Zhang, Wenqiang; Lin, Xiaojuan; Jiang, Ping; Tao, Zexin; Liu, Xiaolin; Ji, Feng; Wang, Tongzhan; Wang, Suting; Lv, Hui; Xu, Aiqiang; Wang, Haiyan
2016-08-01
Coxsackievirus B3 (CV-B3) has frequently been associated with aseptic meningitis outbreaks in China. To identify sequence motifs related to aseptic meningitis and to construct an infectious clone, the genome sequence of 08TC170, a representative strain isolated from cerebrospinal fluid (CSF) samples from an outbreak in Shandong in 2008, was determined, and the coding regions for P1-P3 and VP1 were aligned. The first 21 and last 20 residues were "TTAAAACAGCCTGTGGGTTGT" and "ATTCTCCGCATTCGGTGCGG", respectively. The whole genome consisted of 7401 nucleotides, sharing 80.8 % identity with the prototype strain Nancy and low sequence similarity with members of clusters A-C. In contrast, 08TC170 showed high sequence similarity to members of cluster D. An especially high level of sequence identity (≥97.7 %) was found within a branch constituted by 08TC170 and four Chinese strains that clustered together in all of the P1-P3 phylogenic trees. In addition, 08TC170 also possessed a close relationship to the Hong Kong strain 26362/08 in VP1. Similarity plot analysis showed that 08TC170 was most similar to the Chinese CV-B3 strain SSM in P1 and the partial P2 coding region but to the CV-B5 or E-6 strain in 2C and following regions. A T277A mutation was found in 08TC170 and other strains isolated in 2008-2010, but not in strains isolated before 2008, which had high sequence similarity and formed the cluster A277. The results suggested that 08TC170 was the product of both intertypic recombination and point mutation, whose effects on viral neurovirulence will be investigated in a further study. The high homology between 08TC170 and other strains revealed their co-circulation in mainland China and Hong Kong and indicates that further surveillance is needed.
Tumova, Bela; Easterday, Bernard C.
1969-01-01
This study demonstrates relationships in envelope antigens of 4 human influenza A2 strains isolated during the period 1957-68 (including A2/Hong Kong/68), 2 strains of A/Equi-2/63 and 7 avian influenza viruses isolated in Europe, North America, and the Ukraine in the years 1960-67. Antigenic relationships among the strains were determined on the basis of haemagglutination-inhibition, virus-neutralization, strain-specific complement-fixation, and neuraminidase-inhibition tests. North American avian influenza strains, Turkey/California/64, Turkey/Massachusetts/65, Turkey/Wisconsin/66, Turkey/Ontario/6828/67, and the Italian strain Duck/Italy/574/66 are antigenically related to human A2 influenza viruses by haemagglutinin and/or neuraminidase. None of these viruses is antigenically related to the A/Equi-2/63 strains, Duck/Ukraine/2/60, Duck/Ukraine/1/63 or A2/Hong Kong/68. However, A2/Hong Kong/68 has neuraminidase similar to other A2 strains from previous years. A definite relationship was shown between the haemagglutinin of A/Equi-2/63, A2/Hong Kong/68, Duck/Ukraine/2/60 and Duck/Ukraine/1/63 strains by the use of hyperimmune sera in 3 different serological tests. Related neuraminidase was demonstrated only between A/Equi-2/63 and both duck strains from the Ukraine. The significance of these findings and their interpretation with respect to the ecology of influenza viruses are discussed. PMID:5309452
Yip, Cyril C Y; Lo, Janice Y C; Sridhar, Siddharth; Lung, David C; Luk, Shik; Chan, Kwok-Hung; Chan, Jasper F W; Cheng, Vincent C C; Woo, Patrick C Y; Yuen, Kwok-Yung; Lau, Susanna K P
2017-05-16
A fatal case associated with enterovirus D68 (EV-D68) infection affecting a 10-year-old boy was reported in Hong Kong in 2014. To examine if a new strain has emerged in Hong Kong, we sequenced the partial genome of the EV-D68 strain identified from the fatal case and the complete VP1, and partial 5'UTR and 2C sequences of nine additional EV-D68 strains isolated from patients in Hong Kong. Sequence analysis indicated that a cluster of strains including the previously recognized A2 strains should belong to a separate clade, clade D, which is further divided into subclades D1 and D2. Among the 10 EV-D68 strains, 7 (including the fatal case) belonged to the previously described, newly emerged subclade B3, 2 belonged to subclade B1, and 1 belonged to subclade D1. Three EV-D68 strains, each from subclades B1, B3, and D1, were selected for complete genome sequencing and recombination analysis. While no evidence of recombination was noted among local strains, interclade recombination was identified in subclade D2 strains detected in mainland China in 2008 with VP2 acquired from clade A. This study supports the reclassification of subclade A2 into clade D1, and demonstrates interclade recombination between clades A and D2 in EV-D68 strains from China.
Chan, Wallace Chi Ho; Chan, Christopher L F; Suen, Margaret
2013-11-01
Family caregivers may often experience caregiving stress and burden. To systematically assess this issue, medical social workers may need to use a brief and valid measurement in their practice. In the Hong Kong Chinese context, one additional challenge is to examine whether a measurement developed in the West is valid for Hong Kong Chinese caregivers. Thus, medical social workers in Hong Kong initiated this research study to validate the Chinese version of the Modified Caregiver Strain Index (C-M-CSI). A total of 223 Chinese caregivers of patients with various chronic illnesses were recruited for this validation study. C-M-CSI demonstrated good reliability (Cronbach's alpha coefficient = .91), concurrent validity with the Chinese version of the Caregiver Burden Inventory, and discriminant validity with the Chinese version of the Meaning in Life Questionnaire. Factor analysis yielded a single factor as the original M-CSI, which explained 49 percent of variance. Construct validity was shown by differentiating spousal and nonspousal caregivers, as well as caregivers of patients with and without behavioral problems. C-M-CSI is recommended as a brief and valid measurement that can be used by medical social workers in assessing the caregiving strain of Chinese caregivers of patients in Hong Kong.
Lobmann, M.; Delem, A.; Jovanovic, D.; Peetermans, J.
1981-01-01
Two recombinants (R22 and R75) of the attenuated B/USSR/69 strain Bright and the virulent B/Hong Kong/5/72 and one recombinant (R5) of Bright and the virulent B/Hong Kong /8/73 were selected for genotypic and phenotypic caracterization. All three recombinants had the growth property of the attenuated parent Brigit. Analysis of their RNA's by polyacrylamide gel electrophoresis revealed that, the strains R22 and R75 had derived all their genes from Brigit, those coding for haemagglutinin excepted. These recombinants were clinically evaluated and found to be attenuated and immunogenic. The recombinant R5 which derived, besides the bene coding for the haemagglutinin, several other genes from B/Hong Kong/8/73 was only partly attenuated since it induced influenza-like symptoms in one out of three volunteers. It is concluded that the strain Brigit can be used as a donor of genes for the attenuation of the B/Hong Kong/5/72 virus and that recombinants of influenza type B can be identified, like influenza type A recombinants, by their RNA pattern. Images Plate 1 PMID:7019320
Chen, Qi; Thomas, Joseph T; Giménez-Lirola, Luis G; Hardham, John M; Gao, Qinshan; Gerber, Priscilla F; Opriessnig, Tanja; Zheng, Ying; Li, Ganwu; Gauger, Phillip C; Madson, Darin M; Magstadt, Drew R; Zhang, Jianqiang
2016-04-05
At least two genetically different porcine epidemic diarrhea virus (PEDV) strains have been identified in the United States (U.S. PEDV prototype and S-INDEL-variant strains). The current serological assays offered at veterinary diagnostic laboratories for detection of PEDV-specific antibody are based on the U.S. PEDV prototype strain. The objectives of this study were: 1) isolate the U.S. PEDV S-INDEL-variant strain in cell culture; 2) generate antisera against the U.S. PEDV prototype and S-INDEL-variant strains by experimentally infecting weaned pigs; 3) determine if the various PEDV serological assays could detect antibodies against the U.S. PEDV S-INDEL-variant strain and vice versa. A U.S. PEDV S-INDEL-variant strain was isolated in cell culture in this study. Three groups of PEDV-negative, 3-week-old pigs (five pigs per group) were inoculated orally with a U.S. PEDV prototype isolate (previously isolated in our lab), an S-INDEL-variant isolate or virus-negative culture medium. Serum samples collected at 0, 7, 14, 21 and 28 days post inoculation were evaluated by the following PEDV serological assays: 1) indirect fluorescent antibody (IFA) assays using the prototype and S-INDEL-variant strains as indicator viruses; 2) virus neutralization (VN) tests against the prototype and S-INDEL-variant viruses; 3) PEDV prototype strain whole virus based ELISA; 4) PEDV prototype strain S1-based ELISA; and 5) PEDV S-INDEL-variant strain S1-based ELISA. The positive antisera against the prototype strain reacted to and neutralized both prototype and S-INDEL-variant viruses, and the positive antisera against the S-INDEL-variant strain also reacted to and neutralized both prototype and S-INDEL-variant viruses, as examined by IFA antibody assays and VN tests. Antibodies against the two PEDV strains could be detected by all three ELISAs although detection rates varied to some degree. These data indicate that the antibodies against U.S. PEDV prototype and S-INDEL-variant strains cross-reacted and cross-neutralized both strains in vitro. The current serological assays based on U.S. PEDV prototype strain can detect antibodies against both U.S. PEDV strains.
Molecular epidemiology of Vibrio cholerae in Hong Kong.
Yam, W C; Lung, M L; Ng, K Y; Ng, M H
1989-01-01
We studied restriction fragment length polymorphism of the enterotoxin genes of isolates of Vibrio cholerae El Tor, indistinguishable by bacteriophage typing, which were collected in Hong Kong since 1978. Using this approach, we could distinguish indigenous and exogenous strains obtained from different sources and epidemiological settings. Images PMID:2570082
Newcastle disease virus surveillance in Hong Kong on local and imported poultry.
Shortridge, K F; Alexander, D J
1978-09-01
Surveillance of apparently healthy ducks, geese and fowl originating in Hong Kong and the People's Republic of China at a poultry dressing plant in Hong Kong yielded 67 isolates of Newcastle disease virus. More than twice as many viruses were isolated from the cloaca than from the trachea. Twelve representative isolates were examined in virulence tests--all six of the fowl isolates and two of five duck isolates behaved as velogenic strains, the other four were lentogenic.
Hung, Ivan Fan-Ngai; Zhang, Anna Jinxia; To, Kelvin Kai-Wang; Chan, Jasper Fuk-Woo; Li, Patrick; Wong, Tin-Lun; Zhang, Ricky; Chan, Tuen-Ching; Chan, Brian Chun-Yuan; Wai, Harrison Ho; Chan, Lok-Wun; Fong, Hugo Pak-Yiu; Hui, Raymond Kar-Ching; Kong, Ka-Lun; Leung, Arthur Chun-Fung; Ngan, Abe Ho-Ting; Tsang, Louise Wing-Ki; Yeung, Alex Pat-Chung; Yiu, Geo Chi-Ngo; Yung, Wing; Lau, Johnson Y-N; Chen, Honglin; Chan, Kwok-Hung; Yuen, Kwok-Yung
2016-02-01
Pretreatment with topical imiquimod, a synthetic agonist of toll-like receptor 7, significantly improved the immunogenicity of influenza vaccination in elderly people. We aimed to clarify its effect in a younger age group. In this double-blind, randomised controlled trial, we enrolled healthy volunteers aged 18-30 years in early 2014 to receive the 2013-14 northern-hemisphere winter trivalent influenza vaccine at the Queen Mary Hospital, (Hong Kong, China). Eligible participants were randomly assigned (1:1:1:1) to one of the four vaccination groups: the study group, topical imiquimod-cream followed by intradermal trivalent influenza vaccine (INF-Q-ID), or one of three control groups, topical aqueous-cream control followed by intradermal trivalent influenza vaccine (INF-C-ID), topical aqueous-cream control followed by intramuscular trivalent influenza vaccine (INF-C-IM), and topical imiquimod-cream followed by intradermal normal-saline injection (SAL-Q-ID). Randomisation was by computer-generated lists in blocks of four. The type of topical treatment was masked from volunteers and investigators, although not from the study nurse. Serum haemagglutination-inhibition and microneutralisation-antibody titres were assayed. The primary outcome was seroconversion at day 7 after treatment for three vaccine strains of influenza (A/California/07/2009 H1N1-like virus [A/California/H1N1], A/Victoria/361/2011 H3N2-like virus [A/Victoria/H3N2], and B/Massachusetts/2/2012-like virus [B/Yamagata lineage]) and four non-vaccine strains (A/HK/485197/14 [H3N2 Switzerland-like lineage], prototype A/WSN/1933 [H1N1], A/HK/408027/09 [prepandemic seasonal H1N1], and B/HK/418078/11 [Victoria lineage]). Analysis was done on an intention-to-treat basis. This trial is registered with ClinicalTrials.gov, number NCT02103023. We enrolled 160 healthy volunteers between March 1 and May 31, 2014, and 40 participants were randomly assigned to each study group. For the A/California/H1N1 strain, seroconversion at day 7 occurred in 39 participants (98%) in the INF-Q-ID group, 25 (63%) in the INF-C-ID group, 18 (45%) in the INF-C-IM group, and none in the SAL-Q-ID group; for the A/Victoria/H3N2, this was 30 (75%) in the INF-Q-ID group, four (10%) in the INF-C-ID group, four (10%) in the INF-C-IM group, and none in the SAL-Q-ID group; and for the B/Massachusetts (Yamagata lineage) strain, this was 36 (90%) in the INF-Q-ID group, 27 (68%) in the INF-C-ID group, 17 (43%) in the INF-C-IM group, and one (3%) in the SAL-Q-ID group (p<0·0001 for all three vaccine strains). Adverse reactions were infrequent and self-limited and did not differ between the four groups. Furthermore, the seroconversion rate against the four non-vaccine strains was better in the INF-Q-ID group than in the control groups on days 7 and 21 (p<0·0001). The most common adverse events were grade 1 redness (five participants in the INF-Q-ID group, three in INF-C-ID, one in INF-C-IM, and one in SAL-Q-ID) and grade 1 swelling (seven participants in INF-Q-ID group, five in INF-C-ID, three in INF-C-IM, and two in SAL-Q-ID. Topical application of imiquimod before intradermal trivalent influenza vaccine significantly improved immunogenicity against the vaccine influenza strains in young healthy individuals and increased immunogenicity against the non-vaccine strains, especially the antigenically drifted H3N2 strain of 2015, which was not included in the 2013-14 recommended vaccine. Further studies should be done to establish the efficacy and safety of this approach for other injectable vaccines to augment the onset and range of protection. The Shaw Foundation Hong Kong, Health and Medical Research Fund (Hong Kong, China), The Consultancy Service for Enhancing Laboratory Surveillance of Emerging Infectious Disease for the HKSAR (Department of Health, Hong Kong, China), The Providence Foundation, Respiratory Viral Research Foundation. Copyright © 2016 Elsevier Ltd. All rights reserved.
Family Strain and Adolescent Delinquency in Two Chinese Cities, Guangzhou and Hong Kong
ERIC Educational Resources Information Center
Cheung, Chau-Kiu; Ngai, Ngan-Pun; Ngai, Steven Sek-Yum
2007-01-01
Elucidating the conditions in which family strain takes effect in adolescent delinquency is one avenue along which to substantiate general strain theory. These conditions include family relationship and the type of delinquency. In the context of Chinese societies, the conditions also include the differences between socialist, collectivist Mainland…
Spilling over strain between elders and their caregivers in Hong Kong.
Cheung, Chau-Kiu; Chow, Esther Oi-wah
2006-01-01
According to the dialectical model, the well-being of the older care recipient, the informal caregiver, and the professional care provider mutually affect each other. Particularly, the caregiver's strain can affect the care recipient's well-being both positively and negatively. Moreover, the task-specific model suggests that as social workers are responsible for maintaining elders' well-being, the workers' strain would be particularly influential on the elders' well-being. To clarify these dialectic relationships, the present study surveyed the three parties involved in home help or home care services in Hong Kong over two successive waves using a panel design. This study reveals the significant negative effect the professional care provider's earlier strain has on the elder's later well-being. Moreover, the social worker's earlier strain was particularly detrimental to the elder's later well-being. In contrast, the effect of the informal caregiver's earlier strain was not significant. Additionally, the elder's well-being had no significant impact on the strain of either the professional care provider or the informal caregiver. Findings of this study support the qualification of the dialectical model by the task-specific model to yield a model of channeled spillover. Accordingly, dialectical influence requires a channel to materialize the spillover effect.
Changing epidemiology of rotavirus G-types circulating in Hong Kong, China.
Lo, Janice Yee Chi; Szeto, Kai Cheung; Tsang, Dominic Ngai Chong; Leung, Kwok Hung; Lim, Wilina Wei Ling
2005-01-01
Group A rotaviruses are the most common cause of severe diarrhoeal disease in young children worldwide. The development of a vaccine is advocated by the World Health Organization. Obtaining local baseline information regarding rotavirus strain variation is important to ensure matching of circulating and vaccine strains. The current study was undertaken to determine the epidemiology of rotavirus G-types in Hong Kong in anticipation of a vaccination program. From 2001 to 2002 over a period of one year, diarrhoeal stool specimens known to be positive for rotavirus were subjected to G-typing by reverse transcriptase-polymerase chain reaction using nested type-specific primers. Rotavirus G-type distribution was correlated with patient demographics. Among 747 rotavirus positive stool specimens, 723 strains could be G-typed as G1 (302, 40.4%), G2 (128, 17.1%), G3 (231, 30.9%), G4 (24, 3.2%), and G9 (38, 5.1%). G1 strains were found predominantly in those 5 years old or younger (P < 0.0001), while G2 strains were more prevalent among those over 5 years of age (P < 0.001). When compared with similar studies in 1983 to 1984 and 1999 to 2000, there were significant changes in the prevalence of various G-types, with consistent detection of G9 strains in the current study. It is concluded that rotavirus G-type distribution in Hong Kong has varied with time. Continuous monitoring of the epidemiology of rotavirus is important, especially in anticipation of the introduction of a vaccine, in order to document its impact and to ensure its continued effectiveness. Copyright 2005 Wiley-Liss, Inc.
Zhou, Xiaoming; Chan, Paul K. S.; Tam, John S.; Tang, Julian W.
2011-01-01
Background Hepatitis C virus (HCV) 6a accounts for 23.6% of all HCV infections of the general population and 58.5% of intravenous drug users in Hong Kong. However, the geographical origin of this highly predominant HCV subgenotype is largely unknown. This study explores a hypothesis for one possible transmission route of HCV 6a to Hong Kong. Methods NS5A sequences derived from 26 HCV 6a samples were chosen from a five year period (1999–2004) from epidemiologically unrelated patients from Hong Kong. Partial-NS5A sequences (513-bp from nt 6728 to 7240) were adopted for Bayesian coalescent analysis to reconstruct the evolutionary history of HCV infections in Hong Kong using the BEAST v1.3 program. A rooted phylogenetic tree was drawn for these sequences by alignment with reference Vietnamese sequences. Demographic data were accessed from “The Statistic Yearbooks of Hong Kong”. Results Bayesian coalescent analysis showed that the rapid increase in 6a infections, which had increased more than 90-fold in Hong Kong from 1986 to 1994 correlated to two peaks of Vietnamese immigration to Hong Kong from 1978 to 1997. The second peak, which occurred from 1987 through 1997, overlapped with the rapid increase of HCV 6a occurrence in Hong Kong. Phylogenetic analyses have further revealed that HCV 6a strains from Vietnam may be ancestral to Hong Kong counterparts. Conclusions The high predominance of HCV 6a infections in Hong Kong was possibly associated with Vietnamese immigration during 1987–1997. PMID:21931867
Zhou, Xiaoming; Chan, Paul K S; Tam, John S; Tang, Julian W
2011-01-01
Hepatitis C virus (HCV) 6a accounts for 23.6% of all HCV infections of the general population and 58.5% of intravenous drug users in Hong Kong. However, the geographical origin of this highly predominant HCV subgenotype is largely unknown. This study explores a hypothesis for one possible transmission route of HCV 6a to Hong Kong. NS5A sequences derived from 26 HCV 6a samples were chosen from a five year period (1999-2004) from epidemiologically unrelated patients from Hong Kong. Partial-NS5A sequences (513-bp from nt 6728 to 7240) were adopted for Bayesian coalescent analysis to reconstruct the evolutionary history of HCV infections in Hong Kong using the BEAST v1.3 program. A rooted phylogenetic tree was drawn for these sequences by alignment with reference Vietnamese sequences. Demographic data were accessed from "The Statistic Yearbooks of Hong Kong". Bayesian coalescent analysis showed that the rapid increase in 6a infections, which had increased more than 90-fold in Hong Kong from 1986 to 1994 correlated to two peaks of Vietnamese immigration to Hong Kong from 1978 to 1997. The second peak, which occurred from 1987 through 1997, overlapped with the rapid increase of HCV 6a occurrence in Hong Kong. Phylogenetic analyses have further revealed that HCV 6a strains from Vietnam may be ancestral to Hong Kong counterparts. The high predominance of HCV 6a infections in Hong Kong was possibly associated with Vietnamese immigration during 1987-1997.
Life strain and psychological distress of older women and older men in Hong Kong.
Boey, K W; Chiu, H F K
2005-11-01
This study examined the life strain and psychological distress among a group of older adults (N = 1034, 51.2% female) in Hong Kong. Data were collected through individual interviews in which a standardized questionnaire was administered. The results indicated that older women had more somatic complaints and poorer self-rated health. Family network and interdependent relationships were significantly poorer among the older women than in the older men. Women were also found to experience a higher level of psychological distress (as measured by GDS-15 and GHQ-12) than did men. Perceived financial strain and poor physical health had similar direct effect on the psychological distress of both older women and older men. In contrast to Western findings, a poor family network was observed to exert a greater direct effect on psychological distress than an inadequate social network of friends. Generally, a good social network was found to mitigate the negative impact of life strain factors among older men, but not among older women.
Chen, Qi; Gauger, Phillip C; Stafne, Molly R; Thomas, Joseph T; Madson, Darin M; Huang, Haiyan; Zheng, Ying; Li, Ganwu; Zhang, Jianqiang
2016-05-01
At least two genetically different porcine epidemic diarrhoea virus (PEDV) strains have been identified in the USA: US PEDV prototype and S-INDEL-variant strains. The objective of this study was to compare the pathogenicity differences of the US PEDV prototype and S-INDEL-variant strains in conventional neonatal piglets under experimental infections. Fifty PEDV-negative 5-day-old pigs were divided into five groups of ten pigs each and were inoculated orogastrically with three US PEDV prototype isolates (IN19338/2013, NC35140/2013 and NC49469/2013), an S-INDEL-variant isolate (IL20697/2014), and virus-negative culture medium, respectively, with virus titres of 104 TCID50 ml- 1, 10 ml per pig. All three PEDV prototype isolates tested in this study, regardless of their phylogenetic clades, had similar pathogenicity and caused severe enteric disease in 5-day-old pigs as evidenced by clinical signs, faecal virus shedding, and gross and histopathological lesions. Compared with pigs inoculated with the three US PEDV prototype isolates, pigs inoculated with the S-INDEL-variant isolate had significantly diminished clinical signs, virus shedding in faeces, gross lesions in small intestines, caeca and colons, histopathological lesions in small intestines, and immunohistochemistry staining in ileum. However, the US PEDV prototype and the S-INDEL-variant strains induced similar viraemia levels in inoculated pigs. Whole genome sequences of the PEDV prototype and S-INDEL-variant strains were determined, but the molecular basis of virulence differences between these PEDV strains remains to be elucidated using a reverse genetics approach.
Evidence of Clonal Dissemination of Multidrug-Resistant Streptococcus pneumoniae in Hong Kong
Ip, Margaret; Lyon, Donald J.; Yung, Raymond W. H.; Chan, Colin; Cheng, Augustine F. B.
1999-01-01
The relationship between the phenotypic and genotypic characteristics of 105 penicillin-intermediate or -resistant Streptococcus pneumoniae isolates saved during 1994 to 1997 at the Prince of Wales Hospital and Pamela Youde Nethersole Eastern Hospital, Hong Kong, was studied. The pbp genes for penicillin-binding proteins 1a, 2b, and 2x for each isolate were amplified by PCR, and the products were digested with restriction enzymes HinfI and AluI. A combination of the pulsed-field gel electrophoresis (PFGE) profiles, pbp fingerprints, and phenotypic characteristics of capsular types and antibiograms enabled these isolates to be divided into four major groups. Seventy-four percent (78 of 105) of the strains, belonging to serotypes 23F, 19F, and 14, showed indistinguishable pbp fingerprint patterns (group A1, 1-1-1, 1-1-1), with PFGE patterns belonging to group A and its subtypes, suggesting that these strains were closely related. Eighty-three percent (65 of 78) of these isolates were also resistant to tetracycline, erythromycin, chloramphenicol, and trimethoprim. The type 23F isolates were indistinguishable from representative strains of the Spanish 23F clone by these molecular methods, indicating that these strains may be variants of the Spanish 23F clone. Serotype 6B accounted for 19% (20 of 105) of the isolates with reduced penicillin susceptibility and was made up of variants belonging to four different pbp fingerprint groups with the PFGE pattern group B, the predominant group being indistinguishable from that of the Spanish 6B clone. Other PFGE and fingerprint groups were mainly obtained from penicillin-susceptible strains of various serotypes. The results suggest that the rapid emergence of drug-resistant S. pneumoniae in Hong Kong has been due to the rapid dissemination of several successful clones. PMID:10449461
Lo, Angela Kwok Fung; Huang, Dolly P; Lo, Kwok Wai; Chui, Yiu Loon; Li, Hoi Ming; Pang, Jesse Chung Sean; Tsao, Sai-Wah
2004-05-10
Epstein-Barr virus (EBV) is closely associated with nasopharyngeal carcinoma (NPC), a common cancer in Hong Kong. The EBV-encoded LMP1 protein is believed to play an important role in cell transformation. We have previously identified a prevalent LMP1 variant (2117-LMP1) that is expressed in 86% of primary NPC in Hong Kong. In this study, the biologic phenotypes induced by 2117-LMP1 were compared with those of the prototypic B95.8-LMP1 in an immortalized nasopharyngeal epithelial cell line, NP69. The 2117-LMP1 could induce cell proliferation and resistance to apoptosis induced by growth factor deprivation. Expression of 2117-LMP1 also suppressed expression of p16, p21 and Bax but induced expression of CDK2 and A20. Compared with B95.8-LMP1, 2117-LMP1 could induce a higher migration ability in NP69 cells but was less efficient in inducing morphologic changes, anchorage-independent growth and cell invasion. Relatively weaker ability of 2117-LMP1 than B95.8-LMP1 in upregulation of vimentin, VEGF and MMP9 as well as in downregulation of E-cadherin was observed. 2117-LMP1 could activate higher level of NF-kappaB activity in HEK 293 cells than B95.8-LMP1. The present study supports a role of 2117-LMP1 in NPC development by enhancing cell proliferation, cell death inhibition and migration in premalignant nasopharyngeal epithelial cells. Furthermore, our study reveals significant functional differences between 2117-LMP1 and the prototypic B95.8-LMP1. Our results provide insights into the pathologic significance of this prevalent LMP1 variant, 2117-LMP1, in the development of NPC in the Hong Kong population. Copyright 2004 Wiley-Liss, Inc.
Social Strain, Self-Control, and Juvenile Gambling Pathology: Evidence From Chinese Adolescents
ERIC Educational Resources Information Center
Cheung, Nicole W. T.
2016-01-01
Despite recent concerns over youthful problem gambling, few gambling studies have looked into Asian adolescent populations. This study of a stratified, random sample of high school students in Hong Kong is designed to estimate the prevalence of gambling pathology among Chinese adolescents and to examine the relationships between social strain,…
Spilling over Strain between Elders and Their Caregivers in Hong Kong
ERIC Educational Resources Information Center
Cheung, Chau-Kiu; Chow, Esther Oi-Wah
2006-01-01
According to the dialectical model, the well-being of the older care recipient, the informal caregiver, and the professional care provider mutually affect each other. Particularly, the caregiver's strain can affect the care recipient's well-being both positively and negatively. Moreover, the task-specific model suggests that as social workers are…
Billam, P; LeRoith, T; Pudupakam, R S; Pierson, F W; Duncan, R B; Meng, X J
2009-11-18
Avian hepatitis E virus (avian HEV) is the primary causative agent of Hepatitis-Splenomegaly (HS) syndrome in chickens. Recently, a genetically unique strain of avian HEV, designated avian HEV-VA, was recovered from healthy chickens in Virginia. The objective of this study was to experimentally compare the pathogenicity of the prototype strain recovered from a chicken with HS syndrome and the avian HEV-VA strain in specific-pathogen-free chickens. An infectious stock of the avian HEV-VA strain was first generated and its infectivity titer determined in chickens. For the comparative pathogenesis study, 54 chickens of 6-week-old were assigned to 3 groups of 18 chickens each. The group 1 chickens were each intravenously inoculated with 5x10(2.5) 50% chicken infectious dose of the prototype strain. The group 2 received the same dose of the avian HEV-VA strain, and the group 3 served as negative controls. Six chickens from each group were necropsied at 2, 3 and 4 weeks post-inoculation (wpi). Most chickens in both inoculated groups seroconverted by 3wpi, and the mean anti-avian HEV antibody titers were higher for the prototype strain group than the avian HEV-VA strain group. There was no significant difference in the patterns of viremia and fecal virus shedding. Blood analyte profiles did not differ between treatment groups except for serum creatine phosphokinase levels which were higher for prototype avian HEV group than avian HEV-VA group. The hepatic lesion score was higher for the prototype strain group than the other two groups. The results indicated that the avian HEV-VA strain is only slightly attenuated compared to the prototype strain, suggesting that the full spectrum of HS syndrome is likely associated with other co-factors.
Purkayastha, Anjan; Su, Jing; McGraw, John; Ditty, Susan E; Hadfield, Ted L; Seto, Jason; Russell, Kevin L; Tibbetts, Clark; Seto, Donald
2005-07-01
Vaccine strains of human adenovirus serotypes 4 and 7 (HAdV-4vac and HAdV-7vac) have been used successfully to prevent adenovirus-related acute respiratory disease outbreaks. The genomes of these two vaccine strains have been sequenced, annotated, and compared with their prototype equivalents with the goals of understanding their genomes for molecular diagnostics applications, vaccine redevelopment, and HAdV pathoepidemiology. These reference genomes are archived in GenBank as HAdV-4vac (35,994 bp; AY594254) and HAdV-7vac (35,240 bp; AY594256). Bioinformatics and comparative whole-genome analyses with their recently reported and archived prototype genomes reveal six mismatches and four insertions-deletions (indels) between the HAdV-4 prototype and vaccine strains, in contrast to the 611 mismatches and 130 indels between the HAdV-7 prototype and vaccine strains. Annotation reveals that the HAdV-4vac and HAdV-7vac genomes contain 51 and 50 coding units, respectively. Neither vaccine strain appears to be attenuated for virulence based on bioinformatics analyses. There is evidence of genome recombination, as the inverted terminal repeat of HAdV-4vac is initially identical to that of species C whereas the prototype is identical to species B1. These vaccine reference sequences yield unique genome signatures for molecular diagnostics. As a molecular forensics application, these references identify the circulating and problematic 1950s era field strains as the original HAdV-4 prototype and the Greider prototype, from which the vaccines are derived. Thus, they are useful for genomic comparisons to current epidemic and reemerging field strains, as well as leading to an understanding of pathoepidemiology among the human adenoviruses.
Purkayastha, Anjan; Su, Jing; McGraw, John; Ditty, Susan E.; Hadfield, Ted L.; Seto, Jason; Russell, Kevin L.; Tibbetts, Clark; Seto, Donald
2005-01-01
Vaccine strains of human adenovirus serotypes 4 and 7 (HAdV-4vac and HAdV-7vac) have been used successfully to prevent adenovirus-related acute respiratory disease outbreaks. The genomes of these two vaccine strains have been sequenced, annotated, and compared with their prototype equivalents with the goals of understanding their genomes for molecular diagnostics applications, vaccine redevelopment, and HAdV pathoepidemiology. These reference genomes are archived in GenBank as HAdV-4vac (35,994 bp; AY594254) and HAdV-7vac (35,240 bp; AY594256). Bioinformatics and comparative whole-genome analyses with their recently reported and archived prototype genomes reveal six mismatches and four insertions-deletions (indels) between the HAdV-4 prototype and vaccine strains, in contrast to the 611 mismatches and 130 indels between the HAdV-7 prototype and vaccine strains. Annotation reveals that the HAdV-4vac and HAdV-7vac genomes contain 51 and 50 coding units, respectively. Neither vaccine strain appears to be attenuated for virulence based on bioinformatics analyses. There is evidence of genome recombination, as the inverted terminal repeat of HAdV-4vac is initially identical to that of species C whereas the prototype is identical to species B1. These vaccine reference sequences yield unique genome signatures for molecular diagnostics. As a molecular forensics application, these references identify the circulating and problematic 1950s era field strains as the original HAdV-4 prototype and the Greider prototype, from which the vaccines are derived. Thus, they are useful for genomic comparisons to current epidemic and reemerging field strains, as well as leading to an understanding of pathoepidemiology among the human adenoviruses. PMID:16000418
Chan, Martin C W; Kwok, Kirsty; Hung, Tin-Nok; Chan, Paul K S
2017-05-01
Hepatitis E virus (HEV) causes substantial morbidity and mortality in developing countries and is considered an emerging foodborne pathogen in developed countries in which it was previously not endemic. To investigate genetic association between human HEV infection and HEV-contaminated high-risk food in Hong Kong, we compared local virus strains obtained from hepatitis E patient sera with those surveyed from high-risk food items during 2014 to 2016. Twenty-four cases of laboratory-confirmed human HEV infections were identified from January 2014 to March 2016 in our hospitals. Five types of food items at risk of HEV contamination were purchased on a biweekly basis from April 2014 to March 2016 in two local market settings: supermarkets (lamb, oyster, and pig liver) and wet markets (oyster, pig blood curd, pig large intestine, and pig liver). HEV RNA detection was performed by a real-time reverse transcription-PCR assay. HEV RNA was detected in pig liver, pig intestine, and oyster samples with prevalences of 1.5%, 0.4%, and 0.2%, respectively. Neighbor-joining phylogenetic inference showed that all human and swine HEV strains belonged to genotype 4. HEV subtype distributions in humans and swine were highly comparable: subtype 4b predominated, while subtype 4d was the minority. Local human and swine HEV genotype 4 strains shared over 95% nucleotide identity and were genetically very similar, implicating swine as an important foodborne source of autochthonous human HEV infections in Hong Kong. Action should be taken to raise the awareness among public and health care professionals of hepatitis E as an emerging foodborne disease. Copyright © 2017 American Society for Microbiology.
A novel strain of porcine deltacoronavirus in Vietnam.
Le, Van Phan; Song, Sok; An, Byung-Hyun; Park, Gyu-Nam; Pham, Ngoc Thach; Le, Dinh Quyen; Nguyen, Van Tam; Vu, Thi Thu Hang; Kim, Ki-Sun; Choe, SeEun; An, Dong-Jun
2018-01-01
Two porcine deltacoronavirus (PDCoV) strains (Binh21 and HaNoi6) were isolated from two pig farms in North Vietnam. Phylogenetic analysis of the complete genomes and the Spike and Membrane genes revealed that the two Vietnam PDCoVs belong to the same lineage as PDCoVs from Thailand and Laos; however, the N genes belonged to the same lineage as PDCoVs from the USA, Korea, China, and Hong Kong. The recombination detection program subsequently identified the major parent (S5011 strain) and minor parent (HKU15-44 strain) of the two Vietnam PDCoV strains (p < 0.01).
Analysis of airborne particulate matter (PM2.5) over Hong Kong using remote sensing and GIS.
Shi, Wenzhong; Wong, Man Sing; Wang, Jingzhi; Zhao, Yuanling
2012-01-01
Airborne fine particulates (PM(2.5); particulate matter with diameter less than 2.5 μm) are receiving increasing attention for their potential toxicities and roles in visibility and health. In this study, we interpreted the behavior of PM(2.5) and its correlation with meteorological parameters in Hong Kong, during 2007-2008. Significant diurnal variations of PM(2.5) concentrations were observed and showed a distinctive bimodal pattern with two marked peaks during the morning and evening rush hour times, due to dense traffic. The study observed higher PM(2.5) concentrations in winter when the northerly and northeasterly winds bring pollutants from the Chinese mainland, whereas southerly monsoon winds from the sea bring fresh air to the city in summer. In addition, higher concentrations of PM(2.5) were observed in rush hours on weekdays compared to weekends, suggesting the influence of anthropogenic activities on fine particulate levels, e.g., traffic-related local PM(2.5) emissions. To understand the spatial pattern of PM(2.5) concentrations in the context of the built-up environment of Hong Kong, we utilized MODerate Resolution Imaging Spectroradiometer (MODIS) Aerosol Optical Thickness (AOT) 500 m data and visibility data to derive aerosol extinction profile, then converted to aerosol and PM(2.5) vertical profiles. A Geographic Information Systems (GIS) prototype was developed to integrate atmospheric PM(2.5) vertical profiles with 3D GIS data. An example of the query function in GIS prototype is given. The resulting 3D database of PM(2.5) concentrations provides crucial information to air quality regulators and decision makers to comply with air quality standards and in devising control strategies.
Analysis of Airborne Particulate Matter (PM2.5) over Hong Kong Using Remote Sensing and GIS
Shi, Wenzhong; Wong, Man Sing; Wang, Jingzhi; Zhao, Yuanling
2012-01-01
Airborne fine particulates (PM2.5; particulate matter with diameter less than 2.5 μm) are receiving increasing attention for their potential toxicities and roles in visibility and health. In this study, we interpreted the behavior of PM2.5 and its correlation with meteorological parameters in Hong Kong, during 2007–2008. Significant diurnal variations of PM2.5 concentrations were observed and showed a distinctive bimodal pattern with two marked peaks during the morning and evening rush hour times, due to dense traffic. The study observed higher PM2.5 concentrations in winter when the northerly and northeasterly winds bring pollutants from the Chinese mainland, whereas southerly monsoon winds from the sea bring fresh air to the city in summer. In addition, higher concentrations of PM2.5 were observed in rush hours on weekdays compared to weekends, suggesting the influence of anthropogenic activities on fine particulate levels, e.g., traffic-related local PM2.5 emissions. To understand the spatial pattern of PM2.5 concentrations in the context of the built-up environment of Hong Kong, we utilized MODerate Resolution Imaging Spectroradiometer (MODIS) Aerosol Optical Thickness (AOT) 500 m data and visibility data to derive aerosol extinction profile, then converted to aerosol and PM2.5 vertical profiles. A Geographic Information Systems (GIS) prototype was developed to integrate atmospheric PM2.5 vertical profiles with 3D GIS data. An example of the query function in GIS prototype is given. The resulting 3D database of PM2.5 concentrations provides crucial information to air quality regulators and decision makers to comply with air quality standards and in devising control strategies. PMID:22969323
Novel Human Adenovirus Causing Nosocomial Epidemic Keratoconjunctivitis▿
Ishiko, Hiroaki; Shimada, Yasushi; Konno, Tsunetada; Hayashi, Akio; Ohguchi, Takeshi; Tagawa, Yoshitsugu; Aoki, Koki; Ohno, Shigeaki; Yamazaki, Shudo
2008-01-01
In 2000, we encountered cases of nosocomial infections with epidemic keratoconjunctivitis (EKC) at a university hospital in Kobe, in the western part of Japan. Two human adenovirus (HAdV) strains, Kobe-H and Kobe-S, were isolated from patients with nosocomial EKC infection. They were untypeable by existing neutralizing antisera; however, the isolate was neutralized with homologous antisera. We then encountered several cases of EKC due to nosocomial infections in eye clinics in different parts of Japan. A total of 80 HAdVs were isolated from patients with EKC at eight different hospitals. The partial hexon gene sequences of the isolates were determined and compared to those of the prototype strains of 51 serotypes. All isolates had identical partial hexon nucleotide sequences. Phylogenetic analysis classified these isolates into species of HAdV-D. The isolates showed 93.9 to 96.7% nucleotide identity with HAdV-D prototype strains, while all 32 HAdV-D prototype strains ranged from 93.2 to 99.2% identity. The sequences of the loop 2 and fiber knob regions from the representative strain, Kobe-H, were dissimilar in all prototype strains of 51 serotypes. We believe that this virus is a novel serotype of HAdV that causes EKC. PMID:18385435
Ching, C K; Leung, K P; Yung, R W; Lam, S K; Wong, B C; Lai, K C; Lai, C L
1996-05-01
A study was conducted to evaluate the prevalence of metronidazole resistant Helicobacter pylori strains among the Chinese in Hong Kong. The efficacy of the triple therapy that contains metronidazole as one of the anti-microbial agents in eradication of the metronidazole susceptible and the metronidazole resistant strains was also assessed. Culture for H pylori was attempted from antral biopsy specimens of 70 peptic ulcer and 51 control subjects. Successfully cultured H pylori strains were tested for metronidazole susceptibility. Twenty six peptic ulcer disease subjects who had received a course of triple therapy were also reassessed four to six weeks later for successful eradication of H pylori infection. H pylori was successfully cultured from antral biopsy specimens in 69 of 80 (86%) of the infected subjects. The overall metronidazole resistance rate was 53.5% (37 of 69). There was a significantly higher metronidazole resistance rate among H pylori isolates from the asymptomatic controls (20 of 25) than the peptic ulcer disease subjects (17 of 44) (p = 0.0007). Twenty three of 32 (73%) women and 14 of 37 (38%) men harboured the metronidazole resistant strains. There was no sex or age difference as far as the prevalence of metronidazole resistant strains were concerned within each study group. Pre-treatment metronidazole susceptible H pylori were significantly more likely to respond to the triple therapy used than those with the metronidazole resistant ones (14 of 15 v five of 10) (p = 0.021).
Molecular Insights Into the Evolutionary Pathway of Vibrio cholerae O1 Atypical El Tor Variants
Kim, Eun Jin; Lee, Dokyung; Moon, Se Hoon; Lee, Chan Hee; Kim, Sang Jun; Lee, Jae Hyun; Kim, Jae Ouk; Song, Manki; Das, Bhabatosh; Clemens, John D.; Pape, Jean William; Nair, G. Balakrish; Kim, Dong Wook
2014-01-01
Pandemic V. cholerae strains in the O1 serogroup have 2 biotypes: classical and El Tor. The classical biotype strains of the sixth pandemic, which encode the classical type cholera toxin (CT), have been replaced by El Tor biotype strains of the seventh pandemic. The prototype El Tor strains that produce biotype-specific cholera toxin are being replaced by atypical El Tor variants that harbor classical cholera toxin. Atypical El Tor strains are categorized into 2 groups, Wave 2 and Wave 3 strains, based on genomic variations and the CTX phage that they harbor. Whole-genome analysis of V. cholerae strains in the seventh cholera pandemic has demonstrated gradual changes in the genome of prototype and atypical El Tor strains, indicating that atypical strains arose from the prototype strains by replacing the CTX phages. We examined the molecular mechanisms that effected the emergence of El Tor strains with classical cholera toxin-carrying phage. We isolated an intermediary V. cholerae strain that carried two different CTX phages that encode El Tor and classical cholera toxin, respectively. We show here that the intermediary strain can be converted into various Wave 2 strains and can act as the source of the novel mosaic CTX phages. These results imply that the Wave 2 and Wave 3 strains may have been generated from such intermediary strains in nature. Prototype El Tor strains can become Wave 3 strains by excision of CTX-1 and re-equipping with the new CTX phages. Our data suggest that inter-chromosomal recombination between 2 types of CTX phages is possible when a host bacterial cell is infected by multiple CTX phages. Our study also provides molecular insights into population changes in V. cholerae in the absence of significant changes to the genome but by replacement of the CTX prophage that they harbor. PMID:25233006
Davies, Mark R; Holden, Matthew T; Coupland, Paul; Chen, Jonathan H K; Venturini, Carola; Barnett, Timothy C; Zakour, Nouri L Ben; Tse, Herman; Dougan, Gordon; Yuen, Kwok-Yung; Walker, Mark J
2015-01-01
A scarlet fever outbreak began in mainland China and Hong Kong in 2011 (refs. 1-6). Macrolide- and tetracycline-resistant Streptococcus pyogenes emm12 isolates represent the majority of clinical cases. Recently, we identified two mobile genetic elements that were closely associated with emm12 outbreak isolates: the integrative and conjugative element ICE-emm12, encoding genes for tetracycline and macrolide resistance, and prophage ΦHKU.vir, encoding the superantigens SSA and SpeC, as well as the DNase Spd1 (ref. 4). Here we sequenced the genomes of 141 emm12 isolates, including 132 isolated in Hong Kong between 2005 and 2011. We found that the introduction of several ICE-emm12 variants, ΦHKU.vir and a new prophage, ΦHKU.ssa, occurred in three distinct emm12 lineages late in the twentieth century. Acquisition of ssa and transposable elements encoding multidrug resistance genes triggered the expansion of scarlet fever-associated emm12 lineages in Hong Kong. The occurrence of multidrug-resistant ssa-harboring scarlet fever strains should prompt heightened surveillance within China and abroad for the dissemination of these mobile genetic elements.
Molecular epidemiological study of HIV-1 CRF01_AE transmission in Hong Kong.
Chen, J H K; Wong, K H; Li, P; Chan, K C; Lee, M P; Lam, H Y; Cheng, V C C; Yuen, K Y; Yam, W C
2009-08-15
The objective of this study was to investigate the transmission history of the HIV-1 CRF01_AE epidemics in Hong Kong between 1994 and 2007. A total of 465 HIV-1 CRF01_AE pol sequences were derived from an in-house or a commercial HIV-1 genotyping system. Phylogenies of CRF01_AE sequences were analyzed by the Bayesian coalescent method. CRF01_AE patient population included 363 males (78.1%) and 102 females (21.9%), whereas 65% (314 of 465) were local Chinese. Major transmission routes were heterosexual contact (63%), followed by intravenous drug use (IDU) (19%) and men having sex with men (MSM) (17%). From phylogenetic analysis, local CRF01_AE strains were from multiple origins with 3 separate transmission clusters identified. Cluster 1 consisted mainly of Chinese male IDUs and heterosexuals. Clusters 2 and 3 included mainly local Chinese MSM and non-Chinese Asian IDUs, respectively. Chinese reference isolates available from China (Fujian, Guangxi, or Liaoning) were clonally related to our transmission clusters, demonstrating the epidemiological linkage of CRF01_AE infections between Hong Kong and China. The 3 individual local transmission clusters were estimated to have initiated since late 1980s and late 1990s, causing subsequent epidemics in the early 2000s. This is the first comprehensive molecular epidemiological study of HIV-1 CRF01_AE in Hong Kong. It revealed that MSM contact is becoming a major route of local CRF01_AE transmission in Hong Kong. Epidemiological linkage of CRF01_AE between Hong Kong and China observed in this study indicates the importance of regular molecular epidemiological surveillance for the HIV-1 epidemic in our region.
Influenza at Christ's Hospital: March, 1974.
Hoskins, T W; Davies, J R; Smith, A J; Allchin, A; Miller, C L; Pollock, T M
1976-01-17
Boys in a boarding-school given inactivated influenza-A or influenza-B vaccine have been observed during a simultaneous outbreak of influenza due to A/Port Chalmers, B/Hong Kong, and B/Intermediate strains. Influenza-B vaccine conferred substantial protection, the attack-rates in boys given B vaccine being 24% compared with 45% in a control group. A/Hong Kong vaccine, by preventing infection during the previous influenza A/England outbreak, left the boys vulnerable to influenza A/Port Chalmers. Influenza-A haemagglutination-inhibiting (H.I.) antibody acquired by natural infection was associated with more protection than H.I. antibody induced by vaccination. This difference was not seen with influenza-B H.I. antibody.
Characterization of virulent West Nile virus Kunjin strain, Australia, 2011.
Frost, Melinda J; Zhang, Jing; Edmonds, Judith H; Prow, Natalie A; Gu, Xingnian; Davis, Rodney; Hornitzky, Christine; Arzey, Kathleen E; Finlaison, Deborah; Hick, Paul; Read, Andrew; Hobson-Peters, Jody; May, Fiona J; Doggett, Stephen L; Haniotis, John; Russell, Richard C; Hall, Roy A; Khromykh, Alexander A; Kirkland, Peter D
2012-05-01
To determine the cause of an unprecedented outbreak of encephalitis among horses in New South Wales, Australia, in 2011, we performed genomic sequencing of viruses isolated from affected horses and mosquitoes. Results showed that most of the cases were caused by a variant West Nile virus (WNV) strain, WNV(NSW2011), that is most closely related to WNV Kunjin (WNV(KUN)), the indigenous WNV strain in Australia. Studies in mouse models for WNV pathogenesis showed that WNV(NSW2011) is substantially more neuroinvasive than the prototype WNV(KUN) strain. In WNV(NSW2011), this apparent increase in virulence over that of the prototype strain correlated with at least 2 known markers of WNV virulence that are not found in WNV(KUN). Additional studies are needed to determine the relationship of the WNV(NSW2011) strain to currently and previously circulating WNV(KUN) strains and to confirm the cause of the increased virulence of this emerging WNV strain.
Chan, Wai-Sing; Au, Chun-Hang; Ho, Dona N; Chan, Tsun-Leung; Ma, Edmond Shiu-Kwan; Tang, Bone Siu-Fai
2018-02-13
Human fecal carriage of Enterobacteriaceae possessing mobilized colistin resistance genes (mcr-1 and mcr-2) remains obscure in Hong Kong. As part of routine surveillance on emerging antibiotic resistance, we conducted a prospective study on this topic in a regional hospital in Hong Kong. From October 31 to November 25, 2016, all fecal specimens submitted for routine analysis were included in this surveillance study. These comprised 672 consecutive routine fecal specimens collected from 616 individuals. Fecal specimens were screened for colistin-resistant Enterobacteriaceae by culture-based method, and the presence of mcr-1 and mcr-2 genes in resistant isolates was identified by polymerase chain reaction and Sanger sequencing. Whole genome sequencing (WGS) of mcr-1-possessing Escherichia coli strains was facilitated using Illumina® MiSeq® followed by sequence analysis with appropriate bioinformatics tools. Fourteen mcr-1-positive E. coli strains were isolated from 14 separate individuals (2.08% of total fecal specimens), with 9 of them being asymptomatic, healthy clients coming for health assessment. No mcr-2-possessing Enterobacteriaceae was identified. Colistin minimum inhibitory concentrations of these mcr-1-positive isolates ranged from 2 to 4 μg/mL. All these isolates were susceptible to carbapenems with 2 being extended spectrum β-lactamase producers. WGS data revealed that these isolates belonged to at least 12 different sequence types (STs) and possessed diversified plasmid replicons, virulence and acquired antibiotic resistance genes. Further study on an E. coli ST201 strain (Pasteur scheme) revealed coexistence of 47,818-bp IncP-1 and 33,309-bp IncX4 types of mcr-1 plasmids, which was a combination of stability and high transmissibility. To the best of our knowledge, this is the first study on human fecal carriage of Enterobacteriaceae possessing mcr-1 and mcr-2 genes in Hong Kong. Our data further revealed asymptomatic carriage of mcr-1-possessing Enterobacteriaceae by both patients and healthy individuals. This is alarming considering wide diversity and high transmissibility of mcr-1 plasmids, which potentially facilitate emergence of pan-drug-resistant bacteria in future infection. This also highlights the importance of surveillance on emerging antibiotic resistance, especially for patients under intensive care.
Sobolev, Ivan A; Sharshov, Kirill; Yurchenko, Kseniya; Korneev, Denis; Glushchenko, Alexandra; Alikina, Tatyana; Kabilov, Marsel; Bi, Yuhai; Liu, Wenjun; Gubanova, Natalia; Shestopalov, Alexander
2016-11-01
The complete genome sequence was determined for avian paramyxovirus (APMV-6) serotype 6 strain teal/Chany/455/2009, isolated from a teal (Anas crecca) in Siberia. Siberia is crossed by four major migration flyways and represents the major breeding area for many wild bird species in the Palearctic. Strain teal/Chany/455/2009 is genetically closely related to Kazakh and Chinese strains and belongs to the genetic group of duck/Hong Kong/18/199/77-like APMV-6 viruses. We show that the virus has low pathogenic potential according to genetic markers and animal model experiments.
Greek Goat Encephalitis Virus Strain Isolated from Ixodes ricinus, Greece
Pavlidou, Vasiliki; Antoniadis, Antonis
2008-01-01
A strain of Greek goat encephaltitis virus was isolated from engorged Ixodes ricinus ticks that had fed on goats in northern Greece. The strain was almost identical to the prototype strain isolated 35 years ago. PMID:18258134
Complete Genome Sequence of Biofilm-Forming Strain Staphylococcus haemolyticus S167.
Hong, Jisoo; Kim, Jonguk; Kim, Byung-Yong; Park, Jin-Woo; Ryu, Jae-Gee; Roh, Eunjung
2016-06-16
Staphylococcus haemolyticus S167 has the ability to produce biofilms in large quantities. Genomic analyses revealed information on the biofilm-related genes of S. haemolyticus S167. Detailed studies of biofilm formation at the molecular level could provide a foundation for biofilm control research. Copyright © 2016 Hong et al.
Kwon, Hyuk Moo; LeRoith, Tanya; Pudupakam, R S; Pierson, F William; Huang, Yao-Wei; Dryman, Barbara A; Meng, Xiang-Jin
2011-01-27
A genetically distinct strain of avian hepatitis E virus (avian HEV-VA strain) was isolated from a healthy chicken in Virginia, and thus it is important to characterize and compare its pathogenicity with the prototype strain (avian HEV-prototype) isolated from a diseased chicken. Here we first constructed an infectious clone of the avian HEV-VA strain. Capped RNA transcripts from the avian HEV-VA clone were replication-competent after transfection of LMH chicken liver cells. Chickens inoculated intrahepatically with RNA transcripts of avian HEV-VA clone developed active infection as evidenced by fecal virus shedding, viremia, and seroconversion. To characterize the pathogenicity, RNA transcripts of both avian HEV-VA and avian HEV-prototype clones were intrahepatically inoculated into the livers of chickens. Avian HEV RNA was detected in feces, serum and bile samples from 10/10 avian HEV-VA-inoculated and 9/9 avian HEV-prototype-inoculated chickens although seroconversion occurred only in some chickens during the experimental period. The histopathological lesion scores were lower for avian HEV-VA group than avian HEV-prototype group in the liver at 3 and 5 weeks post-inoculation (wpi) and in the spleen at 3 wpi, although the differences were not statistically significant. The liver/body weight ratio, indicative of liver enlargement, of both avian HEV-VA and avian HEV-prototype groups were significantly higher than that of the control group at 5 wpi. Overall, the avian HEV-VA strain still induces histological liver lesions even though it was isolated from a healthy chicken. The results also showed that intrahepatic inoculation of chickens with RNA transcripts of avian HEV infectious clone may serve as an alternative for live virus in animal pathogenicity studies. Copyright © 2010 Elsevier B.V. All rights reserved.
1998-11-01
a BSc in Physiology (1988), BPhEd in Kinesiology (1989) and MPhEd (1992) in physiological and epidemiological aspects of hypothermia. He moved to...Hong Kong in 1979 in Biology and Biochemistry and obtained his M. Phil in environmental biology in 1981. Supported by a Croucher Foundation
Pandemic Threat Posed by Avian Influenza A Viruses
Horimoto, Taisuke; Kawaoka, Yoshihiro
2001-01-01
Influenza pandemics, defined as global outbreaks of the disease due to viruses with new antigenic subtypes, have exacted high death tolls from human populations. The last two pandemics were caused by hybrid viruses, or reassortants, that harbored a combination of avian and human viral genes. Avian influenza viruses are therefore key contributors to the emergence of human influenza pandemics. In 1997, an H5N1 influenza virus was directly transmitted from birds in live poultry markets in Hong Kong to humans. Eighteen people were infected in this outbreak, six of whom died. This avian virus exhibited high virulence in both avian and mammalian species, causing systemic infection in both chickens and mice. Subsequently, another avian virus with the H9N2 subtype was directly transmitted from birds to humans in Hong Kong. Interestingly, the genes encoding the internal proteins of the H9N2 virus are genetically highly related to those of the H5N1 virus, suggesting a unique property of these gene products. The identification of avian viruses in humans underscores the potential of these and similar strains to produce devastating influenza outbreaks in major population centers. Although highly pathogenic avian influenza viruses had been identified before the 1997 outbreak in Hong Kong, their devastating effects had been confined to poultry. With the Hong Kong outbreak, it became clear that the virulence potential of these viruses extended to humans. PMID:11148006
Maguari Virus Associated with Human Disease
Groseth, Allison; Vine, Veronica; Weisend, Carla; Guevara, Carolina; Watts, Douglas; Russell, Brandy; Tesh, Robert B.
2017-01-01
Despite the lack of evidence for symptomatic human infection with Maguari virus (MAGV), its close relation to Cache Valley virus (CVV), which does infect humans, remains a concern. We sequenced the complete genome of a MAGV-like isolate (OBS6657) obtained from a febrile patient in Pucallpa, Ucayali, Peru, in 1998. To facilitate its classification, we generated additional full-length sequences for the MAGV prototype strain, 3 additional MAGV-like isolates, and the closely related CVV (7 strains), Tlacotalpan (1 strain), Playas (3 strains), and Fort Sherman (1 strain) viruses. The OBS6657 isolate is similar to the MAGV prototype, whereas 2 of the other MAGV-like isolates are located on a distinct branch and most likely warrant classification as a separate virus species and 1 is, in fact, a misclassified CVV strain. Our findings provide clear evidence that MAGV can cause human disease. PMID:28726602
Definition of human rotavirus serotypes by plaque reduction assay.
Wyatt, R G; Greenberg, H B; James, W D; Pittman, A L; Kalica, A R; Flores, J; Chanock, R M; Kapikian, A Z
1982-01-01
Twenty different human rotavirus reassortants were characterized serologically by a plaque reduction assay as belonging to one of three distinct serotypes. Fourteen were similar if not identical to our prototype Wa strain; two were like the prototype DS-1 strain, and four belonged to a third serotype for which a prototype has not yet been selected. Hyperimmune sera raised against the three serotypes were required to distinguish among them, since postinfection sera had lower titers and were more cross-reactive than hyperimmune sera. These results confirmed the ability of a qualitative cytopathic neutralization test to predict correctly the Wa or DS-1 serotype. A strain of rhesus rotavirus (MMU 18006) was identified as belonging to the newly defined third serotype. Finally, an attempt was made to correlate previously published serotype analysis by neutralization of fluorescent cell-forming units with the results determined by the plaque reduction neutralization assay. PMID:6286487
Leung, Kathy; Lipsitch, Marc; Yuen, Kwok Yung; Wu, Joseph T
2017-01-01
Summary Background Antivirals (e.g. oseltamivir) are important for mitigating influenza epidemics. In 2007, an oseltamivir-resistant seasonal A(H1N1) strain emerged and spread to global fixation within one year. This showed that antiviral-resistant (AVR) strains can be intrinsically more transmissible than their contemporaneous antiviral-sensitive (AVS) counterpart. Surveillance of AVR fitness is therefore essential. Methods We define the fitness of AVR strains as their reproductive number relative to their co-circulating AVS counterparts. We develop a simple method for real-time estimation of AVR fitness from surveillance data. This method requires only information on generation time without other specific details regarding transmission dynamics. We first use simulations to validate this method by showing that it yields unbiased and robust fitness estimates in most epidemic scenarios. We then apply this method to two retrospective case studies and one hypothetical case study. Findings We estimate that (i) the oseltamivir-resistant A(H1N1) strain that emerged in 2007 was 4% (3–5%) more transmissible than its oseltamivir-sensitive predecessor and (ii) the oseltamivir-resistant pandemic A(H1N1) strain that emerged and circulated in Japan during 2013–2014 was 24% (17–30%) less transmissible than its oseltamivir-sensitive counterpart. We show that in the event of large-scale antiviral interventions during a pandemic with co-circulation of AVS and AVR strains, our method can be used to inform optimal use of antivirals by monitoring intrinsic AVR fitness and drug pressure on the AVS strain. Conclusions We have developed a simple method that can be easily integrated into contemporary influenza surveillance systems to provide reliable estimates of AVR fitness in real time. Funding Research Fund for the Control of Infectious Disease (09080792) and a commissioned grant from the Health and Medical Research Fund from the Government of the Hong Kong Special Administrative Region, Harvard Center for Communicable Disease Dynamics from the National Institute of General Medical Sciences (grant no. U54 GM088558), Area of Excellence Scheme of the Hong Kong University Grants Committee (grant no. AoE/M-12/06). PMID:27914853
Lee, Martha; Brauer, Michael; Wong, Paulina; Tang, Robert; Tsui, Tsz Him; Choi, Crystal; Cheng, Wei; Lai, Poh-Chin; Tian, Linwei; Thach, Thuan-Quoc; Allen, Ryan; Barratt, Benjamin
2017-08-15
Land use regression (LUR) is a common method of predicting spatial variability of air pollution to estimate exposure. Nitrogen dioxide (NO 2 ), nitric oxide (NO), fine particulate matter (PM 2.5 ), and black carbon (BC) concentrations were measured during two sampling campaigns (April-May and November-January) in Hong Kong (a prototypical high-density high-rise city). Along with 365 potential geospatial predictor variables, these concentrations were used to build two-dimensional land use regression (LUR) models for the territory. Summary statistics for combined measurements over both campaigns were: a) NO 2 (Mean=106μg/m 3 , SD=38.5, N=95), b) NO (M=147μg/m 3 , SD=88.9, N=40), c) PM 2.5 (M=35μg/m 3 , SD=6.3, N=64), and BC (M=10.6μg/m 3 , SD=5.3, N=76). Final LUR models had the following statistics: a) NO 2 (R 2 =0.46, RMSE=28μg/m 3 ) b) NO (R 2 =0.50, RMSE=62μg/m 3 ), c) PM 2.5 (R 2 =0.59; RMSE=4μg/m 3 ), and d) BC (R 2 =0.50, RMSE=4μg/m 3 ). Traditional LUR predictors such as road length, car park density, and land use types were included in most models. The NO 2 prediction surface values were highest in Kowloon and the northern region of Hong Kong Island (downtown Hong Kong). NO showed a similar pattern in the built-up region. Both PM 2.5 and BC predictions exhibited a northwest-southeast gradient, with higher concentrations in the north (close to mainland China). For BC, the port was also an area of elevated predicted concentrations. The results matched with existing literature on spatial variation in concentrations of air pollutants and in relation to important emission sources in Hong Kong. The success of these models suggests LUR is appropriate in high-density, high-rise cities. Copyright © 2017 Elsevier B.V. All rights reserved.
ERIC Educational Resources Information Center
Shiu, Ann Tak-Ying
1999-01-01
Nine public-health nurses studying part time and 11 other nurses sampled their mood states randomly over seven days. The part-time student role created additional strain for nurses with children. The stress of managing multiple roles was greatest when both work and nonwork role responsibilities were heavy. (SK)
Complete Genome Analysis of an Enterovirus EV-B83 Isolated in China.
Tang, Jingjing; Li, Qiongfen; Tian, Bingjun; Zhang, Jie; Li, Kai; Ding, Zhengrong; Lu, Lin
2016-07-12
Enterovirus B83 (EV-B83) is a recently identified member of enterovirus species B. It is a rarely reported serotype and up to date, only the complete genome sequence of the prototype strain from the United States is available. In this study, we describe the complete genomic characterization of an EV-B83 strain 246/YN/CHN/08HC isolated from a healthy child living in border region of Yunnan Province, China in 2008. Compared with the prototype strain, it had 79.6% similarity in the complete genome and 78.9% similarity in the VP1 coding region, reflecting the great genetic divergence among them. VP1-coding region alignment revealed it had 77.2-91.3% with other EV-B83 sequences available in GenBank. Similarity plot analysis revealed it had higher identity with several other EV-B serotypes than the EV-B83 prototype strain in the P2 and P3 coding region, suggesting multiple recombination events might have occurred. The great genetic divergence with previously isolated strains and the extremely rare isolation suggest this serotype has circulated at a low epidemic strength for many years. This is the first report of complete genome of EV-B83 in China.
Côrtes, Marina Farrel; Costa, Maiana OC; Lima, Nicholas CB; Souza, Rangel C; Almeida, Luiz GP; Guedes, Luciane Prioli Ciapina; Vasconcelos, Ana TR; Nicolás, Marisa F; Figueiredo, Agnes MS
2017-01-01
Staphylococcus aureus subsp. aureus, commonly referred as S. aureus, is an important bacterial pathogen frequently involved in hospital- and community-acquired infections in humans, ranging from skin infections to more severe diseases such as pneumonia, bacteraemia, endocarditis, osteomyelitis, and disseminated infections. Here, we report the complete closed genome sequence of a community-acquired methicillin-resistant S. aureus strain, USA400-0051, which is a prototype of the USA400 clone. PMID:29091141
Gomersall, Charles D; Tai, Dessmon Y H; Loo, Shi; Derrick, James L; Goh, Mia Siang; Buckley, Thomas A; Chua, Catherine; Ho, Ka Man; Raghavan, Geeta P; Ho, Oi Man; Lee, Lay Beng; Joynt, Gavin M
2006-07-01
Epidemics have the potential to severely strain intensive care resources and may require an increase in intensive care capability. Few intensivists have direct experience of rapidly expanding intensive care services in response to an epidemic. This contribution presents the recommendations of an expert group from Hong Kong and Singapore who had direct experience of expanding intensive care services in response to the epidemic of severe acute respiratory syndrome. These recommendations cover training, infection control, staffing, communication and ethical issues. The issue of what equipment to purchase is not addressed. Early preparations should include fit testing of negative pressure respirators, training of reserve staff, sourcing of material for physical modifications to the ICU, development of infection control policies and training programmes, and discussion of triage and quarantine issues.
ERIC Educational Resources Information Center
Cheung, Nicole W. T.; Cheung, Yuet W.
2008-01-01
The objectives of this study were to test the predictive power of self-control theory for delinquency in a Chinese context, and to explore if social factors as predicted in social bonding theory, differential association theory, general strain theory, and labeling theory have effects on delinquency in the presence of self-control. Self-report data…
Chan, Albert P C; Zhang, Ying; Wang, Faming; Wong, Francis F K; Chan, Daniel W M
2017-12-01
A novel hybrid cooling vest (HCV) incorporated with phase change materials (PCMs) and ventilation fans has been developed for construction workers in Hong Kong to attenuate heat stress and prevent heat-related illnesses, and its effectiveness and practicality have been validated in this study. A total of 140 wear trials involving of 140 workers were conducted in Hong Kong construction sites during the summer time. Each wear trial involves a two-day wear test, of which one day workers wore the HCV (denoted as VEST) during resting, and another day they wore traditional workwear (denoted as CON). Subjects were asked to rate their perceived exertion (RPE), thermal sensations (TS) and 7 other subjective attributes. There were significant differences in the effectiveness on reducing workers' heat strain between VEST and CON in terms of alleviations of heart rate (ΔHR), ΔTS, ΔRPE as well as ΔPeSI (p < 0.001). The practicality of HCV is evidenced by a significant improvement by 0.93-1.34 on the rating scores of perceived cooling effect, sensations of comfort and skin dryness during rest and fatigue recovery in VEST at the level of 0.05, and high ratings of 4.85-5 (rating scale from 1 to 7, and the higher the better) by subjects on the preference, fitness as well as effectiveness to combat heat stress. In addition, a remarkable proportion of 91 per cent of subjects prefer to use this newly designed HCV as a cooling measure during rest. The power to alleviate perceptual heat stain (PeSA) in VEST is about twice of that by rest, which means HCV can notably improve the workers' perceptual heat strain in a limited resting duration. However, the strain alleviation power of HCV nearly remains unchanged with the prolonged rest duration. Thus, the optimal work-rest schedule needs to be investigated in a further study. Copyright © 2017 Elsevier Ltd. All rights reserved.
Smart Textiles for Strengthening of Structures
NASA Astrophysics Data System (ADS)
Górski, Marcin; Krzywoń, Rafał; Dawczyński, Szymon; Szojda, Leszek; Salvado, Rita; Lopes, Catarina; Araujo, Pedro; Velez, Fernando Jose; Castro-Gomes, Joao
2016-11-01
This paper presents results of mechanical tests on a prototype of an innovative structural strengthening in form of self-monitoring fabric. Smart textile employs carbon fibers conductivity for measuring strains while monitoring changes of electric resistance under increasing load. A general solution was tested in a series of calibrating tests on strengthening of small size concrete slabs. Promising results of simple specimen, has encouraged the research team to perform the next tests using mastered carbon fibre reinforced fabric. Main tests were performed on natural scale RC beam. Smart textile proved its efficiency in both: strengthening and monitoring of strains during load increase. New strengthening proposal was given 10% increase of loading capacity and the readings of strain changes were similar to those obtained in classical methods. In order to calibrate the prototype and to define range limits of solution usability, textile sensor was tested in areas of large deformations (timber beam) and aswell as very small strains (bridge bearing block). In both cases, the prototype demonstrated excellent performance in the range of importance for structural engineering. This paper also presents an example of use of the smart strengthening in situ, in a real life conditions.
Oguntimein, Gbekeloluwa B; Rodriguez, Miguel; Dumitrache, Alexandru; Shollenberger, Todd; Decker, Stephen R; Davison, Brian H; Brown, Steven D
2018-02-01
To develop and prototype a high-throughput microplate assay to assess anaerobic microorganisms and lignocellulosic biomasses in a rapid, cost-effective screen for consolidated bioprocessing potential. Clostridium thermocellum parent Δhpt strain deconstructed Avicel to cellobiose, glucose, and generated lactic acid, formic acid, acetic acid and ethanol as fermentation products in titers and ratios similar to larger scale fermentations confirming the suitability of a plate-based method for C. thermocellum growth studies. C. thermocellum strain LL1210, with gene deletions in the key central metabolic pathways, produced higher ethanol titers in the Consolidated Bioprocessing (CBP) plate assay for both Avicel and switchgrass fermentations when compared to the Δhpt strain. A prototype microplate assay system is developed that will facilitate high-throughput bioprospecting for new lignocellulosic biomass types, genetic variants and new microbial strains for bioethanol production.
A Novel Recombinant Enterovirus Type EV-A89 with Low Epidemic Strength in Xinjiang, China
Fan, Qin; Zhang, Yong; Hu, Lan; Sun, Qiang; Cui, Hui; Yan, Dongmei; Sikandaner, Huerxidan; Tang, Haishu; Wang, Dongyan; Zhu, Zhen; Zhu, Shuangli; Xu, Wenbo
2015-01-01
Enterovirus A89 (EV-A89) is a novel member of the EV-A species. To date, only one full-length genome sequence (the prototype strain) has been published. Here, we report the molecular identification and genomic characterization of a Chinese EV-A89 strain, KSYPH-TRMH22F/XJ/CHN/2011, isolated in 2011 from a contact of an acute flaccid paralysis (AFP) patient during AFP case surveillance in Xinjiang China. This was the first report of EV-A89 in China. The VP1 coding sequence of this strain demonstrated 93.2% nucleotide and 99.3% amino acid identity with the EV-A89 prototype strain. In the P2 and P3 regions, the Chinese EV-A89 strain demonstrated markedly higher identity than the prototype strains of EV-A76, EV-A90, and EV-A91, indicating that one or more recombination events between EV-A89 and these EV-A types might have occurred. Long-term evolution of these EV types originated from the same ancestor provides the spatial and temporal circumstances for recombination to occur. An antibody sero-prevalence survey against EV-A89 in two Xinjiang prefectures demonstrated low positive rates and low titres of EV-A89 neutralization antibody, suggesting limited range of transmission and exposure to the population. This study provides a solid foundation for further studies on the biological and pathogenic properties of EV-A89. PMID:26685900
A Novel Recombinant Enterovirus Type EV-A89 with Low Epidemic Strength in Xinjiang, China.
Fan, Qin; Zhang, Yong; Hu, Lan; Sun, Qiang; Cui, Hui; Yan, Dongmei; Sikandaner, Huerxidan; Tang, Haishu; Wang, Dongyan; Zhu, Zhen; Zhu, Shuangli; Xu, Wenbo
2015-12-21
Enterovirus A89 (EV-A89) is a novel member of the EV-A species. To date, only one full-length genome sequence (the prototype strain) has been published. Here, we report the molecular identification and genomic characterization of a Chinese EV-A89 strain, KSYPH-TRMH22F/XJ/CHN/2011, isolated in 2011 from a contact of an acute flaccid paralysis (AFP) patient during AFP case surveillance in Xinjiang China. This was the first report of EV-A89 in China. The VP1 coding sequence of this strain demonstrated 93.2% nucleotide and 99.3% amino acid identity with the EV-A89 prototype strain. In the P2 and P3 regions, the Chinese EV-A89 strain demonstrated markedly higher identity than the prototype strains of EV-A76, EV-A90, and EV-A91, indicating that one or more recombination events between EV-A89 and these EV-A types might have occurred. Long-term evolution of these EV types originated from the same ancestor provides the spatial and temporal circumstances for recombination to occur. An antibody sero-prevalence survey against EV-A89 in two Xinjiang prefectures demonstrated low positive rates and low titres of EV-A89 neutralization antibody, suggesting limited range of transmission and exposure to the population. This study provides a solid foundation for further studies on the biological and pathogenic properties of EV-A89.
Campbell, Jacquelyn A.; Schelling, Pierre; Wetzel, J. Denise; Johnson, Elizabeth M.; Forrest, J. Craig; Wilson, Greame A. R.; Aurrand-Lions, Michel; Imhof, Beat A.; Stehle, Thilo; Dermody, Terence S.
2005-01-01
Reovirus infections are initiated by the binding of viral attachment protein σ1 to receptors on the surface of host cells. The σ1 protein is an elongated fiber comprised of an N-terminal tail that inserts into the virion and a C-terminal head that extends from the virion surface. The prototype reovirus strains type 1 Lang/53 (T1L/53) and type 3 Dearing/55 (T3D/55) use junctional adhesion molecule A (JAM-A) as a receptor. The C-terminal half of the T3D/55 σ1 protein interacts directly with JAM-A, but the determinants of receptor-binding specificity have not been identified. In this study, we investigated whether JAM-A also mediates the attachment of the prototype reovirus strain type 2 Jones/55 (T2J/55) and a panel of field-isolate strains representing each of the three serotypes. Antibodies specific for JAM-A were capable of inhibiting infections of HeLa cells by T1L/53, T2J/55, and T3D/55, demonstrating that strains of all three serotypes use JAM-A as a receptor. To corroborate these findings, we introduced JAM-A or the structurally related JAM family members JAM-B and JAM-C into Chinese hamster ovary cells, which are poorly permissive for reovirus infection. Both prototype and field-isolate reovirus strains were capable of infecting cells transfected with JAM-A but not those transfected with JAM-B or JAM-C. A sequence analysis of the σ1-encoding S1 gene segment of the strains chosen for study revealed little conservation in the deduced σ1 amino acid sequences among the three serotypes. This contrasts markedly with the observed sequence variability within each serotype, which is confined to a small number of amino acids. Mapping of these residues onto the crystal structure of σ1 identified regions of conservation and variability, suggesting a likely mode of JAM-A binding via a conserved surface at the base of the σ1 head domain. PMID:15956543
Streptococcus suis infection in Hong Kong: an emerging infectious disease?
Ma, E; Chung, P H; So, T; Wong, L; Choi, K M; Cheung, D T; Kam, K M; Chuang, S K; Tsang, T
2008-12-01
We conducted a 31-month retrospective review of all laboratory-confirmed Streptococcus suis infections admitted to public hospitals in Hong Kong. Strain identification, serotyping and antibiotic susceptibility tests were conducted on S. suis isolates. Twenty-one sporadic cases were identified, comprising 18 (86%) males and 3 (14%) females. About half were patients aged 65 years. More cases occurred during summer. Occupational exposure was documented in five (24%) cases. The estimated annual incidence was 0.09/100 000 in the general population and 32/100 000 in people with occupational exposure to pigs and raw pork. The primary clinical manifestations were meningitis (48%), septicaemia (38%) and endocarditis (14%). The case-fatality rate was 5%. All available isolates from 15 patients were serotype 2, sensitive to penicillin, ampicillin, ceftriaxone, but resistant to tetracycline. Injury prevention and proper handling of pigs or raw pork should be advocated to both at-risk occupational groups and the general population.
Oguntimein, Gbekeloluwa B.; Rodriguez, Jr., Miguel; Dumitrache, Alexandru; ...
2017-11-09
Here, to develop and prototype a high-throughput microplate assay to assess anaerobic microorganisms and lignocellulosic biomasses in a rapid, cost-effective screen for consolidated bioprocessing potential. Clostridium thermocellum parent Δ hpt strain deconstructed Avicel to cellobiose, glucose, and generated lactic acid, formic acid, acetic acid and ethanol as fermentation products in titers and ratios similar to larger scale fermentations confirming the suitability of a plate-based method for C. thermocellum growth studies. C. thermocellum strain LL1210, with gene deletions in the key central metabolic pathways, produced higher ethanol titers in the Consolidated Bioprocessing (CBP) plate assay for both Avicel and switchgrass fermentationsmore » when compared to the Δ hpt strain. A prototype microplate assay system is developed that will facilitate high-throughput bioprospecting for new lignocellulosic biomass types, genetic variants and new microbial strains for bioethanol production.« less
DOE Office of Scientific and Technical Information (OSTI.GOV)
Oguntimein, Gbekeloluwa B.; Rodriguez, Jr., Miguel; Dumitrache, Alexandru
Here, to develop and prototype a high-throughput microplate assay to assess anaerobic microorganisms and lignocellulosic biomasses in a rapid, cost-effective screen for consolidated bioprocessing potential. Clostridium thermocellum parent Δ hpt strain deconstructed Avicel to cellobiose, glucose, and generated lactic acid, formic acid, acetic acid and ethanol as fermentation products in titers and ratios similar to larger scale fermentations confirming the suitability of a plate-based method for C. thermocellum growth studies. C. thermocellum strain LL1210, with gene deletions in the key central metabolic pathways, produced higher ethanol titers in the Consolidated Bioprocessing (CBP) plate assay for both Avicel and switchgrass fermentationsmore » when compared to the Δ hpt strain. A prototype microplate assay system is developed that will facilitate high-throughput bioprospecting for new lignocellulosic biomass types, genetic variants and new microbial strains for bioethanol production.« less
Almahmoud, Safieh; Vahdati, Nader; Rostron, Paul
2018-01-01
A monitoring solution was developed for detection of material loss in metals such as carbon steel using the force generated by permanent magnets in addition to the optical strain sensing technology. The working principle of the sensing system is related to the change in thickness of a steel plate, which typically occurs due to corrosion. As thickness decreases, the magnetostatic force between the magnet and the steel structure also decreases. This, in turn, affects the strain measured using the optical fiber. The sensor prototype was designed and built after verifying its sensitivity using a numerical model. The prototype was tested on steel plates of different thicknesses to establish the relationship between the metal thickness and measured strain. The results of experiments and numerical models demonstrate a strong relationship between the metal thickness and the measured strain values. PMID:29518006
You, Joyce H S; Ming, Wai-kit; Chan, Paul K S
2014-11-25
Cost and quality-adjusted life-years (QALYs) gained by quadrivalent influenza vaccine (QIV) versus trivalent influenza vaccine (TIV) in Hong Kong elderly were estimated over 9 seasons. TIV-unmatched influenza B infection rates with QIV versus TIV were estimated by an epidemiology model. Model parameters included percentages of influenza B lineages in circulation, influenza B-associated hospital admission, age-specific population, vaccine coverage and effectiveness. Incremental cost per QALY gained (ICER) by QIV versus TIV were estimated from Hong Kong's societal perspective. Mean reduction in influenza B infection rate was 191.3 (95%CI 45.1-337.5) per 100,000 population aged ≥65 years. Highest cost savings and QALYs gained by QIV occurred in 2007 with high percentage of TIV-unmatched strain (92.9%) for age groups 65-79 years (USD266,473 and 22.8 QALYs) and ≥80 years (USD483,461 and 27.3 QALYs). ICERs of QIV were below willingness-to-pay for age group 65-79 years in 6, 5 and 3 years when QIV cost + USD1 + USD2 and + USD5 more than TIV, respectively. For age group ≥80 years, ICERs of QIV were below willingness-to-pay in 7 and 5 years when QIV cost + USD1 and + USD5, correspondingly. Acceptance of QIV to be cost-effective in Hong Kong elderly was subject to QIV unit cost and percentage of circulating TIV-unmatched influenza B lineages.
Prototype to measure bracket debonding force in vivo.
Tonus, Jéssika Lagni; Manfroi, Fernanda Borguetti; Borges, Gilberto Antonio; Grigolo, Eduardo Correa; Helegda, Sérgio; Spohr, Ana Maria
2017-02-01
Material biodegradation that occurs in the mouth may interfere in the bonding strength between the bracket and the enamel, causing lower bond strength values in vivo, in comparison with in vitro studies. To develop a prototype to measure bracket debonding force in vivo and to evaluate, in vitro, the bond strength obtained with the prototype. A original plier (3M Unitek) was modified by adding one strain gauge directly connected to its claw. An electronic circuit performed the reading of the strain gauge, and the software installed in a computer recorded the values of the bracket debonding force, in kgf. Orthodontic brackets were bonded to the facial surface of 30 bovine incisors with adhesive materials. In Group 1 (n = 15), debonding was carried out with the prototype, while tensile bond strength testing was performed in Group 2 (n = 15). A universal testing machine was used for the second group. The adhesive remnant index (ARI) was recorded. According to Student's t test (α = 0.05), Group 1 (2.96 MPa) and Group 2 (3.08 MPa) were not significantly different. ARI score of 3 was predominant in the two groups. The prototype proved to be reliable for obtaining in vivo bond strength values for orthodontic brackets.
Escherichia coli mastitis strains: In vitro phenotypes and severity of infection in vivo.
Roussel, Perrine; Porcherie, Adeline; Répérant-Ferter, Maryline; Cunha, Patricia; Gitton, Christophe; Rainard, Pascal; Germon, Pierre
2017-01-01
Mastitis remains a major infection of dairy cows and an important issue for dairy farmers and the dairy industry, in particular infections due to Escherichia coli strains. So far, properties specific to E. coli causing mastitis remain ill defined. In an attempt to better understand the properties required for E. coli to trigger mastitis, we used a range of in vitro assays to phenotypically characterize four E. coli strains, including the prototypical E. coli mastitis strain P4, possessing different relative abilities to cause mastitis in a mouse model. Our results indicate that a certain level of serum resistance might be required for colonization of the mammary gland. Resistance to neutrophil killing is also likely to contribute to a slower clearance of bacteria and higher chances to colonize the udder. In addition, we show that the four different strains do induce a pro-inflammatory response by mammary epithelial cells but with different intensities. Interestingly, the prototypical mastitis strain P4 actually induces the less intense response while it is responsible for the most severe infections in vivo. Altogether, our results suggest that different strategies can be used by E. coli strains to colonize the mammary gland and cause mastitis.
Song, Jae-Hoon; Chang, Hyun-Ha; Suh, Ji Yoeun; Ko, Kwan Soo; Jung, Sook-In; Oh, Won Sup; Peck, Kyong Ran; Lee, Nam Yong; Yang, Yonghong; Chongthaleong, Anan; Aswapokee, Nalinee; Chiu, Cheng-Hsun; Lalitha, M K; Perera, Jennifer; Yee, Ti Teow; Kumararasinghe, Gamini; Jamal, Farida; Kamarulazaman, Adeeba; Parasakthi, Navaratnam; Van, Pham Hung; So, Thomas; Ng, Tak Keung
2004-03-01
To characterize mechanisms of macrolide resistance among Streptococcus pneumoniae from 10 Asian countries during 1998-2001. Phenotypic and genotypic characterization of the isolates and their resistance mechanisms. Of 555 isolates studied, 216 (38.9%) were susceptible, 10 (1.8%) were intermediate and 329 (59.3%) were resistant to erythromycin. Vietnam had the highest prevalence of erythromycin resistance (88.3%), followed by Taiwan (87.2%), Korea (85.1%), Hong Kong (76.5%) and China (75.6%). Ribosomal methylation encoded by erm(B) was the most common mechanism of erythromycin resistance in China, Taiwan, Sri Lanka and Korea. In Hong Kong, Singapore, Thailand and Malaysia, efflux encoded by mef(A) was the more common in erythromycin-resistant isolates. In most Asian countries except Hong Kong, Malaysia and Singapore, erm(B) was found in >50% of pneumococcal isolates either alone or in combination with mef(A). The level of erythromycin resistance among pneumococcal isolates in most Asian countries except Thailand and India was very high with MIC(90)s of >128 mg/L. Molecular epidemiological studies suggest the horizontal transfer of the erm(B) gene and clonal dissemination of resistant strains in the Asian region. Data confirm that macrolide resistance in pneumococci is a serious problem in many Asian countries.
Whole-genome sequence of Escherichia coli serotype O157:H7 strain EDL932 (ATCC 43894)
USDA-ARS?s Scientific Manuscript database
Escherichia coli serotype O157:H7 EDL 933 is a ground beef isolate associated with a 1983 hemorrhagic colitis outbreak. Considered the prototype O157:H7 strain, its derived genome sequence is a standard reference strain for comparative genomic studies of Shiga toxin-producing E. coli (STEC). Here we...
Yip, Y
2001-12-01
Low back pain (LBP) remains a common and costly problem among the nursing profession. Several studies have indicated that LBP is attributed to mentally straining or demanding work, fatigue or exhaustion or general work satisfaction. This study aims to measure the magnitude of LBP among Hong Kong nurses and its association with the work-related psychological strain and patients handling activities. RESEARCH METHODS AND MEASURES: A cross-sectional study of Hong Kong hospital nurses was conducted. Three hundred and seventy-seven nurses were recruited from six district hospitals. They were registered nurses or enrolled nurses working full-time for at least 1 month in the current ward. One hundred and seventy-eight (47.2%) study subjects were randomly selected from two district hospitals and 199 (52.8%) study nurses made up the convenience sample. Possible bias from psychological distress, socio-demographics and lifestyle factors was controlled for. Data were collected by face-to-face interviews. The data included work factors (both psychological stress and patient handling activities related to work), demographics, psychological distress and lifestyle factors and the occurrence of LBP. Of the 377 nurses interviewed, 153 (40.6%) reported having LBP within the last 12 months. With symptoms of LBP as the outcome, risks were increased where nurses self-reported that they only occasionally or never enjoyed their work [adjusted odds ratio (OR) 2.07], where frequent manual repositioning of patients on the bed was required (adjusted OR 1.84) and where they were required to assist patients while walking (adjusted OR 2.11) after adjustment for other potential confounders. The results indicate that an association exists between work stress, manual lifting and LBP prevalence. The main route to prevention of LBP among nurses is likely to lie in improved ergonomics and psychological health in their work place. Good posture and correct transferring techniques in ward situations should be reinforced with hands-on practice performed on nurses' common types of clients.
Prototype to measure bracket debonding force in vivo
Tonus, Jéssika Lagni; Manfroi, Fernanda Borguetti; Borges, Gilberto Antonio; Grigolo, Eduardo Correa; Helegda, Sérgio; Spohr, Ana Maria
2017-01-01
ABSTRACT Introduction: Material biodegradation that occurs in the mouth may interfere in the bonding strength between the bracket and the enamel, causing lower bond strength values in vivo, in comparison with in vitro studies. Objective: To develop a prototype to measure bracket debonding force in vivo and to evaluate, in vitro, the bond strength obtained with the prototype. Methods: A original plier (3M Unitek) was modified by adding one strain gauge directly connected to its claw. An electronic circuit performed the reading of the strain gauge, and the software installed in a computer recorded the values of the bracket debonding force, in kgf. Orthodontic brackets were bonded to the facial surface of 30 bovine incisors with adhesive materials. In Group 1 (n = 15), debonding was carried out with the prototype, while tensile bond strength testing was performed in Group 2 (n = 15). A universal testing machine was used for the second group. The adhesive remnant index (ARI) was recorded. Results: According to Student’s t test (α = 0.05), Group 1 (2.96 MPa) and Group 2 (3.08 MPa) were not significantly different. ARI score of 3 was predominant in the two groups. Conclusion: The prototype proved to be reliable for obtaining in vivo bond strength values for orthodontic brackets. PMID:28444011
Molecular characterization of the 2011 Hong Kong scarlet fever outbreak.
Tse, Herman; Bao, Jessie Y J; Davies, Mark R; Maamary, Peter; Tsoi, Hoi-Wah; Tong, Amy H Y; Ho, Tom C C; Lin, Chi-Ho; Gillen, Christine M; Barnett, Timothy C; Chen, Jonathan H K; Lee, Mianne; Yam, Wing-Cheong; Wong, Chi-Kin; Ong, Cheryl-Lynn Y; Chan, Yee-Wai; Wu, Cheng-Wei; Ng, Tony; Lim, Wilina W L; Tsang, Thomas H F; Tse, Cindy W S; Dougan, Gordon; Walker, Mark J; Lok, Si; Yuen, Kwok-Yung
2012-08-01
A scarlet fever outbreak occurred in Hong Kong in 2011. The majority of cases resulted in the isolation of Streptococcus pyogenes emm12 with multiple antibiotic resistances. Phylogenetic analysis of 22 emm12 scarlet fever outbreak isolates, 7 temporally and geographically matched emm12 non-scarlet fever isolates, and 18 emm12 strains isolated during 2005-2010 indicated the outbreak was multiclonal. Genome sequencing of 2 nonclonal scarlet fever isolates (HKU16 and HKU30), coupled with diagnostic polymerase chain reaction assays, identified 2 mobile genetic elements distributed across the major lineages: a 64.9-kb integrative and conjugative element encoding tetracycline and macrolide resistance and a 46.4-kb prophage encoding superantigens SSA and SpeC and the DNase Spd1. Phenotypic comparison of HKU16 and HKU30 with the S. pyogenes M1T1 strain 5448 revealed that HKU16 displays increased adherence to HEp-2 human epithelial cells, whereas HKU16, HKU30, and 5448 exhibit equivalent resistance to neutrophils and virulence in a humanized plasminogen murine model. However, in contrast to M1T1, the virulence of HKU16 and HKU30 was not associated with covRS mutation. The multiclonal nature of the emm12 scarlet fever isolates suggests that factors such as mobile genetic elements, environmental factors, and host immune status may have contributed to the 2011 scarlet fever outbreak.
Molecular Characterization of the 2011 Hong Kong Scarlet Fever Outbreak
Tse, Herman; Bao, Jessie Y. J.; Davies, Mark R.; Maamary, Peter; Tsoi, Hoi-Wah; Tong, Amy H. Y.; Ho, Tom C. C.; Lin, Chi-Ho; Gillen, Christine M.; Barnett, Timothy C.; Chen, Jonathan H. K.; Lee, Mianne; Yam, Wing-Cheong; Wong, Chi-Kin; Ong, Cheryl-lynn Y.; Chan, Yee-Wai; Wu, Cheng-Wei; Ng, Tony; Lim, Wilina W. L.; Tsang, Thomas H. F.; Tse, Cindy W. S.; Dougan, Gordon; Walker, Mark J.; Lok, Si; Yuen, Kwok-Yung
2012-01-01
A scarlet fever outbreak occurred in Hong Kong in 2011. The majority of cases resulted in the isolation of Streptococcus pyogenes emm12 with multiple antibiotic resistances. Phylogenetic analysis of 22 emm12 scarlet fever outbreak isolates, 7 temporally and geographically matched emm12 non–scarlet fever isolates, and 18 emm12 strains isolated during 2005–2010 indicated the outbreak was multiclonal. Genome sequencing of 2 nonclonal scarlet fever isolates (HKU16 and HKU30), coupled with diagnostic polymerase chain reaction assays, identified 2 mobile genetic elements distributed across the major lineages: a 64.9-kb integrative and conjugative element encoding tetracycline and macrolide resistance and a 46.4-kb prophage encoding superantigens SSA and SpeC and the DNase Spd1. Phenotypic comparison of HKU16 and HKU30 with the S. pyogenes M1T1 strain 5448 revealed that HKU16 displays increased adherence to HEp-2 human epithelial cells, whereas HKU16, HKU30, and 5448 exhibit equivalent resistance to neutrophils and virulence in a humanized plasminogen murine model. However, in contrast to M1T1, the virulence of HKU16 and HKU30 was not associated with covRS mutation. The multiclonal nature of the emm12 scarlet fever isolates suggests that factors such as mobile genetic elements, environmental factors, and host immune status may have contributed to the 2011 scarlet fever outbreak. PMID:22615319
Hierholzer, J C; Pumarola, A
1976-01-01
An unusual variant of adenovirus (AV) 11 was isolated from throat and rectal swabs from six persons with upper respiratory illness in a Spanish military camp in March 1969. The same strain was serologically related to the upper respiratory illness of seven other men among 25 sample cases studied in detail. After strain purification, the virus was grouped as an AV by standard biological tests; it possessed the usual titers of group-specific hexon antigen but only low hemagglutinin titers (1:4 to 1:8) with erythrocytes from selected rhesus monkeys. The virus gave little reaction in hemagglutination inhibition (HI) tests with antisera to AV 1 through 35, but was neutralized to homologous titers by AV 11 antiserum. Reciprocally, rabbit and guinea pig antisera to the isolates possessed high HI antibody titers to prototype AV 14 and high serum neutralization (SN) antibody titers to prototype AV 11. On this basis, the variants were classified as AV 14-11 intermediates. Sequential serum specimens from the patients with and without positive cultures showed diagnostic rises in HI and SN antibody levels to the AV 14-11 intermediate and to prototype AV 11, but little response to AV 14. PMID:177365
Goldstone, Robert J.; Talbot, Richard; Schuberth, Hans-Joachim; Sandra, Olivier; Sheldon, I. Martin
2014-01-01
Specific Escherichia coli strains associated with bovine postpartum uterine infection have recently been described. Many recognized virulence factors are absent in these strains; therefore, to define a prototypic strain, we report here the genome sequence of E. coli isolate MS499 from a cow with the postpartum disease metritis. PMID:24994791
Lee, V W Y; Chau, T S; Chan, A K W; Lee, K K C; Waye, M M Y; Ling, T K W; Chan, F K L
2010-06-01
Our study aimed to assess the effectiveness of esomeprazole or rabeprazole in combination with amoxicillin and clarithromycin for the eradication of Helicobacter pylori in Hong Kong non-ulcer dyspepsia (NUD) patients. A prospective clinical trial was conducted at the Alice Ho Miu ling Nethersole Hospital outpatient endoscopy center from June 2004 to December 2005. Participants received amoxicillin 1 g, clarithromycin 500 mg, and, esomeprazole 20 mg (EAC) or rabeprazole 20 mg (RAC), all given twice daily for 1 week. The H. pylori status was determined by the [13C] urea breath test at least 4 weeks after completion of the treatment. Mutation status of CYP2C19 in exon 4 and exon 5 associated with the poor metabolizer phenotype was determined. The intention-to-treat eradication rates in patients treated with RAC and EAC were 77% and 84.6% respectively, and per protocol-based eradication rates were 83.7% and 88.9% respectively. The eradication rates did not vary with CYP2C19 phenotype found. For clarithromycin-sensitive strains, the cure rates were statistically significant regardless of CYP2C19 polymorphism (P < 0.0001). Triple therapy with either EAC or RAC is effective for Hong Kong Chinese NUD patients with H. pylori infection. Success eradication was related to clarithromycin resistance and not CYP2C19 genotype.
Streptococcus suis infection in Hong Kong: an emerging infectious disease?
MA, E.; CHUNG, P. H.; SO, T.; WONG, L.; CHOI, K. M.; CHEUNG, D. T.; KAM, K. M.; CHUANG, S. K.; TSANG, T.
2008-01-01
SUMMARY We conducted a 31-month retrospective review of all laboratory-confirmed Streptococcus suis infections admitted to public hospitals in Hong Kong. Strain identification, serotyping and antibiotic susceptibility tests were conducted on S. suis isolates. Twenty-one sporadic cases were identified, comprising 18 (86%) males and 3 (14%) females. About half were patients aged ⩾65 years. More cases occurred during summer. Occupational exposure was documented in five (24%) cases. The estimated annual incidence was 0·09/100 000 in the general population and 32/100 000 in people with occupational exposure to pigs and raw pork. The primary clinical manifestations were meningitis (48%), septicaemia (38%) and endocarditis (14%). The case-fatality rate was 5%. All available isolates from 15 patients were serotype 2, sensitive to penicillin, ampicillin, ceftriaxone, but resistant to tetracycline. Injury prevention and proper handling of pigs or raw pork should be advocated to both at-risk occupational groups and the general population. PMID:18252026
Resurgence of cholera in Hong Kong.
Lee, S. H.; Lai, S. T.; Lai, J. Y.; Leung, N. K.
1996-01-01
Cholera is one of the three diseases subject to the International Health Regulations. After a period of over 30 years, the seventh pandemic of cholera, which started in South East Asia in 1961, still shows no sign of a decline. On the contrary, it has increased its severity and invaded many other countries in Africa and Latin America. In the last two years, there has been a recrudescence of the disease in South East Asia and Western Pacific Regions. The discovery of a new strain of Vibrio cholerae 0139 in these regions is causing concern in view of its potential to cause major epidemics and higher mortality. Hong Kong had two intensive outbreaks of cholera in the last two years. The cause of these outbreaks was not clear, but adverse environmental conditions and increasing pollution of coastal waters have been implicated. The spread of cholera knows no geographical boundaries. There is a need for intensified efforts among health authorities in the affected areas to prevent the international spread of the disease. PMID:8760949
Yi, Yanjie; Isaacs, Stuart N.; Williams, Darlisha A.; Frank, Ian; Schols, Dominique; De Clercq, Erik; Kolson, Dennis L.; Collman, Ronald G.
1999-01-01
Dual-tropic human immunodeficiency virus type 1 (HIV-1) strains infect both primary macrophages and transformed T-cell lines. Prototype T-cell line-tropic (T-tropic) strains use CXCR4 as their principal entry coreceptor (X4 strains), while macrophagetropic (M-tropic) strains use CCR5 (R5 strains). Prototype dual tropic strains use both coreceptors (R5X4 strains). Recently, CXCR4 expressed on macrophages was found to support infection by certain HIV-1 isolates, including the dual-tropic R5X4 strain 89.6, but not by T-tropic X4 prototypes like 3B. To better understand the cellular basis for dual tropism, we analyzed the macrophage coreceptors used for Env-mediated cell-cell fusion as well as infection by several dual-tropic HIV-1 isolates. Like 89.6, the R5X4 strain DH12 fused with and infected both wild-type and CCR5-negative macrophages. The CXCR4-specific inhibitor AMD3100 blocked DH12 fusion and infection in macrophages that lacked CCR5 but not in wild-type macrophages. This finding indicates two independent entry pathways in macrophages for DH12, CCR5 and CXCR4. Three primary isolates that use CXCR4 but not CCR5 (tybe, UG021, and UG024) replicated efficiently in macrophages regardless of whether CCR5 was present, and AMD3100 blocking of CXCR4 prevented infection in both CCR5 negative and wild-type macrophages. Fusion mediated by UG021 and UG024 Envs in both wild-type and CCR5-deficient macrophages was also blocked by AMD3100. Therefore, these isolates use CXCR4 exclusively for entry into macrophages. These results confirm that macrophage CXCR4 can be used for fusion and infection by primary HIV-1 isolates and indicate that CXCR4 may be the sole macrophage coreceptor for some strains. Thus, dual tropism can result from two distinct mechanisms: utilization of both CCR5 and CXCR4 on macrophages and T-cell lines, respectively (dual-tropic R5X4), or the ability to efficiently utilize CXCR4 on both macrophages and T-cell lines (dual-tropic X4). PMID:10438797
USDA-ARS?s Scientific Manuscript database
Genomes from fifteen porcine reproductive and respiratory syndrome virus (PRRSV) isolates were derived simultaneously using 454 pyrosequencing technology. The viral isolates sequenced were from a recent swine study, in which engineered Type 2 prototype PRRSV strain VR-2332 mutants, with 87, 184, 200...
Lung, M L; Chang, R S; Jones, J H
1988-01-01
We analyzed Epstein-Barr virus (EBV) genomes from lymphoblastoid cell lines isolated from patients with infectious mononucleosis and from healthy subjects from California, Hawaii, and Hong Kong between 1970 and 1987. Using genetic polymorphism as epidemiological markers, we found that several genotypes of EBV cocirculate in a community and that although most EBV strains isolated from California and Southern China may be differentiated genotypically, there was no specific association between genotype and disease or time of isolation. Images PMID:2901499
Finite Element Analysis of Elastomeric Seals for LIDS
NASA Technical Reports Server (NTRS)
Oswald, Jay J.; Daniels, Christopher C.
2007-01-01
Objective: Create a means of evaluating seals w/o prototypes. Motivation: Cost Prototype 54" seal approx.$100k per seal pair FEA license + high end workstation approx. $30k per year. Development time: 6 months lead time for a new seal design Many designs per day (solution time <1 minute) Understanding: Difficult to experimentally measure strains, contact pressure profile, stresses, displacements
Li, Lei; Wong, Hin-chung; Nong, Wenyan; Cheung, Man Kit; Law, Patrick Tik Wan; Kam, Kai Man; Kwan, Hoi Shan
2014-12-18
Vibrio parahaemolyticus is a Gram-negative halophilic bacterium. Infections with the bacterium could become systemic and can be life-threatening to immunocompromised individuals. Genome sequences of a few clinical isolates of V. parahaemolyticus are currently available, but the genome dynamics across the species and virulence potential of environmental strains on a genome-scale have not been described before. Here we present genome sequences of four V. parahaemolyticus clinical strains from stool samples of patients and five environmental strains in Hong Kong. Phylogenomics analysis based on single nucleotide polymorphisms revealed a clear distinction between the clinical and environmental isolates. A new gene cluster belonging to the biofilm associated proteins of V. parahaemolyticus was found in clincial strains. In addition, a novel small genomic island frequently found among clinical isolates was reported. A few environmental strains were found harboring virulence genes and prophage elements, indicating their virulence potential. A unique biphenyl degradation pathway was also reported. A database for V. parahaemolyticus (http://kwanlab.bio.cuhk.edu.hk/vp) was constructed here as a platform to access and analyze genome sequences and annotations of the bacterium. We have performed a comparative genomics analysis of clinical and environmental strains of V. parahaemolyticus. Our analyses could facilitate understanding of the phylogenetic diversity and niche adaptation of this bacterium.
The 987P fimbrial gene cluster of enterotoxigenic Escherichia coli is plasmid encoded.
Schifferli, D M; Beachey, E H; Taylor, R K
1990-01-01
A clone containing the 987P fimbrial gene cluster was selected from a cosmid library of total DNA of the prototype Escherichia coli strain 987 by using 987P-specific antiserum. A subclone of 12 kilobases containing all of the genes required for fimbrial expression on a nonfimbriated K-12 strain of E. coli and a DNA fragment internal to the fimbrial subunit gene were used to probe the prototype strain and various isolates of 987P-fimbriated enterotoxigenic E. coli. All strains had several plasmids, as shown by agarose gel electrophoresis, and each of five strains which expressed 987P fimbriae showed a plasmid of 35 to 40 megadaltons (MDa) hybridizing to both 987P-specific probes. Hybridization to restricted DNA of strain 987 supported a plasmid origin for the cloned 987P gene cluster. Moreover, an isogenic strain which had lost its 35-MDa plasmid was no longer capable of synthesizing fimbrial subunits, but regained fimbrial expression after reintroduction of the TnphoA (Tn5 IS50L::phoA)-tagged 35-MDa plasmid. Absence of fimbrial subunit synthesis in K-12 strains transformed with the 35-MDa plasmid alone suggested the requirement of regulatory elements existing in strain 987 but missing in K-12 strains. A probe for the heat-stable enterotoxin STIa hybridized in each of the 987P-fimbriated strains to the plasmid containing the 987P genes and in most of these strains to an additional plasmid which contained the gene for the heat-stable enterotoxin STII. Occurrence of the 987P and STIa genes on the same replicon correlates with epidemiological observations, STIa being the most prevalent toxin produced by 987P-fimbriated E. coli. Images PMID:1967167
Hong's grading for evaluating anterior chamber angle width.
Kim, Seok Hwan; Kang, Ja Heon; Park, Ki Ho; Hong, Chul
2012-11-01
To compare Hong's grading method with anterior segment optical coherence tomography (AS-OCT), gonioscopy, and the dark-room prone-position test (DRPT) for evaluating anterior chamber width. The anterior chamber angle was graded using Hong's grading method, and Hong's angle width was calculated from the arctangent of Hong's grades. The correlation between Hong's angle width and AS-OCT parameters was analyzed. The area under the receiver operating characteristic curve (AUC) for Hong's grading method when discriminating between narrow and open angles as determined by gonioscopy was calculated. Correlation analysis was performed between Hong's angle width and intraocular pressure (IOP) changes determined by DRPT. A total of 60 subjects were enrolled. Of these subjects, 53.5 % had a narrow angle. Hong's angle width correlated significantly with the AS-OCT parameters (r = 0.562-0.719, P < 0.01). A Bland-Altman plot showed relatively good agreement between Hong's angle width and the angle width obtained by AS-OCT. The ability of Hong's grading method to discriminate between open and narrow angles was good (AUC = 0.868, 95 % CI 0.756-0.942). A significant linear correlation was found between Hong's angle width and IOP change determined by DRPT (r = -0.761, P < 0.01). Hong's grading method is useful for detecting narrow angles. Hong's grading correlated well with AS-OCT parameters and DRPT.
McCarthy, Troy; Lebeck, Mark G.; Capuano, Ana W.; Schnurr, David P.; Gray, Gregory C.
2009-01-01
Background Epidemiological data suggest that clinical outcomes of human adenovirus (HAdV) infection may be influenced by virus serotype, coinfection with multiple strains, or infection with novel intermediate strains. In this report, we propose a clinical algorithm for detecting HAdV coinfection and intermediate strains. Study Design We PCR amplified and sequenced subregions of the hexon and fiber genes of 342 HAdV positive clinical specimens obtained from 14 surveillance laboratories. Sequences were then compared with those from 52 HAdV prototypic strains. HAdV positive specimens that showed nucleotide sequence identity with a corresponding prototype strain were designated as being of that strain. When hexon and fiber gene sequences disagreed, or sequence identity was low, the specimens were further characterized by viral culture, plaque purification, repeat PCR with sequencing, and genome restriction enzyme digest analysis. Results Of the 342 HAdV-positive clinical specimens, 328 (95.9%) were single HAdV strain infections, 12 (3.5%) were coinfections, and 2 (0.6%) had intermediate strains. Coinfected specimens and intermediate HAdV strains considered together were more likely to be associated with severe illness compared to other HAdv-positive specimens (OR=3.8; 95% CI = 1.2–11.9). Conclusions The majority of severe cases of HAdV illness cases occurred among immunocompromised patients. The analytic algorithm we describe here can be used to screen clinical specimens for evidence of HAdV coinfection and novel intermediate HAdV strains. This algorithm may be especially useful in investigating HAdV outbreaks and clusters of unusually severe HAdV disease. PMID:19577957
1986-02-01
This discussion of Hong Kong focuses on the following: geography; the people; history; government; political conditions; and the economy. In 1984 the population of Hong Kong totaled 5.4 million with an annual growth rate of 1.3%. The infant mortality rate is 9.9/1000; life expectancy is 76 years. Hong Kong adjoins Guangdong province on the southeastern coast of the Chinese mainland. It consists of Hong Kong and Lan Tao islands, the Kowloon Peninsula, and more than 200 smaller islands. Hong Kong's population consists of about 98% ethnic Chinese and 2% other ethnic groups, mostly European. Only 57.2% of the population were born in Hong Kong. Cantonese is the Chinese dialect spoken by most of the territory's population, but English is widely understood. Not until after 1949 did Hong Kong develop into a leading manufacturing, commercial, and tourist center. Hong Kong's foreign relations are the responsibility of the British government, but considerable autonomy has been permitted in the area of commercial relations. Following the June 30, 1997, expiration date of the lease on the New Territories, which comprise 92% of Hong Kong's total area, Hong Kong will become a Special Administrative Region of China in 1997. Hong Kong has little arable land and virtually no natural resources. The colony always has depended on foreign trade. Hong Kong has developed into a center of light manufacturing and international finance. In 1984, Hong Kong's foreign trade was valued at $57 billion. Hong Kongs economy has recovered strongly from the 1981-82 recession.
Cheung, Nicole W T
2015-02-01
Knowledge of the influence of couple dynamics on gender differences in gambling behavior remains meager. Building on general strain theory from the sociology of deviance and stress crossover theory from social psychology, we argue that the strain encountered by one partner in a social setting may affect his or her spouse. For instance, the wife of a man under more social strain may experience more strain in turn and thus be at a higher risk of developing disordered gambling than the wife of a man under less social strain. Using community survey data of 1620 Chinese married couples, we performed multilevel dyad analyses to address social strain and couple dynamics, in addition to their roles as predictors of gambling behavior in both spouses. This was a community survey of Hong Kong and therefore was not representative of China. Based on the DSM-IV screen, the rates of probable problem gambling and pathological gambling among male partners (12.8% vs. 2.5%) were twice those among female partners (5.2% vs. 0.3%). We also found that the social strain experienced by a male partner significantly predicted both his and his wife's likelihood of developing gambling problems. Although a female partner's exposure to social strain was a significant correlate of her gambling problem, it had no significant association with her husband's gambling behavior. These results suggest that the cross-spouse transference of social strain may be a gendered process. Copyright © 2014 Elsevier Ltd. All rights reserved.
Pillet, Stéphane; Aubin, Éric; Trépanier, Sonia; Bussière, Diane; Dargis, Michèle; Poulin, Jean-François; Yassine-Diab, Bader; Ward, Brian J; Landry, Nathalie
2016-07-01
Recent issues regarding efficacy of influenza vaccines have re-emphasized the need of new approaches to face this major public health issue. In a phase 1-2 clinical trial, healthy adults received one intramuscular dose of a seasonal influenza plant-based quadrivalent virus-like particle (QVLP) vaccine or placebo. The hemagglutination inhibition (HI) titers met all the European licensure criteria for the type A influenza strains at the 3μg/strain dose and for all four strains at the higher dosages 21days after immunization. High HI titers were maintained for most of the strains 6months after vaccination. QVLP vaccine induced a substantial and sustained increase of hemagglutinin-specific polyfunctional CD4 T cells, mainly transitional memory and TEMRA effector IFN-γ(+) CD4 T cells. A T cells cross-reactive response was also observed against A/Hong-Kong/1/1968 H3N2 and B/Massachusetts/2/2012. Plant-based QVLP offers an attractive alternative manufacturing method for producing effective and HA-strain matching seasonal influenza vaccines. Copyright © 2016 The Authors. Published by Elsevier Inc. All rights reserved.
Antigenic variation of the human influenza A (H3N2) virus during the 2014-2015 winter season.
Hua, Sha; Li, XiYan; Liu, Mi; Cheng, YanHui; Peng, YouSong; Huang, WeiJuan; Tan, MinJu; Wei, HeJiang; Guo, JunFeng; Wang, DaYan; Wu, AiPing; Shu, YueLong; Jiang, TaiJiao
2015-09-01
The human influenza A (H3N2) virus dominated the 2014-2015 winter season in many countries and caused massive morbidity and mortality because of its antigenic variation. So far, very little is known about the antigenic patterns of the recent H3N2 virus. By systematically mapping the antigenic relationships of H3N2 strains isolated since 2010, we discovered that two groups with obvious antigenic divergence, named SW13 (A/Switzerland/9715293/2013-like strains) and HK14 (A/Hong Kong/5738/2014-like strains), co-circulated during the 2014-2015 winter season. HK14 group co-circulated with SW13 in Europe and the United States during this season, while there were few strains of HK14 in mainland China, where SW13 has dominated since 2012. Furthermore, we found that substitutions near the receptor-binding site on hemagglutinin played an important role in the antigenic variation of both the groups. These findings provide a comprehensive understanding of the recent antigenic evolution of H3N2 virus and will aid in the selection of vaccine strains.
Thick film wireless and powerless strain sensor
NASA Astrophysics Data System (ADS)
Jia, Yi; Sun, Ke
2006-03-01
The development of an innovative wireless strain sensing technology has a great potential to extend its applications in manufacturing, civil engineering and aerospace industry. This paper presents a novel wireless and powerless strain sensor with a multi-layer thick film structure. The sensor employs a planar inductor (L) and capacitive transducer (C) resonant tank sensing circuit, and a strain sensitive material of a polarized polyvinylidene fluoride (PVDF) piezoelectric thick film to realize the wireless strain sensing by strain to frequency conversion and to receive radio frequency electromagnetic energy for powering the sensor. The prototype sensor was designed and fabricated. The results of calibration on a strain constant cantilever beam show a great linearity and sensitivity about 0.0013 in a strain range of 0-0.018.
Wong, Sunny H; Ip, Margaret; Hawkey, Peter M; Lo, Norman; Hardy, Katie; Manzoor, Susan; Hui, Wyman W M; Choi, Kin-Wing; Wong, Rity Y K; Yung, Irene M H; Cheung, Catherine S K; Lam, Kelvin L Y; Kwong, Thomas; Wu, William K K; Ng, Siew C; Wu, Justin C Y; Sung, Joseph J Y; Lee, Nelson
2016-08-01
We aim to study the disease burden, risk factors and severity of Clostridium difficile infection (CDI) in Hong Kong. We conducted a prospective, case-control study in three acute-care hospitals in Hong Kong. Adult inpatients who developed CDI diarrhoea confirmed by PCR (n = 139) were compared with the non-CDI controls (n = 114). Ribotyping of isolates and antimicrobial susceptibility testing were performed. The estimated crude annual incidence of CDI was 23-33/100,000 population, and 133-207/100,000 population among those aged ≥65 years. The mean age of CDI patients was 71.5. Nursing home care, recent hospitalization, antibiotics exposure (adjusted OR 3.0, 95% CI 1.3-7.1) and proton-pump inhibitors use (adjusted OR 2.2, 95% CI 1.2-3.9) were risk factors. Severe CDI occurred in 41.7%. Overall mortality was 16.5% (among severe CDI, 26.5%). The commonest ribotypes were 002 (22.8%), 014 (14.1%), 012 and 046; ribotype 027 was absent. Ribotype 002 was associated with fluoroquinolone resistance and higher mortality (47.6% vs. 12.7%; adjusted HR 2.8, 95% CI 1.1-7.0). Our findings show high morbidity and mortality of CDI in the older adults, and identify ribotype 002 as a possible virulent strain causing serious infections in this cohort. Copyright © 2016 The British Infection Association. Published by Elsevier Ltd. All rights reserved.
Hong-Ou-Mandel Gravitational Wave Space spectrometER - HOMER mission
NASA Astrophysics Data System (ADS)
Jacinto de Matos, Clovis; Tajmar, Martin
2018-06-01
Michelson type gravitational wave detectors measure the strain caused by gravitational waves on the interferometer's arms. Gravitational waves can also cause the rotation of photon's linear polarization vector, thus disturbing the interference of entangled photons in Hong-Ou-Mandel (HOM) interferometers. Here one uses that physical phenomenon to devise a spectrometer for gravitational waves through the implementation of a Hong-Ou-Mandel interferometer in Earth geostationary orbit with a constellation of three different spacecraft in accurate formation flight. We call this mission, the Hong-Ou-Mandel Gravitational Waves Space SpectrometER (HOMER). HOMER will cover the part of the gravitational wave spectrum with wavelengths around λ =105 km, which falls between the long wavelength detection range of LISA, around λ =106 km, and of ground based detectors like LIGO, around λ =103 km. With respect to Michelson type detectors, the proposed concept for the detection and spectral analysis of gravitational waves has the advantage of operating without the need of drag free satellites, however it requires a relative precision of the attitude between satellites of the order of the gravitational waves amplitude δθ / θ ∼ h ∼10-20 , which makes the architecture of the HOMER mission as challenging as the Michelson type space detectors. The difficulty being however transferred from the monitoring of the relative distance between spacecraft (for Michelson antennas) to their relative attitude. By focusing on photons polarization instead of photons phase one can measure the spectrum of the detected gravitational signal. As a bonus, the proposed instrument could also investigate the influence of spacetime curvature on photons quantum entanglement, thus experimentally peering into the relation between general relativity and quantum mechanics, which is currently a subject of high interest in theoretical physics. This paper will describe the HOMER mission concept in general and the main elements of the payload and spacecraft design in particular.
Worldwide Report, Telecommunications Policy, Research and Development
1985-12-31
3 Hong Kong Database Signs Contract With PRC (K. Gopinath; Hong Kong HONGKONG STANDARD, 18 Oct 85) .... 5 Briefs Hong Kong-London Data Link...KONG HONG KONG DATABASE SIGNS CONTRACT WITH PRC Hong Kong HONGKONG STANDARD in English Supplement 18 Oct 85 p 1 [Article by K. Gopinath] [Text...information group. The agreement between state-owned China Hua Yang Technology and Trade Corporation and DataBase Asia of Hong- kong, authorises
Development of an Active Twist Rotor for Wind: Tunnel Testing (NLPN97-310
NASA Technical Reports Server (NTRS)
Cesnik, Carlos E. S.; Shin, SangJoon; Hagood, Nesbitt W., IV
1998-01-01
The development of the Active Twist Rotor prototype blade for hub vibration and noise reduction studies is presented in this report. Details of the modeling, design, and manufacturing are explored. The rotor blade is integrally twisted by direct strain actuation. This is accomplished by distributing embedded piezoelectric fiber composites along the span of the blade. The development of the analysis framework for this type of active blade is presented. The requirements for the prototype blade, along with the final design results are also presented. A detail discussion on the manufacturing aspects of the prototype blade is described. Experimental structural characteristics of the prototype blade compare well with design goals, and preliminary bench actuation tests show lower performance than originally predicted. Electrical difficulties with the actuators are also discussed. The presented prototype blade is leading to a complete fully articulated four-blade active twist rotor system for future wind tunnel tests.
Usui, Tatsufumi; Yamaguchi, Tsuyoshi; Ito, Hiroshi; Ozaki, Hiroichi; Murase, Toshiyuki; Ito, Toshihiro
2009-12-01
In April and May 2008, highly pathogenic avian influenza viruses subtype H5N1 were isolated from dead or moribund whooper swans in Aomori, Akita and Hokkaido prefectures in northern Japan. To trace the genetic lineage of the isolates, the nucleotide sequences of all eight genes were determined and phylogenetically analyzed. The Japanese strains were nearly identical to chicken viruses isolated in Russia in April 2008 and closely related to viruses isolated from dead wild birds in Hong Kong in 2007-2008. Their HA genes clustered in clade 2.3.2. On the other hand, NA and the other internal genes were closely related to those of clade 2.3.4 viruses (genotype V) whose NP genes originated from an HA clade 2.3.2 virus. In conclusion, the H5N1 viruses isolated in Japan, Russia and Hong Kong were derived from a common ancestor virus belonging to genotype V that was generated from genetic reassortment events between viruses of HA clades 2.3.2 and 2.3.4.
Aoki, Koki; Ishiko, Hiroaki; Konno, Tsunetada; Shimada, Yasushi; Hayashi, Akio; Kaneko, Hisatoshi; Ohguchi, Takeshi; Tagawa, Yoshitsugu; Ohno, Shigeaki; Yamazaki, Shudo
2008-01-01
In a 2-month period in 2003, we encountered an outbreak of epidemic keratoconjunctivitis (EKC) in Japan. We detected 67 human adenoviruses (HAdVs) by PCR from eye swabs of patients with EKC at five eye clinics in different parts of Japan. Forty-one of the 67 HAdV DNAs from the swabs were identified as HAdV-37 by phylogenetic analysis using a partial hexon gene sequence. When the restriction patterns of these viral genomes were compared with that of the HAdV-37 prototype strain, one isolate showed a never-before-seen restriction pattern. Within 1 year, we encountered three more EKC cases caused by a genetically identical virus: two nosocomial infections at two different university hospitals and a sporadic infection at an eye clinic. We determined the nucleotide sequences of the full-length hexon and fiber genes of these isolates and compared them to those of the 51 prototype strains. Surprisingly, the sequence of the hexon (ɛ determinant) loop-1 and -2 regions showed the highest nucleotide identity with HAdV-22, a rare EKC isolate. However, the nucleotide sequence of the fiber gene was identical to that of the HAdV-8 prototype strain. 22 We propose that this virus is a new hexon-chimeric intermediate HAdV-22,37/H8, and may be an etiological agent of EKC. PMID:18701656
Detection and molecular characterization of J subgroup avian leukosis virus in wild ducks in China.
Zeng, Xiangwei; Liu, Lanlan; Hao, Ruijun; Han, Chunyan
2014-01-01
To assess the status of avian leukosis virus subgroup J (ALV-J) in wild ducks in China, we examined samples from 528 wild ducks, representing 17 species, which were collected in China over the past 3 years. Virus isolation and PCR showed that 7 ALV-J strains were isolated from wild ducks. The env genes and the 3'UTRs from these isolates were cloned and sequenced. The env genes of all 7 wild duck isolates were significantly different from those in the prototype strain HPRS-103, American strains, broiler ALV-J isolates and Chinese local chicken isolates, but showed close homology with those found in some layer chicken ALV-J isolates and belonged to the same group. The 3'UTRs of 7 ALV-J wild ducks isolates showed close homology with the prototype strain HPRS-103 and no obvious deletion was found in the 3'UTR except for a 1 bp deletion in the E element that introduced a binding site for c-Ets-1. Our study demonstrated the presence of ALV-J in wild ducks and investigated the molecular characterization of ALV-J in wild ducks isolates.
The Preparation of Educational Psychologists in Hong Kong
ERIC Educational Resources Information Center
Lam, Shui-fong
2014-01-01
Modeled after the British system, school psychologists in Hong Kong are called educational psychologists. Hong Kong is the first location in Asia to have a recognized specialty vocation in educational psychology and a program for their professional preparation. The first program in Hong Kong, established by the University of Hong Kong in 1981…
Forecasting Influenza Epidemics in Hong Kong.
Yang, Wan; Cowling, Benjamin J; Lau, Eric H Y; Shaman, Jeffrey
2015-07-01
Recent advances in mathematical modeling and inference methodologies have enabled development of systems capable of forecasting seasonal influenza epidemics in temperate regions in real-time. However, in subtropical and tropical regions, influenza epidemics can occur throughout the year, making routine forecast of influenza more challenging. Here we develop and report forecast systems that are able to predict irregular non-seasonal influenza epidemics, using either the ensemble adjustment Kalman filter or a modified particle filter in conjunction with a susceptible-infected-recovered (SIR) model. We applied these model-filter systems to retrospectively forecast influenza epidemics in Hong Kong from January 1998 to December 2013, including the 2009 pandemic. The forecast systems were able to forecast both the peak timing and peak magnitude for 44 epidemics in 16 years caused by individual influenza strains (i.e., seasonal influenza A(H1N1), pandemic A(H1N1), A(H3N2), and B), as well as 19 aggregate epidemics caused by one or more of these influenza strains. Average forecast accuracies were 37% (for both peak timing and magnitude) at 1-3 week leads, and 51% (peak timing) and 50% (peak magnitude) at 0 lead. Forecast accuracy increased as the spread of a given forecast ensemble decreased; the forecast accuracy for peak timing (peak magnitude) increased up to 43% (45%) for H1N1, 93% (89%) for H3N2, and 53% (68%) for influenza B at 1-3 week leads. These findings suggest that accurate forecasts can be made at least 3 weeks in advance for subtropical and tropical regions.
Forecasting Influenza Epidemics in Hong Kong
Yang, Wan; Cowling, Benjamin J.; Lau, Eric H. Y.; Shaman, Jeffrey
2015-01-01
Recent advances in mathematical modeling and inference methodologies have enabled development of systems capable of forecasting seasonal influenza epidemics in temperate regions in real-time. However, in subtropical and tropical regions, influenza epidemics can occur throughout the year, making routine forecast of influenza more challenging. Here we develop and report forecast systems that are able to predict irregular non-seasonal influenza epidemics, using either the ensemble adjustment Kalman filter or a modified particle filter in conjunction with a susceptible-infected-recovered (SIR) model. We applied these model-filter systems to retrospectively forecast influenza epidemics in Hong Kong from January 1998 to December 2013, including the 2009 pandemic. The forecast systems were able to forecast both the peak timing and peak magnitude for 44 epidemics in 16 years caused by individual influenza strains (i.e., seasonal influenza A(H1N1), pandemic A(H1N1), A(H3N2), and B), as well as 19 aggregate epidemics caused by one or more of these influenza strains. Average forecast accuracies were 37% (for both peak timing and magnitude) at 1-3 week leads, and 51% (peak timing) and 50% (peak magnitude) at 0 lead. Forecast accuracy increased as the spread of a given forecast ensemble decreased; the forecast accuracy for peak timing (peak magnitude) increased up to 43% (45%) for H1N1, 93% (89%) for H3N2, and 53% (68%) for influenza B at 1-3 week leads. These findings suggest that accurate forecasts can be made at least 3 weeks in advance for subtropical and tropical regions. PMID:26226185
Probe Without Moving Parts Measures Flow Angle
NASA Technical Reports Server (NTRS)
Corda, Stephen; Vachon, M. Jake
2003-01-01
The measurement of local flow angle is critical in many fluid-dynamic applications, including the aerodynamic flight testing of new aircraft and flight systems. Flight researchers at NASA Dryden Flight Research Center have recently developed, flight-tested, and patented the force-based flow-angle probe (FLAP), a novel, force-based instrument for the measurement of local flow direction. Containing no moving parts, the FLAP may provide greater simplicity, improved accuracy, and increased measurement access, relative to conventional moving vane-type flow-angle probes. Forces in the FLAP can be measured by various techniques, including those that involve conventional strain gauges (based on electrical resistance) and those that involve more advanced strain gauges (based on optical fibers). A correlation is used to convert force-measurement data to the local flow angle. The use of fiber optics will enable the construction of a miniature FLAP, leading to the possibility of flow measurement in very small or confined regions. This may also enable the tufting of a surface with miniature FLAPs, capable of quantitative flow-angle measurements, similar to attaching yarn tufts for qualitative measurements. The prototype FLAP was a small, aerodynamically shaped, low-aspect-ratio fin about 2 in. (approximately equal to 5 cm) long, 1 in. (approximately equal to 2.5 cm) wide, and 0.125 in. (approximately equal to 0.3 cm) thick (see Figure 1). The prototype FLAP included simple electrical-resistance strain gauges for measuring forces. Four strain gauges were mounted on the FLAP; two on the upper surface and two on the lower surface. The gauges were connected to form a full Wheatstone bridge, configured as a bending bridge. In preparation for a flight test, the prototype FLAP was mounted on the airdata boom of a flight-test fixture (FTF) on the NASA Dryden F-15B flight research airplane.
Students' Concepts and Attitudes toward Citizenship: The Case of Hong Kong
ERIC Educational Resources Information Center
Lee, Wing On
2003-01-01
This paper analyses the data obtained from the findings on Hong Kong, as a part of the IEA second civic study. Because the survey was conducted two years after Hong Kong's return to China, the findings reflect concepts and attitudes toward citizenship among Hong Kong students shortly after the change of sovereignty. The study shows that Hong Kong…
Language Use, and Language Policy and Planning in Hong Kong
ERIC Educational Resources Information Center
Poon, Anita Y. K.
2010-01-01
This monograph provides an overview of the language situation in Hong Kong from a historical perspective. Hong Kong has evolved in the past 167 years from a small fishing port to an international financial centre which forms part of a financial network hailed by "Time Magazine" as Ny.Lon.Kong (i.e. New York-London-Hong Kong). Hong Kong…
Research pressure instrumentation for NASA Space Shuttle main engine
NASA Technical Reports Server (NTRS)
Anderson, P. J.; Nussbaum, P.; Gustafson, G.
1984-01-01
The development of prototype pressure transducers which are targeted to meet the Space Shuttle Main Engine SSME performance design goals is discussed. The fabrication, testing and delivery of 10 prototype units is examined. Silicon piezoresistive strain sensing technology is used to achieve the objectives of advanced state-of-the-art pressure sensors in terms of reliability, accuracy and ease of manufacture. Integration of multiple functions on a single chip is the key attribute of this technology.
Very High Load Capacity Air Bearing Spindle for Large Diamond Turning Machines
2010-06-08
testing and a surplus air bearing rotary table has been located. A prototype spindle has been designed to work with the table. 15. SUBJECT TERMS...MSFC) • PROTOTYPE SPINDLE DESIGN June 8, 2010Mirror Technology Workshop 3 Introduction • DT is a proven method of manufacturing aspheric off-axis... designed to hold in a strain-free condition. This spindle development is aimed at producing 3 meter diameter components. This requirement results in the
Autobalancing and FDIR for a space-based centrifuge prototype
NASA Technical Reports Server (NTRS)
Wilson, Edward; Mah, Robert W.
2005-01-01
This report summarizes centrifuge-related work performed at the Smart Systems Research Laboratory at NASA Ames Research Center's Computational Sciences Division from 1995 through 2003. The goal is to develop an automated system that will sense an imbalance (both static and dynamic3) in a centrifuge and issue control commands to drive counterweights to eliminate the effects of the imbalance. This autobalancing development began when the ISS centrifuge design was not yet finalized, and was designed to work with the SSRL Centrifuge laboratory prototype, constructed in 1993-1995. Significant differences between that prototype and the current International Space Station (ISS) Centrifuge design are that: the spin axis for the SSRL Centrifuge prototype can translate freely in x and y, but not wobble, whereas the ISS centrifuge spin axis has 3 translational and two rotational degrees of freedom, supported by a vibration 34. The imbalance sensors are strained gauges both in the rotor and the stator, measuring the imbalance forces, whereas the ISS centrifuge uses eddy current displacement sensors to measure the displacements resulting from imbalance. High fidelity autobalancing and FDIR systems (for both counterweights and strain gauges) are developed and tested in MATLAB simulation, for the SSRL Centrifuge configuration. Hardware implementation of the autobalancing technology was begun in 1996, but was terminated due to lack of funding. The project lay dormant until 2001-2002 when the FDIR capability was added.
Ravignani, Andrea; Olivera, Vicente Matellán; Gingras, Bruno; Hofer, Riccardo; Hernández, Carlos Rodríguez; Sonnweber, Ruth-Sophie; Fitch, W. Tecumseh
2013-01-01
The possibility of achieving experimentally controlled, non-vocal acoustic production in non-human primates is a key step to enable the testing of a number of hypotheses on primate behavior and cognition. However, no device or solution is currently available, with the use of sensors in non-human animals being almost exclusively devoted to applications in food industry and animal surveillance. Specifically, no device exists which simultaneously allows: (i) spontaneous production of sound or music by non-human animals via object manipulation, (ii) systematical recording of data sensed from these movements, (iii) the possibility to alter the acoustic feedback properties of the object using remote control. We present two prototypes we developed for application with chimpanzees (Pan troglodytes) which, while fulfilling the aforementioned requirements, allow to arbitrarily associate sounds to physical object movements. The prototypes differ in sensing technology, costs, intended use and construction requirements. One prototype uses four piezoelectric elements embedded between layers of Plexiglas and foam. Strain data is sent to a computer running Python through an Arduino board. A second prototype consists in a modified Wii Remote contained in a gum toy. Acceleration data is sent via Bluetooth to a computer running Max/MSP. We successfully pilot tested the first device with a group of chimpanzees. We foresee using these devices for a range of cognitive experiments. PMID:23912427
Ravignani, Andrea; Matellán Olivera, Vicente; Gingras, Bruno; Hofer, Riccardo; Rodríguez Hernández, Carlos; Sonnweber, Ruth-Sophie; Fitch, W Tecumseh
2013-07-31
The possibility of achieving experimentally controlled, non-vocal acoustic production in non-human primates is a key step to enable the testing of a number of hypotheses on primate behavior and cognition. However, no device or solution is currently available, with the use of sensors in non-human animals being almost exclusively devoted to applications in food industry and animal surveillance. Specifically, no device exists which simultaneously allows: (i) spontaneous production of sound or music by non-human animals via object manipulation, (ii) systematical recording of data sensed from these movements, (iii) the possibility to alter the acoustic feedback properties of the object using remote control. We present two prototypes we developed for application with chimpanzees (Pan troglodytes) which, while fulfilling the aforementioned requirements, allow to arbitrarily associate sounds to physical object movements. The prototypes differ in sensing technology, costs, intended use and construction requirements. One prototype uses four piezoelectric elements embedded between layers of Plexiglas and foam. Strain data is sent to a computer running Python through an Arduino board. A second prototype consists in a modified Wii Remote contained in a gum toy. Acceleration data is sent via Bluetooth to a computer running Max/MSP. We successfully pilot tested the first device with a group of chimpanzees. We foresee using these devices for a range of cognitive experiments.
USDA-ARS?s Scientific Manuscript database
An infectious clone of a highly pathogenic PRRSV strain from Vietnam (rSRV07) was prepared, analyzed and compared to Chinese highly pathogenic PRRSV rJXwn06 and US Type 2 prototype VR-2332 in order to examine the effects of virus phenotype and genotype on growth in MARC-145 cells, as well as the imp...
ERIC Educational Resources Information Center
Fong, Emily Tsz Yan
2010-01-01
Hong Kong popular culture played an important role in the construction and consolidation of Hong Kong identity long before the handover to China. In the past few years leading up to the 10th anniversary of the handover, both Hong Kong and China have undergone numerous changes which seem to be changing their relations. Whilst Hong Kong people had…
Li, Yi-Ping; Ramirez, Santseharay; Mikkelsen, Lotte; Bukh, Jens
2015-01-01
The first discovered and sequenced hepatitis C virus (HCV) genome and the first in vivo infectious HCV clones originated from the HCV prototype strains HCV-1 and H77, respectively, both widely used in research of this important human pathogen. In the present study, we developed efficient infectious cell culture systems for these genotype 1a strains by using the HCV-1/SF9_A and H77C in vivo infectious clones. We initially adapted a genome with the HCV-1 5'UTR-NS5A (where UTR stands for untranslated region) and the JFH1 NS5B-3'UTR (5-5A recombinant), including the genotype 2a-derived mutations F1464L/A1672S/D2979G (LSG), to grow efficiently in Huh7.5 cells, thus identifying the E2 mutation S399F. The combination of LSG/S399F and reported TNcc(1a)-adaptive mutations A1226G/Q1773H/N1927T/Y2981F/F2994S promoted adaptation of the full-length HCV-1 clone. An HCV-1 recombinant with 17 mutations (HCV1cc) replicated efficiently in Huh7.5 cells and produced supernatant infectivity titers of 10(4.0) focus-forming units (FFU)/ml. Eight of these mutations were identified from passaged HCV-1 viruses, and the A970T/I1312V/C2419R/A2919T mutations were essential for infectious particle production. Using CD81-deficient Huh7 cells, we further demonstrated the importance of A970T/I1312V/A2919T or A970T/C2419R/A2919T for virus assembly and that the I1312V/C2419R combination played a major role in virus release. Using a similar approach, we found that NS5B mutation F2994R, identified here from culture-adapted full-length TN viruses and a common NS3 helicase mutation (S1368P) derived from viable H77C and HCV-1 5-5A recombinants, initiated replication and culture adaptation of H77C containing LSG and TNcc(1a)-adaptive mutations. An H77C recombinant harboring 19 mutations (H77Ccc) replicated and spread efficiently after transfection and subsequent infection of naive Huh7.5 cells, reaching titers of 10(3.5) and 10(4.4) FFU/ml, respectively. Hepatitis C virus (HCV) was discovered in 1989 with the cloning of the prototype strain HCV-1 genome. In 1997, two molecular clones of H77, the other HCV prototype strain, were shown to be infectious in chimpanzees, but not in vitro. HCV research was hampered by a lack of infectious cell culture systems, which became available only in 2005 with the discovery of JFH1 (genotype 2a), a genome that could establish infection in Huh7.5 cells. Recently, we developed in vitro infectious clones for genotype 1a (TN), 2a (J6), and 2b (J8, DH8, and DH10) strains by identifying key adaptive mutations. Globally, genotype 1 is the most prevalent. Studies using HCV-1 and H77 prototype sequences have generated important knowledge on HCV. Thus, the in vitro infectious clones developed here for these 1a strains will be of particular value in advancing HCV research. Moreover, our findings open new avenues for the culture adaptation of HCV isolates of different genotypes. Copyright © 2015, American Society for Microbiology. All Rights Reserved.
Yamashita, Teruo; Ito, Miyabi; Tsuzuki, Hideaki; Sakae, Kenji; Minagawa, Hiroko
2010-04-01
Of 58 enterovirus strains isolated from Japanese travellers returning from Asian countries, eight were non-serotypable with existing antisera. By sequencing a part of the VP1 region, six of these strains were typed as echovirus 9, enterovirus (EV)-73, EV-79 or EV-97. The nucleotide identity of the VP1 region of isolate T92-1499 to all enterovirus prototypes was <70 %. The VP1 sequence of isolate TN94-0349 was closely related to coxsackievirus (CV)-A9 (73.3 % nucleotide identity), but the virus could not be neutralized with a serum raised against the prototype CV-A9 strain. On the basis of complete molecular comparisons, T92-1499 and TN94-0349 were identified as EV-98 and EV-107, respectively, by the ICTV Picornavirus Study Group. Serum neutralization tests of Japanese individuals revealed a seroprevalence rate of 11 % for EV-73, and even lower seroprevalence rates, 1.0-3.8 %, were found for the other new enteroviruses, suggesting that prior circulation of these viruses in Japan was unlikely.
ERIC Educational Resources Information Center
Tam, Raymond Kwok-Wai
2017-01-01
In the previous literature on gifted education in Hong Kong, there has been little mention of special schools for gifted and/or talented students in Hong Kong except for GT College, Hong Kong's first college for the gifted. Some notable researchers in gifted education in Hong Kong have described the college briefly with regard to its admission…
Consensus statement on iodine deficiency disorders in Hong Kong.
But, Betty; Chan, C W; Chan, Fredriech; Chan, K W; Cheng, Anna W F; Cheung, Patrick; Choi, K L; Chow, C B; Chow, Francis C C; Eastman, Creswell; Fok, T F; Fung, L M; Gomes, Cynthia; Huen, K F; Ip, T P; Kung, Annie W C; Lam, Karen S L; Lam, Y Y; Lao, Terence; Lee, C Y; Lee, K F; Leung, Jenny; Leung, N K; Li, Dominic; Li, June; Lo, K W; Lo, Louis; Ng, K L; Siu, S C; Tam, Sidney; Tan, Kathryn C B; Tiu, S C; Tse, H Y; Tse, Winnie; Wong, Gary; Wong, Shell; Wong, William; Yeung, Vincent T F; Young, Rosie; Yu, C M; Yu, Richard
2003-12-01
This article reviews the available data on the study of iodine deficiency disorders in Hong Kong and to discuss the approach towards preventing such disorders in Hong Kong. The importance of iodine and iodine deficiency disorders is described, and the available data on the dietary iodine intake and urinary iodine concentration in different populations of Hong Kong are summarised and discussed. Dietary iodine insufficiency among pregnant women in Hong Kong is associated with maternal goitrogenesis and hypothyroxinaemia as well as neonatal hypothyroidism. Borderline iodine deficiency exists in the expectant mothers in Hong Kong. Women of reproductive age, and pregnant and lactating women should be made aware and educated to have an adequate iodine intake, such as iodised salt, as an interim measure. A steering group involving all stakeholders should be formed to advise on the strategy of ensuring adequate iodine intake, including universal iodisation of salt in Hong Kong. Continuous surveillance of iodine status in the Hong Kong population is necessary.
Lau, Stanley CK; Riedel, Thomas; Fiebig, Anne; ...
2015-08-11
Loktanella hongkongensis UST950701-009PT is a Gram-negative, non-motile and rod-shaped bacterium isolated from a marine biofilm in the subtropical seawater of Hong Kong. When growing as a monospecies biofilm on polystyrene surfaces, this bacterium is able to induce larval settlement and metamorphosis of a ubiquitous polychaete tubeworm Hydroides elegans. The inductive cues are low-molecular weight compounds bound to the exopolymeric matrix of the bacterial cells. In the present study we describe the features of L. hongkongensis strain DSM 17492T together with its genome sequence and annotation and novel aspects of its phenotype. The 3,198,444 bp long genome sequence encodes 3104 protein-codingmore » genes and 57 RNA genes. Lastly, the two unambiguously identified extrachromosomal replicons contain replication modules of the RepB and the Rhodobacteraceae-specific DnaA-like type, respectively.« less
Lau, Stanley Ck; Riedel, Thomas; Fiebig, Anne; Han, James; Huntemann, Marcel; Petersen, Jörn; Ivanova, Natalia N; Markowitz, Victor; Woyke, Tanja; Göker, Markus; Kyrpides, Nikos C; Klenk, Hans-Peter; Qian, Pei-Yuan
2015-01-01
Loktanella hongkongensis UST950701-009P(T) is a Gram-negative, non-motile and rod-shaped bacterium isolated from a marine biofilm in the subtropical seawater of Hong Kong. When growing as a monospecies biofilm on polystyrene surfaces, this bacterium is able to induce larval settlement and metamorphosis of a ubiquitous polychaete tubeworm Hydroides elegans. The inductive cues are low-molecular weight compounds bound to the exopolymeric matrix of the bacterial cells. In the present study we describe the features of L. hongkongensis strain DSM 17492(T) together with its genome sequence and annotation and novel aspects of its phenotype. The 3,198,444 bp long genome sequence encodes 3104 protein-coding genes and 57 RNA genes. The two unambiguously identified extrachromosomal replicons contain replication modules of the RepB and the Rhodobacteraceae-specific DnaA-like type, respectively.
Delayed Disease Progression in Cynomolgus Macaques Infected with Ebola Virus Makona Strain.
Marzi, Andrea; Feldmann, Friederike; Hanley, Patrick W; Scott, Dana P; Günther, Stephan; Feldmann, Heinz
2015-10-01
In late 2013, the largest documented outbreak of Ebola hemorrhagic fever started in Guinea and has since spread to neighboring countries, resulting in almost 27,000 cases and >11,000 deaths in humans. In March 2014, Ebola virus (EBOV) was identified as the causative agent. This study compares the pathogenesis of a new EBOV strain, Makona, which was isolated in Guinea in 2014 with the prototype strain from the 1976 EBOV outbreak in the former Zaire. Both strains cause lethal disease in cynomolgus macaques with similar pathologic changes and hallmark features of Ebola hemorrhagic fever. However, disease progression was delayed in EBOV-Makona-infected animals, suggesting decreased rather than increased virulence of this most recent EBOV strain.
Hong Kong is an impact crater: Proof from the geomorphological and geological evidence
NASA Technical Reports Server (NTRS)
Chan, Chu-Lok; Wu, Siben; Luo, Xiuquan
1992-01-01
Hong Kong is a city in southern China. The urban districts of Hong Kong, Kowloon, and Victoria Harbour are situated within Hong Kong. Hong Kong is surrounded by mountains with a diameter of 11 km. Three million people live inside the basin. The round structure of the mountains in Hong Kong has been describd as a granite dome that is deeply eroded (batholith). The circularity of the mountains, the existence of a central hill, the inner slope of the mountains being greater than the outer slope, the presence of deep layer rock inside the basin, and the depth-to-diameter ratio were studied. All this evidence shows that the Hong Kong structure satisfies the geomorphological requirement of an impact crater. Some shock metamorphic phenomena of the rocks in Hong Kong such as planar features, microspherilitic silica glass (lechaterlierite), fused margins of rock fragments, concussion fractures, impact glass in which some schlierens are consistent with pyroxene spiculites, etc., were first discovered in Oct. 1990. In Hong Kong Island, an impact melt sheet was observed from the Victoria Peak to the southern shore. Quenching fractures of quartz in Kowloon fine-grained granite was also discovered. In our work, the K-Ar age (83.34 + 1.26 m.y.) of the impact melt rock, which is younger in comparison to the K-Ar age (117 m.y.) in Hong Kong and Kowloon granite, was measured, and the phenomena indicate that after the granite body formed, there was another geologic event. Maybe it is the Hong Kong cratering event.
Hong Kong is an impact crater: Proof from the geomorphological and geological evidence
NASA Astrophysics Data System (ADS)
Chan, Chu-Lok; Wu, Siben; Luo, Xiuquan
Hong Kong is a city in southern China. The urban districts of Hong Kong, Kowloon, and Victoria Harbour are situated within Hong Kong. Hong Kong is surrounded by mountains with a diameter of 11 km. Three million people live inside the basin. The round structure of the mountains in Hong Kong has been describd as a granite dome that is deeply eroded (batholith). The circularity of the mountains, the existence of a central hill, the inner slope of the mountains being greater than the outer slope, the presence of deep layer rock inside the basin, and the depth-to-diameter ratio were studied. All this evidence shows that the Hong Kong structure satisfies the geomorphological requirement of an impact crater. Some shock metamorphic phenomena of the rocks in Hong Kong such as planar features, microspherilitic silica glass (lechaterlierite), fused margins of rock fragments, concussion fractures, impact glass in which some schlierens are consistent with pyroxene spiculites, etc., were first discoverd in Oct. 1990. In Hong Kong Island, an impact melt sheet was observed from the Victoria Peak to the southern shore. Quenching fractures of quartz in Kowloon fine-grained granite was also discovered. In our work, the K-Ar age (83.34 + 1.26 m.y.) of the impact melt rock, which is younger in comparison to the K-Ar age (117 m.y.) in Hong Kong and Kowloon granite, was measured, and the phenomena indicate that after the granite body formed, there was another geologic event. Maybe it is the Hong Kong cratering event.
Implementation of the Hong Kong Language Policy in Pre-School Settings
ERIC Educational Resources Information Center
Leung, Cheung-Shing Sam; Lim, Swee Eng Audrey; Li, Yuen Ling
2013-01-01
In the past, the Curriculum Development Council in Hong Kong [Curriculum Development Council (CDC). (1996). "Guide to the Pre-Primary Curriculum." Hong Kong: Government Printer; CDC. (2000). "Consultation Document: Learning to Learn: The Way Forward in Curriculum Development." Hong Kong: Government Printer; CDC. (2001).…
Hong Kong Tertiary Students' Conceptions of Assessment of Academic Ability
ERIC Educational Resources Information Center
Wang, Zhenlin; Brown, Gavin T. L.
2014-01-01
Students' beliefs, attitudes, experiences and responses towards assessment reflect the ecology of their specific context. The study examines Hong Kong tertiary students' conceptions of assessment using focus group interviews and the content analysis technique. Using six focus groups, 26 Hong Kong university students were interviewed. Hong Kong…
Ergonomics of disposable handles for minimally invasive surgery.
Büchel, D; Mårvik, R; Hallabrin, B; Matern, U
2010-05-01
The ergonomic deficiencies of currently available minimally invasive surgery (MIS) instrument handles have been addressed in many studies. In this study, a new ergonomic pistol handle concept, realized as a prototype, and two disposable ring handles were investigated according to ergonomic properties set by new European standards. In this study, 25 volunteers performed four practical tasks to evaluate the ergonomics of the handles used in standard operating procedures (e.g., measuring a suture and cutting to length, precise maneuvering and targeting, and dissection of a gallbladder). Moreover, 20 participants underwent electromyography (EMG) tests to measure the muscle strain they experienced while carrying out the basic functions (grasp, rotate, and maneuver) in the x, y, and z axes. The data measured included the number of errors, the time required for task completion, perception of pressure areas, and EMG data. The values for usability in the test were effectiveness, efficiency, and user satisfaction. Surveys relating to the subjective rating were completed after each task for each of the three handles tested. Each handle except the new prototype caused pressure areas and pain. Extreme differences in muscle strain could not be observed for any of the three handles. Experienced surgeons worked more quickly with the prototype when measuring and cutting a suture (approximately 20%) and during precise maneuvering and targeting (approximately 20%). On the other hand, they completed the dissection task faster with the handle manufactured by Ethicon. Fewer errors were made with the prototype in dissection of the gallbladder. In contrast to the handles available on the market, the prototype was always rated as positive by the volunteers in the subjective surveys. None of the handles could fulfil all of the requirements with top scores. Each handle had its advantages and disadvantages. In contrast to the ring handles, the volunteers could fulfil most of the tasks more efficiently using the prototype handle without any remarkable pressure areas, cramps, or pain.
Ka-Shui, L O
2001-01-01
One of the significant features of Hong Kong is its public healthcare system, which provides universal, easily accessible and heavily subsidized medical care for all. The governing policy has been to ensure that no one is denied adequate medical care because of insufficient means through the provision of a comprehensive range of healthcare services funded from the public purse at extremely low fees to users. Over the past decade, the public hospital sector has been able to provide efficient and quality health services comparable to those of the industrialised nations. However, the reality today is that the public hospitals are facing many challenges that must be overcome and ways must be sought to mitigate the growing strains on the healthcare system and rebalance the healthcare economics. The recently published Consultation Document on Healthcare Reform, by Dr E K Yeoh, Secretary for Health & Welfare, proposes the introduction of a comprehensive range of short-term and long-term initiatives to revitalize and transform the healthcare system into a community-focused, patient-centred and knowledge-based integrated healthcare service with improved interface between the public and private sectors.
Poverty, deprivation, and depressive symptoms among older adults in Hong Kong.
Cheung, Kelvin Chi Kin; Chou, Kee-Lee
2017-10-31
Examine the association of income poverty and material deprivation with depression in old age. Our data contains a survey of 1,959 older Chinese adults in Hong Kong. We used the Geriatric Depression Scale - Short Form to assess their depressive symptoms. Income poverty was defined as having household income below half the median household income (adjusted by household size); material deprivation was measured by a validated 28-item material deprivation. In addition to income poverty and material deprivation, we also assessed the effect of socio-demographic variables, financial strain, health indicators, and social and community resources on depressive symptoms. Those who experienced material deprivation reported a significantly more severe depressive symptoms, even after income poverty and all other covariates were controlled for; the bivariate association between income poverty and depressive symptoms disappeared once material deprivation was controlled for. Further, we found a significant interaction effect between income poverty and material deprivation on depressive symptoms; and both engagement in cultural activities and neighborhood collective efficacy moderated the impact of being materially deprived on depressive symptoms. Our results have important policy implications for the measurement of poverty and for the development of anti-poverty measures for materially deprived older adults.
Neoliberalism in Two Hong Kong School Categories
ERIC Educational Resources Information Center
Woo, David
2013-01-01
This article examines the link between the governance of Hong Kong's international school and Direct Subsidy Scheme school categories and changes in the broader Hong Kong society through a neoliberal framework. As Hong Kong's economy has grown since the 1997 handover to the People's Republic of China, an increasing number of people have come to…
Intra-Nationalization of Higher Education: The Hong Kong Case
ERIC Educational Resources Information Center
Chao, Roger Y.
2012-01-01
This paper explores the internationalization of higher education initiatives of Hong Kong, being one of the Special Administrative Regions (SAR) of China, within the context of the Chinese Mainland-Hong Kong (CM-HK) relations. Historical, social, economic, and political ties between Hong Kong and the Mainland of China, their economic and political…
Quality Assurance and School Monitoring in Hong Kong
ERIC Educational Resources Information Center
Mok, Magdalena Mo Ching
2007-01-01
This study reports on the Hong Kong education quality assurance and school monitoring system. Three research questions were addressed: (1) Who controls the quality of school education in Hong Kong? (2) What strategies are used in the Hong Kong school education quality assurance process? (3) Agenda for Future Research on quality assurance and…
Traumatic Brain Injury Rehabilitation in Hong Kong: A Review of Practice and Research.
Yu, Junhong; Tam, Helena M K; Lee, Tatia M C
2015-01-01
The rising public health concern regarding traumatic brain injury (TBI) implies a growing need for rehabilitation services for patients surviving TBI. To this end, this paper reviews the practices and research on TBI rehabilitation in Hong Kong so as to inform future developments in this area. This paper begins by introducing the general situation of TBI patients in Hong Kong and the need for rehabilitation. Next, the trauma system in Hong Kong is introduced. Following that is a detailed description of the rehabilitation services for TBI patients in Hong Kong, as exemplified by a rehabilitation hospital in Hong Kong. This paper will also review intervention studies on rehabilitating brain-injured populations in Hong Kong with respect to various rehabilitation goals. Lastly, the implications of culture-related issues will be discussed in relation to TBI. The intervention studies conducted in Hong Kong are generally successful in achieving various rehabilitative outcomes. Additionally, certain cultural-related issues, such as the stigma associated with TBI, may impede the rehabilitative process and lead to various psychosocial problems.
Lee, K L; Chan, Y H; Lee, T C; Goggins, William B; Chan, Emily Y Y
2016-07-01
This paper presents a study to develop a heat index, for use in hot and humid sub-tropical climate in Hong Kong. The study made use of hospitalization data and heat stress measurement data in Hong Kong from 2007 to 2011. The heat index, which is called Hong Kong Heat Index (HKHI), is calculated from the natural wet bulb temperature, the globe temperature, and the dry bulb temperature together with a set of coefficients applicable to the high humidity condition in the summer of Hong Kong. Analysis of the response of hospitalization rate to variation in HKHI and two other heat indices, namely Wet Bulb Globe Temperature (WBGT) and Net Effective Temperature (NET), revealed that HKHI performed generally better than WBGT and NET in reflecting the heat stress impact on excess hospitalization ratio in Hong Kong. Based on the study results, two reference criteria of HKHI were identified to establish a two-tier approach for the enhancement of the heat stress information service in Hong Kong.
Ruan, Yi Jun; Wei, Chia Lin; Ee, Ai Ling; Vega, Vinsensius B; Thoreau, Herve; Su, Se Thoe Yun; Chia, Jer-Ming; Ng, Patrick; Chiu, Kuo Ping; Lim, Landri; Zhang, Tao; Peng, Chan Kwai; Lin, Ean Oon Lynette; Lee, Ng Mah; Yee, Sin Leo; Ng, Lisa F P; Chee, Ren Ee; Stanton, Lawrence W; Long, Philip M; Liu, Edison T
2003-05-24
The cause of severe acute respiratory syndrome (SARS) has been identified as a new coronavirus. Whole genome sequence analysis of various isolates might provide an indication of potential strain differences of this new virus. Moreover, mutation analysis will help to develop effective vaccines. We sequenced the entire SARS viral genome of cultured isolates from the index case (SIN2500) presenting in Singapore, from three primary contacts (SIN2774, SIN2748, and SIN2677), and one secondary contact (SIN2679). These sequences were compared with the isolates from Canada (TOR2), Hong Kong (CUHK-W1 and HKU39849), Hanoi (URBANI), Guangzhou (GZ01), and Beijing (BJ01, BJ02, BJ03, BJ04). We identified 129 sequence variations among the 14 isolates, with 16 recurrent variant sequences. Common variant sequences at four loci define two distinct genotypes of the SARS virus. One genotype was linked with infections originating in Hotel M in Hong Kong, the second contained isolates from Hong Kong, Guangzhou, and Beijing with no association with Hotel M (p<0.0001). Moreover, other common sequence variants further distinguished the geographical origins of the isolates, especially between Singapore and Beijing. Despite the recent onset of the SARS epidemic, genetic signatures are emerging that partition the worldwide SARS viral isolates into groups on the basis of contact source history and geography. These signatures can be used to trace sources of infection. In addition, a common variant associated with a non-conservative aminoacid change in the S1 region of the spike protein, suggests that immunological pressures might be starting to influence the evolution of the SARS virus in human populations.
Overview of the experimental tests in prototype
NASA Astrophysics Data System (ADS)
Egusquiza, Eduard; Valentín, David; Presas, Alexandre; Valero, Carme
2017-04-01
Experimental tests in prototype are necessary to understand the dynamic behaviour of the machine during different operating points. Hydraulic phenomena as well as its effect on the structure need to be studied in order to avoid instabilities during operation and to extend the life-time of the different components. For this purpose, a complete experimental study of a large Francis turbine prototype has been performed installing several sensors along the machine. Pressure sensors were installed in the penstock, spiral case, runner and draft tube, strain gauges were installed in the runner, vibration sensors were used in the stationary parts and different electrical and operational parameters were also measured. All these signals were acquired simultaneously for different operating points of the turbine.
Monecke, Stefan; Coombs, Geoffrey; Shore, Anna C.; Coleman, David C.; Akpaka, Patrick; Borg, Michael; Chow, Henry; Ip, Margaret; Jatzwauk, Lutz; Jonas, Daniel; Kadlec, Kristina; Kearns, Angela; Laurent, Frederic; O'Brien, Frances G.; Pearson, Julie; Ruppelt, Antje; Schwarz, Stefan; Scicluna, Elizabeth; Slickers, Peter; Tan, Hui-Leen; Weber, Stefan; Ehricht, Ralf
2011-01-01
In recent years, methicillin-resistant Staphylococcus aureus (MRSA) have become a truly global challenge. In addition to the long-known healthcare-associated clones, novel strains have also emerged outside of the hospital settings, in the community as well as in livestock. The emergence and spread of virulent clones expressing Panton-Valentine leukocidin (PVL) is an additional cause for concern. In order to provide an overview of pandemic, epidemic and sporadic strains, more than 3,000 clinical and veterinary isolates of MRSA mainly from Germany, the United Kingdom, Ireland, France, Malta, Abu Dhabi, Hong Kong, Australia, Trinidad & Tobago as well as some reference strains from the United States have been genotyped by DNA microarray analysis. This technique allowed the assignment of the MRSA isolates to 34 distinct lineages which can be clearly defined based on non-mobile genes. The results were in accordance with data from multilocus sequence typing. More than 100 different strains were distinguished based on affiliation to these lineages, SCCmec type and the presence or absence of PVL. These strains are described here mainly with regard to clinically relevant antimicrobial resistance- and virulence-associated markers, but also in relation to epidemiology and geographic distribution. The findings of the study show a high level of biodiversity among MRSA, especially among strains harbouring SCCmec IV and V elements. The data also indicate a high rate of genetic recombination in MRSA involving SCC elements, bacteriophages or other mobile genetic elements and large-scale chromosomal replacements. PMID:21494333
Education Reform in Hong Kong: The "Through-Road" Model and Its Societal Consequences
ERIC Educational Resources Information Center
Poon, Anita Y. K.; Wong, Yiu-Chung
2008-01-01
Although Hong Kong's education system has long been criticized as lacking in creativity and over-emphasising rote learning, on the whole it has served Hong Kong well in the past years, breeding outstanding business, academic and political leaders who continue to maintain Hong Kong's competitive edge. The traditional elite schools have played a…
ERIC Educational Resources Information Center
Chan, Wai Ling
2016-01-01
This study examines the discrepancy between teachers' beliefs and practices in Hong Kong kindergartens and the factors that influence this discrepancy. Three kindergartens, considered by the Hong Kong Education Bureau to be of varying quality, were chosen from different areas of Hong Kong. Questionnaires about teaching beliefs were administered to…
Referencing and Borrowing from Other Systems: The Hong Kong Education Reforms
ERIC Educational Resources Information Center
Forestier, Katherine; Adamson, Bob; Han, Christine; Morris, Paul
2016-01-01
Background: This paper analyses the role of, and approach to, policy referencing and borrowing in Hong Kong's recent reforms that culminated in the creation of its New Academic Structure and the Hong Kong Diploma of Secondary Education. Main argument: It argues that Hong Kong has gone further than most jurisdictions not just in responding to…
2010-01-01
We also compare the genome sequences of the recent isolates with those of the prototype HAdV-14 that circulated in Eurasia 30 years ago and the...closely related sequence of HAdV-11a, which has been circulating in southeast Asia. Conclusions: The data suggest that the currently circulating strain of...both mild and severe outbreaks. We also compare the genome sequences of the recent isolates with those of the prototype HAdV-14 that circulated in
Impacts of Credit Cards on Individuals, Families and Society in Hong Kong: An Exploration.
ERIC Educational Resources Information Center
Chan, Alfred C. M.
Credit cards have swept through almost every social class and all ages in Hong Kong. This paper attempts to provide a preliminary analysis of the possible impact of credit cards on individuals and their families in Hong Kong. A literature review reveals that Hong Kong people, while enjoying the freedom and convenience of "plastic money,"…
ERIC Educational Resources Information Center
Chou, Bill K. P.
2012-01-01
This article seeks to explain a paradox concerning education qualities and reform in Hong Kong and Macau: Hong Kong is ranked higher than Macau on Program for International Student Assessment and various world university leagues. Even so, the education reform in Hong Kong is more profound and vigorous than that in Macau. From the postcolonial…
ERIC Educational Resources Information Center
Spires, Robert W.
2016-01-01
Many social issues exist for marginalized youth in the New Territories of Hong Kong, despite Hong Kong's high standard of living. Increasingly, attention is being paid to social mobility of Hong Kong's younger generations. Youth in the New Territories face academic, economic, social and cultural barriers, in part due to tracking into low-ranked…
Developments in Teacher Education in Hong Kong: 1997 and Beyond.
ERIC Educational Resources Information Center
Pang, K. C.
This paper describes the initial and inservice education of teachers in Hong Kong, and explores improving teacher education in the context of a changing era. According to the Basic Law for the future Hong Kong Government after China takes over in 1997, Hong Kong will not dispose of the existing educational system, but will build on it and continue…
Education Reform in Hong Kong and the Paradigm Shift.
ERIC Educational Resources Information Center
Fok, Shui Che
Hong Kong has always been proud of its economic achievement of the past decades. However, the economic turmoil that swept over East Asia has revealed the weakness in its economy, which, in turn, urges Hong Kong to reform its education system to meet the challenge of this era of information technology. There are many problems in Hong Kong's…
Reforming the Curriculum in a Post-Colonial Society: The Case of Hong Kong
ERIC Educational Resources Information Center
Kennedy, Kerry J.; Fok, Ping Kwan; Chan, Kin Sang Jacqueline
2006-01-01
The current curriculum reform agenda in Hong Kong is enmeshed in the politics of a post-colonial society. Yet, there is not a single view of what post-coloniality means for Hong Kong's school curriculum. This article focuses on analyzing the curriculum reform agenda that has emerged in post-colonial Hong Kong. This agenda was not only…
European Languages and Culture in Hong Kong: Trade or Education?
ERIC Educational Resources Information Center
Cribbin, John
2009-01-01
Hong Kong Government policy is to promote Hong Kong as an international education hub for the region. This may be more rhetoric than reality. The article surveys the historical background of Hong Kong in terms of its role as a trading centre, a gateway to China and a meeting place for East and West for which interchange with European languages and…
Wong, Joyce Y P; Chin, David; Fung, Henry; Li, Ann; Wong, Marcus M S; Kwok, Henry K H
2014-01-01
Upper limb musculoskeletal complaints are common among certain health professionals. We report two cases, both involving technicians working in a diagnostic tuberculosis laboratory in Hong Kong. A work process evaluation suggest that the need to repeatedly open and close small bottles, as well as to work for prolonged periods of time in confined areas, could be related to the workers' clinical presentation. The cases are also compatible with the diagnosis of repetitive strain injury (RSI) of the upper limb, but this term is not commonly used nowadays because of various definitional issues. A review of the various diagnostic issues in RSI is presented.
2010-11-01
and Escherichia ferguso- . TABLE 2. General characteristics of the plasm ids from ETEC strains H10407 and E1392/75 Value in E. c·oli: Characteristic...0352). consetved proteins with unknown func- tions (CDSs 0673 to 0678), a flavoprotein electron transfer system (CDSs 1730 to 1734), the colanic...mediating diarrhea are not chromosomally encoded. indicating that the essential virulence factors are encoded on the plasm ids (61 ). Potentia l
Spring roll dielectric elastomer actuators for a portable force feedback glove
NASA Astrophysics Data System (ADS)
Zhang, Rui; Lochmatter, Patrick; Kunz, Andreas; Kovacs, Gabor
2006-03-01
Miniature spring roll dielectric elastomer actuators for a novel kinematic-free force feedback concept were manufactured and experimentally characterized. The actuators exhibited a maximum blocking force of 7.2 N and a displacement of 5 mm. The theoretical considerations based on the material's incompressibility were discussed in order to estimate the actuator behavior under blocked-strain activation and free-strain activation. One prototype was built for the demonstration of the proposed force feedback concept.
1983-09-01
17 adenovirus strains were found to be antigenically related to prototype Ad 15 by neutralization. No relationship to Ad 15, but to Ad 9 could be detected by hemagglutination-inhibition; we therefore named them Ad 15/H9 intermediate strains. After analysis of the genome by five different restriction enzymes, the fragment patterns obtained deviated widely from the prototype Ad 15, but only slightly from Ad 9. Differences could also be observed among the variants. After digestion by five restriction enzymes, altogether six genome types could be established among the 17 intermediate strains. To map the variations on the genome of the 15/H9 strains, two methods were employed: the double digestion of the DNA and DNA fragments together with the determination of the terminal fragments made it possible to construct a physical map. The second method depends on a particularity of adenoviruses: the DNA is covalently linked with a 55 kD protein at the 5' terminus. After digestion of the DNA, which does contain this protein, the terminal DNA fragments do not migrate into the agarose gel; after an additional digestion with pronase B, they do migrate into the gel. Thus the terminal fragments were determined by comparing the fragment patterns with and without previous pronase B treatment.
[Relationship between leaf anatomical structure and heat resistance of 15 Rhododendron cultivars].
Shen, Hui Fei; Zhao, Bing; Xu, Jing Jing
2016-12-01
In this study, 17 anatomical structure indexes of 15 Rhododendron cultivars were mea-sured by scanning electron microscope (SEM). Leaf anatomical structure indexes were screened via coefficient of variation, analysis of correlation and hierarchical cluster analysis, and comprehensive evaluation on heat resistance for each cultivar was conducted by the subordinate function. The results showed that the leaves of Rhododendron cultivars were typical bifacial leaf and the epidermal anticlinal walls showed slightly sinuate. The stomata only distributed in the lower epidermis and the shape was ruleless. The anatomical structure indexes all reached a significant level difference among 15 cultivars (P<0.01), except for lower epidermis thickness (P<0.05). Thickness of lamina corneum, stomatal density, stomatal width, the thickness palisade tissue and looseness of leaf spongy tissue were the main factors related to the hardness, while other indexes, such as stomatal length, stoma aperture, stomatal opening, length and thickness of upper epidermis, length and thickness of lower epidermis, thickness of spongy tissue, the ratio of the palisade tissue to spongy tissue, tightness of leaf palisade tissue, leaf thickness and media thickness didn't show much effect on heat resistance. There were some differences among 15 cultivars in heat resistance, and the order was Rhododendron 'Song Jiang Da Tao Hong' > Rhododendron 'Zhuang Yuan Hong' > Rhododendron 'Lv Se Guang Hui' > Rhododendron 'Fen Zhen Zhu' > Rhododendron 'Wai Guo Hong' > Rhododendron 'Lan Yin' > Rhododendron 'Bi Zhi' >Rhododendron 'Da He Zhi Chun' > Rhododendron 'Guo Qi Hong' > Rhododendron 'Yu Ling Long' > Rhododendron 'Hong Shan Hu' > Rhododendron 'Ning Bo Hong' > Rhododendron 'Tao Ban Zhu Sha' > Rhododendron 'Ai Ding Bao' > Rhododendron 'Liu Qiu Hong'. According to the heat hardiness, the cultivars could be divided into 4 groups: R. 'Song Jiang Da Tao Hong', R. 'Zhuang Yuan Hong' and R. 'Lv Se Guang Hui' with high heat resistance, R. 'Fen Zhen Zhu', R. 'Wai Guo Hong', R. 'Lan Yin', R. 'Bi Zhi', R. 'Da He Zhi Chun', R. 'Guo Qi Hong' and R. 'Yu Ling Long' with medium heat resistance, R. 'Hong Shan Hu', R. 'Ning Bo Hong', R. 'Tao Ban Zhu Sha' and R. 'Ai Ding Bao' with lower heat resistance, R. 'Liu Qiu Hong' without heat resistance. However, the accurate heat hardiness evaluation of Rhododendron still needs to consider other factors, including morphological structure, physiological and biochemical indicators and genetic factor of heat resistance, the harmfulness of Rhododendron, and the recovery state after being injured by high temperature.
Molecular epidemiology of duck hepatitis a virus types 1 and 3 in China, 2010-2015.
Wen, X; Zhu, D; Cheng, A; Wang, M; Chen, S; Jia, R; Liu, M; Sun, K; Zhao, X; Yang, Q; Wu, Y; Chen, X
2018-02-01
Duck hepatitis A virus (DHAV) is the most common aetiologic agent of duck virus hepatitis (DVH), causing substantial economic losses in the duck industry worldwide. In China, officially approved DHAV-1 live-attenuated vaccines have been used widely to vaccinate breeder ducks since 2013. However, following the reports of DVH outbreaks, it has become necessary to assess the epidemiological situation of this virus in China. We conducted molecular epidemiological analyses of 32 DHAV field isolates while analysing the samples from ducks suspected of having hepatitis collected from commercial duck farms in China between May 2010 and December 2015. Considerable changes were observed in the epidemiology of DHAV-1 and DHAV-3 in China over time. A higher number of DHAV-1 strains were isolated during 2010-2012, coinciding with the widespread use of officially approved DHAV-1 live vaccine strains beginning in 2013. In contrast, a higher rate of DHAV-3 causing DHAV infections was observed between 2013 and 2015. Phylogenetic analyses based on the full-length VP1 gene were performed on these field isolates and using reference strains available in GenBank. DHAV-1 field isolates were evaluated in two groups: one group closely related to prototype strains and circulating in China between 2010 and 2012 and another group exhibiting genetic and serological differences from prototype strains. All DHAV-3 strains isolated in this study were grouped as monophyletic, which has become the predominant viral type, particularly in Shandong and Sichuan provinces, since 2013. In conclusion, these data provide updated information on the genetic and serological diversity of DHAV-1 and DHAV-3, and our findings may serve as a foundation for the prevention of, and vaccine development for, DHAV in China. © 2017 Blackwell Verlag GmbH.
The Dragon Cometh: 1997 and the ELT Scene in Hong Kong.
ERIC Educational Resources Information Center
Boyle, Joseph P.
The results of a survey of 180 part-time students' opinions on the standard of English in Hong Kong, on governmental efforts to improve the level of English in Hong Kong, and on how returning Hong Kong to China in 1997 will effect the standard of English are reported. The students were enrolled in a 6-year course in Chinese/English/Translation at…
ERIC Educational Resources Information Center
Bickley, Gillian
1990-01-01
Suggests that the attitudes of the people of Hong Kong toward learning English, during both an earlier period and at present, are similar and deeply entrenched. The increasing emigration of Hong Kong people, mainly to Anglophone countries, makes an international understanding of the attitude of Hong Kong people toward learning English very…
ERIC Educational Resources Information Center
Stevenson, Phoebe Hsu
2010-01-01
Since the establishment of the University of Hong Kong in 1911, higher education in Hong Kong has been transformed from an elitist system to one that supports the Hong Kong government's vision of a highly educated workforce and widely accessible lifelong learning. Between the late 1970s and 1994 the system expanded from admitting 2% of college-age…
Impacts of a STSE High School Biology Course on the Scientific Literacy of Hong Kong Students
ERIC Educational Resources Information Center
Lau, Kwok-chi
2013-01-01
The PISA performance of Hong Kong has prompted this study to investigate if scientific literacy (SL) of Hong Kong students can be improved further through a high school biology course employing the STSE approach. A STSE course was developed in accordance to the contexts of Hong Kong and a framework for the assessment of scientific literacy was…
A Study of the Impact of the First Phase of the Curriculum Reform on Student Learning in Hong Kong
ERIC Educational Resources Information Center
Yuen, Timothy W. W.; Cheung, Alan C. K.; Wong, Ping Man
2012-01-01
Purpose: To prepare Hong Kong students to face a rapidly changing twenty-first century, the Hong Kong Government implemented a major curriculum reform entitled Learning to Learn--The Way Forward in Curriculum Development. This reform has shaped the direction of Hong Kong's school education since 2001. The purpose of this paper is to examine the…
Reorganizing Hospital Space: The 1894 Plague Epidemic in Hong Kong and the Germ Theory.
Sihn, Kyu-Hwan
2017-04-01
This paper examined whether the preventive measures taken by the Hong Kong's colonial authorities were legitimate during the 1894 Hong Kong plague epidemic, and illuminated the correlation between the plague epidemic and hospital space in Hong Kong in the late 19th century. The quarantine measures taken by the colonial authorities were neither a clear-cut victory for Western medicine nor for a rational quarantine based on scientific medical knowledge. Hong Kong's medical officials based on the miasma theory, and focused only on house-to-house inspections and forced quarantine or isolation, without encouraging people to wear masks and without conducting disinfection. Even after Hong Kong plague spread, the Hong Kong's colonial authorities were not interested in what plague bacilli were, but in where they were to be found and how to prevent and control an outbreak of the disease. The germ theory brought significant changes to the disease classification system. Until the 1890s, Hong Kong's colonial authority had classified cause of death mainly on the basis of symptoms, infectious diseases, parts of the body and diseases of systems. Microbiological analysis of the cause of death in Hong Kong was started by Hunter, a bacteriologist, in 1902. He used bacteriological tests with a microscope to analyze the cause of death. New disease recognition and medical recognition brought large changes to hospital space as well. In particular, from the 1880s to the early 1900s, Western medical circles witnessed shifts from miasma theory to the germ theory, thereby influencing Hong Kong's hospital spaces. As the germ theory took ground in Hong Kong in 1894, the bacteriological laboratory and isolation ward became inevitable facilities, and hospital space were reorganized accordingly. However, the colonial authorities and local elites' strategy was different. As a government bacteriologist, Hunter established a central facility to unify several laboratories and to manage urban space from ouside the hospital. On the contrary, the Tungwah Hospital tried to transform hospital space with isolation ward and Receiving Ward System as the eclectic form of Chinese and Western medicine. The 1894 Hong Kong plague promoted the introduction of germ theory and the reorganization of hospital space.
Zhang, Di; Wang, Xiaming; Yuan, Xueru; Yang, Li; Xue, Yu; Xie, Qian
2016-01-01
China has witnessed remarkable progress in scientific performance in recent years. However, the quantity and quality of nursing publications from three major regions (Mainland China, Taiwan, and Hong Kong) have not been reported. This study aimed to investigate the characteristics of scientific research productivity from Mainland China, Taiwan, and Hong Kong in the field of nursing. Articles published in the 110 nursing journals originating from Mainland China, Taiwan, and Hong Kong between 2005 and 2014 were retrieved from the Web of Science. The total number of articles published, the impact factor, and the citation count were analyzed. There were 2,439 publications between 2005 and 2014 from China, including 438 from Mainland China, 1,506 from Taiwan, and 495 from Hong Kong. There was a significant increase in publications for these three regions (p < 0.05), especially for Mainland China, with a 59.50-fold increase experienced. From 2011, the number of publications from Mainland China exceeded that from Hong Kong. Taiwan had the highest total journal impact factor (2,142.81), followed by Hong Kong (720.39) and Mainland China (583.94). The mean journal impact factor from Hong Kong (1.46) was higher than that from Taiwan (1.42) and Mainland China (1.33). Taiwan had the highest total citation count (8,392), followed by Hong Kong (3,785) and Mainland China (1,493). The mean citation count from Hong Kong (7.65) was higher than that from Taiwan (5.57) and Mainland China (3.41). The Journal of Clinical Nursing was the most popular journal in the three regions. Chinese contributions to the field of nursing have significantly increased in the past ten years, particularly from Mainland China. Taiwan is the most productive region in China. Hong Kong had the highest-quality research output, according to mean journal impact factor and mean citation count.
High-sensitivity strain visualization using electroluminescence technologies
NASA Astrophysics Data System (ADS)
Xu, Jian; Jo, Hongki
2016-04-01
Visualizing mechanical strain/stress changes is an emerging area in structural health monitoring. Several ways are available for strain change visualization through the color/brightness change of the materials subjected to the mechanical stresses, for example, using mechanoluminescence (ML) materials and mechanoresponsive polymers (MRP). However, these approaches were not effectively applicable for civil engineering system yet, due to insufficient sensitivity to low-level strain of typical civil structures and limitation in measuring both static and dynamic strain. In this study, design and validation for high-sensitivity strain visualization using electroluminescence technologies are presented. A high-sensitivity Wheatstone bridge, of which bridge balance is precisely controllable circuits, is used with a gain-adjustable amplifier. The monochrome electroluminescence (EL) technology is employed to convert both static and dynamic strain change into brightness/color change of the EL materials, through either brightness change mode (BCM) or color alternation mode (CAM). A prototype has been made and calibrated in lab, the linearity between strain and brightness change has been investigated.
Perceptions of professional attributes in medicine: a qualitative study in Hong Kong.
Leung, Danny C; Hsu, Enoch K; Hui, Edwin C
2012-08-01
OBJECTIVE. Medical professionalism has been widely discussed in western scholarly literature. However, since Hong Kong has a mixed Chinese-western culture, it remains uncertain whether Hong Kong health care professionals, medical students, and patients see medical professionalism in exactly the same way as westerners. The objective of the present study was to explore perceptions of medical professionalism in Hong Kong. DESIGN. Individual semi-structured interviews. SETTING. Medical faculty preceptors, residents, interns, nurses, and students from the Li Ka Shing Faculty of Medicine of the University of Hong Kong. Subjects were recruited at an out-patient clinic of Queen Mary Hospital. PARTICIPANTS. We interviewed 39 subjects, including six medical faculty preceptors, six hospital residents, four medical interns, eight nurses, eight out-patients, and seven medical students. The interviews were transcribed and coded. Grounded theory was employed for framing and analysing the interviews. RESULTS. A total of 30 primary themes were identified and grouped under three secondary themes, ie 'Expectations of a professional doctor', 'Work values', and 'Patient care'. In general, the primary themes were consistent with recognised professional attributes in western bioethics, such as knowledge and skills, holistic care, and communication skills. A closer analysis suggested that traditional Chinese thought also played an important role in shaping the medical professionalism of Hong Kong. Challenges to be faced by Hong Kong doctors due to recent social changes were also identified. CONCLUSIONS. Medical professionalism in Hong Kong is shaped by both western medical ethics and traditional Chinese thought. The values treasured by Hong Kong health care professionals as well as technological advance, and the city's proximity to Mainland China makes Hong Kong health care unique. It is important to maintain the present work attitudes and at the same time adapt to new social changes.
Fozzard, A
1988-09-01
In the 1840s, the small fishing community that is now Hong Kong became a British colony and an important naval base for the Opium Wars. Now it is a leading capitalist center operating on mainland communist China. Hong Kong is scheduled to go back to China in 1997. In the agreement signed between the British government and China, Hong Kong's present lifestyle is guaranteed for at least 50 years. Textbook colonialism rules here. Foreigners hold the key jobs and earn much more than do the indigenous people. They even receive subsidized housing in this very high rent colony. As for the Hong Kong Chinese, overcrowding into 2 room apartments is the norm even though the government tries to provide more housing units. The large skyscrapers in the New Territories breed their unique social and mental health problems, such as poverty, drug abuse and frustration. Essentially all food is imported from communist China, yet agriculture in Hong Kong does exist--pig farms, duck lakes, and fields of the popular vegetable choi sum. Major industry comprise textiles and sweat shops which pay their workers (mostly illegal immigrants and children with no legal protection) wages that are 1/4 of those paid in Great Britain. Financial services, trade, and tourism may soon dominate Hong Kong's economy. Almost 4 million tourists visit Hong Kong yearly, often looking for bargains. Despite Hong Kong's active Western-like business climate, Chinese culture still abounds. Traditional incense burns in Buddhist temples. Snake soup is served in restaurants. Plus traditional medicine practiced alongside Western medicine contributes to Hong Kong having 1 of the lowest infant mortality rates in the world (9/1000) and to its high life expectancy of 76 years.
Vietnam and Britain agree to forced return of Vietnamese boat people in Hong Kong.
1991-10-31
On 29 October 1991, the Governments of the United Kingdom and Viet Nam reached an Agreement on the return of certain categories of Vietnamese "boat people," i.e., persons who fled from Viet Nam to Hong Kong. Under the Agreement, Vietnamese who arrive in Hong Kong after the date of the Agreement and who do not qualify for refugee status will be returned first. The determination of such status is to occur within six weeks of their arrival. Later, Vietnamese in Hong Kong who have already failed to qualify for refugee status will be returned. The Agreement follows an Agreement earlier in October to return Vietnamese arriving in Hong Kong who are known as "double backers," i.e., persons who had previously voluntarily been repatriated to Viet Nam only to return to Hong Kong.
Consumers' perceptions of health care: the case of Hong Kong.
Liu, S S; Dubinsky, A J
2000-01-01
The health care industry in Hong Kong has undergone major changes in organization as well as philosophy of operation since the 1970s. During this period, the Hong Kong government has also experienced a political transition from colonial status to a special administrative region of Mainland China. Because of the economic downturn in East Asia, including Hong Kong, contraction of public spending has compelled the government to reconsider the alternatives for health care provision in Hong Kong. A number of multinational health care providers have entered this market and operate mainly in the private sector, including solely-owned clinics and alliances with existing hospitals. This paper provides an understanding of the evolution and development of the health care industry in Hong Kong and, on that basis, suggests elements of quality health care from the findings of a survey of patients.
Analysis of Storm Surge in Hong Kong
NASA Astrophysics Data System (ADS)
Kao, W. H.
2017-12-01
A storm surge is a type of coastal flood that is caused by low-pressure systems such as tropical cyclones. Storm surges caused by tropical cyclones can be very powerful and damaging, as they can flood coastal areas, and even destroy infrastructure in serious cases. Some serious cases of storm surges leading to more than thousands of deaths include Hurricane Katrina (2005) in New Orleans and Typhoon Haiyan (2013) in Philippines. Hong Kong is a coastal city that is prone to tropical cyclones, having an average of 5-6 tropical cyclones entering 500km range of Hong Kong per year. Storm surges have seriously damaged Hong Kong in the past, causing more than 100 deaths by Typhoon Wanda (1962), and leading to serious damage to Tai O and Cheung Chau by Typhoon Hagupit (2008). To prevent economic damage and casualties from storm surges, accurately predicting the height of storm surges and giving timely warnings to citizens is very important. In this project, I will be analyzing how different factors affect the height of storm surge, mainly using data from Hong Kong. These factors include the windspeed in Hong Kong, the atmospheric pressure in Hong Kong, the moon phase, the wind direction, the intensity of the tropical cyclone, distance between the tropical cyclone and Hong Kong, the direction of the tropical cyclone relative to Hong Kong, the speed of movement of the tropical cyclone and more. My findings will also be compared with cases from other places, to see if my findings also apply for other places.
ERIC Educational Resources Information Center
Chan, Chi Chuen; Ohtsuka, Keis
2011-01-01
This study aims to investigate the characterization of male gamblers in popular Hong Kong movies in the past 50 years. A total of nine Hong Kong films with gambling themes were selected for analysis. The criteria for selection of the films were as follows: the movies in which the protagonists are portrayed by well known Hong Kong actors that…
ERIC Educational Resources Information Center
Willis, Mike
2005-01-01
Over 300 Foreign (non Hong Kong) universities deliver undergraduate degree programs in Hong Kong either on campus in that city or via distance education (or both). Although this topic has been studied from a variety of perspectives, the issue of why Hong Kong students might switch from one locally provided foreign university program to another has…
Avian influenza: risk, preparedness and the roles of public health nurses in Hong Kong.
Ho, Georgina; Parker, Judith
2006-03-01
This paper provides an overview of the Hong Kong government's influenza preparedness plan and the key roles of public health nurses in that plan. The part played by Hong Kong public health nurses in the management of the avian influenza outbreak in Hong Kong in 1997 and the sudden acute respiratory syndrome outbreak in 2003, together with the capacity-building work they are now undertaking in preparing for an influenza pandemic, highlight their crucial role in public health. Recent strengthening of public health infrastructure in Hong Kong and heightened public awareness of public health issues have facilitated more proactive and effective public health nursing activities.
Overview of the health care system in Hong Kong and its referential significance to mainland China.
Kong, Xiangyi; Yang, Yi; Gao, Jun; Guan, Jian; Liu, Yang; Wang, Renzhi; Xing, Bing; Li, Yongning; Ma, Wenbin
2015-10-01
Hong Kong's health system was established within the framework of a perfect market-oriented economic matrix, where there are wide-ranging social security and medical service systems. There are many differences in the economic foundations, social systems, and ideologies between Hong Kong and mainland China, therefore, it would probably be entirely impossible to copy Hong Kong's health care system mode. However, under the framework of one country, two systems, the referential significance of relevant concepts of Hong Kong's medical service system to mainland China cannot be ignored, and merits further study. Copyright © 2015. Published by Elsevier Taiwan.
Strain Imaging of Nanoscale Semiconductor Heterostructures with X-Ray Bragg Projection Ptychography
NASA Astrophysics Data System (ADS)
Holt, Martin V.; Hruszkewycz, Stephan O.; Murray, Conal E.; Holt, Judson R.; Paskiewicz, Deborah M.; Fuoss, Paul H.
2014-04-01
We report the imaging of nanoscale distributions of lattice strain and rotation in complementary components of lithographically engineered epitaxial thin film semiconductor heterostructures using synchrotron x-ray Bragg projection ptychography (BPP). We introduce a new analysis method that enables lattice rotation and out-of-plane strain to be determined independently from a single BPP phase reconstruction, and we apply it to two laterally adjacent, multiaxially stressed materials in a prototype channel device. These results quantitatively agree with mechanical modeling and demonstrate the ability of BPP to map out-of-plane lattice dilatation, a parameter critical to the performance of electronic materials.
Continuously controlled optical band gap in oxide semiconductor thin films
Herklotz, Andreas; Rus, Stefania Florina; Ward, Thomas Zac
2016-02-02
The optical band gap of the prototypical semiconducting oxide SnO 2 is shown to be continuously controlled through single axis lattice expansion of nanometric films induced by low-energy helium implantation. While traditional epitaxy-induced strain results in Poisson driven multidirectional lattice changes shown to only allow discrete increases in bandgap, we find that a downward shift in the band gap can be linearly dictated as a function of out-of-plane lattice expansion. Our experimental observations closely match density functional theory that demonstrates that uniaxial strain provides a fundamentally different effect on the band structure than traditional epitaxy-induced multiaxes strain effects. In conclusion,more » charge density calculations further support these findings and provide evidence that uniaxial strain can be used to drive orbital hybridization inaccessible with traditional strain engineering techniques.« less
Enhancing the electron mobility of SrTiO3 with strain
NASA Astrophysics Data System (ADS)
Jalan, Bharat; Allen, S. James; Beltz, Glenn E.; Moetakef, Pouya; Stemmer, Susanne
2011-03-01
We demonstrate, using high-mobility SrTiO3 thin films grown by molecular beam epitaxy, that stress has a pronounced influence on the electron mobility in this prototype complex oxide. Moderate strains result in more than 300% increases in the electron mobilities with values exceeding 120 000 cm2/V s and no apparent saturation in the mobility gains. The results point to a range of opportunities to tailor high-mobility oxide heterostructure properties and open up ways to explore oxide physics.
College Psychotherapy at a Hong Kong Counseling Center
ERIC Educational Resources Information Center
Leung, Eugenie Y.
2013-01-01
This article presents an online interview about college psychotherapy at a Hong Kong counseling center. The interview discusses how students generally feel about going for counseling or therapy and how common it is in Hong Kong.
Suicides in Hong Kong and Australia.
Yip, P S
1998-01-01
Although the suicide rate for both Hong Kong and Australia was about 12 per 100,000 in 1994, the age- and gender-specific rates, methods of suicide, and time trends vary greatly for these two places. This paper explores the possible social, economic, and cultural background to explain this discrepancy. We used the official suicide death statistics of Hong Kong and Australia for the period 1984-1994. We calculated age-standardized suicide rates in order to take into account the differences in the age composition between the two countries and years. We employed a log-linear (Poisson) model to detect the age- and gender-specific trends, and to determine whether there were specific age or gender groups whose suicide behavior had changed significantly between 1984 and 1994. Hong Kong experienced a slight increase in suicide rate for both genders in the years 1984-1994, whereas Australia experienced a cubic trend for both genders during the same period and a rise in suicide rate in recent years. The suicide rate in Hong Kong increased with age, with a sharp increase (nearly four times the average) among the group aged 75 or over. A relatively low gender ratio (male:female) was also observed in Hong Kong, whereas in Australia there was not much difference in suicide rates among all age groups, though the suicide rate of the group aged 75 or over was 1.2 times the average. The gender ratio in Australia was higher, and the male suicide rate was four times higher than that of females. The Hong Kong suicide rate in females was twice that of Australia, whereas the Hong Kong male suicide rate was about half that of Australia. Jumping and hanging were the most common methods of suicide in Hong Kong, accounting for more than 80% of all suicide deaths. Poisoning (including gas poisoning) was the most common method used in Australia, with firearms being more common among young males. Australia had a higher years of potential life lost (YPLL) than Hong Kong because of the higher suicide rate among young males (aged 15-24). The high suicide rate among the elderly in Hong Kong raises the possibility that medical and social support to the elderly could be enhanced. The high female suicide rate in Hong Kong could be related to workload, responsibility, and expectations. The high suicide rate in Australia among males aged 15-24 was disturbing. Availability of the suicide methods is certainly one explanation for the difference in suicide methods used in Hong Kong and Australia.
Lau, Joseph T F; Tsui, H Y; Ho, Shara P Y
2007-12-01
The present study investigated the prevalence of HIV and HIV-related behaviors and perceptions among 336 female sex workers (FSW) traveling from mainland China to work in Hong Kong. None of the participants tested HIV positive. Of the participants, 13.2% and 26.8%, respectively, would have unprotected sex with a client in Hong Kong or in mainland China if they liked the client; 16.7% and 21.7%, respectively, would have unprotected sex with a client in Hong Kong and in mainland China if he paid more. Of the participants, 98.5% used condoms in the last episode of sex work in Hong Kong and 78.1% were consistent condom users in Hong Kong in the last month. Yet, among those who previously worked as FSW in mainland China (n = 141), only 28.6% used condoms consistently in mainland China in the last year; 60% of those who used condoms inconsistently while in mainland China became consistent condom users in Hong Kong. Among those who did not use condoms in mainland China, willingness to have unprotected sex with a client who was liked by the FSW was a strong predictor for consistent condom use in Hong Kong (OR = 18.67, p < .001). Among those who were consistent condom users in Hong Kong, the same variable predicted inconsistent condom use while in mainland China (OR = 14.02, p < .05). Condom use behaviors change when FSW are working in different social contexts and behavioral changes are possible. Education programs should take socio-contextual factors into account.
Identifying Core Competencies of Infection Control Nurse Specialists in Hong Kong.
Chan, Wai Fong; Bond, Trevor G; Adamson, Bob; Chow, Meyrick
2016-01-01
To confirm a core competency scale for Hong Kong infection control nurses at the advanced nursing practice level from the core competency items proposed in a previous phase of this study. This would serve as the foundation of competency assurance in Hong Kong hospitals. A cross-sectional survey design was used. All public and private hospitals in Hong Kong. All infection control nurses in hospitals of Hong Kong. The 83-item proposed core competency list established in an earlier study was transformed into a questionnaire and sent to 112 infection control nurses in 48 hospitals in Hong Kong. They were asked to rate the importance of each infection prevention and control item using Likert-style response categories. Data were analyzed using the Rasch model. The response rate of 81.25% was achieved. Seven items were removed from the proposed core competency list, leaving a scale of 76 items that fit the measurement requirements of the unidimensional Rasch model. Essential core competency items of advanced practice for infection control nurses in Hong Kong were identified based on the measurement criteria of the Rasch model. Several items of the scale that reflect local Hong Kong contextual characteristics are distinguished from the overseas standards. This local-specific competency list could serve as the foundation for education and for certification of infection control nurse specialists in Hong Kong. Rasch measurement is an appropriate analytical tool for identifying core competencies of advanced practice nurses in other specialties and in other locations in a manner that incorporates practitioner judgment and expertise.
Serologic assays for the detection and strain identification of Pteropine orthoreovirus.
Singh, Harpal; Shimojima, Masayuki; Fukushi, Shuetsu; Fukuma, Aiko; Tani, Hideki; Yoshikawa, Tomoki; Taniguchi, Satoshi; Yang, Ming; Sugamata, Masami; Morikawa, Shigeru; Saijo, Masayuki
2016-05-11
Pteropine orthoreovirus (PRV), potentially of bat origin, is reported to be a causative agent of emerging respiratory tract infections among humans in Southeast Asia. We evaluated the efficacy of serologic assays using the major outer capsid and cell attachment proteins (CAP) of PRV strains in the screening, confirmation and identification of three groups of human PRV infections; Indonesian/Japanese, Indonesian/Hong Kong and Malaysian strains. The different serologic assays were tested using rabbit polyclonal antisera raised against these proteins of selected PRV strains, and validation was carried out using sera from a Miyazaki-Bali/2007 PRV-infected patient and the patient's contacts. The results of this study showed that rabbit polyclonal antisera raised against the CAP of the Miyazaki-Bali/2007 PRV strain showed the highest reactivity to the Miyazaki-Bali/2007 PRV and to a lesser extent, cross-reactivity with the HK23629/07 and Melaka PRVs, respectively. Neutralization activity against the Miyazaki-Bali/2007 PRV was observed using rabbit anti-Miyazaki-Bali/2007 PRV CAP (320) but not with rabbit anti-HK23629/07 (<20) and Melaka (<20) PRV CAP. This lack of cross-neutralization, suggests the potential for human reinfection with different strains. The use of sera collected from contacts of the Miyazaki-Bali/2007 PRV-infected patient suggested that human-to-human infections with PRV are unlikely. Previously reported cases of PRV infections among human have been mild. However, the expanding geographic distribution of these viruses, of which its virulence remains unknown, warrants close monitoring to enable the development of prevention and control strategies in the event that a change in virulence occurs.
Shiu, A T
1999-04-01
The study investigated the contribution of the added part-time student role on the emotional experience of managing multiple roles of Hong Kong public health nurses (PHNs) who have children by comparing PHNs with and without the part-time student role. The research design employed the experience sampling method. Convenience sampling was used to recruit 20 subjects of which nine were undertaking part-time degree programmes. A watch was worn that gave a signal at six random times each day for 7 days to complete an experience sampling diary. PHNs on average responded to 34 signals (80%) and therefore completed 34 diaries, which collected data on work, college-work and family juggling and their effects on mood states. Results indicate that PHNs with an added part-time student role, although having fewer juggling occasions and higher emotional spouse support, had fewer family-related activities as well as a lower positive effect and a higher negative effect than PHNs without this role. These results suggest that taking up an added part-time student role creates additional role strain to nurses with children, and lend support to the argument that the stress of managing multiple roles is greatest and benefits least when work and non-work role responsibilities are both heavy.
The putative drug efflux systems of the Bacillus cereus group
Elbourne, Liam D. H.; Vörös, Aniko; Kroeger, Jasmin K.; Simm, Roger; Tourasse, Nicolas J.; Finke, Sarah; Henderson, Peter J. F.; Økstad, Ole Andreas; Paulsen, Ian T.; Kolstø, Anne-Brit
2017-01-01
The Bacillus cereus group of bacteria includes seven closely related species, three of which, B. anthracis, B. cereus and B. thuringiensis, are pathogens of humans, animals and/or insects. Preliminary investigations into the transport capabilities of different bacterial lineages suggested that genes encoding putative efflux systems were unusually abundant in the B. cereus group compared to other bacteria. To explore the drug efflux potential of the B. cereus group all putative efflux systems were identified in the genomes of prototypical strains of B. cereus, B. anthracis and B. thuringiensis using our Transporter Automated Annotation Pipeline. More than 90 putative drug efflux systems were found within each of these strains, accounting for up to 2.7% of their protein coding potential. Comparative analyses demonstrated that the efflux systems are highly conserved between these species; 70–80% of the putative efflux pumps were shared between all three strains studied. Furthermore, 82% of the putative efflux system proteins encoded by the prototypical B. cereus strain ATCC 14579 (type strain) were found to be conserved in at least 80% of 169 B. cereus group strains that have high quality genome sequences available. However, only a handful of these efflux pumps have been functionally characterized. Deletion of individual efflux pump genes from B. cereus typically had little impact to drug resistance phenotypes or the general fitness of the strains, possibly because of the large numbers of alternative efflux systems that may have overlapping substrate specificities. Therefore, to gain insight into the possible transport functions of efflux systems in B. cereus, we undertook large-scale qRT-PCR analyses of efflux pump gene expression following drug shocks and other stress treatments. Clustering of gene expression changes identified several groups of similarly regulated systems that may have overlapping drug resistance functions. In this article we review current knowledge of the small molecule efflux pumps encoded by the B. cereus group and suggest the likely functions of numerous uncharacterised pumps. PMID:28472044
Evidence for Elizabethkingia anophelis transmission from mother to infant, Hong Kong.
Lau, Susanna K P; Wu, Alan K L; Teng, Jade L L; Tse, Herman; Curreem, Shirly O T; Tsui, Stephen K W; Huang, Yi; Chen, Jonathan H K; Lee, Rodney A; Yuen, Kwok-Yung; Woo, Patrick C Y
2015-02-01
Elizabethkingia anophelis, recently discovered from mosquito gut, is an emerging bacterium associated with neonatal meningitis and nosocomial outbreaks. However, its transmission route remains unknown. We use rapid genome sequencing to investigate 3 cases of E. anophelis sepsis involving 2 neonates who had meningitis and 1 neonate's mother who had chorioamnionitis. Comparative genomics revealed evidence for perinatal vertical transmission from a mother to her neonate; the 2 isolates from these patients, HKU37 and HKU38, shared essentially identical genome sequences. In contrast, the strain from another neonate (HKU36) was genetically divergent, showing only 78.6% genome sequence identity to HKU37 and HKU38, thus excluding a clonal outbreak. Comparison to genomes from mosquito strains revealed potential metabolic adaptations in E. anophelis under different environments. Maternal infection, not mosquitoes, is most likely the source of neonatal E. anophelis infections. Our findings highlight the power of genome sequencing in gaining rapid insights on transmission and pathogenesis of emerging pathogens.
Hover Testing of the NASA/Army/MIT Active Twist Rotor Prototype Blade
NASA Technical Reports Server (NTRS)
Wilbur, Matthew L.; Yeager, William T., Jr.; Wilkie, W. Keats; Cesnik, Carlos E. S.; Shin, Sangloon
2000-01-01
Helicopter rotor individual blade control promises to provide a mechanism for increased rotor performance and reduced rotorcraft vibrations and noise. Active material methods, such as piezoelectrically actuated trailing-edge flaps and strain-induced rotor blade twisting, provide a means of accomplishing individual blade control without the need for hydraulic power in the rotating system. Recent studies have indicated that controlled strain induced blade twisting can be attained using piezoelectric active fiber composite technology. In order to validate these findings experimentally, a cooperative effort between NASA Langley Research Center, the Army Research Laboratory, and the MIT Active Materials and Structures Laboratory has been developed. As a result of this collaboration an aeroelastically-scaled active-twist model rotor blade has been designed and fabricated for testing in the heavy gas environment of the Langley Transonic Dynamics Tunnel (TDT). The results of hover tests of the active-twist prototype blade are presented in this paper. Comparisons with applicable analytical predictions of active-twist frequency response in hovering flight are also presented.
Lifelong Learning in Action: Hong Kong Practitioners' Perspectives.
ERIC Educational Resources Information Center
Cribbin, John, Ed.; Kennedy, Peter, Ed.
This document consists of 32 papers presenting Hong Kong practitioners' perspectives on lifelong learning. The following papers are included: "Lifelong Learning" (Albert Tuijnman); "Growth and Development of Lifelong Learning in Hong Kong " (John Cribbin); "Competition and Collaboration" (John Cribbin); "A…
Federal Register 2010, 2011, 2012, 2013, 2014
2013-11-21
... exist: Weighted- average Exporter dumping margin (percent) Golden Dragon Precise Copper Tube Group, Inc., Hong Kong 3.55 GD Trading Co., Ltd., and Golden Dragon Holding (Hong Kong) International, Ltd Hong Kong...
Predictors of breastfeeding initiation in Hong Kong and Mainland China born mothers.
Lok, Kris Yuet Wan; Bai, Dorothy Li; Tarrant, Marie
2015-11-03
In recent years there has been a steady influx of immigrants into Hong Kong from Mainland China, where breastfeeding patterns differ. Studies in other regions have found substantial differences in breastfeeding rates between native-born and immigrant mothers. The purpose of this study was to examine factors associated with breastfeeding initiation in Hong Kong born and Mainland China born mothers living in Hong Kong. We used a multi-center cross-sectional study design and recruited 2761 new mothers from the postnatal wards of all eight public hospitals in Hong Kong that offer obstetric services. We assessed breastfeeding status as well as various socio-demographic, maternal and birth characteristics. Chi-square tests and multivariable logistic regression were used to identify the predictors of breastfeeding initiation in Hong Kong born and Mainland China born participants. 80.3 % of Hong Kong and 81.1 % of Mainland Chinese born women initiated breastfeeding. In the fully adjusted models, multiparity (Odds Ratio [OR] 0.53, 95 % CI 0.43-0.66) and maternal smoking (OR 0.29, 95 % CI 0.18-0.45) were strongly associated with failure to initiate breastfeeding in both Hong Kong and Mainland China born participants. In Hong Kong born mothers, participants with lower maternal education and those who had a cesarean section were significantly less likely to breastfeed. For Mainland China born mothers, paternal smoking (OR 0.70, 95 % CI 0.49-0.99) and having a pregnancy-related health problem (OR 0.60, 95 % CI 0.38-0.94) were both additional risk factors for not breastfeeding. This study has identified predictors of breastfeeding initiation in Hong Kong and Mainland China born mothers. Given the current high breastfeeding initiation rates among both groups, antenatal breastfeeding education and promotion programmes need to specifically intervene with sub-groups of pregnant women at risk for not breastfeeding so that their efforts are more strategic and cost-effective.
Developing chemical signatures of particulate air pollution in the Pearl River Delta region, China.
Zheng, Mei; Cheng, Yuan; Zeng, Limin; Zhang, Yuanhang
2011-01-01
PM2.5 samples were collected in a regional sampling network with three sites in Hong Kong and four sites in the adjacent inland Pearl River Delta (PRD) or Guangdong Province during four months/seasons from 2002-2003. Trans-boundary transport between Hong Kong and the inland PRD is inevitable under the influence of Asian monsoon. In summer, Hong Kong serves as the upwind site of the inland PRD while during other seasons it is under the influence of continental emissions. Previous studies have recognized the importance of using chemical signatures to differentiate local vs. regional contributions to air pollutants in Hong Kong such as the CO/NOx ratio, ratios of different VOC species. In this study, detailed chemical speciation by gas chromatography-mass spectrometry was performed with PM2.5 samples to identify new chemical signatures to distinguish aerosols in Hong Kong from those from the inland PRD. Since Hong Kong is not influenced by the continental emissions from the inland PRD during summer, comparison focused on chemical data obtained from this season for chemical signatures. The new ratios developed from the current study include LCPI/HCPI ratio of alkanes (0.39 +/- 0.02 in Hong Kong vs. 0.78 +/- 0.08 in the inland PRD), pyrene to benzo[ghi]perylene ratio (0.97 +/- 0.21 in Hong Kong compared to 0.20 +/- 0.06 in the inland PRD), and the ratio of 1,2-benzenedioic acid to 1,4-benzenedioic acid (1.8 +/- 0.1 in Hong Kong vs. 0.6 +/- 0.05 in the inland PRD). Results from this study also revealed that Hong Kong was impacted by ship emissions as reflected by substantially high V/Ni ratio (9 +/- 2) while this ratio was about 1-2 at all sites in the inland PRD, which is very close to typical ratios from residual oil combustion.
Does the Shanghai-Hong Kong Stock Connect significantly affect the A-H premium of the stocks?
NASA Astrophysics Data System (ADS)
Hui, Eddie C. M.; Chan, Ka Kwan Kevin
2018-02-01
Since the Shanghai-Hong Kong Stock Connect ("the Connect") was launched in late 2014, more and more Mainland investors have invested in Hong Kong listed shares, and vice versa, increasing the transaction volume of the stock market on both sides. However, only a few studies investigated how the Shanghai-Hong Kong Stock Connect affected the pricing dynamics of stocks listed in both Shanghai and Hong Kong. Applying linear regression, this study investigates how the Connect affects the H-share discounts of 12 stocks cross-listed in Shanghai and Hong Kong. A new feature of our model is that we add a dummy variable so as to be the first study to examine the effect of the China financial crisis on the A-H premium of the stocks. We find that the A-H premium of all stocks widens significantly after the Connect is launched, implying immatureness or even inefficiency of China's financial market. Furthermore, the result shows that trading activities in the mainland market affects the A-H premium more significantly than trading activities in the Hong Kong market do. This implies that China's financial market plays a dominant role in the Connect.
Federal Register 2010, 2011, 2012, 2013, 2014
2011-12-21
..., Fortex Blucore Limited, Kowloon Bay, Hong Kong, HONG KONG-CHINA, and S&O Electronics (Malaysia) Sdn. Bhd, Kedah Darul Aman, MALAYSIA, have been added as parties to this venture. Also Challenge Technology (Hong...
Press Ideology and Organizational Control in Hong Kong.
ERIC Educational Resources Information Center
Chan, Joseph Man; Lee, Chin-Chuan
1988-01-01
Surveys the entire Chinese journalist population of Hong Kong to determine how news organizations in the highly politicized environment of Hong Kong exercise institutional control on recruitment and newswork. Finds that press ideology is a major determinant of its organizational control. (MS)
The PRC Medium and Long-Term National Science and Technology Development Plan: A Manifesto to Steal
2015-02-17
rise in Chinese espionage cases, lax export laws in Hong Kong and recent changes to U.S. visa laws U.S. lawmakers must increase the focus on the...and embedded overseas Chinese scholars, importation of foreign technology through Hong Kong , joint ventures and export relationships with foreign...particularly hardware - to the PRC is through Hong Kong front companies. As example, just last year on 10 November 2014 a PRC national from Hong Kong
'Carcinogens in a puff': smoking in Hong Kong movies.
Ho, Sai-Yin; Wang, Man-Ping; Lai, Hak-Kan; Hedley, Anthony J; Lam, Tai-Hing
2010-12-01
Smoking scenes in movies, exploited by the tobacco industry to circumvent advertisement bans, are linked to adolescent smoking. Recently, a Hong Kong romantic comedy Love in a puff put smoking at centre stage, with numerous smoking scenes and words that glamourise smoking. Although WHO has issued guidelines on reducing the exposure of children to smoking in movies, none is adopted in Hong Kong. Comprehensive tobacco control strategies are urgently needed to protect young people in Hong Kong from cigarette promotion in movies.
The influence of strain rate and hydrogen on the plane-strain ductility of Zircaloy cladding
DOE Office of Scientific and Technical Information (OSTI.GOV)
Link, T.M.; Motta, A.T.; Koss, D.A.
1998-03-01
The authors studied the ductility of unirradiated Zircaloy-4 cladding under loading conditions prototypical of those found in reactivity-initiated accidents (RIA), i.e.: near plane-strain deformation in the hoop direction (transverse to the cladding axis) at room temperature and 300 C and high strain rates. To conduct these studies, they developed a specimen configuration in which near plane-strain deformation is achieved in the gage section, and a testing methodology that allows one to determine both the limit strain at the onset of localized necking and the fracture strain. The experiments indicate that there is little effect of strain rate (10{sup {minus}3} tomore » 10{sup 2} s{sup {minus}1}) on the ductility of unhydrided Zircaloy tubing deformed under near plane-strain conditions at either room temperature or 300 C. Preliminary experiments on cladding containing 190 ppm hydrogen show only a small loss of fracture strain but no clear effect on limit strain. The experiments also indicate that there is a significant loss of Zircaloy ductility when surface flaws are present in the form of thickness imperfections.« less
Kajon, Adriana E; Hang, Jun; Hawksworth, Anthony; Metzgar, David; Hage, Elias; Hansen, Christian J; Kuschner, Robert A; Blair, Patrick; Russell, Kevin L; Jarman, Richard G
2015-09-15
The circulation of human adenovirus type 21 (HAdV21) in the United States has been documented since the 1960s in association with outbreaks of febrile respiratory illness (FRI) in military boot camps and civilian cases of respiratory disease. To describe the molecular epidemiology of HAdV21 respiratory infections across the country, 150 clinical respiratory isolates obtained from continuous surveillance of military recruit FRI, and 23 respiratory isolates recovered from pediatric and adult civilian cases of acute respiratory infection were characterized to compile molecular typing data spanning 37 years (1978-2014). Restriction enzyme analysis and genomic sequencing identified 2 clusters of closely related genomic variants readily distinguishable from the prototype and designated 21a-like and 21b-like. A-like variants predominated until 1999. A shift to b-like variants was noticeable by 2007 after a 7-year period (2000-2006) of cocirculation of the 2 genome types. US strains are phylogenetically more closely related to European and Asian strains isolated over the last 4 decades than to the Saudi Arabian prototype strain AV-1645 isolated in 1956. Knowledge of circulating HAdV21 variants and their epidemic behavior will be of significant value to local and global FRI surveillance efforts. © The Author 2015. Published by Oxford University Press on behalf of the Infectious Diseases Society of America. All rights reserved. For Permissions, please e-mail: journals.permissions@oup.com.
Characterization of a prototype strain of hepatitis E virus.
Tsarev, S A; Emerson, S U; Reyes, G R; Tsareva, T S; Legters, L J; Malik, I A; Iqbal, M; Purcell, R H
1992-01-15
A strain of hepatitis E virus (SAR-55) implicated in an epidemic of enterically transmitted non-A, non-B hepatitis, now called hepatitis E, was characterized extensively. Six cynomolgus monkeys (Macaca fascicularis) were infected with a strain of hepatitis E virus from Pakistan. Reverse transcription-polymerase chain reaction was used to determine the pattern of virus shedding in feces, bile, and serum relative to hepatitis and induction of specific antibodies. Virtually the entire genome of SAR-55 (7195 nucleotides) was sequenced. Comparison of the sequence of SAR-55 with that of a Burmese strain revealed a high level of homology except for one region encoding 100 amino acids of a putative nonstructural polyprotein. Identification of this region as hypervariable was obtained by partial sequencing of a third isolate of hepatitis E virus from Kirgizia.
Attenuated CagA oncoprotein in Helicobacter pylori from Amerindians in Peruvian Amazon.
Suzuki, Masato; Kiga, Kotaro; Kersulyte, Dangeruta; Cok, Jaime; Hooper, Catherine C; Mimuro, Hitomi; Sanada, Takahito; Suzuki, Shiho; Oyama, Masaaki; Kozuka-Hata, Hiroko; Kamiya, Shigeru; Zou, Quan-Ming; Gilman, Robert H; Berg, Douglas E; Sasakawa, Chihiro
2011-08-26
Population genetic analyses of bacterial genes whose products interact with host tissues can give new understanding of infection and disease processes. Here we show that strains of the genetically diverse gastric pathogen Helicobacter pylori from Amerindians from the remote Peruvian Amazon contain novel alleles of cagA, a major virulence gene, and reveal distinctive properties of their encoded CagA proteins. CagA is injected into the gastric epithelium where it hijacks pleiotropic signaling pathways, helps Hp exploit its special gastric mucosal niche, and affects the risk that infection will result in overt gastroduodenal diseases including gastric cancer. The Amerindian CagA proteins contain unusual but functional tyrosine phosphorylation motifs and attenuated CRPIA motifs, which affect gastric epithelial proliferation, inflammation, and bacterial pathogenesis. Amerindian CagA proteins induced less production of IL-8 and cancer-associated Mucin 2 than did those of prototype Western or East Asian strains and behaved as dominant negative inhibitors of action of prototype CagA during mixed infection of Mongolian gerbils. We suggest that Amerindian cagA is of relatively low virulence, that this may have been selected in ancestral strains during infection of the people who migrated from Asia into the Americas many thousands of years ago, and that such attenuated CagA proteins could be useful therapeutically.
Simo Tchetgna, Huguette Dorine; Nakoune, Emmanuel; Selekon, Benjamin; Gessain, Antoine; Manuguerra, Jean-Claude; Kazanji, Mirdad; Berthet, Nicolas
2017-06-01
Rhabdoviridae is one of the most diversified families of RNA viruses whose members infect a wide range of plants, animals, and arthropods. The members of this family are classified into 13 genera and >150 unassigned viruses. Here, we sequenced the complete genome of a rhabdovirus belonging to the Hart Park serogroup, the Kamese virus (KAMV), isolated in 1977 from Culex pruina in the Central African Republic. The genomic sequence showed an organization typical of rhabdoviruses with additional genes in the P-M and G-L intergenic regions, as already reported for the Hart Park serogroup. Our Kamese strain (ArB9074) had 98% and 78.8% nucleotide sequence similarity with the prototypes of the KAMV and Mossuril virus isolated in Uganda and Mozambique in two different Culex species, respectively. Moreover, the protein sequences had 98-100% amino acid similarity with the prototype of the KAMV, except for an additional gene (U3) that showed a divergence of 6%. These molecular data show that our strain of the KAMV is genetically close to the Culex annuliorus strain that was circulating in Uganda in 1967. However, this study suggests the need to improve our knowledge of the KAMV to better understand its behavior, its life cycle, and its potential reservoirs.
Choi, Susanne Yuk-Ping; Cheung, Adam Ka-Lok; Cheung, Yuet-Wah; David, Roman
2014-12-01
Resource theory constitutes important explanations of spousal violence in culturally diverse societies. This article extends the theory by adding several subjective indicators: husband's financial strain and the couple's appraisal of each other's financial and nonfinancial contributions to family. We examined the role of these subjective dimensions of resource in spousal violence against the backdrop of other predictors, including the husband's absolute socioeconomic resources, the wife's economic dependence, and relative resource differences between the husband and wife. The findings not only partly support absolute and relative resource theories but also suggest the salient role of subjective indicators of resources on husband-to-wife physical assault. © The Author(s) 2014.
Xia, Xue-kui; Liu, Chang-heng; Yuan, Wen-peng; Wang, Xiao-jun; Meng, Xiu-mei; Zhang, Mian-song; She, Zhi-gang; Lin, Yong-cheng
2009-09-01
The secondary metabolites of the fungus ZZF13 isolated from the leaves of the mangrove sample Kandelia candel in Zhanjiang and Guignardia sp. 4382 isolated from bark of Kandelia candel (endophyte) of Mai Po, Hong Kong were studied. The compounds were isolated by siliga gel, and their structures were identified by IR, MS and NMR. Four compounds were isolated from the culture of this strain. Their structures were identified as Bacillpsporin C (1), 5-carboxymellein (2), 5-methylmellein (3) and 1-(2,6-dihydroxyphenyl) butanone (4). The compounds 2 - 4 are isolated from the Guignardia sp. of Marine fungi for the first time.
The Cultural Obstacles of Counseling Licensure in Hong Kong
ERIC Educational Resources Information Center
Lam, Gigi; Yeung, Marine
2017-01-01
A comprehensive package of counseling credentialism comprises certification, registration, and licensing. Counseling in Hong Kong adheres to certification for which diverse counseling master's programs exist. In addition, counselors can register as members of professional counseling organizations such as the Hong Kong Professional Counseling…
NASA Astrophysics Data System (ADS)
Christopher, Jason; Vutukuru, Mounika; Kohler, Travis; Bishop, David; Swan, Anna; Goldberg, Bennett
2D materials can withstand an order of magnitude more strain than their bulk counterparts which can be used to dramatically change electrical, thermal and optical properties or even cause unconventional behavior such as generating pseudo-magnetic fields. Here we present micro-electromechanical systems (MEMS) as a platform for straining 2D materials to make such novel phenomena accessible. Unlike other strain techniques, MEMS are capable of precisely controlling the magnitude and orientation of the strain field and are readily integrated with current technology facilitating a path from lab bench to application. In this study, we use graphene as our prototypical 2D material, and determine strain via micro-Raman spectroscopy making extensive use of graphene's well-characterized phonon strain response. We report on the strength of various techniques for affixing graphene to MEMS, and investigate the role of surface morphology and chemistry in creating a high friction interface capable of inducing large strain. This work is supported by NSF DMR Grant 1411008, and author J. Christopher thanks the NDSEG program for its support.
Sensor Prototype to Evaluate the Contact Force in Measuring with Coordinate Measuring Arms
Cuesta, Eduardo; Telenti, Alejandro; Patiño, Hector; González-Madruga, Daniel; Martínez-Pellitero, Susana
2015-01-01
This paper describes the design, development and evaluation tests of an integrated force sensor prototype for portable Coordinate Measuring Arms (CMAs or AACMMs). The development is based on the use of strain gauges located on the surface of the CMAs’ hard probe. The strain gauges as well as their cables and connectors have been protected with a custom case, made by Additive Manufacturing techniques (Polyjet 3D). The same method has been selected to manufacture an ergonomic handle that includes trigger mechanics and the electronic components required for synchronizing the trigger signal when probing occurs. The paper also describes the monitoring software that reads the signals in real time, the calibration procedure of the prototype and the validation tests oriented towards increasing knowledge of the forces employed in manual probing. Several experiments read and record the force in real time comparing different ways of probing (discontinuous and continuous contact) and measuring different types of geometric features, from single planes to exterior cylinders, cones, or spheres, through interior features. The probing force is separated into two components allowing the influence of these strategies in probe deformation to be known. The final goal of this research is to improve the probing technique, for example by using an operator training programme, allowing extra-force peaks and bad contacts to be minimized or just to avoid bad measurements. PMID:26057038
Choi, Su-In; Park, Jihoon; Kim, Pil
2017-03-28
To investigate the potential applications of bacterial heme, aminolevulinic acid synthase (HemA) was expressed in a Corynebacterium glutamicum HA strain that had been adaptively evolved against oxidative stress. The red pigment from the constructed strain was extracted and it exhibited the typical heme absorbance at 408 nm from the spectrum. To investigate the potential of this strain as an iron additive for swine, a prototype feed additive was manufactured in pilot scale by culturing the strain in a 5 ton fermenter followed by spray-drying the biomass with flour as an excipient (biomass: flour = 1:10 (w/w)). The 10% prototype additive along with regular feed was supplied to a pig, resulting in a 1.1 kg greater increase in weight gain with no diarrhea in 3 weeks as compared with that in a control pig that was fed an additive containing only flour. To verify if C. glutamicum -synthesized heme is a potential electron carrier, lactic acid bacteria were cultured under aerobic conditions with the extracted heme. The biomasses of the aerobically grown Lactococcus lactis , Lactobacillus rhamosus , and Lactobacillus casei were 97%, 15%, and 4% greater, respectively, than those under fermentative growth conditions. As a potential preservative, cultures of the four strains of lactic acid bacteria were stored at 4°C with the extracted heme and living lactic acid bacterial cells were counted. There were more L. lactis and L. plantarum live cells when stored with heme, whereas L. rhamosus and L. casei showed no significant differences in live-cell numbers. The potential uses of the heme from C. glutamicum are further discussed.
Fitness of Pandemic H1N1 and Seasonal influenza A viruses during Co-infection
Perez, Daniel Roberto; Sorrell, Erin; Angel, Matthew; Ye, Jianqiang; Hickman, Danielle; Pena, Lindomar; Ramirez-Nieto, Gloria; Kimble, Brian; Araya, Yonas
2009-01-01
On June 11, 2009 the World Health Organization (WHO) declared a new H1N1 influenza pandemic. This pandemic strain is as transmissible as seasonal H1N1 and H3N2 influenza A viruses. Major concerns facing this pandemic are whether the new virus will replace, co-circulate and/or reassort with seasonal H1N1 and/or H3N2 human strains. Using the ferret model, we investigated which of these three possibilities were most likely favored. Our studies showed that the current pandemic virus is more transmissible than, and has a biological advantage over, prototypical seasonal H1 or H3 strains. PMID:20029606
Homework Involvement among Hong Kong Primary School Students
ERIC Educational Resources Information Center
Tam, Vicky C. W.
2009-01-01
One component of the curriculum reform in Hong Kong focuses on the use of homework in consolidating learning, deepening understanding and constructing knowledge. This study examines the profile of Hong Kong primary school students' homework involvement, and investigates the relationships between time involvement and academic attributes, namely…
Lee, Regina L T; Pang, Samantha M C; Wong, Thomas K S; Chan, M F
2007-11-01
In 2006, a two-week summer exchange programme was conducted for nursing students from 15 institutes and/or universities, including places in Taiwan, Macau, Chinese mainland and Hong Kong. This paper evaluates a summer exchange programme focusing on nursing students' professional and personal development within the context of learning health counselling skills and studying cultural aspects of the host Region. The programme was evaluated using a mixed method of both quantitative and qualitative research design. Three dimensions include students' exchange perspective, professional development and personal development were evaluated at the end of the two-week programme. Data for this evaluation were derived from the results of questionnaires completed by the 64 nursing students enrolled in this programme, and from the analysis of five focus group interviews. Overall, students (98%) reported that they were very positive about their experiences during the programme, and felt they had gained a greater awareness of effective health counselling skills, of the latest developments in advanced nursing technology within the host School, and of cultural diversity in relation to their personal and professional development. Comparison of sub-total mean scores and standard deviations (mean+/-SD) of the three dimensions among students from Taiwan, Chinese mainland and Hong Kong/Macau, revealing significant differences in the exchange perspective (Taiwan: 18.6+/-1.4; Chinese mainland: 18.8+/-1.4; and Hong Kong/Macau: 16.5+/-1.1) professional development (Taiwan: 18.4+/-1.6; Chinese mainland: 18.2+/-1.5; and Hong Kong/Macau: 16.2+/-2.0) and personal development dimensions (Taiwan: 18.9+/-1.0; Chinese mainland: 18.6+/-1.4; and Hong Kong/Macau: 17.3+/-1.1) among these three places (p<0.001). For paired comparison (post-hoc test), the findings also show that the sub-total mean scores of the students from Taiwan and Chinese mainland were significantly higher than those of students from Hong Kong and Macau in the exchange perspective (Taiwan versus Hong Kong/Macau, p<0.001; Chinese mainland versus Hong Kong/Macau, p<0.001), professional development (Taiwan versus Hong Kong/Macau, p=0.001; Chinese mainland versus Hong Kong/Macau, p<0.001), and personal development (Taiwan versus Hong Kong/Macau, p<0.001; Chinese mainland versus Hong Kong/Macau, p=0.002). Although the findings cannot be generalized, the programme evaluation highlights the positive impact on one's exchange perspective and professional and personal development of a culturally integrated exchange programme for nursing students, with emphasis on skill practices and cultural diversity.
Zhu, C; Feng, S; Yang, Z; Davis, K; Rios, H; Kaper, J B; Boedeker, E C
2007-02-26
We previously showed that single dose orogastric immunization with an attenuated regulatory Lee-encoded regulator (ler) mutant of the rabbit enteropathogenic Escherichia coli (REPEC) strain E22 (O103:H2) protected rabbits from fatal infection with the highly virulent parent strain. In the current study we assessed the degree of homologous (serotype-specific) and heterologous (cross-serotype) protection induced by immunization with REPEC ler mutant strains of differing serotypes, or with a prototype strain RDEC-1 (O15:H-) which expresses a full array of ler up-regulated proteins. We constructed an additional ler mutant using RDEC-1 thus, permitting immunization with a ler mutant of either serotype, O15 or O103, followed by challenge with a virulent REPEC strain of the same or different serotypes. Consistent with our previous data, the current study demonstrated that rabbits immunized with a RDEC-1 ler mutant were protected from challenge with virulent RDEC-H19A (RDEC-1 transduced with Shiga toxin-producing phage H19A) of the same serotype. Rabbits immunized with RDEC-1 or E22 derivative ler mutants demonstrated significant increase in serum antibody titers to the respective whole bacterial cells expressing O antigen but not to the LEE-encoded proteins. However, immunization with the ler mutants of either E22 or RDEC-1 failed to protect rabbits from infections with virulent organisms belonging to different serotypes. In contrast, rabbits immunized with the prototype RDEC-1 were cross protected against challenge with the heterologous E22 strain as shown by normal weight gain, and the absence of clinical signs of disease or characteristic attaching and effacing (A/E) lesions. Immunization with RDEC-1 induced significantly elevated serum IgG titers to LEE-encoded proteins. We thus, demonstrated homologous protection induced by the REPEC ler mutants and heterologous protection by RDEC-1. The observed correlation between elevated immune responses to the LEE-encoded proteins and the protection against challenge with heterologous virulent REPEC strain suggests that serotype-non-specific cross protection requires the expression of, and induction of antibody to, LEE-encoded virulence factors.
NASA Astrophysics Data System (ADS)
Zhao, Dongning; Rasool, Shafqat; Forde, Micheal; Weafer, Bryan; Archer, Edward; McIlhagger, Alistair; McLaughlin, James
2017-04-01
Recently, there has been increasing demand in developing low-cost, effective structure health monitoring system to be embedded into 3D-woven composite wind turbine blades to determine structural integrity and presence of defects. With measuring the strain and temperature inside composites at both in-situ blade resin curing and in-service stages, we are developing a novel scheme to embed a resistive-strain-based thin-metal-film sensory into the blade spar-cap that is made of composite laminates to determine structural integrity and presence of defects. Thus, with fiberglass, epoxy, and a thinmetal- film sensing element, a three-part, low-cost, smart composite laminate is developed. Embedded strain sensory inside composite laminate prototype survived after laminate curing process. The internal strain reading from embedded strain sensor under three-point-bending test standard is comparable. It proves that our proposed method will provide another SHM alternative to reduce sensing costs during the renewable green energy generation.
Discourse Processes and Products: Land Surveyors in Hong Kong
ERIC Educational Resources Information Center
Cheng, Winnie; Mok, Esmond
2008-01-01
The study reported in this paper aims to provide a description of professional communication pertaining to land surveying project management in Hong Kong, achieved through a comprehensive analysis of both workplace discourse processes and products. The study, situated in Hong Kong, represents a collaborative effort between English and Land…
Hong Kong Teachers' Sources of Stress, Burnout, and Job Satisfaction.
ERIC Educational Resources Information Center
Tang, Tak-On; Yeung, Alexander Seeshing
This study investigated factors that affected stress, burnout, and job satisfaction among Hong Kong high school teachers. First, the researchers interviewed former Hong Kong teachers to determine possible teacher stress sources. On the basis of their suggested list of stress sources, the researchers created a questionnaire that included items…
A Values Approach to Business Education in Hong Kong
ERIC Educational Resources Information Center
Radbourne, Jeniifer
2006-01-01
This paper investigates the learning behaviour, learning environment and learning outcomes of Hong Kong Chinese students enrolled on an Australian university's Bachelor of Business degree course taught by visiting Australian lecturers in Hong Kong. The Chinese students are task-focused and passive learners. They do not demonstrate creative…
The Hong Kong Special Administrative Region.
ERIC Educational Resources Information Center
Li, Louisa
In Hong Kong, career guidance and employment services for secondary school students and the public at large are provided by the Education Department, the Labour Department, and the Hong Kong Association of Careers Masters and Guidance Masters. These organizations work together to provide career information, guidance, and employment assistance. The…
Views from the Chalkface: English Language School-Based Assessment in Hong Kong
ERIC Educational Resources Information Center
Davison, Chris
2007-01-01
The Hong Kong Examinations and Assessment Authority (HKEAA) has recently moved from norm-referenced to standards-referenced assessment, including the incorporation of a substantial school-based summative oral assessment component into the compulsory English language subject in the Hong Kong Certificate of Education Examination (HKCEE). Starting in…
School Experience of Chinese Sexual Minority Students in Hong Kong
ERIC Educational Resources Information Center
Kwok, Diana K.
2016-01-01
Heterosexism faced by sexual minority (lesbian, gay, bisexual, and queer/questioning [LGBQ]) students has been extensively studied internationally in the past 2 decades but has only recently received attention from Hong Kong Chinese society. Chinese LGBQ students are not guaranteed to be included in Hong Kong schools, where antidiscrimination…
Community Work across Ideological Boundaries: The Case of Hong Kong and Guangzhou.
ERIC Educational Resources Information Center
Mok, Bong-ho
1993-01-01
Despite contrasts between capitalist Hong Kong and socialist Guangzhou, the two cities' community work is similar in terms of superficial emphasis on citizen participation, maintenance of status quo, and consensus orientation. The imminent changeover in Hong Kong's sovereignty will change social welfare services in both cities. (SK)
Developments in early intervention for psychosis in Hong Kong.
Wong, G H Y; Hui, C L M; Wong, D Y; Tang, J Y M; Chang, W C; Chan, S K W; Lee, E H M; Xu, J Q; Lin, J J X; Lai, D C; Tam, W; Kok, J; Chung, D W S; Hung, S F; Chen, E Y H
2012-09-01
The year 2011 marked the 10-year milestone of early intervention for psychosis in Hong Kong. Since 2001, the landscape of early psychosis services has changed markedly in Hong Kong. Substantial progress has been made in the areas of early intervention service implementation, knowledge generation, and public awareness promotion. Favourable outcomes attributable to the early intervention service are supported by solid evidence from local clinical research studies; early intervention service users showed improved functioning, ameliorated symptoms, and decreased hospitalisation and suicide rates. Continued development of early intervention in Hong Kong over the decade includes the introduction and maturation of several key platforms, such as the Hospital Authority Early Assessment Service for Young People with Psychosis programme, the Psychosis Studies and Intervention Unit by the University of Hong Kong, the Hong Kong Early Psychosis Intervention Society, the Jockey Club Early Psychosis Project, and the postgraduate Psychological Medicine (Psychosis Studies) programme. In this paper, we reviewed some of the major milestones in local service development with reference to features of the Hong Kong mental health system. We describe chronologically the implementation and consolidation of public early intervention services as well as recent progresses in public awareness work that are tied in with knowledge generation and transfer, and outline the prospects for early intervention in the next decade and those that follow.
Spring-Based Helmet System Support Prototype to Address Aircrew Neck Strain
2014-06-01
Helicopter Squadron stationed at CFB Borden ALSE Personnel Flight Engineers Pilots 4.6 Discussion of Verification Results 4.6.1 Reduce the mass on the...the participant in the pilot’s posture. Figure 8. A simulation of Flight Engineers’ postures during landing and low flying maneuvres. Figure 9
Strategic environmental assessment in Hong Kong.
Ng, Kay Leng; Obbard, Jeffrey Philip
2005-05-01
This review examines the development and application of strategic environmental assessment (SEA) process in the planning framework of Hong Kong. Two strategic planning case studies are evaluated within the context of SEA, namely the Territorial Development Strategy Review (TDS Review) and the Third Comprehensive Transport Study (CTS-3). Rapid population growth and urbanisation in Hong Kong, coupled with a historic lack of planning controls and inherent conflicts between government departments have been major obstacles to achieving sustainable development in the territory. Despite these challenges, Hong Kong was one of the first Asian countries to apply SEA to major development plans, where the implementation of the 'SUSDEV 21' study on sustainable development has demonstrated the government's commitment towards integrated environmental protection. The application of SEA has provided decision-makers with key information on potential environment impacts arising from proposed developments, resulting in greater accountability and transparency in the decision-making process. SEA in Hong Kong has also prompted an increased level of environmental awareness and co-operation between government departments and agencies responsible for the management of Hong Kong's natural and urban environments. However, the application of SEA in Hong Kong continues to have notable limitations. SEA needs to evolve beyond its current sectoral application to examine ways in which development decisions can not only pre-empt and prevent environmental damage, but also positively enhance and restore existing natural resources. Current land use plans and transportation strategies still largely determine the pattern of development in the near future without adequate longer-term environmental cost-benefit analysis. Sustainable development includes environmental, social and economic considerations, and these inter-related elements need be suitably balanced. SEA is not a means to obstruct development in Hong Kong, but should be recognised for its inherent socio-economic and ecological value, and fully integrated with the decision-making process. Whilst it is admirable that Hong Kong has taken positive steps in this direction, it is now an opportune moment for the government to have the foresight and tenacity to create a sustainable development framework for Hong Kong into the future.
Internationalization: the Hong Kong-China experience as a model for collaborative education in Asia.
Tam, Paul K H; Wong, Kenneth K Y; Li, Long; Zhang, J Z
2013-10-01
The Hong Kong model for collaboration in education in Asia is based on internationalization. Hong Kong benefits from being an international city combining an Eastern heritage and a Western society. The University of Hong Kong ranks among the world's top 25 universities (2012/2013 QS world university rankings), and its Division of Paediatric Surgery has an international reputation in research and training. In the past two decades, Hong Kong has leading roles in major international pediatric surgical organizations including Pacific Association of Pediatric Surgeons, International Pediatric Endosurgery Group, Asian Association of Pediatric Surgeons and World Federation of Associations of Pediatric Surgeons. While Hong Kong has close collaboration with Japan and other advanced economies, the talk will focus on our transfer of international experience to Mainland China. (1) A Train-the-Trainer scheme consisting of a 1-year structured education program for next-generation leaders from selected centers enabled replication and proliferation of similar training nationwide. (2) A series of laparoscopic workshops resulted in training of over 1,300 surgeons in basic and advanced skills in minimally invasive surgery within 5 years and the establishment of a national specialist organization overseeing development and quality assurance. (3) A series of Cross-Strait Symposia on Pediatric Oncology established the foundation of multidisciplinary, multicenter collaboration in education and research in Mainland China, Taiwan and Hong Kong. (4) Initiation of a scientific writing course will enhance surgical research and training in China. The Hong Kong experience may serve as a model of collaboration with other developing economies in Asia.
Yu, Ruby; Wu, Wan-Chi; Leung, Jason; Hu, Susan C; Woo, Jean
2017-09-21
This study aimed to compare the prevalence of frailty across three Chinese populations: Hong Kong, Taiwan-urban and Taiwan-rural. Contributing factors to disparities in frailty were also examined. Data were derived from the Osteoporotic Fractures in Men (MrOs) and Women (MsOs) (Hong Kong) Study ( n = 4000) and the Taiwan Longitudinal Study on Aging ( n = 2392). Frailty was defined as an index calculated from 30 multiple deficits. The ratio of the frailty index to life expectancy at birth (FI/LE) was used as an indicator of compression of morbidity. Frailty was more prevalent in Taiwan-urban (33.1%) and Taiwan-rural (38.1%) compared to Hong Kong (16.6%, p < 0.05) and was higher in women (22.6-49.7%) than in men (10.5-27.5%, p < 0.05). The ratios of FI/LE were higher in Taiwan-urban and Taiwan-rural (both 0.27) compared to Hong Kong (0.20, p < 0.05). Multivariate analyses revealed that older age, being a woman and low levels of physical activity were common risk factors for frailty across the three populations. Alcohol use was inversely associated with frailty in both Hong Kong and Taiwan-urban populations, but not in Taiwan-rural. Living alone was associated with frailty in Hong Kong men, but not in Hong Kong women or Taiwanese people. For all study populations, older age and being a woman constituted the highest attributable factor. This comparison provides useful data to inform government policies.
Yu, Ruby; Wu, Wan-Chi; Leung, Jason
2017-01-01
This study aimed to compare the prevalence of frailty across three Chinese populations: Hong Kong, Taiwan-urban and Taiwan-rural. Contributing factors to disparities in frailty were also examined. Data were derived from the Osteoporotic Fractures in Men (MrOs) and Women (MsOs) (Hong Kong) Study (n = 4000) and the Taiwan Longitudinal Study on Aging (n = 2392). Frailty was defined as an index calculated from 30 multiple deficits. The ratio of the frailty index to life expectancy at birth (FI/LE) was used as an indicator of compression of morbidity. Frailty was more prevalent in Taiwan-urban (33.1%) and Taiwan-rural (38.1%) compared to Hong Kong (16.6%, p < 0.05) and was higher in women (22.6–49.7%) than in men (10.5–27.5%, p < 0.05). The ratios of FI/LE were higher in Taiwan-urban and Taiwan-rural (both 0.27) compared to Hong Kong (0.20, p < 0.05). Multivariate analyses revealed that older age, being a woman and low levels of physical activity were common risk factors for frailty across the three populations. Alcohol use was inversely associated with frailty in both Hong Kong and Taiwan-urban populations, but not in Taiwan-rural. Living alone was associated with frailty in Hong Kong men, but not in Hong Kong women or Taiwanese people. For all study populations, older age and being a woman constituted the highest attributable factor. This comparison provides useful data to inform government policies. PMID:28934150
Wong, Waiky W K; Yip, Yiu-chung; Choi, Koon-kay; Ho, Y Y; Xiao, Ying
2013-01-01
Dioxins and dioxin-like polychlorinated biphenyls (PCBs) are persistent organic pollutants (POPs) covered by the Stockholm Convention on POPs. To assess the associated health risk of the Hong Kong population, the dietary exposure of the Hong Kong population and various age-gender subgroups to dioxins and dioxin-like PCBs was estimated in the first Hong Kong Total Diet Study (TDS), where food samples were collected and prepared "as consumed". A total of 142 composite food samples, mainly foods of animal origin and their products and oily food, were analysed for polychlorinated dibenzo-p-dioxins (PCDDs) and dibenzofurans (PCDFs) and dioxin-like PCBs by the high-resolution gas chromatograph/high-resolution mass spectrometer (HRGC/HRMS) system. Dietary exposures were estimated by combining the analytical results with the food consumption data of Hong Kong adults. The mean and 95th percentile exposures to dioxins and dioxin-like PCBs of the Hong Kong population were 21.9 and 59.7 pg toxic equivalent (TEQ) kg⁻¹ body weight (bw) month⁻¹ respectively, which amounted to 31.3% and 85.2% of the provisional tolerable monthly intake (PTMI). The main dietary source of dioxins and dioxin-like PCBs was "Fish and seafood and their products" (61.9% of the total exposure), followed by "Meat, poultry and game and their products" (20.0%) and "Mixed dishes" (6.95%). The study findings suggest that the Hong Kong population is unlikely to experience the major undesirable health effects of dioxins and dioxin-like PCBs.
Wu, Peng; Cowling, Benjamin J.; Wu, Joseph T.; Lau, Eric H. Y.; Ip, Dennis K. M.; Nishiura, Hiroshi
2012-01-01
In recent years, Hong Kong has invested in research infrastructure to appropriately respond to novel infectious disease epidemics. Research from Hong Kong made a strong contribution to the international response to the 2009 influenza A (H1N1) pandemic (pH1N1). Summarizing, describing, and reviewing Hong Kong’s response to the 2009 pandemic, this article aimed to identify key elements of a real‐time research response. A systematic search in PubMed and EMBASE for research into the infection dynamics and natural history, impact, or control of pH1N1 in Hong Kong. Eligible articles were analyzed according to their scope. Fifty‐five articles were included in the review. Transmissibility of pH1N1 was similar in Hong Kong to elsewhere, and only a small fraction of infections were associated with severe disease. School closures were effective in reducing pH1N1 transmission, oseltamivir was effective for treatment of severe cases while convalescent plasma therapy has the potential to mitigate future pandemics. There was a rapid and comprehensive research response to pH1N1 in Hong Kong, providing important information on the epidemiology of the novel virus with relevance internationally as well as locally. The scientific knowledge gained through these detailed studies of pH1N1 is now being used to revise and update pandemic plans. The experiences of the research response in Hong Kong could provide a template for the research response to future emerging and reemerging disease epidemics. PMID:22883352
A biography of arsenic and medicine in Hong Kong and China.
Au, W Y
2011-12-01
Arsenic trioxide has been used in traditional Chinese medicine for over 5000 years, but lost its appeal due to its toxicity. It was rediscovered in western medicine and enjoyed a renaissance from 1830 to 1930, as the first effective chemotherapy against syphilis, parasites and leukaemia. These years were also a time of political turmoil in China. The Nanking treaty (29 August 1842) turned Hong Kong into a colony, while the Xinhai Revolution (10 October 1911) gave birth to a republic of China. Arsenic returned to China and Hong Kong with the establishment of the first medical schools from 1887 to 1920. Until 1950, oral arsenic trioxide was the standard anti-leukaemic treatment in Queen Mary Hospital. The advent of alkylating chemotherapeutic agents replaced arsenic trioxide in Hong Kong and around the world. In the 1970s, however, the specific activity of arsenic trioxide against acute promyelocytic leukaemia was re-discovered during the Cultural Revolution in Harbin, China. In 1997, Hong Kong was returned to China. In the same year, arsenic trioxide returned to the world stage. Intravenous arsenic trioxide became the worldwide standard therapy for relapsed acute promyelocytic leukaemia. Oral administration of arsenic trioxide was revived in Hong Kong in 2000. This resulted in the first locally produced, registered, patented prescription drug in Hong Kong. Pending imminent manufacture, this product is poised to revolutionise acute promyelocytic leukaemia care and may hold the key to saving the lives of acute promyelocytic leukaemia patients worldwide. The remarkable journey of arsenic in the setting of medical history of China and Hong Kong is reviewed.
Phillips, Patrick P. J.; Fielding, Katherine; Nunn, Andrew J.
2013-01-01
It is widely acknowledged that new regimens are urgently needed for the treatment of tuberculosis. The primary endpoint in the Phase III trials is a composite outcome of failure at the end of treatment or relapse after stopping treatment. Such trials are usually both long and expensive. Valid surrogate endpoints measured during or at the end of treatment could dramatically reduce both the time and cost of assessing the effectiveness of new regimens. The objective of this study was to evaluate sputum culture results on solid media during treatment as surrogate endpoints for poor outcome. Data were obtained from twelve randomised controlled trials conducted by the British Medical Research Council in the 1970s and 80s in East Africa and East Asia, consisting of 6974 participants and 49 different treatment regimens. The month two culture result was shown to be a poor surrogate in East Africa but a good surrogate in Hong Kong. In contrast, the month three culture was a good surrogate in trials conducted in East Africa but not in Hong Kong. As well as differences in location, ethnicity and probable strain of Mycobacteria tuberculosis, Hong Kong trials more often evaluated regimens with rifampicin throughout and intermittent regimens, and patients in East African trials more often presented with extensive cavitation and were slower to convert to culture negative during treatment. An endpoint that is a summary measure of the longitudinal profile of culture results over time or that is able to detect the presence of M. tuberculosis later in treatment is more likely to be a better endpoint for a phase II trial than a culture result at a single time point and may prove to be an acceptable surrogate. More data are needed before any endpoint can be used as a surrogate in a confirmatory phase III trial. PMID:23667677
Phillips, Patrick P J; Fielding, Katherine; Nunn, Andrew J
2013-01-01
It is widely acknowledged that new regimens are urgently needed for the treatment of tuberculosis. The primary endpoint in the Phase III trials is a composite outcome of failure at the end of treatment or relapse after stopping treatment. Such trials are usually both long and expensive. Valid surrogate endpoints measured during or at the end of treatment could dramatically reduce both the time and cost of assessing the effectiveness of new regimens. The objective of this study was to evaluate sputum culture results on solid media during treatment as surrogate endpoints for poor outcome. Data were obtained from twelve randomised controlled trials conducted by the British Medical Research Council in the 1970s and 80s in East Africa and East Asia, consisting of 6974 participants and 49 different treatment regimens. The month two culture result was shown to be a poor surrogate in East Africa but a good surrogate in Hong Kong. In contrast, the month three culture was a good surrogate in trials conducted in East Africa but not in Hong Kong. As well as differences in location, ethnicity and probable strain of Mycobacteria tuberculosis, Hong Kong trials more often evaluated regimens with rifampicin throughout and intermittent regimens, and patients in East African trials more often presented with extensive cavitation and were slower to convert to culture negative during treatment. An endpoint that is a summary measure of the longitudinal profile of culture results over time or that is able to detect the presence of M. tuberculosis later in treatment is more likely to be a better endpoint for a phase II trial than a culture result at a single time point and may prove to be an acceptable surrogate. More data are needed before any endpoint can be used as a surrogate in a confirmatory phase III trial.
Research pressure instrumentation for NASA space shuttle main engine
NASA Technical Reports Server (NTRS)
Anderson, P. J.; Nussbaum, P.; Gustafson, G.
1985-01-01
The breadboard feasibility model of a silicon piezoresistive pressure transducer suitable for space shuttle main engine (SSME) applications was demonstrated. The development of pressure instrumentation for the SSME was examined. The objective is to develop prototype pressure transducers which are targeted to meet the SSME performance design goals and to fabricate, test and deliver a total of 10 prototype units. Effective utilization of the many advantages of silicon piezoresistive strain sensing technology to achieve the objectives of advanced state-of-the-art pressure sensors for reliability, accuracy and ease of manufacture is analyzed. Integration of multiple functions on a single chip is the key attribute of the technology.
Setoh, Yin Xiang; Amarilla, Alberto A; Peng, Nias Y; Slonchak, Andrii; Periasamy, Parthiban; Figueiredo, Luiz T M; Aquino, Victor H; Khromykh, Alexander A
2018-01-01
Rocio virus (ROCV) is an arbovirus belonging to the genus Flavivirus, family Flaviviridae. We present an updated sequence of ROCV strain SPH 34675 (GenBank: AY632542.4), the only available full genome sequence prior to this study. Using next-generation sequencing of the entire genome, we reveal substantial sequence variation from the prototype sequence, with 30 nucleotide differences amounting to 14 amino acid changes, as well as significant changes to predicted 3'UTR RNA structures. Our results present an updated and corrected sequence of a potential emerging human-virulent flavivirus uniquely indigenous to Brazil (GenBank: MF461639).
Reading Intervention for Secondary Students with Hyperactive Behaviours in Hong Kong
ERIC Educational Resources Information Center
Pang, Wai Chung; Zhang, Kaili Chen
2011-01-01
This study examines the effect of a reading intervention aimed at improving the comprehension performance of three students with hyperactive behaviours in Hong Kong. Comprehension tasks, adopted from local exercise books based on Hong Kong Certificate Education Examination Paper I, were used to appraise three participants' reading performance, and…
Continuing Education in a Lifelong Learning Society: The Hong Kong Model
ERIC Educational Resources Information Center
Young, Enoch C. M.
2008-01-01
This paper examines the role and position of continuing education in the lifelong learning society of Hong Kong. The first section describes the basic components of Hong Kong's lifelong learning system, which is composed of two interconnected sub-systems--namely, conventional education and continuing education--integrated under a common…
The Career Trajectory of Physical Education Teachers in Hong Kong
ERIC Educational Resources Information Center
Sum, Raymond Kim Wai; Dimmock, Clive
2013-01-01
This study investigates the career trajectory of primary school physical education teachers (PSPETs) in Hong Kong. It is focused on the problems arising from apparent overload and the multiple roles of physical education teachers' career development in Hong Kong brought about by education and curriculum reforms. The specific research question is,…
Prevalence of Insomnia and Its Psychosocial Correlates among College Students in Hong Kong
ERIC Educational Resources Information Center
Sing, C. Y.; Wong, W. S.
2010-01-01
Objective: This study examined the prevalence of insomnia and its psychosocial correlates among college students in Hong Kong. Participants: A total of 529 Hong Kong college students participated in the study. Methods: Participants completed a self-reported questionnaire that included the Pittsburgh Sleep Quality Index (PSQI), the Revised Life…
Literacy Practices in Computer-Mediated Communication in Hong Kong.
ERIC Educational Resources Information Center
Lee, Carmen
2002-01-01
Examines linguistic features of text-based computer-mediated communication (CMC) in Hong Kong. The study is based on a 70,000-word corpus of electronic mail and ICQ instant messaging texts, which were collected from students in Hong Kong. Identified language-specific features that may be seen as new literacy practices within the theoretical…
ERIC Educational Resources Information Center
Kutnick, Peter; Fung, Dennis C. L.; Mok, Ida. A. C.; Leung, Frederick K. S.; Li, Johnson C. H.; Lee, Betty P.-Y.; Lai, Veronica K. W.
2017-01-01
The Hong Kong Education Bureau recommends that primary school pupils' mathematical achievement be enhanced via collaborative discussions engendered by group work. This pedagogic change may be hindered by Confucian heritage classroom practices and Western-dominated group work approaches that predominate in Hong Kong. To overcome these obstacles, we…
Language and the Curriculum in Hong Kong: Dilemmas of Triglossia.
ERIC Educational Resources Information Center
Adamson, Bob; Lai, Winnie Auyeung
1997-01-01
Draws on official documents and teaching materials to trace the growth of Putonghua (the official language of China) in school curricula in Hong Kong (where Hong Kong Cantonese and English predominate). Although promoting Putonghua is logical, tensions arise from the already heavy bias toward language subjects in school curricula and shortage of…
Talking about AIDS in Hong Kong: Cultural Models in Public Health Discourse.
ERIC Educational Resources Information Center
Jones, Rodney H.
A study explored the issues of cultural identity and interaction in public health discourse concerning Acquired Immune Deficiency Syndrome (AIDS) in Hong Kong's multilingual, multicultural social context. Twenty public service announcements (PSAs) concerning AIDS awareness televised in both English and Cantonese in Hong Kong from 1987 to 1994 were…
Investigating the Role of Bilingual Teaching Assistants in Hong Kong: An Exploratory Study
ERIC Educational Resources Information Center
Gao, Fang; Shum, Mark S. K.
2010-01-01
Background: Recent government initiatives in Hong Kong have focused on raising the participation of students from South Asian backgrounds in mainstream schools, to encourage their further integration into Hong Kong's educational system and society. These students' learning in mainstream schools takes place within the context of the central…
Workplace Communication in a Time of Transition: The Case of Hong Kong's Construction Industry.
ERIC Educational Resources Information Center
Evans, Stephen
1999-01-01
Examines language in the workplace, specifically the construction industry in Hong Kong. Provides detailed information on language use in a professional context at the time of Hong Kong's return to China and shows that written communication is mainly in English, while spoken language is predominately Cantonese. (Author/VWL)
Inclusive Education Policy in the Hong Kong Primary Music Classroom
ERIC Educational Resources Information Center
Wong, Marina Wai-yee; Chik, Maria Pik-yuk
2016-01-01
An education reform policy and inclusive education policy have been implemented in Hong Kong for over a decade. As more students with special educational needs have entered the mainstream education system under these policies, Hong Kong's primary music classrooms offer a site where three policies interact--the education reform policy entitled…
Chinese Children with ASD in Hong Kong (SAR): Development of Inclusive Practice
ERIC Educational Resources Information Center
Peters, Brenda; Forlin, Chris
2011-01-01
The advancement of inclusive educational provision in the Asia-Pacific region has been guided by international research. As one example, Hong Kong has developed a unique and cultural response to inclusive practice within the region. This paper reviews Hong Kong's development of inclusive education practice for children with autism spectrum…
Earth Sciences as a Vehicle for Gifted Education--The Hong Kong Experience
ERIC Educational Resources Information Center
Murphy, Phillip J.; Chan, Lung Sang; Murphy, Elizabeth
2012-01-01
The development and delivery of an Earth-science-focused short course designed to prepare Hong Kong students for university level study is described. Earth sciences provide an inspirational and challenging context for learning and teaching in Hong Kong's increasingly skills-based curriculum. (Contains 3 figures and 4 online resources.)
Voices of Donors: Case Reports of Body Donation in Hong Kong
ERIC Educational Resources Information Center
Chiu, Hei Yeung; Ng, Kwok Sing; Ma, Sin Kwan; Chan, Chi Hung; Ng, Sheung Wah; Tipoe, George L.; Chan, Lap Ki
2012-01-01
Body donation is important for medical education and academic research. However, it is relatively rare in Hong Kong when compared with many Western countries. Comprehensive research has been performed on the motivation for body donation in Western countries; however, there is still insufficient research on body donation in Hong Kong to provide…
Appropriating Drama Pedagogy: Learning from the Local Practices in Hong Kong
ERIC Educational Resources Information Center
Tam, Po-chi
2010-01-01
This paper aims at describing and explaining how drama pedagogy is appropriated in Chinese language classrooms in Hong Kong. Drawing on the theories of dialogue and appropriation of Mikhail Bakhtin, the research shows that the dialogicality of drama in Hong Kong's classrooms is conditional, and therefore deviant from the conventional as…
An Investigation of How Lecturers' Teaching Strategies Promote Productive Classroom Interaction
ERIC Educational Resources Information Center
Sit, Helena Hing Wa
2013-01-01
Both the Mainland and Hong Kong have witnessed the trend of educational internationalisation since the handover. The recruitment of non-local students is regarded as an important strategy to internalise universities in Hong Kong. Within Hong Kong's western-style educational setting, an increasing number of Mainland students attracted by the…
Letter from Hong Kong: A Report on Chinese Food, Fake Apples, and IBM's Asian Strategy.
ERIC Educational Resources Information Center
Immel, A. Richard
1984-01-01
Notes that microcomputer use in Hong Kong's small business community does not reflect the growth of its high-tech electronics industry and discusses IBM's influence in Hong Kong and Asia, the counterfeiting of Apple microcomputers and software, and why Apple currently has no recourse. (MBR)
Gifted Education in the Hong Kong Special Administrative Region
ERIC Educational Resources Information Center
Tommis, Stephen
2013-01-01
Despite its close geographical, economic, and political ties with mainland China, Hong Kong has not followed the same trajectory on gifted education but instead has preferred to adopt a more Western approach to the definitions and provision for gifted learners (Shi & Zixiu, 2000; Zou, Yang, & Greene, 2007). Hong Kong is, on most measures…
Dealing with Change in Hong Kong Schools Using Strategic Thinking Skills
ERIC Educational Resources Information Center
Pang, Nicholas Sun-Keung; Pisapia, John
2012-01-01
This paper reports an investigation into the strategic thinking skills of school leaders in Hong Kong. By adapting the Strategic Thinking Questionnaire in the school context and based on data self-reported from 543 Hong Kong school leaders, three cognitive capabilities with strategic thinking were identified: reflection, systems thinking and…
Church, State and Education: Catholic Education in Hong Kong during the Political Transition.
ERIC Educational Resources Information Center
Tan, John Kang
1997-01-01
Draws on interviews and published sources to examine Catholic educational policies and issues in Hong Kong, 1984-97, in the context of relationships between the Hong Kong Catholic Church and three authorities: colonial government, Chinese government, and Vatican. Discusses conflicts between Roman Catholicism and Communism, and language of…
Entrepreneurship Education in Hong Kong's Secondary Curriculum: Possibilities and Limitations
ERIC Educational Resources Information Center
Cheung, Chi-Kim
2008-01-01
Purpose: This paper aims to give a picture of the entrepreneurship education programs currently provided in Hong Kong secondary schools, to present teachers' evaluations of the effectiveness of the programs offered, and to point out the factors that hinder the development of entrepreneurship education in Hong Kong secondary schools.…
Hong Kong Perspectives on Educational Technology Research and Practice
ERIC Educational Resources Information Center
Spector, J. Michael; Yuen, H. K.; Wang, Minhong; Churchill, Daniel; Law, Nancy
2014-01-01
This is the 25th anniversary of the Hong Kong Association for Educational Communications and Technology (HKAECT; see http://www.hkaect.org/). The silver anniversary annual meeting will be held at the University of Hong Kong December 8--10, with the theme of the conference being "Communication and Education: New Media, Knowledge Practices, and…
Curriculum Reform in the Hong Kong Primary Classroom: What Gives?
ERIC Educational Resources Information Center
Forrester, Victor; Wong, Marina
2008-01-01
Curriculum reform in Hong Kong is one facet of a broad systemic reform variously explained in terms of addressing a changing sovereignty or more recently, of servicing Hong Kong's economic growth. One initiative supporting this curriculum reform entitled "Assessment for Learning" seeks to promote formative assessment. Three case studies,…
Stumbling Blocks in the Implementation of Accounting Education Reform: Evidence from Hong Kong
ERIC Educational Resources Information Center
Chen, Theodore T. Y.
2016-01-01
In determining whether stumbling blocks exist in the implementation of accounting education reform in Hong Kong, a survey questionnaire was sent to all accounting departments at public universities representing accounting academics, and the Hong Kong Institute of Certified Public Accountants representing the profession. The survey showed that both…
A Comparative Study of Science Achievement and Self-Concept during a Historical Transition
ERIC Educational Resources Information Center
Wang, Jianjun
2012-01-01
Cross-cultural changes were accompanied by the sovereignty transition of Hong Kong during the TIMSS data collection, which triggered migration of intellectual families between Hong Kong and other places. To enhance comparability of the urban setting, this investigation focuses on Singapore and Hong Kong for having similar Chinese majority and…
Characterization of a prototype strain of hepatitis E virus.
Tsarev, S A; Emerson, S U; Reyes, G R; Tsareva, T S; Legters, L J; Malik, I A; Iqbal, M; Purcell, R H
1992-01-01
A strain of hepatitis E virus (SAR-55) implicated in an epidemic of enterically transmitted non-A, non-B hepatitis, now called hepatitis E, was characterized extensively. Six cynomolgus monkeys (Macaca fascicularis) were infected with a strain of hepatitis E virus from Pakistan. Reverse transcription-polymerase chain reaction was used to determine the pattern of virus shedding in feces, bile, and serum relative to hepatitis and induction of specific antibodies. Virtually the entire genome of SAR-55 (7195 nucleotides) was sequenced. Comparison of the sequence of SAR-55 with that of a Burmese strain revealed a high level of homology except for one region encoding 100 amino acids of a putative nonstructural polyprotein. Identification of this region as hypervariable was obtained by partial sequencing of a third isolate of hepatitis E virus from Kirgizia. Images PMID:1731327
Garcia-Pozuelo, Daniel; Yunta, Jorge; Olatunbosun, Oluremi; Yang, Xiaoguang; Diaz, Vicente
2017-04-16
Tires equipped with sensors, the so-called "intelligent tires", can provide vital information for control systems, drivers and external users. In this research, tire dynamic strain characteristics in cornering conditions are collected and analysed in relation to the variation of tire working conditions, such as inflation pressure, rolling speed, vertical load and slip angle. An experimental tire strain-based prototype and an indoor tire test rig are used to demonstrate the suitability of strain sensors to establish relations between strain data and lateral force. The results of experiments show that strain values drop sharply when lateral force is decreasing, which can be used to predict tire slip conditions. As a first approach to estimate some tire working conditions, such as the slip angle and vertical load, a fuzzy logic method has been developed. The simulation and test results confirm the feasibility of strain sensors and the proposed computational model to solve the non-linearity characteristics of the tires' parameters and turn tires into a source of useful information.
Garcia-Pozuelo, Daniel; Yunta, Jorge; Olatunbosun, Oluremi; Yang, Xiaoguang; Diaz, Vicente
2017-01-01
Tires equipped with sensors, the so-called “intelligent tires”, can provide vital information for control systems, drivers and external users. In this research, tire dynamic strain characteristics in cornering conditions are collected and analysed in relation to the variation of tire working conditions, such as inflation pressure, rolling speed, vertical load and slip angle. An experimental tire strain-based prototype and an indoor tire test rig are used to demonstrate the suitability of strain sensors to establish relations between strain data and lateral force. The results of experiments show that strain values drop sharply when lateral force is decreasing, which can be used to predict tire slip conditions. As a first approach to estimate some tire working conditions, such as the slip angle and vertical load, a fuzzy logic method has been developed. The simulation and test results confirm the feasibility of strain sensors and the proposed computational model to solve the non-linearity characteristics of the tires’ parameters and turn tires into a source of useful information. PMID:28420156
Gubler, D J; Nalim, S; Tan, R; Saipan, H; Sulianti Saroso, J
1979-11-01
The comparative susceptibility of 13 geographic strains of Aedes aegypti to oral infection with dengue viruses was studied by feeding the mosquitoes on a virus-erythrocyte-sugar suspension. Significant variation in susceptibility to four dengue serotypes was observed among the geographic strains tested. Mosquito strains which were more susceptible to one serotype were also more susceptible to the other serotypes, suggesting that the factors controlling susceptibility were the same for all types. The amount of virus required to infect mosquitoes orally varied inversely with the susceptibility of the geographic strain. Thresholds of infection were not the same for dengue types 1, 2, 3 and 4. There was no apparent difference in infectivity between prototype and recently isolated strains of dengue types 1 and 3. Crossing experimentibility as the resistant parent. No difference was observed between resistant and susceptible mosquito strains in the rate or the amount of viral replication after infection by the parenteral route, or in their ability to transmit dengue 2 virus after infection by the oral route.
Bartlett, H P; Phillips, D R
1995-12-01
Aspects of demographic aging in Hong Kong are examined in this study. "By regional standards, many of Hong Kong's 1992 population of 5.9 million have a good standard of living and adequate housing. However, there are considerable discrepancies in wealth and well-being; elderly people are not always financially secure, and there are growing difficulties in maintaining the oft-cited mode of family care for elderly members. Hong Kong is a rapidly aging society and it is essential to see this process in the context of local and regional socioeconomic change and the future political linkages of the territory with China." excerpt
Flevares, Lucia M; Schiff, Jamie R
2014-01-01
In the past 25 years an identifiable interest in using children's literature in mathematics learning emerged (Clyne and Griffiths, 1991; Welchman-Tischler, 1992; Hong, 1996; Hellwig etal., 2000; Haury, 2001). We critically review the rationales given for the use of picture books in mathematics learning, with a special focus on geometry due to its underrepresentation in this body of literature and the need for greater focus on this topic. The benefits and effectiveness of using picture books for children's mathematics learning and interest have been documented (Hong, 1996; O'Neill etal., 2004; Young-Loveridge, 2004). For geometry, although much learning of shape ideas should be hands-on, two-dimensional figures are essential to develop children's understanding of plane geometry. Books may effectively engage pre-literate children with plane shapes (van den Heuvel-Panhuizen and van den Boogaard, 2008; Skoumpourdi and Mpakopoulou, 2011) and shapes as gestalt wholes or prototypes (van Hiele, 1986; Clements etal., 1999; Hannibal, 1999). We review several guidelines and evaluative criteria for book selection, including Cianciolo (2000), Schiro (1997), Hunsader (2004), and van den Heuvel-Panhuizen and Elia (2012). Geometry concepts have proven challenging for young students, but their difficulties may stem, in part, from inadequate teacher training and professional development (Clements and Sarama, 2000; Chard etal., 2008) which lead to misconceptions (Oberdorf and Taylor-Cox, 1999; Inan and Dogan-Temur, 2010). Using picture books in teacher training may be an inviting way for early childhood teachers to enhance their own knowledge. We will examine the literature for guidance on incorporating children's literature into teacher training. In closing we will outline a comprehensive, multi-pronged agenda for best instructional practices for selection and use of children's books in mathematics activities and for teacher training.
Hirakata, Yoichi; Matsuda, Junichi; Miyazaki, Yoshitsugu; Kamihira, Shimeru; Kawakami, Sayoko; Miyazawa, Yukihisa; Ono, Yasuo; Nakazaki, Nobuhiko; Hirata, Yasuyoshi; Inoue, Matsuhisa; Turnidge, John D; Bell, Jan M; Jones, Ronald N; Kohno, Shigeru
2005-08-01
We examined the prevalence of extended-spectrum beta-lactamase (ESBL)-producing strains of Klebsiella pneumoniae, Klebsiella oxytoca, Escherichia coli, Proteus mirabilis, Citrobacter koseri, and Salmonella spp. that were isolated as part of the SENTRY Asia-Pacific Surveillance Program between 1998 and 2002. During the study period, a total of 6,388 strains were gathered from 17 medical centers in 7 countries and examined for ESBL production and hyperproduction of K. oxytoca chromosomal K1 beta-lactamase enzyme. High rates of confirmed ESBL-producing isolates were found in K. pneumoniae strains from Singapore (35.6%), followed by those from mainland China (30.7%), South Africa (28.1%), and the Philippines (21.9%), whereas the rates were less than 10% in Japan and Australia. ESBL-producing E. coli strains were also prominent in mainland China (24.5%), Hong Kong (14.3%), and Singapore (11.3%). ESBL-producing K. oxytoca were common in the Philippines (38.5%), Singapore (33.3%), and China (30.0%). Hyperproduction of K. oxytoca chromosomal K1 beta-lactamase enzyme was common in Australia and Japan. P. mirabilis strains from Singapore produced ESBL (17.9%) despite the low prevalence (0-8.1%) in other countries. Few ESBL-producing C. koseri and Salmonella spp. strains were found in Japan, Singapore, Taiwan, and South Africa. Although there was variation among countries in substrate preference, ceftazidime was more likely to detect presumptive ESBL phenotype in K. pneumoniae and aztreonam more likely in E. coli, whereas ceftriaxone was the best substrate for the confirmation of ESBL production. ESBL-producing strains showed high levels of co-resistance to aminoglycosides, tetracycline, trimethoprim-sulfamethoxazole, and ciprofloxacin. Imipenem retained activity against all ESBL-producing strains. Organisms expressing ESBLs are widely distributed in the Asia-Pacific region, although prevalence rates vary significantly.
Incidence of genital warts among the Hong Kong general adult population
2010-01-01
Background The objective of this study is to estimate the incidence of genital warts in Hong Kong and explore a way to establish a surveillance system for genital warts among the Hong Kong general population. Methods A total of 170 private doctors and all doctors working in the 5 local Social Hygiene Clinics (SHC) participated in this study. During the 14-day data collection period (January 5 through18, 2009), the participating doctors filled out a log-form on a daily basis to record the number of patients with genital warts. The total number of new cases of genital warts presented to private and public doctors in Hong Kong was projected using the stratification sampling method. Results A total of 721 (0.94%) adults presented with genital warts to the participating doctors during the two-week study period, amongst them 73 (10.1%) were new cases. The projected number of new cases of genital warts among Hong Kong adults was 442 (297 male and 144 female) during the study period. The incidence of genital warts in Hong Kong was estimated to be 203.7 per 100,000 person-years (respectively 292.2 and 124.9 per 100,000 person-years for males and females). Conclusions The incidence of genital warts is high among adults in Hong Kong. The study demonstrates the importance of collecting surveillance data from both private and public sectors. PMID:20849578
Incidence of genital warts among the Hong Kong general adult population.
Lin, Chunqing; Lau, Joseph T F; Ho, King-Man; Lau, Man-Chun; Tsui, Hi-Yi; Lo, Kuen-Kong
2010-09-17
The objective of this study is to estimate the incidence of genital warts in Hong Kong and explore a way to establish a surveillance system for genital warts among the Hong Kong general population. A total of 170 private doctors and all doctors working in the 5 local Social Hygiene Clinics (SHC) participated in this study. During the 14-day data collection period (January 5 through 18, 2009), the participating doctors filled out a log-form on a daily basis to record the number of patients with genital warts. The total number of new cases of genital warts presented to private and public doctors in Hong Kong was projected using the stratification sampling method. A total of 721 (0.94%) adults presented with genital warts to the participating doctors during the two-week study period, amongst them 73 (10.1%) were new cases. The projected number of new cases of genital warts among Hong Kong adults was 442 (297 male and 144 female) during the study period. The incidence of genital warts in Hong Kong was estimated to be 203.7 per 100,000 person-years (respectively 292.2 and 124.9 per 100,000 person-years for males and females). The incidence of genital warts is high among adults in Hong Kong. The study demonstrates the importance of collecting surveillance data from both private and public sectors.
Fatigue evaluation for Tsing Ma Bridge using structural health monitoring data
NASA Astrophysics Data System (ADS)
Chan, Hung-tin Tommy; Ko, Jan Ming; Li, Zhao-Xia
2001-08-01
Fatigue assessment for the Tsing Ma Bridge (TMB) are presented based on the British standard BS5400 and the real-time structural health monitoring data under railway loading. TMB, as an essential portion of transport network for the Hong Kong airport, is the longest suspension bridge in the world carrying both highway and railway traffic. The bridge design has been mainly based on BS5400. A structural health monitoring system - Wind and Structural Health Monitoring System (WASHMS) for TMB has been operated since the bridge commissioning in May 1997. In order to assess the fatigue behavior of TMB under railway loading, strain gauges were installed on the bridge deck to measure the strain-time histories as soon as the bridge is loaded by a standard railway loading due to the service of an actual train. The strain-time history data at the critical members are then used to determine the stress spectrum, of which the rainflow method recommended for railway bridges by BS5400 is applied to count cycles of stress range. Miner's law is employed to evaluate fatigue damage and remaining service life of the bridge. The evaluated results of fatigue damage and remaining service life would help us to well understand about the fatigue design of the bridge and status in fatigue accumulation.
Ideology, Linguistic Capital and the Medium of Instruction in Hong Kong.
ERIC Educational Resources Information Center
Morrison, Keith; Lui, Icy
2000-01-01
Examines the links between linguistic capital, cultural capital, linguistic imperialism, and the use of English as the medium of instruction (MOI) in Hong Kong. Suggests that the notion of linguistic imperialism in Hong Kong is superceded by the notion of linguistic capital, although neither presents a complete analysis of the MOI issue in Hong…
ERIC Educational Resources Information Center
Lau, Patrick S. Y.; Yuen, Man Tak; Chan, Raymond M. C.
2005-01-01
This study aims to investigate the relationship between teachers' demographic variables and burnout in Hong Kong using the Maslach Burnout Inventory. It is found that when compared with the North American normative data, Hong Kong teachers scored in the average range of burnout in emotional exhaustion and personal accomplishment while they scored…
ERIC Educational Resources Information Center
Chan, Kwok Wai; Chan, Siu Mui
2009-01-01
Three hundred and seven teacher education students of a Hong Kong university were administered two questionnaires, one measuring emotional autonomy (EAS) and the other measuring perceived parenting styles (PAQ) of their parents. It was found that the Hong Kong teacher education students tended to be autonomous and they characterized their parents…
ERIC Educational Resources Information Center
Mok, Ka Ho
2014-01-01
Aspiring to become an international city in Asia, the government of the Hong Kong Special Administrative Region (HKSAR) has been investing more in higher education. In order to enhance its global competitiveness, all public universities in Hong Kong have gone through different forms of quality assurance exercises, including teaching and learning…
Global Agenda, Local Responses: Changing Education Governance in Hong Kong's Higher Education
ERIC Educational Resources Information Center
Chan, David K. K.
2007-01-01
Hong Kong has undergone a series of educational reforms since the mid 1990s in response to the tidal wave of globalisation. This article tries to examine the recent education reforms in Hong Kong's higher education within the global context, by putting into perspective a discussion of its policy implications of marketisation, privatisation and…
ERIC Educational Resources Information Center
Chan, David; Mok, Ka-Ho
2001-01-01
Compares trends toward privatization and marketization of public education in socialist mainland China and capitalist Hong Kong, a Special Administrative Region of China. Discusses policy shifts on the mainland toward decentralization, diversified educational services, and reduced government funding, and Hong Kong's efforts to promote…
Values Orientations of Hong Kong's Reform Proposals
ERIC Educational Resources Information Center
Che, Fok Shui
2004-01-01
Hong Kong has put forward a package of education reform proposals in 2000. The education reform is to set the blueprint for Hong Kong's development of education for the 21st century. An analysis of the values orientation of the reform proposals shows that the impact of globalization and the economic restructuring are the guiding forces. The main…
Implicit Theories of Creativity: A Comparison of Student-Teachers in Hong Kong and Singapore
ERIC Educational Resources Information Center
Seng, Quek Khiok; Keung, Ho Kwok; Cheng, Soh Kay
2008-01-01
This study attempts to uncover the beliefs regarding various aspects of creativity among trainee-teachers in Hong Kong and Singapore. Trainee-teachers from Hong Kong (N = 188) and Singapore (N = 127) completed a questionnaire on beliefs about creativity. The 30-item questionnaire covering 15 aspects of beliefs regarding creativity was presented to…
Is Student-Centered Pedagogy Impossible in Hong Kong? The Case of Inquiry in Classrooms
ERIC Educational Resources Information Center
Yeung, Sze Yin Shirley
2009-01-01
Hong Kong has been actively promoting a student-centered approach to teaching since the 1980s. Despite this effort, students in Hong Kong still tend to be traditional learners who rarely experience and gain from real student-centered learning. While teachers hold a "quantitative" concept of learning and focus on transmitting declarative…
Self-Esteem: A Comparison between Hong Kong Children and Newly Arrived Chinese Children
ERIC Educational Resources Information Center
Chan, Yiu Man; Chan, Christine Mei-Sheung
2004-01-01
The Self-esteem Inventory developed by Coopersmith (1967) was used to measure the self-esteem of 387 Chinese children. The sample included newly arrived mainland Chinese children and Hong Kong children. The results showed significant statistical differences when measuring the self-esteem level associated with the length of their stay in Hong Kong…
Hong Kong Parents' Perceptions of Benefits of Music to Their Children
ERIC Educational Resources Information Center
Choi, Angel Lai Yan; Tse, Jennie Chen Yee; So, Cindy Sin Ni; Yeung, Alexander Seeshing
2005-01-01
Background: In Hong Kong, many parents encourage their children to take extra music lessons beyond normal school hours. This study investigates parents' perceptions of the benefits of music to children. Aims: To investigate why many parents in Hong Kong encourage their children to take extra music lessons beyond normal school hours, and to examine…
"Countability Not Answerability?" Accountability in Hong Kong and Singapore Universities
ERIC Educational Resources Information Center
Currie, Jan; Vidovich, Lesley; Yang, Rui
2008-01-01
Singapore and Hong Kong are vying to be the principal educational hub for the Asia-Pacific region and have begun to compete with Australia, Britain, Canada and the USA in providing cross-border education. Although these four Anglo-American countries still dominate cross-border education, Singapore and Hong Kong hope to make inroads into this…
ERIC Educational Resources Information Center
Lo, William Yat Wai; Tang, Hei-Hang Hayes
2017-01-01
This article examines the significance of global trends in higher education (HE) development in Hong Kong between 1997 and 2012. Two trends, massification and internationalisation, are considered key driving forces that shaped Hong Kong's HE policy during the period. The former refers to government measures to widen participation in HE. The latter…
ERIC Educational Resources Information Center
Chan, Yiu Man
2000-01-01
Evaluates the self-esteem scores of 1303 children, including Chinese children from Britain and Hong Kong and white British children, using the Coopersmith Self-Esteem Inventory. Finds that British Chinese have significantly higher self-esteem than the Hong Kong children, but there is little difference among white British children. (CMK)
Historical Development of Hong Kong Sign Language
ERIC Educational Resources Information Center
Sze, Felix; Lo, Connie; Lo, Lisa; Chu, Kenny
2013-01-01
This article traces the origins of Hong Kong Sign Language (hereafter HKSL) and its subsequent development in relation to the establishment of Deaf education in Hong Kong after World War II. We begin with a detailed description of the history of Deaf education with a particular focus on the role of sign language in such development. We then…
ERIC Educational Resources Information Center
Clark, John L.; And Others
This document sets out a "Framework" to underpin the development and ongoing renewal of the school curriculum in Hong Kong. It also indicates the bases on which the Framework is developed. The Framework forms the foundation of Hong Kong's Target-Oriented Curriculum (TOC) initiative and provides a useful reference for curriculum…
Difficulties in Reforming Education Policy: The Hong Kong Case.
ERIC Educational Resources Information Center
Godwin, C. D.
1999-01-01
Over the past decade, the education-policy machinery in Hong Kong has been faced with important quality issues emerging that concern the history and culture of the school system. Evaluates two change-management initiatives between 1990 and 1995 and examines their outcomes in light of the endemic features of Hong Kong civil-service culture and…
A Study of the Implementation of Sex Education in Hong Kong Secondary Schools
ERIC Educational Resources Information Center
Che, Fok Shui
2005-01-01
Sex education is not treated as an important subject in the school curriculum of Hong Kong. The Hong Kong Education Department issued in 1986 and 1997, respectively, two guidelines on sex education for schools' reference. The 1997 Guidelines cover a broader conceptual framework relating to different aspects of human sexuality and also include…
Distance Education in Hong Kong
ERIC Educational Resources Information Center
Hope, Andrea; Butcher, Bob
2005-01-01
Hong Kong's economic fortunes have always depended on trade with China. By the mid-1980s, the colonial higher education system was catering to only 6% of the 18-20 age cohort and there was a backlog of adult learners who had been denied access. The Open Learning Institute of Hong Kong was launched in 1989 to overwhelming public response. It…
Indicators and Implications of Zero Tolerance of Corruption: The Case of Hong Kong
ERIC Educational Resources Information Center
Gong, Ting; Wang, Shiru
2013-01-01
Notwithstanding the voluminous studies of Hong Kong's anticorruption experience and the admiration the ICAC has earned from other governments as a model for "institutional engineering," little is known about how the public in Hong Kong has perceived and responded to corruption. Less clear is what factors beyond a powerful and independent…
Determinants of the Safety Performance of Private Multi-Storey Residential Buildings in Hong Kong
ERIC Educational Resources Information Center
Yau, Yung; Ho, Daniel Chi Wing; Chau, Kwong Wing
2008-01-01
Given the high population and development density in Hong Kong, building failures can result in catastrophic consequences. It is thus worthwhile identifying those dilapidated buildings, and this explains why the Hong Kong government has considered launching a mandatory building inspection scheme in the city. Apart from the measurement of building…
ERIC Educational Resources Information Center
Leung, Maggi W. H.; Waters, Johanna L.
2013-01-01
Drawing upon a project on British transnational education (TNE) programmes offered in Hong Kong, this paper interrogates the capacity development impact of TNE on the students, the Hong Kong Government and the programme providers. It addresses the questions: "What capacity is being developed in TNE operations?" and "For whom?"…
Hong Kong in Transition: A Look at Economic Interdependence.
ERIC Educational Resources Information Center
Lai, Selena
Economic interdependence has played an important role in Hong Kong's history, from its earliest days as a British colony to its current status as a center of international trade and finance. Hong Kong occupies a unique place in history because of its unprecedented transfer of power in 1997 from Britain to the People's Republic of China. The future…
Suicidality Among High School Students in Hong Kong, SAR
ERIC Educational Resources Information Center
Yip, Paul S. F.; Liu, K. Y.; Lam, T. H.; Stewart, Sunita M.; Chen, Eric; Fan, Susan
2004-01-01
Suicide is the leading cause of death in Hong Kong SAR for the youth aged 15?24. This study examined the prevalence of suicidality among secondary school students in Hong Kong using a representative, territory-wide sample of 2,586 students. Suicidal behaviors can be conceptualized as a spectrum of self-destructive behaviors. Cumulative logit model…
The Pre- and Post-1997 Well-Being of Hong Kong Residents
ERIC Educational Resources Information Center
Shen, Shir Ming; Choy, S. T. Boris
2005-01-01
Since July 1997, Hong Kong has become a Special Administrative Region (SAR) under the sovereignty of China. This paper compares the social well-being of Hong Kong residents before and after the change of sovereignty by analyzing six sets of survey data collected between 1990 and 2001. These are six biennial territory wide Social Indicator Surveys…
Liberal Studies Reform in Hong Kong Secondary Education: Contrasting Desirability with Feasibility
ERIC Educational Resources Information Center
Fok, Ping Kwan
2016-01-01
In major curriculum reforms, there are inevitably gaps between design and implementation issues, taking the introduction of liberal studies (LS) into the senior secondary curriculum in Hong Kong as a classic example. The current paper illustrates how the implementation of LS as a compulsory core subject has impacted noticeably on Hong Kong senior…
Opening up a Road to Somewhere: Development of Associate Degree Students in Hong Kong
ERIC Educational Resources Information Center
Lee, Wincy W. S.
2014-01-01
Associate (community college) degrees have expanded rapidly in the past decade in Hong Kong, but their value has been questioned due to the limited number of government-funded articulation opportunities available. This paper argues that associate degrees in Hong Kong are not valued solely for articulation purposes, but also for nurturing students'…
The Political Vocabulary of Hong Kong English.
ERIC Educational Resources Information Center
Benson, Phil
1994-01-01
A study analyzed patterns of usage of political vocabulary in Hong Kong English as found in newspaper reports of a leading Hong Kong English-medium newspaper and two other English-medium newspapers. Data were drawn from a computerized corpus and a clippings file. The report begins with an overview of the theoretical basis of the study of ideology…
ERIC Educational Resources Information Center
Cheung, Alan C. K.
2013-01-01
Purpose: The purpose of this paper is to examine language, academic, social-cultural and financial adjustments facing mainland Chinese students in Hong Kong. Design/methodology/approach: The current study employed both quantitative and qualitative methods and included over 300 mainland Chinese students from seven major universities in Hong Kong.…
Acculturation Attitudes and Sociocultural Adaptation of Chinese Mainland Sojourners in Hong Kong
ERIC Educational Resources Information Center
Ma, Yuanyi; Wang, Bo
2015-01-01
Within these years, there has been a significant increase in the number of Chinese Mainland sojourners studying in Hong Kong. Due to the huge differences in various aspects like language, culture, cultural value, it would be considerably difficult for the Chinese Mainland students to adapt to the Hong Kong environment. This article investigates…
Challenges of Chinese Language Education in Multi-Lingual Societies: Hong Kong and Singapore
ERIC Educational Resources Information Center
Tong, Ho-kin; Goh, Yeng-seng
2008-01-01
This paper aims to study the current challenges of Chinese language education in the multilingual societies of Hong Kong and Singapore through policy documents. After the handover of Hong Kong to China in 1997, the role of "Putonghua" is far more important than before due to political and economic reasons. However, the medium of…
Leading the Academy or Being Led? Hong Kong Women Academics
ERIC Educational Resources Information Center
Aiston, Sarah Jane
2014-01-01
This paper provides a new gender-based analysis of survey data collected on Hong Kong academics in 2008. First, it illustrates the gender differences that exist in the Hong Kong academy. Second, it discusses possible explanations for these differences as informed by the data. And third, it offers a novel argument, again informed by the data, for…
Cantonese-English Code-Switching Research in Hong Kong: A Y2K Review.
ERIC Educational Resources Information Center
Li, David C. S.
2000-01-01
Reviews the major works on code switching in Hong Kong to date. Four context-specific motivations commonly found in the Hong Kong Chinese Press--euphemism, specificity, bilingual punning, and principle of economy--are adduced to show that English is one of the important linguistic resources used by Chinese Hongkongers to fulfill a variety of…
Understanding Residents' Environmental Knowledge in a Metropolitan City of Hong Kong, China
ERIC Educational Resources Information Center
Cheung, Lewis T. O.; Fok, Lincoln; Tsang, Eric P. K.; Fang, Wei; Tsang, H. Y.
2015-01-01
This study aimed to understand the environmental knowledge (EK) of the residents of Hong Kong. A territory-wide survey was administered to investigate the subjective and objective EK of the respondents as well as their means of receiving information about the environment. The results indicated that Hong Kong's residents have a comparatively low…
ERIC Educational Resources Information Center
Lam, Terence Yuk Ping; Lau, Kwok Chi
2014-01-01
This study uses hierarchical linear modeling to examine the influence of a range of factors on the science performances of Hong Kong students in PISA 2006. Hong Kong has been consistently ranked highly in international science assessments, such as Programme for International Student Assessment and Trends in International Mathematics and Science…
ERIC Educational Resources Information Center
Tam, Vicky C. W.; Chan, Raymond M. C.
2011-01-01
This study examines the perceptions of Chinese students and parents in Hong Kong on homework involvement, assignment type and homework functions. The relationships of homework perceptions to student and parent attributes are also assessed. The sample includes 1393 pairs of students and their parents from 36 primary schools in Hong Kong. Findings…
Creativity in the Hong Kong Classroom: What Is the Contextual Practice?
ERIC Educational Resources Information Center
Forrester, Victor; Hui, Anna
2007-01-01
A review is offered of Hong Kong's current education reform that sites a key role for "creativity." This key role leads us to ask "Creativity in the Hong Kong Classroom: what is the contextual practice?" To address this question 27 Primary classroom teachers across three subject areas were observed and rated using the Classroom…
ERIC Educational Resources Information Center
Lai, Ling Mee
2012-01-01
Four years after the sovereignty of Hong Kong was returned from Britain to China, a survey was conducted in 2001 to examine the attitudes of students toward Cantonese (the vernacular language), English (the colonizer's and international language), and Putonghua (the new ruler's language) in the early postcolonial era of Hong Kong. Eight years…
Gender Representation in Hong Kong Primary School ELT Textbooks--A Comparative Study
ERIC Educational Resources Information Center
Lee, Jackie F. K.
2014-01-01
This article seeks to investigate whether the improvement of the status of women in Hong Kong in recent decades, effected through various efforts to promote the values of equal opportunity concepts, is reflected in patterns of gender representation in primary school textbooks used in Hong Kong. A comparison of a popular series of primary school…
ERIC Educational Resources Information Center
Shing, Richard Wong Kwok; Perry, Conrad; MacWhinney, Brian; Oi-ling, Irene Wong
2013-01-01
There is little consensus among different early childhood education stakeholders in Hong Kong on whether it is beneficial or detrimental for children to receive an English bilingual education before the age of 6. This longitudinal study investigated the issue of potential "detrimental effects of learning English" on Hong Kong…
Implementing the SENCo System in Hong Kong: An Initial Investigation
ERIC Educational Resources Information Center
Poon-McBrayer, Kim Fong
2012-01-01
Monitoring mechanisms of support services for students with special needs can be broadly classified as external and internal. Resembling the UK model, Hong Kong has adopted an internal mechanism through the establishment of the SENCo post. This investigation, written by Dr Kim Fong Poon-McBrayer, of the Hong Kong Institute of Education, explores…
Class Size and Language Learning in Hong Kong: The Students' Perspective
ERIC Educational Resources Information Center
Harfitt, Gary James
2012-01-01
Background: There is currently ongoing debate in Hong Kong between the teachers' union and the Government on the reduction of large class size (typically more than 40 students) in secondary schools and whether smaller class sizes might facilitate improvements in teaching and learning. In fact, many Hong Kong secondary schools have already started…
ERIC Educational Resources Information Center
Chui, Raymond Chi-Fai; Chan, Chi-Keung
2017-01-01
We investigated the relationship of school adjustment and social support with the mental health of mainland Chinese college students studying in Hong Kong. During the spring semester in 2011, 384 mainland Chinese college students across the postsecondary institutions in Hong Kong completed a questionnaire. Results showed that better school…
Heterosexism in School: The Counselling Experience of Chinese Tongzhi Students in Hong Kong
ERIC Educational Resources Information Center
Kwok, Diana K.; Winter, Sam; Yuen, Mantak
2012-01-01
The study is part of a larger project involving a phenomenological inquiry into the lived experiences of tongzhi students in Hong Kong public schools. The research question of this article focuses on the counselling experiences of nine Chinese lesbian, gay, bisexual and questioning/queer (LGBQ) students aged 14-18 in Hong Kong Chinese secondary…
Identity and Sense of Belonging in Post-Colonial Education in Hong Kong
ERIC Educational Resources Information Center
Kuah-Pearce, Khun Eng; Fong, Yiu-Chak
2010-01-01
This paper explores the construction of local and national identities among secondary school students in post-colonial Hong Kong. As a Chinese society that has undergone a prolonged period of British colonial rule, the reunification of capitalist Hong Kong with the motherland under socialism in 1997 has set the context for a negotiation of…
Developing Transnational Higher Education: Comparing the Approaches of Hong Kong and Singapore
ERIC Educational Resources Information Center
Chan, David; Ng, Pak Tee
2008-01-01
This article examines the approaches that Hong Kong and Singapore have adopted in trying to develop themselves as regional hubs of higher education through their developments of transnational higher education. Hong Kong and Singapore compete for this market share of global higher education because it can be a lucrative business. Adapting a model…
NASA Astrophysics Data System (ADS)
Gao, Hong
The tunable vacuum ultraviolet (VUV) laser generated through the two-photon resonance-enhanced four-wave mixing scheme is combined with the newly developed time-slice velocity map imaging photoion method to study the photodissociation of small molecules in the VUV region, and with the velocity map imaging photoelectron method to study the photoionization of free radicals. The photodissociation dynamics of NO in the energy region around 13.5 eV has been investigated. Branching ratios of the three lowest dissociation channels of 12C 16O that produce C(3P) + O(3P), C( 1D) + O(3P) and C(3P) + O(1D) are measured for the first time in the VUV region from 102,500 cm-1 to 110,500 cm-1, valuable information of the dissociation dynamics for this prototype system has been deduced. We demonstrated an experiment that has two independently tunable VUV lasers and a time-slice velocity map imaging setup, this provides us a global way to perform systematic state-selected photodissociation of small molecules via state-selected detection of the atomic products in the VUV region. The velocity map imaging photoelectron method was successfully used to obtain the photoelectron spectrum of the propargyl radical (C3H3) via a single VUV photoionization process. The propargyl radical is generated by the 193 nm laser photodissociation of the precursor C3H3Cl. This is the first time that the velocity map imaging photoelectron method is used to get the photoelectron spectra of free radicals, indicating that it is a powerful technique for studying the photoionization of free radicals which are always hard to be produced with high enough number densities for spectroscopic studies. This dissertation is mainly based on the following peer-reviewed journal articles: 1. Hong Gao, Yang Pan, Lei Yang, Jingang Zhou, C. Y. Ng and William M. Jackson. "Time-slice velocity-map ion imaging studies of the Photodissociation of NO in the vacuum ultraviolet region", the Journal of Chemical Physics, 136, 134302 (2012). (Chapter 2) 2. Hong Gao, Yu Song, Lei Yang, Xiaoyu Shi, Qing-Zhu Yin, C. Y. Ng and William M. Jackson. "Branching ratio measurements of the predissociation of 12C16O by time-slice velocity-map ion imaging in the energy region from 108,000 to 110,500 cm-1", the Journal of Chemical Physics, 137, 034305 (2012). (Chapter 3) 3. Hong Gao, Yu Song, Yih-Chung Chang, Xiaoyu Shi, Qing-Zhu Yin, Roger C. Wiens, William M. Jackson, C. Y. Ng, "Branching Ratio Measurements for Vacuum Ultraviolet Photodissociation of 12C16O", the Journal of Physical Chemistry A. (article online ASAP). (Chapter 4) 4. Hong Gao, Yu Song, C. Y. Ng, William M. Jackson, " Communication: State-to-state photodissociation study by the two-color VUV-VUV laser pump-probe time-slice velocity-map-imaging-photoion method", the Journal of Chemical Physics, 138, 191102(2013). (Chapter 5) 5. Hong Gao, Zhou Lu, Lei Yang, Jingang Zhou, C. Y. Ng, "Communication: A vibrational study of propargyl cation using the vacuum ultraviolet laser velocity-map imaging photoelectron method", the Journal of Chemical Physics, 137, 161101(2012). (Chapter 6)
[Electron microscopic study of the An-750 strain of Powassan virus isolated in the Soviet Union].
Sobolev, S G; Shestopalova, N M; Linev, M B; Rubin, S G
1978-01-01
Electron microscopic examinations of brains of white mice inoculated with the An 750 strain isolated for the first time from adult mosquitoes and with the prototype LB strain of Powassan virus were carried out. The method of combination of light and electron microscopy used in the study permitted to compare ultrastructural changes in one cell with the results of light microscopy. Sizes of virions and their localizations in the brain cells were determined. Virus particles were found in large and small neurons as well as in glial elements. Subcellular changes in neurons associated with virus multiplication are described. The causes of differences in sizes of virions measured in ultrathin sections are discussed.
Lau, J.; Yang, X.; Tsui, H; Pang, E.
2004-01-01
Objectives: To investigate patterns of behaviours and attitudes related to SARS prevention in the Hong Kong cross border traveller population. Settings: A survey was carried out at the Hong Kong-China cross border checkpoint in the middle of the epidemic. Participants: A total of 839 Hong Kong adult residents returning to Hong Kong from mainland China were surveyed. Main outcome measures: Practice of preventive measures and relevant behaviours and attitudes. Results: Around 40% of the respondents were using masks all or most of the time in public places or washing their hands frequently (>10 times per day) and about one third avoided visiting crowded places in mainland China. Such figures were however lower than those practised by the general public in Hong Kong. SARS related perceptions, such as perceived risk of transmission and efficacy, etc, were associated with mask use and not visiting crowded places, but not with hand washing, which was associated with duration of stay. Gender differences were also observed. Around 70% of the travellers would have delayed medical consultation for influenza-like illness in China; 12.7% would not wear masks during such episodes of illness. Furthermore, about 30% of the respondents used to wear masks in Hong Kong but not in mainland China. Conclusions: The findings have implications on cross border prevention of SARS. It seems that those travelling during the SARS epidemic were a "self selected" group, and they were using less preventive measures. Special attention and intervention need to be provided to travellers to prevent a second wave cross border transmission of the disease. PMID:15547057
NASA Astrophysics Data System (ADS)
Yang, Zhe; Liu, Zhizhao
2016-05-01
This study presents the ionospheric responses observed in Hong Kong to a Typhoon, namely, Tembin, from the aspects of the occurrence of ionospheric irregularities and scintillations, using Global Positioning System (GPS) observations from a ground-based GPS scintillation monitoring station in Hong Kong and from GPS receivers on board the Constellation Observing System for Meteorology, Ionosphere, and Climate (COSMIC) satellites. The ionospheric irregularities and scintillations are characterized by the rate of total electron content variation index (ROTI) and the amplitude scintillation index S4, respectively. The typhoon Tembin formed over the western North Pacific during 18-30 August 2012 and approached Hong Kong during 24-27 August 2012 with the closest distance 290 km from Hong Kong at around 17 universal time (UT) on 25 August 2012. The ground-based observations indicate that in the nighttime period of 20:00-02:00 local time (LT = UT + 8 h) on 26 August when Tembin passed closely to Hong Kong, the ionospheric irregularities and scintillations of GPS signals were observed in the south of Hong Kong, over the area of 13°N ~ 23°N in latitude and 110°E ~ 120°E in longitude. From the COSMIC observations, it shows that the number of radio occultation scintillation events peaks on 26 August 2012 during the passage of Tembin. Without the presence of strong geomagnetic or solar activity, it is suspected that gravity waves might be generated in the lower atmosphere and likely seed the formation of ionospheric plasma irregularities. This work for the first time from Hong Kong observes the sign of coupling between the lower atmosphere and ionosphere in a tropical cyclone event, combining both ground- and space-based GPS observation data.
Prevalence of myopia in a group of Hong Kong microscopists.
Ting, Patrick W K; Lam, Carly S Y; Edwards, Marion H; Schmid, Katrina L
2004-02-01
To study the prevalence and magnitude of myopia in a group of Hong Kong Chinese microscopists and compare it with that observed in microscopists working in the United Kingdom. Forty-seven microscopists (36 women and 11 men) with a median age of 31 years and working in hospital laboratories throughout Hong Kong were recruited to the study. Information about past refractive corrections, microscopy work, and visual symptoms associated with microscope use were collected. All subjects had a comprehensive eye examination at The Hong Kong Polytechnic University Optometry Clinic, including measures of refractive error (both noncycloplegic and cycloplegic), binocular vision functions, and axial length. The prevalence of myopia in this group of microscopists was 87%, the mean (+/- SD) refractive error was -4.45 +/- 3.03 D and mean axial length was 25.13 +/- 1.52 mm. No correlation was found between refractive error and years spent working as a microscopist or number of hours per day spent performing microscopy. Subjects reporting myopia progression (N = 22) did not differ from the refractively stable group (N = 19) in terms of their microscopy working history, working hours, tonic accommodation level, or near phoria. However, the AC/A ratio of the progressing group was significantly greater than that of the stable group (4.59 delta/D cf. 3.34 delta/D). The myopia prevalence of Hong Kong Chinese microscopists was higher than that of microscopists in the United Kingdom (87% cf. 71%), as well as the Hong Kong general population (87% cf. 70%). The average amount of myopia was also higher in the Hong Kong Chinese microscopists than the Hong Kong general population (-4.45 D cf. -3.00 D). We have confirmed that the microscopy task may slightly exacerbate myopia development in Chinese people.
Profiling the careers of Thoroughbred horses racing in Hong Kong between 2000 and 2010.
Velie, B D; Stewart, B D; Lam, K; Wade, C M; Hamilton, N A
2013-11-01
Research in Thoroughbred racehorses is often specific to horses from a given racing population or region. In order to investigate trends in racehorse careers across populations accurately, population-specific benchmarks for performance outcomes must be established. To provide summary statistics for performance outcomes for Thoroughbreds racing in Hong Kong between 2000 and 2010 and to document and provide evidence on the current differences in racing careers across sexes and regions of origin for horses racing in Hong Kong. Performance data on the population of Thoroughbreds racing in Hong Kong between 3 September 2000 and 12 March 2011 (n = 4950) were acquired and used to describe and compare the careers of Thoroughbred racehorses in Hong Kong. Career length, number of career starts and number of spells from racing per year were evaluated. Kaplan-Meier survival curves, stratified by sex, age group, country of origin and region of origin were produced for career length. A Cox's proportional hazards model was fitted to assess factors influencing the risk of retirement from racing in Hong Kong. Log-rank tests for equality of career length survivor functions showed significant differences (P<0.001) across sexes, age groups, countries of origin and regions of origin. An increased age at first start in Hong Kong tended to increase the hazard rate for retirement from racing in Hong Kong, whereas greater earnings per race and originating from Europe tended to reduce the hazard rate for racing retirement. Differences in career outcomes within a racing population appear to be influenced partly by the region from which a horse originates, with specific effects on each performance outcome also varying between regions. Future research should take into account these potential differences when comparing results across populations. © 2013 EVJ Ltd.
Shek, Daniel T L; Chan, Chitat
2011-01-01
This article explores whether professionals working with young people hold a negative view on adolescents in Hong Kong. Data were collected from 1112 participants from 23 workshops in a 3-day training program of the Project P.A.T.H.S. in Hong Kong. In the workshop, there was a group activity inviting the participants to describe the characteristics of contemporary young people in Hong Kong. The findings showed that positive comments about adolescents were only half of the negative comments. The common themes that emerged from the negative comments included: "problematic self-conceptions", "do not have long-term life goals", "irresponsible", "materialistic", and "calculative". The common themes that emerged from the positive comments included: "good at learning new things", "energetic", and "creative". The themes apparently reflected sociocultural characteristics of the contemporary Hong Kong Society.
Acoustical conditions of typical classrooms in Hong Kong
NASA Astrophysics Data System (ADS)
Li, Kai Ming; Lam, Coriolanus C. L.
2005-04-01
This paper presents measurement results of the acoustical environments of local schools in Hong Kong. In the measurements, several acoustical aspects that affect verbal communication in classrooms have been studied. These conditions include outdoor and indoor ambient noise levels, signal-to-noise ratios, reverberation time and the speech transmission index. Typical classrooms in many different schools and other higher-education institutions have been selected in the present study. Experimental results are compared with such national standards as USA (ANSI S 12.60 V 2002), Australian/New Zealand (AS/NZS 2107:2000), China (GB/T 15508 V 1995) and other national and industrial standards. This study will form the basis of devising acceptable standards for use in Hong Kong. [Work supported by the Research Grants Council of the SAR Government, the Research Committee of the Hong Kong Polytechnic University and Architectural Services Department of the Hong Kong SAR Government.
Mak, Winnie W S; Cheung, Rebecca Y M; Law, Lawrence S C
2009-09-01
Sense of community (SOC) has been one of the most studied topics in community psychology. However, no empirical study to date has investigated SOC in Hong Kong and its relations with community characteristics and residents' psychological well-being. A representative sample of 941 Hong Kong Chinese based on a randomized household survey was conducted in all 18 districts in Hong Kong. Results of hierarchical linear modeling indicated that SOC was not associated with sociodemographic indicators on both the individual-level (i.e., gender, age, family income, education level, type of residence, and area-to-capita ratio of residence) and the community-level (i.e., proportion of individuals with tertiary education, median family income, ownership of residence, population density, and resident stability). SOC was negatively related to daily hassles and positively with social support and quality of life. Conceptualization of SOC in Hong Kong was discussed.
Sit Down to Float: The Cultural Meaning of Ketamine Use in Hong Kong
Joe-Laidler, Karen; Hunt, Geoffrey
2009-01-01
From the late 1990s onward, ketamine use among young persons in Hong Kong grew rapidly becoming the drug of choice. This article examines ketamine’s attraction in Hong Kong, and in so doing uncover the cultural meaning of ketamine use. The analysis is organized around the emergence and shifts in meanings and experiences of those who initiate and continue to use ketamine. The data stems from a comparative study of the social setting of club drug use in Hong Kong, San Francisco, and Rotterdam. Here we draw from 100 in-depth interviews to examine the experiences of young persons who have used drugs in dance venues in Hong Kong. Our findings indicate that ketamine has become embedded in a distinctively working class youth dance scene, is accessible in terms of supply and cost, shared among a group of friends, and results in a stimulating yet liberating experience beyond that of ecstasy. PMID:19759834
Hong Kong at the Pearl River Estuary: A hotspot of microplastic pollution.
Fok, Lincoln; Cheung, P K
2015-10-15
Large plastic (>5mm) and microplastic (0.315-5mm) debris were collected from 25 beaches along the Hong Kong coastline. More than 90% consisted of microplastics. Among the three groups of microplastic debris, expanded polystyrene (EPS) represented 92%, fragments represented 5%, and pellets represented 3%. The mean microplastic abundance for Hong Kong was 5595items/m(2). This number is higher than international averages, indicating that Hong Kong is a hotspot of marine plastic pollution. Microplastic abundance was significantly higher on the west coast than on the east coast, indicating that the Pearl River, which is west of Hong Kong, may be a potential source of plastic debris. The amounts of large plastic and microplastic debris of the same types (EPS and fragments) were positively correlated, suggesting that the fragmentation of large plastic material may increase the quantity of beach microplastic debris. Copyright © 2015 Elsevier Ltd. All rights reserved.
NASA Astrophysics Data System (ADS)
Shmalenyuk, E. R.; Kochetkov, S. N.; Alexandrova, L. A.
2013-09-01
The review summarizes data on the synthesis and antituberculosis activity of pyrimidine nucleoside derivatives and their analogues. Enzymes from M. tuberculosis as promising targets for prototypes of new-generation drugs are considered. Nucleosides as inhibitors of drug-resistant M. tuberculosis strains are characterized. The bibliography includes 101 references.
USDA-ARS?s Scientific Manuscript database
New liquid fermentation techniques for the production of the bioinsecticidal fungus Metarhizium brunneum strain F-52 have resulted in the formation of microsclerotia (MS), a compact, melonized-hyphal structure capable of surviving desiccation and formulation as dry granules. When rehydrated, these M...
A simple pendulum borehole tiltmeter based on a triaxial optical-fibre displacement sensor
NASA Astrophysics Data System (ADS)
Chawah, P.; Chéry, J.; Boudin, F.; Cattoen, M.; Seat, H. C.; Plantier, G.; Lizion, F.; Sourice, A.; Bernard, P.; Brunet, C.; Boyer, D.; Gaffet, S.
2015-11-01
Sensitive instruments like strainmeters and tiltmeters are necessary for measuring slowly varying low amplitude Earth deformations. Nonetheless, laser and fibre interferometers are particularly suitable for interrogating such instruments due to their extreme precision and accuracy. In this paper, a practical design of a simple pendulum borehole tiltmeter based on laser fibre interferometric displacement sensors is presented. A prototype instrument has been constructed using welded borosilicate with a pendulum length of 0.85 m resulting in a main resonance frequency of 0.6 Hz. By implementing three coplanar extrinsic fibre Fabry-Perot interferometric probes and appropriate signal filtering, our instrument provides tilt measurements that are insensitive to parasitic deformations caused by temperature and pressure variations. This prototype has been installed in an underground facility (Rustrel, France) where results show accurate measurements of Earth strains derived from Earth and ocean tides, local hydrologic effects, as well as local and remote earthquakes. The large dynamic range and the high sensitivity of this tiltmeter render it an invaluable tool for numerous geophysical applications such as transient fault motion, volcanic strain and reservoir monitoring.
Astell, C R; Gardiner, E M; Tattersall, P
1986-02-01
The sequence of molecular clones of the genome of MVM(i), a lymphotropic variant of minute virus of mice, was determined and compared with that of MVM(p), the fibrotropic prototype strain. At the nucleotide level there are 163 base changes: 129 transitions and 34 transversions. Most nucleotide changes are silent, with only 27 amino acids changes predicted, of which 22 are conservative. Notable differences between the MVM(i) and MVM(p) genomes which may account for the cell specificities of these viruses occur within the 3' nontranslated regions. The differences discussed include the absence of a 65-base-pair direct in MVM(i), the presence of only two polyadenylation sites in MVM(i) compared with four in MVM(p), and sequences that bear a resemblance to enhancer sequences. Also included in this paper is an important correction to the MVM(p) sequence (C.R. Astell, M. Thomson, M. Merchlinsky, and D. C. Ward, Nucleic Acids Res. 11:999-1018, 1983).
NASA Technical Reports Server (NTRS)
Hedenstierna, K. O.; Lee, Y. H.; Yang, Y.; Fox, G. E.
1993-01-01
A prototype stable RNA identification cassette for monitoring genetically engineered plasmids carried by strains of Escherichia coli has been developed. The cassette consists of a Vibrio proteolyticus 5S ribosomal RNA (rRNA) gene surrounded by promoters and terminators from the rrnB operon of Escherischia coli. The identifier RNA is expressed and successfully processed so that approximately 30% of the 5S rRNA isolated from either whole cells or 70S ribosomes is of the V. proteolyticus type. Cells carrying the identifier are readily detectable by hybridization. Accurate measurements show that the identification cassette has little effect on fitness compared to a strain containing an analogous plasmid carrying wild type E. coli 5S rRNA, and the V. proteolyticus 5S rRNA gene is not inactivated after prolonged growth. These results demonstrate the feasibility of developing small standardized identification cassettes that can utilize already existing highly sensitive rRNA detection methods. Cassettes of this type could in principle be incorporated into either the engineered regions of recombinant plasmids or their hosts.
Electric field responsive origami structures using electrostriction-based active materials
NASA Astrophysics Data System (ADS)
Ahmed, Saad; Arrojado, Erika; Sigamani, Nirmal; Ounaies, Zoubeida
2015-04-01
The objective of origami engineering is to combine origami principles with advanced materials to yield active origami shapes, which fold and unfold in response to external stimuli. We are investigating the use of P(VDF-TrFE-CTFE), a relaxor ferroelectric terpolymer, to realize origami-inspired folding and unfolding of structures and to actuate so-called action origami structures. To accomplish these two objectives, we have explored different approaches to the P(VDF-TrFECTFE) polymer actuator construction, ranging from unimorph to multilayered stacks. Electromechanical characterization of the terpolymer-based actuators is conducted with a focus on free strain, force-displacement and blocked force. Moreover dynamic thickness strains of P(VDF-TrFE-CTFE) terpolymer at different frequencies ranging from 0.1Hz to 10Hz is also measured. Quantifying the performance of terpolymer-based actuators is important to the design of action origami structures. Following these studies, action origami prototypes based on catapult, flapping butterfly wings and barking fox are actuated and characterization of these prototypes are conducted by studying impact of various parameters such as electric field magnitude and frequency, number of active layers, and actuator dimensions.
Lee, Hee Suk; Sobsey, Mark D
2011-06-01
The potential use of specific somatic coliphage taxonomic groups as viral indicators based on their persistence and prevalence in water was investigated. Representative type strains of the 4 major somatic coliphage taxonomic groups were seeded into reagent water and an ambient surface water source of drinking water and the survival of the added phages was measured over 90 days at temperatures of 23-25 and 4 °C. Microviridae (type strain PhiX174), Siphoviridae (type strain Lambda), and Myoviridae (type strain T4) viruses were the most persistent in water at the temperatures tested. The Microviridae (type strain PhiX174) and the Siphoviridae (type strain Lambda) were the most resistant viruses to UV radiation and the Myoviridae (type strain T4) and the Microviridae (type strain PhiX174) were the most resistant viruses to heat. Based on their greater persistence in water over time and their relative resistance to heat and/or UV radiation, the Myoviridae (type strain T4), the Microviridae (type strain PhiX174), and the Siphoviridae (type strain Lambda) were the preferred candidate somatic coliphages as fecal indicator viruses in water, with the Microviridae (type strain PhiX174) the most resistant to these conditions overall. Copyright © 2011 Elsevier Ltd. All rights reserved.
Chaudhuri, Roy R.; Sebaihia, Mohammed; Hobman, Jon L.; Webber, Mark A.; Leyton, Denisse L.; Goldberg, Martin D.; Cunningham, Adam F.; Scott-Tucker, Anthony; Ferguson, Paul R.; Thomas, Christopher M.; Frankel, Gad; Tang, Christoph M.; Dudley, Edward G.; Roberts, Ian S.; Rasko, David A.; Pallen, Mark J.; Parkhill, Julian; Nataro, James P.; Thomson, Nicholas R.; Henderson, Ian R.
2010-01-01
Background Escherichia coli can experience a multifaceted life, in some cases acting as a commensal while in other cases causing intestinal and/or extraintestinal disease. Several studies suggest enteroaggregative E. coli are the predominant cause of E. coli-mediated diarrhea in the developed world and are second only to Campylobacter sp. as a cause of bacterial-mediated diarrhea. Furthermore, enteroaggregative E. coli are a predominant cause of persistent diarrhea in the developing world where infection has been associated with malnourishment and growth retardation. Methods In this study we determined the complete genomic sequence of E. coli 042, the prototypical member of the enteroaggregative E. coli, which has been shown to cause disease in volunteer studies. We performed genomic and phylogenetic comparisons with other E. coli strains revealing previously uncharacterised virulence factors including a variety of secreted proteins and a capsular polysaccharide biosynthetic locus. In addition, by using Biolog™ Phenotype Microarrays we have provided a full metabolic profiling of E. coli 042 and the non-pathogenic lab strain E. coli K-12. We have highlighted the genetic basis for many of the metabolic differences between E. coli 042 and E. coli K-12. Conclusion This study provides a genetic context for the vast amount of experimental and epidemiological data published thus far and provides a template for future diagnostic and intervention strategies. PMID:20098708
H13 influenza viruses in wild birds have undergone genetic and antigenic diversification in nature.
Wang, Zu-Jyun; Kikutani, Yuto; Nguyen, Lam Thanh; Hiono, Takahiro; Matsuno, Keita; Okamatsu, Masatoshi; Krauss, Scott; Webby, Richard; Lee, Youn-Jeong; Kida, Hiroshi; Sakoda, Yoshihiro
2018-05-23
Among 16 haemagglutinin (HA) subtypes of avian influenza viruses (AIVs), H13 AIVs have rarely been isolated in wild waterfowl. H13 AIVs cause asymptomatic infection and are maintained mainly in gull and tern populations; however, the recorded antigenic information relating to the viruses has been limited. In this study, 2 H13 AIVs, A/duck/Hokkaido/W345/2012 (H13N2) and A/duck/Hokkaido/WZ68/2012 (H13N2), isolated from the same area in the same year in our surveillance, were genetically and antigenically analyzed with 10 representative H13 strains including a prototype strain, A/gull/Maryland/704/1977 (H13N6). The HA genes of H13 AIVs were phylogenetically divided into 3 groups (I, II, and III). A/duck/Hokkaido/W345/2012 (H13N2) was genetically classified into Group III. This virus was distinct from a prototype strain, A/gull/Maryland/704/1977 (H13N6), and the virus, A/duck/Hokkaido/WZ68/2012 (H13N2), both belonging to Group I. Antigenic analysis indicated that the viruses of Group I were antigenically closely related to those of Group II, but distinct from those of Group III, including A/duck/Hokkaido/W345/2012 (H13N2). In summary, our study indicates that H13 AIVs have undergone antigenic diversification in nature.
ERIC Educational Resources Information Center
Xu, Cora Lingling
2017-01-01
Drawing on in-depth interview data from 31 mainland Chinese (MLC) students in a Hong Kong university, this article conceptualises MLC and Hong Kong higher education as two dissonant but interrelated subfields of the Chinese higher education field. The article argues that these MLC students' habitus, one that possesses rich economic, social and…
ERIC Educational Resources Information Center
Lee, Margaret T. Y.; Wong, Betty P.; Chow, Bonnie W.-Y.; McBride-Chang, Catherine
2006-01-01
The unique dimensions of perceptions of school and family contributing to depression and suicide ideation in Hong Kong adolescents were examined in two studies. In Study 1, among 327 Hong Kong Chinese female students ages 13-18, 47% reported some suicide ideation. Suicide ideation was significantly associated with depression, test anxiety,…
Science and Biology Assessment in Hong Kong--Progress and Developments
ERIC Educational Resources Information Center
Cheng, May Hung; Cheung, Wing Ming Francis
2005-01-01
A paper was published in JBE in 2001 which examined the background of the education reform launched in 2000 in Hong Kong, and reviewed existing practices as well as beliefs in science and biology assessment among secondary teachers in Hong Kong. The direction of the reform was to take the emphasis away from public examinations as the sole…
ERIC Educational Resources Information Center
Chan, Yuk-chung; Lam, Gladys L. T.; Shae, Wan-Chaw
2011-01-01
Objectives: This research study explored children's views on issues about child abuse in Hong Kong and examined their implications on child protection work and research in Chinese societies. Method: Six primary schools were recruited from different districts of Hong Kong. Five vignettes of child maltreatment in the form of flash movies were…
The Pre-Primary Education Voucher Scheme of Hong Kong: A Promise of Quality Education Provision?
ERIC Educational Resources Information Center
Fung, Chanel Kit-Ho; Lam, Chi-Chung
2008-01-01
The issue of education vouchers has been widely researched as they are seen by many people as an effective strategy for improving the quality of education services. Striving to enhance the quality of the kindergarten education service in Hong Kong, the government of the Hong Kong Special Administrative Region has committed a substantial sum of…
Similarities and Differences in Views of Ageing and Learning in Hong Kong and Australia
ERIC Educational Resources Information Center
Tam, Maureen; Boulton-Lewis, Gillian; Buys, Laurie; Chui, Ernest
2017-01-01
This article is an overview and summary of the findings from a General Research Fund project funded (2012-2014) by the Research Grants Council of the University Grants Committee of Hong Kong to investigate cross cultural understanding of ageing and learning by seniors in Hong Kong and Australia. Results have been published separately in…
ERIC Educational Resources Information Center
Lee, Kaman
2011-01-01
This article explores how exposure to environment-related media content, subjective norm and perceived behavioral control play a role in Hong Kong adolescents' environmental intention. The author conducted a survey with a sample of 1,012 (465 male, 547 female) adolescents in Hong Kong. Structural equation modeling confirms that exposure to…
Elder Learning in Hong Kong: Policies, Programmes, Provisions, and Issues
ERIC Educational Resources Information Center
Tam, Maureen
2012-01-01
This paper explores the notions of active ageing and elder learning in Hong Kong where a strategic approach to elderly education is applied by the government to encourage lifelong learning. The paper outlines the policy development and support for elder learning in Hong Kong in two distinct periods: pre-1997 and post-1997. The post-1997 period is…
A Systematic Review of Research on Educational Leadership in Hong Kong, 1995-2014
ERIC Educational Resources Information Center
Szeto, Elson; Lee, Theodore Tai Hoi; Hallinger, Philip
2015-01-01
Purpose: The purpose of this paper is to provide a research synthesis of substantive findings drawn from studies of educational leadership and management in Hong Kong between 1995 and 2014. The goal of the research synthesis was to identify and elaborate on key trends identified by scholars who studied educational leadership in Hong Kong over the…
Federal Register 2010, 2011, 2012, 2013, 2014
2012-05-30
...., Ltd. of China; Sino Legend Holding Group, Inc. of British Virgin Islands; Sino Legend Holding Group Limited of Hong Kong; HongKong Sino Legend Group Ltd. of Hong Kong; Red Avenue Chemical Co., Ltd. of... and Procedure filed on behalf of SI Group, Inc., on May 21, 2012. The complaint alleges violations of...
The Quality of Hong Kong's Self-Financing Sub-Degree Education from an Economic Perspective
ERIC Educational Resources Information Center
Chan, Chi Wai
2012-01-01
This paper examines the quality of Hong Kong's sub-degree level education provided by the self-financing institutes in terms of its impact on the earnings of workers, based on Hong Kong's 2006 by-census data. Education is an investment in human capital that enhances the productivity of workers and increases their lifetime incomes; and a more…
ERIC Educational Resources Information Center
Wong, Wendy Siuyi; Cuklanz, Lisa M.
Hong Kong's Department of Information Services has been producing and systematically airing public service announcements (known as announcements in the public interest, or APIs) on a variety of selected themes such as cleaning up Hong Kong, road safety, crime, drugs, and health issues for over 20 years. The television announcements are shown every…
ERIC Educational Resources Information Center
Ou, Dongshu
2013-01-01
This paper examines the causal impacts of Hong Kong's 1971 policy of free compulsory education on students' educational attainment. Using a regression discontinuity method and Hong Kong Census data, this study compares children born just before and just after the month in which the compulsory-education law came into effect. The results show that…
ERIC Educational Resources Information Center
Wong, Phoebe; Ng, Peggy M. L.; Mak, Connie K. Y.; Chan, Jason K. Y.
2016-01-01
The higher education sector in Hong Kong has restructured substantially from elite to mass higher education since the introduction of education reform by the Hong Kong government in 2000. To stay ahead in this competitive environment in the education sector, management teams of self-financing institutions have to compete for students and identify…
ERIC Educational Resources Information Center
Chu, Chau Kan; Morrison, Keith
2011-01-01
This paper argues that, despite government support in financial and contractual matters, ongoing problems of retention of Native-speaking English Teachers (NETs) in Hong Kong stem, in part, from problems of cross-cultural adjustment. The paper reports a small-scale qualitative investigation into the experiences of NETS in Hong Kong and finds…
ERIC Educational Resources Information Center
Chan, Ko Ling; Tiwari, Agnes; Fong, Daniel Y. T.; Leung, Wing Cheong; Brownridge, Douglas A.; Ho, Pak Chung
2009-01-01
This study examines correlates of in-law conflict with intimate partner violence (IPV) against pregnant women in a cohort of Chinese pregnant women who visited antenatal clinics in Hong Kong. This was a territory-wide, cross-sectional study of 3,245 pregnant women recruited from seven hospitals in Hong Kong. Participants were invited to complete…
Portrayals of Pro-Beijing Workers' Night Schools in Hong Kong from 1946 to Post-1997
ERIC Educational Resources Information Center
Lau, Chui Shan
2011-01-01
This study focuses on the transformation of pro-Beijing labour education in the socio-political context of Hong Kong. It explores the reasons that Hong Kong pro-Beijing educators initiated Workers' Night Schools for adults; the organisation of schools in many locales and the transformation of labour education that workers received in these…
Business as Usual: The Use of English in the Professional World in Hong Kong
ERIC Educational Resources Information Center
Evans, Stephen
2010-01-01
This article examines the role of written and spoken English vis-a-vis written Chinese, Cantonese and Putonghua in the four key service industries that have driven Hong Kong's economy in the past decade. The study forms part of a long-standing and continuing investigation into the impact of Hong Kong's transition from British colony to Chinese…
ERIC Educational Resources Information Center
Lam, Chi-Chung; Lai, Edith; Wong, Janice
2009-01-01
Using geographic information system (GIS) in teaching and learning geography is an important direction in the secondary geography curriculum in Hong Kong. In the present study, interviews were conducted individually with 28 geography teachers from different secondary schools in Hong Kong, with a view to finding their views on the inclusion of GIS…
ERIC Educational Resources Information Center
Kwok-Wah, Cheung
2011-01-01
Students--and their best interests--are the focal point of curriculum reform in basic education in Hong Kong. Since 2001, Hong Kong has sought to reform basic education so as to enable every student to become "all-rounded." At a practical level, this has meant the cultivation of students' ethics and values, intellect, physical fitness,…
Western Perceptions of Hong Kong Ten Years on: A Corpus-Driven Critical Discourse Study
ERIC Educational Resources Information Center
Cheng, Winnie; Lam, Phoenix W. Y.
2013-01-01
This article studies the Western perceptions of and relations with Hong Kong a decade after the reversion of the sovereignty from Britain to China in 1997. Previous studies have demonstrated that the West had a significantly negative view on the future of Hong Kong with respect to the handover. According to recent observations, however, the…
Correlates of Quality of Life in New Migrants to Hong Kong from Mainland China
ERIC Educational Resources Information Center
Wong, Winky K. F.; Chou, Kee-Lee; Chow, Nelson W. S.
2012-01-01
The concept of Quality of life (QOL) has received considerable attention from different disciplines. The aim of this study was to identify what are the correlates of QOL among Chinese new immigrants in Hong Kong. Data were collected through a cross-sectional survey among 449 Hong Kong new immigrants from Mainland China. Bivariate and multiple…
ERIC Educational Resources Information Center
Ha, Amy; Abbott, Rebecca; Macdonald, Doune; Pang, Bonnie
2009-01-01
This study compared the self-reported physical activity, perceived social support for, and perceived barriers to, physical activity of primary and secondary school children from Hong Kong and Australia. Hong Kong boys and girls reported spending significantly less time, outside of school hours, on physical activity than their Australian…
ERIC Educational Resources Information Center
Morris, Paul
2010-01-01
In 2007, a Judicial Commission of Inquiry was established by the Government of Hong Kong to investigate allegations that senior officials had interfered with the academic freedom and institutional autonomy of the Hong Kong Institute of Education (HKIEd). It concluded that a former minister had requested the President of that institution to curb…
ERIC Educational Resources Information Center
Wang, Jianjun
2004-01-01
Located at a meeting place between the West and the East, Hong Kong has been chosen in this comparative investigation to reconfirm a theoretical model of "reciprocal relationship" between mathematics achievement and self-concept using the 8th grade databases from TIMSS and TIMSS-R. During the time between these two projects, Hong Kong…
Coming to Grips with Change: The Initial Training of Geography Teachers in Hong Kong
ERIC Educational Resources Information Center
Stimpson, Philip
2004-01-01
Hong Kong styles itself as "the city that never sleeps", "the ever changing city". The dynamism and pace of change in teacher education, however, has to be seen as laggardly in comparison. This is not to say there has been no experiment but changes have been piecemeal and "add-ons". Teacher education in Hong Kong has…
ERIC Educational Resources Information Center
Ng, Vinci
2012-01-01
This article reports the findings of a qualitative study that investigates why some local Hong Kong parents decide to give up local education and send their children to international schools in Hong Kong. Data were gathered from 25 parents across eight selected school sites grouped as four cases based on the continental origins of those…
Principals' and Teachers' Perceptions of Quality Management in Hong Kong Primary Schools
ERIC Educational Resources Information Center
Cheng, Alison Lai Fong; Yau, Hon Keung
2011-01-01
Purpose: The purpose of this paper is to examine the perceptions of a sample of Hong Kong principals and teachers of the extent to which quality management (QM) has been effectively implemented in primary schools. The features of QM improvement implemented in Hong Kong primary schools include: values and duties, systems and teams(ST) resources and…
Exploraton of the aging phenomenon in Hong Kong from a leisure perspective
Kam Hung; John L. Crompton
2007-01-01
This study explores perceptions of a sample of Hong Kong's elderly on aging and life satisfaction, and suggests implications for leisure service delivery. Interviews were conducted with 25 elderly in Tsuen Wan District in Hong Kong. The study found that some of the propositions which have been developed in western countries to explain aging appear to be...
Academic Staff Views of Quality Systems for Teaching and Learning: A Hong Kong Case Study
ERIC Educational Resources Information Center
Jones, John; Saram, Don Darshi De
2005-01-01
The "Teaching and Learning Quality Process Review" (TLQPR) recently completed in Hong Kong had an emphasis on education quality work. This paper analyses how, from the perspective of academic staff in one university in Hong Kong, the good intentions embedded in that idea are enhanced or subverted by the broader ?quality system setting in…
USDA-ARS?s Scientific Manuscript database
Physical activity (PA) correlates have not been extensively studied in Hong Kong children. The aim of this study is to assess the validity and reliability of translated scales to measure PA related self-efficacy, enjoyment and social support in Hong Kong Chinese children. Sample 1 (n=273, aged 8–12 ...
Implementing the Project Approach: A Case Study of Hybrid Pedagogy in a Hong Kong Kindergarten
ERIC Educational Resources Information Center
Chen, Jennifer J.; Li, Hui; Wang, Jing-ying
2017-01-01
The Project Approach has been promoted in Hong Kong kindergartens since the 1990s. However, the dynamic processes and underlying mechanisms involved in the teachers' implementation of this pedagogical method there have not yet been fully investigated. This case study of one typical kindergarten in Hong Kong documented how and why eight teachers…
ERIC Educational Resources Information Center
Hon-keung, Yau; Man-shan, Kan; Lai-fong, Cheng Alison
2012-01-01
The purposes of this paper are to identify: (1) the factors affecting the intrinsic motivation of university students in Hong Kong; and (2) gender differences in the perception of intrinsic motivation in Hong Kong higher education environment. The factors of curiosity and external regulation with intrinsic motivation are taken into investigation…
ERIC Educational Resources Information Center
Lo, William Yat Wai; Ng, Felix Sai Kit
2015-01-01
With the processes of inter- and intranationalization, higher education in Hong Kong has been rapidly expanding in an effort to develop the city into a regional education hub. This article explores the trends and developments of higher education research (HER) in Hong Kong in the context of inter- and intranationalization. By drawing on the data…
A Model of Active Ageing through Elder Learning: The Elder Academy Network in Hong Kong
ERIC Educational Resources Information Center
Tam, Maureen
2013-01-01
This article presents the Elder Academy (EA) Network as the policy and practice in promoting active ageing through elder learning in Hong Kong. First, the article examines how the change in demographics and the prevalent trend of an ageing population have propelled the government in Hong Kong to tackle issues and challenges brought about by an…
Developing a Rasch Measurement Physical Fitness Scale for Hong Kong Primary School-Aged Students
ERIC Educational Resources Information Center
Yan, Zi; Bond, Trevor G.
2011-01-01
The main purpose of this study was to develop a Rasch Measurement Physical Fitness Scale (RMPFS) based on physical fitness indicators routinely used in Hong Kong primary schools. A total of 9,439 records of students' performances on physical fitness indicators, retrieved from the database of a Hong Kong primary school, were used to develop the…
The Development of Local Private Primary and Secondary Schooling in Hong Kong, 1841-2012
ERIC Educational Resources Information Center
Cheung, Alan C. K.; Randall, E. Vance; Tam, Man Kwan
2016-01-01
Purpose: This paper is a historical review of the development of private primary and secondary education in Hong Kong from 1841-2012. The purpose of this paper is to examine the evolving relationship between the state and private schools in Hong Kong. Design/methodology/approach: This paper utilizes sources from published official documents,…
Managing Human Capital in World Cities: The Development of Hong Kong into an Education Hub
ERIC Educational Resources Information Center
Lai, Ada; Maclean, Rupert
2011-01-01
Since 2004, the Hong Kong government has sought to build a regional education hub and develop an education industry. However, the rationales and intentions behind this move and the implications these have for the nurturing of local human capital and economic capacity are not always clear. This article seeks to contextualize Hong Kong's economic…
The Perfect Marriage?--Language and Art Criticism in the Hong Kong Public Examination Context
ERIC Educational Resources Information Center
Lau, Chung-yim; Tam, Cheung-on
2017-01-01
Art education in Hong Kong has undergone various changes in response to educational reform. In art assessment, a major change in the Hong Kong New Senior Secondary (NSS) Curriculum is the inclusion of art criticism as a compulsory component of the new public examination. Assessing students' abilities to interpret art in an art criticism public…
ERIC Educational Resources Information Center
Chan, Sophia S. C.; Viswanath, K.; Au, Doreen W. H.; Ma, C. M. S.; Lam, W. W. T.; Fielding, R.; Leung, G. M.; Lam, Tai-Hing
2011-01-01
This paper examines the views of Hong Kong community leaders on the underlying issues that affect family health, happiness and harmony (3Hs) in Hong Kong. Using a community reconnaissance method, a series of individual in-depth interviews with 26 leaders that represent neighbourhoods of diverse socio-economic status (SES) from June to August 2008…
Online Measurement of Academic Programme Preferences for Distance Learners in Hong Kong
ERIC Educational Resources Information Center
Zhang, Wei-yuan; Yeung, Lai-hung Au
2003-01-01
The purpose of this paper is to report on the development of the first online self-directed inventory on the measurement of academic programme preferences (MAPP) for potential students at the Open University of Hong Kong (OUHK). In this study, trait-factor theory and personality type theory were employed. 1,963 respondents in Hong Kong were…
ERIC Educational Resources Information Center
Cheung, Hoi Yan; Wu, Joseph; Tao, Jun
2013-01-01
This paper compares risk perception and risk-taking attitude between Hong Kong and mainland China undergraduate students using a Chinese version of the 30-item domain-specific risk-taking (DOSPERT) scale (Blais and Weber 2006b). Compared with their counterparts from mainland China, Hong Kong university students reported higher levels of risk…
ERIC Educational Resources Information Center
Loh, Elizabeth K. Y.; Tam, Loretta C. W.
2016-01-01
The paper explores how the policy of alternative Chinese qualifications policy affects ethnic minorities' (EM) social mobility, and how such multi-exit assessment framework affects Chinese as a second language learning and teaching in Hong Kong. Chinese language (CL) qualifications other than the Hong Kong Diploma of Secondary Education (HKDSE)…
Student Behaviour and Emotional Challenges for Teachers and Parents in Hong Kong
ERIC Educational Resources Information Center
Forlin, Chris; Cooper, Paul
2013-01-01
Social, emotional, and behavioural disorders of children, within the context of a whole-school approach to inclusion as adopted by Hong Kong, can be challenging for teachers and parents. Based on a comprehensive review of the literature and feedback from a range of experts and parent groups in Hong Kong, specific scales were developed to measure…
Hong Kong Junior Secondary Students' Changing Conceptions of Mainland China
ERIC Educational Resources Information Center
Lam, Chi Chung; Lai, Edith; Wong, Janice Lai Yin
2012-01-01
This study attempted to investigate Hong Kong junior secondary students' conceptions of China before and after the 1997 handover of Hong Kong to China, with a view to finding out any changes in their conceptions, and if any, the factors that might have contributed to these changes. The study found that, over the years from 1997 to 2009, students…
A Comparative Study of Singapore's School Excellence Model with Hong Kong's School-Based Management
ERIC Educational Resources Information Center
Ng, Pak Tee; Chan, David
2008-01-01
Purpose: This paper aims to examine and compare the school excellence model (SEM) approach adopted by Singapore and the school-based management (SBM) approach adopted by Hong Kong. It discusses the implications of such a strategy and the challenges that both Singapore and Hong Kong schools face in navigating a new paradigm of managerialism while…
ERIC Educational Resources Information Center
Cheung, Chi-Kim; Jhaveri, Aditi Dubey
2016-01-01
This paper argues that the planned introduction of visual literacy into the New Secondary School Curriculum can play a crucial role in enabling students to think critically and creatively in Hong Kong's highly visual landscape. As Hong Kong's educational system remains entrenched in long-established and conventional pedagogies, the primacy given…
Making Sense of Divergent Perceptions of Racial-Ethnic Discrimination in Hong Kong
ERIC Educational Resources Information Center
Chan, Carol Wing Sze; Lam, Beatrice Oi-yeung; Teng, Yue; Lee, Moosung
2015-01-01
Behind a veneer of cosmopolitanism in Hong Kong, racial-ethnic discrimination is pervasively experienced by ethnic minorities such as South and South East Asians (hereafter referred to as South/South East Asians). It is the aim of this study to examine why Hong Kong Chinese and South/South East Asians express what seem to be divergent perceptions…
NASA Astrophysics Data System (ADS)
Liu, Siqi; Huang, Guanqi
2018-01-01
Recent years, people have paid more attentions to environmental issues involving air pollution, urban heat island effect and accessibility of green space. Hong Kong is a representative high-density city. The mission of Hong Kong New Town Development is to scatter the densely urban centre population and to improve living quality. Based on the ArcGIS and CFD scientific simulation, this paper focus on the sustainability analysis of Hong Kong new town from the view of Low-Carbon Eco-City, taking Tseung Kwan O new town as the research object.
Hong, Y; Chan, K; Wang, Y
1997-01-01
A study on the data of the physique investigated in teenagers was carried out between Hong Kong and inland cities to compare their cardiopulmonary endurance and muscular fitness. Results revealed that cardiopulmonary endurance in school teenagers of both sex at different ages in inland cities was better than that in Hong Kong. Muscular strength and endurance of sports performance of teenagers, except for standing long jump, in Hong Kong were weaker than that in inland cities. It suggests that attention should be paid to the involvement of teenagers in physical education with the increase of people's living standard.
Busiol, Diego
2015-06-01
The majority of Western psychotherapies are known and practiced in Hong Kong, while psychoanalysis still has little resonance. A recent study finds that psychoanalysis is perceived neither as ineffective nor as necessarily in conflict with Hong Kong Chinese values. Nevertheless, Hong Kong Chinese culture influences how psychoanalysis is received and understood, when compared to Mainland China and Taiwan. It is argued that a better reception in the latter two was possible because of different social and historical backgrounds, different clinical backgrounds of those who receive training, and the more active role of Western psychoanalysts. © 2015 by the American Psychoanalytic Association.
Comparison of stress in anaesthetic trainees between Hong Kong and Victoria, Australia.
Chia, A C L; Irwin, M G; Lee, P W H; Lee, T H W; Man, S E
2008-11-01
A postal survey was sent to anaesthetic trainees in Hong Kong and Victoria, Australia to compare work-related stress levels. Demographic data were collected. Anaesthetist-specific stressors, Maslach Burnout Inventory and Global Job Satisfaction scores were used for psychological testing. The response rates from Hong Kong and Melbourne were 64 of 133 (48.1%) and 108 of 196 (55.1%), respectively. Victorian respondents were older with greater family commitments, but more advanced in fulfilling training requirements. Hong Kong respondents, being faced with both the challenge of dual College requirements, exhibited consistently higher indices of stress (P < 0.001) and less job satisfaction (P < 0.001). Common occupational stressors related to dealing with critically ill patients and medicolegal concerns. Higher stress scores observed in Hong Kong trainees related to service provision and a perceived lack of resources. Despite the complex nature of stress, its antecedents and manifestations, an inverse relationship between emotional exhaustion and job satisfaction was evident in correlation analysis (P < 0.001). This survey suggests that stress was present in some trainees in both areas. Hong Kong trainees may benefit from local development to address mental wellbeing as being important to fulfil this highly competitive training program.
Work injury management model and implication in Hong Kong: a literature review.
Chong, Cecilia Suk-Mei; Cheng, Andy Shu-Kei
2010-01-01
The objective of this review is to explore the work injury management models in literatures and the essential components in different models. The resulting information could be used to develop an integrated holistic model that could be applied in the work injury management system in Hong Kong. A keyword search of MEDLINE and CINAHL databases was conducted. A total of 68 studies related to the management of an injury were found within the above mentioned electronic database. Together with the citation tracking, there were 13 studies left for selection after the exclusion screening. Only 7 out of those 13 studies met the inclusion criteria for review. It is noticeable that the most important component in the injury management model in the reviewed literatures is early intervention. Because of limitations in Employees' Compensation Ordinance in Hong Kong, there is an impetus to have a model and practice guideline for work injury management in Hong Kong to ensure the quality of injury management services. At the end of this paper, the authors propose a work injury management model based on the employees' compensation system in Hong Kong. This model can be used as a reference for those countries adopting similar legislation as in Hong Kong.
Historical trends of organic pollutants in sediment cores from Hong Kong.
Wei, S; Wang, Y; Lam, James C W; Zheng, Gene J; So, M K; Yueng, Leo W Y; Horii, Y; Chen, L Q; Yu, Hongxia; Yamashita, N; Lam, Paul K S
2008-01-01
Recent studies have indicated the occurrence of a wide range of trace organic contaminants, including polychlorinated biphenyls (PCBs) and organochlorine pesticides (OCPs) in the Hong Kong environment. These contaminants are potentially harmful to ecological systems, particularly in coastal areas. In this study, two sediment cores (4m) were collected from southern waters of Hong Kong in 2004 to study the historical trends, distribution patterns, and potential sources of trace organic contaminants. DDTs (p,p'-DDT, o,p'-DDT, p,p'-DDD, o,p'-DDD and p,p'-DDE), hexachlorohexanes (HCHs) (alpha and gamma), hexachlorobenzene (HCB), and PCBs were detected in the samples, whereas other target compounds were all below detection limits. Many OCPs have not been produced or used for many years due to toxicological or environmental concerns and PCB use is prohibited in Hong Kong. However, some compounds were still detectable in recent years, and were found to be widely distributed in the environment, likely because of pollutant inputs from the highly industrialized Pearl River Delta region. These results provide important information on current and historical contamination in Hong Kong, and help to reconstruct the pollution history of these trace organic pollutants in Hong Kong coastal waters.
Liu, Ding-Hua; Cui, Wei; Yao, Yun-Tai; Jiang, Qi-Qi
2010-10-09
We investigated scientific publications in laboratory medicine originating from mainland China, Hong Kong and Taiwan over the past 10 years. The information about articles published in the included journals were determined by computer-searching on PubMed and data were extracted independently and analyzed in relation to the number of articles. From 2000 to 2009 there were 1166 articles published in laboratory medicine journals from the major Chinese regions (mainland China, Hong Kong and Taiwan). This exceeded Japan, Germany, the United Kingdom and France from 2005 onwards. Also, the number of articles from mainland China exceeded those from Hong Kong and Taiwan from 2004 onwards. The average impact factor (IF) from Hong Kong ranked the first, followed by mainland China, and then Taiwan. Clinica Chimica Acta seems to be the most popular laboratory medicine journal among Chinese authors. Over the past 10 years, Chinese authors have been more and more active in the field of laboratory medicine. Mainland China seems to have caught up to Hong Kong and Taiwan regarding publication of papers in this field. Copyright 2010 Elsevier B.V. All rights reserved.
NASA Astrophysics Data System (ADS)
Wing-Hung Lo, Carlos
1995-05-01
Within the context of political democratization, this article explores environmental protection in Hong Kong since the government lauched a ten-year program to “save the environment” in 1989. Examining environmental management by law from a social-choice perspective, it argues that the government has yet to reach an integrative policy orocess. Hence the preconditions for an integrative set of environmental legislation are absent. Institutionally, without a comprehensive green policy, the current arrangements lack a vision as an integrative force to promote effective coordination among various sectoral environmental coordination among various sectoral environmental programs. The dominant approach of policy and law enforcement through consultation has rendered impossible strict enforcement of environmental rules and regulations as local economic growth enjoys a priority over environmental protection. At a time of environmental awakening, the people of Hong Kong are not yet prepared awakening, the people of Hong Kong are not yet prepared to participate in environmental management in a strict legal manner. The overall observation is that Hong Kong has yet to see more mature political, legal, administrative, and social conditions for managing its environment within a legal framework.
Comparison of Fiber Optic Strain Demodulation Implementations
NASA Technical Reports Server (NTRS)
Quach, Cuong C.; Vazquez, Sixto L.
2005-01-01
NASA Langley Research Center is developing instrumentation based upon principles of Optical Frequency-Domain Reflectometry (OFDR) for the provision of large-scale, dense distribution of strain sensors using fiber optics embedded with Bragg gratings. Fiber Optic Bragg Grating technology enables the distribution of thousands of sensors immune to moisture and electromagnetic interference with negligible weight penalty. At Langley, this technology provides a key component for research and development relevant to comprehensive aerospace vehicle structural health monitoring. A prototype system is under development that includes hardware and software necessary for the acquisition of data from an optical network and conversion of the data into strain measurements. This report documents the steps taken to verify the software that implements the algorithm for calculating the fiber strain. Brief descriptions of the strain measurement system and the test article are given. The scope of this report is the verification of software implementations as compared to a reference model. The algorithm will be detailed along with comparison results.
NASA Astrophysics Data System (ADS)
Shimizu, Takayuki; Yari, Takashi; Nagai, Kanehiro; Takeda, Nobuo
2001-07-01
We conducted theoretical and experimental approaches for applying Brillouin optical time domain reflectometer (BOTDR) to aircraft and spacecraft structure health monitoring system. Firstly, distributed strain was measured by BOTDR under 3-point bending test and a spatial resolution was enhanced up to 0.5m using Brillouin spectrum analysis and processing though the device used in this experiment had a spatial resolution of 2m normally. Secondly, dynamic strain measurement was executed under cyclic loading conditions. Brillouin spectrum measured under dynamic conditions is equivalent to superposed spectrum using many spectra measured under static loading conditions. As the measured spectrum was decomposed into many spectra in static loading state, the strain amplitude and its ratio could be estimated. Thirdly, strain and temperature could be measured independently using combined system of BOTDR and fiber Bragg grating (FBG) with wavelength division multiplexing (WDM). Additionally, the application of BOTDR sensing system was shown for a prototype carbon fiber reinforced plastic (CFRP) liquid hydrogen (LH2) tank under cryogenic condition.
Sculpting the Immunological Response against Viral Disease: Statistical Mechanics and Network Theory
NASA Astrophysics Data System (ADS)
Zhou, Hao; Deem, Michael
2007-03-01
The twin challenges of immunodominance and heterologous immunity have hampered discovery of an effective vaccine against all four dengue viruses. Here we develop a generalized NK, or spin glass, theory of T cell original antigenic sin and immunodominance. The theory we develop predicts dengue vaccine clinical trial data well. From the insights that we gain by this theory, we propose two new ideas for design of epitope-based T cell vaccines against dengue. The H5N1 strain of avian influenza first appeared in Hong Kong in 1997. Since then, it has spread to at least eight other Asian countries, Romania, and Russia, and it is widely expected to enter the rest of Europe through migratory birds. Various countries around the world have started to create stockpiles of avian influenza vaccines. However, since the avian influenza is mutating, how many and which strains should be stockpiled? Here we use a combination of statistical physics and network theory to simulate the bird flu transmission and evolution. From the insights that we gain by the theory, we propose new strategies to improve the vaccine efficacy.
Iosipescu shear properties of graphite fabric/epoxy composite laminates
NASA Technical Reports Server (NTRS)
Walrath, D. E.; Adams, D. F.
1985-01-01
The Iosipescu shear test method is used to measure the in-plane and interlaminar shear properties of four T300 graphite fabric/934 epoxy composite materials. Different weave geometries tested include an Oxford weave, a 5-harness satin weave, an 8-harness satin weave, and a plain weave with auxiliary warp yarns. Both orthogonal and quasi-isotropic layup laminates were tested. In-plane and interlaminar shear properties are obtained for laminates of all four fabric types. Overall, little difference in shear properties attributable to the fabric weave pattern is observed. The auxiliary warp material is significantly weaker and less stiff in interlaminar shear parallel to its fill direction. A conventional strain gage extensometer is modified to measure shear strains for use with the Iosipescu shear test. While preliminary results are encouraging, several design iterations failed to produce a reliable shear transducer prototype. Strain gages are still the most reliable shear strain transducers for use with this test method.
Cajimat, Maria N. B.; Milazzo, Mary Louise; Borchert, Jeff N.; Abbott, Ken D.; Bradley, Robert D.; Fulhorst, Charles F.
2008-01-01
The results of analyses of glycoprotein precursor and nucleocapsid protein gene sequences indicated that an arenavirus isolated from a Mexican woodrat (Neotoma mexicana) captured in Arizona is a strain of a novel species (proposed name Skinner Tank virus) and that arenaviruses isolated from Mexican woodrats captured in Colorado, New Mexico, and Utah are strains of Whitewater Arroyo virus or species phylogenetically closely related to Whitewater Arroyo virus. Pairwise comparisons of glycoprotein precursor sequences and nucleocapsid protein sequences revealed a high level of divergence among the viruses isolated from the Mexican woodrats captured in Colorado, New Mexico, and Utah and the Whitewater Arroyo virus prototype strain AV 9310135, which originally was isolated from a white-throated woodrat (Neotoma albigula) captured in New Mexico. Conceptually, the viruses from Colorado, New Mexico, and Utah and strain AV 9310135 could be grouped together in a species complex in the family Arenaviridae, genus Arenavirus. PMID:18304671
NASA Astrophysics Data System (ADS)
Nica, Emilian M.; Franz, Marcel
2018-02-01
Motivated by recent work on strain-induced pseudomagnetic fields in Dirac and Weyl semimetals, we analyze the possibility of analogous fields in two-dimensional nodal superconductors. We consider the prototypical case of a d -wave superconductor, a representative of the cuprate family, and find that the presence of weak, spatially varying strain leads to pseudomagnetic fields and Landau quantization of Bogoliubov quasiparticles in the low-energy sector. A similar effect is induced by the presence of generic, weak doping gradients. In contrast to genuine magnetic fields in superconductors, the strain- and doping-gradient-induced pseudomagnetic fields couple in a way that preserves time-reversal symmetry and is not subject to the screening associated with the Meissner effect. These effects can be probed by tuning weak applied supercurrents which lead to shifts in the energies of the Landau levels and hence to quantum oscillations in thermodynamic and transport quantities.
Low-Cycle Fatigue Behavior of Die-Cast Mg Alloy AZ91
NASA Astrophysics Data System (ADS)
Rettberg, Luke; Anderson, Warwick; Jones, J. Wayne
An investigation has been conducted on the influence of microstructure and artificial aging response (T6) on the low-cycle fatigue behavior of super vacuum die-cast (SVDC) AZ91. Fatigue lifetimes were determined from total strain-controlled fatigue tests for strain amplitudes of 0.2%, 0.4% and 0.6%, under fully reversed loading at a frequency of 5 Hz. Cyclic stress-strain behavior was determined using incremental step test (IST) methods. Two locations in a prototype casting with different thicknesses and, therefore, solidification rates, microstructure and porosity, were examined. In general., at all total strain amplitudes fatigue life was unaffected by microstructure refinement and was attributed to significant levels of porosity. Cyclic softening and a subsequent increased cyclic hardening rate, compared to monotonic tests, were observed, independent of microstructure. These results, fractography and damage accumulation processes, determined from metallographic sectioning, are discussed.
Pan, Jia-Yan; Wong, Daniel Fu Keung; Joubert, Lynette; Chan, Cecilia Lai Wan
2007-09-01
The purpose of the present study was to compare the predictive effects of acculturative stressor and meaning of life on negative affect in the process of acculturation between Chinese international students in Australia and Hong Kong. Four hundred mainland Chinese students studying at six universities in Hong Kong and 227 Chinese international students studying at the University of Melbourne in Australia completed a questionnaire that included measures of acculturative stressor, meaning of life, negative affect and demographic information. The Australian sample was found to have a higher level of acculturative stressor and negative affect than the Hong Kong sample. Acculturative stressor had a positive impact on negative affect in both samples, but the impact of different domains of acculturative stressor on negative affect varied between the two groups. Finally, meaning of life partially mediated the relationship between acculturative stressor and negative affect in the Hong Kong sample, but no such effect was found in the Australia sample. Acculturative stressor is a critical risk factor for negative affect in acculturation for Chinese international students in Australia and Hong Kong. Meaning of life acted as a protective factor that mitigated negative affect for mainland Chinese students in Hong Kong, but not for the Chinese international students in Australia. The theoretical and practical implications for resilience-based and meaning-oriented intervention for Chinese international students are discussed.
Lok, Kris Yuet Wan; Bai, Dorothy Li; Chan, Noel P T; Wong, Janet Y H; Tarrant, Marie
2018-03-01
Researchers have found breastfeeding disparities between immigrant and native-born women in many countries. However, most studies on immigration and breastfeeding practices have been in Western countries. The aim of this study was to examine the effect of length of time since immigration on the breastfeeding practices of Mainland Chinese immigrants living in Hong Kong. We recruited 2704 mother-infant pairs from the postnatal wards of four public hospitals in Hong Kong. We examined the effect of migration status on the duration of any and exclusive breastfeeding. Breastfeeding duration was progressively shorter as the time since immigration increased. When compared with mothers who had lived in Hong Kong for <5 years, Hong Kong-born participants had a 30% higher risk of stopping any breastfeeding (hazard ratio [HR] 1.34 [95% confidence interval {CI} 1.10-1.63]) and exclusive breastfeeding (HR 1.33 [95% CI 1.11-1.58]). In both Hong Kong-born and immigrant participants, breastfeeding cessation was associated with return to work postpartum and the husband's preference for infant formula or mixed feeding. Intention to exclusively breastfeed and to breastfeed for >6 months, and previous breastfeeding experience substantially reduced the risk of breastfeeding cessation for both Hong Kong-born and immigrant participants. Health care professionals should consider immigration history in their assessment of pregnant women and provide culturally adapted breastfeeding support and encouragement to this population. © 2017 Wiley Periodicals, Inc.
First dengue haemorrhagic fever epidemic in the Americas, 1981: insights into the causative agent.
Rodriguez-Roche, Rosmari; Hinojosa, Yoandri; Guzman, Maria G
2014-12-01
Historical records describe a disease in North America that clinically resembled dengue haemorrhagic fever during the latter part of the slave-trading period. However, the dengue epidemic that occurred in Cuba in 1981 was the first laboratory-confirmed and clinically diagnosed outbreak of dengue haemorrhagic fever in the Americas. At that time, the presumed source of the dengue type 2 strain isolated during this epidemic was considered controversial, partly because of the limited sequence data and partly because the origin of the virus appeared to be southern Asia. Here, we present a molecular characterisation at the whole-genome level of the original strains isolated at different time points during the epidemic. Phylogenetic trees constructed using Bayesian methods indicated that 1981 Cuban strains group within the Asian 2 genotype. In addition, the study revealed that viral evolution occurred during the epidemic - a fact that could be related to the increasing severity from month to month. Moreover, the Cuban strains exhibited particular amino acid substitutions that differentiate them from the New Guinea C prototype strain as well as from dengue type 2 strains isolated globally.
Miniature Six-Axis Load Sensor for Robotic Fingertip
NASA Technical Reports Server (NTRS)
Diftler, Myron A.; Martin, Toby B.; Valvo, Michael C.; Rodriguez, Dagoberto; Chu, Mars W.
2009-01-01
A miniature load sensor has been developed as a prototype of tactile sensors that could fit within fingertips of anthropomorphic robot hands. The sensor includes a force-and-torque transducer in the form of a spring instrumented with at least six semiconductor strain gauges. The strain-gauge wires are secured to one side of an interface circuit board mounted at the base of the spring. This board protects the strain-gauge wires from damage that could otherwise occur as a result of finger motions. On the opposite side of the interface board, cables routed along the neutral axis of the finger route the strain-gauge output voltages to an analog-to-digital converter (A/D) board. The A/D board is mounted as close as possible to the strain gauges to minimize electromagnetic noise and other interference effects. The outputs of the A/D board are fed to a controller, wherein, by means of a predetermined calibration matrix, the digitized strain-gauge output voltages are converted to three vector components of force and three of torque exerted by or on the fingertip.
Knitted Strain Sensor Textiles of Highly Conductive All-Polymeric Fibers.
Seyedin, Shayan; Razal, Joselito M; Innis, Peter C; Jeiranikhameneh, Ali; Beirne, Stephen; Wallace, Gordon G
2015-09-30
A scaled-up fiber wet-spinning production of electrically conductive and highly stretchable PU/PEDOT:PSS fibers is demonstrated for the first time. The PU/PEDOT:PSS fibers possess the mechanical properties appropriate for knitting various textile structures. The knitted textiles exhibit strain sensing properties that were dependent upon the number of PU/PEDOT:PSS fibers used in knitting. The knitted textiles show sensitivity (as measured by the gauge factor) that increases with the number of PU/PEDOT:PSS fibers deployed. A highly stable sensor response was observed when four PU/PEDOT:PSS fibers were co-knitted with a commercial Spandex yarn. The knitted textile sensor can distinguish different magnitudes of applied strain with cyclically repeatable sensor responses at applied strains of up to 160%. When used in conjunction with a commercial wireless transmitter, the knitted textile responded well to the magnitude of bending deformations, demonstrating potential for remote strain sensing applications. The feasibility of an all-polymeric knitted textile wearable strain sensor was demonstrated in a knee sleeve prototype with application in personal training and rehabilitation following injury.
A Pilot Study of Using Jazz Warm Up Exercises in Primary School Choir in Hong Kong
ERIC Educational Resources Information Center
Chen, Jason Chi Wai; Lee, Han Wai
2013-01-01
This pilot study is to examine whether it is valuable to implement jazz choral practice in Hong Kong primary school setting. The findings can serve as a reference to explore the possibilities of promoting jazz education in Asian countries or in China. The participants were 70 public primary school students from grade 2 to 5 in Hong Kong. All…
The Challenges for Educational Achievements of Young Mainland Chinese Migrants in Hong Kong
ERIC Educational Resources Information Center
Wong, Yu-Cheung
2011-01-01
Hong Kong's population has increased by around one million per decade from the end of World War II till the 1990s. A large proportion of this growth came from the mass influx of migrants from Mainland China, and the children born to them. During the 1960s and 1970s when Hong Kong's economy was booming rapidly, career advancement opportunities were…
ERIC Educational Resources Information Center
Yip, Din Yan; Chiu, Ming Ming; Ho, Esther Sui Chu
2004-01-01
This study examined gender differences in students' scientific literacy as measured by OECD-PISA. In particular, we focused on the 2437 students from 140 Hong Kong schools. Hong Kong boys' and girls' science scores did not differ overall. However, boys scored higher than girls at the higher percentiles (75th and above). Moreover, specific test…
ERIC Educational Resources Information Center
Lau, Grace; Ho, Kwok Keung
2016-01-01
This paper will present multiple themes that are intermingled with one another, aiming to bring an overview of sociology of education and its application in the Hong Kong situation. One of the themes concerns how sociology of education has intertwined with the socio-political aspect of Hong Kong before and after year 1997 resulting in different…
ERIC Educational Resources Information Center
Hue, Ming-Tak; Kennedy, Kerry John
2013-01-01
Many Hong Kong schools are concerned about their growing numbers of ethnic minority students. When these students are enrolled in Hong Kong secondary schools, how their cultural diversity is catered for becomes critical. This article examines how teachers narrate the cultural diversity of ethnic minority students, who come from Pakistan, India,…
ERIC Educational Resources Information Center
Mo, P. K. H.; Lau, J. T. F.
2015-01-01
The impact of influenza on elderly can be severe and fatal. Influenza vaccination (IV) has been shown to be effective in reducing influenza-related complications, but the IV uptake among elderly in Hong Kong remains low. This study investigated the prevalence and factors associated with IV among Chinese elderly in Hong Kong using the Health Belief…
ERIC Educational Resources Information Center
Kim, Koomi J.; Ng, Patrick; Fahrenbruck, Mary L.
2015-01-01
This study investigates how university students in the US and Hong Kong perceive themselves as literate and biliterate beings. All the participants in Hong Kong are biliterate in at least two languages (including Cantonese, Mandarin, and English), whereas only 40% of the U.S. participants are biliterate in at least two languages (including…
Aspects of the Two Language System and Three Language Problem in the Changing Society of Hong Kong.
ERIC Educational Resources Information Center
Tsou, Benjamin K.
1996-01-01
Presents details of the language shifts among the various sections of the Chinese-speaking population in Hong Kong and analyzes patterns of allegiance. Notes that complex social, economic, and political pressures will affect future language in Hong Kong and that, within the domains of family, work, and others, the use of Modern Standard Chinese is…
Educating Teachers in Hong Kong for Leadership in the Age of the Internet: A Re-Conceptualisation
ERIC Educational Resources Information Center
Katyal, Kokila
2010-01-01
There is very little argument that one of the major developments to have impacted in schools in the past decade is the rapid and world-wide development of information and communication technologies (ICT), particularly the Internet. In Hong Kong, reforms in the ICT teacher training policy, and the fact that Hong Kong is a "wired" city,…
ERIC Educational Resources Information Center
Bridges, Susan; emerald, elke
2013-01-01
In 1998, the government of the Hong Kong Special Administrative Region began a large-scale project to import qualified, experienced native-speaking teachers of English into Hong Kong secondary schools. The Native-speaking English Teacher (NET) scheme later expanded to include Hong Kong primary schools. Currently, teachers from around the world are…
ERIC Educational Resources Information Center
Tam, Angela Choi Fung
2012-01-01
Immediately after the handover of Hong Kong to China, the teaching of Chinese in Putonghua was promulgated by the Hong Kong SAR government as a long-term goal. However, no clear definition and guidance regarding Putonghua instruction has been provided to teachers to facilitate the smooth implementation of this change. A review of the literature…
Social Development in Hong Kong: Development Issues Identified by Social Development Index (SDI)
ERIC Educational Resources Information Center
Chua, Hoi-wai; Wong, Anthony K. W.; Shek, Daniel T. L.
2010-01-01
Surviving the aftermaths of the Asian Financial Crisis and SARS in 2003, Hong Kong's economy has re-gained its momentum and its economic growth has been quite remarkable too in recent few years. Nevertheless, as reflected by the Social Development Index (SDI), economic growth in Hong Kong does not seem to have benefited the people of the city at…
Applying Resource Utilization Groups (RUG-III) in Hong Kong Nursing Homes
ERIC Educational Resources Information Center
Chou, Kee-Lee; Chi, Iris; Leung, Joe C. B.
2008-01-01
Resource Utilization Groups III (RUG-III) is a case-mix system developed in the United States for categorization of nursing home residents and the financing of residential care services. In Hong Kong, RUG-III is based on several board groups of residents. The aim of this study was to examine the reliability and validity of the RUG-III in Hong Kong…
ERIC Educational Resources Information Center
Lo, Patrick; Chiu, Dickson K. W.; Chu, Wilson
2013-01-01
The Hong Kong Design Institute (HKDI) is a leading design education institute in Hong Kong under the Vocational Training Council (VTC) group. Opened in September 2010, the HKDI Learning Resources Centre is a specialist library for the study of art and design. The mission of the HKDI Library is to support and promote the academic goals of the…
ERIC Educational Resources Information Center
Wong, Ting-Hong
2015-01-01
This paper compares public-private partnerships (PPPs) in education in post-war Singapore and Hong Kong. After the Second World War the Singapore government shied away from PPPs, while the state in Hong Kong collaborated extensively with the non-state sector in education. Singapore was a small city-state flanked by two Muslim nations, and its…
The Influence of Health Promoting Practices on the Quality of Life of Community Adults in Hong Kong
ERIC Educational Resources Information Center
Mo, Phoenix K. H.; Winnie, W. S. Mak
2010-01-01
The importance of a healthy lifestyle is receiving increasing attention due to its impact on health and well-being. However, very few studies have been done on health promoting practices of the general public in Hong Kong. The present study aimed to identify the patterns of health promoting practices of the general public in Hong Kong, to compare…
ERIC Educational Resources Information Center
Ho, Wai-Chung; Law, Wing-Wah
2006-01-01
In the past, the music curricula of Hong Kong (HK), Mainland China and Taiwan have focused on Western music, but with the advent of music technology and the new tripartite paradigm of globalisation, localisation and Sinophilia this has begun to change. Hong Kong, Shanghai and Taipei share a common historical culture and their populations are…
ERIC Educational Resources Information Center
Yu, Timothy L.M., Comp.
This bibliography lists and describes published and unpublished material relating to mass communications in Hong Kong and Macao, from 1945 to 1973. Most of the items listed are written in Chinese; a limited number are in English. Part one, which deals with Hong Kong, lists 115 items divided into 18 sections: bibliography and reference material;…
From Recipient to Contributor: The Story of a Social Justice Leader in a Hong Kong Primary School
ERIC Educational Resources Information Center
Szeto, Elson
2014-01-01
This article presents a principal's story of social justice practice in a Hong Kong primary school. The narration accounts for the notion of social justice through his practice in various ways. Studying in a "rooftop" primary school located in a public housing area in Hong Kong was the principal's salient memory of his first year of…
Perception of high-density living in Hong Kong
Lawrence H. Travers
1977-01-01
Analysis of the Hong Kong experience of adaptation to urban living can provide insights into some of the problems that can be expected to occur in the rapidly expanding cities of the Third World. Population densities in Hong Kong are among the highest in the world, exceeding 400,000 persons per square mile in parts of Kowloon. Research based upon residence in a worker...
Verifying entanglement in the Hong-Ou-Mandel dip
DOE Office of Scientific and Technical Information (OSTI.GOV)
Ray, Megan R.; Enk, S. J. van
2011-04-15
The Hong-Ou-Mandel interference dip is caused by an entangled state, a delocalized biphoton state. We propose a method of detecting this entanglement by utilizing inverse Hong-Ou-Mandel interference, while taking into account vacuum and multiphoton contaminations, phase noise, and other imperfections. The method uses just linear optics and photodetectors, and for single-mode photodetectors we find a lower bound on the amount of entanglement.
Siu, Judy Yuen-man
2015-10-05
The outbreak of Ebola virus disease (EVD) in Africa in 2014 attracted worldwide attention. Because of the high mortality rate, marginalised social groups are vulnerable to disease-associated stigmatisation and discrimination, according to the literature. In Hong Kong, ethnic minorities such as Africans are often disadvantaged groups because of their low position in the social hierarchy. In 2011, approximately 1700 Africans were residing in Hong Kong. Their overseas experiences during the EVD outbreak were not well documented. Therefore, this study investigated the EVD-associated stigmatisation experiences of African residents of Hong Kong with chronic illnesses, and how these experiences shaped their perceptions of EVD. A qualitative design with 30 in-depth semistructured interviews was conducted with chronically ill African residents of Hong Kong. The interview data showed that the sampled Africans often experienced stigmatisation in their workplaces and in the community during the EVD outbreak. Their experiences of EVD-associated stigma were correlated to the embedded social and cultural values regarding ethnic minorities in Hong Kong. These experiences of being stigmatised shaped the perceptions of the Africans of EVD, leading them to view EVD as shameful and horrifying. They also perceived EVD as retribution and was introduced by Westerners. The participants' perceptions of EVD influenced their responses to and behaviour towards EVD, which may have posed potential threats to Hong Kong's public health. The EVD outbreak was not the only cause of the participants' stigmatisation; rather, their EVD-associated experiences were a continuation and manifestation of the embedded social and cultural values regarding ethnic minorities in Hong Kong. The experiences of being stigmatised shaped the participants' perceptions of EVD. Because of their marginalised social position and isolation from the main community, the participants had extremely limited access to reliable information about EVD. As a result, they used their own cultural beliefs to understand EVD, which might have ultimately influenced their health behaviours. The experiences of the participants showed that ethnic minorities in Hong Kong were in need of more culturally responsive social and health care support to obtain reliable information about the nature of and preventive measures against EVD.
Yawsonde Tests for Prototypes of the 155mm Intermediate Volatility Agent Projectile
1982-07-01
velocities shown in the table have not been corrected back to the muzzle). Time-zero measurements were made using a strain gage attached to the tube...DRXSY-MP, H. Cohen Commander, USATECOM ATTN: DRSTE-TO-F PM SMOKE, Bldg. 324 ATTN: DRCPM- SMK Director, USACSL, EA Bldg. E3516 ATTN: DRDAR-CLB-PA (1 cy
Phase-locked telemetry system for rotary instrumentation of turbomachinery, phase 1
NASA Technical Reports Server (NTRS)
Adler, A.; Hoeks, B.
1978-01-01
A telemetry system for use in making strain and temperature measurements on the rotating components of high speed turbomachines employs phase locked transmitters, which offer greater measurement channel capacity and reliability than existing systems which employ L-C carrier oscillators. A prototype transmitter module was tested at 175 C combined with 40,000 g's acceleration.
Two Asian highly pathogenic strains of Type 2 PRRSV in United States swine
USDA-ARS?s Scientific Manuscript database
Highly pathogenic PRRSV (HP-PRRSV) has been circulating in Asia for 7 years. rJXwn06 and rSRV07 were rescued from infectious clones of two HP-PRRSV for investigation at the National Animal Disease Center. The clinical disease and viral replication kinetics of HP-PRRSV were compared to prototype stra...
Foil Strain Gauges Using Piezoresistive Carbon Nanotube Yarn: Fabrication and Calibration
Góngora-Rubio, Mário R.; Kiyono, César Y.; Mello, Luis A. M.; Cardoso, Valtemar F.; Rosa, Reinaldo L. S.; Kuebler, Derek A.; Brodeur, Grace E.; Alotaibi, Amani H.; Coene, Marisa P.; Coene, Lauren M.; Jean, Elizabeth; Santiago, Rafael C.; Oliveira, Francisco H. A.; Rangel, Ricardo; Thomas, Gilles P.; Belay, Kalayu; da Silva, Luciana W.; Moura, Rafael T.; Seabra, Antonio C.; Silva, Emílio C. N.
2018-01-01
Carbon nanotube yarns are micron-scale fibers comprised by tens of thousands of carbon nanotubes in their cross section and exhibiting piezoresistive characteristics that can be tapped to sense strain. This paper presents the details of novel foil strain gauge sensor configurations comprising carbon nanotube yarn as the piezoresistive sensing element. The foil strain gauge sensors are designed using the results of parametric studies that maximize the sensitivity of the sensors to mechanical loading. The fabrication details of the strain gauge sensors that exhibit the highest sensitivity, based on the modeling results, are described including the materials and procedures used in the first prototypes. Details of the calibration of the foil strain gauge sensors are also provided and discussed in the context of their electromechanical characterization when bonded to metallic specimens. This characterization included studying their response under monotonic and cyclic mechanical loading. It was shown that these foil strain gauge sensors comprising carbon nanotube yarn are sensitive enough to capture strain and can replicate the loading and unloading cycles. It was also observed that the loading rate affects their piezoresistive response and that the gauge factors were all above one order of magnitude higher than those of typical metallic foil strain gauges. Based on these calibration results on the initial sensor configurations, new foil strain gauge configurations will be designed and fabricated, to increase the strain gauge factors even more. PMID:29401745
Shek, Daniel T L
2006-01-01
Several adolescent developmental issues and problems in Hong Kong are examined in this paper. First, the changing adolescent substance abuse patterns are described. Second, although the overall youth crime trend was relatively stable in the past decade, shoplifting and stealing crimes deserve our concern. Third, adolescent mental health problem is a growing problem. Fourth, statistics show that unhealthy life styles, such as smoking, early sex and moral confusion are issues of concern. Fifth, the proportion of adolescents experiencing economic disadvantage has increased. Sixth, youth unemployment and non-engaged youth are growing problems when the economy of Hong Kong is undergoing re-structuring. Seventh, family and parenting problems in families with adolescents deserve our attention. Finally, the Social Development Index showed that the development of young people has gradually deteriorated in the past decade. These adolescent issues and problems provide useful pointers for designing the positive youth development program financially sponsored by the Hong Kong Jockey Club Charities Trust.
Western impressions of the Hong Kong health care system.
Bennett, C L; Pei, G K; Ultmann, J E
1996-01-01
Hong Kong, Taiwan, Singapore, and Malaysia are initiating health care reform to meet the changing demands of populations with improved socioeconomic status and access to modern technologies and who are living longer than in previous generations. Hong Kong, in particular, is facing a unique set of circumstances as its people prepare for the transition in 1997 from a British colony to a Special Administrative Region of China. While spending only 4% of its gross domestic product on health care, it has a large and regulated public hospital system for most inpatient medical care and a separate, loosely regulated private health care system for most outpatient medical care. In 1993 the Secretary for Health and Welfare of Hong Kong initiated a year-long process to debate the pros and cons of 5 fundamental programs for health care reform. After a year of open consultation, options were chosen. We describe the Hong Kong health care system, the fundamental changes that have been adopted, and lessons for reformers in the United States. PMID:8855683
Difference in compliance with Standard Precautions by nursing staff in Brazil versus Hong Kong.
Pereira, Fernanda Maria Vieira; Lam, Simon Ching; Chan, Jackie Hoi Man; Malaguti-Toffano, Silmara Elaine; Gir, Elucir
2015-07-01
The Standard Precautions (SP) are measures to reduce the risk of transmission of bloodborne and other pathogens, and should be used by health professionals in the care of all patients regardless of their condition of infection. However, suboptimal compliance with SP has been consistently reported in the nursing literature. This study evaluated the differences of compliance with SP among nurses from Brazil and Hong Kong. This cross-sectional study was conducted in 2 countries-Hong Kong and Brazil-with nurses working in hospitals who responded to a self-administered questionnaire with demographic data and responses to a 20-item Compliance with Standard Precautions Scale. The compliance rate of 560 nurses was 69.4% for the Brazilian sample and 57.4% for the Hong Kong sample. The additional clinical experience of the Brazilian nurses versus those in Hong Kong may be related to differences in compliance with SP between nurses. Copyright © 2015 Association for Professionals in Infection Control and Epidemiology, Inc. Published by Elsevier Inc. All rights reserved.
Yu, Nancy Xiaonan; Liu, Chang; Yue, Zhenzhu
2017-08-01
The number of Hong Kong citizens living in mainland China is increasing. The process of acculturation may create opportunities for psychological growth. This study aimed at examining whether resilience mediated the effects of acculturation on psychological growth in college students from Hong Kong to Guangzhou. In this cross-sectional survey, 164 college students in Guangzhou who were Hong Kong permanent residents (female: 46%, age: 21.09 ± 1.50) joined the study. The integration group reported more psychological growth than the assimilation, separation, and marginalization groups. Resilience partially mediated the effect of integration on psychological growth and fully mediated the effect of marginalization on psychological growth. Resilience represents one of the mechanisms to explain beneficial effects of integration on psychological growth in college students from Hong Kong to Guangzhou. Theoretical considerations to rethink the acculturation model, implications for developing intervention programs, and recommendations for future research are discussed.
Age, sex, marital status and suicide: an empirical study of east and west.
Yip, P S
1998-02-01
The relationships among age, sex, marital status and suicidal behaviour in Australia and Hong Kong showed disparity in age-specific suicide rates among the four marital status groups, never married, married, widowed and divorced, for both sexes in the two locations. Examining the coefficients of preservation suggested the coefficient for never married to married in all cases was larger than 1, except for the groups of teenagers aged 15-19 years for both sexes and of elderly women aged 60 years or over in Hong Kong. The widowed or divorced groups have lower suicide rates than the married women among the elderly in Hong Kong. Hong Kong women seem not to have been benefited in marriage as much as men. Responsibility and workload in married life rather than low social status are the likely reasons for the relative high female suicide rate in Hong Kong. Possible cultural and environmental factors which are somewhat speculative (yet to be confirmed) are discussed.
Shaffer, M A; Joplin, J R; Bell, M P; Lau, T; Oguz, C
2000-10-01
Drawing on social identity theory (P. J. Burke, 1991) and the current status of women and equal opportunity legislation, the authors tested several factors associated with distress in working women in the People's Republic of China (PRC), Hong Kong, and the United States. Women in Hong Kong experienced significantly greater levels of life stress than PRC and U.S. women. Reports of negative attitudes toward women, gender evaluation, and avoidance coping were greater for Hong Kong and PRC women than for U.S. women. Hong Kong women reported more use of positive/confrontational coping mechanisms. Negative attitudes toward women had an important influence on life stress across regions. Moderator tests resulted in 2 significant findings: The effect of negative attitudes toward women on life stress was stronger for PRC and Hong Kong women, and the relationship between nervous/self-destructive coping and life stress was stronger for U.S. women.
Western impressions of the Hong Kong health care system.
Bennett, C L; Pei, G K; Ultmann, J E
1996-01-01
Hong Kong, Taiwan, Singapore, and Malaysia are initiating health care reform to meet the changing demands of populations with improved socioeconomic status and access to modern technologies and who are living longer than in previous generations. Hong Kong, in particular, is facing a unique set of circumstances as its people prepare for the transition in 1997 from a British colony to a Special Administrative Region of China. While spending only 4% of its gross domestic product on health care, it has a large and regulated public hospital system for most inpatient medical care and a separate, loosely regulated private health care system for most outpatient medical care. In 1993 the Secretary for Health and Welfare of Hong Kong initiated a year-long process to debate the pros and cons of 5 fundamental programs for health care reform. After a year of open consultation, options were chosen. We describe the Hong Kong health care system, the fundamental changes that have been adopted, and lessons for reformers in the United States.
Communication in Hong Kong Accident and Emergency Departments
Chandler, Eloise; Pun, Jack; Lock, Graham; Matthiessen, Christian M. I. M.; Espindola, Elaine; Ng, Carman
2015-01-01
In this article, we report findings from the first qualitatively driven study of patient–clinician communication in Hong Kong Accident and Emergency Departments (AEDs). In light of the Hong Kong Hospital Authority’s policy emphasis on patient-centered care and communication in the public hospitals it oversees, we analyze clinicians’ perceptions of the role and relevance of patient-centered communication strategies in emergency care. Although aware of the importance of effective communication in emergency care, participants discussed how this was frequently jeopardized by chronic understaffing, patient loads, and time pressures. This was raised in relation to the absence of spoken interdisciplinary handovers, the tendency to downgrade interpersonal communication with patients, and the decline in staff attendance at communication training courses. Participants’ frequent descriptions of patient-centered communication as dispensable from, and time-burdensome in, AEDs highlight a discrepancy between the stated Hong Kong Hospital Authority policy of patient-centered care and the reality of contemporary Hong Kong emergency practice. PMID:28462303
Education Reform in Hong Kong: The ``Through-Road'' Model and its Societal Consequences
NASA Astrophysics Data System (ADS)
Poon, Anita Y. K.; Wong, Yiu-Chung
2008-01-01
Although Hong Kong's education system has long been criticized as lacking in creativity and over-emphasising rote learning, on the whole it has served Hong Kong well in the past years, breeding outstanding business, academic and political leaders who continue to maintain Hong Kong's competitive edge. The traditional elite schools have played a crucial role in the process. The education reform, which is still on-going, aims to overhaul the entire system by introducing the "through-road" model. To accomplish this, some mechanisms need to be changed. J.P. Farrell's concepts of equality and equity, C.W. Mills' concept of elitism, and P. Bourdieu and J. Coleman's concepts of cultural and social capital will be applied to analyse the consequences of the reform. The paper argues that the education reform may be well-intentioned in eliminating some elements of inequality and inequity in education, but that this comes at the expense of Hong Kong's cultural and social capital and leads to the development of new forms of inequality.
Nisar, M; Williams, C S; Davies, P D
1991-05-01
We have undertaken a retrospective survey of patients of South East Asian ethnic origin (SEA), presenting with tuberculosis (between 1980 and 1989) while resident in the Liverpool district. Of 708 notifications in the 10-year period, 42 (6%) were SEA patients mainly from Hong Kong or mainland China. A total of 22 (52%) of the SEA patients presented with an extrapulmonary site of disease. Drug resistance was present in 11% of those for whom sensitivity results were available. Rates of disease in Hong Kong are similar to those seen in the Indian Subcontinent (ISC) population in the U.K. With the expected immigration of Hong Kong Chinese and possibly other SEA individuals to the U.K. as a result of the lease back of Hong Kong in 1997, all clinicians must be alerted to the possibility of tuberculosis whenever these individuals present with disease. The high incidence of extra pulmonary disease in SEA immigrants is striking and similar to that seen in the ISC population.
Structural Anomaly Detection Using Fiber Optic Sensors and Inverse Finite Element Method
NASA Technical Reports Server (NTRS)
Quach, Cuong C.; Vazquez, Sixto L.; Tessler, Alex; Moore, Jason P.; Cooper, Eric G.; Spangler, Jan. L.
2005-01-01
NASA Langley Research Center is investigating a variety of techniques for mitigating aircraft accidents due to structural component failure. One technique under consideration combines distributed fiber optic strain sensing with an inverse finite element method for detecting and characterizing structural anomalies anomalies that may provide early indication of airframe structure degradation. The technique identifies structural anomalies that result in observable changes in localized strain but do not impact the overall surface shape. Surface shape information is provided by an Inverse Finite Element Method that computes full-field displacements and internal loads using strain data from in-situ fiberoptic sensors. This paper describes a prototype of such a system and reports results from a series of laboratory tests conducted on a test coupon subjected to increasing levels of damage.
Perez, Daniel Roberto; Sorrell, Erin; Angel, Matthew; Ye, Jianqiang; Hickman, Danielle; Pena, Lindomar; Ramirez-Nieto, Gloria; Kimble, Brian; Araya, Yonas
2009-08-24
On June 11, 2009 the World Health Organization (WHO) declared a new H1N1 influenza pandemic. This pandemic strain is as transmissible as seasonal H1N1 and H3N2 influenza A viruses. Major concerns facing this pandemic are whether the new virus will replace, co-circulate and/or reassort with seasonal H1N1 and/or H3N2 human strains. Using the ferret model, we investigated which of these three possibilities were most likely favored. Our studies showed that the current pandemic virus is more transmissible than, and has a biological advantage over, prototypical seasonal H1 or H3 strains.
ERIC Educational Resources Information Center
Wang, Li-Chih; Yang, Hsien-Ming
2011-01-01
This study focused on a comparison of the visuo-spatial abilities (correct rate and speed) between dyslexic and normal students in Taiwan and Hong Kong. There were a total of 120 10-12 year old students. Thirty students had been diagnosed as dyslexic in Taiwan (T.W. dyslexia) and thirty students had been diagnosed as dyslexic in Hong Kong (H.K.…
ERIC Educational Resources Information Center
Tse, Shek-Kam; Xiao, Xiao-Yun; Ko, Hwa-Wei; Lam, Joseph Wai-Ip; Hui, Sau-Yan; Ng, Hung-Wai
2016-01-01
This study examined the influence of classroom pedagogic reading practices and out-of-school practices in explaining why the reading attainment of Hong Kong Grade 4 students was superior to that of their counterparts in Taiwan in the 2006 Progress in International Reading Literacy Study. Analyses of scores from 9,301 students (4,712 from Hong Kong…
ERIC Educational Resources Information Center
Lau, Melissa May Yee
2016-01-01
Purpose: The purpose of this paper is to investigate how the effects of 8Ps of services marketing affect students' selection of self-financing sub-degree programmes in Hong Kong. The factors that affect students' selection of self-financing sub-degree programmes have not been studied in higher education market of Hong Kong. This research is to…
ERIC Educational Resources Information Center
2001
In an effort to increase access to education and set up a comprehensive qualification framework, Hong Kong's Education Commission made key recommendations to the government in May 2000. Those recommendations included the development of a diversified, multi-channel, multi-layer higher education system. Three of Hong Kong's higher education…
ERIC Educational Resources Information Center
Shen, Simon
2012-01-01
Since the handover of its sovereignty to the People's Republic of China, Hong Kong has had to increasingly rely on Beijing to sustain its economic growth and to maintain its competitiveness in the global arena. The almost unconditional support offered by Beijing is given largely on the assumption that the Hong Kong special administrative region,…
ERIC Educational Resources Information Center
Koh, Aaron
2014-01-01
Why do more than three-quarters of Hong Kong's senior secondary students flock to tutorial centres like moths to light? What is the "magic" that is driving the popularity of the tutorial centre enterprise? Indeed, looking at the ongoing boom of tutorial centres in Hong Kong (there are almost 1,000 of them), it is difficult not to ask…
ERIC Educational Resources Information Center
Trent, John; Gao, Xuesong
2009-01-01
A teacher shortage in Hong Kong in core subjects, such as English, has led to interest in the recruitment and retention of second-career teachers. Drawing upon Wenger's (1998) theory of identity formation and using data from interviews with eight second-career English language teachers in Hong Kong, this paper explores how second-career teachers…
ERIC Educational Resources Information Center
Newbrook, Mark
1990-01-01
A study compared the perceptions of two experts from different cultural backgrounds concerning salience of a variety of errors typical of the English written by Hong Kong secondary and college students. A book on English error types written by a Hong-Kong born, fluent Chinese-English bilingual linguist was analyzed for its emphases, and a list of…
Optimization of Inflammatory Bowel Disease Cohort Studies in Asia.
Leung, Wai K
2015-07-01
With the incidence of inflammatory bowel disease (IBD) increasing rapidly in many Asian countries, including Hong Kong, it is important that patient characteristics are better understood. For example, are the phenotypes, behaviors, complications, and even treatment responses found in Asian patients similar to those of their Western counterparts? To formally address these questions, a properly designed local cohort study is needed. Whilst IBD is still relatively uncommon in Asia, the establishment of a local IBD registry will significantly contribute to the answering of these questions. The Hong Kong IBD registry was established to fill the gap in the understanding of IBD patients, and to foster research into IBD in Hong Kong. The Hong Kong IBD registry is a territory-wide registry that includes all public hospitals in Hong Kong. We included all IBD patients who were currently receiving medical care at these hospitals. With the help of the central computer medical record system of the Hospital Authority of Hong Kong, all clinical events, medications usage, endoscopy records, and laboratory results of patients in the registry were captured. Apart from data collection, the registry is also establishing a bio-specimen bank of blood and stool samples of IBD patients for future research. The IBD registry is a very useful platform for population-based studies on IBD in Asia.
Practice of laryngectomy rehabilitation interventions: a perspective from Hong Kong.
Chan, Jimmy Y W
2013-06-01
To review the current practice of rehabilitation for laryngectomees in Hong Kong. Factors affecting the quality of life of laryngectomees include their performance in speech restoration, the presence of complications of treatment, as well as the availability of psycho-social support. In Hong Kong, more than 90% of laryngectomees have speech restoration by various means, the commonest of which being tracheo-oesophageal puncture and electrolaryngeal speech. However, they face special problems in communication using the current alaryngeal speech modalities, as it is difficult to produce variation in tones, which is important to express different meanings in Cantonese. The responsibility of surgeons to follow-up patients after surgery and the practice of management of common complications after laryngectomy are also discussed. The New Voice Club of Hong Kong promotes self-help and mutual help between laryngectomees, with the aim of helping new members to regain normal speech and to re-integrate into society. Quality-of-life study in Hong Kong shows that although the mean global health score is satisfactory, the social functioning domain is most severely affected after surgery. Cantonese-speaking laryngectomees in Hong Kong are facing unique challenges in speech restoration and re-integration into society after surgery. Surgeons should take the leading role in the multidisciplinary management of these patients.
Hyperbiofilm Formation by Bordetella pertussis Strains Correlates with Enhanced Virulence Traits
Cattelan, Natalia; Jennings-Gee, Jamie; Dubey, Purnima
2017-01-01
ABSTRACT Pertussis, or whooping cough, caused by the obligate human pathogen Bordetella pertussis is undergoing a worldwide resurgence. The majority of studies of this pathogen are conducted with laboratory-adapted strains which may not be representative of the species as a whole. Biofilm formation by B. pertussis plays an important role in pathogenesis. We conducted a side-by-side comparison of the biofilm-forming abilities of the prototype laboratory strains and the currently circulating isolates from two countries with different vaccination programs. Compared to the reference strain, all strains examined herein formed biofilms at high levels. Biofilm structural analyses revealed country-specific differences, with strains from the United States forming more structured biofilms. Bacterial hyperaggregation and reciprocal expression of biofilm-promoting and -inhibitory factors were observed in clinical isolates. An association of increased biofilm formation with augmented epithelial cell adhesion and higher levels of bacterial colonization in the mouse nose and trachea was detected. To our knowledge, this work links for the first time increased biofilm formation in bacteria with a colonization advantage in an animal model. We propose that the enhanced biofilm-forming capacity of currently circulating strains contributes to their persistence, transmission, and continued circulation. PMID:28893915
Genetic differentiation of methicillin-resistant Staphylococcus aureus strains from Korea and Japan.
Soo Ko, Kwan; Peck, Kyong Ran; Sup Oh, Won; Lee, Nam Yong; Hiramatsu, Keiichi; Song, Jae-Hoon
2005-01-01
In this study, we evaluated genetic differentiation between methicillin-resistant Staphylococcus aureus (MRSA) strains from Korea and Japan. Seventy-five MRSA strains, including 25 h VISA strains, were analyzed by molecular typing methods, including multilocus sequence typing (MLST), SCC mec typing, and spa typing. The most prevalent genotype of MRSA strains, in both Korea and Japan, was ST 5-MRSA-II with the DMGMK spa motif, characteristic of the New York/Japan MRSA clone. In spite of these common features in MRSA strains from Korea and Japan, we also observed some genotypic divergence in MRSA from the two countries. Several spa types might be differentiated from a prevalent prototype (TJMBMDMGMK) that is shared by the two countries, revealing a unique geographic distribution. SCC mec type II lacking pUB110, designated type IIA, was found more frequently in Korea than in Japan. The rate of gentamicin resistance was also dramatically different between the two countries: 87.2% (Korea) vs. 28.6% (Japan). These preliminary findings suggested that MRSA strains from Korea and Japan might have originated from a common ancestor, but then clearly differentiated according to locality. A further comprehensive study should be performed to document the hypotheses from this study.
Long-Term Spatio-Temporal Trends of Organotin Contaminations in the Marine Environment of Hong Kong.
Ho, Kevin K Y; Zhou, Guang-Jie; Xu, Elvis G B; Wang, Xinhong; Leung, Kenneth M Y
2016-01-01
Hong Kong imposed a partial restriction on application of organotin-based antifouling paints in 1992. Since September 2008, the International Maritime Organization prohibited the use of such antifouling systems on all sea-going vessels globally. Therefore, it is anticipated a gradual reduction of organotin contamination in Hong Kong's marine waters. Using the rock shell Reishia clavigera as a biomonitor, we evaluated the organotin contamination along Hong Kong's coastal waters over the past two decades (1990-2015). In 2010 and 2015, adult R. clavigera were examined for imposex status and analysed for tissue concentrations of six organotins. We consistently found 100% imposex incidence in female R. clavigera across all sites. Tissue triphenyltin (TPT) concentrations were high in most samples. A probabilistic risk assessment showed that there were over 69% of chance that local R. clavigera would be at risk due to exposure to phenyltins. Comparing with those of previous surveys (2004-2010), both imposex levels and tissue concentrations of organotins did not decline, while the ecological risks due to exposure to organotins were increasing. We also observed high concentrations of monobutyltin and TPT in seawater and sediment from locations with intense shipping activities and from stormwater or sewage discharge. Overall, organotins are still prevalent in Hong Kong's marine waters showing that the global convention alone may be inadequate in reducing organotin contamination in a busy international port like Hong Kong. Appropriate management actions should be taken to control the use and release of organotins in Hong Kong and South China.
Burden of obesity--lessons learnt from Hong Kong Chinese.
Ko, G T C; Chan, J C N
2008-03-01
There is now a pandemic of chronic diseases in Asian countries, driven mainly by obesity, diabetes and cardio-renal complications. In Hong Kong, the reported prevalence of obesity, defined as body mass index (BMI) > or = 25 kg m(-2), varied from one-quarter to one-third of the population. In a population-based survey conducted in 1995, 16.7% of Hong Kong adults had the metabolic syndrome (MES) (National Cholesterol Education Programme criterion). Obesity is now a global concern not only in adults but also among children and adolescents. In 2003, a territory-wide survey in Hong Kong reported the prevalence of central obesity and MES to be 9.0% and 2.4%, respectively, in Chinese adolescents. Overweight, positive family history of diabetes and studying at schools of lower academic grading were independent risk factors for the adolescent MES. Lifestyle modification with proper diet and exercise is essential for health protection. In accord with western data, a weight management programme in Hong Kong Chinese with a 4-6% reduction in body weight or waist circumference was associated with significant reductions in all cardiovascular risk factors. Psychosocial factors related to chronic diseases are also of growing concern. In Hong Kong Chinese, increasing BMI was associated with a lower number of sleeping hours and increasing working hours, suggesting an intimate relationship between physical health and psychosocial stress. Chronic non-communicable diseases are therefore major health threats in Hong Kong, with obesity as one of the major risk factors. A multidimensional and multidisciplinary health promotion and disease management plan is urgently needed to control these epidemics.
Occupational rehabilitation in Hong Kong: current status and future needs.
Kwok, H K H; Szeto, G P Y; Cheng, A S K; Siu, H; Chan, C C H
2011-03-01
This paper reviews the development of occupational rehabilitation in Hong Kong, both in terms of the science as well as the service for injured workers. Besides, it also reviews the existing Employees' Compensation Ordinance for work injury to illustrate how the policy could influence the success and development of the discipline. Five experienced occupational rehabilitation providers, including 1 occupational medicine specialist, 3 occupational therapists, and 1 physiotherapist critically reviewed the past and current development of occupational rehabilitation in Hong Kong as well as the local contextual factors, which could influence its future development. Since the enactment of the Employees' Compensation Ordinance in the 1950s, there have been progressive improvements in the field of occupational rehabilitation in Hong Kong. Services in the early years were mostly based on the biomedical model, where doctors and patients tended to focus on clinical symptoms and physical pathology when making clinical decisions. Since then, remarkable academic achievements have been made in the field locally, from the validation of clinical instruments for assessment of work capacity, assessment of employment readiness to the evaluation of efficacy of interventional programs for injured workers focusing on work related outcomes. However, there has been a relatively lack of progress in the development of related policies and implementation of related programs for occupational rehabilitation. There is no built in linkage between rehabilitation, compensation and prevention in the current system in Hong Kong, and there is no rehabilitation policy specific to those workers with occupational diseases and injuries. There are still deficiencies in the development and provision of occupational rehabilitation services in Hong Kong. Incorporation of requirements for occupational rehabilitation at the legislation and policy levels should be seriously considered in the future. Besides, the development of the Occupational Medicine subspecialty in the public hospital system in Hong Kong is considered a facilitator to the future development of occupational rehabilitation in Hong Kong.
Christiansen, Angela; Vernon, Veronica; Jinks, Annette
2013-04-01
The aim of the study was to identify the factors that nurses perceive may facilitate or hinder the development of advanced practice nurse roles in Hong Kong. Advanced practice nurses are increasingly prominent in nurse-led out-of-hours care in Hong Kong in response to changes to junior doctors' hours of work. Three five-day workshops for Hong Kong-based advanced practice nurses were offered in partnership with UK clinicians. The aim of the workshops was to share UK experiences of implementation of the 'Hospital at Night' model of care delivery. The questionnaire study undertaken was not part of the workshop programme. However, the workshops gave the authors a unique opportunity to access relatively large numbers of Hong Kong-based advanced practice nurses. The workshops were attended by experienced nurses who had been or were about to be appointed as advanced practice nurses. All nurses who attended one of the three workshops (n=120) agreed to participate in the study. Responses to two open questions posed in the questionnaire were the subject of a content analysis. A prominent finding of the study was that respondents viewed the benefits of introducing advanced practice nurse roles in Hong Kong as outweighing any challenges. One of the main features of the perceived benefits relates to improving the quality and safety of patient care. The greatest challenges associated with the role related to acceptance of the role by other healthcare professionals, and difficulties associated with the general public's traditional attitudes to healthcare provision in Hong Kong. Education of the public concerning the implementation of such roles is of crucial importance. Findings from this study enhance understanding of the factors that hinder or facilitate advanced practice roles in out-of-hours care in Hong Kong. © 2012 Blackwell Publishing Ltd.
NASA Technical Reports Server (NTRS)
Lee, Y. C.; Wenig, Mark; Zhang, Zhenxi; Sugimoto, Nobuo; Larko, Dave; Diehl, Thomas
2012-01-01
The study presented in this paper analyses two dust episodes in Hong Kong, one occurring in March 2006 and the other on 22 March 2010. The latter is the worst dust episode on Hong Kong record. The focus is on the relationship between the dust episodes and the Sharav/Mongolian cyclones and jet streams. The 16 March 2006 episode is traceable to a continental-scale Saharan dust outbreak of 5-9 March 2006 caused by the cold front of an East Mediterranean Sharav cyclone arriving at north-west Africa on 5 March 2006. The eastward movement of the cyclone along the North African coast is clearly illustrated in the geopotential height contours. Simulations by the chemistry transport model GOCART provide a visible evidence of the transport as well as an estimate of contributions from the Sahara to the aerosol concentration levels in Hong Kong. The transport simulations suggest that the dust is injected to the polar jet north of the Caspian Sea, while it is transported eastward simultaneously by the more southerly subtropical jet. The major source of dust for Hong Kong is usually the Gobi desert. Despite the effect of remote sources, the 16 March 2006 dust episode was still mainly under the influence of the Mongolian cyclone cold fronts. In the recent episode of 22 March 2010, the influence of the Mongolian cyclone predominated as well. It appears that the concurrent influence of the Sharav and Mongolian cyclones on Hong Kong and East Asia is not a common occurrence. Besides transporting dusts from non-East Asian sources to Hong Kong and East Asia, the strong subtropical jet on 21 March 2010 (i.e. 1 day prior to the major dust episode) is believed to have strengthened an easterly monsoon surge to South China causing the transport of voluminous dusts to Taiwan and Hong Kong the following day.
Schachner, Anna; Marek, Ana; Grafl, Beatrice; Hess, Michael
2016-04-15
Forty-eight fowl aviadenoviruses (FAdVs) isolated from recent IBH outbreaks across Europe were investigated, by utilizing for the first time the two major adenoviral antigenic domains, hexon loop-1 and fiber, for compound molecular characterization of IBH-associated FAdVs. Successful target gene amplification, following virus isolation in cell culture or from FTA-card samples, demonstrated presence of FAdVs in all cases indicative for IBH. Based on hexon loop-1 analysis, 31 European field isolates exhibited highest nucleotide identity (>97.2%) to reference strains FAdV-2 or -11 representing FAdV-D, while 16 and one European isolates shared >96.0% nucleotide identity with FAdV-8a and -8b, or FAdV-7, the prototype strains representing FAdV-E. These results extend recognition of specific FAdV-D and FAdV-E affiliate genotypes as causative agents of IBH to the European continent. In all isolates, species specificity determined by fiber gene analysis correlated with hexon-based typing. A threshold of 72.0% intraspecies nucleotide identity between fibers from investigated prototype and field strains corresponded with demarcation criteria proposed for hexon, suggesting fiber-based analysis as a complementary tool for molecular FAdV typing. A limited number of strains exhibited inconsistencies between hexon and fiber subclustering, indicating potential constraints for single-gene based typing of those FAdVs. Within FAdV-D, field isolate fibers shared a high degree of nucleotide (>96.7%) and aa (>95.8%) identity, while FAdV-E field isolate fibers displayed greater nucleotide divergence of up to 22.6%, resulting in lower aa identities of >81.7%. Furthermore, comparison with FAdVs from IBH outbreaks outside Europe revealed close genetic relationship in the fiber, independent of the strains' geographic origin. Copyright © 2016 Elsevier B.V. All rights reserved.
Aligned Carbon Nanotube Tape for Sensor Applications
NASA Technical Reports Server (NTRS)
Tucker, Dennis S.
2013-01-01
For this effort, will concentrate on three applications: Vibration Gyroscope utilizes piezoelectric properties of the tape and Coriolis effect Accelerometer utilizes the piezoresistive property Strain Gauge utilizes piezoresistive property Accelerometer and Strain Gauge can also utilize piezoelectric effect Test piezoelectric properties using facilities at the Microfabrication Laboratory (AMRDEC) . Enhance piezoelectric effect using polyvinylidine fluoride and P(VDF ]TrFE) which is readily polarizable .Spray matrix solution while winding fiber; Sandwich of CNT tape and PVDF film (DOE .Two Level) . Construct and test prototype vibration gyroscope . Construct and test prototype accelerometer using cantilever design . Test strain sensitivity of CNT tape against industrial strain gauge . Embed CNT tape in composite samples as well as on surface and test to failure (4 ]point bend) A piezoelectric device exhibits an electrical response from a mechanical applied stress. . A piezoelectric device has both capacitance and resistance properties in which by applying an electric field from a waveform will exert a mechanical stress that can be monitored for a response. . The typical waveform applied is a sinusoidal waveform of a defined voltage for a defined period. The defined voltage is driven from 0 volts to the positive defined volts then back to 0 and driven to negative defined volts then back to 0. . Example. Vmax set to 10V and period set to 10 ms. . Voltage will start at zero, go to 10 volts, return to zero, go to ]10 volts and return to zero during 10 ms. . Applying this electrical field to a DUT, the capacitance response and resistance response can be observed. CNT tape is easier to manufacture and cheaper than micromachining silicon or other ceramic piezoelectric used in gyroscopes and accelerometers CNT tape properties can be modified during manufacture for specific application CNT tape has enhanced mechanical and thermal properties in addition to unique electrical properties CNT tape as a strain gauge in Structural Health Monitoring will provide an excellent material to embed within composite structures
Vibrio cholerae O1 epidemic variants in Angola: a retrospective study between 1992 and 2006.
Valia, Romy; Taviani, Elisa; Spagnoletti, Matteo; Ceccarelli, Daniela; Cappuccinelli, Piero; Colombo, Mauro M
2013-01-01
Cholera is still a major public health concern in many African countries. In Angola, after a decade of absence, cholera reemerged in 1987, spreading throughout the country until 1996, with outbreaks recurring in a seasonal pattern. In 2006 Angola was hit by one of the most severe outbreaks of the last decade, with ca. 240,000 cases reported. We analyzed 21 clinical strains isolated between 1992 and 2006 from several provinces throughout the country: Benguela, Bengo, Luanda, Cuando Cubango, and Cabinda. We used two multiplex PCR assays to investigate discriminatory mobile genetic elements (MGE) [Integrative Conjugative Elements (ICEs), VSP-II, GI12, GI14, GI15, K, and TLC phages] and we compared the profiles obtained with those of different reference V. cholerae O1 variants (prototypical, altered, and hybrid), responsible for the ongoing 7th pandemic. We also tested the strains for the presence of specific VSP-II variants and for the presence of a genomic island (GI) (WASA-1), correlated with the transmission of seventh pandemic cholera from Africa to South America. Based on the presence/absence of the analyzed genetic elements, five novel profiles were detected in the epidemic strains circulating in the 1990s. The most frequent profiles, F and G, were characterized by the absence of ICEs and the three GIs tested, and the presence of GI WASA-1 and the WASA variant of the VSP-II island. Our results identified unexpected variability within the 1990s epidemic, showing different rearrangements in a dynamic part of the genome not present in the prototypical V. cholerae O1 N16961. Moreover the 2006 strains differed from the current pandemic V. cholerae O1 strain. Taken together, our results highlight the role of horizontal gene transfer (HGT) in diversifying the genetic background of V. cholerae within a single epidemic.
Li, Shujiao; Lin, Hang; Qu, Cheng; Tang, Yuping; Shen, Juan; Li, Weixia; Yue, Shijun; Kai, Jun; Shang, Guanxiong; Zhu, Zhenhua; Zhang, Changbin; Liu, Pei; Yan, Hui; Zhang, Li; Qian, Li; Qian, Dawei; Duan, Jin-ao
2015-07-21
The compatibility of Angelicae Sinensis Radix (Danggui) and Carthami Flos (Honghua), a famous herb pair Gui-Hong, can produce synergistic and complementary hematinic effects. Our previous studies have indicated that Gui-Hong has therapeutic potential treatment in hemolytic and aplastic anemia (HAA). The present study aimed to investigate the hematinic effects of Danggui, Honghua and Gui-Hong on HAA rats induced by acetyl phenylhydrazine (APH) and cyclophosphamide (CP) and to explore the underlying hematinic regulation mechanisms. Rats were divided into 5 groups, and drugs were administered by oral gavage one time each day for continuous 7 days from the experiment began. Urine and plasma were analyzed by ultra-high-performance liquid chromatography coupled to quadrupole time-of-flight mass spectrometry (UHPLC-QTOF/MS). Partial least-squares discriminate analysis (PLS-DA) models were built to evaluate the therapeutic effects of Danggui, Honghua and Gui-Hong. Pearson correlation matrix analysis method was used to discover the correlations between potential biomarkers and biochemical indicators of HAA rats. Seven potential biomarkers contribute to the separation of model group and control group were tentatively identified. The levels of l-kynurenine, phenylalanine, nicotinic acid and sphingosine increased significantly (P<0.05) in HAA rats, while the levels of l-isoleucine, l-tyrosine and serotonin decreased significantly (P<0.05) in comparison with control rats. Those endogenous metabolites were chiefly involved in phenylalanine, tyrosine and tryptophan biosynthesis, valine, leucine and isoleucine biosynthesis, tryptophan metabolism and tyrosine metabolism. The metabolic deviations could be regulated closer to normal level after Danggui, Honghua and Gui-Hong intervention. In term of hematinic effects, Gui-Hong was the most effective as shown by the relative distance in PLS-DA score plots and relative intensity of potential biomarkers. The result reflected the synergic action between Danggui and Honghua. The above results were found to be reasonable in explaining the hematinic effects mechanism of Gui-Hong. The results of routine blood, urinary metabolic pattern and plasma metabolic pattern show the Danggui, Honghua and Gui-Hong groups are moving toward the control group and the HAA was being prevented and alleviated. The effect of Gui-Hong group is more remarkable than Danggui and Honghua groups. Some potential biomarkers like l-kynurenine, phenylalanine, l-isoleucine, l-tyrosine, serotonin, nicotinic acid and sphingosine have been found and identified. The work shows that the metabonomics method is a promising tool in the efficacy and mechanism research of traditional Chinese medicines. Copyright © 2015 Elsevier Ireland Ltd. All rights reserved.
ERIC Educational Resources Information Center
To, Siu-ming; Kan, Siu-mee Iu; Ngai, Steven Sek-yum
2015-01-01
This study examined the interaction effects between Hong Kong adolescents' exposure to sexually explicit online materials (SEOM) and individual, family, peer, and cultural factors on their beliefs about gender role equality and body-centered sexuality. Based on a survey design with a sample of 503 high school students in Hong Kong, the results…
ERIC Educational Resources Information Center
McNaught, Carmel
2004-01-01
This paper is a narrative about the use of narrative as a means to understand how the use of technology assisted the educational community of Hong Kong during the SARS crisis of 2003. It is not a carefully planned conventional research study. It is based on seven narratives written by staff at The Chinese University of Hong Kong about their…
Rising Strengths Hong Kong SAR in Bioinformatics.
Chakraborty, Chiranjib; George Priya Doss, C; Zhu, Hailong; Agoramoorthy, Govindasamy
2017-06-01
Hong Kong's bioinformatics sector is attaining new heights in combination with its economic boom and the predominance of the working-age group in its population. Factors such as a knowledge-based and free-market economy have contributed towards a prominent position on the world map of bioinformatics. In this review, we have considered the educational measures, landmark research activities and the achievements of bioinformatics companies and the role of the Hong Kong government in the establishment of bioinformatics as strength. However, several hurdles remain. New government policies will assist computational biologists to overcome these hurdles and further raise the profile of the field. There is a high expectation that bioinformatics in Hong Kong will be a promising area for the next generation.
Lao, Lixing; Ning, Zhipeng
2015-11-01
The European Congress for Integrative Medicine 2015 Global Summit on Integrative Medicine and Healthcare in Greater Copenhagen has successfully promoted integrative medicine to the public once again. Integrative medicine, which is called the art and science of healthcare by Nordic Integrative Medicine, has been widely used in the world. In Hong Kong, integrated traditional Chinese and Western medicine, which is also known as the Chinese version of integrative medicine, provides a valuable reference for the development of integrative medicine in the world. In this article, we introduce the development of traditional Chinese medicine in Hong Kong and an integrated traditional Chinese and Western medicine model in the University of Hong Kong-Shenzhen Hospital.
Lo, T Wing
2012-06-01
This article examines the political and legal barriers to introducing restorative justice (RJ) in Hong Kong. It argues that the processes involved in RJ may be in conflict with the rule of law, which is regarded by the citizens of Hong Kong as sacrosanct in their resistance to the "mainlandization" of criminal justice practices after China resumed sovereignty of Hong Kong. It is argued that, because it could admit such potentially harmful Chinese criminal justice concepts as "rule by the people," "absence of the presumption of innocence," "leniency for self-confession and severity for resistance," and "toeing the party line," RJ would be devoid of any restorative substance and could breach the principles of due process.
NASA Astrophysics Data System (ADS)
Huang, Shieh-Kung; Loh, Kenneth J.
2015-04-01
The main goal of this study was to develop and validate the performance of a miniature and portable data acquisition (DAQ) system designed for interrogating carbon nanotube (CNT)-based thin films for real-time spatial structural sensing and damage detection. Previous research demonstrated that the electrical properties of CNT-based thin film strain sensors were linearly correlated with applied strains. When coupled with an electrical impedance tomography (EIT) algorithm, the detection and localization of damage was possible. In short, EIT required that the film or "sensing skin" be interrogated along its boundaries. Electrical current was injected across a pair of boundary electrodes, and voltage was simultaneously recorded along the remaining electrode pairs. This was performed multiple times to obtain a large dataset needed for solving the EIT spatial conductivity mapping inverse problem. However, one of the main limitations of this technique was the large amount of time required for data acquisition. In order to facilitate the adoption of this technology and for field implementation purposes, a miniature DAQ that could interrogate these CNT-based sensing skins at high sampling rates was designed and tested. The prototype DAQ featured a Howland current source that could generate stable and controlled direct current. Measurement of boundary electrode voltages and the switching of the input, output, and measurement channels were achieved using multiplexer units. The DAQ prototype was fabricated on a two-layer printed circuit board, and it was designed for integration with a prototype wireless sensing system, which is the next phase of this research.
Wei, Xiaolin; Li, Haitao; Yang, Nan; Wong, Samuel Y. S.; Owolabi, Onikepe; Xu, Jianguang; Shi, Leiyu; Tang, Jinling; Li, Donald; Griffiths, Sian M.
2015-01-01
Objectives Primary care is the key element of health reform in China. The objective of this study was to compare patient assessed quality of public primary care between Hong Kong, a city with established primary care environment influenced by its colonial history, and Shanghai, a city leading primary care reform in Mainland China; and to measure the equity of care in the two cities. Methods Cross sectional stratified random sampling surveys were conducted in 2011. Data were collected from 1,994 respondents in Hong Kong and 811 respondents in Shanghai. A validated Chinese version of the primary care assessment tool was employed to assess perceived quality of primary care with respect to socioeconomic characteristics and health status. Results We analyzed 391 and 725 respondents in Hong Kong and Shanghai, respectively, who were regular public primary care users. Respondents in Hong Kong reported significant lower scores in first contact accessibility (1.59 vs. 2.15), continuity of care (2.33 vs. 3.10), coordination of information (2.84 vs. 3.64), comprehensiveness service availability (2.43 vs. 3.31), comprehensiveness service provided (2.11 vs. 2.40), and the total score (23.40 vs. 27.40), but higher scores in first contact utilization (3.15 vs. 2.54) and coordination of services (2.67 vs. 2.40) when compared with those in Shanghai. Respondents with higher income reported a significantly higher total primary care score in Hong Kong, but not in Shanghai. Conclusions Respondents in Shanghai reported better quality of public primary care than those in Hong Kong, while quality of public primary care tended to be more equitable in Shanghai. PMID:25826616
Lee, P M; Wong, K H
2007-06-01
To evaluate the cost-effectiveness of universal antenatal human immunodeficiency virus (HIV) testing in Hong Kong. Cost-effectiveness analysis from the health care provider's perspective. Public antenatal clinics in Hong Kong. All pregnant women who gave birth in Hong Kong during the inclusive period 1 September 2001 and 31 December 2004. The primary endpoints were (i) the cost per HIV infection avoided and (ii) the cost per life-year gained. From 2001 to 2004, a total of 160,878 deliveries were recorded in Hong Kong; and 75% of the corresponding women had HIV testing before delivery. In all, 28 women tested HIV-positive and gave birth to 15 babies, one of which was HIV-positive. The mother of the infected baby presented late in labour, without her HIV status being diagnosed and thus missed the opportunity for prompt intervention. Assuming a natural transmission rate of 25%, it was estimated that six out of seven anticipated HIV infections among the newborns had been avoided. The cost for implementation of the programme for the first 3 years was HKD12 227 988. Hence, the average costs per HIV infection averted and per discounted life-year gained were HKD2 037 998 and HKD79 099, respectively. Sensitivity analysis showed that both the coverage and the loss-to-follow-up rate were the major determinants of the cost-effectiveness of the universal antenatal testing programme in Hong Kong. The universal antenatal testing programme in Hong Kong is largely efficient. In view of the low prevalence of HIV infection, high rates of HIV testing and uptake of antiretroviral prophylaxis are crucial to the success of the programme.
Liang, Yan; Fung, Pui Ka; Tse, Man Fung; Hong, Hua Chang; Wong, Ming Hung
2008-11-01
The main objective of this study was to investigate occurrence of polycyclic aromatic hydrocarbons (PAHs) in the sources of the drinking water supply of Hong Kong. The main emphasis was on the Dongjiang River in mainland China which is the major source, supplying 80% of the total consumption in Hong Kong (the remaining 20% is obtained from rain water). Sediments were collected from four sites along the Dongjiang River and four reservoirs in Hong Kong during both the dry and wet weather seasons. The concentrations of total PAHs in the sediments ranged between 36 and 539 microg/kg dry wt. The lower levels were detected at the upstream site on the Dongjiang River and at the reservoirs in Hong Kong (44-85 microg/kg dry wt), while the mid- and downstream sites on the Dongjiang River were more polluted (588-658 microg/kg dry wt). Examination of the PAH profiles revealed that the mid- and downstream sections of the Dongjiang River contained high percentages of 4,5,6-ring PAHs, similar to the amounts of atmospheric particulate matter and road dust collected during the dry weather season from the Pearl River Delta region as reported in the literature. Seasonal changes were revealed in the reservoirs of Hong Kong, with higher PAH levels in the wet weather season than in the dry weather season. For those reservoirs in Hong Kong that store water from the Dongjiang River, a distinct seasonal pattern was also observed, namely, that under dry weather season conditions the PAHs found in the sediments were primarily from petrogenic source, while under wet weather season conditions they were from pyrolytic sources. No such pattern was detected in the reservoirs which stored only rain water.
DEM Simulated Results And Seismic Interpretation of the Red River Fault Displacements in Vietnam
NASA Astrophysics Data System (ADS)
Bui, H. T.; Yamada, Y.; Matsuoka, T.
2005-12-01
The Song Hong basin is the largest Tertiary sedimentary basin in Viet Nam. Its onset is approximately 32 Ma ago since the left-lateral displacement of the Red River Fault commenced. Many researches on structures, formation and tectonic evolution of the Song Hong basin have been carried out for a long time but there are still remained some problems that needed to put into continuous discussion such as: magnitude of the displacements, magnitude of movement along the faults, the time of tectonic inversion and right lateral displacement. Especially the mechanism of the Song Hong basin formation is still in controversy with many different hypotheses due to the activation of the Red River fault. In this paper PFC2D based on the Distinct Element Method (DEM) was used to simulate the development of the Red River fault system that controlled the development of the Song Hong basin from the onshore to the elongated portion offshore area. The numerical results show the different parts of the stress field such as compress field, non-stress field, pull-apart field of the dynamic mechanism along the Red River fault in the onshore area. This propagation to the offshore area is partitioned into two main branch faults that are corresponding to the Song Chay and Song Lo fault systems and said to restrain the east and west flanks of the Song Hong basin. The simulation of the Red River motion also showed well the left lateral displacement since its onset. Though it is the first time the DEM method was applied to study the deformation and geodynamic evolution of the Song Hong basin, the results showed reliably applied into the structural configuration evaluation of the Song Hong basin.
Protective Mechanisms of Nitrone Antioxidants in Kanic Acid Induced Neurodegeneration
2004-01-01
Hong, Dextromethorphan modulates the AP-1 DNA bind- Med. 14 (1993) 633-642. ing activity induced by kainic acid, Brain Res. 824 (1999) 125-132. [71 S.C...Hong, The effect of dextromethorphan on kainic acid-induced after kainic acid-induced seizures, Free Radical Biol. Med. 18 seizures in the rat...Bing, G., Bronstein, D., McMillian, M., Hong, J.-S. (1996) the effects of dextromethorphan on kainic acid-induced seizures in the rat. J. Neurotoxic
Koljonen, Paul A
2007-08-01
To review and summarise current controversies in cervical screening in Hong Kong and discuss the potential impact of prophylactic human papillomavirus vaccination. Literature search of Medline to December 2006, the Hong Kong Cancer Registry, and Centre of Disease Control. Key words search terms were: 'human papillomavirus', 'vaccine', 'cervical cancer', 'screening programme', and 'Hong Kong'. Original articles, review papers, books, and the worldwide web. Cervical cancer is one of the most common cancers in Hong Kong, and can be prevented if detected at its pre-cancerous stage. Despite the huge disease burden this imposes on our society and robust advocacy by the academic sector, an appropriate screening programme is still not in place. Existence of a vaccine that could potentially reduce the costs of universal screening should prompt our government to re-consider subsidising such a programme. While a combined screening-vaccination programme may be more cost-effective than screening alone, the vaccine is still costly, and the government must consider all the pros and cons. The new human papillomavirus vaccine, combined with an organised screening programme, is probably a more cost-effective way of preventing morbidity and mortality due to cervical cancer than the current programme in Hong Kong. More research and cost-effectiveness analyses are needed to decide on the ideal ages for primary vaccination and the requirement for booster shots.
Doubling over ten years of central obesity in Hong Kong Chinese working men.
Ko, Tin-choi Gary; Chan, Juliana; Chan, Amy; Wong, Patrick; Hui, Stanley; Chow, Ferrie; Tong, Spencer; Chan, Cecilia
2007-07-05
Obesity is now an epidemic in most parts of the world. In this cross sectional study, we report the most recent data on obesity in Hong Kong Chinese working population and compare the changes over 10 years. Between July 2000 and March 2002, 5882 adult subjects from the working class in Hong Kong were recruited (2716 men (46.2%) and 3166 women (53.8%)). They were randomly selected using computer generated codes according to the distribution of occupational groups. Results of this study were compared with the data collected from a prevalence survey for cardiovascular risk factors in a Hong Kong Chinese working population conducted in 1990 (1513 subjects, 910 men (60.1%) and 603 women (39.9%)). Standardized percentages of overweight, obesity, and central obesity, in Hong Kong Chinese working population were 59.7%, 35.0%, 26.7% in men and 32.0%, 21.7%, 26.7% in women. Compared to the data collected in 1990, the percentage of obesity increased by 5% in men and reduced by 6% in women. The percentage of central obesity doubled in men (from 12.2% to 26.7%) but remained stable in women. There is a doubling of the percentage of central obesity in Hong Kong Chinese working men over previous decade. Education and proper lifestyle modification program to tackle this social health issue are urgently indicated.
NASA Astrophysics Data System (ADS)
Hajjar, G.; Gu, M.; Lee, K. K.
2017-12-01
Air pollution, a leading cause of global warming and many respiratory diseases, has become a global and prevalent concern in today's society. Thus, air pollution is a significant topic that we need to investigate and research, especially in highly-dense and busy cities like Hong Kong. The data collected will be based in Hong Kong. I will collect air pollutant concentrations data from a Central Western station set up by the Hong Kong government and compare it with air pollution data collected by the ISF Academy located in Cyberport. Levels of PM2.5 and PM10.0 will be measured by a TEOM, CH4 and CO2 by a Gasmet DX4015, and SO2, NOx, O3, and CO3 with an Airpointer. To compare pollution level in Hong Kong to the rest of the world, data collected will first be measured against international standards set by the World Health Organization. A mathematical analysis of the two sets of data obtained will then be conducted to determine the environmental circumstances that coincide with times with high levels of pollutants, as well as the types of pollutants that Cyberport has more of, compared to the Central Western district, and vice versa. Finally, an evaluation of the reasons behind the results presented will follow.
Lam, Linda Chiu-Wa; Wong, Corine Sau-Man; Wang, Min-Jung; Chan, Wai-Chi; Chen, Eric Yu-Hai; Ng, Roger Man-Kin; Hung, Se-Fong; Cheung, Eric Fuk-Chi; Sham, Pak-Chung; Chiu, Helen Fung-Kum; Lam, Ming; Chang, Wing-Chung; Lee, Edwin Ho-Ming; Chiang, Tin-Po; Lau, Joseph Tak-Fai; van Os, Jim; Lewis, Glyn; Bebbington, Paul
2015-09-01
Data on mental disorder prevalence and health service utilization required to inform healthcare management and planning are lacking in Hong Kong. The current study determined the prevalence of common mental disorders (CMD), and examined the patterns of mental health service utilization and associated factors. We analyzed data from the Hong Kong Mental Morbidity Survey (HKMMS) of 5,719 Chinese adults aged 16-75 years in the general Hong Kong population, using the Chinese Revised Clinical Interview Schedule (CIS-R). The weighted prevalence estimate for any past-week CMD was 13.3 %, with mixed anxiety and depressive disorder being the most frequent diagnoses. CMD was positively associated with female gender, being divorced or separated, alcohol misuse, substance dependence, lack of regular physical exercise, and a family history of mental disorder. Among individuals with CMD, only 26 % had consulted mental health services in the past year; less than 10 % consulted general practitioners or family physicians. Lack of mental health service usage was significantly more likely in men and those with lower educational attainment. Apart from attention to psychosocial risks, health and lifestyle factors are important considerations for mental health promotion. Service utilization for individuals with CMD in Hong Kong remains suboptimal, and would be enhanced by strengthening community primary care.
Monitoring of wind load and response for cable-supported bridges in Hong Kong
NASA Astrophysics Data System (ADS)
Wong, Kai-yuen; Chan, Wai-Yee K.; Man, King-Leung
2001-08-01
Structural health monitoring for the three cable-supported bridges located in the West of Hong Kong or the Tsing Ma Control Area has been carried out since the opening of these bridges to public traffic. The three cable-supported bridges are referred to as the Tsing Ma (suspension) Bridge, the Kap Shui Mun (cable-stayed) Bridge and the Ting Kau (cable-stayed) Bridge. The structural health monitoring works involved are classified as six monitoring categories, namely, wind load and response, temperature load and response, traffic load and response, geometrical configuration monitoring, strains and stresses/forces monitoring and global dynamic characteristics monitoring. As wind loads and responses had been a major concern in the design and construction stages, this paper therefore outlines the work of wind load and response monitoring on Tsing Ma, Kap Shui Mun and Ting Kau Bridges. The paper starts with a brief description of the sensory systems. The description includes the layout and performance requirements of sensory systems for wind load and responses monitoring. Typical results of wind load and response monitoring in graphical forms are then presented. These graphical forms include the plots of wind rose diagrams, wind incidences vs wind speeds, wind turbulence intensities, wind power spectra, gust wind factors, coefficient of terrain roughness, extreme wind analyses, deck deflections/rotations vs wind speeds, acceleration spectra, acceleration/displacement contours, and stress demand ratios. Finally conclusions on wind load and response monitoring on the three cable-supported bridges are drawn.
Evidence for avian H9N2 influenza virus infections among rural villagers in Cambodia.
Blair, Patrick J; Putnam, Shannon D; Krueger, Whitney S; Chum, Channimol; Wierzba, Thomas F; Heil, Gary L; Yasuda, Chadwick Y; Williams, Maya; Kasper, Matthew R; Friary, John A; Capuano, Ana W; Saphonn, Vonthanak; Peiris, Malik; Shao, Hongxia; Perez, Daniel R; Gray, Gregory C
2013-04-01
Southeast Asia remains a critical region for the emergence of novel and/or zoonotic influenza, underscoring the importance of extensive sampling in rural areas where early transmission is most likely to occur. In 2008, 800 adult participants from eight sites were enrolled in a prospective population-based study of avian influenza (AI) virus transmission where highly pathogenic avian influenza (HPAI) H5N1 virus had been reported in humans and poultry from 2006 to 2008. From their enrollment sera and questionnaires, we report risk factor findings for serologic evidence of previous infection with 18 AI virus strains. Serologic assays revealed no evidence of previous infection with 13 different low-pathogenic AI viruses or with HPAI avian-like A/Cambodia/R0404050/2007(H5N1). However, 21 participants had elevated antibodies against avian-like A/Hong Kong/1073/1999(H9N2), validated with a monoclonal antibody blocking ELISA assay specific for avian H9. Although cross-reaction from antibodies against human influenza viruses cannot be completely excluded, the study data suggest that a number of participants were previously infected with the avian-like A/Hong Kong/1073/1999(H9N2) virus, likely due to as yet unidentified environmental exposures. Prospective data from this cohort will help us better understand the serology of zoonotic influenza infection in a rural cohort in SE Asia. Copyright © 2013 King Saud Bin Abdulaziz University for Health Sciences. All rights reserved.
Cheng, Qijin; Fu, King-wa; Caine, Eric; Yip, Paul S F
2014-01-01
The Hong Kong news media report suicide-related events more frequently and sensationally than Western countries. Little is known about Hong Kong media professionals' experiences and thoughts about such reporting. To understand Hong Kong media professionals' experiences and perceptions of suicide reporting and whether the news media can be better engaged into suicide prevention. We conducted three focus groups of journalists from both the Cantonese and English language news media. Data were analyzed using grounded theory methods. We discerned three rationales from participants regarding their intense coverage of suicide-related events: (1) satisfying commercial competitiveness, (2) addressing social problems, and (3) responding to readers' interests. The first rationale was a dominant and vigorous motivating factor, and often influenced suicide reporting among local Cantonese media. Media professionals recommended engagement strategies targeted at frontline journalists, media managers, and general media consumers. We see potential to involve news media professionals in Hong Kong as working partners in suicide prevention. To succeed, this effort requires engagement in a proactive, consistent, and sustained fashion.
Woo, Jean; Zhang, Xin Hua; Ho, Suzanne; Sham, Aprille; Tang, Zhe; Fang, Xiang Hua
2008-06-01
To explore the hypothesis that better health status of elderly populations is primarily determined by the provision of freely accessible health service at low or no cost to the user and a social welfare system. Information was collected by questionnaire from surveys of three cohorts of elderly (70 years and older) Chinese. Data from two health-care systems were compared: the low-cost or free government-subsidized system in Hong Kong, and the market-orientated user-pays system in urban (Beijing), and rural China. The Beijing rural cohort had the best health profile, whereas the Hong Kong cohort had the worst, despite the better lifestyle practices in the Hong Kong and Beijing urban cohorts compared with the Beijing rural cohort, and higher socioeconomic status in the Beijing urban and Hong Kong cohorts. However, the Beijing rural cohort had the highest prevalence of functional limitations. While health-care systems may affect life expectancy at birth, psychosocial, lifestyle and socioeconomic factors influence subsequent health status of elderly people in a complex manner.
Severe acute respiratory syndrome (SARS) and the rhetorical construction of "bad" scientific work.
Attenborough, Frederick Thomas
2012-02-01
How are secondary accounts of "bad" scientific practice constructed? How do they engage with the primary data produced by "bad" scientists? And what happens to those primary data as generations of secondary accounts purporting to describe them accumulate? This paper addresses such questions via a case study of Dr. Hong, a microbiologist accused of "bad" scientific practice by numerous secondary accounts of the 2003 SARS outbreak. Bringing Hong's own account of his own actions into dialogue with one of the most influential secondary accounts of his actions, the paper highlights the gross disparity between the two. Having argued that the rhetorical structuring of the secondary account is, ultimately, responsible for Hong's characterisation as a "bad" scientist, it then moves to explore how subsequent accounts developed their own characterisations. What becomes clear is that as secondary accounts began feeding off one another, references to Hong's account disappeared. Aided by the concepts of the "vanishing" and the "phantasm", the paper concludes with a consideration of how this process left Hong's work with a very peculiar form of existence.
Fluoride Content of Bottled Waters in Hong Kong and Qatar.
Al-Mulla, Hessa I; Anthonappa, Robert P; King, Nigel M
2016-01-01
To determine the F concentration of bottled waters that was available in Hong Kong and Qatar. The F concentrations of bottled waters collected from Hong Kong (n=81) and Qatar (n=32) were analysed. The F ion selective electrode method was used to measure the F concentration in the samples. Three measurements were obtained for every sample to ensure reproducibility and appropriate statistical analyses were employed. Qatar group: F concentrations ranged from 0.06 ppm to 3.0 ppm with a mean value of 0.8 ppm. The F concentrations displayed on the labels of the samples (60%) were significantly lower than the measured F concentration (p < 0.0001). Hong Kong group: F concentrations ranged from 0.04 ppm to 2.52 ppm with a mean value of 0.44 ppm. The F concentrations displayed on the samples (16%) were significantly lower than the measured F concentration (p< 0.0001). Wide variations exist in the F concentration among the different brands of bottled water available in Hong Kong and Qatar. The F concentrations displayed on the labels were not consistent with the measured F concentrations.
Chinese attitudes towards sexual minorities in Hong Kong: Implications for mental health.
Kwok, Diana K; Wu, Joseph
2015-01-01
Intolerant attitudes and sexual prejudice against sexual minorities (lesbian, gay, bisexual, and questioning/queer-LGBQ) has been a long-standing global concern. In this article, Chinese attitudes towards sexual minorities are examined with reference to the cultural context in Hong Kong, a place where the East has intermingled with the West for over a century. Chinese sexuality manifested in Hong Kong is a mix of Confucian ideology and Christian thought. Traditional Confucian values of xiao (filial piety) and conventional religious thoughts of Christianity together influence Chinese attitudes towards sexual minorities. Though many governmental policies have been put in place and numerous laws have been enacted to protect the human rights of underprivileged and disadvantaged groups over the past few decades, sexual minorities are frequently being excluded from most of these protections. In Hong Kong, sexual prejudice exists not only among the general public, but also among educators and mental health professionals. Thus, Chinese sexual minorities experience sexual prejudice and minority stress in Hong Kong under unique cultural circumstances. This calls for inclusive policies and an embracing attitude towards sexual minorities so their mental health will not suffer.
Ba Abdullah, Mohammed M; Palermo, Richard D; Palser, Anne L; Grayson, Nicholas E; Kellam, Paul; Correia, Samantha; Szymula, Agnieszka; White, Robert E
2017-12-01
Epstein-Barr virus (EBV) is a ubiquitous pathogen of humans that can cause several types of lymphoma and carcinoma. Like other herpesviruses, EBV has diversified through both coevolution with its host and genetic exchange between virus strains. Sequence analysis of the EBV genome is unusually challenging because of the large number and lengths of repeat regions within the virus. Here we describe the sequence assembly and analysis of the large internal repeat 1 of EBV (IR1; also known as the BamW repeats) for more than 70 strains. The diversity of the latency protein EBV nuclear antigen leader protein (EBNA-LP) resides predominantly within the exons downstream of IR1. The integrity of the putative BWRF1 open reading frame (ORF) is retained in over 80% of strains, and deletions truncating IR1 always spare BWRF1. Conserved regions include the IR1 latency promoter (Wp) and one zone upstream of and two within BWRF1. IR1 is heterogeneous in 70% of strains, and this heterogeneity arises from sequence exchange between strains as well as from spontaneous mutation, with interstrain recombination being more common in tumor-derived viruses. This genetic exchange often incorporates regions of <1 kb, and allelic gene conversion changes the frequency of small regions within the repeat but not close to the flanks. These observations suggest that IR1-and, by extension, EBV-diversifies through both recombination and breakpoint repair, while concerted evolution of IR1 is driven by gene conversion of small regions. Finally, the prototype EBV strain B95-8 contains four nonconsensus variants within a single IR1 repeat unit, including a stop codon in the EBNA-LP gene. Repairing IR1 improves EBNA-LP levels and the quality of transformation by the B95-8 bacterial artificial chromosome (BAC). IMPORTANCE Epstein-Barr virus (EBV) infects the majority of the world population but causes illness in only a small minority of people. Nevertheless, over 1% of cancers worldwide are attributable to EBV. Recent sequencing projects investigating virus diversity to see if different strains have different disease impacts have excluded regions of repeating sequence, as they are more technically challenging. Here we analyze the sequence of the largest repeat in EBV (IR1). We first characterized the variations in protein sequences encoded across IR1. In studying variations within the repeat of each strain, we identified a mutation in the main laboratory strain of EBV that impairs virus function, and we suggest that tumor-associated viruses may be more likely to contain DNA mixed from two strains. The patterns of this mixing suggest that sequences can spread between strains (and also within the repeat) by copying sequence from another strain (or repeat unit) to repair DNA damage. Copyright © 2017 Ba abdullah et al.
Survey on death and dying in Hong Kong: attitudes, beliefs, and preferred end-of-life care.
Mjelde-Mossey, Lee Ann; Chan, Cecilia L W
2007-01-01
Social Workers in end-of-life and palliative care have a particular opportunity to ease the dying process by providing culturally appropriate services to the dying and their families. In today's multicultural social environment, with an ever-increasing immigrant population, social workers are challenged to be knowledgeable about diverse cultures. Recently, a forum of health care professionals and social workers in Hong Kong conducted a survey of the general population to assess death and dying attitudes, beliefs, and preferences for end-of-life care. Four-hundred-thirty Hong Kong Chinese participated in a telephone interview. Responses were compared by gender. The survey results not only contribute to an understanding of Hong Kong Chinese, but can inform social workers who practice with Chinese immigrants to the United States.
Fung, Helene H; Stoeber, Franziska S; Yeung, Dannii Yuen-lan; Lang, Frieder R
2008-05-01
We examined age differences in social network composition among 330 Germans and 330 Hong Kong Chinese, aged 20 to 91 years. We measured social network composition with the Social Convoy Questionnaire. In both cultures, older age was associated with the same number of close social partners and fewer peripheral social partners than was younger age. However, the patterns of age differences in specific relationships differed across cultures: Age was negatively associated with the proportion of nuclear family members among Germans but the association was positive among Hong Kong Chinese. Age was positively associated with the proportion of acquaintances among Germans but the association was negative among Hong Kong Chinese. We discuss the findings in terms of whether the socioemotional selectivity theory holds in both cultures.
Child slavery in Hong Kong: case report and historical review.
Lee, A C W; So, K T
2006-12-01
An 11-year-old girl was admitted with multiple injuries sustained during a 1-year servitude of domestic labour. She was acquired from her parents in Mainland China by a relative in Hong Kong. The child's parents received a sum of money that the child had to repay with work. Her hardship was characterised by long hours of incessant labour and physical torture when she failed to meet the demands of her mistress or her mistress' children. This case resembles Mui Tsai, a form of child slavery and exploitative domestic labour that was rife in Hong Kong a century ago, and illustrates the new challenges to child rights and protection consequent to the increasing social and economic integration between the Hong Kong Special Administrative Region and Mainland China.
Complete genome characterization of a novel enterovirus type EV-B106 isolated in China, 2012.
Tang, Jingjing; Tao, Zexin; Ding, Zhengrong; Zhang, Yong; Zhang, Jie; Tian, Bingjun; Zhao, Zhixian; Zhang, Lifen; Xu, Wenbo
2014-03-03
Human enterovirus B106 (EV-B106) is a recently identified member of enterovirus species B. In this study, we report the complete genomic characterization of an EV-B106 strain (148/YN/CHN/12) isolated from an acute flaccid paralysis patient in Yunnan Province, China. The new strain had 79.2-81.3% nucleotide and 89.1-94.8% amino acid similarity in the VP1 region with the other two EV-B106 strains from Bolivia and Pakistan. When compared with other EV serotypes, it had the highest (73.3%) VP1 nucleotide similarity with the EV-B77 prototype strain CF496-99. However, when aligned with all EV-B106 and EV-B77 sequences available from the GenBank database, two major frame shifts were observed in the VP1 coding region, which resulted in substantial (20.5%) VP1 amino acid divergence between the two serotypes. Phylogenetic analysis and similarity plot analysis revealed multiple recombination events in the genome of this strain. This is the first report of the complete genome of EV-B106.
Experimental encephalitis in monkeys caused by the Powassan virus.
Frolova, M P; Isachkova, L M; Shestopalova, N M; Pogodina, V V
1985-01-01
We have carried out a comparative study of the experimental infection of monkeys with the P-40 strain of the Powassen virus, isolated in the Primor'e Territory of the USSR, and with the Canadian prototype LB strain. The Powassan virus was found to be pathogenic for Macaca rhesus. The clinical and pathomorphological picture of the experimental encephalitis was studied, and the full identity of the infection produced in the monkeys by the P-40 strain and the Canadian LB strain of the Powassan virus was demonstrated. On electron microscopic examination of the central nervous system the virus was detected in the neurons, glial cells, and intercellular spaces. The virions of the strains studied have identical morphological parameters, being 37-45 nm in diameter and of spherical shape. The data obtained indicated a marked neurotropism of the virus. They will contribute to the elucidation of the role of the virus in the infection pathology of humans, i.e., in the differentiation of encephalitis cases not associated etiologically with the virus of the spring-summer tickborne encephalitis.
NASA Astrophysics Data System (ADS)
Tibbetts, Clark; Lichanska, Agnieszka M.; Borsuk, Lisa A.; Weslowski, Brian; Morris, Leah M.; Lorence, Matthew C.; Schafer, Klaus O.; Campos, Joseph; Sene, Mohamadou; Myers, Christopher A.; Faix, Dennis; Blair, Patrick J.; Brown, Jason; Metzgar, David
2010-04-01
High-density resequencing microarrays support simultaneous detection and identification of multiple viral and bacterial pathogens. Because detection and identification using RPM is based upon multiple specimen-specific target pathogen gene sequences generated in the individual test, the test results enable both a differential diagnostic analysis and epidemiological tracking of detected pathogen strains and variants from one specimen to the next. The RPM assay enables detection and identification of pathogen sequences that share as little as 80% sequence similarity to prototype target gene sequences represented as detector tiles on the array. This capability enables the RPM to detect and identify previously unknown strains and variants of a detected pathogen, as in sentinel cases associated with an infectious disease outbreak. We illustrate this capability using assay results from testing influenza A virus vaccines configured with strains that were first defined years after the design of the RPM microarray. Results are also presented from RPM-Flu testing of three specimens independently confirmed to the positive for the 2009 Novel H1N1 outbreak strain of influenza virus.
L'vov, D K; Al'khovskiĭ, S V; Shchelkanov, M Iu; Deriabin, P G; Gitel'man, A K; Botikov, A G; Aristova, V A
2014-01-01
The complete genomes of the three tick-borne flaviviruses (genus Flavivirus, fam. Bunyaviridae) were sequenced: Povassan virus (POWV, strain LEIV-3070Prm, isolated from Haemophysalis logicornis in Primorsky Krai, Russia in 1977), Alma-Arasan virus (AAV, strain LEIV-1380Kaz, isolated from Ixodes persulcatus ticks in Kazakhstan in 1977) and Malyshevo virus (isolated from a pool of Aedes vexans nipponii mosquitoes, in the Khabarovsk Krai, Russia in 1978). It is shown that AAV and Malyshevo virus are the strains of Tick-borne encephalitis virus (TBEV) and belong to Sibirian and Far-Eastern genotypes, respectively (GenBank ID: AAV KJ744033; strain Malyshevo KJ744034). Phylogenetically AAV is closest related (94,6% nt and 98,3% aa identity) to TBEV strains, isolated in Sibiria (Vasilchenko, Aino, Chita-653, Irkutsk-12). Malyshevo virus is closest related (96,4% nt and 98,3% nt identity) to strains of TBEV, isolated in Far Eastern part of Russia (1230, Spassk-72, Primorye-89). POWV LEIV-3070Prm has 99.7% identity with the prototype strain POWV LB, isolated in Canada and 99.5% of isolates with Far-Eastern strains of POWV (Spassk-9 and Nadezdinsk-1991).
New insight in magnetic saturation behavior of nickel hierarchical structures
NASA Astrophysics Data System (ADS)
Ma, Ji; Zhang, Jianxing; Liu, Chunting; Chen, Kezheng
2017-09-01
It is unanimously accepted that non-ferromagnetic inclusions in a ferromagnetic system will lower down total saturation magnetization in unit of emu/g. In this study, ;lattice strain; was found to be another key factor to have critical impact on magnetic saturation behavior of the system. The lattice strain determined assembling patterns of primary nanoparticles in hierarchical structures and was intimately related with the formation process of these architectures. Therefore, flower-necklace-like and cauliflower-like nickel hierarchical structures were used as prototype systems to evidence the relationship between assembling patterns of primary nanoparticles and magnetic saturation behaviors of these architectures. It was found that the influence of lattice strain on saturation magnetization outperformed that of non-ferromagnetic inclusions in these hierarchical structures. This will enable new insights into fundamental understanding of related magnetic effects.
Yamanaka, Atsushi; Oddgun, Duangjai; Chantawat, Nantarat; Okabayashi, Tamaki; Ramasoota, Pongrama; Churrotin, Siti; Kotaki, Tomohiro; Kameoka, Masanori; Soegijanto, Soegeng; Konishi, Eiji
2016-04-01
Dengue virus (DENV) infection-enhancing antibodies are a hypothetic factor to increase the dengue disease severity. In this study, we investigated the enhancing antibodies against Indonesian strains of DENV-1-4 in 50 healthy inhabitants of central Thailand (Bangkok and Uthai Thani). Indonesia and Thailand have seen the highest dengue incidence in Southeast Asia. The infection history of each subject was estimated by comparing his/her neutralizing antibody titers against prototype DENV-1-4 strains. To resolve the difficulty in obtaining foreign live viruses for use as assay antigens, we used a recombinant system to prepare single-round infectious dengue viral particles based on viral sequence information. Irrespective of the previously infecting serotype(s), most serum samples showed significantly higher enhancement titers against Indonesian DENV-2 strains than against Thai DENV-2 strains, whereas the opposite effect was observed for the DENV-3 strains. Equivalent enhancing activities were observed against both DENV-1 and DENV-4. These results suggest that the genotype has an impact on enhancing antibody activities against DENV-2 and DENV-3, because the predominant circulating genotypes of each serotype differ between Indonesia and Thailand. Copyright © 2015 Institut Pasteur. Published by Elsevier Masson SAS. All rights reserved.
Bell, J M; Turnidge, J D; Jones, R N
2002-02-01
From 1998 to 1999, a large number of community-acquired respiratory tract isolates of Streptococcus pneumoniae (n=566), Haemophilus influenzae (n=513) and Moraxella catarrhalis (n=228) were collected from 15 centres in Australia, Hong Kong, Japan, China, the Philippines, Singapore, South Africa and Taiwan through the SENTRY Antimicrobial Surveillance Program. Isolates were tested against 26 antimicrobial agents using the NCCLS-recommended methods. Overall, 40% of S. pneumoniae isolates were resistant to penicillin with 18% of strains having high-level resistance (MIC > or =2 mg/l). Rates of erythromycin and clindamycin resistance were 41 and 23%, respectively. Penicillin-resistant strains showed high rates of resistance to other antimicrobial agents: 96% to trimethoprim-sulphamethoxazole (TMP-SMX), 84% to tetracycline and 81% to erythromycin. A significant proportion of penicillin-susceptible strains was also resistant to erythromycin (21%), tetracycline (29%) and TMP-SMZ (26%). Small numbers of strains were resistant to levofloxacin (0.7%), trovafloxacin (0.4%) and grepafloxacin (1.3%) where as all strains remained uniformly susceptible to quinupristin/dalfopristin and BMS284756 (MIC(90), 0.06 mg/l), a new desfluoroquinolone. beta-lactamases were, produced by 20% H. influenzae isolates and only rare strains showed intrinsic resistance to amoxycillin. Other beta-lactam agents showed good activity with rates of resistance less than 2% and all isolates showed susceptibility to cefixime, ceftibuten, cefepime and cefotaxime. Rates of resistance to tetracycline and chloramphenicol were also relatively low at 3%. The majority (98%) of M. catarrhalis isolates was found to be beta-lactamase-positive and resistant to penicillins, however, resistance to erythromycin and tetracycline was also low at 1.8%. Both H. influenzae and M. catarrhalis isolates were uniformly susceptible to the new desfluoroquinolone and tested fluoroquinolones.
Risk management of LPG transport activities in Hong Kong.
Boult, M
2000-01-07
This paper gives a background to risk management of liquefied petroleum gas (LPG) transport activities, with special regard to the activities taking place in Hong Kong. In particular, it looks at the recent activities undertaken by the Government of the Hong Kong Special Administrative Region (SAR); the recent risk assessment of LPG transport in the Territory, the measures developed to minimise the risks (including risk management improvements) and the risk management activities undertaken by the Government and the operators.
Dancing with the Dragon: U.S.-China Engagement Policy
2013-03-01
long as it catches mice .”12 Under Deng and the reformed CPC, China gained international recognition and respect in twenty short years. Hong Kong was...2 The rising economies of the so-called “Four Little Dragons”— Hong Kong , Singapore, Taiwan, and South Korea—provide a text-book example of the U.S...war, Hong 4 Kong Island was ceded to United Kingdom in 1842 under the Treaty of Nanking. This marked the first unequal treaty in modern Chinese
[Experimental monkey encephalitis caused by Powassan virus].
Frolova, M P; Isachkova, L M; Shestopalova, N M; Pogodina, V V
1981-01-01
A comparative study of the experimental infection of monkeys caused by brain P-40 of Powassan virus isolated in the Primorye Territory of the USSR and by the prototype Canadian strain LB was carried out. Powassan virus was found to be pathogenic for Macaca rhesus. Clinical and pathomorphological picture of the experimental encephalitis was studied. Full identity of the infection caused in the monkeys by the strain P-40 and the Canadian strain LB of Powassan virus has been proved. On electronmicroscopic examination of the central nervous system the virus was detected in the neurons, glial cells and intercellular spaces. The virions of the strains studied have identical morphological parameters, being 37 to 45 nm in diameter and having spherical shape. The data obtained point to a marked neurotropism of the virus. They will contribute to elucidation of the virus role in the infectious pathology of man, and namely, in verification of encephalitis cases not associated etiologically with the virus of the spring-summer tick-borne encephalitis.
Qiu, Zhongyang; Gao, Qiuqiang; Bao, Jie
2017-12-01
Xylose-assimilating pathway was constructed in a d-lactic acid producing Pediococcus acidilactici strain and evolutionary adapted to yield a co-fermentation strain P. acidilactici ZY15 with 97.3g/L of d-lactic acid and xylose conversion of 92.6% obtained in the high solids content simultaneous saccharification and co-fermentation (SSCF) of dry dilute acid pretreated and biodetoxified corn stover feedstock. The heterologous genes encoding xylose isomerase (xylA) and xylulokinase (xylB) were screened and integrated into the P. acidilactici chromosome. The metabolic flux to acetic acid in phosphoketolase pathway was re-directed to pentose phosphate pathway by substituting the endogenous phosphoketolase gene (pkt) with the heterologous transketolase (tkt) and transaldolase (tal) genes. The xylose-assimilating ability of the newly constructed P. acidilactici strain was significantly improved by adaptive evolution. This study provided an important strain and process prototype for high titer d-lactic acid production from lignocellulose feedstock with efficient xylose assimilation. Copyright © 2017 Elsevier Ltd. All rights reserved.
Schauer, David B.; McCathey, Sonya N.; Daft, Barbara M.; Jha, Sharda S.; Tatterson, Lisa E.; Taylor, Nancy S.; Fox, James G.
1998-01-01
Both enteropathogenic Escherichia coli (EPEC) and an obligate intracellular bacterium, previously referred to as an intracellular Campylobacter-like organism and now designated Lawsonia intracellularis, have been reported as causes of enterocolitis in rabbits. An outbreak of enterocolitis in a group of rabbits, characterized by an unusually high rate of mortality, was found to be associated with dual infection with EPEC and L. intracellularis. The EPEC strain was found to have eaeA gene homology but was negative for afrA homology. The absence of the afrA gene, which encodes the structural subunit for the AF/R1 pilus, indicates that this rabbit EPEC strain is distinct from the prototypic RDEC-1 strain. This finding suggests that rabbit EPEC strains widely reported in Western Europe, which lack AF/R1 pili, are also present in rabbits in the United States. Dual infection with these two pathogens in rabbits has not been previously reported and may have contributed to the unusually high mortality observed in this outbreak. PMID:9620403
Role of meteorological conditions in reported chickenpox cases in Wuhan and Hong Kong, China.
Chen, Banghua; Sumi, Ayako; Wang, Lei; Zhou, Wang; Kobayashi, Nobumichi
2017-08-03
Chickenpox is a common contagious disease that remains an important public health issue worldwide. Over 90% of unvaccinated individuals become infected, but infection occurs at different ages in different parts of the world. Many people have been infected by 20 to 30 years of age in China, and adults and pregnant women who become infected often develop severe infection. Furthermore, a mortality rate of 2-3 per 100,000 infected persons has been reported. In this study, we explore the temperature-dependent transition of patterns of reported chickenpox cases in two large subtropical climate cities, Wuhan and Hong Kong, China, to aid in the prediction of epidemics and preparation for the effects of climatic changes on epidemiology of chickenpox in China. We used a time series analysis comprising a spectral analysis based on the maximum entropy method in the frequency domain and the nonlinear least squares method in the time domain. Specifically, the following time series data were analyzed: data of reported chickenpox cases and meteorological data, including the mean temperature, relative humidity and total rainfall in Wuhan and Hong Kong from January 2008 to June 2015. The time series data of chickenpox for both Wuhan and Hong Kong have two peaks per year, one in winter and another in spring, indicating a bimodal cycle. To investigate the source of the bimodal cycle of the chickenpox data, we defined the contribution ratio of the 1-year cycle, Q 1 , and the 6-month cycle, Q 2 , as the contribution of the amplitude of a 1-year cycle and a 6-month cycle, respectively, to the entire amplitude of the time-series data. The Q 1 values of Wuhan and Hong Kong were positively correlated with the annual mean temperature and rainfall of each city. Conversely, the Q 2 values of Wuhan and Hong Kong were negatively correlated with the annual mean temperature and rainfall of Wuhan and Hong Kong. Our results showed that the mean temperature and rainfall have a significant influence on the incidence of chickenpox, and might be important predictors of chickenpox incidence in Wuhan and Hong Kong.
A comparative study on women's employment in Beijing, Guangzhou and Hong Kong.
Liu, X
1992-01-01
A comparison of the female population in different social systems and different socioeconomic levels was conducted for Beijing, Guangzhou, and Hong Kong between September 1988 and October 1990. The women's federations in Beijing and Guangzhou and the University of Hong Kong performed the sample survey of 12 occupations in China and Hong Kong. The assumption was that the process of women's emancipation was accelerated when material conditions and culture were well-developed. The differences in employment patterns in the three cities are presented followed by a discussion of the motives for employment. Differences in their attachment to the traditional role of women were evident; most expressed the importance of work and family and the desire to be successful in life and career. Differences were also evident in women's expectation of the role of government in having responsibility for women's employment and priorities. The reports from women in Beijing and Guangzhou expressed difficulty in locating a job and lack of information on job availabilities. Hong Kong is different from the other cities in that the supply of workers is less than the demand. Only through productivity increases can women have a brighter prospect for employment. There was a high level of agreement that the reasons for employment are increased income and economic independence. The third factor of importance was "self-realization", and over 90% in all three cities reported that employment would continue if other family members could support the family. Women strongly agreed that success was achieved through extra effort, and wished for the same opportunity for promotion which the men enjoyed. The traditional role of women giving priority to their families was strongest in Hong Kong. 45% of women in Hong Kong agreed that women should avoid being more successful in work than their husbands, while only 13.4% in Beijing agreed. Women in Beijing and Guangzhou expected government to other relevant employment laws, assign jobs and provide training in order to priority. In Hong Kong women considered providing unemployment benefits most important followed by relevant laws and locating jobs.
Duan, Yu; Yang, Li-Juan; Zhang, Yan-Jie; Huang, Xiao-Lei; Pan, Gui-Xia; Wang, Jing
2017-03-01
To reveal the difference of meteorological effect on scarlet fever in Beijing and Hong Kong, China, during different periods among 2004-2014. The data of monthly incidence of scarlet fever and meteorological variables from 2004 to 2014 in Beijing and Hong Kong were collected from Chinese science data center of public health, meteorological data website and Hong Kong observatory website. The whole study period was separated into two periods by the outbreak year 2011 (Jan 2004-Dec 2010 and Jan 2011-Dec 2014). A generalized additive Poisson model was conducted to estimate the effect of meteorological variables on monthly incidence of scarlet fever during two periods in Beijing and Hong Kong, China. Incidence of scarlet fever in two districts were compared and found the average incidence during period of 2004-2010 were significantly different (Z=203.973, P<0.001) while average incidence became generally equal during 2011-2014 (Z=2.125, P>0.05). There was also significant difference in meteorological variables between Beijing and Hong Kong during whole study period, except air pressure (Z=0.165, P=0.869). After fitting GAM model, it could be found monthly mean temperature showed a negative effect (RR=0.962, 95%CI: 0.933, 0.992) on scarlet fever in Hong Kong during the period of 2004-2010. By comparison, for data in Beijing during the period of 2011-2014, the RRs of monthly mean temperature range growing 1°C and monthly sunshine duration growing 1h was equal to 1.196(1.022, 1.399) and 1.006(1.001, 1.012), respectively. The changes of meteorological effect on scarlet fever over time were not significant both in Beijing and Hong Kong. This study suggests that meteorological variables were important factors for incidence of scarlet fever during different period in Beijing and Hong Kong. It also support that some meteorological effects were opposite in different period although these differences might not completely statistically significant. Copyright © 2017 Elsevier B.V. All rights reserved.
Lundgren, A; Leach, S; Tobias, J; Carlin, N; Gustafsson, B; Jertborn, M; Bourgeois, L; Walker, R; Holmgren, J; Svennerholm, A-M
2013-02-06
We have developed a new oral vaccine against enterotoxigenic Escherichia coli (ETEC) diarrhea containing killed recombinant E. coli bacteria expressing increased levels of ETEC colonization factors (CFs) and a recombinant protein (LCTBA), i.e. a hybrid between the binding subunits of E. coli heat labile toxin (LTB) and cholera toxin (CTB). We describe a randomized, comparator controlled, double-blind phase I trial in 60 adult Swedish volunteers of a prototype of this vaccine. The safety and immunogenicity of the prototype vaccine, containing LCTBA and an E. coli strain overexpressing the colonization factor CFA/I, was compared to a previously developed oral ETEC vaccine, consisting of CTB and inactivated wild type ETEC bacteria expressing CFA/I (reference vaccine). Groups of volunteers were given two oral doses of either the prototype or the reference vaccine; the prototype vaccine was administered at the same or a fourfold higher dosage than the reference vaccine. The prototype vaccine was found to be safe and equally well-tolerated as the reference vaccine at either dosage tested. The prototype vaccine induced mucosal IgA (fecal secretory IgA and intestine-derived IgA antibody secreting cell) responses to both LTB and CFA/I, as well as serum IgA and IgG antibody responses to LTB. Immunization with LCTBA resulted in about twofold higher mucosal and systemic IgA responses against LTB than a comparable dose of CTB. The higher dose of the prototype vaccine induced significantly higher fecal and systemic IgA responses to LTB and fecal IgA responses to CFA/I than the reference vaccine. These results demonstrate that CF over-expression and inclusion of the LCTBA hybrid protein in an oral inactivated ETEC vaccine does not change the safety profile when compared to a previous generation of such a vaccine and that the prototype vaccine induces significant dose dependent mucosal immune responses against CFA/I and LTB. Copyright © 2013 Elsevier Ltd. All rights reserved.
ERIC Educational Resources Information Center
McIntyre, Bryce T.
1995-01-01
Investigates videocassette recorder (VCR) use in Hong Kong, finding that the VCR does not compete with cinema-going and television viewing, but complements these activities. Confirms research in Western nations regarding VCR use. (SR)
Man, Rita Li Yi
2009-11-01
Environmental health-related land use planning conditions can enhance the environment in Hong Kong. Previous research by others has shown, however, that a lack of compliance with planning conditions often occurs. And as no direct enforcement of planning conditions exists in Hong Kong, it is of interest to understand possible ways in which to increase the motivation of land developers and property owners to comply with planning conditions. The author looked at motivation from the perspective of three traditional motivation theories: Theory X, Theory Y, and incentive theory. While the majority of this article focuses on the enforcement and the legal tests in land use planning conditions, it also presents the results of the first study of the motivations behind Hong Kong land developers to comply with land use planning conditions.
Child maltreatment hospitalisations in Hong Kong: incidence rate and seasonal pattern.
Ip, Patrick; Ho, Frederick Ka-Wing; Chan, Ko Ling; Yip, Paul Siu-Fai; Lau, Joseph Tak-Fai; Wong, Wilfred Hing-Sang; Chow, Chun-Bong; Jiang, Fan
2016-12-01
We investigated the incidence and seasonal patterns of child maltreatment hospitalisations in Hong Kong. A retrospective study of subjects aged under 19 years with a primary diagnosis of child maltreatment admitted to hospitals in Hong Kong from 2001 to 2010. Data were retrieved from the centralised database of all 42 public hospitals in the Hospital Authority. Child maltreatment incidence rate. A consistent seasonal pattern was found for non-sexual maltreatment in children aged 6-18 years (p<0.001). Hospitalisations peaked in May and October but dipped in August and January. No significant seasonal patterns were found for sexual maltreatment or among children under 6 years. The seasonal pattern of child maltreatment coincided with the two school examination periods. The annual child maltreatment hospitalisation rate in Hong Kong in 2010 was 73.4 per 100 000 children under 19 years, more than double that in 2001. A peculiar seasonal pattern and an alarming increasing trend in child maltreatment hospitalisation were observed in Hong Kong, which we speculated to be related to school examination stress and increasing socioeconomic disparity. Our findings highlighted differences in the trends of child maltreatment between Hong Kong and the West. Professionals and policymakers should be made aware of these trends and develop effective strategies to tackle child maltreatment. Published by the BMJ Publishing Group Limited. For permission to use (where not already granted under a licence) please go to http://www.bmj.com/company/products-services/rights-and-licensing/.
Allergy in Hong Kong: an unmet need in service provision and training.
Chan, Y T; Ho, H K; Lai, Christopher K W; Lau, C S; Lau, Y L; Lee, T H; Leung, T F; Wong, Gary W K; Wu, Y Y
2015-02-01
Many children in Hong Kong have allergic diseases and epidemiological data support a rising trend. Only a minority of children will grow out of their allergic diseases, so the heavy clinical burden will persist into adulthood. In an otherwise high-quality health care landscape in Hong Kong, allergy services and training are a seriously unmet need. There is one allergy specialist for 1.5 million people, which is low not only compared with international figures, but also compared with most other specialties in Hong Kong. The ratio of paediatric and adult allergists per person is around 1:460 000 and 1:2.8 million, respectively, so there is a severe lack of adult allergists, while the paediatric allergists only spend a fraction of their time working with allergy. There are no allergists and no dedicated allergy services in adult medicine in public hospitals. Laboratory support for allergy and immunology is not comprehensive and there is only one laboratory in the public sector supervised by accredited immunologists. These findings clearly have profound implications for the profession and the community of Hong Kong and should be remedied without delay. Key recommendations are proposed that could help bridge the gaps, including the creation of two new pilot allergy centres in a hub-and-spoke model in the public sector. This could require recruitment of specialists from overseas to develop the process if there are no accredited allergy specialists in Hong Kong who could fulfil this role.
Dental caries status of preschool children in Hong Kong.
Chu, C H; Fung, D S; Lo, E C
1999-12-11
To describe the dental caries status of preschool children in Hong Kong and factors which affect their caries status. 658 preschool children aged 4 to 6 years from six randomly selected kindergartens in Hong Kong were surveyed in December 1997. A questionnaire to investigate possible explanatory variables for caries status was completed by their parents. Dental caries was diagnosed according to the criteria recommended by the World Health Organization (1997). Caries experience as measured by the mean number of decayed, missing and filled primary teeth (dmft) of the 4-, 5-, and 6-year-old children were found to be 0.9, 1.8, and 3.3 respectively. Overall, 61% of the children had a zero dmft score. Children born in Mainland China had a higher mean dmft score (4.6) than those born in Hong Kong (1.4). Statistically significant correlations were found between the children's dental caries status and their oral health practices as well as their socio-economic background. Parents' education level, dental knowledge and attitudes were also associated with the children's dental caries experience. In general, the caries status of Hong Kong Chinese preschool children was similar to that of children in industrialised countries and was better than that of children in the nearby areas. However, special dental programmes should be made available to children from lower socio-economic classes and new immigrants from Mainland China because they are the high risk groups for caries in Hong Kong.
Current status of aortic aneurysm surgery in Hong Kong.
Cheng, S W
2001-11-01
To determine the epidemiology and the status of open and endovascular aortic surgery for aortic aneurysm in Hong Kong. Three separate data sources were obtained: (1) the Hong Kong Hospital Authority discharge statistics for 1999 and 2000; (2) a survey on aortic aneurysms in public hospitals conducted by the working group of vascular surgery; and (3) the department of surgery, University of Hong Kong Medical Center aortic aneurysm database. The disease pattern, distribution as well as audit of operative mortality was determined. Aortic aneurysm ranked tenth as the leading causes of death in Hong Kong, and the incidence is increasing. Almost 800 new cases were diagnosed each year, with 10% presenting as rupture, but the death rate for ruptured aneurysms was 80%. About half of all operations on aortic aneurysms was performed for rupture, and a significant number of newly diagnosed patients were not receiving surgery. In experienced centers, the operative mortality for elective and ruptured aneurysm have improved to 2% and 38% in recent years. A growing interest and number of endovascular repair operations were performed which has led to some concerns on patient selection and follow up. Similar to a worldwide trend, aortic aneurysm in Hong Kong is diagnosed more frequently. With the relatively high mortality for ruptured aneurysms, effective diagnosis and elective surgery on patients with aortic aneurysms in experienced vascular centers remained the best treatment. Since a majority of aneurysms remained untreated, patient and physician education is of paramount importance.
Cheung, B My; Cheng, C H; Lau, C P; Wong, C Ky; Ma, R Cw; Chu, D Ws; Ho, D Hk; Lee, K Lf; Tse, H F; Wong, A Sp; Yan, B Py; Yan, V Wt
2017-04-01
In Hong Kong, the prevalence of atherosclerotic cardiovascular disease has increased markedly over the past few decades, and further increases are expected. In 2008, the Hong Kong Cardiovascular Task Force released a consensus statement on preventing cardiovascular disease in the Hong Kong population. The present article provides an update on these recommendations. A multidisciplinary group of clinicians comprising the Hong Kong Cardiovascular Task Force-10 cardiologists, an endocrinologist, and a family physician-met in September 2014 and June 2015 in Hong Kong. Guidelines from the American College of Cardiology/American Heart Association, the European Society of Hypertension/European Society of Cardiology, and the Eighth Joint National Committee for the Management of High Blood Pressure were reviewed. Group members reviewed the 2008 Consensus Statement and relevant international guidelines. At the meetings, each topical recommendation of the 2008 Statement was assessed against the pooled recommendations on that topic from the international guidelines. A final recommendation on each topic was generated by consensus after discussion. It is recommended that a formal risk scoring system should be used for risk assessment of all adults aged 40 years or older who have at least one cardiovascular risk factor. Individuals can be classified as having a low, moderate, or high risk of developing atherosclerotic cardiovascular disease, and appropriate interventions selected accordingly. Recommended lifestyle modifications include adopting a healthy eating pattern; maintaining a low body mass index; quitting smoking; and undertaking regular, moderate-intensity physical activity. Pharmacological interventions should be selected as appropriate after lifestyle modification.
Wang, Jingjing; Baranowski, Tom; Lau, Patrick W C; Pitkethly, Amanda Jane; Buday, Richard
2015-12-01
Positive changes in diet have been observed in research carried out in the United States from the use of "Escape from Diab" (Diab), a health videogame designed to lower the risk of obesity and type 2 diabetes. Whether the American story and characters in Diab might be perceived by Hong Kong Chinese children as interesting has not been explored. This study assessed the acceptability and applicability of Diab among Hong Kong Chinese children, whether the Diab story was understood by them, and whether it had potential to influence them both during the game and afterward. Thirty-four students (21 males, 13 females) 9-12 years of age were included. Upon completion of all the Diab episodes, children completed an immersion scale with 18 items, as well as an individual interview with 10 open-ended questions. Children achieved average immersion after playing Diab with the mean score at 39.1 (standard deviation = 9.0), higher than the median (36) of possible scores (range, 18-54). Four themes using framework analysis emerged from the interviews, including intuitive feelings about the interface, playing experience, perception of the effect of Diab on behavior change, and the applicability of Diab to Hong Kong children. The story and game developed for American children were found acceptable and applicable to Hong Kong Chinese children. The combination of quantitative and qualitative methods confirmed the acceptability and applicability of Diab to Hong Kong Chinese children.
Lee, Tak-Hong; Leung, Ting-Fan; Wong, Gary; Ho, Marco; Duque, Jaime Rosa; Li, Philip Hei; Lau, Chak-Sing; Lam, Wai-Fan; Wu, Adrian; Chan, Eric; Lai, Christopher; Lau, Yu-Lung
2017-12-10
There is a high and rising prevalence of many allergic diseases in the Asia Pacific, including Hong Kong, which is unmatched by a commensurate provision of clinical allergy services. In the last 3 years, the allergy profile in Hong Kong has increased due to greater public engagement and more frequent educational activities, scientific outputs and publication of local guidelines on allergy prevention, diagnosis and treatment. Two new drug allergy clinics have been established in public hospitals, and for the first time in 20 years, Hong Kong has its first trainee in adult allergy. The current ratio of allergists per head of population has improved slightly from 1:1.46 (in 2014) to 1:1.17 million, but it is still low compared to many countries. The Hong Kong community is well supported by allergy-related professional societies and patient organisations. While the recent developments indicated some progress, Hong Kong remains inadequately equipped to take advantage of the new discoveries that may prevent allergic diseases and improve public health. There are also 5-fold more paediatric allergists than adult allergists per head of population. If this unbalance remains uncorrected, continuing care for allergic children as they grow into adulthood will be an increasing problem. This review provides recommendations to improve allergy service provision and training, including the creation of Centres of Excellence in allergy to drive the growth of this specialty.
Pérez-Ramírez, Elisa; Llorente, Francisco; Del Amo, Javier; Fall, Gamou; Sall, Amadou Alpha; Lubisi, Alison; Lecollinet, Sylvie; Vázquez, Ana; Jiménez-Clavero, Miguel Ángel
2017-04-01
Rodent models have been used extensively to study West Nile virus (WNV) infection because they develop severe neurological symptoms similar to those observed in human WNV neuroinvasive disease. Most of this research has focused on old lineage (L) 1 strains, while information about pathogenicity is lacking for the most recent L1 and L2 strains, as well as for newly defined lineages. In this study, 4-week-old Swiss mice were inoculated with a collection of 12 WNV isolates, comprising 10 old and recent L1 and L2 strains, the putative L6 strain from Malaysia and the proposed L7 strain Koutango (KOU). The intraperitoneal inoculation of 10-fold dilutions of each strain allowed the characterization of the isolates in terms of LD50, median survival times, ID50, replication in neural and extraneural tissues and antibody production. Based on these results, we classified the isolates in three groups: high virulence (all L1a strains, recent L2 strains and KOU), moderate virulence (B956 strain) and low virulence (Kunjin and Malaysian isolates). We determined that the inoculation of a single dose of 1000 p.f.u. would be sufficient to classify WNV strains by pathotype. We confirmed the enhanced virulence of the KOU strain with a high capacity to cause rapid systemic infection. We also corroborated that differences in pathogenicity among strains do not correlate with phylogenetic lineage or geographic origin, and confirmed that recent European and African WNV strains belonging to L1 and L2 are highly virulent and do not differ in their pathotype profile compared to the prototype NY99 strain.