Platelets and Plasma Proteins Are Both Required to Stimulate Collagen Gene Expression by Anterior Cruciate Ligament Cells in Three-Dimensional Culture

PubMed Central

Cheng, Mingyu; Wang, Hao; Yoshida, Ryu

2010-01-01

Collagen–platelet (PL)-rich plasma composites have shown in vivo potential to stimulate anterior cruciate ligament (ACL) healing at early time points in large animal models. However, little is known about the cellular mechanisms by which the plasma component of these composites may stimulate healing. We hypothesized that the components of PL-rich plasma (PRP), namely the PLs and PL-poor plasma (PPP), would independently significantly influence ACL cell viability and metabolic activity, including collagen gene expression. To test this hypothesis, ACL cells were cultured in a collagen type I hydrogel with PLs, PPP, or the combination of the two (PRP) for 14 days. The inclusion of PLs, PPP, and PRP all significantly reduced the rate of cell apoptosis and enhanced the metabolic activity of fibroblasts in the collagen hydrogel. PLs promoted fibroblast-mediated collagen scaffold contraction, whereas PPP inhibited this contraction. PPP and PRP both promoted cell elongation and the formation of wavy fibrous structure in the scaffolds. The addition of only PLs or only plasma proteins did not significantly enhance gene expression of collagen types I and III but the combination, as PRP, did. Our findings suggest that the addition of both PLs and plasma proteins to collagen hydrogel may be useful in stimulating ACL healing by enhancing ACL cell viability, metabolic activity, and collagen synthesis. PMID:19958169

Pigeonpea Hybrid-Proline-Rich Protein (CcHyPRP) Confers Biotic and Abiotic Stress Tolerance in Transgenic Rice

PubMed Central

Mellacheruvu, Sunitha; Tamirisa, Srinath; Vudem, Dashavantha Reddy; Khareedu, Venkateswara Rao

2016-01-01

In this study, we report the overexpression of Cajanus cajan hybrid-proline-rich protein encoding gene (CcHyPRP) in rice which resulted in increased tolerance to both abiotic and biotic stresses. Compared to the control plants, the transgenic rice lines, expressing CcHyPRP, exhibited high-level tolerance against major abiotic stresses, viz., drought, salinity, and heat, as evidenced by increased biomass, chlorophyll content, survival rate, root, and shoot growth. Further, transgenic rice lines showed increased panicle size and grain number compared to the control plants under different stress conditions. The CcHyPRP transgenics, as compared to the control, revealed enhanced activities of catalase and superoxide dismutase (SOD) enzymes and reduced malondialdehyde (MDA) levels. Expression pattern of CcHyPRP::GFP fusion-protein confirmed its predominant localization in cell walls. Moreover, the CcHyPRP transgenics, as compared to the control, exhibited increased resistance to the fungal pathogen Magnaporthe grisea which causes blast disease in rice. Higher levels of bZIP and endochitinase transcripts as well as endochitinase activity were observed in transgenic rice compared to the control plants. The overall results demonstrate the intrinsic role of CcHyPRP in conferring multiple stress tolerance at the whole-plant level. The multipotent CcHyPRP seems promising as a prime candidate gene to fortify crop plants for enhanced tolerance/resistance to different stress factors. PMID:26834756

LPS-induced systemic inflammation reveals an immunomodulatory role for the prion protein at the blood-brain interface.

PubMed

Salvesen, Ø; Reiten, M R; Espenes, A; Bakkebø, M K; Tranulis, M A; Ersdal, C

2017-05-22

The cellular prion protein (PrP C ) is an evolutionary conserved protein abundantly expressed not only in the central nervous system but also peripherally including the immune system. A line of Norwegian dairy goats naturally devoid of PrP C (PRNP Ter/Ter ) provides a novel model for studying PrP C physiology. In order to explore putative roles for PrP C in acute inflammatory responses, we performed a lipopolysaccharide (LPS, Escherichia coli O26:B6) challenge of 16 goats (8 PRNP +/+ and 8 PRNP Ter/Ter ) and included 10 saline-treated controls (5 of each PRNP genotype). Clinical examinations were performed continuously, and blood samples were collected throughout the trial. Genome-wide transcription profiles of the choroid plexus, which is at the blood-brain interface, and the hippocampus were analyzed by RNA sequencing, and the same tissues were histologically evaluated. All LPS-treated goats displayed clinical signs of sickness behavior, which were of significantly (p < 0.01) longer duration in animals without PrP C . In the choroid plexus, a substantial alteration of the transcriptome and activation of Iba1-positive cells were observed. This response included genotype-dependent differential expression of several genes associated with the immune response, such as ISG15, CXCL12, CXCL14, and acute phase proteins, among others. Activation of cytokine-responsive genes was skewed towards a more profound type I interferon response, and a less obvious type II response, in PrP C -deficient goats. The magnitude of gene expression in response to LPS was smaller in the hippocampus than in the choroid plexus. Resting state expression profiles revealed a few differences between the PRNP genotypes. Our data suggest that PrP C acts as a modulator of certain pathways of innate immunity signaling, particularly downstream of interferons, and probably contributes to protection of vulnerable tissues against inflammatory damage.

Identification of the soybean HyPRP family and specific gene response to Asian soybean rust disease.

PubMed

Neto, Lauro Bücker; de Oliveira, Rafael Rodrigues; Wiebke-Strohm, Beatriz; Bencke, Marta; Weber, Ricardo Luís Mayer; Cabreira, Caroline; Abdelnoor, Ricardo Vilela; Marcelino, Francismar Correa; Zanettini, Maria Helena Bodanese; Passaglia, Luciane Maria Pereira

2013-07-01

Soybean [Glycine max (L.) Merril], one of the most important crop species in the world, is very susceptible to abiotic and biotic stress. Soybean plants have developed a variety of molecular mechanisms that help them survive stressful conditions. Hybrid proline-rich proteins (HyPRPs) constitute a family of cell-wall proteins with a variable N-terminal domain and conserved C-terminal domain that is phylogenetically related to non-specific lipid transfer proteins. Members of the HyPRP family are involved in basic cellular processes and their expression and activity are modulated by environmental factors. In this study, microarray analysis and real time RT-qPCR were used to identify putative HyPRP genes in the soybean genome and to assess their expression in different plant tissues. Some of the genes were also analyzed by time-course real time RT-qPCR in response to infection by Phakopsora pachyrhizi, the causal agent of Asian soybean rust disease. Our findings indicate that the time of induction of a defense pathway is crucial in triggering the soybean resistance response to P. pachyrhizi. This is the first study to identify the soybean HyPRP group B family and to analyze disease-responsive GmHyPRP during infection by P. pachyrhizi.

Analysis of yeast prp20 mutations and functional complementation by the human homologue RCC1, a protein involved in the control of chromosome condensation.

PubMed

Fleischmann, M; Clark, M W; Forrester, W; Wickens, M; Nishimoto, T; Aebi, M

1991-07-01

Mutations in the PRP20 gene of yeast show a pleiotropic phenotype, in which both mRNA metabolism and nuclear structure are affected. srm1 mutants, defective in the same gene, influence the signal transduction pathway for the pheromone response. The yeast PRP20/SRM1 protein is highly homologous to the RCC1 protein of man, hamster and frog. In mammalian cells, this protein is a negative regulator for initiation of chromosome condensation. We report the analysis of two, independently isolated, recessive temperature-sensitive prp20 mutants. They have identical G to A transitions, leading to the alteration of a highly conserved glycine residue to glutamic acid. By immunofluorescence microscopy the PRP20 protein was localized in the nucleus. Expression of the RCC1 protein can complement the temperature-sensitive phenotype of prp20 mutants, demonstrating the functional similarity of the yeast and mammalian proteins.

The Properties of 3 Different Plasma Formulations and Their Effects on Tendinopathic Cells.

PubMed

Rubio-Azpeitia, Eva; Bilbao, Ane M; Sánchez, Pello; Delgado, Diego; Andia, Isabel

2016-08-01

Tendinopathies are attributed to failure of the healing process and inadequate tissue remodeling. Plasma injections can trigger regenerative responses by modifying the molecular microenvironment. To examine the differences in the mitotic, chemotactic, anabolic, and inflammatory effects between leukocyte- and platelet-rich plasma (L-PRP), platelet-rich plasma (PRP), and platelet-poor plasma (PPP). Controlled laboratory study. Tendinopathic cells were cultured in 3-dimensional (3D) hydrogels formed using PPP, PRP, and L-PRP. Cell migration was evaluated using a μ-Slide chemotaxis chamber with video microscopy. Proliferation was assessed using XTT assays. Expression of genes associated with matrix turnover, including type 1 collagen (COL1A1), COL3A1, aggrecan, decorin, fibronectin, matrix metalloproteinase 1 (MMP-1), MMP-3, A Disintegrin-Like And Metalloprotease With Thrombospondin Type 1 Motif proteins 4 (ADAMTS-4), and ADAMTS-5, was assessed using real-time reverse-transcription polymerase chain reaction. Secreted inflammatory proteins, including interleukin (IL)-1β, IL-6, IL-8, monocyte chemotactic protein 1 (MCP-1), and regulated on activation, normal T cell expressed and secreted (RANTES), as well as vascular endothelial growth factor (VEGF) and connective tissue growth factor (CTGF), were quantified using enzyme-linked immunosorbent assay. Tendinopathic cells migrate at a higher velocity along L-PRP and PRP than along PPP gradients. PRP and L-PRP promote hypercellularity. PPP and PRP showed more pronounced anabolic properties, as demonstrated by enhanced COL1A1 and COL3A1 and reduced MMP-1 expression. Decorin, fibronectin, and aggrecan were downregulated in L-PRP compared with PPP and PRP. L-PRP and PRP were shown to be more proinflammatory than PPP in terms of IL-6 secretion, but cells in PPP showed MCP-1(high) phenotype. CTGF secretion was significantly reduced in L-PRP compared with PPP and PRP. The main advantages of L-PRP and PRP use, compared with PPP, include their stronger chemotactic and proliferative properties. While PPP and PRP stimulate matrix anabolism, L-PRP is more proinflammatory. Emphasis should be placed on the temporal needs and biological characteristics of injured tendons, and plasma formulations need to be tailored accordingly. Versatile systems allowing the preparation of different plasma formulations, such as PPP, PRP, or L-PRP, can help refine clinical applications by taking advantage of their different biological properties. © 2016 The Author(s).

A small molecule modulator of prion protein increases human mesenchymal stem cell lifespan, ex vivo expansion, and engraftment to bone marrow in NOD/SCID mice.

PubMed

Mohanty, Sindhu T; Cairney, Claire J; Chantry, Andrew D; Madan, Sanjeev; Fernandes, James A; Howe, Steven J; Moore, Harry D; Thompson, Mark J; Chen, Beining; Thrasher, Adrian; Keith, W Nicol; Bellantuono, Ilaria

2012-06-01

Human mesenchymal stem cells (hMSCs) have been shown to have potential in regenerative approaches in bone and blood. Most protocols rely on their in vitro expansion prior to clinical use. However, several groups including our own have shown that hMSCs lose proliferation and differentiation ability with serial passage in culture, limiting their clinical applications. Cellular prion protein (PrP) has been shown to enhance proliferation and promote self-renewal of hematopoietic, mammary gland, and neural stem cells. Here we show, for the first time, that expression of PrP decreased in hMSC following ex vivo expansion. When PrP expression was knocked down, hMSC showed significant reduction in proliferation and differentiation. In contrast, hMSC expanded in the presence of small molecule 3/689, a modulator of PrP expression, showed retention of PrP expression with ex vivo expansion and extended lifespan up to 10 population doublings. Moreover, cultures produced a 300-fold increase in the number of cells generated. These cells showed a 10-fold increase in engraftment levels in bone marrow 5 weeks post-transplant. hMSC treated with 3/689 showed enhanced protection from DNA damage and enhanced cell cycle progression, in line with data obtained by gene expression profiling. Moreover, upregulation of superoxide dismutase-2 (SOD2) was also observed in hMSC expanded in the presence of 3/689. The increase in SOD2 was dependent on PrP expression and suggests increased scavenging of reactive oxygen species as mechanism of action. These data point to PrP as a good target for chemical intervention in stem cell regenerative medicine. Copyright © 2012 AlphaMed Press.

Hybrid proline-rich proteins: novel players in plant cell elongation?

PubMed Central

Dvořáková, Lenka; Srba, Miroslav; Opatrny, Zdenek; Fischer, Lukas

2012-01-01

Background and Aims Hybrid proline-rich proteins (HyPRPs) represent a large family of putative cell-wall proteins characterized by the presence of a variable N-terminal domain and a conserved C-terminal domain that is related to non-specific lipid transfer proteins. The function of HyPRPs remains unclear, but their widespread occurrence and abundant expression patterns indicate that they may be involved in a basic cellular process. Methods To elucidate the cellular function of HyPRPs, we modulated the expression of three HyPRP genes in tobacco (Nicotiana tabacum) BY-2 cell lines and in potato (Solanum tuberosum) plants. Key Results In BY-2 lines, over-expression of the three HyPRP genes with different types of N-terminal domains resulted in similar phenotypic changes, namely increased cell elongation, both in suspension culture and on solid media where the over-expression resulted in enhanced calli size. The over-expressing cells showed increased plasmolysis in a hypertonic mannitol solution and accelerated rate of protoplast release, suggesting loosening of the cell walls. In contrast to BY-2 lines, no phenotypic changes were observed in potato plants over-expressing the same or analogous HyPRP genes, presumably due to more complex compensatory mechanisms in planta. Conclusions Based on the results from BY-2 lines, we propose that HyPRPs, more specifically their C-terminal domains, represent a novel group of proteins involved in cell expansion. PMID:22028464

The N-terminal domain of the thermo-regulated surface protein PrpA of Enterococcus faecium binds to fibrinogen, fibronectin and platelets

PubMed Central

Guzmán Prieto, Ana M.; Urbanus, Rolf T.; Zhang, Xinglin; Bierschenk, Damien; Koekman, C. Arnold; van Luit-Asbroek, Miranda; Ouwerkerk, Janneke P.; Pape, Marieke; Paganelli, Fernanda L.; Wobser, Dominique; Huebner, Johannes; Hendrickx, Antoni P. A.; Bonten, Marc J. M.; Willems, Rob J. L.; van Schaik, Willem

2015-01-01

Enterococcus faecium is a commensal of the mammalian gastrointestinal tract, but is also found in non-enteric environments where it can grow between 10 °C and 45 °C. E. faecium has recently emerged as a multi-drug resistant nosocomial pathogen. We hypothesized that genes involved in the colonization and infection of mammals exhibit temperature-regulated expression control and we therefore performed a transcriptome analysis of the clinical isolate E. faecium E1162, during mid-exponential growth at 25 °C and 37 °C. One of the genes that exhibited differential expression between 25 °C and 37 °C, was predicted to encode a peptidoglycan-anchored surface protein. The N-terminal domain of this protein is unique to E. faecium and closely related enterococci, while the C-terminal domain is homologous to the Streptococcus agalactiae surface protein BibA. This region of the protein contains proline-rich repeats, leading us to name the protein PrpA for proline-rich protein A. We found that PrpA is a surface-exposed protein which is most abundant during exponential growth at 37 °C in E. faecium E1162. The heterologously expressed and purified N-terminal domain of PrpA was able to bind to the extracellular matrix proteins fibrinogen and fibronectin. In addition, the N-terminal domain of PrpA interacted with both non-activated and activated platelets. PMID:26675410

The N-terminal domain of the thermo-regulated surface protein PrpA of Enterococcus faecium binds to fibrinogen, fibronectin and platelets.

PubMed

Guzmán Prieto, Ana M; Urbanus, Rolf T; Zhang, Xinglin; Bierschenk, Damien; Koekman, C Arnold; van Luit-Asbroek, Miranda; Ouwerkerk, Janneke P; Pape, Marieke; Paganelli, Fernanda L; Wobser, Dominique; Huebner, Johannes; Hendrickx, Antoni P A; Bonten, Marc J M; Willems, Rob J L; van Schaik, Willem

2015-12-17

Enterococcus faecium is a commensal of the mammalian gastrointestinal tract, but is also found in non-enteric environments where it can grow between 10 °C and 45 °C. E. faecium has recently emerged as a multi-drug resistant nosocomial pathogen. We hypothesized that genes involved in the colonization and infection of mammals exhibit temperature-regulated expression control and we therefore performed a transcriptome analysis of the clinical isolate E. faecium E1162, during mid-exponential growth at 25 °C and 37 °C. One of the genes that exhibited differential expression between 25 °C and 37 °C, was predicted to encode a peptidoglycan-anchored surface protein. The N-terminal domain of this protein is unique to E. faecium and closely related enterococci, while the C-terminal domain is homologous to the Streptococcus agalactiae surface protein BibA. This region of the protein contains proline-rich repeats, leading us to name the protein PrpA for proline-rich protein A. We found that PrpA is a surface-exposed protein which is most abundant during exponential growth at 37 °C in E. faecium E1162. The heterologously expressed and purified N-terminal domain of PrpA was able to bind to the extracellular matrix proteins fibrinogen and fibronectin. In addition, the N-terminal domain of PrpA interacted with both non-activated and activated platelets.

Structure and polymorphism of the mouse prion protein gene.

PubMed Central

Westaway, D; Cooper, C; Turner, S; Da Costa, M; Carlson, G A; Prusiner, S B

1994-01-01

Missense mutations in the prion protein (PrP) gene, overexpression of the cellular isoform of PrP (PrPC), and infection with prions containing the scrapie isoform of PrP (PrPSc) all cause neurodegenerative disease. To understand better the physiology and expression of PrPC, we retrieved mouse PrP gene (Prn-p) yeast artificial chromosome (YAC), cosmid, phage, and cDNA clones. Physical mapping positions Prn-p approximately 300 kb from ecotropic virus integration site number 4 (Evi-4), compatible with failure to detect recombination between Prn-p and Evi-4 in genetic crosses. The Prn-pa allele encompasses three exons, with exons 1 and 2 encoding the mRNA 5' untranslated region. Exon 2 has no equivalent in the Syrian hamster and human PrP genes. The Prn-pb gene shares this intron/exon structure but harbors an approximately 6-kb deletion within intron 2. While the Prn-pb open reading frame encodes two amino acid substitutions linked to prolonged scrapie incubation periods, a deletion of intron 2 sequences also characterizes inbred strains such as RIII/S and MOLF/Ei with shorter incubation periods, making a relationship between intron 2 size and scrapie pathogenesis unlikely. The promoter regions of a and b Prn-p alleles include consensus Sp1 and AP-1 sites, as well as other conserved motifs which may represent binding sites for as yet unidentified transcription factors. Images PMID:7912827

mRNAs for PRPs, statherin, and histatins in von Ebner's gland tissues.

PubMed

Azen, E A; Hellekant, G; Sabatini, L M; Warner, T F

1990-11-01

A search was made for expression of genes for proline-rich proteins (PRPs) and other salivary-type proteins, including statherin and histatins, in taste-bud tissues of mice and primates because of previous genetic findings in mice (Azen et al., 1986) that Prp and taste genes for certain bitter substances are either the same or closely linked. Taste-bud tissues and other tissues were tested for specific mRNAs with labeled DNA probes by Northern blotting and in situ hybridization. It was found that PRP mRNAs were present in von Ebner's glands of mice and macaques, and that there was a much greater degree of PRP mRNA induction in mouse parotid (16-fold) than in von Ebner's gland (two-fold) after in vivo isoproterenol stimulation. This difference may be due, in part, to differences in autonomic nerve innervation. Statherin and histatin mRNAs were found in macaque taste-bud tissues containing von Ebner's gland, and statherin protein was found in human von Ebner's gland by immunohistochemistry. The finding of PRP gene expression in von Ebner's gland, whose secretions have been suggested to play a role in taste stimulation, adds further support to a possible function of PRPs in bitter tasting. The possible functions of statherin and histatins in von Ebner's gland secretions may be related to statherin's regulation of salivary calcium and histatins' antibacterial and antifungal properties.

Effect of activated autologous platelet-rich plasma on proliferation and osteogenic differentiation of human adipose-derived stem cells in vitro

PubMed Central

Xu, Fang-Tian; Li, Hong-Mian; Yin, Qing-Shui; Liang, Zhi-Jie; Huang, Min-Hong; Chi, Guang-Yi; Huang, Lu; Liu, Da-Lie; Nan, Hua

2015-01-01

To investigate whether activated autologous platelet-rich plasma (PRP) can promote proliferation and osteogenic differentiation of human adipose-derived stem cells (hASCs) in vitro. hASCs were isolated from lipo-aspirates, and characterized by specific cell markers and multilineage differentiation capacity after culturing to the 3rd passage. PRP was collected and activated from human peripheral blood of the same patient. Cultured hASCs were treated with normal osteogenic inductive media alone (group A, control) or osteogenic inductive media plus 5%, 10%, 20%, 40%PRP (group B, C, D, E, respectively). Cell proliferation was assessed by CCK-8 assay. mRNA expression of osteogenic marker genes including alkaline phosphatase (ALP), osteopontin (OPN), osteocalcin (OCN) and core binding factor alpha 1 (Cbfa1) were determined by Real-Time Quantitative PCR Analysis (qPCR). Data revealed that different concentrations of activated autologous PRP significantly promoted hASCs growth in the proliferation phase compared to the without PRP group and resulted in a dose-response relationship. At 7-d and 14-d time point of the osteogenic induced stage, ALP activity in PRP groups gradually increased with the increasing of concentrations of PRP and showed that dose-response relationship. At 21-d time point of the osteogenic induced stage, PRP groups make much more mineralization and mRNA relative expression of ALP, OPN, OCN and Cbfa1 than that without PRP groups and show that dose-response relationship. This study indicated that different concentrations of activated autologous PRP can promote cell proliferation at earlier stage and promote osteogenic differentiation at later stage of hASCs in vitro. Moreover, it displayed a dose-dependent effect of activated autologous PRP on cell proliferation and osteogenic differentiation of hASCs in vitro. PMID:25901195

Cloning and expression of prion protein encoding gene of flounder ( Paralichthys olivaceus)

NASA Astrophysics Data System (ADS)

Zhang, Zhiwen; Sun, Xiuqin; Zhang, Jinxing; Zan, Jindong

2008-02-01

The prion protein (PrP) encoding gene of flounder ( Paralichthys olivaceus) was cloned. It was not interrupted by an intron. This gene has two promoters in its 5' upstream, indicating that its transcription may be intensive, and should have an important function. It was expressed in all 14 tissues tested, demonstrating that it is a house-keeping gene. Its expression in digestion and reproduction systems implies that the possible prions of fish may transfer horizontally.

Goats without Prion Protein Display Enhanced Proinflammatory Pulmonary Signaling and Extracellular Matrix Remodeling upon Systemic Lipopolysaccharide Challenge.

PubMed

Salvesen, Øyvind; Reiten, Malin R; Kamstra, Jorke H; Bakkebø, Maren K; Espenes, Arild; Tranulis, Michael A; Ersdal, Cecilie

2017-01-01

A naturally occurring mutation in the PRNP gene of Norwegian dairy goats terminates synthesis of the cellular prion protein (PrP C ), rendering homozygous goats ( PRNP Ter/Ter ) devoid of the protein. Although PrP C has been extensively studied, particularly in the central nervous system, the biological role of PrP C remains incompletely understood. Here, we examined whether loss of PrP C affects the initial stage of lipopolysaccharide (LPS)-induced acute lung injury (ALI). Acute pulmonary inflammation was induced by intravenous injection of LPS ( Escherichia coli O26:B6) in 16 goats (8 PRNP Ter/Ter and 8 PRNP +/+ ). A control group of 10 goats (5 PRNP Ter/Ter and 5 PRNP +/+ ) received sterile saline. Systemic LPS challenge induced sepsis-like clinical signs including tachypnea and respiratory distress. Microscopic examination of lungs revealed multifocal areas with alveolar hemorrhages, edema, neutrophil infiltration, and higher numbers of alveolar macrophages, with no significant differences between PRNP genotypes. A total of 432 ( PRNP +/+ ) and 596 ( PRNP Ter/Ter ) genes were differentially expressed compared with the saline control of the matching genotype. When assigned to gene ontology categories, biological processes involved in remodeling of the extracellular matrix (ECM), were exclusively enriched in PrP C -deficient goats. These genes included a range of collagen-encoding genes, and proteases such as matrix metalloproteinases ( MMP1, MMP2, MMP14, ADAM15 ) and cathepsins. Several proinflammatory upstream regulators (TNF-α, interleukin-1β, IFN-γ) showed increased activation scores in goats devoid of PrP C . In conclusion, LPS challenge induced marked alterations in the lung tissue transcriptome that corresponded with histopathological and clinical findings in both genotypes. The increased activation of upstream inflammatory regulators and enrichment of ECM components could reflect increased inflammation in the absence of PrP C . Further studies are required to elucidate whether these alterations may affect the later reparative phase of ALI.

Collagen IX is required for the integrity of collagen II fibrils and the regulation of vascular plexus formation in Zebrafish caudal fins

PubMed Central

Huang, Cheng-chen; Wang, Tai-Chuan; Lin, Bo-Hung; Wang, Yi-Wen; Johnson, Stephen L.; Yu, John

2013-01-01

Capillary plexuses form during both vasculogenesis and angiogenesis and are remodeled into mature vessel types and patterns which are delicately orchestrated with the sizes and shapes of other tissues and organs. We isolated a zebrafish mutation named prp (for persistent plexus) that causes persistent formation of vascular plexuses in the caudal fins and consequent mispatterning of bony fin rays and the fin shape. Detailed analyses revealed that the prp mutation causes a significant reduction in the size and dramatic structural defects in collagen II-rich extracellular matrices called actinotrichia of both embryonic finfolds and adult fins. prp was mapped to chromosome 19 and found to encode the zebrafish collagen9α1 (col9α1) gene which is abundantly expressed in developing finfolds. A point mutation resulting in a leucine-to-histidine change was detected in the thrombospondin domain of the col9α1 gene in prp. Morpholino-mediated knockdown of col9α1 phenocopied the prp small-finfold phenotype in wild-type embryos, and an injection of plasmids containing the col9α1 cDNA into prp embryos locally restored the finfold size. Furthermore, we found that osteoblasts in prp mutants were mispatterned apparently following the abnormal vascular plexus pattern, demonstrating that blood vessels play an important role in the patterning of bony rays in zebrafish caudal fins. PMID:19501583

Collagen IX is required for the integrity of collagen II fibrils and the regulation of vascular plexus formation in zebrafish caudal fins.

PubMed

Huang, Cheng-chen; Wang, Tai-Chuan; Lin, Bo-Hung; Wang, Yi-Wen; Johnson, Stephen L; Yu, John

2009-08-15

Capillary plexuses form during both vasculogenesis and angiogenesis and are remodeled into mature vessel types and patterns which are delicately orchestrated with the sizes and shapes of other tissues and organs. We isolated a zebrafish mutation named prp (for persistent plexus) that causes persistent formation of vascular plexuses in the caudal fins and consequent mispatterning of bony fin rays and the fin shape. Detailed analyses revealed that the prp mutation causes a significant reduction in the size and dramatic structural defects in collagen II-rich extracellular matrices called actinotrichia of both embryonic finfolds and adult fins. prp was mapped to chromosome 19 and found to encode the zebrafish collagen9alpha1 (col9alpha1) gene which is abundantly expressed in developing finfolds. A point mutation resulting in a leucine-to-histidine change was detected in the thrombospondin domain of the col9alpha1 gene in prp. Morpholino-mediated knockdown of col9alpha1 phenocopied the prp small-finfold phenotype in wild-type embryos, and an injection of plasmids containing the col9alpha1 cDNA into prp embryos locally restored the finfold size. Furthermore, we found that osteoblasts in prp mutants were mispatterned apparently following the abnormal vascular plexus pattern, demonstrating that blood vessels play an important role in the patterning of bony rays in zebrafish caudal fins.

Evaluation of 3D-Printed Polycaprolactone Scaffolds Coated with Freeze-Dried Platelet-Rich Plasma for Bone Regeneration.

PubMed

Li, Junda; Chen, Meilin; Wei, Xiaoying; Hao, Yishan; Wang, Jinming

2017-07-19

Three-dimensional printing is one of the most promising techniques for the manufacturing of scaffolds for bone tissue engineering. However, a pure scaffold is limited by its biological properties. Platelet-rich plasma (PRP) has been shown to have the potential to improve the osteogenic effect. In this study, we improved the biological properties of scaffolds by coating 3D-printed polycaprolactone (PCL) scaffolds with freeze-dried and traditionally prepared PRP, and we evaluated these scaffolds through in vitro and in vivo experiments. In vitro, we evaluated the interaction between dental pulp stem cells (DPSCs) and the scaffolds by measuring cell proliferation, alkaline phosphatase (ALP) activity, and osteogenic differentiation. The results showed that freeze-dried PRP significantly enhanced ALP activity and the mRNA expression levels of osteogenic genes (ALP, RUNX2 (runt-related gene-2), OCN (osteocalcin), OPN (osteopontin)) of DPSCs ( p < 0.05). In vivo, 5 mm calvarial defects were created, and the PRP-PCL scaffolds were implanted. The data showed that compared with traditional PRP-PCL scaffolds or bare PCL scaffolds, the freeze-dried PRP-PCL scaffolds induced significantly greater bone formation ( p < 0.05). All these data suggest that coating 3D-printed PCL scaffolds with freeze-dried PRP can promote greater osteogenic differentiation of DPSCs and induce more bone formation, which may have great potential in future clinical applications.

Genomic assessment of the evolution of the prion protein gene family in vertebrates.

PubMed

Harrison, Paul M; Khachane, Amit; Kumar, Manish

2010-05-01

Prion diseases are devastating neurological disorders caused by the propagation of particles containing an alternative beta-sheet-rich form of the prion protein (PrP). Genes paralogous to PrP, called Doppel and Shadoo, have been identified, that also have neuropathological relevance. To aid in the further functional characterization of PrP and its relatives, we annotated completely the PrP gene family (PrP-GF), in the genomes of 42 vertebrates, through combined strategic application of gene prediction programs and advanced remote homology detection techniques (such as HMMs, PSI-TBLASTN and pGenThreader). We have uncovered several previously undescribed paralogous genes and pseudogenes. We find that current high-quality genomic evidence indicates that the PrP relative Doppel, was likely present in the last common ancestor of present-day Tetrapoda, but was lost in the bird lineage, since its divergence from reptiles. Using the new gene annotations, we have defined the consensus of structural features that are characteristic of the PrP and Doppel structures, across diverse Tetrapoda clades. Furthermore, we describe in detail a transcribed pseudogene derived from Shadoo that is conserved across primates, and that overlaps the meiosis gene, SYCE1, thus possibly regulating its expression. In addition, we analysed the locus of PRNP/PRND for significant conservation across the genomic DNA of eleven mammals, and determined the phylogenetic penetration of non-coding exons. The genomic evidence indicates that the second PRNP non-coding exon found in even-toed ungulates and rodents, is conserved in all high-coverage genome assemblies of primates (human, chimp, orang utan and macaque), and is, at least, likely to have fallen out of use during primate speciation. Furthermore, we have demonstrated that the PRNT gene (at the PRNP human locus) is conserved across at least sixteen mammals, and evolves like a long non-coding RNA, fashioned from fragments of ancient, long, interspersed elements. These annotations and evolutionary analyses will be of further use for functional characterisation of the PrP-GF, and will be updatable in a semi-automated fashion as more genomes accumulate. Copyright 2010 Elsevier Inc. All rights reserved.

Viral and bacterial septicaemic infections modulate the expression of PACAP splicing variants and VIP/PACAP receptors in brown trout immune organs.

PubMed

Gorgoglione, Bartolomeo; Carpio, Yamila; Secombes, Christopher J; Taylor, Nick G H; Lugo, Juana María; Estrada, Mario Pablo

2015-12-01

Pituitary Adenylate Cyclase-Activating Polypeptide (PACAP) and PACAP-Related Peptide (PRP) are structurally similar peptides encoded in the same transcripts. Their transcription has been detected not only in the brain but also in a wide range of peripheral tissues, even including organs of the immune system. PACAP exerts pleiotropic activities through G-protein coupled membrane receptors: the PACAP-specific PAC-1 and the VPAC-1 and VPAC-2 receptors that exhibit similar affinities for the Vasoactive Intestinal Peptide (VIP) and PACAP. Recent findings added PACAP and its receptors to the growing list of mediators that allow cross-talk between the nervous, endocrine and immune systems in fish. In this study the expression of genes encoding for PACAP and PRP, as well as VIP/PACAP receptors was studied in laboratory-reared brown trout (Salmo trutta) after septicaemic infections. Respectively Viral Haemorrhagic Septicaemia Virus (VHSV-Ia) or the Gram-negative bacterium Yersinia ruckeri (ser. O1 - biot. 2) were used in infection challenges. Kidney and spleen, the teleost main lymphopoietic organs, were sampled during the first two weeks post-infection. RT-qPCR analysis assessed specific pathogens burden and gene expression levels. PACAP and PRP transcription in each organ was positively correlated to the respective pathogen burden, assessed targeting the VHSV-glycoprotein or Y. ruckeri 16S rRNA. Results showed as the transcription of PACAP splicing variants and VIP/PACAP receptors is modulated in these organs during an acute viral and bacterial septicaemic infections in brown trout. These gene expression results provide clues as to how the PACAP system is modulated in fish, confirming an involvement during active immune responses elicited by both viral and bacterial aetiological agents. However, further experimental evidence is still required to fully elucidate and characterize the role of PACAP and PRP for an efficient immune response against pathogens. Copyright © 2015 Elsevier Ltd. All rights reserved.

Prion potency in stem cells biology.

PubMed

Lopes, Marilene H; Santos, Tiago G

2012-01-01

Prion protein (PrP) can be considered a pivotal molecule because it interacts with several partners to perform a diverse range of critical biological functions that might differ in embryonic and adult cells. In recent years, there have been major advances in elucidating the putative role of PrP in the basic biology of stem cells in many different systems. Here, we review the evidence indicating that PrP is a key molecule involved in driving different aspects of the potency of embryonic and tissue-specific stem cells in self-perpetuation and differentiation in many cell types. It has been shown that PrP is involved in stem cell self-renewal, controlling pluripotency gene expression, proliferation, and neural and cardiomyocyte differentiation. PrP also has essential roles in distinct processes that regulate tissue-specific stem cell biology in nervous and hematopoietic systems and during muscle regeneration. Results from our own investigations have shown that PrP is able to modulate self-renewal and proliferation in neural stem cells, processes that are enhanced by PrP interactions with stress inducible protein 1 (STI1). Thus, the available data reveal the influence of PrP in acting upon the maintenance of pluripotent status or the differentiation of stem cells from the early embryogenesis through adulthood.

Platelet-rich plasma inhibits the apoptosis of highly adipogenic homogeneous preadipocytes in an in vitro culture system.

PubMed

Fukaya, Yoshitaka; Kuroda, Masayuki; Aoyagi, Yasuyuki; Asada, Sakiyo; Kubota, Yoshitaka; Okamoto, Yoshitaka; Nakayama, Toshinori; Saito, Yasushi; Satoh, Kaneshige; Bujo, Hideaki

2012-05-31

Auto-transplantation of adipose tissue is commonly used for the treatment of tissue defects in plastic surgery. The survival of the transplanted adipose tissue is not always constant, and one of reasons is the accelerated apoptosis of the implanted preadipocytes. We have recently established highly homogeneous preadipocytes, named ccdPAs. The aim of the current study was to evaluate the regulation of the potency of platelet-rich plasma (PRP) on the apoptosis of ccdPAs in vitro. PRP stimulated the proliferation of the preadipocytes in a dose-dependent manner, and the stimulatory activity of 2% PRP was significantly higher than that of 2% FBS or 2% platelet-poor plasma (PPP). The presence of 2% PRP significantly inhibited serum starvation- or TNF-α/cycloheximide-induced apoptosis in comparison to 2% FBS or 2% PPP. DAPK1 and Bcl-2-interacting mediator of cell death (BIM) mRNAs were reduced in the preadipocytes cultured with 2% PRP in comparison to those cultured in 2% FBS. The gene expression levels were significantly higher in cells cultured without serum in comparison to cells cultured with 2% FBS, and the levels in the cells with 2% PRP were reduced to 5-10% of those in the cells without serum. These results indicated that ccdPAs exhibit anti- apoptotic activities, in addition to increased proliferation, when cultured in 2% PRP in comparison to the same concentration of FBS, and that this was accompanied with reduced levels of DAPK1 and BIM mRNA expression in in vitro culture. PRP may improve the outcome of transplantation of adipose tissue by enhancing the anti-apoptotic activities of the implanted preadipocytes.

Peripheral Blood Mononuclear Cells Enhance the Anabolic Effects of Platelet-Rich Plasma on Anterior Cruciate Ligament Fibroblasts

PubMed Central

Yoshida, Ryu; Murray, Martha M.

2012-01-01

Use of platelet-rich plasma (PRP) has shown promise in various orthopaedic applications, including treatment of anterior cruciate ligament (ACL) injuries. However, various components of blood, including peripheral blood mononuclear cells (PBMCs), are removed in the process of making PRP. It is yet unknown whether these PBMCs have a positive or negative effect on fibroblast behavior. To begin to define the effect of PBMCs on ACL fibroblasts, ACL fibroblasts were cultured on three-dimensional collagen scaffolds for 14 days with and without PBMCs. ACL fibroblasts exposed to PBMCs showed increased type I and type III procollagen gene expression, collagen protein expression, and cell proliferation when the cells were cultured in the presence of platelets and plasma. However, addition of PBMCs to cells cultured without the presence of platelets had no effect. The increase in collagen gene and protein expression was accompanied by an increase in IL-6 expression by the PBMCs with exposure to the platelets. Our results suggest that the interaction between platelets and PBMCs leads to an IL-6 mediated increase in collagen expression by ACL fibroblasts. PMID:22767425

RSR-2, the Caenorhabditis elegans Ortholog of Human Spliceosomal Component SRm300/SRRM2, Regulates Development by Influencing the Transcriptional Machinery

PubMed Central

Fontrodona, Laura; Porta-de-la-Riva, Montserrat; Morán, Tomás; Niu, Wei; Díaz, Mònica; Aristizábal-Corrales, David; Villanueva, Alberto; Schwartz, Simó; Reinke, Valerie; Cerón, Julián

2013-01-01

Protein components of the spliceosome are highly conserved in eukaryotes and can influence several steps of the gene expression process. RSR-2, the Caenorhabditis elegans ortholog of the human spliceosomal protein SRm300/SRRM2, is essential for viability, in contrast to the yeast ortholog Cwc21p. We took advantage of mutants and RNA interference (RNAi) to study rsr-2 functions in C. elegans, and through genetic epistasis analysis found that rsr-2 is within the germline sex determination pathway. Intriguingly, transcriptome analyses of rsr-2(RNAi) animals did not reveal appreciable splicing defects but instead a slight global decrease in transcript levels. We further investigated this effect in transcription and observed that RSR-2 colocalizes with DNA in germline nuclei and coprecipitates with chromatin, displaying a ChIP-Seq profile similar to that obtained for the RNA Polymerase II (RNAPII). Consistent with a novel transcription function we demonstrate that the recruitment of RSR-2 to chromatin is splicing-independent and that RSR-2 interacts with RNAPII and affects RNAPII phosphorylation states. Proteomic analyses identified proteins associated with RSR-2 that are involved in different gene expression steps, including RNA metabolism and transcription with PRP-8 and PRP-19 being the strongest interacting partners. PRP-8 is a core component of the spliceosome and PRP-19 is the core component of the PRP19 complex, which interacts with RNAPII and is necessary for full transcriptional activity. Taken together, our study proposes that RSR-2 is a multifunctional protein whose role in transcription influences C. elegans development. PMID:23754964

Isolation of an essential Schizosaccharomyces pombe gene, prp31+, that links splicing and meiosis

PubMed Central

Bishop, Danielle T.; McDonald, W. Hayes; Gould, Kathleen L.; Forsburg, Susan L.

2000-01-01

We carried out a screen for mutants that arrest prior to premeiotic S phase. One of the strains we isolated contains a temperature-sensitive allele mutation in the fission yeast prp31+ gene. The prp31-E1 mutant is defective in vegetative cell growth and in meiotic progression. It is synthetically lethal with prp6 and displays a pre-mRNA splicing defect at the restrictive temperature. We cloned the wild-type gene by complementation of the temperature-sensitive mutant phenotype. Prp31p is closely related to human and budding yeast PRP31 homologs and is likely to function as a general splicing factor in both vegetative growth and sexual differentiation. PMID:10871341

In vitro effects of three blood derivatives on human corneal epithelial cells.

PubMed

Freire, Vanesa; Andollo, Noelia; Etxebarria, Jaime; Durán, Juan A; Morales, María-Celia

2012-08-15

We compared the effects of three blood derivatives, autologous serum (AS), platelet-rich plasma (PRP), and serum derived from plasma rich in growth factors (PRGF), on a human corneal epithelial (HCE) cell line to evaluate their potential as an effective treatment for corneal epithelial disorders. The concentrations of epidermal growth factor (EGF), fibroblast growth factor (FGF), vascular endothelial growth factor (VEGF), hepatocyte growth factor (HGF), platelet-derived growth factor (PDGF), and fibronectin were quantified by ELISA. The proliferation and viability of HCE cells were measured by an 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyl tetrazolium bromide (MTT) colorimetric assay. Cell morphology was assessed by phase-contrast microscopy. The patterns of expression of several connexin, involucrin, and integrin α6 genes were analyzed by real-time RT-PCR. We found significantly higher levels of EGF in PRGF compared to AS and PRP. However, AS and PRGF induced robust proliferation of HCE cells. In addition, PRGF cultured cells grew as heterogeneous colonies, exhibiting differentiated and non-differentiated cell phenotypes, whereas AS- and PRP-treated cultures exhibited quite homogeneous colonies. Finally, PRGF upregulated the expression of several genes associated with communication and cell differentiation, in comparison to AS or PRP. PRGF promotes biological processes required for corneal epithelialization, such as proliferation and differentiation. Since PRGF effects are similar to those associated with routinely used blood derivatives, the present findings warrant further research on PRGF as a novel alternative treatment for ocular surface diseases.

Involvement of Cellular Prion Protein in α-Synuclein Transport in Neurons.

PubMed

Urrea, Laura; Segura-Feliu, Miriam; Masuda-Suzukake, Masami; Hervera, Arnau; Pedraz, Lucas; García Aznar, José Manuel; Vila, Miquel; Samitier, Josep; Torrents, Eduard; Ferrer, Isidro; Gavín, Rosalina; Hagesawa, Masato; Del Río, José Antonio

2018-03-01

The cellular prion protein, encoded by the gene Prnp, has been reported to be a receptor of β-amyloid. Their interaction is mandatory for neurotoxic effects of β-amyloid oligomers. In this study, we aimed to explore whether the cellular prion protein participates in the spreading of α-synuclein. Results demonstrate that Prnp expression is not mandatory for α-synuclein spreading. However, although the pathological spreading of α-synuclein can take place in the absence of Prnp, α-synuclein expanded faster in PrP C -overexpressing mice. In addition, α-synuclein binds strongly on PrP C -expressing cells, suggesting a role in modulating the effect of α-synuclein fibrils.

Increasing platelet concentrations in leukocyte-reduced platelet-rich plasma decrease collagen gene synthesis in tendons.

PubMed

Boswell, Stacie G; Schnabel, Lauren V; Mohammed, Hussni O; Sundman, Emily A; Minas, Tom; Fortier, Lisa A

2014-01-01

Platelet-rich plasma (PRP) is used for the treatment of tendinopathy. There are numerous PRP preparations, and the optimal combination of platelets and leukocytes is not known. Within leukocyte-reduced PRP (lrPRP), there is a plateau effect of platelet concentration, with increasing platelet concentrations being detrimental to extracellular matrix synthesis. Controlled laboratory study. Different formulations of lrPRP with respect to the platelet:leukocyte ratio were generated from venous blood of 8 horses. Explants of the superficial digital flexor tendon were cultured in lrPRP products for 96 hours. Platelet-derived growth factor-BB (PDGF-BB), tumor necrosis factor-α (TNF-α), transforming growth factor-β1 (TGF-β1), and interleukin-1β (IL-1β) concentrations were determined in the media by enzyme-linked immunosorbent assay. Gene expression in tendon tissue for collagen type I and III (COL1A1 and COL3A1, respectively), matrix metalloproteinase-3 and -13 (MMP-3 and MMP-13, respectively), cartilage oligomeric matrix protein (COMP), and IL-1β was determined. Data were divided into 3 groups of lrPRP based on the ratio of platelets:leukocytes and evaluated to determine the effect of platelet concentration. Complete blood counts verified leukocyte reduction and platelet enrichment in all PRP preparations. In the lrPRP preparation, the anabolic growth factors PDGF-BB and TGF-β1 were increased with increasing platelet concentrations, and the catabolic cytokine IL-1β was decreased with increasing platelet concentrations. Increasing the platelet concentration resulted in a significant reduction in COL1A1 and COL3A1 synthesis in tendons. Increasing the platelet concentration within lrPRP preparations results in the delivery of more anabolic growth factors and less proinflammatory cytokines, but the biological effect on tendons is diminished metabolism as indicated by a decrease in the synthesis of both COL1A1 and COL3A1. Together, this information suggests that minimizing leukocytes in PRP is more important than maximizing platelet numbers with respect to decreasing inflammation and enhancing matrix gene synthesis. This study suggests that reducing leukocytes to minimize catabolic signaling appears to be more important than increasing platelets in an effort to maximize anabolic signaling. Further, a maximum biological threshold of benefit was demonstrated with regard to the number of platelets beyond which further increases in platelet concentration did not result in further anabolic upregulation. In vivo investigations documenting the use of platelets for the treatment of tendinopathy are justified as well as further in vitro characterization of the ideal PRP product for the treatment of tendinopathy and other musculoskeletal applications.

Improved fat graft survival by different volume fractions of platelet-rich plasma and adipose-derived stem cells.

PubMed

Li, Feng; Guo, Weihua; Li, Kun; Yu, Mei; Tang, Wei; Wang, Hang; Tian, Weidong

2015-03-01

The success of soft-tissue augmentation is offset by the low survival rates of grafted fat tissue. Research shows that adipose-derived stem cells (ASCs) and platelet-rich plasma (PRP) are beneficial to tissue healing. To evaluate the long-term effects of different volume fractions of PRP combined with ASCs on fat graft. ASCs were isolated from human fat tissue, and PRP was obtained from human blood. Cell count kit-8 and real-time polymerase chain reaction (PCR) were used to evaluate the influence of PRP (0%, 10%, 20%, and 30%; volume/volume [v/v]) in medium on ASC proliferation and adipogenic differentiation, respectively. A novel lipoinjection consisting of granular fat, PRP, and ASCs was subcutaneously transplanted into nude mice. The grafts were volumetrically and histologically evaluated 10, 30, 60, and 90 days after transplantation. The addition of PRP improved ASC proliferation. Expression of adipogenic-related genes, peroxisome proliferator-activated receptor-γ, lipoprotein lipase, and adipophilin were up-regulated in PRP-induced ASCs. Compared with other groups, granular fat grafts formed with 20% (v/v) and 30% (v/v) PRP significantly improved residual volumes. More intact adipocytes and capillary formation, but less vacuolization, were observed in the 20% (v/v) and 30% (v/v) PRP groups at 30, 60, and 90 days. However, no significant difference was observed between the 20% (v/v) and 30% (v/v) PRP groups in retaining fat grafts and improving histology. Fat grafting with 20% (v/v) PRP and ASCs constitutes an appropriate transplantation strategy for improving graft survival and provides a potential approach for soft-tissue restoration in plastic and reconstructive surgery. © 2015 The American Society for Aesthetic Plastic Surgery, Inc. Reprints and permission: journals.permissions@oup.com.

FgPrp4 Kinase Is Important for Spliceosome B-Complex Activation and Splicing Efficiency in Fusarium graminearum

PubMed Central

Jiang, Cong; Li, Yang; Li, Chaohui; Liu, Huiquan; Kang, Zhensheng; Xu, Jin-Rong

2016-01-01

PRP4 encodes the only kinase among the spliceosome components. Although it is an essential gene in the fission yeast and other eukaryotic organisms, the Fgprp4 mutant was viable in the wheat scab fungus Fusarium graminearum. Deletion of FgPRP4 did not block intron splicing but affected intron splicing efficiency in over 60% of the F. graminearum genes. The Fgprp4 mutant had severe growth defects and produced spontaneous suppressors that were recovered in growth rate. Suppressor mutations were identified in the PRP6, PRP31, BRR2, and PRP8 orthologs in nine suppressor strains by sequencing analysis with candidate tri-snRNP component genes. The Q86K mutation in FgMSL1 was identified by whole genome sequencing in suppressor mutant S3. Whereas two of the suppressor mutations in FgBrr2 and FgPrp8 were similar to those characterized in their orthologs in yeasts, suppressor mutations in Prp6 and Prp31 orthologs or FgMSL1 have not been reported. Interestingly, four and two suppressor mutations identified in FgPrp6 and FgPrp31, respectively, all are near the conserved Prp4-phosphorylation sites, suggesting that these mutations may have similar effects with phosphorylation by Prp4 kinase. In FgPrp31, the non-sense mutation at R464 resulted in the truncation of the C-terminal 130 aa region that contains all the conserved Prp4-phosphorylation sites. Deletion analysis showed that the N-terminal 310-aa rich in SR residues plays a critical role in the localization and functions of FgPrp4. We also conducted phosphoproteomics analysis with FgPrp4 and identified S289 as the phosphorylation site that is essential for its functions. These results indicated that FgPrp4 is critical for splicing efficiency but not essential for intron splicing, and FgPrp4 may regulate pre-mRNA splicing by phosphorylation of other components of the tri-snRNP although itself may be activated by phosphorylation at S289. PMID:27058959

Does leukocyte-poor or leukocyte-rich platelet-rich plasma applied with biopolymers have superiority to conventional platelet-rich plasma applications on chondrocyte proliferation?

PubMed

Yaşar Şirin, Duygu; Yılmaz, İbrahim; İsyar, Mehmet; Öznam, Kadir; Mahiroğulları, Mahir

2017-12-01

This study aims to investigate the possible effects of leukocyte concentration in the content of platelet-rich plasma (PRP) and the administration of PRP using a drug delivery system on chondrocyte proliferation in vitro conditions. Blood from nine male patients (mean age 65 years; range 49 to 81 years) with advanced stage osteoarthritis who had not responded to medical or conservative treatments and underwent total knee arthroplasty was used to prepare two formulations: PRP with low concentration leukocytes (2000-4000 leukocytes/µL) was designated as pure PRP (P-PRP), whereas PRP with high concentration leukocytes (9000-11000 leukocytes/µL) as leukocyte-rich PRP (L-PRP). Samples were divided into five groups as control group (group 1), chondrocyte cultures with P-PRP applied directly (group 2), chondrocyte cultures with L-PRP applied directly (group 3), chondrocytes co-cultured with P-PRP applied hydrogel (group 4), and chondrocytes co-cultured with L-PRP applied hydrogel (group 5). In all groups; cell morphology, viability and proliferation were compared with the expression of stage-specific embryonic antigen-1 (SSEA-1), a precondrocyte marker. Maximum cell proliferation and SSEA-1 expression occurred in group 4, with a statistically significant correlation between SSEA-1 expression and cell proliferation. Our study showed the importance of leukocyte concentration of PRP and efficiency of delivery systems such as hydrogel and that L-PRP administered with a delivery system is more efficient than conventional applications of PRP in the treatment of cartilage damage.

Genetic Studies of the Prp17 Gene of Saccharomyces Cerevisiae: A Domain Essential for Function Maps to a Nonconserved Region of the Protein

PubMed Central

Seshadri, V.; Vaidya, V. C.; Vijayraghavan, U.

1996-01-01

The PRP17 gene product is required for the second step of pre-mRNA splicing reactions. The C-terminal half of this protein bears four repeat units with homology to the β transducin repeat. Missense mutations in three temperature-sensitive prp17 mutants map to a region in the N-terminal half of the protein. We have generated, in vitro, 11 missense alleles at the β transducin repeat units and find that only one affects function in vivo. A phenotypically silent missense allele at the fourth repeat unit enhances the slow-growing phenotype conferred by an allele at the third repeat, suggesting an interaction between these domains. Although many missense mutations in highly conserved amino acids lack phenotypic effects, deletion analysis suggests an essential role for these units. Only mutations in the N-terminal nonconserved domain of PRP17 are synthetically lethal in combination with mutations in PRP16 and PRP18, two other gene products required for the second splicing reaction. A mutually allele-specific interaction between prp17 and snr7, with mutations in U5 snRNA, was observed. We therefore suggest that the functional region of Prp17p that interacts with Prp18p, Prp16p, and U5 snRNA is in the N terminal region of the protein. PMID:8722761

An endogenous reference gene of common and durum wheat for detection of genetically modified wheat.

PubMed

Imai, Shinjiro; Tanaka, Keiko; Nishitsuji, Yasuyuki; Kikuchi, Yosuke; Matsuoka, Yasuyuki; Arami, Shin-Ichiro; Sato, Megumi; Haraguchi, Hiroyuki; Kurimoto, Youichi; Mano, Junichi; Furui, Satoshi; Kitta, Kazumi

2012-01-01

To develop a method for detecting GM wheat that may be marketed in the near future, we evaluated the proline-rich protein (PRP) gene as an endogenous reference gene of common wheat (Triticum aestivum L.) and durum wheat (Triticum durum L.). Real-time PCR analysis showed that only DNA of wheat was amplified and no amplification product was observed for phylogenetically related cereals, indicating that the PRP detection system is specific to wheat. The intensities of the amplification products and Ct values among all wheat samples used in this study were very similar, with no nonspecific or additional amplification, indicating that the PRP detection system has high sequence stability. The limit of detection was estimated at 5 haploid genome copies. The PRP region was demonstrated to be present as a single or double copy in the common wheat haploid genome. Furthermore, the PRP detection system showed a highly linear relationship between Ct values and the amount of plasmid DNA, indicating that an appropriate calibration curve could be constructed for quantitative detection of GM wheat. All these results indicate that the PRP gene is a suitable endogenous reference gene for PCR-based detection of GM wheat.

DNA damage induces down-regulation of Prp19 via impairing Prp19 stability in hepatocellular carcinoma cells.

PubMed

Yin, Jie; Zhang, Yi-An; Liu, Tao-Tao; Zhu, Ji-Min; Shen, Xi-Zhong

2014-01-01

Pre-mRNA processing factor 19 (Prp19) activates pre-mRNA spliceosome and also mediates DNA damage response. Prp19 overexpression in cells with functional p53 leads to decreased apoptosis and increases cell survival after DNA damage. Here we showed that in hepatocellular carcinoma (HCC) cells with inactive p53 or functional p53, Prp19 was down-regulated due to the impaired stability under chemotherapeutic drug treatment. Silencing Prp19 expression enhanced apoptosis of HCC cells with or without chemotherapeutic drug treatment. Furthermore high level of Prp19 may inhibit chemotherapeutic drugs induced apoptosis in hepatocellular carcinoma cells through modulating myeloid leukemia cell differentiation 1 expression. These results indicated that targeting Prp19 may potentiate pro-apoptotic effect of chemotherapeutic agents on HCC.

Platelet-rich plasma enhances the integration of bioengineered cartilage with native tissue in an in vitro model.

PubMed

Sermer, Corey; Kandel, Rita; Anderson, Jesse; Hurtig, Mark; Theodoropoulos, John

2018-02-01

Current therapies for cartilage repair can be limited by an inability of the repair tissue to integrate with host tissue. Thus, there is interest in developing approaches to enhance integration. We have previously shown that platelet-rich plasma (PRP) improves cartilage tissue formation. This raised the question as to whether PRP could promote cartilage integration. Chondrocytes were isolated from cartilage harvested from bovine joints, seeded on a porous bone substitute and grown in vitro to form an osteochondral-like implant. After 7 days, the biphasic construct was soaked in PRP for 30 min before implantation into the core of a donut-shaped biphasic explant of native cartilage and bone. Controls were not soaked in PRP. The implant-explant construct was cultured for 2-4 weeks. PRP-soaked bioengineered implants integrated with host tissue in 73% of samples, whereas controls only integrated in 19% of samples. The integration strength, as determined by a push-out test, was significantly increased in the PRP-soaked implant group (219 ± 35.4 kPa) compared with controls (72.0 ± 28.5 kPa). This correlated with an increase in glycosaminoglycan and collagen accumulation in the region of integration in the PRP-treated implant group, compared with untreated controls. Immunohistochemical studies revealed that the integration zone contained collagen type II and aggrecan. The cells at the zone of integration in the PRP-soaked group had a 3.5-fold increase in matrix metalloproteinase-13 gene expression compared with controls. These results suggest that PRP-soaked bioengineered cartilage implants may be a better approach for cartilage repair due to enhanced integration. Copyright © 2017 John Wiley & Sons, Ltd.

Effects of platelet rich plasma and chondrocyte co-culture on MSC chondrogenesis, hypertrophy and pathological responses

PubMed Central

Ramezanifard, Rouhallah; Kabiri, Mahboubeh; Hanaee Ahvaz, Hana

2017-01-01

Regarding the inadequate healing capability of cartilage tissue, cell-based therapy is making the future of cartilage repair and regeneration. Mesenchymal stem cells (MSC) have shown great promise in cartilage regeneration. However, a yet-unresolved issue is the emergence of hypertrophic and pathologic markers during in vitro MSC chondrogenesis. Articular chondrocytes (AC) can suppress the undesired hypertrophy when co-cultured with MSC. On the other hand, platelet rich plasma (PRP), is considered potentially effective for cartilage repair and in-vitro chondrogenesis. We thus aimed to harness chondro-promotive effects of PRP and hypertrophic-suppressive effects of AC:MSC co-culture to achieve a more functional cartilage neo-tissue. We used PRP or conventional-differentiation chondrogenic media (ConvDiff) in MSC mono-cultures and AC:MSC co-cultures. We assessed gene expression of chondrogenic and hypertrophic markers using real-time RT-PCR and immunostaining. Alkaline-phosphatase activity (ALP) and calcium content of the pellets were quantified. We also measured VEGF and TNF-α secretion via ELISA. We showed PRP had higher chondrogenic potential (in mRNA and protein level) and hypertrophic-suppressive effects than Conv-Diff (mRNA level). Co-culturing reduced ALP while PRP increased calcium deposition. In all four groups, TNF-α was down-regulated compared to MSC controls, with co-cultures receiving ConvDiff media secreting the least. Meanwhile, the only group with increased VEGF secretion was PRP-mono-cultures. We observed synergistic effects for PRP and AC:MSC co-culture in enhancing chondrogenesis. Inclusion of AC reduced hypertrophic markers and angiogenic potential in PRP groups. We thus propose that combination of PRP and co-culture would favor chondrogenesis while alleviate but not totally eradicate undesired hypertrophic and pathologic responses. PMID:28900383

Effects of Platelet-Rich Plasma With Concomitant Use of a Corticosteroid on Tenocytes From Degenerative Rotator Cuff Tears in Interleukin 1β-Induced Tendinopathic Conditions.

PubMed

Jo, Chris Hyunchul; Lee, Seung Yeon; Yoon, Kang Sup; Shin, Sue

2017-04-01

A corticosteroid injection is commonly used to treat tendinopathy, but it has been associated with negative effects on tendon homeostasis. Platelet-rich plasma (PRP) is known to have proliferative and anabolic effects as well as cytoprotective effects against corticosteroids on tenocytes. However, the combined effects of a corticosteroid and PRP on the anti-inflammatory, matrix synthesis, and cytoprotective potential of tenocytes in conditions simulating tendinopathy have not been investigated. To assess the effects of PRP on tenocytes from degenerative rotator cuff tears with the concomitant use of a corticosteroid in interleukin 1β (IL-1β)-induced tendinopathic conditions. Controlled laboratory study. Tenocytes were enzymatically isolated and cultured from patients with degenerative rotator cuff tears. PRP was prepared using a plateletpheresis system, and growth factor concentrations were measured. To evaluate the gene expression of proinflammatory and anti-inflammatory cytokines, enzymes and their inhibitors, and matrix molecules, cells were cultured with 1 ng/mL IL-1β, 1 μM dexamethasone, and 10% (vol/vol) platelet-poor plasma (PPP) and PRP of 200, 1000, and 4000 × 10 3 /μL; quantitative real-time reverse transcriptase polymerase chain reaction was also performed. Western blotting was performed to investigate the protein synthesis of degradative enzymes and their inhibitors. Cell viability, apoptosis, and senescence assays were also conducted. PRP did not interfere with the anti-inflammatory effects of dexamethasone on tenocytes pretreated with IL-1β, but it increased the synthesis of tissue inhibitor of metalloproteinase (TIMP)-1 and -3. Meanwhile, PRP did not induce anti-inflammatory cytokines that had been suppressed with a corticosteroid. It did increase the type I/III collagen ratio mainly through the suppression of type III collagen expression. PRP reversed the decreased viability, increased apoptosis, and induced senescence with IL-1β and a corticosteroid. This study shows that the addition of PRP does not interfere with the anti-inflammatory effects of a corticosteroid on IL-1β-treated tenocytes from degenerative rotator cuff tears but that it does avoid the deleterious side effects of a corticosteroid. PRP can be clinically useful with a corticosteroid as a treatment for tendinopathy.

PRP5: a helicase-like protein required for mRNA splicing in yeast.

PubMed Central

Dalbadie-McFarland, G; Abelson, J

1990-01-01

A 96-kDa protein predicted by the DNA sequence of the Saccharomyces cerevisiae PRP5 gene contains a domain that bears a striking resemblance to a family of RNA helicases characterized by the conserved amino acid sequence Asp-Glu-Ala-Asp (D-E-A-D). Previous work indicated that the product of the PRP5 gene is required for splicing and that spliceosome assembly does not occur in its absence. However, its precise role in splicing and the nature of its biochemical activity remained unknown. To examine the role of PRP5 in splicing, we cloned the gene by complementation of a temperature-sensitive mutation and determined its DNA sequence. We discuss here the possible roles for an RNA helicase in splicing and for the activity of the PRP5 protein. Images PMID:2349233

Genetic and physical interactions between factors involved in both cell cycle progression and pre-mRNA splicing in Saccharomyces cerevisiae.

PubMed Central

Ben-Yehuda, S; Dix, I; Russell, C S; McGarvey, M; Beggs, J D; Kupiec, M

2000-01-01

The PRP17/CDC40 gene of Saccharomyces cerevisiae functions in two different cellular processes: pre-mRNA splicing and cell cycle progression. The Prp17/Cdc40 protein participates in the second step of the splicing reaction and, in addition, prp17/cdc40 mutant cells held at the restrictive temperature arrest in the G2 phase of the cell cycle. Here we describe the identification of nine genes that, when mutated, show synthetic lethality with the prp17/cdc40Delta allele. Six of these encode known splicing factors: Prp8p, Slu7p, Prp16p, Prp22p, Slt11p, and U2 snRNA. The other three, SYF1, SYF2, and SYF3, represent genes also involved in cell cycle progression and in pre-mRNA splicing. Syf1p and Syf3p are highly conserved proteins containing several copies of a repeated motif, which we term RTPR. This newly defined motif is shared by proteins involved in RNA processing and represents a subfamily of the known TPR (tetratricopeptide repeat) motif. Using two-hybrid interaction screens and biochemical analysis, we show that the SYF gene products interact with each other and with four other proteins: Isy1p, Cef1p, Prp22p, and Ntc20p. We discuss the role played by these proteins in splicing and cell cycle progression. PMID:11102353

Genetic and physical interactions between factors involved in both cell cycle progression and pre-mRNA splicing in Saccharomyces cerevisiae.

PubMed

Ben-Yehuda, S; Dix, I; Russell, C S; McGarvey, M; Beggs, J D; Kupiec, M

2000-12-01

The PRP17/CDC40 gene of Saccharomyces cerevisiae functions in two different cellular processes: pre-mRNA splicing and cell cycle progression. The Prp17/Cdc40 protein participates in the second step of the splicing reaction and, in addition, prp17/cdc40 mutant cells held at the restrictive temperature arrest in the G2 phase of the cell cycle. Here we describe the identification of nine genes that, when mutated, show synthetic lethality with the prp17/cdc40Delta allele. Six of these encode known splicing factors: Prp8p, Slu7p, Prp16p, Prp22p, Slt11p, and U2 snRNA. The other three, SYF1, SYF2, and SYF3, represent genes also involved in cell cycle progression and in pre-mRNA splicing. Syf1p and Syf3p are highly conserved proteins containing several copies of a repeated motif, which we term RTPR. This newly defined motif is shared by proteins involved in RNA processing and represents a subfamily of the known TPR (tetratricopeptide repeat) motif. Using two-hybrid interaction screens and biochemical analysis, we show that the SYF gene products interact with each other and with four other proteins: Isy1p, Cef1p, Prp22p, and Ntc20p. We discuss the role played by these proteins in splicing and cell cycle progression.

Curcumin Induces Apoptosis in Human Colorectal Carcinoma (HCT-15) Cells by Regulating Expression of Prp4 and p53

PubMed Central

Shehzad, Adeeb; Lee, Jaetae; Huh, Tae-Lin; Lee, Young Sup

2013-01-01

Curcumin (diferuloylmethane), the yellow pigment of turmeric, is one of the most commonly used and extensively studied phytochemicals due to its pleiotropic effects in several human cancers. In the current study, the therapeutic efficacy of curcumin was investigated in human colorectal carcinoma HCT-15 cells. Curcumin inhibited HCT-15 cells proliferation and induced apoptosis in a dose- and time-dependent manner. Hoechst 33342 and DCFHDA staining revealed morphological and biochemical features of apoptosis as well as ROS generation in HCT-15 cells treated with 30 and 50 μM curcumin. Over-expression of pre-mRNA processing factor 4B (Prp4B) and p53 mutations have been reported as hallmarks of cancer cells. Western blot analysis revealed that curcumin treatment activated caspase-3 and decreased expression of p53 and Prp4B in a time-dependent manner. Transfection of HCT-15 cells with Prp4B clone perturbed the growth inhibition induced by 30 μM curcumin. Fractionation of cells revealed increased accumulation of Prp4B in the nucleus, following its translocation from the cytoplasm. To further evaluate the underlying mechanism and survival effect of Prp4B, we generated siRNA-Prp4B HCT15 clones. Knockdown of Prp4B with siRNA diminished the protective effects of Prp4B against curcumin-induced apoptosis. These results suggest a possible underlying molecular mechanism in which Prp4B over-expression and activity are closely associated with the survival and regulation of apoptotic events in human colon cancer HCT-15 cells. PMID:23686430

The Tomato Hybrid Proline-Rich Protein regulates the abcission zone competence to respond to ethylene signals

USDA-ARS?s Scientific Manuscript database

The Tomato Hybrid Proline-Rich Protein (THyPRP) gene was specifically expressed in the tomato (Solanum lycopersicum) flower abscission zone (FAZ), and its stable antisense silencing under the control of an abscission zone (AZ)-specific promoter, Tomato Abscission Polygalacturonase4,significantly inh...

Unique inflammatory RNA profiles of microglia in Creutzfeldt-Jakob disease

NASA Astrophysics Data System (ADS)

Baker, Christopher A.; Manuelidis, Laura

2003-01-01

Previous studies in Creutzfeldt-Jakob disease (CJD) have shown that myeloid cells in the periphery as well as derivative microglial cells in the brain are infectious. Microglia can show an activated phenotype before prion protein (PrP) pathology is detectable in brain, and isolated infectious microglia contain very little PrP. To find whether a set of inflammatory genes are significantly induced or suppressed with infection, we analyzed RNA from isolated microglia with relevant cDNA arrays, and identified 30 transcripts not previously examined in any transmissible spongiform encephalopathy. This CJD expression profile contrasted with that of uninfected microglia exposed to prototypic inflammatory stimuli such as lipopolysaccharide and IFN-, as well as PrP amyloid. These findings underscore inflammatory pathways evoked by the infectious agent in brain. Transcript profiles unique for CJD microglia and other myeloid cells provide opportunities for more sensitive preclinical diagnoses of infectious and noninfectious neurodegenerative diseases.

Effects of pulsed electromagnetic fields and platelet rich plasma in preventing osteoclastogenesis in an in vitro model of osteolysis.

PubMed

Tschon, Matilde; Veronesi, Francesca; Contartese, Deyanira; Sartori, Maria; Martini, Lucia; Vincenzi, Fabrizio; Ravani, Annalisa; Varani, Katia; Fini, Milena

2018-03-01

Osteolysis is the main limiting cause for the survival of an orthopedic prosthesis and is accompanied by an enhancement in osteoclastogenesis and inflammation, due by wear debris formation. Unfortunately therapeutic treatments, besides revision surgery, are not available. The aim of the present study was to evaluate the effects of Pulsed Electro Magnetic Fields (PEMFs) and platelet rich plasma (PRP), alone or in combination, in an in vitro model of osteolysis. Rats peripheral blood mononuclear cells were cultured on Ultra High Molecular Weight Polyethylene particles and divided into four groups of treatments: (1) PEMF stimulation (12 hr/day, 2.5 mT, 75 Hz, 1.3 ms pulse duration); (2) 10% PRP; (3) combination of PEMFs, and PRP; (4) no treatment. Treatments were performed for 3 days and cell viability, osteoclast number, expression of genes related to osteoclastogenesis and inflammation and production of pro-inflammatory cytokines were assessed up to 14 days. PEMF stimulation exerted best results because it increased cell viability at early time points and counteracted osteoclastogenesis at 14 days. On the contrary, PRP increased osteoclastogenesis and reduced cell viability in comparison to PEMFs alone. The combination of PEMFs and PRP increased cell viability over time and reduced osteoclastogenesis in comparison to PRP alone. However, these positive results did not exceed the level achieved by PEMF alone. At longer time points PEMF could not counteract osteoclastogenesis increased by PRP. Regarding inflammation, all treatments maintained the production of pro-inflammatory cytokines at low level, although PRP increased the level of interleukin 1 beta. © 2017 Wiley Periodicals, Inc.

CD36 Participates in PrP106–126-Induced Activation of Microglia

PubMed Central

Tan, Rongrong; Shi, Fushan; Lu, Yun; Zhang, Siming; Yin, Xiaomin; Zhou, Xiangmei; Zhao, Deming

2012-01-01

Microglial activation is a characteristic feature of the pathogenesis of prion diseases. The molecular mechanisms that underlie prion-induced microglial activation are not very well understood. In the present study, we investigated the role of the class B scavenger receptor CD36 in microglial activation induced by neurotoxic prion protein (PrP) fragment 106–126 (PrP106–126). We first examined the time course of CD36 mRNA expression upon exposure to PrP106–126 in BV2 microglia. We then analyzed different parameters of microglial activation in PrP106–126-treated cells in the presence or not of anti-CD36 monoclonal antibody (mAb). The cells were first incubated for 1 h with CD36 monoclonal antibody to block the CD36 receptor, and were then treated with neurotoxic prion peptides PrP106–126. The results showed that PrP106–126 treatment led to a rapid yet transitory increase in the mRNA expression of CD36, upregulated mRNA and protein levels of proinflammatory cytokines (IL-1β, IL-6 and TNF-α), increased iNOS expression and nitric oxide (NO) production, stimulated the activation of NF-κB and caspase-1, and elevated Fyn activity. The blockade of CD36 had no effect on PrP106–126-stimulated NF-κB activation and TNF-α protein release, abrogated the PrP106–126-induced iNOS stimulation, downregulated IL-1β and IL-6 expression at both mRNA and protein levels as well as TNF-α mRNA expression, decreased NO production and Fyn phosphorylation, reduced caspase-1 cleavage induced by moderate PrP106–126 –treatment, but had no effect on caspase-1 activation after treatment with a high concentration of PrP106–126. Together, these results suggest that CD36 is involved in PrP106–126-induced microglial activation and that the participation of CD36 in the interaction between PrP106–126 and microglia may be mediated by Src tyrosine kinases. Our findings provide new insights into the mechanisms underlying the activation of microglia by neurotoxic prion peptides and open perspectives for new therapeutic strategies for prion diseases by modulation of CD36 signaling. PMID:22292032

Polymorphism analysis of prion protein gene in 11 Pakistani goat breeds

PubMed Central

Hassan, Mohammad Farooque; Khan, Sher Hayat; Babar, Masroor Ellahi; Yang, Lifeng; Ali, Tariq; Khan, Jamal Muhammad; Shah, Syed Zahid Ali; Zhou, Xiangmei; Hussain, Tanveer; Zhu, Ting; Hussain, Tariq; Zhao, Deming

2016-01-01

ABSTRACT The association between caprine PrP gene polymorphisms and its susceptibility to scrapie has been investigated in current years. As the ORF of the PrP gene is extremely erratic in different breeds of goats, we studied the PrP gene polymorphisms in 80 goats which belong to 11 Pakistani indigenous goat breeds from all provinces of Pakistan. A total of 6 distinct polymorphic sites (one novel) with amino acid substitutions were identified in the PrP gene which includes 126 (A -> G), 304 (G -> T), 379 (A -> G), 414 (C -> T), 428 (A -> G) and 718 (C -> T). The locus c.428 was found highly polymorphic in all breeds as compare to other loci. On the basis of these PrP variants NJ phylogenetic tree was constructed through MEGA6.1 which showed that all goat breeds along with domestic sheep and Mauflon sheep appeared as in one clade and sharing its most recent common ancestors (MRCA) with deer species while Protein analysis has shown that these polymorphisms can lead to varied primary, secondary and tertiary structure of protein. Based on these polymorphic variants, genetic distance, multidimensional scaling plot and principal component analyses revealed the clear picture regarding greater number of substitutions in cattle PrP regions as compared to the small ruminant species. In particular these findings may pinpoint the fundamental control over the scrapie in Capra hircus on genetic basis. PMID:27388702

Cellular Prion Protein Combined with Galectin-3 and -6 Affects the Infectivity Titer of an Endogenous Retrovirus Assayed in Hippocampal Neuronal Cells

PubMed Central

Shin, Hae-Young; Goto, Joy J.; Carp, Richard I.; Choi, Eun-Kyoung; Kim, Yong-Sun

2016-01-01

Prion diseases are infectious and fatal neurodegenerative diseases which require the cellular prion protein, PrPC, for development of diseases. The current study shows that the PrPC augments infectivity and plaque formation of a mouse endogenous retrovirus, MuLV. We have established four neuronal cell lines expressing mouse PrPC, PrP+/+; two express wild type PrPC (MoPrPwild) and the other two express mutant PrPC (MoPrPmut). Infection of neuronal cells from various PrP+/+ and PrP-/- (MoPrPKO) lines with MuLV yielded at least three times as many plaques in PrP+/+ than in PrP-/-. Furthermore, among the four PrP+/+ lines, one mutant line, P101L, had at least 2.5 times as many plaques as the other three PrP+/+ lines. Plaques in P101L were four times larger than those in other PrP+/+ lines. Colocalization of PrP and CAgag was seen in MuLV-infected PrP+/+ cells. In the PrP-MuLV interaction, the involvement of galectin-3 and -6 was observed by immunoprecipitation with antibody to PrPC. These results suggest that PrPC combined with galectin-3 and -6 can act as a receptor for MuLV. P101L, the disease form of mutant PrPC results suggest the genetic mutant form of PrPC may be more susceptible to viral infection. PMID:27936017

Increased infectivity of anchorless mouse scrapie prions in transgenic mice overexpressing human prion protein.

PubMed

Race, Brent; Phillips, Katie; Meade-White, Kimberly; Striebel, James; Chesebro, Bruce

2015-06-01

Prion protein (PrP) is found in all mammals, mostly as a glycoprotein anchored to the plasma membrane by a C-terminal glycosylphosphatidylinositol (GPI) linkage. Following prion infection, host protease-sensitive prion protein (PrPsen or PrPC) is converted into an abnormal, disease-associated, protease-resistant form (PrPres). Biochemical characteristics, such as the PrP amino acid sequence, and posttranslational modifications, such as glycosylation and GPI anchoring, can affect the transmissibility of prions as well as the biochemical properties of the PrPres generated. Previous in vivo studies on the effects of GPI anchoring on prion infectivity have not examined cross-species transmission. In this study, we tested the effect of lack of GPI anchoring on a species barrier model using mice expressing human PrP. In this model, anchorless 22L prions derived from tg44 mice were more infectious than 22L prions derived from C57BL/10 mice when tested in tg66 transgenic mice, which expressed wild-type anchored human PrP at 8- to 16-fold above normal. Thus, the lack of the GPI anchor on the PrPres from tg44 mice appeared to reduce the effect of the mouse-human PrP species barrier. In contrast, neither source of prions induced disease in tgRM transgenic mice, which expressed human PrP at 2- to 4-fold above normal. Prion protein (PrP) is found in all mammals, usually attached to cells by an anchor molecule called GPI. Following prion infection, PrP is converted into a disease-associated form (PrPres). While most prion diseases are species specific, this finding is not consistent, and species barriers differ in strength. The amino acid sequence of PrP varies among species, and this variability affects prion species barriers. However, other PrP modifications, including glycosylation and GPI anchoring, may also influence cross-species infectivity. We studied the effect of PrP GPI anchoring using a mouse-to-human species barrier model. Experiments showed that prions produced by mice expressing only anchorless PrP were more infectious than prions produced in mice expressing anchored PrP. Thus, the lack of the GPI anchor on prions reduced the effect of the mouse-human species barrier. Our results suggest that prion diseases that produce higher levels of anchorless PrP may pose an increased risk for cross-species infection. Copyright © 2015, American Society for Microbiology. All Rights Reserved.

Platelet rich plasma promotes skeletal muscle cell migration in association with up-regulation of FAK, paxillin, and F-Actin formation.

PubMed

Tsai, Wen-Chung; Yu, Tung-Yang; Lin, Li-Ping; Lin, Mioa-Sui; Tsai, Ting-Ta; Pang, Jong-Hwei S

2017-11-01

Platelet rich plasma (PRP) contains various cytokines and growth factors which may be beneficial to the healing process of injured muscle. The aim of this study was to investigate the effect and molecular mechanism of PRP on migration of skeletal muscle cells. Skeletal muscle cells intrinsic to Sprague-Dawley rats were treated with PRP. The cell migration was evaluated by transwell filter migration assay and electric cell-substrate impedance sensing. The spreading of cells was evaluated microscopically. The formation of filamentous actin (F-actin) cytoskeleton was assessed by immunofluorescence staining. The protein expressions of paxillin and focal adhesion kinase (FAK) were assessed by Western blot analysis. Transfection of paxillin small-interfering RNA (siRNAs) to muscle cells was performed to validate the role of paxillin in PRP-mediated promotion of cell migration. Dose-dependently PRP promotes migration of and spreading and muscle cells. Protein expressions of paxillin and FAK were up-regulated dose-dependently. F-actin formation was also enhanced by PRP treatment. Furthermore, the knockdown of paxillin expression impaired the effect of PRP to promote cell migration. It was concluded that PRP promoting migration of muscle cells is associated with up-regulation of proteins expression of paxillin and FAK as well as increasing F-actin formation. © 2017 Orthopaedic Research Society. Published by Wiley Periodicals, Inc. J Orthop Res 35:2506-2512, 2017. © 2017 Orthopaedic Research Society. Published by Wiley Periodicals, Inc.

Inherited prion disease A117V is not simply a proteinopathy but produces prions transmissible to transgenic mice expressing homologous prion protein.

PubMed

Asante, Emmanuel A; Linehan, Jacqueline M; Smidak, Michelle; Tomlinson, Andrew; Grimshaw, Andrew; Jeelani, Asif; Jakubcova, Tatiana; Hamdan, Shyma; Powell, Caroline; Brandner, Sebastian; Wadsworth, Jonathan D F; Collinge, John

2013-01-01

Prions are infectious agents causing fatal neurodegenerative diseases of humans and animals. In humans, these have sporadic, acquired and inherited aetiologies. The inherited prion diseases are caused by one of over 30 coding mutations in the human prion protein (PrP) gene (PRNP) and many of these generate infectious prions as evidenced by their experimental transmissibility by inoculation to laboratory animals. However, some, and in particular an extensively studied type of Gerstmann-Sträussler-Scheinker syndrome (GSS) caused by a PRNP A117V mutation, are thought not to generate infectious prions and instead constitute prion proteinopathies with a quite distinct pathogenetic mechanism. Multiple attempts to transmit A117V GSS have been unsuccessful and typical protease-resistant PrP (PrP(Sc)), pathognomonic of prion disease, is not detected in brain. Pathogenesis is instead attributed to production of an aberrant topological form of PrP, C-terminal transmembrane PrP ((Ctm)PrP). Barriers to transmission of prion strains from one species to another appear to relate to structural compatibility of PrP in host and inoculum and we have therefore produced transgenic mice expressing human 117V PrP. We found that brain tissue from GSS A117V patients did transmit disease to these mice and both the neuropathological features of prion disease and presence of PrP(Sc) was demonstrated in the brains of recipient transgenic mice. This PrP(Sc) rapidly degraded during laboratory analysis, suggesting that the difficulty in its detection in patients with GSS A117V could relate to post-mortem proteolysis. We conclude that GSS A117V is indeed a prion disease although the relative contributions of (Ctm)PrP and prion propagation in neurodegeneration and their pathogenetic interaction remains to be established.

The synergistic effect of TiO2 nanoporous modification and platelet-rich plasma treatment on titanium-implant stability in ovariectomized rats.

PubMed

Jiang, Nan; Du, Pinggong; Qu, Weidong; Li, Lin; Liu, Zhonghao; Zhu, Songsong

For several decades, titanium and its alloys have been commonly utilized for endosseous implantable materials, because of their good mechanical properties, chemical resistance, and biocompatibility. But associated low bone mass, wear and loss characteristics, and high coefficients of friction have limited their long-term stable performance, especially in certain abnormal bone-metabolism conditions, such as postmenopausal osteoporosis. In this study, we investigated the effects of platelet-rich plasma (PRP) treatment and TiO 2 nanoporous modification on the stability of titanium implants in osteoporotic bone. After surface morphology, topographical structure, and chemical changes of implant surface had been detected by scanning electron microscopy (SEM), atomic force microscopy, contact-angle measurement, and X-ray diffraction, we firstly assessed in vivo the effect of PRP treatment on osseointegration of TiO 2 -modified implants in ovariectomized rats by microcomputed tomography examinations, histology, biomechanical testing, and SEM observation. Meanwhile, the potential molecular mechanism involved in peri-implant osseous enhancement was also determined by quantitative real-time polymerase chain reaction. The results showed that this TiO 2 -modified surface was able to lead to improve bone implant contact, while PRP treatment was able to increase the implant surrounding bone mass. The synergistic effect of both was able to enhance the terminal force of implants drastically in biomechanical testing. Compared with surface modification, PRP treatment promoted earlier osteogenesis with increased expression of the RUNX2 and COL1 genes and suppressed osteoclastogenesis with increased expression of OPG and decreased levels of RANKL. These promising results show that PRP treatment combined with a TiO 2 -nanomodified surface can improve titanium-implant biomechanical stability in ovariectomized rats, suggesting a beneficial effect to support the success of implants in osteoporotic bone.

The synergistic effect of TiO2 nanoporous modification and platelet-rich plasma treatment on titanium-implant stability in ovariectomized rats

PubMed Central

Jiang, Nan; Du, Pinggong; Qu, Weidong; Li, Lin; Liu, Zhonghao; Zhu, Songsong

2016-01-01

For several decades, titanium and its alloys have been commonly utilized for endosseous implantable materials, because of their good mechanical properties, chemical resistance, and biocompatibility. But associated low bone mass, wear and loss characteristics, and high coefficients of friction have limited their long-term stable performance, especially in certain abnormal bone-metabolism conditions, such as postmenopausal osteoporosis. In this study, we investigated the effects of platelet-rich plasma (PRP) treatment and TiO2 nanoporous modification on the stability of titanium implants in osteoporotic bone. After surface morphology, topographical structure, and chemical changes of implant surface had been detected by scanning electron microscopy (SEM), atomic force microscopy, contact-angle measurement, and X-ray diffraction, we firstly assessed in vivo the effect of PRP treatment on osseointegration of TiO2-modified implants in ovariectomized rats by microcomputed tomography examinations, histology, biomechanical testing, and SEM observation. Meanwhile, the potential molecular mechanism involved in peri-implant osseous enhancement was also determined by quantitative real-time polymerase chain reaction. The results showed that this TiO2-modified surface was able to lead to improve bone implant contact, while PRP treatment was able to increase the implant surrounding bone mass. The synergistic effect of both was able to enhance the terminal force of implants drastically in biomechanical testing. Compared with surface modification, PRP treatment promoted earlier osteogenesis with increased expression of the RUNX2 and COL1 genes and suppressed osteoclastogenesis with increased expression of OPG and decreased levels of RANKL. These promising results show that PRP treatment combined with a TiO2-nanomodified surface can improve titanium-implant biomechanical stability in ovariectomized rats, suggesting a beneficial effect to support the success of implants in osteoporotic bone. PMID:27695328

Water deficit modulates gene expression in growing zones of soybean seedlings. Analysis of differentially expressed cDNAs, a new beta-tubulin gene, and expression of genes encoding cell wall proteins.

PubMed

Creelman, R A; Mullet, J E

1991-10-01

Transfer of soybean seedlings to low-water-potential vermiculite (psi w = -0.3 MPa) results in a reversible decrease in hypocotyl growth and modulation of several polysomal mRNAs (Plant Physiol 92: 205-214). We report here the isolation of two cDNA clones (pGE16 and pGE95) which correspond to genes whose mRNA levels are increased, and one cDNA clone (pGE23) which corresponds to a gene whose mRNA level is decreased in the hypocotyl zone of cell elongation by water deficit. In well-watered seedlings mRNAs hybridizing to pGE16 and pGE95 are most abundant in mature regions of the seedling, but in water-deficient seedlings mRNA levels are reduced in mature regions and enhanced in elongating regions. RNA corresponding to soybean proline-rich protein 1 (sbPRP1) shows a similar tissue distribution and response to water deficit. In contrast, in well-watered seedlings, the gene corresponding to pGE23 was highly expressed in the hypocotyl and root growing zones. Transfer of seedlings to low-water-potential vermiculite caused a rapid decrease in mRNA hybridizing to pGE23. Sequence analysis revealed that pGE23 has high homology with beta-tubulin. Water deficit also reduced the level of mRNA hybridizing to JCW1, an auxin-modulated gene, although with different kinetics. Furthermore, mRNA encoding actin, glycine-rich proteins (GRPs), and hydroxyproline-rich glycoproteins (HRGPs) were down-regulated in the hypocotyl zone of elongation of seedlings exposed to water deficit. No effect of water deficit was observed on the expression of chalcone synthase. Decreased expression of beta-tubulin, actin, JCW1, HRGP and GRP and increased expression of sbPRP1, pGE95 and pGE16 in the hypocotyl zone of cell elongation could participate in the reversible growth inhibition observed in water-deficient soybean seedlings.

Platelet-rich plasma loaded in situ-formed hydrogel enhances hyaline cartilage regeneration by CB1 upregulation.

PubMed

Lee, Hye-Rim; Park, Kyung Min; Joung, Yoon Ki; Park, Ki Dong; Do, Sun Hee

2012-11-01

The efficacy of three-dimensional (3D) culture on the proliferation and maturation of chondrocytes seeded into a hydrogel scaffold was assessed. Three types of hydrogel were prepared for the 3D culture of primary isolated chondrocytes. Chondrocyte proliferation was assessed using a live/dead viability/cytotoxicity assay and semiquantitative RT-PCR after 3D culture in hydrogel. Cylindrical defects in the center of rat xyphoids were used for the implantation of platelet-rich plasma (PRP)/hydrogel composites. Rats were killed at day 7 postoperatively and evaluated histochemically and immunohistologically. Xyphoid chondrocytes proliferated well with time in hydrogels. In the PRP-containing hydrogels, xyphoid defects displayed early formation of chondroid matrix with massive peripheral infiltration of spindle cells. These results were consistent with Safranin-O staining for proteoglycans and immunohistochemistry for type II collagen. Gene expression analyses in vitro revealed aggrecan, type II collagen, and ChM-1 and CB1 upregulation by PRP/hydrogel. PRP/hydrogel provided a suitable environment for hyaline cartilaginous regeneration, leading to anti-inflammation by significant increase of CB1 and inhibiting vascular ingrowth via considerable upregulation of ChM-1. The results provide a valuable reference for the clinical application of hydrogel scaffolds for hyaline cartilage regeneration, as well as the use of autologous PRP to improve cellular proliferation and maturation of xyphoid repair. Copyright © 2012 Wiley Periodicals, Inc.

Cloning, tissue distribution and effects of fasting on pituitary adenylate cyclase-activating polypeptide in largemouth bass

NASA Astrophysics Data System (ADS)

Li, Shengjie; Han, Linqiang; Bai, Junjie; Ma, Dongmei; Quan, Yingchun; Fan, Jiajia; Jiang, Peng; Yu, Lingyun

2015-03-01

Pituitary adenylate cyclase activating polypeptide (PACAP) has a wide range of biological functions. We cloned the full-length cDNAs encoding PACAP and PACAP-related peptide (PRP) from the brain of largemouth bass ( Micropterus salmoides) and used real-time quantitative PCR to detect PRP-PACAP mRNA expression. The PRP-PACAP cDNA has two variants expressed via alternative splicing: a long form, which encodes both PRP and PACAP, and a short form, which encodes only PACAP. Sequence analysis results are consistent with a higher conservation of PACAP than PRP peptide sequences. The expression of PACAP-long and PACAP-short transcripts was highest in the forebrain, followed by the medulla, midbrain, pituitary, stomach, cerebellum, intestine, and kidney; however, these transcripts were either absent or were weakly expressed in the muscle, spleen, gill, heart, fatty tissue, and liver. The level of PACAP-short transcript expression was significantly higher than expression of the long transcript in the forebrain, cerebella, pituitary and intestine, but lower than that of the long transcript in the stomach. PACAP-long and PACAP-short transcripts were first detected at the blastula stage of embryogenesis, and the level of expression increased markedly between the muscular contraction stage and 3 d post hatch (dph). The expression of PACAP-long and PACAP-short transcripts decreased significantly in the brain following 4 d fasting compared with the control diet group. The down-regulation effect was enhanced as fasting continued. Conversely, expression levels increased significantly after 3 d of re-feeding. Our results suggest that PRP-PACAP acts as an important factor in appetite regulation in largemouth bass.

Transmission Characteristics of Variably Protease-Sensitive Prionopathy

PubMed Central

Notari, Silvio; Xiao, Xiangzhu; Espinosa, Juan Carlos; Cohen, Yvonne; Qing, Liuting; Aguilar-Calvo, Patricia; Kofskey, Diane; Cali, Ignazio; Cracco, Laura; Kong, Qingzhong; Torres, Juan Maria

2014-01-01

Variably protease-sensitive prionopathy (VPSPr), a recently identified and seemingly sporadic human prion disease, is distinct from Creutzfeldt-Jakob disease (CJD) but shares features of Gerstmann-Sträussler-Scheinker disease (GSS). However, contrary to exclusively inherited GSS, no prion protein (PrP) gene variations have been detected in VPSPr, suggesting that VPSPr might be the long-sought sporadic form of GSS. The VPSPr atypical features raised the issue of transmissibility, a prototypical property of prion diseases. We inoculated VPSPr brain homogenate into transgenic mice expressing various levels of human PrP (PrPC). On first passage, 54% of challenged mice showed histopathologic lesions, and 34% harbored abnormal PrP similar to that of VPSPr. Surprisingly, no prion disease was detected on second passage. We concluded that VPSPr is transmissible; thus, it is an authentic prion disease. However, we speculate that normal human PrPC is not an efficient conversion substrate (or mouse brain not a favorable environment) and therefore cannot sustain replication beyond the first passage. PMID:25418590

Differential expression of isoproterenol-induced salivary polypeptides in two mouse strains that are congenic for the H-2 histocompatibility gene complex.

PubMed

López Solís, Remigio O; Weis, Ulrike Kemmerling; Ceballos, Alicia Ramos; Salas, Gustavo Hoecker

2003-12-01

Two inbred mouse strains, A/Snell and A.Swiss, which were produced as congenic with regard to the H-2 histocompatibility gene complex, are homozygous for two different groups of isoproterenol-induced salivary polypeptides (IISP). These polypeptides, which have been considered as markers of the hypertrophic growth of the parotid acinar cells, are members of the complex family of salivary proline-rich proteins (PRP) on the basis of both their massive accumulation in the parotid acinar cells in response to chronic isoproterenol, secretory character, high solubility in trichloroacetic acid and metachromatic staining by Coomassie blue. IISP expressed in both mouse strains were identified by unidimensional SDS-polyacrylamide electrophoresis and Coomassie blue staining both in parotid gland homogenates and in whole salivas obtained from mice repeatedly stimulated at 24-h intervals with isoproterenol. Parotid glands from 40 mice (20 A/Snell and 20 A.Swiss) and salivas from 270 mice (200 A/Snell and 70 A.Swiss) were analyzed. One of the congenic strains (A/Snell) expressed five IISP (Mr 65, 61, 51.5, 38, and 37 kDa) and the other strain (A.Swiss) expressed six IISP (Mr 59, 57, 54.5, 46, 36, and 34 kDa). No inter-individual intra-strain variations were observed, thus defining strain-associated patterns of IISP (PRP). Copyright 2003 Wiley-Liss, Inc.

Markedly Increased Susceptibility to Natural Sheep Scrapie of Transgenic Mice Expressing Ovine PrP

PubMed Central

Vilotte, Jean-Luc; Soulier, Solange; Essalmani, Rachid; Stinnakre, Marie-George; Vaiman, Daniel; Lepourry, Laurence; Da Silva, Jose Costa; Besnard, Nathalie; Dawson, Mike; Buschmann, Anne; Groschup, Martin; Petit, Stephanie; Madelaine, Marie-Francoise; Rakatobe, Sabine; Le Dur, Annick; Vilette, Didier; Laude, Hubert

2001-01-01

The susceptibility of sheep to scrapie is known to involve, as a major determinant, the nature of the prion protein (PrP) allele, with the VRQ allele conferring the highest susceptibility to the disease. Transgenic mice expressing in their brains three different ovine PrPVRQ-encoding transgenes under an endogenous PrP-deficient genetic background were established. Nine transgenic (tgOv) lines were selected and challenged with two scrapie field isolates derived from VRQ-homozygous affected sheep. All inoculated mice developed neurological signs associated with a transmissible spongiform encephalopathy (TSE) disease and accumulated a protease-resistant form of PrP (PrPres) in their brains. The incubation duration appeared to be inversely related to the PrP steady-state level in the brain, irrespective of the transgene construct. The survival time for animals from the line expressing the highest level of PrP was reduced by at least 1 year compared to those of two groups of conventional mice. With one isolate, the duration of incubation was as short as 2 months, which is comparable to that observed for the rodent TSE models with the briefest survival times. No survival time reduction was observed upon subpassaging of either isolate, suggesting no need for adaptation of the agent to its new host. Overexpression of the transgene was found not to be required for transmission to be accelerated compared to that observed with wild-type mice. Conversely, transgenic mice overexpressing murine PrP were found to be less susceptible than tgOv lines expressing ovine PrP at physiological levels. These data argue that ovine PrPVRQ provided a better substrate for sheep prion replication than did mouse PrP. Altogether, these tgOv mice could be an improved model for experimental studies on natural sheep scrapie. PMID:11390599

In vitro effects of platelet-rich gel supernatants on histology and chondrocyte apoptosis scores, hyaluronan release and gene expression of equine cartilage explants challenged with lipopolysaccharide.

PubMed

Carmona, Jorge U; Ríos, Diana L; López, Catalina; Álvarez, María E; Pérez, Jorge E; Bohórquez, Mabel E

2016-07-01

Platelet-rich plasma (PRP) preparations are a common treatment in equine osteoarthritis (OA). However, there are controversies regarding the ideal concentration of platelets and leukocytes in these biological substances necessary to induce an adequate anti-inflammatory and anabolic response in articular cartilage. The aims were to study the influence of leukocyte- and platelet-rich gel (L-PRG) and pure platelet-rich gel (P-PRG) supernatants on the histological changes of cartilage, the degree of chondrocyte apoptosis, the production of hyaluronan (HA) and the gene expression of nuclear factor kappa beta (NFkβ), matrix metalloproteinase 13 (MMP-13), a disintegrin and metalloproteinase with thrombospondin motifs 4 (ADAMTS-4), collagen type I alpha 1 (COL1A1), collagen type II alpha 1 (COL2A1) and cartilage oligomeric matrix protein (COMP) in normal cartilage explants (CEs) challenged with lipopolysaccharide (LPS). Overall, 25 % L-PRG supernatant (followed in order of importance by, 50 % P-PRG, 25 % P-PRG and 50 % L-PRG) represented the substance with the most important anti-inflammatory and anabolic effect. 25 % P-PRG supernatant presented important anabolic effects, but it induced a more severe chondrocyte apoptosis than the other evaluated substances. 25 % L-PRG supernatant presented the best therapeutic profile. Our results demonstrate that the biological variability of PRP preparations makes their application rather challenging. Additional in vivo research is necessary to know the effect of PRP preparations at different concentrations.

Effect of autologous platelet-rich plasma on the chondrogenic differentiation of rabbit adipose-derived stem cells in vitro

PubMed Central

TANG, XIAO-BO; DONG, PEI-LONG; WANG, JIAN; ZHOU, HAI-YANG; ZHANG, HAI-XIANG; WANG, SHAN-ZHENG

2015-01-01

This study aimed to isolate rabbit adipose-derived stem cells (ADSCs) and explore the potential of platelet-rich plasma (PRP) in the chondrogenic differentiation of ADSCs, thereby potentially providing a new approach for the repair and regeneration of cartilage injury. Rabbit ADSCs were isolated and characterized by induction towards adipogenic, osteogenic and chondrogenic lineages in vitro. The isolated ADSCs were also cultured with or without 10% PRP. Immunofluorescence staining, toluidine blue staining and reverse transcription-quantitative polymerase chain reaction (RT-qPCR) were used to detect type II collagen (Col II) and aggrecan (AGC) expression. Col II immunofluorescence staining and toluidine blue staining indicated that following induction by autologous PRP, ADSCs manifested Col II and AGC expression. The expression of Col II and AGC mRNA was significantly upregulated in the PRP-treated cells when compared with that in control cells. Autologous PRP produced by laboratory centrifugation was able to promote the chondrogenic differentiation of rabbit ADSCs in vitro. PMID:26622340

Close Vicinity of PrP Expressing Cells (FDC) with Noradrenergic Fibers in Healthy Sheep Spleen

PubMed Central

Lezmi, S.; Hunsmann, G.; Baron, T.

2001-01-01

In naturally and experimentally occurring scrapie in sheep, prions invade the immune system and replicate in lymphoid organs. Here we analysed immunohistochemically, in seven spleens of 6-month-old healthy sheep, the nature of the cells expressing prion protein (PrP) potentially supporting prion replication, as well as their relationship with autonomic innervation. PrP was identified using either RB1 rabbit antiserum or 4F2 monoclonal antibody directed against AA 108–123 portion of the bovine and AA 79–92 of human prion protein respectively. Using double labelling analysis, we demonstrated that PrPc is expressed by follicular dendritic cells using a specific monoclonal antibody (CNA42). We also showed the close vicinity of these PrP expressing cells with noradrenergic fibers, using a polyclonal tyrosine hydroxylase antibody. Our results may help the study of the cellular requirements for the possible neuroinvasion from the spleen. PMID:11785673

Could single nucleotide polymorphisms influence on the efficacy of platelet-rich plasma in the treatment of sport injuries?

PubMed Central

Pruna, Ricard; Til, Lluis; Artells, Rosa

2014-01-01

Summary Platelet-rich plasma (PRP) is a new powerful biological tool in sports medicine, when used to treat tendon, ligament and muscle injuries. PRP is a fraction of autologous whole blood containing an increased number of platelets and a wide variety of cytokines that can improve and accelerate the healing of various tissues. An analysis of the literature shows promising pre-clinical results for PRP treatment, but there is a lack of solid clinical proof to support its use in sports medicine, and in fact, clinical findings on individual responses to PRP treatment are contradictory. These contradictions may be due to interindividual differences in the presence of single nucleotide polymorphisms (SNPs) in genes related to PRPs and/or their receptors. These SNPs can determine a greater or lesser response to this treatment and consequently a shorter or longer recovery time. We have focused our attention in the study of genes related to PRP with the aim to develope a genetic profile that will identify the individuals and injuries most likely to benefit from PRP treatment. PMID:24932449

Combination of herbal extracts and platelet-rich plasma induced dermal papilla cell proliferation: involvement of ERK and Akt pathways.

PubMed

Rastegar, Hosein; Ahmadi Ashtiani, Hamidreza; Aghaei, Mahmoud; Ehsani, Amirohushang; Barikbin, Behrooz

2013-06-01

Recently, platelet-rich plasma (PRP) has attracted attention in various medical fields, including plastic surgery, treatment for problematic wounds, and dermatology. Specifically, PRP has been tested during hair transplantation to reduce swelling and pain and to increase hair density. We examined the effects of PRP and herbal extracts combination in order to identify potential stimulants of hair growth. PRP was prepared using the double-spin method and applied to dermal papilla cells (DPCs). MTT viability test and BrdU cell proliferation assay were used to study the effect of herbal extracts and PRP on proliferation of DPCs. To understand the mechanisms of herbal extracts and PRP involved in the regulation of hair growth, we evaluated signaling pathways and measured the expressions of ERK and Akt, by Western blot. Combination of herbal extracts and PRP was found to induce significant proliferation of human DPCs at concentrations ranging from 1.5% to 4.5%. The present study shows that herbal extracts and PRP affect the expressions of extracellular signal-regulated kinase (ERK) and Akt in DPCs. In this study, we have shown that combination of herbal extracts and PRP plays an active role in promoting the proliferation of human dermal papilla (DP) cells via the regulation of ERK and Akt proteins, and this may be applicable to the future development of herbal extracts and PRP combination therapeutics to enhance hair growth. © 2013 Wiley Periodicals, Inc.

Propagation of prion strains through specific conformers of the prion protein.

PubMed Central

Scott, M R; Groth, D; Tatzelt, J; Torchia, M; Tremblay, P; DeArmond, S J; Prusiner, S B

1997-01-01

Two prion strains with identical incubation periods in mice exhibited distinct incubation periods and different neuropathological profiles upon serial transmission to transgenic mice expressing chimeric Syrian hamster/mouse (MH2M) prion protein (PrP) genes [Tg(MH2M) mice] and subsequent transmission to Syrian hamsters. After transmission to Syrian hamsters, the Me7 strain was indistinguishable from the previously established Syrian hamster strain Sc237, despite having been derived from an independent ancestral source. This apparent convergence suggests that prion diversity may be limited. The Me7 mouse strain could also be transmitted directly to Syrian hamsters, but when derived in this way, its properties were distinct from those of Me7 passaged through Tg(MH2M) mice. The Me7 strain did not appear permanently altered in either case, since the original incubation period could be restored by effectively reversing the series of passages. Prion diversity enciphered in the conformation of the scrapie isoform of PrP (PrP(Sc)) (G. C. Telling et al., Science 274:2079-2082, 1996) seems to be limited by the sequence of the PrP substrates serially converted into PrP(Sc), while prions are propagated through interactions between the cellular and scrapie isoforms of PrP. PMID:9371560

The Biological Function of the Prion Protein: A Cell Surface Scaffold of Signaling Modules.

PubMed

Linden, Rafael

2017-01-01

The prion glycoprotein (PrP C ) is mostly located at the cell surface, tethered to the plasma membrane through a glycosyl-phosphatydil inositol (GPI) anchor. Misfolding of PrP C is associated with the transmissible spongiform encephalopathies (TSEs), whereas its normal conformer serves as a receptor for oligomers of the β-amyloid peptide, which play a major role in the pathogenesis of Alzheimer's Disease (AD). PrP C is highly expressed in both the nervous and immune systems, as well as in other organs, but its functions are controversial. Extensive experimental work disclosed multiple physiological roles of PrP C at the molecular, cellular and systemic levels, affecting the homeostasis of copper, neuroprotection, stem cell renewal and memory mechanisms, among others. Often each such process has been heralded as the bona fide function of PrP C , despite restricted attention paid to a selected phenotypic trait, associated with either modulation of gene expression or to the engagement of PrP C with a single ligand. In contrast, the GPI-anchored prion protein was shown to bind several extracellular and transmembrane ligands, which are required to endow that protein with the ability to play various roles in transmembrane signal transduction. In addition, differing sets of those ligands are available in cell type- and context-dependent scenarios. To account for such properties, we proposed that PrP C serves as a dynamic platform for the assembly of signaling modules at the cell surface, with widespread consequences for both physiology and behavior. The current review advances the hypothesis that the biological function of the prion protein is that of a cell surface scaffold protein, based on the striking similarities of its functional properties with those of scaffold proteins involved in the organization of intracellular signal transduction pathways. Those properties are: the ability to recruit spatially restricted sets of binding molecules involved in specific signaling; mediation of the crosstalk of signaling pathways; reciprocal allosteric regulation with binding partners; compartmentalized responses; dependence of signaling properties upon posttranslational modification; and stoichiometric requirements and/or oligomerization-dependent impact on signaling. The scaffold concept may contribute to novel approaches to the development of effective treatments to hitherto incurable neurodegenerative diseases, through informed modulation of prion protein-ligand interactions.

A randomized controlled experimental study of the efficacy of platelet-rich plasma and hyaluronic acid for the prevention of adhesion formation in a rat uterine horn model.

PubMed

Oz, Murat; Cetinkaya, Nilufer; Bas, Sevda; Korkmaz, Elmas; Ozgu, Emre; Terzioglu, Gokay Serdar; Buyukkagnici, Umran; Akbay, Serap; Caydere, Muzaffer; Gungor, Tayfun

2016-09-01

Platelet-rich plasma (PRP) has been known to possess an efficacy in tissue regeneration. The aim of this study was to determine the role of PRP on post-operative adhesion formation in an experimental rat study. Thirty Sprague-Dawley rats were randomly divided into control, hyaluronic acid, and PRP treatment groups and operated on for uterine horn adhesion modeling. Blood was collected to produce a PRP with platelet counts of 688 × 10(3)/μL, and 1 ml of either hyaluronic acid gel or PRP was administered over the standard lesions, while the control group received no medication. The evaluation of post-operative adhesions was done on the 30th post-operative day. The location, extent, type, and tenacity of adhesions as well as total adhesion scores, tissue inflammation, fibrosis and transforming growth factor-1beta (TGF-1β) expressions were evaluated. The total adhesion score was significantly lower in the PRP group (3.2 ± 1.5) compared with the hyaluronic acid (5.0 ± 1.3) and control (8.1 ± 1.7) groups. The extent of the adhesions was significantly lower in the PRP group. There was no significant difference in the type and tenacity of adhesions between the hyaluronic acid and the PRP group. The level of inflammation was significantly higher in the control group than the others, while there was no difference between the PRP and hyaluronic acid groups. TGF-1β expression was significantly lesser in the PRP group than the control and hyaluronic acid groups. PRP is more effective than hyaluronic acid treatment in preventing post-operative adhesion formation in an experimental rat uterine horn adhesion model.

Cell bricks-enriched platelet-rich plasma gel for injectable cartilage engineering - an in vivo experiment in nude mice.

PubMed

Zhu, Jun; Cai, Bolei; Ma, Qin; Chen, Fulin; Wu, Wei

2013-10-01

Clinical application of platelet-rich plasma (PRP)-based injectable tissue engineering is limited by weak mechanical properties and a rapid fibrinolytic rate. We proposed a new strategy, a cell bricks-stabilized PRP injectable system, to engineer and regenerate cartilage with stable morphology and structure in vivo. Chondrocytes from the auricular cartilage of rabbits were isolated and cultured to form cell bricks (fragmented cell sheet) or cell expansions. Fifteen nude mice were divided evenly (n = 5) into cells-PRP (C-P), cell bricks-PRP (CB-P) and cell bricks-cells-PRP (CB-C-P) groups. Cells, cell bricks or a cell bricks/cells mixture were suspended in PRP and were injected subcutaneously in animals. After 8 weeks, all the constructs were replaced by white resilient tissue; however, specimens from the CB-P and CB-C-P groups were well maintained in shape, while the C-P group appeared distorted, with a compressed outline. Histologically, all groups presented lacuna-like structures, glycosaminoglycan-enriched matrices and positive immunostaining of collagen type II. Different from the uniform structure presented in CB-C-P samples, CB-P presented interrupted, island-like chondrogenesis and contracted structure; fibrous interruption was shown in the C-P group. The highest percentage of matrix was presented in CB-C-P samples. Collagen and sGAG quantification confirmed that the CB-C-P constructs had statistically higher amounts than the C-P and CB-P groups; statistical differences were also found among the groups in terms of biomechanical properties and gene expression. We concluded that cell bricks-enriched PRP gel sufficiently enhanced the morphological stability of the constructs, maintained chondrocyte phenotypes and favoured chondrogenesis in vivo, which suggests that such an injectable, completely biological system is a suitable cell carrier for cell-based cartilage repair. Copyright © 2012 John Wiley & Sons, Ltd.

Biologic response of human anterior cruciate ligamentocytes on collagen-patches to platelet-rich plasma formulations with and without leucocytes.

PubMed

Krismer, Anna M; Cabra, Romina S; May, Rahel D; Frauchiger, Daniela A; Kohl, Sandro; Ahmad, Sufian S; Gantenbein, Benjamin

2017-12-01

Due to the poor self-healing capacities of the anterior cruciate ligament, previous primary repair attempts have failed. To enhance biologic healing, platelet rich plasma and collagen scaffold have shown promise in animal models. Platelet rich plasma (PRP) is already used in several clinical applications although outcomes are quite debated. The purpose of this study was to examine the effects of different PRP formulations during 21 days: With leucocytes and pure PRP on human anterior cruciate ligament-derived ligamentocytes grown on collagen patches in 3D cell cultures in vitro. Three experimental groups were formed: 2.5% leucocyte rich PRP, 2.5% pure PRP, 20% leucocyte rich PRP, a negative control, and a positive control. Cell proliferation, cell phenotype on mRNA transcript level, and extracellular matrix production (total collagen and glycosaminoglycan content) were evaluated. DNA content and metabolic cell activity increased significantly in all groups on day 21 compared to day 7, except in the negative control. No changes in extracellular matrix production were detected. Different catabolic genes were induced depending on the concentration of leucocyte rich PRP. PRP with and without leucocytes treated anterior cruciate ligamentocytes significantly increased cell proliferation but not extracellular matrix production. However, the specific activation of different catabolic genes was dependent on the relative content of leucocytes. © 2017 Orthopaedic Research Society. Published by Wiley Periodicals, Inc. J Orthop Res 35:2733-2739, 2017. © 2017 Orthopaedic Research Society. Published by Wiley Periodicals, Inc.

Soluble polymorphic bank vole prion proteins induced by co-expression of quiescin sulfhydryl oxidase in E. coli and their aggregation behaviors.

PubMed

Abskharon, Romany; Dang, Johnny; Elfarash, Ameer; Wang, Zerui; Shen, Pingping; Zou, Lewis S; Hassan, Sedky; Wang, Fei; Fujioka, Hisashi; Steyaert, Jan; Mulaj, Mentor; Surewicz, Witold K; Castilla, Joaquín; Wohlkonig, Alexandre; Zou, Wen-Quan

2017-10-04

The infectious prion protein (PrP Sc or prion) is derived from its cellular form (PrP C ) through a conformational transition in animal and human prion diseases. Studies have shown that the interspecies conversion of PrP C to PrP Sc is largely swayed by species barriers, which is mainly deciphered by the sequence and conformation of the proteins among species. However, the bank vole PrP C (BVPrP) is highly susceptible to PrP Sc from different species. Transgenic mice expressing BVPrP with the polymorphic isoleucine (109I) but methionine (109M) at residue 109 spontaneously develop prion disease. To explore the mechanism underlying the unique susceptibility and convertibility, we generated soluble BVPrP by co-expression of BVPrP with Quiescin sulfhydryl oxidase (QSOX) in Escherichia coli. Interestingly, rBVPrP-109M and rBVPrP-109I exhibited distinct seeded aggregation pathways and aggregate morphologies upon seeding of mouse recombinant PrP fibrils, as monitored by thioflavin T fluorescence and electron microscopy. Moreover, they displayed different aggregation behaviors induced by seeding of hamster and mouse prion strains under real-time quaking-induced conversion. Our results suggest that QSOX facilitates the formation of soluble prion protein and provide further evidence that the polymorphism at residue 109 of QSOX-induced BVPrP may be a determinant in mediating its distinct convertibility and susceptibility.

Scaffold-assisted cartilage tissue engineering using infant chondrocytes from human hip cartilage.

PubMed

Kreuz, P C; Gentili, C; Samans, B; Martinelli, D; Krüger, J P; Mittelmeier, W; Endres, M; Cancedda, R; Kaps, C

2013-12-01

Studies about cartilage repair in the hip and infant chondrocytes are rare. The aim of our study was to evaluate the use of infant articular hip chondrocytes for tissue engineering of scaffold-assisted cartilage grafts. Hip cartilage was obtained from five human donors (age 1-10 years). Expanded chondrocytes were cultured in polyglycolic acid (PGA)-fibrin scaffolds. De- and re-differentiation of chondrocytes were assessed by histological staining and gene expression analysis of typical chondrocytic marker genes. In vivo, cartilage matrix formation was assessed by histology after subcutaneous transplantation of chondrocyte-seeded PGA-fibrin scaffolds in immunocompromised mice. The donor tissue was heterogenous showing differentiated articular cartilage and non-differentiated tissue and considerable expression of type I and II collagens. Gene expression analysis showed repression of typical chondrocyte and/or mesenchymal marker genes during cell expansion, while markers were re-induced when expanded cells were cultured in PGA-fibrin scaffolds. Cartilage formation after subcutaneous transplantation of chondrocyte loaded PGA-fibrin scaffolds in nude mice was variable, with grafts showing resorption and host cell infiltration or formation of hyaline cartilage rich in type II collagen. Addition of human platelet rich plasma (PRP) to cartilage grafts resulted robustly in formation of hyaline-like cartilage that showed type II collagen and regions with type X collagen. These results suggest that culture of expanded and/or de-differentiated infant hip cartilage cells in PGA-fibrin scaffolds initiates chondrocyte re-differentiation. The heterogenous donor tissue containing immature chondrocytes bears the risk of cartilage repair failure in vivo, which may be possibly overcome by the addition of PRP. Copyright © 2013 Osteoarthritis Research Society International. Published by Elsevier Ltd. All rights reserved.

Platelet-Rich Plasma Injection in Burn Scar Areas Alleviates Neuropathic Scar Pain

PubMed Central

Huang, Shu-Hung; Wu, Sheng-Hua; Lee, Su-Shin; Lin, Yun-Nan; Chai, Chee-Yin; Lai, Chung-Sheng; Wang, Hui-Min David

2018-01-01

Objective: No effective treatments have yet been developed for burn-induced neuropathic pain. Platelet-rich plasma (PRP) has been reported to ameliorate various types of inflammation pain. However, the effect of PRP on burn-induced neuropathic pain is unclear. Methods: Burn-induced neuropathic pain Sprague-Dawley rat model was confirmed using a mechanical response test 4 weeks after the burn injuries were sustained, following which PRP was injected in the scar area. The rats were divided into four groups (n = 6) as following: Group A, Sham; Group B, Sham + PRP; Group C, Burn; and Group D, Burn + PRP. Four weeks after the PRP injection, the animals were subjected to behavior tests and then sacrificed; specimens were collected for inflammation tests, Masson's trichrome stain and chromosome 10 (PTEN) in the injured skin; and PTEN, phosphorylated mammalian target of rapamycin (p-mTOR), p38, nuclear factor κB (NFκB), chemokine (CC motif) ligand 2 (CCL2), and CCL2 cognate receptor (CCR2) in spinal cord dorsal horns through immunohistochemistry and immunofluorescence staining. Results: PRP significantly alleviated allodynia in burn-induced neuropathic pain 4 weeks after treatment, and PTEN expression in the skin and spinal cord were significantly increased in group D compared with the group C. p-PTEN, p-mTOR, and CCL2 expression in neuron cells; p-p38 and p-NFκB expression in microglia; and p-JNK and p-NFκB activation in spinal astrocytes decreased significantly in the group D compared with the group C. Conclusions: PRP is effective in treating burn-induced neuropathic pain and may be used in clinical practice. PMID:29483815

Horizontal alignment of 5' -> 3' intergene distance segment tropy with respect to the gene as the conserved basis for DNA transcription.

PubMed

Sarin, Hemant

2017-03-01

To study the conserved basis for gene expression in comparative cell types at opposite ends of the cell pressuromodulation spectrum, the lymphatic endothelial cell and the blood microvascular capillary endothelial cell. The mechanism for gene expression is studied in terms of the 5' -> 3' direction paired point tropy quotients ( prpT Q s) and the final 5' -> 3' direction episodic sub-episode block sums split-integrated weighted average-averaged gene overexpression tropy quotient ( esebssiwaagoT Q ). The final 5' -> 3' esebssiwaagoT Q classifies an lymphatic endothelial cell overexpressed gene as a supra-pressuromodulated gene ( esebssiwaagoT Q ≥ 0.25 < 0.75) every time and classifies a blood microvascular capillary endothelial cell overexpressed gene every time as an infra-pressuromodulated gene ( esebssiwaagoT Q < 0.25) (100% sensitivity; 100% specificity). Horizontal alignment of 5' -> 3' intergene distance segment tropy wrt the gene is the basis for DNA transcription in the pressuromodulated state.

Impact of strong selection for the PrP major gene on genetic variability of four French sheep breeds (Open Access publication)

PubMed Central

Palhiere, Isabelle; Brochard, Mickaël; Moazami-Goudarzi, Katayoun; Laloë, Denis; Amigues, Yves; Bed'hom, Bertrand; Neuts, Étienne; Leymarie, Cyril; Pantano, Thais; Cribiu, Edmond Paul; Bibé, Bernard; Verrier, Étienne

2008-01-01

Effective selection on the PrP gene has been implemented since October 2001 in all French sheep breeds. After four years, the ARR "resistant" allele frequency increased by about 35% in young males. The aim of this study was to evaluate the impact of this strong selection on genetic variability. It is focussed on four French sheep breeds and based on the comparison of two groups of 94 animals within each breed: the first group of animals was born before the selection began, and the second, 3–4 years later. Genetic variability was assessed using genealogical and molecular data (29 microsatellite markers). The expected loss of genetic variability on the PrP gene was confirmed. Moreover, among the five markers located in the PrP region, only the three closest ones were affected. The evolution of the number of alleles, heterozygote deficiency within population, expected heterozygosity and the Reynolds distances agreed with the criteria from pedigree and pointed out that neutral genetic variability was not much affected. This trend depended on breed, i.e. on their initial states (population size, PrP frequencies) and on the selection strategies for improving scrapie resistance while carrying out selection for production traits. PMID:18990357

The combined use of kartogenin and platelet-rich plasma promotes fibrocartilage formation in the wounded rat Achilles tendon entheses.

PubMed

Zhang, J; Yuan, T; Zheng, N; Zhou, Y; Hogan, M V; Wang, J H-C

2017-04-01

After an injury, the biological reattachment of tendon to bone is a challenge because healing takes place between a soft (tendon) and a hard (bone) tissue. Even after healing, the transition zone in the enthesis is not completely regenerated, making it susceptible to re-injury. In this study, we aimed to regenerate Achilles tendon entheses (ATEs) in wounded rats using a combination of kartogenin (KGN) and platelet-rich plasma (PRP). Wounds created in rat ATEs were given three different treatments: kartogenin platelet-rich plasma (KGN-PRP); PRP; or saline (control), followed by histological and immunochemical analyses, and mechanical testing of the rat ATEs after three months of healing. Histological analysis showed well organised arrangement of collagen fibres and proteoglycan formation in the wounded ATEs in the KGN-PRP group. Furthermore, immunohistochemical analysis revealed fibrocartilage formation in the KGN-PRP-treated ATEs, evidenced by the presence of both collagen I and II in the healed ATE. Larger positively stained collagen III areas were found in both PRP and saline groups than those in the KGN-PRP group. Chondrocyte-related genes, SOX9 and collagen II, and tenocyte-related genes, collagen I and scleraxis (SCX), were also upregulated by KGN-PRP. Moreover, mechanical testing results showed higher ultimate tensile strength in the KGN-PRP group than in the saline control group. In contrast, PRP treatment appeared to have healed the injured ATE but induced no apparent formation of fibrocartilage. The saline-treated group showed poor healing without fibrocartilage tissue formation in the ATEs. Our results show that injection of KGN-PRP induces fibrocartilage formation in the wounded rat ATEs. Hence, KGN-PRP may be a clinically relevant, biological approach to regenerate injured enthesis effectively. Cite this article: J. Zhang, T. Yuan, N. Zheng, Y. Zhou, M. V. Hogan, J. H-C. Wang. The combined use of kartogenin and platelet-rich plasma promotes fibrocartilage formation in the wounded rat Achilles tendon entheses. Bone Joint Res 2017;6:231-244. DOI: 10.1302/2046-3758.64.BJR-2017-0268.R1. © 2017 Wang et al.

The combined use of kartogenin and platelet-rich plasma promotes fibrocartilage formation in the wounded rat Achilles tendon entheses

PubMed Central

Zhang, J.; Yuan, T.; Zheng, N.; Zhou, Y.; Hogan, M. V.

2017-01-01

Objectives After an injury, the biological reattachment of tendon to bone is a challenge because healing takes place between a soft (tendon) and a hard (bone) tissue. Even after healing, the transition zone in the enthesis is not completely regenerated, making it susceptible to re-injury. In this study, we aimed to regenerate Achilles tendon entheses (ATEs) in wounded rats using a combination of kartogenin (KGN) and platelet-rich plasma (PRP). Methods Wounds created in rat ATEs were given three different treatments: kartogenin platelet-rich plasma (KGN-PRP); PRP; or saline (control), followed by histological and immunochemical analyses, and mechanical testing of the rat ATEs after three months of healing. Results Histological analysis showed well organised arrangement of collagen fibres and proteoglycan formation in the wounded ATEs in the KGN-PRP group. Furthermore, immunohistochemical analysis revealed fibrocartilage formation in the KGN-PRP-treated ATEs, evidenced by the presence of both collagen I and II in the healed ATE. Larger positively stained collagen III areas were found in both PRP and saline groups than those in the KGN-PRP group. Chondrocyte-related genes, SOX9 and collagen II, and tenocyte-related genes, collagen I and scleraxis (SCX), were also upregulated by KGN-PRP. Moreover, mechanical testing results showed higher ultimate tensile strength in the KGN-PRP group than in the saline control group. In contrast, PRP treatment appeared to have healed the injured ATE but induced no apparent formation of fibrocartilage. The saline-treated group showed poor healing without fibrocartilage tissue formation in the ATEs. Conclusions Our results show that injection of KGN-PRP induces fibrocartilage formation in the wounded rat ATEs. Hence, KGN-PRP may be a clinically relevant, biological approach to regenerate injured enthesis effectively. Cite this article: J. Zhang, T. Yuan, N. Zheng, Y. Zhou, M. V. Hogan, J. H-C. Wang. The combined use of kartogenin and platelet-rich plasma promotes fibrocartilage formation in the wounded rat Achilles tendon entheses. Bone Joint Res 2017;6:231–244. DOI: 10.1302/2046-3758.64.BJR-2017-0268.R1. PMID:28450316

Combined use of bone marrow-derived mesenchymal stromal cells (BM-MSCs) and platelet rich plasma (PRP) stimulates proliferation and differentiation of myoblasts in vitro: new therapeutic perspectives for skeletal muscle repair/regeneration.

PubMed

Sassoli, Chiara; Vallone, Larissa; Tani, Alessia; Chellini, Flaminia; Nosi, Daniele; Zecchi-Orlandini, Sandra

2018-06-01

Satellite cell-mediated skeletal muscle repair/regeneration is compromised in cases of extended damage. Bone marrow mesenchymal stromal cells (BM-MSCs) hold promise for muscle healing but some criticisms hamper their clinical application, including the need to avoid animal serum contamination for expansion and the scarce survival after transplant. In this context, platelet-rich plasma (PRP) could offer advantages. Here, we compare the effects of PRP or standard culture media on C2C12 myoblast, satellite cell and BM-MSC viability, survival, proliferation and myogenic differentiation and evaluate PRP/BM-MSC combination effects in promoting myogenic differentiation. PRP induced an increase of mitochondrial activity and Ki67 expression comparable or even greater than that elicited by standard media and promoted AKT signaling activation in myoblasts and BM-MSCs and Notch-1 pathway activation in BM-MSCs. It stimulated MyoD, myogenin, α-sarcomeric actin and MMP-2 expression in myoblasts and satellite cell activation. Notably, PRP/BM-MSC combination was more effective than PRP alone. We found that BM-MSCs influenced myoblast responses through a paracrine activation of AKT signaling, contributing to shed light on BM-MSC action mechanisms. Our results suggest that PRP represents a good serum substitute for BM-MSC manipulation in vitro and could be beneficial towards transplanted cells in vivo. Moreover, it might influence muscle resident progenitors' fate, thus favoring the endogenous repair/regeneration mechanisms. Finally, within the limitations of an in vitro experimentation, this study provides an experimental background for considering the PRP/BM-MSC combination as a potential therapeutic tool for skeletal muscle damage, combining the beneficial effects of BM-MSCs and PRP on muscle tissue, while potentiating BM-MSC functionality.

Evaluation of subcutaneous infiltration of autologous platelet-rich plasma on skin-wound healing in dogs

PubMed Central

Farghali, Haithem A.; AbdElKader, Naglaa A.; Khattab, Marwa S.

2017-01-01

Platelet-rich plasma (PRP) is known to be rich in growth factors and cytokines, which are crucial to the healing process. This study investigate the effect of subcutaneous (S/C) infiltration of autologous PRP at the wound boundaries on wound epithelization and contraction. Five adult male mongrel dogs were used. Bilateral acute full thickness skin wounds (3 cm diameter) were created on the thorax symmetrically. Right side wounds were subcutaneously infiltrated with activated PRP at day 0 and then every week for three consecutive weeks. The left wound was left as control. Wound contraction and epithelization were clinically evaluated. Expression of collagen type I (COLI) A2, (COLIA2),histopathology and immunohistochemical (IHC) staining of COLI α1 (COLIA1) were performed on skin biopsies at first, second and third weeks. The catalase activity, malondialdehyde (MDA) concentration and matrix metalloproteinase (MMP) 9 (MMP-9) activity were assessed in wound fluid samples. All data were analysed statistically. The epithelization percent significantly increased in the PRP-treated wound at week 3. Collagen was well organized in the PRP-treated wounds compared with control wounds at week 3. The COLIA2 expression and intensity of COLIA1 significantly increased in PRP-treated wounds. MDA concentration was significantly decreased in PRP-treated wound at week 3. The catalase activity exhibited no difference between PRP treated and untreated wounds. The activity of MMP-9 reached its peak at the second week and was significantly high in the PRP-treated group. S/C infiltration of autologous PRP at the wound margins enhances the wound epithelization and reduces the scar tissue formation. PMID:28246352

Evaluation of subcutaneous infiltration of autologous platelet-rich plasma on skin-wound healing in dogs.

PubMed

Farghali, Haithem A; AbdElKader, Naglaa A; Khattab, Marwa S; AbuBakr, Huda O

2017-04-28

Platelet-rich plasma (PRP) is known to be rich in growth factors and cytokines, which are crucial to the healing process. This study investigate the effect of subcutaneous (S/C) infiltration of autologous PRP at the wound boundaries on wound epithelization and contraction. Five adult male mongrel dogs were used. Bilateral acute full thickness skin wounds (3 cm diameter) were created on the thorax symmetrically. Right side wounds were subcutaneously infiltrated with activated PRP at day 0 and then every week for three consecutive weeks. The left wound was left as control. Wound contraction and epithelization were clinically evaluated. Expression of collagen type I (COLI) A2, (COLIA2),histopathology and immunohistochemical (IHC) staining of COLI α1 (COLIA1) were performed on skin biopsies at first, second and third weeks. The catalase activity, malondialdehyde (MDA) concentration and matrix metalloproteinase (MMP) 9 (MMP-9) activity were assessed in wound fluid samples. All data were analysed statistically. The epithelization percent significantly increased in the PRP-treated wound at week 3. Collagen was well organized in the PRP-treated wounds compared with control wounds at week 3. The COLIA2 expression and intensity of COLIA1 significantly increased in PRP-treated wounds. MDA concentration was significantly decreased in PRP-treated wound at week 3. The catalase activity exhibited no difference between PRP treated and untreated wounds. The activity of MMP-9 reached its peak at the second week and was significantly high in the PRP-treated group. S/C infiltration of autologous PRP at the wound margins enhances the wound epithelization and reduces the scar tissue formation. © 2017 The Author(s).

A naturally occurring variant of the human prion protein completely prevents prion disease.

PubMed

Asante, Emmanuel A; Smidak, Michelle; Grimshaw, Andrew; Houghton, Richard; Tomlinson, Andrew; Jeelani, Asif; Jakubcova, Tatiana; Hamdan, Shyma; Richard-Londt, Angela; Linehan, Jacqueline M; Brandner, Sebastian; Alpers, Michael; Whitfield, Jerome; Mead, Simon; Wadsworth, Jonathan D F; Collinge, John

2015-06-25

Mammalian prions, transmissible agents causing lethal neurodegenerative diseases, are composed of assemblies of misfolded cellular prion protein (PrP). A novel PrP variant, G127V, was under positive evolutionary selection during the epidemic of kuru--an acquired prion disease epidemic of the Fore population in Papua New Guinea--and appeared to provide strong protection against disease in the heterozygous state. Here we have investigated the protective role of this variant and its interaction with the common, worldwide M129V PrP polymorphism. V127 was seen exclusively on a M129 PRNP allele. We demonstrate that transgenic mice expressing both variant and wild-type human PrP are completely resistant to both kuru and classical Creutzfeldt-Jakob disease (CJD) prions (which are closely similar) but can be infected with variant CJD prions, a human prion strain resulting from exposure to bovine spongiform encephalopathy prions to which the Fore were not exposed. Notably, mice expressing only PrP V127 were completely resistant to all prion strains, demonstrating a different molecular mechanism to M129V, which provides its relative protection against classical CJD and kuru in the heterozygous state. Indeed, this single amino acid substitution (G→V) at a residue invariant in vertebrate evolution is as protective as deletion of the protein. Further study in transgenic mice expressing different ratios of variant and wild-type PrP indicates that not only is PrP V127 completely refractory to prion conversion but acts as a potent dose-dependent inhibitor of wild-type prion propagation.

Modification of Pulsed Electric Field Conditions Results in Distinct Activation Profiles of Platelet-Rich Plasma.

PubMed

Frelinger, Andrew L; Gerrits, Anja J; Garner, Allen L; Torres, Andrew S; Caiafa, Antonio; Morton, Christine A; Berny-Lang, Michelle A; Carmichael, Sabrina L; Neculaes, V Bogdan; Michelson, Alan D

2016-01-01

Activated autologous platelet-rich plasma (PRP) used in therapeutic wound healing applications is poorly characterized and standardized. Using pulsed electric fields (PEF) to activate platelets may reduce variability and eliminate complications associated with the use of bovine thrombin. We previously reported that exposing PRP to sub-microsecond duration, high electric field (SMHEF) pulses generates a greater number of platelet-derived microparticles, increased expression of prothrombotic platelet surfaces, and differential release of growth factors compared to thrombin. Moreover, the platelet releasate produced by SMHEF pulses induced greater cell proliferation than plasma. To determine whether sub-microsecond duration, low electric field (SMLEF) bipolar pulses results in differential activation of PRP compared to SMHEF, with respect to profiles of activation markers, growth factor release, and cell proliferation capacity. PRP activation by SMLEF bipolar pulses was compared to SMHEF pulses and bovine thrombin. PRP was prepared using the Harvest SmartPreP2 System from acid citrate dextrose anticoagulated healthy donor blood. PEF activation by either SMHEF or SMLEF pulses was performed using a standard electroporation cuvette preloaded with CaCl2 and a prototype instrument designed to take into account the electrical properties of PRP. Flow cytometry was used to assess platelet surface P-selectin expression, and annexin V binding. Platelet-derived growth factor (PDGF), vascular endothelial growth factor (VEGF), endothelial growth factor (EGF) and platelet factor 4 (PF4), and were measured by ELISA. The ability of supernatants to stimulate proliferation of human epithelial cells in culture was also evaluated. Controls included vehicle-treated, unactivated PRP and PRP with 10 mM CaCl2 activated with 1 U/mL bovine thrombin. PRP activated with SMLEF bipolar pulses or thrombin had similar light scatter profiles, consistent with the presence of platelet-derived microparticles, platelets, and platelet aggregates whereas SMHEF pulses primarily resulted in platelet-derived microparticles. Microparticles and platelets in PRP activated with SMLEF bipolar pulses had significantly lower annexin V-positivity than those following SMHEF activation. In contrast, the % P-selectin positivity and surface P-selectin expression (MFI) for platelets and microparticles in SMLEF bipolar pulse activated PRP was significantly higher than that in SMHEF-activated PRP, but not significantly different from that produced by thrombin activation. Higher levels of EGF were observed following either SMLEF bipolar pulses or SMHEF pulses of PRP than after bovine thrombin activation while VEGF, PDGF, and PF4 levels were similar with all three activating conditions. Cell proliferation was significantly increased by releasates of both SMLEF bipolar pulse and SMHEF pulse activated PRP compared to plasma alone. PEF activation of PRP at bipolar low vs. monopolar high field strength results in differential platelet-derived microparticle production and activation of platelet surface procoagulant markers while inducing similar release of growth factors and similar capacity to induce cell proliferation. Stimulation of PRP with SMLEF bipolar pulses is gentler than SMHEF pulses, resulting in less platelet microparticle generation but with overall activation levels similar to that obtained with thrombin. These results suggest that PEF provides the means to alter, in a controlled fashion, PRP properties thereby enabling evaluation of their effects on wound healing and clinical outcomes.

Prion protein modulates glucose homeostasis by altering intracellular iron.

PubMed

Ashok, Ajay; Singh, Neena

2018-04-26

The prion protein (PrP C ), a mainly neuronal protein, is known to modulate glucose homeostasis in mouse models. We explored the underlying mechanism in mouse models and the human pancreatic β-cell line 1.1B4. We report expression of PrP C on mouse pancreatic β-cells, where it promoted uptake of iron through divalent-metal-transporters. Accordingly, pancreatic iron stores in PrP knockout mice (PrP -/- ) were significantly lower than wild type (PrP +/+ ) controls. Silencing of PrP C in 1.1B4 cells resulted in significant depletion of intracellular (IC) iron, and remarkably, upregulation of glucose transporter GLUT2 and insulin. Iron overloading, on the other hand, resulted in downregulation of GLUT2 and insulin in a PrP C -dependent manner. Similar observations were noted in the brain, liver, and neuroretina of iron overloaded PrP +/+ but not PrP -/- mice, indicating PrP C -mediated modulation of insulin and glucose homeostasis through iron. Peripheral challenge with glucose and insulin revealed blunting of the response in iron-overloaded PrP +/+ relative to PrP -/- mice, suggesting that PrP C -mediated modulation of IC iron influences both secretion and sensitivity of peripheral organs to insulin. These observations have implications for Alzheimer's disease and diabetic retinopathy, known complications of type-2-diabetes associated with brain and ocular iron-dyshomeostasis.

USP15 regulates dynamic protein–protein interactions of the spliceosome through deubiquitination of PRP31

PubMed Central

Das, Tanuza; Park, Joon Kyu; Park, Jinyoung; Kim, Eunji; Rape, Michael

2017-01-01

Abstract Post-translational modifications contribute to the spliceosome dynamics by facilitating the physical rearrangements of the spliceosome. Here, we report USP15, a deubiquitinating enzyme, as a regulator of protein–protein interactions for the spliceosome dynamics. We show that PRP31, a component of U4 snRNP, is modified with K63-linked ubiquitin chains by the PRP19 complex and deubiquitinated by USP15 and its substrate targeting factor SART3. USP15SART3 makes a complex with USP4 and this ternary complex serves as a platform to deubiquitinate PRP31 and PRP3. The ubiquitination and deubiquitination status of PRP31 regulates its interaction with the U5 snRNP component PRP8, which is required for the efficient splicing of chromosome segregation related genes, probably by stabilizing the U4/U6.U5 tri-snRNP complex. Collectively, our data suggest that USP15 plays a key role in the regulation of dynamic protein–protein interactions of the spliceosome. PMID:28088760

The CNS glycoprotein Shadoo has PrPC-like protective properties and displays reduced levels in prion infections

PubMed Central

Watts, Joel C; Drisaldi, Bettina; Ng, Vivian; Yang, Jing; Strome, Bob; Horne, Patrick; Sy, Man-Sun; Yoong, Larry; Young, Rebecca; Mastrangelo, Peter; Bergeron, Catherine; Fraser, Paul E; Carlson, George A; Mount, Howard T J; Schmitt-Ulms, Gerold; Westaway, David

2007-01-01

The cellular prion protein, PrPC, is neuroprotective in a number of settings and in particular prevents cerebellar degeneration mediated by CNS-expressed Doppel or internally deleted PrP (‘ΔPrP'). This paradigm has facilitated mapping of activity determinants in PrPC and implicated a cryptic PrPC-like protein, ‘π'. Shadoo (Sho) is a hypothetical GPI-anchored protein encoded by the Sprn gene, exhibiting homology and domain organization similar to the N-terminus of PrP. Here we demonstrate Sprn expression and Sho protein in the adult CNS. Sho expression overlaps PrPC, but is low in cerebellar granular neurons (CGNs) containing PrPC and high in PrPC-deficient dendritic processes. In Prnp0/0 CGNs, Sho transgenes were PrPC-like in their ability to counteract neurotoxic effects of either Doppel or ΔPrP. Additionally, prion-infected mice exhibit a dramatic reduction in endogenous Sho protein. Sho is a candidate for π, and since it engenders a PrPC-like neuroprotective activity, compromised neuroprotective activity resulting from reduced levels may exacerbate damage in prion infections. Sho may prove useful in deciphering several unresolved facets of prion biology. PMID:17703189

Combination of platelet rich plasma in fractional carbon dioxide laser treatment increased clinical efficacy of for acne scar by enhancement of collagen production and modulation of laser-induced inflammation.

PubMed

Min, Seonguk; Yoon, Ji Young; Park, Seon Yong; Moon, Jungyoon; Kwon, Hyuck Hoon; Suh, Dae Hun

2018-04-01

Platelet-rich plasma (PRP) which contains large amounts of growth factors has been tried to enhance therapeutic efficacy of laser treatment for acne scar with unknown underlying mechanism. The present study was conducted to investigate the molecular mechanism of increased clinical efficacy of PRP when combined with fractional laser treatment for treating acne scars. Subjects with mild to moderate acne scars were treated with two sessions of fractional CO 2 laser therapy given with and without co-administration of PRP. Skin biopsy specimens were obtained at baseline, 1, 3, 7, and 28 days for investigation of molecular profiles associated with skin changes produced by laser plus PRP treatment. The PRP treatment increased clinical efficacy with decreased severity of adverse effects such as erythema, swelling and oozing. Productions of TGFβ1 and TGFβ3 proteins were more highly elevated on the PRP-treated side of the face compared to the control side at day 28. Furthermore, PRP-treated side showed significant increase of c-myc, TIMP, and HGF expression. Experimental fibroblast culture model was also used. PRP administration after laser irradiation increased expressions of p-Akt, TGFβ1, TGFβ3, β-catenin, collagen 1, and collagen 3 in both dose-dependent and time dependent manners in fibroblast. Moreover, we acquired clinical and histological data through randomized control clinical trial. Taken together with human study results combined with the data from cell experiments we suggest that PRP treatment increased fibrogenetic molecules induced by fractional CO 2 laser, which have association with clinical effect. Lasers Surg. Med. 50:302-310, 2018. © 2017 Wiley Periodicals, Inc. © 2017 Wiley Periodicals, Inc.

In Vitro Studies on the Degradability, Bioactivity, and Cell Differentiation of PRP/AZ31B Mg Alloys Composite Scaffold.

PubMed

Zou, Jian; Shi, Zhongmin; Xu, Hongwei; Li, Xiaolin

2017-01-01

In recent years, more and more methods have been developed to improve the bioactivity of the biodegradable materials in bone tissue regeneration. In present study, we used rat mesenchymal stem cells (rMSCs) to evaluate the outcomes of Mg alloys (AZ31B, Magnesium, and Aluminum) and Platelet-rich plasma (PRP)/Mg alloys on rMSCs biocompatibility and osteogenic differentiation. Water absorption experiments indicated that both bare AZ31B and PRP/AZ31B were capable of absorbing large amounts of water. But the water absorption ratio for PRP/AZ31B was significantly higher than that for bare AZ31B. The degradability experiments implied that both samples degraded at same speed. rMSCs on the surface of AZ31B distributed more and better than those on the AZ31B scaffold. In ALP activity experiment, the activity of rMSCs on the PRP/AZ31B was markedly higher than that on the AZ31B scaffolds on the 7th day and 14th day. qRT-PCR also showed that OPN and OCN were expressed in both samples. OPN and OCN expression in PRP/AZ31B sample were higher than those in bare AZ31B samples. In summary, the in vitro study implied that AZ31B combined with PRP could remarkably improve cell seeding, attachment, proliferation, and differentiation.

Platelet-Rich Plasma, Especially When Combined with a TGF-β Inhibitor Promotes Proliferation, Viability and Myogenic Differentiation of Myoblasts In Vitro

PubMed Central

Kelc, Robi; Trapecar, Martin; Gradisnik, Lidija; Rupnik, Marjan Slak; Vogrin, Matjaz

2015-01-01

Regeneration of skeletal muscle after injury is limited by scar formation, slow healing time and a high recurrence rate. A therapy based on platelet-rich plasma (PRP) has become a promising lead for tendon and ligament injuries in recent years, however concerns have been raised that PRP-derived TGF-β could contribute to fibrotic remodelling in skeletal muscle after injury. Due to the lack of scientific grounds for a PRP -based muscle regeneration therapy, we have designed a study using human myogenic progenitors and evaluated the potential of PRP alone and in combination with decorin (a TGF-β inhibitor), to alter myoblast proliferation, metabolic activity, cytokine profile and expression of myogenic regulatory factors (MRFs). Advanced imaging multicolor single-cell analysis enabled us to create a valuable picture on the ratio of quiescent, activated and terminally committed myoblasts in treated versus control cell populations. Finally high-resolution confocal microscopy validated the potential of PRP and decorin to stimulate the formation of polynucleated myotubules. PRP was shown to down-regulate fibrotic cytokines, increase cell viability and proliferation, enhance the expression of MRFs, and contribute to a significant myogenic shift during differentiation. When combined with decorin further synergistc effects were identified. These results suggest that PRP could not only prevent fibrosis but could also stimulate muscle commitment, especially when combined with a TGF-β inhibitor. PMID:25679956

Characterization of Variant Creutzfeldt-Jakob Disease Prions in Prion Protein-humanized Mice Carrying Distinct Codon 129 Genotypes*

PubMed Central

Takeuchi, Atsuko; Kobayashi, Atsushi; Ironside, James W.; Mohri, Shirou; Kitamoto, Tetsuyuki

2013-01-01

To date, all clinical variant Creutzfeldt-Jakob disease (vCJD) patients are homozygous for methionine at polymorphic codon 129 (129M/M) of the prion protein (PrP) gene. However, the appearance of asymptomatic secondary vCJD infection in individuals with a PRNP codon 129 genotype other than M/M and transmission studies using animal models have raised the concern that all humans might be susceptible to vCJD prions, especially via secondary infection. To reevaluate this possibility and to analyze in detail the transmission properties of vCJD prions to transgenic animals carrying distinct codon 129 genotype, we performed intracerebral inoculation of vCJD prions to humanized knock-in mice carrying all possible codon 129 genotypes (129M/M, 129M/V, or 129V/V). All humanized knock-in mouse lines were susceptible to vCJD infection, although the attack rate gradually decreased from 129M/M to 129M/V and to 129V/V. The amount of PrP deposition including florid/amyloid plaques in the brain also gradually decreased from 129M/M to 129M/V and to 129V/V. The biochemical properties of protease-resistant abnormal PrP in the brain and transmissibility of these humanized mouse-passaged vCJD prions upon subpassage into knock-in mice expressing bovine PrP were not affected by the codon 129 genotype. These results indicate that individuals with the 129V/V genotype may be more susceptible to secondary vCJD infection than expected and may lack the neuropathological characteristics observed in vCJD patients with the 129M/M genotype. Besides the molecular typing of protease-resistant PrP in the brain, transmission studies using knock-in mice carrying bovine PrP may aid the differential diagnosis of secondary vCJD infection, especially in individuals with the 129V/V genotype. PMID:23792955

Characterization of variant Creutzfeldt-Jakob disease prions in prion protein-humanized mice carrying distinct codon 129 genotypes.

PubMed

Takeuchi, Atsuko; Kobayashi, Atsushi; Ironside, James W; Mohri, Shirou; Kitamoto, Tetsuyuki

2013-07-26

To date, all clinical variant Creutzfeldt-Jakob disease (vCJD) patients are homozygous for methionine at polymorphic codon 129 (129M/M) of the prion protein (PrP) gene. However, the appearance of asymptomatic secondary vCJD infection in individuals with a PRNP codon 129 genotype other than M/M and transmission studies using animal models have raised the concern that all humans might be susceptible to vCJD prions, especially via secondary infection. To reevaluate this possibility and to analyze in detail the transmission properties of vCJD prions to transgenic animals carrying distinct codon 129 genotype, we performed intracerebral inoculation of vCJD prions to humanized knock-in mice carrying all possible codon 129 genotypes (129M/M, 129M/V, or 129V/V). All humanized knock-in mouse lines were susceptible to vCJD infection, although the attack rate gradually decreased from 129M/M to 129M/V and to 129V/V. The amount of PrP deposition including florid/amyloid plaques in the brain also gradually decreased from 129M/M to 129M/V and to 129V/V. The biochemical properties of protease-resistant abnormal PrP in the brain and transmissibility of these humanized mouse-passaged vCJD prions upon subpassage into knock-in mice expressing bovine PrP were not affected by the codon 129 genotype. These results indicate that individuals with the 129V/V genotype may be more susceptible to secondary vCJD infection than expected and may lack the neuropathological characteristics observed in vCJD patients with the 129M/M genotype. Besides the molecular typing of protease-resistant PrP in the brain, transmission studies using knock-in mice carrying bovine PrP may aid the differential diagnosis of secondary vCJD infection, especially in individuals with the 129V/V genotype.

Prion Strain Characterization of a Novel Subtype of Creutzfeldt-Jakob Disease.

PubMed

Galeno, Roberta; Di Bari, Michele Angelo; Nonno, Romolo; Cardone, Franco; Sbriccoli, Marco; Graziano, Silvia; Ingrosso, Loredana; Fiorini, Michele; Valanzano, Angelina; Pasini, Giulia; Poleggi, Anna; Vinci, Ramona; Ladogana, Anna; Puopolo, Maria; Monaco, Salvatore; Agrimi, Umberto; Zanusso, Gianluigi; Pocchiari, Maurizio

2017-06-01

In 2007, we reported a patient with an atypical form of Creutzfeldt-Jakob disease (CJD) heterozygous for methionine-valine (MV) at codon 129 who showed a novel pathological prion protein (PrP TSE ) conformation with an atypical glycoform (AG) profile and intraneuronal PrP deposition. In the present study, we further characterize the conformational properties of this pathological prion protein (PrP TSE MV AG ), showing that PrP TSE MV AG is composed of multiple conformers with biochemical properties distinct from those of PrP TSE type 1 and type 2 of MV sporadic CJD (sCJD). Experimental transmission of CJD-MV AG to bank voles and gene-targeted transgenic mice carrying the human prion protein gene (TgHu mice) showed unique transmission rates, survival times, neuropathological changes, PrP TSE deposition patterns, and PrP TSE glycotypes that are distinct from those of sCJD-MV1 and sCJD-MV2. These biochemical and experimental data suggest the presence of a novel prion strain in CJD-MV AG IMPORTANCE Sporadic Creutzfeldt-Jakob disease is caused by the misfolding of the cellular prion protein, which assumes two different major conformations (type 1 and type 2) and, together with the methionine/valine polymorphic codon 129 of the prion protein gene, contribute to the occurrence of distinct clinical-pathological phenotypes. Inoculation in laboratory rodents of brain tissues from the six possible combinations of pathological prion protein types with codon 129 genotypes results in the identification of 3 or 4 strains of prions. We report on the identification of a novel strain of Creutzfeldt-Jakob disease isolated from a patient who carried an abnormally glycosylated pathological prion protein. This novel strain has unique biochemical characteristics, does not transmit to humanized transgenic mice, and shows exclusive transmission properties in bank voles. The identification of a novel human prion strain improves our understanding of the pathogenesis of the disease and of possible mechanisms of prion transmission. Copyright © 2017 American Society for Microbiology.

Flow cytometric analysis of platelet cyclooxygenase-1 and -2 and surface glycoproteins in patients with immune thrombocytopenia and healthy individuals.

PubMed

Rubak, Peter; Kristensen, Steen D; Hvas, Anne-Mette

2017-06-01

Immature platelets may contain more platelet enzymes such as cyclooxygenase (COX)-1 and COX-2 than mature platelets. Patients with immune thrombocytopenia (ITP) have a higher fraction of immature platelets and can therefore be utilized as a biological model for investigating COX-1 and COX-2 platelet expression. The aims were to develop flow cytometric assays for platelet COX-1 and COX-2 and to investigate the COX-1 and COX-2 platelet expression, platelet turnover, and platelet glycoproteins in ITP patients (n = 10) compared with healthy individuals (n = 30). Platelet count and platelet turnover parameters (mean platelet volume (MPV), immature platelet fraction (IPF), and immature platelet count (IPC)) were measured by flow cytometry (Sysmex XE-5000). Platelet COX-1, COX-2, and the glycoproteins (GP)IIb, IX, Ib, Ia, and IIIa were all analyzed by flow cytometry (Navios) and expressed as median fluorescence intensity. COX analyses were performed in both whole blood and platelet rich plasma (PRP), whereas platelet glycoproteins were analyzed in whole blood only. ITP patients had significantly lower platelet count (55 × 10 9 /L) than healthy individuals (240 × 10 9 /L, p < 0.01), but a higher MPV (p = 0.03) and IPF (p < 0.01). IPC was similar for the two groups (p = 0.74). PRP had significantly lower MPV (p < 0.01) and significantly higher platelet count and IPC (both p-values <0.03) when compared with whole blood. IPF was similar for PRP and whole blood (p = 0.18). COX-1 expression was 10 times higher and COX-2 expression was 50% higher in PRP than in whole blood (p COX-1 < 0.01, p COX-2 < 0.01). Platelet COX-1 expression was higher in ITP patients than healthy individuals using whole blood (p COX-1 < 0.01) and PRP, though this was nonsignificant in PRP (p COX-1 = 0.17). In ITP patients, positive correlations were found between platelet turnover and COX-1 expression (all p-values <0.01, rho = 0.80-0.94), whereas healthy individuals showed significant though weaker correlations between platelet turnover and COX-1 and COX-2 expressions (all p-values <0.03, rho = 0.44-0.71). GPIIb, IX, and Ib expression was increased in ITP patients compared with healthy individuals (all p-values < 0.03). GPIIb, IX, Ib, and IIIa showed positive correlations with platelet turnover in ITP patients (all p-values <0.02, rho = 0.71-0.94), but weak and nonsignificant correlations in healthy individuals (all p-values >0.14, rho = 0.11-0.28). In conclusion, ITP patients expressed higher COX-1 and platelet glycoprotein levels than healthy individuals. COX-1 and platelet glycoproteins demonstrated positive correlations with platelet turnover in ITP patients. In healthy individuals, COX-1 and COX-2 expression correlated positively with platelet turnover. PRP was more sensitive compared with whole blood as regards determination of COX. Therefore, PRP is the recommended matrix for investigating COX-1 and COX-2 in platelets.

Prion protein is essential for diabetic retinopathy-associated neovascularization.

PubMed

Zhu, Lingyan; Xu, Jixiong; Liu, Ying; Gong, Tian; Liu, Jianying; Huang, Qiong; Fischbach, Shane; Zou, Wenquan; Xiao, Xiangwei

2018-05-30

Diabetic retinopathy (DR), a major complication of diabetes caused by vascular damage and pathological proliferation of retinal vessels, often progresses to vision loss. Vascular endothelial growth factor (VEGF) signaling plays a pivotal role in the development of DR, but the exact underlying molecular mechanisms remain ill-defined. Cellular prion protein (PrP c ) is a surface protein expressed by vascular endothelial cells, and the increased expression of PrP c is associated with physiological and pathological vascularization. Nevertheless, a role for PrP c in the development of DR has not been appreciated. Here, we addressed this question. We found that the development of streptozocin (STZ)-induced DR, but not the STZ-induced hyperglycemia/diabetes itself, was significantly attenuated in PrP c -KO mice, compared to control wildtype (WT) mice, evident by measurement of retinal vascular leakage, retinal neovascularization, a retinopathy score and visual acuity assessment. Moreover, the attenuation of DR severity seemingly resulted from attenuation of retinal neovascularization via VEGF/ras/rac signaling. Together, our study suggests a previously unappreciated role for PrP c in the development of DR.

A Highly Toxic Cellular Prion Protein Induces a Novel, Nonapoptotic Form of Neuronal Death

PubMed Central

Christensen, Heather M.; Dikranian, Krikor; Li, Aimin; Baysac, Kathleen C.; Walls, Ken C.; Olney, John W.; Roth, Kevin A.; Harris, David A.

2010-01-01

Several different deletions within the N-terminal tail of the prion protein (PrP) induce massive neuronal death when expressed in transgenic mice. This toxicity is dose-dependently suppressed by coexpression of full-length PrP, suggesting that it results from subversion of a normal physiological activity of cellular PrP. We performed a combined biochemical and morphological analysis of Tg(ΔCR) mice, which express PrP carrying a 21-aa deletion (residues 105-125) within a highly conserved region of the protein. Death of cerebellar granule neurons in Tg(ΔCR) mice is not accompanied by activation of either caspase-3 or caspase-8 or by increased levels of the autophagy marker, LC3-II. In electron micrographs, degenerating granule neurons displayed a unique morphology characterized by heterogeneous condensation of the nuclear matrix without formation of discrete chromatin masses typical of neuronal apoptosis. Our data demonstrate that perturbations in PrP functional activity induce a novel, nonapoptotic, nonautophagic form of neuronal death whose morphological features are reminiscent of those associated with excitotoxic stress. PMID:20472884

Production of a soluble recombinant prion protein fused to blue fluorescent protein without refolding or detergents in Escherichia coli cells.

PubMed

Arii, Yasuhiro; Yamaguchi, Hidenori; Fukuoka, Shin-Ichi

2007-10-01

The physiological function of prion proteins (PrP) remains unclear. To investigate the physiological relevance of PrP, we constructed a fusion protein of PrP with enhanced blue fluorescent protein (PrP-EBFP) to quantify the interaction of PrP with other molecules. Production of soluble PrP-EBFP was achieved by lowering the expression temperature in Escherichia coli (E. coli) cells to 15 degrees C. Soluble PrP-EBFP was purified on cation exchange and heparin-affinity columns to yield high purity protein. This is the first report of the preparation of soluble recombinant PrP without refolding following solubilization using denaturants or disruption using detergents. To confirm the integrity of PrP-EBFP, anisotropy was estimated under physiological conditions in the presence of heparin, which interacts with PrP. The dissociation constant was determined to be 0.88+/-0.07 microM. PrP-EBFP should be useful in the quantification of PrP interactions with other molecules.

Characterization of PhPRP1, a histidine domain arabinogalactan protein from Petunia hybrida pistils.

PubMed

Twomey, Megan C; Brooks, Jenna K; Corey, Jillaine M; Singh-Cundy, Anu

2013-10-15

An arabinogalactan protein, PhPRP1, was purified from Petunia hybrida pistils and shown to be orthologous to TTS-1 and TTS-2 from Nicotiana tabacum and NaTTS from Nicotiana alata. Sequence comparisons among these proteins, and CaPRP1 from Capsicum annuum, reveal a conserved histidine-rich domain and two hypervariable domains. Immunoblots show that TTS-1 and PhPRP1 are also expressed in vegetative tissues of tobacco and petunia respectively. In contrast to the molecular mass heterogeneity displayed by the pistil proteins, the different isoforms found in seedlings, roots, and leaves each has a discrete size (37, 80, 160, and 200 kDa) on SDS-PAGE gels. On the basis of their chemistry, distinctive domain architecture, and the unique pattern of expression, we have named this group of proteins HD-AGPs (histidine domain-arabinogalactan proteins). Copyright © 2013 Elsevier GmbH. All rights reserved.

Platelet‑rich plasma promotes the migration and invasion of synovial fibroblasts in patients with rheumatoid arthritis.

PubMed

Yan, Shanshan; Yang, Binzhou; Shang, Chen; Ma, Zhongshuang; Tang, Zizheng; Liu, Guiping; Shen, Weigan; Zhang, Yu

2016-09-01

Platelet-rich plasma (PRP) is blood plasma that has been enriched with platelets, and the number of platelets is correlated with rheumatoid activity. PRP is a concentrated source of autologous platelets, and contains several different growth factors and cytokines, including platelet‑derived growth factor, transforming growth factor‑β and insulin‑like growth factor‑1, which stimulate healing of bone and soft tissue. Rheumatoid arthritis (RA) is characterized by synovial hyperplasia, cell activation, articular inflammation and invasion of the synovium into the adjacent bone and cartilage. The adhesion of fibroblast‑like synoviocytes (FLSs) onto the extracellular matrix (ECM), migration and invasion are important for the erosion and destruction of the articular cartilage of patients with RA. The aim of the present study was to investigate the effects of PRP on the adhesion, migration and invasion of RA‑FLSs. Scratch and Transwell migration assays determined that PRP at a concentration of 2 and 5% significantly enhanced the migration ability of RA‑FLSs. Treatment of RA‑FLSs with 2 and 5% PRP promoted the adhesion and invasion of the cells. Additionally, the immunofluorescence assay revealed that PRP induced a decrease in the number of centrally located stress fibers and led to an increase in the formation of filopodia and lamellipodia in the detectable leading edge protrusions in RA‑FLSs. In addition, reverse transcription‑quantitative polymerase chain reaction and western blot analysis determined that PRP upregulated the protein and mRNA expression levels of matrix metalloproteinase‑1 (MMP‑1). In conclusion, the promotion of RA‑FLS cell migration, invasion and adhesion on the ECM by PRP may be modulated through the upregulation of MMP‑1 expression and the induction of actin cytoskeletal reorganization.

Identification of seven haplotypes of the caprine PrP gene at codons 127, 142, 154, 211, 222 and 240 in French Alpine and Saanen breeds and their association with classical scrapie.

PubMed

Barillet, F; Mariat, D; Amigues, Y; Faugeras, R; Caillat, H; Moazami-Goudarzi, K; Rupp, R; Babilliot, J M; Lacroux, C; Lugan, S; Schelcher, F; Chartier, C; Corbière, F; Andréoletti, O; Perrin-Chauvineau, C

2009-03-01

In sheep, susceptibility to scrapie is mainly influenced by polymorphisms of the PrP gene. In goats, there are to date few data related to scrapie susceptibility association with PrP gene polymorphisms. In this study, we first investigated PrP gene polymorphisms of the French Alpine and Saanen breeds. Based on PrP gene open reading frame sequencing of artificial insemination bucks (n=404), six encoding mutations were identified at codons 127, 142, 154, 211, 222 and 240. However, only seven haplotypes could be detected: four (GIH(154)RQS, GIRQ(211)QS, GIRRK(222)S and GIRRQP(240)) derived from the wild-type allele (G(127)I(142)R(154)R(211)Q(222)S(240)) by a single-codon mutation, and two (S(127)IRRQP(240) and GM(142)RRQP(240)) by a double-codon mutation. A case-control study was then implemented in a highly affected Alpine and Saanen breed herd (90 cases/164 controls). Mutations at codon 142 (I/M), 154 (R/H), 211 (R/Q) and 222 (Q/K) were found to induce a significant degree of protection towards natural scrapie infection. Compared with the baseline homozygote wild-type genotype I(142)R(154)R(211)Q(222)/IRRQ goats, the odds of scrapie cases in IRQ(211)Q/IRRQ and IRRK(222)/IRRQ heterozygous animals were significantly lower [odds ratio (OR)=0.133, P<0.0001; and OR=0.048, P<0.0001, respectively]. The heterozygote M(142)RRQ/IRRQ genotype was only protective (OR=0.243, P=0.0186) in goats also PP(240) homozygous at codon 240. However, mutated allele frequencies in French Alpine and Saanen breeds were low (0.5-18.5 %), which prevent us from assessing the influence of all the possible genotypes in natural exposure conditions.

The inhibition of functional expression of calcium channels by prion protein demonstrates competition with α2δ for GPI-anchoring pathways

PubMed Central

Alvarez-Laviada, Anita; Kadurin, Ivan; Senatore, Assunta; Chiesa, Roberto; Dolphin, Annette C.

2013-01-01

It has been shown recently that PrP (prion protein) and the calcium channel auxiliary α2δ subunits interact in neurons and expression systems [Senatore, Colleoni, Verderio, Restelli, Morini, Condliffe, Bertani, Mantovani, Canovi, Micotti, Forloni, Dolphin, Matteoli, Gobbi and Chiesa (2012) Neuron 74, 300–313]. In the present study we examined whether there was an effect of PrP on calcium currents. We have shown that when PrP is co-expressed with calcium channels formed from CaV2.1/β and α2δ-1 or α2δ-2, there is a consistent decrease in calcium current density. This reduction was absent when a PrP construct was used lacking its GPI (glycosylphosphatidylinositol) anchor. We have reported previously that α2δ subunits are able to form GPI-anchored proteins [Davies, Kadurin, Alvarez-Laviada, Douglas, Nieto-Rostro, Bauer, Pratt and Dolphin (2010) Proc. Natl. Acad. Sci. U.S.A. 107, 1654–1659] and show further evidence in the present paper. We have characterized recently a C-terminally truncated α2δ-1 construct, α2δ-1ΔC, and found that, despite loss of its membrane anchor, it still shows a partial ability to increase calcium currents [Kadurin, Alvarez-Laviada, Ng, Walker-Gray, D’Arco, Fadel, Pratt and Dolphin (2012) J. Biol. Chem. 1287, 33554–33566]. We now find that PrP does not inhibit CaV2.1/β currents formed with α2δ-1ΔC, rather than α2δ-1. It is possible that PrP and α2δ-1 compete for GPI-anchor intermediates or trafficking pathways, or that interaction between PrP and α2δ-1 requires association in cholesterol-rich membrane microdomains. Our additional finding that CaV2.1/β1b/α2δ-1 currents were inhibited by GPI–GFP, but not cytosolic GFP, indicates that competition for limited GPI-anchor intermediates or trafficking pathways may be involved in PrP suppression of α2δ subunit function. PMID:24329154

Associations between lamb survival and prion protein genotype: analysis of data for ten sheep breeds in Great Britain

PubMed Central

Gubbins, Simon; Cook, Charlotte J; Hyder, Kieran; Boulton, Kay; Davis, Carol; Thomas, Eurion; Haresign, Will; Bishop, Stephen C; Villanueva, Beatriz; Eglin, Rachel D

2009-01-01

Background Selective breeding programmes, based on prion protein (PrP) genotype, have been introduced throughout the European Union to reduce the risk of sheep transmissible spongiform encephalopathies (TSEs). These programmes could have negative consequences on other important traits, such as fitness and production traits, if the PrP gene has pleiotropic effects or is in linkage disequilibrium with genes affecting these traits. This paper presents the results of an investigation into associations between lamb survival and PrP genotype in ten mainstream sheep breeds in Great Britain (GB). In addition, the reasons for lamb deaths were examined in order to identify any associations between these and PrP genotype. Results Survival times from birth to weaning were analysed for over 38000 lambs (2427 dead and 36096 live lambs) from 128 flocks using Cox proportional hazard models for each breed, including additive animal genetic effects. No significant associations between PrP genotype and lamb survival were identified, except in the Charollais breed for which there was a higher risk of mortality in lambs of the ARR/VRQ genotype compared with those of the ARR/ARR genotype. Significant effects of birth weight, litter size, sex, age of dam and year of birth on survival were also identified. For all breeds the reasons for death changed significantly with age; however, no significant associations between reason for death and PrP genotype were found for any of the breeds. Conclusion This study found no evidence to suggest that a selective breeding programme based on PrP genotype will have a detrimental effect on lamb survival. The only significant effect of PrP genotype identified was likely to be of little consequence because an increased risk of mortality was associated with a genotype that is selected against in current breeding strategies. PMID:19159456

Platelet-rich plasma-induced feedback inhibition of activin A/follistatin signaling: A mechanism for tumor-low risk skin rejuvenation in irradiated rats.

PubMed

Omar, Nesreen Nabil; Rashed, Rasha R; El-Hazek, Rania M; El-Sabbagh, Walaa A; Rashed, Engy R; El-Ghazaly, Mona A

2018-03-01

Platelet-rich plasma (PRP) is a source of natural growth factors and is emerging as a treatment modality to mitigate radiotherapy- induced adverse effects. Activin A (ACTA) is a member of the transforming growth factor-β (TGF-β) superfamily, which has been shown to modulate the inflammatory response and macrophages polarization between different phenotypes. The aim of this study is to determine the value of PRP in preventing radiation-induced malignancies in light of the cross-talk between PRP and activin A type II receptors (ActR-IIA)/follistatin (FST) signaling pathways where the inflammatory responses at 2 different time points were evaluated. Male albino rats were exposed to radiation and given PRP over the course of 6 days. Rats were sacrificed on day 7 or day 28 post radiation. Quantitative real-time reverse transcriptase polymerase chain reaction (QRT-PCR) and western-blot showed that after 7 days of administrating of PRP, ActR-IIA/FST signaling was markedly induced and was associated with the expressions of inflammatory, natural killer and M1 macrophages markers, TNF-α, IL-1β, IFN-γ and IL-12. By contrast, on day 28 of PRP administration, ActR-IIA/FST signaling and the expressions of proinflammatory cytokines were downregulated in parallel with inducing M2 macrophages phenotype as indicated by arginase-1, IL-10 and dectin-1. The suppression of inflammation and induction of M2 macrophages phenotype in response to PRP administration were found significantly linked to ActR-IIA/FST signaling downregulation. Furthermore, the specific M2 macrophage subtype was found to express dectin-1 receptors which have high affinity for tumor cells thereby is expected to reduce the potential for developing tumors after radiotherapy. Copyright © 2018 Elsevier B.V. All rights reserved.

Spontaneous generation of rapidly transmissible prions in transgenic mice expressing wild-type bank vole prion protein.

PubMed

Watts, Joel C; Giles, Kurt; Stöhr, Jan; Oehler, Abby; Bhardwaj, Sumita; Grillo, Sunny K; Patel, Smita; DeArmond, Stephen J; Prusiner, Stanley B

2012-02-28

Currently, there are no animal models of the most common human prion disorder, sporadic Creutzfeldt-Jakob disease (CJD), in which prions are formed spontaneously from wild-type (WT) prion protein (PrP). Interestingly, bank voles (BV) exhibit an unprecedented promiscuity for diverse prion isolates, arguing that bank vole PrP (BVPrP) may be inherently prone to adopting misfolded conformations. Therefore, we constructed transgenic (Tg) mice expressing WT BVPrP. Tg(BVPrP) mice developed spontaneous CNS dysfunction between 108 and 340 d of age and recapitulated the hallmarks of prion disease, including spongiform degeneration, pronounced astrogliosis, and deposition of alternatively folded PrP in the brain. Brain homogenates of ill Tg(BVPrP) mice transmitted disease to Tg(BVPrP) mice in ∼35 d, to Tg mice overexpressing mouse PrP in under 100 d, and to WT mice in ∼185 d. Our studies demonstrate experimentally that WT PrP can spontaneously form infectious prions in vivo. Thus, Tg(BVPrP) mice may be useful for studying the spontaneous formation of prions, and thus may provide insight into the etiology of sporadic CJD.

Clinical-grade quality platelet-rich plasma releasate (PRP-R/SRGF) from CaCl2 -activated platelet concentrates promoted expansion of mesenchymal stromal cells.

PubMed

Borghese, C; Agostini, F; Durante, C; Colombatti, A; Mazzucato, M; Aldinucci, D

2016-08-01

The aim of our study was to test a platelet-rich plasma releasate (PRP-R/SRGF) from CaCl2 -activated platelets as a source of growth factors for the expansion of mesenchymal stromal cells (MSCs). PRP-R/SRGF, obtained with a low-cost procedure, is characterized by a reduced variability of growth factor release. PRP-R/SRGF is a clinical-grade quality solution obtained from CaCl2 -activated platelets. Its activity was evaluated by measuring the proliferation, the phenotype, the differentiation potential and the immunosuppressive properties of MSCs derived from bone marrow (BM) and adipose tissue (AT). PRP-R/SRGF was more active than FBS to expand BM- and AT-derived MSCs. PRP-R/SRGF treatment did not affect the expression of typical MSCs surface markers, neither MSCs differentiation potential nor their capability to inhibit activated T-cell proliferation. The clinical-grade PRP-R/SRGF may be used in the clinical setting for the expansion of MSCs. © 2016 International Society of Blood Transfusion.

Superior integrin activating capacity and higher adhesion to fibrinogen matrix in buffy coat-derived platelet concentrates (PCs) compared to PRP-PCs.

PubMed

Beshkar, Pezhman; Hosseini, Ehteramolsadat; Ghasemzadeh, Mehran

2018-02-01

Regardless of different sources, methods or devices which are applied for preparation of therapeutic platelets, these products are generally isolated from whole blood by the sedimentation techniques which are based on PRP or buffy coat (BC) separation. As a general fact, platelet preparation and storage are also associated with some deleterious changes that known as platelet storage lesion (PSL). Although these alternations in platelet functional activity are aggravated during storage, whether technical issues within preparation can affect integrin activation and platelet adhesion to fibrinogen were investigated in this study. PRP- and BC-platelet concentrates (PCs) were subjected to flowcytometry analysis to examine the expression of platelet activation marker, P-selectin as well as active confirmation of the GPIIb/IIIa (α IIb β 3 ) on day 0, 1, 3 and 5 post-storage. Platelet adhesion to fibrinogen matrix was evaluated by fluorescence microscopy. Glucose concentration and LDH activity were also measured by colorimetric methods. The increasing P-selectin expression during storage was in a reverse correlation with PAC-1 binding (r = -0.67; p = .001). PRP-PCs showed the higher level of P-selectin expression than BC-PCs, whereas the levels of PAC-1 binding and platelet adhesion to fibrinogen matrix were significantly lower in PRP-PCs. Higher levels of active confirmation of the GPIIb/IIIa in BC-PCs were also associated with greater concentration of glucose in these products. We demonstrated the superior capacities of integrin activation and adhesion to fibrinogen for BC-PCs compared to those of PRP-PCs. These findings may provide more advantages for BC method of platelet preparation. Copyright © 2017 Elsevier Ltd. All rights reserved.

Electrophysiological properties of prion-positive cardiac progenitors derived from murine embryonic stem cells.

PubMed

Fujii, Hiroshi; Ikeuchi, Yu; Kurata, Yasutaka; Ikeda, Nobuhito; Bahrudin, Udin; Li, Peili; Nakayama, Yuji; Endo, Ryo; Hasegawa, Akira; Morikawa, Kumi; Miake, Junichiro; Yoshida, Akio; Hidaka, Kyoko; Morisaki, Takayuki; Ninomiya, Haruaki; Shirayoshi, Yasuaki; Yamamoto, Kazuhiro; Hisatome, Ichiro

2012-01-01

The prion protein (PrP) has been reported to serve as a surface maker for isolation of cardiomyogenic progenitors from murine embryonic stem (ES) cells. Although PrP-positive cells exhibited automaticity, their electrophysiological characteristics remain unresolved. The aim of the present study was therefore to investigate the electrophysiological properties of PrP-positive cells in comparison with those of HCN4p-or Nkx2.5-positive cells. Differentiation of AB1, HCN5p-EGFP and hcgp7 ES cells into cardiac progenitors was induced by embryoid body (EB) formation. EBs were dissociated and cells expressing PrP, HCN4-EGFP and/or Nkx2.5-GFP were collected via flow cytometry. Sorted cells were subjected to reverse transcriptase-polymerase chain reaction, immunostaining and patch-clamp experiments. PrP-positive cells expressed mRNA of undifferentiation markers, first and second heart field markers, and cardiac-specific genes and ion channels, indicating their commitment to cardiomyogenic progenitors. PrP-positive cells with automaticity showed positive and negative chronotropic responses to isoproterenol and carbamylcholine, respectively. Hyperpolarization-activated cation current (I(f)) was barely detectable, whereas Na(+) and L-type Ca(2+) channel currents were frequently observed. Their spontaneous activity was slowed by inhibition of sarcoplasmic reticulum Ca(2+) uptake and release but not by blocking I(f). The maximum diastolic potential of their spontaneous firings was more depolarized than that of Nkx2.5-GFP-positive cells. PrP-positive cells contained cardiac progenitors that separated from the lineage of sinoatrial node cells. PrP can be used as a marker to enrich nascent cardiac progenitors.

Analysis of protein levels of 24 cytokines in scrapie agent-infected brain and glial cell cultures from mice differing in prion protein expression levels.

PubMed

Tribouillard-Tanvier, Déborah; Striebel, James F; Peterson, Karin E; Chesebro, Bruce

2009-11-01

Activation of microglia and astroglia is seen in many neurodegenerative diseases including prion diseases. Activated glial cells produce cytokines as a protective response against certain pathogens and as part of the host inflammatory response to brain damage. In addition, cytokines might also exacerbate tissue damage initiated by other processes. In the present work using multiplex assays to analyze protein levels of 24 cytokines in scrapie agent-infected C57BL/10 mouse brains, we observed elevation of CCL2, CCL5, CXCL1, CXCL10, granulocyte-macrophage colony-stimulating factor (GM-CSF), gamma interferon (IFN-gamma), interleukin 1alpha (IL-1alpha), IL-1beta, IL-6, and IL-12p40. Scrapie agent-infected wild-type mice and transgenic mice expressing anchorless prion protein (PrP) had similar cytokine responses in spite of extensive differences in neuropathology. Therefore, these responses may be primarily a reaction to brain damage induced by prion infection rather than specific inducers of a particular type of pathology. To study the roles of astroglia and microglia in these cytokine responses, primary glial cultures were exposed to scrapie agent-infected brain homogenates. Microglia produced only IL-12p40 and CXCL10, whereas astroglia produced these cytokines plus CCL2, CCL3, CCL5, CXCL1, G-CSF, IL-1beta, IL-6, IL-12p70, and IL-13. Glial cytokine responses from wild-type mice and transgenic mice expressing anchorless PrP differed only slightly, but glia from PrP-null mice produced only IL-12p40, indicating that PrP expression was required for scrapie agent induction of other cytokines detected. The difference in cytokine response between microglia and astroglia correlated with 20-fold-higher levels of PrP expression in astroglia versus microglia, suggesting that high-level PrP expression on astroglia might be important for induction of certain cytokines.

The Use of Platelet-Rich and Platelet-Poor Plasma to Enhance Differentiation of Skeletal Myoblasts: Implications for the Use of Autologous Blood Products for Muscle Regeneration.

PubMed

Miroshnychenko, Olga; Chang, Wen-Teh; Dragoo, Jason L

2017-03-01

Platelet-rich plasma (PRP) has been used to augment tissue repair and regeneration after musculoskeletal injury. However, there is increasing clinical evidence that PRP does not show a consistent clinical effect. Purpose/Hypothesis: This study aimed to compare the effects of the following non-neutrophil-containing (leukocyte-poor) plasma fractions on human skeletal muscle myoblast (HSMM) differentiation: (1) PRP, (2) modified PRP (Mod-PRP), in which transforming growth factor β1 (TGF-β1) and myostatin (MSTN) were depleted, and (3) platelet-poor plasma (PPP). The hypothesis was that leukocyte-poor PRP would lead to myoblast proliferation (not differentiation), whereas certain modifications of PRP preparations would increase myoblast differentiation, which is necessary for skeletal muscle regeneration. Controlled laboratory study. Blood from 7 human donors was individually processed to simultaneously create leukocyte-poor fractions: PRP, Mod-PRP, PPP, and secondarily spun PRP and Mod-PRP (PRP ss and Mod-PRP ss , respectively). Mod-PRP was produced by removing TGF-β1 and MSTN from PRP using antibodies attached to sterile beads, while a second-stage centrifugal spin of PRP was performed to remove platelets. The biologics were individually added to cell culture groups. Analysis for induction into myoblast differentiation pathways included Western blot analysis, reverse-transcription polymerase chain reaction, and immunohistochemistry, as well as confocal microscopy to assess polynucleated myotubule formation. HSMMs cultured with PRP showed an increase in proliferation but no evidence of differentiation. Western blot analysis confirmed that MSTN and TGF-β1 could be decreased in Mod-PRP using antibody-coated beads, but this modification mildly improved myoblast differentiation. However, cell culture with PPP, PRP ss , and Mod-PRP ss led to a decreased proliferation rate but a significant induction of myoblast differentiation verified by increased multinucleated myotubule formation and myosin heavy chain expression (mean 8-fold change in mRNA level; P < .05), which was comparable with 2% horse serum, the positive control. PPP and leukocyte-poor PRP preparations subjected to a second spin to remove the platelets led to induction of myoblast cells into the muscle differentiation pathway, whereas unmodified leukocyte-poor PRP led to myoblast proliferation. These results indicate that traditionally formulated PRP may not be appropriate to induce muscle regeneration. Laboratory evidence suggests that PPP or non-neutrophil-containing PRP ss , subjected to an additional spin to remove platelets, should be used to stimulate myoblast differentiation, which is necessary for skeletal muscle regeneration. Clinical studies will be required to confirm the effect of these biologics on muscle regeneration.

Loss of prion protein is associated with the development of insulin resistance and obesity.

PubMed

de Brito, Giovanna; Lupinacci, Fernanda C; Beraldo, Flávio H; Santos, Tiago G; Roffé, Martín; Lopes, Marilene H; de Lima, Vladmir C; Martins, Vilma R; Hajj, Glaucia N

2017-08-17

Prion protein (PrP C ) was initially described due to its involvement in transmissible spongiform encephalopathies. It was subsequently demonstrated to be a cell surface molecule involved in many physiological processes, such as vesicle trafficking. Here, we investigated the roles of PrP C in the response to insulin and obesity development. Two independent PrP C knockout (KO) and one PrP C overexpressing (TG20) mouse models were fed high-fat diets, and the development of insulin resistance and obesity was monitored. PrP C KO mice fed high-fat diets presented all of the symptoms associated with the development of insulin resistance: hyperglycemia, hyperinsulinemia, and obesity. Conversely, TG20 animals fed high-fat diets showed reduced weight and insulin resistance. Accordingly, the expression of peroxisome proliferator-activated receptor gamma (PPARγ) was reduced in PrP C KO mice and increased in TG20 animals. PrP C KO cells also presented reduced glucose uptake upon insulin stimulation, due to reduced translocation of the glucose transporter Glut4. Thus, our results suggest that PrP C reflects susceptibility to the development of insulin resistance and metabolic syndrome. © 2017 The Author(s). Published by Portland Press Limited on behalf of the Biochemical Society.

Arabidopsis thaliana RALF1 opposes brassinosteroid effects on root cell elongation and lateral root formation

PubMed Central

Moura, Daniel S.

2014-01-01

Rapid alkalinization factor (RALF) is a peptide signal that plays a basic role in cell biology and most likely regulates cell expansion. In this study, transgenic Arabidopsis thaliana lines with high and low levels of AtRALF1 transcripts were used to investigate this peptide’s mechanism of action. Overexpression of the root-specific isoform AtRALF1 resulted in reduced cell size. Conversely, AtRALF1 silencing increased root length by increasing the size of root cells. AtRALF1-silenced plants also showed an increase in the number of lateral roots, whereas AtRALF1 overexpression produced the opposite effect. In addition, four AtRALF1-inducible genes were identified: two genes encoding proline-rich proteins (AtPRP1 and AtPRP3), one encoding a hydroxyproline-rich glycoprotein (AtHRPG2), and one encoding a xyloglucan endotransglucosylase (TCH4). These genes were expressed in roots and involved in cell-wall rearrangement, and their induction was concentration dependent. Furthermore, AtRALF1-overexpressing plants were less sensitive to exogenous brassinolide (BL); upon BL treatment, the plants showed no increase in root length and a compromised increase in hypocotyl elongation. In addition, the treatment had no effect on the number of emerged lateral roots. AtRALF1 also induces two brassinosteroid (BR)-downregulated genes involved in the BR biosynthetic pathway: the cytochrome P450 monooxygenases CONSTITUTIVE PHOTOMORPHISM AND DWARFISM (CPD) and DWARF4 (DWF4). Simultaneous treatment with both AtRALF1 and BL caused a reduction in AtRALF1-inducible gene expression levels, suggesting that these signals may compete for components shared by both pathways. Taken together, these results indicate an opposing effect of AtRALF1 and BL, and suggest that RALF’s mechanism of action could be to interfere with the BR signalling pathway. PMID:24620000

Antiplatelet Agents Can Promote Two-Peaked Thrombin Generation in Platelet Rich Plasma: Mechanism and Possible Applications

PubMed Central

Tarandovskiy, Ivan D.; Artemenko, Elena O.; Panteleev, Mikhail A.; Sinauridze, Elena I.; Ataullakhanov, Fazoil I.

2013-01-01

Background Thrombin generation assay is a convenient and widely used method for analysis of the blood coagulation system status. Thrombin generation curve (TGC) is usually bell-shaped with a single peak, but there are exceptions. In particular, TGC in platelet-rich plasma (PRP) can sometimes have two peaks. Objective We sought to understand the mechanism underlying the occurrence of two peaks in the PRP thrombin generation curve. Methods Tissue factor-induced thrombin generation in PRP and platelet-poor plasma (PPP) was monitored using continuous measurement of the hydrolysis rate of the thrombin-specific fluorogenic substrate Z-Gly-Gly-Arg-AMC. Expression of phosphatidylserine (PS) and CD62P on the surface of activated platelets was measured by flow cytometry using corresponding fluorescently labeled markers. Results The addition of the P2Y12 receptor antagonist MeS-AMP (160 µM), 83 nM prostaglandin E1 (PGE1), or 1.6% DMSO to PRP caused the appearance of two peaks in the TGC. The PS exposure after thrombin activation on washed platelets in a suspension supplemented with DMSO, PGE1 or MeS-AMP was delayed, which could indicate mechanism of the second peak formation. Supplementation of PRP with 1.6% DMSO plus 830 nM PGE1 mediated the disappearance of the second peak and decreased the amplitude of the first peak. Increasing the platelet concentration in the PRP promoted the consolidation of the two peaks into one. Conclusions Procoagulant tenase and prothrombinase complexes in PRP assemble on phospholipid surfaces containing PS of two types - plasma lipoproteins and the surface of activated platelets. Thrombin generation in the PRP can be two-peaked. The second peak appears in the presence of platelet antagonists as a result of delayed PS expression on platelets, which leads to delayed assembly of the membrane-dependent procoagulant complexes and a second wave of thrombin generation. PMID:23405196

PrPC Undergoes Basal to Apical Transcytosis in Polarized Epithelial MDCK Cells

PubMed Central

Arkhipenko, Alexander; Syan, Sylvie; Victoria, Guiliana Soraya

2016-01-01

The Prion Protein (PrP) is an ubiquitously expressed glycosylated membrane protein attached to the external leaflet of the plasma membrane via a glycosylphosphatidylinositol anchor (GPI). While the misfolded PrPSc scrapie isoform is the infectious agent of prion disease, the cellular isoform (PrPC) is an enigmatic protein with unclear function. Of interest, PrP localization in polarized MDCK cells is controversial and its mechanism of trafficking is not clear. Here we investigated PrP traffic in MDCK cells polarized on filters and in three-dimensional MDCK cysts, a more physiological model of polarized epithelia. We found that, unlike other GPI-anchored proteins (GPI-APs), PrP undergoes basolateral-to-apical transcytosis in fully polarized MDCK cells. Following this event full-length PrP and its cleavage fragments are segregated in different domains of the plasma membrane in polarized cells in both 2D and 3D cultures. PMID:27389581

Therapeutic Effect of Platelet-Rich Plasma in Rat Spinal Cord Injuries

PubMed Central

Chen, Nan-Fu; Sung, Chun-Sung; Wen, Zhi-Hong; Chen, Chun-Hong; Feng, Chien-Wei; Hung, Han-Chun; Yang, San-Nan; Tsui, Kuan-Hao; Chen, Wu-Fu

2018-01-01

Platelet-rich plasma (PRP) is prepared by centrifuging fresh blood in an anticoagulant state, and harvesting the platelet-rich portion or condensing platelets. Studies have consistently demonstrated that PRP concentrates are an abundant source of growth factors, such as platelet-derived growth factor (PDGF), transforming growth factor β (TGF-β), insulin-like growth factor 1 (IGF-1), and epithelial growth factor (EGF). The complex mechanisms underlying spinal cord injury (SCI) diminish intrinsic repair and neuronal regeneration. Several studies have suggested that growth factor-promoted axonal regeneration can occur for an extended period after injury. More importantly, the delivery of exogenous growth factors contained in PRP, such as EGF, IGF-1, and TGF-β, has neurotrophic effects on central nervous system (CNS) injuries and neurodegenerative diseases. However, only a few studies have investigated the effects of PRP on CNS injuries or neurodegenerative diseases. According to our review of relevant literature, no study has investigated the effect of intrathecal (i.t.) PRP injection into the injured spinal cord and activation of intrinsic mechanisms. In the present study, we directly injected i.t. PRP into rat spinal cords and examined the effects of PRP on normal and injured spinal cords. In rats with normal spinal cords, PRP induced microglia and astrocyte activation and PDGF-B and ICAM-1 expression. In rats with SCIs, i.t. PRP enhanced the locomotor recovery and spared white matter, promoted angiogenesis and neuronal regeneration, and modulated blood vessel size. Furthermore, a sustained treatment (a bolus of PRP followed by a 1/3 dose of initial PRP concentration) exerted more favorable therapeutic effects than a single dose of PRP. Our findings suggest by i.t. PRP stimulate angiogenesis, enhancing neuronal regeneration after SCI in rats. Although PRP induces minor inflammation in normal and injured spinal cords, it has many advantages. It is an autologous, biocompatible, nontoxic material that does not result in a major immune response. In addition, based on its safety and ease of preparation, we hypothesize that PRP is a promising therapeutic agent for SCI. PMID:29740270

Platelet-Rich Plasma Injection With Arthroscopic Acromioplasty for Chronic Rotator Cuff Tendinopathy: A Randomized Controlled Trial.

PubMed

Carr, Andrew J; Murphy, Richard; Dakin, Stephanie G; Rombach, Ines; Wheway, Kim; Watkins, Bridget; Franklin, Sarah L

2015-12-01

Platelet-rich plasma (PRP) has been proposed to augment tendon healing through improving tissue structure during the initial repair phase. To investigate both the clinical and tissue effects of the coapplication of PRP injection with arthroscopic acromioplasty (AA) in patients with chronic rotator cuff tendinopathy. Randomized controlled trial; Level of evidence, 1. The study comprised 60 randomized patients diagnosed with rotator cuff tendinopathy (55% women) aged between 35 and 75 years. Patients were randomized to AA alone or in combination with an injection of autologous PRP into the subacromial bursa (AA + PRP). Efficacy of treatment was assessed by analysis of patient-reported outcomes up to 2 years after treatment (Oxford Shoulder Score [OSS]) and by analysis of tendon biopsy specimens taken 12 weeks after treatment. There was no significant difference in the OSS between AA alone and AA + PRP at any time point in the study. From 12 weeks onward, there was a significant increase in the OSS for both groups compared with their baseline scores (P < .001). Bonar scoring determined no significant change in tissue structure with the coapplication of PRP compared with surgery alone. The number of blood vessels and tendon cellularity were significantly decreased in tissue biopsy specimens taken from PRP-treated patients. The expression of p53-positive apoptotic cells increased after AA + PRP but decreased after AA alone. Arthroscopic acromioplasty significantly improves long-term clinical outcomes up to 2 years. The coapplication of PRP did not affect clinical outcomes. PRP significantly alters the tissue characteristics in tendons after surgery with reduced cellularity and vascularity and increased levels of apoptosis. The coapplication of PRP did not improve clinical outcomes and may have potential deleterious effects on healing tendons. ISRCTN 10464365. © 2015 The Author(s).

Splicing Factor Prp8 Interacts With NES(AR) and Regulates Androgen Receptor in Prostate Cancer Cells.

PubMed

Wang, Dan; Nguyen, Minh M; Masoodi, Khalid Z; Singh, Prabhpreet; Jing, Yifeng; O'Malley, Katherine; Dar, Javid A; Dhir, Rajiv; Wang, Zhou

2015-12-01

Androgen receptor (AR) plays a pivotal role in the development of primary as well as advanced castration-resistant prostate cancer. Previous work in our lab identified a novel nuclear export signal (NES) (NES(AR)) in AR ligand-binding domain essential for AR nucleocytoplasmic trafficking. By characterizing the localization of green fluorescence protein (GFP)-tagged NES(AR), we designed and executed a yeast mutagenesis screen and isolated 7 yeast mutants that failed to display the NES(AR) export function. One of those mutants was identified as the splicing factor pre-mRNA processing factor 8 (Prp8). We further showed that Prp8 could regulate NES(AR) function using short hairpin RNA knockdown of Prp8 coupled with a rapamycin export assay in mammalian cells and knockdown of Prp8 could induce nuclear accumulation of GFP-tagged AR in PC3 cells. Prp8 expression was decreased in castration-resistant LuCaP35 xenograft tumors as compared with androgen-sensitive xenografts. Laser capture microdissection and quantitative PCR showed Prp8 mRNA levels were decreased in human prostate cancer specimens with high Gleason scores. In prostate cancer cells, coimmunoprecipitation and deletion mutagenesis revealed a physical interaction between Prp8 and AR mainly mediated by NES(AR). Luciferase assay with prostate specific antigen promoter-driven reporter demonstrated that Prp8 regulated AR transcription activity in prostate cancer cells. Interestingly, Prp8 knockdown also increased polyubiquitination of endogenous AR. This may be 1 possible mechanism by which it modulates AR activity. These results show that Prp8 is a novel AR cofactor that interacts with NES(AR) and regulates AR function in prostate cancer cells.

Ionic mechanisms of action of prion protein fragment PrP(106-126) in rat basal forebrain neurons.

PubMed

Alier, Kwai; Li, Zongming; Mactavish, David; Westaway, David; Jhamandas, Jack H

2010-08-01

Prion diseases are neurodegenerative disorders that are characterized by the presence of the misfolded prion protein (PrP). Neurotoxicity in these diseases may result from prion-induced modulation of ion channel function, changes in neuronal excitability, and consequent disruption of cellular homeostasis. We therefore examined PrP effects on a suite of potassium (K(+)) conductances that govern excitability of basal forebrain neurons. Our study examined the effects of a PrP fragment [PrP(106-126), 50 nM] on rat neurons using the patch clamp technique. In this paradigm, PrP(106-126) peptide, but not the "scrambled" sequence of PrP(106-126), evoked a reduction of whole-cell outward currents in a voltage range between -30 and +30 mV. Reduction of whole-cell outward currents was significantly attenuated in Ca(2+)-free external media and also in the presence of iberiotoxin, a blocker of calcium-activated potassium conductance. PrP(106-126) application also evoked a depression of the delayed rectifier (I(K)) and transient outward (I(A)) potassium currents. By using single cell RT-PCR, we identified the presence of two neuronal chemical phenotypes, GABAergic and cholinergic, in cells from which we recorded. Furthermore, cholinergic and GABAergic neurons were shown to express K(v)4.2 channels. Our data establish that the central region of PrP, defined by the PrP(106-126) peptide used at nanomolar concentrations, induces a reduction of specific K(+) channel conductances in basal forebrain neurons. These findings suggest novel links between PrP signalling partners inferred from genetic experiments, K(+) channels, and PrP-mediated neurotoxicity.

An in vitro evaluation of the anti-inflammatory effects of platelet-rich plasma, ketorolac, and methylprednisolone.

PubMed

Mazzocca, Augustus D; McCarthy, Mary Beth R; Intravia, Jessica; Beitzel, Knut; Apostolakos, John; Cote, Mark P; Bradley, James; Arciero, Robert A

2013-04-01

The purpose of this study was to quantify the extent of the anti-inflammatory effect of platelet-rich plasma (PRP) in a controlled in vitro environment. Through the stimulation of human umbilical vein endothelial cells with inflammatory cytokines (tumor necrosis factor α and interferon γ), cell adhesion molecule expression (E-selectin, vascular cell adhesion molecule, and human leukocyte antigen DR) and PRP's anti-inflammatory effect can be measured. PRP was produced from 3 individuals using a single-spin (PRPLP) process. Treatment groups include negative (unstimulated) controls, positive (stimulated) controls, ketorolac tromethamine, methylprednisolone, PRP, ketorolac-PRP, and methylprednisolone-PRP. A fluorescence assay of the cellular inflammation markers was measured by the BioTek Synergy HT plate reader (BioTek Instruments, Winooski, VT) at 0, 1, 2, and 5 days. At days 2 and 5, methylprednisolone treatment showed a 2.1- to 5.8-fold reduction (P < .05) in inflammation markers over PRP. In addition, PRP and ketorolac showed a 1.4- to 2.5-fold reduction (P < .05) in cellular inflammation markers over the control. There was no statistically significant difference between ketorolac and PRP. Although PRP and ketorolac reduced cellular inflammation markers (E-selectin, vascular cell adhesion molecule, and human leukocyte antigen DR) compared with control, neither caused as great a reduction as methylprednisolone. Although PRP and ketorolac did not produce as significant a reduction in cellular inflammation markers as methylprednisolone, they reduced cellular inflammation compared with the control. These agents may have clinical application as injectable anti-inflammatory medications. Copyright © 2013 Arthroscopy Association of North America. Published by Elsevier Inc. All rights reserved.

PrP0\\0 mice show behavioral abnormalities that suggest PrPC has a role in maintaining the cytoskeleton.

USDA-ARS?s Scientific Manuscript database

Background/Introduction. PrPC is highly conserved among mammals, but its natural function is unclear. Prnp ablated mice (PrP0/0) appear to develop normally and are able to reproduce. These observations seem to indicate that the gene is not essential for viability, in spite of it being highly conse...

Prion Protein Devoid of the Octapeptide Repeat Region Delays Bovine Spongiform Encephalopathy Pathogenesis in Mice.

PubMed

Hara, Hideyuki; Miyata, Hironori; Das, Nandita Rani; Chida, Junji; Yoshimochi, Tatenobu; Uchiyama, Keiji; Watanabe, Hitomi; Kondoh, Gen; Yokoyama, Takashi; Sakaguchi, Suehiro

2018-01-01

Conformational conversion of the cellular isoform of prion protein, PrP C , into the abnormally folded, amyloidogenic isoform, PrP Sc , is a key pathogenic event in prion diseases, including Creutzfeldt-Jakob disease in humans and scrapie and bovine spongiform encephalopathy (BSE) in animals. We previously reported that the octapeptide repeat (OR) region could be dispensable for converting PrP C into PrP Sc after infection with RML prions. We demonstrated that mice transgenically expressing mouse PrP with deletion of the OR region on the PrP knockout background, designated Tg(PrPΔOR)/ Prnp 0 / 0 mice, did not show reduced susceptibility to RML scrapie prions, with abundant accumulation of PrP Sc ΔOR in their brains. We show here that Tg(PrPΔOR)/ Prnp 0 / 0 mice were highly resistant to BSE prions, developing the disease with markedly elongated incubation times after infection with BSE prions. The conversion of PrPΔOR into PrP Sc ΔOR was markedly delayed in their brains. These results suggest that the OR region may have a crucial role in the conversion of PrP C into PrP Sc after infection with BSE prions. However, Tg(PrPΔOR)/ Prnp 0 / 0 mice remained susceptible to RML and 22L scrapie prions, developing the disease without elongated incubation times after infection with RML and 22L prions. PrP Sc ΔOR accumulated only slightly less in the brains of RML- or 22L-infected Tg(PrPΔOR)/ Prnp 0 / 0 mice than PrP Sc in control wild-type mice. Taken together, these results indicate that the OR region of PrP C could play a differential role in the pathogenesis of BSE prions and RML or 22L scrapie prions. IMPORTANCE Structure-function relationship studies of PrP C conformational conversion into PrP Sc are worthwhile to understand the mechanism of the conversion of PrP C into PrP Sc We show here that, by inoculating Tg(PrPΔOR)/ Prnp 0 / 0 mice with the three different strains of RML, 22L, and BSE prions, the OR region could play a differential role in the conversion of PrP C into PrP Sc after infection with RML or 22L scrapie prions and BSE prions. PrPΔOR was efficiently converted into PrP Sc ΔOR after infection with RML and 22L prions. However, the conversion of PrPΔOR into PrP Sc ΔOR was markedly delayed after infection with BSE prions. Further investigation into the role of the OR region in the conversion of PrP C into PrP Sc after infection with BSE prions might be helpful for understanding the pathogenesis of BSE prions. Copyright © 2017 American Society for Microbiology.

Prion Protein Does Not Confer Resistance to Hippocampus-Derived Zpl Cells against the Toxic Effects of Cu2+, Mn2+, Zn2+ and Co2+ Not Supporting a General Protective Role for PrP in Transition Metal Induced Toxicity

PubMed Central

Cingaram, Pradeep Kumar Reddy; Nyeste, Antal; Dondapati, Divya Teja; Fodor, Elfrieda; Welker, Ervin

2015-01-01

The interactions of transition metals with the prion protein (PrP) are well-documented and characterized, however, there is no consensus on their role in either the physiology of PrP or PrP-related neurodegenerative disorders. PrP has been reported to protect cells from the toxic stimuli of metals. By employing a cell viability assay, we examined the effects of various concentrations of Cu2+, Zn2+, Mn2+, and Co2+ on Zpl (Prnp -/-) and ZW (Prnp +/+) hippocampus-derived mouse neuronal cells. Prnp -/- Zpl cells were more sensitive to all four metals than PrP-expressing Zw cells. However, when we introduced PrP or only the empty vector into Zpl cells, we could not discern any protective effect associated with the presence of PrP. This observation was further corroborated when assessing the toxic effect of metals by propidium-iodide staining and fluorescence activated cell sorting analysis. Thus, our results on this mouse cell culture model do not seem to support a strong protective role for PrP against transition metal toxicity and also emphasize the necessity of extreme care when comparing cells derived from PrP knock-out and wild type mice. PMID:26426582

PrPC Governs Susceptibility to Prion Strains in Bank Vole, While Other Host Factors Modulate Strain Features.

PubMed

Espinosa, J C; Nonno, R; Di Bari, M; Aguilar-Calvo, P; Pirisinu, L; Fernández-Borges, N; Vanni, I; Vaccari, G; Marín-Moreno, A; Frassanito, P; Lorenzo, P; Agrimi, U; Torres, J M

2016-12-01

Bank vole is a rodent species that shows differential susceptibility to the experimental transmission of different prion strains. In this work, the transmission features of a panel of diverse prions with distinct origins were assayed both in bank vole expressing methionine at codon 109 (Bv109M) and in transgenic mice expressing physiological levels of bank vole PrP C (the BvPrP-Tg407 mouse line). This work is the first systematic comparison of the transmission features of a collection of prion isolates, representing a panel of diverse prion strains, in a transgenic-mouse model and in its natural counterpart. The results showed very similar transmission properties in both the natural species and the transgenic-mouse model, demonstrating the key role of the PrP amino acid sequence in prion transmission susceptibility. However, differences in the PrP Sc types propagated by Bv109M and BvPrP-Tg407 suggest that host factors other than PrP C modulate prion strain features. The differential susceptibility of bank voles to prion strains can be modeled in transgenic mice, suggesting that this selective susceptibility is controlled by the vole PrP sequence alone rather than by other species-specific factors. Differences in the phenotypes observed after prion transmissions in bank voles and in the transgenic mice suggest that host factors other than the PrP C sequence may affect the selection of the substrain replicating in the animal model. Copyright © 2016, American Society for Microbiology. All Rights Reserved.

Knockdown of the bovine prion gene PRNP by RNA interference (RNAi) technology.

PubMed

Sutou, Shizuyo; Kunishi, Miho; Kudo, Toshiyuki; Wongsrikeao, Pimprapar; Miyagishi, Makoto; Otoi, Takeshige

2007-07-26

Since prion gene-knockout mice do not contract prion diseases and animals in which production of prion protein (PrP) is reduced by half are resistant to the disease, we hypothesized that bovine animals with reduced PrP would be tolerant to BSE. Hence, attempts were made to produce bovine PRNP (bPRNP) that could be knocked down by RNA interference (RNAi) technology. Before an in vivo study, optimal conditions for knocking down bPRNP were determined in cultured mammalian cell systems. Factors examined included siRNA (short interfering RNA) expression plasmid vectors, target sites of PRNP, and lengths of siRNAs. Four siRNA expression plasmid vectors were used: three harboring different cloning sites were driven by the human U6 promoter (hU6), and one by the human tRNAVal promoter. Six target sites of bovine PRNP were designed using an algorithm. From 1 (22 mer) to 9 (19, 20, 21, 22, 23, 24, 25, 27, and 29 mer) siRNA expression vectors were constructed for each target site. As targets of siRNA, the entire bPRNP coding sequence was connected to the reporter gene of the fluorescent EGFP, or of firefly luciferase or Renilla luciferase. Target plasmid DNA was co-transfected with siRNA expression vector DNA into HeLaS3 cells, and fluorescence or luminescence was measured. The activities of siRNAs varied widely depending on the target sites, length of the siRNAs, and vectors used. Longer siRNAs were less effective, and 19 mer or 21 mer was generally optimal. Although 21 mer GGGGAGAACTTCACCGAAACT expressed by a hU6-driven plasmid with a Bsp MI cloning site was best under the present experimental conditions, the corresponding tRNA promoter-driven plasmid was almost equally useful. The effectiveness of this siRNA was confirmed by immunostaining and Western blotting. Four siRNA expression plasmid vectors, six target sites of bPRNP, and various lengths of siRNAs from 19 mer to 29 mer were examined to establish optimal conditions for knocking down of bPRNP in vitro. The most effective siRNA so far tested was 21 mer GGGGAGAACTTCACCGAAACT driven either by a hU6 or tRNA promoter, a finding that provides a basis for further studies in vivo.

Effect of Bone Marrow Aspirate Concentrate-Platelet-Rich Plasma on Tendon-Derived Stem Cells and Rotator Cuff Tendon Tear

PubMed Central

Kim, Sun Jeong; Song, Da Hyun; Park, Jong Wook; Park, Silvia; Kim, Sang Jun

2017-01-01

Bone marrow aspirate concentrates (BMACs) and platelet-rich plasma (PRP) are good sources to control the differentiation of tendon-derived stem cells (TDSCs), but there has been no study about the effect of the BMAC–PRP complex on TDSCs and tendinopathy. The aim of this study was to investigate the effect of BMAC–PRP on the TDSCs and to find the therapeutic effect of BMAC–PRP on the rotator cuff tendon tear. The chondrogenic and osteogenic potential of TDSCs decreased, but the adipogenic potential of TDSCs revealed no significant difference when they were cocultured with BMAC–PRP. Cell proliferation was significantly greater in TDSCs cocultured with BMAC–PRP than in TDSCs. The degree of wound closure (percentage) was different between TDSCs and TDSCs with BMAC–PRP. There was no significant difference in expression of collagen type I and type III in immunocytochemical staining in the presence of BMAC–PRP. Initial visual analog scale (VAS) score was 5.8±1.9, which changed to 5.0±2.3 at 3 weeks and 2.8±2.3 at 3 months after the BMAC–PRP injection (p<0.01). The American Shoulder Elbow Surgeon score changed from 39.4±13.0 at baseline to 52.9±22.9 at 3 weeks and 71.8±19.7 at 3 months after the injection (p<0.01). The initial torn area of the rotator cuff tendon was 30.2±24.5 mm2, and this area was reduced to 22.5±18.9 mm2 at 3 months, but the change was not significant (p > 0.05). The data indicate that BMAC–PRP enhances the proliferation and migration of TDSCs and prevents the aberrant chondrogenic and osteogenic differentiation of TDSCs, which might provide a mechanistic basis for the therapeutic benefits of BMAC–PRP for rotator cuff tendon tear. PMID:28105983

The prion protein has RNA binding and chaperoning properties characteristic of nucleocapsid protein NCP7 of HIV-1.

PubMed

Gabus, C; Derrington, E; Leblanc, P; Chnaiderman, J; Dormont, D; Swietnicki, W; Morillas, M; Surewicz, W K; Marc, D; Nandi, P; Darlix, J L

2001-06-01

Transmissible spongiform encephalopathies are fatal neurodegenerative diseases associated with the accumulation of a protease-resistant form of the prion protein (PrP). Although PrP is conserved in vertebrates, its function remains to be identified. In vitro PrP binds large nucleic acids causing the formation of nucleoprotein complexes resembling human immunodeficiency virus type 1 (HIV-1) nucleocapsid-RNA complexes and in vivo MuLV replication accelerates the scrapie infectious process, suggesting possible interactions between retroviruses and PrP. Retroviruses, including HIV-1 encode a major nucleic acid binding protein (NC protein) found within the virus where 2000 NC protein molecules coat the dimeric genome. NC is required in virus assembly and infection to chaperone RNA dimerization and packaging and in proviral DNA synthesis by reverse transcriptase (RT). In HIV-1, 5'-leader RNA/NC interactions appear to control these viral processes. This prompted us to compare and contrast the interactions of human and ovine PrP and HIV-1 NCp7 with HIV-1 5'-leader RNA. Results show that PrP has properties characteristic of NCp7 with respect to viral RNA dimerization and proviral DNA synthesis by RT. The NC-like properties of huPrP map to the N-terminal region of huPrP. Interestingly, PrP localizes in the membrane and cytoplasm of PrP-expressing cells. These findings suggest that PrP is a multifunctional protein possibly participating in nucleic acid metabolism.

Prion replication without host adaptation during interspecies transmissions.

PubMed

Bian, Jifeng; Khaychuk, Vadim; Angers, Rachel C; Fernández-Borges, Natalia; Vidal, Enric; Meyerett-Reid, Crystal; Kim, Sehun; Calvi, Carla L; Bartz, Jason C; Hoover, Edward A; Agrimi, Umberto; Richt, Jürgen A; Castilla, Joaquín; Telling, Glenn C

2017-01-31

Adaptation of prions to new species is thought to reflect the capacity of the host-encoded cellular form of the prion protein (PrP C ) to selectively propagate optimized prion conformations from larger ensembles generated in the species of origin. Here we describe an alternate replicative process, termed nonadaptive prion amplification (NAPA), in which dominant conformers bypass this requirement during particular interspecies transmissions. To model susceptibility of horses to prions, we produced transgenic (Tg) mice expressing cognate PrP C Although disease transmission to only a subset of infected TgEq indicated a significant barrier to EqPrP C conversion, the resulting horse prions unexpectedly failed to cause disease upon further passage to TgEq. TgD expressing deer PrP C was similarly refractory to deer prions from diseased TgD infected with mink prions. In both cases, the resulting prions transmitted to mice expressing PrP C from the species of prion origin, demonstrating that transmission barrier eradication of the originating prions was ephemeral and adaptation superficial in TgEq and TgD. Horse prions produced in vitro by protein misfolding cyclic amplification of mouse prions using horse PrP C also failed to infect TgEq but retained tropism for wild-type mice. Concordant patterns of neuropathology and prion deposition in susceptible mice infected with NAPA prions and the corresponding prion of origin confirmed preservation of strain properties. The comparable responses of both prion types to guanidine hydrochloride denaturation indicated this occurs because NAPA precludes selection of novel prion conformations. Our findings provide insights into mechanisms regulating interspecies prion transmission and a framework to reconcile puzzling epidemiological features of certain prion disorders.

Postinjury Exercise and Platelet-Rich Plasma Therapies Improve Skeletal Muscle Healing in Rats But Are Not Synergistic When Combined.

PubMed

Contreras-Muñoz, Paola; Torrella, Joan Ramon; Serres, Xavier; Rizo-Roca, David; De la Varga, Meritxell; Viscor, Ginés; Martínez-Ibáñez, Vicente; Peiró, José Luis; Järvinen, Tero A H; Rodas, Gil; Marotta, Mario

2017-07-01

Skeletal muscle injuries are the most common sports-related injury and a major concern in sports medicine. The effect of platelet-rich plasma (PRP) injections on muscle healing is still poorly understood, and current data are inconclusive. To evaluate the effects of an ultrasound-guided intramuscular PRP injection, administered 24 hours after injury, and/or posttraumatic daily exercise training for 2 weeks on skeletal muscle healing in a recently established rat model of skeletal muscle injury that highly mimics the muscle trauma seen in human athletes. Controlled laboratory study. A total of 40 rats were assigned to 5 groups. Injured rats (medial gastrocnemius injury) received a single PRP injection (PRP group), daily exercise training (Exer group), or a combination of a single PRP injection and daily exercise training (PRP-Exer group). Untreated and intramuscular saline-injected animals were used as controls. Muscle force was determined 2 weeks after muscle injury, and muscles were harvested and evaluated by means of histological assessment and immunofluorescence microscopy. Both PRP (exhibiting 4.8-fold higher platelet concentration than whole blood) and exercise training improved muscle strength (maximum tetanus force, TetF) in approximately 18%, 20%, and 30% of rats in the PRP, PRP-Exer, and Exer groups, respectively. Specific markers of muscle regeneration (developmental myosin heavy chain, dMHC) and scar formation (collagen I) demonstrated the beneficial effect of the tested therapies in accelerating the muscle healing process in rats. PRP and exercise treatments stimulated the growth of newly formed regenerating muscle fibers (1.5-, 2-, and 2.5-fold increase in myofiber cross-sectional area in PRP, PRP-Exer, and Exer groups, respectively) and reduced scar formation in injured skeletal muscle (20%, 34%, and 41% of reduction in PRP, PRP-Exer, and Exer groups, respectively). Exercise-treated muscles (PRP-Exer and Exer groups) had significantly reduced percentage of dMHC-positive regenerating fibers (35% and 47% decrease in dMHC expression, respectively), indicating that exercise therapies accelerated the muscle healing process witnessed by the more rapid replacement of the embryonic-developmental myosin isoform by mature muscle myosin isoforms. Intramuscular PRP injection and, especially, treadmill exercise improve histological outcome and force recovery of the injured skeletal muscle in a rat injury model that imitates sports-related muscle injuries in athletes. However, there was not a synergistic effect when both treatments were combined, suggesting that PRP does not add any beneficial effect to exercise-based therapy in the treatment of injured skeletal muscle. This study demonstrates the efficacy of an early active rehabilitation protocol or single intramuscular PRP injection on muscle recovery. The data also reveal that the outcome of the early active rehabilitation is adversely affected by the PRP injection when the two therapies are combined, and this could explain why PRP therapies have failed in randomized clinical trials where the athletes have adhered to postinjection rehabilitation protocols based on the principle of early, active mobilization.

Generating Bona Fide Mammalian Prions with Internal Deletions.

PubMed

Munoz-Montesino, Carola; Sizun, Christina; Moudjou, Mohammed; Herzog, Laetitia; Reine, Fabienne; Chapuis, Jérôme; Ciric, Danica; Igel-Egalon, Angelique; Laude, Hubert; Béringue, Vincent; Rezaei, Human; Dron, Michel

2016-08-01

Mammalian prions are PrP proteins with altered structures causing transmissible fatal neurodegenerative diseases. They are self-perpetuating through formation of beta-sheet-rich assemblies that seed conformational change of cellular PrP. Pathological PrP usually forms an insoluble protease-resistant core exhibiting beta-sheet structures but no more alpha-helical content, loosing the three alpha-helices contained in the correctly folded PrP. The lack of a high-resolution prion structure makes it difficult to understand the dynamics of conversion and to identify elements of the protein involved in this process. To determine whether completeness of residues within the protease-resistant domain is required for prions, we performed serial deletions in the helix H2 C terminus of ovine PrP, since this region has previously shown some tolerance to sequence changes without preventing prion replication. Deletions of either four or five residues essentially preserved the overall PrP structure and mutant PrP expressed in RK13 cells were efficiently converted into bona fide prions upon challenge by three different prion strains. Remarkably, deletions in PrP facilitated the replication of two strains that otherwise do not replicate in this cellular context. Prions with internal deletion were self-propagating and de novo infectious for naive homologous and wild-type PrP-expressing cells. Moreover, they caused transmissible spongiform encephalopathies in mice, with similar biochemical signatures and neuropathologies other than the original strains. Prion convertibility and transfer of strain-specific information are thus preserved despite shortening of an alpha-helix in PrP and removal of residues within prions. These findings provide new insights into sequence/structure/infectivity relationship for prions. Prions are misfolded PrP proteins that convert the normal protein into a replicate of their own abnormal form. They are responsible for invariably fatal neurodegenerative disorders. Other aggregation-prone proteins appear to have a prion-like mode of expansion in brains, such as in Alzheimer's or Parkinson's diseases. To date, the resolution of prion structure remains elusive. Thus, to genetically define the landscape of regions critical for prion conversion, we tested the effect of short deletions. We found that, surprisingly, removal of a portion of PrP, the C terminus of alpha-helix H2, did not hamper prion formation but generated infectious agents with an internal deletion that showed characteristics essentially similar to those of original infecting strains. Thus, we demonstrate that completeness of the residues inside prions is not necessary for maintaining infectivity and the main strain-specific information, while reporting one of the few if not the only bona fide prions with an internal deletion. Copyright © 2016, American Society for Microbiology. All Rights Reserved.

Generating Bona Fide Mammalian Prions with Internal Deletions

PubMed Central

Munoz-Montesino, Carola; Sizun, Christina; Moudjou, Mohammed; Herzog, Laetitia; Reine, Fabienne; Chapuis, Jérôme; Ciric, Danica; Igel-Egalon, Angelique; Laude, Hubert; Béringue, Vincent; Rezaei, Human

2016-01-01

ABSTRACT Mammalian prions are PrP proteins with altered structures causing transmissible fatal neurodegenerative diseases. They are self-perpetuating through formation of beta-sheet-rich assemblies that seed conformational change of cellular PrP. Pathological PrP usually forms an insoluble protease-resistant core exhibiting beta-sheet structures but no more alpha-helical content, loosing the three alpha-helices contained in the correctly folded PrP. The lack of a high-resolution prion structure makes it difficult to understand the dynamics of conversion and to identify elements of the protein involved in this process. To determine whether completeness of residues within the protease-resistant domain is required for prions, we performed serial deletions in the helix H2 C terminus of ovine PrP, since this region has previously shown some tolerance to sequence changes without preventing prion replication. Deletions of either four or five residues essentially preserved the overall PrP structure and mutant PrP expressed in RK13 cells were efficiently converted into bona fide prions upon challenge by three different prion strains. Remarkably, deletions in PrP facilitated the replication of two strains that otherwise do not replicate in this cellular context. Prions with internal deletion were self-propagating and de novo infectious for naive homologous and wild-type PrP-expressing cells. Moreover, they caused transmissible spongiform encephalopathies in mice, with similar biochemical signatures and neuropathologies other than the original strains. Prion convertibility and transfer of strain-specific information are thus preserved despite shortening of an alpha-helix in PrP and removal of residues within prions. These findings provide new insights into sequence/structure/infectivity relationship for prions. IMPORTANCE Prions are misfolded PrP proteins that convert the normal protein into a replicate of their own abnormal form. They are responsible for invariably fatal neurodegenerative disorders. Other aggregation-prone proteins appear to have a prion-like mode of expansion in brains, such as in Alzheimer's or Parkinson's diseases. To date, the resolution of prion structure remains elusive. Thus, to genetically define the landscape of regions critical for prion conversion, we tested the effect of short deletions. We found that, surprisingly, removal of a portion of PrP, the C terminus of alpha-helix H2, did not hamper prion formation but generated infectious agents with an internal deletion that showed characteristics essentially similar to those of original infecting strains. Thus, we demonstrate that completeness of the residues inside prions is not necessary for maintaining infectivity and the main strain-specific information, while reporting one of the few if not the only bona fide prions with an internal deletion. PMID:27226369

ERK1/2 and p38 MAP kinases control prion protein fragment 90-231-induced astrocyte proliferation and microglia activation.

PubMed

Thellung, Stefano; Villa, Valentina; Corsaro, Alessandro; Pellistri, Francesca; Venezia, Valentina; Russo, Claudio; Aceto, Antonio; Robello, Mauro; Florio, Tullio

2007-11-01

Astrogliosis and microglial activation are a common feature during prion diseases, causing the release of chemoattractant and proinflammatory factors as well as reactive free radicals, involved in neuronal degeneration. The recombinant protease-resistant domain of the prion protein (PrP90-231) displays in vitro neurotoxic properties when refolded in a beta-sheet-rich conformer. Here, we report that PrP90-231 induces the secretion of several cytokines, chemokines, and nitric oxide (NO) release, in both type I astrocytes and microglial cells. PrP90-231 elicited in both cell types the activation of ERK1/2 MAP kinase that displays, in astrocytes, a rapid kinetics and a proliferative response. Conversely, in microglia, PrP90-231-dependent MAP kinase activation was delayed and long lasting, inducing functional activation and growth arrest. In microglial cells, NO release, dependent on the expression of the inducible NO synthase (iNOS), and the secretion of the chemokine CCL5 were Ca(2+) dependent and under the control of the MAP kinases ERK1/2 and p38: ERK1/2 inhibition, using PD98059, reduced iNOS expression, while p38 blockade by PD169316 inhibited CCL5 release. In summary, we demonstrate that glial cells are activated by extracellular misfolded PrP90-231 resulting in a proliferative/secretive response of astrocytes and functional activation of microglia, both dependent on MAP kinase activation. In particular, in microglia, PrP90-231 activated a complex signalling cascade involved in the regulation of NO and chemokine release. These data argue in favor of a causal role for misfolded prion protein in sustaining glial activation and, possibly, glia-mediated neuronal death.

The cellular prion protein identifies bipotential cardiomyogenic progenitors.

PubMed

Hidaka, Kyoko; Shirai, Manabu; Lee, Jong-Kook; Wakayama, Takanari; Kodama, Itsuo; Schneider, Michael D; Morisaki, Takayuki

2010-01-08

The paucity of specific surface markers for cardiomyocytes and their progenitors has impeded the development of embryonic or pluripotent stem cell-based transplantation therapy. Identification of relevant surface markers may also enhance our understanding of the mechanisms underlying differentiation. Here, we show that cellular prion protein (PrP) serves as an effective surface marker for isolating nascent cardiomyocytes as well as cardiomyogenic progenitors. Embryonic stem (or embryo-derived) cells were analyzed using flow cytometry to detect surface expression of PrP and intracellular myosin heavy chain (Myhc) proteins. Sorted cells were then analyzed for their differentiation potential. PrP+ cells from beating embryoid bodies (EBs) frequently included nascent Myhc+ cardiomyocytes. Cultured PrP+ cells further differentiated, giving rise to cardiac troponin I+ definitive cardiomyocytes with either an atrial or a ventricular identity. These cells were electrophysiologically functional and able to survive in vivo after transplantation. Combining PrP with a second marker, platelet-derived growth factor receptor (PDGFR)alpha, enabled us to identify an earlier cardiomyogenic population from prebeating EBs, the PrP+PDGFRalpha+ (PRa) cells. The Myhc- PRa cells expressed cardiac transcription factors, such as Nkx2.5, T-box transcription factor 5, and Isl1 (islet LIM homeobox 1), although they were not completely committed. In mouse embryos, PRa cells in cardiac crescent at the 1 to 2 somite stage were Myhc+, whereas they were Myhc- at headfold stages. PRa cells clonally expanded in methlycellulose cultures. Furthermore, single Myhc- PRa cell-derived colonies contained both cardiac and smooth muscle cells. Thus, PrP demarcates a population of bipotential cardiomyogenic progenitor cells that can differentiate into cardiac or smooth muscle cells.

Variably Protease-Sensitive Prionopathy: A New Sporadic Disease of the Prion Protein

PubMed Central

Zou, Wen-Quan; Puoti, Gianfranco; Xiao, Xiangzhu; Yuan, Jue; Qing, Liuting; Cali, Ignazio; Shimoji, Miyuki; Langeveld, Jan P. M.; Castellani, Rudy; Notari, Silvio; Crain, Barbara; Schmidt, Robert E.; Geschwind, Michael; DeArmond, Stephen J.; Cairns, Nigel J.; Dickson, Dennis; Honig, Lawrence; Torres, Juan Maria; Mastrianni, James; Capellari, Sabina; Giaccone, Giorgio; Belay, Ermias D.; Schonberger, Lawrence B.; Cohen, Mark; Perry, George; Kong, Qingzhong; Parchi, Piero; Tagliavini, Fabrizio; Gambetti, Pierluigi

2011-01-01

Objective The objective of the study is to report 2 new genotypic forms of protease-sensitive prionopathy (PSPr), a novel prion disease described in 2008, in 11 subjects all homozygous for valine at codon 129 of the prion protein (PrP) gene (129VV). The 2 new PSPr forms affect individuals who are either homozygous for methionine (129MM) or heterozygous for methionine/valine (129MV). Methods Fifteen affected subjects with 129MM, 129MV, and 129VV underwent comparative evaluation at the National Prion Disease Pathology Surveillance Center for clinical, histopathologic, immunohistochemical, genotypical, and PrP characteristics. Results Disease duration (between 22 and 45 months) was significantly different in the 129VV and 129MV subjects. Most other phenotypic features along with the PrP electrophoretic profile were similar but distinguishable in the 3 129 genotypes. A major difference laid in the sensitivity to protease digestion of the disease-associated PrP, which was high in 129VV but much lower, or altogether lacking, in 129MV and 129MM. This difference prompted the substitution of the original designation with “variably protease-sensitive prionopathy” (VPSPr). None of the subjects had mutations in the PrP gene coding region. Interpretation Because all 3 129 genotypes are involved, and are associated with distinguishable phenotypes, VPSPr becomes the second sporadic prion protein disease with this feature after Creutzfeldt-Jakob disease, originally reported in 1920. However, the characteristics of the abnormal prion protein suggest that VPSPr is different from typical prion diseases, and perhaps more akin to subtypes of Gerstmann-Sträussler-Scheinker disease. PMID:20695009

Overexpression of PLK3 Mediates the Degradation of Abnormal Prion Proteins Dependent on Chaperone-Mediated Autophagy.

PubMed

Wang, Hui; Tian, Chan; Sun, Jing; Chen, Li-Na; Lv, Yan; Yang, Xiao-Dong; Xiao, Kang; Wang, Jing; Chen, Cao; Shi, Qi; Shao, Qi-Xiang; Dong, Xiao-Ping

2017-08-01

Polo-like kinase 3 (PLK3) is the main cause of cell cycle reentry-related neuronal apoptosis which has been implicated in the pathogenesis of prion diseases. Previous work also showed the regulatory activity of exogenous PLK3 on the degradation of PrP (prion protein) mutants and pathogenic PrP Sc ; however, the precise mechanisms remain unknown. In this study, we identified that the overexpression of PLK3-mediated degradation of PrP mutant and PrP Sc was repressed by lysosome rather than by proteasomal and macroautophagy inhibitors. Core components of chaperone-mediated autophagy (CMA) effectors, lysosome-associated membrane protein type 2A (LAMP2a), and heat shock cognate protein 70 (Hsc70) are markedly decreased in the HEK293T cells expressing PrP mutant and scrapie-infected cell line SMB-S15. Meanwhile, PrP mutant showed ability to interact with LAMP2a and Hsc70. Overexpression of PLK3 sufficiently increased the cellular levels of LAMP2a and Hsc70, accompanying with declining the accumulations of PrP mutant and PrP Sc . The kinase domain (KD) of PLK3 was responsible for elevating LAMP2a and Hsc70. Knockdown of endogenous PLK3 enhanced the activity of macroautophagy in the cultured cells. Moreover, time-dependent reductions of LAMP2a and Hsc70 were also observed in the brain tissues of hamster-adapted scrapie agent 263K-infected hamsters, indicating an impairment of CMA during prion infection. Those data indicate that the overexpression of PLK3-mediated degradation of abnormal PrP is largely dependent on CMA pathway.

A B lymphocyte mitogen is a Brucella abortus virulence factor required for persistent infection

PubMed Central

Spera, Juan Manuel; Ugalde, Juan Esteban; Mucci, Juan; Comerci, Diego J.; Ugalde, Rodolfo Augusto

2006-01-01

Microbial pathogens with the ability to establish chronic infections have evolved strategies to actively modulate the host immune response. Brucellosis is a disease caused by a Gram-negative intracellular pathogen that if not treated during the initial phase of the infection becomes chronic as the bacteria persist for the lifespan of the host. How this pathogen and others achieve this action is a largely unanswered question. We report here the identification of a Brucella abortus gene (prpA) directly involved in the immune modulation of the host. PrpA belongs to the proline-racemase family and elicits a B lymphocyte polyclonal activation that depends on the integrity of its proline-racemase catalytic site. Stimulation of splenocytes with PrpA also results in IL-10 secretion. Construction of a B. abortus-prpA mutant allowed us to assess the contribution of PrpA to the infection process. Mice infected with B. abortus induced an early and transient nonresponsive status of splenocytes to both Escherichia coli LPS and ConA. This phenomenon was not observed when mice were infected with a B. abortus-prpA mutant. Moreover, the B. abortus-prpA mutant had a reduced capacity to establish a chronic infection in mice. We propose that an early and transient nonresponsive immune condition of the host mediated by this B cell polyclonal activator is required for establishing a successful chronic infection by Brucella. PMID:17053080

The Tla protein of Porphyromonas gingivalis W50: a homolog of the RI protease precursor (PrpRI) is an outer membrane receptor required for growth on low levels of hemin.

PubMed

Aduse-Opoku, J; Slaney, J M; Rangarajan, M; Muir, J; Young, K A; Curtis, M A

1997-08-01

The prpR1 gene of Porphyromonas gingivalis W50 encodes the polyprotein precursor (PrpRI) of an extracellular arginine-specific protease. PrpRI is organized into four distinct domains (pro, alpha, beta, and gamma) and is processed to a heterodimeric protease (RI) which comprises the alpha and beta components in a noncovalent association. The alpha component contains the protease active site, whereas the beta component appears to have a role in adherence and hemagglutination processes. DNA sequences homologous to the coding region for the RI beta component are present at multiple loci on the P. gingivalis chromosome and may represent a family of related genes. In this report, we describe the cloning, sequence analysis, and characterization of one of these homologous loci isolated in plasmid pJM7. The 6,041-bp P. gingivalis DNA fragment in pJM7 contains a major open reading frame of 3,291 bp with coding potential for a protein with an Mr 118,700. An internal region of the deduced sequence (V304 to N768) shows 98% identity to the beta domain of PrpRI, and the recombinant product of pJM7 is immunoreactive with an antibody specific to the RI beta component. The N terminus of the deduced sequence has regional similarity to TonB-linked receptors which are frequently involved in periplasmic translocation of hemin, iron, colicins, or vitamin B12 in other bacteria. We have therefore designated this gene tla (TonB-linked adhesin). In contrast to the parent strain, an isogenic mutant of P. gingivalis W50 in which the tla was insertionally inactivated was unable to grow in medium containing low concentrations of hemin (<2.5 mg liter(-1)), and hemin-depleted cells of this mutant failed to respond to hemin in an agar diffusion plate assay. These data suggest a role for this gene product in hemin acquisition and utilization. Furthermore, the mutant produced significantly less arginine- and lysine-specific protease activities than the parent strain, indicating that there may be a regulatory relationship between tla and other members of this gene family.

The Tla protein of Porphyromonas gingivalis W50: a homolog of the RI protease precursor (PrpRI) is an outer membrane receptor required for growth on low levels of hemin.

PubMed Central

Aduse-Opoku, J; Slaney, J M; Rangarajan, M; Muir, J; Young, K A; Curtis, M A

1997-01-01

The prpR1 gene of Porphyromonas gingivalis W50 encodes the polyprotein precursor (PrpRI) of an extracellular arginine-specific protease. PrpRI is organized into four distinct domains (pro, alpha, beta, and gamma) and is processed to a heterodimeric protease (RI) which comprises the alpha and beta components in a noncovalent association. The alpha component contains the protease active site, whereas the beta component appears to have a role in adherence and hemagglutination processes. DNA sequences homologous to the coding region for the RI beta component are present at multiple loci on the P. gingivalis chromosome and may represent a family of related genes. In this report, we describe the cloning, sequence analysis, and characterization of one of these homologous loci isolated in plasmid pJM7. The 6,041-bp P. gingivalis DNA fragment in pJM7 contains a major open reading frame of 3,291 bp with coding potential for a protein with an Mr 118,700. An internal region of the deduced sequence (V304 to N768) shows 98% identity to the beta domain of PrpRI, and the recombinant product of pJM7 is immunoreactive with an antibody specific to the RI beta component. The N terminus of the deduced sequence has regional similarity to TonB-linked receptors which are frequently involved in periplasmic translocation of hemin, iron, colicins, or vitamin B12 in other bacteria. We have therefore designated this gene tla (TonB-linked adhesin). In contrast to the parent strain, an isogenic mutant of P. gingivalis W50 in which the tla was insertionally inactivated was unable to grow in medium containing low concentrations of hemin (<2.5 mg liter(-1)), and hemin-depleted cells of this mutant failed to respond to hemin in an agar diffusion plate assay. These data suggest a role for this gene product in hemin acquisition and utilization. Furthermore, the mutant produced significantly less arginine- and lysine-specific protease activities than the parent strain, indicating that there may be a regulatory relationship between tla and other members of this gene family. PMID:9244265

Optimization of Saanen sperm genes amplification: evaluation of standardized protocols in genetically uncharacterized rural goats reared under a subtropical environment.

PubMed

Barbour, Elie K; Saade, Maya F; Sleiman, Fawwak T; Hamadeh, Shady K; Mouneimne, Youssef; Kassaifi, Zeina; Kayali, Ghazi; Harakeh, Steve; Jaber, Lina S; Shaib, Houssam A

2012-10-01

The purpose of this research is to optimize quantitatively the amplification of specific sperm genes in reference genomically characterized Saanen goat and to evaluate the standardized protocols applicability on sperms of uncharacterized genome of rural goats reared under subtropical environment for inclusion in future selection programs. The optimization of the protocols in Saanen sperms included three production genes (growth hormone (GH) exons 2, 3, and 4, αS1-casein (CSN1S1), and α-lactalbumin) and two health genes (MHC class II DRB and prion (PrP)). The optimization was based on varying the primers concentrations and the inclusion of a PCR cosolvent (Triton X). The impact of the studied variables on statistically significant increase in the yield of amplicons was noticed in four out of five (80%) optimized protocols, namely in those related to GH, CSN1S1, α-lactalbumin, and PrP genes (P < 0.05). There was no significant difference in the yield of amplicons related to MHC class II DRB gene, regardless of the variables used (P > 0.05). The applicability of the optimized protocols of Saanen sperm genes on amplification of uncharacterized rural goat sperms revealed a 100% success in tested individuals for amplification of GH, CSN1S1, α-lactalbumin, and MHC class II DRB genes and a 75% success for the PrP gene. The significant success in applicability of the Saanen quantitatively optimized protocols to other uncharacterized genome of rural goats allows for their inclusion in future selection, targeting the sustainability of this farming system in a subtropical environment and the improvement of the farmers livelihood.

Pre-mRNA Processing Factor Prp18 Is a Stimulatory Factor of Influenza Virus RNA Synthesis and Possesses Nucleoprotein Chaperone Activity.

PubMed

Minakuchi, M; Sugiyama, K; Kato, Y; Naito, T; Okuwaki, M; Kawaguchi, A; Nagata, K

2017-02-01

The genome of influenza virus (viral RNA [vRNA]) is associated with the nucleoprotein (NP) and viral RNA-dependent RNA polymerases and forms helical viral ribonucleoprotein (vRNP) complexes. The NP-vRNA complex is the biologically active template for RNA synthesis by the viral polymerase. Previously, we identified human pre-mRNA processing factor 18 (Prp18) as a stimulatory factor for viral RNA synthesis using a Saccharomyces cerevisiae replicon system and a single-gene deletion library of Saccharomyces cerevisiae (T. Naito, Y. Kiyasu, K. Sugiyama, A. Kimura, R. Nakano, A. Matsukage, and K. Nagata, Proc Natl Acad Sci USA, 104:18235-18240, 2007, https://doi.org/10.1073/pnas.0705856104). In infected Prp18 knockdown (KD) cells, the synthesis of vRNA, cRNA, and viral mRNAs was reduced. Prp18 was found to stimulate in vitro viral RNA synthesis through its interaction with NP. Analyses using in vitro RNA synthesis reactions revealed that Prp18 dissociates newly synthesized RNA from the template after the early elongation step to stimulate the elongation reaction. We found that Prp18 functions as a chaperone for NP to facilitate the formation of NP-RNA complexes. Based on these results, it is suggested that Prp18 accelerates influenza virus RNA synthesis as an NP chaperone for the processive elongation reaction. Templates for viral RNA synthesis of negative-stranded RNA viruses are not naked RNA but rather RNA encapsidated by viral nucleocapsid proteins forming vRNP complexes. However, viral basic proteins tend to aggregate under physiological ionic strength without chaperones. We identified the pre-mRNA processing factor Prp18 as a stimulatory factor for influenza virus RNA synthesis. We found that one of the targets of Prp18 is NP. Prp18 facilitates the elongation reaction of viral polymerases by preventing the deleterious annealing of newly synthesized RNA to the template. Prp18 functions as a chaperone for NP to stimulate the formation of NP-RNA complexes. Based on these results, we propose that Prp18 may be required to maintain the structural integrity of vRNP for processive template reading. Copyright © 2017 American Society for Microbiology.

Profoundly different prion diseases in knock-in mice carrying single PrP codon substitutions associated with human diseases.

PubMed

Jackson, Walker S; Borkowski, Andrew W; Watson, Nicki E; King, Oliver D; Faas, Henryk; Jasanoff, Alan; Lindquist, Susan

2013-09-03

In man, mutations in different regions of the prion protein (PrP) are associated with infectious neurodegenerative diseases that have remarkably different clinical signs and neuropathological lesions. To explore the roots of this phenomenon, we created a knock-in mouse model carrying the mutation associated with one of these diseases [Creutzfeldt-Jakob disease (CJD)] that was exactly analogous to a previous knock-in model of a different prion disease [fatal familial insomnia (FFI)]. Together with the WT parent, this created an allelic series of three lines, each expressing the same protein with a single amino acid difference, and with all native regulatory elements intact. The previously described FFI mice develop neuronal loss and intense reactive gliosis in the thalamus, as seen in humans with FFI. In contrast, CJD mice had the hallmark features of CJD, spongiosis and proteinase K-resistant PrP aggregates, initially developing in the hippocampus and cerebellum but absent from the thalamus. A molecular transmission barrier protected the mice from any infectious prion agents that might have been present in our mouse facility and allowed us to conclude that the diseases occurred spontaneously. Importantly, both models created agents that caused a transmissible neurodegenerative disease in WT mice. We conclude that single codon differences in a single gene in an otherwise normal genome can cause remarkably different neurodegenerative diseases and are sufficient to create distinct protein-based infectious elements.

A stretch of residues within the protease-resistant core is not necessary for prion structure and infectivity.

PubMed

Munoz-Montesino, Carola; Sizun, Christina; Moudjou, Mohammed; Herzog, Laetitia; Reine, Fabienne; Igel-Egalon, Angelique; Barbereau, Clément; Chapuis, Jérôme; Ciric, Danica; Laude, Hubert; Béringue, Vincent; Rezaei, Human; Dron, Michel

2017-01-02

Mapping out regions of PrP influencing prion conversion remains a challenging issue complicated by the lack of prion structure. The portion of PrP associated with infectivity contains the α-helical domain of the correctly folded protein and turns into a β-sheet-rich insoluble core in prions. Deletions performed so far inside this segment essentially prevented the conversion. Recently we found that deletion of the last C-terminal residues of the helix H2 was fully compatible with prion conversion in the RK13-ovPrP cell culture model, using 3 different infecting strains. This was in agreement with preservation of the overall PrP C structure even after removal of up to one-third of this helix. Prions with internal deletion were infectious for cells and mice expressing the wild-type PrP and they retained prion strain-specific characteristics. We thus identified a piece of the prion domain that is neither necessary for the conformational transition of PrP C nor for the formation of a stable prion structure.

Antimicrobial activity of platelet-rich plasma and other plasma preparations against periodontal pathogens.

PubMed

Yang, Li-Chiu; Hu, Suh-Woan; Yan, Min; Yang, Jaw-Ji; Tsou, Sing-Hua; Lin, Yuh-Yih

2015-02-01

In addition to releasing a pool of growth factors during activation, platelets have many features that indicate their role in the anti-infective host defense. The antimicrobial activities of platelet-rich plasma (PRP) and related plasma preparations against periodontal disease-associated bacteria were evaluated. Four distinct plasma fractions were extracted in the formulation used commonly in dentistry and were tested for their antibacterial properties against three periodontal bacteria: Porphyromonas gingivalis, Aggregatibacter actinomycetemcomitans, and Fusobacterium nucleatum. The minimum inhibitory concentration of each plasma preparation was determined, and in vitro time-kill assays were used to detect their abilities to inhibit bacterial growth. Bacterial adhesion interference and the susceptibility of bacterial adherence by these plasma preparations were also conducted. All plasma preparations can inhibit bacterial growth, with PRP showing the superior activity. Bacterial growth inhibition by PRP occurred in the first 24 hours after application in the time-kill assay. PRP interfered with P. gingivalis and A. actinomycetemcomitans attachment and enhanced exfoliation of attached P. gingivalis but had no influences on F. nucleatum bacterial adherence. PRP expressed antibacterial properties, which may be attributed to platelets possessing additional antimicrobial molecules. The application of PRP on periodontal surgical sites is advisable because of its regenerative potential and its antibacterial effects.

Effect of Bone Marrow Aspirate Concentrate-Platelet-Rich Plasma on Tendon-Derived Stem Cells and Rotator Cuff Tendon Tear.

PubMed

Kim, Sun Jeong; Song, Da Hyun; Park, Jong Wook; Park, Silvia; Kim, Sang Jun

2017-05-09

Bone marrow aspirate concentrates (BMACs) and platelet-rich plasma (PRP) are good sources to control the differentiation of tendon-derived stem cells (TDSCs), but there has been no study about the effect of the BMAC-PRP complex on TDSCs and tendinopathy. The aim of this study was to investigate the effect of BMAC-PRP on the TDSCs and to find the therapeutic effect of BMAC-PRP on the rotator cuff tendon tear. The chondrogenic and osteogenic potential of TDSCs decreased, but the adipogenic potential of TDSCs revealed no significant difference when they were cocultured with BMAC-PRP. Cell proliferation was significantly greater in TDSCs cocultured with BMAC-PRP than in TDSCs. The degree of wound closure (percentage) was different between TDSCs and TDSCs with BMAC-PRP. There was no significant difference in expression of collagen type I and type III in immunocytochemical staining in the presence of BMAC-PRP. Initial visual analog scale (VAS) score was 5.8 ± 1.9, which changed to 5.0 ± 2.3 at 3 weeks and 2.8 ± 2.3 at 3 months after the BMAC-PRP injection (p < 0.01). The American Shoulder Elbow Surgeon score changed from 39.4 ± 13.0 at baseline to 52.9 ± 22.9 at 3 weeks and 71.8 ± 19.7 at 3 months after the injection (p < 0.01). The initial torn area of the rotator cuff tendon was 30.2 ± 24.5 mm2, and this area was reduced to 22.5 ± 18.9 mm2 at 3 months, but the change was not significant (p > 0.05). The data indicate that BMAC-PRP enhances the proliferation and migration of TDSCs and prevents the aberrant chondrogenic and osteogenic differentiation of TDSCs, which might provide a mechanistic basis for the therapeutic benefits of BMAC-PRP for rotator cuff tendon tear.

A systematic investigation of production of synthetic prions from recombinant prion protein.

PubMed

Schmidt, Christian; Fizet, Jeremie; Properzi, Francesca; Batchelor, Mark; Sandberg, Malin K; Edgeworth, Julie A; Afran, Louise; Ho, Sammy; Badhan, Anjna; Klier, Steffi; Linehan, Jacqueline M; Brandner, Sebastian; Hosszu, Laszlo L P; Tattum, M Howard; Jat, Parmjit; Clarke, Anthony R; Klöhn, Peter C; Wadsworth, Jonathan D F; Jackson, Graham S; Collinge, John

2015-12-01

According to the protein-only hypothesis, infectious mammalian prions, which exist as distinct strains with discrete biological properties, consist of multichain assemblies of misfolded cellular prion protein (PrP). A critical test would be to produce prion strains synthetically from defined components. Crucially, high-titre 'synthetic' prions could then be used to determine the structural basis of infectivity and strain diversity at the atomic level. While there have been multiple reports of production of prions from bacterially expressed recombinant PrP using various methods, systematic production of high-titre material in a form suitable for structural analysis remains a key goal. Here, we report a novel high-throughput strategy for exploring a matrix of conditions, additives and potential cofactors that might generate high-titre prions from recombinant mouse PrP, with screening for infectivity using a sensitive automated cell-based bioassay. Overall, approximately 20,000 unique conditions were examined. While some resulted in apparently infected cell cultures, this was transient and not reproducible. We also adapted published methods that reported production of synthetic prions from recombinant hamster PrP, but again did not find evidence of significant infectious titre when using recombinant mouse PrP as substrate. Collectively, our findings are consistent with the formation of prion infectivity from recombinant mouse PrP being a rare stochastic event and we conclude that systematic generation of prions from recombinant PrP may only become possible once the detailed structure of authentic ex vivo prions is solved. © 2015 The Authors.

A systematic investigation of production of synthetic prions from recombinant prion protein

PubMed Central

Schmidt, Christian; Fizet, Jeremie; Properzi, Francesca; Batchelor, Mark; Sandberg, Malin K.; Edgeworth, Julie A.; Afran, Louise; Ho, Sammy; Badhan, Anjna; Klier, Steffi; Linehan, Jacqueline M.; Brandner, Sebastian; Hosszu, Laszlo L. P.; Tattum, M. Howard; Jat, Parmjit; Clarke, Anthony R.; Klöhn, Peter C.; Wadsworth, Jonathan D. F.; Jackson, Graham S.; Collinge, John

2015-01-01

According to the protein-only hypothesis, infectious mammalian prions, which exist as distinct strains with discrete biological properties, consist of multichain assemblies of misfolded cellular prion protein (PrP). A critical test would be to produce prion strains synthetically from defined components. Crucially, high-titre ‘synthetic' prions could then be used to determine the structural basis of infectivity and strain diversity at the atomic level. While there have been multiple reports of production of prions from bacterially expressed recombinant PrP using various methods, systematic production of high-titre material in a form suitable for structural analysis remains a key goal. Here, we report a novel high-throughput strategy for exploring a matrix of conditions, additives and potential cofactors that might generate high-titre prions from recombinant mouse PrP, with screening for infectivity using a sensitive automated cell-based bioassay. Overall, approximately 20 000 unique conditions were examined. While some resulted in apparently infected cell cultures, this was transient and not reproducible. We also adapted published methods that reported production of synthetic prions from recombinant hamster PrP, but again did not find evidence of significant infectious titre when using recombinant mouse PrP as substrate. Collectively, our findings are consistent with the formation of prion infectivity from recombinant mouse PrP being a rare stochastic event and we conclude that systematic generation of prions from recombinant PrP may only become possible once the detailed structure of authentic ex vivo prions is solved. PMID:26631378

Semi-synthesis of murine prion protein by native chemical ligation and chemical activation for preparation of polypeptide-α-thioester.

PubMed

Shi, Lei; Chen, Huai; Zhang, Si-Yu; Chu, Ting-Ting; Zhao, Yu-Fen; Chen, Yong-Xiang; Li, Yan-Mei

2017-06-01

Prions are suspected as pathogen of the fatal transmissible spongiform encephalopathies. Strategies to access homogenous prion protein (PrP) are required to fully comprehend the molecular mechanism of prion diseases. However, the polypeptide fragments from PrP show a high tendency to form aggregates, which is a gigantic obstacle of protein synthesis and purification. In this study, murine prion sequence 90 to 230 that is the core three-dimensional structure domain was constructed from three segments murine PrP (mPrP)(90-177), mPrP(178-212), and mPrP(213-230) by combining protein expression, chemical synthesis and chemical ligation. The protein sequence 90 to 177 was obtained from expression and finally converted into the polypeptide hydrazide by chemical activation of a cysteine in the tail. The other two polypeptide fragments of the C-terminal were obtained by chemical synthesis, which utilized the strategies of isopeptide and pseudoproline building blocks to complete the synthesis of such difficult sequences. The three segments were finally assembled by sequentially using native chemical ligation. This strategy will allow more straightforward access to homogeneously modified PrP variants. Copyright © 2017 European Peptide Society and John Wiley & Sons, Ltd. Copyright © 2017 European Peptide Society and John Wiley & Sons, Ltd.

Salivary proline-rich protein may reduce tannin-iron chelation: a systematic narrative review.

PubMed

Delimont, Nicole M; Rosenkranz, Sara K; Haub, Mark D; Lindshield, Brian L

2017-01-01

Tannins are often cited for antinutritional effects, including chelation of non-heme iron. Despite this, studies exploring non-heme iron bioavailability inhibition with long-term consumption have reported mixed results. Salivary proline-rich proteins (PRPs) may mediate tannin-antinutritional effects on non-heme iron bioavailability. To review evidence regarding biochemical binding mechanisms and affinity states between PRPs and tannins, as well as effects of PRPs on non-heme iron bioavailability with tannin consumption in vivo. Narrative systematic review and meta-analysis. Common themes in biochemical modeling and affinity studies were collated for summary and synthesis; data were extracted from in vivo experiments for meta-analysis. Thirty-two studies were included in analysis. Common themes that positively influenced tannin-PRP binding included specificity of tannin-PRP binding, PRP and tannin stereochemistry. Hydrolyzable tannins have different affinities than condensed tannins when binding to PRPs. In vivo, hepatic iron stores and non-heme iron absorption are not significantly affected by tannin consumption ( d  = -0.64-1.84; -2.7-0.13 respectively), and PRP expression may increase non-heme iron bioavailability with tannin consumption. In vitro modeling suggests that tannins favor PRP binding over iron chelation throughout digestion. Hydrolyzable tannins are not representative of tannin impact on non-heme iron bioavailability in food tannins because of their unique structural properties and PRP affinities. With tannin consumption, PRP production is increased, and may be an initial line of defense against tannin-non-heme iron chelation in vivo . More research is needed to compare competitive binding of tannin-PRP to tannin-non-heme iron complexes, and elucidate PRPs' role in adaption to non-heme iron bioavailability in vivo.

Competition between pre-mRNAs for the splicing machinery drives global regulation of splicing

PubMed Central

Munding, Elizabeth M.; Shiue, Lily; Katzman, Sol; Donohue, John Paul; Ares, Manuel

2013-01-01

Summary During meiosis in yeast, global splicing efficiency increases and then decreases. Here we provide evidence that splicing improves due to reduced competition for the splicing machinery. The timing of this regulation corresponds to repression and reactivation of ribosomal protein genes (RPGs) during meiosis. In vegetative cells RPG repression by rapamycin treatment also increases splicing efficiency. Down-regulation of the RPG-dedicated transcription factor gene IFH1 genetically suppresses two spliceosome mutations prp11-1 and prp4-1, and globally restores splicing efficiency in prp4-1 cells. We conclude that the splicing apparatus is limiting and pre-mRNAs compete. Splicing efficiency of a pre-mRNA therefore depends not just on its own concentration and affinity for limiting splicing factor(s) but also on those of competing pre-mRNAs. Competition between RNAs for limiting RNA processing factors appears to be a general condition in eukaryotic cells important for function of a variety of post-transcriptional control mechanisms including miRNA repression, polyadenylation and splicing. PMID:23891561

Prion protein gene analysis in three kindreds with fatal familial insomnia (FFI): Codon 178 mutation and codon 129 polymorphism

DOE Office of Scientific and Technical Information (OSTI.GOV)

Medori, R.; Tritschler, H.J.

1993-10-01

Fatal familial insomnia (FFI) is a disease linked to a GAC(Asp) [yields] AAC(Asn) mutation in codon 178 of the prion protein (PrP) gene. FFI is characterized clinically by untreatable progressive insomnia, dysautonomia, and motor dysfunctions and is characterized pathologically by selective thalamic atrophy. The authors confirmed the 178[sup Asn] mutation in the PrP gene of a third FFI family of French ancestry. Three family members who are under 40 years of age and who inherited the mutation showed only reduced perfusion in the basal ganglia on single photon emission computerized tomography. Some FFI features differ from the clinical and neuropathologicmore » findings associated with 178[sup Asn] reported elsewhere. However, additional intragenic mutations accounting for the phenotypic differences were not observed in two affected individuals. In other sporadic and familial forms of Creutzfeldt-Jakob disease and Gerstmann-Straeussler syndrome, Met or Val homozygosity at polymorphic codon 129 is associated with a more severe phenotype, younger age at onset, and faster progression. In FFI, young and old individuals at disease onset had 129[sup Met/Val]. Moreover, of five 178[sup Asn] individuals who are above age-at-onset range and who are well, two have 129[sup Met] and three have 129[sup Met/Val], suggesting that polymorphic site 129 does not modulate FFI phenotypic expression. Genetic heterogeneity and environment may play an important role in inter- and intrafamilial variability of the 178[sup Asn] mutation. 32 refs., 5 figs., 1 tab.« less

Substitutions of PrP N-terminal histidine residues modulate scrapie disease pathogenesis and incubation time in transgenic mice

PubMed Central

Eigenbrod, Sabina; Frick, Petra; Bertsch, Uwe; Mitteregger-Kretzschmar, Gerda; Mielke, Janina; Maringer, Marko; Piening, Niklas; Hepp, Alexander; Daude, Nathalie; Windl, Otto; Levin, Johannes; Giese, Armin; Sakthivelu, Vignesh; Tatzelt, Jörg

2017-01-01

Prion diseases have been linked to impaired copper homeostasis and copper induced-oxidative damage to the brain. Divalent metal ions, such as Cu2+ and Zn2+, bind to cellular prion protein (PrPC) at octapeptide repeat (OR) and non-OR sites within the N-terminal half of the protein but information on the impact of such binding on conversion to the misfolded isoform often derives from studies using either OR and non-OR peptides or bacterially-expressed recombinant PrP. Here we created new transgenic mouse lines expressing PrP with disrupted copper binding sites within all four histidine-containing OR's (sites 1–4, H60G, H68G, H76G, H84G, "TetraH>G" allele) or at site 5 (composed of residues His-95 and His-110; "H95G" allele) and monitored the formation of misfolded PrP in vivo. Novel transgenic mice expressing PrP(TetraH>G) at levels comparable to wild-type (wt) controls were susceptible to mouse-adapted scrapie strain RML but showed significantly prolonged incubation times. In contrast, amino acid replacement at residue 95 accelerated disease progression in corresponding PrP(H95G) mice. Neuropathological lesions in terminally ill transgenic mice were similar to scrapie-infected wt controls, but less severe. The pattern of PrPSc deposition, however, was not synaptic as seen in wt animals, but instead dense globular plaque-like accumulations of PrPSc in TgPrP(TetraH>G) mice and diffuse PrPSc deposition in (TgPrP(H95G) mice), were observed throughout all brain sections. We conclude that OR and site 5 histidine substitutions have divergent phenotypic impacts and that cis interactions between the OR region and the site 5 region modulate pathogenic outcomes by affecting the PrP globular domain. PMID:29220360

Introducing a Rigid Loop Structure from Deer into Mouse Prion Protein Increases Its Propensity for Misfolding In Vitro

PubMed Central

Kyle, Leah M.; John, Theodore R.; Schätzl, Hermann M.; Lewis, Randolph V.

2013-01-01

Prion diseases are fatal neurodegenerative disorders characterized by misfolding of the cellular prion protein (PrPc) into the disease-associated isoform (PrPSc) that has increased β-sheet content and partial resistance to proteolytic digestion. Prion diseases from different mammalian species have varying propensities for transmission upon exposure of an uninfected host to the infectious agent. Chronic Wasting Disease (CWD) is a highly transmissible prion disease that affects free ranging and farmed populations of cervids including deer, elk and moose, as well as other mammals in experimental settings. The molecular mechanisms allowing CWD to maintain comparatively high transmission rates have not been determined. Previous work has identified a unique structural feature in cervid PrP, a rigid loop between β-sheet 2 and α-helix 2 on the surface of the protein. This study was designed to test the hypothesis that the rigid loop has a direct influence on the misfolding process. The rigid loop was introduced into murine PrP as the result of two amino acid substitutions: S170N and N174T. Wild-type and rigid loop murine PrP were expressed in E. coli and purified. Misfolding propensity was compared for the two proteins using biochemical techniques and cell free misfolding and conversion systems. Murine PrP with a rigid loop misfolded in cell free systems with greater propensity than wild type murine PrP. In a lipid-based conversion assay, rigid loop PrP converted to a PK resistant, aggregated isoform at lower concentrations than wild-type PrP. Using both proteins as substrates in real time quaking-induced conversion, rigid loop PrP adopted a misfolded isoform more readily than wild type PrP. Taken together, these findings may help explain the high transmission rates observed for CWD within cervids. PMID:23825561

Melatonin-mediated β-catenin activation protects neuron cells against prion protein-induced neurotoxicity.

PubMed

Jeong, Jae-Kyo; Lee, Ju-Hee; Moon, Ji-Hong; Lee, You-Jin; Park, Sang-Youel

2014-11-01

Activation of β-catenin in neurons regulates mitochondrial function and protects against protein misfolding disorders, including Alzheimer's disease and Huntington's disease. Melatonin, a natural secretory product of the pineal gland, exerts neuroprotective effects through the activation of β-catenin. In this study, melatonin increased β-catenin protein expression and activation in human neuroblastoma cell lines SH-SY5Y cells. Melatonin also inhibited PrP (106-126)-induced neurotoxicity and the inhibition attenuated by treatment of β-catenin inhibitor ICG-001. Activation of β-catenin blocked PrP (106-126)-mediated downregulation of anti-apoptotic protein survivin and Bcl-2. Reduction of mitochondrial membrane potential, translocation of Bax, and cytochrome c release which induced by PrP (106-126) treatment were inhibited by β-catenin activation, which contributed to prevented PrP (106-126)-induced neuronal cell death. In conclusion, β-catenin activation by melatonin prevented PrP (106-126)-induced neuronal cell death through regulating anti-apoptotic proteins and mitochondrial pathways. These results also suggest the therapeutic value of Wnt/β-catenin signaling in prion-related disorders as influenced by melatonin. © 2014 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.

Prion Propagation in Cells Expressing PrP Glycosylation Mutants ▿

PubMed Central

Salamat, Muhammad K.; Dron, Michel; Chapuis, Jérôme; Langevin, Christelle; Laude, Hubert

2011-01-01

Infection by prions involves conversion of a host-encoded cell surface protein (PrPC) to a disease-related isoform (PrPSc). PrPC carries two glycosylation sites variably occupied by complex N-glycans, which have been suggested by previous studies to influence the susceptibility to these diseases and to determine characteristics of prion strains. We used the Rov cell system, which is susceptible to sheep prions, to generate a series of PrPC glycosylation mutants with mutations at one or both attachment sites. We examined their subcellular trafficking and ability to convert into PrPSc and to sustain stable prion propagation in the absence of wild-type PrP. The susceptibility to infection of mutants monoglycosylated at either site differed dramatically depending on the amino acid substitution. Aglycosylated double mutants showed overaccumulation in the Golgi compartment and failed to be infected. Introduction of an ectopic glycosylation site near the N terminus fully restored cell surface expression of PrP but not convertibility into PrPSc, while PrPC with three glycosylation sites conferred cell permissiveness to infection similarly to the wild type. In contrast, predominantly aglycosylated molecules with nonmutated N-glycosylation sequons, produced in cells expressing glycosylphosphatidylinositol-anchorless PrPC, were able to form infectious PrPSc. Together our findings suggest that glycosylation is important for efficient trafficking of anchored PrP to the cell surface and sustained prion propagation. However, properly trafficked glycosylation mutants were not necessarily prone to conversion, thus making it difficult in such studies to discern whether the amino acid changes or glycan chain removal most influences the permissiveness to prion infection. PMID:21248032

Salivary proline-rich proteins and gluten: Do structural similarities suggest a role in celiac disease?

PubMed

Tian, Na; Messana, Irene; Leffler, Daniel A; Kelly, Ciaran P; Hansen, Joshua; Cabras, Tiziana; D'Alessandro, Alfredo; Schuppan, Detlef; Castagnola, Massimo; Helmerhorst, Eva J

2015-10-01

Gluten proteins, the culprits in celiac disease (CD), show striking similarities in primary structure with human salivary proline-rich proteins (PRPs). Both are enriched in proline and glutamine residues that often occur consecutively in their sequences. We investigated potential differences in the spectrum of salivary PRPs in health and CD. Stimulated salivary secretions were collected from CD patients, patients with refractory CD, patients with gastrointestinal complaints but no CD, and healthy controls. PRP isoforms/peptides were characterized by anionic and SDS-PAGE, PCR, and LC-ESI-MS. The gene frequencies of the acidic PRP isoforms PIF, Db, Pa, PRP1, and PRP2 did not differ between groups. At the protein level, PRPs peptides showed minor group differences, but these could not differentiate the CD and/or refractory CDs groups from the controls. This extensive study established that salivary PRPs, despite similarity to gluten proteins, show no apparent correlation with CD and thus will not serve as diagnostic markers for the disease. The structural basis for the tolerance to the gluten-like PRP proteins in CD is worthy of further exploration and may lead to the development of gluten-like analogs lacking immunogenicity that could be used therapeutically. © 2015 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

Performance of a PCR assay for the rapid identification of the Klebsiella pneumoniae ST258 epidemic clone in Latin American clinical isolates.

PubMed

Gomez, S A; Rapoport, M; Piergrossi, N; Faccone, D; Pasteran, F; De Belder, D; ReLAVRA-Group; Petroni, A; Corso, A

2016-10-01

The worldwide dissemination of Klebsiella pneumoniae carbapenemase (KPC)-producing Klebsiella pneumoniae ST258 demands a rapid PCR-based typing method to detect unique genes of the ST258 clone. This study evaluates a PCR developed by Adler et al. (2014) for the detection of ST258 in K. pneumoniae clinical isolates centered on the identification of the pilv-I and prp genes. We tested 143 clinical isolates from Argentina (n=109), Chile (n=1), Colombia (n=1), Costa Rica (n=2), Ecuador (n=5), El Salvador (n=2), Nicaragua (n=5), Panamá (n=2), Paraguay (n=2), Perú (n=3) and Trinidad and Tobago (n=11) recovered from 2006 to 2015. blaKPC, pilv-l and prp genes were detected by PCR and sequenced by standard procedures. ST258 and non-ST258 were defined by PFGE and/or MLST. Isolates were grouped according to PFGE patterns: 58 were compatible with ST258 (group 1) and 85 with non-ST258 (group 2). MLST study was done on an arbitrary selection of isolates. The pilv-l gene was present only in ST258 isolates, regardless of the presence of the blaKPC gene. Results for the prp gene were variable. Its presence did not define ST258. The pilv-I PCR had a sensitivity and specificity of 100%, respectively, for the detection of ST258 in the isolates under investigation. Given our findings, the pilv-I PCR could replace more time and resource consuming methods, allowing for more rapid detection of the circulating high risk K. pneumoniae clone ST258 in Latin American (LA) countries. Copyright © 2016 Elsevier B.V. All rights reserved.

Effects of an injectable platelet-rich fibrin on osteoblast behavior and bone tissue formation in comparison to platelet-rich plasma.

PubMed

Wang, Xuzhu; Zhang, Yufeng; Choukroun, Joseph; Ghanaati, Shahram; Miron, Richard J

2018-01-01

Platelet-rich plasma (PRP) has been utilized for many years as a regenerative agent capable of inducing vascularization of various tissues using blood-derived growth factors. Despite this, drawbacks mostly related to the additional use of anti-coagulants found in PRP have been shown to inhibit the wound healing process. For these reasons, a novel platelet concentrate has recently been developed with no additives by utilizing lower centrifugation speeds. The purpose of this study was therefore to investigate osteoblast behavior of this novel therapy (injectable-platelet-rich fibrin; i-PRF, 100% natural with no additives) when compared to traditional PRP. Human primary osteoblasts were cultured with either i-PRF or PRP and compared to control tissue culture plastic. A live/dead assay, migration assay as well as a cell adhesion/proliferation assay were investigated. Furthermore, osteoblast differentiation was assessed by alkaline phosphatase (ALP), alizarin red and osteocalcin staining, as well as real-time PCR for genes encoding Runx2, ALP, collagen1 and osteocalcin. The results showed that all cells had high survival rates throughout the entire study period irrespective of culture-conditions. While PRP induced a significant 2-fold increase in osteoblast migration, i-PRF demonstrated a 3-fold increase in migration when compared to control tissue-culture plastic and PRP. While no differences were observed for cell attachment, i-PRF induced a significantly higher proliferation rate at three and five days when compared to PRP. Furthermore, i-PRF induced significantly greater ALP staining at 7 days and alizarin red staining at 14 days. A significant increase in mRNA levels of ALP, Runx2 and osteocalcin, as well as immunofluorescent staining of osteocalcin was also observed in the i-PRF group when compared to PRP. In conclusion, the results from the present study favored the use of the naturally-formulated i-PRF when compared to traditional PRP with anti-coagulants. Further investigation into the direct role of fibrin and leukocytes contained within i-PRF are therefore warranted to better elucidate their positive role in i-PRF on tissue wound healing.

Gerstmann-Straeussler-Scheinker disease with P102L prion protein gene mutation presenting with rapidly progressive clinical course.

PubMed

Iwasaki, Yasushi; Mori, Keiko; Ito, Masumi; Nokura, Kazuya; Tatsumi, Shinsui; Mimuro, Maya; Kitamoto, Tetsuyuki; Yoshida, Mari

2014-01-01

We describe an autopsied case of a Japanese woman with Gerstmann-Straeussler-Scheinker disease (GSS) presenting with a rapidly progressive clinical course. Disease onset occurred at the age of 54 with dementia and gait disturbance. Her clinical course progressively deteriorated until she reached a bedridden state with myoclonus 9 months after onset. Two months later, she reached the akinetic mutism state. Nasal tube feeding was introduced at this point and continued for several years. Electroencephalograms showed diffuse slowing without periodic sharp-wave complexes. Diffusion-weighted magnetic resonance imaging (MRI) showed widespread cerebral cortical hyperintensity. Prion protein (PrP) gene analysis revealed a Pro to Leu point mutation at codon 102 with methionine homozygosity at codon 129. The patient died of respiratory failure after a total disease duration of 62 months. Neuropathologic examination revealed widespread spongiform change with numerous eosinophilic amyloid plaques (Kuru plaques) in the cerebral and cerebellar cortices by H & E staining. Diffuse myelin pallor with axon loss of the cerebral white matter, suggestive of panencephalopathic-type pathology was observed. Numerous PrP immunopositive plaques and diffuse synaptic-type PrP deposition were extensively observed, particularly in the cerebral and cerebellar cortices. Western blot analysis of proteinase Kresistant PrP showed a characteristic band pattern with a small molecular band of 6 kDa. The reason for the similarity in clinicopathologic findings between the present case and Creutzfeldt-Jakob disease is uncertain; however, the existence of an unknown disease-modifying factor is suspected.

Characterization of expressed sequence tags (ESTs) of pigeonpea (Cajanus cajan L.) and functional validation of selected genes for abiotic stress tolerance in Arabidopsis thaliana.

PubMed

Priyanka, B; Sekhar, K; Sunita, T; Reddy, V D; Rao, Khareedu Venkateswara

2010-03-01

Pigeonpea, a major grain legume crop with remarkable drought tolerance traits, has been used for the isolation of stress-responsive genes. Herein, we report generation of ESTs, transcript profiles of selected genes and validation of candidate genes obtained from the subtracted cDNA libraries of pigeonpea plants subjected to PEG/water-deficit stress conditions. Cluster analysis of 124 selected ESTs yielded 75 high-quality ESTs. Homology searches disclosed that 55 ESTs share significant similarity with the known/putative proteins or ESTs available in the databases. These ESTs were characterized and genes relevant to the specific physiological processes were identified. Of the 75 ESTs obtained from the cDNA libraries of drought-stressed plants, 20 ESTs proved to be unique to the pigeonpea. These sequences are envisaged to serve as a potential source of stress-inducible genes of the drought stress-response transcriptome, and hence may be used for deciphering the mechanism of drought tolerance of the pigeonpea. Expression profiles of selected genes revealed increased levels of m-RNA transcripts in pigeonpea plants subjected to different abiotic stresses. Transgenic Arabidopsis lines, expressing Cajanus cajan hybrid-proline-rich protein (CcHyPRP), C. cajan cyclophilin (CcCYP) and C. cajan cold and drought regulatory (CcCDR) genes, exhibited marked tolerance, increased plant biomass and enhanced photosynthetic rates under PEG/NaCl/cold/heat stress conditions. This study represents the first report dealing with the isolation of drought-specific ESTs, transcriptome analysis and functional validation of drought-responsive genes of the pigeonpea. These genes, as such, hold promise for engineering crop plants bestowed with tolerance to major abiotic stresses.

Comparative de novo transcriptome analysis of male and female Sea buckthorn.

PubMed

Bansal, Ankush; Salaria, Mehul; Sharma, Tashil; Stobdan, Tsering; Kant, Anil

2018-02-01

Sea buckthorn is a dioecious medicinal plant found at high altitude. The plant has both male and female reproductive organs in separate individuals. In this article, whole transcriptome de novo assemblies of male and female flower bud samples were carried out using Illumina NextSeq 500 platform to determine the role of the genes involved in sex determination. Moreover, genes with differential expression in male and female transcriptomes were identified to understand the underlying sex determination mechanism. The current study showed 63,904 and 62,272 coding sequences (CDS) in female and male transcriptome data sets, respectively. 16,831 common CDS were screened out from both transcriptomes, out of which 625 were upregulated and 491 were found to be downregulated. To understand the potential regulatory roles of differentially expressed genes in metabolic networks and biosynthetic pathways: KEGG mapping, gene ontology, and co-expression network analysis were performed. Comparison with Flowering Interactive Database (FLOR-ID) resulted in eight differentially expressed genes viz. CHD3-type chromatin-remodeling factor PICKLE ( PKL ), phytochrome-associated serine/threonine-protein phosphatase ( FYPP ), protein TOPLESS ( TPL ), sensitive to freezing 6 ( SFR6 ), lysine-specific histone demethylase 1 homolog 1 ( LDL1 ), pre-mRNA-processing-splicing factor 8A ( PRP8A ), sucrose synthase 4 ( SUS4 ), ubiquitin carboxyl-terminal hydrolase 12 ( UBP12 ), known to be broadly involved in flowering, photoperiodism, embryo development, and cold response pathways. Male and female flower bud transcriptome data of Sea buckthorn may provide comprehensive information at genomic level for the identification of genetic regulation involved in sex determination.

Spontaneous Generation of Infectious Prion Disease in Transgenic Mice

PubMed Central

Castilla, Joaquín; Pintado, Belén; Gutiérrez-Adan, Alfonso; Andréoletti, Olivier; Aguilar-Calvo, Patricia; Arroba, Ana-Isabel; Parra-Arrondo, Beatriz; Ferrer, Isidro; Manzanares, Jorge; Espinosa, Juan-Carlos

2013-01-01

We generated transgenic mice expressing bovine cellular prion protein (PrPC) with a leucine substitution at codon 113 (113L). This protein is homologous to human protein with mutation 102L, and its genetic link with Gerstmann–Sträussler–Scheinker syndrome has been established. This mutation in bovine PrPC causes a fully penetrant, lethal, spongiform encephalopathy. This genetic disease was transmitted by intracerebral inoculation of brain homogenate from ill mice expressing mutant bovine PrP to mice expressing wild-type bovine PrP, which indicated de novo generation of infectious prions. Our findings demonstrate that a single amino acid change in the PrPC sequence can induce spontaneous generation of an infectious prion disease that differs from all others identified in hosts expressing the same PrPC sequence. These observations support the view that a variety of infectious prion strains might spontaneously emerge in hosts displaying random genetic PrPC mutations. PMID:24274622

Biochemical features of genetic Creutzfeldt-Jakob disease with valine-to-isoleucine substitution at codon 180 on the prion protein gene.

PubMed

Ito, Yoko; Sanjo, Nobuo; Hizume, Masaki; Kobayashi, Atsushi; Ohgami, Tetsuya; Satoh, Katsuya; Hamaguchi, Tsuyoshi; Yamada, Masahito; Kitamoto, Tetsuyuki; Mizusawa, Hidehiro; Yokota, Takanori

2018-02-19

Valine-to-isoleucine substitution at codon 180 of the prion protein gene is only observed in patients with Creutzfeldt-Jakob disease and accounts for approximately half of all cases of genetic prion disease in Japan. In the present study, we investigated the biochemical characteristics of valine-to-isoleucine substitution at codon 180 in the prion protein gene, using samples obtained from the autopsied brains of seven patients with genetic Creutzfeldt-Jakob disease exhibiting this mutation (diagnoses confirmed via neuropathological examination). Among these patients, we observed an absence of diglycosylated and monoglycosylated forms of PrP res at codon 181. Our findings further indicated that the abnormal prion proteins were composed of at least three components, although smaller carboxyl-terminal fragments were predominant. Western blot analyses revealed large amounts of PrP res in the cerebral neocortices, where neuropathological examination revealed marked spongiosis. Relatively smaller amounts of PrP res were detected in the hippocampus, where milder spongiosis was observed, than in the cerebral neocortex. These findings indicate that abnormal prion proteins in the neocortex are associated with severe toxicity, resulting in severe spongiosis. Our findings further indicate that the valine-to-isoleucine substitution is not a polymorphism, but rather an authentic pathogenic mutation associated with specific biochemical characteristics that differ from those observed in sporadic Creutzfeldt-Jakob disease. Copyright © 2018 Elsevier Inc. All rights reserved.

A novel PRNP Y218N mutation in Gerstmann-Sträussler-Scheinker disease with neurofibrillary degeneration.

PubMed

Alzualde, Ainhoa; Indakoetxea, Begoña; Ferrer, Isidre; Moreno, Fermin; Barandiaran, Myriam; Gorostidi, Ana; Estanga, Ainara; Ruiz, Irune; Calero, Miguel; van Leeuwen, Fred W; Atares, Begoña; Juste, Ramón; Rodriguez-Martínez, Ana Belén; López de Munain, Adolfo

2010-08-01

Gerstmann-Sträussler-Scheinker (GSS) disease is a prion disease associated with prion protein gene (PRNP) mutations. We report a novel PRNP mutation (Y218N) associated with GSS disease in a pathologically confirmed case and in two other affected family members. The clinical features of these cases met criteria for possible Alzheimer disease and possible frontotemporal dementia. Neuropathologic analysis revealed deposition of proteinase K-resistant prion protein (PrP(res)), widespread hyperphosphorylated tau pathology, abnormal accumulation of mitochondria in the vicinity of PrP deposits, and expression of mutant ubiquitin (UBB(+1)) in neurofibrillary tangles and dystrophic neurites. Prion protein immunoblotting using 3F4 and 1E4 antibodies disclosed multiple bands ranging from approximately 20 kd to 80 kd and lower bands of 15 kd and approximately 10 kd, the latter only seen after a long incubation. These bands were partially resistant to proteinase K pretreatment. This pattern differs from those seen in Creutzfeldt-Jakob disease andresembles those reported in other GSS cases. The approximately 10kd band was recognized with anti-PrP C-terminus antibodies but not with anti-N terminus antibodies, suggesting PrP truncation at the N terminal. This new mutation extends the list of known mutations responsible for GSS disease and reinforces its clinical heterogeneity. Genetic examination of the PRNP gene should be included in the workup of patients with poorly classifiable dementia.

A ZIP6-ZIP10 heteromer controls NCAM1 phosphorylation and integration into focal adhesion complexes during epithelial-to-mesenchymal transition.

PubMed

Brethour, Dylan; Mehrabian, Mohadeseh; Williams, Declan; Wang, Xinzhu; Ghodrati, Farinaz; Ehsani, Sepehr; Rubie, Elizabeth A; Woodgett, James R; Sevalle, Jean; Xi, Zhengrui; Rogaeva, Ekaterina; Schmitt-Ulms, Gerold

2017-01-18

The prion protein (PrP) evolved from the subbranch of ZIP metal ion transporters comprising ZIPs 5, 6 and 10, raising the prospect that the study of these ZIPs may reveal insights relevant for understanding the function of PrP. Building on data which suggested PrP and ZIP6 are critical during epithelial-to-mesenchymal transition (EMT), we investigated ZIP6 in an EMT paradigm using ZIP6 knockout cells, mass spectrometry and bioinformatic methods. Reminiscent of PrP, ZIP6 levels are five-fold upregulated during EMT and the protein forms a complex with NCAM1. ZIP6 also interacts with ZIP10 and the two ZIP transporters exhibit interdependency during their expression. ZIP6 contributes to the integration of NCAM1 in focal adhesion complexes but, unlike cells lacking PrP, ZIP6 deficiency does not abolish polysialylation of NCAM1. Instead, ZIP6 mediates phosphorylation of NCAM1 on a cluster of cytosolic acceptor sites. Substrate consensus motif features and in vitro phosphorylation data point toward GSK3 as the kinase responsible, and interface mapping experiments identified histidine-rich cytoplasmic loops within the ZIP6/ZIP10 heteromer as a novel scaffold for GSK3 binding. Our data suggests that PrP and ZIP6 inherited the ability to interact with NCAM1 from their common ZIP ancestors but have since diverged to control distinct posttranslational modifications of NCAM1.

Platelet rich plasma (PRP) induces chondroprotection via increasing autophagy, anti-inflammatory markers, and decreasing apoptosis in human osteoarthritic cartilage

DOE Office of Scientific and Technical Information (OSTI.GOV)

Moussa, Mayssam, E-mail: Moussa-mayssam@hotmail.com; Lajeunesse, Daniel, E-mail: daniel.lajeunesse@umontreal.ca; Hilal, George, E-mail: George2266@gmail.com

Objectives: Autophagy constitutes a defense mechanism to overcome aging and apoptosis in osteoarthritic cartilage. Several cytokines and transcription factors are linked to autophagy and play an important role in the degradative cascade in osteoarthritis (OA). Cell therapy such as platelet rich plasma (PRP) has recently emerged as a promising therapeutic tool for many diseases including OA. However, its mechanism of action on improving cartilage repair remains to be determined. The purpose of this study is to investigate the effect of PRP on osteoarthritic chondrocytes and to elucidate the mechanism by which PRP contributes to cartilage regeneration. Methods: Osteoarthritic chondrocytes weremore » co-cultured with an increasing concentration of PRP obtained from healthy donors. The effect of PRP on the proliferation of chondrocytes was performed using cell counting and WST8 proliferation assays. Autophagy, apoptosis and intracellular level of IL-4, IL-10, and IL-13 were determined using flow cytometry analyses. Autophagy markers BECLIN and LC3II were also determined using quantitative polymerase chain reaction (qPCR). qPCR and ELISA were used to measure the expression of ADAMDTS-5, MMP3, MMP13, TIMP-1–2–3, aggregan, Collagen type 2, TGF-β, Cox-2, Il-6, FOXO1, FOXO3, and HIF-1 in tissues and co-cultured media. Results: PRP increased significantly the proliferation of chondrocytes, decreased apoptosis and increased autophagy and its markers along with its regulators FOXO1, FOXO3 and HIF-1 in osteoarthritic chondrocytes. Furthermore, PRP caused a dose-dependent significant decrease in MMP3, MMP13, and ADAMTS-5, IL-6 and COX-2 while increasing TGF-β, aggregan, and collagen type 2, TIMPs and intracellular IL-4, IL-10, IL-13. Conclusion: These results suggest that PRP could be a potential therapeutic tool for the treatment of OA. - Highlights: • Platelet Rich Plasma is suggested as a new treatment for osteoarthritis. • The proposed therapeutic effect is chondroprotection. • Chondroprotection is assumed via two major mechanisms:1-by increasing the major players in cartilage protection as as autophagy 2-by decreasing the markers of cartilage degradation such as MMPs.« less

Melatonin Promotes Apoptosis of Oxaliplatin-resistant Colorectal Cancer Cells Through Inhibition of Cellular Prion Protein.

PubMed

Lee, Jun Hee; Yoon, Yeo Min; Han, Yong-Seok; Yun, Chul Won; Lee, Sang Hun

2018-04-01

Drug resistance restricts the efficacy of chemotherapy in colorectal cancer. However, the detailed molecular mechanism of drug resistance in colorectal cancer cells remains unclear. The level of cellular prion protein (PrP C ) in oxaliplatin-resistant colorectal cancer (SNU-C5/Oxal-R) cells was assessed. PrP C level in SNU-C5/Oxal-R cells was significantly increased compared to that in wild-type (SNU-C5) cells. Superoxide dismutase and catalase activities were higher in SNU-C5/Oxal-R cells than in SNU-C5 cells. Treatment of SNU-C5/Oxal-R cells with oxaliplatin and melatonin reduced PrP C expression, while suppressing antioxidant enzyme activity and increasing superoxide anion generation. In SNU-C5/Oxal-R cells, endoplasmic reticulum stress and apoptosis were significantly increased following co-treatment with oxaliplatin and melatonin compared to treatment with oxaliplatin alone. Co-treatment with oxaliplatin and melatonin increased endoplasmic reticulum stress in and apoptosis of SNU-C5/Oxal-R cells through inhibition of PrP C , suggesting that PrP C could be a key molecule in oxaliplatin resistance of colorectal cancer cells. Copyright© 2018, International Institute of Anticancer Research (Dr. George J. Delinasios), All rights reserved.

Platelet collection efficiencies of three different platelet-rich plasma preparation systems.

PubMed

Aydin, Fatma; Pancar Yuksel, Esra; Albayrak, Davut

2015-06-01

Different systems have been used for the preparation of platelet-rich plasma (PRP), but platelet collection efficiencies of these systems are not clear. To evaluate the platelet collection efficiencies of three different PRP preparation systems. Blood samples were obtained from the same 16 volunteers for each system. The samples were centrifuged and PRP was prepared by three systems. The ratio of the total number of platelets in PRP to the total number of platelets of the venous blood sample of the patient expressed in percentage was named as platelet collection efficiency and calculated for each system. Mean platelet collection efficiencies were 66.6 (min: 56.9, max: 76.9), 58.3 (min: 27.3, max: 102.8), 50.8 (min: 27.2, max: 73) for top and bottom bag system, system using citrated tube, and the system using tube with Ficoll and cell extraction kit, respectively. Statistically significant difference was found only between the platelet collection efficiencies of systems using the tube with ficoll and cell extraction kit and the top and bottom bag system (p = 0.002). All three systems could be used for PRP preparation, but top and bottom bag system offers a slight advantage over the system using Ficoll and cell extraction kit regarding the platelet collection efficiency.

Prion protein- and cardiac troponin T-marked interstitial cells from the adult myocardium spontaneously develop into beating cardiomyocytes

PubMed Central

Omatsu-Kanbe, Mariko; Nishino, Yuka; Nozuchi, Nozomi; Sugihara, Hiroyuki; Matsuura, Hiroshi

2014-01-01

Atypically-shaped cardiomyocytes (ACMs) constitute a novel subpopulation of beating heart cells found in the cultures of cardiac myocyte-removed crude fraction cells obtained from adult mouse cardiac ventricles. Although ~500 beating ACMs are observed under microscope in the cell cultures obtained from the hearts of either male or female mice, the origin of these cells in cardiac tissue has yet to be elucidated due to the lack of exclusive markers. In the present study, we demonstrate the efficacy of cellular prion protein (PrP) as a surface marker of ACMs. Cells expressing PrP at the plasma membrane in the culture of the crude fraction cells were found to develop into beating ACMs by themselves or fuse with each other to become larger multinuclear beating ACMs. Combining PrP with a cardiac-specific contractile protein cardiac troponin T (cTnT) allowed us to identify native ACMs in the mouse cardiac ventricles as either clustered or solitary cells. PrP- and cTnT-marked cells were also found in the adult, even aged, human cardiac ventricles. These findings suggest that interstitial cells marked by PrP and cTnT, native ACMs, exhibit life-long survival in the cardiac ventricles of both mice and humans. PMID:25466571

Prion propagation in cells expressing PrP glycosylation mutants.

PubMed

Salamat, Muhammad K; Dron, Michel; Chapuis, Jérôme; Langevin, Christelle; Laude, Hubert

2011-04-01

Infection by prions involves conversion of a host-encoded cell surface protein (PrP(C)) to a disease-related isoform (PrP(Sc)). PrP(C) carries two glycosylation sites variably occupied by complex N-glycans, which have been suggested by previous studies to influence the susceptibility to these diseases and to determine characteristics of prion strains. We used the Rov cell system, which is susceptible to sheep prions, to generate a series of PrP(C) glycosylation mutants with mutations at one or both attachment sites. We examined their subcellular trafficking and ability to convert into PrP(Sc) and to sustain stable prion propagation in the absence of wild-type PrP. The susceptibility to infection of mutants monoglycosylated at either site differed dramatically depending on the amino acid substitution. Aglycosylated double mutants showed overaccumulation in the Golgi compartment and failed to be infected. Introduction of an ectopic glycosylation site near the N terminus fully restored cell surface expression of PrP but not convertibility into PrP(Sc), while PrP(C) with three glycosylation sites conferred cell permissiveness to infection similarly to the wild type. In contrast, predominantly aglycosylated molecules with nonmutated N-glycosylation sequons, produced in cells expressing glycosylphosphatidylinositol-anchorless PrP(C), were able to form infectious PrP(Sc). Together our findings suggest that glycosylation is important for efficient trafficking of anchored PrP to the cell surface and sustained prion propagation. However, properly trafficked glycosylation mutants were not necessarily prone to conversion, thus making it difficult in such studies to discern whether the amino acid changes or glycan chain removal most influences the permissiveness to prion infection.

[Effect of white spot syndrome virus envelope protein Vp28 expressed in silkworm (Bombyx mori) pupae on disease resistence in Procambarus clarkii].

PubMed

Wei, Ke Qiang; Xu, Zi Rong

2005-06-01

The vaccine made of recombinant envelope protein (rVp28) of white spot syndrome virus (WSSV) expressed in silkworm (Bombyx mori) pupae using a baculovirus vector was used to investigate the efficacy of oral administration on WSSV disease resistance of Procambarus clarkii. Vaccine was mixed with diet at a ratio of 2% (w/w), and Procambarus clarkii were orally administered throughout 75 days. Vaccination with rVP28 showed the significantly higher cumulative survival compared with positive and negative control (P < 0.05) following an oral challenge on the 35th day post-vaccination (dpv), with PRP values 54.16% and 59.26%, respectively. rVP28 induced higher resistance via IM (intramuscular) injection challenge with WSSV stock, with PRP value of 46.12% and 49.99%, respectively. The survivors were subsequently re-challenged on the 55th dpv. rVP28 induced the significantly higher resistance to oral re-challenge (P < 0.05), with both PRP values 55.80% and 63.16%, respectively. rVP28 induced higher resistance to IM injection re-challenge, with both PRP values 31.25%. A DIG labeled WSSV DNA probe was used to detect WSSV by in situ hybridization. The positive cells were observed in epithelial cells of stomach, hepatopancreas and gut of the infected control crayfish, while negative reaction were observed in the tissues of survivors-vaccinated. These results indicated that vaccination of crayfish with recombinant protein had significant effect on oral infection, and had higher resistance against intramuscular injection challenge. This suggested the protection against WSSV could be induced in crayfish by recombinant protein rVp28 expressed in silkworm pupae.

Screening of potential genes contributing to the macrocycle drug resistance of C. albicans via microarray analysis

PubMed Central

Yang, Jing; Zhang, Wei; Sun, Jian; Xi, Zhiqin; Qiao, Zusha; Zhang, Jinyu; Wang, Yan; Ji, Ying; Feng, Wenli

2017-01-01

The aim of the present study was to investigate the potential genes involved in drug resistance of Candida albicans (C. albicans) by performing microarray analysis. The gene expression profile of GSE65396 was downloaded from the Gene Expression Omnibus, including a control, 15-min and 45-min macrocyclic compound RF59-treated group with three repeats for each. Following preprocessing using RAM, the differentially expressed genes (DEGs) were screened using the Limma package. Subsequently, the Kyoto Encyclopedia of Genes and Genomes pathways of these genes were analyzed using the Database for Annotation, Visualization and Integrated Discovery. Based on interactions estimated by the Search Tool for Retrieval of Interacting Gene, the protein-protein interaction (PPI) network was visualized using Cytoscape. Subnetwork analysis was performed using ReactomeFI. A total of 154 upregulated and 27 downregulated DEGs were identified in the 15-min treated group, compared with the control, and 235 upregulated and 233 downregulated DEGs were identified in the 45-min treated group, compared with the control. The upregulated DEGs were significantly enriched in the ribosome pathway. Based on the PPI network, PRP5, RCL1, NOP13, NOP4 and MRT4 were the top five nodes in the 15-min treated comparison. GIS2, URA3, NOP58, ELP3 and PLP7 were the top five nodes in the 45-min treated comparison, and its subnetwork was significantly enriched in the ribosome pathway. The macrocyclic compound RF59 had a notable effect on the ribosome and its associated pathways of C. albicans. RCL1, NOP4, MRT4, GIS2 and NOP58 may be important in RF59-resistance. PMID:28944888

Use of a Cyclooxygenase-2 Inhibitor Does Not Inhibit Platelet Activation or Growth Factor Release From Platelet-Rich Plasma.

PubMed

Ludwig, Hilary C; Birdwhistell, Kate E; Brainard, Benjamin M; Franklin, Samuel P

2017-12-01

It remains unestablished whether use of cyclooxygenase (COX)-2 inhibitors impairs platelet activation and anabolic growth factor release from platelets in platelet-rich plasma (PRP). The purpose of this study was to assess the effects of a COX-2 inhibitor on platelet activation and anabolic growth factor release from canine PRP when using a clinically applicable PRP activator and to determine whether a 3-day washout would be sufficient to abrogate any COX-2 inhibitor-related impairment on platelet function. Controlled laboratory study. Ten healthy dogs underwent blood collection and PRP preparation. Dogs were then administered a COX-2 inhibitor for 7 days, after which PRP preparation was repeated. The COX-2 inhibitor was continued for 4 more days and PRP preparation performed a third time, 3 days after discontinuation of the COX-2 inhibitor. Immediately after PRP preparation, the PRP was divided into 4 aliquots: 2 unactivated and 2 activated using human γ-thrombin (HGT). One activated and 1 unactivated sample were assessed using flow cytometry for platelet expression of CD62P and platelet-bound fibrinogen using the canine activated platelet-1 (CAP1) antibody. The 2 remaining samples were centrifuged and the supernatant assayed for transforming growth factor-β1 (TGF-β1), platelet-derived growth factor-BB (PDGF-BB), and thromboxane B2 (TXB2) concentrations. Differences in platelet activation and TGF-β1, PDGF-BB, and TXB2 concentrations over the 3 study weeks were evaluated using a 1-way repeated-measures ANOVA, and comparisons between activated and unactivated samples within a study week were assessed with paired t tests. There were no statistically significant ( P > .05) effects of the COX-2 inhibitor on percentage of platelets positive for CD62P or CAP1 or on concentrations of TGF-β1, PDGF-BB, or TXB2. All unactivated samples had low levels of activation or growth factor concentrations and significantly ( P < .05) greater activation and growth factor concentrations in HGT-activated samples. This COX-2 inhibitor did not impair platelet activation, growth factor release, or TXB2 production in this canine PRP when using HGT as an activator. Studies are warranted to determine whether COX-2 inhibitors affect platelet activation and growth factor release from human PRPs. These results suggest that there is no need to withhold a COX-2 inhibitor before PRP preparation, particularly if thrombin is going to be used to activate the PRP. This is clinically relevant information because many patients who are candidates for PRP therapy for treatment of musculoskeletal injury are also using COX-2 inhibitors.

Caprine PrP variants harboring Asp-146, His-154 and Gln-211 alleles display reduced convertibility upon interaction with pathogenic murine prion protein in scrapie infected cells.

PubMed

Kanata, Eirini; Arsenakis, Minas; Sklaviadis, Theodoros

2016-09-02

Scrapie, the prion disease of sheep and goats, is a devastating malady of small ruminants. Due to its infectious nature, epidemic outbreaks may occur in flocks/herds consisting of highly susceptible animals. Field studies identified scrapie-protective caprine PrP variants, harboring specific single amino acid changes (Met-142, Arg-143, Asp-146, Ser-146, His-154, Gln-211 and Lys-222). Their effects are under further evaluation, and aim to determine the most protective allele. We assessed some of these variants (Asp-146, His-154, Gln-211 and Lys-222), after their exogenous expression as murine-caprine chimeras in a scrapie- infected murine cell line. We report that exogenously expressed PrPs undergo conformational conversion upon interaction with the endogenous pathological murine prion protein (PrP SC ), which results in the detection of goat-specific and partially PK-resistant moieties. These moieties display a PK-resistance pattern distinct from the one detected in natural goat scrapie cases. Within this cellular model, distinct conformational conversion potentials were assigned to the tested variants. Molecules carrying the Asp-146, His-154 and Gln-211 alleles showed significantly lower conversion levels compared to wild type, confirming their protective effects against scrapie. Although we utilized a heterologous conversion system, this is to our knowledge, the first study of caprine PrP variants in a cellular context of scrapie, that confirms the protective effects of some of the studied alleles.

Chronic wasting disease prion infection of differentiated neurospheres.

PubMed

Iwamaru, Yoshifumi; Mathiason, Candace K; Telling, Glenn C; Hoover, Edward A

2017-07-04

A possible strategy to develop more diverse cell culture systems permissive to infection with naturally occurring prions is to exploit culture of neurospheres from transgenic mice expressing the normal prion protein (PrP) of the native host species. Accordingly, we developed differentiated neurosphere cultures from the cervid PrP-expressing mice to investigate whether this in vitro system would support replication of non-adapted cervid-origin chronic wasting disease (CWD) prions. Here we report the successful amplification of disease-associated PrP in differentiated neurosphere cultures within 3 weeks after exposure to CWD prions from both white-tailed deer or elk. This neurosphere culture system provides a new in vitro tool that can be used to assess non-adapted CWD prion propagation and transmission.

The prion protein has DNA strand transfer properties similar to retroviral nucleocapsid protein.

PubMed

Gabus, C; Auxilien, S; Péchoux, C; Dormont, D; Swietnicki, W; Morillas, M; Surewicz, W; Nandi, P; Darlix, J L

2001-04-06

The transmissible spongiform encephalopathies are fatal neurodegenerative diseases that are associated with the accumulation of a protease-resistant form of the cellular prion protein (PrP). Although PrP is highly conserved and widely expressed in vertebrates, its function remains a matter of speculation. Indeed PrP null mice develop normally and are healthy. Recent results show that PrP binds to nucleic acids in vitro and is found associated with retroviral particles. Furthermore, in mice the scrapie infectious process appears to be accelerated by MuLV replication. These observations prompted us to further investigate the interaction between PrP and nucleic acids, and compare it with that of the retroviral nucleocapsid protein (NC). As the major nucleic acid-binding protein of the retroviral particle, NC protein is tightly associated with the genomic RNA in the virion nucleocapsid, where it chaperones proviral DNA synthesis by reverse transcriptase. Our results show that the human prion protein (huPrP) functionally resembles NCp7 of HIV-1. Both proteins form large nucleoprotein complexes upon binding to DNA. They accelerate the hybridization of complementary DNA strands and chaperone viral DNA synthesis during the minus and plus DNA strand transfers necessary to generate the long terminal repeats. The DNA-binding and strand transfer properties of huPrP appear to map to the N-terminal fragment comprising residues 23 to 144, whereas the C-terminal domain is inactive. These findings suggest that PrP could be involved in nucleic acid metabolism in vivo. Copyright 2001 Academic Press.

Conversion of truncated and elongated prion proteins into the scrapie isoform in cultured cells.

PubMed Central

Rogers, M; Yehiely, F; Scott, M; Prusiner, S B

1993-01-01

The only known component of the infectious prion is a posttranslationally modified protein known as the scrapie isoform of the prion protein, PrPSc. Upon limited proteolysis, a protease-resistant fragment designated PrP 27-30 is formed. Using in vitro mutagenesis, we examined the role of the N and C termini in the formation of PrPSc in persistently infected, mouse neuroblastoma (ScN2a) cells. Neither deletion of amino acids 23-88, which are also removed by proteinase K in the formation of PrP 27-30, nor deletion of the five octapeptide repeats within this region altered synthesis of PrPSc. Elongation of PrP with one, two, four, or six octapeptide repeats in addition to the five found in wild-type PrP did not alter the synthesis of PrPSc. Truncation of the C terminus was accomplished by substituting a translation stop codon for the predicted glycosylinositol phospholipid (GPI) anchor-attachment signal corresponding to amino acids 231-254. Expression of this C-terminal PrP mutant in ScN2a cells produced PrPSc that appeared to lack a GPI anchor. We conclude that neither the GPI anchor nor the N-terminal 66 amino acids are required for the synthesis of PrPSc as measured by the acquisition of limited resistance to proteinase K digestion. Whether these truncated or elongated PrP molecules are competent to participate in the formation of infectious prions remains to be established. Images Fig. 1 Fig. 2 Fig. 3 Fig. 4 Fig. 5 PMID:8475059

Generic amyloidogenicity of mammalian prion proteins from species susceptible and resistant to prions.

PubMed

Nyström, Sofie; Hammarström, Per

2015-05-11

Prion diseases are lethal, infectious diseases associated with prion protein (PrP) misfolding. A large number of mammals are susceptible to both sporadic and acquired prion diseases. Although PrP is highly conserved and ubiquitously expressed in all mammals, not all species exhibit prion disease. By employing full length recombinant PrP from five known prion susceptible species (human, cattle, cat, mouse and hamster) and two species considered to be prion resistant (pig and dog) the amyloidogenicity of these PrPs has been delineated. All the mammalian PrPs, even from resistant species, were swiftly converted from the native state to amyloid-like structure when subjected to a native condition conversion assay. The PrPs displayed amyloidotypic tinctorial and ultrastructural hallmarks. Self-seeded conversion of the PrPs displayed significantly decreased lag phases demonstrating that nucleation dependent polymerization is a dominating mechanism in the fibrillation process. Fibrils from Aβ1-40, Aβ1-42, Lysozyme, Insulin and Transthyretin did not accelerate conversion of HuPrP whereas fibrils from HuPrP90-231 and HuPrP121-231 as well as full length PrPs of all PrPs efficiently seeded conversion showing specificity of the assay requiring the C-terminal PrP sequence. Our findings have implications for PrP misfolding and could have ramifications in the context of prion resistant species and silent carriers.

De novo generation of infectious prions with bacterially expressed recombinant prion protein.

PubMed

Zhang, Zhihong; Zhang, Yi; Wang, Fei; Wang, Xinhe; Xu, Yuanyuan; Yang, Huaiyi; Yu, Guohua; Yuan, Chonggang; Ma, Jiyan

2013-12-01

The prion hypothesis is strongly supported by the fact that prion infectivity and the pathogenic conformer of prion protein (PrP) are simultaneously propagated in vitro by the serial protein misfolding cyclic amplification (sPMCA). However, due to sPMCA's enormous amplification power, whether an infectious prion can be formed de novo with bacterially expressed recombinant PrP (rPrP) remains to be satisfactorily resolved. To address this question, we performed unseeded sPMCA with rPrP in a laboratory that has never been exposed to any native prions. Two types of proteinase K (PK)-resistant and self-perpetuating recombinant PrP conformers (rPrP-res) with PK-resistant cores of 17 or 14 kDa were generated. A bioassay revealed that rPrP-res(17kDa) was highly infectious, causing prion disease in wild-type mice with an average survival time of about 172 d. In contrast, rPrP-res(14kDa) completely failed to induce any disease. Our findings reveal that sPMCA is sufficient to initiate various self-perpetuating PK-resistant rPrP conformers, but not all of them possess in vivo infectivity. Moreover, generating an infectious prion in a prion-free environment establishes that an infectious prion can be formed de novo with bacterially expressed rPrP.

Overexpression of p62/SQSTM1 promotes the degradations of abnormally accumulated PrP mutants in cytoplasm and relieves the associated cytotoxicities via autophagy-lysosome-dependent way.

PubMed

Xu, Yin; Zhang, Jin; Tian, Chan; Ren, Ke; Yan, Yu-E; Wang, Ke; Wang, Hui; Chen, Cao; Wang, Jing; Shi, Qi; Dong, Xiao-Ping

2014-04-01

The protein of p62/sequestosome 1 (SQSTM1), a key cargo adaptor protein involved in autophagy-lysosome degradation, exhibits inclusion bodies structure in cytoplasm and plays a protective role in some models of neurodegenerative diseases. Some PrP mutants, such as PrP-CYTO and PrP-PG14, also form cytosolic inclusion bodies and trigger neuronal apoptosis either in cultured cells or in transgenic mice. Here, we demonstrated that the cellular p62/SQSTM1 incorporated into the inclusion bodies formed by expressing the abnormal PrP mutants, PrP-CYTO and PrP-PG14, in human embryonic kidney 293 cells. Overexpression of p62/SQSTM1 efficiently relieved the cytosolic aggregations and cell apoptosis induced by the abnormal PrPs. Autophagy-lysosome inhibitors instead of proteasome inhibitor sufficiently blocked the p62/SQSTM1-mediated degradations of abnormal PrPs. Overexpression of p62/SQSTM1 did not alter the levels of light chain 3 (LC3) in the cells expressing various PrPs. However, more complexes of p62/SQSTM1 with LC3 were detected in the cells expressing the misfolded PrPs. These data imply that p62/SQSTM1 plays an important role in the homeostasis of abnormal PrPs via autophagy-lysosome-dependent way.

Graft Product for Autologous Peripheral Blood Stem Cell Transplantation Enhances Thrombin Generation and Expresses Procoagulant Microparticles and Tissue Factor.

PubMed

Sidibe, Fatoumata; Spanoudaki, Anastasia; Vanneaux, Valerie; Mbemba, Elisabeth; Larghero, Jerome; Van Dreden, Patrick; Lotz, Jean-Pierre; Elalamy, Ismail; Larsen, Annette K; Gerotziafas, Grigoris T

2018-05-01

The beneficial effect of autologous peripheral blood stem cell transplantation (APBSCT) may be compromised by acute vascular complications related to hypercoagulability. We studied the impact of graft product on thrombin generation of normal plasma and the expression of tissue factor (TF) and procoagulant platelet-derived procoagulant microparticles (Pd-MPs) in samples of graft products. Graft products from 10 patients eligible for APBSCT were mixed with platelet-poor plasma (PPP) or platelet-rich plasma (PRP) from healthy volunteers and assessed for in vitro thrombin generation. In control experiments, thrombin generation was assessed in (1) PPP and PRP without any exogenous TF and/or procoagulant phospholipids, (2) PPP with the addition of TF (5 pM) and procoagulant phospholipids (4 μM), (3) in PRP with the addition of TF (5 pM). Graft products were assessed with Western blot assay for TF expression, with a specific clotting assay for TF activity and with flow cytometry assay for Pd-MPs. The graft product enhanced thrombin generation and its procoagulant activity was related to the presence of Pd-MPs and TF. The concentration of Pd-MPs in the graft product was characterized by a significant interindividual variability. The present study reveals the need for a thorough quality control of the graft products regarding their procoagulant potential.

Absence of Evidence for a Causal Link between Bovine Spongiform Encephalopathy Strain Variant L-BSE and Known Forms of Sporadic Creutzfeldt-Jakob Disease in Human PrP Transgenic Mice.

PubMed

Jaumain, Emilie; Quadrio, Isabelle; Herzog, Laetitia; Reine, Fabienne; Rezaei, Human; Andréoletti, Olivier; Laude, Hubert; Perret-Liaudet, Armand; Haïk, Stéphane; Béringue, Vincent

2016-12-01

Prions are proteinaceous pathogens responsible for subacute spongiform encephalopathies in animals and humans. The prions responsible for bovine spongiform encephalopathy (BSE) are zoonotic agents, causing variant Creutzfeldt-Jakob disease (CJD) in humans. The transfer of prions between species is limited by a species barrier, which is thought to reflect structural incompatibilities between the host cellular prion protein (PrP C ) and the infecting pathological PrP assemblies (PrP Sc ) constituting the prion. A BSE strain variant, designated L-BSE and responsible for atypical, supposedly spontaneous forms of prion diseases in aged cattle, demonstrates zoonotic potential, as evidenced by its capacity to propagate more easily than classical BSE in transgenic mice expressing human PrP C and in nonhuman primates. In humanized mice, L-BSE propagates without any apparent species barrier and shares similar biochemical PrP Sc signatures with the CJD subtype designated MM2-cortical, thus opening the possibility that certain CJD cases classified as sporadic may actually originate from L-type BSE cross-transmission. To address this issue, we compared the biological properties of L-BSE and those of a panel of CJD subtypes representative of the human prion strain diversity using standard strain-typing criteria in human PrP transgenic mice. We found no evidence that L-BSE causes a known form of sporadic CJD. Since the quasi-extinction of classical BSE, atypical BSE forms are the sole BSE variants circulating in cattle worldwide. They are observed in rare cases of old cattle, making them difficult to detect. Extrapolation of our results suggests that L-BSE may propagate in humans as an unrecognized form of CJD, and we urge both the continued utilization of precautionary measures to eliminate these agents from the human food chain and active surveillance for CJD phenotypes in the general population. Copyright © 2016, American Society for Microbiology. All Rights Reserved.

Prion Replication Elicits Cytopathic Changes in Differentiated Neurosphere Cultures

PubMed Central

Iwamaru, Yoshifumi; Takenouchi, Takato; Imamura, Morikazu; Shimizu, Yoshihisa; Miyazawa, Kohtaro; Mohri, Shirou; Yokoyama, Takashi

2013-01-01

The molecular mechanisms of prion-induced cytotoxicity remain largely obscure. Currently, only a few cell culture models have exhibited the cytopathic changes associated with prion infection. In this study, we introduced a cell culture model based on differentiated neurosphere cultures isolated from the brains of neonatal prion protein (PrP)-null mice and transgenic mice expressing murine PrP (dNP0 and dNP20 cultures). Upon exposure to mouse Chandler prions, dNP20 cultures supported the de novo formation of abnormal PrP and the resulting infectivity, as assessed by bioassays. Furthermore, this culture was susceptible to various prion strains, including mouse-adapted scrapie, bovine spongiform encephalopathy, and Gerstmann-Sträussler-Scheinker syndrome prions. Importantly, a subset of the cells in the infected culture that was mainly composed of astrocyte lineage cells consistently displayed late-occurring, progressive signs of cytotoxicity as evidenced by morphological alterations, decreased cell viability, and increased lactate dehydrogenase release. These signs of cytotoxicity were not observed in infected dNP0 cultures, suggesting the requirement of endogenous PrP expression for prion-induced cytotoxicity. Degenerated cells positive for glial fibrillary acidic protein accumulated abnormal PrP and exhibited features of apoptotic death as assessed by active caspase-3 and terminal deoxynucleotidyltransferase nick-end staining. Furthermore, caspase inhibition provided partial protection from prion-mediated cell death. These results suggest that differentiated neurosphere cultures can provide an in vitro bioassay for mouse prions and permit the study of the molecular basis for prion-induced cytotoxicity at the cellular level. PMID:23740992

Crystallographic Studies of Prion Protein (PrP) Segments Suggest How Structural Changes Encoded by Polymorphism at Residue 129 Modulate Susceptibility to Human Prion Disease

DOE Office of Scientific and Technical Information (OSTI.GOV)

Apostol, Marcin I.; Sawaya, Michael R.; Cascio, Duilio

2010-09-23

A single nucleotide polymorphism (SNP) in codon 129 of the human prion gene, leading to a change from methionine to valine at residue 129 of prion protein (PrP), has been shown to be a determinant in the susceptibility to prion disease. However, the molecular basis of this effect remains unexplained. In the current study, we determined crystal structures of prion segments having either Met or Val at residue 129. These 6-residue segments of PrP centered on residue 129 are 'steric zippers,' pairs of interacting {beta}-sheets. Both structures of these 'homozygous steric zippers' reveal direct intermolecular interactions between Met or Valmore » in one sheet and the identical residue in the mating sheet. These two structures, plus a structure-based model of the heterozygous Met-Val steric zipper, suggest an explanation for the previously observed effects of this locus on prion disease susceptibility and progression.« less

Involvement of Phosphatidylinositol 3-Kinase-Mediated Up-Regulation of IκBα in Anti-Inflammatory Effect of Gemfibrozil in Microglia1

PubMed Central

Jana, Malabendu; Jana, Arundhati; Liu, Xiaojuan; Ghosh, Sankar; Pahan, Kalipada

2008-01-01

The present study underlines the importance of PI3K in mediating the anti-inflammatory effect of gemfibrozil, a prescribed lipid-lowering drug for humans, in mouse microglia. Gemfibrozil inhibited LPS-induced expression of inducible NO synthase (iNOS) and proinflammatory cytokines in mouse BV-2 microglial cells and primary microglia. By overexpressing wild-type and dominant-negative constructs of peroxisome proliferator-activated receptor-α (PPAR-α) in microglial cells and isolating primary microglia from PPAR-α−/− mice, we have demonstrated that gemfibrozil inhibits the activation of microglia independent of PPAR-α. Interestingly, gemfibrozil induced the activation of p85α-associated PI3K (p110β but not p110α) and inhibition of that PI3K by either chemical inhibitors or dominant-negative mutants abrogated the inhibitory effect of gemfibrozil. Conversely, overexpression of the constitutively active mutant of p110 enhanced the inhibitory effect of gemfibrozil on LPS-induced expression of proinflammatory molecules. Similarly, gemfibrozil also inhibited fibrillar amyloid β (Aβ)-, prion peptide (PrP)-, dsRNA (poly IC)-, HIV-1 Tat-, and 1-methyl-4-phenylpyridinium (MPP+)-, but not IFN-γ-, induced microglial expression of iNOS. Inhibition of PI3K also abolished the inhibitory effect of gemfibrozil on Aβ-, PrP-, poly IC-, Tat-, and MPP+-induced microglial expression of iNOS. Involvement of NF-κB activation in LPS-, Aβ-, PrP-, poly IC-, Tat-, and MPP+-, but not IFN-γ-, induced microglial expression of iNOS and stimulation of IκBα expression and inhibition of NF-κB activation by gemfibrozil via the PI3K pathway suggests that gemfibrozil inhibits the activation of NF-κB and the expression of proinflammatory molecules in microglia via PI3K-mediated up-regulation of IκBα. PMID:17785853

Familial Prion Disease with Alzheimer Disease-Like Tau Pathology and Clinical Phenotype

PubMed Central

Jayadev, Suman; Nochlin, David; Poorkaj, Parvoneh; Steinbart, Ellen J.; Mastrianni, James A.; Montine, Thomas J.; Ghetti, Bernardino; Schellenberg, Gerard D.; Bird, Thomas D.; Leverenz, James B.

2011-01-01

Objective To describe the Alzheimer disease (AD)-like clinical and pathological features, including marked neurofibrillary tangle (NFT) pathology, of a familial prion disease due to a rare nonsense mutation of the prion gene (PRNP). Methods Longitudinal clinical assessments were available for the proband and her mother. After death, both underwent neuropathological evaluation. PRNP was sequenced after failure to find immunopositive Aβ deposits in the proband and the documentation of prion protein (PrP) immunopositive pathology. Results The proband presented at age 42 years with a 3-year history of progressive short-term memory impairment and depression. Neuropsychological testing found impaired memory performance, with relatively preserved attention and construction. She was diagnosed with AD and died at age 47 years. Neuropathologic evaluation revealed extensive limbic and neocortical NFT formation and neuritic plaques consistent with a Braak stage of VI. The NFTs were immunopositive, with multiple tau antibodies, and electron microscopy revealed paired helical filaments. However, the neuritic plaques were immunonegative for Aβ, whereas immunostaining for PrP was positive. The mother of the proband had a similar presentation, including depression, and had been diagnosed clinically and pathologically as AD. Reevaluation of her brain tissue confirmed similar tau and PrP immunostaining findings. Genetic analysis revealed that both the proband and her mother had a rare PRNP mutation (Q160X) that resulted in the production of truncated PrP. Interpretation We suggest that PRNP mutations that result in a truncation of PrP lead to a prolonged clinical course consistent with a clinical diagnosis of AD and severe AD-like NFTs. PMID:21416485

[Human transmissible subacute spongiform encephalopathy].

PubMed

Dormont, D

1994-05-01

Human transmissible spongiform encephalopathies (TSE) are rare chronic subacute degenerative diseases of the central nervous system (CNS) which include Creutzfeldt-Jakob disease (CJD), Kuru, Gerstmann-Sträussler-Scheinker syndrome (GSS), and Fatal Familial Insomnia (FFI). CJD can be either inherited or sporadic. All these diseases are always fatal. Neuropathological features are mainly constituted of neuronal vacuolisation, neuronal death, gliosis with hyperastrocytosis; plaques might be evidenced in kuru and GSS. Neither inflammatory syndrome nor demyelination is detectable. No virus like structure could be identified reproducibly. Human TSE are transmissible to non human primates and rodents. Iatrogenic CJD have been described after tissue grafting (cornea, dura mater), neurosurgery, electrophysiology investigation, and treatment with pituitary derived gonadotrophins and growth hormone. Molecular biochemistry of the CNS investigation revealed that a host encoded protein, the prion protein (PrP), accumulates proportionally to the infectious titer: this abnormality is the only detectable hallmark in TSE. Infectious fractions contain no detectable specific nucleic acid, and are mainly constituted of PrP under an isoform which resists to proteinase K digestion (PrP-res). The PrP gene (PRNP) is located on chromosome 20 in humans. Several mutations of this gene have been described in all inherited TSE (CJD, GSS, and IFF). No treatment is available today. Agents inducing TSE (TSA) are not known: several authors claim that TSA are only constituted of PrP-res; others support the hypothesis of a conventional agent with a specific genetic information.

Proinflammatory and Anabolic Gene Expression Effects of Platelet-Rich Gel Supernatants on Equine Synovial Membrane Explants Challenged with Lipopolysaccharide

PubMed Central

Ríos, Diana L.; Pérez, Jorge E.

2017-01-01

Platelet-rich plasma (PRP) preparations are used in horses with osteoarthritis (OA). However, some controversies remain regarding the ideal concentration of platelets and leukocytes to produce an adequate anti-inflammatory and anabolic response in the synovial membrane. The aims of this study were to study the influence of leukoconcentrated platelet-rich gel (Lc-PRG) and leukoreduced platelet-rich gel (Lr-PRG) supernatants on the quantitative expression of some proinflammatory and anabolic genes in equine synovial membrane explants (SMEs) challenged with lipopolysaccharide (LPS). SMEs from six horses were cultured over 96 h. Then, SMEs were harvested for RNA extraction and quantitative gene expression analysis by RT-qPCR for nuclear factor kappa B (NFκB), matrix metalloproteinase 13 (MMP-13), a disintegrin and metalloproteinase with thrombospondin motifs 4 (ADAMTS-4), collagen type I alpha 1 (COL1A1), collagen type II alpha 1 (COL2A1), and cartilage oligomeric matrix protein (COMP). The 25% and 50% Lc-PRG supernatants led to downregulation of NFκB, MMP-13, ADAMTS-4, COL1A1, COL2A1, and COMP in SMEs. Lr-PRG supernatants (particularly at the 50% concentration) induced downregulation of NFκB, MMP-13, ADAMTS-4, and COL1A1 and upregulation of COL2A1 and COMP. Lr-PRG supernatants should be used for the treatment of inflammatory arthropathies in horses because they have anti-inflammatory and anabolic effects in the synovial membrane. PMID:28761774

Proinflammatory and Anabolic Gene Expression Effects of Platelet-Rich Gel Supernatants on Equine Synovial Membrane Explants Challenged with Lipopolysaccharide.

PubMed

Carmona, Jorge U; Ríos, Diana L; López, Catalina; Álvarez, María E; Pérez, Jorge E

2017-01-01

Platelet-rich plasma (PRP) preparations are used in horses with osteoarthritis (OA). However, some controversies remain regarding the ideal concentration of platelets and leukocytes to produce an adequate anti-inflammatory and anabolic response in the synovial membrane. The aims of this study were to study the influence of leukoconcentrated platelet-rich gel (Lc-PRG) and leukoreduced platelet-rich gel (Lr-PRG) supernatants on the quantitative expression of some proinflammatory and anabolic genes in equine synovial membrane explants (SMEs) challenged with lipopolysaccharide (LPS). SMEs from six horses were cultured over 96 h. Then, SMEs were harvested for RNA extraction and quantitative gene expression analysis by RT-qPCR for nuclear factor kappa B (NF κ B), matrix metalloproteinase 13 (MMP-13), a disintegrin and metalloproteinase with thrombospondin motifs 4 (ADAMTS-4), collagen type I alpha 1 (COL1A1), collagen type II alpha 1 (COL2A1), and cartilage oligomeric matrix protein (COMP). The 25% and 50% Lc-PRG supernatants led to downregulation of NF κ B, MMP-13, ADAMTS-4, COL1A1, COL2A1, and COMP in SMEs. Lr-PRG supernatants (particularly at the 50% concentration) induced downregulation of NF κ B, MMP-13, ADAMTS-4, and COL1A1 and upregulation of COL2A1 and COMP. Lr-PRG supernatants should be used for the treatment of inflammatory arthropathies in horses because they have anti-inflammatory and anabolic effects in the synovial membrane.

Protective Effect of Platelet Rich Plasma on Experimental Ischemia/Reperfusion Injury in Rat Ovary.

PubMed

Bakacak, Murat; Bostanci, Mehmet Suhha; İnanc, Fatma; Yaylali, Asli; Serin, Salih; Attar, Rukset; Yildirim, Gazi; Yildirim, Ozge Kizilkale

2016-01-01

Ovarian torsion is a common cause of local ischemic damage, reduced follicular activity and infertility. Platelet-rich plasma (PRP) contains growth factors with demonstrated cytoprotective properties; so we evaluated PRP efficacy in a rat ischemia/reperfusion (I/R) model. Sixty adult female Sprague-Dawley albino rats were randomly assigned to 6 groups of 8 animals each: Sham, Ischemia, I/R, Sham + PRP, I + PRP and I/R + PRP; and the remaining 12 used to prepare PRP. Ischemia groups were subjected to bilateral adnexal torsion for 3 h, while I/R and I/R + PRP groups received subsequent detorsion for 3 h. Intraperitoneal PRP was administered 30 min prior to ischemia (Ischemia + PRP) or reperfusion (I/R + PRP). Total oxidant status (TOS), oxidative stress index (OSI) and total ovarian histopathological scores were higher in Ischemia and I/R groups than in the Sham group (p < 0.05). PRP decreased mean TOS, OSI and histopathological scores in I + PRP and I/R + PRP groups compared to the corresponding Ischemia and I/R groups (p < 0.001). There was a strong correlation between total histopathological score and OSI (r = 0.877, p < 0.001). Peritoneal vascular endothelial growth factor was significantly higher in PRP-treated groups than corresponding untreated groups (p < 0.05). PRP is effective for the prevention of ischemia and reperfusion damage in rat ovary. © 2015 S. Karger AG, Basel.

Prion protein cleavage fragments regulate adult neural stem cell quiescence through redox modulation of mitochondrial fission and SOD2 expression.

PubMed

Collins, Steven J; Tumpach, Carolin; Groveman, Bradley R; Drew, Simon C; Haigh, Cathryn L

2018-03-24

Neurogenesis continues in the post-developmental brain throughout life. The ability to stimulate the production of new neurones requires both quiescent and actively proliferating pools of neural stem cells (NSCs). Actively proliferating NSCs ensure that neurogenic demand can be met, whilst the quiescent pool makes certain NSC reserves do not become depleted. The processes preserving the NSC quiescent pool are only just beginning to be defined. Herein, we identify a switch between NSC proliferation and quiescence through changing intracellular redox signalling. We show that N-terminal post-translational cleavage products of the prion protein (PrP) induce a quiescent state, halting NSC cellular growth, migration, and neurite outgrowth. Quiescence is initiated by the PrP cleavage products through reducing intracellular levels of reactive oxygen species. First, inhibition of redox signalling results in increased mitochondrial fission, which rapidly signals quiescence. Thereafter, quiescence is maintained through downstream increases in the expression and activity of superoxide dismutase-2 that reduces mitochondrial superoxide. We further observe that PrP is predominantly cleaved in quiescent NSCs indicating a homeostatic role for this cascade. Our findings provide new insight into the regulation of NSC quiescence, which potentially could influence brain health throughout adult life.

Genomic analysis of the aconidial and high-performance protein producer, industrially relevant Aspergillus niger SH2 strain.

PubMed

Yin, Chao; Wang, Bin; He, Pan; Lin, Ying; Pan, Li

2014-05-15

Aspergillus niger is usually regarded as a beneficial species widely used in biotechnological industry. Obtaining the genome sequence of the widely used aconidial A. niger SH2 strain is of great importance to understand its unusual production capability. In this study we assembled a high-quality genome sequence of A. niger SH2 with approximately 11,517 ORFs. Relatively high proportion of genes enriched for protein expression related FunCat items verify its efficient capacity in protein production. Furthermore, genome-wide comparative analysis between A. niger SH2 and CBS513.88 reveals insights into unique properties of A. niger SH2. A. niger SH2 lacks the gene related with the initiation of asexual sporulation (PrpA), leading to its distinct aconidial phenotype. Frame shift mutations and non-synonymous SNPs in genes of cell wall integrity signaling, β-1,3-glucan synthesis and chitin synthesis influence its cell wall development which is important for its hyphal fragmentation during industrial high-efficiency protein production. Copyright © 2014 Elsevier B.V. All rights reserved.

Immunogenicity and safety of a fully liquid aluminum phosphate adjuvanted Haemophilus influenzae type b PRP-CRM197-conjugate vaccine in healthy Japanese children: A phase III, randomized, observer-blind, multicenter, parallel-group study.

PubMed

Togashi, Takehiro; Mitsuya, Nodoka; Kogawara, Osamu; Sumino, Shuji; Takanami, Yohei; Sugizaki, Kayoko

2016-08-31

Broad use of monovalent Haemophilus influenzae type b (Hib) conjugate vaccines based on the capsular polysaccharide polyribosyl-ribitol phosphate (PRP), has significantly reduced invasive Hib disease burden in children worldwide, particularly in children aged <1year. In Japan, PRP conjugated to tetanus toxoid (PRP-T) vaccine has been widely used since the initiation of public funding programs followed by a routine vaccination designation in 2013. We compared the immunogenicity and safety of PRP conjugated to a non-toxic diphtheria toxin mutant (PRP-CRM197) vaccine with the PRP-T vaccine when administered subcutaneously to healthy Japanese children in a phase III study. Additionally, we evaluated the immunogenicity and safety profiles of a diphtheria-tetanus acellular pertussis (DTaP) combination vaccine when concomitantly administered with either PRP-CRM197 or PRP-T vaccines. The primary endpoint was the "long-term seroprotection rate", defined as the group proportion with anti-PRP antibody titers ⩾1.0μg/mL, after the primary series. Long-term seroprotection rates were 99.3% in the PRP-CRM197 group and 95.6% in the PRP-T group. The intergroup difference (PRP-CRM197 group - PRP-T group) was 3.7% (95% confidence interval: 0.099-7.336), demonstrating that PRP-CRM197 vaccine was non-inferior to PRP-T vaccine (p<0.0001). Furthermore, the "short-term seroprotection rate" (anti-PRP antibody titer ⩾0.15μg/mL) before booster vaccination was higher in the PRP-CRM197 group than in PRP-T. Concomitant administration of PRP-CRM197 vaccine with DTaP vaccine showed no differences in terms of immunogenicity compared with concomitant vaccination with PRP-T vaccine and DTaP vaccine. Although CRM197 vaccine had higher local reactogenicity, overall, both Hib vaccines had acceptable safety and tolerability profiles. The immunogenicity of PRP-CRM197 vaccine administered subcutaneously as a three-dose primary series in children followed by a booster vaccination 1year after the primary series induced protective levels of Hib antibodies with no safety or tolerability concerns. Registered on ClinicalTrials.gov: NCT01379846. Copyright © 2016 The Authors. Published by Elsevier Ltd.. All rights reserved.

The Physical Relationship between Infectivity and Prion Protein Aggregates Is Strain-Dependent

PubMed Central

Tixador, Philippe; Herzog, Laëtitia; Reine, Fabienne; Jaumain, Emilie; Chapuis, Jérôme; Le Dur, Annick; Laude, Hubert; Béringue, Vincent

2010-01-01

Prions are unconventional infectious agents thought to be primarily composed of PrPSc, a multimeric misfolded conformer of the ubiquitously expressed host-encoded prion protein (PrPC). They cause fatal neurodegenerative diseases in both animals and humans. The disease phenotype is not uniform within species, and stable, self-propagating variations in PrPSc conformation could encode this ‘strain’ diversity. However, much remains to be learned about the physical relationship between the infectious agent and PrPSc aggregation state, and how this varies according to the strain. We applied a sedimentation velocity technique to a panel of natural, biologically cloned strains obtained by propagation of classical and atypical sheep scrapie and BSE infectious sources in transgenic mice expressing ovine PrP. Detergent-solubilized, infected brain homogenates were used as starting material. Solubilization conditions were optimized to separate PrPSc aggregates from PrPC. The distribution of PrPSc and infectivity in the gradient was determined by immunoblotting and mouse bioassay, respectively. As a general feature, a major proteinase K-resistant PrPSc peak was observed in the middle part of the gradient. This population approximately corresponds to multimers of 12–30 PrP molecules, if constituted of PrP only. For two strains, infectivity peaked in a markedly different region of the gradient. This most infectious component sedimented very slowly, suggesting small size oligomers and/or low density PrPSc aggregates. Extending this study to hamster prions passaged in hamster PrP transgenic mice revealed that the highly infectious, slowly sedimenting particles could be a feature of strains able to induce a rapidly lethal disease. Our findings suggest that prion infectious particles are subjected to marked strain-dependent variations, which in turn could influence the strain biological phenotype, in particular the replication dynamics. PMID:20419156

Efficacy of platelet-rich plasma in arthroscopic repair of full-thickness rotator cuff tears: a meta-analysis.

PubMed

Cai, You-zhi; Zhang, Chi; Lin, Xiang-jin

2015-12-01

The use of platelet-rich plasma (PRP) is an innovative clinical therapy, especially in arthroscopic rotator cuff repair. The purpose of this study was to compare the clinical improvement and tendon-to-bone healing with and without PRP therapy in arthroscopic rotator cuff repair. A systematic search was done in the major medical databases to evaluate the studies using PRP therapy (PRP+) or with no PRP (PRP-) for the treatment of patients with rotator cuff tears. We reviewed clinical scores such as the Constant score, the American Shoulder and Elbow Surgeons score, the University of California at Los Angeles (UCLA) Shoulder Rating Scale, the Simple Shoulder Test, and the failure-to-heal rate by magnetic resonance imaging between PRP+ and PRP- groups. Five studies included in this review were used for a meta-analysis based on data availability. There were no statistically significant differences between PRP+ and PRP- groups for overall outcome scores (P > .05). However, the PRP+ group exhibited better healing rates postoperatively than the PRP- group (P = .03) in small/moderate full-thickness tears. The use of PRP therapy in full-thickness rotator cuff repairs showed no statistically significant difference compared with no PRP therapy in clinical outcome scores, but the failure-to-heal rate was significantly decreased when PRP was used for treatment of small-to-moderately sized tears. PRP therapy may improve tendon-to-bone healing in patients with small or moderate rotator cuff tears. Copyright © 2015 Journal of Shoulder and Elbow Surgery Board of Trustees. Published by Elsevier Inc. All rights reserved.

Normal platelet function in platelet concentrates requires non-platelet cells: a comparative in vitro evaluation of leucocyte-rich (type 1a) and leucocyte-poor (type 3b) platelet concentrates

PubMed Central

Parrish, William R; Roides, Breana; Hwang, Julia; Mafilios, Michael; Story, Brooks; Bhattacharyya, Samir

2016-01-01

Background Therapeutic success of platelet-rich plasma (PRP) may vary based on the composition and preparation method. The objective of this study was to evaluate the cellular components of platelet concentrates produced by a leucocyte-rich (LR-PRP) and a leucocyte-poor PRP systems (LP-PRP). Methods Parameters evaluated included platelet recovery, platelet concentration, red blood cell (RBC) and white blood cell (WBC) composition, platelet growth factor release and stimulation of human tendon cell proliferation in vitro. Results Platelet recoveries were 52% for LP-PRP and 89% for LR-PRP. LR-PRP demonstrated greater reproducibility with a 4.2% coefficient of variation (CV) compared with 19.4% for LP-PRP (p<0.001). LR-PRP demonstrated a greater increase in platelet concentration (7.9-fold) than LP-PRP (2.2-fold; p<0.001). LP-PRP showed 5.0-fold reductions in WBCs, while LR-PRP showed a 4.0-fold increase (p<0.001). LP-PRP reduced RBCs to a haematocrit of 0.25, while LR-PRP reduced haematocrit to 11.8. LP-PRP did not coagulate robustly on reactivation with CaCl2, and released significantly lower levels of epidermal growth factor (EGF) and transforming growth factor β1 (TGF-β1) than whole blood (p<0.03). LP-PRP also did not stimulate tendon cell proliferation greater than whole blood. In contrast, LR-PRP showed increases in each growth factor on activation with CaCl2 (p<0.01) and stimulated greater proliferation (p<0.05) compared with whole blood. Forced activation of LP-PRP with exogenous thrombin rescued the coagulation deficiency and induced greater growth factor release than comparable whole blood (p<0.03). Conclusions These data suggest that non-platelet cellular components in platelet concentrates are important for proper platelet function, including thrombin generation, growth factor release and clot retraction. PMID:27900155

Normal platelet function in platelet concentrates requires non-platelet cells: a comparative in vitro evaluation of leucocyte-rich (type 1a) and leucocyte-poor (type 3b) platelet concentrates.

PubMed

Parrish, William R; Roides, Breana; Hwang, Julia; Mafilios, Michael; Story, Brooks; Bhattacharyya, Samir

2016-01-01

Therapeutic success of platelet-rich plasma (PRP) may vary based on the composition and preparation method. The objective of this study was to evaluate the cellular components of platelet concentrates produced by a leucocyte-rich (LR-PRP) and a leucocyte-poor PRP systems (LP-PRP). Parameters evaluated included platelet recovery, platelet concentration, red blood cell (RBC) and white blood cell (WBC) composition, platelet growth factor release and stimulation of human tendon cell proliferation in vitro. Platelet recoveries were 52% for LP-PRP and 89% for LR-PRP. LR-PRP demonstrated greater reproducibility with a 4.2% coefficient of variation (CV) compared with 19.4% for LP-PRP (p<0.001). LR-PRP demonstrated a greater increase in platelet concentration (7.9-fold) than LP-PRP (2.2-fold; p<0.001). LP-PRP showed 5.0-fold reductions in WBCs, while LR-PRP showed a 4.0-fold increase (p<0.001). LP-PRP reduced RBCs to a haematocrit of 0.25, while LR-PRP reduced haematocrit to 11.8. LP-PRP did not coagulate robustly on reactivation with CaCl 2 , and released significantly lower levels of epidermal growth factor (EGF) and transforming growth factor β1 (TGF-β1) than whole blood (p<0.03). LP-PRP also did not stimulate tendon cell proliferation greater than whole blood. In contrast, LR-PRP showed increases in each growth factor on activation with CaCl 2 (p<0.01) and stimulated greater proliferation (p<0.05) compared with whole blood. Forced activation of LP-PRP with exogenous thrombin rescued the coagulation deficiency and induced greater growth factor release than comparable whole blood (p<0.03). These data suggest that non-platelet cellular components in platelet concentrates are important for proper platelet function, including thrombin generation, growth factor release and clot retraction.

Genetic predictions of prion disease susceptibility in carnivore species based on variability of the prion gene coding region.

PubMed

Stewart, Paula; Campbell, Lauren; Skogtvedt, Susan; Griffin, Karen A; Arnemo, Jon M; Tryland, Morten; Girling, Simon; Miller, Michael W; Tranulis, Michael A; Goldmann, Wilfred

2012-01-01

Mammalian species vary widely in their apparent susceptibility to prion diseases. For example, several felid species developed prion disease (feline spongiform encephalopathy or FSE) during the bovine spongiform encephalopathy (BSE) epidemic in the United Kingdom, whereas no canine BSE cases were detected. Whether either of these or other groups of carnivore species can contract other prion diseases (e.g. chronic wasting disease or CWD) remains an open question. Variation in the host-encoded prion protein (PrP(C)) largely explains observed disease susceptibility patterns within ruminant species, and may explain interspecies differences in susceptibility as well. We sequenced and compared the open reading frame of the PRNP gene encoding PrP(C) protein from 609 animal samples comprising 29 species from 22 genera of the Order Carnivora; amongst these samples were 15 FSE cases. Our analysis revealed that FSE cases did not encode an identifiable disease-associated PrP polymorphism. However, all canid PrPs contained aspartic acid or glutamic acid at codon 163 which we propose provides a genetic basis for observed susceptibility differences between canids and felids. Among other carnivores studied, wolverine (Gulo gulo) and pine marten (Martes martes) were the only non-canid species to also express PrP-Asp163, which may impact on their prion diseases susceptibility. Populations of black bear (Ursus americanus) and mountain lion (Puma concolor) from Colorado showed little genetic variation in the PrP protein and no variants likely to be highly resistant to prions in general, suggesting that strain differences between BSE and CWD prions also may contribute to the limited apparent host range of the latter.

Genetic Predictions of Prion Disease Susceptibility in Carnivore Species Based on Variability of the Prion Gene Coding Region

PubMed Central

Stewart, Paula; Campbell, Lauren; Skogtvedt, Susan; Griffin, Karen A.; Arnemo, Jon M.; Tryland, Morten; Girling, Simon; Miller, Michael W.; Tranulis, Michael A.; Goldmann, Wilfred

2012-01-01

Mammalian species vary widely in their apparent susceptibility to prion diseases. For example, several felid species developed prion disease (feline spongiform encephalopathy or FSE) during the bovine spongiform encephalopathy (BSE) epidemic in the United Kingdom, whereas no canine BSE cases were detected. Whether either of these or other groups of carnivore species can contract other prion diseases (e.g. chronic wasting disease or CWD) remains an open question. Variation in the host-encoded prion protein (PrPC) largely explains observed disease susceptibility patterns within ruminant species, and may explain interspecies differences in susceptibility as well. We sequenced and compared the open reading frame of the PRNP gene encoding PrPC protein from 609 animal samples comprising 29 species from 22 genera of the Order Carnivora; amongst these samples were 15 FSE cases. Our analysis revealed that FSE cases did not encode an identifiable disease-associated PrP polymorphism. However, all canid PrPs contained aspartic acid or glutamic acid at codon 163 which we propose provides a genetic basis for observed susceptibility differences between canids and felids. Among other carnivores studied, wolverine (Gulo gulo) and pine marten (Martes martes) were the only non-canid species to also express PrP-Asp163, which may impact on their prion diseases susceptibility. Populations of black bear (Ursus americanus) and mountain lion (Puma concolor) from Colorado showed little genetic variation in the PrP protein and no variants likely to be highly resistant to prions in general, suggesting that strain differences between BSE and CWD prions also may contribute to the limited apparent host range of the latter. PMID:23236380

Flow Cytometric Detection of PrPSc in Neurons and Glial Cells from Prion-Infected Mouse Brains.

PubMed

Yamasaki, Takeshi; Suzuki, Akio; Hasebe, Rie; Horiuchi, Motohiro

2018-01-01

In prion diseases, an abnormal isoform of prion protein (PrP Sc ) accumulates in neurons, astrocytes, and microglia in the brains of animals affected by prions. Detailed analyses of PrP Sc -positive neurons and glial cells are required to clarify their pathophysiological roles in the disease. Here, we report a novel method for the detection of PrP Sc in neurons and glial cells from the brains of prion-infected mice by flow cytometry using PrP Sc -specific staining with monoclonal antibody (MAb) 132. The combination of PrP Sc staining and immunolabeling of neural cell markers clearly distinguished neurons, astrocytes, and microglia that were positive for PrP Sc from those that were PrP Sc negative. The flow cytometric analysis of PrP Sc revealed the appearance of PrP Sc -positive neurons, astrocytes, and microglia at 60 days after intracerebral prion inoculation, suggesting the presence of PrP Sc in the glial cells, as well as in neurons, from an early stage of infection. Moreover, the kinetic analysis of PrP Sc revealed a continuous increase in the proportion of PrP Sc -positive cells for all cell types with disease progression. Finally, we applied this method to isolate neurons, astrocytes, and microglia positive for PrP Sc from a prion-infected mouse brain by florescence-activated cell sorting. The method described here enables comprehensive analyses specific to PrP Sc -positive neurons, astrocytes, and microglia that will contribute to the understanding of the pathophysiological roles of neurons and glial cells in PrP Sc -associated pathogenesis. IMPORTANCE Although formation of PrP Sc in neurons is associated closely with neurodegeneration in prion diseases, the mechanism of neurodegeneration is not understood completely. On the other hand, recent studies proposed the important roles of glial cells in PrP Sc -associated pathogenesis, such as the intracerebral spread of PrP Sc and clearance of PrP Sc from the brain. Despite the great need for detailed analyses of PrP Sc -positive neurons and glial cells, methods available for cell type-specific analysis of PrP Sc have been limited thus far to microscopic observations. Here, we have established a novel high-throughput method for flow cytometric detection of PrP Sc in cells with more accurate quantitative performance. By applying this method, we succeeded in isolating PrP Sc -positive cells from the prion-infected mouse brains via fluorescence-activated cell sorting. This allows us to perform further detailed analysis specific to PrP Sc -positive neurons and glial cells for the clarification of pathological changes in neurons and pathophysiological roles of glial cells. Copyright © 2017 American Society for Microbiology.

Different Molecular Mechanisms Mediate Direct or Glia-Dependent Prion Protein Fragment 90-231 Neurotoxic Effects in Cerebellar Granule Neurons.

PubMed

Thellung, Stefano; Gatta, Elena; Pellistri, Francesca; Villa, Valentina; Corsaro, Alessandro; Nizzari, Mario; Robello, Mauro; Florio, Tullio

2017-10-01

Glia over-stimulation associates with amyloid deposition contributing to the progression of central nervous system neurodegenerative disorders. Here we analyze the molecular mechanisms mediating microglia-dependent neurotoxicity induced by prion protein (PrP)90-231, an amyloidogenic polypeptide corresponding to the protease-resistant portion of the pathological prion protein scrapie (PrP Sc ). PrP90-231 neurotoxicity is enhanced by the presence of microglia within neuronal culture, and associated to a rapid neuronal [Ca ++ ] i increase. Indeed, while in "pure" cerebellar granule neuron cultures, PrP90-231 causes a delayed intracellular Ca ++ entry mediated by the activation of NMDA receptors; when neuron and glia are co-cultured, a transient increase of [Ca ++ ] i occurs within seconds after treatment in both granule neurons and glial cells, then followed by a delayed and sustained [Ca ++ ] i raise, associated with the induction of the expression of inducible nitric oxide synthase and phagocytic NADPH oxidase. [Ca ++ ] i fast increase in neurons is dependent on the activation of multiple pathways since it is not only inhibited by the blockade of voltage-gated channel activity and NMDA receptors but also prevented by the inhibition of nitric oxide and PGE 2 release from glial cells. Thus, Ca ++ homeostasis alteration, directly induced by PrP90-231 in cerebellar granule cells, requires the activation of NMDA receptors, but is greatly enhanced by soluble molecules released by activated glia. In glia-enriched cerebellar granule cultures, the activation of inducible nitric oxide (iNOS) and NADPH oxidase represents the main mechanism of toxicity since their pharmacological inhibition prevented PrP90-231 neurotoxicity, whereas NMDA blockade by D(-)-2-amino-5-phosphonopentanoic acid is ineffective; conversely, in pure cerebellar granule cultures, NMDA blockade but not iNOS inhibition strongly reduced PrP90-231 neurotoxicity. These data indicate that amyloidogenic peptides induce neurotoxic signals via both direct neuron interaction and glia activation through different mechanisms responsible of calcium homeostasis disruption in neurons and potentiating each other: the activation of excitotoxic pathways via NMDA receptors and the release of radical species that establish an oxidative milieu.

Effects of in vivo applications of peripheral blood-derived mesenchymal stromal cells (PB-MSCs) and platlet-rich plasma (PRP) on experimentally injured deep digital flexor tendons of sheep.

PubMed

Martinello, Tiziana; Bronzini, Ilaria; Perazzi, Anna; Testoni, Stefania; De Benedictis, Gulia Maria; Negro, Alessandro; Caporale, Giovanni; Mascarello, Francesco; Iacopetti, Ilaria; Patruno, Marco

2013-02-01

Tendon injuries, degenerative tendinopathies, and overuse tendinitis are common in races horses. Novel therapies aim to restore tendon functionality by means of cell-based therapy, growth factor delivery, and tissue engineering approaches. This study examined the use of autologous mesenchymal stromal cells derived from peripheral blood (PB-MSCs), platelet-rich plasma (PRP) and a combination of both for ameliorating experimental lesions on deep digital flexor tendons (DDFT) of Bergamasca sheep. In particular, testing the combination of blood-derived MSCs and PRP in an experimental animal model represents one of the few studies exploring a putative synergistic action of these treatments. Effectiveness of treatments was evaluated at 30 and 120 days comparing clinical, ultrasonographic, and histological features together with immunohistochemical expression of collagen types 1 and 3, and cartilage oligomeric matrix protein (COMP). Significant differences were found between treated groups and their corresponding controls (placebo) regarding tendon morphology and extracellular matrix (ECM) composition. However, our results indicate that the combined use of PRP and MSCs did not produce an additive or synergistic regenerative response and highlighted the predominant effect of MSCs on tendon healing, enhanced tissue remodeling and improved structural organization. Copyright © 2012 Orthopaedic Research Society.

Short-Term Storage of Platelet-Rich Plasma at Room Temperature Does Not Affect Growth Factor or Catabolic Cytokine Concentration.

PubMed

Wilson, Brooke H; Cole, Brian J; Goodale, Margaret B; Fortier, Lisa A

2018-04-01

The aim of this study was to provide clinical recommendations about the use of platelet-rich plasma (PRP) that was subjected to short-term storage at room temperature. We determined bioactive growth factor and cytokine concentrations as indicators of platelet and white blood cell degranulation in blood and PRP. Additionally, this study sought to validate the use of manual, direct smear analysis as an alternative to automated methods for platelet quantification in PRP. Blood was used to generate low-leukocyte PRP (Llo PRP) or high-leukocyte PRP (Lhi PRP). Blood was either processed immediately or kept at room temperature for 2 or 4 hours prior to generation of PRP, which was then held at room temperature for 0, 1, 2, or 4 hours. Subsequently, bioactive transforming growth factor beta-1 and matrix metalloproteinase-9 were measured by ELISA (enzyme-linked immunosorbent assay). Manual and automated platelet counts were performed on all blood and PRP samples. There were no differences in growth factor or cytokine concentration when blood or Llo PRP or Lhi PRP was retained at room temperature for up to 4 hours. Manual, direct smear analysis for platelet quantification was not different from the use of automated machine counting for PRP samples, but in the starting blood samples, manual platelet counts were significantly higher than those generated using automated technology. When there is a delay of up to 4 hours in the generation of PRP from blood or in the application of PRP to the patient, bioactive growth factor and cytokine concentrations remain stable in both blood and PRP. A manual direct counting method is a simple, cost-effective, and valid method to measure the contents of the PRP product being delivered to the patient.

Transmissibility of Gerstmann-Sträussler-Scheinker syndrome in rodent models: New insights into the molecular underpinnings of prion infectivity.

PubMed

Nonno, Romolo; Angelo Di Bari, Michele; Agrimi, Umberto; Pirisinu, Laura

2016-11-01

Prion diseases, or transmissible spongiform encephalopathies, have revealed the bewildering phenomenon of transmissibility in neurodegenerative diseases. Hence, the experimental transmissibility of prion-like neurodegenerative diseases via template directed misfolding has become the focus of intense research. Gerstmann-Sträussler-Scheinker disease (GSS) is an inherited prion disease associated with mutations in the prion protein gene. However, with the exception of a few GSS cases with P102L mutation characterized by co-accumulation of protease-resistant PrP core (PrP res ) of ∼21 kDa, attempts to transmit to rodents GSS associated to atypical misfolded prion protein with ∼8 kDa PrP res have been unsuccessful. As a result, these GSS subtypes have often been considered as non-transmissible proteinopathies rather than true prion diseases. In a recent study we inoculated bank voles with GSS cases associated with P102L, A117V and F198S mutations and found that they transmitted efficiently and produced distinct pathological phenotypes, irrespective of the presence of 21 kDa PrP res in the inoculum. This study demonstrates that GSS is a genuine prion disease characterized by both transmissibility and strain variation. We discuss the implications of these findings for the understanding of the heterogeneous clinic-pathological phenotypes of GSS and of the molecular underpinnings of prion infectivity.

Use of Whole-Genome Phylogeny and Comparisons for Development of a Multiplex PCR Assay To Identify Sequence Type 36 Vibrio parahaemolyticus.

PubMed

Whistler, Cheryl A; Hall, Jeffrey A; Xu, Feng; Ilyas, Saba; Siwakoti, Puskar; Cooper, Vaughn S; Jones, Stephen H

2015-06-01

Vibrio parahaemolyticus sequence type 36 (ST36) strains that are native to the Pacific Ocean have recently caused multistate outbreaks of gastroenteritis linked to shellfish harvested from the Atlantic Ocean. Whole-genome comparisons of 295 genomes of V. parahaemolyticus, including several traced to northeastern U.S. sources, were used to identify diagnostic loci, one putatively encoding an endonuclease (prp), and two others potentially conferring O-antigenic properties (cps and flp). The combination of all three loci was present in only one clade of closely related strains of ST36, ST59, and one additional unknown sequence type. However, each locus was also identified outside this clade, with prp and flp occurring in only two nonclade isolates and cps in four. Based on the distribution of these loci in sequenced genomes, prp identified clade strains with >99% accuracy, but the addition of one more locus increased accuracy to 100%. Oligonucleotide primers targeting prp and cps were combined in a multiplex PCR method that defines species using the tlh locus and determines the presence of both the tdh and trh hemolysin-encoding genes, which are also present in ST36. Application of the method in vitro to a collection of 94 clinical isolates collected over a 4-year period in three northeastern U.S. states and 87 environmental isolates revealed that the prp and cps amplicons were detected only in clinical isolates identified as belonging to the ST36 clade and in no environmental isolates from the region. The assay should improve detection and surveillance, thereby reducing infections. Copyright © 2015, American Society for Microbiology. All Rights Reserved.

Comparative outcomes of open-wedge high tibial osteotomy with platelet-rich plasma alone or in combination with mesenchymal stem cell treatment: a prospective study.

PubMed

Koh, Yong-Gon; Kwon, Oh-Ryong; Kim, Yong-Sang; Choi, Yun-Jin

2014-11-01

This study compared the clinical results and second-look arthroscopic findings of patients undergoing open-wedge high tibial osteotomy (HTO) for varus deformity, with or without mesenchymal stem cell (MSC) therapy. This prospective, comparative observational study was designed to evaluate the effectiveness of MSC therapy. The patients were divided into 2 groups: HTO with platelet-rich plasma (PRP) injection only (n = 23) or HTO in conjunction with MSC therapy and PRP injection (n = 21). Prospective evaluations of both groups were performed using the Lysholm score, Knee Injury and Osteoarthritis Outcome Score (KOOS), and a visual analog scale (VAS) score for pain. Second-look arthroscopy was carried out in all patients at the time of metal removal. The patients in the MSC-PRP group showed significantly greater improvements in the KOOS subscales for pain (PRP only, 74.0 ± 5.7; MSC-PRP, 81.2 ± 6.9; P < .001) and symptoms (PRP only, 75.4 ± 8.5; MSC-PRP, 82.8 ± 7.2; P = .006) relative to the PRP-only group. Although the mean Lysholm score was similarly improved in both groups (PRP only, 80.6 ± 13.5; MSC-PRP, 84.7 ± 16.2; P = .357), the MSC-PRP group showed a significantly greater improvement in the VAS pain score (PRP only, 16.2 ± 4.6; MSC-PRP, 10.2 ± 5.7; P < .001). There were no differences in the preoperative (PRP only, varus 2.8° ± 1.7°; MSC-PRP, varus 3.4° ± 3.0°; P = .719) and postoperative (PRP only, valgus 9.8° ± 2.4°; MSC-PRP, valgus 8.7° ± 2.3°; P = .678) femorotibial angles or weight-bearing lines between the groups. Arthroscopic evaluation, at plate removal, showed that partial or even fibrocartilage coverage was achieved in 50% of the MSC-PRP group patients but in only 10% of the patients in the PRP-only group (P < .001). MSC therapy, in conjunction with HTO, mildly improved cartilage healing and showed good clinical results in some KOOS subscores and the VAS pain score compared with PRP only. Level II, prospective comparative study. Copyright © 2014 Arthroscopy Association of North America. Published by Elsevier Inc. All rights reserved.

The Role of Shed PrPc in the Neuropathogenesis of HIV Infection.

PubMed

Megra, Bezawit W; Eugenin, Eliseo A; Berman, Joan W

2017-07-01

HIV-1 enters the CNS soon after peripheral infection and causes chronic neuroinflammation and neuronal damage that leads to cognitive impairment in 40-70% of HIV-infected people. The nonpathogenic cellular isoform of the human prion protein (PrP c ) is an adhesion molecule constitutively expressed in the CNS. Previously, our laboratory showed that shed PrP c (sPrP c ) is increased in the cerebrospinal fluid of HIV-infected people with cognitive deficits as compared with infected people with no impairment. In this article, we demonstrate that CCL2 and TNF-α, inflammatory mediators that are elevated in the CNS of HIV-infected people, increase shedding of PrP c from human astrocytes by increasing the active form of the metalloprotease ADAM10. We show that the consequence of this shedding can be the production of inflammatory mediators, because treatment of astrocytes with rPrP c increased secretion of CCL2, CXCL-12, and IL-8. Supernatants from rPrP c -treated astrocytes containing factors produced in response to this treatment, but not rPrP c by itself, cause increased chemotaxis of both uninfected and HIV-infected human monocytes, suggesting a role for sPrP c in monocyte recruitment into the brain. Furthermore, we examined whether PrP c participates in glutamate uptake and found that rPrP c decreased uptake of this metabolite in astrocytes, which could lead to neurotoxicity and neuronal loss. Collectively, our data characterize mediators involved in PrP c shedding and the effect of this sPrP c on monocyte chemotaxis and glutamate uptake from astrocytes. We propose that shedding of PrP c could be a potential target for therapeutics to limit the cognitive impairment characteristic of neuroAIDS. Copyright © 2017 by The American Association of Immunologists, Inc.

Comparison of the Efficacy of Homologous and Autologous Platelet-Rich Plasma (PRP) for Treating Androgenic Alopecia.

PubMed

Ince, Bilsev; Yildirim, Mehmet Emin Cem; Dadaci, Mehmet; Avunduk, Mustafa Cihat; Savaci, Nedim

2018-02-01

Androgenetic alopecia (AGA), the most common cause of hair loss in both sexes, accounts for 95% of all cases of hair loss. Although the literature has suggested that both nonactivated (n-PRP) and activated autologous (a-PRP) PRP can be used to treat AGA, we did not find any study investigating the use of homologous PRP (h-PRP) for this purpose. Also, to the best of our knowledge, there are no studies comparing the efficacy of h-PRP, a-PRP, or n-PRP on AGA therapy. The aim of this study was to compare the increase in hair density, average number of platelets, complications, preparation, and duration of application in the treatment of AGA using a-PRP, n-PRP, and h-PRP. Between 2014 and 2015, we studied male patients who had experienced increased hair loss in the last year. Patients were divided into three groups: Group 1 received n-PRP, Group 2 received active PRP, and Group 3 received h-PRP. For Group 1, PRP was prepared by a single centrifugation prepared from the patient's own blood. For Group 2, the PRP was prepared from the patient's own blood, but a second centrifugation was applied for platelet activation with calcium chloride. For Group 3, the PRP was prepared from pooled platelets with the same blood group as the patient from the blood center. PRP was injected at 1, 2, and 6 months. The hair density (n/cm 2 ) of each patient before and after injection was calculated. Each patient was assigned a fixed evaluation point at the time of application to calculate hair density. At 2, 6, and 12 months after the first treatment, the increase in hair density was calculated as 11.2, 26.1, and 32.4%, respectively, in Group 1; 8.1, 12.5, and 20.8%, respectively, in Group 2; and 16.09, 36.41, and 41.76%, respectively, in Group 3. The increase in hair density was statistically significantly greater in Group 1 than in Group 2 and more so in Group 3 than in both groups among all controls (p < 0.05). The efficacy of both PRPs was determined in AGA treatment in our study. However, it was determined statistically that the increase in hair density with h-PRP was greater than with autologous PRP groups. We believe that h-PRP therapy can be used in patients with AGA presenting with hair loss. This journal requires that authors assign a level of evidence to each article. For a full description of these Evidence-Based Medicine ratings, please refer to the Table of Contents or the online Instructions to Authors www.springer.com/00266 .

Erythrocyte sedimentation rate and fibrinogen concentration of whole blood influences the cellular composition of platelet-rich plasma obtained from centrifugation methods.

PubMed

Yin, Wenjing; Xu, Zhengliang; Sheng, Jiagen; Xie, Xuetao; Zhang, Changqing

2017-09-01

Erythrocyte sedimentation rate (ESR), which reflects the sedimentation rate of platelets, leukocytes and erythrocytes in response to centrifugal force, may influence the cellular composition of platelet-rich plasma (PRP) obtained via centrifugation methods. However, no relevant studies have substantiated this. In the present study, blood was collected from 40 healthy volunteers and used to prepare PRP with two plasma-based preparation systems [YinPRP and Plasma Rich in Growth Factor (PRGF) systems] and two buffy coat-based systems (RegenPRP and WEGOPRP systems) in a single-donor model. Volumes of PRP and platelet-poor plasma (PPP) that were removed in the preparation process were recorded. Analyses of ESR, haematocrit, C-reaction protein, coagulation, serum glucose and serum lipid of the whole blood used for PRP preparation were performed to evaluate the levels of ESR and the factors known to influence it. Whole blood analysis was performed to evaluate the cellular composition of PRP. Results demonstrated that there were marked positive correlations between the ESR of the whole blood used for PRP preparation and PPP removal efficiencies, platelet concentrations, platelet capture efficiencies and platelet enrichment factors of PRP formulations obtained from plasma-based systems, and PRP yield efficiency of RegenPRP and PPP removal efficiency of WEGOPRP. Furthermore, there were marked negative correlations between ESR and concentrations and enrichment factors of platelets, leukocytes and erythrocytes of RegenPRP. Fibrinogen concentration of the whole blood, which had a marked positive correlation with ESR, also influenced the cellular composition of PRP. These findings may increase the understanding of PRP preparation and provide substantial evidence for the individualised optimisation of PRP preparation systems used in clinical practice.

The positive effects of different platelet-rich plasma methods on human muscle, bone, and tendon cells.

PubMed

Mazzocca, Augustus D; McCarthy, Mary Beth R; Chowaniec, David M; Dugdale, Evan M; Hansen, Derek; Cote, Mark P; Bradley, James P; Romeo, Anthony A; Arciero, Robert A; Beitzel, Knut

2012-08-01

Clinical application of platelet-rich plasma (PRP) in the realm of orthopaedic sports medicine has yielded variable results. Differences in separation methods and variability of the individual may contribute to these variable results. To compare the effects of different PRP separation methods on human bone, muscle, and tendon cells in an in vitro model. Controlled laboratory study. Blood collected from 8 participants (mean ± SD age 31.6 ± 10.9 years) was used to obtain PRP preparations. Three different PRP separation methods were used: a single-spin process yielding a lower platelet concentration (PRP(LP)), a single-spin process yielding high platelet and white blood cell concentrations (PRP(HP)), and a double-spin that produces a higher platelet concentration and lower white blood cell concentration (PRP(DS)). Human bone, muscle, and tendon cells obtained from discarded tissue samples during shoulder surgery were placed into culture and treated with the 3 PRP preparations, control media (2% fetal bovine serum [FBS] and 10% FBS), and native blood. Radioactive thymidine assays were obtained to examine cell proliferation, and testing with enzyme-linked immunosorbent assay was used to determine growth factor concentrations. Addition of PRP(LP) to osteocytes, myocytes, and tenocytes significantly increased cell proliferation (P ≤ .05) compared with the controls. Adding PRP(DS) to osteoblasts and tenocytes increased cell proliferation significantly (P ≤ .05), but no significance was shown for its addition to myocytes. The addition of PRP(HP) significantly increased cell proliferation compared with the controls only when added to tenocytes (P ≤ .05). Osteoblasts: Proliferation was significantly increased by addition of PRP(LP) compared with all controls (2% FBS, 10% FBS, native blood) (P ≤ .05). Addition of PRP(DS) led to significantly increased proliferation compared with all controls, native blood, and PRP(HP) (P ≤ .05). Proliferation was significantly less when PRP(HP) was added compared with PRP(DS) (P ≤ .05). Myocytes: Proliferation was significantly increased by addition of PRP(LP) compared with native blood (P ≤ .05). Adding PRP(HP) or PRP(DS) to myocytes showed no significant increase in proliferation compared with the controls or the other separations. Tenocytes: Proliferation was significantly increased by addition of PRP(LP) compared with all controls (2% FBS, 10% FBS, native blood) (P ≤ .05). Addition of PRP(DS) showed a significant increase compared with the controls and native blood. For tenocytes, there was a significant increase (P ≤ .05) seen when PRP(HP) was added compared with the controls and native blood but not compared with the other separations. The primary findings of this study suggest the application of different PRP separations may result in a potential beneficial effect on the clinically relevant target cells in vitro. However, it is unclear which platelet concentration or PRP preparation may be optimal for the treatment of various cell types. In addition, a "more is better" theory for the use of higher platelet concentrations cannot be supported. This study was not intended to prove efficacy but to provide a platform for future research to be built upon. The utilization of different PRP separations may result in a potentially beneficial effect on the clinically relevant target cells in vitro, but it is unclear which platelet concentration or PRP preparation may be optimal for the treatment of various cell types.

Characterization and potential of plant growth promoting rhizobacteria isolated from native Andean crops.

PubMed

Ogata-Gutiérrez, Katty; Chumpitaz-Segovia, Carolina; Lirio-Paredes, Jesus; Finetti-Sialer, Mariella M; Zúñiga-Dávila, Doris

2017-10-27

Bacteria isolated from soil and rhizosphere samples collected in Peru from Andean crops were tested in vitro and in vivo to determine their potential as plant growth promoters and their ability to induce systemic resistance to Alternaria alternata in tomato plants. The isolates were identified by sequencing their 16S ribosomal RNA gene. Test for phosphate solubilization, and indolacetic acid were also carried out, together with in vitro antagonism assays in dual cultures towards the plant pathogens Fusarium solani, A. alternata and Curvularia lunata. The three most promising isolates (Pa15, Ps155, Ps168) belonged to the genus Pseudomonas. Further assays were carried out with tomato plants to assess their plant protection effect towards A. alternata and as growth promoters. Inoculation of tomato seeds with all isolates significantly enhanced seed germination, plantlets emergence and plant development. Bacterial inoculation also reduce damage level caused by A. alternata. The expression levels of three tomato genes involved in the jasmonate (AOS), ethylene responsive (ERF-2) and pathogenesis related (PR-P2) pathways were determined in plants challenged with A. alternata, alone or with each bacterial isolate, respectively. Results showed that at 24 h after infection, in absence of the pathogen, the expression level of the tested genes was very low. The presence of A. alternata alone and in combination with bacteria increased the transcripts of all genes. Data showed a potential of best performing isolate Ps168 to sustain tomato plants nutrition and activate defense-related genes for protection by pathogenic fungi.

PrP(C) regulates epidermal growth factor receptor function and cell shape dynamics in Neuro2a cells.

PubMed

Llorens, Franc; Carulla, Patricia; Villa, Ana; Torres, Juan M; Fortes, Puri; Ferrer, Isidre; del Río, José A

2013-10-01

The prion protein (PrP) plays a key role in prion disease pathogenesis. Although the misfolded and pathologic variant of this protein (PrP(SC)) has been studied in depth, the physiological role of PrP(C) remains elusive and controversial. PrP(C) is a cell-surface glycoprotein involved in multiple cellular functions at the plasma membrane, where it interacts with a myriad of partners and regulates several intracellular signal transduction cascades. However, little is known about the gene expression changes modulated by PrP(C) in animals and in cellular models. In this article, we present PrP(C)-dependent gene expression signature in N2a cells and its implication in the most overrepresented functions: cell cycle, cell growth and proliferation, and maintenance of cell shape. PrP(C) over-expression enhances cell proliferation and cell cycle re-entrance after serum stimulation, while PrP(C) silencing slows down cell cycle progression. In addition, MAP kinase and protein kinase B (AKT) pathway activation are under the regulation of PrP(C) in asynchronous cells and following mitogenic stimulation. These effects are due in part to the modulation of epidermal growth factor receptor (EGFR) by PrP(C) in the plasma membrane, where the two proteins interact in a multimeric complex. We also describe how PrP(C) over-expression modulates filopodia formation by Rho GTPase regulation mainly in an AKT-Cdc42-N-WASP-dependent pathway. © 2013 International Society for Neurochemistry.

Implicit hype? Representations of platelet rich plasma in the news media.

PubMed

Rachul, Christen; Rasko, John E J; Caulfield, Timothy

2017-01-01

Platelet Rich Plasma (PRP) has gained popularity in recent years for treating sports-related injuries and the news media frequently reports on elite athletes' and celebrities' use of PRP. We conducted a content analysis of newspaper coverage of PRP in Australia, Canada, Ireland, New Zealand, United Kingdom, and the United States. Findings show that news media coverage of PRP appears most frequently in sports-related stories, and in relation to elite athletes use of PRP. PRP injections are largely portrayed as a routine treatment for sports-related injuries and newspaper articles rarely discuss the limitations or efficacy of PRP. We argue that while news media coverage of PRP exhibits very few common hallmarks of hype, its portrayal as a routine treatment used by elite athletes and celebrities creates an implicit hype. This implicit hype can contribute to public misunderstandings of the efficacy of PRP.

Implicit hype? Representations of platelet rich plasma in the news media

PubMed Central

2017-01-01

Platelet Rich Plasma (PRP) has gained popularity in recent years for treating sports-related injuries and the news media frequently reports on elite athletes’ and celebrities’ use of PRP. We conducted a content analysis of newspaper coverage of PRP in Australia, Canada, Ireland, New Zealand, United Kingdom, and the United States. Findings show that news media coverage of PRP appears most frequently in sports-related stories, and in relation to elite athletes use of PRP. PRP injections are largely portrayed as a routine treatment for sports-related injuries and newspaper articles rarely discuss the limitations or efficacy of PRP. We argue that while news media coverage of PRP exhibits very few common hallmarks of hype, its portrayal as a routine treatment used by elite athletes and celebrities creates an implicit hype. This implicit hype can contribute to public misunderstandings of the efficacy of PRP. PMID:28792974

Characteristics of canine platelet-rich plasma prepared with five commercially available systems.

PubMed

Franklin, Samuel P; Garner, Bridget C; Cook, James L

2015-09-01

To characterize platelet-rich plasma (PRP) products obtained from canine blood by use of a variety of commercially available devices. Blood samples from 15 dogs between 18 months and 9 years of age with no concurrent disease, except for osteoarthritis in some dogs. PRP products were produced from blood obtained from each of the 15 dogs by use of each of 5 commercially available PRP-concentrating systems. Complete blood counts were performed on each whole blood sample and PRP product. The degree of platelet, leukocyte, and erythrocyte concentration or reduction for PRP, compared with results for the whole blood sample, was quantified for each dog and summarized for each concentrating system. The various PRP-concentrating systems differed substantially in the amount of blood processed, method of PRP preparation, amount of PRP produced, and platelet, leukocyte, and erythrocyte concentrations or reductions for PRP relative to results for whole blood. The characteristics of PRP products differed considerably. Investigators evaluating the efficacy of PRPs need to specify the characteristics of the product they are assessing. Clinicians should be aware of the data (or lack of data) supporting use of a particular PRP for a specific medical condition.

Platelet-Rich Plasma Promotes Axon Regeneration, Wound Healing, and Pain Reduction: Fact or Fiction.

PubMed

Kuffler, Damien P

2015-10-01

Platelet-rich plasma (PRP) has been tested in vitro, in animal models, and clinically for its efficacy in enhancing the rate of wound healing, reducing pain associated with injuries, and promoting axon regeneration. Although extensive data indicate that PRP-released factors induce these effects, the claims are often weakened because many studies were not rigorous or controlled, the data were limited, and other studies yielded contrary results. Critical to assessing whether PRP is effective are the large number of variables in these studies, including the method of PRP preparation, which influences the composition of PRP; type of application; type of wounds; target tissues; and diverse animal models and clinical studies. All these variables raise the question of whether one can anticipate consistent influences and raise the possibility that most of the results are correct under the circumstances where PRP was tested. This review examines evidence on the potential influences of PRP and whether PRP-released factors could induce the reported influences and concludes that the preponderance of evidence suggests that PRP has the capacity to induce all the claimed influences, although this position cannot be definitively argued. Well-defined and rigorously controlled studies of the potential influences of PRP are required in which PRP is isolated and applied using consistent techniques, protocols, and models. Finally, it is concluded that, because of the purported benefits of PRP administration and the lack of adverse events, further animal and clinical studies should be performed to explore the potential influences of PRP.

Ranibizumab Plus Panretinal Photocoagulation versus Panretinal Photocoagulation Alone for High-Risk Proliferative Diabetic Retinopathy (PROTEUS Study).

PubMed

Figueira, João; Fletcher, Emily; Massin, Pascale; Silva, Rufino; Bandello, Francesco; Midena, Edoardo; Varano, Monica; Sivaprasad, Sobha; Eleftheriadis, Haralabos; Menon, Geeta; Amaro, Miguel; Ayello Scheer, Sarah; Creuzot-Garcher, Catherine; Nascimento, João; Alves, Dalila; Nunes, Sandrina; Lobo, Conceição; Cunha-Vaz, José

2018-05-01

Comparison of the efficacy of ranibizumab (RBZ) 0.5 mg intravitreal injections plus panretinal photocoagulation (PRP) versus PRP alone in the regression of the neovascularization (NV) area in subjects with high-risk proliferative diabetic retinopathy (HR-PDR) over a 12-month period. Prospective, randomized, multicenter, open-label, phase II/III study. Eighty-seven participants (aged ≥18 years) with type 1/2 diabetes and HR-PDR (mean age, 55.2 years; 37% were female). Participants were randomized (1:1) to receive RBZ+PRP (n = 41) or PRP monotherapy (n = 46). The RBZ+PRP group received 3 monthly RBZ injections along with standard PRP. The PRP monotherapy group received standard PRP between day 1 and month 2; thereafter, re-treatments in both groups were at the investigators' discretion. The primary outcome was regression of NV total, on the disc (NVD) plus elsewhere (NVE), defined as any decrease in the area of NV from the baseline to month 12. Secondary outcomes included best-corrected visual acuity (BCVA) changes from baseline to month 12, time to complete NV regression, recurrence of NV, macular retinal thickness changes from baseline to month 12, need for treatment for diabetic macular edema, need for vitrectomy because of occurrence of vitreous hemorrhage, tractional retinal detachment or other complications of DR, and adverse events (AEs) related to treatments. Seventy-seven participants (88.5%) completed the study. Overall baseline demographics were similar for both groups, except for age. At month 12, 92.7% of participants in the RBZ+PRP group presented NV total reduction versus 70.5% of the PRP monotherapy participants (P = 0.009). The number of participants with NVD and NVE reductions was higher with RBZ+PRP (93.3% and 91.4%, respectively) versus PRP (68.8% and 73.7%, respectively), significant only for NVE (P = 0.048). Complete NV total regression was observed in 43.9% in the RBZ+PRP group versus 25.0% in the PRP monotherapy group (P = 0.066). At month 12, the mean BCVA was 75.2 letters (20/32) in the RBZ+PRP group versus 69.2 letters (20/40) in the PRP monotherapy group (P = 0.104). In the RBZ+PRP group, the mean number of PRP treatments over month 12 was 3.5±1.3, whereas in the PRP monotherapy group, it was 4.6±1.5 (P = 0.001). No deaths or unexpected AEs were reported. Treatment with RBZ+PRP was more effective than PRP monotherapy for NV regression in HR-PDR participants over 12 months. Copyright © 2018 American Academy of Ophthalmology. Published by Elsevier Inc. All rights reserved.

Phosphorylated human tau associates with mouse prion protein amyloid in scrapie-infected mice but does not increase progression of clinical disease.

PubMed

Race, Brent; Phillips, Katie; Kraus, Allison; Chesebro, Bruce

2016-07-03

Tauopathies are a family of neurodegenerative diseases in which fibrils of human hyperphosphorylated tau (P-tau) are believed to cause neuropathology. In Alzheimer disease, P-tau associates with A-beta amyloid and contributes to disease pathogenesis. In familial human prion diseases and variant CJD, P-tau often co-associates with prion protein amyloid, and might also accelerate disease progression. To test this latter possibility, here we compared progression of amyloid prion disease in vivo after scrapie infection of mice with and without expression of human tau. The mice used expressed both anchorless prion protein (PrP) and membrane-anchored PrP, that generate disease associated amyloid and non-amyloid PrP (PrPSc) after scrapie infection. Human P-tau induced by scrapie infection was only rarely associated with non-amyloid PrPSc, but abundant human P-tau was detected at extracellular, perivascular and axonal deposits associated with amyloid PrPSc. This pathology was quite similar to that seen in familial prion diseases. However, association of human and mouse P-tau with amyloid PrPSc did not diminish survival time following prion infection in these mice. By analogy, human P-tau may not affect prion disease progression in humans. Alternatively, these results might be due to other factors, including rapidity of disease, blocking effects by mouse tau, or low toxicity of human P-tau in this model.

Immunohistochemical Expression of Collagens in the Skin of Horses Treated with Leukocyte-Poor Platelet-Rich Plasma

PubMed Central

Silva, Mariana Brettas; Pinto, José de Oliveira; Lima, Marianna Barros de Souza; Crepaldi, Júlio; Lopes, Gabriela Francine Martins; dos Santos, Hélio Batista; Ribeiro, Rosy Iara Maciel de Azambuja; Thomé, Ralph Gruppi

2015-01-01

This study evaluated the immunohistochemical expression of type I (COL I) and III (COL III) collagens during the healing process of skin treated with leukocyte-poor platelet-rich plasma (LP-PRP). Seven healthy gelding crossbred horses aged 16 to 17 years were used. Two rectangle-shaped wounds were created surgically in the right and left gluteal regions. Twelve hours after wound induction, 0.5 mL of the LP-PRP was administered in each edge of the wounds of one of the gluteal regions. The contralateral region was used as control (CG). Three samples were obtained: after wound induction (T0), 14 days (T1) of healing process, and after complete closure of the skin (T2). The normal skin (T0) showed strong staining for type III and I collagen in papillary and reticular dermis, respectively. In the scar of the treated group, COL III showed important (p < 0.05) increase in immunoreaction in T2 compared with T1. The administration of a single dose of LP-PRP 12 h after induction of wound in horses does not influence formation of collagens I and III. However, the intense labeling for COL III suggests that the tissue was still weak during the macroscopic closure of the wound, demonstrating that healing was not completely finished. PMID:26236743

Effects of Calcium Sulfate Combined with Platelet-rich Plasma on Restoration of Long Bone Defect in Rabbits

PubMed Central

Chen, Hua; Ji, Xin-Ran; Zhang, Qun; Tian, Xue-Zhong; Zhang, Bo-Xun; Tang, Pei-Fu

2016-01-01

Background: The treatment for long bone defects has been a hot topic in the field of regenerative medicine. This study aimed to evaluate the therapeutic effects of calcium sulfate (CS) combined with platelet-rich plasma (PRP) on long bone defect restoration. Methods: A radial bone defect model was constructed through an osteotomy using New Zealand rabbits. The rabbits were randomly divided into four groups (n = 10 in each group): a CS combined with PRP (CS-PRP) group, a CS group, a PRP group, and a positive (recombinant human bone morphogenetic protein-2) control group. PRP was prepared from autologous blood using a two-step centrifugation process. CS-PRP was obtained by mixing hemihydrate CS with PRP. Radiographs and histologic micrographs were generated. The percentage of bone regenerated bone area in each rabbit was calculated at 10 weeks. One-way analysis of variance was performed in this study. Results: The radiographs and histologic micrographs showed bone restoration in the CS-PRP and positive control groups, while nonunion was observed in the CS and PRP groups. The percentages of bone regenerated bone area in the CS-PRP (84.60 ± 2.87%) and positive control (52.21 ± 4.53%) groups were significantly greater than those in the CS group (12.34 ± 2.17%) and PRP group (16.52 ± 4.22%) (P < 0.001). In addition, the bone strength of CS-PRP group (43.10 ± 4.10%) was significantly greater than that of the CS group (20.10 ± 3.70%) or PRP group (25.10 ± 2.10%) (P < 0.001). Conclusion: CS-PRP functions as an effective treatment for long bone defects through stimulating bone regeneration and enhancing new bone strength. PMID:26904990

Pain responses of Pascal 20 ms multi-spot and 100 ms single-spot panretinal photocoagulation: Manchester Pascal Study, MAPASS report 2.

PubMed

Muqit, M M K; Marcellino, G R; Gray, J C B; McLauchlan, R; Henson, D B; Young, L B; Patton, N; Charles, S J; Turner, G S; Stanga, P E

2010-11-01

To evaluate pain responses following Pascal 20 ms multi-spot and 100 ms single-spot panretinal photocoagulation (PRP). Single-centre randomised clinical trial. 40 eyes of 24 patients with treatment-naive proliferative diabetic retinopathy randomised to 20 and 100 ms PRP under topical 0.4% oxybuprocaine. A masked grader used a pain questionnaire within 1 h (numerical pain score (NPS)) and 1 month after treatment (numerical headache score (NHS)). Primary outcome measure was NPS immediately post-PRP. Secondary outcome measures were mean NHS scores and levels of photophobia reported within 4 weeks of primary PRP. Mean laser fluence was significantly lower using 20 ms PRP (4.8 J/cm²) compared to 100 ms PRP (11.8 J/cm²); p < 0.001). Mean NPS scores for treatment were 2.4 (2.3) (mild) for 20 ms PRP group compared to 4.9 (3.3) (moderate) in 100 ms PRP group-a significant difference (95% CI 4.3 to 0.68; p = 0.006). Mean NHS score within 1 month was 1.5 (2.7) in 20 ms PRP group compared to 3.2 (3.5) in the 100 ms PRP group (p < 0.05). The median duration of photophobia after 20 ms PRP was 3 h, and significantly less compared to 100 ms PRP after which 72 h of photophobia was reported (p < 0.001). Multi-spot 20 ms PRP was associated with significantly lower levels of anxiety, headache, pain and photophobia compared to 100 ms single-spot PRP treatment. Possible reasons include lower fluence, shorter-pulse duration, and spatial summation of laser nociception with multi-spot Pascal technique.

The effectiveness of heparin, platelet-rich plasma (PRP), and silver nanoparticles on prevention of postoperative peritoneal adhesion formation in rats.

PubMed

Makarchian, Hamid Reza; Kasraianfard, Amir; Ghaderzadeh, Pezhman; Javadi, Seyed Mohammad Reza; Ghorbanpoor, Manoochehr

2017-01-01

To assess the effectiveness of heparin, platelet-rich plasma (PRP), and silver nanoparticles on prevention of postoperative adhesion in animal models. Sixty males Albino Wistar rats aged 5 to 6 weeks were classified into five groups receiving none, heparin, PRP, silver nanoparticles, PRP plus silver nanoparticles intraperitoneally. After 2 weeks, the animals underwent laparotomy and the damaged site was assessed for peritoneal adhesions severity. The mean severity scores were 2.5 ± 0.9, 2.16 ± 0.7, 1.5 ± 0.5, 2.66 ± 0.88, and 2.25 ± 0.62 in the control, heparin, PRP, silver and PRP plus silver groups, respectively with significant intergroup difference (p = 0.004). The highest effective material for preventing adhesion formation was PRP followed by heparin and PRP plus silver. Moreover, compared to the controls, only use of PRP was significantly effective, in terms of adhesion severity (p = 0.01) . Platelet-rich plasma alone may have the highest efficacy for preventing postoperative peritoneal adhesions in comparison with heparin, silver nanoparticles and PRP plus silver nanoparticles.

Platelet-Rich Plasma Preparation Types Show Impact on Chondrogenic Differentiation, Migration, and Proliferation of Human Subchondral Mesenchymal Progenitor Cells.

PubMed

Kreuz, Peter Cornelius; Krüger, Jan Philipp; Metzlaff, Sebastian; Freymann, Undine; Endres, Michaela; Pruss, Axel; Petersen, Wolf; Kaps, Christian

2015-10-01

To evaluate the chondrogenic potential of platelet concentrates on human subchondral mesenchymal progenitor cells (MPCs) as assessed by histomorphometric analysis of proteoglycans and type II collagen. Furthermore, the migratory and proliferative effect of platelet concentrates were assessed. Platelet-rich plasma (PRP) was prepared using preparation kits (Autologous Conditioned Plasma [ACP] Kit [Arthrex, Naples, FL]; Regen ACR-C Kit [Regen Lab, Le Mont-Sur-Lausanne, Switzerland]; and Dr.PRP Kit [Rmedica, Seoul, Republic of Korea]) by apheresis (PRP-A) and by centrifugation (PRP-C). In contrast to clinical application, freeze-and-thaw cycles were subsequently performed to activate platelets and to prevent medium coagulation by residual fibrinogen in vitro. MPCs were harvested from the cortico-spongious bone of femoral heads. Chondrogenic differentiation of MPCs was induced in high-density pellet cultures and evaluated by histochemical staining of typical cartilage matrix components. Migration of MPCs was assessed using a chemotaxis assay, and proliferation activity was measured by DNA content. MPCs cultured in the presence of 5% ACP, Regen, or Dr.PRP formed fibrous tissue, whereas MPCs stimulated with 5% PRP-A or PRP-C developed compact and dense cartilaginous tissue rich in type II collagen and proteoglycans. All platelet concentrates significantly (ACP, P = .00041; Regen, P = .00029; Dr.PRP, P = .00051; PRP-A, P < .0001; and PRP-C, P < .0001) stimulated migration of MPCs. All platelet concentrates but one (Dr.PRP, P = .63) showed a proliferative effect on MPCs, as shown by significant increases (ACP, P = .027; Regen, P = .0029; PRP-A, P = .00021; and PRP-C, P = .00069) in DNA content. Platelet concentrates obtained by different preparation methods exhibit different potentials to stimulate chondrogenic differentiation, migration, and proliferation of MPCs. Platelet concentrates obtained by commercially available preparation kits failed to induce chondrogenic differentiation of MPCs, whereas highly standardized PRP preparations did induce such differentiation. These findings suggest differing outcomes with PRP treatment in stem cell-based cartilage repair. Our findings may help to explain the variability of results in studies examining the use of PRP clinically. Copyright © 2015 Arthroscopy Association of North America. Published by Elsevier Inc. All rights reserved.

Platelet-Released Growth Factors Modulate the Secretion of Cytokines in Synoviocytes under Inflammatory Joint Disease

PubMed Central

Rasuo, Biljana; Hock, Jennifer Vanessa Phi; Kweider, Nisreen; Fragoulis, Athanassios; Sönmez, Tolga Taha; Jahr, Holger; Pufe, Thomas; Lippross, Sebastian

2017-01-01

The etiology and pathogenesis of rheumatoid arthritis (RA) are marked by a complex interplay of various cell populations and is mediated by different signaling pathways. Traditionally, therapies have primarily focused on pain relief, reducing inflammation and the recovery of joint function. More recently, however, researchers have discussed the therapeutic efficacy of autologous platelet-rich plasma (PRP). The main objective of this work is to examine the influences of platelet-released growth factor (PRGF) on human synoviocytes under inflammatory conditions. Additionally, it is checked to which extend treatment with platelet concentrate influences the release of cytokines form synoviocytes. For this purpose, an in vitro RA model was created by stimulating the cells with the TNF-α. The release of cytokines was measured by ELISA. The cytokine gene expression was analyzed by real-time PCR. It has been observed that the stimulation concentration of 10 ng/ml TNF-α resulted in a significantly increased endogenous secretion and gene expression of IL-6 and TNF-α. The anti-inflammatory effect of PRGF could be confirmed through significant reduction of TNF-α and IL-1β. An induced inflammatory condition seems to cause PRGF to inhibit the release of proinflammatory cytokines. Further study is required to understand the exact effect mechanism of PRGF on synoviocytes. PMID:29348703

A stretch of residues within the protease-resistant core is not necessary for prion structure and infectivity

PubMed Central

Munoz-Montesino, Carola; Sizun, Christina; Moudjou, Mohammed; Herzog, Laetitia; Reine, Fabienne; Igel-Egalon, Angelique; Barbereau, Clément; Chapuis, Jérôme; Ciric, Danica; Laude, Hubert; Béringue, Vincent; Rezaei, Human; Dron, Michel

2017-01-01

ABSTRACT Mapping out regions of PrP influencing prion conversion remains a challenging issue complicated by the lack of prion structure. The portion of PrP associated with infectivity contains the α-helical domain of the correctly folded protein and turns into a β-sheet-rich insoluble core in prions. Deletions performed so far inside this segment essentially prevented the conversion. Recently we found that deletion of the last C-terminal residues of the helix H2 was fully compatible with prion conversion in the RK13-ovPrP cell culture model, using 3 different infecting strains. This was in agreement with preservation of the overall PrPC structure even after removal of up to one-third of this helix. Prions with internal deletion were infectious for cells and mice expressing the wild-type PrP and they retained prion strain-specific characteristics. We thus identified a piece of the prion domain that is neither necessary for the conformational transition of PrPC nor for the formation of a stable prion structure. PMID:28281924

Phenotypes and genes of resistance of pneumococci to penicillin isolated from children.

PubMed

Kotevska, V; Trajkovska-Dokic, E; Jankoska, G; Kaftandzieva, A; Panovski, N; Petrovska, M

2009-07-01

(Full text is available at http://www.manu.edu.mk/prilozi). In recent decades, the increase of Streptococcus pneumoniae strains resistant to beta-lactams, to other classes of antimicrobial drugs and especially to penicillin (penicillin-resistant pneumococcus - PRP) has further complicated the treatment of pneumococcal infection. Penicillin resistance in pneumococci is due to the development of altered penicillin-binding proteins (PBPs) in the bacterial cell wall. PBPs are known as six different variants (PBP1a, 1b, 2x, 2a, 2b and 3). to compare the presence and types of genes responsible for penicillin resistance in Streptococcus pneumoniae isolates with the minimal inhibitory concentrations (MIC) of penicillin as well as their correlation within the period of childhood. A total of 45 pneumococci obtained from nasal swabs and tracheal aspirates of children treated at the University Paediatric Clinic in Skopje were examined. According to age, the children were grouped as 1-3, 4-6 and 7-10 years. the oxacillin test (1microg) was used as a rapid screening test for the detection of PRP. MIC of penicillin were determined using the agar dilution method and interpreted according to NCCLS as resistant (if MIC are > 2 microg/ml), intermediate resistant (between 0,12-1.0 microg/ml) and susceptible (< 0,06 microg/ml). The genes pbp2b and pbp 2x, which are the genes mainly responsible for the onset of PRP, were detected using polymerase chain reaction (PCR). the oxacillin test showed that 38 pneumococci were resistant and 7 susceptible to penicillin. MIC of penicillin showed that 7 strains were resistant, 33 strains were intermediate resistant (12, 18, and 3 with MIC of 0.5 microg/ml, 0.25 microg/ml and 0.12 microg/ml, respectively) and 5 susceptible. According to MIC, of the total 40 resistant/intermediate resistant pneumococci, in 22 genes pbp2b and/or pbp2x, were confirmed (3 resistant strains with both genes; 7 intermediate resistant and 3 resistant strains with pbp2x genes; whereas 8 intermediate resistance and 1 susceptible strain with pbp2b). In a total of 11 strains (10 intermediate resistant and one resistant according to MIC), pbp2b and/or pbp2x genes were not detected, and their resistance is probably due to some other mechanisms or other genes that code PBP. The largest number of the examined pneumococci (32) were isolated from children aged 1-3 years and in 18 of them either pbp2b or pbp2x genes were detected. the oxacillin test is not suitable for discriminating the intermediate resistant and resistant pneumococci, while it is relevant for the detection of susceptible strains. Penicillin resistance of pneumococci that were causes of infection in children was on a lower level (15.5% resistant strains with MIC 1double dagger2 mg/ml and 73.3% intermediate resistant strains with MIC 0.12double dagger1 microg/ml). Pbp2b and/or pbp2x genes were detected in 22 of the examined strains and all of them except one were intermediate resistant or resistant. The Pbp2b gene is mostly present in the intermediate resistant strains and because it was detected in one susceptible strain, this gene is responsible for a low level of resistance. The pbp2x gene was detected in all the resistant strains and that is why we could conclude that it was coding the high level of resistance. Streptococcus pneumoniae was predominantly isolated from the age group 1-3 years where the PRP were not significant (Chi square; p > 0.05). Key words: Streptococcus pneumoniae, Penicillin resistance, Minimal Inhibitory Concentration (MIC), Genes of Resistance.

Assessment of immunogenicity and safety following primary and booster immunisation with a CRM197 -conjugated Haemophilus influenzae type B vaccine in healthy Chinese infants.

PubMed

Jun, L; Yuguo, C; Zhiguo, W; Jinfeng, L; Huawei, M; Xiuhua, L; Yonggui, Z; Yanhua, X; Kong, Y; Hongtao, L; Yuliang, Z

2013-10-01

Invasive meningitis and pneumonia caused by Haemophilus influenzae type b (Hib) is an important cause of childhood mortality in countries where Hib vaccination is not routine. We evaluated the non-inferiority of a licensed Hib vaccine, PRP-CRM(197) compared with a second licensed Hib vaccine, PRP-T, following the recommended Chinese immunisation schedule for infants between 6 months and 1 year of age. In the first study phase, 6-12 month-old infants received two primary doses of either PRP-CRM(197) (n = 335) or PRP-T (n = 335) vaccine administered 1 month apart. In the second study phase 8 months later, the same children received a single booster dose of vaccine identical to that use for priming (PRP-CRM(197), n = 327; PRP-T, n = 333). Serum levels of anti-polyribosylribitol phosphate (PRP) antibodies were measured using enzyme-linked immunosorbent assay (ELISA). Non-inferiority of primary and booster doses was assessed in terms of percentages of subjects with anti-PRP antibody levels associated with providing short-term (≥ 0.15 μg/ml) and long-term (≥ 1.0 μg/ml) protection; the non-inferiority margin was set at -5%. PRP-CRM(197) was demonstrated to be non-inferior to PRP-T. Anti-PRP antibodies levels ≥ 0.15 μg/ml and ≥ 1.0 μg/ml were achieved by 97% of infants in the PRP-CRM(197) group and 98% of infants in the PRP-T group 1 month after primary immunisation, and by all subjects (100%) in both vaccine groups 1 month after booster administration. Safety profiles for both vaccines were similar; no serious adverse events, deaths or adverse events leading to withdrawal occurred during the study. PRP-CRM(197) was well-tolerated and immunologically non-inferior to a licensed comparator Hib vaccine in Chinese infants (Clinicaltrials.gov: NCT01044316 & NCT01226953). © 2013 John Wiley & Sons Ltd.

Biochemical Characterization of Prions.

PubMed

Fiorini, Michele; Bongianni, Matilde; Monaco, Salvatore; Zanusso, Gianluigi

2017-01-01

Prion disease or transmissible spongiform encephalopathies are characterized by the presence of the abnormal form of the prion protein (PrP Sc ). The pathological and transmissible properties of PrP Sc are enciphered in its secondary and tertiary structures. Since it's well established that different strains of prions are linked to different conformations of PrP Sc , biochemical characterization of prions seems a preliminary but reliable approach to detect, analyze, and compare prion strains. Experimental biochemical procedures might be helpful in distinguishing PrP Sc physicochemical properties and include resistance to proteinase K (PK) digestion, insolubility in nonionic detergents, PK-resistance under denaturing conditions and sedimentation properties in sucrose gradients. This biochemical approach has been extensively applied in human prion disorders and subsequently expanded for PrP Sc characterization in animals. In particular, in sporadic Creutzfedlt-Jakob disease (sCJD) PrP Sc is characterized by two main glycotypes conventionally named Type 1 and Type 2, based on the apparent gel migration at 21 and 19kDa of the PrP Sc PK-resistant fragment. An additional PrP Sc type was identified in sCJD characterized by an unglycosylated dominant glycoform pattern and in 2010 a variably protease-sensitive prionopathy (VPSPr) was reported showing a PrP Sc with an electrophoretic ladder like pattern. Additionally, the presence of PrP Sc truncated fragments completes the electrophoretic characterization of different prion strains. By two-dimensional (2D) electrophoretic analysis additional PrP Sc pattern was identified, since this procedure provides information about the isoelectric point and the different peptides length related to PK cleavage, as well as to glycosylation extent or GPI anchor presence. We here provide and extensive review on PrP Sc biochemical analysis in human and animal prion disorders. Further, we show that PrP Sc glycotypes observed in CJD share similarities with PrP Sc in bovine spongiform encephalopathy forms (BSE). © 2017 Elsevier Inc. All rights reserved.

Comparison of growth factor and platelet concentration from commercial platelet-rich plasma separation systems.

PubMed

Castillo, Tiffany N; Pouliot, Michael A; Kim, Hyeon Joo; Dragoo, Jason L

2011-02-01

Clinical studies claim that platelet-rich plasma (PRP) shortens recovery times because of its high concentration of growth factors that may enhance the tissue repair process. Most of these studies obtained PRP using different separation systems, and few analyzed the content of the PRP used as treatment. This study characterized the composition of single-donor PRP produced by 3 commercially available PRP separation systems. Controlled laboratory study. Five healthy humans donated 100 mL of blood, which was processed to produce PRP using 3 PRP concentration systems (MTF Cascade, Arteriocyte Magellan, Biomet GPS III). Platelet, white blood cell (WBC), red blood cell, and fibrinogen concentrations were analyzed by automated systems in a clinical laboratory, whereas ELISA determined the concentrations of platelet-derived growth factor αβ and ββ (PDGF-αβ, PDGF-ββ), transforming growth factor β1 (TGF-β1), and vascular endothelial growth factor (VEGF). There was no significant difference in mean PRP platelet, red blood cell, active TGF-β1, or fibrinogen concentrations among PRP separation systems. There was a significant difference in platelet capture efficiency. The highest platelet capture efficiency was obtained with Cascade, which was comparable with Magellan but significantly higher than GPS III. There was a significant difference among all systems in the concentrations of WBC, PDGF-αβ, PDGF-ββ, and VEGF. The Cascade system concentrated leukocyte-poor PRP, compared with leukocyte-rich PRP from the GPS III and Magellan systems. The GPS III and Magellan concentrate leukocyte-rich PRP, which results in increased concentrations of WBCs, PDGF-αβ, PDGF-ββ, and VEGF as compared with the leukocyte-poor PRP from Cascade. Overall, there was no significant difference among systems in the platelet concentration, red blood cell, active TGF-β1, or fibrinogen levels. Products from commercially available PRP separation systems produce differing concentrations of growth factors and WBCs. Further research is necessary to determine the clinical relevance of these findings.

Pinelliae Rhizoma Praeparatum Involved in the Regulation of Bile Acids Metabolism in Hepatic Injury.

PubMed

Guo, Shun; Zhang, Song; Liu, Linna; Yang, Peng; Dang, Xueliang; Wei, Huamei; Hu, Na; Shi, Lei; Zhang, Yan

2018-06-01

Pinelliae Rhizoma Praeparatum (PRP) as traditional Chinese medicine had been used for hepatic diseases in combinative forms. However, the effect of PRP was not clear when used alone. So to explore the hepatoprotective/hepatotoxin of PRP is necessary. The activities of PRP were investigated in acetaminophen-induced hepatic injury mice. Liver function markers, hepatic oxidative stress markers were evaluated. Bile acids metabolic transports and nuclear factor erythroid 2-related factor 2 (Nrf2) were detected. As a drug for the treatment of liver diseases, PRP slightly restored the parameters towards normal in model mice only in low dosage, and also had no antioxidant activity and regulate Nrf2. Cholestasis was significantly elevated in model mice when pretreatment with routine or high dosage of PRP, but had no effect on normal mice. Bile salt export pump (Bsep) and multidrug resistance-associated protein 2 (Mrp2) in model mice were markedly increased when pretreatment with low dose PRP, but significantly decreased when pretreatment in routine or high dosage. Mrp3 was significantly induced in model mice after pretreatment of PRP. But the adjustment effect to bile acids transporters by PRP was not significant in normal mice. These results reveal that PRP has the different effects on bile acids transporter in hepatic injury mice, and therefore, the dosage of PRP need to be paid attention to when it is used in clinical hepatic injury.

Autologous platelet-rich plasma: a potential therapeutic tool for promoting hair growth.

PubMed

Li, Zheng Jun; Choi, Hye-In; Choi, Dae-Kyoung; Sohn, Kyung-Cheol; Im, Myung; Seo, Young-Joon; Lee, Young-Ho; Lee, Jeung-Hoon; Lee, Young

2012-07-01

Recently, autologous platelet-rich plasma (PRP) has attracted attention in various medical fields, including plastic and orthopedic surgery and dermatology, for its ability to promote wound healing. PRP has been tested during facelift and hair transplantation to reduce swelling and pain and to increase hair density. To investigate the effects of PRP on hair growth using in vivo and in vitro models. PRP was prepared using the double-spin method and applied to dermal papilla (DP) cells. The proliferative effect of activated PRP on DP cells was measured. To understand the mechanisms of activated PRP on hair growth, we evaluated signaling pathways. In an in vivo study, mice received subcutaneous injections of activated PRP, and their results were compared with control mice. Activated PRP increased the proliferation of DP cells and stimulated extracellular signal-regulated kinase (ERK) and Akt signaling. Fibroblast growth factor 7 (FGF-7) and beta-catenin, which are potent stimuli for hair growth, were upregulated in DP cells. The injection of mice with activated PRP induced faster telogen-to-anagen transition than was seen on control mice. Although few studies tested the effects of activated PRP on hair growth, this research provides support for possible clinical application of autologous PRP and its secretory factors for promotion of hair growth. © 2012 by the American Society for Dermatologic Surgery, Inc. Published by Wiley Periodicals, Inc.

Chitosan inhibits platelet-mediated clot retraction, increases platelet-derived growth factor release, and increases residence time and bioactivity of platelet-rich plasma in vivo.

PubMed

Deprés-Tremblay, Gabrielle; Chevrier, Anik; Tran-Khanh, Nicolas; Nelea, Monica; Buschmann, Michael D

2017-11-10

Platelet-rich plasma (PRP) has been used to treat different orthopedic conditions, however, the clinical benefits of using PRP remain uncertain. Chitosan (CS)-PRP implants have been shown to improve meniscus, rotator cuff and cartilage repair in pre-clinical models. The purpose of this current study was to investigate in vitro and in vivo mechanisms of action of CS-PRP implants. Freeze-dried formulations containing 1% (w/v) CS (80% degree of deacetylation and number average molar mass 38 kDa), 1% (w/v) trehalose as a lyoprotectant and 42.2 mM calcium chloride as a clot activator were solubilized in PRP. Gravimetric measurements and molecular/cellular imaging studies revealed that clot retraction is inhibited in CS-PRP hybrid clots through physical coating of platelets, blood cells and fibrin strands by chitosan, which interferes with platelet aggregation and platelet-mediated clot retraction. Flow cytometry and ELISA assays revealed that platelets are activated and granules secreted in CS-PRP hybrid clots and that cumulative release of platelet-derived growth factor (PDGF-AB) and epidermal growth factor is higher from CS-PRP hybrid clots compared to PRP clots in vitro. Finally, CS-PRP implants resided for up to 6 weeks in a subcutaneous implantation model and induced cell recruitment and granulation tissue synthesis, confirming greater residency and bioactivity compared to PRP in vivo.

Platelet-rich plasma, low-level laser therapy, or their combination promotes periodontal regeneration in fenestration defects: a preliminary in vivo study.

PubMed

Nagata, Maria J H; de Campos, Natália; Messora, Michel R; Pola, Natália M; Santinoni, Carolina S; Bomfim, Suely R M; Fucini, Stephen E; Ervolino, Edilson; de Almeida, Juliano M; Theodoro, Letícia H; Garcia, Valdir G

2014-06-01

This study histomorphometrically analyzes the influence of platelet-rich plasma (PRP), low-level laser therapy (LLLT), or their combination on the healing of periodontal fenestration defects (PFDs) in rats. PFDs were surgically created in the mandibles of 80 rats. The animals were randomly divided into four groups: 1) C (control) and 2) PRP, defects were filled with blood clot or PRP, respectively; 3) LLLT and 4) PRP/LLLT, defects received laser irradiation, were filled with blood clot or PRP, respectively, and then irradiated again. Animals were euthanized at either 10 or 30 days post-surgery. Percentage of new bone (NB), density of newly formed bone (DNB), new cementum (NC), and extension of remaining defect (ERD) were histomorphometrically evaluated. Data were statistically analyzed (analysis of variance; Tukey test, P <0.05). At 10 days, group PRP presented ERD significantly lower than group C. At 30 days, group PRP presented NB and DNB significantly greater than group C. Groups LLLT, PRP, and PRP/LLLT showed significant NC formation at 30 days, with collagen fibers inserted obliquely or perpendicularly to the root surface. NC formation was not observed in any group C specimen. LLLT, PRP, or their combination all promoted NC formation with a functional periodontal ligament. The combination PRP/LLLT did not show additional positive effects compared to the use of either therapy alone.

Chimeric elk/mouse prion proteins in transgenic mice.

PubMed

Tamgüney, Gültekin; Giles, Kurt; Oehler, Abby; Johnson, Natrina L; DeArmond, Stephen J; Prusiner, Stanley B

2013-02-01

Chronic wasting disease (CWD) of deer and elk is a highly communicable neurodegenerative disorder caused by prions. Investigations of CWD are hampered by slow bioassays in transgenic (Tg) mice. Towards the development of Tg mice that will be more susceptible to CWD prions, we created a series of chimeric elk/mouse transgenes that encode the N terminus of elk PrP (ElkPrP) up to residue Y168 and the C terminus of mouse PrP (MoPrP) beyond residue 169 (mouse numbering), designated Elk3M(SNIVVK). Between codons 169 and 219, six residues distinguish ElkPrP from MoPrP: N169S, T173N, V183I, I202V, I214V and R219K. Using chimeric elk/mouse PrP constructs, we generated 12 Tg mouse lines and determined incubation times after intracerebral inoculation with the mouse-passaged RML scrapie or Elk1P CWD prions. Unexpectedly, one Tg mouse line expressing Elk3M(SNIVVK) exhibited incubation times of <70 days when inoculated with RML prions; a second line had incubation times of <90 days. In contrast, mice expressing full-length ElkPrP had incubation periods of >250 days for RML prions. Tg(Elk3M,SNIVVK) mice were less susceptible to CWD prions than Tg(ElkPrP) mice. Changing three C-terminal mouse residues (202, 214 and 219) to those of elk doubled the incubation time for mouse RML prions and rendered the mice resistant to Elk1P CWD prions. Mutating an additional two residues from mouse to elk at codons 169 and 173 increased the incubation times for mouse prions to >300 days, but made the mice susceptible to CWD prions. Our findings highlight the role of C-terminal residues in PrP that control the susceptibility and replication of prions.

Biotin-avidin mediates the binding of adipose-derived stem cells to a porous β-tricalcium phosphate scaffold: Mandibular regeneration

PubMed Central

FENG, ZIHAO; LIU, JIAQI; SHEN, CONGCONG; LU, NANHANG; ZHANG, YONG; YANG, YANWEN; QI, FAZHI

2016-01-01

The present study aimed to investigate the properties of a promising bone scaffold for bone repair, which consisted of a novel composite of adipose-derived stem cells (ADSCs) attached to a porous β-tricalcium phosphate (β-TCP) scaffold with platelet-rich plasma (PRP). The β-TCP powder was synthesized and its composition was determined using X-ray diffraction and Fourier transform infrared spectroscopy. The surface morphology and microstructure of the fabricated porous β-TCP scaffold samples were analyzed using light and scanning electron microscopy, and their porosity and compressive strength were also evaluated. In addition, the viability of rabbit ADSCs incubated with various concentrations of the β-TCP extraction fluid was analyzed. The rate of attachment and the morphology of biotinylated ADSCs (Bio-ADSCs) on avidin-coated β-TCP (Avi-β-TCP), and untreated ADSCs on β-TCP, were compared. Furthermore, in vivo bone-forming abilities were determined following the implantation of group 1 (Bio-ADSCs/Avi-β-TCP) and group 2 (Bio-ADSCs/Avi-β-TCP/PRP) constructs using computed tomography, and histological osteocalcin (OCN) and alkaline phosphatase (ALP) expression analyses in a rabbit model of mandibulofacial defects. The β-TCP scaffold exhibited a high porosity (71.26±0.28%), suitable pore size, and good mechanical strength (7.93±0.06 MPa). Following incubation with β-TCP for 72 h, 100% of viable ADSCs remained. The avidin-biotin binding system significantly increased the initial attachment rate of Bio-ADSCs to Avi-β-TCP in the first hour (P<0.01). Following the addition of PRP, group 2 exhibited a bony-union and mandibular body shape, newly formed bone and increased expression levels of OCN and ALP in the mandibulofacial defect area, as compared with group 1 (P<0.05). The results of the present study suggested that the novel Bio-ADSCs/Avi-β-TCP/PRP composite may have potential application in bone repair and bone tissue engineering. PMID:26997987

A light-regulated type I pilus contributes to Acinetobacter baumannii biofilm, motility and virulence functions.

PubMed

Wood, Cecily R; Ohneck, Emily J; Edelmann, Richard E; Actis, Luis A

2018-06-11

Transcriptional analyses of A. baumannii ATCC 17978 showed that the expression of A1S_2091 was enhanced in cells cultured in darkness at 24°C through a process that depended on the BlsA photoreceptor. Disruption of A1S_2091, a component of the A1S_2088-A1S_2091 polycistronic operon predicted to code for a type I chaperone/usher pilus assembly system, abolished surface motility and pellicle formation but significantly enhanced biofilm formation on plastic by bacteria cultured under darkness. Based on these observations, the A1S_2088-A1S_2091 operon was named the p hoto- r egulated p ilus ABCD ( prpABCD ) operon, with A1S_2091 coding for the PrpA pilin subunit. Unexpectedly, the comparative analyses of ATCC 17978 and prpA isogenic mutant cells cultured at 37°C showed the expression of light-regulated biofilm biogenesis and motility functions under a temperature condition that drastically affects BlsA production and its light sensing activity. These assays also suggest that 17978 cells produce alternative light-regulated adhesins and/or pili systems that enhance bacterial adhesion and biofilm formation both at 24°C and 37°C on plastic as well as on the surface of polarized A549 alveolar epithelial cells, where formation of bacterial filaments and cell chains was significantly enhanced. The inactivation of prpA also resulted in a significant reduction in virulence when tested using the Galleria mellonella virulence model. All these observations provide strong evidence showing the capacity of A. baumannii to sense light and interact with biotic and abiotic surfaces using undetermined alternative sensing and regulatory systems as well as alternative adherence and motility cellular functions that allow this pathogen to persist in different ecological niches. Copyright © 2018 American Society for Microbiology.

Intra-articular laser treatment plus Platelet Rich Plasma (PRP) significantly reduces pain in many patients who had failed prior PRP treatment

NASA Astrophysics Data System (ADS)

Prodromos, Chadwick C.; Finkle, Susan; Dawes, Alexander; Dizon, Angelo

2018-02-01

INTRODUCTION: In our practice Platelet Rich Plasma (PRP) injections effectively reduce pain in most but not all arthritic patients. However, for patients who fail PRP treatment, no good alternative currently exists except total joint replacement surgery. Low level laser therapy (LLLT) on the surface of the skin has not been helpful for arthritis patients in our experience. However, we hypothesized that intra-articular laser treatment would be an effective augmentation to PRP injection and would increase its efficacy in patients who had failed prior PRP injection alone. METHODS: We offered Intra-articular Low Level Laser Therapy (IAL) treatment in conjunction with repeat PRP injection to patients who had received no benefit from PRP injection alone at our center. They were the treatment group. They were not charged for PRP or IAL. They also served as a historical control group since they had all had failed PRP treatment alone. 28 patients (30 joints) accepted treatment after informed consent. 22 knees, 4 hips, 2 shoulder glenohumeral joints and 1 first carpo-metacarpal (1st CMC) joint were treated RESULTS: All patients were followed up at 1 month and no adverse events were seen from the treatment. At 6 months post treatment 46% of patients had good outcomes, and at 1 year 17% still showed improvement after treatment. 11 patients failed treatment and went on to joint replacement. DISCUSSION: A single treatment of IAL with PRP salvaged 46% of patients who had failed PRP treatment alone, allowing avoidance of surgery and good pain control.

PRP Treatment Efficacy for Tendinopathy: A Review of Basic Science Studies

PubMed Central

2016-01-01

Platelet-Rich Plasma (PRP) has been widely used in orthopaedic surgery and sport medicine to treat tendon injuries. However, the efficacy of PRP treatment for tendinopathy is controversial. This paper focuses on reviewing the basic science studies on PRP performed under well-controlled conditions. Both in vitro and in vivo studies describe PRP's anabolic and anti-inflammatory effects on tendons. While some clinical trials support these findings, others refute them. In this review, we discuss the effectiveness of PRP to treat tendon injuries with evidence presented in basic science studies and the potential reasons for the controversial results in clinical trials. Finally, we comment on the approaches that may be required to improve the efficacy of PRP treatment for tendinopathy. PMID:27610386

Mandibular Third Molar Extraction Wound Healing With and Without Platelet Rich Plasma: A Comparative Prospective Study.

PubMed

Dutta, Shubha Ranjan; Singh, Purnima; Passi, Deepak; Patter, Pradeep

2015-09-01

To evaluate the efficacy of autologous platelet rich plasma (PRP) in regeneration of bone and to assess clinical compatibility of the material in mandibular third molar extraction socket. To compare the healing of mandibular third molar extraction wounds with and without PRP. Group A consists of the 30 patients where PRP will be placed in the extraction socket before closure of the socket. Group B consists of 30 patients who will be the control group where the extraction sockets will be closed without any intra socket medicaments. The patients would be allocated to the groups randomly. Soft tissue healing was better in study site compared to control site. The result of the study shows rapid bone regeneration in the extraction socket treated with PRP when compared with the socket without PRP. Evaluation for bone blending and trabecular bone formation started earlier in PRP site compared to control, non PRP site. Also there was less postoperative discomfort on the PRP treated side. Autologous PRP is biocompatible and has significant improved soft tissue healing, bone regeneration and increase in bone density in extraction sockets.

PRP19 Transforms into a Sensor of RPA-ssDNA after DNA Damage and Drives ATR Activation via a Ubiquitin-Mediated Circuitry

PubMed Central

Maréchal, Alexandre; Wu, Ching-Shyi; Yazinski, Stephanie A.; Nguyen, Hai Dang; Liu, Shizhou; Jiménez, Amanda E.; Jin, Jianping; Zou, Lee

2014-01-01

Summary PRP19 is a ubiquitin ligase involved in pre-mRNA splicing and the DNA damage response (DDR). While the role for PRP19 in splicing is well characterized, its role in the DDR remains elusive. Through a proteomic screen for proteins that interact with RPA-coated single-stranded DNA (RPA-ssDNA), we identified PRP19 as a sensor of DNA damage. PRP19 binds RPA directly and localizes to DNA damage sites via RPA, promoting RPA ubiquitylation in a DNA damage-induced manner. PRP19 facilitates the accumulation of ATRIP, the regulatory partner of the ATR kinase, at DNA damage sites. Depletion of PRP19 compromised the phosphorylation of ATR substrates, the recovery of stalled replication forks, and the progression of replication forks on damaged DNA. Importantly, PRP19 mutants that cannot bind RPA or function as an E3 ligase failed to support the ATR response, revealing that PRP19 drives ATR activation by acting as an RPA-ssDNA-sensing ubiquitin ligase during the DDR. PMID:24332808

Crystal Structure of the C-terminal Domain of Splicing Factor Prp8 Carrying Retinitis Pigmentosa Mutants

DOE Office of Scientific and Technical Information (OSTI.GOV)

Zhang,L.; Shen, J.; Guarnieri, M.

2007-01-01

Prp8 is a critical pre-mRNA splicing factor. Prp8 is proposed to help form and stabilize the spliceosome catalytic core and to be an important regulator of spliceosome activation. Mutations in human Prp8 (hPrp8) cause a severe form of the genetic disorder retinitis pigmentosa, RP13. Understanding the molecular mechanism of Prp8's function in pre-mRNA splicing and RP13 has been hindered by its large size (over 2000 amino acids) and remarkably low-sequence similarity with other proteins. Here we present the crystal structure of the C-terminal domain (the last 273 residues) of Caenorhabditis elegans Prp8 (cPrp8). The core of the C-terminal domain ismore » an / structure that forms the MPN (Mpr1, Pad1 N-terminal) fold but without Zn{sup 2+} coordination. We propose that the C-terminal domain is a protein interaction domain instead of a Zn{sup 2+}-dependent metalloenzyme as proposed for some MPN proteins. Mapping of RP13 mutants on the Prp8 structure suggests that these residues constitute a binding surface between Prp8 and other partner(s), and the disruption of this interaction provides a plausible molecular mechanism for RP13.« less

The role of the unusual threonine string in the conversion of prion protein.

PubMed

Abskharon, Romany; Wang, Fei; Vander Stel, Kayla J; Sinniah, Kumar; Ma, Jiyan

2016-12-16

The conversion of normal prion protein (PrP) into pathogenic PrP conformers is central to prion disease, but the mechanism remains unclear. The α-helix 2 of PrP contains a string of four threonines, which is unusual due to the high propensity of threonine to form β-sheets. This structural feature was proposed as the basis for initiating PrP conversion, but experimental results have been conflicting. We studied the role of the threonine string on PrP conversion by analyzing mouse Prnp a and Prnp b polymorphism that contains a polymorphic residue at the beginning of the threonine string, and PrP mutants in which threonine 191 was replaced by valine, alanine, or proline. The PMCA (protein misfolding cyclic amplification) assay was able to recapitulate the in vivo transmission barrier between PrP a and PrP b . Relative to PMCA, the amyloid fibril growth assay is less restrictive, but it did reflect certain properties of in vivo prion transmission. Our results suggest a plausible theory explaining the apparently contradictory results in the role of the threonine string in PrP conversion and provide novel insights into the complicated relationship among PrP stability, seeded conformational change, and prion structure, which is critical for understanding the molecular basis of prion infectivity.

Evolutionary Descent of Prion Genes from the ZIP Family of Metal Ion Transporters

PubMed Central

Schmitt-Ulms, Gerold; Ehsani, Sepehr; Watts, Joel C.; Westaway, David; Wille, Holger

2009-01-01

In the more than twenty years since its discovery, both the phylogenetic origin and cellular function of the prion protein (PrP) have remained enigmatic. Insights into a possible function of PrP may be obtained through the characterization of its molecular neighborhood in cells. Quantitative interactome data demonstrated the spatial proximity of two metal ion transporters of the ZIP family, ZIP6 and ZIP10, to mammalian prion proteins in vivo. A subsequent bioinformatic analysis revealed the unexpected presence of a PrP-like amino acid sequence within the N-terminal, extracellular domain of a distinct sub-branch of the ZIP protein family that includes ZIP5, ZIP6 and ZIP10. Additional structural threading and orthologous sequence alignment analyses argued that the prion gene family is phylogenetically derived from a ZIP-like ancestral molecule. The level of sequence homology and the presence of prion protein genes in most chordate species place the split from the ZIP-like ancestor gene at the base of the chordate lineage. This relationship explains structural and functional features found within mammalian prion proteins as elements of an ancient involvement in the transmembrane transport of divalent cations. The phylogenetic and spatial connection to ZIP proteins is expected to open new avenues of research to elucidate the biology of the prion protein in health and disease. PMID:19784368

Factors before enrolment are associated with being removed from a Pharmacy-only Refill Programme at a large urban HIV/AIDS clinic, Uganda.

PubMed

Nakiwogga-Muwanga, A; Katabira, E; Kiragga, A; Kambugu, A; Nakibuuka-Lubwama, E; Manabe, Y C; Alamo, S T; Colebunders, R

2014-02-01

A Pharmacy-only Refill Programme (PRP) a type of task shifting in which stable HIV-positive patients are managed through pharmacy-only visits instead of physician visits. We performed a study to identify factors for being removed from the PRP in order to establish better referral criteria. The study was performed at the Infectious Disease Clinic (IDC) in Kampala, Uganda. We selected a random sample of 588 patients from 2431 patients on antiretroviral therapy referred to the PRP at least 12 months before commencement of the PRP evaluation. We compared the characteristics of patients who during 12 months of follow-up were removed from the PRP with those who continued to be followed up. Data were abstracted from the IDC data base, the pharmacy register and the patient clinical notes. Of 588 patients, 106 (18%) were removed from the PRP. In multivariate analysis, less than 100% self-reported adherence to antiretroviral therapy, missing at least one scheduled appointment in the six months before referral to the PRP and being on a lopinavir/ritonavir-containing regimen were independently associated with being removed from the PRP. Criteria for referring patients to a PRP should focus on antiretroviral therapy adherence and appointment keeping. Patients on a lopinavir/ritonavir-containing regimen should not be targeted for a PRP. On the other hand a PRP is an efficient strategy that targets stable adherent patients in clinics with high patient load.

Advantages of Pure Platelet-Rich Plasma Compared with Leukocyte- and Platelet-Rich Plasma in Treating Rabbit Knee Osteoarthritis

PubMed Central

Yin, Wen-Jing; Xu, Hai-Tao; Sheng, Jia-Gen; An, Zhi-Quan; Guo, Shang-Chun; Xie, Xue-Tao; Zhang, Chang-Qing

2016-01-01

Background Concentrated leukocytes in leukocyte- and platelet-rich plasma (L-PRP) may deliver increased levels of pro-inflammatory cytokines to activate the NF-κB signaling pathway, to counter the beneficial effects of growth factors on osteoarthritic cartilage. However, to date no relevant studies have substantiated that in vivo. Material/Methods Autologous L-PRP and pure platelet-rich plasma (P-PRP) were prepared, measured for componential composition, and injected intra-articularly after 4, 5, and 6 weeks post-anterior cruciate ligament transection. Caffeic acid phenethyl ester (CAPE) was injected intraperitoneally to inhibit NF-κB activation. All rabbits were sacrificed after 8 weeks postoperative. Enzyme-linked immunosorbent assays were performed to determine interleukin 1β (IL-1β) and prostaglandin E2 (PGE2) concentrations in the synovial fluid, Indian ink staining was performed for gross morphological assessment, and hematoxylin and eosin staining and toluidine blue staining were performed for histological assessment. Results Compared with L-PRP, P-PRP injections achieved better outcomes regarding the prevention of cartilage destruction, preservation of cartilaginous matrix, and reduction of IL-1β and PGE2 concentrations. CAPE injections reversed the increased IL-1β and PGE2 concentrations in the synovial fluid after L-PRP injections and improved the outcome of L-PRP injections to a level similar to P-PRP injections, while they had no influence on the therapeutic efficacy of P-PRP injections. Conclusions Concentrated leukocytes in L-PRP may release increased levels of pro-inflammatory cytokines to activate the NF-κB signaling pathway, to counter the beneficial effects of growth factors on osteoarthritic cartilage, and finally, result in a inferior efficacy of L-PRP to P-PRP for the treatment of osteoarthritis. PMID:27086145

Advantages of Pure Platelet-Rich Plasma Compared with Leukocyte- and Platelet-Rich Plasma in Treating Rabbit Knee Osteoarthritis.

PubMed

Yin, Wen-Jing; Xu, Hai-Tao; Sheng, Jia-Gen; An, Zhi-Quan; Guo, Shang-Chun; Xie, Xue-Tao; Zhang, Chang-Qing

2016-04-17

BACKGROUND Concentrated leukocytes in leukocyte- and platelet-rich plasma (L-PRP) may deliver increased levels of pro-inflammatory cytokines to activate the NF-κB signaling pathway, to counter the beneficial effects of growth factors on osteoarthritic cartilage. However, to date no relevant studies have substantiated that in vivo. MATERIAL AND METHODS Autologous L-PRP and pure platelet-rich plasma (P-PRP) were prepared, measured for componential composition, and injected intra-articularly after 4, 5, and 6 weeks post-anterior cruciate ligament transection. Caffeic acid phenethyl ester (CAPE) was injected intraperitoneally to inhibit NF-κB activation. All rabbits were sacrificed after 8 weeks postoperative. Enzyme-linked immunosorbent assays were performed to determine interleukin 1β (IL-1β) and prostaglandin E2 (PGE2) concentrations in the synovial fluid, Indian ink staining was performed for gross morphological assessment, and hematoxylin and eosin staining and toluidine blue staining were performed for histological assessment. RESULTS Compared with L-PRP, P-PRP injections achieved better outcomes regarding the prevention of cartilage destruction, preservation of cartilaginous matrix, and reduction of IL-1β and PGE2 concentrations. CAPE injections reversed the increased IL-1β and PGE2 concentrations in the synovial fluid after L-PRP injections and improved the outcome of L-PRP injections to a level similar to P-PRP injections, while they had no influence on the therapeutic efficacy of P-PRP injections. CONCLUSIONS Concentrated leukocytes in L-PRP may release increased levels of pro-inflammatory cytokines to activate the NF-κB signaling pathway, to counter the beneficial effects of growth factors on osteoarthritic cartilage, and finally, result in a inferior efficacy of L-PRP to P-PRP for the treatment of osteoarthritis.

Epidemiology, Treatment Efficacy, and Anxiety Aspects of Music Students Affected by Playing-Related Pain: A Retrospective Evaluation with Follow-up.

PubMed

Ioannou, Christos I; Hafer, Julia; Lee, André; Altenmüller, Eckart

2018-03-01

Playing-related pain (PRP) is a common problem among music students. We retrospectively assessed epidemiological factors that contributed to the manifestation of PRP and evaluated the efficacy of treatment methods used by affected music students. The long-term course of PRP symptoms was also examined, along with current (today) levels of trait anxieties. Demographic and epidemiological data of 186 music students who visited the musicians' outpatient clinic over a 5-year period were retrieved. Of these students, 122 had been diagnosed with PRP and were invited to participate (response rate 61.5%) in a follow-up online survey to: a) estimate the long-term course of their PRP symptoms, b) assess the efficacy of treatment methods they used, and c) assess their current trait anxiety (general and performance-related) using two standardized psychodiagnostic questionnaires. Two-thirds of music students who sought medical care were affected by PRP, with most being affected during their first year of studies, and with 69% having acute rather than chronic pain. The sudden increase in practice time was the main triggering factor for PRP (but not for non-PRP-related problems). Concerning the course of PRP, almost all students recovered or improved significantly. Students reported that "active" treatment methods (e.g., physical activities) were more effective than "passive" methods (e.g., oral medications). Psychodiagnostic questionnaires indicated that about 40% of PRP-affected students currently had increased levels of trait anxieties (music and non-music related), possibly warranting further medical assistance. PRP in music students occurs mainly at the beginning of their studies and has a good prognosis, although recovery may be lengthy. It is necessary to provide students with early information about PRP and about the multidimensional treatment framework that allows for individualized care of PRP in affected music students.

CHOROIDAL THICKNESS CHANGES IN PROLIFERATIVE DIABETIC RETINOPATHY TREATED WITH PANRETINAL PHOTOCOAGULATION VERSUS PANRETINAL PHOTOCOAGULATION WITH INTRAVITREAL BEVACIZUMAB.

PubMed

Roohipoor, Ramak; Sharifian, Elaheh; Ghassemi, Fariba; Riazi-Esfahani, Mohammad; Karkhaneh, Reza; Fard, Masoud Aghsaei; Zarei, Mohammad; Modjtahedi, Bobeck S; Moghimi, Sasan

2016-10-01

To compare choroidal thickness (CT) and retinal thickness (RT) between eyes with proliferative diabetic retinopathy treated with panretinal photocoagulation (PRP) or PRP with intravitreal bevacizumab (PRP + IVB). Thirty-three patients with proliferative diabetic retinopathy were randomized to have one eye treated with PRP and the other with PRP + IVB. Change in CT was compared with baseline using enhanced depth imaging-optical coherence tomography at baseline and Months 1, 3, 6, and 10 after treatment. Change in RT was similarly assessed using spectral domain optical coherence tomography. Changes in both CT and RT were assessed in all nine macular areas as defined by Early Treatment Diabetic Retinopathy Study subfields. The PRP + IVB group had a significant decrease in subfoveal CT at 3 and 10 months (323.9 ± 62 μm at baseline vs. 320.7 ± 64.8 μm at Month 3 [P = 0.024] and 304.7 ± 65.6 μm at Month 10 [P = 0.003]). Subfoveal CT significantly decreased at 10 months compared with baseline in the PRP group (320.8 ± 57.7 at baseline to 297 ± 66.3 μm at 10 months, P = 0.01). Subfoveal CT was not significantly different between the 2 groups at 10 months. The best-corrected visual acuity did not change after treatment in the two groups, and there was no correlation between BCVA and CT changes (r = 0.222, P = 0.37 in the PRP group and r = 0.387, P = 0.12 in the PRP + IVB group). Significant increases in RT were seen in the PRP + IVB group at 6 months and in the PRP group at Months 1, 3, 6, and 10. A correlation between changes in CT and RT was only seen in the PRP group at 10 months after treatment. Eyes with proliferative diabetic retinopathy treated with PRP + IVB and PRP both had significant reduction in CT at 10 months; however, the eyes that were also treated with IVB also underwent an earlier but transient reduction at 3 months. Patients treated with IVB underwent less increase in RT.

Characterization of the human analogue of a Scrapie-responsive gene.

PubMed

Dron, M; Dandoy-Dron, F; Guillo, F; Benboudjema, L; Hauw, J J; Lebon, P; Dormont, D; Tovey, M G

1998-07-17

We have recently described a novel mRNA denominated ScRG-1, the level of which is increased in the brains of Scrapie-infected mice (Dandoy-Dron, F., Guillo, F., Benboudjema, L., Deslys, J.-P., Lasmézas, C., Dormont, D., Tovey, M. G., and Dron, M. (1998) J. Biol. Chem. 273, 7691-7697). The increase in ScRG-1 mRNA in the brain follows the accumulation of PrPSc, the proteinase K-resistant form of the prion protein (PrP), and precedes the widespread neuronal death that occurs in late stage disease. In the present study, we have isolated a cDNA encoding the human counterpart of ScRG-1. Comparison of the human and mouse transcripts firmly established that both sequences encode a highly conserved protein of 98 amino acids that contains a signal peptide, suggesting that the protein may be secreted. Examination of the distribution of human ScRG-1 mRNA in adult and fetal tissues revealed that the gene was expressed primarily in the central nervous system as a 0.7-kilobase message and was under strict developmental control.

Codon 219 polymorphism of PRNP in healthy caucasians and Creutzfeldt-Jakob disease patients

DOE Office of Scientific and Technical Information (OSTI.GOV)

Petraroli, R.; Pocchiari, M.

1996-04-01

A number of point and insert mutations of the PrP gene (PRNP) have been linked to familial Creutzfeldt-Jakob disease (CJD) and Gerstmann-Straussler-Scheinker disease (GSS). Moreover, the methionine/valine homozygosity at the polymorphic codon 129 of PRNP may cause a predisposition to sporadic and iatrogenic CJD or may control the age at onset of familial cases carrying either the 144-bp insertion or codon 178, codon 198, and codon 210 pathogenic mutations in PRNP. In addition, the association of methionine or valine at codon 129 and the point mutation at codon 178 on the same allele seem to play an important role inmore » determining either fatal familial insomnia or CJD. However, it is noteworthy that a relationship between codon 129 polymorphism and accelerated pathogenesis (early age at onset or shorter duration of the disease) has not been seen in familial CJD patients with codon 200 mutation or in GSS patients with codon 102 mutation, arguing that other, as yet unidentified, gene products or environmental factors, or both, may influence the clinical expression of these diseases. 17 refs.« less

Preparing Platelet-Rich Plasma with Whole Blood Harvested Intraoperatively During Spinal Fusion.

PubMed

Shen, Bin; Zhang, Zheng; Zhou, Ning-Feng; Huang, Yu-Feng; Bao, Yu-Jie; Wu, De-Sheng; Zhang, Ya-Dong

2017-07-22

BACKGROUND Platelet-rich plasma (PRP) has gained growing popularity in use in spinal fusion procedures in the last decade. Substantial intraoperative blood loss is frequently accompanied with spinal fusion, and it is unknown whether blood harvested intraoperatively qualifies for PRP preparation. MATERIAL AND METHODS Whole blood was harvested intraoperatively and venous blood was collected by venipuncture. Then, we investigated the platelet concentrations in whole blood and PRP, the concentration of growth factors in PRP, and the effects of PRP on the proliferation and viability of human bone marrow-derived mesenchymal stem cells (HBMSCs). RESULTS Our results revealed that intraoperatively harvested whole blood and whole blood collected by venipuncture were similar in platelet concentration. In addition, PRP formulations prepared from both kinds of whole blood were similar in concentration of platelet and growth factors. Additional analysis showed that the similar concentrations of growth factors resulted from the similar platelet concentrations of whole blood and PRP between the two groups. Moreover, these two kinds of PRP formulations had similar effects on promoting cell proliferation and enhancing cell viability. CONCLUSIONS Therefore, intraoperatively harvested whole blood may be a potential option for preparing PRP spinal fusion.

PRP19 transforms into a sensor of RPA-ssDNA after DNA damage and drives ATR activation via a ubiquitin-mediated circuitry.

PubMed

Maréchal, Alexandre; Li, Ju-Mei; Ji, Xiao Ye; Wu, Ching-Shyi; Yazinski, Stephanie A; Nguyen, Hai Dang; Liu, Shizhou; Jiménez, Amanda E; Jin, Jianping; Zou, Lee

2014-01-23

PRP19 is a ubiquitin ligase involved in pre-mRNA splicing and the DNA damage response (DDR). Although the role for PRP19 in splicing is well characterized, its role in the DDR remains elusive. Through a proteomic screen for proteins that interact with RPA-coated single-stranded DNA (RPA-ssDNA), we identified PRP19 as a sensor of DNA damage. PRP19 directly binds RPA and localizes to DNA damage sites via RPA, promoting RPA ubiquitylation in a DNA-damage-induced manner. PRP19 facilitates the accumulation of ATRIP, the regulatory partner of the ataxia telangiectasia mutated and Rad3-related (ATR) kinase, at DNA damage sites. Depletion of PRP19 compromised the phosphorylation of ATR substrates, recovery of stalled replication forks, and progression of replication forks on damaged DNA. Importantly, PRP19 mutants that cannot bind RPA or function as an E3 ligase failed to support the ATR response, revealing that PRP19 drives ATR activation by acting as an RPA-ssDNA-sensing ubiquitin ligase during the DDR. Copyright © 2014 Elsevier Inc. All rights reserved.

Freeze-Dried Platelet-Rich Plasma Accelerates Bone Union with Adequate Rigidity in Posterolateral Lumbar Fusion Surgery Model in Rats

NASA Astrophysics Data System (ADS)

Shiga, Yasuhiro; Orita, Sumihisa; Kubota, Go; Kamoda, Hiroto; Yamashita, Masaomi; Matsuura, Yusuke; Yamauchi, Kazuyo; Eguchi, Yawara; Suzuki, Miyako; Inage, Kazuhide; Sainoh, Takeshi; Sato, Jun; Fujimoto, Kazuki; Abe, Koki; Kanamoto, Hirohito; Inoue, Masahiro; Kinoshita, Hideyuki; Aoki, Yasuchika; Toyone, Tomoaki; Furuya, Takeo; Koda, Masao; Takahashi, Kazuhisa; Ohtori, Seiji

2016-11-01

Fresh platelet-rich plasma (PRP) accelerates bone union in rat model. However, fresh PRP has a short half-life. We suggested freeze-dried PRP (FD-PRP) prepared in advance and investigated its efficacy in vivo. Spinal posterolateral fusion was performed on 8-week-old male Sprague-Dawley rats divided into six groups based on the graft materials (n = 10 per group): sham control, artificial bone (A hydroxyapatite-collagen composite) -alone, autologous bone, artificial bone + fresh-PRP, artificial bone + FD-PRP preserved 8 weeks, and artificial bone + human recombinant bone morphogenetic protein 2 (BMP) as a positive control. At 4 and 8 weeks after the surgery, we investigated their bone union-related characteristics including amount of bone formation, histological characteristics of trabecular bone at remodeling site, and biomechanical strength on 3-point bending. Comparable radiological bone union was confirmed at 4 weeks after surgery in 80% of the FD-PRP groups, which was earlier than in other groups (p < 0.05). Histologically, the trabecular bone had thinner and more branches in the FD-PRP. Moreover, the biomechanical strength was comparable to that of autologous bone. FD-PRP accelerated bone union at a rate comparable to that of fresh PRP and BMP by remodeling the bone with thinner, more tangled, and rigid trabecular bone.

In search of a consensus terminology in the field of platelet concentrates for surgical use: platelet-rich plasma (PRP), platelet-rich fibrin (PRF), fibrin gel polymerization and leukocytes.

PubMed

Dohan Ehrenfest, David M; Bielecki, Tomasz; Mishra, Allan; Borzini, Piero; Inchingolo, Francesco; Sammartino, Gilberto; Rasmusson, Lars; Everts, Peter A

2012-06-01

In the field of platelet concentrates for surgical use, most products are termed Platelet-Rich Plasma (PRP). Unfortunately, this term is very general and incomplete, leading to many confusions in the scientific database. In this article, a panel of experts discusses this issue and proposes an accurate and simple terminology system for platelet concentrates for surgical use. Four main categories of products can be easily defined, depending on their leukocyte content and fibrin architecture: Pure Platelet-Rich Plasma (P-PRP), such as cell separator PRP, Vivostat PRF or Anitua's PRGF; Leukocyteand Platelet-Rich Plasma (L-PRP), such as Curasan, Regen, Plateltex, SmartPReP, PCCS, Magellan, Angel or GPS PRP; Pure Plaletet-Rich Fibrin (P-PRF), such as Fibrinet; and Leukocyte- and Platelet-Rich Fibrin (L-PRF), such as Choukroun's PRF. P-PRP and L-PRP refer to the unactivated liquid form of these products, their activated versions being respectively named P-PRP gels and L-PRP gels. The purpose of this search for a terminology consensus is to plead for a more serious characterization of these products. Researchers have to be aware of the complex nature of these living biomaterials, in order to avoid misunderstandings and erroneous conclusions. Understanding the biomaterials or believing in the magic of growth factors ? From this choice depends the future of the field.

Freeze-Dried Platelet-Rich Plasma Accelerates Bone Union with Adequate Rigidity in Posterolateral Lumbar Fusion Surgery Model in Rats

PubMed Central

Shiga, Yasuhiro; Orita, Sumihisa; Kubota, Go; Kamoda, Hiroto; Yamashita, Masaomi; Matsuura, Yusuke; Yamauchi, Kazuyo; Eguchi, Yawara; Suzuki, Miyako; Inage, Kazuhide; Sainoh, Takeshi; Sato, Jun; Fujimoto, Kazuki; Abe, Koki; Kanamoto, Hirohito; Inoue, Masahiro; Kinoshita, Hideyuki; Aoki, Yasuchika; Toyone, Tomoaki; Furuya, Takeo; Koda, Masao; Takahashi, Kazuhisa; Ohtori, Seiji

2016-01-01

Fresh platelet-rich plasma (PRP) accelerates bone union in rat model. However, fresh PRP has a short half-life. We suggested freeze-dried PRP (FD-PRP) prepared in advance and investigated its efficacy in vivo. Spinal posterolateral fusion was performed on 8-week-old male Sprague-Dawley rats divided into six groups based on the graft materials (n = 10 per group): sham control, artificial bone (A hydroxyapatite–collagen composite) –alone, autologous bone, artificial bone + fresh-PRP, artificial bone + FD-PRP preserved 8 weeks, and artificial bone + human recombinant bone morphogenetic protein 2 (BMP) as a positive control. At 4 and 8 weeks after the surgery, we investigated their bone union–related characteristics including amount of bone formation, histological characteristics of trabecular bone at remodeling site, and biomechanical strength on 3-point bending. Comparable radiological bone union was confirmed at 4 weeks after surgery in 80% of the FD-PRP groups, which was earlier than in other groups (p < 0.05). Histologically, the trabecular bone had thinner and more branches in the FD-PRP. Moreover, the biomechanical strength was comparable to that of autologous bone. FD-PRP accelerated bone union at a rate comparable to that of fresh PRP and BMP by remodeling the bone with thinner, more tangled, and rigid trabecular bone. PMID:27833116

Comparison of collagen matrix treatment impregnated with platelet rich plasma vs bone marrow.

PubMed

Minamimura, Ai; Ichioka, Shigeru; Sano, Hitomi; Sekiya, Naomi

2014-02-01

This study has reported the efficacy of an autologous bone marrow-impregnated collagen matrix experimentally and clinically. Then, it reflected that platelet rich plasma (PRP) was as good a source of growth factors as bone marrow and available in a less invasive procedure. This study aimed to compare the efficacy of a PRP-impregnated collagen matrix with that of a bone marrow-impregnated collagen matrix by quantifying wound size and capillary density using genetically diabetic db/db mice. Bone marrow cells were obtained from femurs of ddy mice. Then, a small amount of collagen matrix was immersed in bone marrow suspension. This is called a bone marrow-impregnated collagen matrix. PRP was obtained from healthy human blood and a small amount of collagen matrix was immersed in PRP. This is called a PRP-impregnated collagen matrix. A bone marrow-impregnated collagen matrix and PRP-impregnated collagen matrix were applied to excisional skin wounds on a genetically healing-impaired mouse (n = 6) and wounds were evaluated 6 days after the procedure. Wounds were divided into two groups: PRP (n = 6), in which a PRP-impregnated collagen matrix was applied; and bone marrow (n = 6), in which collagen immersed in a bone marrow suspension was applied. There was no significant difference between the PRP and bone-marrow groups in the rate of vascular density increase or wound size decrease. The present study suggested that the PRP-impregnated collagen matrix promotes repair processes at least as strongly as the bone marrow-impregnated collagen matrix. Given lower invasiveness, the PRP-impregnated collagen matrix would have advantages in clinical use.

Effects of Platelet-Rich Plasma and Indomethacin on Biomechanics of Rotator Cuff Repair.

PubMed

Meadows, Molly C; Levy, David M; Ferry, Christopher M; Gardner, Thomas R; Teratani, Takeshi; Ahmad, Christopher S

We conducted a study to determine if platelet-rich plasma (PRP) enhances the strength of rotator cuff repair (RCR) and if concomitant use of nonsteroidal anti-inflammatory drugs (NSAIDs) affects PRP efficacy. We also wanted to determine the optimal centrifugation protocol for making PRP from rats. This study used 48 rats, 14 in a centrifugation protocol and 34 in an operative protocol. Six syngeneic rats from the operative group were used as PRP blood donors; the other 28 operative rats underwent bilateral RCRs. The Autologous Conditioned Plasma system (Arthrex) was used to prepare leukocyte-poor PRP. One shoulder was randomized to an intratendinous PRP injection, and the other received normal saline. Each rat was also randomly placed on a postoperative diet, either a regular diet or an indomethacin-enhanced diet. After rats were euthanized at 3 weeks, specimens were dissected to isolate the supraspinatus tendon at its humeral attachment, which was subjected to biomechanical testing. PRP prepared with a protocol of 5 minutes × 1300 revolutions per minute had the highest platelet index. Mean (SD) energy to failure was significantly higher (P = .03) in tendons treated with PRP, 11.7 (7.3) N-mm, than in tendons treated with saline, 8.7 (4.6) N-mm. Both groups (PRP, saline) showed no significant differences between tendons treated with NSAIDs and those not treated with NSAIDs. Intraoperative application of PRP enhances energy to failure after RCR in rats. There were no differences in biomechanical strength with NSAID use and no interactions between PRP and NSAID use.

Juvenile pityriasis rubra pilaris: report of 28 cases in Taiwan.

PubMed

Yang, Chao-Chun; Shih, I-Hsin; Lin, Wan-Lung; Yu, Yi-Sheng; Chiu, Hsien-Ching; Huang, Po-Han; Cheng, Yu-Wen; Lee, Julia Yu-Yun; Chen, WenChieh

2008-12-01

Pityriasis rubra pilaris (PRP) is a papulosquamous dermatosis uncommon in juveniles. Large-scale studies are limited, especially from Asian countries. We sought to analyze the clinical manifestations of juvenile PRP in Taiwanese patients and compare them with reported series in the literature. The diagnosis of juvenile PRP was made based on clinical-histopathologic correlation. The therapeutic response and disease course were followed up by re-examination of the patients or by telephone. A total of 47 patients were identified, with histopathologic confirmation of the clinical diagnosis of juvenile PRP in 28 cases. A preponderance of Griffiths' type IV PRP (85.7%) rather than type III PRP (14.3%) was found. Palmoplantar hyperkeratosis appeared to be a cardinal feature. In patients with type IV PRP, skin lesions in areas other than the elbows/knees and palms/soles were common. Treatment with systemic acitretin in 6 patients failed to effect a dose- or time-dependent improvement. In contrast with other studies, two thirds of our patients with type III and IV juvenile PRP had a protracted course lasting more than 3 years. This study was a retrospective review. Patient compliance with treatment was frequently poor. Type IV juvenile PRP predominated but our cases showed a wider distribution of skin lesions than is typically described. When children present with an acute onset of diffuse palmoplantar hyperkeratosis, a diagnosis of juvenile PRP should be considered. Because of the divergent clinical manifestations of juvenile PRP in different populations, there is a need to modify and re-evaluate classification systems based on regional differences.

Structural and functional analysis of the human spliceosomal DEAD-box helicase Prp28

DOE Office of Scientific and Technical Information (OSTI.GOV)

Möhlmann, Sina; Mathew, Rebecca; Neumann, Piotr

The crystal structure of the helicase domain of the human spliceosomal DEAD-box protein Prp28 was solved by SAD. The binding of ADP and ATP by Prp28 was studied biochemically and analysed with regard to the crystal structure. The DEAD-box protein Prp28 is essential for pre-mRNA splicing as it plays a key role in the formation of an active spliceosome. Prp28 participates in the release of the U1 snRNP from the 5′-splice site during association of the U5·U4/U6 tri-snRNP, which is a crucial step in the transition from a pre-catalytic spliceosome to an activated spliceosome. Here, it is demonstrated that themore » purified helicase domain of human Prp28 (hPrp28ΔN) binds ADP, whereas binding of ATP and ATPase activity could not be detected. ATP binding could not be observed for purified full-length hPrp28 either, but within an assembled spliceosomal complex hPrp28 gains ATP-binding activity. In order to understand the structural basis for the ATP-binding deficiency of isolated hPrp28, the crystal structure of hPrp28ΔN was determined at 2.0 Å resolution. In the crystal the helicase domain adopts a wide-open conformation, as the two RecA-like domains are extraordinarily displaced from the productive ATPase conformation. Binding of ATP is hindered by a closed conformation of the P-loop, which occupies the space required for the γ-phosphate of ATP.« less

Modeled Microgravity Affects Fibroblast Functions Related to Wound Healing

NASA Astrophysics Data System (ADS)

Cialdai, Francesca; Vignali, Leonardo; Morbidelli, Lucia; Colciago, Alessandra; Celotti, Fabio; Santi, Alice; Caselli, Anna; Cirri, Paolo; Monici, Monica

2017-02-01

Wound healing is crucial for the survival of an organism. Therefore, in the perspective of space exploration missions, it is important to understand if and how microgravity conditions affect the behavior of the cell populations involved in wound healing and the evolution of the process. Since fibroblasts are the major players in tissue repair, this study was focused on the behavior of fibroblasts in microgravity conditions, modeled by a RCCS. Cell cytoskeleton was studied by immunofluorescence microscopy, the ability to migrate was assessed by microchemotaxis and scratch assay, and the expression of markers of fibroblast activation, angiogenesis, and inflammation was assessed by western blot. Results revealed that after cell exposure to modeled microgravity conditions, a thorough rearrangement of microtubules occurred and α-SMA bundles were replaced by a tight network of faulty and disorganized filaments. Exposure to modeled microgravity induced a decrease in α-SMA and E-CAD expressions. Also, the expression of the pro-angiogenic protein VEGF decreased, while that of the inflammatory signal COX-2 increased. Fibroblast ability to adhere, migrate, and respond to chemoattractants (PRP), closely related to cytoskeleton integrity and membrane junctions, was significantly impaired. Nevertheless, PRP was able to partially restore fibroblast migration.

Cell Biology Approaches to Studying Prion Diseases.

PubMed

Priola, Suzette A

2017-01-01

During the course of prion infection, the normally soluble and protease-sensitive mammalian prion protein (PrP C ) is refolded into an insoluble, partially protease-resistant, and infectious form called PrP Sc . The conformational conversion of PrP C to PrP Sc is a critical event during prion infection and is essential for the production of prion infectivity. This chapter briefly summarizes the ways in which cell biological approaches have enhanced our understanding of how PrP contributes to different aspects of prion pathogenesis.

Influence of EARLI1-like genes on flowering time and lignin synthesis of Arabidopsis thaliana.

PubMed

Shi, Y; Zhang, X; Xu, Z-Y; Li, L; Zhang, C; Schläppi, M; Xu, Z-Q

2011-09-01

EARLI1 encodes a 14.7 kDa protein in the cell wall, is a member of the PRP (proline-rich protein) family and has multiple functions, including resistance to low temperature and fungal infection. RNA gel blot analyses in the present work indicated that expression of EARLI1-like genes, EARLI1, At4G12470 and At4G12490, was down-regulated in Col-FRI-Sf2 RNAi plants derived from transformation with Agrobacterium strain ABI, which contains a construct encoding a double-strand RNA targeting 8CM of EARLI1. Phenotype analyses revealed that Col-FRI-Sf2 RNAi plants of EARLI1 flowered earlier than Col-FRI-Sf2 wild-type plants. The average bolting time of Col-FRI-Sf2 and Col-FRI-Sf2 RNAi plants was 39.7 and 19.4 days, respectively, under a long-day photoperiod. In addition, there were significant differences in main stem length, internode number and rosette leaf number between Col-FRI-Sf2 and Col-FRI-Sf2 RNAi plants. RT-PCR showed that EARLI1-like genes might delay flowering time through the autonomous and long-day photoperiod pathways by maintaining the abundance of FLC transcripts. In Col-FRI-Sf2 RNAi plants, transcription of FLC was repressed, while expression of SOC1 and FT was activated. Microscopy observations showed that EARLI1-like genes were also associated with morphogenesis of leaf cells in Arabidopsis. Using histochemical staining, EARLI1-like genes were found to be involved in regulation of lignin synthesis in inflorescence stems, and Col-FRI-Sf2 and Col-FRI-Sf2 RNAi plants had 9.67% and 8.76% dry weight lignin, respectively. Expression analysis revealed that cinnamoyl-CoA reductase, a key enzyme in lignin synthesis, was influenced by EARLI1-like genes. These data all suggest that EARLI1-like genes could control the flowering process and lignin synthesis in Arabidopsis. © 2011 German Botanical Society and The Royal Botanical Society of the Netherlands.

Augmenting tendon and ligament repair with platelet-rich plasma (PRP)

PubMed Central

Yuan, Ting; Zhang, Chang-Qing; Wang, James H-C.

2013-01-01

Summary Tendon and ligament injuries (TLI) commonly occur in athletes and non-athletes alike, and remarkably debilitate patients’ athletic and personal abilities. Current clinical treatments, such as reconstruction surgeries, do not adequately heal these injuries and often result in the formation of scar tissue that is prone to re-injury. Platelet-rich plasma (PRP) is a widely used alternative option that is also safe because of its autologous nature. PRP contains a number of growth factors that are responsible for its potential to heal TLIs effectively. In this review, we provide a comprehensive report on PRP. While basic science studies in general indicate the potential of PRP to treat TLIs effectively, a review of existing literature on the clinical use of PRP for the treatment of TLIs indicates a lack of consensus due to varied treatment outcomes. This suggests that current PRP treatment protocols for TLIs may not be optimal, and that not all TLIs may be effectively treated with PRP. Certainly, additional basic science studies are needed to develop optimal treatment protocols and determine those TLI conditions that can be treated effectively. PMID:24367773

A phosphorylation-and-ubiquitylation circuitry driving ATR activation and homologous recombination

PubMed Central

Dubois, Jean-Christophe; Yates, Maïlyn; Gaudreau-Lapierre, Antoine; Clément, Geneviève; Cappadocia, Laurent; Gaudreau, Luc

2017-01-01

Abstract RPA-coated single-stranded DNA (RPA–ssDNA), a nucleoprotein structure induced by DNA damage, promotes ATR activation and homologous recombination (HR). RPA is hyper-phosphorylated and ubiquitylated after DNA damage. The ubiquitylation of RPA by PRP19 and RFWD3 facilitates ATR activation and HR, but how it is stimulated by DNA damage is still unclear. Here, we show that RFWD3 binds RPA constitutively, whereas PRP19 recognizes RPA after DNA damage. The recruitment of PRP19 by RPA depends on PIKK-mediated RPA phosphorylation and a positively charged pocket in PRP19. An RPA32 mutant lacking phosphorylation sites fails to recruit PRP19 and support RPA ubiquitylation. PRP19 mutants unable to bind RPA or lacking ubiquitin ligase activity also fail to support RPA ubiquitylation and HR. These results suggest that RPA phosphorylation enhances the recruitment of PRP19 to RPA–ssDNA and stimulates RPA ubiquitylation through a process requiring both PRP19 and RFWD3, thereby triggering a phosphorylation-ubiquitylation circuitry that promotes ATR activation and HR. PMID:28666352

Considerations for the use of platelet-rich plasma in orthopedics.

PubMed

McCarrel, Taralyn M; Mall, Nathan A; Lee, Andrew S; Cole, Brian J; Butty, Davietta C; Fortier, Lisa A

2014-08-01

The use of platelet-rich plasma (PRP) is expanding to numerous medical fields, including orthopedic surgery and sports medicine. The popularity of this new treatment option has prompted a rapid increase in research endeavors; however, the differences in application technique and the composition of PRP have made it difficult to compare results or make any firm conclusions regarding efficacy. The purpose of this article is twofold. First, to recommend details that should be provided in basic science and clinical PRP studies to allow meaningful comparisons between studies which may lead to a better understanding of efficacy. Second, to provide an understanding of the different PRP preparations and their clinical relevance. There are biochemical rationales for the use of PRP because it addresses several aspects of the healing process, including cell proliferation and tissue matrix regeneration, inflammation, nociception, infection, and hemostasis, all of which will be addressed. Given the current understanding of the importance the composition of PRP plays in tissue regeneration, it is likely that our future understanding of PRP will dictate 'customizing' the PRP preparation to the specific pathology of interest. The potential complications following PRP use are minor, and thus it appears to be a safe treatment option with a variety of potentially beneficial effects to injured musculoskeletal tissues.

Can platelet-rich plasma (PRP) improve bone healing? A comparison between the theory and experimental outcomes.

PubMed

Malhotra, Angad; Pelletier, Matthew H; Yu, Yan; Walsh, William R

2013-02-01

The increased concentration of platelets within platelet-rich plasma (PRP) provides a vehicle to deliver supra-physiologic concentrations of growth factors to an injury site, possibly accelerating or otherwise improving connective tissue regeneration. This potential benefit has led to the application of PRP in several applications; however, inconsistent results have limited widespread adoption in bone healing. This review provides a core understanding of the bone healing mechanisms, and corresponds this to the factors present in PRP. In addition, the current state of the art of PRP preparation, the key aspects that may influence its effectiveness, and treatment outcomes as they relate specifically to bone defect healing are presented. Although PRP does have a sound scientific basis, its use for bone healing appears only beneficial when used in combination with osteoconductive scaffolds; however, neither allograft nor autograft appear to be appropriate carriers. Aggressive processing techniques and very high concentrations of PRP may not improve healing outcomes. Moreover, many other variables exist in PRP preparation and use that influence its efficacy; the effect of these variables should be understood when considering PRP use. This review includes the essentials of what has been established, what is currently missing in the literature, and recommendations for future directions.

Effects of different concentrations of Platelet-rich Plasma and Platelet-Poor Plasma on vitality and differentiation of autologous Adipose tissue-derived stem cells.

PubMed

Felthaus, Oliver; Prantl, Lukas; Skaff-Schwarze, Mona; Klein, Silvan; Anker, Alexandra; Ranieri, Marco; Kuehlmann, Britta

2017-01-01

Autologous fat grafts and adipose-derived stem cells (ASCs) can be used to treat soft tissue defects. However, the results are inconsistent and sometimes comprise tissue resorption and necrosis. This might be due to insufficient vascularization. Platelet-rich plasma (PRP) is a source of concentrated autologous platelets. The growth factors and cytokines released by platelets can facilitate angiogenesis. The simultaneous use of PRP might improve the regeneration potential of fat grafts. The optimal ratio has yet to be elucidated. A byproduct of PRP preparation is platelet-poor plasma (PPP). In this study we investigated the influence of different concentrations of PRP on the vitality and differentiation of ASCs. We processed whole blood with the Arthrex Angel centrifuge and isolated ASCs from the same donor. We tested the effects of different PRP and PPP concentrations on the vitality using resazurin assays and the differentiation of ASCs using oil-red staining. Both cell vitality and adipogenic differentiation increase to a concentration of 10% to 20% PRP. With a PRP concentration of 30% cell vitality and differentiation decrease. Both PRP and PPP can be used to expand ASCs without xenogeneic additives in cell culture. A PRP concentration above 20% has inhibitory effects.

Bioactivity of freeze-dried platelet-rich plasma in an adsorbed form on a biodegradable polymer material.

PubMed

Nakajima, Yu; Kawase, Tomoyuki; Kobayashi, Mito; Okuda, Kazuhiro; Wolff, Larry F; Yoshie, Hiromasa

2012-01-01

Owing to the necessity for the immediate preparation from patients' blood, autologous platelet-rich plasma (PRP) limits its clinical applicability. To address this concern and respond to emergency care and other unpredictable uses, we have developed a freeze-dried PRP in an adsorbed form on a biodegradable polymer material (Polyglactin 910). On the polymer filaments of PRP mesh, which was prepared by coating the polymer mesh with human fresh PRP and subsequent freeze-drying, platelets were incorporated, and related growth factors were preserved at high levels. This new PRP mesh preparation significantly and reproducibly stimulated the proliferation of human periodontal ligament cells in vitro and neovascularization in a chorioallantoic membrane assay. A full-thickness skin defect model in a diabetic mouse demonstrated the PRP mesh, although prepared from human blood, substantially facilitated angiogenesis, granulation tissue formation, and re-epithelialization without inducing severe inflammation in vivo. These data demonstrate that our new PRP mesh preparation functions as a bioactive material to facilitate tissue repair/regeneration. Therefore, we suggest that this bioactive material, composed of allogeneic PRP, could be clinically used as a promising alternative in emergency care or at times when autologous PRP is not prepared immediately before application.

Prp43p Is a DEAH-Box Spliceosome Disassembly Factor Essential for Ribosome Biogenesis

PubMed Central

Combs, D. Joshua; Nagel, Roland J.; Ares, Manuel; Stevens, Scott W.

2006-01-01

The known function of the DEXH/D-box protein Prp43p is the removal of the U2, U5, and U6 snRNPs from the postsplicing lariat-intron ribonucleoprotein complex. We demonstrate that affinity-purified Prp43p-associated material includes the expected spliceosomal components; however, we also identify several preribosomal complexes that are specifically purified with Prp43p. Conditional prp43 mutant alleles confer a 35S pre-rRNA processing defect, with subsequent depletion of 27S and 20S precursors. Upon a shift to a nonpermissive temperature, both large and small-ribosomal-subunit proteins accumulate in the nucleolus of prp43 mutants. Pulse-chase analysis demonstrates delayed kinetics of 35S, 27S, and 20S pre-rRNA processing with turnover of these intermediates. Microarray analysis of pre-mRNA splicing defects in prp43 mutants shows a very mild effect, similar to that of nonessential pre-mRNA splicing factors. Prp43p is the first DEXH/D-box protein shown to function in both RNA polymerase I and polymerase II transcript metabolism. Its essential function is in its newly characterized role in ribosome biogenesis of both ribosomal subunits, positioning Prp43p to regulate both pre-mRNA splicing and ribosome biogenesis. PMID:16382144

Functions for fission yeast splicing factors SpSlu7 and SpPrp18 in alternative splice-site choice and stress-specific regulated splicing.

PubMed

Melangath, Geetha; Sen, Titash; Kumar, Rakesh; Bawa, Pushpinder; Srinivasan, Subha; Vijayraghavan, Usha

2017-01-01

Budding yeast spliceosomal factors ScSlu7 and ScPrp18 interact and mediate intron 3'ss choice during second step pre-mRNA splicing. The fission yeast genome with abundant multi-intronic transcripts, degenerate splice signals and SR proteins is an apt unicellular fungal model to deduce roles for core spliceosomal factors in alternative splice-site choice, intron retention and to study the cellular implications of regulated splicing. From our custom microarray data we deduce a stringent reproducible subset of S. pombe alternative events. We examined the role of factors SpSlu7 or SpPrp18 for these splice events and investigated the relationship to growth phase and stress. Wild-type log and stationary phase cells showed ats1+ exon 3 skipped and intron 3 retained transcripts. Interestingly the non-consensus 5'ss in ats1+ intron 3 caused SpSlu7 and SpPrp18 dependent intron retention. We validated the use of an alternative 5'ss in dtd1+ intron 1 and of an upstream alternative 3'ss in DUF3074 intron 1. The dtd1+ intron 1 non-canonical 5'ss yielded an alternative mRNA whose levels increased in stationary phase. Utilization of dtd1+ intron 1 sub-optimal 5' ss required functional SpPrp18 and SpSlu7 while compromise in SpSlu7 function alone hampered the selection of the DUF3074 intron 1 non canonical 3'ss. We analysed the relative abundance of these splice isoforms during mild thermal, oxidative and heavy metal stress and found stress-specific splice patterns for ats1+ and DUF3074 intron 1 some of which were SpSlu7 and SpPrp18 dependent. By studying ats1+ splice isoforms during compromised transcription elongation rates in wild-type, spslu7-2 and spprp18-5 mutant cells we found dynamic and intron context-specific effects in splice-site choice. Our work thus shows the combinatorial effects of splice site strength, core splicing factor functions and transcription elongation kinetics to dictate alternative splice patterns which in turn serve as an additional recourse of gene regulation in fission yeast.

Functions for fission yeast splicing factors SpSlu7 and SpPrp18 in alternative splice-site choice and stress-specific regulated splicing

PubMed Central

Kumar, Rakesh; Bawa, Pushpinder; Srinivasan, Subha

2017-01-01

Budding yeast spliceosomal factors ScSlu7 and ScPrp18 interact and mediate intron 3’ss choice during second step pre-mRNA splicing. The fission yeast genome with abundant multi-intronic transcripts, degenerate splice signals and SR proteins is an apt unicellular fungal model to deduce roles for core spliceosomal factors in alternative splice-site choice, intron retention and to study the cellular implications of regulated splicing. From our custom microarray data we deduce a stringent reproducible subset of S. pombe alternative events. We examined the role of factors SpSlu7 or SpPrp18 for these splice events and investigated the relationship to growth phase and stress. Wild-type log and stationary phase cells showed ats1+ exon 3 skipped and intron 3 retained transcripts. Interestingly the non-consensus 5’ss in ats1+ intron 3 caused SpSlu7 and SpPrp18 dependent intron retention. We validated the use of an alternative 5’ss in dtd1+ intron 1 and of an upstream alternative 3’ss in DUF3074 intron 1. The dtd1+ intron 1 non-canonical 5’ss yielded an alternative mRNA whose levels increased in stationary phase. Utilization of dtd1+ intron 1 sub-optimal 5’ ss required functional SpPrp18 and SpSlu7 while compromise in SpSlu7 function alone hampered the selection of the DUF3074 intron 1 non canonical 3’ss. We analysed the relative abundance of these splice isoforms during mild thermal, oxidative and heavy metal stress and found stress-specific splice patterns for ats1+ and DUF3074 intron 1 some of which were SpSlu7 and SpPrp18 dependent. By studying ats1+ splice isoforms during compromised transcription elongation rates in wild-type, spslu7-2 and spprp18-5 mutant cells we found dynamic and intron context-specific effects in splice-site choice. Our work thus shows the combinatorial effects of splice site strength, core splicing factor functions and transcription elongation kinetics to dictate alternative splice patterns which in turn serve as an additional recourse of gene regulation in fission yeast. PMID:29236736

Membrane Disruption Mechanism of a Prion Peptide (106-126) Investigated by Atomic Force Microscopy, Raman and Electron Paramagnetic Resonance Spectroscopy.

PubMed

Pan, Jianjun; Sahoo, Prasana K; Dalzini, Annalisa; Hayati, Zahra; Aryal, Chinta M; Teng, Peng; Cai, Jianfeng; Rodriguez Gutierrez, Humberto; Song, Likai

2017-05-18

A fragment of the human prion protein spanning residues 106-126 (PrP106-126) recapitulates many essential properties of the disease-causing protein such as amyloidogenicity and cytotoxicity. PrP106-126 has an amphipathic characteristic that resembles many antimicrobial peptides (AMPs). Therefore, the toxic effect of PrP106-126 could arise from a direct association of monomeric peptides with the membrane matrix. Several experimental approaches are employed to scrutinize the impacts of monomeric PrP106-126 on model lipid membranes. Porous defects in planar bilayers are observed by using solution atomic force microscopy. Adding cholesterol does not impede defect formation. A force spectroscopy experiment shows that PrP106-126 reduces Young's modulus of planar lipid bilayers. We use Raman microspectroscopy to study the effect of PrP106-126 on lipid atomic vibrational dynamics. For phosphatidylcholine lipids, PrP106-126 disorders the intrachain conformation, while the interchain interaction is not altered; for phosphatidylethanolamine lipids, PrP106-126 increases the interchain interaction, while the intrachain conformational order remains similar. We explain the observed differences by considering different modes of peptide insertion. Finally, electron paramagnetic resonance spectroscopy shows that PrP106-126 progressively decreases the orientational order of lipid acyl chains in magnetically aligned bicelles. Together, our experimental data support the proposition that monomeric PrP106-126 can disrupt lipid membranes by using similar mechanisms found in AMPs.

Membrane Disruption Mechanism of a Prion Peptide (106-126) Investigated by Atomic Force Microscopy, Raman and Electron Paramagnetic Resonance Spectroscopy

PubMed Central

Pan, Jianjun; Sahoo, Prasana K.; Dalzini, Annalisa; Hayati, Zahra; Aryal, Chinta M.; Teng, Peng; Cai, Jianfeng; Gutierrez, Humberto Rodriguez; Song, Likai

2018-01-01

A fragment of the human prion protein spanning residues 106-126 (PrP106-126) recapitulates many essential properties of the disease-causing protein such as amyloidogenicity and cytotoxicity. PrP106-126 has an amphipathic characteristic that resembles many antimicrobial peptides (AMPs). Therefore, the toxic effect of PrP106-126 could arise from a direct association of monomeric peptides with membrane matrix. Several experimental approaches are employed to scrutinize the impacts of monomeric PrP106-126 on model lipid membranes. Porous defects in planar bilayers are observed by using solution atomic force microscopy. Adding cholesterol does not impede defect formation. Force spectroscopy experiment shows that PrP106-126 reduces Young’s modulus of planar lipid bilayers. We use Raman microspectroscopy to study the effect of PrP106-126 on lipid vibrational dynamics. For phosphatidylcholine lipids, PrP106-126 disorders the intra-chain conformation, while the inter-chain interaction is not altered; for phosphatidylethanolamine lipids, PrP106-126 increases the inter-chain interaction, while the intra-chain conformational order remains similar. We explain the observed differences by considering different modes of peptide insertion. Finally, electron paramagnetic resonance spectroscopy shows that PrP106-126 progressively decreases the orientational order of lipid acyl chains in magnetically aligned bicelles. Together, our experimental data support the proposition that monomeric PrP106-126 can disrupt lipid membranes by using similar mechanisms found in AMPs. PMID:28459565

Molecular dissection of step 2 catalysis of yeast pre-mRNA splicing investigated in a purified system

PubMed Central

Ohrt, Thomas; Odenwälder, Peter; Dannenberg, Julia; Prior, Mira; Warkocki, Zbigniew; Schmitzová, Jana; Karaduman, Ramazan; Gregor, Ingo; Enderlein, Jörg; Fabrizio, Patrizia; Lührmann, Reinhard

2013-01-01

Step 2 catalysis of pre-mRNA splicing entails the excision of the intron and ligation of the 5′ and 3′ exons. The tasks of the splicing factors Prp16, Slu7, Prp18, and Prp22 in the formation of the step 2 active site of the spliceosome and in exon ligation, and the timing of their recruitment, remain poorly understood. Using a purified yeast in vitro splicing system, we show that only the DEAH-box ATPase Prp16 is required for formation of a functional step 2 active site and for exon ligation. Efficient docking of the 3′ splice site (3′SS) to the active site requires only Slu7/Prp18 but not Prp22. Spliceosome remodeling by Prp16 appears to be subtle as only the step 1 factor Cwc25 is dissociated prior to step 2 catalysis, with its release dependent on docking of the 3′SS to the active site and Prp16 action. We show by fluorescence cross-correlation spectroscopy that Slu7/Prp18 and Prp16 bind early to distinct, low-affinity binding sites on the step-1-activated B* spliceosome, which are subsequently converted into high-affinity sites. Our results shed new light on the factor requirements for step 2 catalysis and the dynamics of step 1 and 2 factors during the catalytic steps of splicing. PMID:23685439

Autologous Platelet-Rich Plasma Preparations

PubMed Central

Schippinger, Gert; Prüller, Florian; Divjak, Manuela; Mahla, Elisabeth; Fankhauser, Florian; Rackemann, Steve; Raggam, Reinhard Bernd

2015-01-01

Background Autologous platelet-rich plasma (PRP) has been widely used for the treatment of sports injuries. It has been associated with improved healing and regeneration of soft tissues in elite athletes. Athletes are commonly receiving nonsteroidal anti-inflammatory drugs (NSAIDs). As yet, the effect of these drugs on platelet function in PRP formulations has not been taken into consideration. Hypothesis The function of platelets in PRP produced under the influence of NSAIDs is inhibited and may lessen a possible healing effect on the site of injury. Study Design Controlled laboratory study. Methods PRP was collected from patients receiving NSAIDs after elective orthopaedic surgery, and platelet function was evaluated using light transmission aggregometry (LTA). Results were compared with those obtained from healthy volunteers without a history of NSAID intake during the previous 2 weeks. Two different systems for blood collection and PRP production (Arthrex ACP double-syringe system and standard 4.5-mL sodium citrate blood collection tubes) were used and compared regarding the quality of PRP that was produced. Results For both groups, the baseline platelet counts of whole blood and the platelet counts of PRP formulations were found to be in the normal range. Both collection systems for PRP produced comparable results without significant differences between the groups. Platelet function testing with LTA revealed significantly impaired platelet aggregation in both PRP preparations, obtained from patients taking NSAIDs, irrespective of the type of NSAID (P < .001). All subjects from the control group showed normal platelet aggregation patterns when tested with LTA. Conclusion Autologous PRP produced from subjects after NSAID medication shows significantly impaired platelet function and may result in lower quality regarding the content of bioactive compounds. Clinical Relevance If required, the administration of NSAIDs should be performed after blood collection for preparation of autologous PRP; otherwise, the therapeutic effect may be limited. PMID:26665098

Evaluation of Not-Activated and Activated PRP in Hair Loss Treatment: Role of Growth Factor and Cytokine Concentrations Obtained by Different Collection Systems.

PubMed

Gentile, Pietro; Cole, John P; Cole, Megan A; Garcovich, Simone; Bielli, Alessandra; Scioli, Maria Giovanna; Orlandi, Augusto; Insalaco, Chiara; Cervelli, Valerio

2017-02-14

Platelet rich plasma (PRP) was tested as a potential therapy for androgenetic alopecia (AGA) through two different clinical protocols in which one population (18 participants) received half-head treatment with autologous non-activated PRP (A-PRP) produced by CPunT Preparation System (Biomed Device, Modena, Italy) and the other half-head with placebo, and a second separated population in which all participants (n = 6, 3 participants per group) received treatment with calcium-activated PRP (AA-PRP) produced from one of two different PRP collection devices (Regen Blood Cell Therapy or Arthrex Angel System). For the A-PRP study, three treatments were administered over 30-day intervals. Trichoscan analysis of patients, three months post-treatment, showed a clinical improvement in the number of hairs in the target area (36 ± 3 hairs) and in total hair density (65±  5 hair cm2), whereas negligible improvements in hair count (1.1±  1.4 hairs) and density (1.9 ± 10.2 hair cm2) were seen in the region of the scalp that received placebo. Microscopic evaluation conducted two weeks after treatment showed also an increase in epidermal thickness, Ki67+ keratinocytes, and in the number of follicles. The AA-PRP treatment groups received a singular set of injections, and six months after the treatments were administered, notable differences in clinical outcomes were obtained from the two PRP collection devices (+90 ± 6 hair cm2 versus -73 ± 30 hair cm2 hair densities, Regen versus Arthrex). Growth factor concentrations in AA-PRP prepared from the two collection devices did not differ significantly upon calcium activation.

Evaluation of Not-Activated and Activated PRP in Hair Loss Treatment: Role of Growth Factor and Cytokine Concentrations Obtained by Different Collection Systems

PubMed Central

Gentile, Pietro; Cole, John P.; Cole, Megan A.; Garcovich, Simone; Bielli, Alessandra; Scioli, Maria Giovanna; Orlandi, Augusto; Insalaco, Chiara; Cervelli, Valerio

2017-01-01

Platelet rich plasma (PRP) was tested as a potential therapy for androgenetic alopecia (AGA) through two different clinical protocols in which one population (18 participants) received half-head treatment with autologous non-activated PRP (A-PRP) produced by CPunT Preparation System (Biomed Device, Modena, Italy) and the other half-head with placebo, and a second separated population in which all participants (n = 6, 3 participants per group) received treatment with calcium-activated PRP (AA-PRP) produced from one of two different PRP collection devices (Regen Blood Cell Therapy or Arthrex Angel System). For the A-PRP study, three treatments were administered over 30-day intervals. Trichoscan analysis of patients, three months post-treatment, showed a clinical improvement in the number of hairs in the target area (36 ± 3 hairs) and in total hair density (65 ± 5 hair cm2), whereas negligible improvements in hair count (1.1 ± 1.4 hairs) and density (1.9 ± 10.2 hair cm2) were seen in the region of the scalp that received placebo. Microscopic evaluation conducted two weeks after treatment showed also an increase in epidermal thickness, Ki67+ keratinocytes, and in the number of follicles. The AA-PRP treatment groups received a singular set of injections, and six months after the treatments were administered, notable differences in clinical outcomes were obtained from the two PRP collection devices (+90 ± 6 hair cm2 versus −73 ± 30 hair cm2 hair densities, Regen versus Arthrex). Growth factor concentrations in AA-PRP prepared from the two collection devices did not differ significantly upon calcium activation. PMID:28216604

Elevated levels of maternal anti-tetanus toxin antibodies do not suppress the immune response to a Haemophilus influenzae type b polyribosylphosphate-tetanus toxoid conjugate vaccine.

PubMed Central

Panpitpat, C.; Thisyakorn, U.; Chotpitayasunondh, T.; Fürer, E.; Que, J. U.; Hasler, T.; Cryz, S. J.

2000-01-01

Reported are the effects of elevated levels of anti-tetanus antibodies on the safety and immune response to a Haemophilus influenzae type b polyribosylphosphate (PRP)-tetanus toxoid conjugate (PRP-T) vaccine. A group of Thai infants (n = 177) born to women immunized against tetanus during pregnancy were vaccinated with either a combined diphtheria-tetanus-pertussis (DTP) PRP-T vaccine or DTP and a PRP-conjugate vaccine using Neisseria meningitidis group B outer-membrane proteins as a carrier (PedVax HIB). Although most infants possessed high titres (> 1 IU/ml) of anti-tetanus antibodies, the DTP-PRP-T combined vaccine engendered an excellent antibody response to all vaccine components. In both vaccine groups > 98% of infants attained anti-PRP antibody titres > or = 0.15 microgram/ml. The geometric mean anti-PRP antibody titres were 5.41 micrograms/ml and 2.1 micrograms/ml for infants immunized with three doses of PRP-T versus two doses of PedVax HIB vaccines, respectively (P < 0.005). Similarly, the proportion of infants who achieved titres > or = 1 microgram/ml was higher in the PRP-T group (87.8%) than in the group immunized with PedVax HIB (74.2%) (P = 0.036). A subgroup analysis showed that there was no significant difference in the anti-PRP antibody response for infants exhibiting either < 1 IU of anti-tetanus antibody per millilitre or > or = 1 IU/ml at baseline. These finding indicate that pre-existing anti-carrier antibody does not diminish the immune response to the PRP moiety. All infants possessed protective levels of anti-D and anti-T antibody levels after immunization. PMID:10812736

The Composite of Bone Marrow Concentrate and PRP as an Alternative to Autologous Bone Grafting

PubMed Central

Hakimi, Mohssen; Grassmann, Jan-Peter; Betsch, Marcel; Schneppendahl, Johannes; Gehrmann, Sebastian; Hakimi, Ahmad-Reza; Kröpil, Patric; Sager, Martin; Herten, Monika; Wild, Michael; Windolf, Joachim; Jungbluth, Pascal

2014-01-01

One possible alternative to the application of autologous bone grafts represents the use of autologous bone marrow concentrate (BMC). The purpose of our study was to evaluate the potency of autologous platelet-rich plasma (PRP) in combination with BMC. In 32 mini-pigs a metaphyseal critical-size defect was surgically created at the proximal tibia. The animals were allocated to four treatment groups of eight animals each (1. BMC+CPG group, 2. BMC+CPG+PRP group, 3. autograft group, 4. CPG group). In the BMC+CPG group the defect was filled with autologous BMC in combination with calcium phosphate granules (CPG), whereas in the BMC+CPG+PRP group the defect was filled with the composite of autologous BMC, CPG and autologous PRP. In the autograft group the defect was filled with autologous cancellous graft, whereas in the CPG group the defect was filled with CPG solely. After 6 weeks radiological and histomorphometrical analysis showed significantly more new bone formation in the BMC+CPG+PRP group compared to the BMC+CPG group and the CPG group. There were no significant differences between the BMC+CPG+PRP group and the autograft group. In the PRP platelets were enriched significantly about 4.7-fold compared to native blood. In BMC the count of mononuclear cells increased significantly (3.5-fold) compared to the bone marrow aspirate. This study demonstrates that the composite of BMC+CPG+PRP leads to a significantly higher bone regeneration of critical-size defects at the proximal tibia in mini-pigs than the use of BMC+CPG without PRP. Furthermore, within the limits of the present study the composite BMC+CPG+PRP represents a comparable alternative to autologous bone grafting. PMID:24950251

Intraarticular injection autologous platelet-rich plasma and bone marrow concentrate in a goat osteoarthritis model.

PubMed

Wang, Zhen; Zhai, Chenjun; Fei, Hao; Hu, Junzheng; Cui, Weiding; Wang, Zhen; Li, Zeng; Fan, Weimin

2018-02-21

To evaluate the effects of intraarticular injections of autologous platelet-rich plasma (PRP) or bone marrow concentrate (BMC) on osteoarthritis (OA), 24 adult goats were equally divided into control (Ctrl), saline (NS), PRP, and BMC groups, and OA was induced by surgery in NS, PRP, and BMC groups. Autologous PRP and BMC were obtained from whole blood and bone marrow aspirates, respectively. The data revealed, platelets were increased in BMC by 1.8-fold, monocytes by 5.6-fold, TGF-β1 by 7.7-fold, and IGF-1 by 3.6-fold (p < 0.05), and platelets were increased in PRP by 2.9-fold, and TGF-β1 by 3.3-fold (p < 0.05). From the sixth week post-operation, saline, PRP, and BMC were administered by intraarticular injection once every 4 weeks, three consecutive times. After the animals were sacrificed, inflammatory cytokines in the synovial fluid was measured, and bone and cartilage degeneration progression was observed by macroscopy, histology, and immunohistochemistry. Compared with the NS group, the level of inflammatory cytokines was reduced in the PRP and BMC groups (p < 0.05). Histologically, delayed cartilage degeneration and higher levels of extracellular matrix (ECM) were observed in both PRP and BMC treated groups (p < 0.05). Furthermore, the BMC group showed greater cartilage protection and less ECM loss than the PRP group (p < 0.05). In summary, this study showed that intraarticular injection of autologous PRP and BMC has therapeutic efficacy in a goat osteoarthritis model, with the greater benefit in terms of cartilage protection being observed in the BMC-treated group than PRP. © 2018 Orthopaedic Research Society. Published by Wiley Periodicals, Inc. J Orthop Res. © 2018 Orthopaedic Research Society. Published by Wiley Periodicals, Inc.

Effects of intravitreal injection of ranibizumab on choroidal structure and blood flow in eyes with diabetic macular edema.

PubMed

Okamoto, Masahiro; Yamashita, Mariko; Ogata, Nahoko

2018-05-01

To determine the effects of an intravitreal injection of ranibizumab (IVR) on the choroidal structure and blood flow in eyes with diabetic macular edema (DME). Twenty-eight consecutive patients with DME who received an IVR and 20 non-diabetic, age-matched controls were followed for 1 month. The eyes with DME were divided into those with prior panretinal photocoagulation (PRP, n = 16) and those without prior PRP (no-PRP, n = 12). The enhanced depth imaging optical coherence tomography (EDI-OCT) scans and Niblack's image binarization were performed to determine the choroidal structure. The choroidal blood flow was determined by laser speckle flowgraphy. The subfoveal choroidal thickness at the baseline was significantly thicker in the no-PRP group than in the PRP-treated group. After IVR, the best-corrected visual acuity (BCVA) and central retinal thickness in eyes with DME were significantly improved compared to the baseline values. There were significant differences in the choroidal thickness, total choroidal area, and choroidal vascularity index between the groups after IVR. Choroidal vascular index and choroidal blood flow were significantly reduced only in the no-PRP group and not in the PRP-treated group. In addition, the correlation between the central retinal thickness and the choroidal blood flow was significant in the no-PRP group (r = 0.47, P < 0.05). A single IVR will reduce the central retinal thickness and improve the BCVA in eyes with DME in both the no-PRP and PRP-treated group. IVR affected the choroidal vasculature and blood flow significantly, and a significant correlation was found between the central retinal thickness and the choroidal blood flow in eyes without PRP.

Platelet-rich plasma use in anterior cruciate ligament surgery: systematic review of the literature.

PubMed

Figueroa, David; Figueroa, Francisco; Calvo, Rafael; Vaisman, Alex; Ahumada, Ximena; Arellano, Sergio

2015-05-01

To systematically review the current literature for evidence that would substantiate the use of platelet-rich plasma (PRP) in the treatment of anterior cruciate ligament (ACL) ruptures. We performed a systematic search in PubMed and Embase of studies written in the English and Spanish languages that compared the use of PRP with a control group in patients with ACL injuries assessing graft-to-bone healing, graft maturation, and/or clinical outcomes and were randomized controlled trials or prospective cohort studies. Eleven studies fulfilled the inclusion criteria, comprising 516 patients (266 ACL reconstructions using PRP and 250 ACL reconstructions without PRP). Six studies reported a statistically significant difference (4 studies) or tendency toward faster graft maturation in the platelet group (2 studies). One study found no differences. Regarding tunnel healing/widening, 1 study showed faster healing in the PRP group and 5 studies showed no differences between the 2 groups. Considering clinical outcomes, 1 study showed better clinical outcomes with PRP use and 5 studies showed no benefits with the use of PRP. Concerning ACL graft maturation, there is promising evidence that the addition of PRP could be a synergic factor in acquiring maturity more quickly than grafts with no PRP, with the clinical implication of this remaining unclear. Regarding tunnel healing, it appears that there is not an improvement with the addition of PRP. There is no proof that clinical outcomes of ACL surgery are enhanced by the use of PRP. Level III, systematic review of Level I through III studies. Copyright © 2015 Arthroscopy Association of North America. Published by Elsevier Inc. All rights reserved.

Pilot randomised clinical trial of Pascal TargETEd Retinal versus variable fluence PANretinal 20 ms laser in diabetic retinopathy: PETER PAN study.

PubMed

Muqit, Mahiul M K; Young, Lorna B; McKenzie, Rod; John, Binu; Marcellino, George R; Henson, David B; Turner, George S; Stanga, Paulo E

2013-02-01

To investigate the short-term effects of high-density 20-ms laser on macular thickness using Pascal-targeted retinal photocoagulation (TRP) and reduced fluence/minimally-traumatic panretinal photocoagulation (MT-PRP) compared to standard-intensity PRP (SI-PRP) in proliferative diabetic retinopathy (PDR). Prospective randomised clinical trial. Treatment-naive PDR was treated with single-session 20-ms Pascal 2500 burns photocoagulation randomised to one of three treatment arms (TRP:MT-PRP:SI-PRP). Primary outcome measure was change in central retinal thickness (CRT) on OCT. Secondary outcomes at 4 and 12 weeks post-laser included: OCT peripapillary nerve fibre layer (NFL) thickness; PDR disease regression on Optos angiography; SITA-Std visual fields (VF); and, visual acuity (VA). 30 eyes of 24 patients were studied, ten eyes/arm. At 12 weeks, there were significant reductions in CRT after TRP (9.6 µm; 95% CI, 1.84 to 17.36; p=0.021) and MT-PRP (17.1 µm; 95% CI, 11 to 23.2; p=0.001), versus SI-PRP (+5.9 µm; 95% CI, -6.75 to 18.55; p=0.32). PDR regression was similar between groups (TRP 70%; MT-PRP 70%; SI-PRP 90%; κ=0.76). No significant changes in VA and NFL thickness developed between groups. The VF mean deviation scores increased significantly in all groups at 12 weeks ([TRP, +0.70dB; 95% CI, 0.07 to 1.48; p=0.07], [MT-PRP, +0.63dB; 95% CI, 0.12 to 1.15; p=0.02], [SI-PRP, +1.0dB; 95% CI, 0.19 to 1.74; p=0.02]). There were no laser-related ocular complications. This pilot study reports that high-density 20-ms Pascal TRP and MT-PRP using 2500 burns did not produce increased macular thickness or any ocular adverse events during the short-term.

Stimulation of the Superficial Zone Protein and Lubrication in the Articular Cartilage by Human Platelet-Rich Plasma

PubMed Central

Sakata, Ryosuke; McNary, Sean M.; Miyatake, Kazumasa; Lee, Cassandra A.; Van den Bogaerde, James M.; Marder, Richard A.; Reddi, A. Hari

2016-01-01

Background Platelet-rich plasma (PRP) contains high concentrations of autologous growth factors that originate from platelets. Intra-articular injections of PRP have the potential to ameliorate the symptoms of osteoarthritis in the knee. Superficial zone protein (SZP) is a boundary lubricant in articular cartilage and plays an important role in reducing friction and wear and therefore is critical in cartilage homeostasis. Purpose To determine if PRP influences the production of SZP from human joint-derived cells and to evaluate the lubricating properties of PRP on normal bovine articular cartilage. Study Design Controlled laboratory study. Methods Cells were isolated from articular cartilage, synovium, and the anterior cruciate ligament (ACL) from 12 patients undergoing ACL reconstruction. The concentrations of SZP in PRP and culture media were measured by enzyme-linked immunosorbent assay. Cellular proliferation was quantified by determination of cell numbers. The lubrication properties of PRP from healthy volunteers on bovine articular cartilage were investigated using a pin-on-disk tribometer. Results In general, PRP stimulated proliferation in cells derived from articular cartilage, synovium, and ACL. It also significantly enhanced SZP secretion from synovium- and cartilage-derived cells. An unexpected finding was the presence of SZP in PRP (2.89 ± 1.23 µg/mL before activation and 3.02 ± 1.32 µg/mL after activation). In addition, under boundary mode conditions consisting of high loads and low sliding speeds, nonactivated and thrombin-activated PRP decreased the friction coefficient (μ = 0.012 and μ = 0.015, respectively) compared with saline (μ = 0.047, P < 0.004) and high molecular weight hyaluronan (μ = 0.080, P < 0.006). The friction coefficient of the cartilage with PRP was on par with that of synovial fluid. Conclusion PRP significantly stimulates cell proliferation and SZP secretion by articular cartilage and synovium of the human knee joint. Furthermore, PRP contains endogenous SZP and, in a functional bioassay, lubricates bovine articular cartilage explants. Clinical Relevance These findings provide evidence to explain the biochemical and biomechanical mechanisms underlying the efficacy of PRP treatment for osteoarthritis or damage in the knee joint. PMID:25813869

Effect of arthrocentesis plus platelet-rich plasma and platelet-rich plasma alone in the treatment of temporomandibular joint osteoarthritis: A retrospective matched cohort study (A STROBE-compliant article).

PubMed

Lin, Shang-Lun; Tsai, Chiang-Chin; Wu, Shang-Liang; Ko, Shun-Yao; Chiang, Wei-Fan; Yang, Jung Wu

2018-04-01

Although the research on using platelet-rich plasma (PRP) for temporomandibular joint osteoarthritis (TMJ-OA) has advanced, no unified standards exist for determining the joint use of arthrocentesis and the injection dose and frequency of PRP. This study aimed to compare the efficacy of 2 TMJ-OA treatment approaches, arthrocentesis plus platelet-rich plasma (A+PRP) and PRP alone, and attempted to provide another potential treatment option with a single injection of 2 mL of high-concentration and high-purity PRP.This retrospective matched cohort study enrolled 208 patients who were treated for temporomandibular disorders (TMDs) in the Department of Oral and Maxillofacial Surgery of Tainan Sin-Lau Hospital between August of 2013 and January of 2016, from which 90 patients were selected for the final analysis. The predictor variables were treatment outcome indicators, including joint crepitus sounds, TMD-associated headache, jaw range of motion <6 mm, myofascial pain with referral, temporomandibular joint (TMJ) arthralgia, pain when chewing most foods, and maximum assisted opening (MAO). The data were analyzed using χ tests, t tests, and multiple regression analyses.Among the 90 patients, 30 were assigned into the A+PRP group, and 60 were included in the PRP group. A matching method was used to ensure no statistically significant differences in the categorical and continuous variables between the 2 groups. After treatment, both the A+PRP and PRP groups showed improvements in TMJ-OA. The 2 treatment groups did not show statistically significant differences in the symptom improvement rates of joint crepitus sounds, reparative remodeling, and TMJ arthralgia. However, compared with PRP alone, the A+PRP treatment demonstrated superior performance in improving TMD-associated headache, jaw range of motion <6 mm, myofascial pain with referral, and pain when chewing most foods.Both A+PRP and PRP treatments can effectively improve multiple symptoms of TMJ-OA. Based on the results from this study, we recommend a single injection with 2 mL of high-concentration and high-purity PRP for TMJ-OA treatment. For patients with TMJ-OA accompanied by other clinical symptoms, including TMD-associated headache, jaw range of motion <6 mm, myofascial pain with referral, and pain when chewing most foods, a treatment approach using arthrocentesis prior to a PRP injection can achieve a higher efficacy.

Concentrated Growth Factor Enhanced Fat Graft Survival: A Comparative Study.

PubMed

Hu, Yun; Jiang, Yichen; Wang, Muyao; Tian, Weidong; Wang, Hang

2018-06-08

Concentrated growth factors (CGFs) belong to a new generation biomaterials that concentrate large number of growth factors and CD34 stem cells in small volume of plasma. The purpose of this study was to evaluate the impact of the new technique, CGF, on fat graft survival, which compared with platelet-rich plasma (PRP) and platelet-rich fibrin (PRF). Nude mice received fat graft were divided into PRP group, PRF group, CGF group, and saline. The grafts were volumetrically and histologically evaluated at 4, 8, and 12 weeks after fat grafting. In vitro growth factor levels in PRP, PRF, and CGF were compared using enzyme-linked immunoassay method. Cell count and real-time polymerase chain reaction were used to evaluate the impact of CGF in medium on human adipose-derived stem cell (hADSC) proliferation and vascular differentiation, respectively. Fat graft weight was significantly higher in the CGF group than those in the other groups, and histologic evaluation revealed greater vascularity, fewer cysts, and less fibrosis. Adding CGF to the medium maximally promoted hADSC proliferation and expressing vascular endothelial growth factor and PECAM-1. In this preliminary study, CGF treatment improved the survival and quality of fat grafts.

Ovine recombinant PrP as an inhibitor of ruminant prion propagation in vitro.

PubMed

Workman, Rob G; Maddison, Ben C; Gough, Kevin C

2017-07-04

Prion diseases are fatal and incurable neurodegenerative diseases of humans and animals. Despite years of research, no therapeutic agents have been developed that can effectively manage or reverse disease progression. Recently it has been identified that recombinant prion proteins (rPrP) expressed in bacteria can act as inhibitors of prion replication within the in vitro prion replication system protein misfolding cyclic amplification (PMCA). Here, within PMCA reactions amplifying a range of ruminant prions including distinct Prnp genotypes/host species and distinct prion strains, recombinant ovine VRQ PrP displayed consistent inhibition of prion replication and produced IC50 values of 122 and 171 nM for ovine scrapie and bovine BSE replication, respectively. These findings illustrate the therapeutic potential of rPrPs with distinct TSE diseases.

The transcriptomic fingerprint of glucoamylase over-expression in Aspergillus niger

PubMed Central

2012-01-01

Background Filamentous fungi such as Aspergillus niger are well known for their exceptionally high capacity for secretion of proteins, organic acids, and secondary metabolites and they are therefore used in biotechnology as versatile microbial production platforms. However, system-wide insights into their metabolic and secretory capacities are sparse and rational strain improvement approaches are therefore limited. In order to gain a genome-wide view on the transcriptional regulation of the protein secretory pathway of A. niger, we investigated the transcriptome of A. niger when it was forced to overexpression the glaA gene (encoding glucoamylase, GlaA) and secrete GlaA to high level. Results An A. niger wild-type strain and a GlaA over-expressing strain, containing multiple copies of the glaA gene, were cultivated under maltose-limited chemostat conditions (specific growth rate 0.1 h-1). Elevated glaA mRNA and extracellular GlaA levels in the over-expressing strain were accompanied by elevated transcript levels from 772 genes and lowered transcript levels from 815 genes when compared to the wild-type strain. Using GO term enrichment analysis, four higher-order categories were identified in the up-regulated gene set: i) endoplasmic reticulum (ER) membrane translocation, ii) protein glycosylation, iii) vesicle transport, and iv) ion homeostasis. Among these, about 130 genes had predicted functions for the passage of proteins through the ER and those genes included target genes of the HacA transcription factor that mediates the unfolded protein response (UPR), e.g. bipA, clxA, prpA, tigA and pdiA. In order to identify those genes that are important for high-level secretion of proteins by A. niger, we compared the transcriptome of the GlaA overexpression strain of A. niger with six other relevant transcriptomes of A. niger. Overall, 40 genes were found to have either elevated (from 36 genes) or lowered (from 4 genes) transcript levels under all conditions that were examined, thus defining the core set of genes important for ensuring high protein traffic through the secretory pathway. Conclusion We have defined the A. niger genes that respond to elevated secretion of GlaA and, furthermore, we have defined a core set of genes that appear to be involved more generally in the intensified traffic of proteins through the secretory pathway of A. niger. The consistent up-regulation of a gene encoding the acetyl-coenzyme A transporter suggests a possible role for transient acetylation to ensure correct folding of secreted proteins. PMID:23237452

[Adjusting Platelet Counts for Platelet Aggregation Tests].

PubMed

Ling, Li-Qin; Yang, Xin-Chun; Chen, Hao; Liu, Chao-Nan; Chen, Si; Jiang, Hong; Jin, Ya-Xiong; Zhou, Jing

2018-03-01

To explore a better method to adjust platelet counts for light transmission aggregometry (LTA). Blood samples from 36 healthy participants aged from 18 to 50 yr. were collected.Platelet-rich plasma (PRP) was diluted using platelet-poor plasma (PPP) and physiological saline (PS),respectively,in a ratio of 1.5,2,2.5 and 3 times. Platelet aggregation was induced by adenosine diphosphate (ADP),arachidonic acid (ARA),collagen (COL), epinephrine (EPI),or ristocetin (RIS). The maximal aggregation rates (MAs) of different approaches were compared. We also compared the MAs induced by RIS between PRP-obtained-PPP and whole blood-obtained-PPP (2 100× g, 5 min). Compared with the original PRP,the MAs induced by ADP,ARA,and EPI decreased in PPP-adjusted PRP (significant at 2-3 times dilution ratio, P <0.05),but not in PS-adjusted PRP ( P >0.05). The MA induced by RIS decreased in PS-adjusted PRP (significant at all dilution ratios, P <0.05),but not in PPP-adjusted PRP ( P >0.05). No changes in the MA induced by COL were found in PS-adjusted PRP and PPP-adjusted PRP ( P >0.05). Whole blood-obtained-PPP (2 100× g, 5 min) had the same MA induced by ristocetin compared with PRP-obtained-PPP ( P >0.05). PS is recommended for adjusting platelets counts for platelet aggregation induced by ADP,ARA,COL and EPI. Whole blood-obtained-PPP (2 100 × g, 5 min) is recommended for RIS-induced aggregation as a matter of convenience. Copyright© by Editorial Board of Journal of Sichuan University (Medical Science Edition).

Basic characteristics of plasma rich in growth factors (PRGF): blood cell components and biological effects.

PubMed

Nishiyama, Kazuhiko; Okudera, Toshimitsu; Watanabe, Taisuke; Isobe, Kazushige; Suzuki, Masashi; Masuki, Hideo; Okudera, Hajime; Uematsu, Kohya; Nakata, Koh; Kawase, Tomoyuki

2016-11-01

Platelet-rich plasma (PRP) is widely used in regenerative medicine because of its high concentrations of various growth factors and platelets. However, the distribution of blood cell components has not been investigated in either PRP or other PRP derivatives. In this study, we focused on plasma rich in growth factors (PRGF), a PRP derivative, and analyzed the distributions of platelets and white blood cells (WBCs). Peripheral blood samples were collected from healthy volunteers ( N  = 14) and centrifuged to prepare PRGF and PRP. Blood cells were counted using an automated hematology analyzer. The effects of PRP and PRGF preparations on cell proliferation were determined using human periosteal cells. In the PRGF preparations, both red blood cells and WBCs were almost completely eliminated, and platelets were concentrated by 2.84-fold, whereas in the PRP preparations, both platelets and WBCs were similarly concentrated by 8.79- and 5.51-fold, respectively. Platelet counts in the PRGF preparations were positively correlated with platelet counts in the whole blood samples, while the platelet concentration rate was negatively correlated with red blood cell counts in the whole blood samples. In contrast, platelet counts and concentration rates in the PRP preparations were significantly influenced by WBC counts in whole blood samples. The PRP preparations, but not the PRGF preparations, significantly suppressed cell growth at higher doses in vitro. Therefore, these results suggest that PRGF preparations can clearly be distinguished from PRP preparations by both inclusion of WBCs and dose-dependent stimulation of periosteal cell proliferation in vitro.

Basic characteristics of plasma rich in growth factors (PRGF): blood cell components and biological effects

PubMed Central

Nishiyama, Kazuhiko; Okudera, Toshimitsu; Watanabe, Taisuke; Isobe, Kazushige; Suzuki, Masashi; Masuki, Hideo; Okudera, Hajime; Uematsu, Kohya; Nakata, Koh

2016-01-01

Abstract Platelet‐rich plasma (PRP) is widely used in regenerative medicine because of its high concentrations of various growth factors and platelets. However, the distribution of blood cell components has not been investigated in either PRP or other PRP derivatives. In this study, we focused on plasma rich in growth factors (PRGF), a PRP derivative, and analyzed the distributions of platelets and white blood cells (WBCs). Peripheral blood samples were collected from healthy volunteers (N = 14) and centrifuged to prepare PRGF and PRP. Blood cells were counted using an automated hematology analyzer. The effects of PRP and PRGF preparations on cell proliferation were determined using human periosteal cells. In the PRGF preparations, both red blood cells and WBCs were almost completely eliminated, and platelets were concentrated by 2.84‐fold, whereas in the PRP preparations, both platelets and WBCs were similarly concentrated by 8.79‐ and 5.51‐fold, respectively. Platelet counts in the PRGF preparations were positively correlated with platelet counts in the whole blood samples, while the platelet concentration rate was negatively correlated with red blood cell counts in the whole blood samples. In contrast, platelet counts and concentration rates in the PRP preparations were significantly influenced by WBC counts in whole blood samples. The PRP preparations, but not the PRGF preparations, significantly suppressed cell growth at higher doses in vitro. Therefore, these results suggest that PRGF preparations can clearly be distinguished from PRP preparations by both inclusion of WBCs and dose‐dependent stimulation of periosteal cell proliferation in vitro. PMID:29744155

The Splicing ATPase Prp43p Is a Component of Multiple Preribosomal Particles

PubMed Central

Lebaron, Simon; Froment, Carine; Fromont-Racine, Micheline; Rain, Jean-Christophe; Monsarrat, Bernard; Caizergues-Ferrer, Michèle; Henry, Yves

2005-01-01

Prp43p is a putative helicase of the DEAH family which is required for the release of the lariat intron from the spliceosome. Prp43p could also play a role in ribosome synthesis, since it accumulates in the nucleolus. Consistent with this hypothesis, we find that depletion of Prp43p leads to accumulation of 35S pre-rRNA and strongly reduces levels of all downstream pre-rRNA processing intermediates. As a result, the steady-state levels of mature rRNAs are greatly diminished following Prp43p depletion. We present data arguing that such effects are unlikely to be solely due to splicing defects. Moreover, we demonstrate by a combination of a comprehensive two-hybrid screen, tandem-affinity purification followed by mass spectrometry, and Northern analyses that Prp43p is associated with 90S, pre-60S, and pre-40S ribosomal particles. Prp43p seems preferentially associated with Pfa1p, a novel specific component of pre-40S ribosomal particles. In addition, Prp43p interacts with components of the RNA polymerase I (Pol I) transcription machinery and with mature 18S and 25S rRNAs. Hence, Prp43p might be delivered to nascent 90S ribosomal particles during pre-rRNA transcription and remain associated with preribosomal particles until their final maturation steps in the cytoplasm. Our data also suggest that the ATPase activity of Prp43p is required for early steps of pre-rRNA processing and normal accumulation of mature rRNAs. PMID:16227579

Platelet-rich plasma-containing fragmin-protamine micro-nanoparticles promote epithelialization and angiogenesis in split-thickness skin graft donor sites.

PubMed

Takabayashi, Yuki; Ishihara, Masayuki; Sumi, Yuki; Takikawa, Makoto; Nakamura, Shingo; Kiyosawa, Tomoharu

2015-01-01

Platelet-rich plasma (PRP) contains multiple growth factors, and fragmin-protamine micro-nanoparticles (F-P M-NPs) significantly enhance and stabilize growth factors. The purpose of this study was to evaluate the effects of PRP-containing F-P M-NPs (PRP&F-P M-NPs) on wound repair in split-thickness skin graft (STSG-) donor sites (DS). A total of 56 inbred male rats were anesthetized and split-thickness skin graft donor site (STSG-DS) were created with a Padgett dermatome. PRP&F-P M-NPs, F-P M-NPs, PRP, and saline (control) were then intradermally injected evenly into the STSG-DSs. On 3, 4, 5, 7, and 10 d after creation of STSG-DS, skin sample sections were stained with hematoxylin and eosin to evaluate reepithelialization and angiogenesis. Treatment of STSG-DS with PRP&F-P M-NPs effectively promoted epithelialization and new vessel formation compared with those treated with PRP, F-P M-NPs, and control (saline). The intradermal injection of PRP&F-P M-NPs promotes epithelialization and angiogenesis in STSG-DS wounds. Copyright © 2015 Elsevier Inc. All rights reserved.

Improving bone repair of femoral and radial defects in rabbit by incorporating PRP into PLGA/CPC composite scaffold with unidirectional pore structure.

PubMed

He, Fupo; Chen, Yan; Li, Jiyan; Lin, Bomiao; Ouyang, Yi; Yu, Bo; Xia, Yuanyou; Yu, Bo; Ye, Jiandong

2015-04-01

In this study, a platelet-rich plasma poly(lactic-co-glycolic acid) (PRP-PLGA)/calcium phosphate cement (CPC) composite scaffold was prepared by incorporating PRP into PLGA/CPC scaffold with unidirectional pore structure, which was fabricated by the unidirectional freeze casting of CPC slurry and the following infiltration of PLGA. The results from in vitro cell experiments and in vivo implantation in femoral defects manifested that incorporation of PRP into PLGA/CPC scaffold improved in vitro cell response (cell attachment, proliferation, and differentiation), and markedly boosted bone formation, angiogenesis and material degradation. The incorporation of PRP into scaffold showed more outstanding improvement in osteogenesis as the scaffolds were used to repair the segmental radial defects, especially at the early stage. The new bone tissues grew along the unidirectional lamellar pores of scaffold. At 12 weeks postimplantation, the segmental radial defects treated with PRP-PLGA/CPC scaffold had almost recuperated, whereas treated with the scaffold without PRP was far from healed. Taken together, the PRP-PLGA/CPC scaffold with unidirectional pore structure is a promising candidate to repair bone defects at various sites. © 2014 Wiley Periodicals, Inc.

Effect of autologous platelet-rich plasma application on cutaneous wound healing in dogs.

PubMed

Jee, Cho-Hee; Eom, Na-Young; Jang, Hyo-Mi; Jung, Hae-Won; Choi, Eul-Soo; Won, Jin-Hee; Hong, Il-Hwa; Kang, Byeong-Teck; Jeong, Dong Wook; Jung, Dong-In

2016-03-01

This study was conducted to identify the effectiveness of platelet-rich plasma (PRP) and efficacy of intralesional injection as a method of application to acute cutaneous wounds in dogs. Healthy adult beagles (n = 3) were used in this study. Autologous PRP was separated from anticoagulant treated whole blood in three dogs. Cutaneous wounds were created and then treated by intralesional injection of PRP in the experimental group, while they were treated with saline in the control group on days 0, 2 and 4. The healing process was evaluated by gross examination throughout the experimental period and histologic examination on day 7, 14 and 21. In PRP treated wounds, the mean diameter was smaller and the wound closure rate was higher than in the control. Histological study revealed that PRP treated wounds showed more granulation formation and angiogenesis on day 7, and faster epithelialization, more granulation formation and collagen deposition were observed on day 14 than in control wounds. On day 21, collagen deposition and epithelialization were enhanced in PRP treated groups. Overall, PRP application showed beneficial effects in wound healing, and intralesional injection was useful for application of PRP and could be a good therapeutic option for wound management in dogs.

Platelet-rich plasma for bone healing and regeneration.

PubMed

Oryan, Ahmad; Alidadi, Soodeh; Moshiri, Ali

2016-01-01

Successful healing of large bone defects (LBDs) is a complicated phenomenon because the body's natural ability often fails to effectively repair the LBDs. New modalities should be utilized to increase the quality and accelerate bone healing. Platelet concentrates in different forms can be considered an attractive option for such purpose. Platelets as a natural source of growth factors, cytokines, and other micro and macromolecules are hypothesized to improve bone healing. This review has covered important concepts regarding platelet-rich plasma (PRP) including mechanisms of action, preparation protocols and their differences, and factors affecting the PRP efficacy during bone healing. In addition, the most recent studies in different levels which evaluated the role of PRP on bone repair has been reviewed and discussed to clarify the controversies and conflicts, and to illustrate a future prospective and directions for orthopedic surgeons to overcome current limitations and difficulties. As the efficacy of PRP is dependent on various factors, the outcome of PRP therapy is variable and unpredictable in orthopedic patients. Therefore, it is still too soon to suggest PRP as the first line treatment option in complicated bone injuries such as LBDs and nonunions. However, combination of PRP with natural and synthetic biomaterials can enhance the effectiveness of PRP.

Effect of platelet-rich plasma on fibrocartilage, cartilage, and bone repair in temporomandibular joint.

PubMed

Kütük, Nükhet; Baş, Burcu; Soylu, Emrah; Gönen, Zeynep Burçin; Yilmaz, Canay; Balcioğlu, Esra; Özdamar, Saim; Alkan, Alper

2014-02-01

The purpose of the present study was to explore the potential use of platelet-rich-plasma (PRP) in the treatment of temporomandibular joint osteoarthritis (TMJ-OA). Surgical defects were created bilaterally on the condylar fibrocartilage, hyaline cartilage, and bone to induce an osteoarthritic TMJ in rabbits. PRP was applied to the right joints of the rabbits (PRP group), and the left joints received physiologic saline (control group). After 4 weeks, the rabbits were sacrificed for histologic and scanning electron microscopy (SEM) examinations. The data were analyzed statistically. The new bone regeneration was significantly greater in the PRP group (P < .011). Although the regeneration of the fibrocartilage and hyaline cartilage was greater in the PRP group, no statistically significant difference was found between the 2 groups. SEM showed better ultrastructural architecture of the collagen fibrils in the PRP group. PRP might enhance the regeneration of bone in TMJ-OA. Copyright © 2014 American Association of Oral and Maxillofacial Surgeons. Published by Elsevier Inc. All rights reserved.

The Prp19 WD40 Domain Contains a Conserved Protein Interaction Region Essential for its Function

PubMed Central

Vander Kooi, Craig W.; Ren, Liping; Xu, Ping; Ohi, Melanie D.; Gould, Kathleen L.; Chazin, Walter J.

2010-01-01

Summary Prp19 is a member of the WD40-repeat family of E3 ubiquitin ligases and a conserved eukaryotic RNA splicing factor essential for activation and stabilization of the spliceosome. To understand the role of the WD40 repeat domain of Prp19 we have determined its structure using X-ray crystallography. The domain has a distorted seven bladed WD40 architecture with significant asymmetry due to irregular packing of blades one and seven into the core of the WD40 domain. Structure-based mutagenesis identified a highly conserved surface centered around blade five that is required for the physical interaction between Prp19 and Cwc2, another essential splicing factor. This region is found to be required for Prp19 function and yeast viability. Experiments in vitro and in vivo demonstrate that two molecules of Cwc2 bind to the Prp19 tetramer. These coupled structural and functional studies provide a model for the functional architecture of Prp19. PMID:20462492

[The study of anticoagulants selection in platelet-rich plasma preparation].

PubMed

Hua, Lei; Lai, Gui; Zhenjun, Liu; Guie, Ma

2015-07-01

To investigate the effect of the anticoagulants on PRP quality, so as to clarify the appropriate anticoagulant used in PRP production. The microstructure change of platelets collected via heparin, citrate, acid citrate dextrose (ACD) and citrate-theophylline-adenosine-dipyridamole ( CTAD) was observed by TEM following time course. The extent of spontaneous activation of platelets in four groups was detected by measuring sP-selectin in plasma. The TGF-β1 release amount of activated PRP of four groups was measured. CTAD is superior to other anticoagulants in maintaining the integrity of platelet structures for a long time and preventing platelet spontaneous activation. ACD slightly surpassed heparin and citrate in above two aspects. ACD-PRP and CTAD-PRP released significantly more TGF-β1 compared with heparin and citrate. The PRP quality and biological effects were strongly associated with the type of Anticoagulants. ACD and CTAD are optimal anticoagulants in PRP production for they can maintain platelet viability at a high level.

Platelets and Plasma Stimulate Sheep Rotator Cuff Tendon Tenocytes When Cultured in an Extracellular Matrix Scaffold

PubMed Central

Kelly, Brian A.; Proffen, Benedikt L.; Haslauer, Carla M.; Murray, Martha M.

2015-01-01

The addition of platelet-rich plasma (PRP) to rotator cuff repair has not translated into improved outcomes after surgery. However, recent work stimulating ligament healing has demonstrated improved outcomes when PRP or whole blood is combined with an extracellular matrix carrier. The objective of this study was to evaluate the effect of three components of blood (plasma, platelets and macrophages) on the in vitro activity of ovine rotator cuff cells cultured in an extracellular matrix environment. Tenocytes were obtained from six ovine infraspinatus tendons and cultured over 14 days in an extracellular matrix scaffold with the following additives: 1) Plasma (PPP), 2) Plasma and platelets (PAP), 3) Plasma and macrophages (PPPM), 4) Plasma, platelets and macrophages (PAPM), 5) Phosphate buffered saline (PBS), and 6) PBS with macrophages (PBSM). Assays measuring cellular metabolism (AlamarBlue), proliferation (Quantitative DNA assay), synthesis of collagen and cytokines (SIRCOL, TNF-α and IL-10 ELISA, and MMP assay), and collagen gene expression (qPCR) were performed over the duration of the experiment, as well as histology at the conclusion. Plasma was found to stimulate cell attachment and spreading on the scaffold, as well as cellular proliferation. Platelets also stimulated cell proliferation, cellular metabolism, transition of cells to a myofibroblast phenotype and contraction of the scaffolds. The addition of macrophages did not have any significant effect on the sheep rotator cuff cells in vitro. In vivo studies are needed to determine if these changes in cellular function will translate into improved tendon healing. PMID:26419602

Platelets and plasma stimulate sheep rotator cuff tendon tenocytes when cultured in an extracellular matrix scaffold.

PubMed

Kelly, Brian A; Proffen, Benedikt L; Haslauer, Carla M; Murray, Martha M

2016-04-01

The addition of platelet-rich plasma (PRP) to rotator cuff repair has not translated into improved outcomes after surgery. However, recent work stimulating ligament healing has demonstrated improved outcomes when PRP or whole blood is combined with an extracellular matrix carrier. The objective of this study was to evaluate the effect of three components of blood (plasma, platelets, and macrophages) on the in vitro activity of ovine rotator cuff cells cultured in an extracellular matrix environment. Tenocytes were obtained from six ovine infraspinatus tendons and cultured over 14 days in an extracellular matrix scaffold with the following additives: (1) plasma (PPP), (2) plasma and platelets (PAP), (3) plasma and macrophages (PPPM), (4) plasma, platelets and macrophages (PAPM), (5) phosphate buffered saline (PBS), and (6) PBS with macrophages (PBSM). Assays measuring cellular metabolism (AlamarBlue), proliferation (Quantitative DNA assay), synthesis of collagen and cytokines (SIRCOL, TNF-α and IL-10 ELISA, and MMP assay), and collagen gene expression (qPCR) were performed over the duration of the experiment, as well as histology at the conclusion. Plasma was found to stimulate cell attachment and spreading on the scaffold, as well as cellular proliferation. Platelets also stimulated cell proliferation, cellular metabolism, transition of cells to a myofibroblast phenotype, and contraction of the scaffolds. The addition of macrophages did not have any significant effect on the sheep rotator cuff cells in vitro. In vivo studies are needed to determine whether these changes in cellular function will translate into improved tendon healing. © 2015 Orthopaedic Research Society. Published by Wiley Periodicals, Inc.

Molecular Dynamics Simulation Study on the Binding and Stabilization Mechanism of Antiprion Compounds to the "Hot Spot" Region of PrPC.

PubMed

Zhou, Shuangyan; Liu, Xuewei; An, Xiaoli; Yao, Xiaojun; Liu, Huanxiang

2017-11-15

Structural transitions in the prion protein from the cellular form, PrP C , into the pathological isoform, PrP Sc , are regarded as the main cause of the transmissible spongiform encephalopathies, also known as prion diseases. Hence, discovering and designing effective antiprion drugs that can inhibit PrP C to PrP Sc conversion is regarded as a promising way to cure prion disease. Among several strategies to inhibit PrP C to PrP Sc conversion, stabilizing the native PrP C via specific binding is believed to be one of the valuable approaches and many antiprion compounds have been reported based on this strategy. However, the detailed mechanism to stabilize the native PrP C is still unknown. As such, to unravel the stabilizing mechanism of these compounds to PrP C is valuable for the further design and discovery of antiprion compounds. In this study, by molecular dynamics simulation method, we investigated the stabilizing mechanism of several antiprion compounds on PrP C that were previously reported to have specific binding to the "hot spot" region of PrP C . Our simulation results reveal that the stabilization mechanism of specific binding compounds can be summarized as (I) to stabilize both the flexible C-terminal of α2 and the hydrophobic core, such as BMD42-29 and GN8; (II) to stabilize the hydrophobic core, such as J1 and GJP49; (III) to stabilize the overall structure of PrP C by high binding affinity, as NPR-056. In addition, as indicated by the H-bond analysis and decomposition analysis of binding free energy, the residues N159 and Q160 play an important role in the specific binding of the studied compounds and all these compounds interact with PrP C in a similar way with the key interacting residues L130 in the β1 strand, P158, N159, Q160, etc. in the α1-β2 loop, and H187, T190, T191, etc. in the α2 C-terminus although the compounds have large structural difference. As a whole, our obtained results can provide some insights into the specific binding mechanism of main antiprion compounds to the "hot spot" region of PrP C at the molecular level and also provide guidance for effective antiprion drug design in the future.

Conformation-dependent epitopes recognized by prion protein antibodies probed using mutational scanning and deep sequencing.

PubMed

Doolan, Kyle M; Colby, David W

2015-01-30

Prion diseases are caused by a structural rearrangement of the cellular prion protein, PrP(C), into a disease-associated conformation, PrP(Sc), which may be distinguished from one another using conformation-specific antibodies. We used mutational scanning by cell-surface display to screen 1341 PrP single point mutants for attenuated interaction with four anti-PrP antibodies, including several with conformational specificity. Single-molecule real-time gene sequencing was used to quantify enrichment of mutants, returning 26,000 high-quality full-length reads for each screened population on average. Relative enrichment of mutants correlated to the magnitude of the change in binding affinity. Mutations that diminished binding of the antibody ICSM18 represented the core of contact residues in the published crystal structure of its complex. A similarly located binding site was identified for D18, comprising discontinuous residues in helix 1 of PrP, brought into close proximity to one another only when the alpha helix is intact. The specificity of these antibodies for the normal form of PrP likely arises from loss of this conformational feature after conversion to the disease-associated form. Intriguingly, 6H4 binding was found to depend on interaction with the same residues, among others, suggesting that its ability to recognize both forms of PrP depends on a structural rearrangement of the antigen. The application of mutational scanning and deep sequencing provides residue-level resolution of positions in the protein-protein interaction interface that are critical for binding, as well as a quantitative measure of the impact of mutations on binding affinity. Copyright © 2014 Elsevier Ltd. All rights reserved.

Allografts with autogenous platelet-rich plasma for tibial defect reconstruction: a rabbit study.

PubMed

Nather, Aziz; Wong, Keng Lin; David, Vikram; Pereira, Barry P

2012-12-01

To evaluate the effect of autogenous platelet-rich plasma (PRP) for fresh-frozen allografts in tibial defect reconstruction in rabbits. 40 adult New Zealand white rabbits underwent tibial defect reconstruction with autografts (n=12), allografts without PRP (n=12), or allografts with PRP (n=12) and were observed for 12, 16, and 24 weeks (4 for each period). Tibias of the remaining 4 rabbits were used as donor allografts, and the remaining allografts were procured from recipient rabbits. A 1.5- cm cortical segment of the tibia was osteotomised, and then fixed with a 9-hole mini-compression plate and 2 cerclage wires. Allografts were stripped off the periosteum and soft tissues and medullary contents, and then stored in a freezer at -80 ºC. All allografts were deep frozen for at least 4 weeks before transplantation. 7 ml of whole blood was drawn to prepare 1 ml of PRP. The PRP was then mixed with 1.0 ml of human thrombin to form a platelet gel. The PRP gel was then packed into the medullary canal of the allograft and applied on the cortical surface before tibial defect reconstruction. Rabbits were sacrificed at 12, 16, and 24 weeks. The specimens were assessed for bone union at host-graft junctions and for bone resorption, new bone formation, callus encasement, and viable osteocyte counts. There were 4 specimens in each group at each observation period. Osteoid bridging the gap at host-graft junctions was noted in all specimens in the autograft and allograft-with-PRP groups at week 12 and in the allograft-without-PRP group at week 24. Bone union in allografts without PRP was delayed. All indices for biological incorporation (resorption index, new bone formation index, callus encasement index, and viable osteocyte count) were significantly greater in the autograft than allograft-without-PRP groups, except for the resorption index at week 24, whereas the differences were not significant between the autograft and allograft-with-PRP groups. The differences between the 2 allograft groups were usually not significant, except for the resorption index. PRP-augmented allografts behaved similarly to autografts for tibial defect reconstruction in rabbits. PRP increased bone union and bone resorption.

Efficacy of Intra-articular Platelet-Rich Plasma Injections in Knee Osteoarthritis: A Systematic Review.

PubMed

Meheux, Carlos J; McCulloch, Patrick C; Lintner, David M; Varner, Kevin E; Harris, Joshua D

2016-03-01

To determine (1) whether platelet-rich plasma (PRP) injection significantly improves validated patient-reported outcomes in patients with symptomatic knee osteoarthritis (OA) at 6 and 12 months postinjection, (2) differences in outcomes between PRP and corticosteroid injections or viscosupplementation or placebo injections at 6 and 12 months postinjection, and (3) similarities and differences in outcomes based on the PRP formulations used in the analyzed studies. PubMed, Cochrane Central Register of Controlled Trials, SCOPUS, and Sport Discus were searched for English-language, level I evidence, human in vivo studies on the treatment of symptomatic knee OA with intra-articular PRP compared with other options, with a minimum of 6 months of follow-up. A quality assessment of all articles was performed using the Modified Coleman Methodology Score (average, 83.3/100), and outcomes were analyzed using 2-proportion z-tests. Six articles (739 patients, 817 knees, 39% males, mean age of 59.9 years, with 38 weeks average follow-up) were analyzed. All studies met minimal clinical important difference criteria and showed significant improvements in statistical and clinical outcomes, including pain, physical function, and stiffness, with PRP. All but one study showed significant differences in clinical outcomes between PRP and hyaluronic acid (HA) or PRP and placebo in pain and function. Average pretreatment Western Ontario and McMaster Universities Osteoarthritis Index (WOMAC) scores were 52.36 and 52.05 for the PRP and HA groups, respectively (P = .420). Mean post-treatment WOMAC scores for PRP were significantly better than for HA at 3 to 6 months (28.5 and 43.4, respectively; P = .0008) and at 6 to 12 months (22.8 and 38.1, respectively; P = .0062). None of the included studies used corticosteroids. In patients with symptomatic knee OA, PRP injection results in significant clinical improvements up to 12 months postinjection. Clinical outcomes and WOMAC scores are significantly better after PRP versus HA at 3 to 12 months postinjection. There is limited evidence for comparing leukocyte-rich versus leukocyte-poor PRP or PRP versus steroids in this study. Level I, systematic review of Level I studies. Copyright © 2016 Arthroscopy Association of North America. Published by Elsevier Inc. All rights reserved.

Emergence of two prion subtypes in ovine PrP transgenic mice infected with human MM2-cortical Creutzfeldt-Jakob disease prions.

PubMed

Chapuis, Jérôme; Moudjou, Mohammed; Reine, Fabienne; Herzog, Laetitia; Jaumain, Emilie; Chapuis, Céline; Quadrio, Isabelle; Boulliat, Jacques; Perret-Liaudet, Armand; Dron, Michel; Laude, Hubert; Rezaei, Human; Béringue, Vincent

2016-02-05

Mammalian prions are proteinaceous pathogens responsible for a broad range of fatal neurodegenerative diseases in humans and animals. These diseases can occur spontaneously, such as Creutzfeldt-Jakob disease (CJD) in humans, or be acquired or inherited. Prions are primarily formed of macromolecular assemblies of the disease-associated prion protein PrP(Sc), a misfolded isoform of the host-encoded prion protein PrP(C). Within defined host-species, prions can exist as conformational variants or strains. Based on both the M/V polymorphism at codon 129 of PrP and the electrophoretic signature of PrP(Sc) in the brain, sporadic CJD is classified in different subtypes, which may encode different strains. A transmission barrier, the mechanism of which remains unknown, limits prion cross-species propagation. To adapt to the new host, prions have the capacity to 'mutate' conformationally, leading to the emergence of a variant with new biological properties. Here, we transmitted experimentally one rare subtype of human CJD, designated cortical MM2 (129 MM with type 2 PrP(Sc)), to transgenic mice overexpressing either human or the VRQ allele of ovine PrP(C). In marked contrast with the reported absence of transmission to knock-in mice expressing physiological levels of human PrP, this subtype transmitted faithfully to mice overexpressing human PrP, and exhibited unique strain features. Onto the ovine PrP sequence, the cortical MM2 subtype abruptly evolved on second passage, thereby allowing emergence of a pair of strain variants with distinct PrP(Sc) biochemical characteristics and differing tropism for the central and lymphoid tissues. These two strain components exhibited remarkably distinct replicative properties in cell-free amplification assay, allowing the 'physical' cloning of the minor, lymphotropic component, and subsequent isolation in ovine PrP mice and RK13 cells. Here, we provide in-depth assessment of the transmissibility and evolution of one rare subtype of sporadic CJD upon homologous and heterologous transmission. The notion that the environment or matrix where replication is occurring is key to the selection and preferential amplification of prion substrain components raises new questions on the determinants of prion replication within and between species. These data also further interrogate on the interplay between animal and human prions.

Platelet-rich plasma (PRP) in dental and oral surgery: from the wound healing to bone regeneration

PubMed Central

2013-01-01

Platelet-rich plasma (PRP) is a new approach to tissue regeneration and it is becoming a valuable adjunct to promote healing in many procedures in dental and oral surgery, especially in aging patients. PRP derives from the centrifugation of the patient's own blood and it contains growth factors that influence wound healing, thereby playing an important role in tissue repairing mechanisms. The use of PRP in surgical practice could have beneficial outcomes, reducing bleeding and enhancing soft tissue healing and bone regeneration. Studies conducted on humans have yielded promising results regarding the application of PRP to many dental and oral surgical procedures (i.e. tooth extractions, periodontal surgery, implant surgery). The use of PRP has also been proposed in the management of bisphosphonate-related osteonecrosis of the jaw (BRONJ) with the aim of enhancing wound healing and bone maturation. The aims of this narrative review are: i) to describe the different uses of PRP in dental surgery (tooth extractions and periodontal surgery) and oral surgery (soft tissues and bone tissue surgery, implant surgery and BRONJ surgery); and ii) to discuss its efficacy, efficiency and risk/benefit ratio. This review suggests that the use of PRP in the alveolar socket after tooth extractions is certainly capable of improving soft tissue healing and positively influencing bone regeneration but the latter effect seems to decrease a few days after the extraction. PRP has produced better results in periodontal therapy in association with other materials than when it is used alone. Promising results have also been obtained in implant surgery, when PRP was used in isolation as a coating material. The combination of necrotic bone curettage and PRP application seem to be encouraging for the treatment of refractory BRONJ, as it has proven successful outcomes with minimal invasivity. Since PRP is free from potential risks for patients, not difficult to obtain and use, it can be employed as a valid adjunct in many procedures in oral and dental surgery. However, further RCTs are required to support this evidence. PMID:23763951

Platelet-rich plasma (PRP) in dental and oral surgery: from the wound healing to bone regeneration.

PubMed

Albanese, Antonino; Licata, Maria E; Polizzi, Bianca; Campisi, Giuseppina

2013-06-13

Platelet-rich plasma (PRP) is a new approach to tissue regeneration and it is becoming a valuable adjunct to promote healing in many procedures in dental and oral surgery, especially in aging patients. PRP derives from the centrifugation of the patient's own blood and it contains growth factors that influence wound healing, thereby playing an important role in tissue repairing mechanisms. The use of PRP in surgical practice could have beneficial outcomes, reducing bleeding and enhancing soft tissue healing and bone regeneration. Studies conducted on humans have yielded promising results regarding the application of PRP to many dental and oral surgical procedures (i.e. tooth extractions, periodontal surgery, implant surgery). The use of PRP has also been proposed in the management of bisphosphonate-related osteonecrosis of the jaw (BRONJ) with the aim of enhancing wound healing and bone maturation. The aims of this narrative review are: i) to describe the different uses of PRP in dental surgery (tooth extractions and periodontal surgery) and oral surgery (soft tissues and bone tissue surgery, implant surgery and BRONJ surgery); and ii) to discuss its efficacy, efficiency and risk/benefit ratio. This review suggests that the use of PRP in the alveolar socket after tooth extractions is certainly capable of improving soft tissue healing and positively influencing bone regeneration but the latter effect seems to decrease a few days after the extraction. PRP has produced better results in periodontal therapy in association with other materials than when it is used alone. Promising results have also been obtained in implant surgery, when PRP was used in isolation as a coating material. The combination of necrotic bone curettage and PRP application seem to be encouraging for the treatment of refractory BRONJ, as it has proven successful outcomes with minimal invasivity. Since PRP is free from potential risks for patients, not difficult to obtain and use, it can be employed as a valid adjunct in many procedures in oral and dental surgery. However, further RCTs are required to support this evidence.

A Randomized Controlled Study of a Fully Liquid DTaP-IPV-HB-PRP-T Hexavalent Vaccine for Primary and Booster Vaccinations of Healthy Infants and Toddlers in Latin America.

PubMed

López, Pío; Arguedas Mohs, Adriano; Abdelnour Vásquez, Arturo; Consuelo-Miranda, Maria; Feroldi, Emmanuel; Noriega, Fernando; Jordanov, Emilia; B Chir, Siham; Zambrano, Betzana

2017-11-01

Hexavalent diphtheria-tetanus-acellular pertussis-inactivated poliovirus-hepatitis B-Haemophilus influenzae type b (DTaP-IPV-HB-PRP-T)-containing vaccines are increasingly the standard of care. This study evaluated the primary series (NCT01177722) and booster (NCT01444781) of a fully liquid DTaP-IPV-HB-PRP-T vaccine in Latin America. Infants (N = 1375) received hepatitis B vaccine at birth and were randomized to one of 3 batches of the investigational DTaP-IPV-HB-PRP-T or licensed control vaccine (DTaP-HB-IPV//PRP-T) at 2-4 to 6 months of age, coadministered with 7-valent pneumococcal conjugate vaccine (PCV7) (2-4-6 months) and rotavirus vaccine (2-4 months). A booster of either DTaP-IPV-HB-PRP-T or control was given at 12-24 months, coadministered with PCV7. Immunogenicity was assessed by validated assays and safety from parental reports. Primary series seroprotection and vaccine response rates were equivalent for DTaP-IPV-HB-PRP-T batches. For pooled batches, noninferiority to the control vaccine was demonstrated for each antigen. There were no descriptive differences in antibody persistence or booster response between DTaP-IPV-HB-PRP-T and the control. The booster responses to either vaccine following DTaP-IPV-HB-PRP-T primary series or to DTaP-IPV-HB-PRP-T following a control vaccine primary series were similar. The anti-aP component (filamentous hemagglutinin [FHA] and pertussis toxin [PT]) vaccine response and anti-Haemophilus influenzae type b (PRP) series seroprotection (≥0.15 µg/mL) rates were ≥73.0% after 2 primary series doses. Antipyretics had no effect on the immune response, and an extra (oral) polio vaccination had no effect on the antipolio booster response. Responses to PCV7 and rotavirus vaccine were similar for each coadministration. There were no safety concerns observed with any vaccine. These results confirm the suitability of the fully liquid DTaP-IPV-HB-PRP-T vaccine for primary and booster vaccination of infants.

Does application of moderately concentrated platelet-rich plasma improve clinical and structural outcome after arthroscopic repair of medium-sized to large rotator cuff tear? A randomized controlled trial.

PubMed

Pandey, Vivek; Bandi, Atul; Madi, Sandesh; Agarwal, Lipisha; Acharya, Kiran K V; Maddukuri, Satish; Sambhaji, Charudutt; Willems, W Jaap

2016-08-01

Platelet-rich plasma (PRP) has the potential to improve tendon-bone healing. The evidence is still controversial as to whether PRP application after repair of medium-sized to large cuff tears leads to superior structural and clinical outcome, especially after single-row repair. In a randomized study, 102 patients (PRP group, 52 patients; control group, 50 patients) with medium-sized and large degenerative posterosuperior tears were included for arthroscopic repair with a minimum follow-up of 2 years. Patients were evaluated with clinical scores (visual analog scale score, Constant-Murley score, University of California-Los Angeles score, and American Shoulder and Elbow Surgeons score) and ultrasound to assess retear and vascularity pattern of the cuff. Visual analog scale scores were significantly lower in the PRP group than in controls at 1 month, 3 months, and 6 months but not later. Constant-Murley scores were significantly better in the PRP group compared with controls at 12 and 24 months, whereas University of California-Los Angeles scores were significantly higher in the PRP group at 6 and 12 months (P < .05). The American Shoulder and Elbow Surgeons score in both groups was comparable at all the times. At 24 months, retear in the PRP group (n = 2; 3.8%) was significantly lower than in the control group (n = 10; 20%; P = .01). The retear difference was significant only for large tears (PRP:control group, 1:6; P = .03). Doppler ultrasound examination showed significant vascularity in the PRP group repair site at 3 months postoperatively (P < .05) and in peribursal tissue until 12 months. Application of moderately concentrated PRP improves clinical and structural outcome in large cuff tears. PRP also enhances vascularity around the repair site in the early phase. Copyright © 2016 Journal of Shoulder and Elbow Surgery Board of Trustees. Published by Elsevier Inc. All rights reserved.

An In Vitro Investigation of Platelet-Rich Plasma-Gel as a Cell and Growth Factor Delivery Vehicle for Tissue Engineering

PubMed Central

Jalowiec, Jagoda M.; D'Este, Matteo; Bara, Jennifer Jane; Denom, Jessica; Menzel, Ursula; Alini, Mauro; Herrmann, Marietta

2016-01-01

Platelet-rich plasma (PRP) has been used for different applications in human and veterinary medicine. Many studies have shown promising therapeutic effects of PRP; however, there are still many controversies regarding its composition, properties, and clinical efficacy. The aim of this study was to evaluate the influence of different platelet concentrations on the rheological properties and growth factor (GF) release profile of PRP-gels. In addition, the viability of incorporated bone marrow-derived human mesenchymal stem cells (MSCs) was investigated. PRP (containing 1000 × 103, 2000 × 103, and 10,000 × 103 platelets/μL) was prepared from human platelet concentrates. Platelet activation and gelification were achieved by addition of human thrombin. Viscoelastic properties of PRP-gels were evaluated by rheological studies. The release of GFs and inflammatory proteins was measured using a membrane-based protein array and enzyme-linked immunosorbent assay. MSC viability and proliferation in PRP-gels were assessed over 7 days by cell viability staining. Cell proliferation was examined using DNA quantification. Regardless of the platelet content, all tested PRP-gels showed effective cross-linking. A positive correlation between protein release and the platelet concentration was observed at all time points. Among the detected proteins, the chemokine CCL5 was the most abundant. The greatest release appeared within the first 4 h after gelification. MSCs could be successfully cultured in PRP-gels over 7 days, with the highest cell viability and DNA content found in PRP-gels with 1000 × 103 platelets/μL. The results of this study suggest that PRP-gels represent a suitable carrier for both cell and GF delivery for tissue engineering. Notably, a platelet concentration of 1000 × 103 platelets/μL appeared to provide the most favorable environment for MSCs. Thus, the platelet concentration is an important consideration for the clinical application of PRP-gels. PMID:26467221

Platelet-Rich Plasma in the Animal Long-Bone Model: An Analysis of Basic Science Evidence.

PubMed

Gianakos, Arianna; Zambrana, Lester; Savage-Elliott, Ian; Lane, Joseph M; Kennedy, John G

2015-12-01

Platelet-rich plasma (PRP) has been suggested as an adjunct to aid in long-bone healing. The purpose of this study was to systematically review the basic science in vivo evidence for the use of PRP in the treatment of bone pathology. The PubMed/MEDLINE and EMBASE databases were screened using the following search criteria: "(Platelet-rich plasma OR PRP OR autologous conditioned plasma OR ACP) AND (bone OR osteocytes OR osteogenesis OR nonunion OR delayed union)." Studies were included if they fulfilled the following criteria: (1) studied the effect of PRP or a similar concentrated platelet product, defined as a blood product with platelet concentration elevated to higher than baseline; (2) established a control with which to compare PRP; (3) were published in a peer-reviewed journal; and (4) looked specifically at animal long-bone models. All review articles and clinical studies, including randomized controlled trials and case series, were excluded from the review. Studies examining the effects of PRP on bones of animals with confounding pathology were excluded. In studies that contained additional treatment variables, only the portion of the experiment that compared PRP directly with the control were evaluated. Data were then extracted with a standardized table. The search yielded 29 articles for inclusion. Seventy-two percent of the studies reported platelet concentrations. Eighty-nine percent of studies reported significant improvement in earlier bone healing on histologic/histomorphometric assessment. One hundred percent showed significant increase in bone formation on radiographs in the PRP group. Eighty percent of studies reported a significant increase in bone area on microcomputed tomography. One hundred percent of studies showed a higher torsional stiffness for the PRP-treated defects. In the in vivo studies evaluated, PRP confers several beneficial effects on animal long-bone models. Proof of concept for PRP as a biologic adjunct in long-bone models has been determined. Copyright 2015, SLACK Incorporated.

Crystal structure, mutational analysis and RNA-dependent ATPase activity of the yeast DEAD-box pre-mRNA splicing factor Prp28

DOE Office of Scientific and Technical Information (OSTI.GOV)

Jacewicz, Agata; Schwer, Beate; Smith, Paul

Yeast Prp28 is a DEAD-box pre-mRNA splicing factor implicated in displacing U1 snRNP from the 5' splice site. Here we report that the 588-aa Prp28 protein consists of a trypsin-sensitive 126-aa N-terminal segment (of which aa 1–89 are dispensable for Prp28 function in vivo) fused to a trypsin-resistant C-terminal catalytic domain. Purified recombinant Prp28 and Prp28-(127–588) have an intrinsic RNA-dependent ATPase activity, albeit with a low turnover number. The crystal structure of Prp28-(127–588) comprises two RecA-like domains splayed widely apart. AMPPNP•Mg 2+ is engaged by the proximal domain, with proper and specific contacts from Phe194 and Gln201 (Q motif) tomore » the adenine nucleobase. The triphosphate moiety of AMPPNP•Mg 2+ is not poised for catalysis in the open domain conformation. Guided by the Prp28•AMPPNP structure, and that of the Drosophila Vasa•AMPPNP•Mg 2+•RNA complex, we targeted 20 positions in Prp28 for alanine scanning. ATP-site components Asp341 and Glu342 (motif II) and Arg527 and Arg530 (motif VI) and RNA-site constituent Arg476 (motif Va) are essential for Prp28 activity in vivo. Synthetic lethality of double-alanine mutations highlighted functionally redundant contacts in the ATP-binding (Phe194-Gln201, Gln201-Asp502) and RNA-binding (Arg264-Arg320) sites. As a result, overexpression of defective ATP-site mutants, but not defective RNA-site mutants, elicited severe dominant-negative growth defects.« less

The effects of platelet apheresis on blood saving and coagulation in bilateral total hip replacement: A prospective study on 60 patients.

PubMed

Qu, Zhijun; Wang, Geng; Xu, Chengshi; Zhang, Dazhi; Qu, Xiangdong; Zhou, Haibin; Ma, Jun

2016-10-01

Preoperative platelet rich plasma (PRP) harvest has been used in cardiopulmonary surgery for more than 10 years. There is no previous study dealing with PRP in bilateral total hip replacement. This study was to investigate the effects of PRP on blood saving and blood coagulation function in patients with bilateral total hip replacement. A prospective, randomized, clinical trial was conducted. Sixty patients were enrolled, including 30 patients undergoing PRP in the PRP group and 30 controls. The surgery time, total transfusion volume, blood loss, allogenic blood transfusion, autologous blood transfusion, urine volume, drainage volume, some blood parameters (including Fibrinogen, D-dimer, Prothrombin time, international normalizedratio, activated partial thromboplastin time, Platelet, Haemoglobin B), thrombelastogram (TEG) and blood-gas parameters were studied in the perioperative stage. The measurement data were analyzed statistically. There was no statistical difference between the two groups in baseline characteristics, surgery time, total transfusion volume, blood loss, autologous blood transfusion, etc. Allogenic blood transfusion in the PRP group was less than the control group with statistical difference (p = 0.024). Fibrinogen in the PRP group was higher than the control group (p = 0.008). Among the TEG indicators, activated clotting time and coagulation time K in the PRP group were less than the control group. Clotting rate and maximum amplitude in the PRP group were higher. The blood-gas parameters presented no statistical difference. The results suggested that PRP probably played a positive role in blood coagulation function as well as blood saving in patients with bilateral total hip replacement. Copyright © 2016 IJS Publishing Group Ltd. Published by Elsevier Ltd. All rights reserved.

Kartogenin with PRP promotes the formation of fibrocartilage zone in the tendon-bone interface.

PubMed

Zhou, Yiqin; Zhang, Jianying; Yang, Jinsong; Narava, Manoj; Zhao, Guangyi; Yuan, Ting; Wu, Haishan; Zheng, Nigel; Hogan, MaCalus V; Wang, James H-C

2017-12-01

Treatment of tendon-bone junction injuries is a challenge because tendon-bone interface often heals poorly and the fibrocartilage zone, which reduces stress concentration, at the interface is not formed. In this study, we used a compound called kartogenin (KGN) with platelet-rich plasma (PRP) to induce the formation of fibrocartilage zone in a rat tendon graft-bone tunnel model. The experimental rats received KGN-PRP or PRP injections in the tendon graft-bone tunnel interface. The control group received saline. After 4, 8 and 12 weeks, Safranin O staining of the tendon graft-bone tunnels revealed abundant proteoglycans in the KGN-PRP group indicating the formation of cartilage-like transition zone. Immunohistochemical and immuno-fluorescence staining revealed collagen types I (Col-I) and II (Col-II) in the newly formed fibrocartilage zone. Both fibrocartilage zone formation and maturation were healing time dependent. In contrast, the PRP and saline control groups had no cartilage-like tissues and minimal Col-I and Col-II staining. Some gaps were also present in the saline control group. Finally, pull-out strength in the KGN-PRP-treated group at 8 weeks was 1.4-fold higher than the PRP-treated group and 1.6-fold higher than the saline control group. These findings indicate that KGN, with PRP as a carrier, promotes the formation of fibrocartilage zone between the tendon graft and bone interface. Thus, KGN-PRP may be used as a convenient cell-free therapy in clinics to promote fibrocartilage zone formation in rotator calf repair and anterior cruciate ligament reconstruction, thereby enhancing the mechanical strength of the tendon-bone interface and hence the clinical outcome of these procedures. Copyright © 2017 John Wiley & Sons, Ltd. Copyright © 2017 John Wiley & Sons, Ltd.

Crystal structure, mutational analysis and RNA-dependent ATPase activity of the yeast DEAD-box pre-mRNA splicing factor Prp28

DOE PAGES

Jacewicz, Agata; Schwer, Beate; Smith, Paul; ...

2014-10-10

Yeast Prp28 is a DEAD-box pre-mRNA splicing factor implicated in displacing U1 snRNP from the 5' splice site. Here we report that the 588-aa Prp28 protein consists of a trypsin-sensitive 126-aa N-terminal segment (of which aa 1–89 are dispensable for Prp28 function in vivo) fused to a trypsin-resistant C-terminal catalytic domain. Purified recombinant Prp28 and Prp28-(127–588) have an intrinsic RNA-dependent ATPase activity, albeit with a low turnover number. The crystal structure of Prp28-(127–588) comprises two RecA-like domains splayed widely apart. AMPPNP•Mg 2+ is engaged by the proximal domain, with proper and specific contacts from Phe194 and Gln201 (Q motif) tomore » the adenine nucleobase. The triphosphate moiety of AMPPNP•Mg 2+ is not poised for catalysis in the open domain conformation. Guided by the Prp28•AMPPNP structure, and that of the Drosophila Vasa•AMPPNP•Mg 2+•RNA complex, we targeted 20 positions in Prp28 for alanine scanning. ATP-site components Asp341 and Glu342 (motif II) and Arg527 and Arg530 (motif VI) and RNA-site constituent Arg476 (motif Va) are essential for Prp28 activity in vivo. Synthetic lethality of double-alanine mutations highlighted functionally redundant contacts in the ATP-binding (Phe194-Gln201, Gln201-Asp502) and RNA-binding (Arg264-Arg320) sites. As a result, overexpression of defective ATP-site mutants, but not defective RNA-site mutants, elicited severe dominant-negative growth defects.« less

Platelet-rich plasma injection in the treatment of frozen shoulder: A randomized controlled trial with 6-month follow-up
.

PubMed

Lin, Junhong

2018-06-22

Platelet-rich plasma (PRP) has been utilized in the treatment of chronic injuries. The current study aimed to evaluate the efficiency of PRP in the treatment of frozen shoulder compared to procaine. 60 patients with frozen shoulder were randomly divided into two groups. The PRP group was injected with 2 mL prepared PRP, while in the control group procaine was used. The stretching and formal strengthening exercises were carried out in both groups during the 6-month follow-up. Visual analog scale (VAS) score was used to assess the subjective pain intensity of the patients. The general shoulder assessment instruments (University of California at Los Angeles (UCLA) shoulder scale) was applied to measure the shoulder function of the patients. The evaluation was performed before treatment and 1 week, 1 month, 3 months, and 6 months after the first injection. The efficiency of PRP was superior to and longer than procaine. VAS scores were both declined in PRP and control group after 1 week, 1 month, and 3 months of first injection. By contrast, it was elevated was elevated in the control group while continued to decline in PRP group. The UCLA scores were almost linearly improved in the PRP group, while the UCLA scores decreased to a lower level at the final follow-up visit compared to that post 3 months in the control group. PRP and procaine were effective in treating frozen shoulder. PRP was more effective and had a more prolonged efficiency than the procaine control. Nevertheless, the definite conclusion should come from further large-scale clinical trials.
.

Collaborative study on saccharide quantification of the Haemophilus influenzae type b component in liquid vaccine presentations.

PubMed

Rosskopf, U; Daas, A; Terao, E; von Hunolstein, C

2017-01-01

Before release onto the market, it must be demonstrated that the total and free polysaccharide (poly ribosyl-ribitol-phosphate, PRP) content of Haemophilus influenzae type b (Hib) vaccine complies with requirements. However, manufacturers use different methods to assay PRP content: a national control laboratory must establish and validate the relevant manufacturer methodology before using it to determine PRP content. An international study was organised by the World Health Organization (WHO), in collaboration with the Biological Standardisation Programme (BSP) of the Council of Europe/European Directorate for the Quality of Medicines & HealthCare (EDQM) and of the European Union Commission, to verify the suitability of a single method for determining PRP content in liquid pentavalent vaccines (DTwP-HepB-Hib) containing a whole-cell pertussis component. It consists of HCl hydrolysis followed by chromatographic separation and quantification of ribitol on a CarboPac MA1 column using high-performance anion exchange chromatography coupled with pulsed amperometric detection (HPAEC-PAD). The unconjugated, free, PRP is separated from the total PRP using C4 solid-phase extraction cartridges (SPE C4). Ten quality control laboratories performed two independent analyses applying the proposed analytical test protocol to five vaccine samples, including a vaccine lot with sub-potent PRP content and very high free PRP content. Both WHO PRP standard and ribitol reference standard were included as calibrating standards. A significant bias between WHO PRP standard and ribitol reference standard was observed. Study results showed that the proposed analytical method is, in principle, suitable for the intended use provided that a validation is performed as usually expected from quality control laboratories.

PRP for Degenerative Cartilage Disease: A Systematic Review of Clinical Studies

PubMed Central

Laver, Lior; Marom, Niv; Dnyanesh, Lad; Mei-Dan, Omer; Espregueira-Mendes, João; Gobbi, Alberto

2016-01-01

Objective: To explore the utilization of platelet-rich plasma (PRP) for degenerative cartilage processes and evaluate whether there is sufficient evidence to better define its potential effects. Design: Systematic literature reviews were conducted in PubMed/MEDLINE and Cochrane electronic databases till May 2015, using the keywords “platelet-rich plasma OR PRP OR autologous conditioned plasma OR ACP AND cartilage OR chondrocyte OR chondrogenesis OR osteoarthritis (OA) OR arthritis.” Results: The final result yielded 29 articles. Twenty-six studies examined PRP administration for knee OA and 3 involved PRP administration for hip OA. The results included 9 prospective randomized controlled trials (RCTs) (8 knee and 1 hip), 4 prospective comparative studies, 14 case series, and 2 retrospective comparative studies. Hyaluronic acid (HA) was used as a control in 11 studies (7 RCTs, 2 prospective comparative studies, and 2 retrospective cohort). Overall, all RCTs reported on improved symptoms compared to baseline scores. Only 2 RCTs—one for knee and one for hip—did not report significant superiority of PRP compared to the control group (HA). Nine out of 11 HA controlled studies showed significant better results in the PRP groups. A trend toward better results for PRP injections in patients with early knee OA and young age was observed; however, lack of uniformity was evident in terms of indications, inclusion criteria, and pathology definitions in the different studies. Conclusion: Current clinical evidence supports the benefit in PRP treatment for knee and hip OA, proven to temporarily relieve pain and improve function of the involved joint with superior results compared with several alternative treatments. Further research to establish the optimal preparation protocol and characteristics of PRP injections for OA is needed. PMID:28317389

Transition-metal prion protein attachment: Competition with copper

NASA Astrophysics Data System (ADS)

Hodak, Miroslav; Bernholc, Jerry

2012-02-01

Prion protein, PrP, is a protein capable of binding copper ions in multiple modes depending on their concentration. Misfolded PrP is implicated in a group of neurodegenerative diseases, which include ``mad cow disease'' and its human form, variant Creutzfeld-Jacob disease. An increasing amount of evidence suggests that attachment of non-copper metal ions to PrP triggers transformations to abnormal forms similar to those observed in prion diseases. In this work, we use hybrid Kohn-Sham/orbital-free density functional theory simulations to investigate copper replacement by other transition metals that bind to PrP, including zinc, iron and manganese. We consider all known copper binding modes in the N-terminal domain of PrP. Our calculations identify modes most susceptible to copper replacement and reveal metals that can successfully compete with copper for attachment to PrP.

Effects of pH and aggregation in the human prion conversion into scrapie form: a study using molecular dynamics with excited normal modes.

PubMed

Lima, Angelica Nakagawa; de Oliveira, Ronaldo Junio; Braz, Antônio Sérgio Kimus; de Souza Costa, Maurício Garcia; Perahia, David; Scott, Luis Paulo Barbour

2018-03-15

There are two different prion conformations: (1) the cellular natural (PrP C ) and (2) the scrapie (PrP Sc ), an infectious form that tends to aggregate under specific conditions. PrP C and PrP Sc are widely different regarding secondary and tertiary structures. PrP Sc contains more and longer β-strands compared to PrP C . The lack of solved PrP Sc structures precludes a proper understanding of the mechanisms related to the transition between cellular and scrapie forms, as well as the aggregation process. In order to investigate the conformational transition between PrP C and PrP Sc , we applied MDeNM (molecular dynamics with excited normal modes), an enhanced sampling simulation technique that has been recently developed to probe large structural changes. These simulations yielded new structural rearrangements of the cellular prion that would have been difficult to obtain with standard MD simulations. We observed an increase in β-sheet formation under low pH (≤ 4) and upon oligomerization, whose relevance was discussed on the basis of the energy landscape theory for protein folding. The characterization of intermediate structures corresponding to transition states allowed us to propose a conversion model from the cellular to the scrapie prion, which possibly ignites the fibril formation. This model can assist the design of new drugs to prevent neurological disorders related to the prion aggregation mechanism.

The use of autologous platelet-rich plasma in the orthopedic setting.

PubMed

Cohn, Claudia S; Lockhart, Evelyn; McCullough, J Jeffrey

2015-07-01

Autologous platelet-rich plasma (aPRP) is widely used with orthopedic patients to help treat injuries to tendons, cartilage, ligaments, and muscle. A comprehensive review of the literature was conducted to evaluate aPRP's efficacy and compare available methods. In addition, the production and administration of aPRP were explored. A literature search was performed. Randomized controlled clinical trials (RCTs) in orthopedic procedures on adult patients were included and assessed for methodologic quality. The main outcomes were pain relief, increase in function, structural integrity, and "healing" based on various validated scales. Twelve RCTs and one controlled cohort were included (four lateral epicondylitis, two chronic Achilles tendinopathy, two anterior cruciate ligament injury, and five rotator cuff injuries). Four trials reported some benefit from aPRP versus controls while eight trials found no benefit from aPRP applications versus control. One study had too many patients withdraw from the control arm for acceptable data interpretation. All protocols used a different aPRP formulation or method of delivery or application. Despite its popularity, there are no standardized criteria that define aPRP. Different techniques yield wide variability in terms of platelet count and concentration. These variations make it difficult to compare clinical trials that use aPRP or draw conclusions concerning its clinical efficacy in orthopedic procedures. Blood bankers have experience in the production of standardized blood components. This expertise may be used to develop and implement protocols for the production and administration of aPRP, as well as quality control measures. © 2015 AABB.

Comparison between Conventional Mechanical Fixation and Use of Autologous Platelet Rich Plasma (PRP) in Wound Beds Prior to Resurfacing with Split Thickness Skin Graft.

PubMed

P Waiker, Veena; Shivalingappa, Shanthakumar

2015-01-01

Platelet rich plasma is known for its hemostatic, adhesive and healing properties in view of the multiple growth factors released from the platelets to the site of wound. The primary objective of this study was to use autologous platelet rich plasma (PRP) in wound beds for anchorage of skin grafts instead of conventional methods like sutures, staplers or glue. In a single center based randomized controlled prospective study of nine months duration, 200 patients with wounds were divided into two equal groups. Autologous PRP was applied on wound beds in PRP group and conventional methods like staples/sutures used to anchor the skin grafts in a control group. Instant graft adherence to wound bed was statistically significant in the PRP group. Time of first post-graft inspection was delayed, and hematoma, graft edema, discharge from graft site, frequency of dressings and duration of stay in plastic surgery unit were significantly less in the PRP group. Autologous PRP ensured instant skin graft adherence to wound bed in comparison to conventional methods of anchorage. Hence, we recommend the use of autologous PRP routinely on wounds prior to resurfacing to ensure the benefits of early healing.

Activation of platelet-rich plasma using thrombin receptor agonist peptide.

PubMed

Landesberg, Regina; Burke, Andrea; Pinsky, David; Katz, Ronald; Vo, Jennifer; Eisig, Sidney B; Lu, Helen H

2005-04-01

This study proposes an alternative preparation method of platelet-rich plasma (PRP). Specifically, we compare the use of thrombin receptor agonist peptide-6 (TRAP) and bovine thrombin as a clotting agent in the preparation of PRP. PRP was prepared by centrifugation and clotted with thrombin or TRAP. In vitro clotting times were monitored as a function of TRAP concentration, and clot retraction was determined by measuring clot diameter over time. Following the optimization of TRAP concentration, experiments were repeated with the addition of several commercially available bone substitutes. The release of PRP-relevant growth factors as a function of PRP preparation was also determined. The most rapid polymerization of PRP takes place with the addition of thrombin, followed by TRAP/Allogro (Ceramed, Lakewood, CO), TRAP/BioGlass (Mo-Sci, Rolla, MN), TRAP/BioOss (Osteohealth, Shirley, NY), and TRAP alone. Thrombin caused considerable clot retraction (43%), whereas TRAP alone resulted in only 15% retraction. TRAP/Allogro, TRAP/BioOss, and TRAP/BioGlass all exhibited minimal retraction (8%). The use of TRAP to activate clot formation in the preparation of PRP may be a safe alternative to bovine thrombin. It results in an excellent working time and significantly less clot retraction than the currently available methods of PRP production.

Application of platelet-rich plasma and platelet-rich fibrin in fat grafting: basic science and literature review.

PubMed

Liao, Han-Tsung; Marra, Kacey G; Rubin, J Peter

2014-08-01

Due to the natural properties of fat, fat grafting remains a popular procedure for soft tissue volume augmentation and reconstruction. However, clinical outcome varies and is technique dependent. Platelet-rich plasma (PRP) contains α-granules, from which multiple growth factors such as platelet-derived growth factor, transforming growth factor-β, vascular endothelial growth factor, and epidermal growth factor can be released after activation. In recent years, the scope of PRP therapies has extended from bone regeneration, wound healing, and healing of musculoskeletal injuries, to enhancement of fat graft survival. In this review, we focus on the definition of PRP, the different PRP preparation and activation methods, and growth factor concentrations. In addition, we discuss possible mechanisms for the role of PRP in fat grafting by reviewing in vitro studies with adipose-derived stem cells, preadipocytes, and adipocytes, and preclinical and clinical research. We also review platelet-rich fibrin, a so-called second generation PRP, and its slow-releasing biology and effects on fat grafts compared to PRP in both animal and clinical research. Finally, we provide a general foundation on which to critically evaluate earlier studies, discuss the limitations of previous research, and direct plans for future experiments to improve the optimal effects of PRP in fat grafting.

The influence of environmental variables on platelet concentration in horse platelet-rich plasma.

PubMed

Rinnovati, Riccardo; Romagnoli, Noemi; Gentilini, Fabio; Lambertini, Carlotta; Spadari, Alessandro

2016-07-04

Platelet-rich plasma (PRP) commonly refers to blood products which contain a higher platelet (PLT) concentration as compared to normal plasma. Autologous PRP has been shown to be safe and effective in promoting the natural processes of soft tissue healing or reconstruction in humans and horses. Variability in PLT concentration has been observed in practice between PRP preparations from different patients or from the same individual under different conditions. A change in PLT concentration could modify PRP efficacy in routine applications. The aim of this study was to test the influence of environmental, individual and agonistic variables on the PLT concentration of PRP in horses. Six healthy Standardbred mares were exposed to six different variables with a one-week washout period between variables, and PRP was subsequently obtained from each horse. The variables were time of withdrawal during the day (morning/evening), hydration status (overhydration/dehydration) treatment with anti-inflammatory drugs and training periods on a treadmill. The platelet concentration was significantly higher in horses treated with a non-steroidal anti-inflammatory drug (P = 0.03). The leukocyte concentration increased 2-9 fold with respect to whole blood in the PRP which was obtained after exposure to all the variable considered. Environmental variation in platelet concentration should be taken into consideration during PRP preparation.

Retrospective view of primary Raynaud's phenomenon in childhood.

PubMed

Turan, Enes; Kilic, Sara Sebnem

2018-02-06

Primary Raynaud's phenomenon (PRP) manifests as episodes of transient spasms of peripheral blood vessels. To elucidate the clinical clues and laboratory characteristics will facilitate the identification of PRP. A retrospective data collection of clinical and laboratory characteristics of 58 children with PRP was performed between January 2007 and December 2016. A positive ANA test at lower titers <1:100 was detected in 24.1% of the patients. There was a significant relationship between presence of ANA positivity and migraine in female patients with PRP (p=0.01; p=0.020 respectively). The most common accompanying disorder was migraine which was detected in 37.9% of all patients with PRP. Hemoglobin and serum ferritin levels were significantly lower in PRP patients with migraine (p=0.045; p<0.05, respectively). Additionally, the mean platelet volume (MPV) measurements were significantly higher in patients with migraine compared to those without migraine (p=0.045; p<0.05 respectively). There is limited data concerning childhood PRP. For the first time we showed a high frequency of migraine in childhood PRP. Anemia and high MPV could be the underlying triggering factors of these two episodic diseases. Copyright © 2018 Elsevier España, S.L.U. and Sociedad Española de Reumatología y Colegio Mexicano de Reumatología. All rights reserved.

Effect of autologous platelet-rich plasma application on cutaneous wound healing in dogs

PubMed Central

Jee, Cho-Hee; Eom, Na-Young; Jang, Hyo-Mi; Jung, Hae-Won; Choi, Eul-Soo; Won, Jin-Hee; Hong, Il-Hwa; Kang, Byeong-Teck

2016-01-01

This study was conducted to identify the effectiveness of platelet-rich plasma (PRP) and efficacy of intralesional injection as a method of application to acute cutaneous wounds in dogs. Healthy adult beagles (n = 3) were used in this study. Autologous PRP was separated from anticoagulant treated whole blood in three dogs. Cutaneous wounds were created and then treated by intralesional injection of PRP in the experimental group, while they were treated with saline in the control group on days 0, 2 and 4. The healing process was evaluated by gross examination throughout the experimental period and histologic examination on day 7, 14 and 21. In PRP treated wounds, the mean diameter was smaller and the wound closure rate was higher than in the control. Histological study revealed that PRP treated wounds showed more granulation formation and angiogenesis on day 7, and faster epithelialization, more granulation formation and collagen deposition were observed on day 14 than in control wounds. On day 21, collagen deposition and epithelialization were enhanced in PRP treated groups. Overall, PRP application showed beneficial effects in wound healing, and intralesional injection was useful for application of PRP and could be a good therapeutic option for wound management in dogs. PMID:27051343

Multiple protein–protein interactions converging on the Prp38 protein during activation of the human spliceosome

PubMed Central

Schütze, Tonio; Ulrich, Alexander K.C.; Apelt, Luise; Will, Cindy L.; Bartlick, Natascha; Seeger, Martin; Weber, Gert; Lührmann, Reinhard; Stelzl, Ulrich; Wahl, Markus C.

2016-01-01

Spliceosomal Prp38 proteins contain a conserved amino-terminal domain, but only higher eukaryotic orthologs also harbor a carboxy-terminal RS domain, a hallmark of splicing regulatory SR proteins. We show by crystal structure analysis that the amino-terminal domain of human Prp38 is organized around three pairs of antiparallel α-helices and lacks similarities to RNA-binding domains found in canonical SR proteins. Instead, yeast two-hybrid analyses suggest that the amino-terminal domain is a versatile protein–protein interaction hub that possibly binds 12 other spliceosomal proteins, most of which are recruited at the same stage as Prp38. By quantitative, alanine surface-scanning two-hybrid screens and biochemical analyses we delineated four distinct interfaces on the Prp38 amino-terminal domain. In vitro interaction assays using recombinant proteins showed that Prp38 can bind at least two proteins simultaneously via two different interfaces. Addition of excess Prp38 amino-terminal domain to in vitro splicing assays, but not of an interaction-deficient mutant, stalled splicing at a precatalytic stage. Our results show that human Prp38 is an unusual SR protein, whose amino-terminal domain is a multi-interface protein–protein interaction platform that might organize the relative positioning of other proteins during splicing. PMID:26673105

Application of Platelet-Rich Plasma to Disorders of the Knee Joint

PubMed Central

Mandelbaum, Bert R.; McIlwraith, C. Wayne

2013-01-01

Importance. The promising therapeutic potential and regenerative properties of platelet-rich plasma (PRP) have rapidly led to its widespread clinical use in musculoskeletal injury and disease. Although the basic scientific rationale surrounding PRP products is compelling, the clinical application has outpaced the research. Objective. The purpose of this article is to examine the current concepts around the basic science of PRP application, different preparation systems, and clinical application of PRP in disorders in the knee. Evidence Acquisition. A systematic search of PubMed for studies that evaluated the basic science, preparation and clinical application of platelet concentrates was performed. The search used terms, including platelet-rich plasma or PRP preparation, activation, use in the knee, cartilage, ligament, and meniscus. Studies found in the initial search and related studies were reviewed. Results. A comprehensive review of the literature supports the potential use of PRP both nonoperatively and intraoperatively, but highlights the absence of large clinical studies and the lack of standardization between method, product, and clinical efficacy. Conclusions and Relevance. In addition to the call for more randomized, controlled clinical studies to assess the clinical effect of PRP, at this point, it is necessary to investigate PRP product composition and eventually have the ability to tailor the therapeutic product for specific indications. PMID:26069674

Effect of Leukocyte-Rich and Platelet-Rich Plasma on Healing of a Horizontal Medial Meniscus Tear in a Rabbit Model

PubMed Central

Shin, Kyun Ho; Lee, Haseok; Kang, Seonghyun; Ko, You-Jin; Lee, Seung-Yup; Park, Jung-Ho; Bae, Ji-Hoon

2015-01-01

There are limited reports on the effect of platelet-rich plasma (PRP) on meniscus healing. The purpose of this study was to investigate the effect of leukocyte-rich PRP (L-PRP) on potential healing of the horizontal medial meniscus tears in a rabbit model. A horizontal medial meniscus tear was created in both knees of nine skeletally mature adult rabbits. Left or right knees were randomly assigned to a L-PRP group, or a control group. 0.5 mL of L-PRP from 10 mL of each rabbit's whole blood was prepared and injected into the horizontal tears in a L-PRP group. None was applied to the horizontal tears in a control group. The histological assessment of meniscus healing was performed at two, four, and six weeks after surgery. We found that there were no significant differences of quantitative histologic scoring between two groups at 2, 4, and 6 weeks after surgery (p > 0.05). This study failed to show the positive effect of single injection of L-PRP on enhancing healing of the horizontal medial meniscus tears in a rabbit model. Single injection of L-PRP into horizontal meniscus tears may not effectively enhance healing of horizontal medial meniscus tears. PMID:26180783

The NLRP3-Caspase 1 Inflammasome Negatively Regulates Autophagy via TLR4-TRIF in Prion Peptide-Infected Microglia

PubMed Central

Lai, Mengyu; Yao, Hao; Shah, Syed Zahid Ali; Wu, Wei; Wang, Di; Zhao, Ying; Wang, Lu; Zhou, Xiangmei; Zhao, Deming; Yang, Lifeng

2018-01-01

Prion diseases are neurodegenerative disorders characterized by the accumulation of misfolded prion protein, spongiform changes in the brain, and brain inflammation as a result of the wide-spread activation of microglia. Autophagy is a highly conserved catabolic process for the clearance of cytoplasmic components, including protein aggregates and damaged organelles; this process also eliminates pathological PrPSc as it accumulates during prion infection. The NALP3 inflammasome is a multiprotein complex that is a component of the innate immune system and is responsible for the release of pro-inflammatory cytokines. Our previous study showed that the neurotoxic prion peptide PrP106-126 induces NALP3 inflammasome activation and subsequent IL-1β release in microglia. Autophagy is involved in the regulation of the immune responses and inflammation in many diseases including neurodegenerative diseases. However, the relationship between autophagy and NALP3 inflammasome in prion diseases has not been investigated. In this study, we demonstrated that the processing and release of mature IL-1β is significantly enhanced by the inhibition of autophagy. Conversely, gene-silencing of the NALP3 inflammasome promotes autophagy. Suppression of TRIF or TLR4 by siRNA attenuated PrP106-126-induced autophagy, which is indicating that the TLR4-TRIF signaling pathway is involved in PrP106-26-induced autophagy. Caspase 1 directly cleaved TRIF to diminish TLR-4-TRIF mediated autophagy. Our findings suggest that the inhibition of autophagy by NALP3 inflammasome is probably mediated by activated Caspase-1-induced TRIF cleavage. This is the first study reporting that the NALP3 inflammasome complex negatively regulates autophagy in response to PrP106-126 stimulation in microglia, and partly explains the mechanism of autophagy inhibition by Caspase-1 in PrP106-126-induced BV2 cell activation. Our findings suggest that autophagy up-regulation and inhibition of Caspase-1 may protect against prion-induced neuroinflammation and accelerate misfolded protein degradation and are potential therapeutic approaches for prion diseases. PMID:29720937

Intra-articular Hyaluronic Acid (HA) and Platelet Rich Plasma (PRP) injection versus Hyaluronic acid (HA) injection alone in Patients with Grade III and IV Knee Osteoarthritis (OA): A Retrospective Study on Functional Outcome.

PubMed

Saturveithan, C; Premganesh, G; Fakhrizzaki, S; Mahathir, M; Karuna, K; Rauf, K; William, H; Akmal, H; Sivapathasundaram, N; Jaspreet, K

2016-07-01

Introduction: Intra-articular hyaluronic acid (HA) is widely utilized in the treatment of knee osteoarthritis whereas platelet rich plasma (PRP) enhances the regeneration of articular cartilage. This study analyses the efficacy of HA and PRP in grade III and IV knee osteoarthritis. Methodology: This is a cross sectional study with retrospective review of 64 patients (101 knees) which includes 56 knees injected with HA+ PRP, and 45 knees with HA only. Results: During the post six months International Knee Documentation Committee (IKDC) evaluation, HA+PRP group showed marked improvement of 24.33 compared to 12.15 in HA group. Decrement in visual analogue score (VAS) in HA+PRP was 1.9 compared to 0.8 in HA group. Conclusion: We propose intra-articular HA and PRP injections as an optional treatment modality in Grade III and IV knee osteoarthritis in terms of functional outcome and pain control for up to six months when arthroplasty is not an option.

Intra-articular Hyaluronic Acid (HA) and Platelet Rich Plasma (PRP) injection versus Hyaluronic acid (HA) injection alone in Patients with Grade III and IV Knee Osteoarthritis (OA): A Retrospective Study on Functional Outcome

PubMed Central

Premganesh, G; Fakhrizzaki, S; Mahathir, M; Karuna, K; Rauf, K; William, H; Akmal, H; Sivapathasundaram, N; Jaspreet, K

2016-01-01

Introduction: Intra-articular hyaluronic acid (HA) is widely utilized in the treatment of knee osteoarthritis whereas platelet rich plasma (PRP) enhances the regeneration of articular cartilage. This study analyses the efficacy of HA and PRP in grade III and IV knee osteoarthritis. Methodology: This is a cross sectional study with retrospective review of 64 patients (101 knees) which includes 56 knees injected with HA+ PRP, and 45 knees with HA only. Results: During the post six months International Knee Documentation Committee (IKDC) evaluation, HA+PRP group showed marked improvement of 24.33 compared to 12.15 in HA group. Decrement in visual analogue score (VAS) in HA+PRP was 1.9 compared to 0.8 in HA group. Conclusion: We propose intra-articular HA and PRP injections as an optional treatment modality in Grade III and IV knee osteoarthritis in terms of functional outcome and pain control for up to six months when arthroplasty is not an option. PMID:28435559

PRP and Articular Cartilage: A Clinical Update

PubMed Central

Rossi, Roberto; Castoldi, Filippo; Michielon, Gianni

2015-01-01

The convincing background of the recent studies, investigating the different potentials of platelet-rich plasma, offers the clinician an appealing alternative for the treatment of cartilage lesions and osteoarthritis. Recent evidences in literature have shown that PRP may be helpful both as an adjuvant for surgical treatment of cartilage defects and as a therapeutic tool by intra-articular injection in patients affected by osteoarthritis. In this review, the authors introduce the trophic and anti-inflammatory properties of PRP and the different products of the available platelet concentrates. Then, in a complex scenario made of a great number of clinical variables, they resume the current literature on the PRP applications in cartilage surgery as well as the use of intra-articular PRP injections for the conservative treatment of cartilage degenerative lesions and osteoarthritis in humans, available as both case series and comparative studies. The result of this review confirms the fascinating biological role of PRP, although many aspects yet remain to be clarified and the use of PRP in a clinical setting has to be considered still exploratory. PMID:26075244

Platelet Rich Plasma and Hyaluronic Acid Blend for the Treatment of Osteoarthritis: Rheological and Biological Evaluation

PubMed Central

Russo, Fabrizio; D’Este, Matteo; Vadalà, Gianluca; Cattani, Caterina; Papalia, Rocco; Alini, Mauro; Denaro, Vincenzo

2016-01-01

Introduction Osteoarthritis (OA) is the most common musculoskeletal disease. Current treatments for OA are mainly symptomatic and inadequate since none results in restoration of fully functional cartilage. Hyaluronic Acid (HA) intra-articular injections are widely accepted for the treatment of pain associated to OA. The goal of HA viscosupplementation is to reduce pain and improve viscoelasticity of synovial fluid. Platelet-rich plasma (PRP) has been also employed to treat OA to possibly induce cartilage regeneration. The combination of HA and PRP could supply many advantages for tissue repair. Indeed, it conjugates HA viscosupplementation with PRP regenerative properties. The aim of this study was to evaluate the rheological and biological properties of different HA compositions in combination with PRP in order to identify (i) the viscoelastic features of the HA-PRP blends, (ii) their biological effect on osteoarthritic chondrocytes and (iii) HA formulations suitable for use in combination with PRP. Materials and Methods HA/PRP blends have been obtained mixing human PRP and three different HA at different concentrations: 1) Sinovial, 0.8% (SN); 2) Sinovial Forte 1.6% (SF); 3) Sinovial HL 3.2% (HL); 4) Hyalubrix 1.5% (HX). Combinations of phosphate buffered saline (PBS) and the four HA types were used as control. Rheological measurements were performed on an Anton PaarMCR-302 rheometer. Amplitude sweep, frequency sweep and rotational measurements were performed and viscoelastic properties were evaluated. The rheological data were validated performing the tests in presence of Bovine Serum Albumin (BSA) up to ultra-physiological concentration (7%). Primary osteoarthritic chondrocytes were cultured in vitro with the HA and PRP blends in the culture medium for one week. Cell viability, proliferation and glycosaminoglycan (GAG) content were assessed. Results PRP addition to HA leads to a decrease of viscoelastic shear moduli and increase of the crossover point, due to a pure dilution effect. For viscosupplements with HA concentration below 1% the viscoelasticity is mostly lost. Results were validated also in presence of proteins, which in synovial fluid are more abundant than HA. Chondrocytes proliferated overtime in all different culture conditions. The proliferation rate was higher in chondrocytes cultured in the media containing PRP compared to the cultures with different HA alone. GAG content was significantly higher in chondrocytes cultured in PRP and HL blend. Discussion We investigated the rheological and biological properties of four different HA concentrations when combined with PRP giving insights on viscoelastic and biological properties of a promising approach for future OA therapy. Our data demonstrate that PRP addition is not detrimental to the viscosupplementation effect of HA. Viscosupplements containing low HA concentration are not indicated for combination with PRP, as the viscoelastic properties are lost. Although having the same rheological behavior of SF and HX, HL was superior in stimulating extracellular matrix production in vitro. PMID:27310019

Biodegradable electrospun nanofibers coated with platelet-rich plasma for cell adhesion and proliferation

PubMed Central

Díaz-Gómez, Luis; Alvarez-Lorenzo, Carmen; Concheiro, Angel; Silva, Maite; Dominguez, Fernando; Sheikh, Faheem A.; Cantu, Travis; Desai, Raj; Garcia, Vanessa L.; Macossay, Javier

2014-01-01

Biodegradable electrospun poly(ε-caprolactone) (PCL) scaffolds were coated with platelet-rich plasma (PRP) to improve cell adhesion and proliferation. PRP was obtained from human buffy coat, and tested on human adipose-derived mesenchymal stem cells (MSC) to confirm cell proliferation and cytocompatibility. Then, PRP was adsorbed on the PCL scaffolds via lyophilization, which resulted in uniform sponge-like coating of 2.85 (s.d. 0.14) mg/mg. The scaffolds were evaluated regarding mechanical properties (Young’s modulus, tensile stress and tensile strain), sustained release of total protein and growth factors (PDGF-BB, TGF-β1 and VEGF), and hemocompatibility. MSC seeded on the PRP-PCL nanofibers showed an increased adhesion and proliferation compared to pristine PCL fibers. Moreover, the adsorbed PRP enabled angiogenesis features observed as neovascularization in a chicken chorioallantoic membrane (CAM) model. Overall, these results suggest that PRP-PCL scaffolds hold promise for tissue regeneration applications. PMID:24857481

Amyloid-β Peptide Induces Prion Protein Amyloid Formation: Evidence for Its Widespread Amyloidogenic Effect.

PubMed

Honda, Ryo

2018-04-12

Transmissible spongiform encephalopathy is associated with misfolding of prion protein (PrP) into an amyloid β-rich aggregate. Previous studies have indicated that PrP interacts with Alzheimer's disease amyloid-β peptide (Aβ), but it remains elusive how this interaction impacts on the misfolding of PrP. This study presents the first in vitro evidence that Aβ induces PrP-amyloid formation at submicromolar concentrations. Interestingly, systematic mutagenesis of PrP revealed that Aβ requires no specific amino acid sequences in PrP, and induces the misfolding of other unrelated proteins (insulin and lysozyme) into amyloid fibrils in a manner analogous to PrP. This unanticipated nonspecific amyloidogenic effect of Aβ indicates that this peptide might be involved in widespread protein aggregation, regardless of the amino acid sequences of target proteins, and exacerbate the pathology of many neurodegenerative diseases. © 2018 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.

Melanin or a Melanin-Like Substance Interacts with the N-Terminal Portion of Prion Protein and Inhibits Abnormal Prion Protein Formation in Prion-Infected Cells.

PubMed

Hamanaka, Taichi; Nishizawa, Keiko; Sakasegawa, Yuji; Oguma, Ayumi; Teruya, Kenta; Kurahashi, Hiroshi; Hara, Hideyuki; Sakaguchi, Suehiro; Doh-Ura, Katsumi

2017-03-15

Prion diseases are progressive fatal neurodegenerative illnesses caused by the accumulation of transmissible abnormal prion protein (PrP). To find treatments for prion diseases, we searched for substances from natural resources that inhibit abnormal PrP formation in prion-infected cells. We found that high-molecular-weight components from insect cuticle extracts reduced abnormal PrP levels. The chemical nature of these components was consistent with that of melanin. In fact, synthetic melanin produced from tyrosine or 3-hydroxy-l-tyrosine inhibited abnormal PrP formation. Melanin did not modify cellular or cell surface PrP levels, nor did it modify lipid raft or cellular cholesterol levels. Neither did it enhance autophagy or lysosomal function. Melanin was capable of interacting with PrP at two N-terminal domains. Specifically, it strongly interacted with the PrP region of amino acids 23 to 50 including a positively charged amino acid cluster and weakly interacted with the PrP octarepeat peptide region of residues 51 to 90. However, the in vitro and in vivo data were inconsistent with those of prion-infected cells. Abnormal PrP formation in protein misfolding cyclic amplification was not inhibited by melanin. Survival after prion infection was not significantly altered in albino mice or exogenously melanin-injected mice compared with that of control mice. These data suggest that melanin, a main determinant of skin color, is not likely to modify prion disease pathogenesis, even though racial differences in the incidence of human prion diseases have been reported. Thus, the findings identify an interaction between melanin and the N terminus of PrP, but the pathophysiological roles of the PrP-melanin interaction remain unclear. IMPORTANCE The N-terminal region of PrP is reportedly important for neuroprotection, neurotoxicity, and abnormal PrP formation, as this region is bound by many factors, such as metal ions, lipids, nucleic acids, antiprion compounds, and several proteins, including abnormal PrP in prion disease and the Aβ oligomer in Alzheimer's disease. In the present study, melanin, a main determinant of skin color, was newly found to interact with this N-terminal region and inhibits abnormal PrP formation in prion-infected cells. However, the data for prion infection in mice lacking melanin production suggest that melanin is not associated with the prion disease mechanism, although the incidence of prion disease is reportedly much higher in white people than in black people. Thus, the roles of the PrP-melanin interaction remain to be further elucidated, but melanin might be a useful competitive tool for evaluating the functions of other ligands at the N-terminal region. Copyright © 2017 American Society for Microbiology.

Melanin or a Melanin-Like Substance Interacts with the N-Terminal Portion of Prion Protein and Inhibits Abnormal Prion Protein Formation in Prion-Infected Cells

PubMed Central

Hamanaka, Taichi; Nishizawa, Keiko; Sakasegawa, Yuji; Oguma, Ayumi; Teruya, Kenta; Kurahashi, Hiroshi; Hara, Hideyuki; Sakaguchi, Suehiro

2017-01-01

ABSTRACT Prion diseases are progressive fatal neurodegenerative illnesses caused by the accumulation of transmissible abnormal prion protein (PrP). To find treatments for prion diseases, we searched for substances from natural resources that inhibit abnormal PrP formation in prion-infected cells. We found that high-molecular-weight components from insect cuticle extracts reduced abnormal PrP levels. The chemical nature of these components was consistent with that of melanin. In fact, synthetic melanin produced from tyrosine or 3-hydroxy-l-tyrosine inhibited abnormal PrP formation. Melanin did not modify cellular or cell surface PrP levels, nor did it modify lipid raft or cellular cholesterol levels. Neither did it enhance autophagy or lysosomal function. Melanin was capable of interacting with PrP at two N-terminal domains. Specifically, it strongly interacted with the PrP region of amino acids 23 to 50 including a positively charged amino acid cluster and weakly interacted with the PrP octarepeat peptide region of residues 51 to 90. However, the in vitro and in vivo data were inconsistent with those of prion-infected cells. Abnormal PrP formation in protein misfolding cyclic amplification was not inhibited by melanin. Survival after prion infection was not significantly altered in albino mice or exogenously melanin-injected mice compared with that of control mice. These data suggest that melanin, a main determinant of skin color, is not likely to modify prion disease pathogenesis, even though racial differences in the incidence of human prion diseases have been reported. Thus, the findings identify an interaction between melanin and the N terminus of PrP, but the pathophysiological roles of the PrP-melanin interaction remain unclear. IMPORTANCE The N-terminal region of PrP is reportedly important for neuroprotection, neurotoxicity, and abnormal PrP formation, as this region is bound by many factors, such as metal ions, lipids, nucleic acids, antiprion compounds, and several proteins, including abnormal PrP in prion disease and the Aβ oligomer in Alzheimer's disease. In the present study, melanin, a main determinant of skin color, was newly found to interact with this N-terminal region and inhibits abnormal PrP formation in prion-infected cells. However, the data for prion infection in mice lacking melanin production suggest that melanin is not associated with the prion disease mechanism, although the incidence of prion disease is reportedly much higher in white people than in black people. Thus, the roles of the PrP-melanin interaction remain to be further elucidated, but melanin might be a useful competitive tool for evaluating the functions of other ligands at the N-terminal region. PMID:28077650

Platelet-Rich Plasma-Loaded Poly(d,l-lactide)-Poly(ethylene glycol)-Poly(d,l-lactide) Hydrogel Dressing Promotes Full-Thickness Skin Wound Healing in a Rodent Model

PubMed Central

Qiu, Manle; Chen, Daoyun; Shen, Chaoyong; Shen, Ji; Zhao, Huakun; He, Yaohua

2016-01-01

Traditional therapeutic methods for skin wounds have many disadvantages, and new wound dressings that can facilitate the healing process are thus urgently needed. Platelet-rich plasma (PRP) contains multiple growth factors (GFs) and shows a significant capacity to heal soft tissue wounds. However, these GFs have a short half-life and deactivate rapidly; we therefore need a sustained delivery system to overcome this shortcoming. In this study, poly(d,l-lactide)-poly(ethylene glycol)-poly(d,l-lactide) (PDLLA-PEG-PDLLA: PLEL) hydrogel was successfully created as delivery vehicle for PRP GFs and was evaluated systematically. PLEL hydrogel was injectable at room temperature and exhibited a smart thermosensitive in situ gel-formation behavior at body temperature. In vitro cell culture showed PRP-loaded PLEL hydrogel (PRP/PLEL) had little cytotoxicity, and promoted EaHy926 proliferation, migration and tube formation; the factor release assay additionally indicated that PLEL realized the controlled release of PRP GFs for as long as 14 days. When employed to treat rodents’ full-thickness skin defects, PRP/PLEL showed a significantly better ability to raise the number of both newly formed and mature blood vessels compared to the control, PLEL and PRP groups. Furthermore, the PRP/PLEL-treated group displayed faster wound closure, better reepithelialization and collagen formation. Taken together, PRP/PLEL provides a promising strategy for promoting angiogenesis and skin wound healing, which extends the potential of this dressing for clinical application. PMID:27347938

A single dose of platelet-rich plasma improves the organization and strength of a surgically repaired rotator cuff tendon in rats.

PubMed

Dolkart, Oleg; Chechik, Ofir; Zarfati, Yaron; Brosh, Tamar; Alhajajra, Fadi; Maman, Eran

2014-09-01

Rotator cuff tear (RCT) is a common cause of pain and disability among adults. Platelet-rich plasma (PRP) is a fraction of whole blood containing concentrated growth factors and proteins important for tissue healing. This study aimed at investigating the effects of local autologous PRP injection on repaired rotator cuff (RC) tendon repair in rats. Following experimental RCT and suturing, 44 Wistar rats were randomly allocated into two groups: (1) RC repair only (controls); (2) RC repair + PRP administration-shoulders were treated with intra-articular PRP immediately after the repair. Animals were killed after 3 weeks and tendon, were tested biomechanically in tension (12 rats/group). The remaining tendons (10 rats/group) were stained using hematoxylin and eosin and Picro-sirius Red. Histological analysis evaluated the cellular aspects of the repair tissue. PRP administration following experimental RC tear and suture resulted in a significantly higher maximal load (p < 0.001) and stiffness (p < 0.005) as compared to non-treated animals. Bonar score of PRP-treated tendons was significantly better (p = 0.018) than the control group. Collagen birefringence was significantly higher in PRP shoulders (p = 0.002), indicating improved organization. Vascularity scores were similar in both groups. Application of a single dose autologous PRP in adjunct to surgical repair resultes in improved tendon-to-bone healing, assessed by histological and biomechanical testing in a rat model of acute RCT, when tested at 3 weeks compared to controls. Further studies will be essential to determine the role of PRP in clinical practice.

Direct and indirect effects of a combination of adipose-derived stem cells and platelet-rich plasma on bone regeneration.

PubMed

Tajima, Satoshi; Tobita, Morikuni; Orbay, Hakan; Hyakusoku, Hiko; Mizuno, Hiroshi

2015-03-01

A key goal for successful bone regeneration is to bridge a bone defect using healing procedures that are stable and durable. Adipose-derived stem cells (ASCs) have the potential to differentiate into bone. Meanwhile, platelet-rich plasma (PRP) is an interesting biological means to repair tissue by inducing chemotactic, proliferative, and anabolic cellular responses. This study evaluated bone regeneration using a combination of ASCs and PRP in a rat calvarial defect model. ASCs were isolated from inguinal fat pads of F344 inbred rats, while PRP was prepared from these rats. ASCs were cultured in control medium supplemented with 10% fetal bovine serum or 5% PRP in vitro. After 1 week, levels of growth factors including insulin-like growth factor-1, transforming growth factor-β1, hepatocyte growth factor, and vascular endothelial growth factor in the culture supernatant were measured by enzyme-linked immunosorbent assays. Moreover, the ASC/PRP admixture was transplanted into the rat calvarial defect. Microcomputed tomography, histological, and immunohistochemical (osteopontin and osteocalcin) analyses were performed at 4 and 8 weeks after transplantation. The in vitro study showed that the levels of growth factors secreted by ASCs were significantly increased by the addition of PRP. Transplantation of the ASC/PRP admixture had dramatic effects on bone regeneration overtime in comparison with rats that received other transplants. Furthermore, some ASCs directly differentiated into osteogenic cells in vivo. These findings suggest that the combination of ASCs and PRP has augmentative effects on bone regeneration. The ASC/PRP admixture may be a promising source for the clinical treatment of cranial defects.

Angiogenic effect of platelet-rich plasma combined with gelatin hydrogel granules injected into murine subcutis.

PubMed

Kakudo, Natsuko; Morimoto, Naoki; Ogawa, Takeshi; Hihara, Masakatsu; Notodihardjo, Priscilla Valentin; Matsui, Makoto; Tabata, Yasuhiko; Kusumoto, Kenji

2017-07-01

Platelet-rich plasma (PRP), which contains highly concentrated platelets, is produced by centrifuging whole blood. It is a safe and readily available source of a wide range of growth factors necessary for angiogenesis. Gelatin hydrogel granules have been designed and prepared for the controlled release of many growth factors. The angiogenic effect of human PRP was examined in vitro, and the effect of its subcutaneous injection with gelatin hydrogel granules into murine subcutis was evaluated. Human PRP was prepared using a double-spin method. The concentration of growth factors and the platelet count were examined in PRP and in vitro, and the angiogenic activity of human umbilical vein endothelial cells (HUVECs) in co-culture with human dermal fibroblast cells (NHDFs) in the presence and absence of PRP was evaluated. Then, in vivo, PRP, either free or with gelatin hydrogel granules, was injected subcutaneously into tiebacks on mice. Using a microscope and Kurabo angiogenesis image analyser software, the area containing newly formed capillaries was evaluated histologically and the microvascular network score was calculated. PRP was shown to contain high concentrations of PDGF, VEGF and TGFβ and had an angiogenic effect on the co-culture system. PRP with gelatin hydrogel granules significantly enlarged the area containing newly formed capillaries and promoted the microvascular network in murine subcutaneous tissue. PRP encapsulated in gelatin hydrogel microspheres shows promise for enhancing angiogenic effects in murine subcutis and could represent a potential therapeutic combination for the treatment of ischaemic disorders. Copyright © 2015 John Wiley & Sons, Ltd. Copyright © 2015 John Wiley & Sons, Ltd.

Effect of intralesional platelet-rich plasma (PRP) treatment on clinical and ultrasonographic parameters in equine naturally occurring superficial digital flexor tendinopathies - a randomized prospective controlled clinical trial.

PubMed

Geburek, Florian; Gaus, Moritz; van Schie, Hans T M; Rohn, Karl; Stadler, Peter M

2016-09-07

Regenerative and anti-inflammatory effects on tendinopathies have been attributed to blood-derived biologicals. To date the evidence for the efficacy of autologous platelet-rich plasma (PRP) treatment of naturally occurring equine tendinopathies is limited. The purpose of this placebo-controlled clinical trial was to describe the effect of a single treatment of equine superficial digital flexor tendon (SDFT) disease with PRP on clinical and ultrasonographic parameters. Twenty horses with naturally occurring tendinopathies of forelimb SDFTs were randomly assigned to the PRP-treated group (n = 10) or control group (n = 10) after clinical and ultrasonographic examination. The SDFTs received an intralesional treatment with autologous PRP or were injected with saline, respectively (day 0). All horses participated in a standardized exercise programme and were re-examined clinically, with B-mode ultrasonography (5 times at regular intervals) and ultrasound tissue characterization (week 12 and 24 after treatment) until week 24. Long-term performance was estimated via telephone inquiry. Compared to day 0, lameness decreased significantly by week 8 after treatment with PRP and by week 12 in the control group. Ultrasonographically there was no difference in the summarized cross sectional area between the groups at any time point. Ultrasound tissue characterization showed that echo types representing disorganized matrix decreased significantly throughout the observation period in the PRP-treated group. Echo type II, representing discontinuous fascicles, not yet aligned into lines of stress was significantly higher 24 weeks after PRP treatment. Eighty percent of the PRP treated horses reached their previous or a higher level of performance after 12 months compared to 50 % in the CG. After 24 months these proportions were 60 % and 50 %, respectively. A single intralesional treatment with PRP up to 8 weeks after onset of clinical signs of tendinopathy contributes to an earlier reduction of lameness compared to saline treatment and to an advanced organization of repair tissue as the fibrillar matrix is getting organized into fascicles while remodelling continues. Long term, PRP treatment has the potential to increase the number of horses reaching their previous level of performance. Earlier treatment of tendinopathy with PRP should be considered to enhance these effects.

Outcomes after Intravitreal Bevacizumab versus Laser Photocoagulation for Retinopathy of Prematurity: A 5-Year Retrospective Analysis

PubMed Central

Hwang, Christopher K.; Hubbard, G. Baker; Hutchinson, Amy K.; Lambert, Scott R.

2014-01-01

Purpose To determine the relative effectiveness, major complications, and refractive errors associated with intravitreal bevacizumab (IVB) versus panretinal photocoagulation (PRP) to treat Type 1 retinopathy of prematurity (ROP). Subjects Consecutive infants with Type 1 ROP who received either IVB or PRP between January 2008 and December 2012 and had at least six months of follow-up. Design Retrospective case series. Methods The data from infants treated with either IVB or PRP for Type 1 ROP between January 2008 and December 2012 were recorded from two medical centers in Atlanta, Georgia. Main Outcome Measures Recurrence rate, complication rate, refractive error. Results A total of 54 eyes (28 patients) with Type 1 ROP were evaluated: 22 eyes (11 patients) received IVB, and 32 eyes (17 patients) received PRP. Among the 22 eyes treated with IVB, 16 eyes had Zone I ROP and 6 eyes had posterior Zone II ROP. The number of Zone I and Zone II ROP eyes treated with PRP were 5 and 27 eyes, respectively. Mean gestational age, birth weight, postmenstrual age at the initial treatment, and follow-up period for the infants receiving IVB were 24.2 weeks, 668.1 grams, 35.1 weeks, and 21.7 weeks, respectively, and for the infants receiving PRP were 24.8, 701.4 grams, 36.1 weeks, and 34.5 weeks, respectively. ROP recurred in 3/22 (14%) IVB-treated eyes and in 1/32 (3%) PRP-treated eyes. None of IVB-treated eyes progressed to retinal detachment or developed macular ectopia. Only one eye went on to retinal detachment and five eyes developed macular ectopia in PRP-treated eyes. Mean spherical equivalent and postgestational age at the last refraction for IVB-treated eyes were −2.4 D and 22.4 months, respectively, and for PRP-treated eyes were −5.3 D and 37.1 months, respectively. Mean spherical equivalent for Zone I ROP eyes treated with IVB and PRP were −3.7 D and −10.1 D, respectively, and for Zone II ROP eyes were 0.6 D and −4.7 D, respectively. Conclusions Both IVB and PRP are effective treatment options for Type 1 ROP with low complication rates. Zone I ROP was associated with high minus refractive errors in eyes treated with either IVB or PRP. PMID:25687024

Does Intra-articular Platelet-Rich Plasma Injection Provide Clinically Superior Outcomes Compared With Other Therapies in the Treatment of Knee Osteoarthritis? A Systematic Review of Overlapping Meta-analyses.

PubMed

Campbell, Kirk A; Saltzman, Bryan M; Mascarenhas, Randy; Khair, M Michael; Verma, Nikhil N; Bach, Bernard R; Cole, Brian J

2015-11-01

The aims of this study were (1) to perform a systematic review of meta-analyses evaluating platelet-rich plasma (PRP) injection in the treatment of knee joint cartilage degenerative pathology, (2) to provide a framework for analysis and interpretation of the best available evidence to provide recommendations for use (or lack thereof) of PRP in the setting of knee osteoarthritis (OA), and (3) to identify literature gaps where continued investigation would be suggested. Literature searches were performed for meta-analyses examining use of PRP versus corticosteroids, hyaluronic acid, oral nonsteroidal anti-inflammatory drugs, or placebo. Clinical data were extracted, and meta-analysis quality was assessed. The Jadad algorithm was applied to determine meta-analyses that provided the highest level of evidence. Three meta-analyses met the eligibility criteria and ranged in quality from Level II to Level IV evidence. All studies compared outcomes of treatment with intra-articular platelet-rich plasma (IA-PRP) versus control (intra-articular hyaluronic acid or intra-articular placebo). Use of PRP led to significant improvements in patient outcomes at 6 months after injection, and these improvements were seen starting at 2 months and were maintained for up to 12 months. It is unclear if the use of multiple PRP injections, the double-spinning technique, or activating agents leads to better outcomes. Patients with less radiographic evidence of arthritis benefit more from PRP treatment. The use of multiple PRP injections may increase the risk of self-limited local adverse reactions. After application of the Jadad algorithm, 3 concordant high-quality meta-analyses were selected and all showed that IA-PRP provided clinically relevant improvements in pain and function compared with the control treatment. IA-PRP is a viable treatment for knee OA and has the potential to lead to symptomatic relief for up to 12 months. There appears to be an increased risk of local adverse reactions after multiple PRP injections. IA-PRP offers better symptomatic relief to patients with early knee degenerative changes, and its use should be considered in patients with knee OA. Level IV, systematic review of Level II through IV studies. Copyright © 2015 Arthroscopy Association of North America. Published by Elsevier Inc. All rights reserved.

Multiple protein-protein interactions converging on the Prp38 protein during activation of the human spliceosome.

PubMed

Schütze, Tonio; Ulrich, Alexander K C; Apelt, Luise; Will, Cindy L; Bartlick, Natascha; Seeger, Martin; Weber, Gert; Lührmann, Reinhard; Stelzl, Ulrich; Wahl, Markus C

2016-02-01

Spliceosomal Prp38 proteins contain a conserved amino-terminal domain, but only higher eukaryotic orthologs also harbor a carboxy-terminal RS domain, a hallmark of splicing regulatory SR proteins. We show by crystal structure analysis that the amino-terminal domain of human Prp38 is organized around three pairs of antiparallel α-helices and lacks similarities to RNA-binding domains found in canonical SR proteins. Instead, yeast two-hybrid analyses suggest that the amino-terminal domain is a versatile protein-protein interaction hub that possibly binds 12 other spliceosomal proteins, most of which are recruited at the same stage as Prp38. By quantitative, alanine surface-scanning two-hybrid screens and biochemical analyses we delineated four distinct interfaces on the Prp38 amino-terminal domain. In vitro interaction assays using recombinant proteins showed that Prp38 can bind at least two proteins simultaneously via two different interfaces. Addition of excess Prp38 amino-terminal domain to in vitro splicing assays, but not of an interaction-deficient mutant, stalled splicing at a precatalytic stage. Our results show that human Prp38 is an unusual SR protein, whose amino-terminal domain is a multi-interface protein-protein interaction platform that might organize the relative positioning of other proteins during splicing. © 2016 Schütze et al.; Published by Cold Spring Harbor Laboratory Press for the RNA Society.

Molecular-level insights of early-stage prion protein aggregation on mica and gold surface determined by AFM imaging and molecular simulation.

PubMed

Lou, Zhichao; Wang, Bin; Guo, Cunlan; Wang, Kun; Zhang, Haiqian; Xu, Bingqian

2015-11-01

By in situ time-lapse AFM, we investigated early-stage aggregates of PrP formed at low concentration (100 ng/mL) on mica and Au(111) surfaces in acetate buffer (pH 4.5). Remarkably different PrP assemblies were observed. Oligomeric structures of PrP aggregates were observed on mica surface, which was in sharp contrast to the multi-layer PrP aggregates yielding parallel linear patterns observed Au(111) surface. Combining molecular dynamics and docking simulations, PrP monomers, dimers and trimers were revealed as the basic units of the observed aggregates. Besides, the mechanisms of the observed PrP aggregations and the corresponding molecular-substrate and intermolecular interactions were suggested. These interactions involved gold-sulfur interaction, electrostatic interaction, hydrophobic interaction, and hydrogen binding interaction. In contrast, the PrP aggregates observed in pH 7.2 PBS buffer demonstrated similar large ball-like structures on both mica and Au(111) surfaces. The results indicate that the pH of a solution and the surface of the system can have strong effects on supramolecular assemblies of prion proteins. This study provides in-depth understanding on the structural and mechanistic nature of PrP aggregation, and can be used to study the aggregation mechanisms of other proteins with similar misfolding properties. Copyright © 2015 Elsevier B.V. All rights reserved.

Enhanced Sternal Healing via Platelet-Rich Plasma and Biodegradable Gelatin Hydrogel.

PubMed

Shibata, Masafumi; Takagi, Gen; Kudo, Mitsuhiro; Kurita, Jiro; Kawamoto, Yoko; Miyagi, Yasuo; Kanazashi, Mikimoto; Sakatani, Takashi; Naito, Zenya; Tabata, Yasuhiko; Miyamoto, Masaaki; Nitta, Takashi

2018-05-16

Platelet-rich plasma (PRP) contains numerous growth factors and promotes bone fracture healing. The aim of this study was to evaluate the effectiveness of the controlled release of PRP from biodegradable gelatin hydrogel for promoting healing in a rabbit ischemic sternal model. PRP was prepared from the whole blood of a Japanese white rabbit. Sixteen rabbits were randomized into four groups (each n = 4) and all underwent median sternotomy and bilateral internal thoracic artery removal. Before the sternum was closed, the following solutions were applied between the sternum incisions in three of the groups: 30 mg of gelatin hydrogel incorporating 300 μL of phosphate-buffered saline, 300 μL of a solution form of PRP, or 30 mg of gelatin hydrogel incorporating 300 μL of PRP (PRP+Gel). The fourth group acted as a control. Sternal healing was evaluated by histology and micro-computed tomography 7 days after the intervention. The PRP+Gel group showed a significantly higher proportion of fibrosis within the fracture area (an indicator of sternal healing) than the other groups and a significantly higher mean intensity of osteocalcin. These results indicate that the controlled release of PRP from locally applied gelatin hydrogel was markedly effective in enhancing sternal healing in the early postoperative period. This novel therapy could potentially help prevent complications such as deep sternal wound infection and could result in early postoperative ambulation after median sternotomy.

Interface between breast cancer cells and the tumor microenvironment using platelet-rich plasma to promote tumor angiogenesis - influence of platelets and fibrin bundles on the behavior of breast tumor cells

PubMed Central

Andrade, Sheila Siqueira; Sumikawa, Joana Tomomi; Castro, Eloísa Dognani; Batista, Fabricio Pereira; Paredes-Gamero, Edgar; Oliveira, Lilian Carolina; Guerra, Izabel Monastério; Peres, Giovani Bravin; Cavalheiro, Renan Pelluzzi; Juliano, Luiz; Nazário, Afonso Pinto; Facina, Gil; Tsai, Siu Mui; Oliva, Maria Luiza Vilela; Girão, Manoel João Batista Castello

2017-01-01

Cancer progression is associated with an evolving tissue interface of direct epithelial-tumor microenvironment interactions. In biopsies of human breast tumors, extensive alterations in molecular pathways are correlated with cancer staging on both sides of the tumor-stroma interface. These interactions provide a pivotal paracrine signaling to induce malignant phenotype transition, the epithelial-mesenchymal transition (EMT). We explored how the direct contact between platelets-fibrin bundles primes metastasis using platelet-rich plasma (PRP) as a source of growth factors and mimics the provisional fibrin matrix between actively growing breast cancer cells and the tumor stroma. We have demonstrated PRP functions, modulating cell proliferation that is tumor-subtype and cancer cell-type-specific. Epithelial and stromal primary cells were prepared from breast cancer biopsies from 21 women with different cancer subtypes. Cells supplemented with PRP were immunoblotted with anti-phospho and total Src-Tyr-416, FAK-Try-925, E-cadherin, N-cadherin, TGF-β, Smad2, and Snail monoclonal antibodies. Breast tumor cells from luminal B and HER2 subtypes showed the most malignant profiles and the expression of thrombin and other classes of proteases at levels that were detectable through FRET peptide libraries. The angiogenesis process was investigated in the interface obtained between platelet-fibrin-breast tumor cells co-cultured with HUVEC cells. Luminal B and HER2 cells showed robust endothelial cell capillary-like tubes ex vivo. The studied interface contributes to the attachment of endothelial cells, provides a source of growth factors, and is a solid substrate. Thus, replacement of FBS supplementation with PRP supplementation represents an efficient and simple approach for mimicking the real multifactorial tumor microenvironment. PMID:28187434

Interface between breast cancer cells and the tumor microenvironment using platelet-rich plasma to promote tumor angiogenesis - influence of platelets and fibrin bundles on the behavior of breast tumor cells.

PubMed

Andrade, Sheila Siqueira; Sumikawa, Joana Tomomi; Castro, Eloísa Dognani; Batista, Fabricio Pereira; Paredes-Gamero, Edgar; Oliveira, Lilian Carolina; Guerra, Izabel Monastério; Peres, Giovani Bravin; Cavalheiro, Renan Pelluzzi; Juliano, Luiz; Nazário, Afonso Pinto; Facina, Gil; Tsai, Siu Mui; Oliva, Maria Luiza Vilela; Girão, Manoel João Batista Castello

2017-03-07

Cancer progression is associated with an evolving tissue interface of direct epithelial-tumor microenvironment interactions. In biopsies of human breast tumors, extensive alterations in molecular pathways are correlated with cancer staging on both sides of the tumor-stroma interface. These interactions provide a pivotal paracrine signaling to induce malignant phenotype transition, the epithelial-mesenchymal transition (EMT). We explored how the direct contact between platelets-fibrin bundles primes metastasis using platelet-rich plasma (PRP) as a source of growth factors and mimics the provisional fibrin matrix between actively growing breast cancer cells and the tumor stroma. We have demonstrated PRP functions, modulating cell proliferation that is tumor-subtype and cancer cell-type-specific. Epithelial and stromal primary cells were prepared from breast cancer biopsies from 21 women with different cancer subtypes. Cells supplemented with PRP were immunoblotted with anti-phospho and total Src-Tyr-416, FAK-Try-925, E-cadherin, N-cadherin, TGF-β, Smad2, and Snail monoclonal antibodies. Breast tumor cells from luminal B and HER2 subtypes showed the most malignant profiles and the expression of thrombin and other classes of proteases at levels that were detectable through FRET peptide libraries. The angiogenesis process was investigated in the interface obtained between platelet-fibrin-breast tumor cells co-cultured with HUVEC cells. Luminal B and HER2 cells showed robust endothelial cell capillary-like tubes ex vivo. The studied interface contributes to the attachment of endothelial cells, provides a source of growth factors, and is a solid substrate. Thus, replacement of FBS supplementation with PRP supplementation represents an efficient and simple approach for mimicking the real multifactorial tumor microenvironment.

Analysis of Platelet-Rich Plasma Extraction

PubMed Central

Fitzpatrick, Jane; Bulsara, Max K.; McCrory, Paul Robert; Richardson, Martin D.; Zheng, Ming Hao

2017-01-01

Background: Platelet-rich plasma (PRP) has been extensively used as a treatment in tissue healing in tendinopathy, muscle injury, and osteoarthritis. However, there is variation in methods of extraction, and this produces different types of PRP. Purpose: To determine the composition of PRP obtained from 4 commercial separation kits, which would allow assessment of current classification systems used in cross-study comparisons. Study Design: Controlled laboratory study. Methods: Three normal adults each donated 181 mL of whole blood, some of which served as a control and the remainder of which was processed through 4 PRP separation kits: GPS III (Biomet Biologics), Smart-Prep2 (Harvest Terumo), Magellan (Arteriocyte Medical Systems), and ACP (Device Technologies). The resultant PRP was tested for platelet count, red blood cell count, and white blood cell count, including differential in a commercial pathology laboratory. Glucose and pH measurements were obtained from a blood gas autoanalyzer machine. Results: Three kits taking samples from the “buffy coat layer” were found to have greater concentrations of platelets (3-6 times baseline), while 1 kit taking samples from plasma was found to have platelet concentrations of only 1.5 times baseline. The same 3 kits produced an increased concentration of white blood cells (3-6 times baseline); these consisted of neutrophils, leukocytes, and monocytes. This represents high concentrations of platelets and white blood cells. A small drop in pH was thought to relate to the citrate used in the sample preparation. Interestingly, an unexpected increase in glucose concentrations, with 3 to 6 times greater than baseline levels, was found in all samples. Conclusion: This study reveals the variation of blood components, including platelets, red blood cells, leukocytes, pH, and glucose in PRP extractions. The high concentrations of cells are important, as the white blood cell count in PRP samples has frequently been ignored, being considered insignificant. The lack of standardization of PRP preparation for clinical use has contributed at least in part to the varying clinical efficacy in PRP use. Clinical Relevance: The variation of platelet and other blood component concentrations between commercial PRP kits may affect clinical treatment outcomes. There is a need for standardization of PRP for clinical use. PMID:28210651

US definitions, current use, and FDA stance on use of platelet-rich plasma in sports medicine.

PubMed

Beitzel, Knut; Allen, Donald; Apostolakos, John; Russell, Ryan P; McCarthy, Mary Beth; Gallo, Gregory J; Cote, Mark P; Mazzocca, Augustus D

2015-02-01

With increased utilization of platelet-rich plasma (PRP), it is important for clinicians to understand the United States, the Food and Drug Administration (FDA) regulatory role and stance on PRP. Blood products such as PRP fall under the prevue of FDA's Center for Biologics Evaluation and Research (CBER). CBER is responsible for regulating human cells, tissues, and cellular and tissue-based products. The regulatory process for these products is described in the FDA's 21 CFR 1271 of the Code of Regulations. Under these regulations, certain products including blood products such as PRP are exempt and therefore do not follow the FDA's traditional regulatory pathway that includes animal studies and clinical trials. The 510(k) application is the pathway used to bring PRP preparation systems to the market. The 510(k) application allows devices that are "substantially equivalent" to a currently marketed device to come to the market. There are numerous PRP preparation systems on the market today with FDA clearance; however, nearly all of these systems have 510(k) clearance for producing platelet-rich preparations intended to be used to mix with bone graft materials to enhance bone graft handling properties in orthopedic practices. The use of PRP outside this setting, for example, an office injection, would be considered "off label." Clinicians are free to use a product off-label as long as certain responsibilities are met. Per CBER, when the intent is the practice of medicine, clinicians "have the responsibility to be well informed about the product, to base its use on firm scientific rationale and on sound medical evidence, and to maintain records of the product's use and effects." Finally, despite PRP being exempted, the language in 21 CFR 1271 has caused some recent concern over activated PRP; however to date, the FDA has not attempted to regulate activated PRP. Clinicians using activated PRP should be mindful of these concerns and continued to stay informed. Thieme Medical Publishers 333 Seventh Avenue, New York, NY 10001, USA.

Platelet-rich plasma for arthroscopic repair of large to massive rotator cuff tears: a randomized, single-blind, parallel-group trial.

PubMed

Jo, Chris Hyunchul; Shin, Ji Sun; Lee, Young Gil; Shin, Won Hyoung; Kim, Hyang; Lee, Seung Yeon; Yoon, Kang Sup; Shin, Sue

2013-10-01

Platelet-rich plasma (PRP) is expected to have a biological augmentation potential in the healing of various diseases and injuries, including rotator cuff tears. However, few evaluations have been performed specifically for large to massive tears. To assess the efficacy of PRP augmentation in patients undergoing arthroscopic repair for large to massive rotator cuff tears. Randomized controlled trial; Level of evidence, 1. A total of 48 patients scheduled for arthroscopic repair of large to massive rotator cuff tears were randomly assigned to receive either PRP-augmented (PRP group) or conventional treatment (conventional group). In the PRP group, 3 PRP gels (3 × 3 mL) were applied to each patient between the torn end and the greater tuberosity. The primary outcome measure was the retear rate assessed by magnetic resonance imaging (MRI) or computed tomographic arthrography (CTA) at a minimum of 9 months after surgery. Secondary outcome measures included pain, range of motion, muscle strength, overall satisfaction, functional scores, and the change in cross-sectional area (CSA) of the supraspinatus. The retear rate of the PRP group (20.0%) was significantly lower than that of the conventional group (55.6%) (P = .023). Clinical outcomes showed no statistical difference between the 2 groups (all P > .05) except for the overall function (P = .043). The change in 1-year postoperative and immediately postoperative CSA was significantly different between the 2 groups: -15.54 ± 94.34 mm² in the PRP group versus -85.62 ± 103.57 mm² in the conventional group (P = .047). The application of PRP for large to massive rotator cuff repairs significantly improved structural outcomes, as evidenced by a decreased retear rate and increased CSA of the supraspinatus compared with repairs without PRP augmentation. While there was no significant difference in clinical outcomes except the overall shoulder function after 1-year follow-up, better structural outcomes in the PRP group might suggest improved clinical outcomes at longer term follow-up.

The Biomechanical and Histologic Effects of Platelet-Rich Plasma on Rat Rotator Cuff Repairs

PubMed Central

Beck, Jennifer; Evans, Douglas; Tonino, Pietro M.; Yong, Sherri; Callaci, John J.

2013-01-01

Background Rotator cuff tears are common injuries that are often treated with surgical repair. Because of the high concentration of growth factors within platelets, platelet-rich plasma (PRP) has the potential to enhance healing in rotator cuff repairs. Hypothesis Platelet-rich plasma would alter the biomechanical and histologic properties of rotator cuff repair during an acute injury response. Study Design Controlled laboratory study. Methods Platelet-rich plasma was produced from inbred donor rats. A tendon-from-bone supraspinatus tear was created surgically and an immediate transosseous repair performed. The control group underwent repair only. The PRP group underwent a repair with PRP augmentation. Rats in each group were sacrificed at 7, 14, and 21 days. The surgically repaired tendons underwent biomechanical testing, including failure load, stiffness, failure strain, and stress relaxation characteristics. Histological analysis evaluated the cellular characteristics of the repair tissue. Results At 7- and 21-day periods, augmentation with PRP showed statistically significant effects on the biomechanical properties of the repaired rat supraspinatus tear, but failure load was not increased at the 7-, 14-, or 21-day periods (P = .688, .209, and .477, respectively). The control group had significantly higher stiffness at 21 days (P = .006). The control group had higher failure strain at 7 days (P = .02), whereas the PRP group had higher failure strain at 21 days (P = .008). Histologically, the PRP group showed increased fibroblastic response and vascular proliferation at each time point. At 21 days, the collagen fibers in the PRP group were oriented in a more linear fashion toward the tendon footprint. Conclusion In this controlled, rat model study, PRP altered the tissue properties of the supraspinatus tendon without affecting the construct’s failure load. Clinical Relevance The decreased tendon tissue stiffness acutely and failure to enhance tendon-to-bone healing of repairs should be considered before augmenting rotator cuff repairs with PRP. Further studies will be necessary to determine the role of PRP in clinical practice. PMID:22822177

Platelet-Rich Plasma Versus Tretinoin in Treatment of Striae Distensae: A Comparative Study.

PubMed

Gamil, Hend D; Ibrahim, Samia A; Ebrahim, Howyda M; Albalat, Waleed

2018-05-01

Striae distensae (SD) are dermal scars associated with atrophy of the epidermis. To evaluate the effect and safety of intralesional injection of platelet-rich plasma (PRP) versus topical tretinoin 0.05% in treatment of SD. Thirty patients (27 females and 3 males) had bilateral striae distensae were enrolled in this study. In every patient, half of the selected striae were treated with PRP intralesional injection. The other half was treated by topical tretinoin. Skin biopsies were taken from both sides before and after the treatment. Digital photographs were taken at the baseline and at the end of follow-up period. Clinical improvement was evaluated by 2 blind dermatologists in addition to the patient's satisfaction rating. There was statistically significant improvement in the SD treated with PRP and topical tretinoin cream. The improvement was more in the SD treated with PRP injections (p = .015). Patient's satisfaction showed that the improvement was more in the PRP-treated side (p = .003). Collagen and elastic fibers in the dermis were increased in all biopsies after treatment. PRP injection and topical tretinoin are safe for the treatment of SD, but PRP is more effective and it gives better therapeutic response than tretinoin.

Interactive videogame as rehabilitation tool of patients with chronic respiratory diseases: preliminary results of a feasibility study.

PubMed

Mazzoleni, Stefano; Montagnani, Giulia; Vagheggini, Guido; Buono, Lorenzo; Moretti, Francesca; Dario, Paolo; Ambrosino, Nicolino

2014-10-01

To evaluate the effectiveness of an interactive videogame (IV) system in addition to a supervised pulmonary rehabilitation programme (PRP) in patients with chronic respiratory diseases. Randomised Controlled Trial comparing standard PRP (20 patients, control group: CG), and PRP + sessions of interactive videogame-aided exercises (20 patients, experimental group: EG). Lung and respiratory muscle function, arterial blood gases, exercise capacity, dyspnoea, health status and health-related quality of life (HRQL) and emotional response were measured before and after PRP. A questionnaire on acceptability of the PRP was administered. Exercise capacity, dyspnoea and HRQL significantly improved in both groups after the PRP, whereas the EG showed a greater improvement in six-minute walk test and transitional dyspnoea index than the CG. No difference in psychological status or acceptability of PRP was observed between the two groups. The addition of IV training was more effective for improving some parameters of exercise tolerance and dyspnoea, although did not result in better psychological status nor it was better accepted than the standard PRP in patients with chronic respiratory diseases. Copyright © 2014 Elsevier Ltd. All rights reserved.

The use of platelet-rich plasma to treat chronic tendinopathies: A technical analysis.

PubMed

Kaux, Jean-François; Emonds-Alt, Thibault

2018-05-01

Platelet-rich plasma (PRP) is blood plasma with a high concentration of autologous platelets which constitute an immense reservoir of growth factors. The clinical use of PRP is widespread in various medical applications. Although highly popular with athletes, the use of PRP for the treatment of tendinopathies remains scientifically controversial, particularly due to the diversity of products that go by the name of "PRP." To optimize its use, it is important to look at the various stages of obtaining PRP. In this literature review, we take a closer look at eight parameters which may influence the quality of PRP: 1) anticoagulants used to preserve the best platelet function, 2) the speed of centrifugation used to extract the platelets, 3) the platelet concentrations obtained, 4) the impact of the concentration of red and while blood cells on PRP actions, 5) platelet activators encouraging platelet degranulation and, hence, the release of growth factors, and 6) the use or nonuse of local anesthetics when carrying out infiltration. In addition to these parameters, it may be interesting to analyze other variables such as 7) the use of ultrasound guidance during the injection with a view to determining the influence they have on potential recovery.

PRP For the Treatment of Cartilage Pathology

PubMed Central

Kon, Elizaveta; Filardo, Giuseppe; Di Matteo, Berardo; Marcacci, Maurilio

2013-01-01

In recent years biological strategies are being more widely used to treat cartilage lesions. One of the most exploited novel treatments is Platelet-rich Plasma (PRP), whose high content of growth factors is supposed to determine a regenerative stimulus to cartilaginous tissue. Despite many promising in vitro and in vivo studies, when discussing clinical application a clear indication for the use of PRP cannot be assessed. There are initial encouraging clinical data, but only a few randomized controlled trials have been published, so it is not possible to fully endorse this kind of approach for the treatment of cartilage pathology. Furthermore, study comparison is very difficult due to the great variability in PRP preparation methods, cell content and concentration, storage modalities, activation methods and even application protocols. These factors partially explain the lack of high quality controlled trials up to now. This paper discusses the main aspects concerning the basic biology of PRP, the principal sources of variability, and summarizes the available literature on PRP use, both in surgical and conservative treatments. Based on current evidence, PRP treatment should only be indicated for low-grade cartilage degeneration and in case of failure of more traditional conservative approaches. PMID:23730375

PubMed

Walder, P; Paša, L; Pavliska, L

2017-01-01

PURPOSE OF THE STUDY The aim of the study was to evaluate the safety and efficacy of the application of platelet- and leukocyte-rich plasma (L-PRP) in the treatment of lateral humeral epicondyle (ERH) as compared to the administration of corticosteroid therapy. MATERIAL AND METHODS It was a prospective, double-blind and randomized clinical trial. It included a total of 25 cases of ERH in 23 patients aged 18 to 60 years. They were divided into two arms: L-PRP arm with 10 cases and corticosteroid arm with 15 cases. The therapy of L-PRP group: first application: 3 ml of native L-PRP without activation, second application: after 6 weeks, 3 ml of thawed L-PRP. Therapy of the corticosteroid arm patients: first and second application (both after 6 weeks) of 3.5 mg of Betamethasonum. The follow-up period was 12 months. The safety evaluation was carried out based on the number of adverse events. The efficacy was evaluated using the DASH score and the Visual Analogue Scale (VAS). The time series outcomes were analysed statistically by percentile graphs and repeated measures ANOVA. RESULTS The ascertained values of blood elements in the received L-PRP as against the original blood were the following: platelets around 400%, white blood cells around 200%, red blood cells around 30%. The differences in individual subpopulations of white blood cells: neutrophils 74%, lymphocytes 424%, monocytes 385%, eosinophils 43%, basophils 337%. The product was classified as L-PRP group based on the POSEIDO classification. Safety evaluation: both the groups reported no adverse and also no serious adverse events. One patient withdrew from the corticosteroid group on the grounds of a subjective feeling of treatment failure. Efficacy evaluation: for both the general DASH score and Work Module a statistically better effect of L-PRP was proven in the first 6 months at p < 0.05. For the general DASH score, the L-PRP group reported a decrease of difficulties from approximately 50% to 20% on DASH score and in the corticosteroid group the difficulties returned to more or less the initial value. In the Work Module, the L-PRP group showed a decline in difficulties from approximately 46% to 18% and the corticosteroid group from approximately 43% only to 38%. The Sports and Music Module was evaluated by percentile graphs only. The VAS assessment proved that an effect was achieved only after the administration of the first dose of L-PRP and corticosteroid, with a more significant effect reported in L-PRP. The overall statistical evaluation using the VAS showed no difference between these two therapies at the level of significance of p<0.05 (p = 0.08). DISCUSSION The product used by us was classified as a L-PRP subcategory. The application of the native and subsequently frozen L-PRP is rare as compared to the corticosteroid therapy. CONCLUSIONS According to our results, the application of L-PRP is suitable to treat lateral humeral epicondyle. The benefits can be foreseen in the form of a better functional score, whereas the analgesic effect equals the effect of corticosteroid. A slightly additive effect was seen in the thawed second dose. Key words: platelet- and leucocyte-rich plasma, epicondylitis radialis humeri.

Effect of PR interval prolongation on long-term outcomes in patients with left bundle branch block vs non-left bundle branch block morphologies undergoing cardiac resynchronization therapy.

PubMed

Rickard, John; Karim, Mohammad; Baranowski, Bryan; Cantillon, Daniel; Spragg, David; Tang, W H Wilson; Niebauer, Mark; Grimm, Richard; Trulock, Kevin; Wilkoff, Bruce; Varma, Niraj

2017-10-01

Although the influence of QRS duration (QRSd) and/or bundle branch block morphology on outcomes of cardiac resynchronization therapy (CRT) have been well studied, the effect of PR interval remains uncertain. The purpose of this study was to evaluate the impact of PR prolongation (PRp) before CRT on long-term outcomes, specifically taking into account bundle branch block morphology and QRSd. We extracted clinical data on consecutive patients undergoing CRT. Multivariate models were constructed to analyze the effect of PRp (≥200 ms) on the combined endpoint of death, heart transplant, or left ventricular assist device. Kaplan-Meier curves were constructed stratifying patients based on bundle branch block and QRSd (dichotomized by 150 ms). Of the 472 patients who met inclusion criteria, 197 (41.7%) had PR interval ≥200 ms. During follow-up (mean 5.1 ± 2.6 years) there were 214 endpoints, of which 109 (23.1%) occurred in patients with PRp. In multivariate analysis, PRp was independently associated with worsened outcomes (hazard ratio 1.34, 95% confidence interval 1.01-1.77, P = .04). When stratified by bundle branch block morphology, PRp was significantly associated with worsened outcomes (log-rank P <.001) in patients with LBBB but not in those with non-LBBB (log-rank P = .55). Among patients with LBBB, stratified by QRSd, patients without PRp had improved outcomes compared to those with PRp independent of QRSd (log-rank P <.001). PRp is an independent predictor of impaired long-term outcome after CRT among patients with LBBB but not in non-LBBB patients. Notably, among LBBB patients, PRp is a more important predictor than QRSd in assessing long-term outcomes. Copyright © 2017. Published by Elsevier Inc.

Comparative evaluation of platelet-rich plasma and guided tissue regeneration membrane in the healing of apicomarginal defects: a clinical study.

PubMed

Goyal, Bhawna; Tewari, Sanjay; Duhan, Jigyasa; Sehgal, P K

2011-06-01

The aim of the study was to compare the healing responses of platelet-rich plasma (PRP), PRP + a collagen sponge, and a collagen membrane used as guided tissue regeneration (GTR) materials for the treatment of apicomarginal defects. Thirty patients with suppurative chronic apical periodontitis and apicomarginal communication were selected and allocated randomly into three groups according to the barrier technique to be used during periradicular surgery: the collagen membrane group, the PRP group, and the PRP + collagen sponge group. Clinical and radiographic measurements were determined at baseline and every 3 months after surgery up to 1 year. Cases were defined as healed when no clinical signs or symptoms were present, and radiographs showed complete or incomplete (scar tissue) healing of previous radiolucencies. The PRP and PRP + collagen sponge groups depicted 83.33% and 88.89% healing, respectively, in terms of combined clinical-radiographic healing as compared with 80% in the collagen membrane group. All the three treatments showed highly significant (P < .05) reductions in the periodontal pocket depth (PD), the clinical attachment level (CAL), the gingival margin position (GMP), the size of the periapical lesion, the percentage reduction of the periapical rarefactions, and periapical healing. No significant differences between the three groups were evident for these parameters (P > .05). GTR applied to apicomarginal defects using PRP or PRP + collagen sponge lead to similar enhancements of the clinical outcome of periradicular surgery in terms of periapical healing, gain of periodontal support, PD reduction, and PRP may be an alternative treatment for GTR membrane in the treatment of apicomarginal defects. Copyright © 2011 American Association of Endodontists. Published by Elsevier Inc. All rights reserved.

Effects of three blood derived products on equine corneal cells, an in vitro study.

PubMed

Rushton, J O; Kammergruber, E; Tichy, A; Egerbacher, M; Nell, B; Gabner, S

2018-05-01

Despite advances in therapy of corneal ulcerative diseases in horses, a vast number of cases require surgical intervention, due to poor response to treatment. Topical application of serum has been used for many years, based on its anticollagenolytic properties and the presence of growth factors promoting corneal wound healing. However, although other blood derived products i.e. platelet rich plasma (PRP), plasma rich in growth factors (PRGF) have been widely used in equine orthopaedics and in human ophthalmology, no reports of the effects of these blood derived products exist in equine ophthalmology. To determine in vitro effects of PRGF and PRP on equine corneal cells compared with serum. Prospective controlled cohort study. Blood from 35 healthy horses was used to produce serum, PRGF (Endoret ® ), and PRP (E-PET™). Limbal- and stromal cells were isolated from healthy corneas of six horses and treated with 20% serum, 20% PRGF or 20% PRP. Proliferation rates and migration capacity were analysed in single cell cultures as well as co-culture systems. Cell proliferation increased with PRP treatment, remained constant in PRGF treated cells, and declined upon serum treatment over a period of 48 h. Migration capacity was significantly enhanced with PRP treatment, compared with PRGF treatment. Intact leucocytes, mainly eosinophils, were only detected in PRP. Due to the study design use of autologous blood products on corneal cells was not possible. The results demonstrate beneficial effects of PRP on proliferation as well as migration capacity of equine corneal cells in vitro. In vivo studies are warranted to determine further beneficial effects of PRP in horses with corneal ulcers. © 2017 EVJ Ltd.

The application of PRP combined with TCP in repairing avascular necrosis of the femoral head after femoral neck fracture in rabbit.

PubMed

Zhang, X-L; Wang, Y-M; Chu, K; Wang, Z-H; Liu, Y-H; Jiang, L-H; Chen, X; Zhou, Z-Y; Yin, G

2018-02-01

In view of the high occurrence of avascular necrosis of the femoral head (ANFH) after femoral neck fracture and the difficulties in the treatment, our work aimed to explore the effects of platelet-rich plasma (PRP) combined with tri-calcium phosphate (TCP) on the repair of ANFH after femoral neck fracture and to provide reference for clinical treatment. Thirty New Zealand white rabbits were randomly divided into control group, TCP group, and PRP+TCP group. The rabbit ANFH model was established and femoral head tissues were collected. HE staining was used for histological observation. Image analysis and statistical analysis were used to calculate the New Bone Area fraction (NBA %). The levels of bone morphogenetic protein (BMP)-7, transforming growth factor (TGF)-β1, basic fibroblast growth factor (bFGF), interleukin (IL)-6 and tumor necrosis factor (TNF)-a in serum were detected by Enzyme-Linked ImmunoSorbent Assay (ELISA). The new bone area of TCP group was significantly lower than that of PRP+TCP group (p<0.05). Compared with the control group, the levels of BMP-7, TGF-β1 and bFGF were significantly increased in both TCP and PRP+TCP groups (p<0.05), and the increase in PRP+TCP group was higher than that in TCP group. TCP and PRP+TCP can both significantly reduce the content of IL-6 and TNF-a (p<0.05); however, higher decrease was found in PRP+TCP group compared with the TCP group at 8 weeks after injection. PRP combined with TCP, which can promote new bone formation and inhibit inflammatory response, showed higher efficiency in repairing ANFH than internal fixation alone.

Evaluation of the Effects of Platelet-Rich Plasma (PRP) Therapy Involved in the Healing of Sports-Related Soft Tissue Injuries

PubMed Central

Middleton, Kellie K.; Barro, Victor; Muller, Bart; Terada, Satosha; Fu, Freddie H.

2012-01-01

Abstract Musculoskeletal injuries are the most common cause of severe long-term pain and physical disability, and affect hundreds of millions of people around the world. One of the most popular methods used to biologically enhance healing in the fields of orthopaedic surgery and sports medicine includes the use of autologous blood products, namely, platelet rich plasma (PRP). PRP is an autologous concentration of human platelets to supra-physiologic levels. At baseline levels, platelets function as a natural reservoir for growth factors including platelet-derived growth factor (PDGF), epidermal growth factor (EGF), transforming growth factor-beta 1 (TGF-β1), vascular endothelial growth factor (VEGF), basic fibroblast growth factor (FGF), hepatocyte growth factor (HGF), and insulin-like growth factor (IGF-I). PRP is commonly used in orthopaedic practice to augment healing in sports-related injuries of skeletal muscle, tendons, and ligaments. Despite its pervasive use, the clinical efficacy of PrP therapy and varying mechanisms of action have yet to be established. Basic science research has revealed that PRP exerts is effects through many downstream events secondary to release of growth factors and other bioactive factors from its alpha granules. These effects may vary depending on the location of injury and the concentration of important growth factors involved in various soft tissue healing responses. This review focuses on the effects of PrP and its associated bioactive factors as elucidated in basic science research. Current findings in PRP basic science research, which have shed light on its proposed mechanisms of action, have opened doors for future areas of PrP research. PMID:23576936

Platelet-Rich Plasma Therapy for Knee Joint Problems: Review of the Literature, Current Practice and Legal Perspectives in Korea

PubMed Central

Park, Yong-Geun; Han, Seung Beom; Song, Sang Jun; Kim, Tae Jin

2012-01-01

Platelet-rich plasma (PRP) is a concentrate extract of platelets from autologous blood, and represents a possible treatment option for the stimulation and acceleration of soft-tissue healing and regeneration in orthopedics. Currently, the availability of devices for outpatient preparation and delivery contributes to the increase in the clinical use of PRP therapy in practical setting of orthopedic fields. However, there is still paucity of scientific evidence in the literature to prove efficacy of PRP therapy for the treatment of ligament or tendon problems around the knee joint. Moreover, strong evidence from well-designed clinical trials to support the PRP therapy for osteoarthritis of the knee joint is yet scanty in the literature. Scientific studies need to be performed to assess clinical indications, efficacy, and safety of PRP, and this will require high powered randomized controlled trials. Nonetheless, some hospitals exaggeratedly advertise PRP procedures as the ultimate treatment and a novel technology with abundant scientific evidence for the treatment of knee problems. As a matter of fact, PRP protocols are currently approved only for use in clinical trials and research, and are not allowed for treatment purpose by any institutions in Korea. At present, clinical use of PRP therapy for ligament or tendon problems or osteoarthritis of knee joint is defined as illegal medical practice, regardless of whether it is performed as a sole procedure or as a part of prolotherapy, because the safety and validity are not yet approved by the Ministry of Health and Welfare and Health Insurance Review and Assessment Service. Practicing physicians should remember that injection of PRP to patients by imposing medical charge is still illegal as per the current medical law in Korea. PMID:22708106

Progression through the spliceosome cycle requires Prp38p function for U4/U6 snRNA dissociation.

PubMed Central

Xie, J; Beickman, K; Otte, E; Rymond, B C

1998-01-01

The elaborate and energy-intensive spliceosome assembly pathway belies the seemingly simple chemistry of pre-mRNA splicing. Prp38p was previously identified as a protein required in vivo and in vitro for the first pre-mRNA cleavage reaction catalyzed by the spliceosome. Here we show that Prp38p is a unique component of the U4/U6.U5 tri-small nuclear ribonucleoprotein (snRNP) particle and is necessary for an essential step late in spliceosome maturation. Without Prp38p activity spliceosomes form, but arrest in a catalytically impaired state. Functional spliceosomes shed U4 snRNA before 5' splice-site cleavage. In contrast, Prp38p-defective spliceosomes retain U4 snRNA bound to its U6 snRNA base-pairing partner. Prp38p is the first tri-snRNP-specific protein shown to be dispensable for assembly, but required for conformational changes which lead to catalytic activation of the spliceosome. PMID:9582287

Ex vivo mammalian prions are formed of paired double helical prion protein fibrils.

PubMed

Terry, Cassandra; Wenborn, Adam; Gros, Nathalie; Sells, Jessica; Joiner, Susan; Hosszu, Laszlo L P; Tattum, M Howard; Panico, Silvia; Clare, Daniel K; Collinge, John; Saibil, Helen R; Wadsworth, Jonathan D F

2016-05-01

Mammalian prions are hypothesized to be fibrillar or amyloid forms of prion protein (PrP), but structures observed to date have not been definitively correlated with infectivity and the three-dimensional structure of infectious prions has remained obscure. Recently, we developed novel methods to obtain exceptionally pure preparations of prions from mouse brain and showed that pathogenic PrP in these high-titre preparations is assembled into rod-like assemblies. Here, we have used precise cell culture-based prion infectivity assays to define the physical relationship between the PrP rods and prion infectivity and have used electron tomography to define their architecture. We show that infectious PrP rods isolated from multiple prion strains have a common hierarchical assembly comprising twisted pairs of short fibres with repeating substructure. The architecture of the PrP rods provides a new structural basis for understanding prion infectivity and can explain the inability to systematically generate high-titre synthetic prions from recombinant PrP. © 2016 The Authors.

Cellular mechanisms responsible for cell-to-cell spreading of prions.

PubMed

Vilette, Didier; Courte, Josquin; Peyrin, Jean Michel; Coudert, Laurent; Schaeffer, Laurent; Andréoletti, Olivier; Leblanc, Pascal

2018-05-14

Prions are infectious agents that cause fatal neurodegenerative diseases. Current evidence indicates that they are essentially composed of an abnormally folded protein (PrP Sc ). These abnormal aggregated PrP Sc species multiply in infected cells by recruiting and converting the host PrP C protein into new PrP Sc . How prions move from cell to cell and progressively spread across the infected tissue is of crucial importance and may provide experimental opportunity to delay the progression of the disease. In infected cells, different mechanisms have been identified, including release of infectious extracellular vesicles and intercellular transfer of PrP Sc -containing organelles through tunneling nanotubes. These findings should allow manipulation of the intracellular trafficking events targeting PrP Sc in these particular subcellular compartments to experimentally address the relative contribution of these mechanisms to in vivo prion pathogenesis. In addition, such information may prompt further experimental strategies to decipher the causal roles of protein misfolding and aggregation in other human neurodegenerative diseases.

Evaluation of a group cognitive-behavioral depression prevention program for young adolescents: a randomized effectiveness trial.

PubMed

Gillham, Jane E; Reivich, Karen J; Brunwasser, Steven M; Freres, Derek R; Chajon, Norma D; Kash-Macdonald, V Megan; Chaplin, Tara M; Abenavoli, Rachel M; Matlin, Samantha L; Gallop, Robert J; Seligman, Martin E P

2012-01-01

Depression is a common psychological problem in adolescence. Recent research suggests that group cognitive-behavioral interventions can reduce and prevent symptoms of depression in youth. Few studies have tested the effectiveness of such interventions when delivered by school teachers and counselors (as opposed to research team staff). We evaluated the effectiveness of the Penn Resiliency Program for adolescents (PRP-A), a school-based group intervention that targets cognitive behavioral risk factors for depression. We randomly assigned 408 middle school students (ages 10-15) to one of three conditions: PRP-A, PRP-AP (in which adolescents participated in PRP-A and parents were invited to attend a parent intervention component), or a school-as-usual control. Adolescents completed measures of depression and anxiety symptoms, cognitive style, and coping at baseline, immediately after the intervention, and at 6-month follow-up. PRP-A reduced depression symptoms relative to the school as usual control. Baseline levels of hopelessness moderated intervention effects. Among participants with average and high levels of hopelessness, PRP (A and AP) significantly improved depression symptoms, anxiety symptoms, hopelessness, and active coping relative to control. Among participants with low baseline hopelessness, we found no intervention effects. PRP-AP was not more effective than PRP-A alone. We found no intervention effects on clinical levels of depression or anxiety. These findings suggest that cognitive-behavioral interventions can be beneficial when delivered by school teachers and counselors. These interventions may be most helpful to students with elevated hopelessness.

Study of a Two-Step Centrifugation Protocol for Concentrating Cells and Growth Factors in Bovine Platelet-Rich Plasma

PubMed Central

Gutiérrez, Claudia M.; López, Catalina

2017-01-01

There is a lack of information about the methods used for bovine platelet-rich plasma (PRP)/platelet-rich gel (PRG) procurement, including information on platelet (PLT), white blood cell (WBC) in PRP, and growth factor release from PRG supernatants. The aims of this study were to compare and to correlate the PLT, WBC, transforming growth factor beta-1 (TGF-β1), and platelet-derived growth factor BB (PDGF-BB) concentrations in bovine whole blood, plasma, and four PRP layers and their respective PRG supernatants: A and B (obtained by a single centrifugation tube method at 720g/5 min) and C and D (obtained by a double centrifugation tube method, by using two centrifugation episodes at 720g/5 min). PLT and WBC counts were significantly higher in PRP-C, followed by whole blood, PRP-A, PRP-B, and PRP-D. TGF-β1 concentrations were significantly higher in PRG-B supernatants and its correspondent PRP-B lysate when compared to the other PRG supernatants and plasma. Supernatants from PRG-A, PRG-B, and PRG-D had equivalent TGF-β1 concentrations. PDGF-BB concentrations were not statistically different between the hemoderivatives. Significant Pearson correlations were noted between PLT counts and WBC counts (0.8) and between PLT counts and PLT distribution width (0.6). Further studies should be performed to assess the potential clinical applications of these PRPs. PMID:29214094

Does the Use of Platelet-Rich Plasma at the Time of Surgery Improve Clinical Outcomes in Arthroscopic Rotator Cuff Repair When Compared With Control Cohorts? A Systematic Review of Meta-analyses.

PubMed

Saltzman, Bryan M; Jain, Akshay; Campbell, Kirk A; Mascarenhas, Randy; Romeo, Anthony A; Verma, Nikhil N; Cole, Brian J

2016-05-01

The aims of the study were as follows: (1) to perform a systematic review of meta-analyses evaluating platelet-rich plasma (PRP) use at the time of arthroscopic rotator cuff repair surgery and to determine its effect on retear rates and clinical outcomes; (2) to provide a framework for the analysis and interpretation of the best currently available evidence; and (3) to identify gaps within the literature where suggestions for continued investigational efforts would be valid. Literature searches were performed to identify meta-analyses examining arthroscopic rotator cuff repairs augmented with PRP versus control (no PRP). Clinical data were extracted and meta-analysis quality was assessed using the Quality of Reporting of Meta-analyses and Oxman-Guyatt scales. Seven meta-analyses met inclusion and exclusion criteria. All were considered as being of similar quality with Quality of Reporting of Meta-analyses scores >15 and Oxman scores of 7. A total of 3,193 overlapping patients treated were included with mean follow-up from 12 to 31 months. When compared with control patients, use of PRP at the time of rotator cuff repair did not result in significantly lower overall retear rates or improved clinical outcome scores. The following postoperative functional scores comparing PRP versus control were reported: Constant (no significant difference demonstrated with PRP use in 5 of 6 reporting meta-analyses), University of California - Los Angeles (no difference, 6 of 6), American Shoulder and Elbow Society (no difference, 4 of 4), and Simple Shoulder Test (no difference, 3 of 5). Subgroup analysis performed by 3 meta-analyses showed evidence of improved outcomes with solid PRP matrix versus liquid, small- and/or medium-sized versus large and/or massive tears, PRP application at the tendon-bone interface versus over tendon, and in the setting of double-row versus single-row rotator cuff. The current highest level of evidence suggests that PRP use at the time of arthroscopic rotator cuff repair does not universally improve retear rates or affect clinical outcome scores. However, the effects of PRP use on retear rates trend toward beneficial outcomes if evaluated in the context of the following specific variables: use of a solid PRP matrix; application of PRP at the tendon-bone interface; in double-row repairs; and with small- and/or medium-sized rotator cuff tears. Level III, systematic review of Level II and III studies. Copyright © 2016 Arthroscopy Association of North America. Published by Elsevier Inc. All rights reserved.

Site-Specific Targeting of Platelet-Rich Plasma via Superparamagnetic Nanoparticles

PubMed Central

Talaie, Tara; Pratt, Stephen J.P.; Vanegas, Camilo; Xu, Su; Henn, R. Frank; Yarowsky, Paul; Lovering, Richard M.

2015-01-01

Background: Muscle strains are one of the most common injuries treated by physicians. Standard conservative therapy for acute muscle strains usually involves short-term rest, ice, and nonsteroidal anti-inflammatory medications, but there is no clear consensus regarding treatments to accelerate recovery. Recently, clinical use of platelet-rich plasma (PRP) has gained momentum as an option for therapy and is appealing for many reasons, most notably because it provides growth factors in physiological proportions and it is autologous, safe, easily accessible, and potentially beneficial. Local delivery of PRP to injured muscles can hasten recovery of function. However, specific targeting of PRP to sites of tissue damage in vivo is a major challenge that can limit its efficacy. Hypothesis: Location of PRP delivery can be monitored and controlled in vivo with noninvasive tools. Study Design: Controlled laboratory study. Methods: Superparamagnetic iron oxide nanoparticles (SPIONs) can be visualized by both magnetic resonance imaging (MRI) (in vivo) and fluorescence microscopy (after tissue harvesting). PRP was labeled with SPIONs and administered by intramuscular injections of SPION-containing platelets. MRI was used to monitor the ability to manipulate and retain the location of PRP in vivo by placement of an external magnet. Platelets were isolated from whole blood and incubated with SPIONs. Following SPION incubation with PRP, a magnetic field was used to manipulate platelet location in culture dishes. In vivo, the tibialis anterior (TA) muscles of anesthetized Sprague-Dawley rats were injected with SPION-containing platelets, and MRI was used to track platelet position with and without a magnet worn over the TA muscles for 4 days. Results: The method used to isolate PRP yielded a high concentration (almost 4-fold increase) of platelets. In vitro experiments showed that the platelets successfully took up SPIONs and then rapidly responded to an applied magnetic field. Platelets without SPIONs did not respond to the magnetic field. In vivo experiments showed that the SPION-containing platelets can be noninvasively maintained at a specific site with the application of a magnetic field. Conclusion: PRP may be a useful product in the clinical treatment of muscle injuries, but one problem with using it as a therapeutic tool is retaining PRP at the site of injury. This study proposes a potential solution, with findings that support this method at the cell, whole muscle, and in vivo levels. Controlling the location of PRP will allow the clustering of PRP to enrich the target area with growth factors and will prevent loss of platelets over time at the site of injury. PMID:25664326

[Assessment study on a set of platelet-rich plasma preparation].

PubMed

Li, Ming; Zhang, Changqing; Yuan, Ting; Chen, Shengbao; Lü, Ruju

2011-01-01

To calculate the recovery rate and enrichment factor and to analyse the correlation by measuring the concentrations of platelets, leukocyte, and growth factors in platelet-rich plasma (PRP) so as to evaluate the feasibility and stability of a set of PRP preparation. The peripheral blood (40 mL) was collected from 30 volunteers accorded with the inclusion criteria, and then 4 mL PRP was prepared using the package produced by Shandong Weigao Group Medical Polymer Company Limited. Automatic hematology analyzer was used to count the concentrations of platelets and leukocyte in whole blood and PRP. The enrichment factor and recovery rate of platelets or leukocyte were calculated; the platelet and leukocyte concentrations of male and female volunteers were measured, respectively. The concentrations of platelet-derived growth factor (PDGF), transforming growth factor beta (TGF-beta), and vascular endothelial growth factor (VEGF) were assayed by ELISA. The platelet concentrations of whole blood and PRP were (131.40 +/- 29.44) x 10(9)/L and (819.47 +/- 136.32) x 10(9)/L, respectively, showing significant difference (t = 27.020, P = 0.000). The recovery rate of platelets was 60.85% +/- 8.97%, and the enrichment factor was 6.40 +/- 1.06. The leukocyte concentrations of whole blood and PRP were (5.57 +/- 1.91) x 10(12)/L and (32.20 +/- 10.42) x 10(12)/L, respectively, showing significant difference (t = 13.780, P = 0.000). The recovery rate of leukocyte was 58.30% +/- 19.24%, and the enrichment factor was 6.10 +/- 1.93. The concentrations of platelets and leukocyte in PRP were positively correlated with the platelet concentration (r = 0.652, P = 0.000) and leukocyte concentration (r = 0.460, P = 0.011) in whole blood. The concentrations of platelet and leukocyte in PRP between male and female were not significantly different (P > 0.05). The concentrations of PDGF, TGF-beta, and VEGF in PRP were (698.15 +/- 64.48), (681.36 +/- 65.90), and (1071.55 +/- 106.04) ng/mL, which were (5.67 +/- 1.18), (6.99 +/- 0.61), and (5.74 +/- 0.83) times higher than those in the whole blood, respectively. PDGF concentration (r = 0.832, P = 0.020), TGF-beta concentration (r = 0.835, P = 0.019), and VEGF concentration (r = 0.824, P = 0.023) in PRP were positively correlated with platelet concentration of PRP. PRP with high concentrations of platelets, white blood cells and growth factors can be prepared stably by this package.

Chronic wasting disease and atypical forms of BSE and scrapie are not transmissible to mice expressing wild-type levels of human PrP

USDA-ARS?s Scientific Manuscript database

The association between bovine spongiform encephalopathy (BSE) and variant Creutzfeldt-Jakob disease (vCJD) has demonstrated that cattle TSEs can pose a risk to human health and raises the possibility that other ruminant TSEs may be transmissible to humans. In recent years, several new TSEs in shee...

Mammalian prions: tolerance to sequence changes-how far?

PubMed

Salamat, Muhammad Khalid; Munoz-Montesino, Carola; Moudjou, Mohammed; Rezaei, Human; Laude, Hubert; Béringue, Vincent; Dron, Michel

2013-01-01

Upon prion infection, abnormal prion protein (PrP (Sc) ) self-perpetuate by conformational conversion of α-helix-rich PrP (C) into β sheet enriched form, leading to formation and deposition of PrP (Sc) aggregates in affected brains. However the process remains poorly understood at the molecular level and the regions of PrP critical for conversion are still debated. Minimal amino acid substitutions can impair prion replication at many places in PrP. Conversely, we recently showed that bona fide prions could be generated after introduction of eight and up to 16 additional amino acids in the H2-H3 inter-helix loop of PrP. Prion replication also accommodated the insertions of an octapeptide at different places in the last turns of H2. This reverse genetic approach reveals an unexpected tolerance of prions to substantial sequence changes in the protease-resistant part which is associated with infectivity. It also demonstrates that conversion does not require the presence of a specific sequence in the middle of the H2-H3 area. We discuss the implications of our findings according to different structural models proposed for PrP (Sc) and questioned the postulated existence of an N- or C-terminal prion domain in the protease-resistant region.

Soluble Aβ aggregates can inhibit prion propagation.

PubMed

Sarell, Claire J; Quarterman, Emma; Yip, Daniel C-M; Terry, Cassandra; Nicoll, Andrew J; Wadsworth, Jonathan D F; Farrow, Mark A; Walsh, Dominic M; Collinge, John

2017-11-01

Mammalian prions cause lethal neurodegenerative diseases such as Creutzfeldt-Jakob disease (CJD) and consist of multi-chain assemblies of misfolded cellular prion protein (PrP C ). Ligands that bind to PrP C can inhibit prion propagation and neurotoxicity. Extensive prior work established that certain soluble assemblies of the Alzheimer's disease (AD)-associated amyloid β-protein (Aβ) can tightly bind to PrP C , and that this interaction may be relevant to their toxicity in AD. Here, we investigated whether such soluble Aβ assemblies might, conversely, have an inhibitory effect on prion propagation. Using cellular models of prion infection and propagation and distinct Aβ preparations, we found that the form of Aβ assemblies which most avidly bound to PrP in vitro also inhibited prion infection and propagation. By contrast, forms of Aβ which exhibit little or no binding to PrP were unable to attenuate prion propagation. These data suggest that soluble aggregates of Aβ can compete with prions for binding to PrP C and emphasize the bidirectional nature of the interplay between Aβ and PrP C in Alzheimer's and prion diseases. Such inhibitory effects of Aβ on prion propagation may contribute to the apparent fall-off in the incidence of sporadic CJD at advanced age where cerebral Aβ deposition is common. © 2017 The Authors.

The use of platelet-rich plasma to augment conservative and surgical treatment of hip and pelvic disorders

PubMed Central

Kraeutler, Matthew J.; Garabekyan, Tigran; Mei-Dan, Omer

2016-01-01

Summary Background In recent years, platelet-rich plasma (PRP) has gained popularity within the orthopaedic community as a treatment modality to enhance tissue healing. Purpose This review aims to concisely present the current indications for PRP injections in the treatment of hip and pelvic pathologies and to describe some novel applications for PRP which have not yet been reported in the literature. Methods We reviewed the literature on the non-operative and operative indications for PRP in the treatment of hip and pelvic pathologies. Conclusions With regard to hip and pelvic pathologies, PRP injections are used most commonly as a non-operative intervention, and have been described in the literature to treat osteoarthritis of the hip joint as well as tendinopathy of the hamstrings, adductor longus, and gluteus medius. In contrast, most of the surgical applications of PRP for the hip are novel, with few reported studies in the literature. Because of the increasing awareness of PRP’s beneficial effects on musculoskeletal healing and thus the growing number of indications for its use, this review also describes some novel applications for PRP, including osteitis pubis, post-microfracture of the hip, tears of the rectus femoris, and avulsion of the sartorius muscle. Level of evidence V. PMID:28066748

Effect of diabetic retinopathy and panretinal photocoagulation on retinal nerve fiber layer and optic nerve appearance.

PubMed

Lim, Michele C; Tanimoto, Suzana A; Furlani, Bruno A; Lum, Brent; Pinto, Luciano M; Eliason, David; Prata, Tiago S; Brandt, James D; Morse, Lawrence S; Park, Susanna S; Melo, Luiz A S

2009-07-01

To determine if panretinal photocoagulation (PRP) alters retinal nerve fiber layer (RNFL) thickness and optic nerve appearance. Patients with diabetes who did and did not undergo PRP and nondiabetic control subjects were enrolled in a prospective study. Participants underwent optical coherence tomography of the peripapillary retina and optic nerve. Stereoscopic optic nerve photographs were graded in a masked fashion. Ninety-four eyes of 48 healthy individuals, 89 eyes of 55 diabetic patients who did not undergo PRP, and 37 eyes of 24 subjects with diabetes who underwent PRP were included in this study. Eyes that had been treated with PRP had thinner peripapillary RNFL compared with the other groups; this was statistically significantly different in the inferior (P = .004) and nasal (P = .003) regions. Optic nerve cupping did not increase with severity of disease classification, but the proportion of optic nerves graded as suspicious for glaucoma or as having nonglaucomatous optic neuropathy did (P = .008). These grading categories were associated with thinner RNFL measurements. Diabetic eyes that have been treated with PRP have thinner RNFL than nondiabetic eyes. Optic nerves in eyes treated with PRP are more likely to be graded as abnormal, but their appearance is not necessarily glaucomatous and may be related to thinning of the RNFL.

Prion disease susceptibility is affected by β-structure folding propensity and local side-chain interactions in PrP

PubMed Central

Khan, M. Qasim; Sweeting, Braden; Mulligan, Vikram Khipple; Arslan, Pharhad Eli; Cashman, Neil R.; Pai, Emil F.; Chakrabartty, Avijit

2010-01-01

Prion diseases occur when the normally α-helical prion protein (PrP) converts to a pathological β-structured state with prion infectivity (PrPSc). Exposure to PrPSc from other mammals can catalyze this conversion. Evidence from experimental and accidental transmission of prions suggests that mammals vary in their prion disease susceptibility: Hamsters and mice show relatively high susceptibility, whereas rabbits, horses, and dogs show low susceptibility. Using a novel approach to quantify conformational states of PrP by circular dichroism (CD), we find that prion susceptibility tracks with the intrinsic propensity of mammalian PrP to convert from the native, α-helical state to a cytotoxic β-structured state, which exists in a monomer–octamer equilibrium. It has been controversial whether β-structured monomers exist at acidic pH; sedimentation equilibrium and dual-wavelength CD evidence is presented for an equilibrium between a β-structured monomer and octamer in some acidic pH conditions. Our X-ray crystallographic structure of rabbit PrP has identified a key helix-capping motif implicated in the low prion disease susceptibility of rabbits. Removal of this capping motif increases the β-structure folding propensity of rabbit PrP to match that of PrP from mouse, a species more susceptible to prion disease. PMID:21041683

Prion disease susceptibility is affected by beta-structure folding propensity and local side-chain interactions in PrP.

PubMed

Khan, M Qasim; Sweeting, Braden; Mulligan, Vikram Khipple; Arslan, Pharhad Eli; Cashman, Neil R; Pai, Emil F; Chakrabartty, Avijit

2010-11-16

Prion diseases occur when the normally α-helical prion protein (PrP) converts to a pathological β-structured state with prion infectivity (PrP(Sc)). Exposure to PrP(Sc) from other mammals can catalyze this conversion. Evidence from experimental and accidental transmission of prions suggests that mammals vary in their prion disease susceptibility: Hamsters and mice show relatively high susceptibility, whereas rabbits, horses, and dogs show low susceptibility. Using a novel approach to quantify conformational states of PrP by circular dichroism (CD), we find that prion susceptibility tracks with the intrinsic propensity of mammalian PrP to convert from the native, α-helical state to a cytotoxic β-structured state, which exists in a monomer-octamer equilibrium. It has been controversial whether β-structured monomers exist at acidic pH; sedimentation equilibrium and dual-wavelength CD evidence is presented for an equilibrium between a β-structured monomer and octamer in some acidic pH conditions. Our X-ray crystallographic structure of rabbit PrP has identified a key helix-capping motif implicated in the low prion disease susceptibility of rabbits. Removal of this capping motif increases the β-structure folding propensity of rabbit PrP to match that of PrP from mouse, a species more susceptible to prion disease.

Platelet-rich plasma for arthroscopic repair of medium to large rotator cuff tears: a randomized controlled trial.

PubMed

Jo, Chris Hyunchul; Shin, Ji Sun; Shin, Won Hyoung; Lee, Seung Yeon; Yoon, Kang Sup; Shin, Sue

2015-09-01

Two main questions about the use of platelet-rich plasma (PRP) for regeneration purposes are its effect on the speed of healing and the quality of healing. Despite recent numerous studies, evidence is still lacking in this area, especially in a representative patient population with medium to large rotator cuff tears. To assess the efficacy of PRP augmentation on the speed and quality of healing in patients undergoing arthroscopic repair for medium to large rotator cuff tears. Randomized controlled trial; Level of evidence, 1. A total of 74 patients scheduled for arthroscopic repair of medium to large rotator cuff tears were randomly assigned to undergo either PRP-augmented repair (PRP group) or conventional repair (conventional group). In the PRP group, 3 PRP gels (3 × 3 mL) were applied to each patient between the torn end and the greater tuberosity. The primary outcome was the Constant score at 3 months after surgery. Secondary outcome measures included the visual analog scale (VAS) for pain, range of motion (ROM), muscle strength, overall satisfaction and function, functional scores, retear rate, and change in the cross-sectional area (CSA) of the supraspinatus muscle. There was no difference between the 2 groups in the Constant score at 3 months (P > .05). The 2 groups had similar results on the VAS for pain, ROM, muscle strength, overall satisfaction and function, and other functional scores (all P > .05) except for the VAS for worst pain (P = .043). The retear rate of the PRP group (3.0%) was significantly lower than that of the conventional group (20.0%) (P = .032). The change in 1-year postoperative and immediately postoperative CSAs was significantly different between the 2 groups: -36.76 ± 45.31 mm(2) in the PRP group versus -67.47 ± 47.26 mm(2) in the conventional group (P = .014). Compared with repairs without PRP augmentation, the current PRP preparation and application methods for medium to large rotator cuff repairs significantly improved the quality, as evidenced by a decreased retear rate and increased CSA of the supraspinatus, but not the speed of healing. However, further studies may be needed to investigate the effects of PRP on the speed of healing without risking the quality. © 2015 The Author(s).

Effects of a naturally occurring amino acid substitution in bovine PrP: a model for inherited prion disease in a natural host species

USDA-ARS?s Scientific Manuscript database

The most common hereditary prion disease is human Creutzfeldt-Jakob disease (CJD) associated with a mutation in the prion gene (PRNP) resulting in a glutamic acid to lysine substitution at position 200 (E200K) in the prion protein. Models of E200K CJD in transgenic mice have proven interesting but h...

Widespread Use of Non-productive Alternative Splice Sites in Saccharomyces cerevisiae

PubMed Central

Kawashima, Tadashi; Douglass, Stephen; Gabunilas, Jason; Pellegrini, Matteo; Chanfreau, Guillaume F.

2014-01-01

Saccharomyces cerevisiae has been used as a model system to investigate the mechanisms of pre-mRNA splicing but only a few examples of alternative splice site usage have been described in this organism. Using RNA-Seq analysis of nonsense-mediated mRNA decay (NMD) mutant strains, we show that many S. cerevisiae intron-containing genes exhibit usage of alternative splice sites, but many transcripts generated by splicing at these sites are non-functional because they introduce premature termination codons, leading to degradation by NMD. Analysis of splicing mutants combined with NMD inactivation revealed the role of specific splicing factors in governing the use of these alternative splice sites and identified novel functions for Prp17p in enhancing the use of branchpoint-proximal upstream 3′ splice sites and for Prp18p in suppressing the usage of a non-canonical AUG 3′-splice site in GCR1. The use of non-productive alternative splice sites can be increased in stress conditions in a promoter-dependent manner, contributing to the down-regulation of genes during stress. These results show that alternative splicing is frequent in S. cerevisiae but masked by RNA degradation and that the use of alternative splice sites in this organism is mostly aimed at controlling transcript levels rather than increasing proteome diversity. PMID:24722551

Short term storage stability at room temperature of two different platelet-rich plasma preparations from equine donors and potential impact on growth factor concentrations.

PubMed

Hauschild, Gregor; Geburek, Florian; Gosheger, Georg; Eveslage, Maria; Serrano, Daniela; Streitbürger, Arne; Johannlükens, Sara; Menzel, Dirk; Mischke, Reinhard

2017-01-05

The increasing interest in platelet-rich plasma (PRP) based therapies is as yet accompanied by inconsistent information regarding nearly all aspects of handling and application. Among these storage stability of processed platelet-rich products may be the basis for a more flexible application mode. The objective of this study was (1) to estimate the storage stability of growth factors platelet derived growth factor BB (PDGF-BB) and transforming growth factor ß1 (TGF-ß1) in both, a single-step softspin centrifugation-based pure-PRP (P-PRP, ACP®), and a gravity filtration system-based leukocyte-rich-PRP (L-PRP, E-PET), over a six hours time span after preparation at room temperature and (2) to identify possible factors influencing these growth factor concentrations in an equine model. Growth factor concentrations remained stable over the entire investigation period in L-PRP as well as P-PRP preparations revealing a mean of 3569 pg/ml PDGF-BB for E-PET and means of 1276 pg/ml PDGF-BB and 5086 pg/ml TGF-ß1 for ACP®. Pearson correlations yielded no significant impact of whole blood platelet (PLT), white blood cell (WBC) and red blood cell (RBC) counts on resulting cytokine values. In case of ACP® no significant dependencies between PLT, WBC and RBC counts of the processed platelet-rich product and resulting cytokine content occurred with exception of TGF-ß1 concentrations showing a strong correlation with the WBC content. PDGF-BB content of E-PET preparations showed a strong positive correlation with PLT and a strong negative with WBC of these preparations but not with RBC. L-PRP ad modum E-PET and P-PRP ad modum ACP® are applicable over at least a six hours time span at room temperature without loss of growth factor content. Based on the results of this study factors influencing the resulting growth factor concentrations still remain questionable. Additional studies implicating a further standardization of preparation protocols are necessary to identify consistent impact on cytokine content after PRP processing.

Platelet-rich plasma in orthopedic therapy: a comparative systematic review of clinical and experimental data in equine and human musculoskeletal lesions.

PubMed

Brossi, Patrícia M; Moreira, Juliana J; Machado, Thaís S L; Baccarin, Raquel Y A

2015-04-22

This systematic review aimed to present and critically appraise the available information on the efficacy of platelet rich plasma (PRP) in equine and human orthopedic therapeutics and to verify the influence of study design and methodology on the assumption of PRP's efficacy. We searched Medline, PubMed, Embase, Bireme and Google Scholar without restrictions until July 2013. Randomized trials, human cohort clinical studies or case series with a control group on the use of PRP in tendons, ligaments or articular lesions were included. Equine clinical studies on the same topics were included independently of their design. Experimental studies relevant to the clarification of PRP's effects and mechanisms of action in tissues of interest, conducted in any animal species, were selected. This review included 123 studies. PRP's beneficial effects were observed in 46.7% of the clinical studies, while the absence of positive effects was observed in 43.3%. Among experimental studies, 73% yielded positive results, and 7.9% yielded negative results. The most frequent flaws in the clinical trials' designs were the lack of a true placebo group, poor product characterization, insufficient blinding, small sampling, short follow-up periods, and adoption of poor outcome measures. The methods employed for PRP preparation and administration and the selected outcome measures varied greatly. Poor study design was a common feature of equine clinical trials. From studies in which PRP had beneficial effects, 67.8% had an overall high risk of bias. From the studies in which PRP failed to exhibit beneficial effects, 67.8% had an overall low risk of bias. Most experimental studies revealed positive effects of PRP. Although the majority of equine clinical studies yielded positive results, the human clinical trials' results failed to corroborate these findings. In both species, beneficial results were more frequently observed in studies with a high risk of bias. The use of PRP in musculoskeletal lesions, although safe and promising, has still not shown strong evidence in clinical scenarios.

The effect of corticosteroid versus platelet-rich plasma injection therapies for the management of lateral epicondylitis: A systematic review

PubMed Central

Ben-Nafa, Walid; Munro, Wendy

2018-01-01

Introduction: Lateral epicondylitis is a common musculoskeletal disorder of the upper limb. Corticosteroid injection has been widely used as a major mode of treatment. However, better understanding of the pathophysiology of the disease led to a major change in treating the disease, with new options including platelet-rich plasma (PRP) are currently used. Objectives/research aim: To systematically evaluate the effect of corticosteroid versus PRP injections for the treatment of LE. Hypothesis: PRP injections provide longer-term therapeutic effect and less rate of complications compared to corticosteroid injection. Level of evidence: Level 2 evidence (4 included studies are of level 1 evidence, 1 study of level 2 evidence). Design: Systematic Review (according to PRISMA guidelines). Methods: Eleven databases used to search for relevant primary studies comparing the effects of corticosteroid and PRP injections for the treatment of LE. Quality appraisal of studies performed using Cochrane Handbook for Systematic Reviews of Interventions Version 5.1.0, CASP Randomised Controlled Trial Checklist, and SIGN Methodology Checklist 2. Results: 732 papers were identified. Five randomised controlled trials (250 Patients) met the inclusion criteria. Clinical findings: Corticosteroid injections provided rapid symptomatic improvement with maximum effect at 6/8/8 weeks before symptoms recurrence, whereas PRP showed slower ongoing improvements up to 24/52/104 weeks(3 studies). Corticosteroid showed more rapid symptomatic improvement of symptoms compared to PRP up to the study end-point of 3 months(1 study). Comparable therapeutic effects of corticosteroid and PRP were observed at 6 weeks(1 study). Ultrasonographic Findings: (1) Doppler activity decreased more significantly in patients who received corticosteroid compared to PRP. (2) Reduced tendon thickness and more patients with cortical erosion noted in corticosteroid group whereas increased tendon thickness and less number of patients with common extensor tendon tears noted in PRP group. (3) Fewer patients reported Probe-induced tenderness and oedema in the common extensor tendon in both corticosteroid and PRP groups (2 studies). Conclusion: Corticosteroid injections provide rapid therapeutic effect in the short-term with recurrence of symptoms afterwards, compared to the relatively slower but longer-term effect of platelet-rich plasma. PMID:29561260

Expression profiles of putative defence-related proteins in oil palm (Elaeis guineensis) colonized by Ganoderma boninense.

PubMed

Tan, Yung-Chie; Yeoh, Keat-Ai; Wong, Mui-Yun; Ho, Chai-Ling

2013-11-01

Basal stem rot (BSR) is a major disease of oil palm caused by a pathogenic fungus, Ganoderma boninense. However, the interaction between the host plant and its pathogen is not well characterized. To better understand the response of oil palm to G. boninense, transcript profiles of eleven putative defence-related genes from oil palm were measured by quantitative reverse-transcription (qRT)-PCR in the roots of oil palms treated with G. boninense from 3 to 12 weeks post infection (wpi). These transcripts encode putative Bowman-Birk serine protease inhibitors (EgBBI1 and 2), defensin (EgDFS), dehydrin (EgDHN), early methionine-labeled polypeptides (EgEMLP1 and 2), glycine-rich RNA binding protein (EgGRRBP), isoflavone reductase (EgIFR), metallothionein-like protein (EgMT), pathogenesis-related-1 protein (EgPRP), and type 2 ribosome-inactivating protein (EgT2RIP). The transcript abundance of EgBBI2 increased in G. boninense-treated roots at 3 and 6wpi compared to those of controls; while the transcript abundance of EgBBI1, EgDFS, EgEMLP1, EgMT, and EgT2RIP increased in G. boninense-treated roots at 6 or 12wpi. Meanwhile, the gene expression of EgDHN was up-regulated at all three time points in G. boninense-treated roots. The expression profiles of the eleven transcripts were also studied in leaf samples upon inoculation of G. boninense and Trichoderma harzianum to identify potential biomarkers for early detection of BSR. Two candidate genes (EgEMLP1 and EgMT) that have different profiles in G. boninense-treated leaves compared to those infected by T. harzianum may have the potential to be developed as biomarkers for early detection of G. boninense infection. Copyright © 2013 Elsevier GmbH. All rights reserved.

Platelet-Rich Plasma Treatment With Physical Therapy in Chronic Partial Supraspinatus Tears.

PubMed

Ilhanli, Ilker; Guder, Necip; Gul, Murat

2015-09-01

Despite the insufficient evidence, due to potential contribution to the improvement, platelet-rich plasma (PRP) is emerging as a promising method. The aim of this study was to assess the effectiveness of PRP injection in partial supraspinatus tears by comparing with physical therapy (PT). Seventy patients with chronic partial supraspinatus tears in magnetic resonance imaging were randomized into two groups; PRP (n = 35) and PT (n = 35). Before the treatment, at the end of the treatment and at the 12th month after the end of the treatment, range of motion (ROM), visual analog scale (VAS) for pain, Disabilities of Arm, Shoulder and Hand questionnaire (DASH), Neer's, Hawkins' and drop arm tests and Beck Depression Inventory were investigated. Statistical analysis was made for 62 subjects (PRP group, n = 30; PT group, n = 32). There were no differences between the groups according to demographic data. At the 12th month after the end of the treatment, significant improvement in ROM was detected in both groups, pain was reduced significantly in both groups and improvement of the DASH score was observed in both groups. At all the evaluation steps, increases in ROM degrees were significantly higher in the PT group than the PRP group. For VAS in activity and in rest, after the treatment, improvement was higher in the PT group than the PRP group. However, improvement of the DASH score of the PRP group was significantly better than the PT group. When we compared with PT, PRP seemed to be a well-tolerated application which showed promising results in patients with chronic partial supraspinatus tears.

PARot--assessing platelet-rich plasma plus arthroscopic subacromial decompression in the treatment of rotator cuff tendinopathy: study protocol for a randomized controlled trial.

PubMed

Carr, Andrew; Cooper, Cushla; Murphy, Richard; Watkins, Bridget; Wheway, Kim; Rombach, Ines; Beard, David

2013-06-11

Platelet-rich plasma (PRP) is an autologous platelet concentrate. It is prepared by separating the platelet fraction of whole blood from patients and mixing it with an agent to activate the platelets. In a clinical setting, PRP may be reapplied to the patient to improve and hasten the healing of tissue. The therapeutic effect is based on the presence of growth factors stored in the platelets. Current evidence in orthopedics shows that PRP applications can be used to accelerate bone and soft tissue regeneration following tendon injuries and arthroplasty. Outcomes include decreased inflammation, reduced blood loss and post-treatment pain relief. Recent shoulder research indicates there is poor vascularization present in the area around tendinopathies and this possibly prevents full healing capacity post surgery (Am J Sports Med36(6):1171-1178, 2008). Although it is becoming popular in other areas of orthopedics there is little evidence regarding the use of PRP for shoulder pathologies. The application of PRP may help to revascularize the area and consequently promote tendon healing. Such evidence highlights an opportunity to explore the efficacy of PRP use during arthroscopic shoulder surgery for rotator cuff pathologies. PARot is a single center, blinded superiority-type randomized controlled trial assessing the clinical outcomes of PRP applications in patients who undergo shoulder surgery for rotator cuff disease. Patients will be randomized to one of the following treatment groups: arthroscopic subacromial decompression surgery or arthroscopic subacromial decompression surgery with application of PRP. Current Controlled Trials: ISRCTN10464365.

Evaluation of a group cognitive-behavioral depression prevention program for young adolescents: A randomized effectiveness trial

PubMed Central

Gillham, Jane E.; Reivich, Karen J.; Brunwasser, Steven M.; Freres, Derek R.; Chajon, Norma D.; Megan Kash-MacDonald, V.; Chaplin, Tara M.; Abenavoli, Rachel M.; Matlin, Samantha L.; Gallop, Robert J.; Seligman, Martin E.P.

2015-01-01

Objective Depression is a common psychological problem in adolescence. Recent research suggests that group cognitive-behavioral interventions can reduce and prevent symptoms of depression in youth. Few studies have tested the effectiveness of such interventions when delivered by school teachers and counselors (as opposed to research team staff). Method We evaluated the effectiveness of the Penn Resiliency Program for adolescents (PRP-A), a school-based group intervention that targets cognitive behavioral risk factors for depression. We randomly assigned 408 middle school students (ages 10-15) to one of three conditions: PRP-A, PRP-AP (in which adolescents participated in PRP-A and parents were invited to attend a parent intervention component), or a school-as-usual control. Adolescents completed measures of depression and anxiety symptoms, cognitive style, and coping at baseline, immediately after the intervention, and at 6-month follow-up. Results PRP-A reduced depression symptoms relative to the school as usual control. Baseline levels of hopelessness moderated intervention effects. Among participants with average and high levels of hopelessness, PRP (A and AP) significantly improved depression symptoms, anxiety symptoms, hopelessness, and active coping relative to control. Among participants with low baseline hopelessness, we found no intervention effects. PRP-AP was not more effective than PRP-A alone. We found no intervention effects on clinical levels of depression or anxiety. Conclusion These findings suggest that cognitive-behavioral interventions can be beneficial when delivered by school teachers and counselors. These interventions may be most helpful to students with elevated hopelessness. PMID:22889296

Effects of washed platelets vs platelet-rich plasma on the proliferation and mineralization of rat dental pulp cells.

PubMed

Zhang, L; Xie, Y H; Lin, B R

2015-08-14

We examined the effects of washed platelets (WPLTs) and platelet-rich plasma (PRP) on the proliferation and mineralization of rat dental pulp cells. Rat dental pulp cells were separated, cultured, and identified. Medium containing 1, 10, 100, or 500 mL/L PRP or WPLTs was added to 4th generation cells. The MTS method was used to determine cell proliferation. Alizarin red staining was used to observe the formation of mineralized nodules after cell mineralization and induction for 10 and 20 days under different culture conditions, and the areas of the mineralized nodules formed 20 days after induction were computed. The addition of 1, 10, and 100 mL/L WPLTs or PRP significantly promoted rat dental pulp cell proliferation (P < 0.05) whereas 500 mL/L WPLTs or PRP had no significant effect (P > 0.05). Under the same concentrations, no significant differences on cell proliferation were observed between WPLT and PRP treatments (P > 0.05 in all groups). After 10 days mineralization and culture, the 100 and 500 mL/L WPLT and PRP group positive nodule rates were significantly higher than those of the low concentration and the control groups (P < 0.05). After 20 days, the areas of the mineralized nodules formed in the 100 and 500 mL/L WPLT and PRP groups were significantly larger than those in the control group (P < 0.05). These results demonstrate that both WPLTs and PRP are equally able to significantly promote the proliferation and calcification of rat dental pulp cells under a certain range of concentrations.

Histologic Evaluation of Osseous Regeneration Following Combination Therapy With Platelet-Rich Plasma and Bio-Oss in a Rat Calvarial Critical-Size Defect Model.

PubMed

DeNicolo, Philip J; Guyton, M Kelly; Cuenin, Michael F; Hokett, Steven D; Sharawy, Mohamed; Borke, James; McPherson, James C

2015-10-01

Platelet-rich plasma (PRP) is an autogenous source of growth factors shown to facilitate human bone growth. Bio-Oss, an osteoconductive xenograft, is used clinically to regenerate periodontal defects, restore dental alveolar ridges, and facilitate sinus-lift procedures. The purpose of this study was to analyze whether a combination of PRP and Bio-Oss would enhance bone regeneration better than either material alone. PRP and/or Bio-Oss were administered in an 8-mm critical-size defect (CSD) rat calvarial model of bone defect between 2 polytetrafluoroethylene membranes to prevent soft tissue incursion. Eight weeks after the induction of the CSD, histologic sections were stained with hematoxylin and eosin stain and analyzed via light microscopy. Qualitative analyses revealed new bone regeneration in all 4 groups. The Bio-Oss and PRP plus Bio-Oss groups demonstrated greater areas of closure in the defects than the control or PRP-only groups because of the space-maintaining ability of Bio-Oss. The groups grafted with Bio-Oss showed close contact with new bone growth throughout the defects, suggesting a stronger graft. The use of PRP alone or in combination with Bio-Oss, however, did not appear to enhance osseous regeneration at 8 weeks. Areas grafted with Bio-Oss demonstrated greater space-maintaining capacity than controls, and PRP was an effective vehicle for placement of the Bio-Oss. However, at 8 weeks this study was unable to demonstrate a significant advantage of using PRP plus Bio-Oss over using Bio-Oss alone.

A single amino acid (Asp159) from the dog prion protein suppresses the toxicity of the mouse prion protein in Drosophila

PubMed Central

Sanchez-Garcia, J; Jensen, K; Zhang, Y; Rincon-Limas, DE; Fernandez-Funez, P

2016-01-01

Misfolding of the prion protein (PrP) is the key step in the transmission of spongiform pathologies in humans and several animals. Although PrP is highly conserved in mammals, a few changes in the sequence of endogenous PrP are proposed to confer protection to dogs, which were highly exposed to prion during the mad-cow epidemics. D159 is a unique amino acid found in PrP from dogs and other canines that was shown to alter surface charge, but its functional relevance has never been tested in vivo. Here, we show in transgenic Drosophila that introducing the N159D substitution on mouse PrP decreases its turnover. Additionally, mouse PrP-N159D demonstrates no toxicity and accumulates no pathogenic conformations, suggesting that a single D159 substitution is sufficient to prevent PrP conformational change and pathogenesis. Understanding the mechanisms mediating the protective activity of D159 is likely to lessen the burden of prion diseases in humans and domestic animals. PMID:27477054

Enzymatic characteristics of an ApaH-like phosphatase, PrpA, and a diadenosine tetraphosphate hydrolase, ApaH, from Myxococcus xanthus.

PubMed

Sasaki, Masashi; Takegawa, Kaoru; Kimura, Yoshio

2014-09-17

We characterized the activities of the Myxococcus xanthus ApaH-like phosphatases PrpA and ApaH, which share homologies with both phosphoprotein phosphatases and diadenosine tetraphosphate (Ap4A) hydrolases. PrpA exhibited a phosphatase activity towards p-nitrophenyl phosphate (pNPP), tyrosine phosphopeptide and tyrosine-phosphorylated protein, and a weak hydrolase activity towards ApnA and ATP. In the presence of Mn(2+), PrpA hydrolyzed Ap4A into AMP and ATP, whereas in the presence of Co(2+) PrpA hydrolyzed Ap4A into two molecules of ADP. ApaH exhibited high phosphatase activity towards pNPP, and hydrolase activity towards ApnA and ATP. Mn(2+) was required for ApaH-mediated pNPP dephosphorylation and ATP hydrolysis, whereas Co(2+) was required for ApnA hydrolysis. Thus, PrpA and ApaH may function mainly as a tyrosine protein phosphatase and an ApnA hydrolase, respectively. Copyright © 2014 Federation of European Biochemical Societies. Published by Elsevier B.V. All rights reserved.

Current concept for the use of PRP in arthroscopic surgery.

PubMed

Nourissat, G; Mainard, D; Kelberine, F

2013-12-01

PRP is commonly used in sports medicine and because it is supposed to increase healing capacities of damaged tissues, it is expected to be increase efficiency or god clinical outcomes when added to arthroscopic surgical procedure. The current review of literature explores the evidence-based medicine supporting the use of PRP in three arthroscopic related disorders. Regarding cartilage lesions of the knee, many studies are exploring several aspect of cartilage lesion treatment. It appears that PRP, in some protocols with specific concentration, should be more efficient than current therapies in the treatment of early stages of knee OA, but only in the field of rheumatology or sport medicine, not when used during surgery. PRP have been used in ACL reconstruction, no benefit has been reported in any study regarding clinical or radiological outcomes. In shoulder cuff disorder, to date, no clinical benefit nor increased healing rate have been clearly reported. Thus, in 2013, it is clear that there is no evidence base medicine data supporting the use of PRP in arthroscopic surgery. Copyright © 2013. Published by Elsevier Masson SAS.

PRP Augmentation for ACL Reconstruction

PubMed Central

Di Matteo, Berardo; Kon, Elizaveta; Marcacci, Maurilio

2015-01-01

Current research is investigating new methods to enhance tissue healing to speed up recovery time and decrease the risk of failure in Anterior Cruciate Ligament (ACL) reconstructive surgery. Biological augmentation is one of the most exploited strategies, in particular the application of Platelet Rich Plasma (PRP). Aim of the present paper is to systematically review all the preclinical and clinical papers dealing with the application of PRP as a biological enhancer during ACL reconstructive surgery. Thirty-two studies were included in the present review. The analysis of the preclinical evidence revealed that PRP was able to improve the healing potential of the tendinous graft both in terms of histological and biomechanical performance. Looking at the available clinical evidence, results were not univocal. PRP administration proved to be a safe procedure and there were some evidences that it could favor the donor site healing in case of ACL reconstruction with patellar tendon graft and positively contribute to graft maturation over time, whereas the majority of the papers did not show beneficial effects in terms of bony tunnels/graft area integration. Furthermore, PRP augmentation did not provide superior functional results at short term evaluation. PMID:26064903

Clinical Applications of Platelet-Rich Plasma in Patellar Tendinopathy

PubMed Central

Jeong, D. U.; Lee, C.-R.; Lee, J. H.; Pak, J.; Kang, L.-W.; Jeong, B. C.

2014-01-01

Platelet-rich plasma (PRP), a blood derivative with high concentrations of platelets, has been found to have high levels of autologous growth factors (GFs), such as transforming growth factor-β (TGF-β), platelet-derived growth factor (PDGF), fibroblastic growth factor (FGF), vascular endothelial growth factor (VEGF), and epidermal growth factor (EGF). These GFs and other biological active proteins of PRP can promote tissue healing through the regulation of fibrosis and angiogenesis. Moreover, PRP is considered to be safe due to its autologous nature and long-term usage without any reported major complications. Therefore, PRP therapy could be an option in treating overused tendon damage such as chronic tendinopathy. Here, we present a systematic review highlighting the clinical effectiveness of PRP injection therapy in patellar tendinopathy, which is a major cause of athletes to retire from their respective careers. PMID:25136568

The Prion Concept and Synthetic Prions.

PubMed

Legname, Giuseppe; Moda, Fabio

2017-01-01

Transmissible spongiform encephalopathies or prion diseases are a group of fatal neurodegenerative diseases caused by unconventional infectious agents, known as prions (PrP Sc ). Prions derive from a conformational conversion of the normally folded prion protein (PrP C ), which acquires pathological and infectious features. Moreover, PrP Sc is able to transmit the pathological conformation to PrP C through a mechanism that is still not well understood. The generation of synthetic prions, which behave like natural prions, is of fundamental importance to study the process of PrP C conversion and to assess the efficacy of therapeutic strategies to interfere with this process. Moreover, the ability of synthetic prions to induce pathology in animals confirms that the pathological properties of the prion strains are all enciphered in abnormal conformations, characterizing these infectious agents. © 2017 Elsevier Inc. All rights reserved.

Post-mortem immunodiagnosis of scrapie and bovine spongiform encephalopathy.

PubMed

Farquhar, C F; Somerville, R A; Ritchie, L A

1989-01-01

Two polyclonal antisera were raised in rabbits against the scrapie-associated fibril protein (PrP) prepared from sheep and mice which were terminally infected with experimental scrapie. The anti-mouse PrP serum identifies the proteins of scrapie-associated fibrils (SAF) from all the host species studied (mouse, hamster, sheep and goat) and bovine spongiform encephalopathy (BSE) fibrils from cow. The anti-sheep PrP serum displays species restricted immunoreactivity. While it identifies several PrP polypeptides from terminally affected sheep, goat and cow material, only the highest molecular weight band is recognised from hamster and there is no detection of mouse PrP. The use of these antisera in routine laboratory testing at post mortem provides a highly sensitive test for scrapie and BSE and may allow the identification of infected animals prior to the onset of clinical signs.

Combination of platelet-rich plasma with degradable bioactive borate glass for segmental bone defect repair.

PubMed

Zhang, Ya-Dong; Wang, Gang; Sun, Yan; Zhang, Chang-Qing

2011-02-01

Porous scaffold biomaterials may offer a clinical alternative to bone grafts; however, scaffolds alone are typically insufficient to heal large bone defects. Numerous studies have demonstrated that osteoinductive growth factor significantly improves bone repair. In this study, a strategy combining degradable bioactive borate glass (BG) scaffolds with platelet-rich plasma (PRP) was tested. The bone defect was filled with BG alone, BG combined with autologous PRP or left empty. Bone formation was analyzed at 4, 8 and 12 weeks using both histology and radiology. The PRP treated group yielded better bone formation than the pure BG scaffold as determined by both histology and microcomputer tomography after 12 weeks. In conclusion, PRP improved bone healing in a diaphyseal rabbit model on BG. The combination of PRP and BG may be an effective approach to repair critical defects.

Sporadic fatal insomnia in a young woman: A diagnostic challenge: Case Report

PubMed Central

2011-01-01

Background Sporadic fatal insomnia (sFI) and fatal familial insomnia (FFI) are rare human prion diseases. Case Presentation We report a case of a 33-year-old female who died of a prion disease for whom the diagnosis of sFI or FFI was not considered clinically. Following death of this patient, an interview with a close family member indicated the patient's illness included a major change in her sleep pattern, corroborating the reported autopsy diagnosis of sFI. Genetic tests identified no prion protein (PrP) gene mutation, but neuropathological examination and molecular study showed protease-resistant PrP (PrPres) in several brain regions and severe atrophy of the anterior-ventral and medial-dorsal thalamic nuclei similar to that described in FFI. Conclusions In patients with suspected prion disease, a characteristic change in sleep pattern can be an important clinical clue for identifying sFI or FFI; polysomnography (PSG), genetic analysis, and nuclear imaging may aid in diagnosis. PMID:22040318

The effect of platelet-rich plasma on clinical outcomes in lateral epicondylitis.

PubMed

Ahmad, Zafar; Brooks, Roger; Kang, Sertaz-Niel; Weaver, Holly; Nunney, Ian; Tytherleigh-Strong, Graham; Rushton, Neil

2013-11-01

To evaluate the evidence for application of platelet-rich plasma (PRP) in lateral epicondylitis. We carried out a systematic review of the current evidence on the effects of PRP in lateral epicondylitis on clinical outcomes. We performed a comprehensive search of the PubMed, Medline, Cochrane, CINAHL (Cumulative Index to Nursing and Allied Health Literature), and Embase databases using various combinations of the commercial names of each PRP preparation and "lateral epicondylitis" (with its associated terms), looking specifically at human studies. Data validity was assessed and collected on clinical outcome. Nine studies met the inclusion criteria, of which 5 were randomized controlled trials. Two cohort studies showed that PRP improved clinical satisfaction scores. One case-control study showed that PRP yielded a significantly greater improvement in symptoms compared with bupivacaine. Two randomized controlled trials compared the effect of injections of PRP and blood. Only 1 of the studies noted a significant difference at the 6-week time point. Three randomized controlled trials compared corticosteroids with PRP. Two of the smaller trials, which had follow-up periods of 6 weeks and 3 months, showed no significant difference between treatment groups. The largest randomized controlled trial found that PRP had significant benefit compared with corticosteroids with regard to pain and Disabilities of the Arm, Shoulder and Hand scores at 1- and 2-year time points. This review highlights the limited but evolving evidence for the use of PRP in lateral epicondylitis; however, further research is required to understand the concentration and preparation that facilitate the best clinical outcome. Characterizing the timing of the intervention would optimize the health economics behind the decision to treat for the patient and health care provider. Level III, systematic review of Level I to III studies. Copyright © 2013 Arthroscopy Association of North America. Published by Elsevier Inc. All rights reserved.

Lumbar Intradiskal Platelet-Rich Plasma (PRP) Injections: A Prospective, Double-Blind, Randomized Controlled Study.

PubMed

Tuakli-Wosornu, Yetsa A; Terry, Alon; Boachie-Adjei, Kwadwo; Harrison, Julian R; Gribbin, Caitlin K; LaSalle, Elizabeth E; Nguyen, Joseph T; Solomon, Jennifer L; Lutz, Gregory E

2016-01-01

To determine whether single injections of autologous platelet-rich plasma (PRP) into symptomatic degenerative intervertebral disks will improve participant-reported pain and function. Prospective, double-blind, randomized controlled study. Outpatient physiatric spine practice. Adults with chronic (≥6 months), moderate-to-severe lumbar diskogenic pain that was unresponsive to conservative treatment. Participants were randomized to receive intradiskal PRP or contrast agent after provocative diskography. Data on pain, physical function, and participant satisfaction were collected at 1 week, 4 weeks, 8 weeks, 6 months, and 1 year. Participants in the control group who did not improve at 8 weeks were offered the option to receive PRP and subsequently followed. Functional Rating Index (FRI), Numeric Rating Scale (NRS) for pain, the pain and physical function domains of the 36-item Short Form Health Survey, and the modified North American Spine Society (NASS) Outcome Questionnaire were used. Forty-seven participants (29 in the treatment group, 18 in the control group) were analyzed by an independent observer with a 92% follow-up rate. Over 8 weeks of follow-up, there were statistically significant improvements in participants who received intradiskal PRP with regards to pain (NRS Best Pain) (P = .02), function (FRI) (P = .03), and patient satisfaction (NASS Outcome Questionnaire) (P = .01) compared with controls. No adverse events of disk space infection, neurologic injury, or progressive herniation were reported following the injection of PRP. Participants who received intradiskal PRP showed significant improvements in FRI, NRS Best Pain, and NASS patient satisfaction scores over 8 weeks compared with controls. Those who received PRP maintained significant improvements in FRI scores through at least 1 year of follow-up. Although these results are promising, further studies are needed to define the subset of participants most likely to respond to biologic intradiskal treatment and the ideal cellular characteristics of the intradiskal PRP injectate. Copyright © 2016 American Academy of Physical Medicine and Rehabilitation. Published by Elsevier Inc. All rights reserved.

Platelet rich plasma versus corticosteroid injection for plantar fasciitis: A comparative study.

PubMed

Jain, Kowshik; Murphy, Philip N; Clough, Timothy M

2015-12-01

Intractable plantar fasciitis can be a difficult condition to treat. Early results of platelet rich plasma (PRP) injection have been promising. We compared PRP to traditional cortisone injection in the treatment of chronic cases of plantar fasciitis resistant to traditional nonoperative management. The aim of the study was to compare the efficacy of PRP to that of Steroid at 3, 6 and 12 months after injection. 60 heels with intractable plantar fasciitis who had failed conservative treatment were randomised to receive either PRP or Steroid injection. All patients were assessed with the Roles-Maudsley (RM) Score, Visual Analogue Score (VAS) for pain and the American Orthopaedic Foot and Ankle Society (AOFAS) score. Data was collected prospectively on the cohort, pre-treatment, at 3, 6 and 12 months post injection and the results were compared. Pre-injection, the two groups were well matched with no statistically significant difference. At 3 months, all three outcome scores had significantly improved from their pretreatment level in both groups. The scores in the Steroid arm were marginally better than in the PRP arm, but this difference was not statistically significant. At 6 months, there was no statistically significant difference between the two groups, though there was a trend for the PRP scores to become better than the Steroid scores. At 12 months, the RM, VAS and AOFAS scores in the PRP arm (1.9, 3.3 and 88.5) were significantly better than the Steroid arm (2.6, 5.3 and 75) with P values of .013, .028 and .033, respectively. PRP is as effective as Steroid injection at achieving symptom relief at 3 and 6 months after injection, for the treatment of plantar fasciitis, but unlike Steroid, its effect does not wear off with time. At 12 months, PRP is significantly more effective than Steroid, making it better and more durable than cortisone injection. Copyright © 2015 Elsevier Ltd. All rights reserved.

Biologic injections for osteoarthritis and articular cartilage damage: can we modify disease?

PubMed

Shi, Weilong J; Tjoumakaris, Fotios P; Lendner, Mayan; Freedman, Kevin B

2017-09-01

The purpose of the present investigation is to conduct a systematic review of the literature to review the clinical results of platelet rich plasma (PRP) and mesenchymal stem cell treatments (MSC) (biologics) for articular cartilage lesions and osteoarthritis of the knee. A search of the PubMed, EMBASE, and Cochrane databases was performed to identify studies involving biologic therapy for osteoarthritis or osteochondral defects. Only Level I-III clinical trials with at least 3-month follow-up were included. Outcome data was gathered on any patient-completed surveys, 2nd look arthroscopy, follow-up imaging, biopsy/histology results, and any adverse effects of treatment. Thirty-three articles met our inclusion criteria. There was a total of 21 PRP studies in the study. All PRP studies showed clinical improvement with PRP therapies in outcomes surveys measuring patient satisfaction, pain, and function. Two studies reported no significant difference in improvement compared to hyaluronic acid (HA). Similarly, the 7/9 MSC studies showed improvement. One study found BM-MSC implantation was not significantly superior to matrix assisted chondrocyte implantation (MACI), while one reported peripheral blood stem cells (PBSC) did not significantly improve outcomes over HA. Of the three studies looking at a combination of MSC/PRP, two found MSC/PRP combination did not improve outcomes compared to MSC or PRP therapy alone. The one PRP study that had a 2nd look arthroscopy reported increases cartilage regeneration with PRP. All 8 MSC studies with follow-up MRI and all 7 MSC studies with 2nd look arthroscopy showed improvement in cartilage regeneration in terms of coverage, fill of the defect, and/or firmness of the new cartilage. Current data suggests that, of the two treatments, MSC provides more significant disease modifying effect; however, further research needs to be done to compare these two treatments and determine if there is a synergetic effect when combined.

Mechanical and Controlled PRP Injections in Patients Affected by Androgenetic Alopecia.

PubMed

Gentile, Pietro; Garcovich, Simone; Scioli, Maria Giovanna; Bielli, Alessandra; Orlandi, Augusto; Cervelli, Valerio

2018-01-27

23 patients (18 male and 5 female) aged 21-70 years who displayed male pattern hair loss (MPHL) in Stage 1 to Stage 5 as determined by the Norwood-Hamilton classification scale, and female pattern hair loss (FPHL) in Stage 1 to Stage 2 as determined by the Ludwig classification scale, were treated with non-activated autologous platelet-rich plasma (A-PRP). Autologous blood (55 mL) was harvested using sodium citrate as an anticoagulant. A-PRP (23 mL) was produced for all cases using a closed system according to the transfusion service protocol. Following centrifugation (260 x g for 10 min) the A-PRP was inserted in a laser light selector device, and after the centrifugation, 9 mL of A-PRP was collected. The scalp of the patients affected by androgenetic alopecia (AGA) was divided into four areas (frontal, parietal, vertex, and occipital); local anesthesia was not performed. Interfollicular A-PRP injections (0.2 mL x cm 2 ) were performed by controlled and mechanical injections scheduled at a depth of 5 mm using a medical injector gun. Treatment sessions were performed with a 30-day interval. For each patient, three treatment sessions were performed. PRP was injected in the androgen-related areas of scalp affected by hair loss. Placebo (normal saline solution) was loaded in another syringe (10 mL) and injected on the adjacent side in a similar fashion.

A serum and platelet-rich plasma serotonin assay using liquid chromatography tandem mass spectrometry for monitoring of neuroendocrine tumor patients.

PubMed

Korse, Catharina M; Buning-Kager, Johanna C G M; Linders, Theodora C; Heijboer, Annemieke C; van den Broek, Daan; Tesselaar, Margot E T; van Tellingen, Olaf; van Rossum, Huub H

2017-06-01

Serotonin is used for the diagnosis and follow-up of neuroendocrine tumors (NET). We describe the analytical and clinical validation of a liquid chromatography tandem mass spectrometry (LC-MS/MS) based serotonin assay for serum and platelet-rich plasma (PRP). An LC-MS/MS based method for serum and PRP serotonin was validated by determination of assay imprecision, carry-over, linearity, interference, recovery, sample stability and a matrix/method comparison of serum and PRP serotonin was made with whole blood serotonin. Furthermore, upper limits of normal were determined and serotonin concentrations of healthy individuals, 14 NET patients without evidence of disease and 51 NET patients with evidence of disease were compared. For serum and PRP fractions, total assay imprecision was <5%. All correlation coefficients were 0.98 and the serum and platelet-rich serotonin upper limit of normal were 5.5nmol/10 9 platelet and 5.1nmol/10 9 platelet, respectively. NET patients with confirmed evidence of disease had significantly higher serum and PRP serotonin levels when compared to NET patients without evidence of disease and healthy volunteers. LC-MS/MS based serum and PRP serotonin assays were developed with suitable analytical characteristics. Furthermore, serum and PRP serotonin was found to be useful for monitoring NET patients. Copyright © 2017 Elsevier B.V. All rights reserved.

Infectious prions and proteinopathies.

PubMed

Barron, Rona M

2017-01-02

Transmissible spongiform encephalopathies (TSEs) are caused by an infectious agent that is thought to consist of only misfolded and aggregated prion protein (PrP). Unlike conventional micro-organisms, the agent spreads and propagates by binding to and converting normal host PrP into the abnormal conformer, increasing the infectious titre. Synthetic prions, composed of refolded fibrillar forms of recombinant PrP (rec-PrP) have been generated to address whether PrP aggregates alone are indeed infectious prions. In several reports, the development of TSE disease has been described following inoculation and passage of rec-PrP fibrils in transgenic mice and hamsters. However in studies described here we show that inoculation of rec-PrP fibrils does not always cause clinical TSE disease or increased infectious titre, but can seed the formation of PrP amyloid plaques in PrP-P101L knock-in transgenic mice (101LL). These data are reminiscent of the "prion-like" spread of misfolded protein in other models of neurodegenerative disease following inoculation of transgenic mice with pre-formed amyloid seeds. Protein misfolding, even when the protein is PrP, does not inevitably lead to the development of an infectious TSE disease. It is possible that most in vivo and in vitro produced misfolded PrP is not infectious and that only a specific subpopulation is associated with infectivity and neurotoxicity.

Identification of Alprenolol Hydrochloride as an Anti-prion Compound Using Surface Plasmon Resonance Imaging.

PubMed

Miyazaki, Yukiko; Ishikawa, Takeshi; Kamatari, Yuji O; Nakagaki, Takehiro; Takatsuki, Hanae; Ishibashi, Daisuke; Kuwata, Kazuo; Nishida, Noriyuki; Atarashi, Ryuichiro

2018-04-27

Prion diseases are transmissible neurodegenerative disorders of humans and animals, which are characterized by the aggregation of abnormal prion protein (PrP Sc ) in the central nervous system. Although several small compounds that bind to normal PrP (PrP C ) have been shown to inhibit structural conversion of the protein, an effective therapy for human prion disease remains to be established. In this study, we screened 1200 existing drugs approved by the US Food and Drug Administration (FDA) for anti-prion activity using surface plasmon resonance imaging (SPRi). Of these drugs, 31 showed strong binding activity to recombinant human PrP, and three of these reduced the accumulation of PrP Sc in prion-infected cells. One of the active compounds, alprenolol hydrochloride, which is used clinically as a β-adrenergic blocker for hypertension, also reduced the accumulation of PrP Sc in the brains of prion-infected mice at the middle stage of the disease when the drug was administered orally with their daily water from the day after infection. Docking simulation analysis suggested that alprenolol hydrochloride fitted into the hotspot within mouse PrP C , which is known as the most fragile structure within the protein. These findings provide evidence that SPRi is useful in identifying effective drug candidates for neurodegenerative diseases caused by abnormal protein aggregation, such as prion diseases.

Effect of Platelet Rich Plasma Combined with Chitosan Biodegradable Film on Full-Thickness Wound Healing in Rat Model

PubMed Central

Mohammadi, Rahim; Mehrtash, Moein; Mehrtash, Moeid; Hassani, Nava; Hassanpour, Ali

2016-01-01

Objective: To assess the effects of platelet rich plasma (PRP) with chitosan biodegradable film on full thickness wound healing in rat. Methods: This was an experimental study being performed in 2015 during a 4-month period. Twenty-four male white Wistar rats were divided into four groups of 12 rats each, randomly: Control group (SHAM) with creation of wounds and no treatment, PRP group with creation of wounds and application of one milliliter PRP, Chitosan group (CHIT) with dressing the wound with chitosan and CHIT/PRP group with application of one mL PRPand dressing the wound with chitosan. The wounds were created by cutting healthy skin.Wound size was measured on 6, 9, 12, 15, 18 and 21 post surgery and was compared between groups. Results: Reduction in wound area, hydroxyproline contents and biomechanical parametersindicated there was significant difference (p=0.001) between group CHIT/PRP and other groups. Biomechanical testing was performed on day 9 post surgery in incisional model. Quantitative histological studies and mean rank of the qualitative studies demonstrated that there was significant difference (p<0.001) between group CHIT/PRP and other groups. Conclusion: PRP with chitosan have beneficial effects on wounds repair and could be suggested for treating various types of wounds in animals and human being. PMID:27162924

A systematic review of the effects of platelet rich plasma on outcomes for patients with knee osteoarthritis and following total knee arthroplasty.

PubMed

Muchedzi, Tendai Aswad; Roberts, Simon B

2017-09-21

Platelet rich plasma (PRP) has been suggested to be effective in the management of knee osteoarthritis. Review of current literature reveals conflicting evidence regarding the benefits of PRP in treating knee OA. Preclinical evidence supports the use of PRP injections to promote a favorable environment for joint tissue healing, targeting not only cartilage but also synovial and meniscal tissues which has a positive effect on delaying the progression of OA. Growth factors found in platelet granules are postulated to influence outcomes in knee OA and after total knee arthroplasty (TKA). A systematic review of studies investigating the use of PRP in knee osteoarthritis and following TKA, was performed by searching the following databases for randomised clinical trials and pseudo-randomised clinical and comparative trials comparing the use of PRP to treat knee osteoarthritis and following TKA: MedLine, EMBASE, Science Direct, PubMed, and the Cochrane Library. The primary outcomes were patient reported measures including pain (visual analog scale (VAS)), quality of life scores, and knee function. A total of 2328 participants were analyzed across 17 included studies and pooled results showed a statistically significant reduction in pain in favor of PRP following TKA but not in non-surgical management of knee OA (P < 0.0001 and 0.13 respectively). No clinical benefit of PRP was found on quality of life and knee function (P = 0.07 and 0.05) following TKA, although a statistical improvement in knee function was demonstrated in patients with knee OA after PRP injection (P < 0.0001). There was no statistically significant clinical benefit of PRP on secondary outcomes including wound scores and length of hospital stay (p = 0.33 and 0.31, respectively). There was no statistically significant difference in respect to blood loss and overall symptoms in favor of PRP compared to control group following TKA (p = 0.37). This systematic review demonstrated no long-term statistically significant improvement in patient validated outcomes and secondary outcomes both in patients with knee OA or following TKA for OA. However PRP has been shown to have short to medium-term benefits in pain control after TKA and activities of daily living in patients with OA. Copyright © 2017 Royal College of Surgeons of Edinburgh (Scottish charity number SC005317) and Royal College of Surgeons in Ireland. Published by Elsevier Ltd. All rights reserved.

An intein with genetically selectable markers provides a new approach to internally label proteins with GFP.

PubMed

Ramsden, Richard; Arms, Luther; Davis, Trisha N; Muller, Eric G D

2011-06-27

Inteins are proteins that catalyze their own removal from within larger precursor proteins. In the process they splice the flanking protein sequences, termed the N-and C-terminal exteins. Large inteins frequently have a homing endonuclease that is involved in maintaining the intein in the host. Splicing and nuclease activity are independent and distinct domains in the folded structure. We show here that other biochemical activities can be incorporated into an intein in place of the endonuclease without affecting splicing and that these activities can provide genetic selection for the intein. We have coupled such a genetically marked intein with GFP as the N-terminal extein to create a cassette to introduce GFP within the interior of a targeted protein. The Pch PRP8 mini-intein of Penicillium chrysogenum was modified to include: 1) aminoglycoside phosphotransferase; 2) imidazoleglycerol-phosphate dehydratase, His5 from S. pombe ; 3) hygromycin B phosphotransferase; and 4) the transcriptional activator LexA-VP16. The proteins were inserted at the site of the lost endonuclease. When expressed in E. coli, all of the modified inteins spliced at high efficiency. Splicing efficiency was also greater than 96% when expressed from a plasmid in S. cerevisiae. In addition the inteins conferred either G418 or hygromycin resistance, or histidine or leucine prototropy, depending on the inserted marker and the yeast genetic background. DNA encoding the marked inteins coupled to GFP as the N-terminal extein was PCR amplified with ends homologous to an internal site in the yeast calmodulin gene CMD1. The DNA was transformed into yeast and integrants obtained by direct selection for the intein's marker. The His5-marked intein yielded a fully functional calmodulin that was tagged with GFP within its central linker. Inteins continue to show their flexibility as tools in molecular biology. The Pch PRP8 intein can successfully tolerate a variety of genetic markers and still retain high splicing efficiency. We have shown that a genetically marked intein can be used to insert GFP in one-step within a target protein in vivo.

Platelet-rich plasma affects bacterial growth in vitro.

PubMed

Mariani, Erminia; Filardo, Giuseppe; Canella, Valentina; Berlingeri, Andrea; Bielli, Alessandra; Cattini, Luca; Landini, Maria Paola; Kon, Elizaveta; Marcacci, Maurilio; Facchini, Andrea

2014-09-01

Platelet-rich plasma (PRP), a blood derivative rich in platelets, is a relatively new technique used in tissue regeneration and engineering. The increased quantity of platelets makes this formulation of considerable value for their role in tissue healing and microbicidal activity. This activity was investigated against five of the most important strains involved in nosocomial infections (Escherichia coli, Staphylococcus aureus, Pseudomonas aeruginosa, Klebsiella pneumoniae and Streptococcus faecalis) to understand the prophylactic role of pure (P)-PRP. Microbicidal proteins released from activated P-PRP platelets were also determined. The microbicidal activity of P-PRP and platelet-poor plasma (PPP) was evaluated on different concentrations of the five bacterial strains incubated for 1, 2, 4 and 18 h and plated on agar for 18-24 h. P-PRP and PPP-released microbicidal proteins were evaluated by means of multiplex bead-based immunoassays. P-PRP and PPP inhibited bacterial growth for up to 2 h of incubation. The effect of P-PRP was significantly higher than that of PPP, mainly at the low seeding concentrations and/or shorter incubation times, depending on the bacterial strain. Chemokine (C-C motif) ligand-3, chemokine (C-C motif) ligand-5 and chemokine (C-X-C motif) ligand-1 were the molecules mostly related to Pseudomonas aeruginosa, Staphylococcus aureus and Streptococcus faecalis inhibition. Escherichia coli and Klebsiella pneumoniae were less influenced. The present results show that P-PRP might supply an early protection against bacterial contaminations during surgical interventions because the inhibitory activity is already evident from the first hour of treatment, which suggests that physiological molecules supplied in loco might be important in the time frame needed for the activation of the innate immune response. Copyright © 2014 International Society for Cellular Therapy. Published by Elsevier Inc. All rights reserved.

Toll like receptors TLR1/2, TLR6 and MUC5B as binding interaction partners with cytostatic proline rich polypeptide 1 in human chondrosarcoma.

PubMed

Galoian, Karina; Abrahamyan, Silva; Chailyan, Gor; Qureshi, Amir; Patel, Parthik; Metser, Gil; Moran, Alexandra; Sahakyan, Inesa; Tumasyan, Narine; Lee, Albert; Davtyan, Tigran; Chailyan, Samvel; Galoyan, Armen

2018-01-01

Metastatic chondrosarcoma is a bone malignancy not responsive to conventional therapies; new approaches and therapies are urgently needed. We have previously reported that mTORC1 inhibitor, antitumorigenic cytostatic proline rich polypeptide 1 (PRP-1), galarmin caused a significant upregulation of tumor suppressors including TET1/2 and SOCS3 (known to be involved in inflammatory processes), downregulation of oncoproteins and embryonic stem cell marker miR-302C and its targets Nanog, c-Myc and Bmi-1 in human chondrosarcoma. To understand better the mechanism of PRP-1 action it was very important to identify the receptor it binds to. Nuclear pathway receptor and GPCR assays indicated that PRP-1 receptors are not G protein coupled, neither do they belong to family of nuclear or orphan receptors. In the present study, we have demonstrated that PRP-1 binding interacting partners belong to innate immunity pattern recognition toll like receptors TLR1/2 and TLR6 and gel forming secreted mucin MUC5B. MUC5B was identified as PRP-1 receptor in human chondrosarcoma JJ012 cell line using Ligand-receptor capture technology. Toll like receptors TLR1/2 and TLR6 were identified as binding interaction partners with PRP-1 by western blot analysis in human chondrosarcoma JJ012 cell line lysates. Immunocytochemistry experiments confirmed the finding and indicated the localization of PRP-1 receptors in the tumor nucleus predominantly. TLR1/2, TLR6 and MUC5B were downregulated in human chondrosarcoma and upregulated in dose-response manner upon PRP-1 treatment. Experimental data indicated that in this cellular context the mentioned receptors had tumor suppressive function.

Platelet-Rich Plasma Treatment With Physical Therapy in Chronic Partial Supraspinatus Tears

PubMed Central

Ilhanli, Ilker; Guder, Necip; Gul, Murat

2015-01-01

Background: Despite the insufficient evidence, due to potential contribution to the improvement, platelet-rich plasma (PRP) is emerging as a promising method. Objectives: The aim of this study was to assess the effectiveness of PRP injection in partial supraspinatus tears by comparing with physical therapy (PT). Patients and Methods: Seventy patients with chronic partial supraspinatus tears in magnetic resonance imaging were randomized into two groups; PRP (n = 35) and PT (n = 35). Before the treatment, at the end of the treatment and at the 12th month after the end of the treatment, range of motion (ROM), visual analog scale (VAS) for pain, Disabilities of Arm, Shoulder and Hand questionnaire (DASH), Neer’s, Hawkins’ and drop arm tests and Beck Depression Inventory were investigated. Results: Statistical analysis was made for 62 subjects (PRP group, n = 30; PT group, n = 32). There were no differences between the groups according to demographic data. At the 12th month after the end of the treatment, significant improvement in ROM was detected in both groups, pain was reduced significantly in both groups and improvement of the DASH score was observed in both groups. At all the evaluation steps, increases in ROM degrees were significantly higher in the PT group than the PRP group. For VAS in activity and in rest, after the treatment, improvement was higher in the PT group than the PRP group. However, improvement of the DASH score of the PRP group was significantly better than the PT group. Conclusions: When we compared with PT, PRP seemed to be a well-tolerated application which showed promising results in patients with chronic partial supraspinatus tears. PMID:26473076

In vivo clinical and radiological effects of platelet-rich plasma on interstitial supraspinatus lesion: Case series.

PubMed

Lädermann, A; Zumstein, M A; Kolo, F C; Grosclaude, M; Koglin, L; Schwitzguebel, A J P

2016-12-01

Rotator cuff tear (RCT) is a frequent condition of clinical relevance that can be managed with a symptomatic conservative treatment, but surgery is often needed. Biological components like leukocytes and platelet rich plasma (L-PRP) could represent an alternative curative method for interstitial RCT. It has been hypothesized that an ultrasound guided L-PRP injection in supraspinatus interstitial RCT could induce radiological healing. A prospective case series including 25 patients was performed in order to assess the effect of L-PRP infiltration into supraspinatus interstitial RCTs. Primary outcome was tear size change determined by magnetic resonance imaging arthrogram (MRA) before and 6 months after L-PRP infiltration. Secondary outcomes were Constant score, SANE score, and pain visual analog scale (VAS) after L-PRP infiltration. Tear volume diminution was statistically significant (P=.007), and a >50% tear volume diminution was observed in 15 patients. A statistically significant improvement of Constant score (P<.001), SANE score (P=.001), and VAS (P<.001) was observed. In 21 patients, Constant score improvement reached the minimal clinical important difference of 10.4 points. We observed a statistically significant and clinically relevant effect on RCT size and clinical parameters after L-PRP infiltration. Such an important improvement of supraspinatus interstitial RCT with conservative management is uncommon, therefore intratendinous L-PRP infiltrations could have been beneficial. This encouraging result could pave the way for future randomized studies in order to formally determinate whether L-PRP infiltrations are a possible alternative to surgical treatment of interstitial RCT. Prospective observational study; Level of evidence II. Copyright © 2016 Elsevier Masson SAS. All rights reserved.

Toll like receptors TLR1/2, TLR6 and MUC5B as binding interaction partners with cytostatic proline rich polypeptide 1 in human chondrosarcoma

PubMed Central

Galoian, Karina; Abrahamyan, Silva; Chailyan, Gor; Qureshi, Amir; Patel, Parthik; Metser, Gil; Moran, Alexandra; Sahakyan, Inesa; Tumasyan, Narine; Lee, Albert; Davtyan, Tigran; Chailyan, Samvel; Galoyan, Armen

2018-01-01

Metastatic chondrosarcoma is a bone malignancy not responsive to conventional therapies; new approaches and therapies are urgently needed. We have previously reported that mTORC1 inhibitor, antitumorigenic cytostatic proline rich polypeptide 1 (PRP-1), galarmin caused a significant upregulation of tumor suppressors including TET1/2 and SOCS3 (known to be involved in inflammatory processes), downregulation of oncoproteins and embryonic stem cell marker miR-302C and its targets Nanog, c-Myc and Bmi-1 in human chondrosarcoma. To understand better the mechanism of PRP-1 action it was very important to identify the receptor it binds to. Nuclear pathway receptor and GPCR assays indicated that PRP-1 receptors are not G protein coupled, neither do they belong to family of nuclear or orphan receptors. In the present study, we have demonstrated that PRP-1 binding interacting partners belong to innate immunity pattern recognition toll like receptors TLR1/2 and TLR6 and gel forming secreted mucin MUC5B. MUC5B was identified as PRP-1 receptor in human chondrosarcoma JJ012 cell line using Ligand-receptor capture technology. Toll like receptors TLR1/2 and TLR6 were identified as binding interaction partners with PRP-1 by western blot analysis in human chondrosarcoma JJ012 cell line lysates. Immunocytochemistry experiments confirmed the finding and indicated the localization of PRP-1 receptors in the tumor nucleus predominantly. TLR1/2, TLR6 and MUC5B were downregulated in human chondrosarcoma and upregulated in dose-response manner upon PRP-1 treatment. Experimental data indicated that in this cellular context the mentioned receptors had tumor suppressive function. PMID:29138803

Prevalence of periradicular periodontitis in a Scottish subpopulation found on CBCT images.

PubMed

Dutta, A; Smith-Jack, F; Saunders, W P

2014-09-01

To investigate the prevalence of periradicular periodontitis (PRP) using cone-beam computed tomography (CBCT) scans in a retrospective cross-sectional epidemiological study in a Scottish subpopulation. Of the 319 CBCT scans performed at Dundee Dental Hospital between November 2009 and July 2012, 245 dentate scans of patients over 18 years of age were included and 3595 teeth examined. Odds ratios were calculated, and the association between root filling and posts with PRP was determined. Radiological signs of PRP were detected in 209 teeth (5.8%) in 96 patients (male = 53, female = 43) of which 145 (69.4%) were measurable and 64 (30.6%) appeared as periapical widening. Most lesions were seen in the 46-55-year age group and in maxillary anterior teeth (35.4%); 47.4% (n = 81) of the total root filled teeth (n = 171) had PRP. Of the root filled teeth with lesions, approximately half (50.6%) had an inadequate root filling. Teeth with crowns, but not root filled, accounted for 17.7% of PRP. Periapical changes were detected on a high proportion of teeth with post-retained crowns (70.7%). The presence of a root filling was significantly associated with PRP (z = 17.689 P < 0.0001; odds ratio 16.36 < 23.17 < 32.83, 95% CI) and the presence of a post (z = 10.901 P < 0.0001; odds ratio 21.36 < 41.8021 < 81.78, 95% CI). The prevalence of PRP in a Scottish subpopulation was 5.8%. The presence of a root filling or a post-retained crown was significantly associated with the presence of PRP as determined by CBCT scans. The prevalence of periradicular disease in root filled teeth remains high in the Scottish population. © 2013 International Endodontic Journal. Published by John Wiley & Sons Ltd.

Ultrasound-Guided Intratendinous Injections With Platelet-Rich Plasma or Autologous Whole Blood for Treatment of Proximal Hamstring Tendinopathy: A Double-Blind Randomized Controlled Trial.

PubMed

Davenport, Kathleen L; Campos, Jose Santiago; Nguyen, Joseph; Saboeiro, Gregory; Adler, Ronald S; Moley, Peter J

2015-08-01

To compare the effects of ultrasound-guided platelet-rich plasma (PRP) and whole blood (WB) injections in patients with chronic hamstring tendinopathy. In a prospective double-blind randomized controlled trial, PRP or WB was injected under ultrasound guidance into the proximal hamstring tendon in a cohort of patients with clinically suspected hamstring tendinosis. Questionnaires were administered before injection and 2, 6, and 12 weeks and 6 months after injection. Pain and function outcomes were measured via the Modified Harris Hip Score (MHHS), Hip Outcome Scores for activities of daily living (ADL) and sport-specific function, and International Hip Outcome Tool 33 (IHOT-33). Diagnostic ultrasound was used to compare preinjection and 6-month postinjection tendon appearances. The WB group showed greater improvements in pain and function over the PRP group before 12 weeks, whereas the PRP group showed improved outcomes over WB at 6 months. None of these between-group outcome measures, except 6-week IHOT-33, showed statistical significance. Comparing preinjection and 6-month scores, the PRP group showed significant improvements in ADL (P = .018) and IHOT-33 (P = .28) scores, whereas the WB group showed no significant improvements from baseline. The WB group showed significantly decreased pain with 15-minute sitting (P= .008) at 6 months. Ultrasound imaging showed no significant differences between PRP and WB group tendon appearances. Both PRP and WB groups showed improvements in all outcome measures at 6 months. The PRP group showed significant improvements in 6-month ADL and IHOT-33 scores. The WB group reached significance in 15-minute sitting pain. No significant between-group differences were observed at any time point. © 2015 by the American Institute of Ultrasound in Medicine.

Expansion of the octarepeat domain alters the misfolding pathway but not the folding pathway of the prion protein.

PubMed

Leliveld, S Rutger; Stitz, Lothar; Korth, Carsten

2008-06-10

A misfolded conformation of the prion protein (PrP), PrP (Sc), is the essential component of prions, the infectious agents that cause transmissible neurodegenerative diseases. Insertional mutations that lead to an increase in the number of octarepeats (ORs) in PrP are linked to familial human prion disease. In this study, we investigated how expansion of the OR domain causes PrP to favor a prion-like conformation. Therefore, we compared the conformational and aggregation modulating properties of wild-type versus expanded OR domains, either as a fusion construct with the protein G B1 domain (GB1-OR) or as an integral part of full-length mouse PrP (MoPrP). Using circular dichroism spectroscopy, we first demonstrated that ORs are not unfolded but exist as an ensemble of three distinct conformers: polyproline helix-like, beta-turn, and "Trp-related". Domain expansion had little effect on the conformation of GB1-OR fusion proteins. When part of MoPrP however, OR domain expansion changed PrP's folding landscape, not by hampering the production of native alpha-helical monomers but by greatly reducing the propensity to form amyloid and by altering the assembly of misfolded, beta-rich aggregates. These features may relate to subtle pH-dependent conformational differences between wild-type and mutant monomers. In conclusion, we propose that PrP insertional mutations are pathogenic because they enhance specific misfolding pathways of PrP rather than by undermining native folding. This idea was supported by a trial bioassay in transgenic mice overexpressing wild-type MoPrP, where intracerebral injection of recombinant MoPrP with an expanded OR domain but not wild-type MoPrP caused prion disease.

A conceptual study on the formulation of a permeable reactive pavement with activated carbon additives for controlling the fate of non-point source environmental organic contaminants.

PubMed

Huang, Shengyi; Liang, Chenju

2018-02-01

To take advantage of the road pavement network where non-point source (NPS) pollution such as benzene, toluene, ethyl-benzene, and xylene (BTEX) from vehicle traffic exhaust via wet and dry atmospheric deposition occurs, the asphalt pavement may be used as a media to control the NPS pollution. An experiment to prepare an adsorptive porous reactive pavement (PRP) was initiated to explore the potential to reduce environmental NPS vehicle pollution. The PRP was prepared and studied as follows: various activated carbons (AC) were initially screened to determine if they were suitable as an additive in the porous asphalt mixture; various mixtures of a selected AC were incorporated with the design of porous asphalt concrete (PAC) to produce PRP, and the PRP formulations were tested to ensure that they comply with the required specifications; qualified specimens were subsequently tested to determine their adsorption capacity for BTEX in aqueous solution, as compared to conventional PAC. The PRP08 and PRP16 samples, named for the design formulations of 0.8% and 1.6% of AC (by wt. in the formulation), exhibited low asphalt drain-down and low abrasion loss and also met all regulated specifications. The BTEX adsorption capacity measurements of PRP08 and PRP16 were 33-46%, 36-51%, 20-22%, and 6-8% respectively, higher than those obtained from PACs. Based on the test results, PRPs showed good physical performance and adsorption and may be considered as a potential method for controlling the transport of NPS vehicle pollutants. Copyright © 2017 Elsevier Ltd. All rights reserved.

Preparation and testing of a Haemophilus influenzae Type b/Hepatitis B surface antigen conjugate vaccine.

PubMed

An, So Jung; Woo, Joo Sung; Chae, Myung Hwa; Kothari, Sudeep; Carbis, Rodney

2015-03-24

The majority of conjugate vaccines focus on inducing an antibody response to the polysaccharide antigen and the carrier protein is present primarily to induce a T-cell dependent response. In this study conjugates consisting of poly(ribosylribitolphosphate) (PRP) purified from Haemophilus influenzae Type b bound to Hepatitis B virus surface antigen (HBsAg) virus like particles were prepared with the aim of inducing an antibody response to not only the PRP but also the HBsAg. A conjugate consisting of PRP bound to HBsAg via an adipic acid dihydrazide (ADH) spacer induced strong IgG antibodies to both the PRP and HBsAg. When conjugation was performed without the ADH spacer the induction of an anti-PRP response was equivalent to that seen by conjugate with the ADH spacer, however, a negligible anti-HBsAg response was induced. For comparison, PRP was conjugated to diphtheria toxoid (DT) and Vi polysaccharide purified from Salmonella Typhi conjugated to HBsAg both using an ADH spacer. The PRPAH-DT conjugate induced strong anti-PRP and anti-DT responses, the Vi-AHHBsAg conjugate induced a good anti-HBsAg response but not as strong as that induced by the PRPAH-HBsAg conjugate. This study demonstrated that in mice it was possible to induce robust antibody responses to both polysaccharide and carrier protein provided the conjugate has certain physico-chemical properties. A PRPAH-HBsAg conjugate with the capacity to induce anti-PRP and anti-HBsAg responses could be incorporated into a multivalent pediatric vaccine and simplify formulation of such a vaccine. Copyright © 2015 Elsevier Ltd. All rights reserved.

Approaches to and Treatment Strategies for Playing-Related Pain Problems Among Czech Instrumental Music Students: An Epidemiological Study.

PubMed

Ioannou, Christos I; Altenmüller, Eckart

2015-09-01

The current study examined the severity of playing-related pain (PRP) problems among music students at the Prague State Conservatoire, as well as the various treatment methods used by these students and how they approach and deal with these phenomena while studying. In total, 180 instrumental students participated and completed a paper questionnaire. Of these, 88.9% reported that they had experienced PRP at least once in their lives, with 12.6% experiencing pain every time they play. The onset of PRP seemed to coincide with the transition period on entry to the conservatoire and was associated with the increase in hours of practice. Specific body regions associated with playing each particular instrument were most frequently affected, with females being more susceptible than males to the development of PRP. An alarming 35% of the affected students tended not to seek help at all, whereas those who did tended to seek advice first from their instrument tutor and second from medical doctors. Most students who visited doctors reported that medical treatments only partially helped them to overcome PRP problems. The most frequent treatment methods used were resting, gel or creams, and physical exercises. Students believed that inappropriate posture played a key role in the development of their PRP problems. Finally, students indicated a willingness to be aware of and educated about PRP issues during their studies. Further exploration of PRP problems among student musicians is warranted. Better understanding of differing attitudes toward, use of, and efficiency of various treatment methods after the occurrence of PRPs will provide additional insight for prevention and treatment.

Periodontal tissue regeneration by combined implantation of adipose tissue-derived stem cells and platelet-rich plasma in a canine model.

PubMed

Tobita, Morikuni; Uysal, Cagri A; Guo, Xin; Hyakusoku, Hiko; Mizuno, Hiroshi

2013-12-01

One goal of periodontal therapy is to regenerate periodontal tissues. Stem cells, growth factors and scaffolds and biomaterials are vital for the restoration of the architecture and function of complex tissues. Adipose tissue-derived stem cells (ASCs) are an ideal population of stem cells for practical regenerative medicine. In addition, platelet-rich plasma (PRP) can be useful for its ability to stimulate tissue regeneration. PRP contains various growth factors and may be useful as a cell carrier in stem cell therapies. The purpose of this study was to determine whether a mixture of ASCs and PRP promoted periodontal tissue regeneration in a canine model. Autologous ASCs and PRP were implanted into areas with periodontal tissue defects. Periodontal tissue defects that received PRP alone or non-implantation were also examined. Histologic, immunohistologic and x-ray studies were performed 1 or 2 months after implantation. The amount of newly formed bone and the scale of newly formed cementum in the region of the periodontal tissue defect were analyzed on tissue sections. The areas of newly formed bone and cementum were greater 2 months after implantation of ASCs and PRP than at 1 month after implantation, and the radiopacity in the region of the periodontal tissue defect increased markedly by 2 months after implantation. The ASCs and PRP group exhibited periodontal tissue with the correct architecture, including alveolar bone, cementum-like structures and periodontal ligament-like structures, by 2 months after implantation. These findings suggest that a combination of autologous ASCs and PRP promotes periodontal tissue regeneration that develops the appropriate architecture for this complex tissue. Copyright © 2013 International Society for Cellular Therapy. Published by Elsevier Inc. All rights reserved.

Platelet-rich plasma in tendon-related disorders: results and indications.

PubMed

Filardo, Giuseppe; Di Matteo, Berardo; Kon, Elizaveta; Merli, Giulia; Marcacci, Maurilio

2016-09-24

Platelet-rich plasma (PRP) is currently the most exploited strategy in the clinical practice to provide a regenerative stimulus for tendon healing. The aim of the present study was to systematically review the available evidence on the treatment of the main tendon disorders where PRP is currently applied. A systematic review of the literature was performed on the use of PRP as a treatment for tendinopathies focusing on the following sites: Achilles tendon, patellar tendon, rotator cuff tendons, and lateral elbow tendons. The following inclusion criteria for relevant articles were used: clinical trials written in English language up to 21 June 2016 on the use of PRP in the conservative or surgical treatment of the aforementioned tendinopathies. The research identified the following clinical trials dealing with the application of PRP in the selected tendons: 19 papers on patellar tendon (6 being RCTs: 4 dealing with PRP conservative application and 2 surgical), 24 papers on Achilles tendon (4 RCTs: 3 conservative and 1 surgical), 29 on lateral elbow tendons (17 RCTs, all conservative), and 32 on rotator cuff (22 RCTs: 18 surgical and 3 conservative). Patellar tendons seem to benefit from PRP injections, whereas in the Achilles tendon, PRP application is not indicated neither as a conservative approach nor as a surgical augmentation. Lateral elbow tendinopathy showed an improvement in most of the high-level studies, but the lack of proven superiority with respect to the more simple whole-blood injections still questions its use in the clinical practice. With regard to rotator cuff pathology, the vast majority of surgical RCTs documented a lack of beneficial effects, whereas there is still inconclusive evidence concerning its conservative application in rotator cuff disorders. Systematic review of level I-IV trials, Level IV.

Effect of platelet-rich plasma on polypropylene meshes implanted in the rabbit vagina: histological analysis.

PubMed

Parizzi, Natália Gomes; Rubini, Oscar Ávila; Almeida, Silvio Henrique Maia de; Ireno, Lais Caetano; Tashiro, Roger Mitio; Carvalho, Victor Hugo Tolotto de

2017-01-01

The polypropylene mesh (PPM) is used in many surgical interventions because of its good incorporation and accessibility. However, potential mesh-related complications are common. Platelet-rich plasma (PRP) improves the healing of wounds and is inexpensive. Thus, the purpose of this study was to analyze the effect of the PRP-gel coating of a PPM on inflammation, production of collagen, and smooth muscle in the rabbit vagina. The intervention consisted of a 1.5cm incision and divulsion of the vaginal mucosa for the implantation of a PRP-coated PPM. The PRP-coated mesh was implanted in 15 rabbits, and in the second group, the same implant was used without the PRP coating. In the sham group, the intervention consisted of the incision, divulsion, and suture. The rabbits were euthanized at 7, 30 and 90 days, and full-thickness sagittal sections of the posterior vaginal wall and rectum were scored. The inflammatory infiltrate was evaluated using hematoxylin and eosin staining. The Sirius Red stain was used to examine deposition of collagen I and III, and Masson's trichrome staining was used to visualize the smooth muscle. The group with PRP-coated meshes had a lower inflammatory infiltrate count at 30 days. Deposition of collagen III increased with the use of PRP-coating at 90 days. The area of inflammatory infiltrate was significantly increased in the group without the PRP-coated mesh at 30 days but not in the group with the PRPcoated mesh, indicating a less intense inflammatory response. In addition, a significant increase in collagen III occurred at 90 days. Copyright® by the International Brazilian Journal of Urology.

A Meta-Analytic Review of the Penn Resiliency Program’s Effect on Depressive Symptoms

PubMed Central

Brunwasser, Steven M.; Gillham, Jane E.; Kim, Eric S.

2015-01-01

Objectives The purpose of this review was to evaluate whether the Penn Resiliency Program (PRP), a group cognitive-behavioral intervention, is effective in targeting depressive symptoms in youth. Data sources We identified 17 controlled evaluations of PRP (N = 2498) measuring depressive symptoms via an online search of PsycInfo, Medline, ERIC, and ProQuest Dissertations and Theses, and by requesting data from PRP researchers. Review methods We combined effect sizes (ESs; Glass’s d), using random effects models at post-intervention and two follow-up assessments. Results PRP participants reported fewer depressive symptoms at post-intervention and both follow-up assessments compared to youth receiving no intervention, with ESs ranging from 0.11 to 0.21. Limited data show no evidence that PRP is superior to active control conditions. Subgroup analyses showed that PRP’s effects were significant at 1 or more follow-up assessments among studies using both targeted and universal approaches, when group leaders were research team members and community providers, among participants with both low and elevated baseline symptoms, and among boys and girls. Preliminary analyses suggest that PRP’s effects on depressive disorders may be smaller than those reported in a larger meta-analysis of depression prevention programs for older adolescents and adults. Conclusion We found evidence that PRP significantly reduces depressive symptoms through at least 1 year post-intervention. Future PRP research should examine whether PRP’s effects on depressive symptoms lead to clinically meaningful benefits for its participants, whether the program is cost-effective, whether CBT skills mediate program effects, and whether PRP is effective when delivered under real-world conditions. PMID:19968381

A systematic review of the use of platelet-rich plasma in sports medicine as a new treatment for tendon and ligament injuries.

PubMed

Taylor, Drew W; Petrera, Massimo; Hendry, Mike; Theodoropoulos, John S

2011-07-01

To evaluate, through a systematic review of the current literature, the evidence-based outcomes of the use of platelet-rich plasma (PRP) for the treatment of tendon and ligament injuries. A search of English-language articles was performed in PubMed and EMBASE using keywords "PRP," "platelet plasma," and "platelet concentrate" combined with "tendon" and then "ligament" independently. The search was conducted through September 2010. Search was limited to in vivo studies. Nonhuman studies were excluded. Tissue engineering strategies, which included a combination of PRP with additional cell types (bone marrow), were also excluded. Articles with all levels of evidence were included. Thirteen of 32 retrieved articles respected the inclusion criteria. The authors reviewed and tabulated data according to the year of study and journal, study type and level of evidence, patient demographics, method of PRP preparation, site of application, and outcomes. The selected studies focused on the application of PRP in the treatment of patellar and elbow tendinosis, Achilles tendon injuries, rotator cuff repair, and anterior cruciate ligament (ACL) reconstruction. Seven studies demonstrated favorable outcomes in tendinopathies in terms of improved pain and functional scores. In 3 studies on the use of PRP in ACL reconstruction, no statistically significant differences were seen with regard to clinical outcomes, tunnel widening, and graft integration. One study examined the systemic effects after the local PRP application for patellar and elbow tendinosis. Presently, PRP use in tendon and ligament injuries has several potential advantages, including faster recovery and, possibly, a reduction in recurrence, with no adverse reactions described. However, only 3 randomized clinical trials have been conducted.

Genetic, histochemical and biochemical studies on goat TSE cases from Cyprus.

PubMed

Niedermeyer, Susanne; Eiden, Martin; Toumazos, Pavlos; Papasavva-Stylianou, Penelope; Ioannou, Ioannis; Sklaviadis, Theodoros; Panagiotidis, Cynthia; Langeveld, Jan; Bossers, Alex; Kuczius, Thorsten; Kaatz, Martin; Groschup, Martin H; Fast, Christine

2016-10-06

Scrapie and bovine spongiform encephalopathy (BSE) are transmissible spongiform encephalopathies (TSE's) affecting sheep and goats. Susceptibility of goats to scrapie is influenced by polymorphisms of the prion protein gene (PRNP) of the host. Five polymorphisms are associated with reduced susceptibility to TSE's. In the study presented here caprine samples from a scrapie eradication program on Cyprus were genotyped and further characterized using BioRad TeSeE rapid test, histological, immunohistochemical and biochemical methods. In total 42 goats from 20 flocks were necropsied from which 25 goats showed a positive result in the rapid test, a spongiform encephalopathy and an accumulation of pathological prion protein (PrP Sc ) in the obex. PrP Sc deposits were demonstrated in the placenta, peripheral nervous and lymphoreticular system. Two animals showed PrP Sc -accumulations in peripheral tissues only. By discriminatory immunoblots a scrapie infection could be confirmed for all cases. Nevertheless, slight deviations in the glycosylation pattern might indicate the presence of different scrapie strains. Furthermore scrapie samples from goats in the current study demonstrated less long term resistance to proteinase K than ovine or caprine BSE control samples. Reduced scrapie susceptibility according to the PRNP genotype was demonstrated (Fishers Exact test, p < 0.05) for the goats with at least one polymorphism (p = 0.023) at the six codons examined and in particular for those with polymorphisms at codon 146 (p = 0.016). This work characterizes scrapie in goats having implications for breeding and surveillance strategies.

Bioenergetics of photoheterotrophic bacteria in the oceans.

PubMed

Kirchman, David L; Hanson, Thomas E

2013-04-01

Photoheterotrophic microbes, such as proteorhodopsin (PR)-based phototrophic (PRP) and aerobic anoxygenic phototrophic (AAP) bacteria, are well known to be abundant in the oceans, potentially playing unique roles in biogeochemical cycles. However, the contribution of phototrophy to the energy requirements of these bacteria has not been quantitatively examined to date. To better understand the implications of photoheterophy in the oceans, we calculated energy benefits and costs of phototrophy and compared net benefits with maintenance costs. Benefits depend on the number of photosynthetic units (PSUs), absorption cross-section area of each PSU as function of wavelength, the in situ light quality, and the energy yield per absorbed photon. For costs we considered the energy required for the synthesis of pigments, amino acids and proteins in each PSU. Our calculations indicate that AAP bacteria harvest more light energy than do PRP bacteria, but the costs of phototrophy are much higher for AAP bacteria. Still, the net energy gained by AAP bacteria is often sufficient to meet maintenance costs, while that is not the case for PRP bacteria except with high light intensities and large numbers of proteorhodopsin molecules per cell. The low costs and simplicity of PR-based phototrophy explain the high abundance of proteorhodopsin genes in the oceans. However, even for AAP bacteria, the net energy yield of phototrophy is apparently too low to influence the distribution of photoheterotrophic bacteria among various marine systems. © 2012 Society for Applied Microbiology and Blackwell Publishing Ltd.

Classification of platelet concentrates: from pure platelet-rich plasma (P-PRP) to leucocyte- and platelet-rich fibrin (L-PRF).

PubMed

Dohan Ehrenfest, David M; Rasmusson, Lars; Albrektsson, Tomas

2009-03-01

The topical use of platelet concentrates is recent and its efficiency remains controversial. Several techniques for platelet concentrates are available; however, their applications have been confusing because each method leads to a different product with different biology and potential uses. Here, we present classification of the different platelet concentrates into four categories, depending on their leucocyte and fibrin content: pure platelet-rich plasma (P-PRP), such as cell separator PRP, Vivostat PRF or Anitua's PRGF; leucocyte- and platelet-rich plasma (L-PRP), such as Curasan, Regen, Plateltex, SmartPReP, PCCS, Magellan or GPS PRP; pure plaletet-rich fibrin (P-PRF), such as Fibrinet; and leucocyte- and platelet-rich fibrin (L-PRF), such as Choukroun's PRF. This classification should help to elucidate successes and failures that have occurred so far, as well as providing an objective approach for the further development of these techniques.

Intradiscal platelet-rich plasma (PRP) injections for discogenic low back pain: an update.

PubMed

Monfett, Michael; Harrison, Julian; Boachie-Adjei, Kwadwo; Lutz, Gregory

2016-06-01

The aim of this article is to provide an overview of clinical and translational research on intradiscal platelet-rich plasma (PRP) as a minimally invasive treatment for discogenic low back pain. A literature review of in vitro, in vivo, and clinical studies was performed. There is strong in vitro evidence that supports the use of intradiscal PRP for discogenic low back pain. There are also promising findings in select preclinical animal studies. A clinical study of 29 participants who underwent intradiscal PRP injections for discogenic low back pain found statistically and clinically significant improvements in pain and function through two years of follow-up. Intradiscal PRP is a safe and a possibly effective treatment for discogenic low back pain. Future studies are warranted to determine the best candidates for this treatment, what the optimal injectate is and what relationships exist between patient-reported outcomes and radiological findings.

Contributions for classification of platelet rich plasma - proposal of a new classification: MARSPILL.

PubMed

Lana, Jose Fabio Santos Duarte; Purita, Joseph; Paulus, Christian; Huber, Stephany Cares; Rodrigues, Bruno Lima; Rodrigues, Ana Amélia; Santana, Maria Helena; Madureira, João Lopo; Malheiros Luzo, Ângela Cristina; Belangero, William Dias; Annichino-Bizzacchi, Joyce Maria

2017-07-01

Platelet-rich plasma (PRP) has emerged as a significant therapy used in medical conditions with heterogeneous results. There are some important classifications to try to standardize the PRP procedure. The aim of this report is to describe PRP contents studying celular and molecular components, and also propose a new classification for PRP. The main focus is on mononuclear cells, which comprise progenitor cells and monocytes. In addition, there are important variables related to PRP application incorporated in this study, which are the harvest method, activation, red blood cells, number of spins, image guidance, leukocytes number and light activation. The other focus is the discussion about progenitor cells presence on peripherial blood which are interesting due to neovasculogenesis and proliferation. The function of monocytes (in tissue-macrophages) are discussed here and also its plasticity, a potential property for regenerative medicine treatments.

The use of autologous blood-derived growth factors in bone regeneration

PubMed Central

Civinini, Roberto; Macera, Armando; Nistri, Lorenzo; Redl, Birgit; Innocenti, Massimo

2011-01-01

Platelet-rich plasma (PRP) is defined as a portion of the plasma fraction of autologous blood having platelet concentrations above baseline. When activated the platelets release growth factors that play an essential role in bone healing such as Platelet-derived Growth Factor, Transforming Growth Factor-β, Vascular Endothelial Growth Factor and others. Multiple basic science and in vivo animal studies agree that PRP has a role in the stimulation of the healing cascade in ligament, tendon, muscle cartilage and in bone regeneration in the last years PRP had a widespread diffusion in the treatment of soft tissue and bone healing. The purpose of this review is to describe the biological properties of platelets and its factors, the methods used for producing PRP, to provide a background on the underlying basic science and an overview of evidence based medicine on clinical application of PRP in bone healing. PMID:22461800

Participation in Research Program: A Novel Course in Undergraduate Education of Life Science

ERIC Educational Resources Information Center

Zhou, Xuanwei; Lin, Juan; Yin, Yizhou; Sun, Xiaofen; Tang, Kexuan

2007-01-01

A novel course, "Participation in Research Program (PRP)" in life sciences is open for 1st to 3rd year undergraduates. PRP introduces the principles of a variety of biological methods and techniques and also offers an opportunity to explore some specific knowledge in more detail prior to thesis research. In addition, the PRP introduces some…

Pathogenic prion protein fragment (PrP106-126) promotes human immunodeficiency virus type-1 infection in peripheral blood monocyte-derived macrophages.

PubMed

Bacot, Silvia M; Feldman, Gerald M; Yamada, Kenneth M; Dhawan, Subhash

2015-02-01

Transfusion of blood and blood products contaminated with the pathogenic form of prion protein Prp(sc), thought to be the causative agent of variant a Creutzfeldt-Jakob disease (vCJD), may result in serious consequences in recipients with a compromised immune system, for example, as seen in HIV-1 infection. In the present study, we demonstrate that treatment of peripheral blood monocyte-derived macrophages (MDM) with PrP106-126, a synthetic domain of PrP(sc) that has intrinsic functional activities related to the full-length protein, markedly increased their susceptibility to HIV-1 infection, induced cytokine secretion, and enhanced their migratory behavior in response to N-formyl-l-methionyl-l-leucyl-l-phenylalanine (fMLP). Live-cell imaging of MDM cultured in the presence of PrP106-126 showed large cell clusters indicative of cellular activation. Tyrosine kinase inhibitor STI-571, protein kinase C inhibitor K252B, and cyclin-dependent kinase inhibitor olomoucine attenuated PrP106-126-induced altered MDM functions. These findings delineate a previously undefined functional role of PrP106-126-mediated host cell response in promoting HIV-1 pathogenesis. Published by Elsevier Inc.

Truncated forms of the prion protein PrP demonstrate the need for complexity in prion structure.

PubMed

Wan, William; Stöhr, Jan; Kendall, Amy; Stubbs, Gerald

2015-01-01

Self-propagation of aberrant protein folds is the defining characteristic of prions. Knowing the structural basis of self-propagation is essential to understanding prions and their related diseases. Prion rods are amyloid fibrils, but not all amyloids are prions. Prions have been remarkably intractable to structural studies, so many investigators have preferred to work with peptide fragments, particularly in the case of the mammalian prion protein PrP. We compared the structures of a number of fragments of PrP by X-ray fiber diffraction, and found that although all of the peptides adopted amyloid conformations, only the larger fragments adopted conformations that modeled the complexity of self-propagating prions, and even these fragments did not always adopt the PrP structure. It appears that the relatively complex structure of the prion form of PrP is not accessible to short model peptides, and that self-propagation may be tied to a level of structural complexity unobtainable in simple model systems. The larger fragments of PrP, however, are useful to illustrate the phenomenon of deformed templating (heterogeneous seeding), which has important biological consequences.

Polymorphisms and variants in the prion protein sequence of European moose (Alces alces), reindeer (Rangifer tarandus), roe deer (Capreolus capreolus) and fallow deer (Dama dama) in Scandinavia

PubMed Central

Wik, Lotta; Mikko, Sofia; Klingeborn, Mikael; Stéen, Margareta; Simonsson, Magnus; Linné, Tommy

2012-01-01

The prion protein (PrP) sequence of European moose, reindeer, roe deer and fallow deer in Scandinavia has high homology to the PrP sequence of North American cervids. Variants in the European moose PrP sequence were found at amino acid position 109 as K or Q. The 109Q variant is unique in the PrP sequence of vertebrates. During the 1980s a wasting syndrome in Swedish moose, Moose Wasting Syndrome (MWS), was described. SNP analysis demonstrated a difference in the observed genotype proportions of the heterozygous Q/K and homozygous Q/Q variants in the MWS animals compared with the healthy animals. In MWS moose the allele frequencies for 109K and 109Q were 0.73 and 0.27, respectively, and for healthy animals 0.69 and 0.31. Both alleles were seen as heterozygotes and homozygotes. In reindeer, PrP sequence variation was demonstrated at codon 176 as D or N and codon 225 as S or Y. The PrP sequences in roe deer and fallow deer were identical with published GenBank sequences. PMID:22441661

Truncated forms of the prion protein PrP demonstrate the need for complexity in prion structure

DOE Office of Scientific and Technical Information (OSTI.GOV)

Wan, William; Stöhr, Jan; Kendall, Amy

2015-09-01

Self-propagation of aberrant protein folds is the defining characteristic of prions. Knowing the structural basis of self-propagation is essential to understanding prions and their related diseases. Prion rods are amyloid fibrils, but not all amyloids are prions. Prions have been remarkably intractable to structural studies, so many investigators have preferred to work with peptide fragments, particularly in the case of the mammalian prion protein PrP. We compared the structures of a number of fragments of PrP by X-ray fiber diffraction, and found that although all of the peptides adopted amyloid conformations, only the larger fragments adopted conformations that modeled themore » complexity of self-propagating prions, and even these fragments did not always adopt the PrP structure. It appears that the relatively complex structure of the prion form of PrP is not accessible to short model peptides, and that self-propagation may be tied to a level of structural complexity unobtainable in simple model systems. The larger fragments of PrP, however, are useful to illustrate the phenomenon of deformed templating (heterogeneous seeding), which has important biological consequences.« less

Reduction of pain via platelet-rich plasma in split-thickness skin graft donor sites: a series of matched pairs

PubMed Central

Miller, John D.; Rankin, Timothy M.; Hua, Natalie T.; Ontiveros, Tina; Giovinco, Nicholas A.; Mills, Joseph L.; Armstrong, David G.

2015-01-01

In the past decade, autologous platelet-rich plasma (PRP) therapy has seen increasingly widespread integration into medical specialties. PRP application is known to accelerate wound epithelialization rates, and may also reduce postoperative wound site pain. Recently, we observed an increase in patient satisfaction following PRP gel (Angel, Cytomedix, Rockville, MD) application to split-thickness skin graft (STSG) donor sites. We assessed all patients known to our university-based hospital service who underwent multiple STSGs up to the year 2014, with at least one treated with topical PRP. Based on these criteria, five patients aged 48.4±17.6 (80% male) were identified who could serve as their own control, with mean time of 4.4±5.1 years between operations. In both therapies, initial dressing changes occurred on postoperative day (POD) 7, with donor site pain measured by Likert visual pain scale. Paired t-tests compared the size and thickness of harvested skin graft and patient pain level, and STSG thickness and surface area were comparable between control and PRP interventions (p>0.05 for all). Donor site pain was reduced from an average of 7.2 (±2.6) to 3 (±3.7), an average reduction in pain of 4.2 (standard error 1.1, p=0.0098) following PRP use. Based on these results, the authors suggest PRP as a beneficial adjunct for reducing donor site pain following STSG harvest. PMID:25623477

Effects of Platelet-Rich Plasma (PRP) on a Model of Renal Ischemia-Reperfusion in Rats.

PubMed

Martín-Solé, Oriol; Rodó, Joan; García-Aparicio, Lluís; Blanch, Josep; Cusí, Victoria; Albert, Asteria

2016-01-01

Renal ischemia-reperfusion injury is a major cause of acute renal failure, causing renal cell death, a permanent decrease of renal blood flow, organ dysfunction and chronic kidney disease. Platelet-rich plasma (PRP) is an autologous product rich in growth factors, and therefore able to promote tissue regeneration and angiogenesis. This product has proven its efficacy in multiple studies, but has not yet been tested on kidney tissue. The aim of this work is to evaluate whether the application of PRP to rat kidneys undergoing ischemia-reperfusion reduces mid-term kidney damage. A total of 30 monorrenal Sprague-Dawley male rats underwent renal ischemia-reperfusion for 45 minutes. During ischemia, PRP (PRP Group, n = 15) or saline solution (SALINE Group, n = 15) was administered by subcapsular renal injection. Control kidneys were the contralateral organs removed immediately before the start of ischemia in the remaining kidneys. Survival, body weight, renal blood flow on Doppler ultrasound, kidney weight, kidney volume, blood biochemistry and histopathology were determined for all subjects and kidneys, as applicable. Correlations between these variables were searched for. The PRP Group showed significantly worse kidney blood flow (p = 0.045) and more histopathological damage (p<0.0001). Correlations were found between body weight, kidney volume, kidney weight, renal blood flow, histology, and serum levels of creatinine and urea. Our study provides the first evidence that treatment with PRP results in the deterioration of the kidney's response to ischemia-reperfusion injury.

Effects of Platelet-Rich Plasma (PRP) on a Model of Renal Ischemia-Reperfusion in Rats

PubMed Central

Martín-Solé, Oriol; Rodó, Joan; García-Aparicio, Lluís; Blanch, Josep; Cusí, Victoria; Albert, Asteria

2016-01-01

Renal ischemia-reperfusion injury is a major cause of acute renal failure, causing renal cell death, a permanent decrease of renal blood flow, organ dysfunction and chronic kidney disease. Platelet-rich plasma (PRP) is an autologous product rich in growth factors, and therefore able to promote tissue regeneration and angiogenesis. This product has proven its efficacy in multiple studies, but has not yet been tested on kidney tissue. The aim of this work is to evaluate whether the application of PRP to rat kidneys undergoing ischemia-reperfusion reduces mid-term kidney damage. A total of 30 monorrenal Sprague-Dawley male rats underwent renal ischemia-reperfusion for 45 minutes. During ischemia, PRP (PRP Group, n = 15) or saline solution (SALINE Group, n = 15) was administered by subcapsular renal injection. Control kidneys were the contralateral organs removed immediately before the start of ischemia in the remaining kidneys. Survival, body weight, renal blood flow on Doppler ultrasound, kidney weight, kidney volume, blood biochemistry and histopathology were determined for all subjects and kidneys, as applicable. Correlations between these variables were searched for. The PRP Group showed significantly worse kidney blood flow (p = 0.045) and more histopathological damage (p<0.0001). Correlations were found between body weight, kidney volume, kidney weight, renal blood flow, histology, and serum levels of creatinine and urea. Our study provides the first evidence that treatment with PRP results in the deterioration of the kidney’s response to ischemia-reperfusion injury. PMID:27551718

A Systematic Review of Autologous Platelet-Rich Plasma and Fat Graft Preparation Methods.

PubMed

Luck, Joshua; Smith, Oliver J; Mosahebi, Afshin

2017-12-01

The addition of platelet-rich plasma (PRP) to adipose tissue may improve fat graft survival, although graft retention rates vary markedly between studies. To what extent this outcome heterogeneity reflects differing methodological factors remains unknown. This systematic review aims to synthesize and critically review methodological approaches to autologous PRP and fat cotransplantation in both human and animal studies. In accordance with PRISMA guidelines, Ovid MEDLINE, Scopus, and Cochrane Library databases were searched from inception to April 2017. Data were extracted from all in vivo studies involving autologous PRP and fat cotransplantation. A secondary aim was to assess reporting of technical detail; authors were not contacted to provide missing data. From 335 articles, 23 studies were included in the qualitative synthesis. Some 21 were performed in humans and 2 in rabbits. Six studies were randomized control trials; the remainder reported on observational data. Methods of PRP extraction and activation varied markedly between studies. Fat graft preparation was comparatively more consistent. Methods of PRP and fat mixing differed significantly, especially with regards to relative volume/volume ratios. Our study represents the first systematic review of methodological factors in autologous PRP and fat cotransplantation. It demonstrates that technical factors in graft preparation and administration vary significantly between in vivo studies. Such methodological heterogeneity may explain observed differences in experimental and clinical outcomes. Reporting of key procedural information is inconsistent and often inadequate. These issues make meaningful evaluation of the PRP-enhanced fat grafting literature difficult and may limit its translation into clinical practice.

Portable Radiation Package (PRP) Instrument Handbook

DOE Office of Scientific and Technical Information (OSTI.GOV)

Reynolds, R Michael

The Portable Radiation Package (PRP) was developed to provide basic radiation information in locations such as ships at sea where proper exposure is remote and difficult, the platform is in motion, and azimuth alignment is not fixed. Development of the PRP began at Brookhaven National Laboratory (BNL) in the mid-1990s and versions of it were deployed on ships in the U.S. Department of Energy (DOE) Atmospheric Radiation Measurement (ARM) Climate Research Facility’s Nauru-99 project. The PRP was deployed on ships in support of the National Aeronautics and Space Administration (NASA) Sensor Intercomparison for Marine Biological and Interdisciplinary Ocean Studies (SIMBIOS)more » program. Over the years the measurements have remained the same while the post-processing data analysis, especially for the FRSR, has evolved. This document describes the next-generation Portable Radiation Package (PRP2) that was developed for the DOE ARM Facility, under contract no. 9F-31462 from Argonne National Laboratory (ANL). The PRP2 has the same scientific principles that were well validated in prior studies, but has upgraded electronic hardware. The PRP2 approach is completely modular, both in hardware and software. Each sensor input is treated as a separate serial stream into the data collection computer. In this way the operator has complete access to each component of the system for purposes of error checking, calibration, and maintenance. The resulting system is more reliable, easier to install in complex situations, and more amenable to upgrade.« less

Effect of platelet-rich plasma on patients after blepharoplasty surgery.

PubMed

Parra, Fidelina; Morales-Rome, David Enrique; Campos-Rodríguez, Rafael; Cruz-Hernández, Teresita Rocío; Drago-Serrano, Maria Elisa

2018-04-01

To evaluate the effect of platelet-rich plasma (PRP) treatment on patients after blepharoplasty surgery. After undergoing blepharoplasty, 20 patients were randomly divided into two groups (n = 10 each). One was treated with autologous PRP and the other was not given any post-surgery treatment (basal group). Autologous PRP application was performed intradermically 24 h, 1 month, and 2 months post-surgery, and the outcome of the applications was assessed 1, 2, and 3 months post-surgery. The postoperative wound was assessed on a patient and observer scar assessment scale (POSAS) by patients and by an unblinded clinical observer. Statistical comparison between the two groups was analyzed by using the Mann-Whitney unpaired, two-tailed test. Significant differences were considered with P ≤ 0.05. Patient-reported data indicate that compared to the basal group, the PRP group showed no significant differences regarding pain, itching, or color, but had better values for stiffness and thickness (months 1 and 2) as well as scar irregularity (month 1). Data reported by the clinical observer showed that in comparison with the basal group, the PRP group showed no differences in vascularization or pigmentation, but had lower (better) scores regarding thickness, relief, and pliability (at all assessment times). The total assessment values from patients and the observer were significantly better for the PRP than the basal group. Autologous PRP treatment enhanced some parameters associated with healing properties, suggesting a potential therapeutic value after blepharoplasty surgery.

Evaluation of the efficacy of platelet-rich plasma and platelet-rich fibrin in alveolar defects after removal of impacted bilateral mandibular third molars

PubMed Central

Doiphode, Amol M.; Hegde, Prashanth; Mahindra, Uma; Santhosh Kumar, S. M.; Tenglikar, Pavan D.; Tripathi, Vivek

2016-01-01

Aim and Objectives: This study attempted the evaluation of the efficacy of platelet-rich plasma (PRP) and platelet-rich fibrin (PRF) in alveolar defects after removal of bilateral mandibular third molars. Materials and Methods: A total of 30 patients reporting to Department of Oral and Maxillofacial Surgery and having bilateral mandibular third molar impaction in both male and female aged between 18 and 30 years were included in this study. PRF and PRP were placed in extraction site and recalled at 2nd, 4th, and 6th month postoperatively. Data were statistically analyzed using IBM SPSS software for Windows, version 19.0. IBM Corp., Armonk, NY, USA. Results: This study showed decreased probing depth in PRF group compared to PRP and control one. This signifies a better soft tissue healing of extraction sockets with PRF as compared to the PRP and the control group and increase in the bone density highlights the use of PRP and PRF certainly as a valid method in inducing hard tissue regeneration. Conclusion: This study indicates a definite improvement in the periodontal health distal to second molar after third molar surgery in cases treated with PRF as compared to the PRP group and control group. Hence, PRP and PRF can be incorporated as an adjunct to promote wound healing and osseous regeneration in mandibular third molar extraction sites. PMID:27195227

Platelet-Rich Plasma Injection With Percutaneous Needling for Recalcitrant Lateral Epicondylitis: Comparison of Tenotomy and Fenestration Techniques.

PubMed

Gaspar, Michael P; Motto, Michael A; Lewis, Sarah; Jacoby, Sidney M; Culp, Randall W; Lee Osterman, A; Kane, Patrick M

2017-12-01

Recalcitrant lateral epicondylitis (LE) is a common debilitating condition, with numerous treatment options of varying success. An injection of platelet-rich plasma (PRP) has been shown to improve LE, although it is unclear whether the method of needling used in conjunction with a PRP injection is of clinical importance. To determine whether percutaneous needle tenotomy is superior to percutaneous needle fenestration when each is combined with a PRP injection for the treatment of recalcitrant LE. Cohort study; Level of evidence, 3. A total of 93 patients with recalcitrant LE were treated with a PRP injection and percutaneous needle fenestration (n = 45) or percutaneous needle tenotomy (n = 48) over a 5-year study interval. Preoperative patient data, including visual analog scale for pain (VAS-P), Quick Disabilities of the Arm, Shoulder and Hand (QuickDASH), and Patient-Rated Tennis Elbow Evaluation (PRTEE) scores and grip strength, were obtained from a chart review and compared with postoperative values obtained prospectively. Secondary outcomes included the incidence of complications, need for additional interventions, return to work, and patient satisfaction. At a mean follow-up of 40 months, significant improvements in VAS-P (mean, -6.1; 95% CI, -6.8 to -5.5; P < .0001), QuickDASH (mean, -46; 95% CI, -52 to -40; P < .0001), and PRTEE (mean, -57; 95% CI, -64 to -50; P < .0001) scores and grip strength (mean, +6.1 kg; 95% CI, 4.9 to 7.3; P < .0001) were observed across the entire study cohort, with no significant differences noted between the fenestration and tenotomy groups. Nine of 45 patients (22%) underwent additional procedures to treat recurrent symptoms in the fenestration group compared with 5 of 48 patients (10%) in the tenotomy group ( P = .05). No complications occurred in any patients, and no patients expressed dissatisfaction with their treatment course. A PRP injection with concomitant percutaneous needling is an effective treatment for recalcitrant LE, with sustained improvements in pain, strength, and function demonstrated at a mean follow-up of longer than 3 years. Although the method of concomitant needling does not appear to have a significant effect on treatment outcomes, more aggressive needle tenotomy is less likely to require conversion to open tenotomy than needle fenestration in the short term to midterm.

Novel celecoxib analogues inhibit glial production of prostaglandin E2, nitric oxide, and oxygen radicals reverting the neuroinflammatory responses induced by misfolded prion protein fragment 90-231 or lipopolysaccharide.

PubMed

Villa, Valentina; Thellung, Stefano; Bajetto, Adriana; Gatta, Elena; Robello, Mauro; Novelli, Federica; Tasso, Bruno; Tonelli, Michele; Florio, Tullio

2016-11-01

We tested the efficacy of novel cyclooxygenase 2 (COX-2) inhibitors in counteracting glia-driven neuroinflammation induced by the amyloidogenic prion protein fragment PrP90-231 or lipopolysaccharide (LPS). In search for molecules with higher efficacy than celecoxib, we focused our study on its 2,3-diaryl-1,3-thiazolidin-4-one analogues. As experimental models, we used the immortalized microglial cell line N9, rat purified microglial primary cultures, and mixed cultures of astrocytes and microglia. Microglia activation in response to PrP90-231 or LPS was characterized by growth arrest, morphology changes and the production of reactive oxygen species (ROS). Moreover, PrP90-231 treatment caused the overexpression of the inducible nitric oxide synthase (iNOS) and COX-2, with the consequent nitric oxide (NO), and prostaglandin E 2 (PGE 2 ) accumulation. These effects were challenged by different celecoxib analogues, among which Q22 (3-[4-(sulfamoyl)phenyl]-2-(4-tolyl)thiazolidin-4-one) inhibited microglia activation more efficiently than celecoxib, lowering both iNOS and COX-2 activity and reducing ROS release. During neurodegenerative diseases, neuroinflammation induced by amyloidogenic peptides causes the activation of both astrocytes and microglia with these cell populations mutually regulating each other. Thus the effects of PrP90-231 and LPS were also studied on mixed glial cultures containing astrocytes and microglia. PrP90-231 treatment elicited different responses in the co-cultures induced astrocyte proliferation and microglia growth arrest, resulting in a differential ability to release proinflammatory molecules with the production of NO and ROS mainly attributable on microglia, while COX-2 expression was induced also in astrocytes. Q22 effects on both NO and PGE 2 secretion were more significant in the mixed glial cultures than in purified microglia, demonstrating Q22 ability to revert the functional interaction between astrocytes and microglia. These results demonstrate that Q22 is a powerful drug able to revert glial neuroinflammatory responses and might represent a lead to explore the chemical space around celecoxib frameworks to design even more effective agents, paving the way to novel approaches to contrast the neuroinflammation-dependent toxicity. Copyright © 2016 Elsevier Ltd. All rights reserved.

Ecosystems supporting clusters of sporadic TSEs demonstrate excesses of the radical-generating divalent cation manganese and deficiencies of antioxidant co factors Cu, Se, Fe, Zn. Does a foreign cation substitution at prion protein's Cu domain initiate TSE?

PubMed

Purdey, M

2000-02-01

Analyses of food chains supporting isolated clusters of sporadic TSEs (CWD in N Colorado, scrapie in Iceland, CJD in Slovakia) demonstrate a consistent 2 1/2+ fold greater concentration of the pro-oxidant divalent cation, manganese (Mn), in relation to normal levels recorded in adjoining TSE-free localities. Deficiencies of the antioxidant co factors Cu/Se/Zn/Fe and Mg, P and Na were also consistently recorded in TSE foodchains. Similarities between the clinical/pathological profile of TSEs and Mn delayed psycho-neurotoxicity in miners are cited, and a novel theory generated which suggests that sporadic TSE results from early life dependence of TSE susceptible genotypes on ecosystems characterised by this specific pattern of mineral imbalance. Low Cu/Fe induces an excessive absorption of Mn in ruminants and an increased oxidation of Mn2+ into its pro oxidant species, Mn3+, which accumulates in mitochondria of CNS astrocytes in Mn SOD deficient genotypes. Deficiencies of scavenger co factors Cu/Zn/Se/Fe in the CNS permits Mn3+ initiated chain reactions of auto-oxidant mediated neuronal degeneration to proliferate, which, in turn, up-regulates the expression of the Cu-metalloprotein, prion protein (PrP). Once the rate of PrP turnover and its demand for Cu exceeds the already depleted supply of Cu within the CNS, PrP can no longer bind sufficient Cu to maintain its conformation. Mn3+ substitutes at the vacated Cu domain on PrP, thus priming up a latent capacity for lethal auto-oxidative activity to be carried along with PrP like a 'trojan horse'; where Mn 3+ serves as the integral 'infectious' transmissible component of the misfolded PrP-cation complex. The Mn overactivation of concanavalin A binding to glycoprotein and Mn-initiated autoxidation results in a diverse pathological profile involving receptor capping, aggregation/modification of CNS membrane/cytoskeletal proteins. TSE ensues. The BSE/nv CJD strain entails a 'synthetic' induction of the same CNS mineral disturbance, where 'in utero' exposure to Cu-chelating insecticides/Mn supplements accelerates the onset of a more virulent 'strain' of adolescent TSE. Copyright 2000 Harcourt Publishers Ltd.

Influence of 4-week multi-strain probiotic administration on resting-state functional connectivity in healthy volunteers.

PubMed

Bagga, Deepika; Aigner, Christoph Stefan; Reichert, Johanna Louise; Cecchetto, Cinzia; Fischmeister, Florian Ph S; Holzer, Peter; Moissl-Eichinger, Christine; Schöpf, Veronika

2018-05-30

Experimental investigations in rodents have contributed significantly to our current understanding of the potential importance of the gut microbiome and brain interactions for neurotransmitter expression, neurodevelopment, and behaviour. However, clinical evidence to support such interactions is still scarce. The present study used a double-blind, randomized, pre- and post-intervention assessment design to investigate the effects of a 4-week multi-strain probiotic administration on whole-brain functional and structural connectivity in healthy volunteers. Forty-five healthy volunteers were recruited for this study and were divided equally into three groups (PRP: probiotic, PLP: placebo, and CON: control). All the participants underwent resting-state functional MRI and diffusion MRI brain scans twice during the course of study, at the beginning (time point 1) and after 4 weeks (time point 2). MRI data were acquired using a 3T whole-body MR system (Magnetom Skyra, Siemens, Germany). Functional connectivity (FC) changes were observed in the default mode network (DMN), salience network (SN), and middle and superior frontal gyrus network (MFGN) in the PRP group as compared to the PLP and CON groups. PRP group showed a significant decrease in FC in MFGN (in frontal pole and frontal medial cortex) and in DMN (in frontal lobe) as compared to CON and PLP groups, respectively. Further, significant increase in FC in SN (in cingulate gyrus and precuneus cortex) was also observed in PRP group as compared to CON group. The significance threshold was set to p < 0.05 FWE corrected. No significant structural differences were observed between the three groups. This work provides new insights into the role of a multi-strain probiotic administration in modulating the behaviour, which is reflected as changes in the FC in healthy volunteers. This study motivates future investigations into the role of probiotics in context of major depression and stress disorders.

Somatic mosaicism in a case of apparently sporadic Creutzfeldt-Jakob disease carrying a de novo D178N mutation in the PRNP gene.

PubMed

Alzualde, A; Moreno, F; Martínez-Lage, P; Ferrer, I; Gorostidi, A; Otaegui, D; Blázquez, L; Atares, B; Cardoso, S; Martínez de Pancorbo, M; Juste, R; Rodríguez-Martínez, A B; Indakoetxea, B; López de Munain, A

2010-10-05

Transmissible spongiform encephalopathies (TSEs) are a group of rare fatal neurodegenerative disorders. Creutzfeldt-Jakob disease (CJD) represents the most common form of TSE and can be classified into sporadic, genetic, iatrogenic and variant forms. Genetic cases are related to prion protein gene mutations but they only account for 10-20% of cases. Here we report an apparently sporadic CJD case with negative family history carrying a mutation at codon 178 of prion protein gene. This mutation is a de novo mutation as the parents of the case do not show it. Furthermore the presence of three different alleles (wild type 129M-178D and 129V-178D and mutated 129V-178N), confirmed by different methods, indicates that this de novo mutation is a post-zygotic mutation that produces somatic mosaicism. The proportion of mutated cells in peripheral blood cells and in brain tissue was similar and was estimated at approximately 97%, suggesting that the mutation occurred at an early stage of embryogenesis. Neuropathological examination disclosed spongiform change mainly involving the caudate and putamen, and the cerebral cortex, together with proteinase K-resistant PrP globular deposits in the cerebrum and cerebellum. PrP typing was characterized by a lower band of 21 kDa. This is the first case of mosaicism described in prion diseases and illustrates a potential etiology for apparently sporadic neurodegenerative diseases. In light of this case, genetic counseling for inherited and sporadic forms of transmissible encephalopathies should take into account this possibility for genetic screening procedures.

The Patient Research Partner Network Matures: A Report from the GRAPPA 2017 Annual Meeting.

PubMed

Goel, Niti; O'Sullivan, Denis; de Wit, Maarten; Lindsay, Chris A; Bertheussen, Heidi; Latella, John; Chau, Jeffrey; MacDonald, Roland; Grieb, Suzanne; Steinkoenig, Ingrid; Campbell, Willemina

2018-06-01

The Group for Research and Assessment of Psoriasis and Psoriatic Arthritis (GRAPPA) has reached the third of 5 stages of organizational maturity regarding incorporating patient research partners (PRP) into psoriatic arthritis (PsA) and psoriasis research and educational efforts. Herein, we report the involvement of PRP at the GRAPPA 2017 annual meeting and plans for future PRP engagement.

Utilization of Platelet-Rich Plasma for Musculoskeletal Injuries

PubMed Central

Zhang, Joanne Y.; Fabricant, Peter D.; Ishmael, Chad R.; Wang, Jeffrey C.; Petrigliano, Frank A.; Jones, Kristofer J.

2016-01-01

Background: Platelet-rich plasma (PRP) has emerged as a popular biologic treatment for musculoskeletal injuries and conditions. Despite numerous investigations on the efficacy of PRP therapy, current utilization of this treatment within the United States is not widely known. Purpose: To investigate the national utilization of PRP, including the incidence and conditions for which it is used in the clinical setting, and to determine the current charges associated with this treatment. Study Design: Descriptive epidemiology study. Methods: Using a national database (PearlDiver) of private insurance billing records, we conducted a comprehensive search using Current Procedural Terminology (CPT) codes to identify patients who received PRP injections over a 2-year period (2010-2011). Associated International Classification of Diseases, 9th Revision (ICD-9) codes were identified to determine the specific conditions the injection was used to treat. The aggregate patient data were analyzed by yearly quarter, practice setting, geographic region, and demographics. PRP therapy charges were calculated and reported as per-patient average charges (PPACs). Results: A total of 2571 patients who received PRP injections were identified; 51% were male and 75% were older than 35 years. The overall incidence ranged from 5.9 to 7.9 per 1000 patients over the study period. PRP was most commonly administered in hospitals (39%) and ambulatory surgical centers (37%) compared with in private offices (26%). The most common conditions treated were knee meniscus/plica disorders, followed by unspecified shoulder conditions, rotator cuff injuries, epicondylitis, and plantar fasciitis. Further evaluation revealed that 25% of all patients received injections for cartilage-related conditions, 25% meniscus, 25% unspecified, 12% tendon, 8% glenoid labrum, and 5% ligament. The PPAC for PRP treatment was US$1755 per injection. Conclusion: Despite a lack of consensus regarding PRP indications and efficacy, we observed widespread application of this treatment for a myriad of musculoskeletal injuries. Most treated patients were older than 35 years, and the most commonly treated conditions included cartilage and meniscus disorders. Given the current controversy surrounding this treatment, further studies are necessary to guide clinicians on the value of this therapy for each clinical diagnosis. PMID:28210648

Utilization of Platelet-Rich Plasma for Musculoskeletal Injuries: An Analysis of Current Treatment Trends in the United States.

PubMed

Zhang, Joanne Y; Fabricant, Peter D; Ishmael, Chad R; Wang, Jeffrey C; Petrigliano, Frank A; Jones, Kristofer J

2016-12-01

Platelet-rich plasma (PRP) has emerged as a popular biologic treatment for musculoskeletal injuries and conditions. Despite numerous investigations on the efficacy of PRP therapy, current utilization of this treatment within the United States is not widely known. To investigate the national utilization of PRP, including the incidence and conditions for which it is used in the clinical setting, and to determine the current charges associated with this treatment. Descriptive epidemiology study. Using a national database (PearlDiver) of private insurance billing records, we conducted a comprehensive search using Current Procedural Terminology (CPT) codes to identify patients who received PRP injections over a 2-year period (2010-2011). Associated International Classification of Diseases, 9th Revision (ICD-9) codes were identified to determine the specific conditions the injection was used to treat. The aggregate patient data were analyzed by yearly quarter, practice setting, geographic region, and demographics. PRP therapy charges were calculated and reported as per-patient average charges (PPACs). A total of 2571 patients who received PRP injections were identified; 51% were male and 75% were older than 35 years. The overall incidence ranged from 5.9 to 7.9 per 1000 patients over the study period. PRP was most commonly administered in hospitals (39%) and ambulatory surgical centers (37%) compared with in private offices (26%). The most common conditions treated were knee meniscus/plica disorders, followed by unspecified shoulder conditions, rotator cuff injuries, epicondylitis, and plantar fasciitis. Further evaluation revealed that 25% of all patients received injections for cartilage-related conditions, 25% meniscus, 25% unspecified, 12% tendon, 8% glenoid labrum, and 5% ligament. The PPAC for PRP treatment was US$1755 per injection. Despite a lack of consensus regarding PRP indications and efficacy, we observed widespread application of this treatment for a myriad of musculoskeletal injuries. Most treated patients were older than 35 years, and the most commonly treated conditions included cartilage and meniscus disorders. Given the current controversy surrounding this treatment, further studies are necessary to guide clinicians on the value of this therapy for each clinical diagnosis.

The Endoplasmic Reticulum Chaperone GRP78/BiP Modulates Prion Propagation in vitro and in vivo.

PubMed

Park, Kyung-Won; Eun Kim, Gyoung; Morales, Rodrigo; Moda, Fabio; Moreno-Gonzalez, Ines; Concha-Marambio, Luis; Lee, Amy S; Hetz, Claudio; Soto, Claudio

2017-03-23

Prion diseases are fatal neurodegenerative disorders affecting several mammalian species, characterized by the accumulation of the misfolded form of the prion protein, which is followed by the induction of endoplasmic reticulum (ER) stress and the activation of the unfolded protein response (UPR). GRP78, also called BiP, is a master regulator of the UPR, reducing ER stress levels and apoptosis due to an enhancement of the cellular folding capacity. Here, we studied the role of GRP78 in prion diseases using several in vivo and in vitro approaches. Our results show that a reduction in the expression of this molecular chaperone accelerates prion pathogenesis in vivo. In addition, we observed that prion replication in cell culture was inversely related to the levels of expression of GRP78 and that both proteins interact in the cellular context. Finally, incubation of PrP Sc with recombinant GRP78 led to the dose-dependent reduction of protease-resistant PrP Sc in vitro. Our results uncover a novel role of GRP78 in reducing prion pathogenesis, suggesting that modulating its levels/activity may offer a novel opportunity for designing therapeutic approaches for these diseases. These findings may also have implications for other diseases involving the accumulation of misfolded proteins.

Does Pure Platelet-Rich Plasma Affect Postoperative Clinical Outcomes After Arthroscopic Rotator Cuff Repair? A Randomized Controlled Trial.

PubMed

Flury, Matthias; Rickenbacher, Dominik; Schwyzer, Hans-Kaspar; Jung, Christian; Schneider, Marco M; Stahnke, Katharina; Goldhahn, Jörg; Audigé, Laurent

2016-08-01

The exact role of platelet-rich plasma (PRP) in rotator cuff tendon reconstruction remains unclear. This study investigated whether an intraoperative pure PRP injection, compared with a local anesthetic injection, improves patient-reported outcomes at 3 and 6 months after arthroscopic rotator cuff repair. The hypothesis was that pure PRP improves patient-reported outcomes (Oxford Shoulder Score [OSS]) at 3 and 6 months after surgery and has the same pain-reducing effect compared with a postoperative subacromial local anesthetic (ropivacaine) injection. Randomized controlled trial; Level of evidence, 1. Between January 2011 and November 2012, a total of 120 patients who underwent arthroscopic double-row repair of a supraspinatus tendon rupture were randomized to receive either pure PRP by an injection at the footprint (PRP group; n = 60) or ropivacaine injected in the subacromial region (control group; n = 60). Seventy-eight percent of patients had other concomitant tears. All patients, surgeons, and follow-up investigators were blinded. Clinical parameters and various outcome scores (Constant-Murley shoulder score; OSS; patient American Shoulder and Elbow Surgeons score; quick Disabilities of the Arm, Shoulder and Hand score; EuroQol 5 dimensions) were documented preoperatively and at 3, 6, and 24 months postoperatively. The repair integrity was assessed by magnetic resonance imaging or ultrasound at 24 months. Furthermore, a pain diary was completed within the first 10 postoperative days, and adverse events were recorded. Group outcome differences were analyzed using t tests, Fisher exact tests, and mixed models. The final follow-up rate was 91%. An associated tear of the subscapularis tendon was diagnosed in 23% of PRP-treated patients and 36% of control patients. Three months after surgery, the mean (±SD) OSS was 32.9 ± 8.6 in PRP-treated patients and 30.7 ± 10.0 in control patients (P = .221). No significant differences were noted for other outcome parameters as well as at 6 and 24 months postoperatively. Smoking was a significant effect modifier. Pain for both groups decreased from postoperative day 1 to 10 without any significant group difference (P = .864). Six (12.2%) and 11 (20.8%) patients were diagnosed with a recurrent supraspinatus tendon defect in the PRP and control groups, respectively (P = .295). Twenty-two (40.7%) and 18 (30.5%) PRP-treated and control patients, respectively, experienced a local adverse event within 24 months (P = .325). Patients treated with pure PRP showed no significantly improved function at 3, 6, and 24 months after arthroscopic repair compared with control patients receiving ropivacaine; however, a similar pain reduction was documented in both groups. The negative influence of smoking on the effect of pure PRP requires further investigation. NCT01266226 (ClinicalTrials.gov). © 2016 The Author(s).

Platelet-rich plasma injections: an emerging therapy for chronic discogenic low back pain.

PubMed

Mohammed, Suja; Yu, James

2018-03-01

Autologous platelet-rich plasma (PRP) injections have been investigated in recent years as an emerging therapy for various musculoskeletal conditions, including lumbar degenerative disc disease. Although PRP has received increasing attention from medical science experts, comprehensive clinical reports of its efficacy are limited to those treating knee osteoarthritis and epicondylitis. Use of PRP is gaining popularity in the area of degenerative disc disease, but there is a clear need for reliable clinical evidence of its applications and effectiveness. In this article, we review the current literature on PRP therapy and its potential use in the treatment of chronic discogenic low back pain, with a focus on evidence from clinical trials.

Identification of Two Prion Protein Regions That Modify Scrapie Incubation Time

PubMed Central

Supattapone, Surachai; Muramoto, Tamaki; Legname, Giuseppe; Mehlhorn, Ingrid; Cohen, Fred E.; DeArmond, Stephen J.; Prusiner, Stanley B.; Scott, Michael R.

2001-01-01

A series of prion transmission experiments was performed in transgenic (Tg) mice expressing either wild-type, chimeric, or truncated prion protein (PrP) molecules. Following inoculation with Rocky Mountain Laboratory (RML) murine prions, scrapie incubation times for Tg(MoPrP)4053, Tg(MHM2)294/Prnp0/0, and Tg(MoPrP,Δ23–88)9949/Prnp0/0 mice were ∼50, 120, and 160 days, respectively. Similar scrapie incubation times were obtained after inoculation of these lines of Tg mice with either MHM2(MHM2(RML)) or MoPrP(Δ23–88)(RML) prions, excluding the possibility that sequence-dependent transmission barriers could account for the observed differences. Tg(MHM2)294/Prnp0/0 mice displayed prolonged scrapie incubation times with four different strains of murine prions. These data provide evidence that the N terminus of MoPrP and the chimeric region of MHM2 PrP (residues 108 through 111) both influence the inherent efficiency of prion propagation. PMID:11152514

A conformational switch in PRP8 mediates metal ion coordination that promotes pre-mRNA exon ligation

PubMed Central

Schellenberg, Matthew J.; Wu, Tao; Ritchie, Dustin B.; Fica, Sebastian; Staley, Jonathan P.; Atta, Karim A.; LaPointe, Paul; MacMillan, Andrew M.

2013-01-01

SUMMARY Splicing of pre-mRNAs in eukaryotes is catalyzed by the spliceosome a large RNA–protein metalloenzyme. The catalytic center of the spliceosome involves a structure comprised of the U2 and U6 snRNAs and includes a metal bound by U6 snRNA. The precise architecture of the splicesome active site however, including the question of whether it includes protein components, remains unresolved. A wealth of evidence places the protein PRP8 at the heart of the spliceosome through assembly and catalysis. Here we provide evidence that the RNase H domain of PRP8 undergoes a conformational switch between the two steps of splicing rationalizing yeast prp8 alleles promoting either the first or second step. We also show that this switch unmasks a metal-binding site involved in the second step. Together these data establish that PRP8 is a metalloprotein that promotes exon ligation within the spliceosome. PMID:23686287

School-based prevention of depressive symptoms: A randomized controlled study of the effectiveness and specificity of the Penn Resiliency Program.

PubMed

Gillham, Jane E; Reivich, Karen J; Freres, Derek R; Chaplin, Tara M; Shatté, Andrew J; Samuels, Barbra; Elkon, Andrea G L; Litzinger, Samantha; Lascher, Marisa; Gallop, Robert; Seligman, Martin E P

2007-02-01

The authors investigated the effectiveness and specificity of the Penn Resiliency Program (PRP; J. E. Gillham, L. H. Jaycox, K. J. Reivich, M. E. P. Seligman, & T. Silver, 1990), a cognitive-behavioral depression prevention program. Children (N = 697) from 3 middle schools were randomly assigned to PRP, Control (CON), or the Penn Enhancement Program (PEP; K. J. Reivich, 1996; A. J. Shatté, 1997), an alternate intervention that controls for nonspecific intervention ingredients. Children's depressive symptoms were assessed through 3 years of follow-up. There was no intervention effect on average levels of depressive symptoms in the full sample. Findings varied by school. In 2 schools, PRP significantly reduced depressive symptoms across the follow-up relative to both CON and PEP. In the 3rd school, PRP did not prevent depressive symptoms. The authors discuss the findings in relation to previous research on PRP and the dissemination of prevention programs. Copyright 2007 APA, all rights reserved.

School-Based Prevention of Depressive Symptoms: A Randomized Controlled Study of the Effectiveness and Specificity of the Penn Resiliency Program

PubMed Central

Gillham, Jane E.; Reivich, Karen J.; Freres, Derek R.; Chaplin, Tara M.; Shatté, Andrew J.; Samuels, Barbra; Elkon, Andrea G. L.; Litzinger, Samantha; Lascher, Marisa; Gallop, Robert; Seligman, Martin E. P.

2015-01-01

The authors investigated the effectiveness and specificity of the Penn Resiliency Program (PRP; J. E. Gillham, L. H. Jaycox, K. J. Reivich, M. E. P. Seligman, & T. Silver, 1990), a cognitive–behavioral depression prevention program. Children (N = 697) from 3 middle schools were randomly assigned to PRP, Control (CON), or the Penn Enhancement Program (PEP; K. J. Reivich, 1996; A. J. Shatté, 1997), an alternate intervention that controls for nonspecific intervention ingredients. Children’s depressive symptoms were assessed through 3 years of follow-up. There was no intervention effect on average levels of depressive symptoms in the full sample. Findings varied by school. In 2 schools, PRP significantly reduced depressive symptoms across the follow-up relative to both CON and PEP. In the 3rd school, PRP did not prevent depressive symptoms. The authors discuss the findings in relation to previous research on PRP and the dissemination of prevention programs. PMID:17295559

Leukocyte Inclusion within a Platelet Rich Plasma-Derived Fibrin Scaffold Stimulates a More Pro-Inflammatory Environment and Alters Fibrin Properties

PubMed Central

Anitua, Eduardo; Zalduendo, Mar; Troya, María; Padilla, Sabino; Orive, Gorka

2015-01-01

One of the main differences among platelet-rich plasma (PRP) products is the inclusion of leukocytes that may affect the biological efficacy of these autologous preparations. The purpose of this study was to evaluate whether the addition of leukocytes modified the morphological, biomechanical and biological properties of PRP under normal and inflammatory conditions. The release of pro-inflammatory cytokines from plasma rich in growth factors (PRGF) and leukocyte-platelet rich plasma (L-PRP) scaffolds was determined by enzyme-linked immunosorbent assay (ELISA) and was significantly increased under an inflammatory condition when leukocytes were included in the PRP. Fibroblasts and osteoblasts treated with L-PRP, under an inflammatory situation, underwent a greater activation of NFĸB pathway, proliferated significantly less and secreted a higher concentration of pro-inflammatory cytokines. These cellular events were assessed through Western blot and fluorimetric and ELISA methods, respectively. Therefore, the inclusion of leukocytes induced significantly higher pro-inflammatory conditions. PMID:25823008

Antimicrobial effect of platelet-rich plasma and platelet-rich fibrin.

PubMed

Badade, Pallavi S; Mahale, Swapna A; Panjwani, Alisha A; Vaidya, Prutha D; Warang, Ayushya D

2016-01-01

Platelet concentrates have been extensively used in a variety of medical fields to promote soft- and hard-tissue regeneration. The significance behind their use lies in the abundance of growth factors (GFs) in platelets α-granules that promote wound healing. Other than releasing a pool of GFs upon activation, platelets also have many features that indicate their role in the anti-infective host defense. The aim of this study is to evaluate the antimicrobial activities of platelet-rich plasma (PRP) and platelet-rich fibrin (PRF) against periodontal disease-associated bacteria. Blood samples were obtained from ten adult male patients. PRP and PRF were procured using centrifugation. The antimicrobial activity of PRP and PRF was evaluated by microbial culturing using bacterial strains of Porphyromonas gingivalis and Aggregatibacter actinomycetemcomitans. P. gingivalis and A. actinomycetemcomitans were inhibited by PRP but not by PRF. PRP is a potentially useful substance in the fight against periodontal pathogens. This might represent a valuable property in adjunct to the enhancement of tissue regeneration.

Platelet-rich plasma (PRP) for knee disorders

PubMed Central

Shahid, Mohammad; Kundra, Rik

2017-01-01

Platelet-rich plasma (PRP) is an autologous blood product with platelet concentrations above baseline values. The process involves the extraction of blood from the patient which is then centrifuged to obtain a concentrated suspension of platelets by plasmapheresis. It then undergoes a two-stage centrifugation process to separate the solid and liquid components of the anticoagulated blood. PRP owes its therapeutic use to the growth factors released by the platelets which are claimed to possess multiple regenerative properties. In the knee, PRP has been used in patients with articular cartilage pathology, ligamentous and meniscal injuries. There is a growing body of evidence to support its use in selected indications and this review looks at the most recent evidence. We also look at the current UK National Institute of Health & Clinical Excellence (NICE) guidelines with respect to osteoarthritis and the use of PRP in the knee. Cite this article: EFORT Open Rev 2017;2:28–34. DOI: 10.1302/2058-5241.2.160004. PMID:28607768

An evidence-based evaluation on the use of platelet rich plasma in orthopedics – a review of the literature

PubMed Central

Hussain, Nasir; Johal, Herman; Bhandari, Mohit

2017-01-01

Within orthopedics, the use of platelet-rich plasma (PRP) has been rapidly increasing in popularity, however, its true effectiveness has yet to be fully established. Several studies find that injecting PRP to the site of injury does not provide any significant benefit with respect to clinical outcomes; however, many others report the contrary. Due to the conflicting evidence and multiple meta-analyses conducted on the topic, a literature review of high-quality evidence on the use of PRP for common orthopaedic conditions was performed. Thus far, the evidence appears to suggest that PRP may provide some benefit in patients who present with knee osteoarthritis or lateral epicondylitis. On the other hand, evidence appears to be inconsistent or shows a minimal benefit for PRP usage in rotator cuff repair, patellar and Achilles tendinopathies, hamstring injuries, anterior cruciate ligament (ACL) repair, and medial epicondylitis. There is limited confidence in the conclusions from the published meta-analyses due to issues with statistical pooling, and limited subgroup analyses exploring the substantial heterogeneity across studies. Evidence-based clinicians considering the use of PRP in their patients with musculoskeletal injuries should be weary that the literature appears to be inconsistent and thus far, inconclusive. PMID:28990574

Multimodal fluorescence microscopy of prion strain specific PrP deposits stained by thiophene-based amyloid ligands.

PubMed

Magnusson, Karin; Simon, Rozalyn; Sjölander, Daniel; Sigurdson, Christina J; Hammarström, Per; Nilsson, K Peter R

2014-01-01

The disease-associated prion protein (PrP) forms aggregates which vary in structural conformation yet share an identical primary sequence. These variations in PrP conformation are believed to manifest in prion strains exhibiting distinctly different periods of disease incubation as well as regionally specific aggregate deposition within the brain. The anionic luminescent conjugated polythiophene (LCP), polythiophene acetic acid (PTAA) has previously been used to distinguish PrP deposits associated with distinct mouse adapted strains via distinct fluorescence emission profiles from the dye. Here, we employed PTAA and 3 structurally related chemically defined luminescent conjugated oligothiophenes (LCOs) to stain brain tissue sections from mice inoculated with 2 distinct prion strains. Our results showed that in addition to emission spectra, excitation, and fluorescence lifetime imaging microscopy (FLIM) can fruitfully be assessed for optical distinction of PrP deposits associated with distinct prion strains. Our findings support the theory that alterations in LCP/LCO fluorescence are due to distinct conformational restriction of the thiophene backbone upon interaction with PrP aggregates associated with distinct prion strains. We foresee that LCP and LCO staining in combination with multimodal fluorescence microscopy might aid in detecting structural differences among discrete protein aggregates and in linking protein conformational features with disease phenotypes for a variety of neurodegenerative proteinopathies.

Multimodal fluorescence microscopy of prion strain specific PrP deposits stained by thiophene-based amyloid ligands

PubMed Central

Magnusson, Karin; Simon, Rozalyn; Sjölander, Daniel; Sigurdson, Christina J; Hammarström, Per; Nilsson, K Peter R

2014-01-01

The disease-associated prion protein (PrP) forms aggregates which vary in structural conformation yet share an identical primary sequence. These variations in PrP conformation are believed to manifest in prion strains exhibiting distinctly different periods of disease incubation as well as regionally specific aggregate deposition within the brain. The anionic luminescent conjugated polythiophene (LCP), polythiophene acetic acid (PTAA) has previously been used to distinguish PrP deposits associated with distinct mouse adapted strains via distinct fluorescence emission profiles from the dye. Here, we employed PTAA and 3 structurally related chemically defined luminescent conjugated oligothiophenes (LCOs) to stain brain tissue sections from mice inoculated with 2 distinct prion strains. Our results showed that in addition to emission spectra, excitation, and fluorescence lifetime imaging microscopy (FLIM) can fruitfully be assessed for optical distinction of PrP deposits associated with distinct prion strains. Our findings support the theory that alterations in LCP/LCO fluorescence are due to distinct conformational restriction of the thiophene backbone upon interaction with PrP aggregates associated with distinct prion strains. We foresee that LCP and LCO staining in combination with multimodal fluorescence microscopy might aid in detecting structural differences among discrete protein aggregates and in linking protein conformational features with disease phenotypes for a variety of neurodegenerative proteinopathies. PMID:25495506

Platelet-rich plasma for regeneration of neural feedback pathways around dental implants: a concise review and outlook on future possibilities

PubMed Central

Huang, Yan; Bornstein, Michael M; Lambrichts, Ivo; Yu, Hai-Yang; Politis, Constantinus; Jacobs, Reinhilde

2017-01-01

Along with the development of new materials, advanced medical imaging and surgical techniques, osseointegrated dental implants are considered a successful and constantly evolving treatment modality for the replacement of missing teeth in patients with complete or partial edentulism. The importance of restoring the peripheral neural feedback pathway and thus repairing the lack of periodontal mechanoreceptors after tooth extraction has been highlighted in the literature. Nevertheless, regenerating the nerve fibers and reconstructing the neural feedback pathways around osseointegrated implants remain a challenge. Recent studies have provided evidence that platelet-rich plasma (PRP) therapy is a promising treatment for musculoskeletal injuries. Because of its high biological safety, convenience and usability, PRP therapy has gradually gained popularity in the clinical field. Although much remains to be learned, the growth factors from PRP might play key roles in peripheral nerve repair mechanisms. This review presents known growth factors contributing to the biological efficacy of PRP and illustrates basic and (pre-)clinical evidence regarding the use of PRP and its relevant products in peripheral nerve regeneration. In addition, the potential of local application of PRP for structural and functional recovery of injured peripheral nerves around dental implants is discussed. PMID:28282030

Role of platelet-rich plasma in articular cartilage injury and disease.

PubMed

Mascarenhas, Randy; Saltzman, Bryan M; Fortier, Lisa A; Cole, Brian J

2015-02-01

Clinical and laboratory research aimed at biological approaches to cartilage repair are currently in high demand due to the poor regenerative capacity of articular cartilage in the setting of a diseased articular environment. Platelet-rich plasma (PRP) takes advantage of supraphysiological concentrations of platelets and their growth factors harbored in α-granules, which together attempt to return the diseased articular cartilage to a preinjury state. The local use of PRP directly at the site of cartilage injury is thought to stimulate a natural healing cascade and accelerate the formation of cartilage repair tissue. This article provides an overview of the basic science behind the use of PRP in the treatment of cartilage injury and disease. Both initial and current examples of the use of intra-articular PRP in clinical human studies are provided. These include the use of PRP either alone or as an augmentation device with various other procedures, including arthroscopic microfracture and cell-free resorbable polyglycolic acid-hyaluronan implantation. Finally, the authors describe some of the potential future roles of PRP in clinical settings based on recent literature. These include Achilles tendon rupture, chronic tendinosis, chronic rotator cuff tendinopathy or tearing, muscle injury, and meniscal repair. Thieme Medical Publishers 333 Seventh Avenue, New York, NY 10001, USA.

CEF1/CDC5 alleles modulate transitions between catalytic conformations of the spliceosome

PubMed Central

Query, Charles C.; Konarska, Maria M.

2012-01-01

Conformational change within the spliceosome is required between the first and second catalytic steps of pre-mRNA splicing. A prior genetic screen for suppressors of an intron mutant that stalls between the two steps yielded both prp8 and non-prp8 alleles that suppressed second-step splicing defects. We have now identified the strongest non-prp8 suppressors as alleles of the NTC (Prp19 complex) component, CEF1. These cef1 alleles generally suppress second-step defects caused by a variety of intron mutations, mutations in U6 snRNA, or deletion of the second-step protein factor Prp17, and they can activate alternative 3′ splice sites. Genetic and functional interactions between cef1 and prp8 alleles suggest that they modulate the same event(s) in the first-to-second-step transition, most likely by stabilization of the second-step spliceosome; in contrast, alleles of U6 snRNA that also alter this transition modulate a distinct event, most likely by stabilization of the first-step spliceosome. These results implicate a myb-like domain of Cef1/CDC5 in interactions that modulate conformational states of the spliceosome and suggest that alteration of these events affects splice site use, resulting in alternative splicing-like patterns in yeast. PMID:22408182

Platelet-rich plasma injection is more effective than hyaluronic acid in the treatment of knee osteoarthritis.

PubMed

Say, F; Gürler, D; Yener, K; Bülbül, M; Malkoc, M

2013-01-01

There is increasing use of platelet-rich plasma (PRP) in orthopaedics as it is a simple, cheap and minimally invasive technique. This study aimed to compare the effects of the use of PRP and hyaluronic acid (HA) injections in the knee of patients diagnosed with and being followed-up for degenerative arthritis. This prospective study included 90 patients with complaints of knee pain with findings of mild or moderate degenerative arthritis. In the PRP group (n=45), one intra-articular injection was applied and in the HA group (n=45), three doses of intra-articular injection were applied. Clinical evaluation was made by Knee Injury and Osteoarthritis Outcome Score (KOOS) and a visual pain scale. No severe adverse events was observed. Statistically significant better results in the KOOS score and visual pain scale was determined in PRP group than HA group at 3 months and 6 months follow up. The cost of the application for the PRP group was lower than that of the HA group. The results of this study have shown the application of single dose PRP to be a safe, effective and low-cost method for treating OA. However, further studies are required for a more clear result.

Different Type 1 Fimbrial Genes and Tropisms of Commensal and Potentially Pathogenic Actinomyces spp. with Different Salivary Acidic Proline-Rich Protein and Statherin Ligand Specificities

PubMed Central

Li, Tong; Khah, Massoud Kheir; Slavnic, Snjezana; Johansson, Ingegerd; Strömberg, Nicklas

2001-01-01

Actinomyces spp. exhibit type 1 fimbria-mediated adhesion to salivary acidic proline-rich proteins (PRPs) and statherin ligands. Actinomyces spp. with different animal and tissue origins belong to three major adhesion types as relates to ligand specificity and type 1 fimbria genes. (i) In preferential acidic-PRP binding, strains of Actinomyces naeslundii genospecies 1 and 2 from human and monkey mouths displayed at least three ligand specificities characterized by preferential acidic-PRP binding. Slot blot DNA hybridization showed seven highly conserved type 1 fimbria genes (orf1- to -6 and fimP) in genospecies 1 and 2 strains, except that orf5 and orf3 were divergent in genospecies 1. (ii) In preferential statherin binding, oral Actinomyces viscosus strains of rat and hamster origin (and strain 19246 from a human case of actinomycosis) bound statherin preferentially. DNA hybridization and characterization of the type 1 fimbria genes from strain 19246 revealed a homologous gene cluster of four open reading frames (orfA to -C and fimP). Bioinformatics suggested sortase (orfB, orf4, and part of orf5), prepilin peptidase (orfC and orf6), fimbria subunit (fimP), and usher- and autotransporter-like (orfA and orf1 to -3) functions. Those gene regions corresponding to orf3 and orf5 were divergent, those corresponding to orf2, orf1, and fimP were moderately conserved, and those corresponding to orf4 and orf6 were highly conserved. Restriction fragment length polymorphism analyses using a fimP probe separated human and monkey and rat and hamster strains into phylogenetically different groups. (iii) In statherin-specific binding, strains of A. naeslundii genospecies 1 from septic and other human infections displayed a low-avidity binding to statherin. Only the orf4 and orf6 gene regions were highly conserved. Finally, rat saliva devoid of statherin bound bacterial strains avidly irrespective of ligand specificity, and specific antisera detected either type 1, type 2, or both types of fimbria on the investigated Actinomyces strains. PMID:11705891

Proteasome inhibitors promote the sequestration of PrPSc into aggresomes within the cytosol of prion-infected CAD neuronal cells.

PubMed

Dron, Michel; Dandoy-Dron, Françoise; Farooq Salamat, Muhammad Khalid; Laude, Hubert

2009-08-01

Dysfunction of the endoplasmic reticulum associated protein degradation/proteasome system is believed to contribute to the initiation or aggravation of neurodegenerative disorders associated with protein misfolding, and there is some evidence to suggest that proteasome dysfunctions might be implicated in prion disease. This study investigated the effect of proteasome inhibitors on the biogenesis of both the cellular (PrP(C)) and abnormal (PrP(Sc)) forms of prion protein in CAD neuronal cells, a newly introduced prion cell system. In uninfected cells, proteasome impairment altered the intracellular distribution of PrP(C), leading to a strong accumulation in the Golgi apparatus. Moreover, a detergent-insoluble and weakly protease-resistant PrP species of 26 kDa, termed PrP(26K), accumulated in the cells, whether they were prion-infected or not. However, no evidence was found that, in infected cells, this PrP(26K) species converts into the highly proteinase K-resistant PrP(Sc). In the infected cultures, proteasome inhibition caused an increased intracellular aggregation of PrP(Sc) that was deposited into large aggresomes. These findings strengthen the view that, in neuronal cells expressing wild-type PrP(C) from the natural promoter, proteasomal impairment may affect both the process of PrP(C) biosynthesis and the subcellular sites of PrP(Sc) accumulation, despite the fact that these two effects could essentially be disconnected.

Detection and partial discrimination of atypical and classical bovine spongiform encephalopathies in cattle and primates using real-time quaking-induced conversion assay.

PubMed

Levavasseur, Etienne; Biacabe, Anne-Gaëlle; Comoy, Emmanuel; Culeux, Audrey; Grznarova, Katarina; Privat, Nicolas; Simoneau, Steve; Flan, Benoit; Sazdovitch, Véronique; Seilhean, Danielle; Baron, Thierry; Haïk, Stéphane

2017-01-01

The transmission of classical bovine spongiform encephalopathy (C-BSE) through contaminated meat product consumption is responsible for variant Creutzfeldt-Jakob disease (vCJD) in humans. More recent and atypical forms of BSE (L-BSE and H-BSE) have been identified in cattle since the C-BSE epidemic. Their low incidence and advanced age of onset are compatible with a sporadic origin, as are most cases of Creutzfeldt-Jakob disease (CJD) in humans. Transmissions studies in primates and transgenic mice expressing a human prion protein (PrP) indicated that atypical forms of BSE may be associated with a higher zoonotic potential than classical BSE, and require particular attention for public health. Recently, methods designed to amplify misfolded forms of PrP have emerged as promising tools to detect prion strains and to study their diversity. Here, we validated real-time quaking-induced conversion assay for the discrimination of atypical and classical BSE strains using a large series of bovine samples encompassing all the atypical BSE cases detected by the French Centre of Reference during 10 years of exhaustive active surveillance. We obtained a 100% sensitivity and specificity for atypical BSE detection. In addition, the assay was able to discriminate atypical and classical BSE in non-human primates, and also sporadic CJD and vCJD in humans. The RT-QuIC assay appears as a practical means for a reliable detection of atypical BSE strains in a homologous or heterologous PrP context.

A Systematic Review of Autologous Platelet-Rich Plasma and Fat Graft Preparation Methods

PubMed Central

Smith, Oliver J.; Mosahebi, Afshin

2017-01-01

Background: The addition of platelet-rich plasma (PRP) to adipose tissue may improve fat graft survival, although graft retention rates vary markedly between studies. To what extent this outcome heterogeneity reflects differing methodological factors remains unknown. This systematic review aims to synthesize and critically review methodological approaches to autologous PRP and fat cotransplantation in both human and animal studies. Methods: In accordance with PRISMA guidelines, Ovid MEDLINE, Scopus, and Cochrane Library databases were searched from inception to April 2017. Data were extracted from all in vivo studies involving autologous PRP and fat cotransplantation. A secondary aim was to assess reporting of technical detail; authors were not contacted to provide missing data. Results: From 335 articles, 23 studies were included in the qualitative synthesis. Some 21 were performed in humans and 2 in rabbits. Six studies were randomized control trials; the remainder reported on observational data. Methods of PRP extraction and activation varied markedly between studies. Fat graft preparation was comparatively more consistent. Methods of PRP and fat mixing differed significantly, especially with regards to relative volume/volume ratios. Conclusions: Our study represents the first systematic review of methodological factors in autologous PRP and fat cotransplantation. It demonstrates that technical factors in graft preparation and administration vary significantly between in vivo studies. Such methodological heterogeneity may explain observed differences in experimental and clinical outcomes. Reporting of key procedural information is inconsistent and often inadequate. These issues make meaningful evaluation of the PRP-enhanced fat grafting literature difficult and may limit its translation into clinical practice. PMID:29632775

Comparative effectiveness of platelet-rich plasma injections for treating knee joint cartilage degenerative pathology: a systematic review and meta-analysis.

PubMed

Chang, Ke-Vin; Hung, Chen-Yu; Aliwarga, Fanny; Wang, Tyng-Guey; Han, Der-Sheng; Chen, Wen-Shiang

2014-03-01

To explore the effectiveness of platelet-rich plasma (PRP) in treating cartilage degenerative pathology in knee joints. Electronic databases, including PubMed and Scopus, were searched from the earliest record to September 2013. We included single-arm prospective studies, quasi-experimental studies, and randomized controlled trials that used PRP to treat knee chondral degenerative lesions. Eight single-arm studies, 3 quasi-experimental studies, and 5 randomized controlled trials were identified, comprising 1543 participants. We determined effect sizes for the selected studies by extracting changes in functional scales after the interventions and compared the PRP group pooled values with the pretreatment baseline and the groups receiving placebo or hyaluronic acid (HA) injections. PRP injections in patients with knee degenerative pathology showed continual efficacy for 12 months compared with their pretreatment condition. The effectiveness of PRP was likely better and more prolonged than that of HA. Injection doses ≤2, the use of a single-spinning approach, and lack of additional activators led to an uncertainty in the treatment effects. Patients with lower degrees of cartilage degeneration achieved superior outcomes as opposed to those affected by advanced osteoarthritis. PRP application improves function from basal evaluations in patients with knee joint cartilage degenerative pathology and tends to be more effective than HA administration. Discrepancy in the degenerative severity modifies the treatment responses, leading to participants with lower degrees of degeneration benefiting more from PRP injections. Copyright © 2014 American Congress of Rehabilitation Medicine. Published by Elsevier Inc. All rights reserved.

Autologous platelet-rich plasma in the treatment of venous leg ulcers in primary care: a randomised controlled, pilot study.

PubMed

Burgos-Alonso, Natalia; Lobato, Igone; Hernández, Igone; Sebastian, Kepa San; Rodríguez, Begoña; March, Anna Giné; Perez-Salvador, Adriana; Arce, Veronica; Garcia-Alvarez, Arturo; Gomez-Fernandez, Maria Cruz; Grandes, Gonzalo; Andia, Isabel

2018-06-01

To examine the potential efficacy and safety of autologous platelet-rich plasma (PRP) in comparison with the conventional treatment (standard care, SoC) for the treatment of leg ulcers in patients with chronic venous insufficiency, in a primary health-care setting. A Phase I-II, open-label, parallel-group, multicentre, randomised pilot study was conducted. The outcome variables at baseline and at weeks five and nine included reduction in the ulcer area, Chronic Venous Insufficiency Quality of Life Questionnaire score, cost of the treatment for up to nine weeks and average weekly cure rate. A total of eight patients, each with at least a six-month history of venous leg ulcer (VLUs), were included in the study. A total of 12 ulcers were treated with either autologous PRP or standard SoC. Patients treated with PRP required wound care only once per week. In the SoC group, patients required intervention 2-3 times per week. A reduction in the mean ulcer size in the PRP group was 3.9cm 2 compared with the SoC group at 3.2cm 2 , although the sample size was insufficient to reach statistical significance. Improvement in quality of life (QoL) score was observed in the patients in the PRP group. This study offers proof-of-concept of the feasibility and safety of PRP treatment to inform larger clinical trials in patients with VLUs. Our preliminary results suggest that PRP delivers a safe and effective treatment for VLU care that can be implemented in primary health-care settings.

The Efficacy of Platelet-Rich Plasma in the Treatment of Rib Fractures.

PubMed

Gunay, Samil; Candan, Huseyin; Yılmaz, Rahsan; Eser, Irfan; Aydoğmus, Umit

2017-10-01

Background  Rib fracture is the most common result of thoracic traumas. Intrapulmonary shunt, alveolar capillary membrane damage, intra-alveolar hemorrhage, and hypoxia may develop following rib fractures. Therefore, prompt treatment is important. The aim of this experimental study was to analyze the effects of platelet-rich plasma (PRP) on rib fractures to secure a speedier and more efficient treatment method. Materials and Methods  The study involved 18 New Zealand white rabbits, randomly divided into three groups as Group 1, the sham group with no surgical intervention; Group 2, the control group in which simple rib fractures were applied and no treatment; and Group 3, in which rib fractures were applied and then PRP treatment was administered. Results  The mean recovery plate thickness measurements were found to be statistically significantly higher in the PRP group compared with the other groups ( p  < 0.005). A thicker fibrotic cell proliferation and the formation of many capillaries were observed around the growth plate in the PRP group compared with the other groups. These structures were lesser in the control group compared with the PRP group and at the lowest level in the sham group. Larger and distinct callus formation was observed and a new intramedullary field in the PRP group. Conclusions  PRP is a reliable and effective autologous product with minimal side effects, which can be considered as an alternative treatment in patients with rib fractures and used easily in pseudoarthrosis, surgical fracture, or flail chest. Georg Thieme Verlag KG Stuttgart · New York.

Influence of calcium salts and bovine thrombin on growth factor release from equine platelet-rich gel supernatants.

PubMed

Giraldo, Carlos E; Álvarez, María E; Carmona, Jorge U

2017-01-16

To compare five activation methods in equine platelet-rich plasma (PRP) by determination of platelet-derived growth factor BB (PDGF-BB) and transforming growth factor beta 1 (TGF-β1) concentrations in platelet-rich gel (PRG) supernatants. Platelet-rich plasma from 20 horses was activated by calcium chloride (CC), calcium gluconate (CG), bovine thrombin (BT), and their combinations, BTCC and BTCG. Both growth factor concentrations in PRG supernatants were measured by ELISA and compared with plasma and platelet lysates (PL) over time. Growth factor concentrations were significantly lower in plasma and higher for all PRG supernatants. Platelet lysates contained a significantly lower concentration of PDGF-BB than PRG supernatants and a significantly higher concentration of TGF-β1 than PRG supernatants. Clots from PRP activated with sodium salts were more stable over time and had significant growth factor release, whereas CC produced gross salt deposition. Significant correlations were noticed for platelet with leukocyte concentrations in PRP (r s : 0.76), platelet counts in PRP with TGF-β1 concentrations in PRG supernatants (r s : 0.86), platelet counts in PRP with PDGF-BB concentrations in PRG supernatants (r s : 0.78), leukocyte counts in PRP with TGF-β1 concentrations in PRG supernatants (r s : 0.76), and PDGF-BB concentrations with activating substances (r s : 0.72). Calcium gluconate was the better substance to induce PRP activation. It induced growth factor release free from calcium precipitates in the clots. Use of BT alone or combined with calcium salts was not advantageous for growth factor release.

Evaluation of two platelet-rich plasma processing methods and two platelet-activation techniques for use in llamas and alpacas.

PubMed

Semevolos, Stacy A; Youngblood, Cori D; Grissom, Stephanie K; Gorman, M Elena; Larson, Maureen K

2016-11-01

OBJECTIVE To evaluate 2 processing methods (commercial kit vs conical tube centrifugation) for preparing platelet rich plasma (PRP) for use in llamas and alpacas. SAMPLES Blood samples (30 mL each) aseptically collected from 6 healthy llamas and 6 healthy alpacas. PROCEDURES PRP was prepared from blood samples by use of a commercial kit and by double-step conical tube centrifugation. A CBC was performed for blood and PRP samples. Platelets in PRP samples were activated by means of a freeze-thaw method with or without 23mM CaCl 2 , and concentrations of platelet-derived growth factor-BB and transforming growth factor-β 1 were measured. Values were compared between processing methods and camelid species. RESULTS Blood CBC values for llamas and alpacas were similar. The commercial kit yielded a significantly greater degree of platelet enrichment (mean increase, 8.5 fold vs 2.8 fold) and WBC enrichment (mean increase, 3.7 fold vs 1.9 fold) than did conical tube centrifugation. Llamas had a significantly greater degree of platelet enrichment than alpacas by either processing method. No difference in WBC enrichment was identified between species. Concentrations of both growth factors were significantly greater in PRP samples obtained by use of the commercial kit versus those obtained by conical tube centrifugation. CONCLUSIONS AND CLINICAL RELEVANCE For blood samples from camelids, the commercial kit yielded a PRP product with a higher platelet and WBC concentration than achieved by conical tube centrifugation. Optimal PRP platelet and WBC concentrations for various applications need to be determined for llamas and alpacas.

Assessment of canine autologous platelet-rich plasma produced with a commercial centrifugation and platelet recovery kit.

PubMed

Frye, Chris W; Enders, Andrew; Brooks, Marjory B; Struble, Angela M; Wakshlag, Joseph J

2016-01-01

To characterize the cellular composition (platelets, erythrocytes, and leukocytes) and confirm reproducibility of platelet enrichment, as well as determine the platelet activation status in the final product of a commercial platelet-rich plasma kit using canine blood. Venous blood from 20 sedated client-owned dogs was used to prepare platelet-rich plasma (PRP) from a commercial kit. Complete blood counts were performed to determine erythrocyte, leukocyte, and platelet numbers in both whole blood (WB) and resultant PRP. The WB and PRP samples from jugular (fast collection) and cephalic (slow collection) venipuncture were also compared. P-selectin externalization was measured in WB and PRP samples from 15 of 20 dogs. This commercial kit produced an average percent recovery in platelets of 64.7 ± 17.4; erythrocytes of 3.7 ± 0.8, and leukocytes of 31.6 ± 10.0. Neutrophil, monocyte, and lymphocyte percent recovery was 19.6 ± 7.2, 44.89 ± 19.8, and 57.5 ± 10.6, respectively. The recovery of platelets from jugular venipuncture (59.7 ± 13.6%) was lower than from cephalic recovery (68.8 ± 19.1%). The mean percent P-Selectin externalization for WB, PRP, and PRP with thrombin was 25.5 ± 30.9, 4.5 ± 6.4, and 90.6 ± 4.4 respectively. Cellular reproducibility of this kit was confirmed and platelets were concentrated within autologous serum. Additionally, measurements of P-selectin externalization showed that platelets are inactive in PRP unless stimulated to degranulate.

Alteration of microcirculation is a hallmark of very early systemic sclerosis patients: a laser speckle contrast analysis.

PubMed

Della Rossa, Alessandra; Cazzato, Massimiliano; d'Ascanio, Anna; Tavoni, Antonio; Bencivelli, Walter; Pepe, Pasquale; Mosca, Marta; Baldini, Chiara; Rossi, Marco; Bombardieri, Stefano

2013-01-01

To investigate blood flow and microvascular reactivity by laser speckle perfusion imager (Perimed, Jarfalla) in consecutive patients affected by Raynaud's phenomenon at baseline and following dynamic stimulations. Skin blood flow in the dorsum of the hand was measured at baseline and after cold test and post-occlusive hyperemia test in 56 consecutive subjects affected by Raynaud's phenomenon (RP), 20 primary (PRP) and 36 secondary to systemic sclerosis (SSc). Twenty healthy subjects (HS) were studied as controls. After cold test, SSc had a significant reduction of blood flow (-58%) as compared to HS (-19%) (p=0.01). Recovery time was significantly higher in SSc (58 minutes) as compared to HS (18 minutes) and PRP (19 minutes) (p=0.006 and 0.0016, respectively). Peak flow after ischaemic test was significantly reduced in SSc (+237%) as compared to PRP (+485%) (p=0.0068). Post-ischaemic hyperemic area under the curve (AUC) was blunted in SSc (79U/sec) compared to PRP (167 U/sec) (p=0.0126). Proximal distal gradient was noticed in 74% of HS, 45% of PRP and 36% of SSc (p=0.01). Homogeneous pattern of flux distribution was significantly different between HS (95%), PRP (80%), and SSc (16%) (p<0.0001). Among SSc patients, a significant difference in ischaemic challenge was shown between patients with early-SSc versus patients with definite-SSc. Our preliminary results indicate a clearcut alteration of the dynamic of microcirculation in SSc-RP as compared to PRP and HS. Among SSc patients, early-SSc is a separate entity as compared to established disease.

Copper Coordination in the Full-Length, Recombinant Prion Protein†

PubMed Central

Burns, Colin S.; Aronoff-Spencer, Eliah; Legname, Giuseppe; Prusiner, Stanley B.; Antholine, William E.; Gerfen, Gary J.; Peisach, Jack; Millhauser, Glenn L.

2010-01-01

The prion protein (PrP) binds divalent copper at physiologically relevant conditions and is believed to participate in copper regulation or act as a copper-dependent enzyme. Ongoing studies aim at determining the molecular features of the copper binding sites. The emerging consensus is that most copper binds in the octarepeat domain, which is composed of four or more copies of the fundamental sequence PHGGGWGQ. Previous work from our laboratory using PrP-derived peptides, in conjunction with EPR and X-ray crystallography, demonstrated that the HGGGW segment constitutes the fundamental binding unit in the octarepeat domain [Burns et al. (2002) Biochemistry 41, 3991–4001; Aronoff-Spencer et al. (2000) Biochemistry 39, 13760–13771]. Copper coordination arises from the His imidazole and sequential deprotonated glycine amides. In this present work, recombinant, full-length Syrian hamster PrP is investigated using EPR methodologies. Four copper ions are taken up in the octarepeat domain, which supports previous findings. However, quantification studies reveal a fifth binding site in the flexible region between the octarepeats and the PrP globular C-terminal domain. A series of PrP peptide constructs show that this site involves His96 in the PrP(92–96) segment GGGTH. Further examination by X-band EPR, S-band EPR, and electron spin–echo envelope spectroscopy, demonstrates coordination by the His96 imidazole and the glycine preceding the threonine. The copper affinity for this type of binding site is highly pH dependent, and EPR studies here show that recombinant PrP loses its affinity for copper below pH 6.0. These studies seem to provide a complete profile of the copper binding sites in PrP and support the hypothesis that PrP function is related to its ability to bind copper in a pH-dependent fashion. PMID:12779334

Positive effect of an autologous platelet concentrate in lateral epicondylitis in a double-blind randomized controlled trial: platelet-rich plasma versus corticosteroid injection with a 1-year follow-up.

PubMed

Peerbooms, Joost C; Sluimer, Jordi; Bruijn, Daniël J; Gosens, Taco

2010-02-01

Platelet-rich plasma (PRP) has shown to be a general stimulation for repair. Purpose To determine the effectiveness of PRP compared with corticosteroid injections in patients with chronic lateral epicondylitis. Randomized controlled trial; Level of evidence, 1. The trial was conducted in 2 teaching hospitals in the Netherlands. One hundred patients with chronic lateral epicondylitis were randomly assigned in the PRP group (n = 51) or the corticosteroid group (n = 49). A central computer system carried out randomization and allocation to the trial group. Patients were randomized to receive either a corticosteroid injection or an autologous platelet concentrate injection through a peppering technique. The primary analysis included visual analog scores and DASH Outcome Measure scores (DASH: Disabilities of the Arm, Shoulder, and Hand). Successful treatment was defined as more than a 25% reduction in visual analog score or DASH score without a reintervention after 1 year. The results showed that, according to the visual analog scores, 24 of the 49 patients (49%) in the corticosteroid group and 37 of the 51 patients (73%) in the PRP group were successful, which was significantly different (P <.001). Furthermore, according to the DASH scores, 25 of the 49 patients (51%) in the corticosteroid group and 37 of the 51 patients (73%) in the PRP group were successful, which was also significantly different (P = .005). The corticosteroid group was better initially and then declined, whereas the PRP group progressively improved. Treatment of patients with chronic lateral epicondylitis with PRP reduces pain and significantly increases function, exceeding the effect of corticosteroid injection. Future decisions for application of the PRP for lateral epicondylitis should be confirmed by further follow-up from this trial and should take into account possible costs and harms as well as benefits.

Platelet-rich plasma versus autologous blood versus steroid injection in lateral epicondylitis: systematic review and network meta-analysis.

PubMed

Arirachakaran, Alisara; Sukthuayat, Amnat; Sisayanarane, Thaworn; Laoratanavoraphong, Sorawut; Kanchanatawan, Wichan; Kongtharvonskul, Jatupon

2016-06-01

Clinical outcomes between the use of platelet-rich plasma (PRP), autologous blood (AB) and corticosteroid (CS) injection in lateral epicondylitis are still controversial. A systematic review and network meta-analysis of randomized controlled trials was conducted with the aim of comparing relevant clinical outcomes between the use of PRP, AB and CS injection. Medline and Scopus databases were searched from inception to January 2015. A network meta-analysis was performed by applying weight regression for continuous outcomes and a mixed-effect Poisson regression for dichotomous outcomes. Ten of 374 identified studies were eligible. When compared to CS, AB injection showed significantly improved effects with unstandardized mean differences (UMD) in pain visual analog scale (VAS), Disabilities of Arm Shoulder and Hand (DASH), Patient-Related Tennis Elbow Evaluation (PRTEE) score and pressure pain threshold (PPT) of -2.5 (95 % confidence interval, -3.5, -1.5), -25.5 (-33.8, -17.2), -5.3 (-9.1, -1.6) and 9.9 (5.6, 14.2), respectively. PRP injections also showed significantly improved VAS and DASH scores when compared with CS. PRP showed significantly better VAS with UMD when compared to AB injection. AB injection has a higher risk of adverse effects, with a relative risk of 1.78 (1.00, 3.17), when compared to CS. The network meta-analysis suggested no statistically significant difference in multiple active treatment comparisons of VAS, DASH and PRTEE when comparing PRP and AB injections. However, AB injection had improved DASH score and PPT when compared with PRP injection. In terms of adverse effects, AB injection had a higher risk than PRP injection. This network meta-analysis provided additional information that PRP injection can improve pain and lower the risk of complications, whereas AB injection can improve pain, disabilities scores and pressure pain threshold but has a higher risk of complications. Level I evidence.