultaneously, the efficiency of the energy harvester prototype also increased at lower resonant frequencies from 16% to 90%. The insights presented in the paper may serve for the development and fabrication of advanced piezoelectric energy harvesters which would be able to generate a considerably increased amount of electrical energy independently of the frequency of kinematical excitation. PMID:26029948
Sankar, Viswanath; Sanchez, Justin C; McCumiskey, Edward; Brown, Nagid; Taylor, Curtis R; Ehlert, Gregory J; Sodano, Henry A; Nishida, Toshikazu
2013-01-01
While the signal quality of recording neural electrodes is observed to degrade over time, the degradation mechanisms are complex and less easily observable. Recording microelectrodes failures are attributed to different biological factors such as tissue encapsulation, immune response, and disruption of blood-brain barrier (BBB) and non-biological factors such as strain due to micromotion, insulation delamination, corrosion, and surface roughness on the recording site (1-4). Strain due to brain micromotion is considered to be one of the important abiotic factors contributing to the failure of the neural implants. To reduce the forces exerted by the electrode on the brain, a high compliance 2D serpentine shaped electrode cable was designed, simulated, and measured using polyimide as the substrate material. Serpentine electrode cables were fabricated using MEMS microfabrication techniques, and the prototypes were subjected to load tests to experimentally measure the compliance. The compliance of the serpentine cable was numerically modeled and quantitatively measured to be up to 10 times higher than the compliance of a straight cable of same dimensions and material.
Kovalev, S Y; Mukhacheva, T A
2017-11-01
Tick-borne encephalitis is widespread in Eurasia and transmitted by Ixodes ticks. Classification of its causative agent, tick-borne encephalitis virus (TBEV), includes three subtypes, namely Far-Eastern, European, and Siberian (TBEV-Sib), as well as a group of 886-84-like strains with uncertain taxonomic status. TBEV-Sib is subdivided into three phylogenetic lineages: Baltic, Asian, and South-Siberian. A reason to reconsider TBEV-Sib classification was the analysis of 186 nucleotide sequences of an E gene fragment submitted to GenBank during the last two years. Within the South-Siberian lineage, we have identified a distinct group with prototype strains Aina and Vasilchenko as an individual lineage named East-Siberian. The analysis of reclassified lineages has promoted a new model of the evolutionary history of TBEV-Sib lineages and TBEV-Sib as a whole. Moreover, we present arguments supporting separation of 886-84-like strains into an individual TBEV subtype, which we propose to name Baikalian (TBEV-Bkl). Copyright © 2017 Elsevier B.V. All rights reserved.
Sankar, Viswanath; Sanchez, Justin C.; McCumiskey, Edward; Brown, Nagid; Taylor, Curtis R.; Ehlert, Gregory J.; Sodano, Henry A.; Nishida, Toshikazu
2013-01-01
While the signal quality of recording neural electrodes is observed to degrade over time, the degradation mechanisms are complex and less easily observable. Recording microelectrodes failures are attributed to different biological factors such as tissue encapsulation, immune response, and disruption of blood-brain barrier (BBB) and non-biological factors such as strain due to micromotion, insulation delamination, corrosion, and surface roughness on the recording site (1–4). Strain due to brain micromotion is considered to be one of the important abiotic factors contributing to the failure of the neural implants. To reduce the forces exerted by the electrode on the brain, a high compliance 2D serpentine shaped electrode cable was designed, simulated, and measured using polyimide as the substrate material. Serpentine electrode cables were fabricated using MEMS microfabrication techniques, and the prototypes were subjected to load tests to experimentally measure the compliance. The compliance of the serpentine cable was numerically modeled and quantitatively measured to be up to 10 times higher than the compliance of a straight cable of same dimensions and material. PMID:24062716
Jóźwik, A; Manteufel, J; Selbitz, H-J; Truyen, U
2009-10-01
The demonstration of field isolates of porcine parvovirus (PPV) that differ genetically and antigenically from vaccine strains of PPV raises the question of whether the broadly used inactivated vaccines can still protect sows against the novel viruses. Ten specific-pathogen-free primiparous sows were assigned to three groups and were vaccinated with one of two vaccines based on the old vaccine strains, or served as non-vaccinated controls. After insemination, all sows were challenged with the prototype genotype 2 virus, PPV-27a, on gestation day 41; fetuses were delivered on gestation day 90 and examined for virus infection. The fetuses of the vaccinated sows were protected against disease, but both the vaccinated and the non-vaccinated sows showed a marked increase in antibody titres after challenge infection, indicating replication of the challenge virus. All sows (vaccinated and non-vaccinated) shed the challenge virus for at least 10 days after infection, with no difference in the pattern or duration of virus shedding.
Chen, Yin; Sun, Yi; Yan, Juying; Miao, Ziping; Xu, Changping; Zhang, Yanjun; Mao, Haiyan; Gong, Liming
2017-12-28
Echovirus serotype 30 (ECHO30) has been responsible for several recent worldwide outbreaks of viral meningitis. In Zhejiang Province, China, ECHO30 has been one of the main causes of viral meningitis for years. This study, using phylogenetic analysis of the VP1 gene, was performed to investigate the general molecular epidemiology and genetic patterns of ECHO30 circulating in Zhejiang Province between the years 2002 and 2015. The nucleotide sequences of ECHO30 VP1 showed that they were 64.8% identical with the prototype strain, Bastianni, while the amino acids were 84.9% identical. Phylogenetic analyses showed that ECHO30 in the Zhejiang area has diverged into two genotypes. Genotype I consists of strains isolated since 2002, whereas genotype II includes strains that were mainly isolated during the 2002 to 2004 outbreak. ECHO30 has been endemically circulating in both humans and the environment for a long period of time. Additionally, we evaluated the significance of recombination presented during the years 2005 to 2007 to demonstrate that recombination plays an important role in the prevalence of ECHO30 in the Zhejiang area.
Wehbe, Michel; Huguenin, Antoine; Leveque, Nicolas; Semler, Bert L; Hamze, Monzer; Andreoletti, Laurent; Bouin, Alexis
2016-04-01
Coxsackieviruses B (CV-B) (Picornaviridae) are a common infectious cause of acute myocarditis in children and young adults, a disease, which is a precursor to 10-20% of chronic myocarditis and dilated cardiomyopathy (DCM) cases. The mechanisms involved in the disease progression from acute to chronic myocarditis phase and toward the DCM clinical stage are not fully understood but are influenced by both viral and host factors. Subgenomic replicons of CV-B can be used to assess viral replication mechanisms in human cardiac cells and evaluate the effects of potential antiviral drugs on viral replication activities. Our objectives were to generate a reporter replicon from a cardiotropic prototype CV-B3/28 strain and to characterize its replication properties into human cardiac primary cells. To obtain this replicon, a cDNA plasmid containing the full CV-B3/28 genome flanked by a hammerhead ribozyme sequence and an MluI restriction site was generated and used as a platform for the insertion of sequences encoding emerald green fluorescent protein (EmGFP) in place of those encoding VP3. In vitro transcribed RNA from this plasmid was transfected into HeLa cells and human primary cardiac cells and was able to produce EmGFP and VP1-containing polypeptides. Moreover, non-structural protein biological activity was assessed by the specific cleavage of eIF4G1 by viral 2A(pro). Viral RNA replication was indirectly demonstrated by inhibition assays, fluoxetine was added to cell culture and prevented the EmGFP synthesis. Our results indicated that the EmGFP CV-B3 replicon was able to replicate and translate as well as the CV-B3/28 prototype strain. Our EmGFP CV-B3 replicon will be a valuable tool to readily investigate CV-B3 replication activities in human target cell models. Copyright © 2016 Elsevier B.V. All rights reserved.
NASA Astrophysics Data System (ADS)
McKnight, G. P.; Henry, C. P.
2008-03-01
Morphing or reconfigurable structures potentially allow for previously unattainable vehicle performance by permitting several optimized structures to be achieved using a single platform. The key to enabling this technology in applications such as aircraft wings, nozzles, and control surfaces, are new engineered materials which can achieve the necessary deformations but limit losses in parasitic actuation mass and structural efficiency (stiffness/weight). These materials should exhibit precise control of deformation properties and provide high stiffness when exercised through large deformations. In this work, we build upon previous efforts in segmented reinforcement variable stiffness composites employing shape memory polymers to create prototype hybrid composite materials that combine the benefits of cellular materials with those of discontinuous reinforcement composites. These composites help overcome two key challenges for shearing wing skins: the resistance to out of plane buckling from actuation induced shear deformation, and resistance to membrane deflections resulting from distributed aerodynamic pressure loading. We designed, fabricated, and tested composite materials intended for shear deformation and address out of plane deflections in variable area wing skins. Our designs are based on the kinematic engineering of reinforcement platelets such that desired microstructural kinematics is achieved through prescribed boundary conditions. We achieve this kinematic control by etching sheets of metallic reinforcement into regular patterns of platelets and connecting ligaments. This kinematic engineering allows optimization of materials properties for a known deformation pathway. We use mechanical analysis and full field photogrammetry to relate local scale kinematics and strains to global deformations for both axial tension loading and shear loading with a pinned-diamond type fixture. The Poisson ratio of the kinematically engineered composite is ~3x higher than prototypical orthotropic variable stiffness composites. This design allows us to create composite materials that have high stiffness in the cold state below SMP T g (4-14GPa) and yet achieve large composite shear strains (5-20%) in the hot state (above SMP T g).
Thermal energy conversion by coupled shape memory and piezoelectric effects
NASA Astrophysics Data System (ADS)
Zakharov, Dmitry; Lebedev, Gor; Cugat, Orphee; Delamare, Jerome; Viala, Bernard; Lafont, Thomas; Gimeno, Leticia; Shelyakov, Alexander
2012-09-01
This work gives experimental evidence of a promising method of thermal-to-electric energy conversion by coupling shape memory effect (SME) and direct piezoelectric effect (DPE) for harvesting quasi-static ambient temperature variations. Two original prototypes of thermal energy harvesters have been fabricated and tested experimentally. The first is a hybrid laminated composite consisting of TiNiCu shape memory alloy (SMA) and macro fiber composite piezoelectric. This composite comprises 0.1 cm3 of active materials and harvests 75 µJ of energy for each temperature variation of 60 °C. The second prototype is a SME/DPE ‘machine’ which uses the thermally induced linear strains of the SMA to bend a bulk PZT ceramic plate through a specially designed mechanical structure. The SME/DPE ‘machine’ with 0.2 cm3 of active material harvests 90 µJ over a temperature increase of 35 °C (60 µJ when cooling). In contrast to pyroelectric materials, such harvesters are also compatible with both small and slow temperature variations.
Crook, Nathan C; Schmitz, Alexander C; Alper, Hal S
2014-05-16
Reduction of endogenous gene expression is a fundamental operation of metabolic engineering, yet current methods for gene knockdown (i.e., genome editing) remain laborious and slow, especially in yeast. In contrast, RNA interference allows facile and tunable gene knockdown via a simple plasmid transformation step, enabling metabolic engineers to rapidly prototype knockdown strategies in multiple strains before expending significant cost to undertake genome editing. Although RNAi is naturally present in a myriad of eukaryotes, it has only been recently implemented in Saccharomyces cerevisiae as a heterologous pathway and so has not yet been optimized as a metabolic engineering tool. In this study, we elucidate a set of design principles for the construction of hairpin RNA expression cassettes in yeast and implement RNA interference to quickly identify routes for improvement of itaconic acid production in this organism. The approach developed here enables rapid prototyping of knockdown strategies and thus accelerates and reduces the cost of the design-build-test cycle in yeast.
Allison, Andrew B; Kevin Keel, M; Philips, Jamie E; Cartoceti, Andrew N; Munk, Brandon A; Nemeth, Nicole M; Welsh, Trista I; Thomas, Jesse M; Crum, James M; Lichtenwalner, Anne B; Fadly, Aly M; Zavala, Guillermo; Holmes, Edward C; Brown, Justin D
2014-02-01
Lymphoproliferative disease virus (LPDV) is an exogenous oncogenic retrovirus that induces lymphoid tumors in some galliform species of birds. Historically, outbreaks of LPDV have been reported from Europe and Israel. Although the virus has previously never been detected in North America, herein we describe the widespread distribution, genetic diversity, pathogenesis, and evolution of LPDV in the United States. Characterization of the provirus genome of the index LPDV case from North America demonstrated an 88% nucleotide identity to the Israeli prototype strain. Although phylogenetic analysis indicated that the majority of viruses fell into a single North American lineage, a small subset of viruses from South Carolina were most closely related to the Israeli prototype. These results suggest that LPDV was transferred between continents to initiate outbreaks of disease. However, the direction (New World to Old World or vice versa), mechanism, and time frame of the transcontinental spread currently remain unknown. © 2013 Published by Elsevier Inc.
Lee, Jin Goo; Gu, Se Hun; Baek, Luck Ju; Shin, Ok Sarah; Park, Kwang Sook; Kim, Heung-Chul; Klein, Terry A.; Yanagihara, Richard; Song, Jin-Won
2014-01-01
The genome of Muju virus (MUJV), identified originally in the royal vole (Myodes regulus) in Korea, was fully sequenced to ascertain its genetic and phylogenetic relationship with Puumala virus (PUUV), harbored by the bank vole (My. glareolus), and a PUUV-like virus, named Hokkaido virus (HOKV), in the grey red-backed vole (My. rufocanus) in Japan. Whole genome sequence analysis of the 6544-nucleotide large (L), 3652-nucleotide medium (M) and 1831-nucleotide small (S) segments of MUJV, as well as the amino acid sequences of their gene products, indicated that MUJV strains from different capture sites might represent genetic variants of PUUV, the prototype arvicolid rodent-borne hantavirus in Europe. Distinct geographic-specific clustering of MUJV was found in different provinces in Korea, and phylogenetic analyses revealed that MUJV and HOKV share a common ancestry with PUUV. A better understanding of the taxonomic classification and pathogenic potential of MUJV must await its isolation in cell culture. PMID:24736214
Picconi, Maria Alejandra; Gronda, Jorge; Alonio, Lidia V; Villa, Luisa L; Sichero, Laura; Miranda, Sergio; Barcena, Martin; Teyssie, Angelica
2002-01-01
Human Papillomaviruses (HPVs) are etiologically associated to cervical carcinoma. In order to evaluate HPV infection and its relationship with the high frequency of this neoplasia in Quechua women from Jujuy (Argentina), 271 cervical samples from preneoplastic and neoplastic lesions (biopsies) and normal controls (cytologies) were studied. Detection and typing were performed using PCR-RFLP or PCR-hybridization and the HPV-16 variability in L1 and E6 genes (by PCR-hybridization) was analysed. HPV was detected in 52% of controls, 91% of low-grade lesions, 97% of high-grade lesions and 100% of invasive carcinomas, corresponding 55% to HPV-16. HPV-16 European variants were predominant, most of them being non-prototypic strains. The high frequency of high risk infection types and the raised proportion of HPV-16 non-prototypic variants related to a greater oncogenic potential could explain, in part, the high cervical cancer frequency of this native population. These data may contribute to disease control and vaccinal formulation.
Dong, Jing; Gu, Zhenqing; Jin, Ling; Lv, Lin; Wang, Jichun; Sun, Tao; Bai, Juan; Sun, Haifeng; Wang, Xianwei; Jiang, Ping
2018-06-01
An outbreak of a highly virulent pseudorabies virus strain, ZJ01, occurred in PRV-vaccinated pigs in China in 2011. In this study, ZJ01 caused fatal diseases, while the Chinese prototypic PRV strain LA caused mild respiratory disorders. Full-genome sequencing results indicate the two viruses can be classified into two sub-clusters that distinct from traditional European and US strains. To examine the potential role of the gE and gI proteins in ZJ01 virulence, we generated several recombinant viruses. In two chimeric viruses (rZJ01-LA/gEI and rLA-ZJ01/gEI), the gE and gI genes were swapped using corresponding genes from ZJ01 and LA. rZJ01-LA/gEI and the parental virus rZJ01 retained high virulence in piglets, although the survival time for rZJ01-LA/gEI infected piglets was obviously prolonged. In contrast, rLA-ZJ01/gEI exhibited higher virulence than its parental virus rLA. We conclude that changes in gE and gI proteins partly contribute to the enhanced virulence of ZJ01 strain. Copyright © 2018 Elsevier Inc. All rights reserved.
The Considere Condition and Rapid Stretching of Linear and Branched Polymer Melts
NASA Technical Reports Server (NTRS)
McKinley, Gareth H.; Hassager, Ole
1999-01-01
We analyze the onset of "necking" and subsequent filament failure during the transient uniaxial elongation of viscoelastic fluid samples in extensional rheometers. In the limit of rapid elongation (such that no molecular relaxation occurs), the external work applied is all stored elastically and the Considere criterion originally developed in solid mechanics can be used to quantitatively predict the critical Hencky strain to failure. By comparing the predictions of the Doi-Edwards model for linear homopolymer melts with those of the "Pom-Pom" model for prototypical branched melts we show that the critical strain to failure in rapid elongation of a rubbery material is intimately linked to the molecular topology of the chain, especially the degree of chain branching. The onset of necking instability is monotonically shifted to larger Hencky strains as the number of branches is increased. Numerical computations at finite Deborah numbers also show that there is an optimal range of deformation rates over which homogeneous extensions can be maintained to large strain. We also consider other rapid homogeneous stretching deformations, such as biaxial and planar stretching, and show that the degree of stabilization afforded by inclusion of material with long-chain branching is a sensitive function of the imposed mode of deformation.
NASA Astrophysics Data System (ADS)
Vasseur, Romain; Lookman, Turab; Shenoy, Subodh R.
2010-09-01
We show how microstructure can arise in first-order ferroelastic structural transitions, in two and three spatial dimensions, through a local mean-field approximation of their pseudospin Hamiltonians, that include anisotropic elastic interactions. Such transitions have symmetry-selected physical strains as their NOP -component order parameters, with Landau free energies that have a single zero-strain “austenite” minimum at high temperatures, and spontaneous-strain “martensite” minima of NV structural variants at low temperatures. The total free energy also has gradient terms, and power-law anisotropic effective interactions, induced by “no-dislocation” St Venant compatibility constraints. In a reduced description, the strains at Landau minima induce temperature dependent, clocklike ZNV+1 Hamiltonians, with NOP -component strain-pseudospin vectors S⃗ pointing to NV+1 discrete values (including zero). We study elastic texturing in five such first-order structural transitions through a local mean-field approximation of their pseudospin Hamiltonians, that include the power-law interactions. As a prototype, we consider the two-variant square/rectangle transition, with a one-component pseudospin taking NV+1=3 values of S=0,±1 , as in a generalized Blume-Capel model. We then consider transitions with two-component (NOP=2) pseudospins: the equilateral to centered rectangle (NV=3) ; the square to oblique polygon (NV=4) ; the triangle to oblique (NV=6) transitions; and finally the three-dimensional (3D) cubic to tetragonal transition (NV=3) . The local mean-field solutions in two-dimensional and 3D yield oriented domain-wall patterns as from continuous-variable strain dynamics, showing the discrete-variable models capture the essential ferroelastic texturings. Other related Hamiltonians illustrate that structural transitions in materials science can be the source of interesting spin models in statistical mechanics.
Choi, Seon Young; Rashed, Shah M.; Hasan, Nur A.; Alam, Munirul; Islam, Tarequl; Sadique, Abdus; Johura, Fatema-Tuz; Eppinger, Mark; Huq, Anwar; Cravioto, Alejandro
2016-01-01
ABSTRACT An outbreak of cholera occurred in 1991 in Mexico, where it had not been reported for more than a century and is now endemic. Vibrio cholerae O1 prototype El Tor and classical strains coexist with altered El Tor strains (1991 to 1997). Nontoxigenic (CTX−) V. cholerae El Tor dominated toxigenic (CTX+) strains (2001 to 2003), but V. cholerae CTX+ variant El Tor was isolated during 2004 to 2008, outcompeting CTX− V. cholerae. Genomes of six Mexican V. cholerae O1 strains isolated during 1991 to 2008 were sequenced and compared with both contemporary and archived strains of V. cholerae. Three were CTX+ El Tor, two were CTX− El Tor, and the remaining strain was a CTX+ classical isolate. Whole-genome sequence analysis showed the six isolates belonged to five distinct phylogenetic clades. One CTX− isolate is ancestral to the 6th and 7th pandemic CTX+ V. cholerae isolates. The other CTX− isolate joined with CTX− non-O1/O139 isolates from Haiti and seroconverted O1 isolates from Brazil and Amazonia. One CTX+ isolate was phylogenetically placed with the sixth pandemic classical clade and the V. cholerae O395 classical reference strain. Two CTX+ El Tor isolates possessing intact Vibrio seventh pandemic island II (VSP-II) are related to hybrid El Tor isolates from Mozambique and Bangladesh. The third CTX+ El Tor isolate contained West African-South American (WASA) recombination in VSP-II and showed relatedness to isolates from Peru and Brazil. Except for one isolate, all Mexican isolates lack SXT/R391 integrative conjugative elements (ICEs) and sensitivity to selected antibiotics, with one isolate resistant to streptomycin. No isolates were related to contemporary isolates from Asia, Africa, or Haiti, indicating phylogenetic diversity. PMID:26980836
Khamrin, Pattara; Okitsu, Shoko; Ushijima, Hiroshi; Maneekarn, Niwat
2013-07-01
Epidemiological surveillance of human bocavirus (HBoV) was conducted on fecal specimens collected from hospitalized children with diarrhea in Chiang Mai, Thailand in 2011. By partial sequence analysis of VP1 gene, an unusual strain of HBoV (CMH-S011-11), was initially identified as HBoV4. The complete genome sequence of CMH-S011-11 was performed and analyzed further to clarify whether it was a recombinant strain or a new HBoV variant. Analysis of complete genome sequence revealed that the coding sequence starting from NS1, NP1 to VP1/VP2 was 4795 nucleotides long. Interestingly, the nucleotide sequence of NS1 gene of CMH-S011-11 was most closely related to the HBoV2 reference strains detected in Pakistan, which contradicted to the initial genotyping result of the partial VP1 region in the previous study. In addition, comparison of NP1 nucleotide sequence of CMH-S011-11 with those of other HBoV1-4 reference strains also revealed a high level of sequence identity with HBoV2. On the other hand, nucleotide sequence of VP1/VP2 gene of CMH-S011-11 was most closely related to those of HBoV4 reference strains detected in Nigeria. The overall full-length sequence analysis revealed that this CMH-S011-11 was grouped within HBoV4 species, but located in a separate branch from other HBoV4 prototype strains. Recombination analysis revealed that CMH-S011-11 was the result of recombination between HBoV2 and HBoV4 strains with the break point located near the start codon of VP2. Copyright © 2013 Elsevier B.V. All rights reserved.
Ipe, Deepak S; Ben Zakour, Nouri L; Sullivan, Matthew J; Beatson, Scott A; Ulett, Kimberly B; Benjamin, William H; Davies, Mark R; Dando, Samantha J; King, Nathan P; Cripps, Allan W; Schembri, Mark A; Dougan, Gordon; Ulett, Glen C
2016-01-01
Streptococcus agalactiae causes both symptomatic cystitis and asymptomatic bacteriuria (ABU); however, growth characteristics of S. agalactiae in human urine have not previously been reported. Here, we describe a phenotype of robust growth in human urine observed in ABU-causing S. agalactiae (ABSA) that was not seen among uropathogenic S. agalactiae (UPSA) strains isolated from patients with acute cystitis. In direct competition assays using pooled human urine inoculated with equal numbers of a prototype ABSA strain, designated ABSA 1014, and any one of several UPSA strains, measurement of the percentage of each strain recovered over time showed a markedly superior fitness of ABSA 1014 for urine growth. Comparative phenotype profiling of ABSA 1014 and UPSA strain 807, isolated from a patient with acute cystitis, using metabolic arrays of >2,500 substrates and conditions revealed unique and specific l-malic acid catabolism in ABSA 1014 that was absent in UPSA 807. Whole-genome sequencing also revealed divergence in malic enzyme-encoding genes between the strains predicted to impact the activity of the malate metabolic pathway. Comparative growth assays in urine comparing wild-type ABSA and gene-deficient mutants that were functionally inactivated for the malic enzyme metabolic pathway by targeted disruption of the maeE or maeK gene in ABSA demonstrated attenuated growth of the mutants in normal human urine as well as synthetic human urine containing malic acid. We conclude that some S. agalactiae strains can grow in human urine, and this relates in part to malic acid metabolism, which may affect the persistence or progression of S. agalactiae ABU. Copyright © 2015, American Society for Microbiology. All Rights Reserved.
NASA Technical Reports Server (NTRS)
Werlink, Rudolph J.; Pena, Francisco
2015-01-01
This Paper will describe the results of pressurization to failure of 100 gallon composite tanks using liquid nitrogen. Advanced methods of health monitoring will be compared as will the experimental data to a finite element model. The testing is wholly under NASA including unique PZT (Lead Zirconate Titanate) based active vibration technology. Other technologies include fiber optics strain based systems including NASA AFRC technology, Acoustic Emission, Acellent smart sensor, this work is expected to lead to a practical in-Sutu system for composite tanks.
Assessment on the methods of measuring the tyre-road contact patch stresses
NASA Astrophysics Data System (ADS)
Anghelache, G.; Moisescu, A.-R.; Buretea, D.
2017-08-01
The paper reviews established and modern methods for investigating tri-axial stress distributions in the tyre-road contact patch. The authors used three methods of measuring stress distributions: strain gauge method; force sensing technique; acceleration measurements. Four prototypes of instrumented pins transducers involving mentioned measuring methods were developed. Data acquisitions of the contact patch stresses distributions were performed using each transducer with instrumented pin. The results are analysed and compared, underlining the advantages and drawbacks of each method. The experimental results indicate that the three methods are valuable.
SigB is a dominant regulator of virulence in Staphylococcus aureus small-colony variants.
Mitchell, Gabriel; Fugère, Alexandre; Pépin Gaudreau, Karine; Brouillette, Eric; Frost, Eric H; Cantin, André M; Malouin, François
2013-01-01
Staphylococcus aureus small-colony variants (SCVs) are persistent pathogenic bacteria characterized by slow growth and, for many of these strains, an increased ability to form biofilms and to persist within host cells. The virulence-associated gene expression profile of SCVs clearly differs from that of prototypical strains and is often influenced by SigB rather than by the agr system. One objective of this work was to confirm the role of SigB in the control of the expression of virulence factors involved in biofilm formation and intracellular persistence of SCVs. This study shows that extracellular proteins are involved in the formation of biofilm by three SCV strains, which, additionally, have a low biofilm-dispersing activity. It was determined that SigB activity modulates biofilm formation by strain SCV CF07-S and is dominant over that of the agr system without being solely responsible for the repression of proteolytic activity. On the other hand, the expression of fnbA and the control of nuclease activity contributed to the SigB-dependent formation of biofilm of this SCV strain. SigB was also required for the replication of CF07-S within epithelial cells and may be involved in the colonization of lungs by SCVs in a mouse infection model. This study methodically investigated SigB activity and associated mechanisms in the various aspects of SCV pathogenesis. Results confirm that SigB activity importantly influences the production of virulence factors, biofilm formation and intracellular persistence for some clinical SCV strains.
Almeida, Filipe; Borges, Vítor; Ferreira, Rita; Borrego, Maria José; Gomes, João Paulo
2012-01-01
Chlamydia trachomatis is a human bacterial pathogen that multiplies only within an intracellular membrane-bound vacuole, the inclusion. C. trachomatis includes ocular and urogenital strains, usually causing infections restricted to epithelial cells of the conjunctiva and genital mucosa, respectively, and lymphogranuloma venereum (LGV) strains, which can infect macrophages and spread into lymph nodes. However, C. trachomatis genomes display >98% identity at the DNA level. In this work, we studied whether C. trachomatis Inc proteins, which have a bilobed hydrophobic domain that may mediate their insertion in the inclusion membrane, could be a factor determining these different types of infection and tropisms. Analyses of polymorphisms and phylogeny of 48 Inc proteins from 51 strains encompassing the three disease groups showed significant amino acid differences that were mainly due to variations between Inc proteins from LGV and ocular or urogenital isolates. Studies of the evolutionary dynamics of inc genes suggested that 10 of them are likely under positive selection and indicated that most nonsilent mutations are LGV specific. Additionally, real-time quantitative PCR analyses in prototype and clinical strains covering the three disease groups identified three inc genes with LGV-specific expression. We determined the transcriptional start sites of these genes and found LGV-specific nucleotides within their promoters. Thus, subtle variations in the amino acids of a subset of Inc proteins and in the expression of inc genes may contribute to the unique tropism and invasiveness of C. trachomatis LGV strains. PMID:23042990
Norris, Michael H.; Schweizer, Herbert P.
2017-01-01
Burkholderia pseudomallei (Bp) causes the disease melioidosis. The main cause of mortality in this disease is septic shock triggered by the host responding to lipopolysaccharide (LPS) components of the Gram-negative outer membrane. Bp LPS is thought to be a weak inducer of the host immune system. LPS from several strains of Bp were purified and their ability to induce the inflammatory mediators TNF-α and iNOS in murine macrophages at low concentrations was investigated. Innate and adaptive immunity qPCR arrays were used to profile expression patterns of 84 gene targets in response to the different LPS types. Additional qPCR validation confirmed large differences in macrophage response. LPS from a high-virulence serotype B strain 576a and a virulent rough central nervous system tropic strain MSHR435 greatly induced the innate immune response indicating that the immunopathogenesis of these strains is different than in infections with strains similar to the prototype strain 1026b. The accumulation of autophagic vesicles was also increased in macrophages challenged with highly immunogenic Bp LPS. Gene induction and concomitant cytokine secretion profiles of human PBMCs in response to the various LPS were also investigated. MALDI-TOF/TOF was used to probe the lipid A portions of the LPS, indicating substantial structural differences that likely play a role in host response to LPS. These findings add to the evolving knowledge of host-response to bacterial LPS, which can be used to better understand septic shock in melioidosis patients and in the rational design of vaccines. PMID:28453531
Lundkvist, A; Fatouros, A; Niklasson, B
1991-09-01
Monoclonal antibodies (MAbs) against Puumala (PUU) virus, the aetiological agent of nephropathia epidemica, were produced by fusing activated spleen cells from a bank vole (Clethrionomys glareolus) with the mouse myeloma cell line SP2/0. This novel approach, utilizing the natural vector of PUU virus for hybridoma production, proved to be highly efficient, and eight stable PUU virus-specific heterohybridomas were isolated and characterized. The bank vole MAbs were all specific for the nucleocapsid protein (N) of PUU virus, as determined by immunoprecipitation. When evaluated by additivity immunoassays, the MAbs were found to recognize several different, distinct or overlapping, epitopes on N. The MAbs were used in immunofluorescence assays to compare eight PUU-related virus isolates, and the prototype Hantaan, Urban rat and Prospect Hill viruses. The reactivity varied among the different MAbs and could be classified into five groups. One MAb reacted exclusively with PUU-related viruses; two MAbs reacted with all PUU-related virus strains tested, as well as Prospect Hill virus, but did not react with Urban rat virus and Hantaan virus; one MAb reacted with all PUU-related virus strains tested and weakly with Hantaan virus, but not with Urban rat and Prospect Hill viruses; two MAbs reacted with all the virus strains tested. Two virus strains, K-27 and CG-1820, isolated in the western U.S.S.R., were distinguished from the other PUU-related virus strains by two MAbs, suggesting that the large group of independently isolated PUU-related viruses may be more heterogeneous than previously believed.
Defining Potential Vaccine Targets of Haemophilus ducreyi Trimeric Autotransporter Adhesin DsrA
Fusco, William G.; Choudhary, Neelima R.; Stewart, Shelley M.; Alam, S. Munir; Sempowski, Gregory D.; Elkins, Christopher
2015-01-01
Haemophilus ducreyi is the causative agent of the sexually transmitted genital ulcer disease chancroid. Strains of H. ducreyi are grouped in two classes (I and II) based on genotypic and phenotypic differences, including those found in DsrA, an outer membrane protein belonging to the family of multifunctional trimeric autotransporter adhesins. DsrA is a key serum resistance factor of H. ducreyi that prevents binding of natural IgM at the bacterial surface and functions as an adhesin to fibronectin, fibrinogen, vitronectin, and human keratinocytes. Monoclonal antibodies (MAbs) were developed to recombinant DsrA (DsrAI) from prototypical class I strain 35000HP to define targets for vaccine and/or therapeutics. Two anti-DsrAI MAbs bound monomers and multimers of DsrA from genital and non-genital/cutaneous H. ducreyi strains in a Western blot and reacted to the surface of the genital strains; however, these MAbs did not recognize denatured or native DsrA from class II strains. In a modified extracellular matrix protein binding assay using viable H. ducreyi, one of the MAbs partially inhibited binding of fibronectin, fibrinogen, and vitronectin to class I H. ducreyi strain 35000HP, suggesting a role for anti-DsrA antibodies in preventing binding of H. ducreyi to extracellular matrix proteins. Standard ELISA and surface plasmon resonance using a peptide library representing full-length, mature DsrAI revealed the smallest nominal epitope bound by one of the MAbs to be MEQNTHNINKLS. Taken together, our findings suggest that this epitope is a potential target for an H. ducreyi vaccine. PMID:25897604
Defining Potential Vaccine Targets of Haemophilus ducreyi Trimeric Autotransporter Adhesin DsrA.
Fusco, William G; Choudhary, Neelima R; Stewart, Shelley M; Alam, S Munir; Sempowski, Gregory D; Elkins, Christopher; Leduc, Isabelle
2015-04-01
Haemophilus ducreyi is the causative agent of the sexually transmitted genital ulcer disease chancroid. Strains of H. ducreyi are grouped in two classes (I and II) based on genotypic and phenotypic differences, including those found in DsrA, an outer membrane protein belonging to the family of multifunctional trimeric autotransporter adhesins. DsrA is a key serum resistance factor of H. ducreyi that prevents binding of natural IgM at the bacterial surface and functions as an adhesin to fibronectin, fibrinogen, vitronectin, and human keratinocytes. Monoclonal antibodies (MAbs) were developed to recombinant DsrA (DsrA(I)) from prototypical class I strain 35000HP to define targets for vaccine and/or therapeutics. Two anti-DsrAI MAbs bound monomers and multimers of DsrA from genital and non-genital/cutaneous H. ducreyi strains in a Western blot and reacted to the surface of the genital strains; however, these MAbs did not recognize denatured or native DsrA from class II strains. In a modified extracellular matrix protein binding assay using viable H. ducreyi, one of the MAbs partially inhibited binding of fibronectin, fibrinogen, and vitronectin to class I H. ducreyi strain 35000HP, suggesting a role for anti-DsrA antibodies in preventing binding of H. ducreyi to extracellular matrix proteins. Standard ELISA and surface plasmon resonance using a peptide library representing full-length, mature DsrAI revealed the smallest nominal epitope bound by one of the MAbs to be MEQNTHNINKLS. Taken together, our findings suggest that this epitope is a potential target for an H. ducreyi vaccine.
Singh, Mini Pritam; Majumdar, Manasi; Thapa, Babu Ram; Gupta, Puneet Kumar; Khurana, Jasmine; Budhathoki, Bimal; Ratho, Radha Kanta
2015-02-01
Hepatitis A virus usually causes acute viral hepatitis (AVH) in the paediatric age group with a recent shift in age distribution and disease manifestations like acute liver failure (ALF). This has been attributed to mutations in 5'non-translated region (5'NTR) which affects the viral multiplication. The present study was aimed to carry out the molecular detection and phylogenetic analysis of hepatitis A virus strains circulating in north western India. Serum samples from in patients and those attending out patient department of Pediatric Gastroenterology in a tertiary care hospital in north India during 2007-2011 with clinically suspected AVH were tested for anti-hepatitis A virus (HAV) IgM antibodies. Acute phase serum samples were subjected to nested PCR targeting the 5'NTR region followed by sequencing of the representative strains. A total of 1334 samples were tested, 290 (21.7%) were positive for anti-HAV IgM antibody. Of these, 78 serum samples (< 7 days old) were subjected to PCR and 47.4% (37/78) samples showed the presence of HAV RNA. Children < 15 yr of age accounted for majority (94%) of cases with highest seropositivity during rainy season. Sequencing of 15 representative strains was carried out and the circulating genotype was found to be III A. The nucleotide sequences showed high homology among the strains with a variation ranging from 0.1-1 per cent over the years. An important substitution of G to A at 324 position was shown by both AVH and ALF strains. The cumulative substitution in AVH strains Vs ALF strains as compared to GBM, Indian and prototype strain in the 200-500 region of 5' NTR was comparable. Our results showed hepatitis A still a disease of children with III A as a circulating genotype in this region. The mutations at 5'NTR region warrant further analysis as these affect the structure of internal ribosomal entry site which is important for viral replication.
Zhang, Wenqiang; Lin, Xiaojuan; Jiang, Ping; Tao, Zexin; Liu, Xiaolin; Ji, Feng; Wang, Tongzhan; Wang, Suting; Lv, Hui; Xu, Aiqiang; Wang, Haiyan
2016-08-01
Coxsackievirus B3 (CV-B3) has frequently been associated with aseptic meningitis outbreaks in China. To identify sequence motifs related to aseptic meningitis and to construct an infectious clone, the genome sequence of 08TC170, a representative strain isolated from cerebrospinal fluid (CSF) samples from an outbreak in Shandong in 2008, was determined, and the coding regions for P1-P3 and VP1 were aligned. The first 21 and last 20 residues were "TTAAAACAGCCTGTGGGTTGT" and "ATTCTCCGCATTCGGTGCGG", respectively. The whole genome consisted of 7401 nucleotides, sharing 80.8 % identity with the prototype strain Nancy and low sequence similarity with members of clusters A-C. In contrast, 08TC170 showed high sequence similarity to members of cluster D. An especially high level of sequence identity (≥97.7 %) was found within a branch constituted by 08TC170 and four Chinese strains that clustered together in all of the P1-P3 phylogenic trees. In addition, 08TC170 also possessed a close relationship to the Hong Kong strain 26362/08 in VP1. Similarity plot analysis showed that 08TC170 was most similar to the Chinese CV-B3 strain SSM in P1 and the partial P2 coding region but to the CV-B5 or E-6 strain in 2C and following regions. A T277A mutation was found in 08TC170 and other strains isolated in 2008-2010, but not in strains isolated before 2008, which had high sequence similarity and formed the cluster A277. The results suggested that 08TC170 was the product of both intertypic recombination and point mutation, whose effects on viral neurovirulence will be investigated in a further study. The high homology between 08TC170 and other strains revealed their co-circulation in mainland China and Hong Kong and indicates that further surveillance is needed.
Hydrogen production from salt water by Marine blue green algae and solar radiation
NASA Technical Reports Server (NTRS)
Mitsui, A.; Rosner, D.; Kumazawa, S.; Barciela, S.; Phlips, E.
1985-01-01
Two marine bluegreen algae, Oscillatoria sp. Miami BG 7 and Synechococcus sp Miami 041511 have been selected as the result of over 10 years continuous and intensive effort of isolation, growth examination, and the screening of hydrogen photoproduction capability in this laboratory. Both strains photoproduced hydrogen for several days at high rates and a quantity of hydrogen was accumulated in a closed vessel. Overall hydrogen donor substance of the hydrogen photoproduction was found to be salt water. Using strain Miami BG 7, a two step method of hydrogen photoproduction from salt water was successfully developed and this was recycled several times over a one month period using both free cells and immobilized cells in both indoor and outdoor under natural sunlight. According to these experiments, a prototype floating hydrogen production system was designed for further development of the biosolar hydrogen production system.
Tuning bad metal and non-Fermi liquid behavior in a Mott material: Rare-earth nickelate thin films
Mikheev, Evgeny; Hauser, Adam J.; Himmetoglu, Burak; Moreno, Nelson E.; Janotti, Anderson; Van de Walle, Chris G.; Stemmer, Susanne
2015-01-01
Resistances that exceed the Mott-Ioffe-Regel limit (known as bad metal behavior) and non-Fermi liquid behavior are ubiquitous features of the normal state of many strongly correlated materials. We establish the conditions that lead to bad metal and non-Fermi liquid phases in NdNiO3, which exhibits a prototype bandwidth-controlled metal-insulator transition. We show that resistance saturation is determined by the magnitude of Ni eg orbital splitting, which can be tuned by strain in epitaxial films, causing the appearance of bad metal behavior under certain conditions. The results shed light on the nature of a crossover to a non-Fermi liquid metal phase and provide a predictive criterion for Anderson localization. They elucidate a seemingly complex phase behavior as a function of film strain and confinement and provide guidelines for orbital engineering and novel devices. PMID:26601140
Burgmeier, Jörg; Schippers, Wolfgang; Emde, Nico; Funken, Peter; Schade, Wolfgang
2011-05-01
A fiber Bragg grating sensor system used for monitoring the effects of strain on the power cable of an offshore wind turbine is presented. The Bragg grating structure was inscribed into coated nonphotosensitive standard telecommunication fibers using an IR femtosecond laser and the point-by-point writing technique. Because of the presence of the protective coating of the fiber, the mechanical stability of the resultant sensor device is better than that of a sensor consisting of a bare fiber. A system containing this sensing element was to our knowledge for the first time successfully installed and tested in an offshore wind turbine prototype (REpower 6M, REpower Systems, AG, Germany) in February 2010, near Ellhöft (Germany). The fabrication process of the fiber Bragg gratings, measurement results of the online monitoring, and a comparison between the sensor signal and commonly used sensing techniques are presented.
NASA Astrophysics Data System (ADS)
Setiono, Andi; Ula, Rini Khamimatul; Hanto, Dwi; Widiyatmoko, Bambang; Purnamaningsih, Retno Wigajatri
2016-02-01
In general, Fiber Bragg Grating (FBG) sensor works based on observation of spectral response characteristic to detect the desired parameter. In this research, we studied intensity response characteristic of FBG to detect the dynamic strain. Experiment result show that the reflected intensity had linier relationships with dynamic strain. Based on these characteristics, we developed the FBG sensor to detect low frequency vibration. This sensor is designed by attaching the FBG on the bronze cantilever with dimensions of 85×3×0.5 mm. Measurement results showed that the sensor was able to detect vibrations in the frequency range of 7-10 Hz at temperature range of 25-45 ˚C. The measured frequency range is still within the frequency range of digging activity, therefore this vibration sensor can be applied for oil pipelines vandalisation detection system.
Temperature and strain characterization of long period gratings in air guiding fiber
NASA Astrophysics Data System (ADS)
Iadicicco, Agostino; Cutolo, Antonello; Cusano, Andrea; Campopiano, Stefania
2013-05-01
This paper reports on the fabrication of Long Period Gratings (LPGs) in hollow-core air-silica photonic bandgap fibers by using pressure assisted Electrode Arc Discharge (EAD) technique. In particular, the fabrication procedure relies on the combined use of EAD step, to locally heat the HC fiber, and of a static pressure (slightly higher than the external one) inside the fiber holes, to modify the holes. This procedure permits to preserve the holey structure of the host fiber avoiding any hole collapsing and it enables a local effective refractive index change due to the size and shape modifications of core and cladding holes. Periodically repeated EAD treatments permit the fabrication of LPGs based devices in hollow core optical fibers enabling new functionalities hitherto not possible. Here, the experimental fabrication of LPG prototypes with different periods and lengths are discussed. And, the HC-LPGs sensitivity to environmental parameters such as strain and temperature are investigated.
Yan, Ju-ying; Lu, Yi-yu; Xu, Chang-ping; Gong, Li-ming; Chen, Yin; Zhang, Yan-jun; Zhu, Jian-sheng
2011-12-01
In order to confirm the causes of viral meningitis outbreaks in Linhai county, Zhejiang province in 2004, and to analyze the relationship between hereditary variation and evolution of the pathogen. 60 cerebrospinal fluid (CSF) specimens were collected from the suspected patients. Virus strains from the specimens were isolated with RD and Hep-2 cell lines, and identified through neutralization test. VP1 and VP4/VP2 genes of the isolated viruses were sequenced. Both phylogenetic and homological trees were also constructed. 19 Echovirus type 30 (E30) strains were isolated from 60 CSFs, in which E30 accounted for 31.7%. All of the complete VP1 genes in 4 sequenced virus isolates of E30 were composed of 876 nt, encoding 292 amino acids (aa). The identity of nucleotide and amino acid in VP1 gene were 82.4% - 84.1% and 93.5% - 94.2% between the 4 Linhai strains and the prototype strain Bastianni of E30, were 87.1% - 99.9% and 97.9% - 100.0% among the 4 virus strains of E30 from Linhai, respectively. The 4 Linhai strains could be classified into two classes. The diversity of nt and aa was minimal in the same class but obvious between the two classes, with the range of diversities as 12.9% and 2.1%, respectively. The Linhai E30 strains had maximum similarity with the Zhejiang E30 strains in 2002 - 2003. The 4 Linhai strains of E30 in the phylogenetic tree of the VP1 gene were attributed into two branches of the G and H genotype, respectively. The G branch also included the E30 strains from Zhejiang, Jiangsu and Shangdong in 2003, while the H branch including E30 strains from Zhuji, Zhejiang in 2002. The phylogenetic tree of VP4/VP2 genes was similar to that of VP1 gene. The outbreak of viral meningitis in Linhai county in 2004 was caused by the two classes of E30 strains with G and H genotype existed simultaneously. The Linhai E30 strains had maximum genetic relations to the Zhejiang, Jiangsu and Shangdong strains of E30. The H genotype was inferred to be a new variant strain, which was first isolated in Zhejiang province in 2002.
Ferroelectricity in d0 double perovskite fluoroscandates
NASA Astrophysics Data System (ADS)
Charles, Nenian; Rondinelli, James M.
2015-08-01
Ferroelectricity in strain-free and strained double perovskite fluorides, Na3ScF6 and K2NaScF6 , is investigated using first-principles density functional theory. Although the experimental room temperature crystal structures of these fluoroscandates are centrosymmetric, i.e., Na3ScF6 (P 21/n ) and K2NaScF6 (F m 3 ¯m ), lattice dynamical calculations reveal that soft polar instabilities exist in each prototypical cubic phase and that the modes harden as the tolerance factor approaches unity. Thus the double fluoroperovskites bear some similarities to A B O3 perovskite oxides; however, in contrast, these fluorides exhibit large acentric displacements of alkali metal cations (Na, K) rather than polar displacements of the transition metal cations. Biaxial strain investigations of the centrosymmetric and polar Na3ScF6 and K2NaScF6 phases reveal that the paraelectric structures are favored under compressive strain, whereas polar structures with in-plane electric polarizations (˜5 -18 μ C cm-2 ) are realized at sufficiently large tensile strains. The electric polarization and stability of the polar structures for both chemistries are found to be further enhanced and stabilized by a coexisting single octahedral tilt system. Our results suggest that polar double perovskite fluorides may be realized by suppression of octahedral rotations about more than one Cartesian axis; structures exhibiting in- or out-of-phase octahedral rotations about the c axis are more susceptible to polar symmetries.
Kemble, George W.; Annunziato, Paula; Lungu, Octavian; Winter, Ruth E.; Cha, Tai-An; Silverstein, Saul J.; Spaete, Richard R.
2000-01-01
We report the discovery of a novel gene in the varicella-zoster virus (VZV) genome, designated open reading frame (ORF) S/L. This gene, located at the left end of the prototype VZV genome isomer, expresses a polyadenylated mRNA containing a splice within the 3′ untranslated region in virus-infected cells. Sequence analysis reveals significant differences between the ORF S/Ls of wild-type and attenuated strains of VZV. Antisera raised to a bacterially expressed portion of ORF S/L reacted specifically with a 21-kDa protein synthesized in cells infected with a VZV clinical isolate and with the original vaccine strain of VZV (Oka-ATCC). Cells infected with other VZV strains, including a wild-type strain that has been extensively passaged in tissue culture and commercially produced vaccine strains of Oka, synthesize a family of proteins ranging in size from 21 to 30 kDa that react with the anti-ORF S/L antiserum. MeWO cells infected with recombinant VZV harboring mutations in the C-terminal region of the ORF S/L gene lost adherence to the stratum and adjacent cells, resulting in an altered plaque morphology. Immunohistochemical analysis of VZV-infected cells demonstrated that ORF S/L protein localizes to the cytoplasm. ORF S/L protein was present in skin lesions of individuals with primary or reactivated infection and in the neurons of a dorsal root ganglion during virus reactivation. PMID:11070031
NASA Astrophysics Data System (ADS)
Osmani, Bekim; Töpper, Tino; Deschenaux, Christian; Nohava, Jiri; Weiss, Florian M.; Leung, Vanessa; Müller, Bert
2015-02-01
Treatments of severe incontinence are currently based on purely mechanical systems that generally result in revision after three to five years. Our goal is to develop a prototype acting in a natural-analogue manner as artificial muscle, which is based on electro-active polymers. Dielectric actuators have outstanding performances including millisecond response times, mechanical strains of more than 10 % and power to mass densities similar to natural muscles. They basically consist of polymer films sandwiched between two compliant electrodes. The incompressible but elastic polymer film transduces the electrical energy into mechanical work according to the Maxwell pressure. Available polymer films are micrometers thick and voltages as large as kV are necessary to obtain 10 % strain. For medical implants, polymer films should be nanometer thin to realize actuation below 48 V. The metallic electrodes have to be stretchable to follow the strain of 10 % and remain conductive. Recent results on the stress/strain behavior of anisotropic EAP-cantilevers have shown dependencies on metal electrode preparation. We have investigated tunable anisotropic micro- and nanostructures for metallic electrodes. They show a preferred actuation direction with improved stress-strain behavior. The bending of the cantilever has been characterized by the laser beam deflection method. The impact of the electrode on the effective Young's Modulus is measured using an Ultra Nanoindentation Tester with an integrated reference system for soft polymer surfaces. Once ten thousand layers of nanometer-thin EAP actuators are available, devices beyond the envisioned application will flood the market.
Marcacci, Maurilia; Ancora, Massimo; Mangone, Iolanda; Teodori, Liana; Di Sabatino, Daria; De Massis, Fabrizio; Camma', Cesare; Savini, Giovanni; Lorusso, Alessio
2014-06-01
Dynamic surveillance and characterization of canine distemper virus (CDV) circulating strains are essential against possible vaccine breakthroughs events. This study describes the setup of a fast and robust next-generation sequencing (NGS) Ion PGM™ protocol that was used to obtain the complete genome sequence of a CDV isolate (CDV2784/2013). CDV2784/2013 is the prototype of CDV strains responsible for severe clinical distemper in dogs and wolves in Italy during 2013. CDV2784/2013 was isolated on cell culture and total RNA was used for NGS sample preparation. A total of 112.3 Mb of reads were assembled de novo using MIRA version 4.0rc4, which yielded a total number of 403 contigs with 12.1% coverage. The whole genome (15,690 bp) was recovered successfully and compared to those of existing CDV whole genomes. CDV2784/2013 was shown to have 92% nt identity with the Onderstepoort vaccine strain. This study describes for the first time a fast and robust Ion PGM™ platform-based whole genome amplification protocol for non-segmented negative stranded RNA viruses starting from total cell-purified RNA. Additionally, this is the first study reporting the whole genome analysis of an Arctic lineage strain that is known to circulate widely in Europe, Asia and USA. Copyright © 2014 Elsevier B.V. All rights reserved.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Yang, Nancy; Yee, J.; Zheng, B.
We investigate the process-structure-property relationships for 316L stainless steel prototyping utilizing 3-D laser engineered net shaping (LENS), a commercial direct energy deposition additive manufacturing process. Our study concluded that the resultant physical metallurgy of 3-D LENS 316L prototypes is dictated by the interactive metallurgical reactions, during instantaneous powder feeding/melting, molten metal flow and liquid metal solidification. This study also showed 3-D LENS manufacturing is capable of building high strength and ductile 316L prototypes due to its fine cellular spacing from fast solidification cooling, and the well-fused epitaxial interfaces at metal flow trails and interpass boundaries. However, without further LENS processmore » control and optimization, the deposits are vulnerable to localized hardness variation attributed to heterogeneous microstructure, i.e., the interpass heat-affected zone (HAZ) from repetitive thermal heating during successive layer depositions. Most significantly, the current deposits exhibit anisotropic tensile behavior, i.e., lower strain and/or premature interpass delamination parallel to build direction (axial). This anisotropic behavior is attributed to the presence of interpass HAZ, which coexists with flying feedstock inclusions and porosity from incomplete molten metal fusion. Our current observations and findings contribute to the scientific basis for future process control and optimization necessary for material property control and defect mitigation.« less
Yang, Nancy; Yee, J.; Zheng, B.; ...
2016-12-08
We investigate the process-structure-property relationships for 316L stainless steel prototyping utilizing 3-D laser engineered net shaping (LENS), a commercial direct energy deposition additive manufacturing process. Our study concluded that the resultant physical metallurgy of 3-D LENS 316L prototypes is dictated by the interactive metallurgical reactions, during instantaneous powder feeding/melting, molten metal flow and liquid metal solidification. This study also showed 3-D LENS manufacturing is capable of building high strength and ductile 316L prototypes due to its fine cellular spacing from fast solidification cooling, and the well-fused epitaxial interfaces at metal flow trails and interpass boundaries. However, without further LENS processmore » control and optimization, the deposits are vulnerable to localized hardness variation attributed to heterogeneous microstructure, i.e., the interpass heat-affected zone (HAZ) from repetitive thermal heating during successive layer depositions. Most significantly, the current deposits exhibit anisotropic tensile behavior, i.e., lower strain and/or premature interpass delamination parallel to build direction (axial). This anisotropic behavior is attributed to the presence of interpass HAZ, which coexists with flying feedstock inclusions and porosity from incomplete molten metal fusion. Our current observations and findings contribute to the scientific basis for future process control and optimization necessary for material property control and defect mitigation.« less
A first look at the use of centrifuge modelling for glacier crevassing
NASA Astrophysics Data System (ADS)
Rea, B. R.; Brennan, A.; Benn, D.
2013-12-01
Realisation of the importance of calving margins and supraglacial meltwater routing to the bed of ice sheets both of which have potential roles to play in controlling mass flux from the Greenland and Antarctic Ice Sheets has raised interest in crevassing processes. Advances have been made in, theoretical treatments of crevasse formation and propagation, the development of physically-based calving models with subsequent implementation in ice sheet/glacier flow models utilising a number of different approaches. To-date only one study has tested crevassing propagation theory against empirical data and this dealt only with shallow water-free crevasses. There is a need for more such studies where key parameters are well constrained, for example crevasse water depths, crevasse depth, stress/strain regime, temperature. The challenges for a field-based study are great due in part to the difficulty in determining crevasse depths/crevasse water depths and with the general working environment in which crevasses generally form. An alternative solution is to utilise physical modelling and here we report on the preliminary stages of such a project using a geotechnical beam centrifuge. The centrifuge creates real-world (prototype) stress conditions in scaled models, by testing in an enhanced ';gravity' field, and is ideal for problems governed by self-weight stresses. Scaling factors, for model to prototype, have to be confirmed. Following the Linear Elastic Fracture Mechanics (LEFM) approach crevasses propagate instantaneously when KI, (the stress intensity at the crack tip) exceeds KIC (the fracture toughness). KI is determined from the sum of three stress intensity factors (SIF): KI-1 a positive tensile stress resulting from the resistive stress, KI-2 the lithostatic stress which is negative (compressive) and for a water holding crevasse, KI-3 the hydrostatic stress which is positive. Experiments start with a pre-cast crevasse and as the models are constructed at 1g the elastic strain developed as the centrifuge spins up to 100g provides KI-1 which (due to lateral confinement) is directed perpendicular to the pre-cast crevasse. SIF scaling relationships should be KIp = √N KIm (where p is prototype and m is model) but this has to be confirmed for ice fracturing.
A microdot multilayer oxide device: let us tune the strain-ionic transport interaction.
Schweiger, Sebastian; Kubicek, Markus; Messerschmitt, Felix; Murer, Christoph; Rupp, Jennifer L M
2014-05-27
In this paper, we present a strategy to use interfacial strain in multilayer heterostructures to tune their resistive response and ionic transport as active component in an oxide-based multilayer microdot device on chip. For this, fabrication of strained multilayer microdot devices with sideways attached electrodes is reported with the material system Gd0.1Ce0.9O(2-δ)/Er2O3. The fast ionic conducting Gd0.1Ce0.9O(2-δ) single layers are altered in lattice strain by the electrically insulating erbia phases of a microdot. The strain activated volume of the Gd0.1Ce0.9O(2-δ) is investigated by changing the number of individual layers from 1 to 60 while keeping the microdot at a constant thickness; i.e., the proportion of strained volume was systematically varied. Electrical measurements showed that the activation energy of the devices could be altered by Δ0.31 eV by changing the compressive strain of a microdot ceria-based phase by more than 1.16%. The electrical conductivity data is analyzed and interpreted with a strain volume model and defect thermodynamics. Additionally, an equivalent circuit model is presented for sideways contacted multilayer microdots. We give a proof-of-concept for microdot contacting to capture real strain-ionic transport effects and reveal that for classic top-electrode contacting the effect is nil, highlighting the need for sideways electric contacting on a nanoscopic scale. The near order ionic transport interaction is supported by Raman spectroscopy measurements. These were conducted and analyzed together with fully relaxed single thin film samples. Strain states are described relative to the strain activated volumes of Gd0.1Ce0.9O(2-δ) in the microdot multilayer. These findings reveal that strain engineering in microfabricated devices allows altering the ionic conduction over a wide range beyond classic doping strategies for single films. The reported fabrication route and concept of strained multilayer microdots is a promising path for applying strained multilayer oxides as active new building blocks relevant for a broad range of microelectrochemical devices, e.g., resistive switching memory prototypes, resistive or electrochemical sensors, or as active catalytic solid state surface components for microfuel cells or all-solid-state batteries.
2009-01-01
Background In the global eradication program for poliomyelitis, the laboratory diagnosis plays a critical role by isolating poliovirus (PV) from the stool samples of acute flaccid paralysis (AFP) cases. In this study, we developed a reverse transcription-loop-mediated isothermal amplification (RT-LAMP) system for a rapid and highly sensitive detection of enterovirus including PV to identify stool samples positive for enterovirus including PV. Methods A primer set was designed for RT-LAMP to detect enterovirus preferably those with PV-like 5'NTRs of the viral genome. The sensitivity of RT-LAMP system was evaluated with prototype strains of enterovirus. Detection of enterovirus from stool extracts was examined by using RT-LAMP system. Results We detected at least 400 copies of the viral genomes of PV(Sabin) strains within 90 min by RT-LAMP with the primer set. This RT-LAMP system showed a preference for Human enterovirus species C (HEV-C) strains including PV, but exhibited less sensitivity to the prototype strains of HEV-A and HEV-B (detection limits of 7,400 to 28,000 copies). Stool extracts, from which PV, HEV-C, or HEV-A was isolated in the cell culture system, were mostly positive by RT-LAMP method (positive rates of 15/16 (= 94%), 13/14 (= 93%), and 4/4 (= 100%), respectively). The positive rate of this RT-LAMP system for stool extracts from which HEV-B was isolated was lower than that of HEV-C (positive rate of 11/21 (= 52%)). In the stool samples, which were negative for enterovirus isolation by the cell culture system, we found that two samples were positive for RT-LAMP (positive rates of 2/38 (= 5.3%)). In these samples, enterovirus 96 was identified by sequence analysis utilizing a seminested PCR system. Conclusions RT-LAMP system developed in this study showed a high sensitivity comparable to that of the cell culture system for the detection of PV, HEV-A, and HEV-C, but less sensitivity to HEV-B. This RT-LAMP system would be useful for the direct detection of enterovirus from the stool extracts. PMID:20015403
Fabrication and electromechanical examination of a spherical dielectric elastomer actuator
NASA Astrophysics Data System (ADS)
Ahmadi, S.; Gooyers, M.; Soleimani, M.; Menon, C.
2013-11-01
In this paper, a procedure for fabricating and testing a seamless spherical dielectric elastomer actuator (DEA) is presented. In previously developed spherical prototypes, the DEA material is pre-strained by a rigid frame to improve the actuator’s output force; however, it is possible to pre-strain a spherical DEA by inflating the sample with a liquid or gas as long as the sample contains the pressure. In this work, a very compliant silicone-based material was used to fabricate a nearly spherical balloon-shaped prototype. The DEA sample was inflated by air and various electrical-actuation regimes were considered. The performance of the DEA sample was studied using an analytical and a finite element-based model. An Ogden hyperelastic model was used in formulation of the analytical model to include nonlinear behavior of the silicone material. Full statistical analysis of the experimental and numerical results was carried out using the root-mean-square (RMS) error and the normalized RMS error. The analytical and FEM results were in good agreement with the experimental data. According to modeling results, it was found that the DEA’s actuation force can be mainly improved by increasing the voltage, reducing the thickness, lowering the stiffness, and/or increasing the initial pressure. As an example, a three-fold increase of the actuation force was found when the thickness was reduced to half of its initial value. This improvement of the efficiency suggests that the spherical DEA is suitable for use in several applications if an appropriate design with optimal governing parameters is developed.
McErlean, Peter; Shackelton, Laura A; Andrews, Emily; Webster, Dale R; Lambert, Stephen B; Nissen, Michael D; Sloots, Theo P; Mackay, Ian M
2008-04-02
Human rhinoviruses (HRVs) are the most frequently detected pathogens in acute respiratory tract infections (ARTIs) and yet little is known about the prevalence, recurrence, structure and clinical impact of individual members. During 2007, the complete coding sequences of six previously unknown and highly divergent HRV strains were reported. To catalogue the molecular and clinical features distinguishing the divergent HRV strains, we undertook, for the first time, in silico analyses of all available polyprotein sequences and performed retrospective reviews of the medical records of cases in which variants of the prototype strain, HRV-QPM, had been detected. Genomic analyses revealed that the six divergent strains, residing within a clade we previously called HRV A2, had the shortest polyprotein of all picornaviruses investigated. Structure-based amino acid alignments identified conserved motifs shared among members of the genus Rhinovirus as well as substantive deletions and insertions unique to the divergent strains. Deletions mostly affected regions encoding proteins traditionally involved in antigenicity and serving as HRV and HEV receptor footprints. Because the HRV A2 strains cannot yet be cultured, we created homology models of predicted HRV-QPM structural proteins. In silico comparisons confirmed that HRV-QPM was most closely related to the major group HRVs. HRV-QPM was most frequently detected in infants with expiratory wheezing or persistent cough who had been admitted to hospital and required supplemental oxygen. It was the only virus detected in 65% of positive individuals. These observations contributed to an objective clinical impact ranging from mild to severe. The divergent strains did not meet classification requirements for any existing species of the genus Rhinovirus or Enterovirus. HRV A2 strains should be partitioned into at least one new species, putatively called Human rhinovirus C, populated by members detected with high frequency, from individuals with respiratory symptoms requiring hospital admission.
Mel'nikova, Ol'ga V; Adel'shin, R V; Korzun, V M; Trushina, Yu N; Andaev, E I
The Irkutsk region is the unique territory where all known subtypes of tick-borne encephalitis virus (TBEV) circulate. In the last years, the phenomenon of changes in TBEV subtypes (substitution of the Far-Eastern subtype by the Siberian one) was noted in some regions of the Russian Federation. The results of individual investigation of 11522 Ixodes persulcatus ticks and brain specimens from 81 small mammals collected in natural foci of the Irkutsk region during 2006-2014 are presented in the article. More than 60 TBEV strains have been isolated and studied by virological methods; E gene fragments (1193 b.p.) of 68 isolates have been typed. The majority of the strains (irrespective of subtype) were of high virulence for laboratory mice (LM) in case of both intracerebral and subcutaneous inoculation of virus. All isolates from warm-blooded small mammals and humans were of high virulence for LM, but placed in the same clusters of the phylogenetic tree with ticks collected in the same area. Tick-borne strains of different virulence also did not form separate clusters on the tree. Phylogenetic analysis showed that modern TBEV genotypic landscape of the studied territory is changing toward absolute predominance of the Siberian subtype (94.1%). This subtype is represented by two groups with prototype strains “Zausaev” and “Vasilchenko”. The “Vasilchenko” group of strains is spread on the whole territory under study; the strains of “Zausaev” group were isolated previously in the Irkutsk suburbs. The European subtype of TBEV circulates in natural foci of Pribaikalie permanently (at least 5% of the random sampling); the strains are of high virulence for LM. The Far-Eastern TBEV subtype was not found within the group of isolates collected in 20062014. The phylogenetic relationship of the strains under study had a higher correlation with the place of isolation than with the year or source.
Yi, Yanjie; Shaheen, Farida; Collman, Ronald G.
2005-01-01
Coreceptor specificity of human immunodeficiency virus type 1 (HIV-1) strains is generally defined in vitro in cell lines expressing CCR5 or CXCR4, but lymphocytes and macrophages are the principal targets in vivo. CCR5-using (R5) variants dominate early in infection, but strains that use CXCR4 emerge later in a substantial minority of subjects. Many or most CXCR4-using variants can use both CXCR4 and CCR5 (R5X4), but the pathways that are actually used to cause infection in primary cells and in vivo are unknown. We examined several R5X4 prototype and primary isolates and found that they all were largely or completely restricted to CXCR4-mediated entry in primary lymphocytes, even though lymphocytes are permissive for CCR5-mediated entry by R5 strains. In contrast, in primary macrophages R5X4 isolates used both CCR5 and CXCR4. The R5X4 strains were also more sensitive than R5 strains to CCR5 blocking, suggesting that interactions between the R5X4 strains and CCR5 are less efficient. These results indicate that coreceptor phenotyping in transformed cells does not necessarily predict utilization in primary cells, that variability exists among HIV-1 isolates in the ability to use CCR5 expressed on lymphocytes, and that many or most strains characterized as R5X4 are functionally X4 in primary lymphocytes. Less efficient interactions between R5X4 strains and CCR5 may be responsible for the inability to use CCR5 on lymphocytes, which express relatively low CCR5 levels. Since isolates that acquire CXCR4 utilization retain the capacity to use CCR5 on macrophages despite their inability to use it on lymphocytes, these results also raise the possibility that a CCR5-mediated macrophage reservoir is required for sustained infection in vivo. PMID:15650174
Nascimento, Heloisa H; Silva, Lucas E P; Souza, Renata T; Silva, Neusa P; Scaletsky, Isabel C A
2014-07-10
Biofilm formation by enteropathogenic Escherichia coli (EPEC) have been recently described in the prototype typical EPEC E2348/69 strain and in an atypical EPEC O55:H7 strain. In this study, we sought to evaluate biofilm formation in a collection of 126 atypical EPEC strains isolated from 92 diarrheic and 34 nondiarrheic children, belonging to different serotypes. The association of biofilm formation and adhesin-related genes were also investigated. Biofilm formation occurred in 37 (29%) strains of different serotypes, when the assays were performed at 26°C and 37°C for 24 h. Among these, four strains (A79, A87, A88, and A111) formed a stronger biofilm than did the others. The frequency of biofilm producers was higher among isolates from patients compared with isolates from controls (34.8% vs 14.7%; P = 0.029). An association was found between biofilm formation and expression of type 1 fimbriae and curli (P < 0.05). Unlike the previously described aEPEC O55:H7, one aEPEC O119:HND strain (A111) formed a strong biofilm and pellicle at the air-liquid interface, but did not express curli. Transposon mutagenesis was used to identify biofilm-deficient mutants. Transposon insertion sequences of six mutants revealed similarity with type 1 fimbriae (fimC, fimD, and fimH), diguanylate cyclase, ATP synthase F1, beta subunit (atpD), and the uncharacterized YjiC protein. All these mutants were deficient in biofilm formation ability. This study showed that the ability to adhere to abiotic surfaces and form biofilm is present in an array of aEPEC strains. Moreover, it seems that the ability to form biofilms is associated with the presence of type 1 fimbriae and diguanylate cyclase. Characterization of additional biofilm formation mutants may reveal other mechanisms involved in biofilm formation and bring new insights into aEPEC adhesion and pathogenesis.
Nunes, Marcio R T; Vianez, João Lídio; Nunes, Keley N B; da Silva, Sandro Patroca; Lima, Clayton P S; Guzman, Hilda; Martins, Lívia C; Carvalho, Valéria L; Tesh, Robert B; Vasconcelos, Pedro F C
2015-12-15
Yellow Fever virus (YFV) is an important human pathogen in tropical areas of Africa and South America. Although an efficient vaccine is available and has been used since the early 1940s, sylvatic YFV transmission still occurs in forested areas where anthropogenic actions are present, such as mineral extraction, rearing livestock and agriculture, and ecological tourism. In this context, two distinct techniques based on the RT-PCR derived method have been previously developed, however both methods are expensive due to the use of thermo cyclers and labeled probes. We developed isothermal genome amplification, which is a rapid, sensitive, specific and low cost molecular approach for YFV genome detection. This assay used a set of degenerate primers designed for the NS1 gene and was able to amplify, within 30 min in isothermal conditions, the YFV 17D vaccine strain derived from an African wild prototype strain (Asibi), as well as field strains from Brazil, other endemic countries from South and Central America, and the Caribbean. The generic RT-LAMP assay could be helpful for YFV surveillance in field and rapid response during outbreaks in endemic areas. Copyright © 2015 Elsevier B.V. All rights reserved.
Data driven modeling of plastic deformation
Versino, Daniele; Tonda, Alberto; Bronkhorst, Curt A.
2017-05-01
In this paper the application of machine learning techniques for the development of constitutive material models is being investigated. A flow stress model, for strain rates ranging from 10 –4 to 10 12 (quasi-static to highly dynamic), and temperatures ranging from room temperature to over 1000 K, is obtained by beginning directly with experimental stress-strain data for Copper. An incrementally objective and fully implicit time integration scheme is employed to integrate the hypo-elastic constitutive model, which is then implemented into a finite element code for evaluation. Accuracy and performance of the flow stress models derived from symbolic regression are assessedmore » by comparison to Taylor anvil impact data. The results obtained with the free-form constitutive material model are compared to well-established strength models such as the Preston-Tonks-Wallace (PTW) model and the Mechanical Threshold Stress (MTS) model. Here, preliminary results show candidate free-form models comparing well with data in regions of stress-strain space with sufficient experimental data, pointing to a potential means for both rapid prototyping in future model development, as well as the use of machine learning in capturing more data as a guide for more advanced model development.« less
A Novel Sensor System for Measuring Wheel Loads of Vehicles on Highways
Zhang, Wenbin; Suo, Chunguang; Wang, Qi
2008-01-01
With the development of the highway transportation and business trade, vehicle Weigh-In-Motion (WIM) technology has become a key technology for measuring traffic loads. In this paper a novel WIM system based on monitoring of pavement strain responses in rigid pavement was investigated. In this WIM system multiple low cost, light weight, small volume and high accuracy embedded concrete strain sensors were used as WIM sensors to measure rigid pavement strain responses. In order to verify the feasibility of the method, a system prototype based on multiple sensors was designed and deployed on a relatively busy freeway. Field calibration and tests were performed with known two-axle truck wheel loads and the measurement errors were calculated based on the static weights measured with a static weighbridge. This enables the weights of other vehicles to be calculated from the calibration constant. Calibration and test results for individual sensors or three-sensor fusions are both provided. Repeatability, sources of error, and weight accuracy are discussed. Successful results showed that the proposed method was feasible and proven to have a high accuracy. Furthermore, a sample mean approach using multiple fused individual sensors could provide better performance compared to individual sensors. PMID:27873952
Chen, Minjie; Lan, Shuiyun; Ou, Rong; Price, Graeme E.; Jiang, Hong; de la Torre, Juan Carlos; Moskophidis, Demetrius
2008-01-01
Arenaviruses include several causative agents of hemorrhagic fever disease in humans. In addition, the prototypic arenavirus lymphocytic choriomeningitis virus (LCMV) is a superb model for the study of virus-host interactions, including the basis of viral persistence and associated diseases. The molecular mechanisms concerning the regulation and specific role of viral proteins in modulating arenavirus-host cell interactions associated either with an acute or persistent infection and associated disease remain little understood. Here we report the genomic and biological characterization of LCMV strains Docile (persistent) and Aggressive (not persistent) recovered from cloned cDNA via reverse genetics. Our results confirmed that the cloned viruses accurately recreated the in vivo phenotypes associated with the corresponding natural Docile and Aggressive viral isolates. In addition, we provide evidence that the ability of the Docile strain to persist is determined by the nature of both S and L RNA segments. Thus, our findings provide the foundation for studies aimed at gaining a detailed understanding of viral determinants of LCMV persistence in its natural host that may aid in the development of vaccines to prevent or treat the diseases caused by arenaviruses in humans. PMID:18474558
Low-frequency meandering piezoelectric vibration energy harvester.
Berdy, David F; Srisungsitthisunti, Pornsak; Jung, Byunghoo; Xu, Xianfan; Rhoads, Jeffrey F; Peroulis, Dimitrios
2012-05-01
The design, fabrication, and characterization of a novel low-frequency meandering piezoelectric vibration energy harvester is presented. The energy harvester is designed for sensor node applications where the node targets a width-to-length aspect ratio close to 1:1 while simultaneously achieving a low resonant frequency. The measured power output and normalized power density are 118 μW and 5.02 μW/mm(3)/g(2), respectively, when excited by an acceleration magnitude of 0.2 g at 49.7 Hz. The energy harvester consists of a laser-machined meandering PZT bimorph. Two methods, strain-matched electrode (SME) and strain-matched polarization (SMP), are utilized to mitigate the voltage cancellation caused by having both positive and negative strains in the piezoelectric layer during operation at the meander's first resonant frequency. We have performed finite element analysis and experimentally demonstrated a prototype harvester with a footprint of 27 x 23 mm and a height of 6.5 mm including the tip mass. The device achieves a low resonant frequency while maintaining a form factor suitable for sensor node applications. The meandering design enables energy harvesters to harvest energy from vibration sources with frequencies less than 100 Hz within a compact footprint.
Data driven modeling of plastic deformation
DOE Office of Scientific and Technical Information (OSTI.GOV)
Versino, Daniele; Tonda, Alberto; Bronkhorst, Curt A.
In this paper the application of machine learning techniques for the development of constitutive material models is being investigated. A flow stress model, for strain rates ranging from 10 –4 to 10 12 (quasi-static to highly dynamic), and temperatures ranging from room temperature to over 1000 K, is obtained by beginning directly with experimental stress-strain data for Copper. An incrementally objective and fully implicit time integration scheme is employed to integrate the hypo-elastic constitutive model, which is then implemented into a finite element code for evaluation. Accuracy and performance of the flow stress models derived from symbolic regression are assessedmore » by comparison to Taylor anvil impact data. The results obtained with the free-form constitutive material model are compared to well-established strength models such as the Preston-Tonks-Wallace (PTW) model and the Mechanical Threshold Stress (MTS) model. Here, preliminary results show candidate free-form models comparing well with data in regions of stress-strain space with sufficient experimental data, pointing to a potential means for both rapid prototyping in future model development, as well as the use of machine learning in capturing more data as a guide for more advanced model development.« less
Pythium invasion of plant-based life support systems: biological control and sources
NASA Technical Reports Server (NTRS)
Jenkins, D. G.; Cook, K. L.; Garland, J. L.; Board, K. F.; Sager, J. C. (Principal Investigator)
2000-01-01
Invasion of plant-based life support systems by plant pathogens could cause plant disease and disruption of life support capability. Root rot caused by the fungus, Pythium, was observed during tests of prototype plant growth systems containing wheat at the Kennedy Space Center (KSC). We conducted experiments to determine if the presence of complex microbial communities in the plant root zone (rhizosphere) resisted invasion by the Pythium species isolated from the wheat root. Rhizosphere inocula of different complexity (as assayed by community-level physiological profile: CLPP) were developed using a dilution/extinction approach, followed by growth in hydroponic rhizosphere. Pythium growth on wheat roots and concomitant decreases in plant growth were inversely related to the complexity of the inocula during 20-day experiments in static hydroponic systems. Pythium was found on the seeds of several different wheat cultivars used in controlled environmental studies, but it is unclear if the seed-borne fungal strain(s) were identical to the pathogenic strain recovered from the KSC studies. Attempts to control pathogens and their effects in hydroponic life support systems should include early inoculation with complex microbial communities, which is consistent with ecological theory.
Assessment of the chloracnegenic response induced by 3,4,3',4'-tetrachloroazoxybenzene in mice
DOE Office of Scientific and Technical Information (OSTI.GOV)
Horton, V.L.; Yeary, R.A.
Chloracne is a follicular hyperkeratosis produced by exposure to certain halogenated aromatic compounds. The rabbit ear bioassay has been used successfully for testing the acnegenic activity of compounds, but the lack of reference data in this species limits its usefulness in correlating chloracne to other toxic effects such as skin carcinogenesis. In this study, a prototype chloracnegen, 3,4,3',4'-tetrachloroazoxybenzene (TCAOB), was used. Five strains of mice (hairless, rhino, rhino+, DBA/2J, and C57BL/6) were treated topically with 100 ..mu..l of 0.001, 0.01, or 0.1% TCAOB daily for 3-9 wk. Skin and liver histology were performed and hepatic enzyme activities measured. At themore » 0.001% TCAOB level, induction of hepatic aniline hydroxylase and cytochrome P-450 occurred in the C57BL/6 mice and induction of cytochrome c reductase occurred in the rhino mice. Dose-dependent gross and histologic skin lesions, characteristic of follicular hyperkeratosis, were observed in the rhino and hairless strains at the 0.01% and 0.1% levels. These two strains also had induction of hepatic cytochrome c reductase, cytochrome P-450, and aniline hydroxylase at TCAOB concentrations of 0.01 or 0.1%. These results suggest that the rhino and hairless strains of mice may be useful in the study of chloracne.« less
Balagué, Claudia; Véscovi, Eleonora García
2001-01-01
Clofibric and ethacrynic acids are prototypical pharmacological agents administered in the treatment of hypertrigliceridemia and as a diuretic agent, respectively. They share with 2,4-dichlorophenoxyacetic acid (the widely used herbicide known as 2,4-D) a chlorinated phenoxy structural moiety. These aryloxoalcanoic agents (AOAs) are mainly excreted by the renal route as unaltered or conjugated active compounds. The relatedness of these agents at the structural level and their potential effect on therapeutically treated or occupationally exposed individuals who are simultaneously undergoing a bacterial urinary tract infection led us to analyze their action on uropathogenic, clinically isolated Escherichia coli strains. We found that exposure to these compounds increases the bacterial resistance to an ample variety of antibiotics in clinical isolates of both uropathogenic and nonpathogenic E. coli strains. We demonstrate that the AOAs induce an alteration of the bacterial outer membrane permeability properties by the repression of the major porin OmpF in a micF-dependent process. Furthermore, we establish that the antibiotic resistance phenotype is primarily due to the induction of the MarRAB regulatory system by the AOAs, while other regulatory pathways that also converge into micF modulation (OmpR/EnvZ, SoxRS, and Lrp) remained unaltered. The fact that AOAs give rise to uropathogenic strains with a diminished susceptibility to antimicrobials highlights the impact of frequently underestimated or ignored collateral effects of chemical agents. PMID:11353631
Hu, Lan; Zhang, Yong; Hong, Mei; Zhu, Shuangli; Yan, Dongmei; Wang, Dongyan; Li, Xiaolei; Zhu, Zhen; Tsewang; Xu, Wenbo
2014-01-01
Enterovirus B81 (EV-B81) is a newly identified serotype within the species enterovirus B (EV-B). To date, only eight nucleotide sequences of EV-B81 have been published and only one full-length genome sequence (the prototype strain) has been made available in the GenBank database. Here, we report the full-length genome sequences of two EV-B81 strains isolated in the Tibet Autonomous Region of China during acute flaccid paralysis surveillance activities, and we also conducted an antibody seroprevalence study in two prefectures of Tibet. The sequence comparison and phylogenetic dendrogram analysis revealed high variability among the global EV-B81 strains and frequent intertypic recombination in the non-structural protein region of EV-B serotypes, suggesting high genetic diversity of EV-B81. However, low positive rates and low titers of neutralizing antibodies against EV-B81 were detected. Nearly 68% of children under the age of five had no neutralizing antibodies against EV-B81. Hence, the extent of transmission and the exposure of the population to this EV type are very limited. Although little is known about the biological and pathogenic properties of EV-B81 because of few research in this field owing to the limited number of isolates, our study provides basic information for further studies of EV-B81. PMID:25112835
Thin-film dielectric elastomer sensors to measure the contraction force of smooth muscle cells
NASA Astrophysics Data System (ADS)
Araromi, O.; Poulin, A.; Rosset, S.; Favre, M.; Giazzon, M.; Martin-Olmos, C.; Liley, M.; Shea, H.
2015-04-01
The development of thin-film dielectric elastomer strain sensors for the characterization of smooth muscle cell (SMC) contraction is presented here. Smooth muscle disorders are an integral part of diseases such as asthma and emphysema. Analytical tools enabling the characterization of SMC function i.e. contractile force and strain, in a low-cost and highly parallelized manner are necessary for toxicology screening and for the development of new and more effective drugs. The main challenge with the design of such tools is the accurate measurement of the extremely low contractile cell forces expected as a result of SMC monolayer contraction (as low as ~ 100 μN). Our approach utilizes ultrathin (~5 μm) and soft elastomer membranes patterned with elastomer-carbon composite electrodes, onto which the SMCs are cultured. The cell contraction induces an in-plane strain in the elastomer membrane, predicted to be in the order 1 %, which can be measured via the change in the membrane capacitance. The cell force can subsequently be deduced knowing the mechanical properties of the elastomer membrane. We discuss the materials and fabrication methods selected for our system and present preliminary results indicating their biocompatibility. We fabricate functional capacitive senor prototypes with good signal stability over the several hours (~ 0.5% variation). We succeed in measuring in-plane strains of 1 % with our fabricated devices with good repeatability and signal to noise ratio.
Cai, Dongbo; Wang, Hao; He, Penghui; Zhu, Chengjun; Wang, Qin; Wei, Xuetuan; Nomura, Christopher T; Chen, Shouwen
2017-04-24
Signal peptide peptidases play an important role in the removal of remnant signal peptides in the cell membrane, a critical step for extracellular protein production. Although these proteins are likely a central component for extracellular protein production, there has been a lack of research on whether protein secretion could be enhanced via overexpression of signal peptide peptidases. In this study, both nattokinase and α-amylase were employed as prototypical secreted target proteins to evaluate the function of putative signal peptide peptidases (SppA and TepA) in Bacillus licheniformis. We observed dramatic decreases in the concentrations of both target proteins (45 and 49%, respectively) in a sppA deficient strain, while the extracellular protein yields of nattokinase and α-amylase were increased by 30 and 67% respectively in a strain overexpressing SppA. In addition, biomass, specific enzyme activities and the relative gene transcriptional levels were also enhanced due to the overexpression of sppA, while altering the expression levels of tepA had no effect on the concentrations of the secreted target proteins. Our results confirm that SppA, but not TepA, plays an important functional role for protein secretion in B. licheniformis. Our results indicate that the sppA overexpression strain, B. licheniformis BL10GS, could be used as a promising host strain for the industrial production of heterologous secreted proteins.
West Nile Virus Temperature Sensitivity and Avian Virulence Are Modulated by NS1-2B Polymorphisms.
Dietrich, Elizabeth A; Langevin, Stanley A; Huang, Claire Y-H; Maharaj, Payal D; Delorey, Mark J; Bowen, Richard A; Kinney, Richard M; Brault, Aaron C
2016-08-01
West Nile virus (WNV) replicates in a wide variety of avian species, which serve as reservoir and amplification hosts. WNV strains isolated in North America, such as the prototype strain NY99, elicit a highly pathogenic response in certain avian species, notably American crows (AMCRs; Corvus brachyrhynchos). In contrast, a closely related strain, KN3829, isolated in Kenya, exhibits a low viremic response with limited mortality in AMCRs. Previous work has associated the difference in pathogenicity primarily with a single amino acid mutation at position 249 in the helicase domain of the NS3 protein. The NY99 strain encodes a proline residue at this position, while KN3829 encodes a threonine. Introduction of an NS3-T249P mutation in the KN3829 genetic background significantly increased virulence and mortality; however, peak viremia and mortality were lower than those of NY99. In order to elucidate the viral genetic basis for phenotype variations exclusive of the NS3-249 polymorphism, chimeric NY99/KN3829 viruses were created. We show herein that differences in the NS1-2B region contribute to avian pathogenicity in a manner that is independent of and additive with the NS3-249 mutation. Additionally, NS1-2B residues were found to alter temperature sensitivity when grown in avian cells.
Zhang, Yong; Sun, Qiang; Cui, Hui; Yan, Dongmei; Fan, Qin; Song, Yang; Zhu, Shuangli; Li, Xiaolei; Huang, Guohong; Ji, Tianjiao; Hu, Lan; Wang, Dongyan; Yang, Qian; Xu, Wenbo
2016-01-01
Poliomyelitis associated with circulating vaccine-derived polioviruses (cVDPVs) is a serious public health issue in the post-eradication era, and the occurrence of recombinant cVDPVs emphasizes the need to elucidate enterovirus C (EV-C) epidemiology. Stool samples were collected from 826 healthy children in Southern Xinjiang in 2011 to investigate EV-C circulation and epidemiology. Thirty-six EV-Cs were isolated and assigned to eight EV-C serotypes by molecular serotyping, suggesting the circulation of diverse EV-Cs in Xinjiang. Phylogenetic analysis showed that the Xinjiang EV-C strains had larger variation compared to the prototype and other modern strains. Additionally, the results showed unique characteristics of Xinjiang EV-Cs, such as the cytopathicity of CV-A1 strains to RD cells; the high divergence in CV-A11, CV-A13, CV-A17, and CV-A20 strains; the divergence of Xinjiang CV-A24 from AHC-related CV-A24 variant stains distributed worldwide; and the circulation of two novel EV-C serotypes (EV-C96 and EV-C99). Evaluations of this dense and diverse EV-C ecosystem will help elucidate the processes shaping enteroviral biodiversity. This study will improve our understanding of the evolution of enteroviruses and the recombination potential between polioviruses and other EV-Cs. PMID:27642136
Flavor preferences conditioned by oral monosodium glutamate in mice.
Ackroff, Karen; Sclafani, Anthony
2013-11-01
The prototypic umami substance monosodium glutamate (MSG) reinforces preferences for its own flavor, as well as preferences for flavors associated with it, by conditioning processes. Mice of 3 inbred strains (C57BL/6J (B6), 129P3/J, and FVB/NJ) and 2 taste-knockout (KO) groups derived from the B6 lineage were initially indifferent to 200mM MSG, but this evaluation was altered by forced exposure to MSG. B6 and KO mice acquired an MSG preference, 129 mice remained indifferent, and FVB mice avoided MSG. The shifts in preference imply a postoral basis for MSG effects, suggesting that it could produce preferences for associated flavors. New mice were trained with a conditioned stimulus (CS+) flavor mixed in 200mM MSG and a CS- flavor in water. Similar to the parent B6 strain, mice missing the T1r3 element of an umami receptor or the downstream signaling component Trpm5 learned to prefer the CS+ flavor and subsequently showed similar preferences for MSG in an ascending concentration series. Consistent with their responses to forced exposure, the 129 strain did not acquire a significant CS+ preference, and the FVB strain avoided the CS+ flavor. The 129 and FVB strains showed little attraction in the ascending MSG concentration series. Together, these data indicate that the postoral effects of MSG can modulate responses to its own and MSG-paired flavors. The basis for strain differences in the responses to MSG is not certain, but the taste-signaling elements T1r3 and Trpm5, which are also present in the gut, are not required for mediation of this flavor learning.
López-Soriano, Pablo; Noguera, Patricia; Gorris, María Teresa; Puchades, Rosa; Maquieira, Ángel; Marco-Noales, Ester; López, María M.
2017-01-01
Xanthomonas arboricola pv. pruni is a quarantine pathogen and the causal agent of the bacterial spot disease of stone fruits and almond, a major threat to Prunus species. Rapid and specific detection methods are essential to improve disease management, and therefore a prototype of a lateral flow immunoassay (LFIA) was designed for the detection of X. arboricola pv. pruni in symptomatic field samples. It was developed by producing polyclonal antibodies which were then combined with carbon nanoparticles and assembled on nitrocellulose strips. The specificity of the LFIA was tested against 87 X. arboricola pv. pruni strains from different countries worldwide, 47 strains of other Xanthomonas species and 14 strains representing other bacterial genera. All X. arboricola pv. pruni strains were detected and cross-reactions were observed only with four strains of X. arboricola pv. corylina, a hazelnut pathogen that does not share habitat with X. arboricola pv. pruni. The sensitivity of the LFIA was assessed with suspensions from pure cultures of three X. arboricola pv. pruni strains and with spiked leaf extracts prepared from four hosts inoculated with this pathogen (almond, apricot, Japanese plum and peach). The limit of detection observed with both pure cultures and spiked samples was 104 CFU ml-1. To demonstrate the accuracy of the test, 205 samples naturally infected with X. arboricola pv. pruni and 113 samples collected from healthy plants of several different Prunus species were analyzed with the LFIA. Results were compared with those obtained by plate isolation and real time PCR and a high correlation was found among techniques. Therefore, we propose this LFIA as a screening tool that allows a rapid and reliable diagnosis of X. arboricola pv. pruni in symptomatic plants. PMID:28448536
Carrillo-Casas, Erika Margarita; Durán, Laura; Zhang, Yushan; Hernández-Castro, Rigoberto; Puente, José L.; Daaka, Yehia; Girón, Jorge A.
2014-01-01
Uropathogenic Escherichia coli (UPEC) strains cause urinary tract infections and employ type 1 and P pili in colonization of the bladder and kidney, respectively. Most intestinal and extra-intestinal E. coli strains produce a pilus called E. coli common pilus (ECP) involved in cell adherence and biofilm formation. However, the contribution of ECP to the interaction of UPEC with uroepithelial cells remains to be elucidated. Here, we report that prototypic UPEC strains CFT073 and F11 mutated in the major pilin structural gene ecpA are significantly deficient in adherence to cultured HeLa (cervix) and HTB-4 (bladder) epithelial cells in vitro as compared to their parental strains. Complementation of the ecpA mutant restored adherence to wild-type levels. UPEC strains produce ECP upon growth in Luria-Bertani broth or DMEM tissue culture medium preferentially at 26°C, during incubation with cultured epithelial cells in vitro at 37°C, and upon colonization of mouse bladder urothelium ex vivo. ECP was demonstrated on and inside exfoliated bladder epithelial cells present in the urine of urinary tract infection patients. The ability of the CFT073 ecpA mutant to invade the mouse tissue was significantly reduced. The presence of ECP correlated with the architecture of the biofilms produced by UPEC strains on inert surfaces. These data suggest that ECP can potentially be produced in the bladder environment and contribute to the adhesive and invasive capabilities of UPEC during its interaction with the host bladder. We propose that along with other known adhesins, ECP plays a synergistic role in the multi-step infection of the urinary tract. PMID:25036370
Saldaña, Zeus; De la Cruz, Miguel A; Carrillo-Casas, Erika Margarita; Durán, Laura; Zhang, Yushan; Hernández-Castro, Rigoberto; Puente, José L; Daaka, Yehia; Girón, Jorge A
2014-01-01
Uropathogenic Escherichia coli (UPEC) strains cause urinary tract infections and employ type 1 and P pili in colonization of the bladder and kidney, respectively. Most intestinal and extra-intestinal E. coli strains produce a pilus called E. coli common pilus (ECP) involved in cell adherence and biofilm formation. However, the contribution of ECP to the interaction of UPEC with uroepithelial cells remains to be elucidated. Here, we report that prototypic UPEC strains CFT073 and F11 mutated in the major pilin structural gene ecpA are significantly deficient in adherence to cultured HeLa (cervix) and HTB-4 (bladder) epithelial cells in vitro as compared to their parental strains. Complementation of the ecpA mutant restored adherence to wild-type levels. UPEC strains produce ECP upon growth in Luria-Bertani broth or DMEM tissue culture medium preferentially at 26°C, during incubation with cultured epithelial cells in vitro at 37°C, and upon colonization of mouse bladder urothelium ex vivo. ECP was demonstrated on and inside exfoliated bladder epithelial cells present in the urine of urinary tract infection patients. The ability of the CFT073 ecpA mutant to invade the mouse tissue was significantly reduced. The presence of ECP correlated with the architecture of the biofilms produced by UPEC strains on inert surfaces. These data suggest that ECP can potentially be produced in the bladder environment and contribute to the adhesive and invasive capabilities of UPEC during its interaction with the host bladder. We propose that along with other known adhesins, ECP plays a synergistic role in the multi-step infection of the urinary tract.
Al-Qahtani, Ahmed Ali; Mubin, Muhammad; Dela Cruz, Damian M; Althawadi, Sahar Isa; Ul Rehman, Muhammad Shah Nawaz; Bohol, Marie Fe F; Al-Ahdal, Mohammed N
2017-01-30
In early 2009, a novel influenza A (H1N1) virus appeared in Mexico and rapidly disseminated worldwide. Little is known about the phylogeny and evolutionary dynamics of the H1N1 strain found in Saudi Arabia. Nucleotide sequencing and bioinformatics analyses were used to study molecular variation between the virus isolates. In this report, 72 hemagglutinin (HA) and 45 neuraminidase (NA) H1N1 virus gene sequences, isolated in 2009 from various regions of Saudi Arabia, were analyzed. Genetic characterization indicated that viruses from two different clades, 6 and 7, were circulating in the region, with clade 7, the most widely circulating H1N1 clade globally in 2009, being predominant. Sequence analysis of the HA and NA genes revealed a high degree of sequence identity with the corresponding genes from viruses circulating in the South East Asia region and with the A/California/7/2009 strain. New mutations in the HA gene of pandemic H1N1 (pH1N1) viruses, that could alter viral fitness, were identified. Relaxed-clock and Bayesian Skyline Plot analyses, based on the isolates used in this study and closely related globally representative strains, indicated marginally higher substitution rates than the type strain (5.14×10-3 and 4.18×10-3 substitutions/nucleotide/year in the HA and NA genes, respectively). The Saudi isolates were antigenically homogeneous and closely related to the prototype vaccine strain A/California/7/2009. The antigenic site of the HA gene had acquired novel mutations in some isolates, making continued monitoring of these viruses vital for the identification of potentially highly virulent and drug resistant variants.
Electronic doping of transition metal oxide perovskites
DOE Office of Scientific and Technical Information (OSTI.GOV)
Cammarata, Antonio, E-mail: cammaant@fel.cvut.cz; Rondinelli, James M.
2016-05-23
CaFeO{sub 3} is a prototypical negative charge transfer oxide that undergoes electronic metal-insulator transition concomitant with a dilation and contraction of nearly rigid octahedra. Altering the charge neutrality of the bulk system destroys the electronic transition, while the structure is significantly modified at high charge content. Using density functional theory simulations, we predict an alternative avenue to modulate the structure and the electronic transition in CaFeO{sub 3}. Charge distribution can be modulated using strain-rotation coupling and thin film engineering strategies, proposing themselves as a promising avenue for fine tuning electronic features in transition metal-oxide perovskites.
Status of the Neutron Imaging and Diffraction Instrument IMAT
NASA Astrophysics Data System (ADS)
Kockelmann, Winfried; Burca, Genoveva; Kelleher, Joe F.; Kabra, Saurabh; Zhang, Shu-Yan; Rhodes, Nigel J.; Schooneveld, Erik M.; Sykora, Jeff; Pooley, Daniel E.; Nightingale, Jim B.; Aliotta, Francesco; Ponterio, Rosa C.; Salvato, Gabriele; Tresoldi, Dario; Vasi, Cirino; McPhate, Jason B.; Tremsin, Anton S.
A cold neutron imaging and diffraction instrument, IMAT, is currently being constructed at the ISIS second target station. IMAT will capitalize on time-of-flight transmission and diffraction techniques available at a pulsed neutron source. Analytical techniques will include neutron radiography, neutron tomography, energy-selective neutron imaging, and spatially resolved diffraction scans for residual strain and texture determination. Commissioning of the instrument will start in 2015, with time-resolving imaging detectors and two diffraction detector prototype modules. IMAT will be operated as a user facility for material science applications and will be open for developments of time-of-flight imaging methods.
Active chainmail fabrics for soft robotic applications
NASA Astrophysics Data System (ADS)
Ransley, Mark; Smitham, Peter; Miodownik, Mark
2017-08-01
This paper introduces a novel type of smart textile with electronically responsive flexibility. The chainmail inspired fabric is modelled parametrically and simulated via a rigid body physics framework with an embedded model of temperature controlled actuation. Our model assumes that individual fabric linkages are rigid and deform only through their own actuation, thereby decoupling flexibility from stiffness. A physical prototype of the active fabric is constructed and it is shown that flexibility can be significantly controlled through actuator strains of ≤10%. Applications of these materials to soft-robotics such as dynamically reconfigurable orthoses and splints are discussed.
On the manufacturing of a gas turbine engine part through metal spinning process
NASA Astrophysics Data System (ADS)
Hassanin, A. El; Astarita, A.; Scherillo, F.; Velotti, C.; Squillace, A.; Liguori, A.
2018-05-01
Metal spinning processes represents an interesting alternative to traditional sheet metal forming processes in several industrial contexts, such as automotive and aerospace. In this work, the production of a combustion chamber liner top prototype using AISI 304L stainless steel is proposed, in order to evaluate the process feasibility for the required part geometry. The prototypes production was carried out using a two-stage semiautomatic spinning process. The effects in terms of wall thickness reduction were investigated. Using optical microscopy and Scanning Electron Microscopy (SEM) techniques, the microstructural behavior of the metal subjected to the forming process was investigated, while for an evaluation of the influence on the mechanical properties Vickers micro-indentation tests were performed. The main result of the process, as observed from all the investigation techniques adopted, is the formation of strain induced martensite due to the severe plastic deformation and cold reduction of the material, ranging in this case from 30% to 50%. In some areas of the part section, some rips indicating an excessive tensile stress were also detected.
Design and Flight Evaluation of a New Force-Based Flow Angle Probe
NASA Technical Reports Server (NTRS)
Corda, Stephen; Vachon, Michael Jacob
2006-01-01
A novel force-based flow angle probe was designed and flight tested on the NASA F-15B Research Testbed aircraft at NASA Dryden Flight Research Center. The prototype flow angle probe is a small, aerodynamic fin that has no moving parts. Forces on the prototype flow angle probe are measured with strain gages and correlated with the local flow angle. The flow angle probe may provide greater simplicity, greater robustness, and better access to flow measurements in confined areas relative to conventional moving vane-type flow angle probes. Flight test data were obtained at subsonic, transonic, and supersonic Mach numbers to a maximum of Mach 1.70. Flight conditions included takeoff, landing, straight and level flight, flight at higher aircraft angles of attack, and flight at elevated g-loadings. Flight test maneuvers included angle-of-attack and angle-of-sideslip sweeps. The flow angle probe-derived flow angles are compared with those obtained with a conventional moving vane probe. The flight tests validated the feasibility of a force-based flow angle measurement system.
Assembly Tests of the First Nb 3 Sn Low-Beta Quadrupole Short Model for the Hi-Lumi LHC
Pan, H.; Felice, H.; Cheng, D. W.; ...
2016-01-18
In preparation for the high-luminosity upgrade of the Large Hadron Collider (LHC), the LHC Accelerator Research Program (LARP) in collaboration with CERN is pursuing the development of MQXF: a 150-mm-aperture high-field Nb3Sn quadrupole magnet. Moreover, the development phase starts with the fabrication and test of several short models (1.2-m magnetic length) and will continue with the development of several long prototypes. All of them are mechanically supported using a shell-based support structure, which has been extensively demonstrated on several R&D models within LARP. The first short model MQXFS-AT has been assembled at LBNL with coils fabricated by LARP and CERN.more » In our paper, we summarize the assembly process and show how it relies strongly on experience acquired during the LARP 120-mm-aperture HQ magnet series. We also present comparison between strain gauges data and finite-element model analysis. Finally, we present the implication of the MQXFS-AT experience on the design of the long prototype support structure.« less
Decontamination Efficiency of a DBD Lamp Containing an UV-C Emitting Phosphor.
Caillier, Bruno; Caiut, José Maurício Almeida; Muja, Cristina; Demoucron, Julien; Mauricot, Robert; Dexpert-Ghys, Jeanette; Guillot, Philippe
2015-01-01
Among different physical and chemical agents, the UV radiation appears to be an important route for inactivation of resistant microorganisms. The present study introduces a new mercury-free Dielectric Barrier Discharge (DBD) flat lamp, where the biocide action comes from the UV emission produced by rare-earth phosphor obtained by spray pyrolysis, following plasma excitation. In this study, the emission intensity of the prototype lamp is tuned by controlling gas pressure and electrical power, 500 mbar and 15 W, corresponding to optimal conditions. In order to characterize the prototype lamp, the energetic output, temperature increase following lamp ignition and ozone production of the source were measured. The bactericidal experiments carried out showed excellent results for several gram-positive and gram-negative bacterial strains, thus demonstrating the high decontamination efficiency of the DBD flat lamp. Finally, the study of the external morphology of the microorganisms after the exposure to the UV emission suggested that other mechanisms than the bacterial DNA damage could be involved in the inactivation process. © 2015 The American Society of Photobiology.
O'Connor, Paula M.; O'Shea, Eileen F.; Guinane, Caitriona M.; O'Sullivan, Orla; Cotter, Paul D.; Hill, Colin
2015-01-01
Accumulating evidence suggests that bacteriocin production represents a probiotic trait for intestinal strains to promote dominance, fight infection, and even signal the immune system. In this respect, in a previous study, we isolated from the porcine intestine a strain of Streptococcus hyointestinalis DPC6484 that displays antimicrobial activity against a wide range of Gram-positive bacteria and produces a bacteriocin with a mass of 3,453 Da. Interestingly, the strain was also found to be immune to a nisin-producing strain. Genome sequencing revealed the genetic determinants responsible for a novel version of nisin, designated nisin H, consisting of the nshABTCPRKGEF genes, with transposases encoded between nshP and nshR and between nshK and nshG. A similar gene cluster is also found in S. hyointestinalis LMG14581. Notably, the cluster lacks an equivalent of the nisin immunity gene, nisI. Nisin H is proposed to have the same structure as the prototypical nisin A but differs at 5 amino acid positions—Ile1Phe (i.e., at position 1, nisin A has Ile while nisin H has Phe), Leu6Met, Gly18Dhb (threonine dehydrated to dehydrobutyrine), Met21Tyr, and His31Lys—-and appears to represent an intermediate between the lactococcal nisin A and the streptococcal nisin U variant of nisin. Purified nisin H inhibits a wide range of Gram-positive bacteria, including staphylococci, streptococci, Listeria spp., bacilli, and enterococci. It represents the first example of a natural nisin variant produced by an intestinal isolate of streptococcal origin. PMID:25841003
Goswami, Kakolie; Chen, Chun; Xiaoli, Lingzi; Eaton, Kathryn A.
2015-01-01
Escherichia coli O157:H7 is a notorious foodborne pathogen due to its low infectious dose and the disease symptoms it causes, which include bloody diarrhea and severe abdominal cramps. In some cases, the disease progresses to hemorrhagic colitis (HC) and hemolytic uremic syndrome (HUS), due to the expression of one or more Shiga toxins (Stx). Isoforms of Stx, including Stx2a, are encoded within temperate prophages. In the presence of certain antibiotics, phage induction occurs, which also increases the expression of toxin genes. Additionally, increased Stx2 accumulation has been reported when O157:H7 was cocultured with phage-susceptible nonpathogenic E. coli. This study characterized an E. coli O157:H7 strain, designated PA2, that belongs to the hypervirulent clade 8 cluster. Stx2a levels after ciprofloxacin induction were lower for PA2 than for the prototypical outbreak strains Sakai and EDL933. However, during coculture with the nonpathogenic strain E. coli C600, PA2 produced Stx2a levels that were 2- to 12-fold higher than those observed during coculture with EDL933 and Sakai, respectively. Germfree mice cocolonized by PA2 and C600 showed greater kidney damage, increased Stx2a accumulation in feces, and more visible signs of disease than mice given PA2 or C600 alone. These data suggest one mechanism by which microorganisms associated with the colonic microbiota could enhance the virulence of E. coli O157:H7, particularly a subset of clade 8 strains. PMID:26259815
Enterovirus D68 receptor requirements unveiled by haploid genetics
Baggen, Jim; Thibaut, Hendrik Jan; Staring, Jacqueline; Jae, Lucas T.; Liu, Yue; Guo, Hongbo; Slager, Jasper J.; de Bruin, Jost W.; van Vliet, Arno L. W.; Blomen, Vincent A.; Overduin, Pieter; Sheng, Ju; de Haan, Cornelis A. M.; de Vries, Erik; Meijer, Adam; Rossmann, Michael G.; Brummelkamp, Thijn R.; van Kuppeveld, Frank J. M.
2016-01-01
Enterovirus D68 (EV-D68) is an emerging pathogen that can cause severe respiratory disease and is associated with cases of paralysis, especially among children. Heretofore, information on host factor requirements for EV-D68 infection is scarce. Haploid genetic screening is a powerful tool to reveal factors involved in the entry of pathogens. We performed a genome-wide haploid screen with the EV-D68 prototype Fermon strain to obtain a comprehensive overview of cellular factors supporting EV-D68 infection. We identified and confirmed several genes involved in sialic acid (Sia) biosynthesis, transport, and conjugation to be essential for infection. Moreover, by using knockout cell lines and gene reconstitution, we showed that both α2,6- and α2,3-linked Sia can be used as functional cellular EV-D68 receptors. Importantly, the screen did not reveal a specific protein receptor, suggesting that EV-D68 can use multiple redundant sialylated receptors. Upon testing recent clinical strains, we identified strains that showed a similar Sia dependency, whereas others could infect cells lacking surface Sia, indicating they can use an alternative, nonsialylated receptor. Nevertheless, these Sia-independent strains were still able to bind Sia on human erythrocytes, raising the possibility that these viruses can use multiple receptors. Sequence comparison of Sia-dependent and Sia-independent EV-D68 strains showed that many changes occurred near the canyon that might allow alternative receptor binding. Collectively, our findings provide insights into the identity of the EV-D68 receptor and suggest the possible existence of Sia-independent viruses, which are essential for understanding tropism and disease. PMID:26787879
DOE Office of Scientific and Technical Information (OSTI.GOV)
Osmani, Bekim, E-mail: bekim.osmani@unibas.ch, E-mail: tino.toepper@unibas.ch; Töpper, Tino, E-mail: bekim.osmani@unibas.ch, E-mail: tino.toepper@unibas.ch; Weiss, Florian M., E-mail: vanessa.leung@unibas.ch, E-mail: bert.mueller@unibas.ch
2015-02-17
Treatments of severe incontinence are currently based on purely mechanical systems that generally result in revision after three to five years. Our goal is to develop a prototype acting in a natural-analogue manner as artificial muscle, which is based on electro-active polymers. Dielectric actuators have outstanding performances including millisecond response times, mechanical strains of more than 10 % and power to mass densities similar to natural muscles. They basically consist of polymer films sandwiched between two compliant electrodes. The incompressible but elastic polymer film transduces the electrical energy into mechanical work according to the Maxwell pressure. Available polymer films aremore » micrometers thick and voltages as large as kV are necessary to obtain 10 % strain. For medical implants, polymer films should be nanometer thin to realize actuation below 48 V. The metallic electrodes have to be stretchable to follow the strain of 10 % and remain conductive. Recent results on the stress/strain behavior of anisotropic EAP-cantilevers have shown dependencies on metal electrode preparation. We have investigated tunable anisotropic micro- and nanostructures for metallic electrodes. They show a preferred actuation direction with improved stress-strain behavior. The bending of the cantilever has been characterized by the laser beam deflection method. The impact of the electrode on the effective Young's Modulus is measured using an Ultra Nanoindentation Tester with an integrated reference system for soft polymer surfaces. Once ten thousand layers of nanometer-thin EAP actuators are available, devices beyond the envisioned application will flood the market.« less
Waleron, K; Waleron, M; Osipiuk, J; Podhajska, A J; Lojkowska, E
2006-02-01
Polish isolates of pectinolytic bacteria from the species Pectobacterium carotovorum were screened for the presence of a DNA restriction-modification (R-M) system. Eighty-nine strains of P. carotovorum were isolated from infected potato plants. Sixty-six strains belonged to P. carotovorum ssp. atrosepticum and 23 to P. carotovorum ssp. carotovorum. The presence of restriction enzyme Pca17AI, which is an isoschizomer of EcoRII endonuclease, was observed in all isolates of P. c. atrosepticum but not in P. c. carotovorum. The biochemical properties, PCR amplification, and sequences of the Pca17AI restriction endonuclease and methyltransferase genes were compared with the prototype EcoRII R-M system genes. Only when DNA isolated from cells of P. c. atrosepticum was used as a template, amplification of a 680 bp homologous to the gene coding EcoRII endonuclease. Endonuclease Pca17AI, having a relatively low temperature optimum, was identified. PCR amplification revealed that the nucleotide sequence of genes for EcoRII and Pca17AI R-M are different. Dcm methylation was observed in all strains of Pectobacterium and other Erwinia species tested. The sequence of a DNA fragment coding Dcm methylase in P. carotovorum was different from that of Escherichia coli. Pca17AI is the first psychrophilic isoschizomer of EcoRII endonuclease. The presence of specific Dcm methylation in chromosomal DNA isolated from P. carotovorum is described for the first time. A 680 bp PCR product, unique for P. c. atrosepticum strains, could serve as a molecular marker for detection of these bacteria in environmental samples.
Wang, Yanqun; Li, Yamin; Lu, Roujian; Zhao, Yanjie; Xie, Zhengde; Shen, Jun; Tan, Wenjie
2016-03-10
Human adenoviruses (HAdVs) are prevalent in hospitalized children with severe acute respiratory infection (SARI). Here, we report a unique recombinant HAdV strain (CBJ113) isolated from a HAdV-positive child with SARI. The whole-genome sequence was determined using Sanger sequencing and high-throughput sequencing. A phylogenetic analysis of the complete genome indicated that the CBJ113 strain shares a common origin with HAdV-C2, HAdV-C6, HAdV-C1, HAdV-C5, and HAdV-C57 and formed a novel subclade on the same branch as other HAdV-C subtypes. BootScan and single nucleotide polymorphism analyses showed that the CBJ113 genome has an intra-subtype recombinant structure and comprises gene regions mainly originating from two circulating viral strains: HAdV-1 and HAdV-2. The parental penton base, pVI, and DBP genes of the recombinant strain clustered with the HAdV-1 prototype strain, and the E1B, hexon, fiber, and 100 K genes of the recombinant clustered within the HAdV-2 subtype, meanwhile the E4orf1 and DNA polymerase genes of the recombinant shared the greatest similarity with those of HAdV-5 and HAdV-6, respectively. All of these findings provide insight into our understanding of the dynamics of the complexity of the HAdV-C epidemic. More extensive studies should address the pathogenicity and clinical characteristics of the novel recombinant.
Wang, Yanqun; Li, Yamin; Lu, Roujian; Zhao, Yanjie; Xie, Zhengde; Shen, Jun; Tan, Wenjie
2016-01-01
Human adenoviruses (HAdVs) are prevalent in hospitalized children with severe acute respiratory infection (SARI). Here, we report a unique recombinant HAdV strain (CBJ113) isolated from a HAdV-positive child with SARI. The whole-genome sequence was determined using Sanger sequencing and high-throughput sequencing. A phylogenetic analysis of the complete genome indicated that the CBJ113 strain shares a common origin with HAdV-C2, HAdV-C6, HAdV-C1, HAdV-C5, and HAdV-C57 and formed a novel subclade on the same branch as other HAdV-C subtypes. BootScan and single nucleotide polymorphism analyses showed that the CBJ113 genome has an intra-subtype recombinant structure and comprises gene regions mainly originating from two circulating viral strains: HAdV-1 and HAdV-2. The parental penton base, pVI, and DBP genes of the recombinant strain clustered with the HAdV-1 prototype strain, and the E1B, hexon, fiber, and 100 K genes of the recombinant clustered within the HAdV-2 subtype, meanwhile the E4orf1 and DNA polymerase genes of the recombinant shared the greatest similarity with those of HAdV-5 and HAdV-6, respectively. All of these findings provide insight into our understanding of the dynamics of the complexity of the HAdV-C epidemic. More extensive studies should address the pathogenicity and clinical characteristics of the novel recombinant. PMID:26960434
Fast Raman single bacteria identification: toward a routine in-vitro diagnostic
NASA Astrophysics Data System (ADS)
Douet, Alice; Josso, Quentin; Marchant, Adrien; Dutertre, Bertrand; Filiputti, Delphine; Novelli-Rousseau, Armelle; Espagnon, Isabelle; Kloster-Landsberg, Meike; Mallard, Frédéric; Perraut, Francois
2016-04-01
Timely microbiological results are essential to allow clinicians to optimize the prescribed treatment, ideally at the initial stage of the therapeutic process. Several approaches have been proposed to solve this issue and to provide the microbiological result in a few hours directly from the sample such as molecular biology. However fast and sensitive those methods are not based on single phenotypic information which presents several drawbacks and limitations. Optical methods have the advantage to allow single-cell sensitivity and to probe the phenotype of measured cells. Here we present a process and a prototype that allow automated single-bacteria phenotypic analysis. This prototype is based on the use of Digital In-line Holography techniques combined with a specially designed Raman spectrometer using a dedicated device to capture bacteria. The localization of single-cell is finely determined by using holograms and a proper propagation kernel. Holographic images are also used to analyze bacteria in the sample to sort potential pathogens from flora dwelling species or other biological particles. This accurate localization enables the use of a small confocal volume adapted to the measurement of single-cell. Along with the confocal volume adaptation, we also have modified every components of the spectrometer to optimize single-bacteria Raman measurements. This optimization allowed us to acquire informative single-cell spectra using an integration time of 0.5s only. Identification results obtained with this prototype are presented based on a 65144 Raman spectra database acquired automatically on 48 bacteria strains belonging to 8 species.
Ramos-Hryb, Ana B; Harris, Cari; Aighewi, Omorose; Lino-de-Oliveira, Cilene
2018-06-07
This commentary aims to discuss the impact of publication bias on the estimated effect of prototypic antidepressants in the forced swim test (FST). A systematic review and meta-analysis (SRMA) recently reported by Kara et al. (2018) showed that selected prototypic antidepressants reduced immobility time of mice in the FST across a variety of experimental designs. Despite differences in the procedures for SRMA, these results resemble the interim data collected by our research group according to a protocol deposited in the Systematic Review Facility and Open Science Framework (osf.io/9kxm4). Both studies detected a high amount of publications reporting statistically significant results and agreement with the primary hypothesis raising the possibility of publication bias in the field of FST. In our preliminary analysis, no evidence for publication bias was observed. However, the present work was limited to the effects of imipramine (doses ranging from 4 to 64 mg/kg) in different strains of mice. Therefore, more comprehensive studies are required to evaluate the risk of publication bias in the field of basic antidepressant research. We see the need to expand the current preliminary studies to evaluate the risk of publication bias within the preclinical research using the FST. Appraisal of the risk of publication bias may avoid misestimated effects of drugs in the FST providing better bases for the discovery of new antidepressants. Copyright © 2018. Published by Elsevier Ltd.
Singh, Mini Pritam; Majumdar, Manasi; Thapa, Babu Ram; Gupta, Puneet Kumar; Khurana, Jasmine; Budhathoki, Bimal; Ratho, Radha Kanta
2015-01-01
Background & objectives: Hepatitis A virus usually causes acute viral hepatitis (AVH) in the paediatric age group with a recent shift in age distribution and disease manifestations like acute liver failure (ALF). This has been attributed to mutations in 5’non-translated region (5’NTR) which affects the viral multiplication. The present study was aimed to carry out the molecular detection and phylogenetic analysis of hepatitis A virus strains circulating in north western India. Methods: Serum samples from in patients and those attending out patient department of Pediatric Gastroenterology in a tertiary care hospital in north India during 2007-2011 with clinically suspected AVH were tested for anti-hepatitis A virus (HAV) IgM antibodies. Acute phase serum samples were subjected to nested PCR targeting the 5’NTR region followed by sequencing of the representative strains. Results: A total of 1334 samples were tested, 290 (21.7%) were positive for anti-HAV IgM antibody. Of these, 78 serum samples (< 7 days old) were subjected to PCR and 47.4% (37/78) samples showed the presence of HAV RNA. Children < 15 yr of age accounted for majority (94%) of cases with highest seropositivity during rainy season. Sequencing of 15 representative strains was carried out and the circulating genotype was found to be III A. The nucleotide sequences showed high homology among the strains with a variation ranging from 0.1-1 per cent over the years. An important substitution of G to A at 324 position was shown by both AVH and ALF strains. The cumulative substitution in AVH strains Vs ALF strains as compared to GBM, Indian and prototype strain in the 200-500 region of 5’ NTR was comparable. Interpretation & conclusion: Our results showed hepatitis A still a disease of children with III A as a circulating genotype in this region. The mutations at 5’NTR region warrant further analysis as these affect the structure of internal ribosomal entry site which is important for viral replication. PMID:25900957
Tapia, Lorena I; Shaw, Chad A; Aideyan, Letisha O; Jewell, Alan M; Dawson, Brian C; Haq, Taha R; Piedra, Pedro A
2014-01-01
Human respiratory syncytial virus (HRSV) has three surface glycoproteins: small hydrophobic (SH), attachment (G) and fusion (F), encoded by three consecutive genes (SH-G-F). A 270-nt fragment of the G gene is used to genotype HRSV isolates. This study genotyped and investigated the variability of the gene and amino acid sequences of the three surface proteins of HRSV strains collected from 1987 to 2005 from one center. Sixty original clinical isolates and 5 prototype strains were analyzed. Sequences containing SH, F and G genes were generated, and multiple alignments and phylogenetic trees were analyzed. Genetic variability by protein domains comparing virus genotypes was assessed. Complete sequences of the SH-G-F genes were obtained for all 65 samples: HRSV-A = 35; HRSV-B = 30. In group A strains, genotypes GA5 and GA2 were predominant. For HRSV-B strains, the genotype GB4 was predominant from 1992 to 1994 and only genotype BA viruses were detected in 2004-2005. Different genetic variability at nucleotide level was detected between the genes, with G gene being the most variable and the highest variability detected in the 270-nt G fragment that is frequently used to genotype the virus. High variability (>10%) was also detected in the signal peptide and transmembrane domains of the F gene of HRSV A strains. Variability among the HRSV strains resulting in non-synonymous changes was detected in hypervariable domains of G protein, the signal peptide of the F protein, a not previously defined domain in the F protein, and the antigenic site Ø in the pre-fusion F. Divergent trends were observed between HRSV -A and -B groups for some functional domains. A diverse population of HRSV -A and -B genotypes circulated in Houston during an 18 year period. We hypothesize that diverse sequence variation of the surface protein genes provide HRSV strains a survival advantage in a partially immune-protected community.
Tapia, Lorena I.; Shaw, Chad A.; Aideyan, Letisha O.; Jewell, Alan M.; Dawson, Brian C.; Haq, Taha R.; Piedra, Pedro A.
2014-01-01
Human respiratory syncytial virus (HRSV) has three surface glycoproteins: small hydrophobic (SH), attachment (G) and fusion (F), encoded by three consecutive genes (SH-G-F). A 270-nt fragment of the G gene is used to genotype HRSV isolates. This study genotyped and investigated the variability of the gene and amino acid sequences of the three surface proteins of HRSV strains collected from 1987 to 2005 from one center. Sixty original clinical isolates and 5 prototype strains were analyzed. Sequences containing SH, F and G genes were generated, and multiple alignments and phylogenetic trees were analyzed. Genetic variability by protein domains comparing virus genotypes was assessed. Complete sequences of the SH-G-F genes were obtained for all 65 samples: HRSV-A = 35; HRSV-B = 30. In group A strains, genotypes GA5 and GA2 were predominant. For HRSV-B strains, the genotype GB4 was predominant from 1992 to 1994 and only genotype BA viruses were detected in 2004–2005. Different genetic variability at nucleotide level was detected between the genes, with G gene being the most variable and the highest variability detected in the 270-nt G fragment that is frequently used to genotype the virus. High variability (>10%) was also detected in the signal peptide and transmembrane domains of the F gene of HRSV A strains. Variability among the HRSV strains resulting in non-synonymous changes was detected in hypervariable domains of G protein, the signal peptide of the F protein, a not previously defined domain in the F protein, and the antigenic site Ø in the pre-fusion F. Divergent trends were observed between HRSV -A and -B groups for some functional domains. A diverse population of HRSV -A and -B genotypes circulated in Houston during an 18 year period. We hypothesize that diverse sequence variation of the surface protein genes provide HRSV strains a survival advantage in a partially immune-protected community. PMID:24625544
Junttila, N; Lévêque, N; Magnius, L O; Kabue, J P; Muyembe-Tamfum, J J; Maslin, J; Lina, B; Norder, H
2015-03-01
Complete coding regions were sequenced for two new enterovirus genomes: EV-B93 previously identified by VP1 sequencing, derived from a child with acute flaccid paralysis in the Democratic Republic of Congo; and EV-C95 from a French soldier with acute gastroenteritis in Djibouti. The EV-B93 P1 had more than 30% nucleotide divergence from other EV-B types, with highest similarity to E-15 and EV-B80. The P1 nucleotide sequence of EV-C95 was most similar, 71%, to CV-A21. Complete coding regions for the new enteroviruses were compared with those of 135 EV-B and 176 EV-C strains representing all types available in GenBank. When strains from the same outbreak or strains isolated during the same year in the same geographical region were excluded, 27 of the 58 EV-B, and 16 of the 23 EV-C types were represented by more than one sequence. However, for EV-B the P3 sequences formed three clades mainly according to origin or time of isolation, irrespective of type, while for EV-C the P3 sequences segregated mainly according to disease manifestation, with most strains causing paralysis, including polioviruses, forming one clade, and strains causing respiratory illness forming another. There was no intermixing of types between these two clades, apart from two EV-C96 strains. The EV-B P3 sequences had lower inter-clade and higher intra-clade variability as compared to the EV-C sequences, which may explain why inter-clade recombinations are more frequent in EV-B. Further analysis of more isolates may shed light on the role of recombinations in the evolution of EV-B in geographical context. © 2014 Wiley Periodicals, Inc.
Greenberg, David P; Robertson, Corwin A; Noss, Michael J; Blatter, Mark M; Biedenbender, Rex; Decker, Michael D
2013-01-21
To evaluate the safety and immunogenicity of a prototype quadrivalent inactivated influenza vaccine (QIV) containing two influenza B strains, one of each lineage, compared with licensed trivalent inactivated influenza vaccines (TIVs) containing either a Victoria B-lineage strain (2009-2010 TIV) or a Yamagata B-lineage strain (2008-2009 TIV). Healthy adults ≥18 years of age were eligible to participate in this phase II, open-label, randomized, controlled, multicenter study conducted in the US. Participants received a single dose of 2009-2010 TIV, 2008-2009 TIV, or QIV. Sera were collected before and 21 days after vaccine administration to test for hemagglutination inhibition (HAI) antibodies to each of the four influenza strains. Immunogenicity endpoints included geometric mean HAI antibody titers (GMTs) and rates of seroprotection (titer ≥1:40) and seroconversion (4-fold rise pre- to post-vaccination). Safety endpoints included frequency of solicited injection-site and systemic reactions occurring within 3 days of vaccination, and unsolicited non-serious adverse events (AEs) and serious AEs (SAEs) within 21 days of vaccination. One hundred and ninety participants were enrolled to each vaccine group. QIV induced GMTs to each A and B strain that were noninferior to those induced by the 2009-2010 and 2008-2009 TIVs (i.e., lower limit of the two-sided 95% confidence interval of the ratio of GMT(QIV)/GMT(TIV)>0.66 for each strain). Rates of seroprotection and seroconversion were similar in all groups. Incidence and severity of solicited injection-site and systemic reactions, AEs, and SAEs were similar among groups. QIV, containing two B strains (one from each B lineage), was as safe and immunogenic as licensed TIV. QIV has the potential to be a useful alternative to TIV and offer protection against both B lineages. Copyright © 2012 Elsevier Ltd. All rights reserved.
DOE Office of Scientific and Technical Information (OSTI.GOV)
DeLuca, N.; Bzik, D.J.; Bond, V.C.
1982-10-30
The tsB5 strain of Herpes Simplex Virus type 1 (HSV-1) contains at least two mutations; one mutation specifies the syncytial phenotype and the other confers temperature sensitivity for virus growth. These functions are known to be located between the prototypic map coordinates 0.30 and 0.42. In this study it was demonstrated that tsB5 enters human embryonic lung (HEL) cells more rapidly than KOS, another strain of HSV-1. The EcoRI restriction fragment F from the KOS strain (map coordinates 0.315 to 0.421) was mapped with eight restriction endonucleases, and 16 recombinant plasmids were constructed which contained varying portions of the KOSmore » genome. Recombinant viruses were generated by marker-rescue and marker-transfer cotransfection procedures, using intact DNA from one strain and a recombinant plasmid containing DNA from the other strain. The region of the crossover between the two nonisogenic strains was inferred by the identification of restriction sites in the recombinants that were characteristic of the parental strains. The recombinants were subjected to phenotypic analysis. Syncytium formation, rate of virus entry, and the production of gB were all separable by the crossovers that produced the recombinants. The KOS sequences which rescue the syncytial phenotype of tsB5 were localized to 1.5 kb (map coordinates 0.345 to 0.355), and the temperature-sensitive mutation was localized to 1.2 kb (0.360 to 0.368), giving an average separation between the mutations of 2.5 kb on the 150-kb genome. DNA sequences that specify a functional domain for virus entry were localized to the nucleotide sequences between the two mutations. All three functions could be encoded by the virus gene specifying the gB glycoprotein.« less
Gebhart, Dana; Lok, Stephen; Clare, Simon; Tomas, Myreen; Stares, Mark; Scholl, Dean; Donskey, Curtis J.; Lawley, Trevor D.
2015-01-01
ABSTRACT Clostridium difficile is a leading cause of nosocomial infections worldwide and has become an urgent public health threat requiring immediate attention. Epidemic lineages of the BI/NAP1/027 strain type have emerged and spread through health care systems across the globe over the past decade. Limiting person-to-person transmission and eradicating C. difficile, especially the BI/NAP1/027 strain type, from health care facilities are difficult due to the abundant shedding of spores that are impervious to most interventions. Effective prophylaxis for C. difficile infection (CDI) is lacking. We have genetically modified a contractile R-type bacteriocin (“diffocin”) from C. difficile strain CD4 to kill BI/NAP1/027-type strains for this purpose. The natural receptor binding protein (RBP) responsible for diffocin targeting was replaced with a newly discovered RBP identified within a prophage of a BI/NAP1/027-type target strain by genome mining. The resulting modified diffocins (a.k.a. Avidocin-CDs), Av-CD291.1 and Av-CD291.2, were stable and killed all 16 tested BI/NAP1/027-type strains. Av-CD291.2 administered in drinking water survived passage through the mouse gastrointestinal (GI) tract, did not detectably alter the mouse gut microbiota or disrupt natural colonization resistance to C. difficile or the vancomycin-resistant Enterococcus faecium (VREF), and prevented antibiotic-induced colonization of mice inoculated with BI/NAP1/027-type spores. Given the high incidence and virulence of the pathogen, preventing colonization by BI/NAP1/027-type strains and limiting their transmission could significantly reduce the occurrence of the most severe CDIs. This modified diffocin represents a prototype of an Avidocin-CD platform capable of producing targetable, precision anti-C. difficile agents that can prevent and potentially treat CDIs without disrupting protective indigenous microbiota. PMID:25805733
Real-Time PCR with an Internal Control for Detection of All Known Human Adenovirus Serotypes▿
Damen, Marjolein; Minnaar, René; Glasius, Patricia; van der Ham, Alwin; Koen, Gerrit; Wertheim, Pauline; Beld, Marcel
2008-01-01
The “gold standard” for the diagnosis of adenovirus (AV) infection is virus culture, which is rather time-consuming. Especially for immunocompromised patients, in whom severe infections with AV have been described, rapid diagnosis is important. Therefore, an internally controlled AV real-time PCR assay detecting all known human AV serotypes was developed. Primers were chosen from the hexon region, which is the most conserved region, and in order to cover all known serotypes, degenerate primers were used. The internal control (IC) DNA contained the same primer binding sites as the AV DNA control but had a shuffled probe region compared to the conserved 24-nucleotide consensus AV hexon probe region (the target). The IC DNA was added to the clinical sample in order to monitor extraction and PCR efficiency. The sensitivity and the linearity of the AV PCR were determined. For testing the specificity of this PCR assay for human AVs, a selection of 51 AV prototype strains and 66 patient samples positive for other DNA viruses were tested. Moreover, a comparison of the AV PCR method described herein with culture and antigen (Ag) detection was performed with a selection of 151 clinical samples. All 51 AV serotypes were detected in the selection of AV prototype strains. Concordant results from culture or Ag detection and PCR were found for 139 (92.1%) of 151 samples. In 12 cases (7.9%), PCR was positive while the culture was negative. In conclusion, a sensitive, internally controlled nonnested AV real-time PCR assay which is able to detect all known AV serotypes with higher sensitivity than a culture or Ag detection method was developed. PMID:18923006
Prototypical anxiolytics do not reduce anxiety-like behavior in the open field in C57BL/6J mice.
Thompson, Trey; Grabowski-Boase, Laura; Tarantino, Lisa M
2015-06-01
Understanding and effectively treating anxiety disorders are a challenge for both scientists and clinicians. Despite a variety of available therapies, the efficacy of current treatments is still not optimal and adverse side effects can result in non-compliance. Animal models have been useful for studying the underlying biology of anxiety and assessing the anxiolytic properties of potential therapeutics. The open field (OF) is a commonly used assay of anxiety-like behavior. The OF was developed and validated in rats and then transferred to use in the mouse with only limited validation. The present study tests the efficacy of prototypical benzodiazepine anxiolytics, chlordiazepoxide (CDP) and diazepam (DZ), for increasing center time in the OF in C57BL/6J (B6) mice. Multiple doses of CDP and DZ did not change time spent in the center of the OF. Increasing illumination in the OF did not alter these results. The non-benzodiazepine anxiolytic, buspirone (BUSP) also failed to increase center time in the OF while the anxiogenic meta-chlorophenylpiperazine (mCPP) increased center time. Additional inbred mouse strains, BALB/cJ (BALB) and DBA/2J (D2) did not show any change in center time in response to CDP. Moreover, evaluation of CDP in B6 mice in the elevated plus maze (EPM), elevated zero maze (EZM) and light dark assay (LD) did not reveal changes in anxiety-like behavior while stress-induced hyperthermia (SIH) was decreased by DZ. Pharmacokinetic (PK) studies suggest that adequate CDP is present to induce anxiolysis. We conclude that the measure of center time in the OF does not show predictive validity for anxiolysis in these inbred mouse strains. Copyright © 2015 Elsevier Inc. All rights reserved.
Scaling effects in the impact response of graphite-epoxy composite beams
NASA Technical Reports Server (NTRS)
Jackson, Karen E.; Fasanella, Edwin L.
1989-01-01
In support of crashworthiness studies on composite airframes and substructure, an experimental and analytical study was conducted to characterize size effects in the large deflection response of scale model graphite-epoxy beams subjected to impact. Scale model beams of 1/2, 2/3, 3/4, 5/6, and full scale were constructed of four different laminate stacking sequences including unidirectional, angle ply, cross ply, and quasi-isotropic. The beam specimens were subjected to eccentric axial impact loads which were scaled to provide homologous beam responses. Comparisons of the load and strain time histories between the scale model beams and the prototype should verify the scale law and demonstrate the use of scale model testing for determining impact behavior of composite structures. The nonlinear structural analysis finite element program DYCAST (DYnamic Crash Analysis of STructures) was used to model the beam response. DYCAST analysis predictions of beam strain response are compared to experimental data and the results are presented.
Vinogradov, Evgeny; Sadovskaya, Irina; Courtin, Pascal; Kulakauskas, Saulius; Grard, Thierry; Mahony, Jennifer; van Sinderen, Douwe; Chapot-Chartier, Marie-Pierre
2018-06-15
In the lactic acid bacterium Lactococcus lactis, a cell wall polysaccharide (CWPS) is the bacterial receptor of the majority of infecting bacteriophages. The diversity of CWPS structures between strains explains, at least partially, the narrow host range of lactococcal phages. In the present work, we studied the polysaccharide components of the cell wall of the prototype L. lactis subsp. lactis strain IL1403. We identified a rhamnose-rich complex polysaccharide, carrying a glycerophosphate substitution, as the major component. Its structure was analyzed by 2D NMR spectroscopy, methylation analysis and MALDI-TOF MS and shown to be distinctly different from currently known lactococcal CWPS structures. It contains a linear backbone of repeated α-l-Rha disaccharide subunits, which is irregularly substituted with a trisaccharide occasionally bearing a glycerophosphate group. A poly (glycerol phosphate) teichoic acid, another important carbohydrate component of the IL1403 cell wall, was also isolated and structurally characterized. Copyright © 2018 Elsevier Ltd. All rights reserved.
Genomic sequencing of deer tick virus and phylogeny of powassan-related viruses of North America.
Kuno, G; Artsob, H; Karabatsos, N; Tsuchiya, K R; Chang, G J
2001-11-01
Powassan (POW) virus is responsible for central nervous system infection in humans in North America and the eastern parts of Russia. Recently, a new flavivirus, deer tick (DT) virus, related to POW virus was isolated in the United States, but neither its pathogenic potential in human nor the taxonomic relationship with POW virus has been elucidated. In this study, we obtained the near-full-length genomic sequence of the DT virus and complete sequences of 3 genomic regions of 15 strains of POW-related virus strains. The phylogeny revealed 2 lineages, one of which had the prototype POW virus and the other DT virus. Both lineages can cause central nervous system infection in humans. By use of the combination of molecular definition of virus species within the genus Flavivirus and serological distinction in a 2-way cross-neutralization test, the lineage of DT virus is classified as a distinct genotype of POW virus.
Electro optical system to measure strains at high temperature
NASA Astrophysics Data System (ADS)
Sciammarella, Cesar A.
1991-01-01
The goals of this proposal were to develop a prototype of an electro-optics system for the measurement of strains in structures at high temperatures and to perform a test under field conditions. In the research task section, the topics addressed include: (1) correction of the effect of vibrations and thermal currents by means of an active compensation system; (2) reduction of the speckle noise by means of electronic filter and TV signal reconstruction circuit; (4) compensation of the rigid body motions by mounting the camera in a universal motion system; and (5) removal of phase errors left by the active compensation system by dynamic reading. In the design and construction section, the topics addressed include: (1) preliminary design; (2) final design; (3) software development; (4) signal conditioning; (5) data processing; (6) recorrelation of two holograms in the presence of rigid body motions; and (7) phase extraction using a computer generated image. Testing in the high temperature oven is also addressed.
Molecular identification of enteroviruses associated with aseptic meningitis in children from India.
Kumar, Arvind; Shukla, Deepti; Kumar, Rashmi; Idris, Mohammad Z; Jauhari, Prashant; Srivastava, Shalini; Dhole, Tapan N
2013-01-01
We identified and characterized enteroviruses associated with aseptic meningitis in children between April 2009 and March 2010. Enterovirus RNA was detected in 51 (45.5 %) of 112 CSF samples. Molecular typing by RT-PCR and sequencing of a partial VP1 region revealed the predominance of echovirus (ECV) 32 (n = 20), followed by ECV 11 (n = 10), ECV 13 and ECV 14 (n = 5 each), coxsackievirus (CV) B3 and CV B6 (n = 3 each), CV A2, CV A10 and ECV 30 (n = 1 each). Phylogenetic analysis of ECV 32 showed 0 to 4 % sequence divergence among strains of the present study and 20-23 % from the prototype Puerto Rico strain at the nucleotide level. This is the first report of ECV 32 associated with an aseptic meningitis epidemic and identification of seven different enterovirus serotypes (CV A2, CV A10, CV B3, CV B6, ECV 13, ECV 14 and ECV 32) in meningitis cases from India.
Wang, Zheng; Malanoski, Anthony P; Lin, Baochuan; Kidd, Carolyn; Long, Nina C; Blaney, Kate M; Thach, Dzung C; Tibbetts, Clark; Stenger, David A
2008-01-01
Background Febrile respiratory illness (FRI) has a high impact on public health and global economics and poses a difficult challenge for differential diagnosis. A particular issue is the detection of genetically diverse pathogens, i.e. human rhinoviruses (HRV) and enteroviruses (HEV) which are frequent causes of FRI. Resequencing Pathogen Microarray technology has demonstrated potential for differential diagnosis of several respiratory pathogens simultaneously, but a high confidence design method to select probes for genetically diverse viruses is lacking. Results Using HRV and HEV as test cases, we assess a general design strategy for detecting and serotyping genetically diverse viruses. A minimal number of probe sequences (26 for HRV and 13 for HEV), which were potentially capable of detecting all serotypes of HRV and HEV, were determined and implemented on the Resequencing Pathogen Microarray RPM-Flu v.30/31 (Tessarae RPM-Flu). The specificities of designed probes were validated using 34 HRV and 28 HEV strains. All strains were successfully detected and identified at least to species level. 33 HRV strains and 16 HEV strains could be further differentiated to serotype level. Conclusion This study provides a fundamental evaluation of simultaneous detection and differential identification of genetically diverse RNA viruses with a minimal number of prototype sequences. The results demonstrated that the newly designed RPM-Flu v.30/31 can provide comprehensive and specific analysis of HRV and HEV samples which implicates that this design strategy will be applicable for other genetically diverse viruses. PMID:19046445
Fabrication of mandible fracture plate by indirect additive manufacturing
NASA Astrophysics Data System (ADS)
Aizat, M.; Khan, S. F.
2017-10-01
Bone fracture is a serious skeletal injury due to accidents and fragility of the bones at a certain age. In order to accelerate fracture healing process, fracture bone plate is use to hold the fracture segment for more stability. The purpose of this study is to fabricate mandibular fracture plate by using indirect additive manufacturing methods in order to reduce time taken during bending and shaping the fracture fixation plate that conform to the anatomy of the fractured bone site. The design and analysis of the plates are performed using CATIA and ANSYS software. The 3D-CAD data were sent to an additive manufacturing machine (fused filament fabricated) to generate master pattern using PLA and the mould were fabricated using Plaster of Paris. A melt ZAMAK 3 was poured directly into the moulds, and left it until completely harden. 3point bending test was performed on the prototype plate using universal testing machine. Stress-strain curve shows the graph exhibited a linear relationship of stress-strain up to a strain value of 0.001. Specimens give a maximum yielding stress and then break before the conventional deflection. Since the maximum flexural stress and the breaking stress are far apart with a plateau stating at strain value of 0.003mm/mm in most specimens, the specimen’s failure types are considered plastic failure mode. The average thickness and width are 1.65mm and 2.18mm respectively. The flexural modulus and flexural strength are 189.5GPa and 518.1MPa, respectively.
Detection of Steel Fatigue Cracks with Strain Sensing Sheets Based on Large Area Electronics
Yao, Yao; Glisic, Branko
2015-01-01
Reliable early-stage damage detection requires continuous monitoring over large areas of structure, and with sensors of high spatial resolution. Technologies based on Large Area Electronics (LAE) can enable direct sensing and can be scaled to the level required for Structural Health Monitoring (SHM) of civil structures and infrastructure. Sensing sheets based on LAE contain dense arrangements of thin-film strain sensors, associated electronics and various control circuits deposited and integrated on a flexible polyimide substrate that can cover large areas of structures. This paper presents the development stage of a prototype strain sensing sheet based on LAE for crack detection and localization. Two types of sensing-sheet arrangements with size 6 × 6 inch (152 × 152 mm) were designed and manufactured, one with a very dense arrangement of sensors and the other with a less dense arrangement of sensors. The sensing sheets were bonded to steel plates, which had a notch on the boundary, so the fatigue cracks could be generated under cyclic loading. The sensors within the sensing sheet that were close to the notch tip successfully detected the initialization of fatigue crack and localized the damage on the plate. The sensors that were away from the crack successfully detected the propagation of fatigue cracks based on the time history of the measured strain. The results of the tests have validated the general principles of the proposed sensing sheets for crack detection and identified advantages and challenges of the two tested designs. PMID:25853407
A Reverse Genetics Platform That Spans the Zika Virus Family Tree
Widman, Douglas G.; Young, Ellen; Yount, Boyd L.; Plante, Kenneth S.; Gallichotte, Emily N.; Carbaugh, Derek L.; Plante, Jessica; Swanstrom, Jesica; Heise, Mark T.; Lazear, Helen M.
2017-01-01
ABSTRACT Zika virus (ZIKV), a mosquito-borne flavivirus discovered in 1947, has only recently caused large outbreaks and emerged as a significant human pathogen. In 2015, ZIKV was detected in Brazil, and the resulting epidemic has spread throughout the Western Hemisphere. Severe complications from ZIKV infection include neurological disorders such as Guillain-Barré syndrome in adults and a variety of fetal abnormalities, including microcephaly, blindness, placental insufficiency, and fetal demise. There is an urgent need for tools and reagents to study the pathogenesis of epidemic ZIKV and for testing vaccines and antivirals. Using a reverse genetics platform, we generated six ZIKV infectious clones and derivative viruses representing diverse temporal and geographic origins. These include three versions of MR766, the prototype 1947 strain (with and without a glycosylation site in the envelope protein), and H/PF/2013, a 2013 human isolate from French Polynesia representative of the virus introduced to Brazil. In the course of synthesizing a clone of a circulating Brazilian strain, phylogenetic studies identified two distinct ZIKV clades in Brazil. We reconstructed viable clones of strains SPH2015 and BeH819015, representing ancestral members of each clade. We assessed recombinant virus replication, binding to monoclonal antibodies, and virulence in mice. This panel of molecular clones and recombinant virus isolates will enable targeted studies of viral determinants of pathogenesis, adaptation, and evolution, as well as the rational attenuation of contemporary outbreak strains to facilitate the design of vaccines and therapeutics. PMID:28270583
Mechanisms of pathogenesis of emerging adenoviruses.
Cook, James; Radke, Jay
2017-01-01
Periodic outbreaks of human adenovirus infections can cause severe illness in people with no known predisposing conditions. The reasons for this increased viral pathogenicity are uncertain. Adenoviruses are constantly undergoing mutation during circulation in the human population, but related phenotypic changes of the viruses are rarely detected because of the infrequency of such outbreaks and the limited biological studies of the emergent strains. Mutations and genetic recombinations have been identified in these new strains. However, the linkage between these genetic changes and increased pathogenicity is poorly understood. It has been observed recently that differences in virus-induced immunopathogenesis can be associated with altered expression of non-mutant viral genes associated with changes in viral modulation of the host innate immune response. Initial small animal studies indicate that these changes in viral gene expression can be associated with enhanced immunopathogenesis in vivo . Available evidence suggests the hypothesis that there is a critical threshold of expression of certain viral genes that determines both the sustainability of viral transmission in the human population and the enhancement of immunopathogenesis. Studies of this possibility will require extension of the analysis of outbreak viral strains from a sequencing-based focus to biological studies of relationships between viral gene expression and pathogenic responses. Advances in this area will require increased coordination among public health organizations, diagnostic microbiology laboratories, and research laboratories to identify, catalog, and systematically study differences between prototype and emergent viral strains that explain the increased pathogenicity that can occur during clinical outbreaks.
Szmolka, Ama; Szabó, Móni; Kiss, János; Pászti, Judit; Adrián, Erzsébet; Olasz, Ferenc; Nagy, Béla
2018-05-01
Salmonella Infantis (SI) became endemic in Hungary where the PFGE cluster B, characterized by a large multiresistance (MDR) plasmid emerged among broilers leading to an increased occurrence in humans. We hypothesized that this plasmid (pSI54/04) assisted dissemination of SI. Indeed, Nal-Sul-Tet phenotypes carrying pSI54/04 occurred increasingly between 2011 and 2013 among SI isolates from broilers and humans. Characterization of pSI54/04 based on genome sequence data of the MDR strain SI54/04 indicated a size of ∼277 kb and a high sequence similarity with the megaplasmid pESI of SI predominant in Israel. Molecular characterization of 78 representative broiler and human isolates detected the prototype plasmid pSI54/04 and its variants together with novel plasmid associations within the emerging cluster B. To test in vitro and in vivo pathogenicity of pSI54/04 we produced plasmidic transconjugant of the plasmid-free pre-emergent strain SI69/94. This parental strain and its transconjugant have been tested on chicken embryo fibroblasts (CEFs) and in orally infected day old chicks. The uptake of pSI54/04 did not increase the pathogenicity of the strain SI69/94 in these systems. Thus, dissemination of SI in poultry could be assisted by antimicrobial resistance rather than by virulence modules of the endemic plasmid pSI54/04 in Hungary. Copyright © 2017 Elsevier Ltd. All rights reserved.
A Mode-Shape-Based Fault Detection Methodology for Cantilever Beams
NASA Technical Reports Server (NTRS)
Tejada, Arturo
2009-01-01
An important goal of NASA's Internal Vehicle Health Management program (IVHM) is to develop and verify methods and technologies for fault detection in critical airframe structures. A particularly promising new technology under development at NASA Langley Research Center is distributed Bragg fiber optic strain sensors. These sensors can be embedded in, for instance, aircraft wings to continuously monitor surface strain during flight. Strain information can then be used in conjunction with well-known vibrational techniques to detect faults due to changes in the wing's physical parameters or to the presence of incipient cracks. To verify the benefits of this technology, the Formal Methods Group at NASA LaRC has proposed the use of formal verification tools such as PVS. The verification process, however, requires knowledge of the physics and mathematics of the vibrational techniques and a clear understanding of the particular fault detection methodology. This report presents a succinct review of the physical principles behind the modeling of vibrating structures such as cantilever beams (the natural model of a wing). It also reviews two different classes of fault detection techniques and proposes a particular detection method for cracks in wings, which is amenable to formal verification. A prototype implementation of these methods using Matlab scripts is also described and is related to the fundamental theoretical concepts.
JOVE Pilot Research Study in Astronomy and Microgravity Sciences
NASA Technical Reports Server (NTRS)
Strauss, Alvin M.; Hmelo, Anthony; Vlasse; Peterson, Steven
1995-01-01
The purpose of this project was to develop hardware and software facilities for evaluating the biomechanical interactions between human hands and space suit gloves. We have constructed a prototype of the glove to demonstrate its sensing technologies. There are two types of sensors in the glove. The positions of the fingers are measured using bend sensors based on the CyberGlove design. This sensor consists of two strain gages mounted to a 0.003 inch thick mylar sheet. The sensor is encapsulated using 0.001 inch kapton film to give it sufficient rigidity. A long gage is used to average the strain generated in the sensor due to bending. This average strain produces an output signal proportional to the angle of the bend. The force sensor, FSR, is manufactured by Interlink. It consists of conductive ink sandwiched between two plastic sheets. An electrode is printed on one of the plastic sheets using silver ink. When the electrode makes contact, current flows through the conductive ink. The resistance of the ink pad is sensitive to pressure. We have also developed circuits for exciting and measuring the sensors. The current version requires a single sided twelve volt power supply which is one inch long and 0.4 inches in diameter.
JOVE Pilot Research Study in Astronomy and Microgravity Sciences
NASA Technical Reports Server (NTRS)
Strauss, Alvin M.; Hmelo, Anthony; Peterson, Steven
1996-01-01
The purpose of this project was to develop hardware and software facilities for evaluating the biomechanical interactions between human hands and space suit gloves. The first task was to measure finger joint angles inside space suit gloves. A preliminary survey identified three potential systems which could be used in the proposed study. In response to the current market situation, a glove for measuring the positions of the hand inside a space suit has been developed. A prototype of the glove has been constructed to demonstrate its sensing technologies. There are two types of sensors in the glove. The positions of the fingers are measured using bend sensors based on the CyberGlove design. This sensor consists of two strain gages mounted to a 0.003 inch thick mylar sheet. The sensor is encapsulated using 0.001 inch kapton film to give it sufficient rigidity. Along gage is used to average the strain generated in the sensor due to bending This average strain produces an output signal proportional to the angle of the bend. The force sensor consists of conductive ink sandwiched between two plastic sheets. An electrode is printed on one of the plastic sheets using silver ink. The resistance of the ink is sensitive to pressure.
Development of an intelligent hypertext system for wind tunnel testing
NASA Technical Reports Server (NTRS)
Lo, Ching F.; Shi, George Z.; Steinle, Frank W.; Wu, Y. C. L. Susan; Hoyt, W. Andes
1991-01-01
This paper summarizes the results of a system utilizing artificial intelligence technology to improve the productivity of project engineers who conduct wind tunnel tests. The objective was to create an intelligent hypertext system which integrates a hypertext manual and expert system that stores experts' knowledge and experience. The preliminary (Phase I) effort implemented a prototype IHS module encompassing a portion of the manuals and knowledge used for wind tunnel testing. The effort successfully demonstrated the feasibility of the intelligent hypertext system concept. A module for the internal strain gage balance, implemented on both IBM-PC and Macintosh computers, is presented. A description of the Phase II effort is included.
Six-degree-of-freedom active vibration isolation using a Stewart platform mechanism
NASA Technical Reports Server (NTRS)
Geng, Zheng; Haynes, Leonard S.
1993-01-01
The design and control problems of a class of multidegree-of-freedom vibration isolation systems (VISs) based on a Stewart platform mechanism are studied. A prototype of a six-degree-of-freedom VIS for precision control of a wide range of space-based structures implemented in Intelligent Automation, Inc. is described. The feasibility of using a Stewart platform to achieve 6-degree-of-freedom vibration control in space applications is shown. A new Terfenol-D actuator characterized by significantly longer stroke than any commercially available Terfenol-D actuator and direct flux and strain sensors integral to the actuator is described.
Palmstrom, J. C.; Hristov, A. T.; Kivelson, S. A.; ...
2017-11-17
We report the observation of a nonlinear elastoresistivity response for the prototypical underdoped iron pnictide Ba(Fe 0.975Co 0.025) 2As 2. Our measurements reveal a large quadratic term in the isotropic (A 1g) electronic response that was produced by a purely shear (B 2g) strain. The divergence of this quantity upon cooling towards the structural phase transition reflects the temperature dependence of the nematic susceptibility. Furthermore, this observation shows that nematic fluctuations play a significant role in determining even the isotropic properties of this family of compounds.
Actinomadura Species: Laboratory Maintenance and Ribosome Engineering.
Dhakal, Dipesh; Chung, Nguyen Thanh; Rayamajhi, Vijay; Sohng, Jae Kyung
2017-02-06
Actinomadura spp. are aerobic, Gram-positive, catalase-positive, non-acid fast, non-motile actinomycetes. Some species of Actinomadura are associated with opportunistic infections in humans. However, many bioactive compounds with pharmaceutical applications can be isolated from various Actinomadura spp. This unit includes general protocols for the laboratory maintenance of Actinomadura spp., including growth in liquid medium, growth on solid agar, long-term storage, and generation of a higher producing strain by ribosome engineering. Actinomadura hibisca P157-2 is used as a prototype for explaining the considerations for efficient laboratory maintenance of Actinomadura spp. © 2017 by John Wiley & Sons, Inc. Copyright © 2017 John Wiley & Sons, Inc.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Palmstrom, J. C.; Hristov, A. T.; Kivelson, S. A.
We report the observation of a nonlinear elastoresistivity response for the prototypical underdoped iron pnictide Ba(Fe 0.975Co 0.025) 2As 2. Our measurements reveal a large quadratic term in the isotropic (A 1g) electronic response that was produced by a purely shear (B 2g) strain. The divergence of this quantity upon cooling towards the structural phase transition reflects the temperature dependence of the nematic susceptibility. Furthermore, this observation shows that nematic fluctuations play a significant role in determining even the isotropic properties of this family of compounds.
NASA Astrophysics Data System (ADS)
Iadicicco, Agostino; Cutolo, A.; Campopiano, Stefania
2014-05-01
This paper reports on the fabrication of Long Period Gratings (LPGs) in hollow-core air-silica photonic bandgap fibers (HC-PCFs) by using pressure assisted Electrode Arc Discharge (EAD) technique. In particular, the fabrication procedure relies on the combined use of EAD step, to locally heat the HC fiber, and of a static pressure (slightly higher than the external one) inside the fiber holes, to modify the holes. Here, the experimental fabrication of LPG prototypes with different periods and lengths are discussed. And, the sensitivity of LPGs in HC-PCF to environmental parameters such as strain, temperature and static pressure are presented and discussed.
Autoinducer-2 Quorum Sensing Contributes to Regulation of Microcin PDI in Escherichia coli
Lu, Shao-Yeh; Zhao, Zhe; Avillan, Johannetsy J.; Liu, Jinxin; Call, Douglas R.
2017-01-01
The Escherichia coli quorum sensing (QS) signal molecule, autoinducer-2 (AI-2), reaches its maximum concentration during mid-to-late growth phase after which it quickly degrades during stationary phase. This pattern of AI-2 concentration coincides with the up- then down-regulation of a recently described microcin PDI (mccPDI) effector protein (McpM). To determine if there is a functional relationship between these systems, a prototypical mccPDI-expressing strain of E. coli 25 was used to generate ΔluxS, ΔlsrACDBFG (Δlsr), and ΔlsrR mutant strains that are deficient in AI-2 production, transportation, and AI-2 transport regulation, respectively. Trans-complementation, RT-qPCR, and western blot assays were used to detect changes of microcin expression and synthesis under co-culture and monoculture conditions. Compared to the wild-type strain, the AI-2-deficient strain (ΔluxS) and -uptake negative strain (Δlsr) were >1,000-fold less inhibitory to susceptible bacteria (P < 0.05). With in trans complementation of luxS, the AI-2 deficient mutant reduced the susceptible E. coli population by 4-log, which was within 1-log of the wild-type phenotype. RT-qPCR and western blot results for the AI-2 deficient E. coli 25 showed a 5-fold reduction in mcpM transcription with an average 2-h delay in McpM synthesis. Furthermore, overexpression of sRNA micC and micF (both involved in porin protein regulation) was correlated with mcpM regulation, consistent with a possible link between QS and mcpM regulation. This is the direct first evidence that microcin regulation can be linked to quorum sensing in a Gram-negative bacterium. PMID:29312248
O'Connor, Paula M; O'Shea, Eileen F; Guinane, Caitriona M; O'Sullivan, Orla; Cotter, Paul D; Ross, R Paul; Hill, Colin
2015-06-15
Accumulating evidence suggests that bacteriocin production represents a probiotic trait for intestinal strains to promote dominance, fight infection, and even signal the immune system. In this respect, in a previous study, we isolated from the porcine intestine a strain of Streptococcus hyointestinalis DPC6484 that displays antimicrobial activity against a wide range of Gram-positive bacteria and produces a bacteriocin with a mass of 3,453 Da. Interestingly, the strain was also found to be immune to a nisin-producing strain. Genome sequencing revealed the genetic determinants responsible for a novel version of nisin, designated nisin H, consisting of the nshABTCPRKGEF genes, with transposases encoded between nshP and nshR and between nshK and nshG. A similar gene cluster is also found in S. hyointestinalis LMG14581. Notably, the cluster lacks an equivalent of the nisin immunity gene, nisI. Nisin H is proposed to have the same structure as the prototypical nisin A but differs at 5 amino acid positions-Ile1Phe (i.e., at position 1, nisin A has Ile while nisin H has Phe), Leu6Met, Gly18Dhb (threonine dehydrated to dehydrobutyrine), Met21Tyr, and His31Lys--and appears to represent an intermediate between the lactococcal nisin A and the streptococcal nisin U variant of nisin. Purified nisin H inhibits a wide range of Gram-positive bacteria, including staphylococci, streptococci, Listeria spp., bacilli, and enterococci. It represents the first example of a natural nisin variant produced by an intestinal isolate of streptococcal origin. Copyright © 2015, American Society for Microbiology. All Rights Reserved.
HIV-1 group P infection: towards a dead-end infection?
Alessandri-Gradt, Elodie; De Oliveira, Fabienne; Leoz, Marie; Lemee, Véronique; Robertson, David L; Feyertag, Felix; Ngoupo, Paul-Alain; Mauclere, Philippe; Simon, François; Plantier, Jean-Christophe
2018-06-19
HIV/1 group P (HIV-1/P) is the last HIV/1 group discovered and, to date, constitutes only two strains. To obtain new insight into this divergent group, we screened for new infections by developing specific tools, and analysed phenotypic and genotypic properties of the prototypic strain RBF168. In addition, the follow-up of the unique infected patient monitored so far has raised the knowledge of the natural history of this infection and its therapeutic management. We developed an HIV-1/P specific seromolecular strategy and screened over 29 498 specimen samples. Infectivity and evolution of the gag-30 position, considered as marker of adaptation to human, were explored by successive passages of RBF168 strain onto human peripheral blood mononuclear cells. Natural history and immunovirological responses to combined antiretroviral therapy (cART) were analysed based on CD4 cells and plasmatic viral load evolution. No new infection was detected. Infectivity of RBF168 was found lower, relative to other main HIV groups and the conservative methionine found in the gag-30 position revealed a lack of adaptation to human. The follow-up of the patient during the 5-year ART-free period, showed a relative stability of CD4 cell count with a mean of 326 cells/μl. Initiation of cART led to rapid RNA undetectability with a significant increase of CD4 cells, reaching 687 cells/μl after 8 years. Our results showed that HIV-1/P strains remain extremely rare and could be less adapted and pathogenic than other HIV strains. These data lead to the hypothesis that HIV-1/P infection could evolve towards, or even already corresponds to, a dead-end infection.
A mouse model of paralytic myelitis caused by enterovirus D68
Yu, Guixia; Leser, J. Smith; Yagi, Shigeo; Tyler, Kenneth L.
2017-01-01
In 2014, the United States experienced an epidemic of acute flaccid myelitis (AFM) cases in children coincident with a nationwide outbreak of enterovirus D68 (EV-D68) respiratory disease. Up to half of the 2014 AFM patients had EV-D68 RNA detected by RT-PCR in their respiratory secretions, although EV-D68 was only detected in cerebrospinal fluid (CSF) from one 2014 AFM patient. Given previously described molecular and epidemiologic associations between EV-D68 and AFM, we sought to develop an animal model by screening seven EV-D68 strains for the ability to induce neurological disease in neonatal mice. We found that four EV-D68 strains from the 2014 outbreak (out of five tested) produced a paralytic disease in mice resembling human AFM. The remaining 2014 strain, as well as 1962 prototype EV-D68 strains Fermon and Rhyne, did not produce, or rarely produced, paralysis in mice. In-depth examination of the paralysis caused by a representative 2014 strain, MO/14-18947, revealed infectious virus, virion particles, and viral genome in the spinal cords of paralyzed mice. Paralysis was elicited in mice following intramuscular, intracerebral, intraperitoneal, and intranasal infection, in descending frequency, and was associated with infection and loss of motor neurons in the anterior horns of spinal cord segments corresponding to paralyzed limbs. Virus isolated from spinal cords of infected mice transmitted disease when injected into naïve mice, fulfilling Koch’s postulates in this model. Finally, we found that EV-D68 immune sera, but not normal mouse sera, protected mice from development of paralysis and death when administered prior to viral challenge. These studies establish an experimental model to study EV-D68-induced myelitis and to better understand disease pathogenesis and develop potential therapies. PMID:28231269
Auger, Jean-Philippe; Chuzeville, Sarah; Roy, David; Mathieu-Denoncourt, Annabelle; Xu, Jianguo; Grenier, Daniel
2017-01-01
Streptococcus suis serotype 2 is an important porcine bacterial pathogen and emerging zoonotic agent mainly responsible for sudden death, septic shock, and meningitis. However, serotype 2 strains are genotypically and phenotypically heterogeneous. Though a multitude of virulence factors have been described for S. suis serotype 2, the lack of a clear definition regarding which ones are truly “critical” has created inconsistencies that have only recently been highlighted. Herein, the involvement of two factors previously described as being critical for S. suis serotype 2 virulence, whether the dipeptidyl peptidase IV and autolysin, were evaluated with regards to different ascribed functions using prototype strains belonging to important sequence types. Results demonstrate a lack of reproducibility with previously published data. In fact, the role of the dipeptidyl peptidase IV and autolysin as critical virulence factors could not be confirmed. Though certain in vitro functions may be ascribed to these factors, their roles are not unique for S. suis, probably due to compensation by other factors. As such, variations and discrepancies in experimental design, including in vitro assays, cell lines, and animal models, are an important source of differences between results. Moreover, the use of different sequence types in this study demonstrates that the role attributed to a virulence factor may vary according to the S. suis serotype 2 strain background. Consequently, it is necessary to establish standard experimental designs according to the experiment and purpose in order to facilitate comparison between laboratories. Alongside, studies should include strains of diverse origins in order to prevent erroneous and biased conclusions that could affect future studies. PMID:28753679
Aboklaish, Ali F; Ahmed, Shatha; McAllister, Douglas; Cassell, Gail; Zheng, Xiaotian T; Spiller, Owen B
2016-08-01
Two separate species of Ureaplasma have been identified that infect humans: Ureaplasma parvum and Ureaplasma urealyticum. Most notably, these bacteria lack a cell wall and are the leading infectious organism associated with infection-related induction of preterm birth. Fourteen separate representative prototype bacterial strains, called serovars, are largely differentiated by the sequence of repeating units in the C-terminus of the major surface protein: multiple-banded antigen (MBA). Monoclonal antibodies that recognise single or small groups of serovars have been previously reported, but these reagents remain sequestered in individual research laboratories. Here we characterise a panel of commercially available monoclonal antibodies raised against the MBA and describe the first monoclonal antibody that cross-reacts by immunoblot with all serovars of U. parvum and U. urealyticum species. We also describe a recombinant MBA expressed by Escherichia coli which facilitated further characterisation by immunoblot and demonstrate immunohistochemistry of paraffin-embedded antigens. Immunoblot reactivity was validated against well characterised previously published monoclonal antibodies and individual commercial antibodies were found to recognise all U. parvum strains, only serovars 3 and 14 or only serovars 1 and 6, or all strains belonging to U. parvum and U. urealyticum. MBA mass was highly variable between strains, consistent with variation in the number of C-terminal repeats between strains. Antibody characterisation will enable future investigations to correlate severity of pathogenicity to MBA isoform number or mass, in addition to development of antibody-based diagnostics that will detect infection by all Ureaplasma species or alternately be able to differentiate between U. parvum, U. urealyticum or mixed infections. Copyright © 2016 Elsevier B.V. All rights reserved.
Time dependence of composite shrinkage using halogen and LED light curing.
Uhl, Alexander; Mills, Robin W; Rzanny, Angelika E; Jandt, Klaus D
2005-03-01
The polymerization shrinkage of light cured dental composites presents the major drawback for these aesthetically adaptable restorative materials. LED based light curing technology has recently become commercially available. Therefore, the aim of the present study was to investigate if there was a statistically significant difference in linear and volumetric composite shrinkage strain if a LED LCU is used for the light curing process rather than a conventional halogen LCU. The volumetric shrinkage strain was determined using the Archimedes buoyancy principle after 5, 10, 20, 40 s of light curing and after 120 s following the 40 s light curing time period. The linear shrinkage strain was determined with a dynamic mechanical analyzer for the composites Z100, Spectrum, Solitaire2 and Definite polymerized with the LCUs Trilight (halogen), Freelight I (LED) and LED63 (LED LCU prototype). The changes in irradiance and spectra of the LCUs were measured after 0, 312 and 360 min of duty time. In general there was no considerable difference in shrinkage of the composites Z100, Spectrum or Solitaire2 when the LED63 was used instead of the Trilight. There was, however, a statistically significant difference in shrinkage strain when the composite Definite was polymerized with the LED63 instead of the Trilight. The spectrum of the Trilight changed during the experiment considerably whereas the LED63 showed an almost constant light output. The Freelight I dropped considerably in irradiance and had to be withdrawn from the study because of technical problems. The composites containing only the photoinitiator camphorquinone showed similar shrinkage strain behaviour when a LED or halogen LCU is used for the polymerization. The irradiance of some LED LCUs can also decrease over time and should therefore be checked on a regular basis.
Sampaio, Suely C. F.; Luiz, Wilson B.; Vieira, Mônica A. M.; Ferreira, Rita C. C.; Garcia, Bruna G.; Sinigaglia-Coimbra, Rita; Sampaio, Jorge L. M.; Ferreira, Luís C. S.
2016-01-01
The expression of flagella correlates with different aspects of bacterial pathogenicity, ranging from adherence to host cells to activation of inflammatory responses by the innate immune system. In the present study, we investigated the role of flagella in the adherence of an atypical enteropathogenic Escherichia coli (aEPEC) strain (serotype O51:H40) to human enterocytes. Accordingly, isogenic mutants deficient in flagellin (FliC), the flagellar structural subunit; the flagellar cap protein (FliD); or the MotAB proteins, involved in the control of flagellar motion, were generated and tested for binding to differentiated Caco-2 cells. Binding of the aEPEC strain to enterocytes was significantly impaired in strains with the fliC and fliD genes deleted, both of which could not form flagella on the bacterial surface. A nonmotile but flagellated MotAB mutant also showed impaired adhesion to Caco-2 cells. In accordance with these observations, adhesion of aEPEC strain 1711-4 to Caco-2 cells was drastically reduced after the treatment of Caco-2 cells with purified FliD. In addition, incubation of aEPEC bacteria with specific anti-FliD serum impaired binding to Caco-2 cells. Finally, incubation of Caco-2 cells with purified FliD, followed by immunolabeling, showed that the protein was specifically bound to the microvillus tips of differentiated Caco-2 cells. The aEPEC FliD or anti-FliD serum also reduced the adherence of prototype typical enteropathogenic, enterohemorrhagic, and enterotoxigenic E. coli strains to Caco-2 cells. In conclusion, our findings further strengthened the role of flagella in the adherence of aEPEC to human enterocytes and disclosed the relevant structural and functional involvement of FliD in the adhesion process. PMID:26831466
Chapell, J D; Goral, M I; Rodgers, S E; dePamphilis, C W; Dermody, T S
1994-01-01
To better understand genetic diversity within mammalian reoviruses, we determined S2 nucleotide and deduced sigma 2 amino acid sequences of nine reovirus strains and compared these sequences with those of prototype strains of the three reovirus serotypes. The S2 gene and sigma 2 protein are highly conserved among the four type 1, one type 2, and seven type 3 strains studied. Phylogenetic analyses based on S2 nucleotide sequences of the 12 reovirus strains indicate that diversity within the S2 gene is independent of viral serotype. Additionally, we found marked topological differences between phylogenetic trees generated from S1 and S2 gene nucleotide sequences of the seven type 3 strains. These results demonstrate that reovirus S1 and S2 genes have distinct evolutionary histories, thus providing phylogenetic evidence for lateral transfer of reovirus genes in nature. When variability among the 12 sigma 2-encoding S2 nucleotide sequences was analyzed at synonymous positions, we found that approximately 60 nucleotides at the 5' terminus and 30 nucleotides at the 3' terminus were markedly conserved in comparison with other sigma 2-encoding regions of S2. Predictions of RNA secondary structures indicate that the more conserved S2 sequences participate in the formation of an extended region of duplex RNA interrupted by a pair of stem-loops. Among the 12 deduced sigma 2 amino acid sequences examined, substitutions were observed at only 11% of amino acid positions. This finding suggests that constraints on the structure or function of sigma 2, perhaps in part because of its location in the virion core, have limited sequence diversity within this protein. PMID:8289378
Goswami, Kakolie; Chen, Chun; Xiaoli, Lingzi; Eaton, Kathryn A; Dudley, Edward G
2015-11-01
Escherichia coli O157:H7 is a notorious foodborne pathogen due to its low infectious dose and the disease symptoms it causes, which include bloody diarrhea and severe abdominal cramps. In some cases, the disease progresses to hemorrhagic colitis (HC) and hemolytic uremic syndrome (HUS), due to the expression of one or more Shiga toxins (Stx). Isoforms of Stx, including Stx2a, are encoded within temperate prophages. In the presence of certain antibiotics, phage induction occurs, which also increases the expression of toxin genes. Additionally, increased Stx2 accumulation has been reported when O157:H7 was cocultured with phage-susceptible nonpathogenic E. coli. This study characterized an E. coli O157:H7 strain, designated PA2, that belongs to the hypervirulent clade 8 cluster. Stx2a levels after ciprofloxacin induction were lower for PA2 than for the prototypical outbreak strains Sakai and EDL933. However, during coculture with the nonpathogenic strain E. coli C600, PA2 produced Stx2a levels that were 2- to 12-fold higher than those observed during coculture with EDL933 and Sakai, respectively. Germfree mice cocolonized by PA2 and C600 showed greater kidney damage, increased Stx2a accumulation in feces, and more visible signs of disease than mice given PA2 or C600 alone. These data suggest one mechanism by which microorganisms associated with the colonic microbiota could enhance the virulence of E. coli O157:H7, particularly a subset of clade 8 strains. Copyright © 2015, American Society for Microbiology. All Rights Reserved.
Lichtenegger, Sabine; Bina, Isabelle; Roier, Sandro; Bauernfeind, Stilla; Keidel, Kristina; Schild, Stefan; Anthony, Mark; Reidl, Joachim
2014-05-01
Haemophilus influenzae is a Gram-negative bacillus and a frequent commensal of the human nasopharynx. Earlier work demonstrated that in H. influenzae type b, l-lactate metabolism is associated with serum resistance and in vivo survival of the organism. To further gain insight into lactate utilization of the non-typeable (NTHi) isolate 2019 and laboratory prototype strain Rd KW20, deletion mutants of the l-lactate dehydrogenase (lctD) and permease (lctP) were generated and characterized. It is shown, that the apparent KM of l-lactate uptake is 20.1μM as determined for strain Rd KW20. Comparison of the COPD isolate NTHi 2019-R with the corresponding lctP knockout strain for survival in human serum revealed no lactate dependent serum resistance. In contrast, we observed a 4-fold attenuation of the mutant strain in a murine model of nasopharyngeal colonization. Characterization of lctP transcriptional control shows that the lactate utilization system in H. influenzae is not an inductor inducible system. Rather negative feedback regulation was observed in the presence of l-lactate and this is dependent on the ArcAB regulatory system. Additionally, for 2019 it was found that lactate may have signaling function leading to increased cell growth in late log phase under conditions where no l-lactate is metabolized. This effect seems to be ArcA independent and was not observed in strain Rd KW20. We conclude that l-lactate is an important carbon-source and may act as host specific signal substrate which fine tunes the globally acting ArcAB regulon and may additionally affect a yet unknown signaling system and thus may contribute to enhanced in vivo survival. Copyright © 2014 Elsevier GmbH. All rights reserved.
NASA Astrophysics Data System (ADS)
Huang, X.; Oram, C.; Sick, M.
2014-03-01
More efforts are put on hydro-power to balance voltage and frequency within seconds for primary control in modern smart grids. This requires hydraulic turbines to run at off-design conditions. especially at low load or speed-no load. Besides. the tendency of increasing power output and decreasing weight of the turbine runners has also led to the high level vibration problem of the runners. especially high head Francis runners. Therefore. it is important to carry out the static and dynamic stress analyses of prototype high head Francis runners. This paper investigates the static and dynamic stresses on the prototype high head Francis runner based on site measurements and numerical simulations. The site measurements are performed with pressure transducers and strain gauges. Based on the measured results. computational fluid dynamics (CFD) simulations for the flow channel from stay vane to draft tube cone are performed. Static pressure distributions and dynamic pressure pulsations caused by rotor-stator interaction (RSI) are obtained under various operating conditions. With the CFD results. static and dynamic stresses on the runner at different operating points are calculated by means of the finite element method (FEM). The agreement between simulation and measurement is analysed with linear regression method. which indicates that the numerical result agrees well with that of measurement. Furthermore. the maximum static and dynamic stresses on the runner blade are obtained at various operating points. The relations of the maximum stresses and the power output are discussed in detail. The influences of the boundary conditions on the structural behaviour of the runner are also discussed.
2017-01-01
Background Malaria control efforts are limited in rural areas. A low-cost system to monitor response without the use of electricity is needed. Plasmodium aldolase is a malaria biomarker measured using enzyme linked immunosorbent assay (ELISA) techniques. A three-part system using ELISA was developed consisting of a microfluidic chip, hand crank centrifuge, and a smartphone. Methods A circular microfluidic chip was fabricated using clear acrylic and a CO2 laser. A series of passive valves released reagents at precise times based upon centrifugal force. Color change was measured via smartphone camera using an application programmed in Java. The microchip was compared to a standard 96-well sandwich ELISA. Results Results from standard ELISA were compared to microchip at varying concentrations (1–10 ng/mL). Over 15 different microfluidic patterns were tested, and a final prototype of the chip was created. The prototype microchip was compared to standard sandwich ELISA (n = 20) using samples of recombinant aldolase. Color readings of standard ELISA and microfluidic microchip showed similar results. Conclusion A low-cost microfluidic system could detect and follow therapeutic outcomes in rural areas and identify resistant strains. PMID:29057138
Full-Genome Sequencing as a Basis for Molecular Epidemiology Studies of Bluetongue Virus in India
Maan, Sushila; Maan, Narender S.; Belaganahalli, Manjunatha N.; Rao, Pavuluri Panduranga; Singh, Karam Pal; Hemadri, Divakar; Putty, Kalyani; Kumar, Aman; Batra, Kanisht; Krishnajyothi, Yadlapati; Chandel, Bharat S.; Reddy, G. Hanmanth; Nomikou, Kyriaki; Reddy, Yella Narasimha; Attoui, Houssam; Hegde, Nagendra R.; Mertens, Peter P. C.
2015-01-01
Since 1998 there have been significant changes in the global distribution of bluetongue virus (BTV). Ten previously exotic BTV serotypes have been detected in Europe, causing severe disease outbreaks in naïve ruminant populations. Previously exotic BTV serotypes were also identified in the USA, Israel, Australia and India. BTV is transmitted by biting midges (Culicoides spp.) and changes in the distribution of vector species, climate change, increased international travel and trade are thought to have contributed to these events. Thirteen BTV serotypes have been isolated in India since first reports of the disease in the country during 1964. Efficient methods for preparation of viral dsRNA and cDNA synthesis, have facilitated full-genome sequencing of BTV strains from the region. These studies introduce a new approach for BTV characterization, based on full-genome sequencing and phylogenetic analyses, facilitating the identification of BTV serotype, topotype and reassortant strains. Phylogenetic analyses show that most of the equivalent genome-segments of Indian BTV strains are closely related, clustering within a major eastern BTV ‘topotype’. However, genome-segment 5 (Seg-5) encoding NS1, from multiple post 1982 Indian isolates, originated from a western BTV topotype. All ten genome-segments of BTV-2 isolates (IND2003/01, IND2003/02 and IND2003/03) are closely related (>99% identity) to a South African BTV-2 vaccine-strain (western topotype). Similarly BTV-10 isolates (IND2003/06; IND2005/04) show >99% identity in all genome segments, to the prototype BTV-10 (CA-8) strain from the USA. These data suggest repeated introductions of western BTV field and/or vaccine-strains into India, potentially linked to animal or vector-insect movements, or unauthorised use of ‘live’ South African or American BTV-vaccines in the country. The data presented will help improve nucleic acid based diagnostics for Indian serotypes/topotypes, as part of control strategies. PMID:26121128
Easton, Donna M.; Totsika, Makrina; Allsopp, Luke P.; Phan, Minh-Duy; Idris, Adi; Wurpel, Daniël J.; Sherlock, Orla; Zhang, Bing; Venturini, Carola; Beatson, Scott A.; Mahony, Timothy J.; Cobbold, Rowland N.; Schembri, Mark A.
2011-01-01
Enterohemorrhagic Escherichia coli (EHEC) and enteropathogenic E. coli (EPEC) are diarrheagenic pathotypes of E. coli that cause gastrointestinal disease with the potential for life-threatening sequelae. While certain EHEC and EPEC virulence mechanisms have been extensively studied, the factors that mediate host colonization remain to be properly defined. Previously, we identified four genes (ehaA, ehaB, ehaC, and ehaD) from the prototypic EHEC strain EDL933 that encode for proteins that belong to the autotransporter (AT) family. Here we have examined the prevalence of these genes, as well as several other AT-encoding genes, in a collection of EHEC and EPEC strains. We show that the complement of AT-encoding genes in EHEC and EPEC strains is variable, with some AT-encoding genes being highly prevalent. One previously uncharacterized AT-encoding gene, which we have termed ehaJ, was identified in 12/44 (27%) of EHEC and 2/20 (10%) of EPEC strains. The ehaJ gene lies immediately adjacent to a gene encoding a putative glycosyltransferase (referred to as egtA). Western blot analysis using an EhaJ-specific antibody indicated that EhaJ is glycosylated by EgtA. Expression of EhaJ in a recombinant E. coli strain, revealed EhaJ is located at the cell surface and in the presence of the egtA glycosyltransferase gene mediates strong biofilm formation in microtiter plate and flow cell assays. EhaJ also mediated adherence to a range of extracellular matrix proteins, however this occurred independent of glycosylation. We also demonstrate that EhaJ is expressed in a wild-type EPEC strain following in vitro growth. However, deletion of ehaJ did not significantly alter its adherence or biofilm properties. In summary, EhaJ is a new glycosylated AT protein from EPEC and EHEC. Further studies are required to elucidate the function of EhaJ in colonization and virulence. PMID:21687429
NASA Astrophysics Data System (ADS)
chery, J.; Boudin, F.; Cattoen, M.; Seat, H.; Suleiman, M.; Chawah, P.; Plantier, G.; Sourice, A.; Bernard, P.; Brunet, C.; Gaffet, S.; Boyer, D.
2011-12-01
Measurements of strain and vibrations due to seismic and volcanic processes are mandatory for the understanding and the monitoring of the behavior of these systems. In the future, risk mitigation will depend on our capability to detect in a reliable way small precursors of large seismic and volcanic events and to assess the seismic/aseismic spatial and temporal distribution and evolution of crustal strain in these unstable systems.The robustness of strain and motion detection is primary linked to measurement accuracy, but also to the number and repartition of instrument. This implies that instrument cost and maintenance are essential for the development of networks. To date, only GPS sensors are robust enough to be deployed for long periods of time with limited problems of maintenance. Tiltmeters and strainmeters capabilities are often plagued by numerous technical problems limiting their usefulness. On the basis of existing or prototype sensors, we develop new instruments (seismometers, tiltmeters, strainmeters) using an interferometric motion measurement. Both Laser source and fringe analysis are connected to the mechanical sensor with long optic fiber (100 m - 10 km) depending on applications (volcanoes, sea bottom, boreholes) The fiber signal transmission is a major improvement by comparison with usual electric wires (cost, data channels, lightning, weight). Also, the absence of embedded electronic on the sensor is a guarantee for reliability and toughness. The proposed optical cell is an extrinsic all-fiber Fabry-Perot type interferometer (EFFPI). While being intrinsically insensitive to external perturbations to the sensing arm such as from stress/strain and temperature variations, the EFFPI is, however, extremely sensitive to changes in its sensing cavity length caused by parameters such as displacement, strain, and mechanical deformation along the optical axis. Coupled to well-advanced associated technologies in terms of laser sources (stability, output power), optical fiber (quality, low losses, couplers, connectics), photodetection (bandwidth, gain, low-noise) and real-time interferometric signal demodulation, this interferometer is today a mature device whose performance potential can be exploited in in-situ environmental monitoring of seismic activities (earthquakes and volcanoes) and in predicting the related risks. In the framework of the LINES project, we develop three types of mechanical sensors: a long baseline tiltmeter based on hydrostatic levelling, a borehole tiltmeter based on a simple pendulum and a seismometer for detecting vibrations at frequencies higher than 1 Hz. A common building principle is an external laser source and phase detector: as this part of the tool is remotely connected through an optic fiber to the underground sensor, this overcomes most of electric, power and maintenance problem occurring with non-optical devices. Moreover, this allows simple analog data transmission for a real-time network monitoring. We will show preliminary results suggesting that a rapid transition between laboratory prototypes and field instruments is likely.
[Genetic evidence for recombination and mutation in the emergence of human enterovirus 71].
Liu, Ai-Ping; Tan, Hui; Xie, Qun; Chen, Bai-Tang; Liu, Xiao-Feng; Zhang, Yong
2014-09-01
We wished to understand the genetic recombination and phylogenetic characteristics of human en- terovirus A71 (EV-A71) and to explore its potential virulence-related sites. Full-length genomes of three EV-A71 strains isolated from patients in Chenzhou City (China) were sequenced and analyzed. Possible re- combination events and crossover sites were analyzed with Recombination Detection Program v4. 1. 6 by comparison with the complete genome sequences of 231 strains of EV-A71. Similarly, plot and bootscanning analyses were undertaken with SimPlot v3. 5. 1. Phylogenetic trees based on the sequences of VP1 regions were constructed with MEGA v5. 2 using the Kimura two-parameter model and neighbor-joining method. Results suggested that recombination events were detected among the three EV-A71 isolates from Chenzhou City. The common main parent sequence was from JF799986 isolated from samples in Guang- zhou City (China) in 2009, and the minor parent sequence was TW/70516/08. Intertypic recombination e- vents were found in the C4b strain (strain SHZH98 isolated in 1998) and C4a strain (Fuyang strain isola- ted in 2008) with the prototype strains of CVA4 and CVA14 in the 3D region. The chi-square test was used to screen-out potential virulence-related sites with nucleotide substitutions of different types of hand, foot, and mouth disease (HFMD) cases using SPSS v19.0. Results suggested that there were no significant nucleotide substitutions between death cases and severe-HFMD cases. Eighteen significant nucleotide substitutions were found between death/severe-HFMD cases and mild-HFMD cases, and all these 18 substitutions were distributed only in P2 and P3 regions. Intertypic recombination among the predominant circulating EV-A71 strains in the Chinese mainland and other EV-A strains probably dates before 1998, and intratypic recombination might have occurred frequently in the HFMD outbreak from 2008 to 2012. Substitutions in the non-capsid region may be correlated with the changes in virulence of EV-A71. These data suggest that researchers should pay more attention to the relationships between substitutions in the noncapsid region and the virulence of the virus.
Determinants of glycan receptor specificity of H2N2 influenza A virus hemagglutinin.
Viswanathan, Karthik; Koh, Xiaoying; Chandrasekaran, Aarthi; Pappas, Claudia; Raman, Rahul; Srinivasan, Aravind; Shriver, Zachary; Tumpey, Terrence M; Sasisekharan, Ram
2010-10-29
The H2N2 subtype of influenza A virus was responsible for the Asian pandemic of 1957-58. However, unlike other subtypes that have caused pandemics such as H1N1 and H3N2, which continue to circulate among humans, H2N2 stopped circulating in the human population in 1968. Strains of H2 subtype still continue to circulate in birds and occasionally pigs and could be reintroduced into the human population through antigenic drift or shift. Such an event is a potential global health concern because of the waning population immunity to H2 hemagglutinin (HA). The first step in such a cross-species transmission and human adaptation of influenza A virus is the ability for its surface glycoprotein HA to bind to glycan receptors expressed in the human upper respiratory epithelia. Recent structural and biochemical studies have focused on understanding the glycan receptor binding specificity of the 1957-58 pandemic H2N2 HA. However, there has been considerable HA sequence divergence in the recent avian-adapted H2 strains from the pandemic H2N2 strain. Using a combination of structural modeling, quantitative glycan binding and human respiratory tissue binding methods, we systematically identify mutations in the HA from a recent avian-adapted H2N2 strain (A/Chicken/PA/2004) that make its quantitative glycan receptor binding affinity (defined using an apparent binding constant) comparable to that of a prototypic pandemic H2N2 (A/Albany/6/58) HA.
Determinants of Glycan Receptor Specificity of H2N2 Influenza A Virus Hemagglutinin
Chandrasekaran, Aarthi; Pappas, Claudia; Raman, Rahul; Srinivasan, Aravind; Shriver, Zachary; Tumpey, Terrence M.; Sasisekharan, Ram
2010-01-01
The H2N2 subtype of influenza A virus was responsible for the Asian pandemic of 1957-58. However, unlike other subtypes that have caused pandemics such as H1N1 and H3N2, which continue to circulate among humans, H2N2 stopped circulating in the human population in 1968. Strains of H2 subtype still continue to circulate in birds and occasionally pigs and could be reintroduced into the human population through antigenic drift or shift. Such an event is a potential global health concern because of the waning population immunity to H2 hemagglutinin (HA). The first step in such a cross-species transmission and human adaptation of influenza A virus is the ability for its surface glycoprotein HA to bind to glycan receptors expressed in the human upper respiratory epithelia. Recent structural and biochemical studies have focused on understanding the glycan receptor binding specificity of the 1957-58 pandemic H2N2 HA. However, there has been considerable HA sequence divergence in the recent avian-adapted H2 strains from the pandemic H2N2 strain. Using a combination of structural modeling, quantitative glycan binding and human respiratory tissue binding methods, we systematically identify mutations in the HA from a recent avian-adapted H2N2 strain (A/Chicken/PA/2004) that make its quantitative glycan receptor binding affinity (defined using an apparent binding constant) comparable to that of a prototypic pandemic H2N2 (A/Albany/6/58) HA. PMID:21060797
Wireless magnetoelastic transducers for biomedical applications
NASA Astrophysics Data System (ADS)
Green, S. R.; Gianchandani, Y. B.
2017-05-01
This paper highlights emerging medical applications for magnetoelastic sensing and actuation, each taking advantage of the wireless capabilities and small form factor enabled by the magnetoelastic transduction technique. Magnetoelastic transduction leverages the strong coupling between stress, strain, and magnetization intrinsic to some materials - notably amorphous metals and rare earth crystalline alloys. This coupling provides inherently wireless transduction that does not require any onboard power; these traits are especially advantageous in diagnostic and therapeutic medical implant applications. This paper first describes the basic transduction technique, and considerations for design and fabrication of medical systems which utilize the technique. These considerations include material selection, magnetic biasing, packaging, and interrogation approaches. The first application highlighted is stent monitoring, in which the masssensitive magnetoelastic resonator is integrated along the inner sidewall of the stent to provide early detection of stent occlusion. Prototype tests indicate clinical feasibility and a full scale range from zero stent occlusion to full stent occlusion. Wireless ranges of up to 15 cm in situ have been achieved using 25 mm long resonators. The second application is wireless strain sensing, which can be useful for orthopedic implants and orthodontia. A differential strain sensor is described, with a dynamic range of 0-1.85 mstrain - accommodating typical palatal expander strain - and a sensitivity of 12.5x103 ppm/mstrain. Finally, a wireless actuator intended to agitate fluid for mitigation of encapsulation of glaucoma drainage devices is shown. Peak actuator vibration amplitudes of 1.5 μm - sufficient to affect cell adhesion in other studies - are recorded at a wireless range of 25-30 mm.
NASA Astrophysics Data System (ADS)
Mohammed, Ahmed A. S.; Moussa, Walied A.; Lou, Edmond
2010-01-01
In this paper, the design of MEMS piezoresistive strain sensor is described. ANSYS®, finite element analysis (FEA) software, was used as a tool to model the performance of the silicon-based sensor. The incorporation of stress concentration regions (SCRs), to localize stresses, was explored in detail. This methodology employs the structural design of the sensor silicon carrier. Therefore, the induced strain in the sensing chip yielded stress concentration in the vicinity of the SCRs. Hence, this concept was proved to enhance the sensor sensitivity. Another advantage of the SCRs is to reduce the sensor transverse gauge factor, which offered a great opportunity to develop a MEMS sensor with minimal cross sensitivity. Two basic SCR designs were studied. The depth of the SCRs was also investigated. Moreover, FEA simulation is utilized to investigate the effect of the sensing element depth on the sensor sensitivity. Simulation results showed that the sensor sensitivity is independent of the piezoresistors' depth. The microfabrication process flow was introduced to prototype the different sensor designs. The experiments covered operating temperature range from -50 °C to +50 °C. Finally, packaging scheme and bonding adhesive selection were discussed. The experimental results showed good agreement with the FEA simulation results. The findings of this study confirmed the feasibility of introducing SCRs in the sensor silicon carrier to improve the sensor sensitivity while using relatively high doping levels (5 × 1019 atoms cm-3). The fabricated sensors have a gauge factor about three to four times higher compared to conventional thin-foil strain gauges.
Mechanical Modulation of Nascent Stem Cell Lineage Commitment in Tissue Engineering Scaffolds
Song, Min Jae; Dean, David; Tate, Melissa L. Knothe
2013-01-01
Taking inspiration from tissue morphogenesis in utero, this study tests the concept of using tissue engineering scaffolds as delivery devices to modulate emergent structure-function relationships at early stages of tissue genesis. We report on the use of a combined computational fluid dynamics (CFD) modeling, advanced manufacturing methods, and experimental fluid mechanics (micro-piv and strain mapping) for the prospective design of tissue engineering scaffold geometries that deliver spatially resolved mechanical cues to cells seeded within. When subjected to a constant magnitude global flow regime, the local scaffold geometry dictates the magnitudes of mechanical stresses and strains experienced by a given cell, and in a spatially resolved fashion, similar to patterning during morphogenesis. In addition, early markers of mesenchymal stem cell lineage commitment relate significantly to the local mechanical environment of the cell. Finally, by plotting the range of stress-strain states for all data corresponding to nascent cell lineage commitment (95% CI), we begin to “map the mechanome”, defining stress-strain states most conducive to targeted cell fates. In sum, we provide a library of reference mechanical cues that can be delivered to cells seeded on tissue engineering scaffolds to guide target tissue phenotypes in a temporally and spatially resolved manner. Knowledge of these effects allows for prospective scaffold design optimization using virtual models prior to prototyping and clinical implementation. Finally, this approach enables the development of next generation scaffolds cum delivery devices for genesis of complex tissues with heterogenous properties, e.g., organs, joints or interface tissues such as growth plates. PMID:23660249
Mechanical modulation of nascent stem cell lineage commitment in tissue engineering scaffolds.
Song, Min Jae; Dean, David; Knothe Tate, Melissa L
2013-07-01
Taking inspiration from tissue morphogenesis in utero, this study tests the concept of using tissue engineering scaffolds as delivery devices to modulate emergent structure-function relationships at early stages of tissue genesis. We report on the use of a combined computational fluid dynamics (CFD) modeling, advanced manufacturing methods, and experimental fluid mechanics (micro-piv and strain mapping) for the prospective design of tissue engineering scaffold geometries that deliver spatially resolved mechanical cues to stem cells seeded within. When subjected to a constant magnitude global flow regime, the local scaffold geometry dictates the magnitudes of mechanical stresses and strains experienced by a given cell, and in a spatially resolved fashion, similar to patterning during morphogenesis. In addition, early markers of mesenchymal stem cell lineage commitment relate significantly to the local mechanical environment of the cell. Finally, by plotting the range of stress-strain states for all data corresponding to nascent cell lineage commitment (95% CI), we begin to "map the mechanome", defining stress-strain states most conducive to targeted cell fates. In sum, we provide a library of reference mechanical cues that can be delivered to cells seeded on tissue engineering scaffolds to guide target tissue phenotypes in a temporally and spatially resolved manner. Knowledge of these effects allows for prospective scaffold design optimization using virtual models prior to prototyping and clinical implementation. Finally, this approach enables the development of next generation scaffolds cum delivery devices for genesis of complex tissues with heterogenous properties, e.g., organs, joints or interface tissues such as growth plates. Copyright © 2013 Elsevier Ltd. All rights reserved.
Haque, Ezazul; Banik, Urmila; Monwar, Tahmina; Anthony, Leela; Adhikary, Arun Kumar
2018-01-01
Human adenovirus type 3 (HAdV-3) respiratory infections occurs worldwide in both children and adults, leading to severe morbidity and mortality, particularly in the paediatric age group and especially in neonates. During HAdV infection, neutralizing antibodies are formed against the epitopes located in the hyper variable regions (HVRs) of the hexon protein. These neutralizing antibodies provide protection against reinfection by viruses of the same type. Therefore it is reasonable to speculate that variations of HAdV-3 in the HVRs could impair the immunity acquired by previous infection with a different strain with variation in its HVRs. HAdV-3 has recently become the major agent of acute respiratory infection worldwide, being responsible for 15% to 87% of all adenoviral respiratory infections. However, despite the increased prevalence of HAdV-3 as respiratory pathogen, the diversity of hexon proteins in circulating strains remains unexplored. This study was designed to explore the variation in HVRs of hexon among globally distributed strains of HAdV-3 as well as to discover possible relationship among them, thus possibly shedding light on the cause for the increased prevalence of HAdV-3. In this study, for the first time we analysed the hexon proteins of all 248 available strains of HAdV-3 from the NCBI database and compared them with those of the HAdV-3 prototype (GB stain). We found that the HVRs of HAdV-3 strains circulating worldwide were highly heterogeneous and have been mutating continuously since -their original isolation. Based on their immense heterogeneity, the strains can be categorized into 25 hexon variants (3Hv-1 to 3Hv-25), 4 of which (3Hv-1 to 3Hv-4) comprises 80% of the strains. This heterogeneity may explain why HAdV-3 has become the most prevalent HAdVs type worldwide. The heterogeneity of hexon proteins also shows that the development of a vaccine against HAdV-3 might be challenging. The data on hexon variants provided here may be useful for the future epidemiological study of HAdV-3 infection.
Lopes, Susana M M; Novais, Juliana S; Costa, Dora C S; Castro, Helena C; Figueiredo, Agnes Marie S; Ferreira, Vitor F; Pinho E Melo, Teresa M V D; da Silva, Fernando de Carvalho
2018-01-01
The generation and reactivity of 3-triazolyl-nitrosoalkenes are reported for the first time. The study showed that hetero-Diels-Alder reaction of these heterodienes is an interesting synthetic strategy to functionalized 1,2,3-triazoles, including 1,2,3-triazolyl-pyrroles, 1,2,3-triazolyl-dipyrromethanes and 1,2,3-triazolyl-indoles. The evaluation of the antibacterial profile against Gram-positive and Gram-negative strains revealed the new 5,5'-diethyldipyrromethane bearing a side chain incorporating a triazole and oxime moieties. The antibacterial profile detected was within the Clinical and Laboratory Standard Institute (CLSI) range and against important Staphylococcus species including Methicillin-resistant strain (S. aureus ATCC 25923, S. epidermidis ATCC 12228 and S. simulans ATCC 27851 and MRSA). Interestingly, this new 1,2,3-triazole presented hemocompatibility and low in silico toxicity profile similar to antibiotics current in use. It also has an usual antibiofilm activity against MRSA, which reinforced its potential as a new antibacterial prototype. Copyright © 2017 Elsevier Masson SAS. All rights reserved.
Design of Force Sensor Leg for a Rocket Thrust Detector
NASA Astrophysics Data System (ADS)
Woten, Douglas; McGehee, Tripp; Wright, Anne
2005-03-01
A hybrid rocket is composed of a solid fuel and a separate liquid or gaseous oxidizer. These rockets may be throttled like liquid rockets, are safer than solid rockets, and are much less complex than liquid rockets. However, hybrid rockets produce thrust oscillations that are not practical for large scale use. A lab scale hybrid rocket at the University of Arkansas at Little Rock (UALR) Hybrid Rocket Facility is used to develop sensors to measure physical properties of hybrid rockets. Research is currently being conducted to design a six degree of freedom force sensor to measure the thrust and torque in all three spacial dimensions. The detector design uses six force sensor legs. Each leg utilizes strain gauges and a Wheatstone bridge to produce a voltage propotional to the force on the leg. The leg was designed using the CAD software ProEngineer and ProMechanica. Computer models of the strains on the single leg will be presented. A prototype leg was built and was tested in an INSTRON and results will be presented.
Carbon Nanotube/Polymer Nanocomposites Flexible Stress and Strain Sensors
NASA Technical Reports Server (NTRS)
Kang, Jin Ho; Sauti, Godfrey; Park, Cheol; Scholl, Jonathan A.; Lowther, Sharon E.; Harrison, Joycelyn S.
2008-01-01
Conformable stress and strain sensors are required for monitoring the integrity of airframe structures as well as for sensing the mechanical stimuli in prosthetic arms. For this purpose, we have developed a series of piezoresistive single-wall carbon nanotube (SWCNT)/polymer nanocomposites. The electromechanical coupling of pressure with resistance changes in these nanocomposites is exceptionally greater than that of metallic piezoresistive materials. In fact, the piezoresistive stress coefficient (pi) of a SWCNT/polymer nanocomposite is approximately two orders of magnitude higher than that of a typical metallic piezoresistive. The piezoresistive stress coefficient is a function of the nanotube concentration wherein the maximum value occurs at a concentration just above the percolation threshold concentration (phi approx. 0.05 %). This response appears to originate from a change in intrinsic resistivity under compression/tension. A systematic study of the effect of the modulus of the polymer matrix on piezoresistivity allowed us to make flexible and conformable sensors for biomedical applications. The prototype haptic sensors using these nanocomposites are demonstrated. The piezocapacitive properties of SWCNT/polymer are also characterized by monitoring the capacitance change under pressure.
Dilatancy of Shear Transformations in a Colloidal Glass
NASA Astrophysics Data System (ADS)
Lu, Y. Z.; Jiang, M. Q.; Lu, X.; Qin, Z. X.; Huang, Y. J.; Shen, J.
2018-01-01
Shear transformations, as fundamental rearrangement events operating in local regions, hold the key of plastic flow of amorphous solids. Despite their importance, the dynamic features of shear transformations are far from clear, which is the focus of the present study. Here, we use a colloidal glass under shear as the prototype to directly observe the shear-transformation events in real space. By tracing the colloidal-particle rearrangements, we quantitatively determine two basic properties of shear transformations: local shear strain and dilatation (or free volume). It is revealed that the local free volume undergoes a significantly temporary increase prior to shear transformations, eventually leading to a jump of local shear strain. We clearly demonstrate that shear transformations have no memory of the initial free volume of local regions. Instead, their emergence strongly depends on the dilatancy ability of these local regions, i.e., the dynamic creation of free volume. More specifically, the particles processing the high dilatancy ability directly participate in subsequent shear transformations. These results experimentally enrich Argon's statement about the dilatancy nature of shear transformations and also shed insight into the structural origin of amorphous plasticity.
Optical Tip Clearance Measurements as a Tool for Rotating Disk Characterization
García, Iker; Zubia, Joseba; Beloki, Josu; Arrue, Jon; Durana, Gaizka; Aldabaldetreku, Gotzon
2017-01-01
An experimental investigation on the vibrational behavior of a rotating disk by means of three optical fiber sensors is presented. The disk, which is a scale model of the real disk of an aircraft engine, was assembled in a wind tunnel in order to simulate real operation conditions. The pressure difference between the upstream and downstream sides of the disk causes an airflow that might force the disk to vibrate. To characterize this vibration, a set of parameters was determined by measuring the tip clearance of the disk: the amplitude, the frequency and the number of nodal diameters in the disk. All this information allowed the design of an upgraded prototype of the disk, whose performance was also characterized by the same method. An optical system was employed for the measurements, in combination with a strain gauge mounted on the disk surface, which served to confirm the results obtained. The data of the strain gauge coincided closely with those provided by the optical fiber sensors, thus demonstrating the suitability of this innovative technique to evaluate the vibrational behavior of rotating disks. PMID:28098845
Bukh, Jens; Meuleman, Philip; Tellier, Raymond; Engle, Ronald E.; Feinstone, Stephen M.; Eder, Gerald; Satterfield, William C.; Govindarajan, Sugantha; Krawczynski, Krzysztof; Miller, Roger H.; Leroux-Roels, Geert; Purcell, Robert H.
2010-01-01
Chimpanzees represent the only animal model for studies of the natural history of hepatitis C virus (HCV). To generate virus stocks of important HCV variants, we infected chimpanzees with HCV strains of genotypes 1–6 and determined the infectivity titer of acute-phase plasma pools in additional animals. The courses of first- and second-passage infections were similar, with early appearance of viremia, HCV RNA titers of >104.7 IU/mL, and development of acute hepatitis; the chronicity rate was 56%. The challenge pools had titers of 103–105 chimpanzee infectious doses/mL. Human liver–chimeric mice developed high-titer infections after inoculation with the challenge viruses of genotypes 1–6. Inoculation studies with different doses of the genotype 1b pool suggested that a relatively high virus dose is required to consistently infect chimeric mice. The challenge pools represent a unique resource for studies of HCV molecular virology and for studies of pathogenesis, protective immunity, and vaccine efficacy in vivo. PMID:20353362
Paneth Iheozor-Ejiofor, Rommel; Levanov, Lev; Hepojoki, Jussi; Strandin, Tomas; Lundkvist, Åke; Plyusnin, Alexander; Vapalahti, Olli
2016-05-01
Puumala virus (PUUV) grows slowly in cell culture. To study antigenic properties of PUUV, an amenable method for their expression would be beneficial. To achieve this, a replication-defective recombinant vesicular stomatitis virus, rVSVΔG*EGFP, was rescued using BSRT7/5 and encephalomyocarditis virus (EMCV) internal ribosomal entry site (IRES)-enabled rescue plasmids. Using these particles, pseudotypes bearing PUUV Sotkamo strain glycoproteins were produced, with titres in the range 105-108, and were used in pseudotype focus reduction neutralization tests (pFRNTs) with neutralizing monoclonal antibodies and patient sera. The results were compared with those from orthodox focus reduction neutralization tests (oFRNTs) using native PUUV with the same samples and showed a strong positive correlation (rs = 0.82) between the methods. While developing the system we identified three amino acids which were mutated in the Vero E6 cell culture adapted PUUV prototype Sotkamo strain sequence, and changing these residues was critical for expression and neutralizing antibody binding of PUUV glycoproteins.
Yi, Xia; Zhang, Peng; Sun, Jiaoe; Tu, Yi; Gao, Qiuqiang; Zhang, Jian; Bao, Jie
2016-01-10
Pediococcus acidilactici TY112 producing L-lactic acid and P. acidilactici ZP26 producing D-lactic acid, were engineered from the wild-type P. acidilactici DQ2 by ldhD or ldh gene disruption, and the robustness of the wild-type strain to the inhibitors derived from lignocellulose pretreatment was maintained well. In simultaneous saccharification and fermentation (SSF), 77.66 g L(-1) of L-lactic acid and 76.76 g L(-1) of D-lactic acid were obtained at 25% (w/w) solids content of dry dilute acid pretreated and biodetoxified corn stover feedstock. L- and D-Lactic acid yield and productivity were highly dependent on the inhibitor removal extent due to the significant down-regulation on the expressions of ldh and ldhD encoding lactate dehydrogenase by inhibitor, especially syringaldehyde and vanillin at the low concentrations. This study provided a prototype of industrial process for high titer L- and D-lactic acid production from lignocellulose feedstock. Copyright © 2015 Elsevier B.V. All rights reserved.
NASA Astrophysics Data System (ADS)
Lin, Dongguo; Li, Fangfang; Wu, Qiuyi; Xie, Xiangkun; Wu, Wenjiao; Wu, Jie; Chen, Qing; Liu, Shuwen; He, Jian
2016-03-01
Influenza A virus (IAV) is a severe worldwide threat to public health and economic development that results in the emergence of drug-resistant or highly virulent strains. Therefore, it is imperative to develop potent anti-IAV drugs with different modes of action to currently available drugs. Herein, we show a new class of antiviral peptides generated by conjugating two known short antiviral peptides: part-1 (named Jp with the sequence of ARLPR) and part-2 (named Hp with the sequence of KKWK). The new peptides were thus created by hybridization of these two domains at C- and N- termini, respectively. The anti-IAV screening results identified that C20-Jp-Hp was the most potent peptide with IC50 value of 0.53 μM against A/Puerto Rico/8/34 (H1N1) strain. Interestingly, these new peptides display lower toxicities toward mammalian cells and higher therapeutic indices than their prototypes. In addition, the mechanism of action of C20-Jp-Hp was extensively investigated.
Inactivated coxsackievirus A10 experimental vaccines protect mice against lethal viral challenge.
Shen, Chaoyun; Liu, Qingwei; Zhou, Yu; Ku, Zhiqiang; Wang, Lili; Lan, Ke; Ye, Xiaohua; Huang, Zhong
2016-09-22
Coxsackievirus A10 (CVA10) has become one of the major causative agents of hand, foot and mouth disease (HFMD). It is now recognized that CVA10 should be targeted for vaccine development. We report here that β-propiolactone inactivated whole-virus based CVA10 vaccines can elicit protective immunity in mice. We prepared two inactivated CVA10 experimental vaccines derived from the prototype strain CVA10/Kowalik and from a clinical isolate CVA10/S0148b, respectively. Immunization with the experimental vaccines elicited CVA10-specific serum antibodies in mice. The antisera from vaccinated mice could potently neutralize in vitro infection with either homologous or heterologous CVA10 strains. Importantly, passive transfer of the anti-CVA10 sera protected recipient mice against CVA10/Kowalik or CVA10/S0148b infections. Moreover, active immunization with the inactivated vaccines also conferred protection against homologous and heterologous infections in mice. Collectively, our results demonstrate the proof-of-concept for inactivated whole-virus based CVA10 vaccines. Copyright © 2016 Elsevier Ltd. All rights reserved.
Designer Shape Anisotropy on Transition-Metal-Dichalcogenide Nanosheets.
Martella, Christian; Mennucci, Carlo; Lamperti, Alessio; Cappelluti, Emmanuele; de Mongeot, Francesco Buatier; Molle, Alessandro
2018-03-01
MoS 2 and generally speaking, the wide family of transition-metal dichalcogenides represents a solid nanotechnology platform on which to engineer a wealth of new and outperforming applications involving 2D materials. An even richer flexibility can be gained by extrinsically inducing an in-plane shape anisotropy of the nanosheets. Here, the synthesis of anisotropic MoS 2 nanosheets is proposed as a prototypical example in this respect starting from a highly conformal chemical vapor deposition on prepatterend substrates and aiming at the more general purpose of tailoring anisotropy of 2D nanosheets by design. This is envisioned to be a suitable configuration for strain engineering as far as strain can be spatially redistributed in morphologically different regions. With a similar approach, both the optical and electronic properties of the 2D transition-metal dichalcogenides can be tailored over macroscopic sample areas in a self-organized fashion, thus paving the way for new applications in the field of optical metasurfaces, light harvesting, and catalysis. © 2018 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.
A Comparison of the Irradiation Creep Behavior of Several Graphites
DOE Office of Scientific and Technical Information (OSTI.GOV)
Burchell, Timothy D; Windes, Will
2016-01-01
Graphite creep strain data from the irradiation creep capsule Advanced Graphite Creep-1 (AGC-1) are reported. This capsule was the first (prototype) of a series of five or six capsules planned as part of the AGC experiment, which was designed to fully characterize the effects of neutron irradiation and the radiation creep behavior of current nuclear graphite. The creep strain data and analysis are reported for the six graphite grades incorporated in the capsule. The AGC-1 capsule was irradiated in the Advanced Test Reactor at Idaho National Laboratory (INL) at approximately 700 C and to a peak dose of 7 dpamore » (displacements per atom). The specimen s final dose, temperature, and stress conditions have been reported by INL and were used during this analysis. The derived creep coefficients (K) were calculated for each grade and were found to compare well to literature data for the creep coefficient, even under the wide range of AGC-1 specimen temperatures. Comparisons were made between AGC-1 data and historical grade data for creep coefficients.« less
A fluid-structure interaction model of soft robotics using an active strain approach
NASA Astrophysics Data System (ADS)
Hess, Andrew; Lin, Zhaowu; Gao, Tong
2017-11-01
Soft robotic swimmers exhibit rich dynamics that stem from the non-linear interplay of the fluid and immersed soft elastic body. Due to the difficulty of handling the nonlinear two-way coupling of hydrodynamic flow and deforming elastic body, studies of flexible swimmers often employ either one-way coupling strategies with imposed motions of the solid body or some simplified elasticity models. To explore the nonlinear dynamics of soft robots powered by smart soft materials, we develop a computational model to deal with the two-way fluid/elastic structure interactions using the fictitious domain method. To mimic the dynamic response of the functional soft material under external actuations, we assume the solid phase to be neo-Hookean, and employ an active strain approach to incorporate actuation, which is based on the multiplicative decomposition of the deformation gradient tensor. We demonstrate the capability of our algorithm by performing a series of numerical explorations that manipulate an elastic structure with finite thickness, starting from simple rectangular or circular plates to soft robot prototypes such as stingrays and jellyfish.
Hoshino, Y; Sereno, M M; Midthun, K; Flores, J; Kapikian, A Z; Chanock, R M
1985-01-01
Antiserum prepared against the M37 strain of rotavirus, recovered from an asymptomatic newborn infant in Venezuela, neutralized two prototype human rotaviruses that define two separate serotypes: serotype 1 (Wa) and serotype 4 (ST3). Thus, the M37 strain is a naturally occurring intertypic rotavirus. Analysis of reassortant viruses produced during coinfection in vitro indicated that the observed dual serotype specificity of M37 resulted from sharing a related outer capsid protein, VP3, with the ST3 virus and another related outer capsid protein, VP7, with the Wa virus. Analysis of single (VP3)-gene-substitution reassortants indicated that VP3 was as potent an immunogen as VP7. In addition, direct evidence was obtained that the serotype specificity of neutralizing antibody elicited by VP3 can differ from the serotype specificity of neutralizing antibody elicited by VP7, indicating the need for a dual system of rotavirus classification in which the neutralization specificity of both VP3 and VP7 outer capsid proteins are identified. Images PMID:3001716
Magnetostrictive direct drive motors
NASA Technical Reports Server (NTRS)
Naik, Dipak; Dehoff, P. H.
1992-01-01
A new rare earth alloy, Terfenol-D, combines low frequency operation and extremely high energy density with high magnetostriction. Its material properties make it suitable as a drive element for actuators requiring high output torque. The high strains, the high forces and the high controllability of Terfenol alloys provide a powerful and challenging basis for new ways to generate motion in actuators. Two prototypes of motors using Terfenol-D rods were developed at NASA Goddard. The basic principles of operation are provided of the motor along with other relevant details. A conceptual design of a torque limiting safety clutch/brake under development is illustrated. Also, preliminary design drawings of a linear actuator using Terfenol-D is shown.
Palacios, Gustavo; Forrester, Naomi L; Savji, Nazir; Travassos da Rosa, Amelia P A; Guzman, Hilda; Detoy, Kelly; Popov, Vsevolod L; Walker, Peter J; Lipkin, W Ian; Vasilakis, Nikos; Tesh, Robert B
2013-07-01
Farmington virus (FARV) is a rhabdovirus that was isolated from a wild bird during an outbreak of epizootic eastern equine encephalitis on a pheasant farm in Connecticut, USA. Analysis of the nearly complete genome sequence of the prototype CT AN 114 strain indicates that it encodes the five canonical rhabdovirus structural proteins (N, P, M, G and L) with alternative ORFs (> 180 nt) in the N and G genes. Phenotypic and genetic characterization of FARV has confirmed that it is a novel rhabdovirus and probably represents a new species within the family Rhabdoviridae. In sum, our analysis indicates that FARV represents a new species within the family Rhabdoviridae.
In-vitro bacterial identification using fluorescence spectroscopy with an optical fiber system
NASA Astrophysics Data System (ADS)
Spector, Brian C.; Werkhaven, Jay A.; Smith, Dana; Reinisch, Lou
2000-05-01
Acute otitis media (AOM) remains a source of significant morbidity in children. With the emergence of antibiotic resistant strains of bacteria, tympanocentesis has become an important method of bacterial identification in the setting of treatment failures. Previous studies described a prototype system for the non-invasive fluorescence identification of bacteria in vitro. We demonstrate the addition of an optical fiber to allow for the identification of a specimen distant to the spectrofluorometer. Emission spectra from three bacteria, Streptococcus pneumoniae, Haemophilus influenzae, and Staphylococcus aureus were successfully obtained in vitro. This represents a necessary step prior to the study of in vivo identification of bacteria in AOM using fluorescence spectroscopy.
Austin, F J
1978-09-01
Ten strains of Johnston Atoll (JA) virus were isolated from Ornithodoros capensis collected in a Gannet (Sula bassana serrator) colony in New Zealand. Its sensitivity to ether and sodium deoxycholate were confirmed and it was shown to have an RNA genome. It multiplied in day-old chicks but, unlike the prototype virus, it was not pathogenic for them. Transmission experiments and the high incidence of birds with neutralizing antibody indicate that the virus is maintained in the colony by a cycle involving ticks and Gannets. This is the first recorded tickborne arbovirus in New Zealand and extends the known range of JA virus from the tropics into the temperate zone.
Bandyopadhyay, Anindita; Elvitigala, Thanura; Welsh, Eric; Stöckel, Jana; Liberton, Michelle; Min, Hongtao; Sherman, Louis A.; Pakrasi, Himadri B.
2011-01-01
ABSTRACT The genus Cyanothece comprises unicellular cyanobacteria that are morphologically diverse and ecologically versatile. Studies over the last decade have established members of this genus to be important components of the marine ecosystem, contributing significantly to the nitrogen and carbon cycle. System-level studies of Cyanothece sp. ATCC 51142, a prototypic member of this group, revealed many interesting metabolic attributes. To identify the metabolic traits that define this class of cyanobacteria, five additional Cyanothece strains were sequenced to completion. The presence of a large, contiguous nitrogenase gene cluster and the ability to carry out aerobic nitrogen fixation distinguish Cyanothece as a genus of unicellular, aerobic nitrogen-fixing cyanobacteria. Cyanothece cells can create an anoxic intracellular environment at night, allowing oxygen-sensitive processes to take place in these oxygenic organisms. Large carbohydrate reserves accumulate in the cells during the day, ensuring sufficient energy for the processes that require the anoxic phase of the cells. Our study indicates that this genus maintains a plastic genome, incorporating new metabolic capabilities while simultaneously retaining archaic metabolic traits, a unique combination which provides the flexibility to adapt to various ecological and environmental conditions. Rearrangement of the nitrogenase cluster in Cyanothece sp. strain 7425 and the concomitant loss of its aerobic nitrogen-fixing ability suggest that a similar mechanism might have been at play in cyanobacterial strains that eventually lost their nitrogen-fixing ability. PMID:21972240
Magri, Mariana Cavalheiro; Brigido, Luis Fernando de Macedo; Morimoto, Helena Kaminami
2013-01-01
Abstract The human T cell lymphotropic virus type 2 (HTLV-2) is found mainly in Amerindians and in intravenous drug users (IDUs) from urban areas of the United States, Europe, and Latin America. Worldwide, HTLV-2a and HTLV-2b subtypes are the most prevalent. Phylogenetic analysis of HTLV-2 isolates from Brazil showed the HTLV-2a subtype, variant -2c, which spread from Indians to the general population and IDUs. The present study searched for the types of HTLV-2 that predominate among HIV-1-coinfected patients from southern and southeastern Brazil. Molecular characterization of the LTR, env, and tax regions of 38 isolates confirmed the HTLV-2c variant in 37 patients, and one HTLV-2b in a patient from Paraguay. Phylogenetic analysis of sequences showed different clades of HTLV-2 associated with risk factors and geographic region. These clades could represent different routes of virus transmission and/or little diverse evolutionary rates of virus. Taking into account the results obtained in the present study and the lack of the prototypic North American HTLV-2a strain and HTLV-2b subtypes commonly detected among HIV-coinfected individuals worldwide, we could speculate on the introduction of Brazilian HTLV-2 strains in such populations before the introduction of HIV. PMID:23484539
Xie, Gary; Johnson, Shannon Lyn; Davenport, Karen Walston; ...
2017-08-29
Here, the genetic make-up of most bacteria is encoded in a single chromosome while about 10% have more than one chromosome. Among these, Vibrio cholerae, with two chromosomes, has served as a model system to study various aspects of chromosome maintenance, mainly replication, and faithful partitioning of multipartite genomes. Here, we describe the genomic characterization of strains that are an exception to the two chromosome rules: naturally occurring single-chromosome V. cholerae. Whole genome sequence analyses of NSCV1 and NSCV2 (natural single-chromosome vibrio) revealed that the Chr1 and Chr2 fusion junctions contain prophages, IS elements, and direct repeats, in addition tomore » large-scale chromosomal rearrangements such as inversions, insertions, and long tandem repeats elsewhere in the chromosome compared to prototypical two chromosome V. cholerae genomes. Many of the known cholera virulence factors are absent. The two origins of replication and associated genes are generally intact with synonymous mutations in some genes, as arerecAand mismatch repair (MMR) genes dam, mutH, and mutL; MutS function is probably impaired in NSCV2. These strains are ideal tools for studying mechanistic aspects of maintenance of chromosomes with multiple origins and other rearrangements and the biological, functional, and evolutionary significance of multipartite genome architecture in general.« less
Blom, D; Fabbri, C; Connor, E C; Schiestl, F P; Klauser, D R; Boller, T; Eberl, L; Weisskopf, L
2011-11-01
Recent studies have suggested that bacterial volatiles play an important role in bacterial-plant interactions. However, few reports of bacterial species that produce plant growth modulating volatiles have been published, raising the question whether this is just an anecdotal phenomenon. To address this question, we performed a large screen of strains originating from the soil for volatile-mediated effects on Arabidopsis thaliana. All of the 42 strains tested showed significant volatile-mediated plant growth modulation, with effects ranging from plant death to a sixfold increase in plant biomass. The effects of bacterial volatiles were highly dependent on the cultivation medium and the inoculum quantity. GC-MS analysis of the tested strains revealed over 130 bacterial volatile compounds. Indole, 1-hexanol and pentadecane were selected for further studies because they appeared to promote plant growth. None of these compounds triggered a typical defence response, using production of ethylene and of reactive oxygen species (ROS) as read-outs. However, when plants were challenged with the flg-22 epitope of bacterial flagellin, a prototypical elicitor of defence responses, additional exposure to the volatiles reduced the flg-22-induced production of ethylene and ROS in a dose-dependent manner, suggesting that bacterial volatiles may act as effectors to inhibit the plant's defence response. © 2011 Society for Applied Microbiology and Blackwell Publishing Ltd.
Stell, F M; Roe, R M; Arellano, C; Kennedy, L; Thornton, H; Saavedra-Rodriguez, K; Wesson, D M; Black, W C; Apperson, C S
2013-09-01
Aedes aegypti L. (Stegomyia aegypti) (Diptera: Culicidae) is the principal vector of dengue and yellow fever viruses in tropical and subtropical regions of the world. Disease management is largely based on mosquito control achieved by insecticides applied to interior resting surfaces and through space sprays. Population monitoring to detect insecticide resistance is a significant component of integrated disease management programmes. We developed a bioassay method for assessing insecticide susceptibility based on the feeding activity of mosquitoes on plant sugars. Our prototype sugar-insecticide feeding bioassay system was composed of inexpensive, disposable components, contained minimal volumes of insecticide, and was compact and highly transportable. Individual mosquitoes were assayed in a plastic cup that contained a sucrose-permethrin solution. Trypan blue dye was added to create a visual marker in the mosquito's abdomen for ingested sucrose-permethrin solution. Blue faecal spots provided further evidence of solution ingestion. With the sugar-insecticide feeding bioassay, the permethrin susceptibility of Ae. aegypti females from two field-collected strains was characterized by probit analysis of dosage-response data. The field strains were also tested by forced contact of females with permethrin residues on filter paper. Dosage-response patterns were similar, indicating that the sugar-insecticide feeding bioassay had appropriately characterized the permethrin susceptibility of the two strains. © 2012 The Royal Entomological Society.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Xie, Gary; Johnson, Shannon Lyn; Davenport, Karen Walston
Here, the genetic make-up of most bacteria is encoded in a single chromosome while about 10% have more than one chromosome. Among these, Vibrio cholerae, with two chromosomes, has served as a model system to study various aspects of chromosome maintenance, mainly replication, and faithful partitioning of multipartite genomes. Here, we describe the genomic characterization of strains that are an exception to the two chromosome rules: naturally occurring single-chromosome V. cholerae. Whole genome sequence analyses of NSCV1 and NSCV2 (natural single-chromosome vibrio) revealed that the Chr1 and Chr2 fusion junctions contain prophages, IS elements, and direct repeats, in addition tomore » large-scale chromosomal rearrangements such as inversions, insertions, and long tandem repeats elsewhere in the chromosome compared to prototypical two chromosome V. cholerae genomes. Many of the known cholera virulence factors are absent. The two origins of replication and associated genes are generally intact with synonymous mutations in some genes, as arerecAand mismatch repair (MMR) genes dam, mutH, and mutL; MutS function is probably impaired in NSCV2. These strains are ideal tools for studying mechanistic aspects of maintenance of chromosomes with multiple origins and other rearrangements and the biological, functional, and evolutionary significance of multipartite genome architecture in general.« less
Shmelkov, Evgeny; Krachmarov, Chavdar; Grigoryan, Arsen V.; Pinter, Abraham; Statnikov, Alexander; Cardozo, Timothy
2014-01-01
The extreme diversity of HIV-1 strains presents a formidable challenge for HIV-1 vaccine design. Although antibodies (Abs) can neutralize HIV-1 and potentially protect against infection, antibodies that target the immunogenic viral surface protein gp120 have widely variable and poorly predictable cross-strain reactivity. Here, we developed a novel computational approach, the Method of Dynamic Epitopes, for identification of neutralization epitopes targeted by anti-HIV-1 monoclonal antibodies (mAbs). Our data demonstrate that this approach, based purely on calculated energetics and 3D structural information, accurately predicts the presence of neutralization epitopes targeted by V3-specific mAbs 2219 and 447-52D in any HIV-1 strain. The method was used to calculate the range of conservation of these specific epitopes across all circulating HIV-1 viruses. Accurately identifying an Ab-targeted neutralization epitope in a virus by computational means enables easy prediction of the breadth of reactivity of specific mAbs across the diversity of thousands of different circulating HIV-1 variants and facilitates rational design and selection of immunogens mimicking specific mAb-targeted epitopes in a multivalent HIV-1 vaccine. The defined epitopes can also be used for the purpose of epitope-specific analyses of breakthrough sequences recorded in vaccine clinical trials. Thus, our study is a prototype for a valuable tool for rational HIV-1 vaccine design. PMID:24587168
Stress, deformation and micromorphological aspects of soil freezing under laboratory conditions
NASA Astrophysics Data System (ADS)
Jetchick, Elizabeth
In this thesis, frost heave is viewed as a process resulting from the interactions between thermodynamic conditions, soil environment controls such as texture, stress/deformation conditions and soil microstructure. A series of laboratory experiments was devised to investigate the links between these aspects. Because a limited number of studies exist on the development of internal stresses and strains in freezing soil, the work focussed on obtaining rheological data using conventional soil strain gauges and prototype stress transducers. A fine-grained unstructured silt was placed in a column (30 cm diameter by 100 cm length) and subjected to freezing and freeze-thaw cycles from the top down, lasting up to three months. Heat and water flows, as well as stresses and strains were monitored. The frozen soil was sectioned at the end of four of the experiments to examine the soil fabrics that had developed. From the experimental results, schematic stress and strain curves are proposed. For a single freeze cycle, compressive normal and tensile normal stresses were recorded simultaneously by the measuring devices within the freezing soil profile. Ice lens inception took place when the stress field changed, a condition which occurred either at the frost front level or at the base of the growing ice lens. Negative and positive strains reflected the different stress states that were sustained below and above the freezing front. Negative strains or soil consolidation took place as stresses increased before the passage of the frost line. Negligible soil strains were recorded as maximum soil consolidation was attained, before soil expansion. Distinct positive strain patterns indicating secondary and continuing heave, were recorded simultaneously throughout a thickness of soil, over a range of temperatures. Ice lens growth mostly took place as secondary frost heave, but continuing heave was measured, and the temperature conditions for both types of heave were determined. During subsequent freeze-thaw cycles, the stress patterns upon freezing were more complex in the second and third cycles due to previous soil structuration. At thaw, the stress pattern was uniform although positive strains in excess of those generated at freezing were recorded over the course of a few hours. Specific soil fabrics and features were evident from a single freeze cycle and for freeze-thaw conditions. Formation mechanisms are proposed for certain fabrics and features. A zonation with depth of these fabrics can be linked to the stress strain history of the soil, revealing the links and feedbacks between rheological processes and cryogenic soil structures.
Fast Dissemination of New HIV-1 CRF02/A1 Recombinants in Pakistan
Chen, Yue; Hora, Bhavna; DeMarco, Todd; Shah, Sharaf Ali; Ahmed, Manzoor; Sanchez, Ana M.; Su, Chang; Carter, Meredith; Stone, Mars; Hasan, Rumina; Hasan, Zahra; Busch, Michael P.; Denny, Thomas N.; Gao, Feng
2016-01-01
A number of HIV-1 subtypes are identified in Pakistan by characterization of partial viral gene sequences. Little is known whether new recombinants are generated and how they disseminate since whole genome sequences for these viruses have not been characterized. Near full-length genome (NFLG) sequences were obtained by amplifying two overlapping half genomes or next generation sequencing from 34 HIV-1-infected individuals in Pakistan. Phylogenetic tree analysis showed that the newly characterized sequences were 16 subtype As, one subtype C, and 17 A/G recombinants. Further analysis showed that all 16 subtype A1 sequences (47%), together with the vast majority of sequences from Pakistan from other studies, formed a tight subcluster (A1a) within the subtype A1 clade, suggesting that they were derived from a single introduction. More in-depth analysis of 17 A/G NFLG sequences showed that five shared similar recombination breakpoints as in CRF02 (15%) but were phylogenetically distinct from the prototype CRF02 by forming a tight subcluster (CRF02a) while 12 (38%) were new recombinants between CRF02a and A1a or a divergent A1b viruses. Unique recombination patterns among the majority of the newly characterized recombinants indicated ongoing recombination. Interestingly, recombination breakpoints in these CRF02/A1 recombinants were similar to those in prototype CRF02 viruses, indicating that recombination at these sites more likely generate variable recombinant viruses. The dominance and fast dissemination of new CRF02a/A1 recombinants over prototype CRF02 suggest that these recombinant have more adapted and may become major epidemic strains in Pakistan. PMID:27973597
Prototyping of automotive components with variable width and depth
NASA Astrophysics Data System (ADS)
Abeyrathna, B.; Rolfe, B.; Harrasser, J.; Sedlmaier, A.; Ge, Rui; Pan, L.; Weiss, M.
2017-09-01
Roll forming enables the manufacturing of longitudinal components from materials that combine high strength with limited formability and is increasingly used in the automotive industry for the manufacture of structural and crash components. An extension of conventional roll forming is the Flexible Roll Forming (FRF) process where the rolls are no longer fixed in space but are free to move which enables the forming of components with variable cross section over the length of the part. Even though FRF components have high weight saving potential the technology has found only limited application in the automotive industry. A new flexible forming facility has recently been developed that enables proof of concept studies and the production of FRF prototypes before a full FRF line is built; this may lead to a wider uptake of the FRF technology in the automotive industry. In this process, the pre-cut blank is placed between two clamps and the whole set up moves back and forth; a forming roll that is mounted on a servo-controlled platform with six degrees of freedom forms the pre-cut blank to the desired shape. In this study an initial forming concept for the flexible roll forming of an automotive component with variable height is developed using COPRA® FEA RF. This is followed by performing experimental prototyping studies on the new concept forming facility. Using the optical strain measurement system Autogrid Compact, material deformation, part shape and wrinkling severity are analysed for some forming passes and compared with the numerical results. The results show that the numerical model gives a good representation of material behaviour and that with increasing forming severity wrinkling issues need to be overcome in the process.
Fracture-tough, corrosion-resistant bearing steels
NASA Technical Reports Server (NTRS)
Olson, Gregory B.
1990-01-01
The fundamental principles allowing design of stainless bearing steels with enhanced toughness and stress corrosion resistance has involved both investigation of basic phenomena in model alloys and evaluation of a prototype bearing steel based on a conceptual design exercise. Progress in model studies has included a scanning Auger microprobe (SAM) study of the kinetics of interfacial segregation of embrittling impurities which compete with the kinetics of alloy carbide precipitation in secondary hardening steels. These results can define minimum allowable carbide precipitation rates and/or maximum allowable free impurity contents in these ultrahigh strength steels. Characterization of the prototype bearing steel designed to combine precipitated austenite transformation toughening with secondary hardening shows good agreement between predicted and observed solution treatment response including the nature of the high temperature carbides. An approximate equilibrium constraint applied in the preliminary design calculations to maintain a high martensitic temperature proved inadequate, and the solution treated alloy remained fully austenitic down to liquid nitrogen temperature rather than transforming above 200 C. The alloy can be martensitically transformed by cryogenic deformation, and material so processed will be studied further to test predicted carbide and austenite precipitation behavior. A mechanistically-based martensitic kinetic model was developed and parameters are being evaluated from available kinetic data to allow precise control of martensitic temperatures of high alloy steels in future designs. Preliminary calculations incorporating the prototype stability results suggest that the transformation-toughened secondary-hardening martensitic-stainless design concept is still viable, but may require lowering Cr content to 9 wt. pct. and adding 0.5 to 1.0 wt. pct. Al. An alternative design approach based on strain-induced martensitic transformation during cryogenic forming, thus removing the high martensitic constraint, may permit alloy compositions offering higher fracture roughness.
Ching, W.-M.; Wang, H.; Eamsila, C.; Kelly, D. J.; Dasch, G. A.
1998-01-01
The variable 56-kDa major outer membrane protein of Orientia tsutsugamushi is the immunodominant antigen in human scrub typhus infections. The gene encoding this protein from Karp strain was cloned into the expression vector pET11a. The recombinant protein (r56) was expressed as a truncated nonfusion protein (amino acids 80 to 456 of the open reading frame) which formed an inclusion body when expressed in Escherichia coli BL21. Refolded r56 was purified and compared to purified whole-cell lysate of the Karp strain of O. tsutsugamushi by immunoglobulin G (IgG) enzyme-linked immunosorbent assay (ELISA) for reactivity with rabbit sera prepared against eight antigenic prototypes of O. tsutsugamushi as well as several other species of Rickettsiales and nonrickettsial antigens. Refolded r56 exhibited broad reactivity with the rabbit antisera against the Orientia prototypes, and the ELISA reactions with the r56 and Karp whole-cell lysate antigens correlated well (r = 0.81, n = 22, sensitivity compared to that of standard ELISA of 91%). Refolded r56 did not react with most antisera against other rickettsial species or control antigens (specificity = 92%, n = 13) using a positive cutoff value determined with eight uninfected rabbit sera. Refolded r56 was evaluated further by ELISA, using 128 sera obtained from patients with suspected scrub typhus from Korat, Thailand, and 74 serum specimens from healthy Thai soldiers. By using the indirect immunoperoxidase assay as the reference assay, the recombinant antigen exhibited a sensitivity and specificity of 93% or greater for detection of both IgG and IgM in the ELISA at 1:400 serum dilution. These results strongly suggest that purified r56 is a suitable candidate for replacing the density gradient-purified, rickettsia-derived, whole-cell antigen currently used in the commercial dipstick assay available in the United States. PMID:9665960
Ching, W M; Wang, H; Eamsila, C; Kelly, D J; Dasch, G A
1998-07-01
The variable 56-kDa major outer membrane protein of Orientia tsutsugamushi is the immunodominant antigen in human scrub typhus infections. The gene encoding this protein from Karp strain was cloned into the expression vector pET11a. The recombinant protein (r56) was expressed as a truncated nonfusion protein (amino acids 80 to 456 of the open reading frame) which formed an inclusion body when expressed in Escherichia coli BL21. Refolded r56 was purified and compared to purified whole-cell lysate of the Karp strain of O. tsutsugamushi by immunoglobulin G (IgG) enzyme-linked immunosorbent assay (ELISA) for reactivity with rabbit sera prepared against eight antigenic prototypes of O. tsutsugamushi as well as several other species of Rickettsiales and nonrickettsial antigens. Refolded r56 exhibited broad reactivity with the rabbit antisera against the Orientia prototypes, and the ELISA reactions with the r56 and Karp whole-cell lysate antigens correlated well (r = 0.81, n = 22, sensitivity compared to that of standard ELISA of 91%). Refolded r56 did not react with most antisera against other rickettsial species or control antigens (specificity = 92%, n = 13) using a positive cutoff value determined with eight uninfected rabbit sera. Refolded r56 was evaluated further by ELISA, using 128 sera obtained from patients with suspected scrub typhus from Korat, Thailand, and 74 serum specimens from healthy Thai soldiers. By using the indirect immunoperoxidase assay as the reference assay, the recombinant antigen exhibited a sensitivity and specificity of 93% or greater for detection of both IgG and IgM in the ELISA at 1:400 serum dilution. These results strongly suggest that purified r56 is a suitable candidate for replacing the density gradient-purified, rickettsia-derived, whole-cell antigen currently used in the commercial dipstick assay available in the United States.
2010-01-01
Background BamHI-A rightward frame-1 (BARF1) is a carcinoma-specific Epstein-Barr virus (EBV) encoded oncogene. Here we describe the BARF1 sequence diversity in nasopharyngeal carcinoma (NPC), other EBV-related diseases and Indonesian healthy EBV carriers in relation to EBV genotype, viral load and serology markers. Nasopharyngeal brushings from 56 NPC cases, blood or tissue from 15 other EBV-related disorders, spontaneous B cell lines (LCL) from 5 Indonesian healthy individuals and several prototype EBV isolates were analysed by PCR-direct sequencing. Results Most NPC isolates revealed specific BARF1 nucleotide changes compared to prototype B95-8 virus. At the protein level these mutations resulted in 3 main substitutions (V29A, W72G, H130R), which are not considered to cause gross tertiary structure alterations in the hexameric BARF1 protein. At least one amino acid conversion was detected in 80.3% of NPC samples compared to 33.3% of non-NPC samples (p < 0.001) and 40.0% of healthy LCLs (p = 0.074). NPC isolates also showed more frequent codon mutation than non-NPC samples. EBV strain typing revealed most isolates as EBV type 1. The viral load of either NPC or non-NPC samples was high, but only in non- NPC group it related to a particular BARF1 variant. Serology on NPC sera using IgA/EBNA-1 ELISA, IgA/VCA-p18 ELISA and immunoblot score showed no relation with BARF1 sequence diversity (p = 0.802, 0.382 and 0.058, respectively). NPC patients had variable antibody reactivity against purified hexameric NPC-derived BARF1 irrespective of the endogenous BARF1 sequence. Conclusion The sequence variation of BARF1 observed in Indonesian NPC patients and controls may reflect a natural selection of EBV strains unlikely to be predisposing to carcinogenesis. The conserved nature of BARF1 may reflect an important role in EBV (epithelial) persistence. PMID:20849661
Hutajulu, Susanna H; Hoebe, Eveline K; Verkuijlen, Sandra Awm; Fachiroh, Jajah; Hariwijanto, Bambang; Haryana, Sofia M; Stevens, Servi Jc; Greijer, Astrid E; Middeldorp, Jaap M
2010-09-19
BamHI-A rightward frame-1 (BARF1) is a carcinoma-specific Epstein-Barr virus (EBV) encoded oncogene. Here we describe the BARF1 sequence diversity in nasopharyngeal carcinoma (NPC), other EBV-related diseases and Indonesian healthy EBV carriers in relation to EBV genotype, viral load and serology markers. Nasopharyngeal brushings from 56 NPC cases, blood or tissue from 15 other EBV-related disorders, spontaneous B cell lines (LCL) from 5 Indonesian healthy individuals and several prototype EBV isolates were analysed by PCR-direct sequencing. Most NPC isolates revealed specific BARF1 nucleotide changes compared to prototype B95-8 virus. At the protein level these mutations resulted in 3 main substitutions (V29A, W72G, H130R), which are not considered to cause gross tertiary structure alterations in the hexameric BARF1 protein. At least one amino acid conversion was detected in 80.3% of NPC samples compared to 33.3% of non-NPC samples (p < 0.001) and 40.0% of healthy LCLs (p = 0.074). NPC isolates also showed more frequent codon mutation than non-NPC samples. EBV strain typing revealed most isolates as EBV type 1. The viral load of either NPC or non-NPC samples was high, but only in non- NPC group it related to a particular BARF1 variant. Serology on NPC sera using IgA/EBNA-1 ELISA, IgA/VCA-p18 ELISA and immunoblot score showed no relation with BARF1 sequence diversity (p = 0.802, 0.382 and 0.058, respectively). NPC patients had variable antibody reactivity against purified hexameric NPC-derived BARF1 irrespective of the endogenous BARF1 sequence. The sequence variation of BARF1 observed in Indonesian NPC patients and controls may reflect a natural selection of EBV strains unlikely to be predisposing to carcinogenesis. The conserved nature of BARF1 may reflect an important role in EBV (epithelial) persistence.
2015-01-01
One-dimensional (1D) boron nitride nanotube (BNNT) and 2D hexagonal BN (h-BN) are attractive for demonstrating fundamental physics and promising applications in nano-/microscale devices. However, there is a high anisotropy associated with these BN allotropes as their excellent properties are either along the tube axis or in-plane directions, posing an obstacle in their widespread use in technological and industrial applications. Herein, we report a series of 3D BN prototypes, namely, pillared boron nitride (PBN), by fusing single-wall BNNT and monolayer h-BN aimed at filling this gap. We use density functional theory and molecular dynamics simulations to probe the diverse mechano-mutable properties of PBN prototypes. Our results demonstrate that the synergistic effect of the tubes, junctions, and sheets imparts cooperative deformation mechanisms, which overcome the intrinsic limitations of the PBN constituents and provide a number of superior characteristics including 3D balance of strength and toughness, emergence of negative Poisson’s ratio, and elimination of strain softening along the armchair orientation. These features, combined with the ultrahigh surface area and lightweight structure, render PBN as a 3D multifunctional template for applications in graphene-based nanoelectronics, optoelectronics, gas storage, and functional composites with fascinating in-plane and out-of-plane tailorable properties. PMID:25289114
X-Ray Backscatter Machine Support Frame
NASA Technical Reports Server (NTRS)
Cannon, Brooke
2010-01-01
This summer at Kennedy Space Center, I spent 10 weeks as an intern working at the Prototype Development Lab. During this time I learned about the design and machining done here at NASA. I became familiar with the process from where a design begins in Pro/Engineer and finishes at the hands of the machinists. As an intern I was given various small jobs to do and then one project of my own. My personal project was a job for the Applied Physics Lab; in their work they use an X-Ray Backscatter machine. Previously it was resting atop a temporary frame that limited the use of the machine. My job was to design a frame for the machine to rest upon that would allow a full range of sample sizes. The frame was required to support the machine and provide a strain relief for the cords attached to the machine as it moved in the x and y directions. Calculations also had to be done to be sure the design would be able to withstand any loads or outside sources of stress. After the calculations proved the design to be ready to withstand the requirements, the parts were ordered or fabricated, as required. This helped me understand the full process of jobs sent to the Prototype Development Lab.
Amimo, J O; Vlasova, A N; Saif, L J
2013-05-31
Swine fecal samples collected from seven farms were screened for group C rotaviruses (RVCs) using a reverse transcription-polymerase chain reaction assay. A total of 380 samples were tested and 19.5% were positive. Of the 128 samples collected in 2012, 23.5% from nursing piglets and 8.5% from weaned piglets were RVC positive, with a higher RVC frequency in diarrheic (28.4%) than in non-diarrheic (6.6%) piglets. Two strains (RVC/Pig-wt/USA/RV0104/2011/G3PX and RVC/Pig-wt/USA/RV0143/2012/G6Px) from two different farms were characterized genetically to gain information on virus diversity based on full length sequences of the inner capsid VP6, enterotoxin NSP4 and the outer capsid VP7 and VP4 (partial for RV0104) genes. The VP6 gene of the two strains showed high (99%) nucleotide identity to one another, 84-91% identity to other porcine RVCstrains and 81-82% identity to human and bovine RVC strains. The NSP4 gene analysis revealed that RVC/Pig-wt/USA/RV0104/2011/G3PX and RVC/Pig-wt/USA/RV0143/2012/G6Px strains were not closely related to each other (87% identity), but shared higher identity with prototype RVC/Pig-wt/USA/Cowden/1980/G1Px strain (93% and 89%, respectively) and were more distantly related to human strains (72-76% identity). The VP7 gene analysis indicated that the two strains were distantly related to one another (72% identity). RVC/Pig-wt/USA/RV0143/2012/G6Px was most closely related to porcine RVC G6 strains (82-86% identity), whereas RVC/Pig-wt/USA/RV0104/2011/G3PX was most closely related to porcine HF (G3) strain (94% identity). Analysis of the full length nucleotide sequence of the VP4 gene revealed that RVC/Pig-wt/USA/RV0143/2012/G6Px was distantly related to porcine (75%), bovine (74%) and human (70%) strains. The deduced amino acid identities (69.5-75.6%) of VP4 between RVC/Pig-wt/USA/RV0143/2012/G6Px and other RVCs were low; hence, we propose that this strain comprises a new VP4 genotype. Our results indicate high genetic heterogeneity in RVCs genes and the concurrent co-circulation of different genotypes at the same time. Our findings are useful for the development of more accurate diagnostic tools, for basic research to understand gene function and to provide information for RVC diversity germane to vaccine development. Copyright © 2013 Elsevier B.V. All rights reserved.
Tamber, Sandeep; Schwartzman, Joseph; Cheung, Ambrose L
2010-08-01
The regulation of cellular processes by eukaryote-like serine/threonine kinases is widespread in bacteria. In the last 2 years, several studies have examined the role of serine/threonine kinases in Staphylococcus aureus on cell wall metabolism, autolysis, and virulence, mostly in S. aureus laboratory isolates in the 8325-4 lineage. In this study, we showed that the pknB gene (also called stk1) of methicillin-resistant S. aureus (MRSA) strain COL and the community-acquired MRSA (CA-MRSA) strain USA300 is involved in cell wall metabolism, with the pknB mutant exhibiting enhanced sensitivity to beta-lactam antibiotics but not to other classes of antibiotics, including aminoglycosides, ciprofloxacin, bactrim, and other types of cell wall-active agents (e.g., vancomycin and bacitracin). Additionally, the pknB mutant of USA300 was found to be more resistant to Triton X-100-induced autolysis and also to lysis by lysostaphin. We also showed that pknB is a positive regulator of sigB activity, resulting in compromise in its response to heat and oxidative stresses. In association with reduced sigB activity, the expression levels of RNAII and RNAIII of agr and the downstream effector hla are upregulated while spa expression is downmodulated in the pknB mutant compared to the level in the parent. Consistent with an enhanced agr response in vitro, virulence studies of the pknB mutant of USA300 in a murine cutaneous model of infection showed that the mutant was more virulent than the parental strain. Collectively, our results have linked the pknB gene in CA-MRSA to antibiotic resistance, sigB activity, and virulence and have highlighted important differences in pknB phenotypes (virulence and sigB activity) between laboratory isolates and the prototypic CA-MRSA strain USA300.
Bayer, Arnold S; Mishra, Nagendra N; Chen, Liang; Kreiswirth, Barry N; Rubio, Aileen; Yang, Soo-Jin
2015-08-01
MprF is responsible for the lysinylation of phosphatidylglycerol (PG) to synthesize the positively charged phospholipid (PL) species, lysyl-PG (L-PG). It has been proposed that the single-nucleotide polymorphisms (SNPs) within the mprF open reading frame (ORF) are associated with a gain-in-function phenotype in terms of daptomycin resistance in Staphylococcus aureus. (Note that although the official term is daptomycin nonsusceptibility, we use the term daptomycin resistance in this paper for ease of presentation.) Using 22 daptomycin-susceptible (DAP(s))/daptomycin-resistant (DAP(r)) clinical methicillin-resistant S. aureus (MRSA) strain pairs, we assessed (i) the frequencies and distribution of putative mprF gain-in-function SNPs, (ii) the relationships of the SNPs to both daptomycin resistance and cross-resistance to the prototypical endovascular host defense peptide (HDP) thrombin-induced platelet microbicidal protein (tPMP), and (iii) the impact of mprF SNPs on positive surface charge phenotype and modifications of membrane PL profiles. Most of the mprF SNPs identified in our DAP(r) strains were clustered within the two MprF loci, (i) the central bifunctional domain and (ii) the C-terminal synthase domain. Moreover, we were able to correlate the presence and location of mprF SNPs in DAP(r) strains with HDP cross-resistance, positive surface charge, and L-PG profiles. Although DAP(r) strains with mprF SNPs in the bifunctional domain showed higher resistance to tPMPs than DAP(r) strains with SNPs in the synthase domain, this relationship was not observed in positive surface charge assays. These results demonstrated that both charge-mediated and -unrelated mechanisms are involved in DAP resistance and HDP cross-resistance in S. aureus. Copyright © 2015, American Society for Microbiology. All Rights Reserved.
Three-axial Fiber Bragg Grating Strain Sensor for Volcano Monitoring
NASA Astrophysics Data System (ADS)
Giacomelli, Umberto; Beverini, Nicolò; Carbone, Daniele; Carelli, Giorgio; Francesconi, Francesco; Gambino, Salvatore; Maccioni, Enrico; Morganti, Mauro; Orazi, Massimo; Peluso, Rosario; Sorrentino, Fiodor
2017-04-01
Fiber optic and FBGs sensors have attained a large diffusion in the last years as cost-effective monitoring and diagnostic devices in civil engineering. However, in spite of their potential impact, these instruments have found very limited application in geophysics. In order to study earthquakes and volcanoes, the measurement of crustal deformation is of crucial importance. Stress and strain behaviour is among the best indicators of changes in the activity of volcanoes .. Deep bore-hole dilatometers and strainmeters have been employed for volcano monitoring. These instruments are very sensitive and reliable, but are not cost-effective and their installation requires a large effort. Fiber optic based devices offer low cost, small size, wide frequency band, easier deployment and even the possibility of creating a local network with several sensors linked in an array. We present the realization, installation and first results of a shallow-borehole (8,5 meters depth) three-axial Fiber Bragg Grating (FBG) strain sensor prototype. This sensor has been developed in the framework of the MED-SUV project and installed on Etna volcano, in the facilities of the Serra La Nave astrophysical observatory. The installation siteis about 7 Km South-West of the summit craters, at an elevation of about 1740 m. The main goal of our work is the realization of a three-axial device having a high resolution and accuracy in static and dynamic strain measurements, with special attention to the trade-off among resolution, cost and power consumption. The sensor structure and its read-out system are innovative and offer practical advantages in comparison with traditional strain meters. Here we present data collected during the first five months of operation. In particular, the very clear signals recorded in the occurrence of the Central Italy seismic event of October 30th demonstrate the performances of our device.
da Silva, Marcelle Figueira Marques; Fumian, Tulio Machado; de Assis, Rosane Maria Santos; Fialho, Alexandre Madi; Carvalho-Costa, Filipe Anibal; da Silva Ribeiro de Andrade, Juliana; Leite, José Paulo Gagliardi
2017-01-01
Group A rotavirus (RVA) genotype G12 is habitually associated with diarrhea disease (DD) in African children and recently its detection has increased worldwide. A total of 970 stool samples collected from individuals with DD in the Northeastern, Southeastern, and Southern Brazilian regions, Eastern coast, were analyzed and 321 (33%) were positive for RVA and of these, 241 (75%) genotyped as G12P[8]. The rate of RVA positivity was higher among children aged 5-10 years old (60%). All RVA infections observed in adults aged >21 years were G12P[8] (n = 27) showing that this genotype affected older age groups during the year of 2014 in Brazil. Phylogenetic analysis of VP7 and VP8* G12P[8] strains demonstrated an elevated similarity among Brazilian and G12-III prototypes strains circulating worldwide recently, suggesting that this lineage is associated with the global spread of the G12 genotype, considered as the 6th most prevalent human RVA genotype nowadays; while other G12 lineages remain sporadically detected and usually detected in association with other P genotypes. VP8* analysis revealed that Brazilian strains belong to P[8]-3 lineage, the single P[8] lineage presently detected in the country. No major nucleotide/amino acid disparities were observed among strains recovered from children and adults for VP7 and VP8* genes. These data are essential to support the surveillance studies, particularly in countries where the RVA vaccine was introduced in their National Immunization Program enabling identification of potential alterations in the epidemiological profile that can impact its efficacy in vaccination programs. J. Med. Virol. 89:64-70, 2017. © 2016 Wiley Periodicals, Inc. © 2016 Wiley Periodicals, Inc.
De Gaspari, E N
2000-12-01
We have generated a hybridoma cell line which produces an 8C7Br1 clone of the IgM antibody isotype. It recognizes the 50-, 65-, and 60-kDa antigens and is reactive with strains of N. meningitidis in the 98% of local Neisseria genera by Dot-ELISA assays. Two percent of the strains of N. meningitidis B do not present reactivity with the 8C7Br1 monoclonal antibody (MAb). The antibody reacted against N. meningitidis of serogroups A, B, C, X, Y, Z, and different serotypes and subtypes of N. meningitidis B and C by means of Dot-ELISA and Immunoblot. It cross-reacted with Neisseria gonorrhoeae, Neisseria lactamica, Haemophilus influenzae type b, Escherichia coli, Salmonella typhimurium, Salmonella typhi, Shigella flexneri, Bordetella pertussis, and Bacillus subtilis. The 8C7Br1 MAb reacted with the 65-kDa protein present in the prototype meningococcal strains B:16:B6(B2a:P1.5.2) and 2996 (B2b:P1.5.2). In H. influenzae type b, E. coli and B. subtilis, the MAb recognized the protein of 60, 65, and 70 kDa, respectively. FACS analysis showed that 8C7Brl MAb could recognize the 50-kDa protein on the surface of N. meningitidis homologous (B:4:P1.9) strain. These results, together with the bactericidal activity of 8C7Br1, and an experiment of passive protection in mice, demonstrated the potential importance of the cross-reactive protein as a candidate antigen for N. meningitidis B vaccine composition.
Aboklaish, Ali F.; Dordet-Frisoni, Emilie; Citti, Christine; Toleman, Mark A; Glass, John I.; Spiller, O. Brad
2015-01-01
While transposon mutagenesis has been successfully used for Mycoplasma spp. to disrupt and determine non-essential genes, previous attempts with Ureaplasma spp. have been unsuccessful. Using a polyethylene glycol-transformation enhancing protocol, we were able to transform three separate serovars of Ureaplasma parvum with a Tn4001-based mini-transposon plasmid containing a gentamicin resistance selection marker. Despite the large degree of homology between Ureaplasma parvum and Ureaplasma urealyticum, all attempts to transform the latter in parallel failed, with the exception of a single clinical U. urealyticum isolate. PCR probing and sequencing were used to confirm transposon insertion into the bacterial genome and identify disrupted genes. Transformation of prototype serovar 3 consistently resulted in transfer only of sequence between the mini-transposon inverted repeats, but some strains showed additional sequence transfer. Transposon insertion occurred randomly in the genome resulting in unique disruption of genes UU047, UU390, UU440, UU450, UU520, UU526, UU582 for single clones from a panel of screened clones. An intergenic insertion between genes UU187 and UU188 was also characterised. Two phenotypic alterations were observed in the mutated strains: Disruption of a DEAD-box RNA helicase (UU582) altered growth kinetics, while the U. urealyticum strain lost resistance to serum attack coincident with disruption of gene UUR10_137 and loss of expression of a 41 kDa protein. Transposon mutagenesis was used successfully to insert single copies of a mini-transposon into the genome and disrupt genes leading to phenotypic changes in Ureaplasma parvum strains. This method can now be used to deliver exogenous genes for expression and determine essential genes for Ureaplasma parvum replication in culture and experimental models. PMID:25444567
Aboklaish, Ali F; Dordet-Frisoni, Emilie; Citti, Christine; Toleman, Mark A; Glass, John I; Spiller, O Brad
2014-11-01
While transposon mutagenesis has been successfully used for Mycoplasma spp. to disrupt and determine non-essential genes, previous attempts with Ureaplasma spp. have been unsuccessful. Using a polyethylene glycol-transformation enhancing protocol, we were able to transform three separate serovars of Ureaplasma parvum with a Tn4001-based mini-transposon plasmid containing a gentamicin resistance selection marker. Despite the large degree of homology between Ureaplasma parvum and Ureaplasma urealyticum, all attempts to transform the latter in parallel failed, with the exception of a single clinical U. urealyticum isolate. PCR probing and sequencing were used to confirm transposon insertion into the bacterial genome and identify disrupted genes. Transformation of prototype serovar 3 consistently resulted in transfer only of sequence between the mini-transposon inverted repeats, but some strains showed additional sequence transfer. Transposon insertion occurred randomly in the genome resulting in unique disruption of genes UU047, UU390, UU440, UU450, UU520, UU526, UU582 for single clones from a panel of screened clones. An intergenic insertion between genes UU187 and UU188 was also characterised. Two phenotypic alterations were observed in the mutated strains: Disruption of a DEAD-box RNA helicase (UU582) altered growth kinetics, while the U. urealyticum strain lost resistance to serum attack coincident with disruption of gene UUR10_137 and loss of expression of a 41 kDa protein. Transposon mutagenesis was used successfully to insert single copies of a mini-transposon into the genome and disrupt genes leading to phenotypic changes in Ureaplasma parvum strains. This method can now be used to deliver exogenous genes for expression and determine essential genes for Ureaplasma parvum replication in culture and experimental models. Copyright © 2014 Elsevier GmbH. All rights reserved.
Bird, Brian H; Khristova, Marina L; Rollin, Pierre E; Ksiazek, Thomas G; Nichol, Stuart T
2007-03-01
Rift Valley fever (RVF) virus is a mosquito-borne RNA virus responsible for large explosive outbreaks of acute febrile disease in humans and livestock in Africa with significant mortality and economic impact. The successful high-throughput generation of the complete genome sequence was achieved for 33 diverse RVF virus strains collected from throughout Africa and Saudi Arabia from 1944 to 2000, including strains differing in pathogenicity in disease models. While several distinct virus genetic lineages were determined, which approximately correlate with geographic origin, multiple exceptions indicative of long-distance virus movement have been found. Virus strains isolated within an epidemic (e.g., Mauritania, 1987, or Egypt, 1977 to 1978) exhibit little diversity, while those in enzootic settings (e.g., 1970s Zimbabwe) can be highly diverse. In addition, the large Saudi Arabian RVF outbreak in 2000 appears to have involved virus introduction from East Africa, based on the close ancestral relationship of a 1998 East African virus. Virus genetic diversity was low (approximately 5%) and primarily involved accumulation of mutations at an average of 2.9 x 10(-4) substitutions/site/year, although some evidence of RNA segment reassortment was found. Bayesian analysis of current RVF virus genetic diversity places the most recent common ancestor of these viruses in the late 1800s, the colonial period in Africa, a time of dramatic changes in agricultural practices and introduction of nonindigenous livestock breeds. In addition to insights into the evolution and ecology of RVF virus, these genomic data also provide a foundation for the design of molecular detection assays and prototype vaccines useful in combating this important disease.
Activation Strain Analysis of SN2 Reactions at C, N, O, and F Centers
2017-01-01
Fundamental principles that determine chemical reactivity and reaction mechanisms are the very foundation of chemistry and many related fields of science. Bimolecular nucleophilic substitutions (SN2) are among the most common and therefore most important reaction types. In this report, we examine the trends in the SN2 reactions with respect to increasing electronegativity of the reaction center by comparing the well-studied backside SN2 Cl– + CH3Cl with similar Cl– substitutions on the isoelectronic series with the second period elements N, O, and F in place of C. Relativistic (ZORA) DFT calculations are used to construct the gas phase reaction potential energy surfaces (PES), and activation strain analysis, which allows decomposition of the PES into the geometrical strain and interaction energy, is employed to analyze the observed trends. We find that SN2@N and SN2@O have similar PES to the prototypical SN2@C, with the well-defined reaction complex (RC) local minima and a central barrier, but all stationary points are, respectively, increasingly stable in energy. The SN2@F, by contrast, exhibits only a single-well PES with no barrier. Using the activation strain model, we show that the trends are due to the interaction energy and originate mainly from the decreasing energy of the empty acceptor orbital (σ*A–Cl) on the reaction center A in the order of C, N, O, and F. The decreasing steric congestion around the central atom is also a likely contributor to this trend. Additional decomposition of the interaction energy using Kohn–Sham molecular orbital (KS-MO) theory provides further support for this explanation, as well as suggesting electrostatic energy as the primary reason for the distinct single-well PES profile for the FCl reaction. PMID:28045531
Activation Strain Analysis of SN2 Reactions at C, N, O, and F Centers.
Kubelka, Jan; Bickelhaupt, F Matthias
2017-02-02
Fundamental principles that determine chemical reactivity and reaction mechanisms are the very foundation of chemistry and many related fields of science. Bimolecular nucleophilic substitutions (S N 2) are among the most common and therefore most important reaction types. In this report, we examine the trends in the S N 2 reactions with respect to increasing electronegativity of the reaction center by comparing the well-studied backside S N 2 Cl - + CH 3 Cl with similar Cl - substitutions on the isoelectronic series with the second period elements N, O, and F in place of C. Relativistic (ZORA) DFT calculations are used to construct the gas phase reaction potential energy surfaces (PES), and activation strain analysis, which allows decomposition of the PES into the geometrical strain and interaction energy, is employed to analyze the observed trends. We find that S N 2@N and S N 2@O have similar PES to the prototypical S N 2@C, with the well-defined reaction complex (RC) local minima and a central barrier, but all stationary points are, respectively, increasingly stable in energy. The S N 2@F, by contrast, exhibits only a single-well PES with no barrier. Using the activation strain model, we show that the trends are due to the interaction energy and originate mainly from the decreasing energy of the empty acceptor orbital (σ* A-Cl ) on the reaction center A in the order of C, N, O, and F. The decreasing steric congestion around the central atom is also a likely contributor to this trend. Additional decomposition of the interaction energy using Kohn-Sham molecular orbital (KS-MO) theory provides further support for this explanation, as well as suggesting electrostatic energy as the primary reason for the distinct single-well PES profile for the FCl reaction.
Wong, Terianne M.; Allen, James D.; Bebin-Blackwell, Anne-Gaelle; Carter, Donald M.; Alefantis, Timothy; DiNapoli, Joshua; Kleanthous, Harold
2017-01-01
ABSTRACT Each influenza season, a set of wild-type viruses, representing one H1N1, one H3N2, and one to two influenza B isolates, are selected for inclusion in the annual seasonal influenza vaccine. In order to develop broadly reactive subtype-specific influenza vaccines, a methodology called computationally optimized broadly reactive antigens (COBRA) was used to design novel hemagglutinin (HA) vaccine immunogens. COBRA technology was effectively used to design HA immunogens that elicited antibodies that neutralized H5N1 and H1N1 isolates. In this report, the development and characterization of 17 prototype H3N2 COBRA HA proteins were screened in mice and ferrets for the elicitation of antibodies with HA inhibition (HAI) activity against human seasonal H3N2 viruses that were isolated over the last 48 years. The most effective COBRA HA vaccine regimens elicited antibodies with broader HAI activity against a panel of H3N2 viruses than wild-type H3 HA vaccines. The top leading COBRA HA candidates were tested against cocirculating variants. These variants were not efficiently detected by antibodies elicited by the wild-type HA from viruses selected as the vaccine candidates. The T-11 COBRA HA vaccine elicited antibodies with HAI and neutralization activity against all cocirculating variants from 2004 to 2007. This is the first report demonstrating broader breadth of vaccine-induced antibodies against cocirculating H3N2 strains compared to the wild-type HA antigens that were represented in commercial influenza vaccines. IMPORTANCE There is a need for an improved influenza vaccine that elicits immune responses that recognize a broader number of influenza virus strains to prevent infection and transmission. Using the COBRA approach, a set of vaccines against influenza viruses in the H3N2 subtype was tested for the ability to elicit antibodies that neutralize virus infection against not only historical vaccine strains of H3N2 but also a set of cocirculating variants that circulated between 2004 and 2007. Three of the H3N2 COBRA vaccines recognized all of the cocirculating strains during this era, but the chosen wild-type vaccine strains were not able to elicit antibodies with HAI activity against these cocirculating strains. Therefore, the COBRA vaccines have the ability to elicit protective antibodies against not only the dominant vaccine strains but also minor circulating strains that can evolve into the dominant vaccine strains in the future. PMID:28978710
In-vacuum sensors for the beamline components of the ITER neutral beam test facility.
Dalla Palma, M; Pasqualotto, R; Sartori, E; Spagnolo, S; Spolaore, M; Veltri, P
2016-11-01
Embedded sensors have been designed for installation on the components of the MITICA beamline, the prototype ITER neutral beam injector (Megavolt ITER Injector and Concept Advancement), to derive characteristics of the particle beam and to monitor the component conditions during operation for protection and thermal control. Along the beamline, the components interacting with the particle beam are the neutralizer, the residual ion dump, and the calorimeter. The design and the positioning of sensors on each component have been developed considering the expected beam-surface interaction including non-ideal and off-normal conditions. The arrangement of the following instrumentation is presented: thermal sensors, strain gages, electrostatic probes including secondary emission detectors, grounding shunt for electrical currents, and accelerometers.
2013-01-01
Background Farmington virus (FARV) is a rhabdovirus that was isolated from a wild bird during an outbreak of epizootic eastern equine encephalitis on a pheasant farm in Connecticut, USA. Findings Analysis of the nearly complete genome sequence of the prototype CT AN 114 strain indicates that it encodes the five canonical rhabdovirus structural proteins (N, P, M, G and L) with alternative ORFs (> 180 nt) in the N and G genes. Phenotypic and genetic characterization of FARV has confirmed that it is a novel rhabdovirus and probably represents a new species within the family Rhabdoviridae. Conclusions In sum, our analysis indicates that FARV represents a new species within the family Rhabdoviridae. PMID:23816310
Saccharopolyspora Species: Laboratory Maintenance and Enhanced Production of Secondary Metabolites.
Dhakal, Dipesh; Pokhrel, Anaya Raj; Jha, Amit Kumar; Thuan, Nguyen Huy; Sohng, Jae Kyung
2017-02-06
Saccharopolyspora spp. are aerobic, Gram-positive, non-acid-fast, and non-motile actinomycetes. Various species of the genus Saccharopolyspora have been reported with an ability to produce various bioactive compounds for pharmaceutical and agricultural uses. This unit includes general protocols for the laboratory maintenance of Saccharopolyspora species, including growth in liquid medium, growth on solid agar, long-term storage, and generation of a higher producer strain by mutagenesis. Saccharopolyspora spinosa ATCC 49460 is used as a prototype for explaining the considerations for efficient laboratory maintenance of Saccharopolyspora spp. Saccharopolyspora spinosa is a producer of spinosad, a prominent insecticide with selective activity against various insects. © 2017 by John Wiley & Sons, Inc. Copyright © 2017 John Wiley & Sons, Inc.
Herzberg, Moshe; Rezene, Tesfalem Zere; Ziemba, Christopher; Gillor, Osnat; Mathee, Kalai
2009-10-01
Extracellular polymeric substances (EPS) have major impact on biofouling of reverse osmosis (RO) membranes. On one hand, EPS can reduce membrane permeability and on the other, EPS production by the primary colonizers may influence their deposition and attachment rate and subsequently affect the biofouling propensity of the membrane. The role of bacterial exopolysaccharides in bacterial deposition followed by the biofouling potential of an RO membrane was evaluated using an alginate overproducing (mucoid) Pseudomonas aeruginosa. The mucoid P. aeruginosa PAOmucA22 was compared with its isogenic nonmucoid prototypic parent PAO1 microscopically in a radial stagnation point flow (RSPF) system for their bacterial deposition characteristics. Then, biofouling potential of PAO1 and PAOmucA22 was determined in a crossflow rectangular plate-and-frame membrane cell, in which the strains were cultivated on a thin-film composite, polyamide, flat RO membrane coupon (LFC-1) under laminar flow conditions. In the RSPF system, the observed deposition rate of the mucoid strain was between 5- and 10-fold lower than of the wild type using either synthetic wastewater medium (with ionic strength of 14.7 mM and pH 7.4) or 15 mM KCl solution (pH of 6.2). The slower deposition rate of the mucoid strain is explained by 5- to 25-fold increased hydrophilicity of the mucoid strain as compared to the isogenic wild type, PAO1. Corroborating with these results, a significant delay in the onset of biofouling of the RO membrane was observed when the mucoid strain was used as the membrane colonizer, in which the observed time for the induced permeate flux decline was delayed (ca. 2-fold). In conclusion, the lower initial cell attachment of the mucoid strain decelerated biofouling of the RO membrane. Bacterial deposition and attachment is a critical step in biofilm formation and governed by intimate interactions between outer membrane proteins of the bacteria and the surface. Shielding these interactions by a hydrated and hydrophilic alginate capsule is shown to dramatically lessen the biofouling potential of the membrane colonizers.
NASA Technical Reports Server (NTRS)
Bentley, Nicole L.; Brower, David V.; Le, Suy Q.; Seaman, Calvin H.; Tang, Henry H.
2017-01-01
This paper presents the design and development of a friction-based coupling device for a fiber-optic monitoring system that can be deployed on existing subsea structures. This paper provides a summary of the design concept, prototype development, prototype performance testing, and design refinements of the device. The results of the laboratory testing of the first prototype performed at the National Aeronautics and Space Administration (NASA) Johnson Space Center (JSC) are included in this paper. Limitations of the initial design were identified and future design improvements were proposed. These new features will enhance the coupling of the device and improve the monitoring system measurement capabilities. A major challenge of a post-installed instrumentation monitoring system is to ensure adequate coupling between the instruments and the structure of interest for reliable measurements. Friction-based coupling devices have the potential to overcome coupling limitations caused by marine growth and soil contamination on subsea structures, flowlines or risers. The work described in this paper investigates the design of a friction-based coupling device (friction clamp), which is applicable for pipelines and structures that are suspended in the water column and those that are resting on the seabed. The monitoring elements consist of fiber-optic sensors that are bonded to a metal clamshell with a high-friction coating. The friction clamp has a single hinge design to facilitate the operation of the clamp and dual rows of opposing fasteners to distribute the clamping force on the structure. The friction clamp can be installed by divers in shallow depths or by remotely operated vehicles in deep-water applications. NASA-JSC was involved in the selection and testing of the friction coating, and in the design and testing of the prototype clamp device. Four-inch diameter and eight-inch diameter sub-scale friction clamp prototypes were built and tested to evaluate the strain measuring capabilities of the design under different loading scenarios. The testing revealed some limitations of the initial design concept, and subsequent refinements were explored to improve the measurement performance of the system. This study was part of a collaboration between NASA-JSC and Astro Technology, Inc. within a study called Clear Gulf. The primary objective of the Clear Gulf study is to develop advanced instrumentation technologies that will improve operational safety and reduce the risk of hydrocarbon spillage. NASA provided unique insights, expansive test facilities, and technical expertise to advance these technologies that would benefit the environment, the public, and commercial industries.
NASA Technical Reports Server (NTRS)
Bentley, Nicole; Brower, David; Le, Suy Q.; Seaman, Calvin; Tang, Henry
2017-01-01
This paper presents the design and development of a friction-based coupling device for a fiber-optic monitoring system that can be deployed on existing subsea structures. This paper provides a summary of the design concept, prototype development, prototype performance testing, and design refinements of the device. The results of the laboratory testing of the first prototype performed at the National Aeronautics and Space Administration (NASA) Johnson Space Center (JSC) are included in this paper. Limitations of the initial design were identified and future design improvements were proposed. These new features will enhance the coupling of the device and improve the monitoring system measurement capabilities. A major challenge of a post-installed instrumentation monitoring system is to ensure adequate coupling between the instruments and the structure of interest for reliable measurements. Friction-based coupling devices have the potential to overcome coupling limitations caused by marine growth and soil contamination on subsea structures, flowlines or risers. The work described in this paper investigates the design of a friction-based coupling device (friction clamp), which is applicable for pipelines and structures that are suspended in the water column and those that are resting on the seabed. The monitoring elements consist of fiber-optic sensors that are bonded to a metal clamshell with a high-friction coating. The friction clamp has a single hinge design to facilitate the operation of the clamp and dual rows of opposing fasteners to distribute the clamping force on the structure. The friction clamp can be installed by divers in shallow depths or by remotely operated vehicles in deep-water applications. NASA-JSC was involved in the selection and testing of the friction coating, and in the design and testing of the prototype clamp device. Four-inch diameter and eight-inch diameter sub-scale friction clamp prototypes were built and tested to evaluate the strain measuring capabilities of the design under different loading scenarios. The testing revealed some limitations of the initial design concept, and subsequent refinements were explored to improve the measurement performance of the system. This study was part of a collaboration between NASA-JSC and Astro Technology, Inc. within a study called Clear Gulf. The primary objective of the Clear Gulf study is to develop advanced instrumentation technologies that will improve operational safety and reduce the risk of hydrocarbon spillage. NASA provided unique insights, expansive test facilities, and technical expertise to advance these technologies that would benefit the environment, the public, and commercial industries.
Kurniawan, Nicholas A; Vos, Bart E; Biebricher, Andreas; Wuite, Gijs J L; Peterman, Erwin J G; Koenderink, Gijsje H
2016-09-06
Tissues and cells sustain recurring mechanical loads that span a wide range of loading amplitudes and timescales as a consequence of exposure to blood flow, muscle activity, and external impact. Both tissues and cells derive their mechanical strength from fibrous protein scaffolds, which typically have a complex hierarchical structure. In this study, we focus on a prototypical hierarchical biomaterial, fibrin, which is one of the most resilient naturally occurring biopolymers and forms the structural scaffold of blood clots. We show how fibrous networks composed of fibrin utilize irreversible changes in their hierarchical structure at different scales to maintain reversible stress stiffening up to large strains. To trace the origin of this paradoxical resilience, we systematically tuned the microstructural parameters of fibrin and used a combination of optical tweezers and fluorescence microscopy to measure the interactions of single fibrin fibers for the first time, to our knowledge. We demonstrate that fibrin networks adapt to moderate strains by remodeling at the network scale through the spontaneous formation of new bonds between fibers, whereas they adapt to high strains by plastic remodeling of the fibers themselves. This multiscale adaptation mechanism endows fibrin gels with the remarkable ability to sustain recurring loads due to shear flows and wound stretching. Our findings therefore reveal a microscopic mechanism by which tissues and cells can balance elastic nonlinearity and plasticity, and thus can provide microstructural insights into cell-driven remodeling of tissues. Copyright © 2016 Biophysical Society. Published by Elsevier Inc. All rights reserved.
Optimization of Aryl Amides that Extend Survival in Prion-Infected Mice.
Giles, Kurt; Berry, David B; Condello, Carlo; Dugger, Brittany N; Li, Zhe; Oehler, Abby; Bhardwaj, Sumita; Elepano, Manuel; Guan, Shenheng; Silber, B Michael; Olson, Steven H; Prusiner, Stanley B
2016-09-01
Developing therapeutics for neurodegenerative diseases (NDs) prevalent in the aging population remains a daunting challenge. With the growing understanding that many NDs progress by conformational self-templating of specific proteins, the prototypical prion diseases offer a platform for ND drug discovery. We evaluated high-throughput screening hits with the aryl amide scaffold and explored the structure-activity relationships around three series differing in their N-aryl core: benzoxazole, benzothiazole, and cyano. Potent anti-prion compounds were advanced to pharmacokinetic studies, and the resulting brain-penetrant leads from each series, together with a related N-aryl piperazine lead, were escalated to long-term dosing and efficacy studies. Compounds from each of the four series doubled the survival of mice infected with a mouse-passaged prion strain. Treatment with aryl amides altered prion strain properties, as evidenced by the distinct patterns of neuropathological deposition of prion protein and associated astrocytic gliosis in the brain; however, none of the aryl amide compounds resulted in drug-resistant prion strains, in contrast to previous studies on compounds with the 2-aminothiazole (2-AMT) scaffold. As seen with 2-AMTs and other effective anti-prion compounds reported to date, the novel aryl amides reported here were ineffective in prolonging the survival of transgenic mice infected with human prions. Most encouraging is our discovery that aryl amides show that the development of drug resistance is not an inevitable consequence of efficacious anti-prion therapeutics. Copyright © 2016 by The American Society for Pharmacology and Experimental Therapeutics.
Optimization of Aryl Amides that Extend Survival in Prion-Infected Mice
Giles, Kurt; Berry, David B.; Condello, Carlo; Dugger, Brittany N.; Li, Zhe; Oehler, Abby; Bhardwaj, Sumita; Elepano, Manuel; Guan, Shenheng; Silber, B. Michael; Olson, Steven H.
2016-01-01
Developing therapeutics for neurodegenerative diseases (NDs) prevalent in the aging population remains a daunting challenge. With the growing understanding that many NDs progress by conformational self-templating of specific proteins, the prototypical prion diseases offer a platform for ND drug discovery. We evaluated high-throughput screening hits with the aryl amide scaffold and explored the structure–activity relationships around three series differing in their N-aryl core: benzoxazole, benzothiazole, and cyano. Potent anti-prion compounds were advanced to pharmacokinetic studies, and the resulting brain-penetrant leads from each series, together with a related N-aryl piperazine lead, were escalated to long-term dosing and efficacy studies. Compounds from each of the four series doubled the survival of mice infected with a mouse-passaged prion strain. Treatment with aryl amides altered prion strain properties, as evidenced by the distinct patterns of neuropathological deposition of prion protein and associated astrocytic gliosis in the brain; however, none of the aryl amide compounds resulted in drug-resistant prion strains, in contrast to previous studies on compounds with the 2-aminothiazole (2-AMT) scaffold. As seen with 2-AMTs and other effective anti-prion compounds reported to date, the novel aryl amides reported here were ineffective in prolonging the survival of transgenic mice infected with human prions. Most encouraging is our discovery that aryl amides show that the development of drug resistance is not an inevitable consequence of efficacious anti-prion therapeutics. PMID:27317802
Surface phenomena revealed by in situ imaging: studies from adhesion, wear and cutting
NASA Astrophysics Data System (ADS)
Viswanathan, Koushik; Mahato, Anirban; Yeung, Ho; Chandrasekar, Srinivasan
2017-03-01
Surface deformation and flow phenomena are ubiquitous in mechanical processes. In this work we present an in situ imaging framework for studying a range of surface mechanical phenomena at high spatial resolution and across a range of time scales. The in situ framework is capable of resolving deformation and flow fields quantitatively in terms of surface displacements, velocities, strains and strain rates. Three case studies are presented demonstrating the power of this framework for studying surface deformation. In the first, the origin of stick-slip motion in adhesive polymer interfaces is investigated, revealing a intimate link between stick-slip and surface wave propagation. Second, the role of flow in mediating formation of surface defects and wear particles in metals is analyzed using a prototypical sliding process. It is shown that conventional post-mortem observation and inference can lead to erroneous conclusions with regard to formation of surface cracks and wear particles. The in situ framework is shown to unambiguously capture delamination wear in sliding. Third, material flow and surface deformation in a typical cutting process is analyzed. It is shown that a long-standing problem in the cutting of annealed metals is resolved by the imaging, with other benefits such as estimation of energy dissipation and power from the flow fields. In closure, guidelines are provided for profitably exploiting in situ observations to study large-strain deformation, flow and friction phenomena at surfaces that display a variety of time-scales.
Determination of strain fields in porous shape memory alloys using micro-computed tomography
NASA Astrophysics Data System (ADS)
Bormann, Therese; Friess, Sebastian; de Wild, Michael; Schumacher, Ralf; Schulz, Georg; Müller, Bert
2010-09-01
Shape memory alloys (SMAs) belong to 'intelligent' materials since the metal alloy can change its macroscopic shape as the result of the temperature-induced, reversible martensite-austenite phase transition. SMAs are often applied for medical applications such as stents, hinge-less instruments, artificial muscles, and dental braces. Rapid prototyping techniques, including selective laser melting (SLM), allow fabricating complex porous SMA microstructures. In the present study, the macroscopic shape changes of the SMA test structures fabricated by SLM have been investigated by means of micro computed tomography (μCT). For this purpose, the SMA structures are placed into the heating stage of the μCT system SkyScan 1172™ (SkyScan, Kontich, Belgium) to acquire three-dimensional datasets above and below the transition temperature, i.e. at room temperature and at about 80°C, respectively. The two datasets were registered on the basis of an affine registration algorithm with nine independent parameters - three for the translation, three for the rotation and three for the scaling in orthogonal directions. Essentially, the scaling parameters characterize the macroscopic deformation of the SMA structure of interest. Furthermore, applying the non-rigid registration algorithm, the three-dimensional strain field of the SMA structure on the micrometer scale comes to light. The strain fields obtained will serve for the optimization of the SLM-process and, more important, of the design of the complex shaped SMA structures for tissue engineering and medical implants.
Fu, Shulin; Ou, Jiwen; Zhang, Minmin; Xu, Juan; Liu, Huazhen; Liu, Jinlin; Yuan, Fangyan; Chen, Huanchun
2013-01-01
Haemophilus parasuis and Actinobacillus pleuropneumoniae both belong to the family Pasteurellaceae and are major respiratory pathogens that cause large economic losses in the pig industry worldwide. We previously constructed an attenuated A. pleuropneumoniae serovar 1 live vaccine prototype, SLW05 (ΔapxIC ΔapxIIC ΔapxIV-ORF1), which is able to produce nontoxic but immunogenic ApxIA, ApxIIA, and ApxIVA. This triple-deletion mutant strain was shown to elicit protective immunity against virulent A. pleuropneumoniae. In the present study, we investigated whether immunization with SLW05 could also protect against lethal challenge with virulent H. parasuis SH0165 (serovar 5) or MD0322 (serovar 4). The SLW05 strain was found to elicit a strong humoral antibody response in pigs and to confer significant protection against challenge with a lethal dose of H. parasuis SH0165 or MD0322. IgG subtype analysis revealed that SLW05 induces a bias toward a Th1-type immune response and stimulates interleukin 2 (IL-2) and gamma interferon (IFN-γ) production. Moreover, antisera from SLW05-vaccinated pigs efficiently inhibited both A. pleuropneumoniae and H. parasuis growth in a whole-blood assay. This is the first report that a live attenuated A. pleuropneumoniae vaccine with SLW05 can protect against lethal H. parasuis infection, which provides a novel approach for developing an attenuated H. parasuis vaccine. PMID:23220998
Fu, Shulin; Ou, Jiwen; Zhang, Minmin; Xu, Juan; Liu, Huazhen; Liu, Jinlin; Yuan, Fangyan; Chen, Huanchun; Bei, Weicheng
2013-02-01
Haemophilus parasuis and Actinobacillus pleuropneumoniae both belong to the family Pasteurellaceae and are major respiratory pathogens that cause large economic losses in the pig industry worldwide. We previously constructed an attenuated A. pleuropneumoniae serovar 1 live vaccine prototype, SLW05 (ΔapxIC ΔapxIIC ΔapxIV-ORF1), which is able to produce nontoxic but immunogenic ApxIA, ApxIIA, and ApxIVA. This triple-deletion mutant strain was shown to elicit protective immunity against virulent A. pleuropneumoniae. In the present study, we investigated whether immunization with SLW05 could also protect against lethal challenge with virulent H. parasuis SH0165 (serovar 5) or MD0322 (serovar 4). The SLW05 strain was found to elicit a strong humoral antibody response in pigs and to confer significant protection against challenge with a lethal dose of H. parasuis SH0165 or MD0322. IgG subtype analysis revealed that SLW05 induces a bias toward a Th1-type immune response and stimulates interleukin 2 (IL-2) and gamma interferon (IFN-γ) production. Moreover, antisera from SLW05-vaccinated pigs efficiently inhibited both A. pleuropneumoniae and H. parasuis growth in a whole-blood assay. This is the first report that a live attenuated A. pleuropneumoniae vaccine with SLW05 can protect against lethal H. parasuis infection, which provides a novel approach for developing an attenuated H. parasuis vaccine.
Kirigami-based PVDF thin-film as stretchable strain sensor
NASA Astrophysics Data System (ADS)
Hu, Nan; Chen, Dajing; Hao, Nanjing; Huang, Shicheng; Yu, Xiaojiao; Zhang, John X. J.; Chen, Zi
Kirigami, as the sister of the origami, involves cutting of 2D sheets to form complex 3D geometries with out-of-plane patterns. Motivated by the development of the high-stretchable biomedical devices, we explore the stretchability of the kirigami-based PVDF thin film under tension. Our structural prototypes include a set of 2D geometry with kirigami-based pattern cutting on PVDF thin films. We first used paper models to generate a wide range of cutting patterns to study the deformation under compression tests, the results of which are compared with finite element simulations. We then proceeded to test different kirigami-based designs to identify geometric parameters that can tune the post-buckling response and strain distribution. Next, we fabricated and tested the PVDF thin film with kirigami pattern. Experiments showed that the PVDF film in the absence of cutting can be stretched to a limited extent and will break upon further stretching. In contrast, the kirigami-based films can be stretched up to 100% without failure. Our designs demonstrate the ability to significantly improve the strain range of the structure and sensing ability of a sensor. We envision a promising future to use this class of structural elements to develop highly stretchable materials, structures, and devices. Z.C. acknowledges the Society in Science-Branco Weiss fellowship, administered by ETH Zürich. J.X.J.Z. acknowledges the NIH Director's Transformative Research Award (1R01 OD022910-01).
Chen, Nanhua; Liu, Qiaorong; Qiao, Mingming; Deng, Xiaoyu; Chen, Xizhao; Sun, Ming
2017-10-01
Genotype 1 porcine reproductive and respiratory syndrome virus (PRRSV 1) have been continuously isolated in China in recent years. Complete genome sequences of these isolates are important to investigate the prevalence and evolution of Chinese PRRSV 1. Herein, we describe the isolation of a novel PRRSV 1 isolate, denominated HLJB1, in the Heilongjiang province of China. Complete genome sequencing of HLJB1 showed that it shares 90.66% and 58.21% nucleotide identities with PRRSV 1 and 2 prototypic strains Lelystad virus and ATCC VR-2332, respectively. HLJB1 has a unique 5-amino-acid insertion in nsp2, which has never been described in other PRRSV 1 isolates. Whole genome-based phylogenetic analysis revealed that all Chinese PRRSV 1 isolates are clustered in pan-European subtype 1 and can be divided into four subgroups. HLJB1 resides in the subgroup of BJEU06-1-like isolates but is also closely related to the Amervac-like isolates. Additionally, recombination analyses suggested that HLJB1 is a recombinant from the Amervac vaccine and the BJEU06-1 isolate. To our best knowledge, our results provide the first genetic evidence for recombination between Amervac vaccine and circulating strains. These findings are also beneficial for studying the origin and evolution of PRRSV 1 in China. Copyright © 2017. Published by Elsevier B.V.
Kitagawa, Yuichi; Yasuki, Tsuyoshi; Hasegawa, Junji
2006-11-01
Many efforts have been made to understand the mechanism of whiplash injury. Recently, the cervical facet joint capsules have been focused on as a potential site of injury. An experimental approach has been taken to analyze the vertebral motion and to estimate joint capsule stretch that was thought to be a potential cause of pain. The purpose of this study is to analyze the kinematics of the cervical facet joint using a human FE model in order to better understand the injury mechanism. The Total Human Model for Safety (THUMS) was used to visually analyze the local and global kinematics of the spine. Soft tissues in the neck were newly modeled and introduced into THUMS for estimating the loading level in rear impacts. The model was first validated against human test data in the literature by comparing vertebrae motion as well as head and neck responses. Joint capsule strain was estimated from a maximum principal strain output from the elements representing the capsule tissues. A rear-end collision was then simulated using THUMS and a prototype seat model, assuming a delta-V of 25 km/h. The trajectory of the vertebrae was analyzed in a local coordinate system defined along the joint surface. Strain growth in the joint capsules was explained, as related to contact events between the occupant and the seat. A new seat concept was proposed to help lessen the loading level to the neck soft tissues. The foam material of the seat back was softened, the initial gap behind the head was reduced and the head restraint was stiffened for firm support. The lower seat back frame was also reinforced to withstand the impact severity at the given delta-V. Another rear impact simulation was conducted using the new seat concept model to examine the effectiveness of the new concept. The joint capsule strain was found to be relatively lower with the new seat concept. The study also discusses the influence of seat parameters to the vertebral motion and the resultant strain in the joint capsules. The meaning of the contact timing of the head to the head restraint was examined based on the results in terms of correlation with injury indicators such as NIC and the joint capsule strain.
Infectivity titration of a prototype strain of hepatitis E virus in cynomolgus monkeys.
Tsarev, S A; Tsareva, T S; Emerson, S U; Yarbough, P O; Legters, L J; Moskal, T; Purcell, R H
1994-06-01
The infectivity titer of a standard stock of the SAR-55 strain of hepatitis E virus (HEV) was determined in cynomolgus macaques (Macaca fascicularis) and the effect of dose on the course of the infection was examined by weekly monitoring of alanine aminotransferase (ALT) and anti-HEV levels. Antibody to HEV (anti-HEV) was measured with ELISAs based on ORF-2 recombinant antigens consisting of either a 55 kDa region expressed in insect cells or shorter regions expressed as fusion proteins in bacteria. The ELISA based on the 55 kDa antigen was generally more sensitive. The infectivity titer of SAR-55 was 10(6) cynomolgus 50% infectious doses per gram of feces. The infectivity titer corresponded to the HEV genome titer of the inoculum as determined by reverse transcriptase-polymerase chain reaction (RT-PCR). Anti-HEV IgM was detected in only a portion of the animals that had an anti-HEV IgG response. Biochemical evidence of hepatitis was most prominent in animals that were inoculated with the higher concentrations of virus and the incubation period to seroconversion was prolonged in animals that received the lower doses.
Hughes, M. S.; Hoey, E. M.; Coyle, P. V.
1993-01-01
Ten coxsackievirus B4 (CVB4) strains isolated from clinical and environmental sources in Northern Ireland in 1985-7, were compared at the nucleotide sequence level. Dideoxynucleotide sequencing of a polymerase chain reaction (PCR) amplified fragment, spanning the VP1/P2A genomic region, classified the isolates into two distinct groups or genotypes as defined by Rico-Hesse and colleagues for poliovirus type 1. Isolates within each group shared approximately 99% sequence identity at the nucleotide level whereas < or = 86% sequence identity was shared between groups. One isolate derived from a clinical specimen in 1987 was grouped with six CVB4 isolates recovered from the aquatic environment in 1986-7. The second group comprised CVB4 isolates from clinical specimens in 1985-6. Both groups were different at the nucleotide level from the prototype strain isolated in 1950. It was concluded that the method could be used to sub-type CVB4 isolates and would be of value in epidemiological studies of CVB4. Predicted amino acid sequences revealed non-conservation of the tyrosine residue at the VP1/P2A cleavage site but were of little value in distinguishing CVB4 variants. PMID:8386098
Dielectric elastomer vibrissal system for active tactile sensing
NASA Astrophysics Data System (ADS)
Conn, Andrew T.; Pearson, Martin J.; Pipe, Anthony G.; Welsby, Jason; Rossiter, Jonathan
2012-04-01
Rodents are able to dexterously navigate confined and unlit environments by extracting spatial and textural information with their whiskers (or vibrissae). Vibrissal-based active touch is suited to a variety of applications where vision is occluded, such as search-and-rescue operations in collapsed buildings. In this paper, a compact dielectric elastomer vibrissal system (DEVS) is described that mimics the vibrissal follicle-sinus complex (FSC) found in rodents. Like the vibrissal FSC, the DEVS encapsulates all sensitive mechanoreceptors at the root of a passive whisker within an antagonistic muscular system. Typically, rats actively whisk arrays of macro-vibrissae with amplitudes of up to +/-25°. It is demonstrated that these properties can be replicated by exploiting the characteristic large actuation strains and passive compliance of dielectric elastomers. A prototype DEVS is developed using VHB 4905 and embedded strain gauges bonded to the root of a tapered whisker. The DEVS is demonstrated to produce a maximum rotational output of +/-22.8°. An electro-mechanical model of the DEVS is derived, which incorporates a hyperelastic material model and Euler- Bernoulli beam equations. The model is shown to predict experimental measurements of whisking stroke amplitude and whisker deflection.
An optical motion measuring system for laterally oscillated fatigue tests
NASA Technical Reports Server (NTRS)
Tripp, John S.; Tcheng, Ping; Murri, Gretchen B.; Sharpe, Scott
1993-01-01
This paper describes an optical system developed for materials testing laboratories at NASA Langley Research Center (LaRC) for high resolution monitoring of the transverse displacement and angular rotation of a test specimen installed in an axial-tension bending machine (ATB) during fatigue tests. It consists of a small laser, optics, a motorized mirror, three photodiodes, electronic detection and counting circuits, a data acquisition system, and a personal computer. A 3-inch by 5-inch rectangular plate attached to the upper grip of the test machine serves as a target base for the optical system. The personal computer automates the fatigue test procedure, controls data acquisition, performs data reduction, and provides user displays. The data acquisition system also monitors signals from up to 16 strain gages mounted on the test specimen. The motion measuring system is designed to continuously monitor and correlate the amplitude of the oscillatory motion with the strain gage signals in order to detect the onset of failure of the composite test specimen. A prototype system has been developed and tested which exceeds the design specifications of +/- 0.01 inch displacement accuracy, and +/- 0.25 deg angular accuracy at a sampling rate of 100 samples per second.
Effects of lactoferricin B against keratitis-associated fungal biofilms.
Sengupta, Jayangshu; Saha, Suman; Khetan, Archana; Sarkar, Sujoy K; Mandal, Santi M
2012-10-01
Biofilms are considered as the most important developmental characteristics in ocular infections. Biofilm eradication is a major challenge today to overcome the incidence of drug resistance. This report demonstrates the in vitro ability of biofilm formation on contact lens by three common keratitis-associated fungal pathogens, namely, Aspergillus fumigatus, Fusarium solani, and Candida albicans. Antifungal sensitivity testing performed for both planktonic cells and biofilm revealed the sessile phenotype to be resistant at MIC levels for the planktonic cells and also at higher concentrations. A prototype lens care solution was also found to be partially effective in eradication of the mature biofilm from contact lenses. Lactoferricin B (Lacf, 64 μg/ml), an antimicrobial peptide, exhibited almost no effect on the sessile phenotype. However, the combinatory effect of Lacf with antifungals against planktonic cells and biofilms of three fungal strains that were isolated from keratitis patients exhibited a reduction of antifungal dose more than eightfold. Furthermore, the effect of Lacf in lens care solution against biofilms in which those strains formed was eradicated successfully. These results suggest that lactoferricin B could be a promising candidate for clinical use in improving biofilm susceptibility to antifungals and also as an antibiofilm-antifungal additive in lens care solution.
Novice designers’ use of prototypes in engineering design
Deininger, Michael; Daly, Shanna R.; Sienko, Kathleen H.; Lee, Jennifer C.
2017-01-01
Prototypes are essential tools in product design processes, but are often underutilized by novice designers. To help novice designers use prototypes more effectively, we must first determine how they currently use prototypes. In this paper, we describe how novice designers conceptualized prototypes and reported using them throughout a design project, and compare reported prototyping use to prototyping best practices. We found that some of the reported prototyping practices by novice designers, such as using inexpensive prototypes early and using prototypes to define user requirements, occurred infrequently and lacked intentionality. Participants’ initial descriptions of prototypes were less sophisticated than how they later described using them and only upon prompted reflection did participants recognize more specific benefits of using prototypes. PMID:29398740
Provenance and geographic spread of St. Louis encephalitis virus.
Kopp, Anne; Gillespie, Thomas R; Hobelsberger, Daniel; Estrada, Alejandro; Harper, James M; Miller, Richard A; Eckerle, Isabella; Müller, Marcel A; Podsiadlowski, Lars; Leendertz, Fabian H; Drosten, Christian; Junglen, Sandra
2013-06-11
St. Louis encephalitis virus (SLEV) is the prototypic mosquito-borne flavivirus in the Americas. Birds are its primary vertebrate hosts, but amplification in certain mammals has also been suggested. The place and time of SLEV emergence remain unknown. In an ecological investigation in a tropical rainforest in Palenque National Park, Mexico, we discovered an ancestral variant of SLEV in Culex nigripalpus mosquitoes. Those SLEV-Palenque strains form a highly distinct phylogenetic clade within the SLEV species. Cell culture studies of SLEV-Palenque versus epidemic SLEV (MSI-7) revealed no growth differences in insect cells but a clear inability of SLEV-Palenque to replicate in cells from birds, cotton rats, and free-tailed bats permissive for MSI-7 replication. Only cells from nonhuman primates and neotropical fruit bats were moderately permissive. Phylogeographic reconstruction identified the common ancestor of all epidemic SLEV strains to have existed in an area between southern Mexico and Panama ca. 330 years ago. Expansion of the epidemic lineage occurred in two waves, the first representing emergence near the area of origin and the second involving almost parallel appearances of the virus in the lower Mississippi and Amazon delta regions. Early diversification events overlapped human habitat invasion during the post-Columbian era. Several documented SLEV outbreaks, such as the 1964 Houston epidemic or the 1990 Tampa epidemic, were predated by the arrival of novel strains between 1 and 4 years before the outbreaks. Collectively, our data provide insight into the putative origins of SLEV, suggesting that virus emergence was driven by human invasion of primary rainforests. IMPORTANCE St. Louis encephalitis virus (SLEV) is the prototypic mosquito-transmitted flavivirus of the Americas. Unlike the West Nile virus, which we know was recently introduced into North America from the Old World, the provenience of SLEV is obscure. In an ecological investigation in a primary rainforest area of Palenque National Park, Mexico, we have discovered an ancestral variant of SLEV. The ancestral virus was much less active than the epidemic virus in cell cultures, reflecting its incomplete adaptation to hosts encountered outside primary rainforests. Knowledge of this virus enabled a spatiotemporal reconstruction of the common ancestor of all SLEVs and how the virus spread from there. We can infer that the cosmopolitan SLEV lineage emerged from Central America in the 17th century, a period of post-Columbian colonial history marked by intense human invasion of primary rainforests. Further spread followed major bird migration pathways over North and South America.
NASA Astrophysics Data System (ADS)
Frankel, Dana J.
The development of non-surgical transcatheter aortic valve implantation (TAVI) techniques, which utilize collapsible artificial heart valves with shape memory alloy (SMA)-based frames, pushes performance requirements for biomedical SMAs beyond those for well-established vascular stent applications. Fatigue life for these devices must extend into the ultra-high cycle fatigue (UHCF) regime (>600M cycles) with zero probability of failure predicted at applied strain levels. High rates of Ni-hypersensitivity raise biocompatibility concerns, driving the development of low-Ni and Ni-free SMAs. This work focuses on the development of biocompatible, precipitation-strengthened, fatigue-resistant PdTi-based SMAs for biomedical applications. Functional and structural fatigue are both manifestations of cyclic instability resulting in accumulation of slip and eventual structural damage. While functional fatigue is easily experimentally evaluated, structural fatigue is more difficult to measure without the proper equipment. Therefore, in this work a theoretical approach using a model well validated in steels is utilized to investigate structural fatigue behavior in NiTi in the UHCF regime, while low cycle functional fatigue is evaluated in order to monitor the core phenomena of the cyclic instability. Results from fatigue simulations modeling crack nucleation at non-metallic inclusions in commercial NiTi underscore the importance of increasing yield strength for UHCF performance. Controlled precipitation of nanoscale, low-misfit, L21 Heusler aluminides can provide effective strengthening. Phase relations, precipitation kinetics, transformation temperature, transformation strain, cyclic stability, and mechanical properties are characterized in both Ni-free (Pd,Fe)(Ti,Al) and low-Ni high-strength "hybrid" (Pd,Ni)(Ti,Zr,Al) systems. Atom probe tomography is employed to measure phase compositions and particle sizes used to calibrate LSW models for coarsening kinetics and Gibbs-Thompson models for composition trajectories for systems under evolving unstable equilibrium. Mechanical and thermal cyclic stability are investigated using compression testing and differential scanning calorimetry. Mechanical properties are characterized using room temperature and high temperature Vickers microhardness as well as nanoindentation. A superelastic Ni-free (Pd,Fe)(Ti,Al) alloy with near-ambient transformation temperatures, low hysteresis, a highly stable cyclic response, and reversible transformation strains of 3.2% was designed. Due to Pd softening, the addition of Zr is considered to improve strength in a low-Ni "hybrid" (Pd,Ni)(Ti,Zr,Al) alloy. Aging studies at 600°C result in unusually fast coarsening kinetics, while low-temperature aging studies at 500-530°C reveal the presence of a Zr-rich phase in association with the matrix and Heusler phase. A strengthening study on a nontransforming hybrid prototype shows lower than expected precipitation strengthening at 600°C but significant strengthening when aged at 500°C due to the Zr-rich phase. Transformation temperatures, transformation strain, and cyclic stability are characterized in a set of transforming hybrid prototypes.
Instant tough bonding of hydrogels for soft machines and electronics
Wirthl, Daniela; Pichler, Robert; Drack, Michael; Kettlguber, Gerald; Moser, Richard; Gerstmayr, Robert; Hartmann, Florian; Bradt, Elke; Kaltseis, Rainer; Siket, Christian M.; Schausberger, Stefan E.; Hild, Sabine; Bauer, Siegfried; Kaltenbrunner, Martin
2017-01-01
Introducing methods for instant tough bonding between hydrogels and antagonistic materials—from soft to hard—allows us to demonstrate elastic yet tough biomimetic devices and machines with a high level of complexity. Tough hydrogels strongly attach, within seconds, to plastics, elastomers, leather, bone, and metals, reaching unprecedented interfacial toughness exceeding 2000 J/m2. Healing of severed ionic hydrogel conductors becomes feasible and restores function instantly. Soft, transparent multilayered hybrids of elastomers and ionic hydrogels endure biaxial strain with more than 2000% increase in area, facilitating soft transducers, generators, and adaptive lenses. We demonstrate soft electronic devices, from stretchable batteries, self-powered compliant circuits, and autonomous electronic skin for triggered drug delivery. Our approach is applicable in rapid prototyping and in delicate environments inaccessible for extended curing and cross-linking. PMID:28691092
Itaya virus, a Novel Orthobunyavirus Associated with Human Febrile Illness, Peru.
Hontz, Robert D; Guevara, Carolina; Halsey, Eric S; Silvas, Jesus; Santiago, Felix W; Widen, Steven G; Wood, Thomas G; Casanova, Wilma; Vasilakis, Nikos; Watts, Douglas M; Kochel, Tadeusz J; Ebihara, Hideki; Aguilar, Patricia V
2015-05-01
Our genetic analyses of uncharacterized bunyaviruses isolated in Peru identified a possible reassortant virus containing small and large gene segment sequences closely related to the Caraparu virus and a medium gene segment sequence potentially derived from an unidentified group C orthobunyavirus. Neutralization tests confirmed serologic distinction among the newly identified virus and the prototype and Caraparu strains. This virus, named Itaya, was isolated in 1999 and 2006 from febrile patients in the cities of Iquitos and Yurimaguas in Peru. The geographic distance between the 2 cases suggests that the Itaya virus could be widely distributed throughout the Amazon basin in northeastern Peru. Identification of a new Orthobunyavirus species that causes febrile disease in humans reinforces the need to expand viral disease surveillance in tropical regions of South America.
NASA Astrophysics Data System (ADS)
Cheng, Shaobo; Zhang, Dong; Deng, Shiqing; Li, Xing; Li, Jun; Tan, Guotai; Zhu, Yimei; Zhu, Jing
2018-04-01
Topological defects and their interactions often arouse multiple types of emerging phenomena from edge states in Skyrmions to disclination pairs in liquid crystals. In hexagonal manganites, partial edge dislocations, a prototype topological defect, are ubiquitous and they significantly alter the topologically protected domains and their behaviors. Herein, combining electron microscopy experiment and graph theory analysis, we report a systematic study of the connections and configurations of domains in this dislocation embedded system. Rules for domain arrangement are established. The dividing line between domains, which can be attributed by the strain field of dislocations, is accurately described by a genus model from a higher dimension in the graph theory. Our results open a door for the understanding of domain patterns in topologically protected multiferroic systems.
Itaya virus, a Novel Orthobunyavirus Associated with Human Febrile Illness, Peru
Hontz, Robert D.; Guevara, Carolina; Halsey, Eric S.; Silvas, Jesus; Santiago, Felix W.; Widen, Steven G.; Wood, Thomas G.; Casanova, Wilma; Vasilakis, Nikos; Watts, Douglas M.; Kochel, Tadeusz J.; Ebihara, Hideki
2015-01-01
Our genetic analyses of uncharacterized bunyaviruses isolated in Peru identified a possible reassortant virus containing small and large gene segment sequences closely related to the Caraparu virus and a medium gene segment sequence potentially derived from an unidentified group C orthobunyavirus. Neutralization tests confirmed serologic distinction among the newly identified virus and the prototype and Caraparu strains. This virus, named Itaya, was isolated in 1999 and 2006 from febrile patients in the cities of Iquitos and Yurimaguas in Peru. The geographic distance between the 2 cases suggests that the Itaya virus could be widely distributed throughout the Amazon basin in northeastern Peru. Identification of a new Orthobunyavirus species that causes febrile disease in humans reinforces the need to expand viral disease surveillance in tropical regions of South America. PMID:25898901
NASA Astrophysics Data System (ADS)
Udd, Eric
2016-05-01
On September 29, 1977 the first written disclosure of a closed loop fiber optic gyro was witnessed and signed off by four people at McDonnell Douglas Astronautics Company in Huntington Beach, California. Over the next ten years a breadboard demonstration unit, and several prototypes were built. In 1987 the fundamental patent for closed loop operation began a McDonnell Douglas worldwide licensing process. Internal fiber optic efforts were redirected to derivative sensors and inventions. This included development of acoustic, strain and distributed sensors as well as a Sagnac interferometer based secure fiber optic communication system and the new field of fiber optic smart structures. This paper provides an overview of these activities and transitions.
Design and fabrication of prototype system for early warning of impending bearing failure
NASA Technical Reports Server (NTRS)
Broderick, J. J.; Burchill, R. F.; Clark, H. L.
1972-01-01
Ball bearing performance tests run on several identical ball bearings under a variety of load, speed, temperature, and lubrication conditions are reported. Bearing temperature, torque, vibration, noise, strain, cage speed, etc., were monitored to establish those measurements most suitable as indicators of ball bearing health. Tape records were made under steady-state conditions of a variety of speeds and loads. Sample sections were selected for narrowband spectral analysis with a real time analyzer. An artificial flow was created across the inner race surface of one bearing using an acid etch technique to produce the scratch. Tape records obtained before and after established a characteristic frequency response that identifies the presence of the flow. The signals found most useful as indicators of performance degradation were ultrasonic outputs.
Whitaker, William B; Sandoval, Nicholas R; Bennett, Robert K; Fast, Alan G; Papoutsakis, Eleftherios T
2015-06-01
Synthetic methylotrophy is the development of non-native methylotrophs that can utilize methane and methanol as sole carbon and energy sources or as co-substrates with carbohydrates to produce metabolites as biofuels and chemicals. The availability of methane (from natural gas) and its oxidation product, methanol, has been increasing, while prices have been decreasing, thus rendering them as attractive fermentation substrates. As they are more reduced than most carbohydrates, methane and methanol, as co-substrates, can enhance the yields of biologically produced metabolites. Here we discuss synthetic biology and metabolic engineering strategies based on the native biology of aerobic methylotrophs for developing synthetic strains grown on methanol, with Escherichia coli as the prototype. Copyright © 2015. Published by Elsevier Ltd.
Instant tough bonding of hydrogels for soft machines and electronics.
Wirthl, Daniela; Pichler, Robert; Drack, Michael; Kettlguber, Gerald; Moser, Richard; Gerstmayr, Robert; Hartmann, Florian; Bradt, Elke; Kaltseis, Rainer; Siket, Christian M; Schausberger, Stefan E; Hild, Sabine; Bauer, Siegfried; Kaltenbrunner, Martin
2017-06-01
Introducing methods for instant tough bonding between hydrogels and antagonistic materials-from soft to hard-allows us to demonstrate elastic yet tough biomimetic devices and machines with a high level of complexity. Tough hydrogels strongly attach, within seconds, to plastics, elastomers, leather, bone, and metals, reaching unprecedented interfacial toughness exceeding 2000 J/m 2 . Healing of severed ionic hydrogel conductors becomes feasible and restores function instantly. Soft, transparent multilayered hybrids of elastomers and ionic hydrogels endure biaxial strain with more than 2000% increase in area, facilitating soft transducers, generators, and adaptive lenses. We demonstrate soft electronic devices, from stretchable batteries, self-powered compliant circuits, and autonomous electronic skin for triggered drug delivery. Our approach is applicable in rapid prototyping and in delicate environments inaccessible for extended curing and cross-linking.
NASA Astrophysics Data System (ADS)
Armanini, A.; Bortoluzzi, D.; Grisenti, P.; Righetti, M.
The hydrodynamic behaviour of partially and fully submerged tall vegetation is of great interest in the river management. Only recently some researchers (Kouwen, 1999, Oplatka, 1998) analyzed the hydrodynamic resistance of bushes, taking into account also the plants elasticity in the classical Petryk & Bosmajian approach. In the present work, an experimental investigation is performed, where the hydrodynamic resistance of isolated and grouped salix alba bushes is measured, in a laboratory chan- nel at prototype scale. This kind of plants has particular interest because they are often used in bank stabilization and remediation works for mountain streams. The tests are performed using young plants, ranging from 1 m up to 2 m high, in a 100 m long, 2 m deep and 2 m large open channel flow, the discharge ranges up to 1,3 m3/sec. A suitable strain gauges system has been realized in order to directly measure the force exerted on the plant by the flow. The results are compared with analogous measure- ments of Oplatka and Kouwen, confirming the influence of elasticity and leaves on hydrodynamic resistance; in particular the effect of smaller branches bending and the influence of foliage on drag has been analyzed, comparing the drag of the same bush with and without leaves. Moreover an approach for drag evaluation, alternative to that of Oplatka and Kouwen is proposed.
Novel remote sensor systems: design, prototyping, and characterization
NASA Astrophysics Data System (ADS)
Kayastha, V.; Gibbons, S.; Lamb, J. E.; Giedd, R. E.
2014-06-01
We have designed and tested a prototype TRL4 radio-frequency (RF) sensing platform containing a transceiver that interrogates a passive carbon nanotube (CNT)-based sensor platform. The transceiver can be interfaced to a server technology such as a Bluetooth® or Wi-Fi device for further connectivity. The novelty of a very-low-frequency (VLF) implementation in the transceiver design will ultimately enable deep penetration into the ground or metal structures to communicate with buried sensing platforms. The sensor platform generally consists of printed electronic devices made of CNTs on flexible poly(ethylene terephthalate) (PET) and Kapton® substrates. This novel remote sensing system can be integrated with both passive and active sensing platforms. It offers unique characteristics suitable for a variety of sensing applications. The proposed sensing platforms can take on different form factors and the RF output of the sensing platforms could be modulated by humidity, temperature, pressure, strain, or vibration signals. Resonant structures were designed and constructed to operate in the very-high-frequency (VHF) and VLF ranges. In this presentation, we will report results of our continued effort to develop a commercially viable transceiver capable of interrogating the conformally mounted sensing platforms made from CNTs or silver-based nanomaterials on polyimide substrates over a broad range of frequencies. The overall performance of the sensing system with different sensing elements and at different frequency ranges will be discussed.
16 CFR 1633.5 - Prototype pooling and confirmation testing requirements.
Code of Federal Regulations, 2010 CFR
2010-01-01
... 16 Commercial Practices 2 2010-01-01 2010-01-01 false Prototype pooling and confirmation testing... Prototype pooling and confirmation testing requirements. (a) Prototype pooling. One or more manufacturers may rely on a qualified prototype produced by another manufacturer or prototype developer provided...
Prototype Effect and the Persuasiveness of Generalizations.
Dahlman, Christian; Sarwar, Farhan; Bååth, Rasmus; Wahlberg, Lena; Sikström, Sverker
An argument that makes use of a generalization activates the prototype for the category used in the generalization. We conducted two experiments that investigated how the activation of the prototype affects the persuasiveness of the argument. The results of the experiments suggest that the features of the prototype overshadow and partly overwrite the actual facts of the case. The case is, to some extent, judged as if it had the features of the prototype instead of the features it actually has. This prototype effect increases the persuasiveness of the argument in situations where the audience finds the judgment more warranted for the prototype than for the actual case (positive prototype effect), but decreases persuasiveness in situations where the audience finds the judgment less warranted for the prototype than for the actual case (negative prototype effect).
Tuning the sensing range of silicon pressure sensor by trench etching technology
NASA Astrophysics Data System (ADS)
Chou, Yu-Tuan; Lin, Hung-Yi; Hu, Hsin-Hua
2006-01-01
The silicon pressure sensor has been developed for over thirty years and widely used in automobiles, medical instruments, commercial electronics, etc. There are many different specifications of silicon pressure sensors that cover a very large sensing range, from less than 1 psi to as high as 1000 psi. The key elements of the silicon pressure sensor are a square membrane and the piezoresistive strain gages near the boundary of the membrane. The dimensions of the membrane determine the full sensing range and the sensitivity of the silicon sensor, including thickness and in-plane length. Unfortunately, in order to change the sensing range, the manufacturers need to order a customized epi wafer to get the desired thickness. All masks (usually six) have to be re-laid and re-fabricated for different membrane sizes. The existing technology requires at least three months to deliver the prototype for specific customer requests or the new application market. This research proposes a new approach to dramatically reduce the prototyping time from three months to one week. The concept is to tune the rigidity of the sensing membrane by modifying the boundary conditions without changing the plenary size. An extra mask is utilized to define the geometry and location of deep-RIE trenches and all other masks remain the same. Membranes with different depths and different patterns of trenches are designed for different full sensing ranges. The simulation results show that for a 17um thick and 750um wide membrane, the adjustable range by tuning trench depth is about 45% (from 5um to 10um), and can go to as high as 100% by tuning both the pattern and depth of the trenches. Based on an actual test in a product fabrication line, we verified that the total delivery time can be minimized to one week to make the prototyping very effective and cost-efficient.
van Lettow, Britt; de Vries, Hein; Burdorf, Alex; Conner, Mark; van Empelen, Pepijn
2015-05-01
Prototypes (i.e., social images) predict health-related behaviours and intentions within the context of the Theory of Planned Behaviour (TPB). This study tested the moderating role of temporal stability of drinker prototype perceptions on prototype-intentions and prototype-behaviour relationships, within an augmented TPB. The study examined abstainer, moderate drinker, heavy drinker, tipsy, and drunk prototypes. An online prospective study with 1-month follow-up was conducted among 410 young adults (18-25 years old, Mage = 21.0, SD = 2.14, 21.7% male). Assessed were prototype perceptions (favourability and similarity, T1, T2), stability of prototype perceptions, TPB variables (T1), intentions (T2), and drinking behaviour (T2). Intention analyses were corrected for baseline behaviour; drinking behaviour analyses were corrected for intentions and baseline behaviour. Hierarchical regressions showed that prototype stability moderated the relationships of drunk and abstainer prototype similarity with intentions. Similarity to the abstainer prototype explained intentions to drink sensibly more strongly among individuals with stable perceptions than among those with unstable perceptions. Conversely, intentions were explained stronger among individuals with stable perceptions of dissimilarity to the drunk prototype than among those with unstable perceptions. No moderation effects were found for stability of favourability or for relationships with behaviour. Stable prototype similarity perceptions were more predictive of intentions than unstable perceptions. These perceptions were most relevant in enhancing the explanation of young adults' intended drinking behaviour. Specifically, young adults' health intentions seem to be guided by the dissociation from the drunk prototype and association with the abstainer prototype. Statement of contribution What is already known on this subject? Prototypes have augmented the Theory of Planned Behaviour in explaining risk behaviour. Temporal stability has been shown to successfully extend the TPB in explaining intentions. Temporal stability of TPB variables can moderate the relationships with behaviour and intentions. What does this study add? Stability of prototype perceptions moderates the prototype-intentions relationship. Stability of abstainer and drunk prototype similarity enhances the explanation of (intentional) drinking. Stable prototype perceptions are more explanatory than unstable perceptions. © 2014 The British Psychological Society.
Characterization of tick-borne encephalitis (TBE) foci in Germany and Latvia (1997-2000).
Süss, Jochen; Schrader, Christina; Abel, Ulrich; Bormane, Antra; Duks, Arnis; Kalnina, Vaira
2002-06-01
Knowledge concerning the prevalence of the tick-borne encephalitis virus (TBEV) in wild living tick populations is very important for understanding the epidemiology of the disease and for immuno prophylactic strategy. In Germany high and low risk areas of TBE exist. In the years 1997-2000, 533 autochthonous clinical TBE cases were recorded, in the high-risk areas of Bavaria and Baden-Wuerttemberg 140 and 363, and in the low risk areas in Hesse (Odenwald) and Rhineland-Palatinate 22 and 8, respectively. Corresponding to these case reports we have measured the virus prevalence in free living ticks in these four risk areas and compared these findings with the situation in high-risk areas in Latvia. In the years 1997-2000, 2,797 clinical TBE cases were recorded in Latvia. For the studies in Germany, a total of 17,398 Ixodesricinus ticks (14,860 nymphs and 2,538 adults) were collected by flagging and examined for TBEV, in Latvia the corresponding numbers were 525 I. ricinus ticks (350 adults and 175 nymphs) and 281 I. persulcatus ticks (adults only). Information concerning annual and seasonal differences of the TBEV prevalence in natural TBE foci is not available in Germany. This paper is a continuation of the study (Süss et al., 1999), starting in 1997. We investigated every year, in May and September, the virus prevalence in ticks in high risk areas of Bavaria (8 foci) and Baden-Wuerttemberg (5 foci). A total of 15,400 ticks (13,100 nymphs and 2,300 adults) were examined for TBEV. The ticks were tested for the presence of TBEV-RNA using a sensitive, nested-RT-PCR. The virus prevalence in the Bavarian foci of the whole tick population ranged from 0.3 to 2.0% during these four years, in adults between 1.2 and 5.3% and in nymphs between 0.1 and 1.4%. In the high-risk areas of Baden-Wuerttemberg, in the Black Forest, the estimated virus prevalence rates of investigated ticks varied from 0.2 to 3.4%, in adults from 0 to 4.8%, and in nymphs from 0.2 to 3.4%. Using the same methods, we have also tested the low risk areas in the Odenwald (840 nymphs, 160 adults) and in Rhineland-Palatinate (920 nymphs, 78 adults). Ticks were collected in those areas where most TBE cases were registered. The virus prevalence in the Odenwald was 0% in adults and 0.5% in nymphs, whereas in ticks from Rhineland-Palatinate we have not found any positive PCR signal. Sequence data of the PCR products have shown that all strains in Germany were closely related to the central European virus prototype Neudoerfl. In I. ricinus ticks, collected in Riga county, the following virus prevalence rates were found: in females 2.4%, in males 3.7%, and in all adults 3.0%, in nymphs 2.4% and in the I. ricinus tick population examined 2.8%. The virus prevalence in I. persulcatus, collected in the eastern parts of Latvia was 6% in females, 4% in males and 5% in all adults. All the PCR products were sequenced and a phylogenetic tree was constructed. Studies in natural foci of TBE in Latvia have shown that I. ricinus carried the central European virus subtype (prototype Neudoerfl) whereas in I. persulcatus two strains have been found, the central European virus subtype (prototype Neudoerfl) and the Siberian virus subtype (prototype Vasilchenko). Sequences of the Far Eastern subtype have not been detected yet.
Effects of antimicrobial treatment on fiberglass-acrylic filters.
Cecchini, C; Verdenelli, M C; Orpianesi, C; Dadea, G M; Cresci, A
2004-01-01
The aims of the present study were to: (i) analyse a group of antimicrobial agents and to select the most active against test microbial strains; (ii) test the effect of the antimicrobial treatment on air filters in order to reduce microbial colonization. Different kinds of antimicrobial agents were analysed to assess their compatibility with the production process of air filter media. The minimal inhibitory concentration for each antimicrobial agent was determined against a defined list of microbial strains, and an antimicrobial activity assay of filter prototypes was developed to determine the most active agent among the compatible antimicrobials. Then, the most active was chosen and added directly to the filter during the production process. The microbial colonization of treated and untreated filter media was assessed at different working times for different incubation times by stereomicroscope and scanning electron microscope analysis. Some of the antimicrobial agents analysed were more active against microbial test strains and compatible with the production process of the filter media. Filter sections analysis of treated filter media showed a significantly lower microbial colonization than those untreated, a reduction of species both in density and varieties and of the presence of bacteria and fungal hyphae with reproductive structures. This study demonstrated the ability of antimicrobial treatments to inhibit the growth of micro-organisms in filter media and subsequently to increase indoor air quality (IAQ), highlighting the value of adding antimicrobials to filter media. To make a contribution to solving the problem of microbial contamination of air filters, by demonstrating the efficacy of incorporating antimicrobial agents in the filter media to improve IAQ and health.
Broderick, Christopher A; Jin, Shirong; Marko, Igor P; Hild, Konstanze; Ludewig, Peter; Bushell, Zoe L; Stolz, Wolfgang; Rorison, Judy M; O'Reilly, Eoin P; Volz, Kerstin; Sweeney, Stephen J
2017-04-19
The potential to extend the emission wavelength of photonic devices further into the near- and mid-infrared via pseudomorphic growth on conventional GaAs substrates is appealing for a number of communications and sensing applications. We present a new class of GaAs-based quantum well (QW) heterostructure that exploits the unusual impact of Bi and N on the GaAs band structure to produce type-II QWs having long emission wavelengths with little or no net strain relative to GaAs, while also providing control over important laser loss processes. We theoretically and experimentally demonstrate the potential of GaAs 1-x Bi x /GaN y As 1-y type-II QWs on GaAs and show that this approach offers optical emission and absorption at wavelengths up to ~3 µm utilising strain-balanced structures, a first for GaAs-based QWs. Experimental measurements on a prototype GaAs 0.967 Bi 0.033 /GaN 0.062 As 0.938 structure, grown via metal-organic vapour phase epitaxy, indicate good structural quality and exhibit both photoluminescence and absorption at room temperature. The measured photoluminescence peak wavelength of 1.72 μm is in good agreement with theoretical calculations and is one of the longest emission wavelengths achieved on GaAs to date using a pseudomorphically grown heterostructure. These results demonstrate the significant potential of this new class of III-V heterostructure for long-wavelength applications.
NASA Astrophysics Data System (ADS)
Broderick, Christopher A.; Jin, Shirong; Marko, Igor P.; Hild, Konstanze; Ludewig, Peter; Bushell, Zoe L.; Stolz, Wolfgang; Rorison, Judy M.; O'Reilly, Eoin P.; Volz, Kerstin; Sweeney, Stephen J.
2017-04-01
The potential to extend the emission wavelength of photonic devices further into the near- and mid-infrared via pseudomorphic growth on conventional GaAs substrates is appealing for a number of communications and sensing applications. We present a new class of GaAs-based quantum well (QW) heterostructure that exploits the unusual impact of Bi and N on the GaAs band structure to produce type-II QWs having long emission wavelengths with little or no net strain relative to GaAs, while also providing control over important laser loss processes. We theoretically and experimentally demonstrate the potential of GaAs1-xBix/GaNyAs1-y type-II QWs on GaAs and show that this approach offers optical emission and absorption at wavelengths up to ~3 µm utilising strain-balanced structures, a first for GaAs-based QWs. Experimental measurements on a prototype GaAs0.967Bi0.033/GaN0.062As0.938 structure, grown via metal-organic vapour phase epitaxy, indicate good structural quality and exhibit both photoluminescence and absorption at room temperature. The measured photoluminescence peak wavelength of 1.72 μm is in good agreement with theoretical calculations and is one of the longest emission wavelengths achieved on GaAs to date using a pseudomorphically grown heterostructure. These results demonstrate the significant potential of this new class of III-V heterostructure for long-wavelength applications.
Tomatidine Is a Lead Antibiotic Molecule That Targets Staphylococcus aureus ATP Synthase Subunit C.
Lamontagne Boulet, Maxime; Isabelle, Charles; Guay, Isabelle; Brouillette, Eric; Langlois, Jean-Philippe; Jacques, Pierre-Étienne; Rodrigue, Sébastien; Brzezinski, Ryszard; Beauregard, Pascale B; Bouarab, Kamal; Boyapelly, Kumaraswamy; Boudreault, Pierre-Luc; Marsault, Éric; Malouin, François
2018-06-01
Methicillin-resistant Staphylococcus aureus (MRSA) is a leading cause of deadly hospital-acquired infections. The discovery of anti- Staphylococcus antibiotics and new classes of drugs not susceptible to the mechanisms of resistance shared among bacteria is imperative. We recently showed that tomatidine (TO), a steroidal alkaloid from solanaceous plants, possesses potent antibacterial activity against S. aureus small-colony variants (SCVs), the notoriously persistent form of this bacterium that has been associated with recurrence of infections. Here, using genomic analysis of in vitro -generated TO-resistant S. aureus strains to identify mutations in genes involved in resistance, we identified the bacterial ATP synthase as the cellular target. Sequence alignments were performed to highlight the modified sequences, and the structural consequences of the mutations were evaluated in structural models. Overexpression of the atpE gene in S. aureus SCVs or introducing the mutation found in the atpE gene of one of the high-level TO-resistant S. aureus mutants into the Bacillus subtilis atpE gene provided resistance to TO and further validated the identity of the cellular target. FC04-100, a TO derivative which also possesses activity against non-SCV strains, prevents high-level resistance development in prototypic strains and limits the level of resistance observed in SCVs. An ATP synthesis assay allowed the observation of a correlation between antibiotic potency and ATP synthase inhibition. The selectivity index (inhibition of ATP production by mitochondria versus that of bacterial ATP synthase) is estimated to be >10 5 -fold for FC04-100. Copyright © 2018 American Society for Microbiology.
Li, Jingru; Wang, Wenliang; Xu, Stacey X.; Magarvey, Nathan A.; McCormick, John K.
2011-01-01
The production of the staphylococcal exotoxin toxic shock syndrome toxin-1 (TSST-1) by Staphylococcus aureus has been associated with essentially all cases of menstruation-associated toxic shock syndrome (TSS). In this work, we show that the human vaginal isolate Lactobacillus reuteri RC-14 produces small signaling molecules that are able to interfere with the staphylococcal quorum-sensing system agr, a key regulator of virulence genes, and repress the expression of TSST-1 in S. aureus MN8, a prototype of menstrual TSS S. aureus strains. Quantitative real-time PCR data showed that transcription from the Ptst promoter, as well as the P2 and P3 promoters of the agr system from all four agr subgroups of S. aureus, was strongly inhibited in response to growth with L. reuteri RC-14 cultural supernatant. Alterations in the transcriptional levels of two other virulence-associated regulators sarA and saeRS were also observed, indicating a potential overall influence of L. reuteri RC-14 signals on the production of virulence factors in S. aureus. S. aureus promoter-lux reporter strains were used to screen biochemically fractionated L. reuteri RC-14 supernatant, and the cyclic dipeptides cyclo(l-Phe-l-Pro) and cyclo(l-Tyr-l-Pro) were identified as the signaling molecules. The results from this work contribute to a better understanding of interspecies cell-to-cell communication between Lactobacillus and Staphylococcus, and provide a unique mechanism by which endogenous or probiotic strains may attenuate virulence factor production by bacterial pathogens. PMID:21282650
Shabbir, Muhammad Zubair; Akhtar, Sameera; Tang, Yi; Yaqub, Tahir; Ahmad, Arfan; Mustafa, Ghulam; Alam, Muhammad Azhar; Santhakumar, Diwakar; Nair, Venugopal; Munir, Muhammad
2016-12-01
Newcastle disease virus, a prototype avian paramyxovirus serotype 1 (APMV-1), causes economically devastating disease in avian species around the world. Newcastle disease is enzootic in Pakistan and recurrent outbreaks are frequent in multiple avian species even after continuous and extensive use of vaccines. A number of APMV-1 and pigeon paramyxovirus serotype 1 (PPMV-1) strains have been isolated and genetically characterized in recent years. However, the impact of recently characterized wild bird-origin APMVs in domestic poultry, and the potency of routinely used vaccines against these novel and genetically diverse viruses remain unknown. Here, we applied next-generation sequencing for unbiased complete genome characterization of APMV-1 and PPMV-1 strains isolated from clinically diseased peacocks (Pavocristatus) and pigeons (Columbalivia), respectively. Global phylodynamics and evolutionary analysis demonstrates Pigeon/MZS-UVAS-Pak/2014 is clustered into lineage 4 (or genotype VI) and Peacock/MZS-UVAS-Pak/2014 into lineage 5 (or genotype VII). The genomes of both isolates encoded for polybasic residues (112RRQKR↓F117) at the fusion protein cleavage motif along with a number of important substitutions in the surface glycoproteins compared with the vaccine strains. Clinicopathological and immunological investigations in domesticated chickens indicate that these isolates can potentially transmit between tested avian species, can cause systemic infections, and can induce antibodies that are unable to prevent virus shedding. Collectively, the data from these genomic and biological assessments highlight the potential of wild birds in transmitting APMVs to domesticated chickens. The study also demonstrates that the current vaccine regimens are incapable of providing complete protection against wild bird-origin APMVs and PPMVs.
Johansson, Åsa; Nagy, Elisabeth; Sóki, József
2014-08-01
Rapid identification of isolates in positive blood cultures are of great importance to secure correct treatment of septicaemic patients. As antimicrobial resistance is increasing, rapid detection of resistance is crucial. Carbapenem resistance in Bacteroides fragilis associated with cfiA-encoded class B metallo-beta-lactamase is emerging. In our study we spiked blood culture bottles with 26 B. fragilis strains with various cfiA-status and ertapenem MICs. By using main spectra specific for cfiA-positive and cfiA-negative B. fragilis strains, isolates could be screened for resistance. To verify strains that were positive in the screening, a carbapenemase assay was performed where the specific peaks of intact and hydrolysed ertapenem were analysed with matrix-assisted laser desorption ionization-time of flight mass spectrometry (MALDI-TOF MS). We show here that it is possible to correctly identify B. fragilis and to screen for enzymic carbapenem resistance directly from the pellet of positive blood cultures. The carbapenemase assay to verify the presence of the enzyme was successfully performed on the pellet from the direct identification despite the presence of blood components. The result of the procedure was achieved in 3 h. Also the Bruker mass spectrometric β-lactamase assay (MSBL assay) prototype software was proven not only to be based on an algorithm that correlated with the manual inspection of the spectra, but also to improve the interpretation by showing the variation in the dataset. © 2014 The Authors.
Development of Field Excavator with Embedded Force Measurement
NASA Technical Reports Server (NTRS)
Johnson, K.; Creager, C.; Izadnegahdar, A.; Bauman, S.; Gallo, C.; Abel, P.
2012-01-01
A semi-intelligent excavation mechanism was developed for use with the NASA-built Centaur 2 rover prototype. The excavator features a continuously rotatable large bucket supported between two parallel arms, both of which share a single pivot axis near the excavator base attached to the rover. The excavator is designed to simulate the collection of regolith, such as on the Moon, and to dump the collected soil into a hopper up to one meter tall for processing to extract oxygen. Because the vehicle can be autonomous and the terrain is generally unknown, there is risk of damaging equipment or using excessive power when attempting to extract soil from dense or rocky terrain. To minimize these risks, it is critical for the rover to sense the digging forces and adjust accordingly. It is also important to understand the digging capabilities and limitations of the excavator. This paper discusses the implementation of multiple strain gages as an embedded force measurement system in the excavator's arms. These strain gages can accurately measure and resolve multi-axial forces on the excavator. In order to validate these sensors and characterize the load capabilities, a series of controlled excavation tests were performed at Glenn Research Center with the excavator at various depths and cut angles while supported by a six axis load cell. The results of these tests are both compared to a force estimation model and used for calibration of the embedded strain gages. In addition, excavation forces generated using two different types of bucket edge (straight vs. with teeth) were compared.
Saubi, Narcís; Gea-Mallorquí, Ester; Ferrer, Pau; Hurtado, Carmen; Sánchez-Úbeda, Sara; Eto, Yoshiki; Gatell, Josep M; Hanke, Tomáš; Joseph, Joan
2014-01-01
In this study, we have engineered a new mycobacterial vaccine design by using an antibiotic-free plasmid selection system. We assembled a novel Escherichia coli (E. coli)–mycobacterial shuttle plasmid p2auxo.HIVA, expressing the HIV-1 clade A immunogen HIVA. This shuttle vector employs an antibiotic resistance-free mechanism for plasmid selection and maintenance based on glycine complementation in E. coli and lysine complementation in mycobacteria. This plasmid was first transformed into glycine auxotroph of E. coli strain and subsequently transformed into lysine auxotroph of Mycobacterium bovis BCG strain to generate vaccine BCG.HIVA2auxo. We demonstrated that the episomal plasmid p2auxo.HIVA was stable in vivo over a 7-week period and genetically and phenotypically characterized the BCG.HIVA2auxo vaccine strain. The BCG.HIVA2auxo vaccine in combination with modified vaccinia virus Ankara (MVA). HIVA was safe and induced HIV-1 and Mycobacterium tuberculosis-specific interferon-γ-producing T-cell responses in adult BALB/c mice. Polyfunctional HIV-1-specific CD8+ T cells, which produce interferon-γ and tumor necrosis factor-α and express the degranulation marker CD107a, were induced. Thus, we engineered a novel, safer, good laboratory practice–compatible BCG-vectored vaccine using prototype immunogen HIVA. This antibiotic-free plasmid selection system based on “double” auxotrophic complementation might be a new mycobacterial vaccine platform to develop not only recombinant BCG-based vaccines expressing second generation of HIV-1 immunogens but also other major pediatric pathogens to prime protective response soon after birth. PMID:26015961
Li, Jingru; Wang, Wenliang; Xu, Stacey X; Magarvey, Nathan A; McCormick, John K
2011-02-22
The production of the staphylococcal exotoxin toxic shock syndrome toxin-1 (TSST-1) by Staphylococcus aureus has been associated with essentially all cases of menstruation-associated toxic shock syndrome (TSS). In this work, we show that the human vaginal isolate Lactobacillus reuteri RC-14 produces small signaling molecules that are able to interfere with the staphylococcal quorum-sensing system agr, a key regulator of virulence genes, and repress the expression of TSST-1 in S. aureus MN8, a prototype of menstrual TSS S. aureus strains. Quantitative real-time PCR data showed that transcription from the Ptst promoter, as well as the P2 and P3 promoters of the agr system from all four agr subgroups of S. aureus, was strongly inhibited in response to growth with L. reuteri RC-14 cultural supernatant. Alterations in the transcriptional levels of two other virulence-associated regulators sarA and saeRS were also observed, indicating a potential overall influence of L. reuteri RC-14 signals on the production of virulence factors in S. aureus. S. aureus promoter-lux reporter strains were used to screen biochemically fractionated L. reuteri RC-14 supernatant, and the cyclic dipeptides cyclo(L-Phe-L-Pro) and cyclo(L-Tyr-L-Pro) were identified as the signaling molecules. The results from this work contribute to a better understanding of interspecies cell-to-cell communication between Lactobacillus and Staphylococcus, and provide a unique mechanism by which endogenous or probiotic strains may attenuate virulence factor production by bacterial pathogens.
Ludlow, M.; Nguyen, D. T.; Silin, D.; Lyubomska, O.; de Vries, R. D.; von Messling, V.; McQuaid, S.; De Swart, R. L.
2012-01-01
The propensity of canine distemper virus (CDV) to spread to the central nervous system is one of the primary features of distemper. Therefore, we developed a reverse genetics system based on the neurovirulent Snyder Hill (SH) strain of CDV (CDVSH) and show that this virus rapidly circumvents the blood-brain and blood-cerebrospinal fluid (CSF) barriers to spread into the subarachnoid space to induce dramatic viral meningoencephalitis. The use of recombinant CDVSH (rCDVSH) expressing enhanced green fluorescent protein (EGFP) or red fluorescent protein (dTomato) facilitated the sensitive pathological assessment of routes of virus spread in vivo. Infection of ferrets with these viruses led to the full spectrum of clinical signs typically associated with distemper in dogs during a rapid, fatal disease course of approximately 2 weeks. Comparison with the ferret-adapted CDV5804P and the prototypic wild-type CDVR252 showed that hematogenous infection of the choroid plexus is not a significant route of virus spread into the CSF. Instead, viral spread into the subarachnoid space in rCDVSH-infected animals was triggered by infection of vascular endothelial cells and the hematogenous spread of virus-infected leukocytes from meningeal blood vessels into the subarachnoid space. This resulted in widespread infection of cells of the pia and arachnoid mater of the leptomeninges over large areas of the cerebral hemispheres. The ability to sensitively assess the in vivo spread of a neurovirulent strain of CDV provides a novel model system to study the mechanisms of virus spread into the CSF and the pathogenesis of acute viral meningitis. PMID:22553334
Broderick, Christopher A.; Jin, Shirong; Marko, Igor P.; Hild, Konstanze; Ludewig, Peter; Bushell, Zoe L.; Stolz, Wolfgang; Rorison, Judy M.; O’Reilly, Eoin P.; Volz, Kerstin; Sweeney, Stephen J.
2017-01-01
The potential to extend the emission wavelength of photonic devices further into the near- and mid-infrared via pseudomorphic growth on conventional GaAs substrates is appealing for a number of communications and sensing applications. We present a new class of GaAs-based quantum well (QW) heterostructure that exploits the unusual impact of Bi and N on the GaAs band structure to produce type-II QWs having long emission wavelengths with little or no net strain relative to GaAs, while also providing control over important laser loss processes. We theoretically and experimentally demonstrate the potential of GaAs1−xBix/GaNyAs1−y type-II QWs on GaAs and show that this approach offers optical emission and absorption at wavelengths up to ~3 µm utilising strain-balanced structures, a first for GaAs-based QWs. Experimental measurements on a prototype GaAs0.967Bi0.033/GaN0.062As0.938 structure, grown via metal-organic vapour phase epitaxy, indicate good structural quality and exhibit both photoluminescence and absorption at room temperature. The measured photoluminescence peak wavelength of 1.72 μm is in good agreement with theoretical calculations and is one of the longest emission wavelengths achieved on GaAs to date using a pseudomorphically grown heterostructure. These results demonstrate the significant potential of this new class of III-V heterostructure for long-wavelength applications. PMID:28422129
Rubio, Mari-Paz; López-Bueno, Alberto; Almendral, José M
2005-09-01
The mechanisms involved in the emergence of virulent mammalian viruses were investigated in the adult immunodeficient SCID mouse infected by the attenuated prototype strain of the parvovirus Minute Virus of Mice (MVMp). Cloned MVMp intravenously inoculated in mice consistently evolved during weeks of subclinical infection to variants showing altered plaque phenotypes. All the isolated large-plaque variants spread systemically from the oronasal cavity and replicated in major organs (brain, kidney, liver), in sharp contrast to the absolute inability of the MVMp and small-plaque variants to productively invade SCID organs by this natural route of infection. The virulent variants retained the MVMp capacity to infect mouse fibroblasts, consistent with the lack of genetic changes across the 220-to-335 amino acid sequence of VP2, a capsid domain containing main determinants of MVM tropism. However, the capsid of the virulent variants shared a lower affinity than the wild type for a primary receptor used in the cytotoxic infection. The capsid gene of a virulent variant engineered in the MVMp background endowed the recombinant virus with a large-plaque phenotype, lower affinity for the receptor, and productive invasiveness by the oronasal route in SCID mice, eventually leading to 100% mortality. In the analysis of virulence in mice, both MVMp and the recombinant virus similarly gained the bloodstream 1 to 2 days postoronasal inoculation and remained infectious when adsorbed to blood cells in vitro. However, the wild-type MVMp was cleared from circulation a few days afterwards, in contrast to the viremia of the recombinant virus, which was sustained for life. Significantly, attachment to an abundant receptor of primary mouse kidney epithelial cells by both viruses could be quantitatively competed by wild-type MVMp capsids, indicating that virulence is not due to an extended receptor usage in target tissues. We conclude that the selection of capsid-receptor interactions of low affinity, which favors systemic infection, is a major evolutionary process in the adaptation of parvoviruses to new hosts and in the cause of disease.
Rubio, Mari-Paz; López-Bueno, Alberto; Almendral, José M.
2005-01-01
The mechanisms involved in the emergence of virulent mammalian viruses were investigated in the adult immunodeficient SCID mouse infected by the attenuated prototype strain of the parvovirus Minute Virus of Mice (MVMp). Cloned MVMp intravenously inoculated in mice consistently evolved during weeks of subclinical infection to variants showing altered plaque phenotypes. All the isolated large-plaque variants spread systemically from the oronasal cavity and replicated in major organs (brain, kidney, liver), in sharp contrast to the absolute inability of the MVMp and small-plaque variants to productively invade SCID organs by this natural route of infection. The virulent variants retained the MVMp capacity to infect mouse fibroblasts, consistent with the lack of genetic changes across the 220-to-335 amino acid sequence of VP2, a capsid domain containing main determinants of MVM tropism. However, the capsid of the virulent variants shared a lower affinity than the wild type for a primary receptor used in the cytotoxic infection. The capsid gene of a virulent variant engineered in the MVMp background endowed the recombinant virus with a large-plaque phenotype, lower affinity for the receptor, and productive invasiveness by the oronasal route in SCID mice, eventually leading to 100% mortality. In the analysis of virulence in mice, both MVMp and the recombinant virus similarly gained the bloodstream 1 to 2 days postoronasal inoculation and remained infectious when adsorbed to blood cells in vitro. However, the wild-type MVMp was cleared from circulation a few days afterwards, in contrast to the viremia of the recombinant virus, which was sustained for life. Significantly, attachment to an abundant receptor of primary mouse kidney epithelial cells by both viruses could be quantitatively competed by wild-type MVMp capsids, indicating that virulence is not due to an extended receptor usage in target tissues. We conclude that the selection of capsid-receptor interactions of low affinity, which favors systemic infection, is a major evolutionary process in the adaptation of parvoviruses to new hosts and in the cause of disease. PMID:16103180
Dielectric Actuation of Polymers
NASA Astrophysics Data System (ADS)
Niu, Xiaofan
Dielectric polymers are widely used in a plurality of applications, such as electrical insulation, dielectric capacitors, and electromechanical actuators. Dielectric polymers with large strain deformations under an electric field are named dielectric elastomers (DE), because of their relative low modulus, high elongation at break, and outstanding resilience. Dielectric elastomer actuators (DEA) are superior to traditional transducers as a muscle-like technology: large strains, high energy densities, high coupling efficiency, quiet operation, and light weight. One focus of this dissertation is on the design of DE materials with high performance and easy processing. UV radiation curing of reactive species is studied as a generic synthesis methodology to provide a platform for material scientists to customize their own DE materials. Oligomers/monomers, crosslinkers, and other additives are mixed and cured at appropriate ratios to control the stress-strain response, suppress electromechanical instability of the resulting polymers, and provide stable actuation strains larger than 100% and energy densities higher than 1 J/g. The processing is largely simplified in the new material system by removal of the prestretching step. Multilayer stack actuators with 11% linear strain are demonstrated in a procedure fully compatible with industrial production. A multifunctional DE derivative material, bistable electroactive polymer (BSEP), is invented enabling repeatable rigid-to-rigid deformation without bulky external structures. Bistable actuation allows the polymer actuator to have two distinct states that can support external load without device failure. Plasticizers are used to lower the glass transition temperature to 45 °C. Interpenetrating polymer network structure is established inside the BSEP to suppress electromechanical instability, providing a breakdown field of 194 MV/m and a stable bistable strain as large as 228% with a 97% strain fixity. The application of BSEP in tactile display is investigated by the prototyping of a large scale refreshable Braille display device. Braille is a critical way for the vision impaired community to learn literacy and improve life quality. Current piezoelectrics-based refreshable Braille display technologies are limited to up to 1 line of Braille text, due to the bulky size of bimorph actuators. Based on the unique actuation feature of BSEP, refreshable Braille display devices up to smartphone-size have been demonstrated by polymer sheet laminates. Dots in the devices can be individually controlled via incorporated field-driven BSEP actuators and Joule heater units. A composite material consisting of silver nanowires (AgNW) embedded in a polymer substrate is brought up as a compliant electrode candidate for BSEP application. The AgNW composite is highly conductive (Rs: 10 Ω/sq) and remains conductive at strains as high as 140% (Rs: <10 3 Ω/sq). The baseline conductivity has only small changes up to 90% strain, which makes it low enough for both field driving and stretchable Joule heating. An out-of-plane bistable area strain up to 68% under Joule heating is achieved.
Walz, Lisa; Kays, Sarah-Katharina; Zimmer, Gert; von Messling, Veronika
2018-06-20
Immune responses induced by currently licensed inactivated influenza vaccines are mainly directed against the hemagglutinin (HA) glycoprotein, the immunodominant antigen of influenza viruses. The resulting antigenic drift of HA requires frequent updating of the vaccine composition and annual revaccination. On the other hand, the level of antibodies directed against the neuraminidase (NA) glycoprotein, the second major influenza virus antigen, vary greatly. To investigate the potential of the more conserved NA protein for the induction of a subtype-specific protection, vesicular stomatitis virus-based replicons expressing a panel of N1 proteins from prototypic seasonal and pandemic H1N1 strain and human H5N1 and H7N9 isolates were generated. Immunization of mice and ferrets with the replicon carrying the matched N1 protein resulted in robust humoral and cellular immune responses and protected against challenge with the homologous influenza virus with similar efficacy as the matched HA protein, illustrating the potential of the NA protein as vaccine antigen. The extent of protection after immunization with mismatched N1 proteins correlated with the level of cross-reactive sialidase-inhibiting antibody titers. Passive serum transfer experiments in mice confirmed that these functional antibodies determine subtype-specific cross-protection. Our findings illustrate the potential of NA-specific immunity for achieving broader protection against antigenic drift variants or newly emerging viruses carrying the same NA but a different HA subtype. IMPORTANCE Despite the availability of vaccines, annual influenza virus epidemics cause 250,000 to 500,000 deaths worldwide. Currently licensed inactivated vaccines, which are standardized for the amount of the hemagglutinin (HA) antigen, primarily induce strain-specific antibodies whereas the immune response to the neuraminidase (NA) antigen, which is also present on the viral surface, is usually low. Using NA-expressing single-cycle vesicular stomatitis virus replicons, we show that the NA antigen not only conferred protection of mice and ferrets to the matched influenza strains, but also against viruses carrying NA proteins from other strains of the same subtype. The extent of protection correlated with the level of cross-reactive NA-inhibiting antibodies. This highlights the potential of the NA antigen for the development of more broadly protective influenza vaccines. Such vaccines may also provide partial protection against newly emerging strains with the same NA but a different HA subtype. Copyright © 2018 American Society for Microbiology.
Bandyopadhyay, Anindita; Elvitigala, Thanura; Welsh, Eric; Stöckel, Jana; Liberton, Michelle; Min, Hongtao; Sherman, Louis A; Pakrasi, Himadri B
2011-01-01
The genus Cyanothece comprises unicellular cyanobacteria that are morphologically diverse and ecologically versatile. Studies over the last decade have established members of this genus to be important components of the marine ecosystem, contributing significantly to the nitrogen and carbon cycle. System-level studies of Cyanothece sp. ATCC 51142, a prototypic member of this group, revealed many interesting metabolic attributes. To identify the metabolic traits that define this class of cyanobacteria, five additional Cyanothece strains were sequenced to completion. The presence of a large, contiguous nitrogenase gene cluster and the ability to carry out aerobic nitrogen fixation distinguish Cyanothece as a genus of unicellular, aerobic nitrogen-fixing cyanobacteria. Cyanothece cells can create an anoxic intracellular environment at night, allowing oxygen-sensitive processes to take place in these oxygenic organisms. Large carbohydrate reserves accumulate in the cells during the day, ensuring sufficient energy for the processes that require the anoxic phase of the cells. Our study indicates that this genus maintains a plastic genome, incorporating new metabolic capabilities while simultaneously retaining archaic metabolic traits, a unique combination which provides the flexibility to adapt to various ecological and environmental conditions. Rearrangement of the nitrogenase cluster in Cyanothece sp. strain 7425 and the concomitant loss of its aerobic nitrogen-fixing ability suggest that a similar mechanism might have been at play in cyanobacterial strains that eventually lost their nitrogen-fixing ability. The unicellular cyanobacterial genus Cyanothece has significant roles in the nitrogen cycle in aquatic and terrestrial environments. Cyanothece sp. ATCC 51142 was extensively studied over the last decade and has emerged as an important model photosynthetic microbe for bioenergy production. To expand our understanding of the distinctive metabolic capabilities of this cyanobacterial group, we analyzed the genome sequences of five additional Cyanothece strains from different geographical habitats, exhibiting diverse morphological and physiological attributes. These strains exhibit high rates of N(2) fixation and H(2) production under aerobic conditions. They can generate copious amounts of carbohydrates that are stored in large starch-like granules and facilitate energy-intensive processes during the dark, anoxic phase of the cells. The genomes of some Cyanothece strains are quite unique in that there are linear elements in addition to a large circular chromosome. Our study provides novel insights into the metabolism of this class of unicellular nitrogen-fixing cyanobacteria.
Implicit face prototype learning from geometric information.
Or, Charles C-F; Wilson, Hugh R
2013-04-19
There is evidence that humans implicitly learn an average or prototype of previously studied faces, as the unseen face prototype is falsely recognized as having been learned (Solso & McCarthy, 1981). Here we investigated the extent and nature of face prototype formation where observers' memory was tested after they studied synthetic faces defined purely in geometric terms in a multidimensional face space. We found a strong prototype effect: The basic results showed that the unseen prototype averaged from the studied faces was falsely identified as learned at a rate of 86.3%, whereas individual studied faces were identified correctly 66.3% of the time and the distractors were incorrectly identified as having been learned only 32.4% of the time. This prototype learning lasted at least 1 week. Face prototype learning occurred even when the studied faces were further from the unseen prototype than the median variation in the population. Prototype memory formation was evident in addition to memory formation of studied face exemplars as demonstrated in our models. Additional studies showed that the prototype effect can be generalized across viewpoints, and head shape and internal features separately contribute to prototype formation. Thus, implicit face prototype extraction in a multidimensional space is a very general aspect of geometric face learning. Copyright © 2013 Elsevier Ltd. All rights reserved.
Teunissen, Hanneke A; Spijkerman, Renske; Kuntsche, Emmanuel; Engels, Rutger C M E; Scholte, Ron H J
2017-04-16
There is still limited understanding of how different kinds of drinker prototypes are associated with adolescent drinking. This study uses the strengths of multiple time-point diary measures (enhanced validity of alcohol use measurement) to test the predictive value of abstainer, moderate and heavy drinker prototypes in social situations. We examined whether the favorability of these prototypes (i.e., "prototype evaluation"), the perceived similarity of these prototypes to one's self-image (i.e., "prototype similarity") assessed at baseline, and their interaction predict alcohol use assessed in social situations. Drinker prototypes were assessed in a baseline sample of 599 adolescents. Subsequently, a sample of 77 alcohol-using 16 to 18-year-old males reported their Friday and Saturday evening drinking behavior the next day during eight weeks (resulting in 495 daily measures). Alcohol use was assessed in the company of peers. The more adolescents perceived themselves as similar to heavy drinker prototypes the higher their alcohol consumption in social situations. The more adolescents held favorable abstainer prototypes, the lower their alcohol consumption. The interaction between prototype evaluation and similarity was not significant. By using a more reliable and valid method to assess adolescents' alcohol use, the present study showed that more "extreme" drinker prototypes (i.e., heavy drinker and abstainer prototypes) are most predictive of adolescent alcohol use in social situations. Increasing the perceived dissimilarity to heavy drinker prototypes and the favorability of abstainer prototypes may therefore be important targets in interventions aimed at reducing adolescents' alcohol consumption.
Hung, Chia-Suei; Zingarelli, Sandra; Nadeau, Lloyd J; Biffinger, Justin C; Drake, Carrie A; Crouch, Audra L; Barlow, Daniel E; Russell, John N; Crookes-Goodson, Wendy J
2016-10-15
Polyester polyurethane (PU) coatings are widely used to help protect underlying structural surfaces but are susceptible to biological degradation. PUs are susceptible to degradation by Pseudomonas species, due in part to the degradative activity of secreted hydrolytic enzymes. Microorganisms often respond to environmental cues by secreting enzymes or secondary metabolites to benefit their survival. This study investigated the impact of exposing several Pseudomonas strains to select carbon sources on the degradation of the colloidal polyester polyurethane Impranil DLN (Impranil). The prototypic Pseudomonas protegens strain Pf-5 exhibited Impranil-degrading activities when grown in sodium citrate but not in glucose-containing medium. Glucose also inhibited the induction of Impranil-degrading activity by citrate-fed Pf-5 in a dose-dependent manner. Biochemical and mutational analyses identified two extracellular lipases present in the Pf-5 culture supernatant (PueA and PueB) that were involved in degradation of Impranil. Deletion of the pueA gene reduced Impranil-clearing activities, while pueB deletion exhibited little effect. Removal of both genes was necessary to stop degradation of the polyurethane. Bioinformatic analysis showed that putative Cbr/Hfq/Crc-mediated regulatory elements were present in the intergenic sequences upstream of both pueA and pueB genes. Our results confirmed that both PueA and PueB extracellular enzymes act in concert to degrade Impranil. Furthermore, our data showed that carbon sources in the growth medium directly affected the levels of Impranil-degrading activity but that carbon source effects varied among Pseudomonas strains. This study uncovered an intricate and complicated regulation of P. protegens PU degradation activity controlled by carbon catabolite repression. Polyurethane (PU) coatings are commonly used to protect metals from corrosion. Microbiologically induced PU degradation might pose a substantial problem for the integrity of these coatings. Microorganisms from diverse genera, including pseudomonads, possess the ability to degrade PUs via various means. This work identified two extracellular lipases, PueA and PueB, secreted by P. protegens strain Pf-5, to be responsible for the degradation of a colloidal polyester PU, Impranil. This study also revealed that the expression of the degradative activity by strain Pf-5 is controlled by glucose carbon catabolite repression. Furthermore, this study showed that the Impranil-degrading activity of many other Pseudomonas strains could be influenced by different carbon sources. This work shed light on the carbon source regulation of PU degradation activity among pseudomonads and identified the polyurethane lipases in P. protegens. Copyright © 2016, American Society for Microbiology. All Rights Reserved.
Virulent poxviruses inhibit DNA sensing by preventing STING activation.
Georgana, Iliana; Sumner, Rebecca P; Towers, Greg J; Maluquer de Motes, Carlos
2018-02-28
Cytosolic recognition of DNA has emerged as a critical cellular mechanism of host immune activation upon pathogen invasion. The central cytosolic DNA sensor cGAS activates STING, which is phosphorylated, dimerises and translocates from the ER to a perinuclear region to mediate IRF-3 activation. Poxviruses are dsDNA viruses replicating in the cytosol and hence likely to trigger cytosolic DNA sensing. Here we investigated the activation of innate immune signalling by 4 different strains of the prototypic poxvirus vaccinia virus (VACV) in a cell line proficient in DNA sensing. Infection with the attenuated VACV strain MVA activated IRF-3 via cGAS and STING, and accordingly STING dimerised and was phosphorylated during MVA infection. Conversely, VACV strains Copenhagen and Western Reserve inhibited STING dimerisation and phosphorylation during infection and in response to transfected DNA and cGAMP, thus efficiently suppressing DNA sensing and IRF-3 activation. A VACV deletion mutant lacking protein C16, thought to be the only viral DNA sensing inhibitor acting upstream of STING, retained the ability to block STING activation. Similar inhibition of DNA-induced STING activation was also observed for cowpox and ectromelia viruses. Our data demonstrate that virulent poxviruses possess mechanisms for targeting DNA sensing at the level of the cGAS-STING axis and that these mechanisms do not operate in replication-defective strains such as MVA. These findings shed light on the role of cellular DNA sensing in poxvirus-host interactions and will open new avenues to determine its impact on VACV immunogenicity and virulence. IMPORTANCE Poxviruses are dsDNA viruses infecting a wide range of vertebrates and include the causative agent of smallpox (variola virus) and its vaccine vaccinia virus (VACV). Despite smallpox eradication VACV remains of interest as a therapeutic. Attenuated strains are popular vaccine candidates, whereas replication-competent strains are emerging as efficient oncolytics in virotherapy. The successful therapeutic use of VACV depends on a detailed understanding of its ability to modulate host innate immune responses. DNA sensing is a critical cellular mechanism for pathogen detection and activation of innate immunity that is centrally coordinated by the ER-resident protein STING. Here STING is shown to mediate immune activation in response to MVA, but not to virulent VACV strains or other virulent poxviruses, which prevent STING activation and DNA sensing during infection and after DNA transfection. These results provide new insights into poxvirus immune evasion and have implications in the rational design of VACV-based therapeutics. Copyright © 2018 Georgana et al.
Plastic flow modeling in glassy polymers
DOE Office of Scientific and Technical Information (OSTI.GOV)
Clements, Brad
2010-12-13
Glassy amorphous and semi-crystalline polymers exhibit strong rate, temperature, and pressure dependent polymeric yield. As a rule of thumb, in uniaxial compression experiments the yield stress increases with the loading rate and applied pressure, and decreases as the temperature increases. Moreover, by varying the loading state itself complex yield behavior can be observed. One example that illustrates this complexity is that most polymers in their glassy regimes (i.e., when the temperature is below their characteristic glass transition temperature) exhibit very pronounced yield in their uniaxial stress stress-strain response but very nebulous yield in their uniaxial strain response. In uniaxial compression,more » a prototypical glassy-polymer stress-strain curve has a stress plateau, often followed by softening, and upon further straining, a hardening response. Uniaxial compression experiments of this type are typically done from rates of 10{sup -5} s{sup -1} up to about 1 s{sup -1}. At still higher rates, say at several thousands per second as determined from Split Hopkinson Pressure Bar experiments, the yield can again be measured and is consistent with the above rule of thumb. One might expect that that these two sets of experiments should allow for a successful extrapolation to yet higher rates. A standard means to probe high rates (on the order of 105-107 S-I) is to use a uniaxial strain plate impact experiment. It is well known that in plate impact experiments on metals that the yield stress is manifested in a well-defined Hugoniot Elastic Limit (HEL). In contrast however, when plate impact experiments are done on glassy polymers, the HEL is arguably not observed, let alone observed at the stress estimated by extrapolating from the lower strain rate experiments. One might argue that polymer yield is still active but somehow masked by the experiment. After reviewing relevant experiments, we attempt to address this issue. We begin by first presenting our recently developed glassy polymer model. While polymers are well known for their non-equilibrium deviatoric behavior we have found the need for incorporating both equilibrium and non-equilibrium volumetric behavior into our theory. Experimental evidence supporting the notion of non-equilibrium volumetric behavior will be summarized. Our polymer yield model accurately captures the stress plateau, softening and hardening and its yield stress predictions agree well with measured values for several glassy polymers including PMMA, PC, and an epoxy resin. We then apply our theory to plate impact experiments in an attempt to address the questions associated with high rate polymer yield in uniaxial strain configurations.« less
Hung, Chia-Suei; Zingarelli, Sandra; Nadeau, Lloyd J.; Biffinger, Justin C.; Drake, Carrie A.; Crouch, Audra L.; Barlow, Daniel E.; Russell, John N.
2016-01-01
ABSTRACT Polyester polyurethane (PU) coatings are widely used to help protect underlying structural surfaces but are susceptible to biological degradation. PUs are susceptible to degradation by Pseudomonas species, due in part to the degradative activity of secreted hydrolytic enzymes. Microorganisms often respond to environmental cues by secreting enzymes or secondary metabolites to benefit their survival. This study investigated the impact of exposing several Pseudomonas strains to select carbon sources on the degradation of the colloidal polyester polyurethane Impranil DLN (Impranil). The prototypic Pseudomonas protegens strain Pf-5 exhibited Impranil-degrading activities when grown in sodium citrate but not in glucose-containing medium. Glucose also inhibited the induction of Impranil-degrading activity by citrate-fed Pf-5 in a dose-dependent manner. Biochemical and mutational analyses identified two extracellular lipases present in the Pf-5 culture supernatant (PueA and PueB) that were involved in degradation of Impranil. Deletion of the pueA gene reduced Impranil-clearing activities, while pueB deletion exhibited little effect. Removal of both genes was necessary to stop degradation of the polyurethane. Bioinformatic analysis showed that putative Cbr/Hfq/Crc-mediated regulatory elements were present in the intergenic sequences upstream of both pueA and pueB genes. Our results confirmed that both PueA and PueB extracellular enzymes act in concert to degrade Impranil. Furthermore, our data showed that carbon sources in the growth medium directly affected the levels of Impranil-degrading activity but that carbon source effects varied among Pseudomonas strains. This study uncovered an intricate and complicated regulation of P. protegens PU degradation activity controlled by carbon catabolite repression. IMPORTANCE Polyurethane (PU) coatings are commonly used to protect metals from corrosion. Microbiologically induced PU degradation might pose a substantial problem for the integrity of these coatings. Microorganisms from diverse genera, including pseudomonads, possess the ability to degrade PUs via various means. This work identified two extracellular lipases, PueA and PueB, secreted by P. protegens strain Pf-5, to be responsible for the degradation of a colloidal polyester PU, Impranil. This study also revealed that the expression of the degradative activity by strain Pf-5 is controlled by glucose carbon catabolite repression. Furthermore, this study showed that the Impranil-degrading activity of many other Pseudomonas strains could be influenced by different carbon sources. This work shed light on the carbon source regulation of PU degradation activity among pseudomonads and identified the polyurethane lipases in P. protegens. PMID:27496773
Virulent Poxviruses Inhibit DNA Sensing by Preventing STING Activation
Georgana, Iliana; Sumner, Rebecca P.; Towers, Greg J.
2018-01-01
ABSTRACT Cytosolic recognition of DNA has emerged as a critical cellular mechanism of host immune activation upon pathogen invasion. The central cytosolic DNA sensor cGAS activates STING, which is phosphorylated, dimerizes and translocates from the endoplasmic reticulum (ER) to a perinuclear region to mediate IRF-3 activation. Poxviruses are double-stranded DNA viruses replicating in the cytosol and hence likely to trigger cytosolic DNA sensing. Here, we investigated the activation of innate immune signaling by 4 different strains of the prototypic poxvirus vaccinia virus (VACV) in a cell line proficient in DNA sensing. Infection with the attenuated VACV strain MVA activated IRF-3 via cGAS and STING, and accordingly STING dimerized and was phosphorylated during MVA infection. Conversely, VACV strains Copenhagen and Western Reserve inhibited STING dimerization and phosphorylation during infection and in response to transfected DNA and cyclic GMP-AMP, thus efficiently suppressing DNA sensing and IRF-3 activation. A VACV deletion mutant lacking protein C16, thought to be the only viral DNA sensing inhibitor acting upstream of STING, retained the ability to block STING activation. Similar inhibition of DNA-induced STING activation was also observed for cowpox and ectromelia viruses. Our data demonstrate that virulent poxviruses possess mechanisms for targeting DNA sensing at the level of the cGAS-STING axis and that these mechanisms do not operate in replication-defective strains such as MVA. These findings shed light on the role of cellular DNA sensing in poxvirus-host interactions and will open new avenues to determine its impact on VACV immunogenicity and virulence. IMPORTANCE Poxviruses are double-stranded DNA viruses infecting a wide range of vertebrates and include the causative agent of smallpox (variola virus) and its vaccine vaccinia virus (VACV). Despite smallpox eradication VACV remains of interest as a therapeutic. Attenuated strains are popular vaccine candidates, whereas replication-competent strains are emerging as efficient oncolytics in virotherapy. The successful therapeutic use of VACV depends on a detailed understanding of its ability to modulate host innate immune responses. DNA sensing is a critical cellular mechanism for pathogen detection and activation of innate immunity that is centrally coordinated by the endoplasmic reticulum-resident protein STING. Here, STING is shown to mediate immune activation in response to MVA, but not in response to virulent VACV strains or other virulent poxviruses, which prevent STING activation and DNA sensing during infection and after DNA transfection. These results provide new insights into poxvirus immune evasion and have implications in the rational design of VACV-based therapeutics. PMID:29491158
Chaturvedi, R; de Sablet, T; Asim, M; Piazuelo, M B; Barry, D P; Verriere, T G; Sierra, J C; Hardbower, D M; Delgado, A G; Schneider, B G; Israel, D A; Romero-Gallo, J; Nagy, T A; Morgan, D R; Murray-Stewart, T; Bravo, L E; Peek, R M; Fox, J G; Woster, P M; Casero, R A; Correa, P; Wilson, K T
2015-06-01
Helicobacter pylori infection causes gastric cancer, the third leading cause of cancer death worldwide. More than half of the world's population is infected, making universal eradication impractical. Clinical trials suggest that antibiotic treatment only reduces gastric cancer risk in patients with non-atrophic gastritis (NAG), and is ineffective once preneoplastic lesions of multifocal atrophic gastritis (MAG) and intestinal metaplasia (IM) have occurred. Therefore, additional strategies for risk stratification and chemoprevention of gastric cancer are needed. We have implicated polyamines, generated by the rate-limiting enzyme ornithine decarboxylase (ODC), in gastric carcinogenesis. During H. pylori infection, the enzyme spermine oxidase (SMOX) is induced, which generates hydrogen peroxide from the catabolism of the polyamine spermine. Herein, we assessed the role of SMOX in the increased gastric cancer risk in Colombia associated with the Andean mountain region when compared with the low-risk region on the Pacific coast. When cocultured with gastric epithelial cells, clinical strains of H. pylori from the high-risk region induced more SMOX expression and oxidative DNA damage, and less apoptosis than low-risk strains. These findings were not attributable to differences in the cytotoxin-associated gene A oncoprotein. Gastric tissues from subjects from the high-risk region exhibited greater levels of SMOX and oxidative DNA damage by immunohistochemistry and flow cytometry, and this occurred in NAG, MAG and IM. In Mongolian gerbils, a prototype colonizing strain from the high-risk region induced more SMOX, DNA damage, dysplasia and adenocarcinoma than a colonizing strain from the low-risk region. Treatment of gerbils with either α-difluoromethylornithine, an inhibitor of ODC, or MDL 72527 (N(1),N(4)-Di(buta-2,3-dien-1-yl)butane-1,4-diamine dihydrochloride), an inhibitor of SMOX, reduced gastric dysplasia and carcinoma, as well as apoptosis-resistant cells with DNA damage. These data indicate that aberrant activation of polyamine-driven oxidative stress is a marker of gastric cancer risk and a target for chemoprevention.
Chaturvedi, Rupesh; de Sablet, Thibaut; Asim, Mohammad; Piazuelo, M. Blanca; Barry, Daniel P.; Verriere, Thomas G.; Sierra, J. Carolina; Hardbower, Dana M.; Delgado, Alberto G.; Schneider, Barbara G.; Israel, Dawn A.; Romero-Gallo, Judith; Nagy, Toni A.; Morgan, Douglas R.; Murray-Stewart, Tracy; Bravo, Luis E.; Peek, Richard M.; Fox, James G.; Woster, Patrick M.; Casero, Robert A.; Correa, Pelayo; Wilson, Keith T.
2014-01-01
Helicobacter pylori infection causes gastric cancer, the third leading cause of cancer death worldwide. More than half of the world’s population is infected, making universal eradication impractical. Clinical trials suggest that antibiotic treatment only reduces gastric cancer risk in patients with non-atrophic gastritis (NAG), and is ineffective once preneoplastic lesions of multifocal atrophic gastritis (MAG) and intestinal metaplasia (IM) have occurred. Therefore, additional strategies for risk stratification and chemoprevention of gastric cancer are needed. We have implicated polyamines, generated by the rate limiting enzyme ornithine decarboxylase (ODC), in gastric carcinogenesis. During H. pylori infection, the enzyme spermine oxidase (SMOX) is induced, which generates hydrogen peroxide from the catabolism of the polyamine spermine. Herein, we assessed the role of SMOX in the increased gastric cancer risk in Colombia associated with the Andean mountain region when compared to the low risk region on the Pacific coast. When co-cultured with gastric epithelial cells, clinical strains of H. pylori from the high risk region induced more SMOX expression and oxidative DNA damage, and less apoptosis than low risk strains. These findings were not attributable to differences in the CagA oncoprotein. Gastric tissues from subjects from the high risk region exhibited greater levels of SMOX and oxidative DNA damage by immunohistochemistry and flow cytometry, and this occurred in NAG, MAG, and IM. In Mongolian gerbils, a prototype colonizing strain from the high risk region induced more SMOX, DNA damage, dysplasia and adenocarcinoma than a colonizing strain from the low risk region. Treatment of gerbils with either α-difluoromethylornithine (DFMO), an inhibitor of ODC, or MDL 72527, an inhibitor of SMOX, reduced gastric dysplasia and carcinoma, as well as apoptosis-resistant cells with DNA damage. These data indicate that aberrant activation of polyamine-driven oxidative stress is a marker of gastric cancer risk and a target for chemoprevention. PMID:25174398
Smatti, Maria K.; Yassine, Hadi M.; AbuOdeh, Raed; AlMarawani, Asmaa; Taleb, Sara A.; Althani, Asmaa A.
2017-01-01
Background The Epstein–Barr virus (EBV) is the causative agent of infectious mononucleosis. EBV is highly prevalent lymphotropic herpesvirus and has been linked to several malignancies. Transmission is generally by oral secretions, but can be through blood transfusions and organ transplantations. This study aimed to determine the seroprevalence, viremia rates, and circulating genotypes of EBV in healthy blood donors in Qatar. Methods Blood samples from 673 blood donors of different nationalities residing in Qatar (mainly Qatar, Egypt, Syria, Jordan, Pakistan, and India) were collected and tested for anti-EBV capsid (VCA; IgG & IgM), nuclear (EBNA; IgG), and early (EA-D; IgG) antigens. Avidity testing was determined when active infection was suspected. DNA was extracted from the buffy coat and subjected to EBV-DNA quantification using qRT-PCR. Genotyping was performed using nested-PCR targeting EBV-EBNA2 gene, and phylogeny by sequence analysis of the LMP-1 gene. Results 97.9% (673/659) of the samples were seropositive as indicated by the presence VCA-IgG, while 52.6% (354/673) had detectible EBV-DNA. EBV seroprevalence and viremia rates increased significantly with age. Genotyping of 51 randomly selected samples showed predominance of Genotype 1 (72.5%, 37/51) as compared to genotype 2 (3.5%), and mixed infections were detected in 4% of the samples. Sub-genotyping for these samples revealed that the Mediterranean strain was predominant (65.3%), followed by B95.8 prototype and North Carolina strains (12.2% each), and China1 strain (6%). Conclusion As a first study to evaluate EBV infection in highly diverse population in Qatar, where expatriates represent more than 85% of the population, our results indicated high seroprevalence and viremia rate of EBV in different nationalities, with genotype 1 and Mediterranean strain being predominant. Clinical significance of these finding have not been investigated and shall be evaluated in future studies. PMID:29228016
Smatti, Maria K; Yassine, Hadi M; AbuOdeh, Raed; AlMarawani, Asmaa; Taleb, Sara A; Althani, Asmaa A; Nasrallah, Gheyath K
2017-01-01
The Epstein-Barr virus (EBV) is the causative agent of infectious mononucleosis. EBV is highly prevalent lymphotropic herpesvirus and has been linked to several malignancies. Transmission is generally by oral secretions, but can be through blood transfusions and organ transplantations. This study aimed to determine the seroprevalence, viremia rates, and circulating genotypes of EBV in healthy blood donors in Qatar. Blood samples from 673 blood donors of different nationalities residing in Qatar (mainly Qatar, Egypt, Syria, Jordan, Pakistan, and India) were collected and tested for anti-EBV capsid (VCA; IgG & IgM), nuclear (EBNA; IgG), and early (EA-D; IgG) antigens. Avidity testing was determined when active infection was suspected. DNA was extracted from the buffy coat and subjected to EBV-DNA quantification using qRT-PCR. Genotyping was performed using nested-PCR targeting EBV-EBNA2 gene, and phylogeny by sequence analysis of the LMP-1 gene. 97.9% (673/659) of the samples were seropositive as indicated by the presence VCA-IgG, while 52.6% (354/673) had detectible EBV-DNA. EBV seroprevalence and viremia rates increased significantly with age. Genotyping of 51 randomly selected samples showed predominance of Genotype 1 (72.5%, 37/51) as compared to genotype 2 (3.5%), and mixed infections were detected in 4% of the samples. Sub-genotyping for these samples revealed that the Mediterranean strain was predominant (65.3%), followed by B95.8 prototype and North Carolina strains (12.2% each), and China1 strain (6%). As a first study to evaluate EBV infection in highly diverse population in Qatar, where expatriates represent more than 85% of the population, our results indicated high seroprevalence and viremia rate of EBV in different nationalities, with genotype 1 and Mediterranean strain being predominant. Clinical significance of these finding have not been investigated and shall be evaluated in future studies.
Zhang, Yong; Hong, Mei; Sun, Qiang; Zhu, Shuangli; Tsewang; Li, Xiaolei; Yan, Dongmei; Wang, Dongyan; Xu, Wenbo
2014-04-01
Molecular methods, based on sequencing the region encoding the complete VP1 or P1 protein, have enabled the rapid identification of new enterovirus serotypes. In the present study, the complete genome of a newly discovered enterovirus serotype, strain Q0011/XZ/CHN/2000 (hereafter referred to as Q0011), was sequenced and analyzed. The virus, isolated from a stool sample from a patient with acute flaccid paralysis in the Tibet region of China in 2000, was characterized by amplicon sequencing and comparison to a GenBank database of enterovirus nucleotide sequences. The nucleotide sequence encoding the complete VP1 capsid protein is most closely related to the sequences of viruses within the species enterovirus B (EV-B), but is less than 72.1% identical to the homologous sequences of the recognized human enterovirus serotypes, with the greatest homology to EV-B101 and echovirus 32. Moreover, the deduced amino acid sequence of the complete VP1 region is less than 84.7% identical to those of the recognized serotypes, suggesting that the strain is a new serotype of enterovirus within EV-B. The virus was characterized as a new enterovirus type, named EV-B111, by the Picornaviridae Study Group of the International Committee on Taxonomy of Viruses. Low positive rate and titer of neutralizing antibody against EV-B111 were found in the Tibet region of China. Nearly 50% of children ≤5 years had no neutralizing antibody against EV-B111. So the extent of transmission and the exposure of the population to this new EV are very limited. This is the first identification of a new serotype of human enterovirus in China, and strain Q0011 was designated the prototype strain of EV-B111. Copyright © 2014 Elsevier B.V. All rights reserved.
Deshpande, J M; Nadkarni, S S; Siddiqui, Z A
2003-12-01
Significant progress has been made towards eradication of poliomyelitis in India. Surveillance for acute flaccid paralysis (AFP) has reached high standards. Among the 3 types of polioviruses, type 2 had been eliminated in India and eradicated globally as of October 1999. However, we isolated wild poliovirus type 2 from a small number of polio cases in northern India in 2000 and again during December 2002 to February 2003. Using molecular tools the origin, of the wild type 2 poliovirus was investigated. Polioviruses isolated from stool samples collected from patients with AFP were differentiated as wild virus or Sabin vaccine-like by ELISA and probe hybridization assays. Complete VP1 gene nucleotide sequences of the wild type 2 poliovirus isolates were determined by reverse transcriptase polymerase chain reaction (RT-PCR), followed by cycle sequencing. VP1 nucleotide sequences were compared with those of wild type 2 polioviruses that were indigenous in India in the past as well as prototype/laboratory strains and the GenBank database. Wild poliovirus type 2 was detected in stool samples from 6 patients with AFP in western Uttar Pradesh and 1 in Gujarat. In addition, the virus was isolated from one healthy contact child and from environmental sewage sample in Moradabad where three of these patients were reported. These isolates were identified as genetically closely related to laboratory reference strain MEF-1. Molecular characterization of the isolates confirmed that there was no evidence of extensive person-to-person transmission of the virus in the community. Laboratory reference strain (MEF-1) of poliovirus type 2 caused paralytic poliomyelitis in 10 patients in September 2000 and November 2002 to February 2003. The origin of the virus was some laboratory as yet not identified. This episode highlights the urgent need for stringent containment of wild poliovirus containing materials in the laboratories across the country in order to prevent recurrence of such incidents.
Progressing in cable-in-conduit for fusion magnets: from ITER to low cost, high performance DEMO
NASA Astrophysics Data System (ADS)
Uglietti, D.; Sedlak, K.; Wesche, R.; Bruzzone, P.; Muzzi, L.; della Corte, A.
2018-05-01
The performance of ITER toroidal field (TF) conductors still have a significant margin for improvement because the effective strain between ‑0.62% and ‑0.95% limits the strands’ critical current between 15% and 45% of the maximum achievable. Prototype Nb3Sn cable-in-conduit conductors have been designed, manufactured and tested in the frame of the EUROfusion DEMO activities. In these conductors the effective strain has shown a clear improvement with respect to the ITER conductors, reaching values between ‑0.55% and ‑0.28%, resulting in a strand critical current which is two to three times higher than in ITER conductors. In terms of the amount of Nb3Sn strand required for the construction of the DEMO TF magnet system, such improvement may lead to a reduction of at least a factor of two with respect to a similar magnet built with ITER type conductors; a further saving of Nb3Sn is possible if graded conductors/windings are employed. In the best case the DEMO TF magnet could require fewer Nb3Sn strands than the ITER one, despite the larger size of DEMO. Moreover high performance conductors could be operated at higher fields than ITER TF conductors, enabling the construction of low cost, compact, high field tokamaks.
Novel role for IL-22 in protection during chronic Mycobacterium tuberculosis HN878 infection.
Treerat, P; Prince, O; Cruz-Lagunas, A; Muñoz-Torrico, M; Salazar-Lezama, M A; Selman, M; Fallert-Junecko, B; Reinhardt, T A; Alcorn, J F; Kaushal, D; Zuñiga, J; Rangel-Moreno, J; Kolls, J K; Khader, S A
2017-07-01
Approximately 2 billion people are infected with Mycobacterium tuberculosis (Mtb), resulting in 1.4 million deaths every year. Among Mtb-infected individuals, clinical isolates belonging to the W-Beijing lineage are increasingly prevalent, associated with drug resistance, and cause severe disease immunopathology in animal models. Therefore, it is exceedingly important to identify the immune mechanisms that mediate protection against rapidly emerging Mtb strains, such as W-Beijing lineage. IL-22 is a member of the IL-10 family of cytokines with both protective and pathological functions at mucosal surfaces. Thus far, collective data show that IL-22 deficient mice are not more susceptible to aerosolized infection with less virulent Mtb strains. Thus, in this study we addressed the functional role for the IL-22 pathway in immunity to emerging Mtb isolates, using W-Beijing lineage member, Mtb HN878 as a prototype. We show that Mtb HN878 stimulates IL-22 production in TLR2 dependent manner and IL-22 mediates protective immunity during chronic stages of Mtb HN878 infection in mice. Interestingly, IL-22-dependent pathways in both epithelial cells and macrophages mediate protective mechanisms for Mtb HN878 control. Thus, our results project a new protective role for IL-22 in emerging Mtb infections.
De Santis, Roberto; Gloria, Antonio; Russo, Teresa; D'Amora, Ugo; Varriale, Angelo; Veltri, Mario; Balleri, Piero; Mollica, Francesco; Riccitiello, Francesco; Ambrosio, Luigi
2014-12-18
This study aimed at investigating the effects of titanium implants and different configurations of full-arch prostheses on the biomechanics of edentulous mandibles. Reverse engineered, composite, anisotropic, edentulous mandibles made of a poly(methylmethacrylate) core and a glass fibre reinforced outer shell were rapid prototyped and instrumented with strain gauges. Brånemark implants RP platforms in conjunction with titanium Procera one-piece or two-piece bridges were used to simulate oral rehabilitations. A lateral load through the gonion regions was used to test the biomechanical effects of the rehabilitations. In addition, strains due to misfit of the one-piece titanium bridge were compared to those produced by one-piece cast gold bridges. Milled titanium bridges had a better fit than cast gold bridges. The stress distribution in mandibular bone rehabilitated with a one-piece bridge was more perturbed than that observed with a two-piece bridge. In particular the former induced a stress concentration and stress shielding in the molar and symphysis regions, while for the latter design these stresses were strongly reduced. In conclusion, prosthetic frameworks changed the biomechanics of the mandible as a result of both their design and manufacturing technology. Copyright © 2014 Elsevier Ltd. All rights reserved.
Investigation of the piezoelectric thimble tactile device operating modes.
Bansevicius, Ramutis; Dragasius, Egidijus; Grigas, Vytautas; Jurenas, Vytautas; Mazeika, Darius; Zvironas, Arunas
2014-01-01
A multifunctional device to transfer graphical or text information for blind or visually impaired is presented. The prototype using tactile perception has been designed where information displayed on the screen of electronic device (mobile phone, PC) is transferred by oscillating needle, touching the fingertip. Having the aim to define optimal parameters of the fingertip excitation by needle, the computational analysis of different excitation modes has been carried out. A 3D solid computational finite element model of the skin segment, comprising four main fingertip skin layers (stratum corneum, epidermis, dermis and hypodermis) was built by using ANSYS Workbench FEA software. Harmonic analysis of its stress-strain state under excitation with different frequency (up to 10000 Hz) and harmonic force (0.01 N), acting outer stratum corneum layer in normal direction at one, two or three points has been performed. The influence of the mode of dynamic loading of skin was evaluated (in terms of the tactile signal level) on the basis of the normal and shear elastic strain in dermis, where mechanoreceptors are placed. It is shown that the tactile perception of information, delivered by three vibrating pins, may be influenced by configuration of excitation points (their number and phase of loading) and the frequency of excitation.
NASA Astrophysics Data System (ADS)
Hwang, Sohyun; Kim, Chan Yeong; Ji, Sun-Gou; Go, Junhyeok; Kim, Hanhae; Yang, Sunmo; Kim, Hye Jin; Cho, Ara; Yoon, Sang Sun; Lee, Insuk
2016-05-01
Pseudomonas aeruginosa is a Gram-negative bacterium of clinical significance. Although the genome of PAO1, a prototype strain of P. aeruginosa, has been extensively studied, approximately one-third of the functional genome remains unknown. With the emergence of antibiotic-resistant strains of P. aeruginosa, there is an urgent need to develop novel antibiotic and anti-virulence strategies, which may be facilitated by an approach that explores P. aeruginosa gene function in systems-level models. Here, we present a genome-wide functional network of P. aeruginosa genes, PseudomonasNet, which covers 98% of the coding genome, and a companion web server to generate functional hypotheses using various network-search algorithms. We demonstrate that PseudomonasNet-assisted predictions can effectively identify novel genes involved in virulence and antibiotic resistance. Moreover, an antibiotic-resistance network based on PseudomonasNet reveals that P. aeruginosa has common modular genetic organisations that confer increased or decreased resistance to diverse antibiotics, which accounts for the pervasiveness of cross-resistance across multiple drugs. The same network also suggests that P. aeruginosa has developed mechanism of trade-off in resistance across drugs by altering genetic interactions. Taken together, these results clearly demonstrate the usefulness of a genome-scale functional network to investigate pathogenic systems in P. aeruginosa.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Song, Min-Suk; Kumar, Gyanendra; Shadrick, William R.
The influenza endonuclease is an essential subdomain of the viral RNA polymerase. It processes host pre-mRNAs to serve as primers for viral mRNA and is an attractive target for antiinfluenza drug discovery. Compound L-742,001 is a prototypical endonuclease inhibitor, and we found that repeated passaging of influenza virus in the presence of this drug did not lead to the development of resistant mutant strains. Reduced sensitivity to L-742,001 could only be induced by creating point mutations via a random mutagenesis strategy. Furthermore, these mutations mapped to the endonuclease active site where they can directly impact inhibitor binding. Engineered viruses containingmore » the mutations showed resistance to L-742,001 both in vitro and in vivo, with only a modest reduction in fitness. Introduction of the mutations into a second virus also increased its resistance to the inhibitor. When using the isolated wild-type and mutant endonuclease domains, we used kinetics, inhibitor binding and crystallography to characterize how the two most significant mutations elicit resistance to L-742,001. These studies lay the foundation for the development of a new class of influenza therapeutics with reduced potential for the development of clinical endonuclease inhibitor-resistant influenza strains.« less
Monitoring the bending and twist of morphing structures
NASA Astrophysics Data System (ADS)
Smoker, J.; Baz, A.
2008-03-01
This paper presents the development of the theoretical basis for the design of sensor networks for determining the 2-dimensioal shape of morphing structures by monitoring simultaneously the bending and twist deflections. The proposed development is based on the non-linear theory of finite elements to extract the transverse linear and angular deflections of a plate-like structure. The sensors outputs are wirelessly transmitted to the command unit to simultaneously compute maps of the linear and angular deflections and maps of the strain distribution of the entire structure. The deflection and shape information are required to ascertain that the structure is properly deployed and that its surfaces are operating wrinkle-free. The strain map ensures that the structure is not loaded excessively to adversely affect its service life. The developed theoretical model is validated experimentally using a prototype of a variable cambered span morphing structure provided with a network of distributed sensors. The structure/sensor network system is tested under various static conditions to determine the response characteristics of the proposed sensor network as compared to other conventional sensor systems. The presented theoretical and experimental techniques can have a great impact on the safe deployment and effective operation of a wide variety of morphing and inflatable structures such as morphing aircraft, solar sails, inflatable wings, and large antennas.
Novel avian paramyxovirus (APMV-15) isolated from a migratory bird in South America.
Thomazelli, Luciano Matsumiya; de Araújo, Jansen; Fabrizio, Thomas; Walker, David; Reischak, Dilmara; Ometto, Tatiana; Barbosa, Carla Meneguin; Petry, Maria Virginia; Webby, Richard J; Durigon, Edison Luiz
2017-01-01
A novel avian paramyxovirus (APMV) isolated from a migratory bird cloacal swab obtained during active surveillance in April 2012 in the Lagoa do Peixe National Park, Rio Grande do Sul state, South of Brazil was biologically and genetically characterized. The nucleotide sequence of the full viral genome was completed using a next-generation sequencing approach. The genome was 14,952 nucleotides (nt) long, with six genes (3'-NP-P-M-F-HN-L-5') encoding 7 different proteins, typical of APMV. The fusion (F) protein gene of isolate RS-1177 contained 1,707 nucleotides in a single open reading frame encoding a protein of 569 amino acids. The F protein cleavage site contained two basic amino acids (VPKER↓L), typical of avirulent strains. Phylogenetic analysis of the whole genome indicated that the virus is related to APMV-10, -2 and -8, with 60.1% nucleotide sequence identity to the closest APMV-10 virus, 58.7% and 58.5% identity to the closest APMV-8 and APMV-2 genome, respectively, and less than 52% identity to representatives of the other APMVs groups. Such distances are comparable to the distances observed among other previously identified APMVs serotypes. These results suggest that unclassified/calidris_fuscicollis/Brazil/RS-1177/2012 is the prototype strain of a new APMV serotype, APMV-15.
Song, Min-Suk; Kumar, Gyanendra; Shadrick, William R.; ...
2016-03-14
The influenza endonuclease is an essential subdomain of the viral RNA polymerase. It processes host pre-mRNAs to serve as primers for viral mRNA and is an attractive target for antiinfluenza drug discovery. Compound L-742,001 is a prototypical endonuclease inhibitor, and we found that repeated passaging of influenza virus in the presence of this drug did not lead to the development of resistant mutant strains. Reduced sensitivity to L-742,001 could only be induced by creating point mutations via a random mutagenesis strategy. Furthermore, these mutations mapped to the endonuclease active site where they can directly impact inhibitor binding. Engineered viruses containingmore » the mutations showed resistance to L-742,001 both in vitro and in vivo, with only a modest reduction in fitness. Introduction of the mutations into a second virus also increased its resistance to the inhibitor. When using the isolated wild-type and mutant endonuclease domains, we used kinetics, inhibitor binding and crystallography to characterize how the two most significant mutations elicit resistance to L-742,001. These studies lay the foundation for the development of a new class of influenza therapeutics with reduced potential for the development of clinical endonuclease inhibitor-resistant influenza strains.« less
NASA Astrophysics Data System (ADS)
Hsu, Hung-Lun; Millet, Jean K.; Costello, Deirdre A.; Whittaker, Gary R.; Daniel, Susan
2016-10-01
Virus pseudotyping is a useful and safe technique for studying entry of emerging strains of influenza virus. However, few studies have compared different reassortant combinations in pseudoparticle systems, or compared entry kinetics of native viruses and their pseudotyped analogs. Here, vesicular stomatitis virus (VSV)-based pseudovirions displaying distinct influenza virus envelope proteins were tested for fusion activity. We produced VSV pseudotypes containing the prototypical X-31 (H3) HA, either alone or with strain-matched or mismatched N2 NAs. We performed single-particle fusion assays using total internal reflection fluorescence microscopy to compare hemifusion kinetics among these pairings. Results illustrate that matching pseudoparticles behaved very similarly to native virus. Pseudoparticles harboring mismatched HA-NA pairings fuse at significantly slower rates than native virus, and NA-lacking pseudoparticles exhibiting the slowest fusion rates. Relative viral membrane HA density of matching pseudoparticles was higher than in mismatching or NA-lacking pseudoparticles. An equivalent trend of HA expression level on cell membranes of HA/NA co-transfected cells was observed and intracellular trafficking of HA was affected by NA co-expression. Overall, we show that specific influenza HA-NA combinations can profoundly affect the critical role played by HA during entry, which may factor into viral fitness and the emergence of new pandemic influenza viruses.
A failure management prototype: DR/Rx
NASA Technical Reports Server (NTRS)
Hammen, David G.; Baker, Carolyn G.; Kelly, Christine M.; Marsh, Christopher A.
1991-01-01
This failure management prototype performs failure diagnosis and recovery management of hierarchical, distributed systems. The prototype, which evolved from a series of previous prototypes following a spiral model for development, focuses on two functions: (1) the diagnostic reasoner (DR) performs integrated failure diagnosis in distributed systems; and (2) the recovery expert (Rx) develops plans to recover from the failure. Issues related to expert system prototype design and the previous history of this prototype are discussed. The architecture of the current prototype is described in terms of the knowledge representation and functionality of its components.
Anomalous stress response of ultrahard WB n compounds
Li, Quan; Zhou, Dan; Zheng, Weitao; ...
2015-10-29
Boron-rich tungsten borides are premier prototypes of a new class of ultrahard compounds. Here, we show by first-principles calculations that their stress-strain relations display surprisingly diverse and anomalous behavior under a variety of loading conditions. Most remarkable is the dramatically changing bonding configurations and deformation modes with rising boron concentration in WB n (n=2, 3, 4), resulting in significantly different stress responses and unexpected indentation strength variations. This novel phenomenon stems from the peculiar structural arrangements in tungsten borides driven by boron’s ability to form unusually versatile bonding states. Our results elucidate the intriguing deformation mechanisms that define a distinctmore » type of ultrahard material. Here, these new insights underscore the need to explore unconventional structure-property relations in a broad range of transition-metal light-element compounds.« less
Subscale Test Methods for Combustion Devices
NASA Technical Reports Server (NTRS)
Anderson, W. E.; Sisco, J. C.; Long, M. R.; Sung, I.-K.
2005-01-01
Stated goals for long-life LRE s have been between 100 and 500 cycles: 1) Inherent technical difficulty of accurately defining the transient and steady state thermochemical environments and structural response (strain); 2) Limited statistical basis on failure mechanisms and effects of design and operational variability; and 3) Very high test costs and budget-driven need to protect test hardware (aversion to test-to-failure). Ambitious goals will require development of new databases: a) Advanced materials, e.g., tailored composites with virtually unlimited property variations; b) Innovative functional designs to exploit full capabilities of advanced materials; and c) Different cycles/operations. Subscale testing is one way to address technical and budget challenges: 1) Prototype subscale combustors exposed to controlled simulated conditions; 2) Complementary to conventional laboratory specimen database development; 3) Instrumented with sensors to measure thermostructural response; and 4) Coupled with analysis
Kolente virus, a rhabdovirus species isolated from ticks and bats in the Republic of Guinea.
Ghedin, Elodie; Rogers, Matthew B; Widen, Steven G; Guzman, Hilda; Travassos da Rosa, Amelia P A; Wood, Thomas G; Fitch, Adam; Popov, Vsevolod; Holmes, Edward C; Walker, Peter J; Vasilakis, Nikos; Tesh, Robert B
2013-12-01
Kolente virus (KOLEV) is a rhabdovirus originally isolated from ticks and a bat in Guinea, West Africa, in 1985. Although tests at the time of isolation suggested that KOLEV is a novel rhabdovirus, it has remained largely uncharacterized. We assembled the complete genome sequence of the prototype strain DakAr K7292, which was found to encode the five canonical rhabdovirus structural proteins (N, P, M, G and L) with alternative ORFs (>180 nt) in the P and L genes. Serologically, KOLEV exhibited a weak antigenic relationship with Barur and Fukuoka viruses in the Kern Canyon group. Phylogenetic analysis revealed that KOLEV represents a distinct and divergent lineage that shows no clear relationship to any rhabdovirus except Oita virus, although with limited phylogenetic resolution. In summary, KOLEV represents a novel species in the family Rhabdoviridae.
Grid-based International Network for Flu observation (g-INFO).
Doan, Trung-Tung; Bernard, Aurélien; Da-Costa, Ana Lucia; Bloch, Vincent; Le, Thanh-Hoa; Legre, Yannick; Maigne, Lydia; Salzemann, Jean; Sarramia, David; Nguyen, Hong-Quang; Breton, Vincent
2010-01-01
The 2009 H1N1 outbreak has demonstrated that continuing vigilance, planning, and strong public health research capability are essential defenses against emerging health threats. Molecular epidemiology of influenza virus strains provides scientists with clues about the temporal and geographic evolution of the virus. In the present paper, researchers from France and Vietnam are proposing a global surveillance network based on grid technology: the goal is to federate influenza data servers and deploy automatically molecular epidemiology studies. A first prototype based on AMGA and the WISDOM Production Environment extracts daily from NCBI influenza H1N1 sequence data which are processed through a phylogenetic analysis pipeline deployed on EGEE and AuverGrid e-infrastructures. The analysis results are displayed on a web portal (http://g-info.healthgrid.org) for epidemiologists to monitor H1N1 pandemics.
James, Kieran; Motherway, Mary O’Connell; Bottacini, Francesca; van Sinderen, Douwe
2016-01-01
In this study, we demonstrate that the prototype B. breve strain UCC2003 possesses specific metabolic pathways for the utilisation of lacto-N-tetraose (LNT) and lacto-N-neotetraose (LNnT), which represent the central moieties of Type I and Type II human milk oligosaccharides (HMOs), respectively. Using a combination of experimental approaches, the enzymatic machinery involved in the metabolism of LNT and LNnT was identified and characterised. Homologs of the key genetic loci involved in the utilisation of these HMO substrates were identified in B. breve, B. bifidum, B. longum subsp. infantis and B. longum subsp. longum using bioinformatic analyses, and were shown to be variably present among other members of the Bifidobacterium genus, with a distinct pattern of conservation among human-associated bifidobacterial species. PMID:27929046
Shop test of the 501F; A 150 MW combustion turbine
DOE Office of Scientific and Technical Information (OSTI.GOV)
Entenmann, D.T.; North, W.E.; Fukue, I.
1991-10-01
The 501F is a 150 MW-class 60 Hz engine jointly developed by Westinghouse Electric Corporation and Mitsubishi Heavy Industries, Ltd. This paper describes the full-load shop test program for the prototype engine, as carried out in Takasago, Japan. The shop test included a full range of operating conditions, from startup through full load at the 1260{degrees} C (2300{degrees} F) design turbine inlet temperature. The engine was prepared with more than 1500 instrumentation points to monitor flow path characteristics, metal temperatures, displacements, pressures, cooling circuit characteristics, strains, sound pressure levels, and exhaust emissions. The results of this shop test indicate themore » new 501F engine design and development effort to be highly successful. The engine exceeds power and overall efficiency expectations, thus verifying the new concepts and design improvements.« less
Modeling of AA5083 Material-Microstructure Evolution During Butt Friction-Stir Welding
NASA Astrophysics Data System (ADS)
Grujicic, M.; Arakere, G.; Yalavarthy, H. V.; He, T.; Yen, C.-F.; Cheeseman, B. A.
2010-07-01
A concise yet a fairly comprehensive overview of the friction stir welding (FSW) process is provided. This is followed by a computational investigation in which FSW behavior of a prototypical solution-strengthened and strain-hardened aluminum alloy, AA5083-H131, is modeled using a fully coupled thermo-mechanical finite-element procedure developed in our prior study. Particular attention is given to proper modeling of the welding work-piece material behavior during the FSW process. Specifically, competition and interactions between plastic-deformation and dynamic-recrystallization processes are considered to properly account for the material-microstructure evolution in the weld nugget zone. The results showed that with proper modeling of the material behavior under high-temperature/severe-plastic-deformation conditions, significantly improved agreement can be attained between the computed and measured post-FSW residual-stress and material-strength distribution results.
TPS In-Flight Health Monitoring Project Progress Report
NASA Technical Reports Server (NTRS)
Kostyk, Chris; Richards, Lance; Hudston, Larry; Prosser, William
2007-01-01
Progress in the development of new thermal protection systems (TPS) is reported. New approaches use embedded lightweight, sensitive, fiber optic strain and temperature sensors within the TPS. Goals of the program are to develop and demonstrate a prototype TPS health monitoring system, develop a thermal-based damage detection algorithm, characterize limits of sensor/system performance, and develop ea methodology transferable to new designs of TPS health monitoring systems. Tasks completed during the project helped establish confidence in understanding of both test setup and the model and validated system/sensor performance in a simple TPS structure. Other progress included complete initial system testing, commencement of the algorithm development effort, generation of a damaged thermal response characteristics database, initial development of a test plan for integration testing of proven FBG sensors in simple TPS structure, and development of partnerships to apply the technology.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Cheng, Shaobo; Zhang, Dong; Deng, Shiqing
Topological defects and their interactions often arouse multiple types of emerging phenomena from edge states in Skyrmions to disclination pairs in liquid crystals. In hexagonal manganites, partial edge dislocations, a prototype topological defect, are ubiquitous and they significantly alter the topologically protected domains and their behaviors. In this work, combining electron microscopy experiment and graph theory analysis, we report a systematic study of the connections and configurations of domains in this dislocation embedded system. Rules for domain arrangement are established. The dividing line between domains, which can be attributed by the strain field of dislocations, is accurately described by amore » genus model from a higher dimension in the graph theory. In conclusion, our results open a door for the understanding of domain patterns in topologically protected multiferroic systems.« less
Shen, Hui; Wang, Chun; Li, Liufeng; Chen, Lisheng
2013-05-01
Being small in size and weight, piezoelectric transducers hold unique positions in vibration sensing and control. Here, we explore the possibility of building a compact vibration isolation system using piezoelectric sensors and actuators. The mechanical resonances of a piezoelectric actuator around a few kHz are suppressed by an order of magnitude via electrical damping, which improves the high-frequency response. Working with a strain gauge located on the piezoelectric actuator, an auxiliary control loop eliminates the drift associated with a large servo gain at dc. Following this approach, we design, optimize, and experimentally verify the loop responses using frequency domain analysis. The vibration isolation between 1 Hz and 200 Hz is achieved and the attenuation peaks at 60 near vibration frequency of 20 Hz. Restrictions and potentials for extending the isolation to lower vibration frequencies are discussed.
A FLINN Station at Pinon Flat Observatory
NASA Technical Reports Server (NTRS)
Agnew, Duncan Carr; Wyatt, Frank
1997-01-01
The main objectives are: (1) To develop Pinon Flat Observatory (PFO) as a prototype 'integrated' FLINN station: one from which many types of data are collected, combined, and made available to the DOSE program to enhance studies of local and regional strains; (2) To develop the theoretical framework and methods to integrate the various types of auxiliary data which are to be collected by NASA at space-geodetic sites of the FLINN network, with the aim of learning as much as possible about the nature of earth deformation; (3) To develop procedures for the efficient and useful storage and retrieval of such auxiliary data so that they may be efficiently utilized by DOSE investigators; (4) To investigate the stability of ground monumentation now used in space-geodetic measurements, including the field testing of existing and new monument designs.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Yasuda, H.; Chong, C.; Charalampidis, E. G.
Here, we investigate the nonlinear wave dynamics of origami-based metamaterials composed of Tachi-Miura polyhedron (TMP) unit cells. These cells exhibit strain softening behavior under compression, which can be tuned by modifying their geometrical configurations or initial folded conditions. We assemble these TMP cells into a cluster of origami-based metamaterials, and we theoretically model and numerically analyze their wave transmission mechanism under external impact. Numerical simulations show that origami-based metamaterials can provide a prototypical platform for the formation of nonlinear coherent structures in the form of rarefaction waves, which feature a tensile wavefront upon the application of compression to the system.more » We also demonstrate the existence of numerically exact traveling rarefaction waves in an effective lumped-mass model. Origami-based metamaterials can be highly useful for mitigating shock waves, potentially enabling a wide variety of engineering applications.« less
Formation of rarefaction waves in origami-based metamaterials
NASA Astrophysics Data System (ADS)
Yasuda, H.; Chong, C.; Charalampidis, E. G.; Kevrekidis, P. G.; Yang, J.
2016-04-01
We investigate the nonlinear wave dynamics of origami-based metamaterials composed of Tachi-Miura polyhedron (TMP) unit cells. These cells exhibit strain softening behavior under compression, which can be tuned by modifying their geometrical configurations or initial folded conditions. We assemble these TMP cells into a cluster of origami-based metamaterials, and we theoretically model and numerically analyze their wave transmission mechanism under external impact. Numerical simulations show that origami-based metamaterials can provide a prototypical platform for the formation of nonlinear coherent structures in the form of rarefaction waves, which feature a tensile wavefront upon the application of compression to the system. We also demonstrate the existence of numerically exact traveling rarefaction waves in an effective lumped-mass model. Origami-based metamaterials can be highly useful for mitigating shock waves, potentially enabling a wide variety of engineering applications.
NASA Astrophysics Data System (ADS)
Wang, Dan; Du, Haoyuan; Wang, Linxiang; Melnik, Roderick
2018-05-01
The fully coupled thermo-electro-mechanical properties of nanoscale ferroelectric actuators are investigated by a phase field model. Firstly, the thermal effect is incorporated into the commonly-used phase field model for ferroelectric materials in a thermodynamic consistent way and the governing equation for the temperature field is derived. Afterwards, the modified model is numerically implemented to study a selected prototype of the ferroelectric actuators, where strain associated with electric field-induced non-180° domain switching is employed. The temperature variation and energy flow in the actuation process are presented, which enhances our understanding of the working mechanism of the actuators. Furthermore, the influences of the input voltage frequency and the thermal boundary condition on the temperature variation are demonstrated and carefully discussed in the context of thermal management for real applications.
Optimal output fast feedback in two-time scale control of flexible arms
NASA Technical Reports Server (NTRS)
Siciliano, B.; Calise, A. J.; Jonnalagadda, V. R. P.
1986-01-01
Control of lightweight flexible arms moving along predefined paths can be successfully synthesized on the basis of a two-time scale approach. A model following control can be designed for the reduced order slow subsystem. The fast subsystem is a linear system in which the slow variables act as parameters. The flexible fast variables which model the deflections of the arm along the trajectory can be sensed through strain gage measurements. For full state feedback design the derivatives of the deflections need to be estimated. The main contribution of this work is the design of an output feedback controller which includes a fixed order dynamic compensator, based on a recent convergent numerical algorithm for calculating LQ optimal gains. The design procedure is tested by means of simulation results for the one link flexible arm prototype in the laboratory.
Dynamic assessment of women pelvic floor function by using a fiber Bragg grating sensor system
NASA Astrophysics Data System (ADS)
Ferreira, Luis A.; Araújo, Francisco M.; Mascarenhas, Teresa; Natal Jorge, Renato M.; Fernandes, António A.
2006-02-01
We present a novel sensing system consisting of an intravaginal probe and an optoelectronic measurement unit, which allows an easy, comfortable and quantitative dynamic evaluation of women pelvic floor muscle strength. The sensing probe is based on a silicone cylinder that transduces radial muscle pressure into axial load applied to a fiber Bragg grating strain sensor. The performance of a first sensor probe prototype with temperature referentiation and of the autonomous, portable optoelectronic measurement unit with data logging capabilities and graphical user interface is disclosed. The presented results refer to an ongoing collaboration work between researchers from the Medical, Optoelectronics and Mechanical areas, directed to the development of equipment that can assist in medical practice and help in the research of primary mechanisms responsible for several pelvic floor disorders, in particular urogenital prolapses.
Cheng, Shaobo; Zhang, Dong; Deng, Shiqing; ...
2018-04-19
Topological defects and their interactions often arouse multiple types of emerging phenomena from edge states in Skyrmions to disclination pairs in liquid crystals. In hexagonal manganites, partial edge dislocations, a prototype topological defect, are ubiquitous and they significantly alter the topologically protected domains and their behaviors. In this work, combining electron microscopy experiment and graph theory analysis, we report a systematic study of the connections and configurations of domains in this dislocation embedded system. Rules for domain arrangement are established. The dividing line between domains, which can be attributed by the strain field of dislocations, is accurately described by amore » genus model from a higher dimension in the graph theory. In conclusion, our results open a door for the understanding of domain patterns in topologically protected multiferroic systems.« less
Patterson, Michael; Seregin, Alexey; Huang, Cheng; Kolokoltsova, Olga; Smith, Jennifer; Miller, Milagros; Smith, Jeanon; Yun, Nadezhda; Poussard, Allison; Grant, Ashley; Tigabu, Bersabeh; Walker, Aida; Paessler, Slobodan
2014-02-01
Machupo virus (MACV) is the etiological agent of Bolivian hemorrhagic fever (BHF), a reemerging and neglected tropical disease associated with high mortality. The prototypical strain of MACV, Carvallo, was isolated from a human patient in 1963, but minimal in vitro and in vivo characterization has been reported. To this end, we utilized reverse genetics to rescue a pathogenic MACV from cloned cDNAs. The recombinant MACV (rMACV) had in vitro growth properties similar to those of the parental MACV. Both viruses caused similar disease development in alpha/beta and gamma interferon receptor knockout mice, including neurological disease development and high mortality. In addition, we have identified a novel murine model with mortality and neurological disease similar to BHF disease reported in humans and nonhuman primates.
Critical current scaling and the pivot-point in Nb3Sn strands
NASA Astrophysics Data System (ADS)
Tsui, Y.; Hampshire, D. P.
2012-05-01
Detailed measurements are provided of the engineering critical current density (Jc) and the index of transition (n-value) of two different types of advanced ITER Nb3Sn superconducting strand for fusion applications. The samples consist of one internal-tin strand (OST) and two bronze-route strands (BEAS I and BEAS II—reacted using different heat treatments). Tests on different sections of these wires show that prior to applying strain, Jc is homogeneous to better than 2% along the length of each strand. Jc data have been characterized as a function of magnetic field (B ≤ 14.5 T), temperature (4.2 K ≤ T ≤ 12 K) and applied axial strain ( - 1% ≤ ɛA ≤ 0.8%). Strain-cycling tests demonstrate that the variable strain Jc data are reversible to better than 2% when the applied axial strain is in the range of - 1% ≤ ɛA ≤ 0.5%. The wires are damaged when the intrinsic strain (ɛI) is ɛI ≥ 0.55% and ɛI ≥ 0.23% for the OST and BEAS strands, respectively. The strain dependences of the normalized Jc for each type of strand are similar to those of prototype strands of similar design measured in 2005 and 2008 to about 2% which makes them candidate strands for a round-robin interlaboratory comparison. The Jc data are described by Durham, ITER and Josephson-junction parameterizations to an accuracy of about 4%. For all of these scaling laws, the percentage difference between the data and the parameterization is larger when Jc is small, caused by high B, T or |ɛI|. The n-values can be described by a modified power law of the form n=1+r{I}_{{c}}^{s}, where r and s are approximately constant and Ic is the critical current. It has long been known that pivot-points (or cross-overs) in Jc occur at high magnetic field and temperature. Changing the magnetic field or temperature from one side of the pivot-point to the other changes the highest Jc sample to the lowest Jc sample and vice versa. The pivot-point follows the B-T phase boundary associated with the upper critical field and is usually attributed to the different tin content profiles and pinning properties of internal-tin and bronze-route strands. We report that the strain dependence of the pivot-point in these strands is quite different from that of the upper critical field and suggest that its origin in optimized high tin content strands is the proximity of the tetragonal Nb3Sn phase, which has low superconducting critical parameters.
Looking the part (to me): effects of racial prototypicality on race perception vary by prejudice
Sprout, Gregory T.; Freeman, Jonathan B.; Krendl, Anne C.
2017-01-01
Abstract Less racially prototypic faces elicit more category competition during race categorization. Top-down factors (e.g. stereotypes), however, affect categorizations, suggesting racial prototypicality may enhance category competition in certain perceivers. Here, we examined how prejudice affects race category competition and stabilization when perceiving faces varying in racial prototypicality. Prototypically low vs high Black relative to White faces elicited more category competition and slower response latencies during categorization (Experiment 1), suggesting a pronounced racial prototypicality effect on minority race categorization. However, prejudice predicted the extent of category competition between prototypically low vs high Black faces. Suggesting more response conflict toward less prototypic Black vs White faces, anterior cingulate cortex activity increased toward Black vs White faces as they decreased in racial prototypicality, with prejudice positively predicting this difference (Experiment 2). These findings extend the literature on racial prototypicality and categorization by showing that relative prejudice tempers the extent of category competition and response conflict engaged when initially perceiving faces. PMID:28077728
Prototyping Visual Learning Analytics Guided by an Educational Theory Informed Goal
ERIC Educational Resources Information Center
Hillaire, Garron; Rappolt-Schlichtmann, Gabrielle; Ducharme, Kim
2016-01-01
Prototype work can support the creation of data visualizations throughout the research and development process through paper prototypes with sketching, designed prototypes with graphic design tools, and functional prototypes to explore how the implementation will work. One challenging aspect of data visualization work is coordinating the expertise…
“In vitro” Implantation Technique Based on 3D Printed Prosthetic Prototypes
NASA Astrophysics Data System (ADS)
Tarnita, D.; Boborelu, C.; Geonea, I.; Malciu, R.; Grigorie, L.; Tarnita, D. N.
2018-06-01
In this paper, Rapid Prototyping ZCorp 310 system, based on high-performance composite powder and on resin-high strength infiltration system and three-dimensional printing as a manufacturing method are used to obtain physical prototypes of orthopaedic implants and prototypes of complex functional prosthetic systems directly from the 3D CAD data. These prototypes are useful for in vitro experimental tests and measurements to optimize and obtain final physical prototypes. Using a new elbow prosthesis model prototype obtained by 3D printing, the surgical technique of implantation is established. Surgical implantation was performed on male corpse elbow joint.
End effector monitoring system: An illustrated case of operational prototyping
NASA Technical Reports Server (NTRS)
Malin, Jane T.; Land, Sherry A.; Thronesbery, Carroll
1994-01-01
Operational prototyping is introduced to help developers apply software innovations to real-world problems, to help users articulate requirements, and to help develop more usable software. Operational prototyping has been applied to an expert system development project. The expert system supports fault detection and management during grappling operations of the Space Shuttle payload bay arm. The dynamic exchanges among operational prototyping team members are illustrated in a specific prototyping session. We discuss the requirements for operational prototyping technology, types of projects for which operational prototyping is best suited and when it should be applied to those projects.
Choi, Seon Young; Rashed, Shah M; Hasan, Nur A; Alam, Munirul; Islam, Tarequl; Sadique, Abdus; Johura, Fatema-Tuz; Eppinger, Mark; Ravel, Jacques; Huq, Anwar; Cravioto, Alejandro; Colwell, Rita R
2016-03-15
An outbreak of cholera occurred in 1991 in Mexico, where it had not been reported for more than a century and is now endemic. Vibrio cholerae O1 prototype El Tor and classical strains coexist with altered El Tor strains (1991 to 1997). Nontoxigenic (CTX(-)) V. cholerae El Tor dominated toxigenic (CTX(+)) strains (2001 to 2003), but V. cholerae CTX(+) variant El Tor was isolated during 2004 to 2008, outcompeting CTX(-) V. cholerae. Genomes of six Mexican V. cholerae O1 strains isolated during 1991 to 2008 were sequenced and compared with both contemporary and archived strains of V. cholerae. Three were CTX(+) El Tor, two were CTX(-) El Tor, and the remaining strain was a CTX(+) classical isolate. Whole-genome sequence analysis showed the six isolates belonged to five distinct phylogenetic clades. One CTX(-) isolate is ancestral to the 6th and 7th pandemic CTX(+) V. cholerae isolates. The other CTX(-) isolate joined with CTX(-) non-O1/O139 isolates from Haiti and seroconverted O1 isolates from Brazil and Amazonia. One CTX(+) isolate was phylogenetically placed with the sixth pandemic classical clade and the V. cholerae O395 classical reference strain. Two CTX(+) El Tor isolates possessing intact Vibrio seventh pandemic island II (VSP-II) are related to hybrid El Tor isolates from Mozambique and Bangladesh. The third CTX(+) El Tor isolate contained West African-South American (WASA) recombination in VSP-II and showed relatedness to isolates from Peru and Brazil. Except for one isolate, all Mexican isolates lack SXT/R391 integrative conjugative elements (ICEs) and sensitivity to selected antibiotics, with one isolate resistant to streptomycin. No isolates were related to contemporary isolates from Asia, Africa, or Haiti, indicating phylogenetic diversity. Sequencing of genomes of V. cholerae is critical if genetic changes occurring over time in the circulating population of an area of endemicity are to be understood. Although cholera outbreaks occurred rarely in Mexico prior to the 1990s, genetically diverse V. cholerae O1 strains were isolated between 1991 and 2008. Despite the lack of strong evidence, the notion that cholera was transmitted from Africa to Latin America has been proposed in the literature. In this study, we have applied whole-genome sequence analysis to a set of 124 V. cholerae strains, including six Mexican isolates, to determine their phylogenetic relationships. Phylogenetic analysis indicated the six V. cholerae O1 isolates belong to five phylogenetic clades: i.e., basal, nontoxigenic, classical, El Tor, and hybrid El Tor. Thus, the results of phylogenetic analysis, coupled with CTXϕ array and antibiotic susceptibility, do not support single-source transmission of cholera to Mexico from African countries. The association of indigenous populations of V. cholerae that has been observed in this study suggests it plays a significant role in the dynamics of cholera in Mexico. Copyright © 2016 Choi et al.
Smart surgical needle actuated by shape memory alloys for percutaneous procedures
NASA Astrophysics Data System (ADS)
Konh, Bardia
Background: Majority of cancer interventions today are performed percutaneously using needle-based procedures, i.e. through the skin and soft tissue. Insufficient accuracy using conventional surgical needles motivated researchers to provide actuation forces to the needle's body for compensating the possible errors of surgeons/physicians. Therefore, active needles were proposed recently where actuation forces provided by shape memory alloys (SMAs) are utilized to assist the maneuverability and accuracy of surgical needles. This work also aims to introduce a novel needle insertion simulation to predict the deflection of a bevel tip needle inside the tissue. Methods: In this work first, the actuation capability of a single SMA wire was studied. The complex response of SMAs was investigated via a MATLAB implementation of the Brinson model and verified via experimental tests. The material characteristics of SMAs were simulated by defining multilinear elastic isothermal stress-strain curves. Rigorous experiments with SMA wires were performed to determine the material properties as well as to show the capability of the code to predict a stabilized SMA transformation behavior with sufficient accuracy. The isothermal stress-strain curves of SMAs were simulated and defined as a material model for the Finite Element Analysis of the active needle. In the second part of this work, a three-dimensional finite element (FE) model of the active steerable needle was developed to demonstrate the feasibility of using SMA wires as actuators to bend the surgical needle. In the FE model, birth and death method of defining boundary conditions, available in ANSYS, was used to achieve the pre-strain condition on SMA wire prior to actuation. This numerical model was validated with needle deflection experiments with developed prototypes of the active needle. The third part of this work describes the design optimization of the active using genetic algorithm aiming for its maximum flexibility. Design parameters influencing the steerability include the needle's diameter, wire diameter, pre-strain, and its offset from the needle. A simplified model was developed to decrease the computation time in iterative analyses of the optimization algorithm. In the fourth part of this work a design of an active needling system was proposed where actuation forces of SMAs as well as shape memory polymers (SMPs) were incorporated. SMP elements provide two major additional advantages to the design: (i) recovery of the SMP's plastic deformation by heating the element above its glass transition temperature, and (ii) achieving a higher needle deflection by having a softer stage of SMP at higher temperatures with less amount of actuation force. Finally, in the fifth and last part of this study, an Arbitrary-Lagrangian-Eulerian formulation in LS-DYNA software was used to model the solid-fluid interactions between the needle and tissue. A 150mm long needle was considered to bend within the tissue due to the interacting forces on its asymmetric bevel tip. Some additional assumptions were made to maintain a reasonable computational time, with no need of parallel processing, while having practical accuracies. Three experimental tests of needle steering in a soft phantom were performed to validate the simulation. Results: The finite element model of the active needle was first validated experimentally with developed prototypes. Several design parameters affecting the needle's deflection such as the needle's Young's modulus, the SMA's pre-strain and its offset from the neutral axis of the cannula were studied using the FE model. Then by the integration of the SMA characteristics with the automated optimization schemes an improved design of the active needle was obtained. Real-time experiments with different prototypes showed that the quickest response and the maximum deflection were achieved by the needle with two sections of actuation compared to a single section of actuation. Also the feasibility of providing actuation forces using both SMAs and SMPs for the surgical needle was demonstrated in this study. The needle insertion simulation was validated while observing less than 10% deviation between the estimated amount of needle deflection by the simulation and by the experiments. Using this model the effect of needle diameter and its bevel tip angle on the final shape of the needle was investigated. Conclusion: The numerical and experimental studies of this work showed that a highly maneuverable active needle can be made using the actuation of multiple SMA wires in series. To maneuver around the anatomical obstacles of the human body and reach the target location, thin sharp needles are recommended as they would create a smaller radius of curvature. The insertion model presented in this work is intended to be used as a base structure for path planning and training purposes for future studies. (Abstract shortened by UMI.).
46 CFR 8.570 - Interim approval of prototype SIP company or vessel plans.
Code of Federal Regulations, 2010 CFR
2010-10-01
... 46 Shipping 1 2010-10-01 2010-10-01 false Interim approval of prototype SIP company or vessel... of prototype SIP company or vessel plans. (a) A company operating under an approved prototype SIP... continue operating under the plans while revisions are developed to bring the prototype SIP company or...
Looking the part (to me): effects of racial prototypicality on race perception vary by prejudice.
Cassidy, Brittany S; Sprout, Gregory T; Freeman, Jonathan B; Krendl, Anne C
2017-04-01
Less racially prototypic faces elicit more category competition during race categorization. Top-down factors (e.g. stereotypes), however, affect categorizations, suggesting racial prototypicality may enhance category competition in certain perceivers. Here, we examined how prejudice affects race category competition and stabilization when perceiving faces varying in racial prototypicality. Prototypically low vs high Black relative to White faces elicited more category competition and slower response latencies during categorization (Experiment 1), suggesting a pronounced racial prototypicality effect on minority race categorization. However, prejudice predicted the extent of category competition between prototypically low vs high Black faces. Suggesting more response conflict toward less prototypic Black vs White faces, anterior cingulate cortex activity increased toward Black vs White faces as they decreased in racial prototypicality, with prejudice positively predicting this difference (Experiment 2). These findings extend the literature on racial prototypicality and categorization by showing that relative prejudice tempers the extent of category competition and response conflict engaged when initially perceiving faces. © The Author (2017). Published by Oxford University Press. For Permissions, please email: journals.permissions@oup.com.
Assessment of Mechanical Performance of Bone Architecture Using Rapid Prototyping Models
NASA Astrophysics Data System (ADS)
Saparin, Peter; Woesz, Alexander; Thomsen, Jasper S.; Fratzl, Peter
2008-06-01
The aim of this on-going research project is to assess the influence of bone microarchitecture on the mechanical performance of trabecular bone. A testing chain consist-ing of three steps was established: 1) micro computed tomography (μCT) imaging of human trabecular bone; 2) building of models of the bone from a light-sensitive polymer using Rapid Prototyping (RP); 3) mechanical testing of the models in a material testing machine. A direct resampling procedure was developed to convert μCT data into the format of the RP machine. Standardized parameters for production and testing of the plastic models were established by use of regular cellular structures. Next, normal, osteoporotic, and extreme osteoporotic vertebral trabecular bone architectures were re-produced by RP and compression tested. We found that normal architecture of vertebral trabecular bone exhibit behaviour characteristic of a cellular structure. In normal bone the fracture occurs at much higher strain values that in osteoporotic bone. After the fracture a normal trabecular architecture is able to carry much higher loads than an osteoporotic architecture. However, no statistically significant differences were found in maximal stress during uniaxial compression of the central part of normal, osteoporotic, and extreme osteoporotic vertebral trabecular bone. This supports the hypothesis that osteoporotic trabecular bone can compensate for a loss of trabeculae by thickening the remaining trabeculae in the loading direction (compensatory hypertrophy). The developed approach could be used for mechanical evaluation of structural data acquired non-invasively and assessment of changes in performance of bone architecture.
Code of Federal Regulations, 2010 CFR
2010-01-01
... 10 Energy 1 2010-01-01 2010-01-01 false Schedule C-prototype tests for calibration or reference... Licensed Items § 32.102 Schedule C—prototype tests for calibration or reference sources containing..., conduct prototype tests, in the order listed, on each of five prototypes of the source, which contains...
Oscherwitz, Jon; Yu, Fen; Jacobs, Jana L; Cease, Kemp B
2013-03-01
We previously showed that a multiple antigenic peptide (MAP) vaccine displaying amino acids (aa) 304 to 319 from the 2β2-2β3 loop of protective antigen was capable of protecting rabbits from an aerosolized spore challenge with Bacillus anthracis Ames strain. Antibodies to this sequence, referred to as the loop-neutralizing determinant (LND), are highly potent at neutralizing lethal toxin yet are virtually absent in rabbit and human protective antigen (PA) antiserum. While the MAP vaccine was protective against anthrax, it contains a single heterologous helper T cell epitope which may be suboptimal for stimulating an outbred human population. We therefore engineered a recombinant vaccine (Rec-LND) containing two tandemly repeated copies of the LND fused to maltose binding protein, with enhanced immunogenicity resulting from the p38/P4 helper T cell epitope from Schistosoma mansoni. Rec-LND was found to be highly immunogenic in four major histocompatibility complex (MHC)-diverse strains of mice. All (7/7) rabbits immunized with Rec-LND developed high-titer antibody, 6 out of 7 developed neutralizing antibody, and all rabbits were protected from an aerosolized spore challenge of 193 50% lethal doses (LD(50)) of the B. anthracis Ames strain. Survivor serum from Rec-LND-immunized rabbits revealed significantly increased neutralization titers and specific activity compared to prechallenge levels yet lacked PA or lethal factor (LF) antigenemia. Control rabbits immunized with PA, which were also completely protected, appeared sterilely immune, exhibiting significant declines in neutralization titer and specific activity compared to prechallenge levels. We conclude that Rec-LND may represent a prototype anthrax vaccine for use alone or potentially combined with PA-containing vaccines.
Ergünay, Koray; Brinkmann, Annika; Litzba, Nadine; Günay, Filiz; Kar, Sırrı; Öter, Kerem; Örsten, Serra; Sarıkaya, Yasemen; Alten, Bülent; Nitsche, Andreas; Linton, Yvonne-Marie
2017-07-01
Next-generation sequencing technologies have significantly facilitated the discovery of novel viruses, and metagenomic surveillance of arthropods has enabled exploration of the diversity of novel or known viral agents. We have identified a novel rhabdovirus that is genetically related to the recently described Merida virus via next-generation sequencing in a mosquito pool from Thrace. The complete viral genome contains 11,798 nucleotides with 83% genome-wide nucleotide sequence similarity to Merida virus. Five major putative open reading frames that follow the canonical rhabdovirus genome organization were identified. A total of 1380 mosquitoes comprising 13 species, collected from Thrace and the Mediterranean and Aegean regions of Anatolia were screened for the novel virus using primers based on the N and L genes of the prototype genome. Eight positive pools (6.2%) exclusively comprised Culex pipiens sensu lato specimens originating from all study regions. Infections were observed in pools with female as well as male or mixed-sex individuals. The overall and Cx. pipiens-specific minimal infection rates were calculated to be 5.7 and 14.8, respectively. Sequencing of the PCR products revealed marked diversity within a portion of the N gene, with up to 4% divergence and distinct amino acid substitutions that were unrelated to the collection site. Phylogenetic analysis of the complete and partial viral polymerase (L gene) amino acid sequences placed the novel virus and Merida virus in a distinct group, indicating that these strains are closely related. The strain is tentatively named "Merida-like virus Turkey". Studies are underway to isolate and further explore the host range and distribution of this new strain.
Park, Jihye; Zhang, Ying; Chen, Chun; Dudley, Edward G; Harvill, Eric T
2015-12-01
Secretion systems are key virulence factors, modulating interactions between pathogens and the host's immune response. Six potential secretion systems (types 1-6; T1SS-T6SS) have been discussed in classical bordetellae, respiratory commensals/pathogens of mammals. The prototypical Bordetella bronchiseptica strain RB50 genome seems to contain all six systems, whilst two human-restricted subspecies, Bordetella parapertussis and Bordetella pertussis, have lost different subsets of these. This implicates secretion systems in the divergent evolutionary histories that have led to their success in different niches. Based on our previous work demonstrating that changes in secretion systems are associated with virulence characteristics, we hypothesized there would be substantial divergence of the loci encoding each amongst sequenced strains. Here, we describe extensive differences in secretion system loci; 10 of the 11 sequenced strains had lost subsets of genes or one entire secretion system locus. These loci contained genes homologous to those present in the respective loci in distantly related organisms, as well as genes unique to bordetellae, suggesting novel and/or auxiliary functions. The high degree of conservation of the T3SS locus, a complex machine with interdependent parts that must be conserved, stands in dramatic contrast to repeated loss of T5aSS 'autotransporters', which function as an autonomous unit. This comparative analysis provided insights into critical aspects of each pathogen's adaptation to its different niche, and the relative contributions of recombination, mutation and horizontal gene transfer. In addition, the relative conservation of various secretion systems is an important consideration in the ongoing search for more highly conserved protective antigens for the next generation of pertussis vaccines.
Chao, Gary Y C; Wallis, Robert H; Marandi, Leili; Ning, Terri; Sarmiento, Janice; Paterson, Andrew D; Poussier, Philippe
2014-04-15
The autoimmune diabetic syndrome of the BioBreeding diabetes-prone (BBDP) rat is a polygenic disease that resembles in many aspects human type 1 diabetes (T1D). A successful approach to gain insight into the mechanisms underlying genetic associations in autoimmune diseases has been to identify and map disease-related subphenotypes that are under simpler genetic control than the full-blown disease. In this study, we focused on the β cell overexpression of Ccl11 (Eotaxin), previously postulated to be diabetogenic in BBDR rats, a BBDP-related strain. We tested the hypothesis that this trait is genetically determined and contributes to the regulation of diabetes in BBDP rats. Similar to the BBDR strain, we observed a time-dependent, insulitis-independent pancreatic upregulation of Ccl11 in BBDP rats when compared with T1D-resistant ACI.1u.lyp animals. Through linkage analysis of a cross-intercross of these two parental strains, this trait was mapped to a region on chromosome 12 that overlaps Iddm30. Linkage results were confirmed by phenotypic assessment of a novel inbred BBDP.ACI-Iddm30 congenic line. As expected, the Iddm30 BBDP allele is associated with a significantly higher pancreatic expression of Ccl11; however, the same allele confers resistance to T1D. Analysis of islet-infiltrating T cells in Iddm30 congenic BBDP animals revealed that overexpression of pancreatic Ccl11, a prototypical Th2 chemokine, is associated with an enrichment in Th2 CD4+ T cells within the insulitic lesions. These results indicate that, in the BBDP rat, Iddm30 controls T1D susceptibility through both the regulation of Ccl11 expression in β cells and the subsequent Th1/Th2 balance within islet-infiltrating T lymphocytes.
Ludlow, M; Nguyen, D T; Silin, D; Lyubomska, O; de Vries, R D; von Messling, V; McQuaid, S; De Swart, R L; Duprex, W P
2012-07-01
The propensity of canine distemper virus (CDV) to spread to the central nervous system is one of the primary features of distemper. Therefore, we developed a reverse genetics system based on the neurovirulent Snyder Hill (SH) strain of CDV (CDV(SH)) and show that this virus rapidly circumvents the blood-brain and blood-cerebrospinal fluid (CSF) barriers to spread into the subarachnoid space to induce dramatic viral meningoencephalitis. The use of recombinant CDV(SH) (rCDV(SH)) expressing enhanced green fluorescent protein (EGFP) or red fluorescent protein (dTomato) facilitated the sensitive pathological assessment of routes of virus spread in vivo. Infection of ferrets with these viruses led to the full spectrum of clinical signs typically associated with distemper in dogs during a rapid, fatal disease course of approximately 2 weeks. Comparison with the ferret-adapted CDV(5804P) and the prototypic wild-type CDV(R252) showed that hematogenous infection of the choroid plexus is not a significant route of virus spread into the CSF. Instead, viral spread into the subarachnoid space in rCDV(SH)-infected animals was triggered by infection of vascular endothelial cells and the hematogenous spread of virus-infected leukocytes from meningeal blood vessels into the subarachnoid space. This resulted in widespread infection of cells of the pia and arachnoid mater of the leptomeninges over large areas of the cerebral hemispheres. The ability to sensitively assess the in vivo spread of a neurovirulent strain of CDV provides a novel model system to study the mechanisms of virus spread into the CSF and the pathogenesis of acute viral meningitis.
Analysis of human herpesvirus-6 IE1 sequence variation in clinical samples.
Stanton, Richard; Wilkinson, Gavin W G; Fox, Julie D
2003-12-01
Herpesvirus immediate early (IE) proteins are known to play key roles in establishing productive infections, regulating reactivation from latency, and creating a cellular environment favourable to viral replication. Human herpesvirus-6 (HHV-6) IE genes have not been studied as intensively as their homologues in the prototype betaherpesvirus human cytomegalovirus (HCMV). Whilst the HCMV IE1 gene is relatively conserved, early studies indicated that HHV-6 IE1 exhibited a high level of sequence variation between HHV-6A and HHV-6B isolates, although the observation was based primarily on virus stocks that had been isolated and propagated in vitro. In this study, we investigated the level of HHV-6 IE1 sequence variation in vivo by direct sequencing of circulating virus in clinical samples without prior in vitro culture. Sequences exactly matching those reported for reference HHV-6 isolates were identified in clinical samples, thus the HHV-6 laboratory strains used in the majority of in vitro studies appear to be representative of virus circulating in vivo with respect to the IE1 gene. The HHV-6 IE1 sequence is also conserved in reference strains that had been passaged extensively in vitro. The high degree of divergence between variant A and B type IE1 sequences was confirmed, but interestingly HHV-6B IE1 sequences were observed to further segregate into two distinct subgroups, with the laboratory strains Z29 and HST representative of these two subgroups. Within each HHV-6B subgroup, a remarkably high level of homology was observed. Thus the HHV-6 IE1 sequence appears highly stable, underlining its potential importance to the viral life cycle. Copyright 2003 Wiley-Liss, Inc.
Chronological analysis of canine parvovirus type 2 isolates in Japan.
Ohshima, Takahisa; Hisaka, Mitsuaki; Kawakami, Kazuo; Kishi, Masahiko; Tohya, Yukinobu; Mochizuki, Masami
2008-08-01
Fifty-five canine parvovirus type 2 (CPV) samples, 12 fecal specimens and 43 cell culture isolates, were examined for their genetic characteristics of VP2 gene. They were collected from the diseased dogs at various districts of Japan during 27 years from 1980 to 2006. A fragment of VP2 gene was analyzed by restriction fragment length polymorphism assay and DNA sequencing. The original antigenic type 2 of CPV (CPV-2) was no longer found in the samples since 1984, and two antigenic variants CPV-2a and CPV-2b replaced CPV-2 as predominant types for about 5 years from 1982. A new genetic variant of prototype CPV-2a with non-synonymous substitution at the VP2 amino acid residue 297 from Ser to Ala was first detected in 1987. New CPV-2b with the same amino acid substitution at position 297 as new CPV-2a was also detected from the samples collected in 1997. Since then new CPV-2b has been the predominant CPV over the field of Japan. Several additional amino acid substitutions were detected in the VP2 gene of some recent CPV strains. Neither CPV-2c(a), CPV-2c(b), nor "Glu-426" of the antigenic variants previously found outside the country was detected in any samples tested. Reactivity of new CPV-2a and 2b variants against antibodies produced by the current vaccine products was determined by a cross hemagglutination-inhibition test. The recent field CPV isolates reacted more efficiently to the antibodies produced in dogs vaccinated with the new CPV-2b vaccine strain than the conventional CPV-2 vaccine strain.
Kim, Shin-Hee; Samal, Siba K
2017-07-24
Avian Influenza virus (AIV) is an important pathogen for both human and animal health. There is a great need to develop a safe and effective vaccine for AI infections in the field. Live-attenuated Newcastle disease virus (NDV) vectored AI vaccines have shown to be effective, but preexisting antibodies to the vaccine vector can affect the protective efficacy of the vaccine in the field. To improve the efficacy of AI vaccine, we generated a novel vectored vaccine by using a chimeric NDV vector that is serologically distant from NDV. In this study, the protective efficacy of our vaccines was evaluated by using H5N1 highly pathogenic avian influenza virus (HPAIV) strain A/Vietnam/1203/2004, a prototype strain for vaccine development. The vaccine viruses were three chimeric NDVs expressing the hemagglutinin (HA) protein in combination with the neuraminidase (NA) protein, matrix 1 protein, or nonstructural 1 protein. Comparison of their protective efficacy between a single and prime-boost immunizations indicated that prime immunization of 1-day-old SPF chicks with our vaccine viruses followed by boosting with the conventional NDV vector strain LaSota expressing the HA protein provided complete protection of chickens against mortality, clinical signs and virus shedding. Further verification of our heterologous prime-boost immunization using commercial broiler chickens suggested that a sequential immunization of chickens with chimeric NDV vector expressing the HA and NA proteins following the boost with NDV vector expressing the HA protein can be a promising strategy for the field vaccination against HPAIVs and against highly virulent NDVs. Copyright © 2017 Elsevier Ltd. All rights reserved.