Science.gov

Sample records for psba gene family

  1. Positive Regulation of psbA Gene Expression by cis-Encoded Antisense RNAs in Synechocystis sp. PCC 68031[OA

    PubMed Central

    Sakurai, Isamu; Stazic, Damir; Eisenhut, Marion; Vuorio, Eerika; Steglich, Claudia; Hess, Wolfgang R.; Aro, Eva-Mari

    2012-01-01

    The D1 protein of photosystem II in the thylakoid membrane of photosynthetic organisms is encoded by psbA genes, which in cyanobacteria occur in the form of a small gene family. Light-dependent up-regulation of psbA gene expression is crucial to ensure the proper replacement of the D1 protein. To gain a high level of gene expression, psbA transcription can be enhanced by several orders of magnitude. Recent transcriptome analyses demonstrated a high number of cis-encoded antisense RNAs (asRNAs) in bacteria, but very little is known about their possible functions. Here, we show the presence of two cis-encoded asRNAs (PsbA2R and PsbA3R) of psbA2 and psbA3 from Synechocystis sp. PCC 6803. These asRNAs are located in the 5′ untranslated region of psbA2 and psbA3 genes. Their expression becomes up-regulated by light and down-regulated by darkness, similar to their target mRNAs. In the PsbA2R-suppressing strain [PsbA2R(−)], the amount of psbA2 mRNA was only about 50% compared with the control strain. Likewise, we identified a 15% lowered activity of photosystem II and a reduced amount of the D1 protein in PsbA2R(−) compared with the control strain. The function of PsbA2R in the stabilization of psbA2 mRNA was shown from in vitro RNase E assay when the AU box and the ribosome-binding site in the 5′ untranslated region of psbA2 mRNA were both covered by PsbA2R. These results add another layer of complexity to the mechanisms that contribute to psbA gene expression and show PsbA2R as a positively acting factor to achieve a maximum level of D1 synthesis. PMID:22858634

  2. Strategies for psbA gene expression in cyanobacteria, green algae and higher plants: from transcription to PSII repair.

    PubMed

    Mulo, Paula; Sakurai, Isamu; Aro, Eva-Mari

    2012-01-01

    The Photosystem (PS) II of cyanobacteria, green algae and higher plants is prone to light-induced inactivation, the D1 protein being the primary target of such damage. As a consequence, the D1 protein, encoded by the psbA gene, is degraded and re-synthesized in a multistep process called PSII repair cycle. In cyanobacteria, a small gene family codes for the various, functionally distinct D1 isoforms. In these organisms, the regulation of the psbA gene expression occurs mainly at the level of transcription, but the expression is fine-tuned by regulation of translation elongation. In plants and green algae, the D1 protein is encoded by a single psbA gene located in the chloroplast genome. In chloroplasts of Chlamydomonas reinhardtii the psbA gene expression is strongly regulated by mRNA processing, and particularly at the level of translation initiation. In chloroplasts of higher plants, translation elongation is the prevalent mechanism for regulation of the psbA gene expression. The pre-existing pool of psbA transcripts forms translation initiation complexes in plant chloroplasts even in darkness, while the D1 synthesis can be completed only in the light. Replacement of damaged D1 protein requires also the assistance by a number of auxiliary proteins, which are encoded by the nuclear genome in green algae and higher plants. Nevertheless, many of these chaperones are conserved between prokaryotes and eukaryotes. Here, we describe the specific features and fundamental differences of the psbA gene expression and the regeneration of the PSII reaction center protein D1 in cyanobacteria, green algae and higher plants. This article is part of a Special Issue entitled Photosystem II. © 2011 Elsevier B.V. All rights reserved.

  3. Low-Oxygen Induction of Normally Cryptic psbA Genes in Cyanobacteria

    SciTech Connect

    Summerfield, Tina; Toepel, Jorg; Sherman, Louis A.

    2008-11-11

    Microarray analysis indicated low-O₂ conditions resulted in upregulation of psbA1, the normally low-abundance transcript that encodes the D1' protein of photosystem II in Synechocystis sp. PCC 6803. Using a ΔpsbA2:ΔpsbA3 strain, we show the psbA1 transcript is translated and the resultant D1' is inserted into functional PSII complexes. Two other cyanobacterial strains have psbA genes that were induced by low oxygen. In two of the three strains examined, psbA was part of an upregulated gene cluster including an alternative Rieske iron-sulfur protein. We conclude this cluster may represent an important adaptation to changing O₂ levels that cyanobacteria experience.

  4. The curved DNA structure in the 5′-upstream region of the light-responsive genes: its universality, binding factor and function for cyanobacterial psbA transcription

    PubMed Central

    Asayama, Munehiko; Kato, Hideki; Shibato, Junko; Shirai, Makoto; Ohyama, Takashi

    2002-01-01

    A unique DNA curvature, the CIT, has been found in the 5′-upstream region of the psbA2 gene, which exhibits basal, light-responsive and circadian rhythmic transcription, in a unicellular photosynthetic cyanobacterium, Microcystis aeruginosa K-81. In this study, we report the universality of curvatures found in 5′-upstream regions in the psbA family and the function of the curvature in gene expression. Intrinsic curvatures were identified within 1000 bp upstream from the psbA genes in another cyanobacterium, a red alga and in plants (monocot and dicot). Mutagenized curvatures were constructed and confirmed to have disrupted architecture by gel electrophoresis and atomic force microscopy. Relatively small amounts but light-responsive transcripts of psbA2 were observed in cyanobacterial transformants harboring the mutagenized curvature under light/dark and light/high-light conditions. This shows that the curvature is important for basal transcription. In vitro primer extension and DNA mobility shift assay revealed that factors which might bind to the region upstream from the bending center contribute to the effective basal transcription of psbA2. PMID:12409456

  5. Ammonium tolerance in the cyanobacterium Synechocystis sp. strain PCC 6803 and the role of the psbA multigene family.

    PubMed

    Dai, Guo-Zheng; Qiu, Bao-Sheng; Forchhammer, Karl

    2014-04-01

    Ammonium is one of the major nutrients for plants, and a ubiquitous intermediate in plant metabolism, but it is also known to be toxic to many organisms, in particular to plants and oxygenic photosynthetic microorganisms. Although previous studies revealed a link between ammonium toxicity and photodamage in cyanobacteria under in vivo conditions, ammonium-induced photodamage of photosystem II (PSII) has not yet been investigated with isolated thylakoid membranes. We show here that ammonium directly accelerated photodamage of PSII in Synechocystis sp. strain PCC6803, rather than affecting the repair of photodamaged PSII. Using isolated thylakoid membranes, it could be demonstrated that ammonium-induced photodamage of PSII primarily occurred at the oxygen evolution complex, which has a known binding site for ammonium. Wild-type Synechocystis PCC6803 cells can tolerate relatively high concentrations of ammonium because of efficient PSII repair. Ammonium tolerance requires all three psbA genes since mutants of any of the three single psbA genes are more sensitive to ammonium than wild-type cells. Even the poorly expressed psbA1 gene, whose expression was studied in some detail, plays a detectable role in ammonium tolerance. © 2013 John Wiley & Sons Ltd.

  6. The evolutionary divergence of psbA gene in Synechococcus and their myoviruses in the East China Sea.

    PubMed

    Zheng, Qiang; Jiao, Nianzhi; Zhang, Rui; Wei, Jingjing; Zhang, Fei

    2014-01-01

    Marine Synechococcus is a principal component of the picophytoplankton and makes an important contribution to primary productivity in the ocean. Synechophages, infecting Synechococcus, are believed to have significant influences on the distribution and abundance of their hosts. Extensive previous ecological studies on cyanobacteria and viruses have been carried out in the East China Sea (ECS). Here we investigate the diversity and divergence of Synechococcus and their myoviruses (Synechomyoviruses) based on their shared photosynthesis psbA gene. Synechococcus is dominated by subclades 5.1A I, 5.1A II and 5.1A IV in the ECS, and clades I and II are the dominant groups in the Synechomyoviruses. As two phylogenetically independent clades, there is much higher diversity of the Synechomyoviruses than Synechococcus. Obvious partitioning characteristics of GC and GC3 (the GC content at the third codon position) contents are obtained among different picophytoplankton populations and their phages. The GC3 content causes the psbA gene in Synechococcus to have a higher GC content, while the opposite is true in the Synechomyoviruses. Analyzing more than one-time difference of the codon usage frequency of psbA sequences, the third position nucleotides of preferred codons for Synechococcus are all G and C, while most Synechomyoviral sequences (72.7%) have A and T at the third position of their preferred codons. This work shed light on the ecology and evolution of phage-host interactions in the environment.

  7. An atypical psbA gene encodes a sentinel D1 protein to form a physiologically relevant inactive photosystem II complex in cyanobacteria.

    PubMed

    Wegener, Kimberly M; Nagarajan, Aparna; Pakrasi, Himadri B

    2015-02-06

    Photosystem II, a large membrane-bound enzyme complex in cyanobacteria and chloroplasts, mediates light-induced oxidation of water to molecular oxygen. The D1 protein of PSII, encoded by the psbA gene, provides multiple ligands for cofactors crucial to this enzymatic reaction. Cyanobacteria contain multiple psbA genes that respond to various physiological cues and environmental factors. Certain unicellular cyanobacterial cells, such as Cyanothece sp. ATCC 51142, are capable of nitrogen fixation, a highly oxygen-sensitive process, by separating oxygen evolution from nitrogen fixation using a day-night cycle. We have shown that c-psbA4, one of the five psbA orthologs in this cyanobacterium, is exclusively expressed during nighttime. Remarkably, the corresponding D1 isoform has replacements of a number of amino acids that are essential ligands for the catalytic Mn4CaO5 metal center for water oxidation by PSII. At least 30 cyanobacterial strains, most of which are known to have nitrogen fixing abilities, have similar psbA orthologs. We expressed the c-psbA4 gene from Cyanothece 51142 in a 4E-3 mutant strain of the model non-nitrogen-fixing cyanobacterium Synechocystis sp. PCC 6803, which lacks any psbA gene. The resultant strain could not grow photoautotrophically. Moreover, these Synechocystis 6803 cells were incapable of PSII-mediated oxygen evolution. Based on our findings, we have named this physiologically relevant, unusual D1 isoform sentinel D1. Sentinel D1 represents a new class of D1 protein that, when incorporated in a PSII complex, ensures that PSII cannot mediate water oxidation, thus allowing oxygen-sensitive processes such as nitrogen fixation to occur in cyanobacterial cells.

  8. An integrated study of photochemical function and expression of a key photochemical gene (psbA) in photosynthetic communities of Lake Bonney (McMurdo Dry Valleys, Antarctica).

    PubMed

    Kong, Weidong; Li, Wei; Romancova, Ingrid; Prášil, Ondřej; Morgan-Kiss, Rachael M

    2014-08-01

    Lake Bonney is one of several permanently ice-covered lakes in the McMurdo Dry Valleys, Antarctica, which maintain the only year-round biological activity on the Antarctic continent. Vertically stratified populations of autotrophic microorganisms occupying the water columns are adapted to numerous extreme conditions, including very low light, hypersalinity, ultra-oligotrophy and low temperatures. In this study, we integrated molecular biology, microscopy, flow cytometry, and functional photochemical analyses of the photosynthetic communities residing in the east and west basins of dry valley Lake Bonney. Diversity and abundance of the psbA gene encoding a major protein of the photosystem II reaction center were monitored during the seasonal transition between Antarctic summer (24-h daylight) to winter (24-h darkness). Vertical trends through the photic zone in psbA abundance (DNA and mRNA) closely matched that of primary production in both lobes. Seasonal trends in psbA transcripts differed between the two lobes, with psbA expression in the west basin exhibiting a transient rise in early Fall. Last, using spectroscopic and flow cytometric analyses, we provide the first evidence that the Lake Bonney photosynthetic community is dominated by picophytoplankton that possess photosynthetic apparatus adapted to extreme shade. © 2014 Federation of European Microbiological Societies. Published by John Wiley & Sons Ltd. All rights reserved.

  9. The nuclear-encoded sigma factor SIG4 directly activates transcription of chloroplast psbA and ycf17 genes in the unicellular red alga Cyanidioschyzon merolae.

    PubMed

    Fujii, Gaku; Imamura, Sousuke; Era, Atsuko; Miyagishima, Shin-ya; Hanaoka, Mitsumasa; Tanaka, Kan

    2015-05-01

    The plant organelle chloroplast originated from the endosymbiosis of a cyanobacterial-like photosynthetic bacterium, and still retains its own genome derived from this ancestor. We have been focusing on a unicellular red alga, Cyanidioschyzon merolae, as a model photosynthetic eukaryote. In this study, we analyzed the transcriptional specificity of SIG4, which is one of four nuclear-encoded chloroplast RNA polymerase sigma factors in this alga. Accumulation of the SIG4 protein was observed in response to nitrogen depletion or high light conditions. By comparing the chloroplast transcriptomes under nitrogen depletion and SIG4-overexpressing conditions, we identified several candidate genes as SIG4 targets. Together with the results of chromatin immunoprecipitation analysis, the promoters of the psbA (encoding the D1 protein of the photosystem II reaction center) and ycf17 (encoding a protein of the early light-inducible protein family) genes were shown to be direct activation targets. The phycobilisome (PBS) CpcB protein was decreased by SIG4 overexpression, which suggests the negative involvement of SIG4 in PBS accumulation. © FEMS 2015. All rights reserved. For permissions, please e-mail: journals.permissions@oup.com.

  10. Exogenous calcium induces tolerance to atrazine stress in Pennisetum seedlings and promotes photosynthetic activity, antioxidant enzymes and psbA gene transcripts.

    PubMed

    Erinle, Kehinde Olajide; Jiang, Zhao; Ma, Bingbing; Li, Jinmei; Chen, Yukun; Ur-Rehman, Khalil; Shahla, Andleeb; Zhang, Ying

    2016-10-01

    Calcium (Ca) has been reported to lessen oxidative damages in plants by upregulating the activities of antioxidant enzymes. However, atrazine mediated reactive oxygen species (ROS) reduction by Ca is limited. This study therefore investigated the effect of exogenously applied Ca on ROS, antioxidants activity and gene transcripts, the D1 protein (psbA gene), and chlorophyll contents in Pennisetum seedlings pre-treated with atrazine. Atrazine toxicity increased ROS production and enzyme activities (ascorbate peroxidase APX, peroxidase POD, Superoxide dismutase SOD, glutathione-S-transferase GST); but decreased antioxidants (APX, POD, and Cu/Zn SOD) and psbA gene transcripts. Atrazine also decreased the chlorophyll contents, but increased chlorophyll (a/b) ratio. Contrarily, Ca application to atrazine pre-treated seedlings lowered the harmful effects of atrazine by reducing ROS levels, but enhancing the accumulation of total chlorophyll contents. Ca-protected seedlings in the presence of atrazine manifested reduced APX and POD activity, whereas SOD and GST activity was further increased with Ca application. Antioxidant gene transcripts that were down-regulated by atrazine toxicity were up-regulated with the application of Ca. Calcium application also resulted in up-regulation of the D1 protein. In conclusion, ability of calcium to reverse atrazine-induced oxidative damage and calcium regulatory role on GST in Pennisetum was presented. Copyright © 2016 Elsevier Inc. All rights reserved.

  11. A functional promoter shift of a chloroplast gene: a transcriptional fusion between a novel psbA gene copy and the trnK (UUU) gene in Pinus contorta.

    PubMed

    Lidholm, J; Gustafsson, P

    1992-11-01

    A comparative transcription analysis of the chloroplast trnK-psbA-trnH region of the two pine species Pinus contorta and Pinus sylvestris is reported. The chloroplast genome of P. contorta has previously been shown to contain a duplicated psbA gene copy integrated closely upstream of the split trnK gene. This rearrangement has resulted in the gene order psbAI-trnK-psbAII-trnH, where psbAII is the ancestral psbA gene copy. In P. sylvestris, a species which lacks the psbA duplication, transcription of the trnK gene originates from a position 291 bp upstream of the trnK 5' exon, adjacent to a canonical promoter structure. In P. contorta, the corresponding promoter structure has been separated from the trnK gene by the insertion of psbAI, and has, in addition, been partially deleted. Analysis of the transcriptional organization of the trnK-psbA-trnH region of the two pine species revealed that the trnK gene in P. contorta is transcriptionally fused to the inserted psbAI gene copy. As a result, trnK is under the control of the psbA promoter in this species and has therefore acquired psbA-like expression characteristics. In P. sylvestris, accumulation of trnK transcripts is not significantly higher in light-grown than in dark-grown seedlings. In contrast, the level of trnK transcripts in P. contorta is approximately 12-fold higher in the light than in the dark. When light-grown seedlings of the two pine species were compared, an approximately 20-fold higher level of trnK RNAs was found in P. contorta. In both pine species, evidence was obtained for trnK-psbA and psbA-trnH co-transcription.

  12. The effect of aluminium-stress and exogenous spermidine on chlorophyll degradation, glutathione reductase activity and the photosystem II D1 protein gene (psbA) transcript level in lichen Xanthoria parietina.

    PubMed

    Sen, Gulseren; Eryilmaz, Isil Ezgi; Ozakca, Dilek

    2014-02-01

    In this study, the effects of short-term aluminium toxicity and the application of spermidine on the lichen Xanthoria parietina were investigated at the physiological and transcriptional levels. Our results suggest that aluminium stress leads to physiological processes in a dose-dependent manner through differences in lipid peroxidation rate, chlorophyll content and glutathione reductase (EC 1.6.4.2) activity in aluminium and spermidine treated samples. The expression of the photosystem II D1 protein (psbA) gene was quantified using semi-quantitative RT-PCR. Increased glutathione reductase activity and psbA mRNA transcript levels were observed in the X. parietina thalli that were treated with spermidine before aluminium-stress. The results showed that the application of spermidine could mitigate aluminium-induced lipid peroxidation and chlorophyll degradation on lichen X. parietina thalli through an increase in psbA transcript levels and activity of glutathione reductase (GR) enzymes. Copyright © 2013 Elsevier Ltd. All rights reserved.

  13. Mobile self-splicing group I introns from the psbA gene of Chlamydomonas reinhardtii: highly efficient homing of an exogenous intron containing its own promoter.

    PubMed

    Odom, O W; Holloway, S P; Deshpande, N N; Lee, J; Herrin, D L

    2001-05-01

    Introns 2 and 4 of the psbA gene of Chlamydomonas reinhardtii chloroplasts (Cr.psbA2 and Cr.psbA4, respectively) contain large free-standing open reading frames (ORFs). We used transformation of an intronless-psbA strain (IL) to test whether these introns undergo homing. Each intron, plus short exon sequences, was cloned into a chloroplast expression vector in both orientations and then cotransformed into IL along with a spectinomycin resistance marker (16S rrn). For Cr.psbA2, the sense construct gave nearly 100% cointegration of the intron whereas the antisense construct gave 0%, consistent with homing. For Cr.psbA4, however, both orientations produced highly efficient cointegration of the intron. Efficient cointegration of Cr.psbA4 also occurred when the intron was introduced as a restriction fragment lacking any known promoter. Deletion of most of the ORF, however, abolished cointegration of the intron, consistent with homing. The Cr.psbA4 constructs also contained a 3-(3,4-dichlorophenyl)-1,1-dimethylurea resistance marker in exon 5, which was always present when the intron integrated, thus demonstrating exon coconversion. Remarkably, primary selection for this marker gave >100-fold more transformants (>10,000/microgram of DNA) than did the spectinomycin resistance marker. A trans homing assay was developed for Cr.psbA4; the ORF-minus intron integrated when the ORF was cotransformed on a separate plasmid. This assay was used to identify an intronic region between bp -88 and -194 (relative to the ORF) that stimulated homing and contained a possible bacterial (-10, -35)-type promoter. Primer extension analysis detected a transcript that could originate from this promoter. Thus, this mobile, self-splicing intron also contains its own promoter for ORF expression. The implications of these results for horizontal intron transfer and organelle transformation are discussed.

  14. Deactivation processes in PsbA1-Photosystem II and PsbA3-Photosystem II under photoinhibitory conditions in the cyanobacterium Thermosynechococcus elongatus.

    PubMed

    Ogami, Shogo; Boussac, Alain; Sugiura, Miwa

    2012-08-01

    The sensitivity to high light conditions of Photosystem II with either PsbA1 (WT*1) or PsbA3 (WT*3) as the D1 protein was studied in whole cells of the thermophilic cyanobacterium Thermosynechococcus elongatus. When the cells are cultivated under high light conditions the following results were found: (i) The O(2) evolution activity decreases faster in WT*1 cells than in WT*3 cells both in the absence and in the presence of lincomycin, a protein synthesis inhibitor; (ii) In WT*1 cells, the rate constant for the decrease of the O(2) evolution activity is comparable in the presence and in the absence of lincomycin; (iii) The D1 content revealed by western blot analysis decays similarly in both WT*1 and WT*3 cells and much slowly than O(2) evolution; (iv) The faster decrease in O(2) evolution in WT*1 than in WT*3 cells correlates with a much faster inhibition of the S(2)-state formation; (v) The shape of the WT*1 cells is altered. All these results are in agreement with a photo-inhibition process resulting in the loss of the O(2) activity much faster than the D1 turnover in PsbA1-PSII and likely to a greater production of reactive oxygen species under high light conditions in WT*1 than in WT*3. This latter result is discussed in view of the known effects of the PsbA1 to PsbA3 substitution on the redox properties of the Photosystem II cofactors. The observation that under low light conditions WT*3 cells are able to express the psbA(3) gene, whereas under similar conditions wild type cells are expressing mainly the psbA(1) gene is also discussed. This article is part of a Special Issue entitled: Photosynthesis Research for Sustainability: from Natural to Artificial. Copyright © 2012 Elsevier B.V. All rights reserved.

  15. Environment of TyrZ in Photosystem II from Thermosynechococcus elongatus in which PsbA2 Is the D1 Protein

    PubMed Central

    Sugiura, Miwa; Ogami, Shogo; Kusumi, Mai; Un, Sun; Rappaport, Fabrice; Boussac, Alain

    2012-01-01

    The main cofactors that determine the photosystem II (PSII) oxygen evolution activity are borne by the D1 and D2 subunits. In the cyanobacterium Thermosynechococcus elongatus, there are three psbA genes coding for D1. Among the 344 residues constituting D1, there are 21 substitutions between PsbA1 and PsbA3, 31 between PsbA1 and PsbA2, and 27 between PsbA2 and PsbA3. Here, we present the first study of PsbA2-PSII. Using EPR and UV-visible time-resolved absorption spectroscopy, we show that: (i) the time-resolved EPR spectrum of TyrZ• in the (S3TyrZ•)′ is slightly modified; (ii) the split EPR signal arising from TyrZ• in the (S2TyrZ•)′ state induced by near-infrared illumination at 4.2 K of the S3TyrZ state is significantly modified; and (iii) the slow phases of P680+⋅ reduction by TyrZ are slowed down from the hundreds of μs time range to the ms time range, whereas both the S1TyrZ• → S2TyrZ and the S3TyrZ• → S0TyrZ + O2 transition kinetics remained similar to those in PsbA(1/3)-PSII. These results show that the geometry of the TyrZ phenol and its environment, likely the Tyr-O···H···Nϵ-His bonding, are modified in PsbA2-PSII when compared with PsbA(1/3)-PSII. They also point to the dynamics of the proton-coupled electron transfer processes associated with the oxidation of TyrZ being affected. From sequence comparison, we propose that the C144P and P173M substitutions in PsbA2-PSII versus PsbA(1/3)-PSII, respectively located upstream of the α-helix bearing TyrZ and between the two α-helices bearing TyrZ and its hydrogen-bonded partner, His-190, are responsible for these changes. PMID:22362776

  16. Light-dependent chlorophyll f synthase is a highly divergent paralog of PsbA of photosystem II.

    PubMed

    Ho, Ming-Yang; Shen, Gaozhong; Canniffe, Daniel P; Zhao, Chi; Bryant, Donald A

    2016-08-26

    Chlorophyll f (Chl f) permits some cyanobacteria to expand the spectral range for photosynthesis by absorbing far-red light. We used reverse genetics and heterologous expression to identify the enzyme for Chl f synthesis. Null mutants of "super-rogue" psbA4 genes, divergent paralogs of psbA genes encoding the D1 core subunit of photosystem II, abolished Chl f synthesis in two cyanobacteria that grow in far-red light. Heterologous expression of the psbA4 gene, which we rename chlF, enables Chl f biosynthesis in Synechococcus sp. PCC 7002. Because the reaction requires light, Chl f synthase is probably a photo-oxidoreductase that employs catalytically useful Chl a molecules, tyrosine YZ, and plastoquinone (as does photosystem II) but lacks a Mn4Ca1O5 cluster. Introduction of Chl f biosynthesis into crop plants could expand their ability to use solar energy.

  17. In vitro transcription and DNA binding characteristics of chloroplast and etioplast extracts from mustard (Sinapis alba) indicate differential usage of the psbA promoter.

    PubMed Central

    Eisermann, A; Tiller, K; Link, G

    1990-01-01

    The psbA gene which is differentially expressed in vivo in chloroplasts and etioplasts has an unusual promoter, containing both prokaryotic-type '-35' and '-10' elements and a sequence motif that resembles the nuclear TATA box. Single base pair substitutions were introduced into the mustard psbA promoter and the mutants were tested in transcription and DNA binding experiments, using extracts from either chloroplasts or etioplasts. Positions within the '-35' region appear to play an essential role in the chloroplast but not in the etioplast system. Altering the first or second position of the 'TATA box'-like region led to decreased psbA in vitro transcription in either plastid extract. These two mutations, however, did not affect binding of extracts to the (linear) psbA promoter fragment in gel retardation assays. Fragments carrying two other plastid promoters effectively competed psbA promoter binding of the etioplast extract, but more weakly that of the chloroplast extract. Lambda exonuclease mapping shows that the 5' border of the binding region is more upstream with the etioplast than with the chloroplast system, whereas the 3' border appears to be the same. Hence, protein(s) of the two plastid types seem to interact differently with the mustard psbA promoter in vitro and perhaps also in vivo. Images Fig. 3. Fig. 4. Fig. 5. Fig. 6. Fig. 7. PMID:2249659

  18. Characterizing gene family evolution

    PubMed Central

    Liberles, David A.

    2008-01-01

    Gene families are widely used in comparative genomics, molecular evolution, and in systematics. However, they are constructed in different manners, their data analyzed and interpreted differently, with different underlying assumptions, leading to sometimes divergent conclusions. In systematics, concepts like monophyly and the dichotomy between homoplasy and homology have been central to the analysis of phylogenies. We critique the traditional use of such concepts as applied to gene families and give examples of incorrect inferences they may lead to. Operational definitions that have emerged within functional genomics are contrasted with the common formal definitions derived from systematics. Lastly, we question the utility of layers of homology and the meaning of homology at the character state level in the context of sequence evolution. From this, we move forward to present an idealized strategy for characterizing gene family evolution for both systematic and functional purposes, including recent methodological improvements. PMID:19461954

  19. The sulfatase gene family.

    PubMed

    Parenti, G; Meroni, G; Ballabio, A

    1997-06-01

    During the past few years, molecular analyses have provided important insights into the biochemistry and genetics of the sulfatase family of enzymes, identifying the molecular bases of inherited diseases caused by sulfatase deficiencies. New members of the sulfatase gene family have been identified in man and other species using a genomic approach. These include the gene encoding arylsulfatase E, which is involved in X-linked recessive chondrodysplasia punctata, a disorder of cartilage and bone development. Another important breakthrough has been the discovery of the biochemical basis of multiple sulfatase deficiency, an autosomal recessive disorder characterized by a severe of all sulfatase activities. These discoveries, together with the resolution of the crystallographic structure of sulfatases, have improved our understanding of the function and evolution of this fascinating family of enzymes.

  20. Chloroplast-coded atrazine resistance in Solanum nigrum: psbA loci from susceptible and resistant biotypes are isogenic except for a single codon change.

    PubMed Central

    Goloubinoff, P; Edelman, M; Hallick, R B

    1984-01-01

    The 32-kDa photosystem II protein of the chloroplast is thought to be a target molecule for the herbicide atrazine. The psbA gene coding for this protein was cloned from Solanum nigrum atrazine-susceptible ('S') and atrazine-resistant ('R') biotypes. The 'S' and 'R' genes are identical in nucleotide sequence except for an A to G transition, predicting a Ser to Gly change at codon 264. The same predicted amino acid change in psbA was previously shown for an Amaranthus hybridus 'S' and 'R' biotypes which had, in addition, two silent nucleotide changes between the genes (Hirschberg, J. and McIntosh, L., Science 222, 1346-1349, 1983). Occurrence of the identical, non-silent change in psbA in different 'S' and 'R' weed biotype pairs suggests a functional, herbicide-related role for this codon position. Images PMID:6514581

  1. GIPC gene family (Review).

    PubMed

    Katoh, Masaru

    2002-06-01

    GIPC1/GIPC/RGS19IP1, GIPC2, and GIPC3 genes constitute the human GIPC gene family. GIPC1 and GIPC2 show 62.0% total-amino-acid identity. GIPC1 and GIPC3 show 59.9% total-amino-acid identity. GIPC2 and GIPC3 show 55.3% total-amino-acid identity. GIPCs are proteins with central PDZ domain and GIPC homology (GH1 and GH2) domains. PDZ, GH1, and GH2 domains are conserved among human GIPCs, Xenopus GIPC/Kermit, and Drosophila GIPC/ LP09416. Bioinformatics revealed that GIPC genes are linked to prostanoid receptor genes and DNAJB genes in the human genome as follows: GIPC1 gene is linked to prostaglandin E receptor 1 (PTGER1) gene and DNAJB1 gene in human chromosome 19p13.2-p13.1 region; GIPC2 gene to prostaglandin F receptor (PTGFR) gene and DNAJB4 gene in human chromosome 1p31.1-p22.3 region; GIPC3 gene to thromboxane A2 receptor (TBXA2R) gene in human chromosome 19p13.3 region. GIPC1 and GIPC2 mRNAs are expressed together in OKAJIMA, TMK1, MKN45 and KATO-III cells derived from diffuse-type of gastric cancer, and are up-regulated in several cases of primary gastric cancer. PDZ domain of GIPC family proteins interact with Frizzled-3 (FZD3) class of WNT receptor, insulin-like growth factor-I (IGF1) receptor, receptor tyrosine kinase TrkA, TGF-beta type III receptor (TGF-beta RIII), integrin alpha6A subunit, transmembrane glycoprotein 5T4, and RGS19/RGS-GAIP. Because RGS19 is a member of the RGS family that regulate heterotrimeric G-protein signaling, GIPCs might be scaffold proteins linking heterotrimeric G-proteins to seven-transmembrane-type WNT receptor or to receptor tyrosine kinases. Therefore, GIPC1, GIPC2 and GIPC3 might play key roles in carcinogenesis and embryogenesis through modulation of growth factor signaling and cell adhesion.

  2. Gene Cluster Statistics with Gene Families

    PubMed Central

    Durand, Dannie

    2009-01-01

    Identifying genomic regions that descended from a common ancestor is important for understanding the function and evolution of genomes. In distantly related genomes, clusters of homologous gene pairs are evidence of candidate homologous regions. Demonstrating the statistical significance of such “gene clusters” is an essential component of comparative genomic analyses. However, currently there are no practical statistical tests for gene clusters that model the influence of the number of homologs in each gene family on cluster significance. In this work, we demonstrate empirically that failure to incorporate gene family size in gene cluster statistics results in overestimation of significance, leading to incorrect conclusions. We further present novel analytical methods for estimating gene cluster significance that take gene family size into account. Our methods do not require complete genome data and are suitable for testing individual clusters found in local regions, such as contigs in an unfinished assembly. We consider pairs of regions drawn from the same genome (paralogous clusters), as well as regions drawn from two different genomes (orthologous clusters). Determining cluster significance under general models of gene family size is computationally intractable. By assuming that all gene families are of equal size, we obtain analytical expressions that allow fast approximation of cluster probabilities. We evaluate the accuracy of this approximation by comparing the resulting gene cluster probabilities with cluster probabilities obtained by simulating a realistic, power-law distributed model of gene family size, with parameters inferred from genomic data. Surprisingly, despite the simplicity of the underlying assumption, our method accurately approximates the true cluster probabilities. It slightly overestimates these probabilities, yielding a conservative test. We present additional simulation results indicating the best choice of parameter values for data

  3. Familial aggregation analysis of gene expressions

    PubMed Central

    Rao, Shao-Qi; Xu, Liang-De; Zhang, Guang-Mei; Li, Xia; Li, Lin; Shen, Gong-Qing; Jiang, Yang; Yang, Yue-Ying; Gong, Bin-Sheng; Jiang, Wei; Zhang, Fan; Xiao, Yun; Wang, Qing K

    2007-01-01

    Traditional studies of familial aggregation are aimed at defining the genetic (and non-genetic) causes of a disease from physiological or clinical traits. However, there has been little attempt to use genome-wide gene expressions, the direct phenotypic measures of genes, as the traits to investigate several extended issues regarding the distributions of familially aggregated genes on chromosomes or in functions. In this study we conducted a genome-wide familial aggregation analysis by using the in vitro cell gene expressions of 3300 human autosome genes (Problem 1 data provided to Genetic Analysis Workshop 15) in order to answer three basic genetics questions. First, we investigated how gene expressions aggregate among different types (degrees) of relative pairs. Second, we conducted a bioinformatics analysis of highly familially aggregated genes to see how they are distributed on chromosomes. Third, we performed a gene ontology enrichment test of familially aggregated genes to find evidence to support their functional consensus. The results indicated that 1) gene expressions did aggregate in families, especially between sibs. Of 3300 human genes analyzed, there were a total of 1105 genes with one or more significant (empirical p < 0.05) familial correlation; 2) there were several genomic hot spots where highly familially aggregated genes (e.g., the chromosome 6 HLA genes cluster) were clustered; 3) as we expected, gene ontology enrichment tests revealed that the 1105 genes were aggregating not only in families but also in functional categories. PMID:18466548

  4. The insect SNMP gene family.

    PubMed

    Vogt, Richard G; Miller, Natalie E; Litvack, Rachel; Fandino, Richard A; Sparks, Jackson; Staples, Jon; Friedman, Robert; Dickens, Joseph C

    2009-07-01

    SNMPs are membrane proteins observed to associate with chemosensory neurons in insects; in Drosophila melanogaster, SNMP1 has been shown to be essential for the detection of the pheromone cis-vaccenyl acetate (CVA). SNMPs are one of three insect gene clades related to the human fatty acid transporter CD36. We previously characterized the CD36 gene family in 4 insect Orders that effectively cover the Holometabola, or some 80% of known insect species and the 300 million years of evolution since this lineage emerged: Lepidoptera (e.g. Bombyx mori, Antheraea polyphemus, Manduca sexta, Heliothis virescens, Helicoverpa assulta, Helicoverpa armigera, Mamestra brassicae); Diptera (D. melanogaster, Drosophila pseudoobscura, Aedes aegypti, Anopheles gambiae, Culex pipiens quinquefasciatus); Hymenoptera (Apis mellifera); and Coleoptera (Tribolium castaneum). This previous study suggested a complex topography within the SNMP clade including a strongly supported SNMP1 sub-clade plus additional SNMP genes. To further resolve the SNMP clade here, we used cDNA sequences of SNMP1 and SNMP2 from various Lepidoptera species, D. melanogaster and Ae. aegypti, as well as BAC derived genomic sequences from Ae. aegypti as models for proposing corrected sequences of orthologues in the D. pseudoobscura and An. gambiae genomes, and for identifying orthologues in the B. mori and C. pipiens q. genomes. We then used these sequences to analyze the SNMP clade of the insect CD36 gene family, supporting the existence of two well supported sub-clades, SNMP1 and SNMP2, throughout the dipteran and lepidopteran lineages, and plausibly throughout the Holometabola and across a broad evolutionary time scale. We present indirect evidence based on evolutionary selection (dN/dS) that the dipteran SNMPs are expressed as functional proteins. We observed expansions of the SNMP1 sub-clade in C. pipiens q. and T. castaneum suggesting that the SNMP1s may have an expanded functional role in these species.

  5. Lineage-Specific Expansion of IFIT Gene Family: An Insight into Coevolution with IFN Gene Family

    PubMed Central

    Liu, Ying; Zhang, Yi-Bing; Liu, Ting-Kai; Gui, Jian-Fang

    2013-01-01

    In mammals, IFIT (Interferon [IFN]-induced proteins with Tetratricopeptide Repeat [TPR] motifs) family genes are involved in many cellular and viral processes, which are tightly related to mammalian IFN response. However, little is known about non-mammalian IFIT genes. In the present study, IFIT genes are identified in the genome databases from the jawed vertebrates including the cartilaginous elephant shark but not from non-vertebrates such as lancelet, sea squirt and acorn worm, suggesting that IFIT gene family originates from a vertebrate ancestor about 450 million years ago. IFIT family genes show conserved gene structure and gene arrangements. Phylogenetic analyses reveal that this gene family has expanded through lineage-specific and species-specific gene duplication. Interestingly, IFN gene family seem to share a common ancestor and a similar evolutionary mechanism; the function link of IFIT genes to IFN response is present early since the origin of both gene families, as evidenced by the finding that zebrafish IFIT genes are upregulated by fish IFNs, poly(I:C) and two transcription factors IRF3/IRF7, likely via the IFN-stimulated response elements (ISRE) within the promoters of vertebrate IFIT family genes. These coevolution features creates functional association of both family genes to fulfill a common biological process, which is likely selected by viral infection during evolution of vertebrates. Our results are helpful for understanding of evolution of vertebrate IFN system. PMID:23818968

  6. Dynamic actin gene family evolution in primates.

    PubMed

    Zhu, Liucun; Zhang, Ying; Hu, Yijun; Wen, Tieqiao; Wang, Qiang

    2013-01-01

    Actin is one of the most highly conserved proteins and plays crucial roles in many vital cellular functions. In most eukaryotes, it is encoded by a multigene family. Although the actin gene family has been studied a lot, few investigators focus on the comparison of actin gene family in relative species. Here, the purpose of our study is to systematically investigate characteristics and evolutionary pattern of actin gene family in primates. We identified 233 actin genes in human, chimpanzee, gorilla, orangutan, gibbon, rhesus monkey, and marmoset genomes. Phylogenetic analysis showed that actin genes in the seven species could be divided into two major types of clades: orthologous group versus complex group. Codon usages and gene expression patterns of actin gene copies were highly consistent among the groups because of basic functions needed by the organisms, but much diverged within species due to functional diversification. Besides, many great potential pseudogenes were found with incomplete open reading frames due to frameshifts or early stop codons. These results implied that actin gene family in primates went through "birth and death" model of evolution process. Under this model, actin genes experienced strong negative selection and increased the functional complexity by reproducing themselves.

  7. Evolution of the Vertebrate Resistin Gene Family.

    PubMed

    Hu, Qingda; Tan, Huanran; Irwin, David M

    2015-01-01

    Resistin (encoded by Retn) was previously identified in rodents as a hormone associated with diabetes; however human resistin is instead linked to inflammation. Resistin is a member of a small gene family that includes the resistin-like peptides (encoded by Retnl genes) in mammals. Genomic searches of available genome sequences of diverse vertebrates and phylogenetic analyses were conducted to determine the size and origin of the resistin-like gene family. Genes encoding peptides similar to resistin were found in Mammalia, Sauria, Amphibia, and Actinistia (coelacanth, a lobe-finned fish), but not in Aves or fish from Actinopterygii, Chondrichthyes, or Agnatha. Retnl originated by duplication and transposition from Retn on the early mammalian lineage after divergence of the platypus, but before the placental and marsupial mammal divergence. The resistin-like gene family illustrates an instance where the locus of origin of duplicated genes can be identified, with Retn continuing to reside at this location. Mammalian species typically have a single copy Retn gene, but are much more variable in their numbers of Retnl genes, ranging from 0 to 9. Since Retn is located at the locus of origin, thus likely retained the ancestral expression pattern, largely maintained its copy number, and did not display accelerated evolution, we suggest that it is more likely to have maintained an ancestral function, while Retnl, which transposed to a new location, displays accelerated evolution, and shows greater variability in gene number, including gene loss, likely evolved new, but potentially lineage-specific, functions.

  8. Metazoan Gene Families from Metazome

    DOE Data Explorer

    Metazome is a joint project of the Department of Energy's Joint Genome Institute and the Center for Integrative Genomics to facilitate comparative genomic studies amongst metazoans. Clusters of orthologous and paralogous genes that represent the modern descendents of ancestral gene sets are constructed at key phylogenetic nodes. These clusters allow easy access to clade specific orthology/paralogy relationships as well as clade specific genes and gene expansions. As of version 2.0.4, Metazome provides access to twenty-four sequenced and annotated metazoan genomes, clustered at nine evolutionarily significant nodes. Where possible, each gene has been annotated with PFAM, KOG, KEGG, and PANTHER assignments, and publicly available annotations from RefSeq, UniProt, Ensembl, and JGI are hyper-linked and searchable. The included organisms (by common name) are: Human, Mouse, Rat, Dog, Opossum, Chicken, Frog, Stickleback, Medaka, Fugu pufferfish; Zebrafish, Seasquirt - savignyi, Seasquirt - intestinalis, Amphioxus, Sea Urchin, Fruitfly, Mosquite, Yellow Fever Mosquito, Silkworm, Red Flour Beetle, Worm, Briggsae Worm, Owl limpet (snail), and Sea anemone. [Copied from Metazome Overview at http://www.metazome.net/Metazome_info.php

  9. The Insect SNMP Gene Family

    DTIC Science & Technology

    2009-01-01

    identified (see Nichols and Vogt, 2008); new sequences include those from Culex pipiens q. and the snmp2 gene of B. mori. For the previous study , sequences...Mamestra brassicae); Diptera (D. melanogaster, Drosophila pseudoobscura, Aedes aegypti, Anopheles gambiae, Culex pipiens quinquefasciatus); Hymenop...tera (Apis mellifera); and Coleoptera (Tribolium castaneum). This previous study suggested a complex topography within the SNMP clade including a

  10. Family reunion--the ZIP/prion gene family.

    PubMed

    Ehsani, Sepehr; Huo, Hairu; Salehzadeh, Ashkan; Pocanschi, Cosmin L; Watts, Joel C; Wille, Holger; Westaway, David; Rogaeva, Ekaterina; St George-Hyslop, Peter H; Schmitt-Ulms, Gerold

    2011-03-01

    Prion diseases are fatal neurodegenerative diseases of humans and animals which, in addition to sporadic and familial modes of manifestation, can be acquired via an infectious route of propagation. In disease, the prion protein (PrP(C)) undergoes a structural transition to its disease-causing form (PrP(Sc)) with profoundly different physicochemical properties. Surprisingly, despite intense interest in the prion protein, its function in the context of other cellular activities has largely remained elusive. We recently employed quantitative mass spectrometry to characterize the interactome of the prion protein in a murine neuroblastoma cell line (N2a), an established cell model for prion replication. Extensive bioinformatic analyses subsequently established an evolutionary link between the prion gene family and the family of ZIP (Zrt-, Irt-like protein) metal ion transporters. More specifically, sequence alignments, structural threading data and multiple additional pieces of evidence placed a ZIP5/ZIP6/ZIP10-like ancestor gene at the root of the PrP gene family. In this review we examine the biology of prion proteins and ZIP transporters from the viewpoint of a shared phylogenetic origin. We summarize and compare available data that shed light on genetics, function, expression, signaling, post-translational modifications and metal binding preferences of PrP and ZIP family members. Finally, we explore data indicative of retropositional origins of the prion gene founder and discuss a possible function for the prion-like (PL) domain within ZIP transporters. While throughout the article emphasis is placed on ZIP proteins, the intent is to highlight connections between PrP and ZIP transporters and uncover promising directions for future research.

  11. The human crystallin gene families

    PubMed Central

    2012-01-01

    Crystallins are the abundant, long-lived proteins of the eye lens. The major human crystallins belong to two different superfamilies: the small heat-shock proteins (α-crystallins) and the βγ-crystallins. During evolution, other proteins have sometimes been recruited as crystallins to modify the properties of the lens. In the developing human lens, the enzyme betaine-homocysteine methyltransferase serves such a role. Evolutionary modification has also resulted in loss of expression of some human crystallin genes or of specific splice forms. Crystallin organization is essential for lens transparency and mutations; even minor changes to surface residues can cause cataract and loss of vision. PMID:23199295

  12. The Dynein Gene Family in Chlamydomonas Reinhardtii

    PubMed Central

    Porter, M. E.; Knott, J. A.; Myster, S. H.; Farlow, S. J.

    1996-01-01

    To correlate dynein heavy chain (Dhc) genes with flagellar mutations and gain insight into the function of specific dynein isoforms, we placed eight members of the Dhc gene family on the genetic map of Chlamydomonas. Using a PCR-based strategy, we cloned 11 Dhc genes from Chlamydomonas. Comparisons with other Dhc genes indicate that two clones correspond to genes encoding the alpha and beta heavy chains of the outer dynein arm. Alignment of the predicted amino acid sequences spanning the nucleotide binding site indicates that the remaining nine clones can be subdivided into three groups that are likely to include representatives of the inner-arm Dhc isoforms. Gene-specific probes reveal that each clone represents a single-copy gene that is expressed as a transcript of the appropriate size (>13 kb) sufficient to encode a high molecular weight Dhc polypeptide. The expression of all nine genes is upregulated in response to deflagellation, suggesting a role in axoneme assembly or motility. Restriction fragment length polymorphisms between divergent C. reinhardtii strains have been used to place each Dhc gene on the genetic map of Chlamydomonas. These studies lay the groundwork for correlating defects in different Dhc genes with specific flagellar mutations. PMID:8889521

  13. Secreted Metalloprotease Gene Family of Microsporum canis

    PubMed Central

    Brouta, Frédéric; Descamps, Frédéric; Monod, Michel; Vermout, Sandy; Losson, Bertrand; Mignon, Bernard

    2002-01-01

    Keratinolytic proteases secreted by dermatophytes are likely to be virulence-related factors. Microsporum canis, the main agent of dermatophytosis in dogs and cats, causes a zoonosis that is frequently reported. Using Aspergillus fumigatus metalloprotease genomic sequence (MEP) as a probe, three genes (MEP1, MEP2, and MEP3) were isolated from an M. canis genomic library. They presented a quite-high percentage of identity with both A. fumigatus MEP and Aspergillus oryzae neutral protease I genes. At the amino acid level, they all contained an HEXXH consensus sequence, confirming that these M. canis genes (MEP genes) encode a zinc-containing metalloprotease gene family. Furthermore, MEP3 was found to be the gene encoding a previously isolated M. canis 43.5-kDa keratinolytic metalloprotease, and was successfully expressed as an active recombinant enzyme in Pichia pastoris. Reverse transcriptase nested PCR performed on total RNA extracted from the hair of M. canis-infected guinea pigs showed that at least MEP2 and MEP3 are produced during the infection process. This is the first report describing the isolation of a gene family encoding potential virulence-related factors in dermatophytes. PMID:12228297

  14. Gene-Family Extension Measures and Correlations

    PubMed Central

    Carmi, Gon; Bolshoy, Alexander

    2016-01-01

    The existence of multiple copies of genes is a well-known phenomenon. A gene family is a set of sufficiently similar genes, formed by gene duplication. In earlier works conducted on a limited number of completely sequenced and annotated genomes it was found that size of gene family and size of genome are positively correlated. Additionally, it was found that several atypical microbes deviated from the observed general trend. In this study, we reexamined these associations on a larger dataset consisting of 1484 prokaryotic genomes and using several ranking approaches. We applied ranking methods in such a way that genomes with lower numbers of gene copies would have lower rank. Until now only simple ranking methods were used; we applied the Kemeny optimal aggregation approach as well. Regression and correlation analysis were utilized in order to accurately quantify and characterize the relationships between measures of paralog indices and genome size. In addition, boxplot analysis was employed as a method for outlier detection. We found that, in general, all paralog indexes positively correlate with an increase of genome size. As expected, different groups of atypical prokaryotic genomes were found for different types of paralog quantities. Mycoplasmataceae and Halobacteria appeared to be among the most interesting candidates for further research of evolution through gene duplication. PMID:27527218

  15. Gene-Family Extension Measures and Correlations.

    PubMed

    Carmi, Gon; Bolshoy, Alexander

    2016-08-03

    The existence of multiple copies of genes is a well-known phenomenon. A gene family is a set of sufficiently similar genes, formed by gene duplication. In earlier works conducted on a limited number of completely sequenced and annotated genomes it was found that size of gene family and size of genome are positively correlated. Additionally, it was found that several atypical microbes deviated from the observed general trend. In this study, we reexamined these associations on a larger dataset consisting of 1484 prokaryotic genomes and using several ranking approaches. We applied ranking methods in such a way that genomes with lower numbers of gene copies would have lower rank. Until now only simple ranking methods were used; we applied the Kemeny optimal aggregation approach as well. Regression and correlation analysis were utilized in order to accurately quantify and characterize the relationships between measures of paralog indices and genome size. In addition, boxplot analysis was employed as a method for outlier detection. We found that, in general, all paralog indexes positively correlate with an increase of genome size. As expected, different groups of atypical prokaryotic genomes were found for different types of paralog quantities. Mycoplasmataceae and Halobacteria appeared to be among the most interesting candidates for further research of evolution through gene duplication.

  16. The glutamine synthetase gene family in Populus

    PubMed Central

    2011-01-01

    Background Glutamine synthetase (GS; EC: 6.3.1.2, L-glutamate: ammonia ligase ADP-forming) is a key enzyme in ammonium assimilation and metabolism of higher plants. The current work was undertaken to develop a more comprehensive understanding of molecular and biochemical features of GS gene family in poplar, and to characterize the developmental regulation of GS expression in various tissues and at various times during the poplar perennial growth. Results The GS gene family consists of 8 different genes exhibiting all structural and regulatory elements consistent with their roles as functional genes. Our results indicate that the family members are organized in 4 groups of duplicated genes, 3 of which code for cytosolic GS isoforms (GS1) and 1 which codes for the choroplastic GS isoform (GS2). Our analysis shows that Populus trichocarpa is the first plant species in which it was observed the complete GS family duplicated. Detailed expression analyses have revealed specific spatial and seasonal patterns of GS expression in poplar. These data provide insights into the metabolic function of GS isoforms in poplar and pave the way for future functional studies. Conclusions Our data suggest that GS duplicates could have been retained in order to increase the amount of enzyme in a particular cell type. This possibility could contribute to the homeostasis of nitrogen metabolism in functions associated to changes in glutamine-derived metabolic products. The presence of duplicated GS genes in poplar could also contribute to diversification of the enzymatic properties for a particular GS isoform through the assembly of GS polypeptides into homo oligomeric and/or hetero oligomeric holoenzymes in specific cell types. PMID:21867507

  17. TRP genes family expression in colorectal cancer.

    PubMed

    Sozucan, Y; Kalender, M E; Sari, I; Suner, A; Oztuzcu, S; Arman, K; Yumrutas, O; Bozgeyik, I; Cengiz, B; Igci, Y Z; Balakan, O; Camci, C

    2015-09-01

    Colorectal cancer (CRC) is the most common cancer of the gastrointestinal tract. Different factors are responsible for the development of CRC. Transient Receptor Potential (TRP) which is an important component of calcium channel is associated with several pathological conditions like cancer, neurodegenerative and cardiovascular diseases. Thirty members of the family of TRP ion channel in mammals have been determined till now. The aim of this study is to investigate TRPM, TRPV and TRPC gene expression levels in tumor tissues of CRC patients and to analyze the relationship of expression in tumor tissue of CRC with other known prognostic factors. In this study, 93 CRC patients were included. The level of TRP gene expression in paraffin blocks of normal and cancerous colorectal tissue samples were studied at the level of mRNA with Real-time PCR. The mRNA expression level of TRPV3, TRPV4, TRPV5, TRPM4 and TRPC6 genes in 37 female and 56 male patients diagnosed with CRC was revealed lower in tumor tissue as compared to normal tissue (p < 0.05). No statistically significant differences of mRNA expression levels of other TRP genes were found. TRP gene family like TRPV3, TRPV4, TRPV5, TRPM4 and TRPC6 may be thought as potential genes contributing to tumorigenesis as their expression decreases in CRC as compared to normal tissues.

  18. The Eucalyptus terpene synthase gene family.

    PubMed

    Külheim, Carsten; Padovan, Amanda; Hefer, Charles; Krause, Sandra T; Köllner, Tobias G; Myburg, Alexander A; Degenhardt, Jörg; Foley, William J

    2015-06-11

    Terpenoids are abundant in the foliage of Eucalyptus, providing the characteristic smell as well as being valuable economically and influencing ecological interactions. Quantitative and qualitative inter- and intra- specific variation of terpenes is common in eucalypts. The genome sequences of Eucalyptus grandis and E. globulus were mined for terpene synthase genes (TPS) and compared to other plant species. We investigated the relative expression of TPS in seven plant tissues and functionally characterized five TPS genes from E. grandis. Compared to other sequenced plant genomes, Eucalyptus grandis has the largest number of putative functional TPS genes of any sequenced plant. We discovered 113 and 106 putative functional TPS genes in E. grandis and E. globulus, respectively. All but one TPS from E. grandis were expressed in at least one of seven plant tissues examined. Genomic clusters of up to 20 genes were identified. Many TPS are expressed in tissues other than leaves which invites a re-evaluation of the function of terpenes in Eucalyptus. Our data indicate that terpenes in Eucalyptus may play a wider role in biotic and abiotic interactions than previously thought. Tissue specific expression is common and the possibility of stress induction needs further investigation. Phylogenetic comparison of the two investigated Eucalyptus species gives insight about recent evolution of different clades within the TPS gene family. While the majority of TPS genes occur in orthologous pairs some clades show evidence of recent gene duplication, as well as loss of function.

  19. Evolutionary history of the Asr gene family.

    PubMed

    Frankel, Nicolás; Carrari, Fernando; Hasson, Esteban; Iusem, Norberto D

    2006-08-15

    The Asr gene family is widespread in higher plants. Most Asr genes are up-regulated under different environmental stress conditions and during fruit ripening. ASR proteins are localized in the nucleus and their likely function is transcriptional regulation. In cultivated tomato, we identified a novel fourth family member, named Asr4, which maps close to its sibling genes Asr1-Asr2-Asr3 and displays an unshared region coding for a domain containing a 13-amino acid repeat. In this work we were able to expand our previous analysis for Asr2 and investigated the coding regions of the four known Asr paralogous genes in seven tomato species from different geographic locations. In addition, we performed a phylogenetic analysis on ASR proteins. The first conclusion drawn from this work is that tomato ASR proteins cluster together in the tree. This observation can be explained by a scenario of concerted evolution or birth and death of genes. Secondly, our study showed that Asr1 is highly conserved at both replacement and synonymous sites within the genus Lycopersicon. ASR1 protein sequence conservation might be associated with its multiple functions in different tissues while the low rate of synonymous substitutions suggests that silent variation in Asr1 is selectively constrained, which is probably related to its high expression levels. Finally, we found that Asr1 activation under water stress is not conserved between Lycopersicon species.

  20. NFAT Gene Family in Inflammation and Cancer

    PubMed Central

    Pan, M.-G.; Xiong, Y.; Chen, F.

    2013-01-01

    Calcineurin-NFAT signaling is critical for numerous aspects of vertebrate function during and after embryonic development. Initially discovered in T cells, the NFAT gene family, consisting of five members, regulates immune system, inflammatory response, angiogenesis, cardiac valve formation, myocardial development, axonal guidance, skeletal muscle development, bone homeostasis, development and metastasis of cancer, and many other biological processes. In this review we will focus on the NFAT literature relevant to the two closely related pathological systems: inflammation and cancer. PMID:22950383

  1. Tumor suppressor genes in familial adenomatous polyposis.

    PubMed

    Eshghifar, Nahal; Farrokhi, Naser; Naji, Tahereh; Zali, Mohammadreza

    2017-01-01

    Colorectal cancer (CRC) is mostly due to a series of genetic alterations that are being greatly under the influence of the environmental factors. These changes, mutational or epigenetic modifications at transcriptional forefront and/or post-transcriptional effects via miRNAs, include inactivation and the conversion of proto-oncogene to oncogenes, and/or inactivation of tumor suppressor genes (TSG). Here, a thorough review was carried out on the role of TSGs with the focus on the APC as the master regulator, mutated genes and mal-/dysfunctional pathways that lead to one type of hereditary form of the CRC; namely familial adenomatous polyposis (FAP). This review provides a venue towards defining candidate genes that can be used as new PCR-based markers for early diagnosis of FAP. In addition to diagnosis, defining the modes of genetic alterations will open door towards genome editing to either suppress the disease or reduce its progression during the course of action.

  2. Mendel-GFDb and Mendel-ESTS: databases of plant gene families and ESTs annotated with gene family numbers and gene family names

    PubMed Central

    Lonsdale, David; Crowe, Mark; Arnold, Benjamin; Arnold, Benedict C.

    2001-01-01

    There is no control over the information provided with sequences when they are deposited in the sequence databases. Consequently mistakes can seed the incorrect annotation of other sequences. Grouping genes into families and applying controlled annotation overcomes the problems of incorrect annotation associated with individual sequences. Two databases (http://www.mendel.ac.uk) were created to apply controlled annotation to plant genes and plant ESTs: Mendel-GFDb is a database of plant protein (gene) families based on gapped-BLAST analysis of all sequences in the SWISS-PROT family of databases. Sequences are aligned (ClustalW) and identical and similar residues shaded. The families are visually curated to ensure that one or more criteria, for example overall relatedness and/or domain similarity relate all sequences within a family. Sequence families are assigned a ‘Gene Family Number’ and a unified description is developed which best describes the family and its members. If authority exists the gene family is assigned a ‘Gene Family Name’. This information is placed in Mendel-GFDb. Mendel-ESTS is primarily a database of plant ESTs, which have been compared to Mendel-GFDb, completely sequenced genomes and domain databases. This approach associated ESTs with individual sequences and the controlled annotation of gene families and protein domains; the information being placed in Mendel-ESTS. The controlled annotation applied to genes and ESTs provides a basis from which a plant transcription database can be developed. PMID:11125066

  3. The Pax gene family: Highlights from cephalopods

    PubMed Central

    Baratte, Sébastien; Andouche, Aude; Bonnaud-Ponticelli, Laure

    2017-01-01

    Pax genes play important roles in Metazoan development. Their evolution has been extensively studied but Lophotrochozoa are usually omitted. We addressed the question of Pax paralog diversity in Lophotrochozoa by a thorough review of available databases. The existence of six Pax families (Pax1/9, Pax2/5/8, Pax3/7, Pax4/6, Paxβ, PoxNeuro) was confirmed and the lophotrochozoan Paxβ subfamily was further characterized. Contrary to the pattern reported in chordates, the Pax2/5/8 family is devoid of homeodomain in Lophotrochozoa. Expression patterns of the three main pax classes (pax2/5/8, pax3/7, pax4/6) during Sepia officinalis development showed that Pax roles taken as ancestral and common in metazoans are modified in S. officinalis, most likely due to either the morphological specificities of cephalopods or to their direct development. Some expected expression patterns were missing (e.g. pax6 in the developing retina), and some expressions in unexpected tissues have been found (e.g. pax2/5/8 in dermal tissue and in gills). This study underlines the diversity and functional plasticity of Pax genes and illustrates the difficulty of using probable gene homology as strict indicator of homology between biological structures. PMID:28253300

  4. The Pax gene family: Highlights from cephalopods.

    PubMed

    Navet, Sandra; Buresi, Auxane; Baratte, Sébastien; Andouche, Aude; Bonnaud-Ponticelli, Laure; Bassaglia, Yann

    2017-01-01

    Pax genes play important roles in Metazoan development. Their evolution has been extensively studied but Lophotrochozoa are usually omitted. We addressed the question of Pax paralog diversity in Lophotrochozoa by a thorough review of available databases. The existence of six Pax families (Pax1/9, Pax2/5/8, Pax3/7, Pax4/6, Paxβ, PoxNeuro) was confirmed and the lophotrochozoan Paxβ subfamily was further characterized. Contrary to the pattern reported in chordates, the Pax2/5/8 family is devoid of homeodomain in Lophotrochozoa. Expression patterns of the three main pax classes (pax2/5/8, pax3/7, pax4/6) during Sepia officinalis development showed that Pax roles taken as ancestral and common in metazoans are modified in S. officinalis, most likely due to either the morphological specificities of cephalopods or to their direct development. Some expected expression patterns were missing (e.g. pax6 in the developing retina), and some expressions in unexpected tissues have been found (e.g. pax2/5/8 in dermal tissue and in gills). This study underlines the diversity and functional plasticity of Pax genes and illustrates the difficulty of using probable gene homology as strict indicator of homology between biological structures.

  5. Rubisco small subunit gene family in cassava.

    PubMed

    Yeo, T W; Mak, Y M; Ho, K K

    1999-01-01

    Cassava leaves of two different cultivars, Brazil and Buloh, were used to isolate mRNA. The mRNA isolated was successfully used in the construction of cDNA libraries for each of the cultivars. The cDNA libraries were screened for members of ribulose-1,5-bisphosphate carboxylase/oxygenase small subunit gene family and positive clones were sequenced. A total of seven different SSU genes, of which five were from cultivar Brazil and two were from cultivar Buloh, were isolated. Comparison results show that even though all the sequences are highly similar, they can be classified into three subfamilies. Homology between members of the same subfamily is higher than homology between members from the same cultivar.

  6. The tomato cis-prenyltransferase gene family.

    PubMed

    Akhtar, Tariq A; Matsuba, Yuki; Schauvinhold, Ines; Yu, Geng; Lees, Hazel A; Klein, Samuel E; Pichersky, Eran

    2013-02-01

    cis-prenyltransferases (CPTs) are predicted to be involved in the synthesis of long-chain polyisoprenoids, all with five or more isoprene (C5) units. Recently, we identified a short-chain CPT, neryl diphosphate synthase (NDPS1), in tomato (Solanum lycopersicum). Here, we searched the tomato genome and identified and characterized its entire CPT gene family, which comprises seven members (SlCPT1-7, with NDPS1 designated as SlCPT1). Six of the SlCPT genes encode proteins with N-terminal targeting sequences, which, when fused to GFP, mediated GFP transport to the plastids of Arabidopsis protoplasts. The SlCPT3-GFP fusion protein was localized to the cytosol. Enzymatic characterization of recombinant SlCPT proteins demonstrated that SlCPT6 produces Z,Z-FPP, and SlCPT2 catalyzes the formation of nerylneryl diphosphate while SlCPT4, SlCPT5 and SlCPT7 synthesize longer-chain products (C25-C55). Although no in vitro activity was demonstrated for SlCPT3, its expression in the Saccharomyces cerevisiae dolichol biosynthesis mutant (rer2) complemented the temperature-sensitive growth defect. Transcripts of SlCPT2, SlCPT4, SlCPT5 and SlCPT7 are present at low levels in multiple tissues, SlCPT6 is exclusively expressed in red fruit and roots, and SlCPT1, SlCPT3 and SlCPT7 are highly expressed in trichomes. RNAi-mediated suppression of NDPS1 led to a large decrease in β-phellandrene (which is produced from neryl diphosphate), with greater reductions achieved with the general 35S promoter compared to the trichome-specific MKS1 promoter. Phylogenetic analysis revealed CPT gene families in both eudicots and monocots, and showed that all the short-chain CPT genes from tomato (SlCPT1, SlCPT2 and SlCPT6) are closely linked to terpene synthase gene clusters.

  7. Tumor suppressor genes in familial adenomatous polyposis

    PubMed Central

    Eshghifar, Nahal; Farrokhi, Naser; Naji, Tahereh; Zali, Mohammadreza

    2017-01-01

    Colorectal cancer (CRC) is mostly due to a series of genetic alterations that are being greatly under the influence of the environmental factors. These changes, mutational or epigenetic modifications at transcriptional forefront and/or post-transcriptional effects via miRNAs, include inactivation and the conversion of proto-oncogene to oncogenes, and/or inactivation of tumor suppressor genes (TSG). Here, a thorough review was carried out on the role of TSGs with the focus on the APC as the master regulator, mutated genes and mal-/dysfunctional pathways that lead to one type of hereditary form of the CRC; namely familial adenomatous polyposis (FAP). This review provides a venue towards defining candidate genes that can be used as new PCR-based markers for early diagnosis of FAP. In addition to diagnosis, defining the modes of genetic alterations will open door towards genome editing to either suppress the disease or reduce its progression during the course of action. PMID:28331559

  8. Inferring Gene Family Histories in Yeast Identifies Lineage Specific Expansions

    PubMed Central

    Ames, Ryan M.; Money, Daniel; Lovell, Simon C.

    2014-01-01

    The complement of genes found in the genome is a balance between gene gain and gene loss. Knowledge of the specific genes that are gained and lost over evolutionary time allows an understanding of the evolution of biological functions. Here we use new evolutionary models to infer gene family histories across complete yeast genomes; these models allow us to estimate the relative genome-wide rates of gene birth, death, innovation and extinction (loss of an entire family) for the first time. We show that the rates of gene family evolution vary both between gene families and between species. We are also able to identify those families that have experienced rapid lineage specific expansion/contraction and show that these families are enriched for specific functions. Moreover, we find that families with specific functions are repeatedly expanded in multiple species, suggesting the presence of common adaptations and that these family expansions/contractions are not random. Additionally, we identify potential specialisations, unique to specific species, in the functions of lineage specific expanded families. These results suggest that an important mechanism in the evolution of genome content is the presence of lineage-specific gene family changes. PMID:24921666

  9. The Arabidopsis Cyclophilin Gene Family1

    PubMed Central

    Romano, Patrick G.N.; Horton, Peter; Gray, Julie E.

    2004-01-01

    Database searching has allowed the identification of a number of previously unreported single and multidomain isoform members of the Arabidopsis cyclophilin gene family. In addition to the cyclophilin-like peptidyl-prolyl cis-trans isomerase domain, the latter contain a variety of other domains with characterized functions. Transcriptional analysis showed they are expressed throughout the plant, and different isoforms are present in all parts of the cell including the cytosol, nucleus, mitochondria, secretory pathway, and chloroplast. The abundance and diversity of cyclophilin isoforms suggests that, like their animal counterparts, plant cyclophilins are likely to be important proteins involved in a wide variety of cellular processes. As well as fulfilling the basic role of protein folding, they may also play important roles in mRNA processing, protein degradation, and signal transduction and thus may be crucial during both development and stress responsiveness. PMID:15051864

  10. Expression profiling the human septin gene family.

    PubMed

    Hall, Peter A; Jung, Kenneth; Hillan, Kenneth J; Russell, S E Hilary

    2005-07-01

    The septins are an evolutionarily conserved family of GTP-binding proteins involved in diverse processes including vesicle trafficking, apoptosis, remodelling of the cytoskeleton, infection, neurodegeneration, and neoplasia. The present paper reports a comprehensive study of septin gene expression by DNA microarray methods in 10 360 samples of normal, diseased, and tumour tissues. A novel septin, SEPT13, has been identified and is shown to be related to SEPT7. It is shown that SEPT13 and the other known human septins are expressed in all tissue types but some show high expression in lymphoid (SEPT1, 6, 9, and 12) or brain tissues (SEPT2, 3, 4, 5, 7, 8, and 11). For a given septin, some isoforms are highly expressed in the brain and others are not. For example, SEPT8_v2 and v1, 1* and 3 are highly expressed in the brain and cluster with SEPT2, 3, 4, 5, 7, and 11. However, a probe set specific for SEPT8_v1 with low brain expression clusters away from this set. Similarly, SEPT4 has lymphoid and non-lymphoid forms; SEPT2 has lymphoid and central nervous system (CNS) forms; and SEPT6 and SEPT9 are elevated in lymphoid tissues but both have forms that cluster away from the lymphoid forms. Perturbation of septin expression was widespread in disease and tumours of the various tissues examined, particularly for conditions of the CNS, where alterations in all 13 septin genes were identified. This analysis provides a comprehensive catalogue of the septin family in health and disease. It is a key step in understanding the role of septins in physiological and pathological states and provides insight into the complexity of septin biology. Copyright 2005 Pathological Society of Great Britain and Ireland. Published by John Wiley & Sons, Ltd.

  11. Modelling the evolution of multi-gene families.

    PubMed

    Nye, Tom M W

    2009-10-01

    A number of biological processes can lead to genes being copied within the genome of some given species. Duplicate genes of this form are called paralogs and such genes share a high degree sequence similarity as well as often having closely related functions. Some genes have become widely duplicated to form multigene families in which the copies are distributed both within the genomes of individual species and across different species. Statistical modelling of gene duplication and the evolution of multi-gene families currently lags behind well-established models of DNA sequence evolution despite an increasing volume of available data, but the analysis of multi-gene families is important as part of a wider effort to understand evolution at the genomic level. This article reviews existing approaches to modelling multi-gene families and presents various challenges and possibilities for this exciting area of research.

  12. Evolutionary analyses of non-family genes in plants

    SciTech Connect

    Ye, Chuyu; Li, Ting; Yin, Hengfu; Weston, David; Tuskan, Gerald A; Tschaplinski, Timothy J; Yang, Xiaohan

    2013-01-01

    There are a large number of non-family (NF) genes that do not cluster into families with three or more members per genome. While gene families have been extensively studied, a systematic analysis of NF genes has not been reported. We performed comparative studies on NF genes in 14 plant species. Based on the clustering of protein sequences, we identified ~94 000 NF genes across these species that were divided into five evolutionary groups: Viridiplantae wide, angiosperm specific, monocot specific, dicot specific, and those that were species specific. Our analysis revealed that the NF genes resulted largely from less frequent gene duplications and/or a higher rate of gene loss after segmental duplication relative to genes in both lowcopy- number families (LF; 3 10 copies per genome) and high-copy-number families (HF; >10 copies). Furthermore, we identified functions enriched in the NF gene set as compared with the HF genes. We found that NF genes were involved in essential biological processes shared by all plant lineages (e.g. photosynthesis and translation), as well as gene regulation and stress responses associated with phylogenetic diversification. In particular, our analysis of an Arabidopsis protein protein interaction network revealed that hub proteins with the top 10% most connections were over-represented in the NF set relative to the HF set. This research highlights the roles that NF genes may play in evolutionary and functional genomics research.

  13. Evolutionary analyses of non-family genes in plants

    SciTech Connect

    Ye, Chuyu; Li, Ting; Yin, Hengfu; Weston, David; Tuskan, Gerald A; Tschaplinski, Timothy J; Yang, Xiaohan

    2013-03-01

    There are a large number of non-family (NF) genes that do not cluster into families with three or more members per genome. While gene families have been extensively studied, a systematic analysis of NF genes has not been reported. We performed comparative studies on NF genes in 14 plant species. Based on the clustering of protein sequences, we identified ~94,000 NF genes across these species that were divided into five evolutionary groups: Viridiplantae-wide, angiosperm-specific, monocot-specific, dicot-specific, and those that were species-specific. Our analysis revealed that the NF genes resulted largely from less frequent gene duplications and/or a higher rate of gene loss after segmental duplication relative to genes in both low-copy-number families (LF; 3 10 copies per genome) and high-copy-number families (HF; >10 copies). Furthermore, we identified functions enriched in the NF gene set as compared with the HF genes. We found that NF genes were involved in essential biological processes shared by all plant lineages (e.g., photosynthesis and translation), as well as gene regulation and stress responses associated with phylogenetic diversification. In particular, our analysis of an Arabidopsis protein-protein interaction network revealed that hub proteins with the top 10% most connections were over-represented in the NF set relative to the HF set. This research highlights the roles that NF genes may play in evolutionary and functional genomics research.

  14. The yeast ubiquitin genes: a family of natural gene fusions.

    PubMed Central

    Ozkaynak, E; Finley, D; Solomon, M J; Varshavsky, A

    1987-01-01

    Ubiquitin is a 76-residue protein highly conserved among eukaryotes. Conjugation of ubiquitin to intracellular proteins mediates their selective degradation in vivo. We describe a family of four ubiquitin-coding loci in the yeast Saccharomyces cerevisiae. UB11, UB12 and UB13 encode hybrid proteins in which ubiquitin is fused to unrelated ('tail') amino acid sequences. The ubiquitin coding elements of UB11 and UB12 are interrupted at identical positions by non-homologous introns. UB11 and UB12 encode identical 52-residue tails, whereas UB13 encodes a different 76-residue tail. The tail amino acid sequences are highly conserved between yeast and mammals. Each tail contains a putative metal-binding, nucleic acid-binding domain of the form Cys-X2-4-Cys-X2-15-Cys-X2-4-Cys, suggesting that these proteins may function by binding to DNA. The fourth gene, UB14, encodes a polyubiquitin precursor protein containing five ubiquitin repeats in a head-to-tail, spacerless arrangement. All four ubiquitin genes are expressed in exponentially growing cells, while in stationary-phase cells the expression of UB11 and UB12 is repressed. The UB14 gene, which is strongly inducible by starvation, high temperatures and other stresses, contains in its upstream region strong homologies to the consensus 'heat shock box' nucleotide sequence. Elsewhere we show that the essential function of the UB14 gene is to provide ubiquitin to cells under stress. Images Fig. 1. Fig. 7. PMID:3038523

  15. Functional divergence in the Arabidopsis LOB-domain gene family

    PubMed Central

    Mangeon, Amanda; Lin, Wan-ching; Springer, Patricia S.

    2012-01-01

    The Arabidopsis LOB-domain (LBD) gene family is composed by 43 members divided in two classes based on amino acid conservation within the LOB-domain. The LOB domain is known to be responsible for DNA binding and protein-protein interactions. There is very little functional information available for most genes in the LBD family and many lbd single mutants do not exhibit conspicuous phenotypes. One plausible explanation for the limited loss-of-function phenotypes observed in this family is that LBD genes exhibit significant functional redundancy. Here we discuss an example of one phylogenetic subgroup of the LBD family, in which genes that are closely related based on phylogeny exhibit distinctly different expression patterns and do not have overlapping functions. We discuss the challenges of using phylogenetic analyses to predict redundancy in gene families. PMID:23073009

  16. Complexity of the MSG gene family of Pneumocystis carinii

    PubMed Central

    Keely, Scott P; Stringer, James R

    2009-01-01

    Background The relationship between the parasitic fungus Pneumocystis carinii and its host, the laboratory rat, presumably involves features that allow the fungus to circumvent attacks by the immune system. It is hypothesized that the major surface glycoprotein (MSG) gene family endows Pneumocystis with the capacity to vary its surface. This gene family is comprised of approximately 80 genes, which each are approximately 3 kb long. Expression of the MSG gene family is regulated by a cis-dependent mechanism that involves a unique telomeric site in the genome called the expression site. Only the MSG gene adjacent to the expression site is represented by messenger RNA. Several P. carinii MSG genes have been sequenced, which showed that genes in the family can encode distinct isoforms of MSG. The vast majority of family members have not been characterized at the sequence level. Results The first 300 basepairs of MSG genes were subjected to analysis herein. Analysis of 581 MSG sequence reads from P. carinii genomic DNA yielded 281 different sequences. However, many of the sequence reads differed from others at only one site, a degree of variation consistent with that expected to be caused by error. Accounting for error reduced the number of truly distinct sequences observed to 158, roughly twice the number expected if the gene family contains 80 members. The size of the gene family was verified by PCR. The excess of distinct sequences appeared to be due to allelic variation. Discounting alleles, there were 73 different MSG genes observed. The 73 genes differed by 19% on average. Variable regions were rich in nucleotide differences that changed the encoded protein. The genes shared three regions in which at least 16 consecutive basepairs were invariant. There were numerous cases where two different genes were identical within a region that was variable among family members as a whole, suggesting recombination among family members. Conclusion A set of sequences that

  17. Differential expression of the ras gene family in mice.

    PubMed Central

    Leon, J; Guerrero, I; Pellicer, A

    1987-01-01

    We compared the expression of the ras gene family (H-ras, K-ras, and N-ras) in adult mouse tissues and during development. We found substantial variations in expression among different organs and in the amounts of the different transcripts originating from each gene, especially for the N-ras gene. The expression patterns were consistent with the reported preferential tissue activation of ras genes and suggested different cellular functions for each of the ras genes. Images PMID:3600635

  18. Recurrent APC gene mutations in Polish FAP families

    PubMed Central

    Pławski, Andrzej; Podralska, Marta; Słomski, Ryszard

    2007-01-01

    The molecular diagnostics of genetically conditioned disorders is based on the identification of the mutations in the predisposing genes. Hereditary cancer disorders of the gastrointestinal tracts are caused by mutations of the tumour suppressor genes or the DNA repair genes. Occurrence of recurrent mutation allows improvement of molecular diagnostics. The mutation spectrum in the genes causing hereditary forms of colorectal cancers in the Polish population was previously described. In the present work an estimation of the frequency of the recurrent mutations of the APC gene was performed. Eight types of mutations occurred in 19.4% of our FAP families and these constitute 43% of all Polish diagnosed families. PMID:19725996

  19. The Roles of Sox Family Genes in Sarcoma.

    PubMed

    Li, Jingyuan; Shen, Jacson; Wang, Kunzheng; Hornicek, Francis; Duan, Zhenfeng

    2016-01-01

    Sox (SRY-related HMG-box) family genes are important regulators of cell development, homeostasis, and regeneration. Deregulation of certain members of the Sox gene family has been implicated in a number of human malignancies, including in sarcoma. Accumulating evidence suggests that Sox genes play crucial roles in sarcoma cell pathogenesis, growth, and proliferation. Here, we review the biological relevance of Sox2 and Sox9 genes in osteosarcoma, chondrosarcoma and chordoma; Sox2, Sox6, and Sox17 genes in Ewing's sarcoma; Sox2, Sox9, and Sox10 genes in synovial sarcoma; Sox2 gene in fibrosarcoma; and Sox21 gene in liposarcoma. These findings potentiate the targeting of Sox genes for novel therapeutic interventions in sarcoma and may also hold valuable clinical potential to improve the care of patients with sarcoma.

  20. The Expansion of the PRAME Gene Family in Eutheria

    PubMed Central

    Chang, Ti-Cheng; Yang, Yang; Yasue, Hiroshi; Bharti, Arvind K.; Retzel, Ernest F.; Liu, Wan-Sheng

    2011-01-01

    The PRAME gene family belongs to the group of cancer/testis genes whose expression is restricted primarily to the testis and a variety of cancers. The expansion of this gene family as a result of gene duplication has been observed in primates and rodents. We analyzed the PRAME gene family in Eutheria and discovered a novel Y-linked PRAME gene family in bovine, PRAMEY, which underwent amplification after a lineage-specific, autosome-to-Y transposition. Phylogenetic analyses revealed two major evolutionary clades. Clade I containing the amplified PRAMEYs and the unamplified autosomal homologs in cattle and other eutherians is under stronger functional constraints; whereas, Clade II containing the amplified autosomal PRAMEs is under positive selection. Deep-sequencing analysis indicated that eight of the identified 16 PRAMEY loci are active transcriptionally. Compared to the bovine autosomal PRAME that is expressed predominantly in testis, the PRAMEY gene family is expressed exclusively in testis and is up-regulated during testicular maturation. Furthermore, the sense RNA of PRAMEY is expressed specifically whereas the antisense RNA is expressed predominantly in spermatids. This study revealed that the expansion of the PRAME family occurred in both autosomes and sex chromosomes in a lineage-dependent manner. Differential selection forces have shaped the evolution and function of the PRAME family. The positive selection observed on the autosomal PRAMEs (Clade II) may result in their functional diversification in immunity and reproduction. Conversely, selective constraints have operated on the expanded PRAMEYs to preserve their essential function in spermatogenesis. PMID:21347312

  1. [Regulatory functions of Pax gene family in Drosophila development].

    PubMed

    Li, Li; Yang, Yang; Xue, Lei

    2010-02-01

    The Pax gene family encodes a group of important transcription factors that have been evolutionary conserved from Drosophila to human. Pax genes play pivotal roles in regulating diverse signal transduction pathways and organogenesis during embryonic development through modulating cell proliferation and self-renewal, embryonic precursor cell migration, and the coordination of specific differentiation programs. Ten members of the Pax gene family, which perform crucial regulatory functions during embryonic and postembryonic development, have been identified in Drosophila. In this report, we described the protein structures, expression patterns, and main functions of Drosophila Pax genes.

  2. A family of selfish minicircular chromosomes with jumbled chloroplast gene fragments from a dinoflagellate.

    PubMed

    Zhang, Z; Cavalier-Smith, T; Green, B R

    2001-08-01

    Chloroplast genes of several dinoflagellate species are located on unigenic DNA minicircular chromosomes. We have now completely sequenced five aberrant minicircular chromosomes from the dinoflagellate Heterocapsa triquetra. These probably nonfunctional DNA circles lack complete genes, with each being composed of several short fragments of two or three different chloroplast genes and a common conserved region with a tripartite 9G-9A-9G core like the putative replicon origin of functional single-gene circular chloroplast chromosomes. Their sequences imply that all five circles evolved by differential deletions and duplications from common ancestral circles bearing fragments of four genes: psbA, psbC, 16S rRNA, and 23S rRNA. It appears that recombination between separate unigenic chromosomes initially gave intermediate heterodimers, which were subsequently stabilized by deletions that included part or all of one putative replicon origin. We suggest that homologous recombination at the 9G-9A-9G core regions produced a psbA/psbC heterodimer which generated two distinct chimeric circles by differential deletions and duplications. A 23S/16S rRNA heterodimer more likely formed by illegitimate recombination between 16S and 23S rRNA genes. Homologous recombination between the 9G-9A-9G core regions of both heterodimers and additional differential deletions and duplications could then have yielded the other three circles. Near identity of the gene fragments and 9G-9A-9G cores, despite diverging adjacent regions, may be maintained by gene conversion. The conserved organization of the 9G-9A-9G cores alone favors the idea that they are replicon origins and suggests that they may enable the aberrant minicircles to parasitize the chloroplast's replication machinery as selfish circles.

  3. Predictions of Gene Family Distributions in Microbial Genomes: Evolution by Gene Duplication and Modification

    NASA Astrophysics Data System (ADS)

    Yanai, Itai; Camacho, Carlos J.; Delisi, Charles

    2000-09-01

    A universal property of microbial genomes is the considerable fraction of genes that are homologous to other genes within the same genome. The process by which these homologues are generated is not well understood, but sequence analysis of 20 microbial genomes unveils a recurrent distribution of gene family sizes. We show that a simple evolutionary model based on random gene duplication and point mutations fully accounts for these distributions and permits predictions for the number of gene families in genomes not yet complete. Our findings are consistent with the notion that a genome evolves from a set of precursor genes to a mature size by gene duplications and increasing modifications.

  4. Expression of ets family genes in hematopoietic-cells.

    PubMed

    Romanospica, V; Suzuki, H; Georgiou, P; Chen, S; Ascione, R; Papas, T; Bhat, N

    1994-03-01

    We have examined the expression of the ets family of transcription factors in different types of hematopoietic cells. Our results demonstrate that several members of the ets gene family are expressed differentially in hematopoietic cells. During phorbol ester induced differentiation of HL60 cells, ETS2, PEA3, as well as GABPalpha and GABPbeta mRNAs are coordinately induced. During the activation of T-cells, ETS2 proteins are induced; however, the expression of the ETS1 and ERGB gene products are reduced. These results demonstrate that the regulation of ets family of genes is complex and depends on cell type. This observation leads to the conclusion that the regulation of ets target genes, will be dependent, in part, upon the type of ets genes expressed in each particular cell type.

  5. Recommended nomenclature for five mammalian carboxylesterase gene families: human, mouse, and rat genes and proteins.

    PubMed

    Holmes, Roger S; Wright, Matthew W; Laulederkind, Stanley J F; Cox, Laura A; Hosokawa, Masakiyo; Imai, Teruko; Ishibashi, Shun; Lehner, Richard; Miyazaki, Masao; Perkins, Everett J; Potter, Phillip M; Redinbo, Matthew R; Robert, Jacques; Satoh, Tetsuo; Yamashita, Tetsuro; Yan, Bingfan; Yokoi, Tsuyoshi; Zechner, Rudolf; Maltais, Lois J

    2010-10-01

    Mammalian carboxylesterase (CES or Ces) genes encode enzymes that participate in xenobiotic, drug, and lipid metabolism in the body and are members of at least five gene families. Tandem duplications have added more genes for some families, particularly for mouse and rat genomes, which has caused confusion in naming rodent Ces genes. This article describes a new nomenclature system for human, mouse, and rat carboxylesterase genes that identifies homolog gene families and allocates a unique name for each gene. The guidelines of human, mouse, and rat gene nomenclature committees were followed and "CES" (human) and "Ces" (mouse and rat) root symbols were used followed by the family number (e.g., human CES1). Where multiple genes were identified for a family or where a clash occurred with an existing gene name, a letter was added (e.g., human CES4A; mouse and rat Ces1a) that reflected gene relatedness among rodent species (e.g., mouse and rat Ces1a). Pseudogenes were named by adding "P" and a number to the human gene name (e.g., human CES1P1) or by using a new letter followed by ps for mouse and rat Ces pseudogenes (e.g., Ces2d-ps). Gene transcript isoforms were named by adding the GenBank accession ID to the gene symbol (e.g., human CES1_AB119995 or mouse Ces1e_BC019208). This nomenclature improves our understanding of human, mouse, and rat CES/Ces gene families and facilitates research into the structure, function, and evolution of these gene families. It also serves as a model for naming CES genes from other mammalian species.

  6. Evolutionary History of the Cancer Immunity Antigen MAGE Gene Family

    PubMed Central

    Katsura, Yukako; Satta, Yoko

    2011-01-01

    The evolutionary mode of a multi-gene family can change over time, depending on the functional differentiation and local genomic environment of family members. In this study, we demonstrate such a change in the melanoma antigen (MAGE) gene family on the mammalian X chromosome. The MAGE gene family is composed of ten subfamilies that can be categorized into two types. Type I genes are of relatively recent origin, and they encode epitopes for human leukocyte antigen (HLA) in cancer cells. Type II genes are relatively ancient and some of their products are known to be involved in apoptosis or cell proliferation. The evolutionary history of the MAGE gene family can be divided into four phases. In phase I, a single-copy state of an ancestral gene and the evolutionarily conserved mode had lasted until the emergence of eutherian mammals. In phase II, eight subfamily ancestors, with the exception for MAGE-C and MAGE-D subfamilies, were formed via retrotransposition independently. This would coincide with a transposition burst of LINE elements at the eutherian radiation. However, MAGE-C was generated by gene duplication of MAGE-A. Phase III is characterized by extensive gene duplication within each subfamily and in particular the formation of palindromes in the MAGE-A subfamily, which occurred in an ancestor of the Catarrhini. Phase IV is characterized by the decay of a palindrome in most Catarrhini, with the exception of humans. Although the palindrome is truncated by frequent deletions in apes and Old World monkeys, it is retained in humans. Here, we argue that this human-specific retention stems from negative selection acting on MAGE-A genes encoding epitopes of cancer cells, which preserves their ability to bind to highly divergent HLA molecules. These findings are interpreted with consideration of the biological factors shaping recent human MAGE-A genes. PMID:21695252

  7. Diversity and distribution of CYP gene family in Bactrian camel.

    PubMed

    Hasi, Surong; Yao, Jirimutu; Yu, Siriguleng; Tian, Yanan

    2017-09-12

    Cytochrome P450 (CYP) enzymes belong to a superfamily of monooxygenases which are phase I enzymes responsible for the first pass metabolism of about 90% of drugs in animals. However, these enzymes are often polymorphic and metabolism of the same drug in different species or different individuals is influenced by genetic and non-genetic factors. Bactrian camels are capable of survival in harsh living environments, being able to consume diets that are often toxic to other mammals and can tolerate extreme water and food deprivation. The aim of this study was to investigate whether the Bactrian camel's special metabolic pathways and unique detoxification capabilities are attributable to particularities of the CYP gene family. The Bactrian camel's whole genome sequencing data were systemically analyzed and annotated, and then, CYP gene family was searched from the whole protein database and compared with CYP gene families of cattle, horse, chicken, and human. The total of 63 CYP gene copies were found in Bactrian camel's whole genome and were classified into 17 families and 38 subfamilies. Among them, 9 multi-gene families were found, and CYP2, CYP3, and CPY4 have 27, 6, and 7 subfamilies, accounting for 43, 10, and 11% in camel CYP gene, respectively. In comparison with cattle, chicken, horse, and human, the distribution of CYP gene subfamilies in camel is different, with more CYP2J and CYP3A copies in the Bactrian camel, which may contribute to the Bactrian camel's specific biological characteristics and metabolic pathways. Comparing to the cow, horse, chicken, and human CYP genes, the distribution of CYP gene subfamilies is distinct in the Bactrian camel. The higher copy number of CYP2J gene and CYP3A gene in Bactrian camel may be the important factors contributing to the distinct biological characteristics and metabolic pathways of Bactrian camels for adaptation to the harsh environments.

  8. The CBF gene family in apple (malus x domestica Borkh.)

    USDA-ARS?s Scientific Manuscript database

    Many vascular plants have evolved mechanisms for protecting themselves from freeze damage. One of the key pathways controlling higher plant responses to low temperature involves a family of genes which belong to the AP2 domain class of transcription factors. The promoters of many genes involved in...

  9. Identification and Functional Analysis of Light-Responsive Unique Genes and Gene Family Members in Rice

    PubMed Central

    Jung, Ki-Hong; Lee, Jinwon; Dardick, Chris; Seo, Young-Su; Cao, Peijian; Canlas, Patrick; Phetsom, Jirapa; Xu, Xia; Ouyang, Shu; An, Kyungsook; Cho, Yun-Ja; Lee, Geun-Cheol; Lee, Yoosook; An, Gynheung; Ronald, Pamela C.

    2008-01-01

    Functional redundancy limits detailed analysis of genes in many organisms. Here, we report a method to efficiently overcome this obstacle by combining gene expression data with analysis of gene-indexed mutants. Using a rice NSF45K oligo-microarray to compare 2-week-old light- and dark-grown rice leaf tissue, we identified 365 genes that showed significant 8-fold or greater induction in the light relative to dark conditions. We then screened collections of rice T-DNA insertional mutants to identify rice lines with mutations in the strongly light-induced genes. From this analysis, we identified 74 different lines comprising two independent mutant lines for each of 37 light-induced genes. This list was further refined by mining gene expression data to exclude genes that had potential functional redundancy due to co-expressed family members (12 genes) and genes that had inconsistent light responses across other publicly available microarray datasets (five genes). We next characterized the phenotypes of rice lines carrying mutations in ten of the remaining candidate genes and then carried out co-expression analysis associated with these genes. This analysis effectively provided candidate functions for two genes of previously unknown function and for one gene not directly linked to the tested biochemical pathways. These data demonstrate the efficiency of combining gene family-based expression profiles with analyses of insertional mutants to identify novel genes and their functions, even among members of multi-gene families. PMID:18725934

  10. Complexity, polymorphism, and connectivity of mouse Vk gene families.

    PubMed

    Kofler, R; Duchosal, M A; Dixon, F J

    1989-01-01

    To define the polymorphism and extent of the mouse immunoglobulin kappa (Igk) gene complex, we have analyzed restriction-enzyme digested genomic DNA from 33 inbred strains of mice with labeled DNA probes corresponding to 16 Vk protein groups (1 of them previously undescribed) and the Jk/Ck region (V, variable; J, joining; C, constant). These probes detected between 1 and 25 distinct restriction enzyme fragments (REF) that appeared in up to eight polymorphic patterns, thus defining eight mouse Igk haplotypes. The investigated portion of the Vk repertoire was estimated to encompass between 60 and 120 discernable Vk gene-containing REFs. In contrast to mouse VH gene families, several Vk gene families defined by these probes appeared to overlap. This observation has implications for Vk gene analyses by nucleic acid hybridization and raises the possibility that the Vk gene complex is a continuum of related sequences.

  11. Mutation in δ-Sg Gene in Familial Dilated Cardiomyopathy

    PubMed Central

    Asadi, Marzieh; Foo, Roger; Salehi, Ahmad Reza; Salehi, Rasoul; Samienasab, Mohammad Reza

    2017-01-01

    Background: Mutations in different genes including dystrophin-associated glycoprotein complex caused familial dilated cardiomyopathy which is a genetically heterogeneous disease. The δ-SG gene contains nine exons spanning a 433-kb region of genomic DNA. It encodes a 35-kDa, singlepass, and type II transmembrane glycoprotein. Materials and Methods: In this study for the first time in Iran we screened 6 patients of a large family that they had positive family history of MI or sudden death by next generation sequencing method. Results: By employing NGS method we found missense mutation (p.R97Q) of δ-SG gene in 2 of 6 patients. Conclusions: The missense mutation (p.R97Q) in familial DCM patients is reported for the first time in Iranian patients with cardiac disease. Although this mutation is already known in other populations in Iran, it is not reported before. PMID:28401079

  12. The multifunctional SNM1 gene family: not just nucleases

    PubMed Central

    Yan, Yiyi; Akhter, Shamima; Zhang, Xiaoshan; Legerski, Randy

    2010-01-01

    The archetypical member of the SNM1 gene family was discovered 30 years ago in the budding yeast Saccharomyces cerevisiae. This small but ubiquitous gene family is characterized by metallo-β-lactamase and β-CASP domains, which together have been demonstrated to comprise a nuclease activity. Three mammalian members of this family, SNM1A, SNM1B/Apollo and Artemis, have been demonstrated to play surprisingly divergent roles in cellular metabolism. These pathways include variable (diversity) joining recombination, nonhomologous end-joining of double-strand breaks, DNA damage and mitotic cell cycle checkpoints, telomere maintenance and protein ubiquitination. Not all of these functions are consistent with a model in which these proteins act only as nucleases, and indicate that the SNM1 gene family encodes multifunctional products that can act in diverse biochemical pathways. In this article we discuss the various functions of SNM1A, SNM1B/Apollo and Artemis. PMID:20528238

  13. Characterizations of 9p21 candidate genes in familial melanoma

    SciTech Connect

    Walker, G.J.; Flores, J.F.; Glendening, J.M.

    1994-09-01

    We have previously collected and characterized 16 melanoma families for the inheritance of a familial melanoma predisposition gene on 9p21. Clear evidence for genetic linkage has been detected in 8 of these families with the 9p21 markers D9S126 and 1FNA, while linkage of the remaining families to this region is less certain. A candidate for the 9p21 familial melanoma gene, the cyclin kinase inhibitor gene p16 (also known as the multiple tumor suppressor 1 (MTS1) gene), has been recently indentified. Notably, a nonsense mutation within the p16 gene has been detected in the lymphoblastoid cell line DNA from a dysplastic nevus syndrome (DNS), or familial melanoma, patient. The p16 gene is also known to be frequently deleted or mutated in a variety of tumor cell lines (including melanoma) and resides within a region that has been defined as harboring the 9p21 melanoma predisposition locus. This region is delineated on the distal side by the marker D9S736 (which resides just distal to the p16 gene) and extends in a proximal direction to the marker D9S171. Overall, the entire distance between these two loci is estimated at 3-5Mb. Preliminary analysis of our two largest 9p21-linked melanoma kindreds (by direct sequencing of PCR products) has not yet revealed mutations within the coding region of the p16 gene. Others have reported that 8/11 unrelated 9p21-linked melanoma families do not appear to carry p16 mutations; thus the possibility exists that p16 is not a melanoma susceptibility gene per se, although it appears to play some role in melanoma tumor progression. Our melanoma kindred DNAs are currently being analyzed by SSCP using primers that amplify exons of other candidate genes from the 9p21 region implicated in familial melanoma. These novel genes reside within a distinct critical region of homozygous loss in melanoma which is located >2 Mb from the p16 gene on 9p21.

  14. Identification of a family of muscarinic acetylcholine receptor genes

    SciTech Connect

    Bonner, T.I.; Buckley, N.J.; Young, A.C.; Brann, M.R.

    1987-07-31

    Complementary DNAs for three different muscarinic acetylcholine receptors were isolated from a rat cerebral cortex library, and the cloned receptors were expressed in mammalian cells. Analysis of human and rat genomic clones indicates that there are at least four functional muscarinic receptor genes and that these genes lack introns in the coding sequence. This gene family provides a new basis for evaluating the diversity of muscarinic mechanisms in the nervous system.

  15. Evolution of the Sox gene family within the chordate phylum.

    PubMed

    Heenan, Phoebe; Zondag, Lisa; Wilson, Megan J

    2016-01-10

    The ancient Sox gene family is a group of related transcription factors that perform a number of essential functions during embryonic development. During evolution, this family has undergone considerable expansion, particularly within the vertebrate lineage. In vertebrates SOX proteins are required for the specification, development and/or morphogenesis of most vertebrate innovations. Tunicates and lancelets are evolutionarily positioned as the closest invertebrate relatives to the vertebrate group. By identifying their Sox gene complement we can begin to reconstruct the gene set of the last common chordate ancestor before the split into invertebrates and vertebrate groups. We have identified core SOX family members from the genomes of six invertebrate chordates. Using phylogenetic analysis we determined their evolutionary relationships. We propose that the last common ancestor of chordates had at least seven Sox genes, including the core suite of SoxB, C, D, E and F as well as SoxH.

  16. Gene turnover and differential retention in the relaxin/insulin-like gene family in primates.

    PubMed

    Arroyo, José Ignacio; Hoffmann, Federico G; Opazo, Juan C

    2012-06-01

    The relaxin/insulin-like gene family is related to the insulin gene family, and includes two separate types of peptides: relaxins (RLNs) and insulin-like peptides (INSLs) that perform a variety of physiological roles including testicular descent, growth and differentiation of the mammary glands, trophoblast development, and cell differentiation. In vertebrates, these genes are found on three separate genomic loci, and in mammals, variation in the number and nature of genes in this family is mostly restricted to the Relaxin Family Locus B. For example, this locus contains a single copy of RLN in platypus and opossum, whereas it contains copies of the INSL6, INSL4, RLN2 and RLN1 genes in human and chimp. The main objective of this research is to characterize changes in the size and membership composition of the RLN/INSL gene family in primates, reconstruct the history of the RLN/INSL genes of primates, and test competing evolutionary scenarios regarding the origin of INSL4 and of the duplicated copies of the RLN gene of apes. Our results show that the relaxin/INSL-like gene family of primates has had a more dynamic evolutionary history than previously thought, including several examples of gene duplications and losses which are consistent with the predictions of the birth-and-death model of gene family evolution. In particular, we found that the differential retention of relatively old paralogs played a key role in shaping the gene complement of this family in primates. Two examples of this phenomenon are the origin of the INSL4 gene of catarrhines (the group that includes Old World monkeys and apes), and of the duplicate RLN1 and RLN2 paralogs of apes. In the case of INSL4, comparative genomics and phylogenetic analyses indicate that the origin of this gene, which was thought to represent a catarrhine-specific evolutionary innovation, is as old as the split between carnivores and primates, which took place approximately 97 million years ago. In addition, in the case

  17. A novel olfactory receptor gene family in teleost fish.

    PubMed

    Saraiva, Luis R; Korsching, Sigrun I

    2007-10-01

    While for two of three mammalian olfactory receptor families (OR and V2R) ortholog teleost families have been identified, the third family (V1R) has been thought to be represented by a single, closely linked gene pair. We identified four further V1R-like genes in every teleost species analyzed (Danio rerio, Gasterosteus aculeatus, Oryzias latipes, Tetraodon nigroviridis, Takifugu rubripes). In the phylogenetic analysis these ora genes (olfactory receptor class A-related) form a single clade, which includes the entire mammalian V1R superfamily. Homologies are much lower in paralogs than in orthologs, indicating that all six family members are evolutionarily much older than the speciation events in the teleost lineage analyzed here. These ora genes are under strong negative selection, as evidenced by very small d(N)/d(S) values in comparisons between orthologs. A pairwise configuration in the phylogenetic tree suggests the existence of three ancestral Ora subclades, one of which has been lost in amphibia, and a further one in mammals. Unexpectedly, two ora genes exhibit a highly conserved multi-exonic structure and four ora genes are organized in closely linked gene pairs across all fish species studied. All ora genes are expressed specifically in the olfactory epithelium of zebrafish, in sparse cells within the sensory surface, consistent with the expectation for olfactory receptors. The ora gene repertoire is highly conserved across teleosts, in striking contrast to the frequent species-specific expansions observed in tetrapod, especially mammalian V1Rs, possibly reflecting a major shift in gene regulation as well as gene function upon the transition to tetrapods.

  18. The ubiquilin gene family: evolutionary patterns and functional insights

    PubMed Central

    2014-01-01

    Background Ubiquilins are proteins that function as ubiquitin receptors in eukaryotes. Mutations in two ubiquilin-encoding genes have been linked to the genesis of neurodegenerative diseases. However, ubiquilin functions are still poorly understood. Results In this study, evolutionary and functional data are combined to determine the origin and diversification of the ubiquilin gene family and to characterize novel potential roles of ubiquilins in mammalian species, including humans. The analysis of more than six hundred sequences allowed characterizing ubiquilin diversity in all the main eukaryotic groups. Many organisms (e. g. fungi, many animals) have single ubiquilin genes, but duplications in animal, plant, alveolate and excavate species are described. Seven different ubiquilins have been detected in vertebrates. Two of them, here called UBQLN5 and UBQLN6, had not been hitherto described. Significantly, marsupial and eutherian mammals have the most complex ubiquilin gene families, composed of up to 6 genes. This exceptional mammalian-specific expansion is the result of the recent emergence of four new genes, three of them (UBQLN3, UBQLN5 and UBQLNL) with precise testis-specific expression patterns that indicate roles in the postmeiotic stages of spermatogenesis. A gene with related features has independently arisen in species of the Drosophila genus. Positive selection acting on some mammalian ubiquilins has been detected. Conclusions The ubiquilin gene family is highly conserved in eukaryotes. The infrequent lineage-specific amplifications observed may be linked to the emergence of novel functions in particular tissues. PMID:24674348

  19. Evolution of the YABBY gene family in seed plants.

    PubMed

    Finet, Cédric; Floyd, Sandra K; Conway, Stephanie J; Zhong, Bojian; Scutt, Charles P; Bowman, John L

    2016-01-01

    Members of the YABBY gene family of transcription factors in angiosperms have been shown to be involved in the initiation of outgrowth of the lamina, the maintenance of polarity, and establishment of the leaf margin. Although most of the dorsal-ventral polarity genes in seed plants have homologs in non-spermatophyte lineages, the presence of YABBY genes is restricted to seed plants. To gain insight into the origin and diversification of this gene family, we reconstructed the evolutionary history of YABBY gene lineages in seed plants. Our findings suggest that either one or two YABBY genes were present in the last common ancestor of extant seed plants. We also examined the expression of YABBY genes in the gymnosperms Ephedra distachya (Gnetales), Ginkgo biloba (Ginkgoales), and Pseudotsuga menziesii (Coniferales). Our data indicate that some YABBY genes are expressed in a polar (abaxial) manner in leaves and female cones in gymnosperms. We propose that YABBY genes already acted as polarity genes in the last common ancestor of extant seed plants.

  20. BranchClust: a phylogenetic algorithm for selecting gene families

    PubMed Central

    Poptsova, Maria S; Gogarten, J Peter

    2007-01-01

    Background Automated methods for assembling families of orthologous genes include those based on sequence similarity scores and those based on phylogenetic approaches. The first are easy to automate but usually they do not distinguish between paralogs and orthologs or have restriction on the number of taxa. Phylogenetic methods often are based on reconciliation of a gene tree with a known rooted species tree; a limitation of this approach, especially in case of prokaryotes, is that the species tree is often unknown, and that from the analyses of single gene families the branching order between related organisms frequently is unresolved. Results Here we describe an algorithm for the automated selection of orthologous genes that recognizes orthologous genes from different species in a phylogenetic tree for any number of taxa. The algorithm is capable of distinguishing complete (containing all taxa) and incomplete (not containing all taxa) families and recognizes in- and outparalogs. The BranchClust algorithm is implemented in Perl with the use of the BioPerl module for parsing trees and is freely available at . Conclusion BranchClust outperforms the Reciprocal Best Blast hit method in selecting more sets of putatively orthologous genes. In the test cases examined, the correctness of the selected families and of the identified in- and outparalogs was confirmed by inspection of the pertinent phylogenetic trees. PMID:17425803

  1. Identification and characterization of TIFY family genes in Brachypodium distachyon.

    PubMed

    Zhang, Lihua; You, Jun; Chan, Zhulong

    2015-11-01

    The TIFY family is a plant-specific gene family encoding proteins characterized by a conserved TIFY domain. This family encodes four subfamilies of proteins, including ZIM-like (ZML), TIFY, PPD and JASMONATE ZIM-Domain (JAZ) proteins. TIFY proteins play important roles in plant development and stress responses. In this study, 21 BdTIFYs were identified in Brachypodium distachyon through genome-wide analysis, including 15 JAZ and 6 ZML genes. Analysis of the distribution of conserved domains showed that there are three additional domains (CCT domain, GATA domain and Jas domain) in the BdTIFY proteins besides the TIFY domain. Phylogenetic analysis indicated that these 21 proteins were classified into two major groups. Expression profile of BdTIFY genes in response to abiotic stresses and phytohormones was analyzed using quantitative real-time RT-PCR. Among 21 BdTIFY genes, 12 of them were induced by JA treatment, and 4 of them were induced by ABA treatment. Most of BdTIFY genes were responsive to one or more abiotic stresses including drought, salinity, low temperature and heat. Especially, BdTIFY5, 9a, 9b, 10c and 11a were significantly up-regulated by multiple abiotic stresses. These results provided important clues for functional analysis of TIFY family genes in B. distachyon.

  2. Molecular Evolution of the Glycosyltransferase 6 Gene Family in Primates

    PubMed Central

    Mendonça-Mattos, Patricia Jeanne de Souza; Harada, Maria Lúcia

    2016-01-01

    Glycosyltransferase 6 gene family includes ABO, Ggta1, iGb3S, and GBGT1 genes and by three putative genes restricted to mammals, GT6m6, GTm6, and GT6m7, only the latter is found in primates. GT6 genes may encode functional and nonfunctional proteins. Ggta1 and GBGT1 genes, for instance, are pseudogenes in catarrhine primates, while iGb3S gene is only inactive in human, bonobo, and chimpanzee. Even inactivated, these genes tend to be conversed in primates. As some of the GT6 genes are related to the susceptibility or resistance to parasites, we investigated (i) the selective pressure on the GT6 paralogs genes in primates; (ii) the basis of the conservation of iGb3S in human, chimpanzee, and bonobo; and (iii) the functional potential of the GBGT1 and GT6m7 in catarrhines. We observed that the purifying selection is prevalent and these genes have a low diversity, though ABO and Ggta1 genes have some sites under positive selection. GT6m7, a putative gene associated with aggressive periodontitis, may have regulatory function, but experimental studies are needed to assess its function. The evolutionary conservation of iGb3S in humans, chimpanzee, and bonobo seems to be the result of proximity to genes with important biological functions. PMID:28044107

  3. Exploiting Gene Families for Phylogenomic Analysis of Myzostomid Transcriptome Data

    PubMed Central

    Hartmann, Stefanie; Helm, Conrad; Nickel, Birgit; Meyer, Matthias; Struck, Torsten H.; Tiedemann, Ralph; Selbig, Joachim; Bleidorn, Christoph

    2012-01-01

    Background In trying to understand the evolutionary relationships of organisms, the current flood of sequence data offers great opportunities, but also reveals new challenges with regard to data quality, the selection of data for subsequent analysis, and the automation of steps that were once done manually for single-gene analyses. Even though genome or transcriptome data is available for representatives of most bilaterian phyla, some enigmatic taxa still have an uncertain position in the animal tree of life. This is especially true for myzostomids, a group of symbiotic (or parasitic) protostomes that are either placed with annelids or flatworms. Methodology Based on similarity criteria, Illumina-based transcriptome sequences of one myzostomid were compared to protein sequences of one additional myzostomid and 29 reference metazoa and clustered into gene families. These families were then used to investigate the phylogenetic position of Myzostomida using different approaches: Alignments of 989 sequence families were concatenated, and the resulting superalignment was analyzed under a Maximum Likelihood criterion. We also used all 1,878 gene trees with at least one myzostomid sequence for a supertree approach: the individual gene trees were computed and then reconciled into a species tree using gene tree parsimony. Conclusions Superalignments require strictly orthologous genes, and both the gene selection and the widely varying amount of data available for different taxa in our dataset may cause anomalous placements and low bootstrap support. In contrast, gene tree parsimony is designed to accommodate multilocus gene families and therefore allows a much more comprehensive data set to be analyzed. Results of this supertree approach showed a well-resolved phylogeny, in which myzostomids were part of the annelid radiation, and major bilaterian taxa were found to be monophyletic. PMID:22276131

  4. Molecular evolution of PKD2 gene family in mammals.

    PubMed

    Ye, Chun; Sun, Huan; Guo, Wenhu; Wei, Yuquan; Zhou, Qin

    2009-09-01

    PKD2 gene encodes a critical cation channel protein that plays important roles in various developmental processes and is usually evolutionarily conserved. In the present study, we analyzed the evolutionary patterns of PKD2 and its homologous genes (PKD2L1, PKD2L2) from nine mammalian species. In this study, we demonstrated the orthologs of PKD2 gene family evolved under a dominant purifying selection force. Our results in combination with the reported evidences from functional researches suggested the entire PKD2 gene family are conserved and perform essential biological roles during mammalian evolution. In rodents, PKD2 gene family members appeared to have evolved more rapidly than other mammalian lineages, probably resulting from relaxation of purifying selection. However, positive selection imposed on synonymous sites also potentially contributed to this case. For the paralogs, our results implied that PKD2L2 genes evolved under a weaker purifying selection constraint than PKD2 and PKD2L1 genes. Interestingly, some loop regions of transmembrane domain of PKD2L2 exhibited higher P (N)/P (S) ratios than expected, suggesting these regions are more functional divergent in organisms and worthy of special attention.

  5. Evolution of an expanded mannose receptor gene family.

    PubMed

    Staines, Karen; Hunt, Lawrence G; Young, John R; Butter, Colin

    2014-01-01

    Sequences of peptides from a protein specifically immunoprecipitated by an antibody, KUL01, that recognises chicken macrophages, identified a homologue of the mammalian mannose receptor, MRC1, which we called MRC1L-B. Inspection of the genomic environment of the chicken gene revealed an array of five paralogous genes, MRC1L-A to MRC1L-E, located between conserved flanking genes found either side of the single MRC1 gene in mammals. Transcripts of all five genes were detected in RNA from a macrophage cell line and other RNAs, whose sequences allowed the precise definition of spliced exons, confirming or correcting existing bioinformatic annotation. The confirmed gene structures were used to locate orthologues of all five genes in the genomes of two other avian species and of the painted turtle, all with intact coding sequences. The lizard genome had only three genes, one orthologue of MRC1L-A and two orthologues of the MRC1L-B antigen gene resulting from a recent duplication. The Xenopus genome, like that of most mammals, had only a single MRC1-like gene at the corresponding locus. MRC1L-A and MRC1L-B genes had similar cytoplasmic regions that may be indicative of similar subcellular migration and functions. Cytoplasmic regions of the other three genes were very divergent, possibly indicating the evolution of a new functional repertoire for this family of molecules, which might include novel interactions with pathogens.

  6. Expansion of transducin subunit gene families in early vertebrate tetraploidizations.

    PubMed

    Lagman, David; Sundström, Görel; Ocampo Daza, Daniel; Abalo, Xesús M; Larhammar, Dan

    2012-10-01

    Hundreds of gene families expanded in the early vertebrate tetraploidizations including many gene families in the phototransduction cascade. We have investigated the evolution of the heterotrimeric G-proteins of photoreceptors, the transducins, in relation to these events using both phylogenetic analyses and synteny comparisons. Three alpha subunit genes were identified in amniotes and the coelacanth, GNAT1-3; two of these were identified in amphibians and teleost fish, GNAT1 and GNAT2. Most tetrapods have four beta genes, GNB1-4, and teleosts have additional duplicates. Finally, three gamma genes were identified in mammals, GNGT1, GNG11 and GNGT2. Of these, GNGT1 and GNGT2 were found in the other vertebrates. In frog and zebrafish additional duplicates of GNGT2 were identified. Our analyses show all three transducin families expanded during the early vertebrate tetraploidizations and the beta and gamma families gained additional copies in the teleost-specific genome duplication. This suggests that the tetraploidizations contributed to visual specialisations.

  7. Runx Family Genes in Tissue Stem Cell Dynamics.

    PubMed

    Wang, Chelsia Qiuxia; Mok, Michelle Meng Huang; Yokomizo, Tomomasa; Tergaonkar, Vinay; Osato, Motomi

    2017-01-01

    The Runx family genes play important roles in development and cancer, largely via their regulation of tissue stem cell behavior. Their involvement in two organs, blood and skin, is well documented. This review summarizes currently known Runx functions in the stem cells of these tissues. The fundamental core mechanism(s) mediated by Runx proteins has been sought; however, it appears that there does not exist one single common machinery that governs both tissue stem cells. Instead, Runx family genes employ multiple spatiotemporal mechanisms in regulating individual tissue stem cell populations. Such specific Runx requirements have been unveiled by a series of cell type-, developmental stage- or age-specific gene targeting studies in mice. Observations from these experiments revealed that the regulation of stem cells by Runx family genes turned out to be far more complex than previously thought. For instance, although it has been reported that Runx1 is required for the endothelial-to-hematopoietic cell transition (EHT) but not thereafter, recent studies clearly demonstrated that Runx1 is also needed during the period subsequent to EHT, namely at perinatal stage. In addition, Runx1 ablation in the embryonic skin mesenchyme eventually leads to complete loss of hair follicle stem cells (HFSCs) in the adult epithelium, suggesting that Runx1 facilitates the specification of skin epithelial stem cells in a cell extrinsic manner. Further in-depth investigation into how Runx family genes are involved in stem cell regulation is warranted.

  8. An evolutionary screen highlights canonical and noncanonical candidate antiviral genes within the primate TRIM gene family.

    PubMed

    Malfavon-Borja, Ray; Sawyer, Sara L; Wu, Lily I; Emerman, Michael; Malik, Harmit S

    2013-01-01

    Recurrent viral pressure has acted on host-encoded antiviral genes during primate and mammalian evolution. This selective pressure has resulted in dramatic episodes of adaptation in host antiviral genes, often detected via positive selection. These evolutionary signatures of adaptation have the potential to highlight previously unrecognized antiviral genes (also called restriction factors). Although the TRIM multigene family is recognized for encoding several bona fide restriction factors (e.g., TRIM5alpha), most members of this expansive gene family remain uncharacterized. Here, we investigated the TRIM multigene family for signatures of positive selection to identify novel candidate antiviral genes. Our analysis reveals previously undocumented signatures of positive selection in 17 TRIM genes, 10 of which represent novel candidate restriction factors. These include the unusual TRIM52 gene, which has evolved under strong positive selection despite its encoded protein lacking a putative viral recognition (B30.2) domain. We show that TRIM52 arose via gene duplication from the TRIM41 gene. Both TRIM52 and TRIM41 have dramatically expanded RING domains compared with the rest of the TRIM multigene family, yet this domain has evolved under positive selection only in primate TRIM52, suggesting that it represents a novel host-virus interaction interface. Our evolutionary-based screen not only documents positive selection in known TRIM restriction factors but also highlights candidate novel restriction factors, providing insight into the interfaces of host-pathogen interactions mediated by the TRIM multigene family.

  9. Human heavy-chain variable region gene family nonrandomly rearranged in familial chronic lymphocytic leukemia

    SciTech Connect

    Shen, A.; Humphries, C.; Tucker, P.; Blattner, F.

    1987-12-01

    The authors have identified a family of human immunoglobulin heavy-chain variable-region (V/sub H/) genes, one member of which is rearranged in two affected members of a family in which the father and four of five siblings developed chronic lymphocytic leukemia. Cloning and sequencing of the rearranged V/sub H/ genes from leukemic lymphocytes of three affected siblings showed that two siblings had rearranged V/sub H/ genes (V/sub H/TS1 and V/sub H/WS1) that were 90% homologous. The corresponding germ-line gene, V/sub H/251, was found to part of a small (four gene) V/sub H/ gene family, which they term V/sub H/V. The DNA sequence homology to V/sub H/WS1 (95%) and V/sub H/TS1 (88%) and identical restriction sites on the 5' side of V/sub H/ confirm that rearrangement of V/sub H/251 followed by somatic mutation produced the identical V/sub H/ gene rearrangements in the two siblings. V/sub H/TS1 is not a functional V/sub H/ gene; a functional V/sub H/ rearrangement was found on the other chromosome of this patient. The other two siblings had different V/sub H/ gene rearrangements. All used different diversity genes. Mechanisms proposed for nonrandom selection of a single V/sub H/ gene include developmental regulation of this V/sub H/ gene rearrangement or selection of a subpopulation of B cells in which this V/sub H/ has been rearranged.

  10. Expression of Sox family genes in early lamprey development

    PubMed Central

    UY, BENJAMIN R.; SIMOES-COSTA, MARCOS; SAUKA-SPENGLER, TATJANA; BRONNER, MARIANNE E.

    2014-01-01

    Members of the Sox (Sry-related high mobility group box) family of transcription factors play a variety of roles during development of both vertebrates and invertebrates. A marked expansion in gene number occurred during emergence of vertebrates, apparently via gene duplication events that are thought to have facilitated new functions. By screening a macroarrayed library as well as the lamprey genome, we have isolated genes of the Sox B, D, E and F subfamilies in the basal jawless vertebrate, lamprey. The expression patterns of all identified Sox genes were examined from gastrulation through early organogenesis (embryonic day 4–14), with particular emphasis on the neural crest, a vertebrate innovation. Coupled with phylogenetic analysis of these Sox genes, the results provide insight into gene duplication and divergence in paralog deployment occurring during early vertebrate evolution. PMID:22811271

  11. The d4 gene family in the human genome

    SciTech Connect

    Chestkov, A.V.; Baka, I.D.; Kost, M.V.

    1996-08-15

    The d4 domain, a novel zinc finger-like structural motif, was first revealed in the rat neuro-d4 protein. Here we demonstrate that the d4 domain is conserved in evolution and that three related genes form a d4 family in the human genome. The human neuro-d4 is very similar to rat neuro-d4 at both the amino acid and the nucleotide levels. Moreover, the same splice variants have been detected among rat and human neuro-d4 transcripts. This gene has been localized on chromosome 19, and two other genes, members of the d4 family isolated by screening of the human genomic library at low stringency, have been mapped to chromosomes 11 and 14. The gene on chromosome 11 is the homolog of the ubiquitously expressed mouse gene ubi-d4/requiem, which is required for cell death after deprivation of trophic factors. A gene with a conserved d4 domain has been found in the genome of the nematode Caenorhabditis elegans. The conservation of d4 proteins from nematodes to vertebrates suggests that they have a general importance, but a diversity of d4 proteins expressed in vertebrate nervous systems suggests that some family members have special functions. 11 refs., 2 figs.

  12. Sucrose metabolism gene families and their biological functions.

    PubMed

    Jiang, Shu-Ye; Chi, Yun-Hua; Wang, Ji-Zhou; Zhou, Jun-Xia; Cheng, Yan-Song; Zhang, Bao-Lan; Ma, Ali; Vanitha, Jeevanandam; Ramachandran, Srinivasan

    2015-11-30

    Sucrose, as the main product of photosynthesis, plays crucial roles in plant development. Although studies on general metabolism pathway were well documented, less information is available on the genome-wide identification of these genes, their expansion and evolutionary history as well as their biological functions. We focused on four sucrose metabolism related gene families including sucrose synthase, sucrose phosphate synthase, sucrose phosphate phosphatase and UDP-glucose pyrophosphorylase. These gene families exhibited different expansion and evolutionary history as their host genomes experienced differentiated rates of the whole genome duplication, tandem and segmental duplication, or mobile element mediated gene gain and loss. They were evolutionarily conserved under purifying selection among species and expression divergence played important roles for gene survival after expansion. However, we have detected recent positive selection during intra-species divergence. Overexpression of 15 sorghum genes in Arabidopsis revealed their roles in biomass accumulation, flowering time control, seed germination and response to high salinity and sugar stresses. Our studies uncovered the molecular mechanisms of gene expansion and evolution and also provided new insight into the role of positive selection in intra-species divergence. Overexpression data revealed novel biological functions of these genes in flowering time control and seed germination under normal and stress conditions.

  13. Sucrose metabolism gene families and their biological functions

    PubMed Central

    Jiang, Shu-Ye; Chi, Yun-Hua; Wang, Ji-Zhou; Zhou, Jun-Xia; Cheng, Yan-Song; Zhang, Bao-Lan; Ma, Ali; Vanitha, Jeevanandam; Ramachandran, Srinivasan

    2015-01-01

    Sucrose, as the main product of photosynthesis, plays crucial roles in plant development. Although studies on general metabolism pathway were well documented, less information is available on the genome-wide identification of these genes, their expansion and evolutionary history as well as their biological functions. We focused on four sucrose metabolism related gene families including sucrose synthase, sucrose phosphate synthase, sucrose phosphate phosphatase and UDP-glucose pyrophosphorylase. These gene families exhibited different expansion and evolutionary history as their host genomes experienced differentiated rates of the whole genome duplication, tandem and segmental duplication, or mobile element mediated gene gain and loss. They were evolutionarily conserved under purifying selection among species and expression divergence played important roles for gene survival after expansion. However, we have detected recent positive selection during intra-species divergence. Overexpression of 15 sorghum genes in Arabidopsis revealed their roles in biomass accumulation, flowering time control, seed germination and response to high salinity and sugar stresses. Our studies uncovered the molecular mechanisms of gene expansion and evolution and also provided new insight into the role of positive selection in intra-species divergence. Overexpression data revealed novel biological functions of these genes in flowering time control and seed germination under normal and stress conditions. PMID:26616172

  14. Analysis of the Prefoldin Gene Family in 14 Plant Species

    PubMed Central

    Cao, Jun

    2016-01-01

    Prefoldin is a hexameric molecular chaperone complex present in all eukaryotes and archaea. The evolution of this gene family in plants is unknown. Here, I identified 140 prefoldin genes in 14 plant species. These prefoldin proteins were divided into nine groups through phylogenetic analysis. Highly conserved gene organization and motif distribution exist in each prefoldin group, implying their functional conservation. I also observed the segmental duplication of maize prefoldin gene family. Moreover, a few functional divergence sites were identified within each group pairs. Functional network analyses identified 78 co-expressed genes, and most of them were involved in carrying, binding and kinase activity. Divergent expression profiles of the maize prefoldin genes were further investigated in different tissues and development periods and under auxin and some abiotic stresses. I also found a few cis-elements responding to abiotic stress and phytohormone in the upstream sequences of the maize prefoldin genes. The results provided a foundation for exploring the characterization of the prefoldin genes in plants and will offer insights for additional functional studies. PMID:27014333

  15. New Genes Originated via Multiple Recombinational Pathways in the β-Globin Gene Family of Rodents

    PubMed Central

    Hoffmann, Federico G.; Opazo, Juan C.; Storz, Jay F.

    2008-01-01

    Species differences in the size or membership composition of multigene families can be attributed to lineage-specific additions of new genes via duplication, losses of genes via deletion or inactivation, and the creation of chimeric genes via domain shuffling or gene fusion. In principle, it should be possible to infer the recombinational pathways responsible for each of these different types of genomic change by conducting detailed comparative analyses of genomic sequence data. Here, we report an attempt to unravel the complex evolutionary history of the β-globin gene family in a taxonomically diverse set of rodent species. The main objectives were: 1) to characterize the genomic structure of the β-globin gene cluster of rodents; 2) to assign orthologous and paralogous relationships among duplicate copies of β-like globin genes; and 3) to infer the specific recombinational pathways responsible for gene duplications, gene deletions, and the creation of chimeric fusion genes. Results of our comparative genomic analyses revealed that variation in gene family size among rodent species is mainly attributable to the differential gain and loss of later expressed β-globin genes via unequal crossing-over. However, two distinct recombinational mechanisms were implicated in the creation of chimeric fusion genes. In muroid rodents, a chimeric γ/ε fusion gene was created by unequal crossing-over between the embryonic ε- and γ-globin genes. Interestingly, this γ/ε fusion gene was generated in the same fashion as the “anti-Lepore” 5′-δ-(β/δ)-β-3′ duplication mutant in humans (the reciprocal exchange product of the pathological hemoglobin Lepore deletion mutant). By contrast, in the house mouse, Mus musculus, a chimeric β/δ fusion pseudogene was created by a β-globin → δ-globin gene conversion event. Although the γ/ε and β/δ fusion genes share a similar chimeric gene structure, they originated via completely different recombinational pathways. PMID

  16. Genome-wide analysis of homeobox gene family in legumes: identification, gene duplication and expression profiling.

    PubMed

    Bhattacharjee, Annapurna; Ghangal, Rajesh; Garg, Rohini; Jain, Mukesh

    2015-01-01

    Homeobox genes encode transcription factors that are known to play a major role in different aspects of plant growth and development. In the present study, we identified homeobox genes belonging to 14 different classes in five legume species, including chickpea, soybean, Medicago, Lotus and pigeonpea. The characteristic differences within homeodomain sequences among various classes of homeobox gene family were quite evident. Genome-wide expression analysis using publicly available datasets (RNA-seq and microarray) indicated that homeobox genes are differentially expressed in various tissues/developmental stages and under stress conditions in different legumes. We validated the differential expression of selected chickpea homeobox genes via quantitative reverse transcription polymerase chain reaction. Genome duplication analysis in soybean indicated that segmental duplication has significantly contributed in the expansion of homeobox gene family. The Ka/Ks ratio of duplicated homeobox genes in soybean showed that several members of this family have undergone purifying selection. Moreover, expression profiling indicated that duplicated genes might have been retained due to sub-functionalization. The genome-wide identification and comprehensive gene expression profiling of homeobox gene family members in legumes will provide opportunities for functional analysis to unravel their exact role in plant growth and development.

  17. Genome-Wide Analysis of Homeobox Gene Family in Legumes: Identification, Gene Duplication and Expression Profiling

    PubMed Central

    Garg, Rohini; Jain, Mukesh

    2015-01-01

    Homeobox genes encode transcription factors that are known to play a major role in different aspects of plant growth and development. In the present study, we identified homeobox genes belonging to 14 different classes in five legume species, including chickpea, soybean, Medicago, Lotus and pigeonpea. The characteristic differences within homeodomain sequences among various classes of homeobox gene family were quite evident. Genome-wide expression analysis using publicly available datasets (RNA-seq and microarray) indicated that homeobox genes are differentially expressed in various tissues/developmental stages and under stress conditions in different legumes. We validated the differential expression of selected chickpea homeobox genes via quantitative reverse transcription polymerase chain reaction. Genome duplication analysis in soybean indicated that segmental duplication has significantly contributed in the expansion of homeobox gene family. The Ka/Ks ratio of duplicated homeobox genes in soybean showed that several members of this family have undergone purifying selection. Moreover, expression profiling indicated that duplicated genes might have been retained due to sub-functionalization. The genome-wide identification and comprehensive gene expression profiling of homeobox gene family members in legumes will provide opportunities for functional analysis to unravel their exact role in plant growth and development. PMID:25745864

  18. Evolutionary Dynamics of the wnt Gene Family: A Lophotrochozoan Perspective

    PubMed Central

    Cho, Sung-Jin; Vallès, Yvonne; Giani, Vincent C.; Seaver, Elaine C.; Weisblat, David A.

    2010-01-01

    The wnt gene family encodes a set of secreted glycoproteins involved in key developmental processes, including cell fate specification and regulation of posterior growth (Cadigan KM, Nusse R. 1997. Wnt signaling: a common theme in animal development. Genes Dev. 11:3286–3305.; Martin BL, Kimelman D. 2009. Wnt signaling and the evolution of embryonic posterior development. Curr Biol. 19:R215–R219.). As for many other gene families, evidence for expansion and/or contraction of the wnt family is available from deuterostomes (e.g., echinoderms and vertebrates [Nusse R, Varmus HE. 1992. Wnt genes. Cell. 69:1073–1087.; Schubert M, Holland LZ, Holland ND, Jacobs DK. 2000. A phylogenetic tree of the Wnt genes based on all available full-length sequences, including five from the cephalochordate amphioxus. Mol Biol Evol. 17:1896–1903.; Croce JC, Wu SY, Byrum C, Xu R, Duloquin L, Wikramanayake AH, Gache C, McClay DR. 2006. A genome-wide survey of the evolutionarily conserved Wnt pathways in the sea urchin Strongylocentrotus purpuratus. Dev Biol. 300:121–131.]) and ecdysozoans (e.g., arthropods and nematodes [Eisenmann DM. 2005. Wnt signaling. WormBook. 1–17.; Bolognesi R, Farzana L, Fischer TD, Brown SJ. 2008. Multiple Wnt genes are required for segmentation in the short-germ embryo of Tribolium castaneum. Curr Biol. 18:1624–1629.]), but little is known from the third major bilaterian group, the lophotrochozoans (e.g., mollusks and annelids [Prud'homme B, Lartillot N, Balavoine G, Adoutte A, Vervoort M. 2002. Phylogenetic analysis of the Wnt gene family. Insights from lophotrochozoan members. Curr Biol. 12:1395.]). To obtain a more comprehensive scenario of the evolutionary dynamics of this gene family, we exhaustively mined wnt gene sequences from the whole genome assemblies of a mollusk (Lottia gigantea) and two annelids (Capitella teleta and Helobdella robusta) and examined them by phylogenetic, genetic linkage, intron–exon structure, and embryonic

  19. [Progress of researches on gene function of GSDMDC family].

    PubMed

    Sun, Qiao; Zhang, Ling-Qiang; He, Fu-Cu

    2006-05-01

    The GSDMDC family,a novel protein superfamily, includes five members (DFNA5, DFNA5L, GSDM, GSDML and MLZE), all of them containing a Gasdermin domain. Many studies indicated that the GSDMDC family had many important physiological functions in development, tumorigenesis and genetic disease with deafness and hair loss phenotype. Many studies have focused on the DFNA5 gene because it is one of the disease genes of autosomal dominant non-syndromic hearingimpairment and it is also associated with melanoma and breast cancer. But it is still unclear of the molecular mechanism of DFNA5 in the genetic disease and tumorigenesis. And there are also few studies on the spatial structure , interacting proteins and physiological functions of the GSDMDC domain. So there are a lot of works to do for shedding light on the physiological functions and the relevance on genetic disease of the other members of the GSDMDC family.

  20. The SLC45 gene family of putative sugar transporters.

    PubMed

    Vitavska, Olga; Wieczorek, Helmut

    2013-01-01

    According to the classic point of view, transport of sugars across animal plasma membranes is performed by two families of transporters. Secondary active transport occurs via Na(+) symporters of the SLC5 gene family, while passive transport occurs via facilitative transporters of the SLC2 family. In recent years a new family appeared in the scenery which was called the SLC45 gene family of putative sugar transporters, mainly because of obvious similarities to plant sucrose transporters. The SLC45 family consists of only four members that have been denominated A1-A4. These members apparently have counterparts in all vertebrates. Moreover, their amino acid sequences reveal close homologies also to respective invertebrate proteins such as a recently detected sucrose transporter in Drosophila, and suggest a phylogenetic relationship also to corresponding proteins from plants, fungi and bacteria. This minireview describes the molecular features of its members with a focus on their possible role as sugar transporters. Copyright © 2012 Elsevier Ltd. All rights reserved.

  1. Differential Gene Expression in the Laccase Gene Family from Basidiomycete I-62 (CECT 20197)

    PubMed Central

    Mansur, Mariana; Suárez, Teresa; González, Aldo E.

    1998-01-01

    A family of genes encoding laccases has recently been described for the basidiomycete I-62 (CECT 20197). Transcript levels of genes lcc1, lcc2, and lcc3 were analyzed under four different culture conditions to study their expression patterns. Two of the laccase genes were clearly inducible by veratryl alcohol: the lcc1 gene is inducible in early stages of growth, and the lcc2 gene is also inducible but only when the organism reaches the stationary phase. Transcript levels for the third gene, lcc3, were uninduced by veratryl alcohol and repressed by glucose. PMID:16349507

  2. The FT/TFL1 gene family in grapevine.

    PubMed

    Carmona, María José; Calonje, Myriam; Martínez-Zapater, José Miguel

    2007-03-01

    The FT/TFL1 gene family encodes proteins with similarity to phosphatidylethanolamine binding proteins which function as flowering promoters and repressors. We show here that the FT/TFL1 gene family in Vitis vinifera is composed of at least five genes. Sequence comparisons with homologous genes identified in other dicot species group them in three major clades, the FT, MFT and TFL1 subfamilies, the latter including three of the Vitis sequences. Gene expression patterns are in agreement with a role of VvFT and VvMFT as flowering promoters; while VvTFL1A, VvTFL1B and VvTFL1C could be associated with vegetative development and maintenance of meristem indetermination. Overexpression of VvFT in transgenic Arabidopsis plants generates early flowering phenotypes similar to those produced by FT supporting a role for this gene in flowering promotion. Overexpression of VvTFL1A does not affect flowering time but the determination of flower meristems, strongly altering inflorescence structure, which is consistent with the biological roles assigned to similar genes in other species.

  3. Origin and evolution of laminin gene family diversity.

    PubMed

    Fahey, Bryony; Degnan, Bernard M

    2012-07-01

    Laminins are a family of multidomain glycoproteins that are important contributors to the structure of metazoan extracellular matrices. To investigate the origin and evolution of the laminin family, we characterized the full complement of laminin-related genes in the genome of the sponge, Amphimedon queenslandica. As a representative of the Demospongiae, a group consistently placed within the earliest diverging branch of animals by molecular phylogenies, Amphimedon is uniquely placed to provide insight into early steps in the evolution of metazoan gene families. Five Amphimedon laminin-related genes possess the conserved molecular features, and most of the domains found in bilaterian laminins, but all display domain architectures distinct from those of the canonical laminin chain types known from model bilaterians. This finding prompted us to perform a comparative genomic analysis of laminins and related genes from a choanoflagellate and diverse metazoans and to conduct phylogenetic analyses using the conserved Laminin N-terminal domain in order to explore the relationships between genes with distinct architectures. Laminin-like genes appear to have originated in the holozoan lineage (choanoflagellates + metazoans + several other unicellular opisthokont taxa), with several laminin domains originating later and appearing only in metazoan (animal) or eumetazoan (placozoans + ctenophores + cnidarians + bilaterians) laminins. Typical bilaterian α, β, and γ laminin chain forms arose in the eumetazoan stem and another chain type that is conserved in Amphimedon, the cnidarian, Nematostella vectensis, and the echinoderm, Strongylocentrotus purpuratus, appears to have been lost independently from the placozoan, Trichoplax adhaerens, and from multiple bilaterians. Phylogenetic analysis did not clearly reconstruct relationships between the distinct laminin chain types (with the exception of the α chains) but did reveal how several members of the netrin family were

  4. Predictions of Gene Family Distributions in Microbial Genomes: Evolution by Gene Duplication and Modification

    SciTech Connect

    Yanai, Itai; Camacho, Carlos J.; DeLisi, Charles

    2000-09-18

    A universal property of microbial genomes is the considerable fraction of genes that are homologous to other genes within the same genome. The process by which these homologues are generated is not well understood, but sequence analysis of 20 microbial genomes unveils a recurrent distribution of gene family sizes. We show that a simple evolutionary model based on random gene duplication and point mutations fully accounts for these distributions and permits predictions for the number of gene families in genomes not yet complete. Our findings are consistent with the notion that a genome evolves from a set of precursor genes to a mature size by gene duplications and increasing modifications. (c) 2000 The American Physical Society.

  5. CHD7 Gene Polymorphisms and Familial Idiopathic Scoliosis

    PubMed Central

    Tilley, Mera K.; Justice, Cristina M.; Swindle, Kandice; Marosy, Beth; Wilson, Alexander F.; Miller, Nancy H.

    2013-01-01

    Study Design Model-independent linkage analysis and tests of association were performed for 22 single nucleotide polymorphisms (SNPs) in the CHD7 gene in 244 families of European descent with familial idiopathic scoliosis (FIS). Objective To replicate an association between FIS and the CHD7 gene on 8q12.2 in an independent sample of families of European descent. Summary of Background Data The CHD7 gene on chromosome 8, responsible for the CHARGE syndrome, was previously associated with FIS in an independent study that included 52 families of European descent. Methods Model-independent linkage analysis and intra-familial tests of association were performed on the degree of lateral curvature considered as a qualitative trait (with thresholds of ≥10°, ≥15°, ≥20° and ≥30°) and as a quantitative trait (degree of lateral curvature). Results from the tests of associations from this study and the previous study were combined in a weighted meta-analysis. Results No significant results (P< 0.01) were found for linkage analysis or tests of association between genetic variants of the CHD7 and FIS in this study sample, failing to replicate the findings from the previous study. Furthermore, no significant results (P< 0.01) were found from meta-analysis of the results from the tests of association from this sample and from the previous sample. Conclusion No association between the 22 genotyped SNPs in the CHD7 gene and FIS within this study sample was found, failing to replicate the earlier findings. Further investigation of the CHD7 gene and its potential association to FIS may be required. PMID:23883829

  6. A Combinatorial Approach to Detecting Gene-Gene and Gene-Environment Interactions in Family Studies

    PubMed Central

    Lou, Xiang-Yang; Chen, Guo-Bo; Yan, Lei; Ma, Jennie Z.; Mangold, Jamie E.; Zhu, Jun; Elston, Robert C.; Li, Ming D.

    2008-01-01

    Widespread multifactor interactions present a significant challenge in determining risk factors of complex diseases. Several combinatorial approaches, such as the multifactor dimensionality reduction (MDR) method, have emerged as a promising tool for better detecting gene-gene (G × G) and gene-environment (G × E) interactions. We recently developed a general combinatorial approach, namely the generalized multifactor dimensionality reduction (GMDR) method, which can entertain both qualitative and quantitative phenotypes and allows for both discrete and continuous covariates to detect G × G and G × E interactions in a sample of unrelated individuals. In this article, we report the development of an algorithm that can be used to study G × G and G × E interactions for family-based designs, called pedigree-based GMDR (PGMDR). Compared to the available method, our proposed method has several major improvements, including allowing for covariate adjustments and being applicable to arbitrary phenotypes, arbitrary pedigree structures, and arbitrary patterns of missing marker genotypes. Our Monte Carlo simulations provide evidence that the PGMDR method is superior in performance to identify epistatic loci compared to the MDR-pedigree disequilibrium test (PDT). Finally, we applied our proposed approach to a genetic data set on tobacco dependence and found a significant interaction between two taste receptor genes (i.e., TAS2R16 and TAS2R38) in affecting nicotine dependence. PMID:18834969

  7. Effects of the Family Environment: Gene-Environment Interaction and Passive Gene-Environment Correlation

    ERIC Educational Resources Information Center

    Price, Thomas S.; Jaffee, Sara R.

    2008-01-01

    The classical twin study provides a useful resource for testing hypotheses about how the family environment influences children's development, including how genes can influence sensitivity to environmental effects. However, existing statistical models do not account for the possibility that children can inherit exposure to family environments…

  8. Effects of the Family Environment: Gene-Environment Interaction and Passive Gene-Environment Correlation

    ERIC Educational Resources Information Center

    Price, Thomas S.; Jaffee, Sara R.

    2008-01-01

    The classical twin study provides a useful resource for testing hypotheses about how the family environment influences children's development, including how genes can influence sensitivity to environmental effects. However, existing statistical models do not account for the possibility that children can inherit exposure to family environments…

  9. Interaction of five globin gene abnormalities in a Cambodian family.

    PubMed

    Simpkins, H; Hill, A V; Derry, S; Clegg, J B; Weatherall, D J

    1986-05-01

    Members of a Cambodian family with an undiagnosed hypochromic, microcytic anaemia were found by haemoglobin and DNA analysis to have five interacting globin gene abnormalities. One child has Hb E and typical Hb H disease, while his mother has the form of Hb H disease associated with Hb Constant Spring interacting with Hb E. Quantitation of Hbs E and A2 by globin chain separation and triton/urea gel electrophoresis support the concept that Hb H/Constant Spring disease is a more severe form of alpha thalassaemia than Hb H disease. This family illustrates how the remarkably high prevalence of globin gene abnormalities in Southeast Asians can give rise to a series of atypical thalassaemic phenotypes, and how they can be defined by direct globin gene analysis.

  10. Comprehensive analyses of the annexin gene family in wheat.

    PubMed

    Xu, Lei; Tang, Yimiao; Gao, Shiqing; Su, Shichao; Hong, Lin; Wang, Weiwei; Fang, Zhaofeng; Li, Xueyin; Ma, Jinxiu; Quan, Wei; Sun, Hui; Li, Xia; Wang, Yongbo; Liao, Xiangzheng; Gao, Jiangang; Zhang, Fengting; Li, Lei; Zhao, Changping

    2016-05-28

    Annexins are an evolutionarily conserved multigene family of calcium-dependent phospholipid binding proteins that play important roles in stress resistance and plant development. They have been relatively well characterized in model plants Arabidopsis (Arabidopsis thaliana) and rice (Oryza sativa), but nothing has been reported in hexaploid bread wheat (Triticum aestivum) and barely (Hordeum vulgare), which are the two most economically important plants. Based on available genomic and transcriptomic data, 25 and 11 putative annexin genes were found through in silico analysis in wheat and barley, respectively. Additionally, eight and 11 annexin genes were identified from the draft genome sequences of Triticum urartu and Aegilops tauschii, progenitor for the A and D genome of wheat, respectively. By phylogenetic analysis, annexins in these four species together with other monocots and eudicots were classified into six different orthologous groups. Pi values of each of Ann1-12 genes among T. aestivum, T. urartu, A. tauschii and H. vulgare species was very low, with the exception of Ann2 and Ann5 genes. Ann2 gene has been under positive selection, but Ann6 and Ann7 have been under purifying selection among the four species in their evolutionary histories. The nucleotide diversities of Ann1-12 genes in the four species were 0.52065, 0.59239, 0.60691 and 0.53421, respectively. No selective pressure was operated on annexin genes in the same species. Gene expression patterns obtained by real-time PCR and re-analyzing the public microarray data revealed differential temporal and spatial regulation of annexin genes in wheat under different abiotic stress conditions such as salinity, drought, cold and abscisic acid. Among those genes, TaAnn10 is specifically expressed in the anther but fails to be induced by low temperature in thermosensitive genic male sterile lines, suggesting that specific down-regulation of TaAnn10 is associated with conditional male sterility in wheat

  11. Ancient origin of glycosyl hydrolase family 9 cellulase genes.

    PubMed

    Davison, Angus; Blaxter, Mark

    2005-05-01

    While it is widely accepted that most animals (Metazoa) do not have endogenous cellulases, relying instead on intestinal symbionts for cellulose digestion, the glycosyl hydrolase family 9 (GHF9) cellulases found in the genomes of termites, abalone, and sea squirts could be an exception. Using information from expressed sequence tags, we show that GHF9 genes (subgroup E2) are widespread in Metazoa because at least 11 classes in five phyla have expressed GHF9 cellulases. We also demonstrate that eukaryotic GHF9 gene families are ancient, forming distinct monophyletic groups in plants and animals. As several intron positions are also conserved between four metazoan phyla then, contrary to the still widespread belief that cellulases were horizontally transferred to animals relatively recently, GHF9 genes must derive from an ancient ancestor. We also found that sequences isolated from the same animal phylum tend to group together, and in some deuterostomes, GHF9 genes are characterized by substitutions in catalytically important sites. Several paralogous subfamilies of GHF9 can be identified in plants, and genes from primitive species tend to arise basally to angiosperm representatives. In contrast, GHF9 subgroup E2 genes are relatively rare in bacteria.

  12. The genetics of alcoholism: identifying specific genes through family studies.

    PubMed

    Edenberg, Howard J; Foroud, Tatiana

    2006-09-01

    Alcoholism is a complex disorder with both genetic and environmental risk factors. Studies in humans have begun to elucidate the genetic underpinnings of the risk for alcoholism. Here we briefly review strategies for identifying individual genes in which variations affect the risk for alcoholism and related phenotypes, in the context of one large study that has successfully identified such genes. The Collaborative Study on the Genetics of Alcoholism (COGA) is a family-based study that has collected detailed phenotypic data on individuals in families with multiple alcoholic members. A genome-wide linkage approach led to the identification of chromosomal regions containing genes that influenced alcoholism risk and related phenotypes. Subsequently, single nucleotide polymorphisms (SNPs) were genotyped in positional candidate genes located within the linked chromosomal regions, and analyzed for association with these phenotypes. Using this sequential approach, COGA has detected association with GABRA2, CHRM2 and ADH4; these associations have all been replicated by other researchers. COGA has detected association to additional genes including GABRG3, TAS2R16, SNCA, OPRK1 and PDYN, results that are awaiting confirmation. These successes demonstrate that genes contributing to the risk for alcoholism can be reliably identified using human subjects.

  13. Population- and Family-Based Studies Associate the "MTHFR" Gene with Idiopathic Autism in Simplex Families

    ERIC Educational Resources Information Center

    Liu, Xudong; Solehdin, Fatima; Cohen, Ira L.; Gonzalez, Maripaz G.; Jenkins, Edmund C.; Lewis, M. E. Suzanne; Holden, Jeanette J. A.

    2011-01-01

    Two methylenetetrahydrofolate reductase gene ("MTHFR") functional polymorphisms were studied in 205 North American simplex (SPX) and 307 multiplex (MPX) families having one or more children with an autism spectrum disorder. Case-control comparisons revealed a significantly higher frequency of the low-activity 677T allele, higher prevalence of the…

  14. Population- and Family-Based Studies Associate the "MTHFR" Gene with Idiopathic Autism in Simplex Families

    ERIC Educational Resources Information Center

    Liu, Xudong; Solehdin, Fatima; Cohen, Ira L.; Gonzalez, Maripaz G.; Jenkins, Edmund C.; Lewis, M. E. Suzanne; Holden, Jeanette J. A.

    2011-01-01

    Two methylenetetrahydrofolate reductase gene ("MTHFR") functional polymorphisms were studied in 205 North American simplex (SPX) and 307 multiplex (MPX) families having one or more children with an autism spectrum disorder. Case-control comparisons revealed a significantly higher frequency of the low-activity 677T allele, higher prevalence of the…

  15. Evolution and expression of the fructokinase gene family in Saccharum.

    PubMed

    Chen, Yihong; Zhang, Qing; Hu, Weichang; Zhang, Xingtan; Wang, Liming; Hua, Xiuting; Yu, Qingyi; Ming, Ray; Zhang, Jisen

    2017-02-21

    Sugarcane is an important sugar crop contributing up to about 80% of the world sugar production. Efforts to characterize the genes involved in sugar metabolism at the molecular level are growing since increasing sugar content is a major goal in the breeding of new sugarcane varieties. Fructokinases (FRK) are the main fructose phosphorylating enzymes with high substrate specificity and affinity. In this study, by combining comparative genomics approaches with BAC resources, seven fructokinase genes were identified in S. spontaneum. Phylogenetic analysis based on representative monocotyledon and dicotyledon plant species suggested that the FRK gene family is ancient and its evolutionary history can be traced in duplicated descending order: SsFRK4, SsFRK6/SsFRK7,SsFRK5, SsFRK3 and SsFRK1/SsFRK2. Among the close orthologs, the number and position of exons in FRKs were conserved; in contrast, the size of introns varied among the paralogous FRKs in Saccharum. Genomic constraints were analyzed within the gene alleles and between S. spontaneum and Sorghum bicolor, and gene expression analysis was performed under drought stress and with exogenous applications of plant hormones. FRK1, which was under strong functional constraint selection, was conserved among the gene allelic haplotypes, and displayed dominant expression levels among the gene families in the control conditions, suggesting that FRK1 plays a major role in the phosphorylation of fructose. FRK3 and FRK5 were dramatically induced under drought stress, and FRK5 was also found to increase its expression levels in the mature stage of Saccharum. Similarly, FRK3 and FRK5 were induced in response to drought stress in Saccharum. FRK2 and FRK7 displayed lower expression levels than the other FRK family members; FRK2 was under strong genomic selection constraints whereas FRK7 was under neutral selection. FRK7 may have become functionally redundant in Saccharum through pseudogenization. FRK4 and FRK6 shared the most

  16. The role of insertions/deletions in the evolution of the intergenic region between psbA and trnH in the chloroplast genome.

    PubMed

    Aldrich, J; Cherney, B W; Merlin, E; Christopherson, L

    1988-08-01

    TrnH and the intergenic region between trnH and psbA of the chloroplast genomes of alfalfa (Medicago sativa), Fabaceae, and petunia (Petunia hybrida), Solanaceae, were sequenced and compared to published sequences of that region from other members of those families. A striking feature of these comparisons is the occurrence of insertions/deletions between short, nearly perfect AT-rich direct repeats. The directionality of these mutations in the petunia, tobacco and Nicotiana debneyi lineages within the Solanaceae cannot be discerned. However, we present several alternative hypotheses that are consistent with Goodspeed's 1954 evolutionary treatment of the genus Nicotiana and family Solanaceae. Within the Fabaceae, the major size differences in the intergenic region between alfalfa, pea and soybean are due to insertions/deletions between direct repeats. The alfalfa intergenic region has an inverted repeat stem-loop structure of 210 bases directly 5' to trnH. This structure is an insert relative to the liver-wort. Marchantia polymorpha. Portions of the insert are found also in pea and soybean as well as in published sequences from other dicots representing diverse orders: petunia, tobacco, N. debneyi (Scrophulariales), spinach (Caryophyllales), and Brassica napus (Capparales). Some of the regions of the insert that are missing in these plants appear to have resulted from deletions of sequences between different imperfect direct repeats within, or 5' to and within the insert. Other deletions are not flanked by repeated sequences. A short insert flanked by imperfect direct repeats in B. napus occurs just within the longer alfalfa insert suggesting that both alfalfa and B. napus have remnants of an even longer insert relative to M. polymorpha. From these analyses we hypothesize the insertion of a stem-loop structure into an M. polymorpha-like ancestral land plant, followed by deletions of sequences, often between different imperfect direct repeats within and upstream of

  17. Evolution of akirin family in gene and genome levels and coexpressed patterns among family members and rel gene in croaker.

    PubMed

    Liu, Tianxing; Gao, Yunhang; Xu, Tianjun

    2015-09-01

    Akirins, which are highly conserved nuclear proteins, are present throughout the metazoan and regulate innate immunity, embryogenesis, myogenesis, and carcinogenesis. This study reports all akirin genes from miiuy croaker and analyzes comprehensively the akirin gene family combined with akirin genes from other species. A second nuclear localization signal (NLS) is observed in akirin2 homologues, which is not in akirin1 homologues in all teleosts and most other vertebrates. Thus, we deduced that the loss of second NLS in akirin1 homologues in teleosts likely occurred in an ancestor to all Osteichthyes after splitting with cartilaginous fish. Significantly, the akirin2(2) gene included six exons interrupted by five introns in the miiuy croaker, which may be caused by the intron insertion event as a novel evidence for the variation of akirin gene structure in some species. In addition, comparison of the genomic neighborhood genes of akirin1, akirin2(1), and akirin2(2) demonstrates a strong level of conserved synteny across the teleost classes, which further proved the deduction of Macqueen and Johnston 2009 that the produce of akirin paralogues can be attributed to whole-genome duplications and the loss of some akirin paralogues after genome duplications. Furthermore, akirin gene family members and relish gene are ubiquitously expressed across all tissues, and their expression levels are increased in three immune tissues after infection with Vibrio anguillarum. Combined with the expression patterns of LEAP-1 and LEAP-2 from miiuy croaker, an intricate network of co-regulation among family members is established. Thus, it is further proved that akirins acted in concert with the relish protein to induce the expression of a subset of downstream pathway elements in the NF-kB dependent signaling pathway. Copyright © 2015 Elsevier Ltd. All rights reserved.

  18. Plant Ion Channels: Gene Families, Physiology, and Functional Genomics Analyses

    PubMed Central

    Ward, John M.; Mäser, Pascal; Schroeder, Julian I.

    2016-01-01

    Distinct potassium, anion, and calcium channels in the plasma membrane and vacuolar membrane of plant cells have been identified and characterized by patch clamping. Primarily owing to advances in Arabidopsis genetics and genomics, and yeast functional complementation, many of the corresponding genes have been identified. Recent advances in our understanding of ion channel genes that mediate signal transduction and ion transport are discussed here. Some plant ion channels, for example, ALMT and SLAC anion channel subunits, are unique. The majority of plant ion channel families exhibit homology to animal genes; such families include both hyperpolarization-and depolarization-activated Shaker-type potassium channels, CLC chloride transporters/channels, cyclic nucleotide–gated channels, and ionotropic glutamate receptor homologs. These plant ion channels offer unique opportunities to analyze the structural mechanisms and functions of ion channels. Here we review gene families of selected plant ion channel classes and discuss unique structure-function aspects and their physiological roles in plant cell signaling and transport. PMID:18842100

  19. A Candida albicans CRISPR system permits genetic engineering of essential genes and gene families.

    PubMed

    Vyas, Valmik K; Barrasa, M Inmaculada; Fink, Gerald R

    Candida albicans is a pathogenic yeast that causes mucosal and systematic infections with high mortality. The absence of facile molecular genetics has been a major impediment to analysis of pathogenesis. The lack of meiosis coupled with the absence of plasmids makes genetic engineering cumbersome, especially for essential functions and gene families. We describe a C. albicans CRISPR system that overcomes many of the obstacles to genetic engineering in this organism. The high frequency with which CRISPR-induced mutations can be directed to target genes enables easy isolation of homozygous gene knockouts, even without selection. Moreover, the system permits the creation of strains with mutations in multiple genes, gene families, and genes that encode essential functions. This CRISPR system is also effective in a fresh clinical isolate of undetermined ploidy. Our method transforms the ability to manipulate the genome of Candida and provides a new window into the biology of this pathogen.

  20. Early evolution of the LIM homeobox gene family

    PubMed Central

    2010-01-01

    Background LIM homeobox (Lhx) transcription factors are unique to the animal lineage and have patterning roles during embryonic development in flies, nematodes and vertebrates, with a conserved role in specifying neuronal identity. Though genes of this family have been reported in a sponge and a cnidarian, the expression patterns and functions of the Lhx family during development in non-bilaterian phyla are not known. Results We identified Lhx genes in two cnidarians and a placozoan and report the expression of Lhx genes during embryonic development in Nematostella and the demosponge Amphimedon. Members of the six major LIM homeobox subfamilies are represented in the genomes of the starlet sea anemone, Nematostella vectensis, and the placozoan Trichoplax adhaerens. The hydrozoan cnidarian, Hydra magnipapillata, has retained four of the six Lhx subfamilies, but apparently lost two others. Only three subfamilies are represented in the haplosclerid demosponge Amphimedon queenslandica. A tandem cluster of three Lhx genes of different subfamilies and a gene containing two LIM domains in the genome of T. adhaerens (an animal without any neurons) indicates that Lhx subfamilies were generated by tandem duplication. This tandem cluster in Trichoplax is likely a remnant of the original chromosomal context in which Lhx subfamilies first appeared. Three of the six Trichoplax Lhx genes are expressed in animals in laboratory culture, as are all Lhx genes in Hydra. Expression patterns of Nematostella Lhx genes correlate with neural territories in larval and juvenile polyp stages. In the aneural demosponge, A. queenslandica, the three Lhx genes are expressed widely during development, including in cells that are associated with the larval photosensory ring. Conclusions The Lhx family expanded and diversified early in animal evolution, with all six subfamilies already diverged prior to the cnidarian-placozoan-bilaterian last common ancestor. In Nematostella, Lhx gene expression is

  1. Early evolution of the LIM homeobox gene family

    SciTech Connect

    Srivastava, Mansi; Larroux, Claire; Lu, Daniel R; Mohanty, Kareshma; Chapman, Jarrod; Degnan, Bernard M; Rokhsar, Daniel S

    2010-01-01

    LIM homeobox (Lhx) transcription factors are unique to the animal lineage and have patterning roles during embryonic development in flies, nematodes and vertebrates, with a conserved role in specifying neuronal identity. Though genes of this family have been reported in a sponge and a cnidarian, the expression patterns and functions of the Lhx family during development in non-bilaterian phyla are not known. We identified Lhx genes in two cnidarians and a placozoan and report the expression of Lhx genes during embryonic development in Nematostella and the demosponge Amphimedon. Members of the six major LIM homeobox subfamilies are represented in the genomes of the starlet sea anemone, Nematostella vectensis, and the placozoan Trichoplax adhaerens. The hydrozoan cnidarian, Hydra magnipapillata, has retained four of the six Lhx subfamilies, but apparently lost two others. Only three subfamilies are represented in the haplosclerid demosponge Amphimedon queenslandica. A tandem cluster of three Lhx genes of different subfamilies and a gene containing two LIM domains in the genome of T. adhaerens (an animal without any neurons) indicates that Lhx subfamilies were generated by tandem duplication. This tandem cluster in Trichoplax is likely a remnant of the original chromosomal context in which Lhx subfamilies first appeared. Three of the six Trichoplax Lhx genes are expressed in animals in laboratory culture, as are all Lhx genes in Hydra. Expression patterns of Nematostella Lhx genes correlate with neural territories in larval and juvenile polyp stages. In the aneural demosponge, A. queenslandica, the three Lhx genes are expressed widely during development, including in cells that are associated with the larval photosensory ring. The Lhx family expanded and diversified early in animal evolution, with all six subfamilies already diverged prior to the cnidarian-placozoan-bilaterian last common ancestor. In Nematostella, Lhx gene expression is correlated with neural

  2. GJB2 gene mutations causing familial hereditary deafness in Turkey.

    PubMed

    Bayazit, Yildirim A; Cable, Benjamin B; Cataloluk, Osman; Kara, Cengiz; Chamberlin, Parker; Smith, Richard J H; Kanlikama, Muzaffer; Ozer, Enver; Cakmak, Ecir Ali; Mumbuc, Semih; Arslan, Ahmet

    2003-12-01

    Mutations in Connexin 26 (Cx26) play an important role in autosomal non-syndromic hereditary hearing loss. In this study, our objective was to find out the significance of Cx26 mutations in Turkish families who had hereditary deafness. Fourteen families who had at least two prelingually deaf children per family were included in the study. One affected child from each of the 14 families was selected for single-stranded conformational polymorphism SSCP analysis. Three PCR reactions were used for each subject to amplify the entire Cx26 coding region with overlap. PCR products were sequenced on an Applied Biosystems (ABI) model 3700 automated sequencer. Six of the 14 representative family members (42.9%) demonstrated shifts on SSCP and were subsequently sequenced for Exons 1 and 2 of GJB2 and were tested for the 432 kb upstream deletion. No mutations were found in Exon 1 and no 432 kb deletions were noted. Three different GJB2 mutations were found in Exon 2 of the probands, which were 35delG, 299-300delAT, and 487G > A (M163V). GJB2 mutations were detected in 21.4% of the families. Two patients were homozygous for 35delG and 299-300delAT mutations, and were given a diagnosis of DFNB1 deafness (14.3%). Two different polymorphisms, 457G > A (V153I) and 380G > AG (R127H) were also found. In conclusion, although GJB2 mutations were detected in 21.4% of the families tested, only 14.3% of subject representatives were homozygous and therefore deafness caused by Cx26 mutation segregated with DFNB1. Thus, contribution of GJB2 mutations appears less significant in familial deafness. This necessitates further assessment for the other known gene regions as well as a search for new genetic factors in familial type of genetic deafness.

  3. MORC Family ATPases Required for Heterochromatin Condensation and Gene Silencing#

    PubMed Central

    Moissiard, Guillaume; Cokus, Shawn J.; Cary, Joshua; Feng, Suhua; Billi, Allison C.; Stroud, Hume; Husmann, Dylan; Zhan, Ye; Lajoie, Bryan R.; McCord, Rachel Patton; Hale, Christopher J.; Feng, Wei; Michaels, Scott D.; Frand, Alison R.; Pellegrini, Matteo; Dekker, Job; Kim, John K.; Jacobsen, Steve

    2012-01-01

    Transposable elements (TEs) and DNA repeats are commonly targeted by DNA and histone methylation to achieve epigenetic gene silencing. We isolated mutations in two Arabidopsis genes, AtMORC1 and AtMORC6, which cause de-repression of DNA-methylated genes and TEs, but no losses of DNA or histone methylation. AtMORC1 and AtMORC6 are members of the conserved Microrchidia (MORC) adenosine triphosphatase (ATPase) family, predicted to catalyze alterations in chromosome superstructure. The atmorc1 and atmorc6 mutants show decondensation of pericentromeric heterochromatin, increased interaction of pericentromeric regions with the rest of the genome, and transcriptional defects that are largely restricted to loci residing in pericentromeric regions. Knockdown of the single MORC homolog in Caenorhabditis elegans also impairs transgene silencing. We propose that the MORC ATPases are conserved regulators of gene silencing in eukaryotes. PMID:22555433

  4. Chromosomal evolution of the PKD1 gene family in primates

    PubMed Central

    2008-01-01

    Background The autosomal dominant polycystic kidney disease (ADPKD) is mostly caused by mutations in the PKD1 (polycystic kidney disease 1) gene located in 16p13.3. Moreover, there are six pseudogenes of PKD1 that are located proximal to the master gene in 16p13.1. In contrast, no pseudogene could be detected in the mouse genome, only a single copy gene on chromosome 17. The question arises how the human situation originated phylogenetically. To address this question we applied comparative FISH-mapping of a human PKD1-containing genomic BAC clone and a PKD1-cDNA clone to chromosomes of a variety of primate species and the dog as a non-primate outgroup species. Results Comparative FISH with the PKD1-cDNA clone clearly shows that in all primate species studied distinct single signals map in subtelomeric chromosomal positions orthologous to the short arm of human chromosome 16 harbouring the master PKD1 gene. Only in human and African great apes, but not in orangutan, FISH with both BAC and cDNA clones reveals additional signal clusters located proximal of and clearly separated from the PKD1 master genes indicating the chromosomal position of PKD1 pseudogenes in 16p of these species, respectively. Indeed, this is in accordance with sequencing data in human, chimpanzee and orangutan. Apart from the master PKD1 gene, six pseudogenes are identified in both, human and chimpanzee, while only a single-copy gene is present in the whole-genome sequence of orangutan. The phylogenetic reconstruction of the PKD1-tree reveals that all human pseudogenes are closely related to the human PKD1 gene, and all chimpanzee pseudogenes are closely related to the chimpanzee PKD1 gene. However, our statistical analyses provide strong indication that gene conversion events may have occurred within the PKD1 family members of human and chimpanzee, respectively. Conclusion PKD1 must have undergone amplification very recently in hominid evolution. Duplicative transposition of the PKD1 gene and

  5. Massive expansion of the calpain gene family in unicellular eukaryotes

    PubMed Central

    2012-01-01

    Background Calpains are Ca2+-dependent cysteine proteases that participate in a range of crucial cellular processes. Dysfunction of these enzymes may cause, for instance, life-threatening diseases in humans, the loss of sex determination in nematodes and embryo lethality in plants. Although the calpain family is well characterized in animal and plant model organisms, there is a great lack of knowledge about these genes in unicellular eukaryote species (i.e. protists). Here, we study the distribution and evolution of calpain genes in a wide range of eukaryote genomes from major branches in the tree of life. Results Our investigations reveal 24 types of protein domains that are combined with the calpain-specific catalytic domain CysPc. In total we identify 41 different calpain domain architectures, 28 of these domain combinations have not been previously described. Based on our phylogenetic inferences, we propose that at least four calpain variants were established in the early evolution of eukaryotes, most likely before the radiation of all the major supergroups of eukaryotes. Many domains associated with eukaryotic calpain genes can be found among eubacteria or archaebacteria but never in combination with the CysPc domain. Conclusions The analyses presented here show that ancient modules present in prokaryotes, and a few de novo eukaryote domains, have been assembled into many novel domain combinations along the evolutionary history of eukaryotes. Some of the new calpain genes show a narrow distribution in a few branches in the tree of life, likely representing lineage-specific innovations. Hence, the functionally important classical calpain genes found among humans and vertebrates make up only a tiny fraction of the calpain family. In fact, a massive expansion of the calpain family occurred by domain shuffling among unicellular eukaryotes and contributed to a wealth of functionally different genes. PMID:23020305

  6. Comparative and Evolutionary Analysis of Major Peanut Allergen Gene Families

    PubMed Central

    Ratnaparkhe, Milind B.; Lee, Tae-Ho; Tan, Xu; Wang, Xiyin; Li, Jingping; Kim, Changsoo; Rainville, Lisa K.; Lemke, Cornelia; Compton, Rosana O.; Robertson, Jon; Gallo, Maria; Bertioli, David J.; Paterson, Andrew H.

    2014-01-01

    Peanut (Arachis hypogaea L.) causes one of the most serious food allergies. Peanut seed proteins, Arah1, Arah2, and Arah3, are considered to be among the most important peanut allergens. To gain insights into genome organization and evolution of allergen-encoding genes, approximately 617 kb from the genome of cultivated peanut and 215 kb from a wild relative were sequenced including three Arah1, one Arah2, eight Arah3, and two Arah6 gene family members. To assign polarity to differences between homoeologous regions in peanut, we used as outgroups the single orthologous regions in Medicago, Lotus, common bean, chickpea, and pigeonpea, which diverged from peanut about 50 Ma and have not undergone subsequent polyploidy. These regions were also compared with orthologs in many additional dicot plant species to help clarify the timing of evolutionary events. The lack of conservation of allergenic epitopes between species, and the fact that many different proteins can be allergenic, makes the identification of allergens across species by comparative studies difficult. The peanut allergen genes are interspersed with low-copy genes and transposable elements. Phylogenetic analyses revealed lineage-specific expansion and loss of low-copy genes between species and homoeologs. Arah1 syntenic regions are conserved in soybean, pigeonpea, tomato, grape, Lotus, and Arabidopsis, whereas Arah3 syntenic regions show genome rearrangements. We infer that tandem and segmental duplications led to the establishment of the Arah3 gene family. Our analysis indicates differences in conserved motifs in allergen proteins and in the promoter regions of the allergen-encoding genes. Phylogenetic analysis and genomic organization studies provide new insights into the evolution of the major peanut allergen-encoding genes. PMID:25193311

  7. NDP gene mutations in 14 French families with Norrie disease.

    PubMed

    Royer, Ghislaine; Hanein, Sylvain; Raclin, Valérie; Gigarel, Nadine; Rozet, Jean-Michel; Munnich, Arnold; Steffann, Julie; Dufier, Jean-Louis; Kaplan, Josseline; Bonnefont, Jean-Paul

    2003-12-01

    Norrie disease is a rare X-inked recessive condition characterized by congenital blindness and occasionally deafness and mental retardation in males. This disease has been ascribed to mutations in the NDP gene on chromosome Xp11.1. Previous investigations of the NDP gene have identified largely sixty disease-causing sequence variants. Here, we report on ten different NDP gene allelic variants in fourteen of a series of 21 families fulfilling inclusion criteria. Two alterations were intragenic deletions and eight were nucleotide substitutions or splicing variants, six of them being hitherto unreported, namely c.112C>T (p.Arg38Cys), c.129C>G (p.His43Gln), c.133G>A (p.Val45Met), c.268C>T (p.Arg90Cys), c.382T>C (p.Cys128Arg), c.23479-1G>C (unknown). No NDP gene sequence variant was found in seven of the 21 families. This observation raises the issue of misdiagnosis, phenocopies, or existence of other X-linked or autosomal genes, the mutations of which would mimic the Norrie disease phenotype.

  8. Mutation Analysis of HTRA2 Gene in Chinese Familial Essential Tremor and Familial Parkinson's Disease.

    PubMed

    He, Ya-Chao; Huang, Pei; Li, Qiong-Qiong; Sun, Qian; Li, Dun-Hui; Wang, Tian; Shen, Jun-Yi; Du, Juan-Juan; Cui, Shi-Shuang; Gao, Chao; Fu, Rao; Chen, Sheng-Di

    2017-01-01

    Background. HTRA2 has already been nominated as PARK13 which may cause Parkinson's disease, though there are still discrepancies among these results. Recently, Gulsuner et al.'s study found that HTRA2 p.G399S is responsible for hereditary essential tremor and homozygotes of this allele develop Parkinson's disease by examining a six-generation family segregating essential tremor and essential tremor coexisting with Parkinson's disease. We performed this study to validate the condition of HTRA2 gene in Chinese familial essential tremor and familial Parkinson's disease patients, especially essential tremor. Methods. We directly sequenced all eight exons, exon-intron boundaries, and part of the introns in 101 familial essential tremor patients, 105 familial Parkinson's disease patients, and 100 healthy controls. Results. No exonic variant was identified, while one exon-intron boundary variant (rs2241028) and one intron variant (rs2241027) were detected, both with no clinical significance and uncertain function. There was no difference in allele, genotype, and haplotype between groups. Conclusions. HTRA2 exonic variant might be rare among Chinese Parkinson's disease and essential tremor patients with family history, and HTRA2 may not be the cause of familial Parkinson's disease and essential tremor in China.

  9. Mutation Analysis of HTRA2 Gene in Chinese Familial Essential Tremor and Familial Parkinson's Disease

    PubMed Central

    Li, Qiong-Qiong; Fu, Rao

    2017-01-01

    Background. HTRA2 has already been nominated as PARK13 which may cause Parkinson's disease, though there are still discrepancies among these results. Recently, Gulsuner et al.'s study found that HTRA2 p.G399S is responsible for hereditary essential tremor and homozygotes of this allele develop Parkinson's disease by examining a six-generation family segregating essential tremor and essential tremor coexisting with Parkinson's disease. We performed this study to validate the condition of HTRA2 gene in Chinese familial essential tremor and familial Parkinson's disease patients, especially essential tremor. Methods. We directly sequenced all eight exons, exon-intron boundaries, and part of the introns in 101 familial essential tremor patients, 105 familial Parkinson's disease patients, and 100 healthy controls. Results. No exonic variant was identified, while one exon-intron boundary variant (rs2241028) and one intron variant (rs2241027) were detected, both with no clinical significance and uncertain function. There was no difference in allele, genotype, and haplotype between groups. Conclusions. HTRA2 exonic variant might be rare among Chinese Parkinson's disease and essential tremor patients with family history, and HTRA2 may not be the cause of familial Parkinson's disease and essential tremor in China. PMID:28243480

  10. The Maize PIN Gene Family of Auxin Transporters.

    PubMed

    Forestan, Cristian; Farinati, Silvia; Varotto, Serena

    2012-01-01

    Auxin is a key regulator of plant development and its differential distribution in plant tissues, established by a polar cell to cell transport, can trigger a wide range of developmental processes. A few members of the two families of auxin efflux transport proteins, PIN-formed (PIN) and P-glycoprotein (ABCB/PGP), have so far been characterized in maize. Nine new Zea mays auxin efflux carriers PIN family members and two maize PIN-like genes have now been identified. Four members of PIN1 (named ZmPIN1a-d) cluster, one gene homologous to AtPIN2 (ZmPIN2), three orthologs of PIN5 (ZmPIN5a-c), one gene paired with AtPIN8 (ZmPIN8), and three monocot-specific PINs (ZmPIN9, ZmPIN10a, and ZmPIN10b) were cloned and the phylogenetic relationships between early-land plants, monocots, and eudicots PIN proteins investigated, including the new maize PIN proteins. Tissue-specific expression patterns of the 12 maize PIN genes, 2 PIN-like genes and ZmABCB1, an ABCB auxin efflux carrier, were analyzed together with protein localization and auxin accumulation patterns in normal conditions and in response to drug applications. ZmPIN gene transcripts have overlapping expression domains in the root apex, during male and female inflorescence differentiation and kernel development. However, some PIN family members have specific tissue localization: ZmPIN1d transcript marks the L1 layer of the shoot apical meristem and inflorescence meristem during the flowering transition and the monocot-specific ZmPIN9 is expressed in the root endodermis and pericycle. The phylogenetic and gene structure analyses together with the expression pattern of the ZmPIN gene family indicate that subfunctionalization of some maize PINs can be associated to the differentiation and development of monocot-specific organs and tissues and might have occurred after the divergence between dicots and monocots.

  11. The Maize PIN Gene Family of Auxin Transporters

    PubMed Central

    Forestan, Cristian; Farinati, Silvia; Varotto, Serena

    2012-01-01

    Auxin is a key regulator of plant development and its differential distribution in plant tissues, established by a polar cell to cell transport, can trigger a wide range of developmental processes. A few members of the two families of auxin efflux transport proteins, PIN-formed (PIN) and P-glycoprotein (ABCB/PGP), have so far been characterized in maize. Nine new Zea mays auxin efflux carriers PIN family members and two maize PIN-like genes have now been identified. Four members of PIN1 (named ZmPIN1a–d) cluster, one gene homologous to AtPIN2 (ZmPIN2), three orthologs of PIN5 (ZmPIN5a–c), one gene paired with AtPIN8 (ZmPIN8), and three monocot-specific PINs (ZmPIN9, ZmPIN10a, and ZmPIN10b) were cloned and the phylogenetic relationships between early-land plants, monocots, and eudicots PIN proteins investigated, including the new maize PIN proteins. Tissue-specific expression patterns of the 12 maize PIN genes, 2 PIN-like genes and ZmABCB1, an ABCB auxin efflux carrier, were analyzed together with protein localization and auxin accumulation patterns in normal conditions and in response to drug applications. ZmPIN gene transcripts have overlapping expression domains in the root apex, during male and female inflorescence differentiation and kernel development. However, some PIN family members have specific tissue localization: ZmPIN1d transcript marks the L1 layer of the shoot apical meristem and inflorescence meristem during the flowering transition and the monocot-specific ZmPIN9 is expressed in the root endodermis and pericycle. The phylogenetic and gene structure analyses together with the expression pattern of the ZmPIN gene family indicate that subfunctionalization of some maize PINs can be associated to the differentiation and development of monocot-specific organs and tissues and might have occurred after the divergence between dicots and monocots. PMID:22639639

  12. Clock-associated genes in Arabidopsis: a family affair.

    PubMed Central

    Somers, D E

    2001-01-01

    The identification of components of the plant circadian clock has been advanced recently with the success of two forward genetics approaches. The ZEITLUPE and TOC1 loci were cloned and each was found to be part of two separate, larger gene families with intriguing domain structures. The ZTL family of proteins contains a subclass of the PAS domain coupled to an F box and kelch motifs, suggesting that they play a role in a novel light-regulated ubiquitination mechanism. TOC1 shares similarity to the receiver domain of the well-known two-component phosphorelay signalling systems, combined with a strong similarity to a region of the CONSTANS transcription factor, which is involved in controlling flowering time. When added to the repertoire of previously identified clock-associated genes, it is clear that both similarities and differences with other circadian systems will emerge in the coming years. PMID:11710981

  13. Epigenetic balance of gene expression by Polycomb and COMPASS families.

    PubMed

    Piunti, Andrea; Shilatifard, Ali

    2016-06-03

    Epigenetic regulation of gene expression in metazoans is central for establishing cellular diversity, and its deregulation can result in pathological conditions. Although transcription factors are essential for implementing gene expression programs, they do not function in isolation and require the recruitment of various chromatin-modifying and -remodeling machineries. A classic example of developmental chromatin regulation is the balanced activities of the Polycomb group (PcG) proteins within the PRC1 and PRC2 complexes, and the Trithorax group (TrxG) proteins within the COMPASS family, which are highly mutated in a large number of human diseases. In this review, we will discuss the latest findings regarding the properties of the PcG and COMPASS families and the insight they provide into the epigenetic control of transcription under physiological and pathological settings.

  14. Variation in the RAD51 gene and familial breast cancer

    PubMed Central

    Lose, Felicity; Lovelock, Paul; Chenevix-Trench, Georgia; Mann, Graham J; Pupo, Gulietta M; Spurdle, Amanda B

    2006-01-01

    Introduction Human RAD51 is a homologue of the Escherichia coli RecA protein and is known to function in recombinational repair of double-stranded DNA breaks. Mutations in the lower eukaryotic homologues of RAD51 result in a deficiency in the repair of double-stranded DNA breaks. Loss of RAD51 function would therefore be expected to result in an elevated mutation rate, leading to accumulation of DNA damage and, hence, to increased cancer risk. RAD51 interacts directly or indirectly with a number of proteins implicated in breast cancer, such as BRCA1 and BRCA2. Similar to BRCA1 mice, RAD51-/- mice are embryonic lethal. The RAD51 gene region has been shown to exhibit loss of heterozygosity in breast tumours, and deregulated RAD51 expression in breast cancer patients has also been reported. Few studies have investigated the role of coding region variation in the RAD51 gene in familial breast cancer, with only one coding region variant – exon 6 c.449G>A (p.R150Q) – reported to date. Methods All nine coding exons of the RAD51 gene were analysed for variation in 46 well-characterised, BRCA1/2-negative breast cancer families using denaturing high-performance liquid chromatography. Genotyping of the exon 6 p.R150Q variant was performed in an additional 66 families. Additionally, lymphoblastoid cell lines from breast cancer patients were subjected to single nucleotide primer extension analysis to assess RAD51 expression. Results No coding region variation was found, and all intronic variation detected was either found in unaffected controls or was unlikely to have functional consequences. Single nucleotide primer extension analysis did not reveal any allele-specific changes in RAD51 expression in all lymphoblastoid cell lines tested. Conclusion Our study indicates that RAD51 is not a major familial breast cancer predisposition gene. PMID:16762046

  15. Recent developments in focused library design: targeting gene-families.

    PubMed

    Miller, Jennifer L

    2006-01-01

    For many years, the most frequently optimized qualities of a screening library, or corporate compound collection, were size and diversity. Maximizing the number of diverse hits is the fundamental goal of such strategies. The ostensible justification that "bigger is better" is based on the large, estimated size of small-molecule space and the hypothesis that the notoriously low hit rates from high-throughput screening (HTS) could be overcome by brute force: i.e. by screening more compounds. Published, detailed studies about the success (or failure) of the brute-force strategy are rare, but it is well-known that it did not fulfill expectations. As a result, published reports in recent years have increasingly described methods for designing, selecting or synthesizing gene family-focused or -biased libraries. Moreover, many of the larger compound suppliers now sell such libraries, reflecting the growing interest in them from both the pharmaceutical and biotechnology markets. The trend towards gene family-focused libraries marks the emergence of a different hypothesis about how to increase HTS hit rates and also reflects an increasingly pragmatic focus on the management of screening libraries. An important, underlying assumption in this trend is that a high-quality, general-purpose screening library of manageable size is neither realizable nor desirable. Whether a biasing strategy based on a specific gene family will do a better job of meeting both the scientific and business needs of the drug discovery enterprise still remains to be seen, but it is certainly an active area of current research. This review focuses on the "who, what, why, when, and how" of the design of gene family-focused libraries. Particular attention is given to reports that discuss not only the techniques used, but also any results obtained.

  16. Leiomodins: larger members of the tropomodulin (Tmod) gene family

    NASA Technical Reports Server (NTRS)

    Conley, C. A.; Fritz-Six, K. L.; Almenar-Queralt, A.; Fowler, V. M.

    2001-01-01

    The 64-kDa autoantigen D1 or 1D, first identified as a potential autoantigen in Graves' disease, is similar to the tropomodulin (Tmod) family of actin filament pointed end-capping proteins. A novel gene with significant similarity to the 64-kDa human autoantigen D1 has been cloned from both humans and mice, and the genomic sequences of both genes have been identified. These genes form a subfamily closely related to the Tmods and are here named the Leiomodins (Lmods). Both Lmod genes display a conserved intron-exon structure, as do three Tmod genes, but the intron-exon structure of the Lmods and the Tmods is divergent. mRNA expression analysis indicates that the gene formerly known as the 64-kDa autoantigen D1 is most highly expressed in a variety of human tissues that contain smooth muscle, earning it the name smooth muscle Leiomodin (SM-Lmod; HGMW-approved symbol LMOD1). Transcripts encoding the novel Lmod gene are present exclusively in fetal and adult heart and adult skeletal muscle, and it is here named cardiac Leiomodin (C-Lmod; HGMW-approved symbol LMOD2). Human C-Lmod is located near the hypertrophic cardiomyopathy locus CMH6 on human chromosome 7q3, potentially implicating it in this disease. Our data demonstrate that the Lmods are evolutionarily related and display tissue-specific patterns of expression distinct from, but overlapping with, the expression of Tmod isoforms. Copyright 2001 Academic Press.

  17. Leiomodins: larger members of the tropomodulin (Tmod) gene family

    NASA Technical Reports Server (NTRS)

    Conley, C. A.; Fritz-Six, K. L.; Almenar-Queralt, A.; Fowler, V. M.

    2001-01-01

    The 64-kDa autoantigen D1 or 1D, first identified as a potential autoantigen in Graves' disease, is similar to the tropomodulin (Tmod) family of actin filament pointed end-capping proteins. A novel gene with significant similarity to the 64-kDa human autoantigen D1 has been cloned from both humans and mice, and the genomic sequences of both genes have been identified. These genes form a subfamily closely related to the Tmods and are here named the Leiomodins (Lmods). Both Lmod genes display a conserved intron-exon structure, as do three Tmod genes, but the intron-exon structure of the Lmods and the Tmods is divergent. mRNA expression analysis indicates that the gene formerly known as the 64-kDa autoantigen D1 is most highly expressed in a variety of human tissues that contain smooth muscle, earning it the name smooth muscle Leiomodin (SM-Lmod; HGMW-approved symbol LMOD1). Transcripts encoding the novel Lmod gene are present exclusively in fetal and adult heart and adult skeletal muscle, and it is here named cardiac Leiomodin (C-Lmod; HGMW-approved symbol LMOD2). Human C-Lmod is located near the hypertrophic cardiomyopathy locus CMH6 on human chromosome 7q3, potentially implicating it in this disease. Our data demonstrate that the Lmods are evolutionarily related and display tissue-specific patterns of expression distinct from, but overlapping with, the expression of Tmod isoforms. Copyright 2001 Academic Press.

  18. Molecular study of the perforin gene in familial hematological malignancies

    PubMed Central

    2011-01-01

    Perforin gene (PRF1) mutations have been identified in some patients diagnosed with the familial form of hemophagocytic lymphohistiocytosis (HLH) and in patients with lymphoma. The aim of the present study was to determine whether patients with a familial aggregation of hematological malignancies harbor germline perforin gene mutations. For this purpose, 81 unrelated families from Tunisia and France with aggregated hematological malignancies were investigated. The variants detected in the PRF1 coding region amounted to 3.7% (3/81). Two of the three variants identified were previously described: the p.Ala91Val pathogenic mutation and the p.Asn252Ser polymorphism. A new p.Ala 211Val missense substitution was identified in two related Tunisian patients. In order to assess the pathogenicity of this new variation, bioinformatic tools were used to predict its effects on the perforin protein structure and at the mRNA level. The segregation of the mutant allele was studied in the family of interest and a control population was screened. The fact that this variant was not found to occur in 200 control chromosomes suggests that it may be pathogenic. However, overexpression of mutated PRF1 in rat basophilic leukemia cells did not affect the lytic function of perforin differently from the wild type protein. PMID:21936944

  19. The carboxylesterase/cholinesterase gene family in invertebrate deuterostomes.

    PubMed

    Johnson, Glynis; Moore, Samuel W

    2012-06-01

    Carboxylesterase/cholinesterase family members are responsible for controlling the nerve impulse, detoxification and various developmental functions, and are a major target of pesticides and chemical warfare agents. Comparative structural analysis of these enzymes is thus important. The invertebrate deuterostomes (phyla Echinodermata and Hemichordata and subphyla Urochordata and Cephalochordata) lie in the transition zone between invertebrates and vertebrates, and are thus of interest to the study of evolution. Here we have investigated the carboxylesterase/cholinesterase gene family in the sequenced genomes of Strongylocentrotus purpuratus (Echinodermata), Saccoglossus kowalevskii (Hemichordata), Ciona intestinalis (Urochordata) and Branchiostoma floridae (Cephalochordata), using sequence analysis of the catalytic apparatus and oligomerisation domains, and phylogenetic analysis. All four genomes show blurring of structural boundaries between cholinesterases and carboxylesterases, with many intermediate enzymes. Non-enzymatic proteins are well represented. The Saccoglossus and Branchiostoma genomes show evidence of extensive gene duplication and retention. There is also evidence of domain shuffling, resulting in multidomain proteins consisting either of multiple carboxylesterase domains, or of carboxylesterase/cholinesterase domains linked to other domains, including RING finger, chitin-binding, immunoglobulin, fibronectin type 3, CUB, cysteine-rich-Frizzled, caspase activation and 7tm-1, amongst others. Such gene duplication and domain shuffling in the carboxylesterase/cholinesterase family appears to be unique to the invertebrate deuterostomes, and we hypothesise that these factors may have contributed to the evolution of the morphological complexity, particularly of the nervous system and neural crest, of the vertebrates.

  20. Organization of the human lipoprotein lipase gene and evolution of the lipase gene family.

    PubMed Central

    Kirchgessner, T G; Chuat, J C; Heinzmann, C; Etienne, J; Guilhot, S; Svenson, K; Ameis, D; Pilon, C; d'Auriol, L; Andalibi, A

    1989-01-01

    The human lipoprotein lipase gene was cloned and characterized. It is composed of 10 exons spanning approximately equal to 30 kilobases. The first exon encodes the 5'-untranslated region, the signal peptide plus the first two amino acids of the mature protein. The next eight exons encode the remaining 446 amino acids, and the tenth exon encodes the long 3'-untranslated region of 1948 nucleotides. The lipoprotein lipase transcription start site and the sequence of the 5'-flanking region were also determined. We compared the organization of genes for lipoprotein lipase, hepatic lipase, pancreatic lipase, and Drosophila yolk protein 1, which are members of a family of related genes. A model for the evolution of the lipase gene family is presented that involves multiple rounds of gene duplication plus exon-shuffling and intron-loss events. Images PMID:2602366

  1. Tomato ABSCISIC ACID STRESS RIPENING (ASR) gene family revisited.

    PubMed

    Golan, Ido; Dominguez, Pia Guadalupe; Konrad, Zvia; Shkolnik-Inbar, Doron; Carrari, Fernando; Bar-Zvi, Dudy

    2014-01-01

    Tomato ABSCISIC ACID RIPENING 1 (ASR1) was the first cloned plant ASR gene. ASR orthologs were then cloned from a large number of monocot, dicot and gymnosperm plants, where they are mostly involved in response to abiotic (drought and salinity) stress and fruit ripening. The tomato genome encodes five ASR genes: ASR1, 2, 3 and 5 encode low-molecular-weight proteins (ca. 110 amino acid residues each), whereas ASR4 encodes a 297-residue polypeptide. Information on the expression of the tomato ASR gene family is scarce. We used quantitative RT-PCR to assay the expression of this gene family in plant development and in response to salt and osmotic stresses. ASR1 and ASR4 were the main expressed genes in all tested organs and conditions, whereas ASR2 and ASR3/5 expression was two to three orders of magnitude lower (with the exception of cotyledons). ASR1 is expressed in all plant tissues tested whereas ASR4 expression is limited to photosynthetic organs and stamens. Essentially, ASR1 accounted for most of ASR gene expression in roots, stems and fruits at all developmental stages, whereas ASR4 was the major gene expressed in cotyledons and young and fully developed leaves. Both ASR1 and ASR4 were expressed in flower organs, with ASR1 expression dominating in stamens and pistils, ASR4 in sepals and petals. Steady-state levels of ASR1 and ASR4 were upregulated in plant vegetative organs following exposure to salt stress, osmotic stress or the plant abiotic stress hormone abscisic acid (ABA). Tomato plants overexpressing ASR1 displayed enhanced survival rates under conditions of water stress, whereas ASR1-antisense plants displayed marginal hypersensitivity to water withholding.

  2. The carotenoid dioxygenase gene family in maize, sorghum, and rice

    PubMed Central

    Vallabhaneni, Ratnakar; Bradbury, Louis M. T.; Wurtzel, Eleanore T.

    2010-01-01

    Carotenoids and their apocarotenoid derivatives play essential physiological and developmental roles and provide plants tolerance to a variety of stresses. Carotenoid cleavage dioxygenases mediate the degradation of carotenoids to apocarotenoids. A better understanding of biosynthesis vs. degradation could be useful for controlling carotenoid levels leading to improved plant fitness and/or enhanced content of nutritionally valuable carotenoids. The Poaceae (grass) plant family contains many crops of agronomic value. Therefore this study focused on characterizing the carotenoid dioxygenase gene family in the grass species maize, rice, and sorghum with comparison made to newly identified gene families in two non-seed plants as well as an alga and previously identified eudicot genes. Genome analysis was used to map grass genes encoding the carotenoid dioxygenases to chromosome locations. Sequences of encoded proteins were phylogenetically compared. CCD8b was identified as a new class of cleavage dioxygenases that may play a specialized role in apocarotenoid biogenesis. A simple PCR assay was developed to measure CCD1 gene copy number which is known to vary in maize. Using a panel of maize inbred lines varying in carotenoid content, linear regression analysis revealed a statistically significant negative correlation between copy number of CCD1 and carotenoid content, an effect likely mediated through the resulting elevated levels of endosperm CCD1 transcripts in high copy number lines. The PCR assay adds to a growing toolbox for metabolic engineering of maize endosperm carotenoids. This new tool can be used to select maize lines that are less likely to promote endosperm carotenoid degradation, thus predicting optimal results in metabolic engineering of endosperm provitamin A and/or nonprovitamin A carotenoids. PMID:20670614

  3. Evolution of the tyrosinase gene family in bivalve molluscs: independent expansion of the mantle gene repertoire.

    PubMed

    Aguilera, Felipe; McDougall, Carmel; Degnan, Bernard M

    2014-09-01

    Tyrosinase is a copper-containing enzyme that mediates the hydroxylation of monophenols and oxidation of o-diphenols to o-quinones. This enzyme is involved in a variety of biological processes, including pigment production, innate immunity, wound healing, and exoskeleton fabrication and hardening (e.g. arthropod skeleton and mollusc shell). Here we show that the tyrosinase gene family has undergone large expansions in pearl oysters (Pinctada spp.) and the Pacific oyster (Crassostrea gigas). Phylogenetic analysis reveals that pearl oysters possess at least four tyrosinase genes that are not present in the Pacific oyster. Likewise, C. gigas has multiple tyrosinase genes that are not orthologous to the Pinctada genes, indicating that this gene family has expanded independently in these bivalve lineages. Many of the tyrosinase genes in these bivalves are expressed at relatively high levels in the mantle, the organ responsible for shell fabrication. Detailed comparisons of tyrosinase gene expression in different regions of the mantle in two closely related pearl oysters, P. maxima and P. margaritifera, reveals that recently evolved orthologous tyrosinase genes can have markedly different expression profiles. The expansion of tyrosinase genes in these oysters and their co-option into the mantle's gene regulatory network is consistent with mollusc shell formation being underpinned by a rapidly evolving transcriptome.

  4. Evolutionary dynamism of the primate LRRC37 gene family

    PubMed Central

    Giannuzzi, Giuliana; Siswara, Priscillia; Malig, Maika; Marques-Bonet, Tomas; Mullikin, James C.; Ventura, Mario; Eichler, Evan E.

    2013-01-01

    Core duplicons in the human genome represent ancestral duplication modules shared by the majority of intrachromosomal duplication blocks within a given chromosome. These cores are associated with the emergence of novel gene families in the hominoid lineage, but their genomic organization and gene characterization among other primates are largely unknown. Here, we investigate the genomic organization and expression of the core duplicon on chromosome 17 that led to the expansion of LRRC37 during primate evolution. A comparison of the LRRC37 gene family organization in human, orangutan, macaque, marmoset, and lemur genomes shows the presence of both orthologous and species-specific gene copies in all primate lineages. Expression profiling in mouse, macaque, and human tissues reveals that the ancestral expression of LRRC37 was restricted to the testis. In the hominid lineage, the pattern of LRRC37 became increasingly ubiquitous, with significantly higher levels of expression in the cerebellum and thymus, and showed a remarkable diversity of alternative splice forms. Transfection studies in HeLa cells indicate that the human FLAG-tagged recombinant LRRC37 protein is secreted after cleavage of a transmembrane precursor and its overexpression can induce filipodia formation. PMID:23064749

  5. The Evolution of Novelty in Conserved Gene Families

    PubMed Central

    Markov, Gabriel V.; Sommer, Ralf J.

    2012-01-01

    One of the major aims of contemporary evolutionary biology is the understanding of the current pattern of biological diversity. This involves, first, the description of character distribution at various nodes of the phylogenetic tree of life and, second, the functional explanation of such changes. The analysis of character distribution is a powerful tool at both the morphological and molecular levels. Recent high-throughput sequencing approaches provide new opportunities to study the genetic architecture of organisms at the genome-wide level. In eukaryotes, one overarching finding is the absence of simple correlations of gene count and biological complexity. Instead, the domain architecture of proteins is becoming a central focus for large-scale evolutionary innovations. Here, we review examples of the evolution of novelty in conserved gene families in insects and nematodes. We highlight how in the absence of whole-genome duplications molecular novelty can arise, how members of gene families have diversified at distinct mechanistic levels, and how gene expression can be maintained in the context of multiple innovations in regulatory mechanisms. PMID:22779028

  6. Influence of the PsbA1/PsbA3, Ca(2+)/Sr(2+) and Cl(-)/Br(-) exchanges on the redox potential of the primary quinone Q(A) in Photosystem II from Thermosynechococcus elongatus as revealed by spectroelectrochemistry.

    PubMed

    Kato, Yuki; Shibamoto, Tadao; Yamamoto, Shoichi; Watanabe, Tadashi; Ishida, Naoko; Sugiura, Miwa; Rappaport, Fabrice; Boussac, Alain

    2012-11-01

    Ca(2+) and Cl(-) ions are essential elements for the oxygen evolution activity of photosystem II (PSII). It has been demonstrated that these ions can be exchanged with Sr(2+) and Br(-), respectively, and that these ion exchanges modify the kinetics of some electron transfer reactions at the Mn₄Ca cluster level (Ishida et al., J. Biol. Chem. 283 (2008) 13330-13340). It has been proposed from thermoluminescence experiments that the kinetic effects arise, at least in part, from a decrease in the free energy level of the Mn(4)Ca cluster in the S₃ state though some changes on the acceptor side were also observed. Therefore, in the present work, by using thin-layer cell spectroelectrochemistry, the effects of the Ca(2+)/Sr(2+) and Cl(-)/Br(-) exchanges on the redox potential of the primary quinone electron acceptor Q(A), E(m)(Q(A)/Q(A)(-)), were investigated. Since the previous studies on the Ca(2+)/Sr(2+) and Cl(-)/Br(-) exchanges were performed in PsbA3-containing PSII purified from the thermophilic cyanobacterium Thermosynechococcus elongatus, we first investigated the influences of the PsbA1/PsbA3 exchange on E(m)(Q(A)/Q(A)(-)). Here we show that i) the E(m)(Q(A)/Q(A)(-)) was up-shifted by ca. +38mV in PsbA3-PSII when compared to PsbA1-PSII and ii) the Ca(2+)/Sr(2+) exchange up-shifted the E(m)(Q(A)/Q(A)(-)) by ca. +27mV, whereas the Cl(-)/Br(-) exchange hardly influenced E(m)(Q(A)/Q(A)(-)). On the basis of the results of E(m)(Q(A)/Q(A)(-)) together with previous thermoluminescence measurements, the ion-exchange effects on the energetics in PSII are discussed.

  7. Evolutionary conservation and diversification of Rh family genes and proteins

    PubMed Central

    Huang, Cheng-Han; Peng, Jianbin

    2005-01-01

    Rhesus (Rh) proteins were first identified in human erythroid cells and recently in other tissues. Like ammonia transporter (Amt) proteins, their only homologues, Rh proteins have the 12 transmembrane-spanning segments characteristic of transporters. Many think Rh and Amt proteins transport the same substrate, \\documentclass[12pt]{minimal} \\usepackage{amsmath} \\usepackage{wasysym} \\usepackage{amsfonts} \\usepackage{amssymb} \\usepackage{amsbsy} \\usepackage{mathrsfs} \\setlength{\\oddsidemargin}{-69pt} \\begin{document} \\begin{equation*}{\\mathrm{NH}}_{3}/{\\mathrm{NH}}_{4}^{+}\\end{equation*}\\end{document}, whereas others think that Rh proteins transport CO2 and Amt proteins NH3. In the latter view, Rh and Amt are different biological gas channels. To reconstruct the phylogeny of the Rh family and study its coexistence with and relationship to Amt in depth, we analyzed 111 Rh genes and 260 Amt genes. Although Rh and Amt are found together in organisms as diverse as unicellular eukaryotes and sea squirts, Rh genes apparently arose later, because they are rare in prokaryotes. However, Rh genes are prominent in vertebrates, in which Amt genes disappear. In organisms with both types of genes, Rh had apparently diverged away from Amt rapidly and then evolved slowly over a long period. Functionally divergent amino acid sites are clustered in transmembrane segments and around the gas-conducting lumen recently identified in Escherichia coli AmtB, in agreement with Rh proteins having new substrate specificity. Despite gene duplications and mutations, the Rh paralogous groups all have apparently been subject to strong purifying selection indicating functional conservation. Genes encoding the classical Rh proteins in mammalian red cells show higher nucleotide substitution rates at nonsynonymous codon positions than other Rh genes, a finding that suggests a possible role for these proteins in red cell morphogenetic evolution. PMID:16227429

  8. Evolutionary conservation and diversification of Rh family genes and proteins.

    PubMed

    Huang, Cheng-Han; Peng, Jianbin

    2005-10-25

    Rhesus (Rh) proteins were first identified in human erythroid cells and recently in other tissues. Like ammonia transporter (Amt) proteins, their only homologues, Rh proteins have the 12 transmembrane-spanning segments characteristic of transporters. Many think Rh and Amt proteins transport the same substrate, NH(3)/NH(4)(+), whereas others think that Rh proteins transport CO(2) and Amt proteins NH(3). In the latter view, Rh and Amt are different biological gas channels. To reconstruct the phylogeny of the Rh family and study its coexistence with and relationship to Amt in depth, we analyzed 111 Rh genes and 260 Amt genes. Although Rh and Amt are found together in organisms as diverse as unicellular eukaryotes and sea squirts, Rh genes apparently arose later, because they are rare in prokaryotes. However, Rh genes are prominent in vertebrates, in which Amt genes disappear. In organisms with both types of genes, Rh had apparently diverged away from Amt rapidly and then evolved slowly over a long period. Functionally divergent amino acid sites are clustered in transmembrane segments and around the gas-conducting lumen recently identified in Escherichia coli AmtB, in agreement with Rh proteins having new substrate specificity. Despite gene duplications and mutations, the Rh paralogous groups all have apparently been subject to strong purifying selection indicating functional conservation. Genes encoding the classical Rh proteins in mammalian red cells show higher nucleotide substitution rates at nonsynonymous codon positions than other Rh genes, a finding that suggests a possible role for these proteins in red cell morphogenetic evolution.

  9. PRODH gene is associated with executive function in schizophrenic families.

    PubMed

    Li, Tao; Ma, Xiaohong; Hu, Xun; Wang, Yingcheng; Yan, Chengying; Meng, Huaqing; Liu, Xiehe; Toulopoulou, Timothea; Murray, Robin M; Collier, David A

    2008-07-05

    The aim of this study was to investigate the relationship between polymorphisms in the PRODH and COMT genes and selected neurocognitive functions. Six SNPs in PRODH and two SNPs in COMT were genotyped in 167 first-episode schizophrenic families who had been assessed by a set of 14 neuropsychological tests. Neuropsychological measures were selected as quantitative traits for association analysis. The haplotype of SNPs PRODH 1945T/C and PRODH 1852G/A was associated with impaired performance on the Tower of Hanoi, a problem-solving task mainly reflecting planning capacity. There was no significant evidence for association with any other neuropsychological traits for other SNPs or haplotypes of paired SNPs in the two genes. This study takes previous findings of association between PRODH and schizophrenia further by associating variation within the gene with performance on a neurocognitive trait characteristic of the illness. It fails to confirm previous reports of an association between COMT and cognitive function.

  10. Biofuel Potential of Plants Transformed Genetically with NAC Family Genes

    PubMed Central

    Singh, Sadhana; Grover, Atul; Nasim, M.

    2016-01-01

    NAC genes contribute to enhance survivability of plants under conditions of environmental stress and in secondary growth of the plants, thereby building biomass. Thus, genetic transformation of plants using NAC genes provides a possibility to tailor biofuel plants. Over-expression studies have indicated that NAC family genes can provide tolerance to various biotic and abiotic stresses, either by physiological or biochemical changes at the cellular level, or by affecting visible morphological and anatomical changes, for example, by development of lateral roots in a number of plants. Over-expression of these genes also work as triggers for development of secondary cell walls. In our laboratory, we have observed a NAC gene from Lepidium latifolium contributing to both enhanced biomass as well as cold stress tolerance of model plants tobacco. Thus, we have reviewed all the developments of genetic engineering using NAC genes which could enhance the traits required for biofuel plants, either by enhancing the stress tolerance or by enhancing the biomass of the plants. PMID:26858739

  11. PlantTribes: a gene and gene family resource for comparative genomics in plants.

    PubMed

    Wall, P Kerr; Leebens-Mack, Jim; Müller, Kai F; Field, Dawn; Altman, Naomi S; dePamphilis, Claude W

    2008-01-01

    The PlantTribes database (http://fgp.huck.psu.edu/tribe.html) is a plant gene family database based on the inferred proteomes of five sequenced plant species: Arabidopsis thaliana, Carica papaya, Medicago truncatula, Oryza sativa and Populus trichocarpa. We used the graph-based clustering algorithm MCL [Van Dongen (Technical Report INS-R0010 2000) and Enright et al. (Nucleic Acids Res. 2002; 30: 1575-1584)] to classify all of these species' protein-coding genes into putative gene families, called tribes, using three clustering stringencies (low, medium and high). For all tribes, we have generated protein and DNA alignments and maximum-likelihood phylogenetic trees. A parallel database of microarray experimental results is linked to the genes, which lets researchers identify groups of related genes and their expression patterns. Unified nomenclatures were developed, and tribes can be related to traditional gene families and conserved domain identifiers. SuperTribes, constructed through a second iteration of MCL clustering, connect distant, but potentially related gene clusters. The global classification of nearly 200 000 plant proteins was used as a scaffold for sorting approximately 4 million additional cDNA sequences from over 200 plant species. All data and analyses are accessible through a flexible interface allowing users to explore the classification, to place query sequences within the classification, and to download results for further study.

  12. Gene Turnover in the Avian Globin Gene Families and Evolutionary Changes in Hemoglobin Isoform Expression

    PubMed Central

    Opazo, Juan C.; Hoffmann, Federico G.; Natarajan, Chandrasekhar; Witt, Christopher C.; Berenbrink, Michael; Storz, Jay F.

    2015-01-01

    The apparent stasis in the evolution of avian chromosomes suggests that birds may have experienced relatively low rates of gene gain and loss in multigene families. To investigate this possibility and to explore the phenotypic consequences of variation in gene copy number, we examined evolutionary changes in the families of genes that encode the α- and β-type subunits of hemoglobin (Hb), the tetrameric α2β2 protein responsible for blood-O2 transport. A comparative genomic analysis of 52 bird species revealed that the size and membership composition of the α- and β-globin gene families have remained remarkably constant during approximately 100 My of avian evolution. Most interspecific variation in gene content is attributable to multiple independent inactivations of the αD-globin gene, which encodes the α-chain subunit of a functionally distinct Hb isoform (HbD) that is expressed in both embryonic and definitive erythrocytes. Due to consistent differences in O2-binding properties between HbD and the major adult-expressed Hb isoform, HbA (which incorporates products of the αA-globin gene), recurrent losses of αD-globin contribute to among-species variation in blood-O2 affinity. Analysis of HbA/HbD expression levels in the red blood cells of 122 bird species revealed high variability among lineages and strong phylogenetic signal. In comparison with the homologous gene clusters in mammals, the low retention rate for lineage-specific gene duplicates in the avian globin gene clusters suggests that the developmental regulation of Hb synthesis in birds may be more highly conserved, with orthologous genes having similar stage-specific expression profiles and similar functional properties in disparate taxa. PMID:25502940

  13. Gene turnover in the avian globin gene families and evolutionary changes in hemoglobin isoform expression.

    PubMed

    Opazo, Juan C; Hoffmann, Federico G; Natarajan, Chandrasekhar; Witt, Christopher C; Berenbrink, Michael; Storz, Jay F

    2015-04-01

    The apparent stasis in the evolution of avian chromosomes suggests that birds may have experienced relatively low rates of gene gain and loss in multigene families. To investigate this possibility and to explore the phenotypic consequences of variation in gene copy number, we examined evolutionary changes in the families of genes that encode the α- and β-type subunits of hemoglobin (Hb), the tetrameric α2β2 protein responsible for blood-O2 transport. A comparative genomic analysis of 52 bird species revealed that the size and membership composition of the α- and β-globin gene families have remained remarkably constant during approximately 100 My of avian evolution. Most interspecific variation in gene content is attributable to multiple independent inactivations of the α(D)-globin gene, which encodes the α-chain subunit of a functionally distinct Hb isoform (HbD) that is expressed in both embryonic and definitive erythrocytes. Due to consistent differences in O2-binding properties between HbD and the major adult-expressed Hb isoform, HbA (which incorporates products of the α(A)-globin gene), recurrent losses of α(D)-globin contribute to among-species variation in blood-O2 affinity. Analysis of HbA/HbD expression levels in the red blood cells of 122 bird species revealed high variability among lineages and strong phylogenetic signal. In comparison with the homologous gene clusters in mammals, the low retention rate for lineage-specific gene duplicates in the avian globin gene clusters suggests that the developmental regulation of Hb synthesis in birds may be more highly conserved, with orthologous genes having similar stage-specific expression profiles and similar functional properties in disparate taxa.

  14. Evolutionary history of chordate PAX genes: dynamics of change in a complex gene family.

    PubMed

    Paixão-Côrtes, Vanessa Rodrigues; Salzano, Francisco Mauro; Bortolini, Maria Cátira

    2013-01-01

    Paired box (PAX) genes are transcription factors that play important roles in embryonic development. Although the PAX gene family occurs in animals only, it is widely distributed. Among the vertebrates, its 9 genes appear to be the product of complete duplication of an original set of 4 genes, followed by an additional partial duplication. Although some studies of PAX genes have been conducted, no comprehensive survey of these genes across the entire taxonomic unit has yet been attempted. In this study, we conducted a detailed comparison of PAX sequences from 188 chordates, which revealed restricted variation. The absence of PAX4 and PAX8 among some species of reptiles and birds was notable; however, all 9 genes were present in all 74 mammalian genomes investigated. A search for signatures of selection indicated that all genes are subject to purifying selection, with a possible constraint relaxation in PAX4, PAX7, and PAX8. This result indicates asymmetric evolution of PAX family genes, which can be associated with the emergence of adaptive novelties in the chordate evolutionary trajectory.

  15. Evolutionary History of Chordate PAX Genes: Dynamics of Change in a Complex Gene Family

    PubMed Central

    Paixão-Côrtes, Vanessa Rodrigues; Salzano, Francisco Mauro; Bortolini, Maria Cátira

    2013-01-01

    Paired box (PAX) genes are transcription factors that play important roles in embryonic development. Although the PAX gene family occurs in animals only, it is widely distributed. Among the vertebrates, its 9 genes appear to be the product of complete duplication of an original set of 4 genes, followed by an additional partial duplication. Although some studies of PAX genes have been conducted, no comprehensive survey of these genes across the entire taxonomic unit has yet been attempted. In this study, we conducted a detailed comparison of PAX sequences from 188 chordates, which revealed restricted variation. The absence of PAX4 and PAX8 among some species of reptiles and birds was notable; however, all 9 genes were present in all 74 mammalian genomes investigated. A search for signatures of selection indicated that all genes are subject to purifying selection, with a possible constraint relaxation in PAX4, PAX7, and PAX8. This result indicates asymmetric evolution of PAX family genes, which can be associated with the emergence of adaptive novelties in the chordate evolutionary trajectory. PMID:24023886

  16. The SUPERMAN gene family in Populus: nucleotide diversity and gene expression in a dioecious plant.

    PubMed

    Song, Yuepeng; Ma, Kaifeng; Ci, Dong; Tian, Xueyuan; Zhang, Zhiyi; Zhang, Deqiang

    2013-08-01

    SUP gene family expression and regulation patterns reported in dioecious woody plant. Phylogenetic and nucleotide diversity analysis indicated PtoSUP1 is highly conserved and has undergone strong purifying selection. The molecular basis of SUPERMAN (SUP) regulation during floral development in monoecious plants has been extensively studied, but little is known of the SUP gene family in dioecious woody plants. In this study, we systematically examined the diversification of the SUP gene family in Populus, integrating genomic organization, expression, and phylogeny data. SUP family members showed sex-specific expression throughout flower development. Transcript profiling of rare gynomonoecious poplar flowers revealed that a significant reduction in PtoSUP1 mRNA might be important for stamen development in gynomonoecious poplar flowers. We found that the coding regions of Populus SUP genes are very highly conserved and that synonymous sites in exon regions have undergone strong purifying selection during SUP evolution in Populus. These results indicate that SUP genes play an important role in floral development of dioecious plants. Expression analysis of SUP suggested possible regulatory mechanisms for gynomonoecious poplar flower development. These findings provide an important insight into the mechanisms of the evolution of SUP function and may help enable engineered regulation of flower development for breeding improved tree varieties.

  17. Cancer genetics and genomics of human FOX family genes.

    PubMed

    Katoh, Masuko; Igarashi, Maki; Fukuda, Hirokazu; Nakagama, Hitoshi; Katoh, Masaru

    2013-01-28

    Forkhead-box (FOX) family proteins, involved in cell growth and differentiation as well as embryogenesis and longevity, are DNA-binding proteins regulating transcription and DNA repair. The focus of this review is on the mechanisms of FOX-related human carcinogenesis. FOXA1 is overexpressed as a result of gene amplification in lung cancer, esophageal cancer, ER-positive breast cancer and anaplastic thyroid cancer and is point-mutated in prostate cancer. FOXA1 overexpression in breast cancer and prostate cancer is associated with good or poor prognosis, respectively. Single nucleotide polymorphism (SNP) within the 5'-UTR of the FOXE1 (TTF2) gene is associated with thyroid cancer risk. FOXF1 overexpression in breast cancer is associated with epithelial-to-mesenchymal transition (EMT). FOXM1 is overexpressed owing to gene amplification in basal-type breast cancer and diffuse large B-cell lymphoma (DLBCL), and it is transcriptionally upregulated owing to Hedgehog-GLI, hypoxia-HIF1α or YAP-TEAD signaling activation. FOXM1 overexpression leads to malignant phenotypes by directly upregulating CCNB1, AURKB, MYC and SKP2 and indirectly upregulating ZEB1 and ZEB2 via miR-200b downregulation. Tumor suppressor functions of FOXO transcription factors are lost in cancer cells as a result of chromosomal translocation, deletion, miRNA-mediated repression, AKT-mediated cytoplasmic sequestration or ubiquitination-mediated proteasomal degradation. FOXP1 is upregulated as a result of gene fusion or amplification in DLBCL and MALT lymphoma and also repression of miRNAs, such as miR-1, miR-34a and miR-504. FOXP1 overexpression is associated with poor prognosis in DLBCL, gastric MALT lymphoma and hepatocellular carcinoma but with good prognosis in breast cancer. In neuroblastoma, the entire coding region of the FOXR1 (FOXN5) gene is fused to the MLL or the PAFAH1B gene owing to interstitial deletions. FOXR1 fusion genes function as oncogenes that repress transcription of FOXO target

  18. Molecular genetics of the aip gene in familial pituitary tumorigenesis.

    PubMed

    Tahir, Asil; Chahal, Harvinder S; Korbonits, Márta

    2010-01-01

    Pituitary adenomas usually occur as sporadic tumors, but familial cases are now increasingly identified. As opposed to multiple endocrine neoplasia type 1 and Carney complex, in familial isolated pituitary adenoma (FIPA) syndrome no other disease is associated with the familial occurrence of pituitary adenomas. It is an autosomal dominant disease with incomplete variable penetrance. Approximately 20% of patients with FIPA harbour germline mutations in the aryl hydrocarbon receptor-interacting protein (AIP) gene located on 11q13. Patients with AIP mutations have an overwhelming predominance of somatotroph and lactotroph adenomas, which often present in childhood or young adulthood. AIP, originally identified as a molecular co-chaperone of several nuclear receptors, is thought to act as a tumor suppressor gene; overexpression of wild-type, but not mutant AIP, reduces cell proliferation while knockdown of AIP stimulates it. AIP is shown to bind various proteins, including the aryl hydrocarbon receptor, Hsp90, phosphodiesterases, survivin, RET and the glucocorticoid receptor, but currently it is not clear which interaction has the leading role in pituitary tumorigenesis. This chapter summarizes the available clinical and molecular data regarding the role of AIP in the pituitary gland.

  19. FoxO gene family evolution in vertebrates

    PubMed Central

    Wang, Minghui; Zhang, Xiangzhe; Zhao, Hongbo; Wang, Qishan; Pan, Yuchun

    2009-01-01

    Background Forkhead box, class O (FoxO) belongs to the large family of forkhead transcription factors that are characterized by a conserved forkhead box DNA-binding domain. To date, the FoxO group has four mammalian members: FoxO1, FoxO3a, FoxO4 and FoxO6, which are orthologs of DAF16, an insulin-responsive transcription factor involved in regulating longevity of worms and flies. The degree of homology between these four members is high, especially in the forkhead domain, which contains the DNA-binding interface. Yet, mouse FoxO knockouts have revealed that each FoxO gene has its unique role in the physiological process. Whether the functional divergences are primarily due to adaptive selection pressure or relaxed selective constraint remains an open question. As such, this study aims to address the evolutionary mode of FoxO, which may lead to the functional divergence. Results Sequence similarity searches have performed in genome and scaffold data to identify homologues of FoxO in vertebrates. Phylogenetic analysis was used to characterize the family evolutionary history by identifying two duplications early in vertebrate evolution. To determine the mode of evolution in vertebrates, we performed a rigorous statistical analysis with FoxO gene sequences, including relative rate ratio tests, branch-specific dN/dS ratio tests, site-specific dN/dS ratio tests, branch-site dN/dS ratio tests and clade level amino acid conservation/variation patterns analysis. Our results suggest that FoxO is constrained by strong purifying selection except four sites in FoxO6, which have undergone positive Darwinian selection. The functional divergence in this family is best explained by either relaxed purifying selection or positive selection. Conclusion We present a phylogeny describing the evolutionary history of the FoxO gene family and show that the genes have evolved through duplications followed by purifying selection except for four sites in FoxO6 fixed by positive selection lie

  20. Eyes absent: a gene family found in several metazoan phyla.

    PubMed

    Duncan, M K; Kos, L; Jenkins, N A; Gilbert, D J; Copeland, N G; Tomarev, S I

    1997-07-01

    Genes related to the Drosophila eyes absent gene were identified in vertebrates (mouse and human), mollusks (squid), and nematodes (C. elegans). Proteins encoded by these genes consist of conserved C-terminal and variable N-terminal domains. In the conserved 271-amino acid C-terminal region, Drosophila and vertebrate proteins are 65-67% identical. A vertebrate homolog of eyes absent, designated Eya2, was mapped to Chromosome (Chr) 2 in the mouse and to Chr 20q13.1 in human. Eya2 shows a dynamic pattern of expression during development. In the mouse, expression of Eya2 was first detected in 8.5-day embryos in the region of head ectoderm fated to become the forebrain. At later stages of development, Eya2 is expressed in the olfactory placode and in a variety of neural crest derivatives. In the eye, expression of Eya2 was first detected after formation of the lens vesicle. At day 17.5, the highest level of Eya2 mRNA was observed in primary lens fibers. Low levels of Eya2 expression was detected in retina, sclera, and cornea. By postnatal day 10, Eya2 was expressed in secondary lens fibers, cornea, and retina. Although Eya2 is expressed relatively late in eye development, it belongs to the growing list of factors that may be essential for eye development across metazoan phyla. Like members of the Pax-6 gene family, eyes absent gene family members were probably first involved in functions not related to vision, with recruitment for visual system formation and function occurring later.

  1. Amelogenesis Imperfecta: 1 Family, 2 Phenotypes, and 2 Mutated Genes.

    PubMed

    Prasad, M K; Laouina, S; El Alloussi, M; Dollfus, H; Bloch-Zupan, A

    2016-12-01

    Amelogenesis imperfecta (AI) is a clinically and genetically heterogeneous group of diseases characterized by enamel defects. The authors have identified a large consanguineous Moroccan family segregating different clinical subtypes of hypoplastic and hypomineralized AI in different individuals within the family. Using targeted next-generation sequencing, the authors identified a novel heterozygous nonsense mutation in COL17A1 (c.1873C>T, p.R625*) segregating with hypoplastic AI and a novel homozygous 8-bp deletion in C4orf26 (c.39_46del, p.Cys14Glyfs*18) segregating with hypomineralized-hypoplastic AI in this family. This study highlights the phenotypic and genotypic heterogeneity of AI that can exist even within a single consanguineous family. Furthermore, the identification of novel mutations in COL17A1 and C4orf26 and their correlation with distinct AI phenotypes can contribute to a better understanding of the pathophysiology of AI and the contribution of these genes to amelogenesis.

  2. The ANKH gene and familial calcium pyrophosphate dihydrate deposition disease.

    PubMed

    Netter, Patrick; Bardin, Thomas; Bianchi, Arnaud; Richette, Pascal; Loeuille, Damien

    2004-09-01

    Familial calcium pyrophosphate dihydrate deposition (CPPD) disease is a chronic condition in which CPPD microcrystals deposit in the joint fluid, cartilage, and periarticular tissues. Two forms of familial CPPD disease have been identified: CCAL1 and CCAL2. The CCAL1 locus is located on the long arm of chromosome 8 and is associated with CPPD and severe osteoarthritis. The CCAL2 locus has been mapped to the short arm of chromosome 5 and identified in families from the Alsace region of France and the United Kingdom. The ANKH protein is involved in pyrophosphate metabolism and, more specifically, in pyrophosphate transport from the intracellular to the extracellular compartment. Numerous ANKH gene mutations cause familial CCAL2; they enhance ANKH protein activity, thereby elevating extracellular pyrophosphate levels and promoting the formation of pyrophosphate crystals, which produce the manifestations of the disease. Recent studies show that growth factors and cytokines can modify the expression of the normal ANKH protein. These results suggest a role for ANKH in sporadic CPPD disease and in CPPD associated with degenerative disease.

  3. The Tomato Terpene Synthase Gene Family1[W][OA

    PubMed Central

    Falara, Vasiliki; Akhtar, Tariq A.; Nguyen, Thuong T.H.; Spyropoulou, Eleni A.; Bleeker, Petra M.; Schauvinhold, Ines; Matsuba, Yuki; Bonini, Megan E.; Schilmiller, Anthony L.; Last, Robert L.; Schuurink, Robert C.; Pichersky, Eran

    2011-01-01

    Compounds of the terpenoid class play numerous roles in the interactions of plants with their environment, such as attracting pollinators and defending the plant against pests. We show here that the genome of cultivated tomato (Solanum lycopersicum) contains 44 terpene synthase (TPS) genes, including 29 that are functional or potentially functional. Of these 29 TPS genes, 26 were expressed in at least some organs or tissues of the plant. The enzymatic functions of eight of the TPS proteins were previously reported, and here we report the specific in vitro catalytic activity of 10 additional tomato terpene synthases. Many of the tomato TPS genes are found in clusters, notably on chromosomes 1, 2, 6, 8, and 10. All TPS family clades previously identified in angiosperms are also present in tomato. The largest clade of functional TPS genes found in tomato, with 12 members, is the TPS-a clade, and it appears to encode only sesquiterpene synthases, one of which is localized to the mitochondria, while the rest are likely cytosolic. A few additional sesquiterpene synthases are encoded by TPS-b clade genes. Some of the tomato sesquiterpene synthases use z,z-farnesyl diphosphate in vitro as well, or more efficiently than, the e,e-farnesyl diphosphate substrate. Genes encoding monoterpene synthases are also prevalent, and they fall into three clades: TPS-b, TPS-g, and TPS-e/f. With the exception of two enzymes involved in the synthesis of ent-kaurene, the precursor of gibberellins, no other tomato TPS genes could be demonstrated to encode diterpene synthases so far. PMID:21813655

  4. Family Size Evolution in Drosophila Chemosensory Gene Families: A Comparative Analysis with a Critical Appraisal of Methods

    PubMed Central

    Almeida, Francisca C.; Sánchez-Gracia, Alejandro; Campos, Jose Luis; Rozas, Julio

    2014-01-01

    Gene turnover rates and the evolution of gene family sizes are important aspects of genome evolution. Here, we use curated sequence data of the major chemosensory gene families from Drosophila—the gustatory receptor, odorant receptor, ionotropic receptor, and odorant-binding protein families—to conduct a comparative analysis among families, exploring different methods to estimate gene birth and death rates, including an ad hoc simulation study. Remarkably, we found that the state-of-the-art methods may produce very different rate estimates, which may lead to disparate conclusions regarding the evolution of chemosensory gene family sizes in Drosophila. Among biological factors, we found that a peculiarity of D. sechellia’s gene turnover rates was a major source of bias in global estimates, whereas gene conversion had negligible effects for the families analyzed herein. Turnover rates vary considerably among families, subfamilies, and ortholog groups although all analyzed families were quite dynamic in terms of gene turnover. Computer simulations showed that the methods that use ortholog group information appear to be the most accurate for the Drosophila chemosensory families. Most importantly, these results reveal the potential of rate heterogeneity among lineages to severely bias some turnover rate estimation methods and the need of further evaluating the performance of these methods in a more diverse sampling of gene families and phylogenetic contexts. Using branch-specific codon substitution models, we find further evidence of positive selection in recently duplicated genes, which attests to a nonneutral aspect of the gene birth-and-death process. PMID:24951565

  5. Characterization of six IL-17 family genes in miiuy croaker and evolution analysis of vertebrate IL-17 family.

    PubMed

    Yang, Qiong; Sun, Yuena; Su, Xiurong; Li, Taiwu; Xu, Tianjun

    2016-02-01

    Interleukin-17 (IL-17) family is a cytokine family which is one of the major signaling molecules family involved in immunity. Six member of IL-17 family cytokines (IL-17A-F) were found in mammals. In fish, all IL-17 family genes except IL-17B and IL-17E have been isolated and identified. Besides, IL-17N is uniquely found from teleosts. IL-17 family genes are widely studied in mammals, but have not been widely reported in lower vertebrates. In this study, we identify six IL-17 family genes (IL-17A/F1-3, IL-17C, IL-17D, IL-17N) from miiuy croaker, using LPS and poly (I:C) to infect miiuy croaker in order to analyze the expression response to bacteria and virus and expression in normal tissues. Challenge experiment showed that miiuy croaker IL-17 family genes exhibited more sensitive response to the poly (I:C) than the LPS. The expression of IL-17 in un-stimulated tissues showed that different gene has expressed in different tissues. Through the analysis of IL-17 family members exist in various representative species to study the evolution of the IL-17 family, and the result showed IL-17A/F, IL-17B, IL-17C, and IL-17D should be present in early gnathostomes species. Copyright © 2015 Elsevier Ltd. All rights reserved.

  6. Visualization of multiple alignments, phylogenies and gene family evolution.

    PubMed

    Procter, James B; Thompson, Julie; Letunic, Ivica; Creevey, Chris; Jossinet, Fabrice; Barton, Geoffrey J

    2010-03-01

    Software for visualizing sequence alignments and trees are essential tools for life scientists. In this review, we describe the major features and capabilities of a selection of stand-alone and web-based applications useful when investigating the function and evolution of a gene family. These range from simple viewers, to systems that provide sophisticated editing and analysis functions. We conclude with a discussion of the challenges that these tools now face due to the flood of next generation sequence data and the increasingly complex network of bioinformatics information sources.

  7. Management of asymptomatic gene carriers of transthyretin familial amyloid polyneuropathy

    PubMed Central

    Barroso, Fabio; González‐Duarte, Alejandra; Conceição, Isabel; Obici, Laura; Keohane, Denis; Amass, Leslie

    2016-01-01

    ABSTRACT Transthyretin familial amyloid polyneuropathy (TTR‐FAP) is a rare, severe, and irreversible, adult‐onset, hereditary disorder caused by autosomal‐dominant mutations in the TTR gene that increase the intrinsic propensity of transthyretin protein to misfold and deposit systemically as insoluble amyloid fibrils in nerve tissues, the heart, and other organs. TTR‐FAP is characterized by relentless, progressively debilitating polyneuropathy, and leads to death, on average, within 10 years of symptom onset without treatment. With increased availability of disease‐modifying treatment options for a wider spectrum of patients with TTR‐FAP, timely detection of the disease may offer substantial clinical benefits. This review discusses mutation‐specific predictive genetic testing in first‐degree relatives of index patients diagnosed with TTR‐FAP and the structured clinical follow‐up of asymptomatic gene carriers for prompt diagnosis and early therapeutic intervention before accumulation of substantial damage. Muscle Nerve 54: 353–360, 2016 PMID:27273296

  8. Management of asymptomatic gene carriers of transthyretin familial amyloid polyneuropathy.

    PubMed

    Schmidt, Hartmut H-J; Barroso, Fabio; González-Duarte, Alejandra; Conceição, Isabel; Obici, Laura; Keohane, Denis; Amass, Leslie

    2016-09-01

    Transthyretin familial amyloid polyneuropathy (TTR-FAP) is a rare, severe, and irreversible, adult-onset, hereditary disorder caused by autosomal-dominant mutations in the TTR gene that increase the intrinsic propensity of transthyretin protein to misfold and deposit systemically as insoluble amyloid fibrils in nerve tissues, the heart, and other organs. TTR-FAP is characterized by relentless, progressively debilitating polyneuropathy, and leads to death, on average, within 10 years of symptom onset without treatment. With increased availability of disease-modifying treatment options for a wider spectrum of patients with TTR-FAP, timely detection of the disease may offer substantial clinical benefits. This review discusses mutation-specific predictive genetic testing in first-degree relatives of index patients diagnosed with TTR-FAP and the structured clinical follow-up of asymptomatic gene carriers for prompt diagnosis and early therapeutic intervention before accumulation of substantial damage. Muscle Nerve 54: 353-360, 2016.

  9. Repeated Evolution of Chimeric Fusion Genes in the β-Globin Gene Family of Laurasiatherian Mammals

    PubMed Central

    Gaudry, Michael J.; Storz, Jay F.; Butts, Gary Tyler; Campbell, Kevin L.; Hoffmann, Federico G.

    2014-01-01

    The evolutionary fate of chimeric fusion genes may be strongly influenced by their recombinational mode of origin and the nature of functional divergence between the parental genes. In the β-globin gene family of placental mammals, the two postnatally expressed δ- and β-globin genes (HBD and HBB, respectively) have a propensity for recombinational exchange via gene conversion and unequal crossing-over. In the latter case, there are good reasons to expect differences in retention rates for the reciprocal HBB/HBD and HBD/HBB fusion genes due to thalassemia pathologies associated with the HBD/HBB “Lepore” deletion mutant in humans. Here, we report a comparative genomic analysis of the mammalian β-globin gene cluster, which revealed that chimeric HBB/HBD fusion genes originated independently in four separate lineages of laurasiatherian mammals: Eulipotyphlans (shrews, moles, and hedgehogs), carnivores, microchiropteran bats, and cetaceans. In cases where an independently derived “anti-Lepore” duplication mutant has become fixed, the parental HBD and/or HBB genes have typically been inactivated or deleted, so that the newly created HBB/HBD fusion gene is primarily responsible for synthesizing the β-type subunits of adult and fetal hemoglobin (Hb). Contrary to conventional wisdom that the HBD gene is a vestigial relict that is typically inactivated or expressed at negligible levels, we show that HBD-like genes often encode a substantial fraction (20–100%) of β-chain Hbs in laurasiatherian taxa. Our results indicate that the ascendancy or resuscitation of genes with HBD-like coding sequence requires the secondary acquisition of HBB-like promoter sequence via unequal crossing-over or interparalog gene conversion. PMID:24814285

  10. Repeated evolution of chimeric fusion genes in the β-globin gene family of laurasiatherian mammals.

    PubMed

    Gaudry, Michael J; Storz, Jay F; Butts, Gary Tyler; Campbell, Kevin L; Hoffmann, Federico G

    2014-05-09

    The evolutionary fate of chimeric fusion genes may be strongly influenced by their recombinational mode of origin and the nature of functional divergence between the parental genes. In the β-globin gene family of placental mammals, the two postnatally expressed δ- and β-globin genes (HBD and HBB, respectively) have a propensity for recombinational exchange via gene conversion and unequal crossing-over. In the latter case, there are good reasons to expect differences in retention rates for the reciprocal HBB/HBD and HBD/HBB fusion genes due to thalassemia pathologies associated with the HBD/HBB "Lepore" deletion mutant in humans. Here, we report a comparative genomic analysis of the mammalian β-globin gene cluster, which revealed that chimeric HBB/HBD fusion genes originated independently in four separate lineages of laurasiatherian mammals: Eulipotyphlans (shrews, moles, and hedgehogs), carnivores, microchiropteran bats, and cetaceans. In cases where an independently derived "anti-Lepore" duplication mutant has become fixed, the parental HBD and/or HBB genes have typically been inactivated or deleted, so that the newly created HBB/HBD fusion gene is primarily responsible for synthesizing the β-type subunits of adult and fetal hemoglobin (Hb). Contrary to conventional wisdom that the HBD gene is a vestigial relict that is typically inactivated or expressed at negligible levels, we show that HBD-like genes often encode a substantial fraction (20-100%) of β-chain Hbs in laurasiatherian taxa. Our results indicate that the ascendancy or resuscitation of genes with HBD-like coding sequence requires the secondary acquisition of HBB-like promoter sequence via unequal crossing-over or interparalog gene conversion. © The Author(s) 2014. Published by Oxford University Press on behalf of the Society for Molecular Biology and Evolution.

  11. Identification and analysis of the metacaspase gene family in tomato.

    PubMed

    Liu, Hui; Liu, Jian; Wei, Yongxuan

    2016-10-21

    Metacaspases play critical roles in developmentally regulated and environmentally induced programmed cell death in plants. In this study, we systematically identified and analyzed metacaspase gene family in tomato (Solanum lycopersicum). The results illustrated that tomato possesses eight metacaspase genes (SlMC1-8) located on chromosomes 1, 3, 5, 9, and 10. SlMC1-6 belonged to type I metacaspases and had 5 exon/4 intron structures. SlMC7 and 8 were type II metacaspases and had 2 and 3 exons, respectively. Expression analysis revealed distinct expression patterns of SlMCs in various tomato tissues. Cis-regulatory element prediction showed that there were many hormone- and stress-related cis-regulatory elements in SlMCs promoter regions. Quantitative real-time PCR analysis further demonstrated that most of the SlMCs were regulated by drought, cold, salt, methyl viologen, and ethephon treatments. This study provides insights into the characteristics of SlMC genes and laid the foundation for further functional analysis of these genes in tomato.

  12. Molecular Evolution of the TET Gene Family in Mammals.

    PubMed

    Akahori, Hiromichi; Guindon, Stéphane; Yoshizaki, Sumio; Muto, Yoshinori

    2015-12-01

    Ten-eleven translocation (TET) proteins, a family of Fe(2+)- and 2-oxoglutarate-dependent dioxygenases, are involved in DNA demethylation. They also help regulate various cellular functions. Three TET paralogs have been identified (TET1, TET2, and TET3) in humans. This study focuses on the evolution of mammalian TET genes. Distinct patterns in TET1 and TET2 vs. TET3 were revealed by codon-based tests of positive selection. Results indicate that TET1 and TET2 genes have experienced positive selection more frequently than TET3 gene, and that the majority of codon sites evolved under strong negative selection. These findings imply that the selective pressure on TET3 may have been relaxed in several lineages during the course of evolution. Our analysis of convergent amino acid substitutions also supports the different evolutionary dynamics among TET gene subfamily members. All of the five amino acid sites that are inferred to have evolved under positive selection in the catalytic domain of TET2 are localized at the protein's outer surface. The adaptive changes of these positively selected amino acid sites could be associated with dynamic interactions between other TET-interacting proteins, and positive selection thus appears to shift the regulatory scheme of TET enzyme function.

  13. Genomics and evolution of the TRIM gene family.

    PubMed

    Meroni, Germana

    2012-01-01

    The TRIM family comprises proteins characterized by the presence of thetripartite motifthat is composed of a RING domain, one or two B-box domains and a Coiled-coil region. These proteins are implicated in a plethora of cellular processes such as apoptosis, cell cycle regulation, muscular physiology and innate immune response. Consistently, their alteration results in several pathological conditions emphasizing their medical relevance. The TRIM members domain structure underscores a common biochemical function as E3 ligases within the ubiquitylation cascade, which is then translated into diverse biological processes. The TRIM proteins represent one of the largest families in mammals counting in human almost 70 members. TRIM proteins are metazoan-specific and have been now identified in several species although the great increase in their number was generated in vertebrate species. The important expansion of the number of TRIM genes underlie the success of the tripartite module in ubiquitylation process. Furthermore, their massive diversification among species was achieved through fast evolution of the TRIM genes implicated in pathogen response.

  14. Identification, Phylogeny, and Transcript of Chitinase Family Genes in Sugarcane

    PubMed Central

    Su, Yachun; Xu, Liping; Wang, Shanshan; Wang, Zhuqing; Yang, Yuting; Chen, Yun; Que, Youxiong

    2015-01-01

    Chitinases are pathogensis-related proteins, which play an important role in plant defense mechanisms. The role of the sugarcane chitinase family genes remains unclear due to the highly heterozygous and aneuploidy chromosome genetic background of sugarcane. Ten differentially expressed chitinase genes (belonging to class I~VII) were obtained from RNA-seq analysis of both incompatible and compatible sugarcane genotypes during Sporisorium scitamineum challenge. Their structural properties and expression patterns were analyzed. Seven chitinases (ScChiI1, ScChiI2, ScChiI3, ScChiIII1, ScChiIII2, ScChiIV1 and ScChiVI1) showed more positive with early response and maintained increased transcripts in the incompatible interaction than those in the compatible one. Three (ScChiII1, ScChiV1 and ScChiVII1) seemed to have no significant difference in expression patterns between incompatible and compatible interactions. The ten chitinases were expressed differentially in response to hormone treatment as well as having distinct tissue specificity. ScChiI1, ScChiIV1 and ScChiVII1 were induced by various abiotic stresses (NaCl, CuCl2, PEG and 4 °C) and their involvement in plant immunity was demonstrated by over-expression in Nicotiana benthamiana. The results suggest that sugarcane chitinase family exhibit differential responses to biotic and abiotic stress, providing new insights into their function. PMID:26035173

  15. Babesia bovis expresses Bbo-6cys-E, a member of a novel gene family that is homologous to the 6-cys family of Plasmodium

    USDA-ARS?s Scientific Manuscript database

    A novel Babesia bovis gene family encoding proteins with similarities to the Plasmodium 6cys protein family was identified by TBLASTN searches of the Babesia bovis genome using the sequence of the P. falciparum PFS230 protein as query, and was termed Bbo-6cys gene family. The Bbo-cys6 gene family co...

  16. GFam: a platform for automatic annotation of gene families

    PubMed Central

    Sasidharan, Rajkumar; Nepusz, Tamás; Swarbreck, David; Huala, Eva; Paccanaro, Alberto

    2012-01-01

    We have developed GFam, a platform for automatic annotation of gene/protein families. GFam provides a framework for genome initiatives and model organism resources to build domain-based families, derive meaningful functional labels and offers a seamless approach to propagate functional annotation across periodic genome updates. GFam is a hybrid approach that uses a greedy algorithm to chain component domains from InterPro annotation provided by its 12 member resources followed by a sequence-based connected component analysis of un-annotated sequence regions to derive consensus domain architecture for each sequence and subsequently generate families based on common architectures. Our integrated approach increases sequence coverage by 7.2 percentage points and residue coverage by 14.6 percentage points higher than the coverage relative to the best single-constituent database within InterPro for the proteome of Arabidopsis. The true power of GFam lies in maximizing annotation provided by the different InterPro data sources that offer resource-specific coverage for different regions of a sequence. GFam’s capability to capture higher sequence and residue coverage can be useful for genome annotation, comparative genomics and functional studies. GFam is a general-purpose software and can be used for any collection of protein sequences. The software is open source and can be obtained from http://www.paccanarolab.org/software/gfam/. PMID:22790981

  17. Candidate genes for oral-facial clefts in Guatemalan families.

    PubMed

    Neiswanger, Katherine; Deleyiannis, Frederic W B; Avila, Joseph R; Cooper, Margaret E; Brandon, Carla A; Vieira, Alexandre R; Noorchashm, Negin; Weinberg, Seth M; Bardi, Kathleen M; Murray, Jeffrey C; Marazita, Mary L

    2006-05-01

    Nonsyndromic cleft lip +/- cleft palate (CL/P) is a complex trait of unknown etiology. Most genetic studies of CL/P define affection status in a way that ignores subtle subclinical manifestations, resulting in a potential loss of statistical power. This study investigated 10 candidate genes in 155 individuals from 25 Guatemalan CL/P families. High-resolution ultrasound images of the orbicularis oris (OO) muscle were obtained. CL/P was present in 28 family members; an additional 10 had subcutaneous OO muscle defects. Family-based association studies were performed for both narrow (CL/P only) and broad (CL/P plus OO muscle defects) definitions of affection status. PVRL1 was significantly associated under both definitions (P = 0.04, narrow; P = 0.02, broad). Association with JAG2 improved from P = 0.09 under the narrow definition to P = 0.04 under the broad definition. Broadening the oral-facial cleft phenotype to include subclinical variants may improve power in genetic studies.

  18. The roles of gene duplication, gene conversion and positive selection in rodent Esp and Mup pheromone gene families with comparison to the Abp family.

    PubMed

    Karn, Robert C; Laukaitis, Christina M

    2012-01-01

    Three proteinaceous pheromone families, the androgen-binding proteins (ABPs), the exocrine-gland secreting peptides (ESPs) and the major urinary proteins (MUPs) are encoded by large gene families in the genomes of Mus musculus and Rattus norvegicus. We studied the evolutionary histories of the Mup and Esp genes and compared them with what is known about the Abp genes. Apparently gene conversion has played little if any role in the expansion of the mouse Class A and Class B Mup genes and pseudogenes, and the rat Mups. By contrast, we found evidence of extensive gene conversion in many Esp genes although not in all of them. Our studies of selection identified at least two amino acid sites in β-sheets as having evolved under positive selection in the mouse Class A and Class B MUPs and in rat MUPs. We show that selection may have acted on the ESPs by determining K(a)/K(s) for Exon 3 sequences with and without the converted sequence segment. While it appears that purifying selection acted on the ESP signal peptides, the secreted portions of the ESPs probably have undergone much more rapid evolution. When the inner gene converted fragment sequences were removed, eleven Esp paralogs were present in two or more pairs with K(a)/K(s) >1.0 and thus we propose that positive selection is detectable by this means in at least some mouse Esp paralogs. We compare and contrast the evolutionary histories of all three mouse pheromone gene families in light of their proposed functions in mouse communication.

  19. Gene expression patterns of invertase gene families and modulation of the inhibitor gene in tomato sucrose metabolism.

    PubMed

    Zhang, Y L; Zhang, A H; Jiang, J

    2013-01-24

    Patterns of gene expression in the different types of sucrose metabolism in the tomato are highly variable and heritable. This genetic variation causes considerable functional differences. We examined the patterns of expression of invertase (Inv) gene families and an invertase inhibitor (INH) gene involved in elongating roots, hypocotyls, and fruit of the tomato (Lycopersicon esculentum cv. Micro-Tom and L. chmielewskii) through a real-time quantitative PCR analysis. We found that the Lin6 gene plays an important role in the vegetative growth stage. Lin5 and Lin7 did not express in Micro-Tom, but did express in L. chmielewskii. Overall relative expression levels of sucrose Inv gene families were significantly lower in L. chmielewskii during the reproductive growth stage than in Micro-Tom, being up to hundreds of times lower. It was not expressed in the dissepiment in L. chmielewskii. We suggest that differences in sucrose accumulation in tomato fruit is mainly due to differentially expressed invertase gene families at the later fruit growth stages.

  20. [Gene diagnosis and genetic counselling of Rb gene mutations in retinoblastoma patients and their family members].

    PubMed

    Huang, Q; Dryja, T P; Yandell, D W

    1998-04-10

    To develop a diagnostic test for direct identification of disease-causing mutation in the patients with retinoblastoma and correct prediction of carrier- status in unaffected adults and newborns in the RB kindred. Southern blot hybridized by Rb cDNA and other intragenic probes were used to detect big deletions or rearrangements at Rb gene locus. SSCP analysis and direct sequencing of primer-directed enzymatic amplification to identify point mutations as small as a single nucleotide change. RFLPs and VNTRs within the Rb gene were used as genetic markers for haplotype analysis. The probands from 79 RB kindreds were identified to have Rb gene mutation, including 25 somatic mutations and 54 germline mutations (36 new germline mutations, 15 inherited mutations and 3 mosaicisms). The WBC DNAs from their family members were also analyzed for determining origin and carrier of mutation. The direct identification of causing- cancer mutations by combining SSCP analysis and direct DNA sequencing showed many advantages than other indirect methods such as haplotype analysis. It can distinguish hereditary RB from nonhereditary RB and identify the unaffected carriers without family history and informes affected family member. This method is helpful in gene diagnosis and genetic counselling.

  1. Recent Developments in Gene Therapy for Homozygous Familial Hypercholesterolemia.

    PubMed

    Ajufo, Ezim; Cuchel, Marina

    2016-05-01

    Homozygous familial hypercholesterolemia (HoFH) is a life-threatening Mendelian disorder with a mean life expectancy of 33 years despite maximally tolerated standard lipid-lowering therapies. This disease is an ideal candidate for gene therapy, and in the last few years, a number of exciting developments have brought this approach closer to the clinic than ever before. In this review, we discuss in detail the most advanced of these developments, a recombinant adeno-associated virus (AAV) vector carrying a low-density lipoprotein receptor (LDLR) transgene which has recently entered phase 1/2a testing. We also review ongoing development of approaches to enhance transgene expression, improve the efficiency of hepatocyte transduction, and minimize the AAV capsid-specific adaptive immune response. We include a summary of key gene therapy approaches for HoFH in pre-clinical development, including RNA silencing of the gene encoding HMG-CoA reductase (HMGCR) and induced pluripotent stem cell transplant therapy.

  2. Isolation and characterization of the chicken trypsinogen gene family.

    PubMed Central

    Wang, K; Gan, L; Lee, I; Hood, L

    1995-01-01

    Based on genomic Southern hybridizations and cDNA sequence analyses, the chicken trypsinogen gene family can be divided into two multi-member subfamilies, a six-member trypsinogen I subfamily which encodes the cationic trypsin isoenzymes and a three-member trypsinogen II subfamily which encodes the anionic trypsin isoenzymes. The chicken cDNA and genomic clones containing these two subfamilies were isolated and characterized by DNA sequence analysis. The results indicated that the chicken trypsinogen genes encoded a signal peptide of 15 to 16 amino acid residues, an activation peptide of 9 to 10 residues and a trypsin of 223 amino acid residues. The chicken trypsinogens contain all the common catalytic and structural features for trypsins, including the catalytic triad His, Asp and Ser and the six disulphide bonds. The trypsinogen I and II subfamilies share approximately 70% sequence identity at the nucleotide and amino acid level. The sequence comparison among chicken trypsinogen subfamily members and trypsin sequences from other species suggested that the chicken trypsinogen genes may have evolved in coincidental or concerted fashion. Images Figure 6 Figure 7 PMID:7733885

  3. Comparison of the expression patterns of two small gene families of S gene family receptor kinase genes during the defence response in Brassica oleracea and Arabidopsis thaliana.

    PubMed

    Pastuglia, Martine; Swarup, Ranjan; Rocher, Anne; Saindrenan, Patrick; Roby, Dominique; Dumas, Christian; Cock, J Mark

    2002-01-09

    SFR2, a member of the S gene family of receptor kinases, has been shown to be rapidly induced by wounding and bacterial infection suggesting that this gene may play a role in the defence response in Brassica. In this study we have compared the response of SFR2 to that of two other members of the SFR gene family in Brassica (SFR1 and SFR3) and to the closely-related ARK genes of Arabidopsis. Different patterns of mRNA accumulation were observed for different members of these families. SFR1 transcripts only accumulated in response to bacterial infection and their abundance was not significantly affected by wounding. Neither treatment induced accumulation of SFR3 transcripts. ARK1 and ARK3 resembled SFR2 in that their mRNAs accumulated in response to both wounding and bacterial infection. Both SFR1 and SFR2 mRNAs accumulated in response to exogenously applied salicylic acid (SA) and SA was shown to be required for induction of expression from the SFR2 promoter in Arabidopsis. However, the timing of the increase in endogenous SA levels following bacterial infiltration in Brassica indicates that the accumulation of SFR mRNA in the first few hours after infiltration does not occur in response to an increase in SA levels. We discuss the possibility that induction of SFR gene expression by SA may contribute to potentialization of the defence response. Taken together with previous studies that indicate a possible role during development, the data presented here suggest that the SFR and ARK gene families may have overlapping roles in both defence and during development.

  4. A novel pathogenic germline mutation in the adenomatous polyposis coli gene in a Chinese family with familial adenomatous coli

    PubMed Central

    He, Long-Jun; Wang, Qi-Jing; Weng, De-Sheng; Pan, Ke; Liu, Qing; Zhao, Jing-Jing; Pan, Qiu-Zhong; Zhang, Xiao-Fei; Tang, Yan; Chen, Chang-Long; Zhang, Hong-Xia; Xu, Guo-Liang; Zeng, Yi-Xin; Xia, Jian-Chuan

    2015-01-01

    Familial adenomatous polyposis (FAP) is an autosomal dominant disease manifesting as colorectal cancer in middle-aged patients. Mutations of the adenomatous polyposis coli (APC) gene contribute to both FAP and sporadic or familial colorectal carcinogenesis. Here we describe the identification of the causative APC gene defects associated with FAP in a Chinese pedigree. All patients with FAP were diagnosed by their combination of clinical features, family history, colonoscopy, and pathology examinations. Blood samples were collected and genomic DNA was extracted. Mutation analysis of APC was conducted by targeted next-generation sequencing, long-range PCR and Sanger sequencing. A novel mutation in exon 14–15(c.1936-2148 del) and intron 14 of the APC gene was demonstrated in all FAP patients and was absent in unaffected family members. This novel deletion causing FAP in Chinese kindred expands the germline mutation spectrum of the APC gene in the Chinese population. PMID:26311738

  5. A novel pathogenic germline mutation in the adenomatous polyposis coli gene in a Chinese family with familial adenomatous coli.

    PubMed

    Jiang, Shan-Shan; Li, Jian-Jun; Li, Yin; He, Long-Jun; Wang, Qi-Jing; Weng, D Sheng; Pan, Ke; Liu, Qing; Zhao, Jing-Jing; Pan, Qiu-Zhong; Zhang, Xiao-Fei; Tang, Yan; Chen, Chang-Long; Zhang, Hong-Xia; Xu, Guo-Liang; Zeng, Yi-Xin; Xia, Jian-Chuan

    2015-09-29

    Familial adenomatous polyposis (FAP) is an autosomal dominant disease manifesting as colorectal cancer in middle-aged patients. Mutations of the adenomatous polyposis coli (APC) gene contribute to both FAP and sporadic or familial colorectal carcinogenesis. Here we describe the identification of the causative APC gene defects associated with FAP in a Chinese pedigree. All patients with FAP were diagnosed by their combination of clinical features, family history, colonoscopy, and pathology examinations. Blood samples were collected and genomic DNA was extracted. Mutation analysis of APC was conducted by targeted next-generation sequencing, long-range PCR and Sanger sequencing. A novel mutation in exon 14-15(c.1936-2148 del) and intron 14 of the APC gene was demonstrated in all FAP patients and was absent in unaffected family members. This novel deletion causing FAP in Chinese kindred expands the germline mutation spectrum of the APC gene in the Chinese population.

  6. Molecular evolution of the polyamine oxidase gene family in Metazoa.

    PubMed

    Polticelli, Fabio; Salvi, Daniele; Mariottini, Paolo; Amendola, Roberto; Cervelli, Manuela

    2012-06-20

    Polyamine oxidase enzymes catalyze the oxidation of polyamines and acetylpolyamines. Since polyamines are basic regulators of cell growth and proliferation, their homeostasis is crucial for cell life. Members of the polyamine oxidase gene family have been identified in a wide variety of animals, including vertebrates, arthropodes, nematodes, placozoa, as well as in plants and fungi. Polyamine oxidases (PAOs) from yeast can oxidize spermine, N1-acetylspermine, and N1-acetylspermidine, however, in vertebrates two different enzymes, namely spermine oxidase (SMO) and acetylpolyamine oxidase (APAO), specifically catalyze the oxidation of spermine, and N1-acetylspermine/N1-acetylspermidine, respectively. Little is known about the molecular evolutionary history of these enzymes. However, since the yeast PAO is able to catalyze the oxidation of both acetylated and non acetylated polyamines, and in vertebrates these functions are addressed by two specialized polyamine oxidase subfamilies (APAO and SMO), it can be hypothesized an ancestral reference for the former enzyme from which the latter would have been derived. We analysed 36 SMO, 26 APAO, and 14 PAO homologue protein sequences from 54 taxa including various vertebrates and invertebrates. The analysis of the full-length sequences and the principal domains of vertebrate and invertebrate PAOs yielded consensus primary protein sequences for vertebrate SMOs and APAOs, and invertebrate PAOs. This analysis, coupled to molecular modeling techniques, also unveiled sequence regions that confer specific structural and functional properties, including substrate specificity, by the different PAO subfamilies. Molecular phylogenetic trees revealed a basal position of all the invertebrates PAO enzymes relative to vertebrate SMOs and APAOs. PAOs from insects constitute a monophyletic clade. Two PAO variants sampled in the amphioxus are basal to the dichotomy between two well supported monophyletic clades including, respectively, all

  7. Molecular evolution of the polyamine oxidase gene family in Metazoa

    PubMed Central

    2012-01-01

    Background Polyamine oxidase enzymes catalyze the oxidation of polyamines and acetylpolyamines. Since polyamines are basic regulators of cell growth and proliferation, their homeostasis is crucial for cell life. Members of the polyamine oxidase gene family have been identified in a wide variety of animals, including vertebrates, arthropodes, nematodes, placozoa, as well as in plants and fungi. Polyamine oxidases (PAOs) from yeast can oxidize spermine, N1-acetylspermine, and N1-acetylspermidine, however, in vertebrates two different enzymes, namely spermine oxidase (SMO) and acetylpolyamine oxidase (APAO), specifically catalyze the oxidation of spermine, and N1-acetylspermine/N1-acetylspermidine, respectively. Little is known about the molecular evolutionary history of these enzymes. However, since the yeast PAO is able to catalyze the oxidation of both acetylated and non acetylated polyamines, and in vertebrates these functions are addressed by two specialized polyamine oxidase subfamilies (APAO and SMO), it can be hypothesized an ancestral reference for the former enzyme from which the latter would have been derived. Results We analysed 36 SMO, 26 APAO, and 14 PAO homologue protein sequences from 54 taxa including various vertebrates and invertebrates. The analysis of the full-length sequences and the principal domains of vertebrate and invertebrate PAOs yielded consensus primary protein sequences for vertebrate SMOs and APAOs, and invertebrate PAOs. This analysis, coupled to molecular modeling techniques, also unveiled sequence regions that confer specific structural and functional properties, including substrate specificity, by the different PAO subfamilies. Molecular phylogenetic trees revealed a basal position of all the invertebrates PAO enzymes relative to vertebrate SMOs and APAOs. PAOs from insects constitute a monophyletic clade. Two PAO variants sampled in the amphioxus are basal to the dichotomy between two well supported monophyletic clades including

  8. The HIN-200 family: More than interferon-inducible genes?

    SciTech Connect

    Ludlow, Louise E.A.; Johnstone, Ricky W.; Clarke, Christopher J.P. . E-mail: chris.clarke@petermac.org

    2005-08-01

    The HIN-200 family was initially grouped together based on their hemopoietic expression, interferon-inducibility, nuclear localization, and characteristic 200 amino-acid domains. In this review, we performed a comprehensive search of genome databases and determined the location of previously characterized and predicted genes within the human, mouse, and rat HIN-200 loci. Several novel proteins were predicted in the mouse and rat. We also discuss recent advances in our understanding of this family of proteins and highlight the most important findings. In addition to a role in interferon biology, there is now good evidence supporting a role for these proteins as regulators of cell proliferation and differentiation. The activity of HIN-200 proteins is not restricted to the hemopoietic system as they are expressed and can function in a variety of other cells and tissues. The importance of HIN-200 proteins in disease now is beginning to be understood as they appear to be involved in autoimmunity and may act as tumor suppressor proteins.

  9. Gene recruitment--a common mechanism in the evolution of transfer RNA gene families.

    PubMed

    Wang, Xiujuan; Lavrov, Dennis V

    2011-04-01

    The evolution of alloacceptor transfer RNAs (tRNAs) has been traditionally thought to occur vertically and reflect the evolution of the genetic code. Yet there have been several indications that a tRNA gene could evolve horizontally, from a copy of an alloacceptor tRNA gene in the same genome. Earlier, we provided the first unambiguous evidence for the occurrence of such "tRNA gene recruitment" in nature--in the mitochondrial (mt) genome of the demosponge Axinella corrugata. Yet the extent and the pattern of this process in the evolution of tRNA gene families remained unclear. Here we analyzed tRNA genes from 21 mt genomes of demosponges as well as nuclear genomes of rhesus macaque, chimpanzee and human. We found four new cases of alloacceptor tRNA gene recruitment in mt genomes and eleven cases in the nuclear genomes. In most of these cases we observed a single nucleotide substitution at the middle position of the anticodon, which resulted in the change of not only the tRNA's amino-acid identity but also the class of the amino-acyl tRNA synthetases (aaRSs) involved in amino-acylation. We hypothesize that the switch to a different class of aaRSs may have prevented the conflict between anticodon and amino-acid identities of recruited tRNAs. Overall our results suggest that gene recruitment is a common phenomenon in tRNA multigene family evolution and should be taken into consideration when tRNA evolutionary history is reconstructed.

  10. Differential loss of ancestral gene families as a source of genomic divergence in animals.

    PubMed Central

    Hughes, Austin L; Friedman, Robert

    2004-01-01

    A phylogenetic approach was used to reconstruct the pattern of an apparent loss of 2106 ancestral gene families in four animal genomes (Caenorhabditis elegans, Drosophila melanogaster, human and fugu). Substantially higher rates of loss of ancestral gene families were found in the invertebrates than in the vertebrates. These results indicate that the differential loss of ancestral gene families can be a significant factor in the evolutionary diversification of organisms. PMID:15101434

  11. Dissimilar evolutionary histories of two resistance gene families in the genus Solanum.

    PubMed

    Segura, Diana María; Masuelli, Ricardo Williams; Sanchez-Puerta, M Virginia

    2017-01-01

    Genomic analyses have shown that most genes in eukaryotic lineages belong to families. Gene families vary in terms of number of members, nucleotide similarity, gene integrity, expression, and function. Often, the members of gene families are arranged in clusters, which contribute to maintaining similarity among gene copies and also to generate duplicates through replication errors. Gene families offer us an opportunity to examine the forces involved in the evolution of the genomes and to study recombination events and genomic rearrangements. In this work, we focused on the evolution of two plant resistance gene families, Sw5 and Mi-1, and analyzed the completely sequenced nuclear genomes of potato and tomato. We first noticed that the potato genome carries larger resistance gene families than tomato, but all gene copies are pseudogenes. Second, phylogenetic analyses indicated that Sw5 and Mi-1 gene families had dissimilar evolutionary histories. In contrast to Sw5, Mi-1 homologues suffered repeated gene conversion events among the gene copies, particularly in the tomato genome.

  12. Gene family encoding the major toxins of lethal Amanita mushrooms.

    PubMed

    Hallen, Heather E; Luo, Hong; Scott-Craig, John S; Walton, Jonathan D

    2007-11-27

    Amatoxins, the lethal constituents of poisonous mushrooms in the genus Amanita, are bicyclic octapeptides. Two genes in A. bisporigera, AMA1 and PHA1, directly encode alpha-amanitin, an amatoxin, and the related bicyclic heptapeptide phallacidin, a phallotoxin, indicating that these compounds are synthesized on ribosomes and not by nonribosomal peptide synthetases. alpha-Amanitin and phallacidin are synthesized as proproteins of 35 and 34 amino acids, respectively, from which they are predicted to be cleaved by a prolyl oligopeptidase. AMA1 and PHA1 are present in other toxic species of Amanita section Phalloidae but are absent from nontoxic species in other sections. The genomes of A. bisporigera and A. phalloides contain multiple sequences related to AMA1 and PHA1. The predicted protein products of this family of genes are characterized by a hypervariable "toxin" region capable of encoding a wide variety of peptides of 7-10 amino acids flanked by conserved sequences. Our results suggest that these fungi have a broad capacity to synthesize cyclic peptides on ribosomes.

  13. The Family of Crumbs Genes and Human Disease

    PubMed Central

    Slavotinek, Anne M.

    2016-01-01

    The family of vertebrate Crumbs proteins, homologous to Drosophila Crumbs (Crb), share large extracellular domains with epidermal growth factor-like repeats and laminin-globular domains, a single transmembrane domain, and a short intracellular C-terminus containing a single membrane proximal 4.1/ezrin/radixin/moesin-binding domain and PSD-95/Discs large/ZO-1-binding motifs. There are 3 Crb genes in humans - Crumbs homolog-1 (CRB1), Crumbs homolog-2 (CRB2), and Crumbs homolog-3 (CRB3). Bilallelic loss-of-function mutations in CRB1 cause visual impairment, with Leber's congenital amaurosis and retinitis pigmentosa, whereas CRB2 mutations are associated with raised maternal serum and amniotic fluid alpha feto-protein levels, ventriculomegaly/hydrocephalus, and renal disease, ranging from focal segmental glomerulosclerosis to congenital Finnish nephrosis. CRB3 has not yet been associated with human disease. In this review, we summarize the phenotypic findings associated with deleterious sequence variants in CRB1 and CRB2. We discuss the mutational spectrum, animal models of loss of function for both genes and speculate on the likely mechanisms of disease. PMID:27867342

  14. Familial dysautonomia is caused by mutations of the IKAP gene.

    PubMed

    Anderson, S L; Coli, R; Daly, I W; Kichula, E A; Rork, M J; Volpi, S A; Ekstein, J; Rubin, B Y

    2001-03-01

    The defective gene DYS, which is responsible for familial dysautonomia (FD) and has been mapped to a 0.5-cM region on chromosome 9q31, has eluded identification. We identified and characterized the RNAs encoded by this region of chromosome 9 in cell lines derived from individuals homozygous for the major FD haplotype, and we observed that the RNA encoding the IkappaB kinase complex-associated protein (IKAP) lacks exon 20 and, as a result of a frameshift, encodes a truncated protein. Sequence analysis reveals a T-->C transition in the donor splice site of intron 20. In individuals bearing a minor FD haplotype, a missense mutation in exon 19 disrupts a consensus serine/threonine kinase phosphorylation site. This mutation results in defective phosphorylation of IKAP. These mutations were observed to be present in a random sample of Ashkenazi Jewish individuals, at approximately the predicted carrier frequency of FD. These findings demonstrate that mutations in the gene encoding IKAP are responsible for FD.

  15. Familial Dysautonomia Is Caused by Mutations of the IKAP Gene

    PubMed Central

    Anderson, Sylvia L.; Coli, Rocco; Daly, Ira W.; Kichula, Elizabeth A.; Rork, Matthew J.; Volpi, Sabrina A.; Ekstein, Josef; Rubin, Berish Y.

    2001-01-01

    The defective gene DYS, which is responsible for familial dysautonomia (FD) and has been mapped to a 0.5-cM region on chromosome 9q31, has eluded identification. We identified and characterized the RNAs encoded by this region of chromosome 9 in cell lines derived from individuals homozygous for the major FD haplotype, and we observed that the RNA encoding the IκB kinase complex–associated protein (IKAP) lacks exon 20 and, as a result of a frameshift, encodes a truncated protein. Sequence analysis reveals a T→C transition in the donor splice site of intron 20. In individuals bearing a minor FD haplotype, a missense mutation in exon 19 disrupts a consensus serine/threonine kinase phosphorylation site. This mutation results in defective phosphorylation of IKAP. These mutations were observed to be present in a random sample of Ashkenazi Jewish individuals, at approximately the predicted carrier frequency of FD. These findings demonstrate that mutations in the gene encoding IKAP are responsible for FD. PMID:11179021

  16. Cloning and characterisation of JAZ gene family in Hevea brasiliensis.

    PubMed

    Hong, H; Xiao, H; Yuan, H; Zhai, J; Huang, X

    2015-05-01

    Mechanical wounding or treatment with exogenous jasmonates (JA) induces differentiation of the laticifer in Hevea brasiliensis. JA is a key signal for latex biosynthesis and wounding response in the rubber tree. Identification of JAZ (jasmonate ZIM-domain) family of proteins that repress JA responses has facilitated rapid progress in understanding how this lipid-derived hormone controls gene expression and related physiological processes in plants. In this work, the full-length cDNAs of six JAZ genes were cloned from H. brasiliensis (termed HbJAZ). These HbJAZ have different lengths and sequence diversity, but all of them contain Jas and ZIM domains, and two of them contain an ERF-associated amphiphilic repression (EAR) motif in the N-terminal. Real-time RT-PCR analyses revealed that HbJAZ have different expression patterns and tissue specificity. Four HbJAZ were up-regulated, one was down-regulated, while two were less effected by rubber tapping treatment, suggesting that they might play distinct roles in the wounding response. A yeast two-hybrid assay revealed that HbJAZ proteins interact with each other to form homologous or heterogeneous dimer complexes, indicating that the HbJAZ proteins may expand their function through diverse JAZ-JAZ interactions. This work lays a foundation for identification of the JA signalling pathway and molecular mechanisms of latex biosynthesis in rubber trees.

  17. Evolution of the multifaceted eukaryotic akirin gene family

    PubMed Central

    Macqueen, Daniel J; Johnston, Ian A

    2009-01-01

    Background Akirins are nuclear proteins that form part of an innate immune response pathway conserved in Drosophila and mice. This studies aim was to characterise the evolution of akirin gene structure and protein function in the eukaryotes. Results akirin genes are present throughout the metazoa and arose before the separation of animal, plant and fungi lineages. Using comprehensive phylogenetic analysis, coupled with comparisons of conserved synteny and genomic organisation, we show that the intron-exon structure of metazoan akirin genes was established prior to the bilateria and that a single proto-orthologue duplicated in the vertebrates, before the gnathostome-agnathan separation, producing akirin1 and akirin2. Phylogenetic analyses of seven vertebrate gene families with members in chromosomal proximity to both akirin1 and akirin2 were compatible with a common duplication event affecting the genomic neighbourhood of the akirin proto-orthologue. A further duplication of akirins occurred in the teleost lineage and was followed by lineage-specific patterns of paralogue loss. Remarkably, akirins have been independently characterised by five research groups under different aliases and a comparison of the available literature revealed diverse functions, generally in regulating gene expression. For example, akirin was characterised in arthropods as subolesin, an important growth factor and in Drosophila as bhringi, which has an essential myogenic role. In vertebrates, akirin1 was named mighty in mice and was shown to regulate myogenesis, whereas akirin2 was characterised as FBI1 in rats and promoted carcinogenesis, acting as a transcriptional repressor when bound to a 14-3-3 protein. Both vertebrate Akirins have evolved under comparably strict constraints of purifying selection, although a likelihood ratio test predicted that functional divergence has occurred between paralogues. Bayesian and maximum likelihood tests identified amino-acid positions where the rate of

  18. A Comprehensive Family-Based Replication Study of Schizophrenia Genes

    PubMed Central

    Aberg, Karolina A.; Liu, Youfang; Bukszár, Jozsef; McClay, Joseph L.; Khachane, Amit N.; Andreassen, Ole A.; Blackwood, Douglas; Corvin, Aiden; Djurovic, Srdjan; Gurling, Hugh; Ophoff, Roel; Pato, Carlos N.; Pato, Michele T.; Riley, Brien; Webb, Todd; Kendler, Kenneth; O’Donovan, Mick; Craddock, Nick; Kirov, George; Owen, Mike; Rujescu, Dan; St Clair, David; Werge, Thomas; Hultman, Christina M.; Delisi, Lynn E.; Sullivan, Patrick; van den Oord, Edwin J.

    2017-01-01

    Importance Schizophrenia (SCZ) is a devastating psychiatric condition. Identifying the specific genetic variants and pathways that increase susceptibility to SCZ is critical to improve disease understanding and address the urgent need for new drug targets. Objective To identify SCZ susceptibility genes. Design We integrated results from a meta-analysis of 18 genome-wide association studies (GWAS) involving 1 085 772 single-nucleotide polymorphisms (SNPs) and 6 databases that showed significant informativeness for SCZ. The 9380 most promising SNPs were then specifically genotyped in an independent family-based replication study that, after quality control, consisted of 8107 SNPs. Setting Linkage meta-analysis, brain transcriptome meta-analysis, candidate gene database, OMIM, relevant mouse studies, and expression quantitative trait locus databases. Patients We included 11 185 cases and 10 768 control subjects from 6 databases and, after quality control 6298 individuals (including 3286 cases) from 1811 nuclear families. Main Outcomes and Measures Case-control status for SCZ. Results Replication results showed a highly significant enrichment of SNPs with small P values. Of the SNPs with replication values of P<.01, the proportion of SNPs that had the same direction of effects as in the GWAS meta-analysis was 89% in the combined ancestry group (sign test, P<2.20×10−16) and 93% in subjects of European ancestry only (P<2.20×10−16). Our results supported the major histocompatibility complex region showing a 3.7-fold overall enrichment of replication values of P<.01 in subjects from European ancestry. We replicated SNPs in TCF4 (P=2.53×10−10) and NOTCH4 (P=3.16×10−7) that are among the most robust SCZ findings. More novel findings included POM121L2 (P=3.51×10−7), AS3MT (P=9.01×10−7), CNNM2 (P=6.07×10−7), and NT5C2 (P=4.09×10−7). To explore the many small effects, we performed pathway analyses. The most significant pathways involved neuronal function

  19. Characterization of the multicopper oxidase gene family in Anopheles gambiae

    PubMed Central

    Gorman, Maureen J.; Dittmer, Neal T.; Marshall, Jeremy L.; Kanost, Michael R.

    2008-01-01

    The multicopper oxidase (MCO) family of enzymes includes laccases, which oxidize a broad range of substrates including diphenols, and several oxidases with specific substrates such as iron, copper or ascorbic acid. We have identified five putative MCO genes in the genome of Anopheles gambiae and have cloned cDNAs encompassing the full coding region for each gene. MCO1 mRNA was detected in all developmental stages and in all of the larval and adult tissues tested. We observed an increase in MCO1 transcript abundance in the midguts and Malphighian tubules of adult females following a blood meal and in adult abdominal carcasses in response to an immune challenge. Two alternatively spliced isoforms of MCO2 mRNA were identified. The A isoform of MCO2 was previously detected in larval and pupal cuticle where it probably catalyzes sclerotization reactions (He et al., 2007). The B isoform was transcriptionally upregulated in ovaries in response to a blood meal. MCO3 mRNA was detected in the adult midgut, Malpighian tubules, and male reproductive tissues; like MCO1, it was upregulated in response to an immune challenge or a blood meal. MCO4 and MCO5 were observed primarily in eggs and in the abdominal carcass of larvae. A phylogenetic analysis of insect MCO genes identified putative orthologs of MCO1 and MCO2 in all of the insect genomes tested, whereas MCO3, MCO4 and MCO5 were found only in the two mosquito species analyzed. MCO2 orthologs have especially high sequence similarity, suggesting that they are under strong purifying selection; the A isoforms are more conserved than the B isoforms. The mosquito specific group shares a common ancestor with MCO2. This initial study of mosquito MCOs suggests that MCO2 may be required for egg development or eggshell tanning in addition to cuticle tanning, while MCO1 and MCO3 may be involved in metal metabolism or immunity. PMID:18675911

  20. Angiotensin converting enzyme gene polymorphism in familial hypertrophic cardiomyopathy patients

    SciTech Connect

    Yu, B; Peric, S.; Ross, D.

    1994-09-01

    An insertion/deletion (I/D) polymorphism of the angiotensin I converting enzyme (ACE) gene is a useful predictor of human plasma ACE levels. ACE levels tend to be lowest in subjects with ACE genotype DD and intermediate in subjects with ACE genotype ID. Angiotensin II (Ang II) as a product of ACE is a cardiac growth factor and produces a marked hypertrophy of the chick myocyte in cell culture. Rat experiments also suggest that a small dose of ACE inhibitor that does not affect the afterload results in prevention or regression of cardiac hypertrophy. In order to study the relationship of ACE and the severity of hypertrophy, the ACE genotype has been determined in 28 patients with a clinical diagnosis of familial hypertrophic cardiomyopathy (FHC) and 51 normal subjects. The respective frequencies of I and D alleles were: 0.52 and 0.48 (in FHC patients) and 0.44 and 0.56 (in the normal controls). There was no significant difference in the allele frequencies between FHC and normal subjects ({chi}{sup 2}=0.023, p>0.05). The II, ID, and DD genotypes were present in 7, 15, and 6 FHC patients, respectively. The averages of maximal thickness of the interventricular septum measured by echocardiography or at autopsy were 18 {plus_minus}3, 19{plus_minus}4, and 19{plus_minus}3 mm in II, ID and DD genotypes, respectively. The ACE gene polymorphism did not correlate with the severity of left ventricular hypertrophy in FHC patients (r{sub s}=0.231, p>0.05). These results do not necessarily exclude the possible effect of Ang II on the hypertrophy since the latter may be produced through the action of chymase in the human ventricles. However, ACE gene polymorphism is not a useful predictor of the severity of myocardial hypertrophy in FHC patients.

  1. MicroSyn: a user friendly tool for detection of microsynteny in a gene family

    SciTech Connect

    Cai, Bin; Yang, Xiaohan; Tuskan, Gerald A; Cheng, Zong-Ming

    2011-01-01

    Background: The traditional phylogeny analysis within gene family is mainly based on DNA or amino acid sequence homologies. However, these phylogenetic tree analyses are not suitable for those non-traditional gene families like microRNA with very short sequences. For the normal protein-coding gene families, low bootstrap values are frequently encountered in some nodes, suggesting low confidence or likely inappropriateness of placement of those members in those nodes. Results: We introduce MicroSyn software as a means of detecting microsynteny in adjacent genomic regions surrounding genes in gene families. MicroSyn searches for conserved, flanking colinear homologous gene pairs between two genomic fragments to determine the relationship between two members in a gene family. The colinearity of homologous pairs is controlled by a statistical distance function. As a result, gene duplication history can be inferred from the output independent of gene sequences. MicroSyn was designed for both experienced and non-expert users with a user-friendly graphical-user interface. MicroSyn is available from: http://fcsb.njau.edu. cn/microsyn/. Conclusions: Case studies of the microRNA167 genes in plants and Xyloglucan ndotransglycosylase/Hydrolase family in Populus trichocarpa were presented to show the utility of the software. The easy using of MicroSyn in these examples suggests that the software is an additional valuable means to address the problem intrinsic in the computational methods and sequence qualities themselves in gene family analysis.

  2. Colon cancer prevention by detection of APC gene mutation in a family with attenuated familial adenomatous polyposis.

    PubMed

    Poovorawan, Kittiyod; Suksawatamnuay, Sirinporn; Sahakitrungruang, Chucheep; Treeprasertsuk, Sombat; Wisedopas, Naruemon; Komolmit, Piyawat; Poovorawan, Yong

    2012-01-01

    Genetic mutation is a significant factor in colon CA pathogenesis. Familial adenomatous polyposis (FAP) is an autosomal dominant hereditary disease characterized by multiple colorectal adenomatous polyps affecting a number of cases in the family. This report focuses on a family with attenuated familial adenomatous polyposis (AFAP) with exon 4 mutation, c.481C>T p.Q161X of the APC gene. We analyzed 20 members of a family with AFAP. Clinical and endoscopic data were collected for phenotype determination. Genetic analysis was also performed by direct sequencing of the APC gene. Five patients with a phenotype of AFAP were found. Endoscopic polyposis was demonstrated among the second generation with genotype mutation of the disease (age > 50 years) consistent with delayed phenotypic adenomatous polyposis in AFAP. APC gene mutation was identified in exon 4 of the APC gene, with mutation points of c.481C>T p.Q161X. Laparoscopic subtotal colectomy was performed to prevent carcinogenesis. A family with attenuated familial adenomatous polyposis of APC related to exon 4 mutation, c.481C>T p.Q161X, was reported and the phenotypic finding was confirmed by endoscopic examination. Genetic mutation analysis might be advantageous in AFAP for long term colon cancer prevention and management due to subtle or asymptomatic phenotype presentation in early adulthood.

  3. Detection of Disease Genes by Use of Family Data. II. Application to Nuclear Families

    PubMed Central

    Tu, I-Ping; Balise, Raymond R.; Whittemore, Alice S.

    2000-01-01

    Two likelihood-based score statistics are used to detect association between a disease and a single diallelic polymorphism, on the basis of data from arbitrary types of nuclear families. The first statistic, the nonfounder statistic, extends the transmission/disequilibrium test to accommodate affected and unaffected offspring and missing parental genotypes. The second statistic, the founder statistic, compares observed or inferred parental genotypes with those of some reference population. In this comparison, the genotypes of affected parents or of those with many affected offspring are weighted more heavily than are the genotypes of unaffected parents or of those with few affected offspring. Genotypes of single unrelated cases and controls can be included in this analysis. We illustrate the two statistics by applying them to data on a polymorphism of the SDR5A2 gene in nuclear families with multiple cases of prostate cancer. We also use simulations to compare the power of the nonfounder statistic with that of the score statistic, on the basis of the conditional logistic regression of offspring genotypes. PMID:10739759

  4. Genome-wide identification and expression profiling of ankyrin-repeat gene family in maize.

    PubMed

    Jiang, Haiyang; Wu, Qingqing; Jin, Jing; Sheng, Lei; Yan, Hanwei; Cheng, Beijiu; Zhu, Suwen

    2013-09-01

    Members of the ankyrin repeats (ANK) gene family encode ANK domain that are common in diverse organisms and play important roles in cell growth and development, such as cell-cell signal transduction and cell cycle regulation. Recently, genome-wide identification and evolutionary analyses of the ANK gene family have been carried out in Arabidopsis and rice. However, little is known regarding the ANK genes in the entire maize genome. In this study, we described the identification and structural characterization of 71 ANK genes in maize (ZmANK). Then, comprehensive bioinformatics analyses of ZmANK genes family were performed including phylogenetic, domain and motif analysis, chromosomal localization, intron/exon structural patterns, gene duplications and expression profiling. Domain composition analyses showed that ZmANK genes formed ten subfamilies. Five tandem duplications and 14 segmental duplications were identified in ZmANK genes. Furthermore, we took comparative analysis of the total ANK gene family in Arabidopsis, rice and maize, ZmANKs were more closely paired with OsANKs than with AtANKs. At last, expression profile analyses were performed. Forty-one members of ZmANK genes held EST sequences records. Semi-quantitative expression and microarray data analysis of these 41 ZmANK genes demonstrated that ZmANK genes exhibit a various expression pattern, suggesting that functional diversification of ZmANK genes family. The results will present significant insights to explore ANK genes expression and function in future studies in maize.

  5. Characterization of the p16 gene in the mouse: Evidence for a large gene family

    SciTech Connect

    Fountain, J.W.; Giendening, J.M.; Flores, J.F.

    1994-09-01

    The p16 gene product is an inhibitor of the cyclin-dependent kinase 4 (CDK4)/cyclin D complex. When uninhibited, the CDK4/cyclin D complex participates in the phosphorylation of the retinoblastoma (RB) protein and renders it inactive. Upon inactivation of the RB protein, transition from the G{sub 1} to the S phase of mitosis occurs and results in cellular proliferation. Thus, p16 is presumed to act as a negative regulator of cell growth by preventing the phosphorylation, and thereby subsequent inactivation, of RB by CDK4/cyclin D. Recently, the p16 gene (also known as the multiple tumor suppressor 1 (MTS1) gene) has been mapped to chromosome 9p21 and found to be deleted or mutated in a number of tumor cell lines. These findings support the role of p16 as a growth inhibitor or tumor suppressor gene and suggest that the mutation of this gene may have global implications in carcinogenesis. We have chosen to test the functional significance of p16 mutations in vivo through the generation of a mouse mutant for p16. In preparation for this undertaking, eight apparently independent (as judged by restriction enzyme digestion and differential hybridization) mouse genomic embryonic stem cell clones have been identified using exon 2 from the human p16 gene as a probe. The identification of these multiple nonoverlapping clones was not entirely surprising since the reduced stringency hybridization of a zoo blot with the same probe also revealed 10-15 positive EcoRI fragments in all species tested, including human, monkey, cow, dog, cat, rabbit, hamster, mouse, chicken and D. melanogaster. Taken together, these findings suggest that the p16 gene is a member of a large gene family. The location of these genomic clones, as well as their potential expression in the mouse, is currently under investigation.

  6. Gene conversions in the growth hormone gene family of primates: stronger homogenizing effects in the Hominidae lineage.

    PubMed

    Petronella, Nicholas; Drouin, Guy

    2011-09-01

    In humans, the growth hormone/chorionic somatomammotropin gene family is composed of five highly similar genes. We characterized the gene conversions that occurred between the growth hormone genes of 11 primate species. We detected 48 conversions using GENECONV and others were only detected using phylogenetic analyses. Gene conversions were detected in all species analyzed, their average size (±standard deviation) is 197.8±230.4 nucleotides, the size of the conversions is correlated with sequence similarity and converted regions are significantly more GC-rich than non-converted regions. Gene conversions have a stronger homogenizing effect in Hominidae genes than in other primate species. They are also less frequent in conserved gene regions and towards functionally important genes. This suggests that the high degree of sequence similarity observed between the growth hormone genes of primate species is a consequence of frequent gene conversions in gene regions which are under little selective constraints.

  7. Divergence pattern of animal gene families and relationship with the Cambrian explosion.

    PubMed

    Miyata, T; Suga, H

    2001-11-01

    There are many gene families that are specific to multicellular animals. These have either diverged from ancestral genes that are shared with fungi and/or plants or evolved from an ancestral gene unique to animals. The evolution of gene families involved in cell-cell communication and developmental control has been studied to establish whether the number of member genes increased dramatically immediately prior to or in concert with the Cambrian explosion. A molecular phylogeny-based analysis of several animal-specific gene families has revealed that gene diversification by duplication occurred during two active periods interrupted by a long intervening quiescent period. Intriguingly, the Cambrian explosion is situated in the silent period, indicating that there is no direct link between the first burst of gene diversification and the Cambrian explosion itself. The importance of gene recruitment as a possible molecular mechanism for morphological diversity, and its possible role for the Cambrian explosion, are discussed. Copyright 2001 John Wiley & Sons, Inc.

  8. Diversity and linkage of genes in the self-incompatibility gene family in Arabidopsis lyrata.

    PubMed Central

    Charlesworth, Deborah; Mable, Barbara K; Schierup, Mikkel H; Bartolomé, Carolina; Awadalla, Philip

    2003-01-01

    We report studies of seven members of the S-domain gene family in Arabidopsis lyrata, a member of the Brassicaceae that has a sporophytic self-incompatibility (SI) system. Orthologs for five loci are identifiable in the self-compatible relative A. thaliana. Like the Brassica stigmatic incompatibility protein locus (SRK), some of these genes have kinase domains. We show that several of these genes are unlinked to the putative A. lyrata SRK, Aly13. These genes have much lower nonsynonymous and synonymous polymorphism than Aly13 in the S-domains within natural populations, and differentiation between populations is higher, consistent with balancing selection at the Aly13 locus. One gene (Aly8) is linked to Aly13 and has high diversity. No departures from neutrality were detected for any of the loci. Comparing different loci within A. lyrata, sites corresponding to hypervariable regions in the Brassica S-loci (SLG and SRK) and in comparable regions of Aly13 have greater replacement site divergence than the rest of the S-domain. This suggests that the high polymorphism in these regions of incompatibility loci is due to balancing selection acting on sites within or near these regions, combined with low selective constraints. PMID:12930757

  9. Identification of genes from pattern formation, tyrosine kinase, and potassium channel families by DNA amplification

    SciTech Connect

    Kamb, A.; Weir, M.; Rudy, B.; Varmus, H.; Kenyon, C. )

    1989-06-01

    The study of gene family members has been aided by the isolation of related genes on the basis of DNA homology. The authors have adapted the polymerase chain reaction to screen animal genomes very rapidly and reliably for likely gene family members. Using conserved amino acid sequences to design degenerate oligonucleotide primers, they have shown that the genome of the nematode Caenorhabditis elegans contains sequences homologous to many Drosophila genes involved in pattern formation, including the segment polarity gene wingless (vertebrate int-1), and homeobox sequences characteristic of the Antennapedia, engrailed, and paired families. In addition, they have used this method to show that C. elegans contains at least five different sequences homologous to genes in the tyrosine kinase family. Lastly, they have isolated six potassium channel sequences from humans, a result that validates the utility of the method with large genomes and suggests that human potassium channel gene diversity may be extensive.

  10. The Phaseolus vulgaris ZIP gene family: identification, characterization, mapping, and gene expression

    PubMed Central

    Astudillo, Carolina; Fernandez, Andrea C.; Blair, Matthew W.; Cichy, Karen A.

    2013-01-01

    Zinc is an essential mineral for humans and plants and is involved in many physiological and biochemical processes. In humans, Zn deficiency has been associated with retarded growth and reduction of immune response. In plants, Zn is an essential component of more than 300 enzymes including RNA polymerase, alkaline phosphatase, alcohol dehydrogenase, Cu/Zn superoxidase dismutase, and carbonic anhydrase. The accumulation of Zn in plants involves many genes and characterization of the role of these genes will be useful in biofortification. Here we report the identification and phlyogenetic and sequence characterization of the 23 members of the ZIP (ZRT, IRT like protein) family of metal transporters and three transcription factors of the bZIP family in Phaseolus vulgaris L. Expression patterns of seven of these genes were characterized in two bean genotypes (G19833 and DOR364) under two Zn treatments. Tissue analyzed included roots and leaves at vegetative and flowering stages, and pods at 20 days after flowering. Four of the genes, PvZIP12, PvZIP13, PvZIP16, and Pv bZIP1, showed differential expression based on tissue, Zn treatment, and/or genotype. PvZIP12 and PvZIP13 were both more highly expressed in G19833 than DOR364. PvZIP12 was most highly expressed in vegetative leaves under the Zn (−) treatment. PvZIP16 was highly expressed in leaf tissue, especially leaf tissue at flowering stage grown in the Zn (−) treatment. Pv bZIP1 was most highly expressed in leaf and pod tissue. The 23 PvZIP genes and three bZIP genes were mapped on the DOR364 × G19833 linkage map. PvZIP12, PvZIP13, and PvZIP18, Pv bZIP2, and Pv bZIP3 were located near QTLs for Zn accumulation in the seed. Based on the expression and mapping results, PvZIP12 is a good candidate gene for increasing seed Zn concentration and increase understanding of the role of ZIP genes in metal uptake, distribution, and accumulation of zinc in P. vulgaris. PMID:23908661

  11. Molecular characterization of edestin gene family in Cannabis sativa L.

    PubMed

    Docimo, Teresa; Caruso, Immacolata; Ponzoni, Elena; Mattana, Monica; Galasso, Incoronata

    2014-11-01

    Globulins are the predominant class of seed storage proteins in a wide variety of plants. In many plant species globulins are present in several isoforms encoded by gene families. The major seed storage protein of Cannabis sativa L. is the globulin edestin, widely known for its nutritional potential. In this work, we report the isolation of seven cDNAs encoding for edestin from the C. sativa variety Carmagnola. Southern blot hybridization is in agreement with the number of identified edestin genes. All seven sequences showed the characteristic globulin features, but they result to be divergent members/forms of two edestin types. According to their sequence similarity four forms named CsEde1A, CsEde1B, CsEde1C, CsEde1D have been assigned to the edestin type 1 and the three forms CsEde2A, CsEde2B, CsEde2C to the edestin type 2. Analysis of the coding sequences revealed a high percentage of similarity (98-99%) among the different forms belonging to the same type, which decreased significantly to approximately 64% between the forms belonging to different types. Quantitative RT-PCR analysis revealed that both edestin types are expressed in developing hemp seeds and the amount of CsEde1 was 4.44 ± 0.10 higher than CsEde2. Both edestin types exhibited a high percentage of arginine (11-12%), but CsEde2 resulted particularly rich in methionine residues (2.36%) respect to CsEde1 (0.82%). The amino acid composition determined in CsEde1 and CsEde2 types suggests that these seed proteins can be used to improve the nutritional quality of plant food-stuffs.

  12. Bcl-2-related protein family gene expression during oligodendroglial differentiation.

    PubMed

    Itoh, Takayuki; Itoh, Aki; Pleasure, David

    2003-06-01

    Oligodendroglial lineage cells (OLC) vary in susceptibility to both necrosis and apoptosis depending on their developmental stages, which might be regulated by differential expression of Bcl-2-related genes. As an initial step to test this hypothesis, we examined the expression of 19 Bcl-2-related genes in purified cultures of rat oligodendroglial progenitors, immature and mature oligodendrocytes. All 'multidomain' anti-apoptotic members (Bcl-x, Bcl-2, Mcl-1, Bcl-w and Bcl2l10/Diva/Boo) except Bcl2a1/A1 are expressed in OLC. Semiquantitative and real-time RT-PCR revealed that Bcl-xL and Mcl-1 mRNAs are the dominant anti-apoptotic members and increase four- and twofold, respectively, with maturation. Bcl-2 mRNA is less abundant than Bcl-xL mRNA in progenitors and falls an additional 10-fold during differentiation. Bcl-w mRNA also increases, with significant changes in its splicing pattern, as OLC mature. Transfection studies demonstrated that Bcl-xL overexpression protects against kainate-induced excitotoxicity, whereas Bcl-2 overexpression does not. As for 'multidomain' pro-apoptotic members (Bax, Bad and Bok/Mtd), Bax and Bak are highly expressed throughout differentiation. Among 'BH3 domain-only' members examined (Bim, Biklk, DP5/Hrk, Bad, Bid, Noxa, Puma/Bbc3, Bmf, BNip3 and BNip3L), BNip3 and Bmf mRNAs increase markedly during differentiation. These results provide basic information to guide further studies on the roles for Bcl-2-related family proteins in OLC death.

  13. Genome-wide analysis reveals diverged patterns of codon bias, gene expression, and rates of sequence evolution in picea gene families.

    PubMed

    De La Torre, Amanda R; Lin, Yao-Cheng; Van de Peer, Yves; Ingvarsson, Pär K

    2015-03-05

    The recent sequencing of several gymnosperm genomes has greatly facilitated studying the evolution of their genes and gene families. In this study, we examine the evidence for expression-mediated selection in the first two fully sequenced representatives of the gymnosperm plant clade (Picea abies and Picea glauca). We use genome-wide estimates of gene expression (>50,000 expressed genes) to study the relationship between gene expression, codon bias, rates of sequence divergence, protein length, and gene duplication. We found that gene expression is correlated with rates of sequence divergence and codon bias, suggesting that natural selection is acting on Picea protein-coding genes for translational efficiency. Gene expression, rates of sequence divergence, and codon bias are correlated with the size of gene families, with large multicopy gene families having, on average, a lower expression level and breadth, lower codon bias, and higher rates of sequence divergence than single-copy gene families. Tissue-specific patterns of gene expression were more common in large gene families with large gene expression divergence than in single-copy families. Recent family expansions combined with large gene expression variation in paralogs and increased rates of sequence evolution suggest that some Picea gene families are rapidly evolving to cope with biotic and abiotic stress. Our study highlights the importance of gene expression and natural selection in shaping the evolution of protein-coding genes in Picea species, and sets the ground for further studies investigating the evolution of individual gene families in gymnosperms.

  14. [The MDR3 gene mutation: a rare cause of progressive familial intrahepatic cholestasis (PFIC)].

    PubMed

    Maisonnette, F; Abita, T; Barriere, E; Pichon, N; Vincensini, J F; Descottes, B

    2005-10-01

    A 47-year old man complained about persistant pain and cholestasis 12-years after a cholescystectomy. In his family, all his brothers and sisters had cholecystectomy. Genetic explorations revealed a MDR3 gene mutation. All symptoms disappeared with a treatment by ursodesoxycholic acid. MDR3 gene mutation is to be researched in all cases of familial cholestasis.

  15. Ortho2ExpressMatrix—a web server that interprets cross-species gene expression data by gene family information

    PubMed Central

    2011-01-01

    Background The study of gene families is pivotal for the understanding of gene evolution across different organisms and such phylogenetic background is often used to infer biochemical functions of genes. Modern high-throughput experiments offer the possibility to analyze the entire transcriptome of an organism; however, it is often difficult to deduct functional information from that data. Results To improve functional interpretation of gene expression we introduce Ortho2ExpressMatrix, a novel tool that integrates complex gene family information, computed from sequence similarity, with comparative gene expression profiles of two pre-selected biological objects: gene families are displayed with two-dimensional matrices. Parameters of the tool are object type (two organisms, two individuals, two tissues, etc.), type of computational gene family inference, experimental meta-data, microarray platform, gene annotation level and genome build. Family information in Ortho2ExpressMatrix bases on computationally different protein family approaches such as EnsemblCompara, InParanoid, SYSTERS and Ensembl Family. Currently, respective all-against-all associations are available for five species: human, mouse, worm, fruit fly and yeast. Additionally, microRNA expression can be examined with respect to miRBase or TargetScan families. The visualization, which is typical for Ortho2ExpressMatrix, is performed as matrix view that displays functional traits of genes (differential expression) as well as sequence similarity of protein family members (BLAST e-values) in colour codes. Such translations are intended to facilitate the user's perception of the research object. Conclusions Ortho2ExpressMatrix integrates gene family information with genome-wide expression data in order to enhance functional interpretation of high-throughput analyses on diseases, environmental factors, or genetic modification or compound treatment experiments. The tool explores differential gene expression in

  16. A novel pathogenic single nucleotide germline deletion in APC gene in a four generation Chinese family with familial adenomatous polyposis.

    PubMed

    Zhang, Zhao; Liang, Shengyun; Wang, Dan; Liang, Shengran; Li, Yuwei; Wang, Bingjie; Jiang, Tao; Zhao, Guoru; Zhang, Xipeng; Banerjee, Santasree

    2017-09-27

    Familial adenomatous polyposis (FAP) is an autosomal dominant precancerous condition which is associated with germline mutations of the APC gene. Clinically, FAP is characterized by the development of multiple colorectal adenomas or polyps which finally result in colorectal cancer by the 40 years age of the patient, if no surgical interventions have been undertaken. In this study, we present a clinical molecular study of a four generation Chinese family with FAP. Diagnosis of FAP was made on the basis of clinical manifestations, family history and medical (colonoscopy and histopathology) records. Genetic screening of the proband and all affected family members were performed by targeted next-generation sequencing and confirmatory Sanger sequencing. Targeted next generation sequencing identified a germline novel heterozygous single nucleotide deletion [c.3418delC; p.Pro1140Leufs*25] in exon18 of APC gene, which segregated with the FAP phenotypes in the proband and in all the affected family members whereas absent in unaffected family members as well as in normal healthy controls of same ethnic origin. Our present study expands the mutational spectrum of APC gene and provides evidence to understand the function of APC gene in FAP.

  17. Evolutionary Diversification of the Vertebrate Transferrin Multi-gene Family

    PubMed Central

    Hughes, Austin L.; Friedman, Robert

    2014-01-01

    In a phylogenetic analysis of vertebrate transferrins (TFs), six major clades (subfamilies) were identified: (1) S, the mammalian serotransferrins; (2) ICA, the mammalian inhibitor of carbonic anhydrase (ICA) homologs; (3) L, the mammalian lactoferrins; (4) O, the ovotransferrins of birds and reptiles; (4) M, the melanotransferrins of bony fishes, amphibians, reptiles, birds, and mammals; and (5) M-like, a newly identified TF subfamily found in bony fishes, amphibians, reptiles, and birds. A phylogenetic tree based on the joint alignment of N-lobes and C-lobes supported the hypothesis that three separate events of internal duplication occurred in vertebrate TFs: (1) in the common ancestor of the M subfamily; (2) in the common ancestor of the M-like subfamily; and (3) in the common ancestor of other vertebrate TFs. The S, ICA, and L subfamilies were found only in placental mammals, and the phylogenetic analysis supported the hypothesis that these three subfamilies arose by gene duplication after the divergence of placental mammals from marsupials. The M-like subfamily was unusual in several respects, including the presence of a uniquely high proportion of clade-specific conserved residues, including distinctive but conserved residues in the sites homologous to those functioning in carbonate binding of human serotransferrin. The M-like family also showed a unusually high proportion of cationic residues in the positively charged region corresponding to human lactoferrampin, suggesting a distinctive role of this region in the M-like subfamily, perhaps in antimicrobial defense. PMID:25142446

  18. FUS GENE MUTATIONS IN FAMILIAL AND SPORADIC AMYOTROPHIC LATERAL SCLEROSIS

    PubMed Central

    Rademakers, Rosa; Stewart, Heather; DeJesus-Hernandez, Mariely; Krieger, Charles; Graff-Radford, Neill; Fabros, Marife; Briemberg, Hannah; Cashman, Neil; Eisen, Andrew; Mackenzie, Ian R. A.

    2010-01-01

    Introduction Mutations in the fused in sarcoma (FUS) gene have recently been found to cause familial amyotrophic lateral sclerosis (FALS). Methods We screened FUS in a cohort of 200 ALS patients [32 FALS and 168 sporadic ALS (SALS)]. Results In one FALS proband, we identified a mutation (p.R521C) that was also present in her affected daughter. Their clinical phenotype was remarkably similar and atypical of classic ALS, with symmetric proximal pelvic and pectoral weakness. Distal weakness and upper motor neuron features only developed late. Neuropathological examination demonstrated FUS-immunoreactive neuronal and glial inclusions in the spinal cord and many extramotor regions, but no TDP-43 pathology. We also identified a novel mutation (p.G187S) in one SALS patient. Overall, FUS mutations accounted for 3% of our non-SOD1, non-TARDBP FALS cases and 0.6% of SALS. Discussion This study demonstrates that the phenotype with FUS mutations extends beyond classical ALS. It suggests there are specific clinicogenetic correlations and provides the first detailed neuropathological description. PMID:20544928

  19. Identification of DOK family genes as lung tumor suppressors

    PubMed Central

    Berger, Alice H.; Niki, Masaru; Morotti, Alessandro; Taylor, Barry S.; Socci, Nicholas D.; Viale, Agnes; Brennan, Cameron; Szoke, Janos; Motoi, Noriko; Rothman, Paul B.; Teruya-Feldstein, Julie; Gerald, William L.; Ladanyi, Marc; Pandolfi, Pier Paolo

    2010-01-01

    Genome-wide analyses in human lung adenocarcinoma have identified regions of consistent copy number gain or loss, but in many cases the oncogenes and tumor suppressors presumed to reside in these loci remain to be determined. Here we identify the “Downstream of tyrosine kinase” (Dok) family members Dok1, Dok2 and Dok3 as lung tumor suppressors. Single, double, or triple compound loss of these genes in the mouse results in lung cancer with penetrance and latency dependent on the number of lost Dok alleles, and which is associated with an aberrant expansion and signaling profile of alveolar type II cells and bronchioalveolar stem cells. In human lung adenocarcinoma, we identify DOK2 as a target of copy number loss and mRNA downregulation and find that DOK2 suppresses lung cancer cell proliferation in vitro and in vivo. Given the genomic localization of DOK2, we propose it as an 8p21.3 haploinsufficient human lung tumor suppressor. PMID:20139980

  20. Evolutionary diversification of the vertebrate transferrin multi-gene family.

    PubMed

    Hughes, Austin L; Friedman, Robert

    2014-11-01

    In a phylogenetic analysis of vertebrate transferrins (TFs), six major clades (subfamilies) were identified: (a) S, the mammalian serotransferrins; (b) ICA, the mammalian inhibitor of carbonic anhydrase (ICA) homologs; (c) L, the mammalian lactoferrins; (d) O, the ovotransferrins of birds and reptiles; (e) M, the melanotransferrins of bony fishes, amphibians, reptiles, birds, and mammals; and (f) M-like, a newly identified TF subfamily found in bony fishes, amphibians, reptiles, and birds. A phylogenetic tree based on the joint alignment of N-lobes and C-lobes supported the hypothesis that three separate events of internal duplication occurred in vertebrate TFs: (a) in the common ancestor of the M subfamily, (b) in the common ancestor of the M-like subfamily, and (c) in the common ancestor of other vertebrate TFs. The S, ICA, and L subfamilies were found only in placental mammals, and the phylogenetic analysis supported the hypothesis that these three subfamilies arose by gene duplication after the divergence of placental mammals from marsupials. The M-like subfamily was unusual in several respects, including the presence of a uniquely high proportion of clade-specific conserved residues, including distinctive but conserved residues in the sites homologous to those functioning in carbonate binding of human serotransferrin. The M-like family also showed an unusually high proportion of cationic residues in the positively charged region corresponding to human lactoferrampin, suggesting a distinctive role of this region in the M-like subfamily, perhaps in antimicrobial defense.

  1. A novel pathogenic large germline deletion in adenomatous polyposis coli gene in a Chinese family with familial adenomatous polyposis.

    PubMed

    Zhang, Zhao; Liang, Shengran; Huang, Hui; Wang, Dan; Zhang, Xipeng; Wu, Jing; Chen, Huishuang; Wang, Yanyan; Rong, Tingting; Zhou, Yulin; Banerjee, Santasree

    2016-08-02

    Germline mutations of the APC gene are associated with an autosomal dominant precancerous condition, termed familial adenomatous polyposis (FAP). FAP is clinically manifested by the presence of multiple colorectal adenomas or polyps. Gradually, these colorectal adenomas or polyps inevitably result in colorectal cancer by the third-to fourth decade of life. Surgical interventions or total proctocolectomy is the best possible treatment for FAP. Here, we present a clinical molecular study of a five generation Chinese family with FAP. Diagnosis of FAP was made on the basis of clinical manifestations, family history and medical (colonoscopy and histopathology) records. Blood samples were collected and genomic DNA was extracted. Genetic screening of the APC gene was performed by targeted next-generation sequencing and quantitative real-time PCR. Targeted next generation sequencing identified a novel heterozygous large deletion [exon5-exon16; c.423_8532del] of APC gene, which segregated with the FAP phenotypes in the proband and in all the affected family members. Unaffected family members and normal controls did not carry this deletion. In the Chinese population, most of the previously reported APC gene mutations are missense mutations. This is the first report describing the largest deletion of the APC gene in the Chinese population associated with FAP.

  2. A novel pathogenic large germline deletion in adenomatous polyposis coli gene in a Chinese family with familial adenomatous polyposis

    PubMed Central

    Wang, Dan; Zhang, Xipeng; Wu, Jing; Chen, Huishuang; Wang, Yanyan; Rong, Tingting; Zhou, Yulin; Banerjee, Santasree

    2016-01-01

    Germline mutations of the APC gene are associated with an autosomal dominant precancerous condition, termed familial adenomatous polyposis (FAP). FAP is clinically manifested by the presence of multiple colorectal adenomas or polyps. Gradually, these colorectal adenomas or polyps inevitably result in colorectal cancer by the third-to fourth decade of life. Surgical interventions or total proctocolectomy is the best possible treatment for FAP. Here, we present a clinical molecular study of a five generation Chinese family with FAP. Diagnosis of FAP was made on the basis of clinical manifestations, family history and medical (colonoscopy and histopathology) records. Blood samples were collected and genomic DNA was extracted. Genetic screening of the APC gene was performed by targeted next-generation sequencing and quantitative real-time PCR. Targeted next generation sequencing identified a novel heterozygous large deletion [exon5-exon16; c.423_8532del] of APC gene, which segregated with the FAP phenotypes in the proband and in all the affected family members. Unaffected family members and normal controls did not carry this deletion. In the Chinese population, most of the previously reported APC gene mutations are missense mutations. This is the first report describing the largest deletion of the APC gene in the Chinese population associated with FAP. PMID:27391059

  3. Genome-wide identification and analysis of the MADS-box gene family in apple.

    PubMed

    Tian, Yi; Dong, Qinglong; Ji, Zhirui; Chi, Fumei; Cong, Peihua; Zhou, Zongshan

    2015-01-25

    The MADS-box gene family is one of the most widely studied families in plants and has diverse developmental roles in flower pattern formation, gametophyte cell division and fruit differentiation. Although the genome-wide analysis of this family has been performed in some species, little is known regarding MADS-box genes in apple (Malus domestica). In this study, 146 MADS-box genes were identified in the apple genome and were phylogenetically clustered into six subgroups (MIKC(c), MIKC*, Mα, Mβ, Mγ and Mδ) with the MADS-box genes from Arabidopsis and rice. The predicted apple MADS-box genes were distributed across all 17 chromosomes at different densities. Additionally, the MADS-box domain, exon length, gene structure and motif compositions of the apple MADS-box genes were analysed. Moreover, the expression of all of the apple MADS-box genes was analysed in the root, stem, leaf, flower tissues and five stages of fruit development. All of the apple MADS-box genes, with the exception of some genes in each group, were expressed in at least one of the tissues tested, which indicates that the MADS-box genes are involved in various aspects of the physiological and developmental processes of the apple. To the best of our knowledge, this report describes the first genome-wide analysis of the apple MADS-box gene family, and the results should provide valuable information for understanding the classification, cloning and putative functions of this family.

  4. Tandem zinc-finger gene families in mammals: insights and unanswered questions.

    PubMed

    Shannon, M; Kim, J; Ashworth, L; Branscomb, E; Stubbs, L

    1998-01-01

    Evidence for the remarkable conservation of mammalian genomes, in both content and organization of resident genes, is rapidly emerging from comparative mapping studies. The frequent occurrence of familial gene clustering, presumably reflecting a history of tandem in situ duplications starting from a single ancestral gene, is also apparent from these analyses. Genes encoding Kruppel-type zinc-finger (ZNF) proteins, including those containing Kruppel-associated box (KRAB) motifs, are particularly prone to such clustered organization. Existing data suggest that genes in KRAB-ZNF gene clusters have diverged in sequence and expression patterns, possibly yielding families of proteins with distinct, yet related, functions. Comparative mapping studies indicate that at least some of the genes within these clusters in mammals were elaborated prior to the divergence of mammalian orders and, subsequently, have been conserved. These data suggest a possible role for these tandem KRAB-ZNF gene families in mammalian evolution.

  5. Evolution of the Schlafen genes, a gene family associated with embryonic lethality, meiotic drive, immune processes and orthopoxvirus virulence.

    PubMed

    Bustos, Olivia; Naik, Saijal; Ayers, Gayle; Casola, Claudio; Perez-Lamigueiro, Maria A; Chippindale, Paul T; Pritham, Ellen J; de la Casa-Esperón, Elena

    2009-11-01

    Genes of the Schlafen family, first discovered in mouse, are expressed in hematopoietic cells and are involved in immune processes. Previous results showed that they are candidate genes for two major phenomena: meiotic drive and embryonic lethality (DDK syndrome). However, these genes remain poorly understood, mostly due to the limitations imposed by their similarity, close location and the potential functional redundancy of the gene family members. Here we use genomic and phylogenetic studies to investigate the evolution and role of this family of genes. Our results show that the Schlafen family is widely distributed in mammals, where we recognize four major clades that experienced lineage-specific expansions or contractions in various orders, including primates and rodents. In addition, we identified members of the Schlafen family in Chondrichthyes and Amphibia, indicating an ancient origin of these genes. We find evidence that positive selection has acted on many Schlafen genes. Moreover, our analyses indicate that a member of the Schlafen family was horizontally transferred from murine rodents to orthopoxviruses, where it is hypothesized to play a role in allowing the virus to survive host immune defense mechanisms. The functional relevance of the viral Schlafen sequences is further underscored by our finding that they are evolving under purifying selection. This is of particular importance, since orthopoxviruses infect mammals and include variola, the causative agent of smallpox, and monkeypox, an emerging virus of great concern for human health.

  6. Structural, functional, and evolutionary analysis of the unusually large stilbene synthase gene family in grapevine.

    PubMed

    Parage, Claire; Tavares, Raquel; Réty, Stéphane; Baltenweck-Guyot, Raymonde; Poutaraud, Anne; Renault, Lauriane; Heintz, Dimitri; Lugan, Raphaël; Marais, Gabriel A B; Aubourg, Sébastien; Hugueney, Philippe

    2012-11-01

    Stilbenes are a small family of phenylpropanoids produced in a number of unrelated plant species, including grapevine (Vitis vinifera). In addition to their participation in defense mechanisms in plants, stilbenes, such as resveratrol, display important pharmacological properties and are postulated to be involved in the health benefits associated with a moderate consumption of red wine. Stilbene synthases (STSs), which catalyze the biosynthesis of the stilbene backbone, seem to have evolved from chalcone synthases (CHSs) several times independently in stilbene-producing plants. STS genes usually form small families of two to five closely related paralogs. By contrast, the sequence of grapevine reference genome (cv PN40024) has revealed an unusually large STS gene family. Here, we combine molecular evolution and structural and functional analyses to investigate further the high number of STS genes in grapevine. Our reannotation of the STS and CHS gene families yielded 48 STS genes, including at least 32 potentially functional ones. Functional characterization of nine genes representing most of the STS gene family diversity clearly indicated that these genes do encode for proteins with STS activity. Evolutionary analysis of the STS gene family revealed that both STS and CHS evolution are dominated by purifying selection, with no evidence for strong selection for new functions among STS genes. However, we found a few sites under different selection pressures in CHS and STS sequences, whose potential functional consequences are discussed using a structural model of a typical STS from grapevine that we developed.

  7. Metallothionein Gene Family in the Sea Urchin Paracentrotus lividus: Gene Structure, Differential Expression and Phylogenetic Analysis

    PubMed Central

    Ragusa, Maria Antonietta; Nicosia, Aldo; Costa, Salvatore; Cuttitta, Angela; Gianguzza, Fabrizio

    2017-01-01

    Metallothioneins (MT) are small and cysteine-rich proteins that bind metal ions such as zinc, copper, cadmium, and nickel. In order to shed some light on MT gene structure and evolution, we cloned seven Paracentrotus lividus MT genes, comparing them to Echinodermata and Chordata genes. Moreover, we performed a phylogenetic analysis of 32 MTs from different classes of echinoderms and 13 MTs from the most ancient chordates, highlighting the relationships between them. Since MTs have multiple roles in the cells, we performed RT-qPCR and in situ hybridization experiments to understand better MT functions in sea urchin embryos. Results showed that the expression of MTs is regulated throughout development in a cell type-specific manner and in response to various metals. The MT7 transcript is expressed in all tissues, especially in the stomach and in the intestine of the larva, but it is less metal-responsive. In contrast, MT8 is ectodermic and rises only at relatively high metal doses. MT5 and MT6 expression is highly stimulated by metals in the mesenchyme cells. Our results suggest that the P. lividus MT family originated after the speciation events by gene duplications, evolving developmental and environmental sub-functionalization. PMID:28417916

  8. A novel heterozygous missense mutation in uromodulin gene in an Indian family with familial juvenile hyperuricemic nephropathy

    PubMed Central

    Saxena, D.; Srivastava, P.; Phadke, S. R.

    2016-01-01

    Familial juvenile hyperuricemic nephropathy (FJHN), characterized by early-onset hyperuricemia, reduced fractional excretion of uric acid, and chronic renal failure is caused due to mutation in uromodulin (UMOD) gene. We identified a novel mutation in a family with multiple members affected with FJHN. Ten coding exons of UMOD gene in three family members with clinical and biochemical features of FJHN and one unaffected family member were sequenced, and sequence variants were analyzed for the pathogenicity by bioinformatics studies. A heterozygous novel missense mutation (c. 949 T >G) in exon 5 leading to the replacement of cysteine by glycine at position 317 was identified in all three affected family members. This mutation has not been reported earlier in Human Gene Mutation Database, Human Genome Variation, Clinvar, and 1000 Genome. The mutation lies in the cysteine-rich 2 domain of the protein, and the affected residue is evolutionary conserved in other species. To our knowledge, this is the first report of the identification of UMOD mutation in an Indian family. PMID:27795632

  9. Gender in childhood obesity: family environment, hormones, and genes.

    PubMed

    Wisniewski, Amy B; Chernausek, Steven D

    2009-01-01

    The prevalence of obesity among children in the United States represents a pool of latent morbidity. Though the prevalence of obesity has increased in both boys and girls, the causes and consequences differ between the sexes. Thus, interventions proposed to treat and prevent childhood obesity will need to account for these differences. This review examines gender differences in the presentation of obesity in children and describes environmental, hormonal, and genetic factors that contribute to observed gender differences. A search of peer-reviewed, published literature was performed with PubMed for articles published from January 1974 through October 2008. Search terms used were obesity, sex, gender, hormones, family environment, body composition, adiposity, and genes. Studies of children aged 0 to 18 years were included, and only articles published in English were reviewed for consideration. Articles that illustrated gender differences in either the presentation or underlying mechanisms of obesity in children were reviewed for content, and their bibliographies were used to identify other relevant literature. Gender differences in childhood obesity have been understudied partially because of how we define the categories of overweight and obesity. Close examination of studies revealed that gender differences were common, both before and during puberty. Boys and girls differ in body composition, patterns of weight gain, hormone biology, and the susceptibility to certain social, ethnic, genetic, and environmental factors. Our understanding of how gender differences in pediatric populations relate to the pathogenesis of obesity and the subsequent development of associated comorbid states is critical to developing and implementing both therapeutic and preventive interventions.

  10. Out of the Water: Origin and Diversification of the LBD Gene Family.

    PubMed

    Chanderbali, Andre S; He, Fengmei; Soltis, Pamela S; Soltis, Douglas E

    2015-08-01

    LBD (lateral organ boundaries domain) genes are essential to the developmental programs of many fundamental plant organs and function in some of the basic metabolic pathways of plants. However, our historical perspective on the roles of LBD genes during plant evolution has, heretofore, been fragmentary. Here, we show that the LBD gene family underwent an initial radiation that established five gene lineages in the ancestral genome of most charophyte algae and land plants. By inference, the LBD gene family originated after the emergence of the green plants (Viridiplantae), but prior to the diversification of most extant streptophytes. After this initial radiation, we find limited instances of gene family diversification in land plants until successive rounds of expansion in the ancestors of seed plants and flowering plants. The most dynamic phases of LBD gene evolution, therefore, trace to the aquatic ancestors of embryophytes followed by relatively recent lineage-specific expansions on land.

  11. Out of the Water: Origin and Diversification of the LBD Gene Family

    PubMed Central

    Chanderbali, Andre S.; He, Fengmei; Soltis, Pamela S.; Soltis, Douglas E.

    2015-01-01

    LBD (LATERAL ORGAN BOUNDARIES DOMAIN) genes are essential to the developmental programs of many fundamental plant organs and function in some of the basic metabolic pathways of plants. However, our historical perspective on the roles of LBD genes during plant evolution has, heretofore, been fragmentary. Here, we show that the LBD gene family underwent an initial radiation that established five gene lineages in the ancestral genome of most charophyte algae and land plants. By inference, the LBD gene family originated after the emergence of the green plants (Viridiplantae), but prior to the diversification of most extant streptophytes. After this initial radiation, we find limited instances of gene family diversification in land plants until successive rounds of expansion in the ancestors of seed plants and flowering plants. The most dynamic phases of LBD gene evolution, therefore, trace to the aquatic ancestors of embryophytes followed by relatively recent lineage-specific expansions on land. PMID:25839188

  12. Genomic organization of the mouse T-cell receptor beta-chain gene family.

    PubMed Central

    Lai, E; Barth, R K; Hood, L

    1987-01-01

    We have combined three different methods, deletion mapping of T-cell lines, field-inversion gel electrophoresis, and the restriction mapping of a cosmid clone, to construct a physical map of the murine T-cell receptor beta-chain gene family. We have mapped 19 variable (V beta) gene segments and the two clusters of diversity (D beta) and joining (J beta) gene segments and constant (C beta) genes. These members of the beta-chain gene family span approximately equal to 450 kilobases of DNA, excluding one potential gap in the DNA fragment alignments. Images PMID:3035555

  13. Inferring Hypotheses on Functional Relationships of Genes: Analysis of the Arabidopsis thaliana Subtilase Gene Family

    PubMed Central

    Büssis, Dirk; Stintzi, Annick; Schaller, Andreas; Kopka, Joachim; Altmann, Thomas

    2005-01-01

    The gene family of subtilisin-like serine proteases (subtilases) in Arabidopsis thaliana comprises 56 members, divided into six distinct subfamilies. Whereas the members of five subfamilies are similar to pyrolysins, two genes share stronger similarity to animal kexins. Mutant screens confirmed 144 T-DNA insertion lines with knockouts for 55 out of the 56 subtilases. Apart from SDD1, none of the confirmed homozygous mutants revealed any obvious visible phenotypic alteration during growth under standard conditions. Apart from this specific case, forward genetics gave us no hints about the function of the individual 54 non-characterized subtilase genes. Therefore, the main objective of our work was to overcome the shortcomings of the forward genetic approach and to infer alternative experimental approaches by using an integrative bioinformatics and biological approach. Computational analyses based on transcriptional co-expression and co-response pattern revealed at least two expression networks, suggesting that functional redundancy may exist among subtilases with limited similarity. Furthermore, two hubs were identified, which may be involved in signalling or may represent higher-order regulatory factors involved in responses to environmental cues. A particular enrichment of co-regulated genes with metabolic functions was observed for four subtilases possibly representing late responsive elements of environmental stress. The kexin homologs show stronger associations with genes of transcriptional regulation context. Based on the analyses presented here and in accordance with previously characterized subtilases, we propose three main functions of subtilases: involvement in (i) control of development, (ii) protein turnover, and (iii) action as downstream components of signalling cascades. Supplemental material is available in the Plant Subtilase Database (PSDB) (http://csbdb.mpimp-golm.mpg.de/psdb.html) , as well as from the CSB.DB (http

  14. Cloning of the mouse BTG3 gene and definition of a new gene family (the BTG family) involved in the negative control of the cell cycle.

    PubMed

    Guéhenneux, F; Duret, L; Callanan, M B; Bouhas, R; Hayette, S; Berthet, C; Samarut, C; Rimokh, R; Birot, A M; Wang, Q; Magaud, J P; Rouault, J P

    1997-03-01

    It is well known that loss of tumor suppressor genes and more generally of antiproliferative genes plays a key role in the development of most tumors. We report here the cloning of the mouse BTG3 gene and show that its human counterpart maps on chromosome 21. This evolutionarily conserved gene codes for a 30 kDa protein and is expressed in most adult murine and human tissues analyzed. However, we demonstrate that its expression is cell cycle dependent and peaks at the end of the G1 phase. This gene is homologous to the human BTG1, BTG2 and TOB genes which were demonstrated to act as inhibitors of cell proliferation. Its description allowed us to define better this seven gene family (the BTG gene family) at the structural level and to speculate about its physiological role in normal and tumoral cells. This family is mainly characterized by the presence of two conserved domains (BTG boxes A and B) of as yet undetermined function which are separated by a non-conserved 20-25 amino acid sequence.

  15. ARLTS1, potential candidate gene in familial aggregation of hematological malignancies.

    PubMed

    Hamadou, Walid Sabri; Besbes, Sawsen; Mani, Rahma; Bourdon, Violaine; Ben Youssef, Yosra; Achour, Béchir; Regaieg, Haifa; Eisinger, François; Mari, Véronique; Gesta, Paul; Dreyfus, Hélène; Bonadona, Valérie; Dugast, Catherine; Zattara, Hélène; Faivre, Laurence; Noguchi, Testsuro; Khélif, Abderrahim; Sobol, Hagay; Soua, Zohra

    2017-02-01

    Genetic predisposition to familial hematological malignancies was previously described through several epidemiological analyses, but the genetic basis remains unclear. The tumor-suppressor ARLTS1 gene was previously described in sporadic hematological malignancies and familial cancer context. In this study, we sequence the ARLTS1 gene in 100 patients belonging to 88 independent Tunisian and French families. After gene sequencing, we report 8 genetic variations, most of which were previously reported in several cancer forms. The most common variants were W149X and C148R and were previously associated to B-cell chronic lymphocytic leukemia and to high-risk of familial breast cancer. These results emphasize the fact that ARLTS1 gene mutations can be considered as a potential predisposing factor in familial hematological malignancies and other several cancer forms. Copyright © 2016 Société Française du Cancer. Published by Elsevier Masson SAS. All rights reserved.

  16. [Analysis of FGFR2 gene mutations in two Chinese families with Crouzon syndrome].

    PubMed

    Huang, Yanru; Mei, Libin; Su, Wei; Yang, Pu; Liang, Desheng; Wu, Lingqian; Pan, Qian

    2014-06-01

    To detect potential mutations of fibroblast growth factor receptor 2 gene (FGFR2) in two Chinese families with Crouzon syndrome. Genomic DNA was extracted from peripheral blood leukocytes of 20 members from two affected families. All of the 18 exons of the FGFR2 gene were amplified with polymerase chain reaction and sequenced after purification. A missense mutation c.868T>C (p.W290R) in exon 8 of the FGFR2 gene was found solely in 2 affected members from family 1. Another missense mutation c.833G>T (p.C278F) in exon 8 was found solely in 5 affected members of family 2. The missense mutations of the FGFR2 gene are responsible for the Crouzon syndrome in the two families. The c.868T>C missense mutation is reported for the first time in Chinese population.

  17. Identification and distribution of the NBS-LRR gene family in the cassava genome

    USDA-ARS?s Scientific Manuscript database

    Plant resistance genes (R genes) exist in large families and usually contain both a nucleotide-binding site domain and a leucine-rich repeat domain, denoted NBS-LRR. The genome sequence of cassava (Manihot esculenta) is a valuable resource for analyzing the genomic organization of resistance genes i...

  18. Different evolutionary histories of two cation/proton exchanger gene families in plants

    PubMed Central

    2013-01-01

    Background Gene duplication events have been proposed to be involved in the adaptation of plants to stress conditions; precisely how is unclear. To address this question, we studied the evolution of two families of antiporters. Cation/proton exchangers are important for normal cell function and in plants, Na+,K+/H+ antiporters have also been implicated in salt tolerance. Two well-known plant cation/proton antiporters are NHX1 and SOS1, which perform Na+ and K+ compartmentalization into the vacuole and Na+ efflux from the cell, respectively. However, our knowledge about the evolution of NHX and SOS1 stress responsive gene families is still limited. Results In this study we performed a comprehensive molecular evolutionary analysis of the NHX and SOS1 families. Using available sequences from a total of 33 plant species, we estimated gene family phylogenies and gene duplication histories, as well as examined heterogeneous selection pressure on amino acid sites. Our results show that, while the NHX family expanded and specialized, the SOS1 family remained a low copy gene family that appears to have undergone neofunctionalization during its evolutionary history. Additionally, we found that both families are under purifying selection although SOS1 is less constrained. Conclusions We propose that the different evolution histories are related with the proteins’ function and localization, and that the NHX and SOS1 families are examples of two different evolutionary paths through which duplication events may result in adaptive evolution of stress tolerance. PMID:23822194

  19. Extensive and continuous duplication facilitates rapid evolution and diversification of gene families.

    PubMed

    Chang, Dan; Duda, Thomas F

    2012-08-01

    The origin of novel gene functions through gene duplication, mutation, and natural selection represents one of the mechanisms by which organisms diversify and one of the possible paths leading to adaptation. Nonetheless, the extent, role, and consequences of duplications in the origins of ecological adaptations, especially in the context of species interactions, remain unclear. To explore the evolution of a gene family that is likely linked to species associations, we investigated the evolutionary history of the A-superfamily of conotoxin genes of predatory marine cone snails (Conus species). Members of this gene family are expressed in the venoms of Conus species and are presumably involved in predator-prey associations because of their utility in prey capture. We recovered sequences of this gene family from genomic DNA of four closely related species of Conus and reconstructed the evolutionary history of these genes. Our study is the first to directly recover conotoxin genes from Conus genomes to investigate the evolution of conotoxin gene families. Our results revealed a phenomenon of rapid and continuous gene turnover that is coupled with heightened rates of evolution. This continuous duplication pattern has not been observed previously, and the rate of gene turnover is at least two times higher than estimates from other multigene families. Conotoxin genes are among the most rapidly evolving protein-coding genes in metazoans, a phenomenon that may be facilitated by extensive gene duplications and have driven changes in conotoxin functions through neofunctionalization. Together these mechanisms led to dramatically divergent arrangements of A-superfamily conotoxin genes among closely related species of Conus. Our findings suggest that extensive and continuous gene duplication facilitates rapid evolution and drastic divergence in venom compositions among species, processes that may be associated with evolutionary responses to predator-prey interactions.

  20. Genomewide analysis of the lateral organ boundaries domain gene family in Vitis vinifera.

    PubMed

    Cao, Hui; Liu, Cai-Yun; Liu, Chun-Xiang; Zhao, Yue-Ling; Xu, Rui-Rui

    2016-09-01

    In plants, the transcription factor families have been implicated in many important biological processes. These processes include morphogenesis, signal transduction and environmental stress responses. Proteins containing the lateral organ boundaries domain (LBD), which encodes a zinc finger-like domain are only found in plants. This finding indicates that this unique gene family regulates only plant-specific biological processes. LBD genes play crucial roles in the growth and development of plants such as Arabidopsis, Oryza sativa, Zea mays, poplar, apple and tomato. However, relatively little is known about the LBD genes in grape (Vitis vinifera). In this study, we identified 40 LBD genes in the grape genome. A complete overview of the chromosomal locations, phylogenetic relationships, structures and expression profiles of this gene family during development in grape is presented here. Phylogenetic analysis showed that the LBD genes could be divided into classes I and II, together with LBDs from Arabidopsis. We mapped the 40 LBD genes on the grape chromosomes (chr1-chr19) and found that 37 of the predicted grape LBD genes were distributed in different densities across 12 chromosomes. Grape LBDs were found to share a similar intron/exon structure and gene length within the same class. The expression profiles of grape LBD genes at different developmental stages were analysed using microarray data. Results showed that 21 grape LBD genes may be involved in grape developmental processes, including preveraison, veraison and ripening. Finally, we analysed the expression patterns of six LBD genes through quantitative real-time polymerase chain reation analysis. The six LBD genes showed differential expression patterns among the three representative grape tissues, and five of these genes were found to be involved in responses to mannitol, sodium chloride, heat stress and low temperature treatments. To our knowledge, this is the first study to analyse the LBD gene family in

  1. Evolution of the chitin synthase gene family correlates with fungal morphogenesis and adaption to ecological niches

    PubMed Central

    Liu, Ran; Xu, Chuan; Zhang, Qiangqiang; Wang, Shiyi; Fang, Weiguo

    2017-01-01

    The fungal kingdom potentially has the most complex chitin synthase (CHS) gene family, but evolution of the fungal CHS gene family and its diversification to fulfill multiple functions remain to be elucidated. Here, we identified the full complement of CHSs from 231 fungal species. Using the largest dataset to date, we characterized the evolution of the fungal CHS gene family using phylogenetic and domain structure analysis. Gene duplication, domain recombination and accretion are major mechanisms underlying the diversification of the fungal CHS gene family, producing at least 7 CHS classes. Contraction of the CHS gene family is morphology-specific, with significant loss in unicellular fungi, whereas family expansion is lineage-specific with obvious expansion in early-diverging fungi. ClassV and ClassVII CHSs with the same domain structure were produced by the recruitment of domains PF00063 and PF08766 and subsequent duplications. Comparative analysis of their functions in multiple fungal species shows that the emergence of ClassV and ClassVII CHSs is important for the morphogenesis of filamentous fungi, development of pathogenicity in pathogenic fungi, and heat stress tolerance in Pezizomycotina fungi. This work reveals the evolution of the fungal CHS gene family, and its correlation with fungal morphogenesis and adaptation to ecological niches. PMID:28300148

  2. Cloning of novel rice blast resistance genes from two rapidly evolving NBS-LRR gene families in rice.

    PubMed

    Guo, Changjiang; Sun, Xiaoguang; Chen, Xiao; Yang, Sihai; Li, Jing; Wang, Long; Zhang, Xiaohui

    2016-01-01

    Most rice blast resistance genes (R-genes) encode proteins with nucleotide-binding site (NBS) and leucine-rich repeat (LRR) domains. Our previous study has shown that more rice blast R-genes can be cloned in rapidly evolving NBS-LRR gene families. In the present study, two rapidly evolving R-gene families in rice were selected for cloning a subset of genes from their paralogs in three resistant rice lines. A total of eight functional blast R-genes were identified among nine NBS-LRR genes, and some of these showed resistance to three or more blast strains. Evolutionary analysis indicated that high nucleotide diversity of coding regions served as important parameters in the determination of gene resistance. We also observed that amino-acid variants (nonsynonymous mutations, insertions, or deletions) in essential motifs of the NBS domain contribute to the blast resistance capacity of NBS-LRR genes. These results suggested that the NBS regions might also play an important role in resistance specificity determination. On the other hand, different splicing patterns of introns were commonly observed in R-genes. The results of the present study contribute to improving the effectiveness of R-gene identification by using evolutionary analysis method and acquisition of novel blast resistance genes.

  3. Genome dynamics explain the evolution of flowering time CCT domain gene families in the Poaceae.

    PubMed

    Cockram, James; Thiel, Thomas; Steuernagel, Burkhard; Stein, Nils; Taudien, Stefan; Bailey, Paul C; O'Sullivan, Donal M

    2012-01-01

    Numerous CCT domain genes are known to control flowering in plants. They belong to the CONSTANS-like (COL) and PREUDORESPONSE REGULATOR (PRR) gene families, which in addition to a CCT domain possess B-box or response-regulator domains, respectively. Ghd7 is the most recently identified COL gene to have a proven role in the control of flowering time in the Poaceae. However, as it lacks B-box domains, its inclusion within the COL gene family, technically, is incorrect. Here, we show Ghd7 belongs to a larger family of previously uncharacterized Poaceae genes which possess just a single CCT domain, termed here CCT MOTIF FAMILY (CMF) genes. We molecularly describe the CMF (and related COL and PRR) gene families in four sequenced Poaceae species, as well as in the draft genome assembly of barley (Hordeum vulgare). Genetic mapping of the ten barley CMF genes identified, as well as twelve previously unmapped HvCOL and HvPRR genes, finds the majority map to colinear positions relative to their Poaceae orthologues. Combined inter-/intra-species comparative and phylogenetic analysis of CMF, COL and PRR gene families indicates they evolved prior to the monocot/dicot divergence ∼200 mya, with Poaceae CMF evolution described as the interplay between whole genome duplication in the ancestral cereal, and subsequent clade-specific mutation, deletion and duplication events. Given the proven role of CMF genes in the modulation of cereals flowering, the molecular, phylogenetic and comparative analysis of the Poaceae CMF, COL and PRR gene families presented here provides the foundation from which functional investigation can be undertaken.

  4. Genome Dynamics Explain the Evolution of Flowering Time CCT Domain Gene Families in the Poaceae

    PubMed Central

    Cockram, James; Thiel, Thomas; Steuernagel, Burkhard; Stein, Nils; Taudien, Stefan; Bailey, Paul C.; O'Sullivan, Donal M.

    2012-01-01

    Numerous CCT domain genes are known to control flowering in plants. They belong to the CONSTANS-like (COL) and PREUDORESPONSE REGULATOR (PRR) gene families, which in addition to a CCT domain possess B-box or response-regulator domains, respectively. Ghd7 is the most recently identified COL gene to have a proven role in the control of flowering time in the Poaceae. However, as it lacks B-box domains, its inclusion within the COL gene family, technically, is incorrect. Here, we show Ghd7 belongs to a larger family of previously uncharacterized Poaceae genes which possess just a single CCT domain, termed here CCT MOTIF FAMILY (CMF) genes. We molecularly describe the CMF (and related COL and PRR) gene families in four sequenced Poaceae species, as well as in the draft genome assembly of barley (Hordeum vulgare). Genetic mapping of the ten barley CMF genes identified, as well as twelve previously unmapped HvCOL and HvPRR genes, finds the majority map to colinear positions relative to their Poaceae orthologues. Combined inter-/intra-species comparative and phylogenetic analysis of CMF, COL and PRR gene families indicates they evolved prior to the monocot/dicot divergence ∼200 mya, with Poaceae CMF evolution described as the interplay between whole genome duplication in the ancestral cereal, and subsequent clade-specific mutation, deletion and duplication events. Given the proven role of CMF genes in the modulation of cereals flowering, the molecular, phylogenetic and comparative analysis of the Poaceae CMF, COL and PRR gene families presented here provides the foundation from which functional investigation can be undertaken. PMID:23028921

  5. Evolution of the RH gene family in vertebrates revealed by brown hagfish (Eptatretus atami) genome sequences.

    PubMed

    Suzuki, Akinori; Komata, Hidero; Iwashita, Shogo; Seto, Shotaro; Ikeya, Hironobu; Tabata, Mitsutoshi; Kitano, Takashi

    2017-02-01

    In vertebrates, there are four major genes in the RH (Rhesus) gene family, RH, RHAG, RHBG, and RHCG. These genes are thought to have been formed by the two rounds of whole-genome duplication (2R-WGD) in the common ancestor of all vertebrates. In our previous work, where we analyzed details of the gene duplications process of this gene family, three nucleotide sequences belonging to this family were identified in Far Eastern brook lamprey (Lethenteron reissneri), and the phylogenetic positions of the genes were determined. Lampreys, along with hagfishes, are cyclostomata (jawless fishes), which is a sister group of gnathostomata (jawed vertebrates). Although those results suggested that one gene was orthologous to the gnathostome RHCG genes, we did not identify clear orthologues for other genes. In this study, therefore, we identified three novel cDNA sequences that belong to the RH gene family using de novo transcriptome analysis of another cyclostome: the brown hagfish (Eptatretus atami). We also determined the nucleotide sequences for the RHBG and RHCG genes in a red stingray (Dasyatis akajei), which belongs to the cartilaginous fishes. The phylogenetic tree showed that two brown hagfish genes, which were probably duplicated in the cyclostome lineage, formed a cluster with the gnathostome RHAG genes, whereas another brown hagfish gene formed a cluster with the gnathostome RHCG genes. We estimated that the RH genes had a higher evolutionary rate than the RHAG, RHBG, and RHCG genes. Interestingly, in the RHBG genes, only the bird lineage showed a higher rate of nonsynonymous substitutions. It is likely that this higher rate was caused by a state of relaxed functional constraints rather than positive selection nor by pseudogenization.

  6. Methuselah/Methuselah-like G protein-coupled receptors constitute an ancient metazoan gene family

    PubMed Central

    de Mendoza, Alexandre; Jones, Jeffery W.; Friedrich, Markus

    2016-01-01

    Inconsistent conclusions have been drawn regarding the phylogenetic age of the Methuselah/Methuselah-like (Mth/Mthl) gene family of G protein-coupled receptors, the founding member of which regulates development and lifespan in Drosophila. Here we report the results from a targeted homolog search of 39 holozoan genomes and phylogenetic analysis of the conserved seven transmembrane domain. Our findings reveal that the Mth/Mthl gene family is ancient, has experienced numerous extinction and expansion events during metazoan evolution, and acquired the current definition of the Methuselah ectodomain during its exceptional expansion in arthropods. In addition, our findings identify Mthl1, Mthl5, Mthl14, and Mthl15 as the oldest Mth/Mthl gene family paralogs in Drosophila. Future studies of these genes have the potential to define ancestral functions of the Mth/Mthl gene family. PMID:26915348

  7. Diversification of the C-TERMINALLY ENCODED PEPTIDE (CEP) gene family in angiosperms, and evolution of plant-family specific CEP genes.

    PubMed

    Ogilvie, Huw A; Imin, Nijat; Djordjevic, Michael A

    2014-10-06

    Small, secreted signaling peptides work in parallel with phytohormones to control important aspects of plant growth and development. Genes from the C-TERMINALLY ENCODED PEPTIDE (CEP) family produce such peptides which negatively regulate plant growth, especially under stress, and affect other important developmental processes. To illuminate how the CEP gene family has evolved within the plant kingdom, including its emergence, diversification and variation between lineages, a comprehensive survey was undertaken to identify and characterize CEP genes in 106 plant genomes. Using a motif-based system developed for this study to identify canonical CEP peptide domains, a total of 916 CEP genes and 1,223 CEP domains were found in angiosperms and for the first time in gymnosperms. This defines a narrow band for the emergence of CEP genes in plants, from the divergence of lycophytes to the angiosperm/gymnosperm split. Both CEP genes and domains were found to have diversified in angiosperms, particularly in the Poaceae and Solanaceae plant families. Multispecies orthologous relationships were determined for 22% of identified CEP genes, and further analysis of those groups found selective constraints upon residues within the CEP peptide and within the previously little-characterized variable region. An examination of public Oryza sativa RNA-Seq datasets revealed an expression pattern that links OsCEP5 and OsCEP6 to panicle development and flowering, and CEP gene trees reveal these emerged from a duplication event associated with the Poaceae plant family. The characterization of the plant-family specific CEP genes OsCEP5 and OsCEP6, the association of CEP genes with angiosperm-specific development processes like panicle development, and the diversification of CEP genes in angiosperms provides further support for the hypothesis that CEP genes have been integral to the evolution of novel traits within the angiosperm lineage. Beyond these findings, the comprehensive set of CEP

  8. Massive Expansion of Ubiquitination-Related Gene Families within the Chlamydiae

    PubMed Central

    Domman, Daryl; Collingro, Astrid; Lagkouvardos, Ilias; Gehre, Lena; Weinmaier, Thomas; Rattei, Thomas; Subtil, Agathe; Horn, Matthias

    2014-01-01

    Gene loss, gain, and transfer play an important role in shaping the genomes of all organisms; however, the interplay of these processes in isolated populations, such as in obligate intracellular bacteria, is less understood. Despite a general trend towards genome reduction in these microbes, our phylogenomic analysis of the phylum Chlamydiae revealed that within the family Parachlamydiaceae, gene family expansions have had pronounced effects on gene content. We discovered that the largest gene families within the phylum are the result of rapid gene birth-and-death evolution. These large gene families are comprised of members harboring eukaryotic-like ubiquitination-related domains, such as F-box and BTB-box domains, marking the largest reservoir of these proteins found among bacteria. A heterologous type III secretion system assay suggests that these proteins function as effectors manipulating the host cell. The large disparity in copy number of members in these families between closely related organisms suggests that nonadaptive processes might contribute to the evolution of these gene families. Gene birth-and-death evolution in concert with genomic drift might represent a previously undescribed mechanism by which isolated bacterial populations diversify. PMID:25069652

  9. Isolation of novel human and mouse genes of the recA/RAD51 recombination-repair gene family.

    PubMed Central

    Cartwright, R; Dunn, A M; Simpson, P J; Tambini, C E; Thacker, J

    1998-01-01

    Genes from the recA/RAD51 family play essential roles in homologous recombination in all organisms. Using sequence homologies from eukaryotic members of this family we have identified fragments of two additional mammalian genes with homology to RAD51. Cloning the full-length cDNAs for both human and mouse genes showed that the sequences are highly conserved, and that the predicted proteins have characteristic features of this gene family. One of the novel genes (R51H2) occurs in two forms in human cDNA, differing extensively at the 3' end, probably due to an unusual form of alternative splicing. The new genes (R51H2 and R51H3) were mapped to human chromosomes 14q23-24 and 17q1.2, respectively. Expression studies showed that R51H2 is expressed at lower levels than R51H3 , but that expression of both genes occurs at elevated levels in the testis compared with other tissues. The combination of gene structure conservation and the transcript expression patterns suggests that these new members of the recA/RAD51 family may also function in homologous recombination-repair pathways. PMID:9512535

  10. Genome-Wide analysis of the AAAP gene family in moso bamboo (Phyllostachys edulis).

    PubMed

    Liu, Huanlong; Wu, Min; Zhu, Dongyue; Pan, Feng; Wang, Yujiao; Wang, Yue; Xiang, Yan

    2017-01-31

    Members of the amino acid/auxin permease (AAAP) gene family play indispensable roles in various plant metabolism and biosynthesis processes. Comprehensive analysis of AAAP genes has been conducted in Arabidopsis, rice, maize and poplar, but has not been reported from moso bamboo. Phylogenetics, evolutionary patterns and further expression profiles analysis of the AAAP gene family in moso bamboo (Phyllostachys edulis) will increase our understanding of this important gene family. In this current study, we conducted phylogenetic, gene structure, promoter region, divergence time, expression patterns and qRT-PCR analysis of the 55 predicted AAAP genes in moso bamboo based on the availability of the moso bamboo genome sequence. We identified 55 putative AAAP (PeAAAP1-55) genes, which were divided into eight distinct subfamilies based on comparative phylogenetic analysis using 184 full-length protein sequences, including 55 sequences from moso bamboo, 58 sequences from rice and 71 sequences from maize. Analysis of evolutionary patterns and divergence showed that the PeAAAP genes have undergone a extensive duplication event approximately 12 million years ago (MYA) and that the split between AAAP family genes in moso bamboo and rice occurred approximately 27 MYA. The microarray analysis suggested that some genes play considerable roles in moso bamboo growth and development. We investigated the expression levels of the 16 AAP subfamily genes under abiotic stress (drought, salt and cold) by qRT-PCR to explore the potential contributions to stress response of individual PeAAAP genes in moso bamboo. The results of this study suggest that PeAAAP genes play crucial roles in moso bamboo growth and development, especially in response to abiotic stress conditions. Our comprehensive, systematic study of the AAAPs gene family in moso bamboo will facilitate further analysis of the functions and evolution of AAAP genes in plants.

  11. Retrieval of glycoside hydrolase family 9 cellulase genes from environmental DNA by metagenomic gene specific multi-primer PCR.

    PubMed

    Xiong, Xiaolong; Yin, Xiaopu; Pei, Xiaolin; Jin, Peng; Zhang, Ao; Li, Yan; Gong, Weibo; Wang, Qiuyan

    2012-05-01

    A new method, termed metagenomic gene specific multi-primer PCR (MGSM-PCR), is presented that uses multiple gene specific primers derived from an isolated gene from a constructed metagenomic library rather than degenerate primers designed based on a known enzyme family. The utility of MGSM-PCR was shown by applying it to search for homologues of the glycoside hydrolase family 9 cellulase in metagenomic DNA. The success of the multiplex PCR was verified by visualizing products on an agarose gel following gel electrophoresis. A total of 127 homologous genes were amplified with combinatorial multi-primer reactions from 34 soil DNA samples. Multiple alignments revealed extensive sequence diversity among these captured sequences with sequence identity varying from 26 to 99.7%. These results indicated that significantly diverse homologous genes were indeed readily accessible when using multiple metagenomic gene specific primers.

  12. Genomic organization of a cellulase gene family in Phanerochaete chrysosporium

    Treesearch

    Sarah F. Covert; Jennifer Bolduc; Daniel Cullen

    1992-01-01

    Southern blot and nucleotide sequence analysis of Phanerochaete chrysosporium BKM-F-1767 genomic clones indicate that this wood-degrading fungus contains at least six genes with significant homology to the Trichoderma reesei cellobiohydrolase I gene (cbh1). Using pulsed-field gel electrophoresis to separate P. chrysosporium chromosomes, the six cellulase genes were...

  13. Integrated pipeline for inferring the evolutionary history of a gene family embedded in the species tree: a case study on the STIMATE gene family.

    PubMed

    Song, Jia; Zheng, Sisi; Nguyen, Nhung; Wang, Youjun; Zhou, Yubin; Lin, Kui

    2017-10-03

    Because phylogenetic inference is an important basis for answering many evolutionary problems, a large number of algorithms have been developed. Some of these algorithms have been improved by integrating gene evolution models with the expectation of accommodating the hierarchy of evolutionary processes. To the best of our knowledge, however, there still is no single unifying model or algorithm that can take all evolutionary processes into account through a stepwise or simultaneous method. On the basis of three existing phylogenetic inference algorithms, we built an integrated pipeline for inferring the evolutionary history of a given gene family; this pipeline can model gene sequence evolution, gene duplication-loss, gene transfer and multispecies coalescent processes. As a case study, we applied this pipeline to the STIMATE (TMEM110) gene family, which has recently been reported to play an important role in store-operated Ca(2+) entry (SOCE) mediated by ORAI and STIM proteins. We inferred their phylogenetic trees in 69 sequenced chordate genomes. By integrating three tree reconstruction algorithms with diverse evolutionary models, a pipeline for inferring the evolutionary history of a gene family was developed, and its application was demonstrated.

  14. Conservation, Divergence, and Genome-Wide Distribution of PAL and POX A Gene Families in Plants

    PubMed Central

    Rawal, H. C.; Singh, N. K.; Sharma, T. R.

    2013-01-01

    Genome-wide identification and phylogenetic and syntenic comparison were performed for the genes responsible for phenylalanine ammonia lyase (PAL) and peroxidase A (POX A) enzymes in nine plant species representing very diverse groups like legumes (Glycine max and Medicago truncatula), fruits (Vitis vinifera), cereals (Sorghum bicolor, Zea mays, and Oryza sativa), trees (Populus trichocarpa), and model dicot (Arabidopsis thaliana) and monocot (Brachypodium distachyon) species. A total of 87 and 1045 genes in PAL and POX A gene families, respectively, have been identified in these species. The phylogenetic and syntenic comparison along with motif distributions shows a high degree of conservation of PAL genes, suggesting that these genes may predate monocot/eudicot divergence. The POX A family genes, present in clusters at the subtelomeric regions of chromosomes, might be evolving and expanding with higher rate than the PAL gene family. Our analysis showed that during the expansion of POX A gene family, many groups and subgroups have evolved, resulting in a high level of functional divergence among monocots and dicots. These results will act as a first step toward the understanding of monocot/eudicot evolution and functional characterization of these gene families in the future. PMID:23671845

  15. Identification of a Novel Gig2 Gene Family Specific to Non-Amniote Vertebrates

    PubMed Central

    Zhang, Yi-Bing; Liu, Ting-Kai; Jiang, Jun; Shi, Jun; Liu, Ying; Li, Shun; Gui, Jian-Fang

    2013-01-01

    Gig2 (grass carp reovirus (GCRV)-induced gene 2) is first identified as a novel fish interferon (IFN)-stimulated gene (ISG). Overexpression of a zebrafish Gig2 gene can protect cultured fish cells from virus infection. In the present study, we identify a novel gene family that is comprised of genes homologous to the previously characterized Gig2. EST/GSS search and in silico cloning identify 190 Gig2 homologous genes in 51 vertebrate species ranged from lampreys to amphibians. Further large-scale search of vertebrate and invertebrate genome databases indicate that Gig2 gene family is specific to non-amniotes including lampreys, sharks/rays, ray-finned fishes and amphibians. Phylogenetic analysis and synteny analysis reveal lineage-specific expansion of Gig2 gene family and also provide valuable evidence for the fish-specific genome duplication (FSGD) hypothesis. Although Gig2 family proteins exhibit no significant sequence similarity to any known proteins, a typical Gig2 protein appears to consist of two conserved parts: an N-terminus that bears very low homology to the catalytic domains of poly(ADP-ribose) polymerases (PARPs), and a novel C-terminal domain that is unique to this gene family. Expression profiling of zebrafish Gig2 family genes shows that some duplicate pairs have diverged in function via acquisition of novel spatial and/or temporal expression under stresses. The specificity of this gene family to non-amniotes might contribute to a large extent to distinct physiology in non-amniote vertebrates. PMID:23593256

  16. Sequence and expression analysis of the AMT gene family in poplar.

    PubMed

    Wu, Xiangyu; Yang, Han; Qu, Chunpu; Xu, Zhiru; Li, Wei; Hao, Bingqing; Yang, Chuanping; Sun, Guangyu; Liu, Guanjun

    2015-01-01

    Ammonium transporters (AMTs) are plasma membrane proteins that exclusively transport ammonium/ammonia. These proteins are encoded by an ancient gene family with many members. The molecular characteristics and evolutionary history of AMTs in woody plants are still poorly understood. We comprehensively evaluated the AMT gene family in the latest release of the Populus trichocarpa genome (version 3.0; Phytozome 9.0), and identified 16 AMT genes. These genes formed four clusters; AMT1 (7 genes), AMT2 (2 genes), AMT3 (2 genes), and AMT4 (5 genes). Evolutionary analyses suggested that the Populus AMT gene family has expanded via whole-genome duplication events. Among the 16 AMT genes, 15 genes are located on 11 chromosomes of Populus. Expression analyses showed that 14 AMT genes were vegetative organs expressed; AMT1;1/1;3/1;6/3;2 and AMT1;1/1;2/2;2/3;1 had high transcript accumulation level in the leaves and roots, respectively and strongly changes under the nitrogen-dependent experiments. The results imply the functional roles of AMT genes in ammonium absorption in poplar.

  17. The ankyrin repeat gene family in rice: genome-wide identification, classification and expression profiling.

    PubMed

    Huang, Jianyan; Zhao, Xiaobo; Yu, Huihui; Ouyang, Yidan; Wang, Lei; Zhang, Qifa

    2009-10-01

    Ankyrin repeat (ANK) containing proteins comprise a large protein family. Although many members of this family have been implicated in plant growth, development and signal transduction, only a few ANK genes have been reported in rice. In this study, we analyzed the structures, phylogenetic relationship, genome localizations and expression profiles of 175 ankyrin repeat genes identified in rice (OsANK). Domain composition analysis suggested OsANK proteins can be classified into ten subfamilies. Chromosomal localizations of OsANK genes indicated nine segmental duplication events involving 17 genes and 65 OsANK genes were involved in tandem duplications. The expression profiles of 158 OsANK genes were analyzed in 24 tissues covering the whole life cycle of two rice genotypes, Minghui 63 and Zhenshan 97. Sixteen genes showed preferential expression in given tissues compared to all the other tissues in Minghui 63 and Zhenshan 97. Nine genes were preferentially expressed in stamen of 1 day before flowering, suggesting that these genes may play important roles in pollination and fertilization. Expression data of OsANK genes were also obtained with tissues of seedlings subjected to three phytohormone (NAA, GA3 and KT) and light/dark treatments. Eighteen genes showed differential expression with at least one phytohormone treatment while under light/dark treatments, 13 OsANK genes showed differential expression. Our data provided a very useful reference for cloning and functional analysis of members of this gene family in rice.

  18. Genome-wide analysis of the GRAS gene family in Chinese cabbage (Brassica rapa ssp. pekinensis).

    PubMed

    Song, Xiao-Ming; Liu, Tong-Kun; Duan, Wei-Ke; Ma, Qing-Hua; Ren, Jun; Wang, Zhen; Li, Ying; Hou, Xi-Lin

    2014-01-01

    The GRAS gene family is one of the most important families of transcriptional regulators. In this study, 48 GRAS genes are identified from Chinese cabbage, and they are classified into eight groups according to the classification of Arabidopsis. The characterization, classification, gene structure and phylogenetic construction of GRAS proteins are performed. Distribution mapping shows that GRAS proteins are nonrandomly localized in 10 chromosomes. Fifty-five orthologous gene pairs are shared by Chinese cabbage and Arabidopsis, and interaction networks of these orthologous genes are constructed. The expansion of GRAS genes in Chinese cabbage results from genome triplication. Among the 17 species examined, 14 higher plants carry the GRAS genes, whereas two lower plants and one fungi species do not. Furthermore, the expression patterns of GRAS genes exhibit differences in three tissues based on RNA-seq data. Taken together, this comprehensive analysis will provide rich resources for studying GRAS protein functions in Chinese cabbage.

  19. Holding blame at bay? ‘Gene talk' in family members' accounts of schizophrenia aetiology

    PubMed Central

    Callard, Felicity; Rose, Diana; Hanif, Emma-Louise; Quigley, Jody; Greenwood, Kathryn; Wykes, Til

    2012-01-01

    We provide the first detailed analysis of how, for what purposes and with what consequences people related to someone with a diagnosis of schizophrenia use ‘gene talk'. The article analyses findings from a qualitative interview study conducted in London and involving 19 participants (mostly women). We transcribed the interviews verbatim and analysed them using grounded theory methods. We analyse how and for what purposes participants mobilized ‘gene talk' in their affectively freighted encounter with an unknown interviewer. Gene talk served to (re)position blame and guilt, and was simultaneously used imaginatively to forge family history narratives. Family members used ‘gene talk' to recruit forebears with no psychiatric diagnosis into a family history of mental illness, and presented the origins of the diagnosed family member's schizophrenia as lying temporally before, and hence beyond the agency of the immediate family. Gene talk was also used in attempts to dislodge the distressing figure of the schizophrenia-inducing mother. ‘Gene talk', however, ultimately displaced, rather than resolved, the (self-)blame of many family members, particularly mothers. Our article challenges the commonly expressed view that genetic accounts will absolve family members' sense of (self-)blame in relation to their relative's/relatives' diagnosis. PMID:23227107

  20. Phylogenetic analysis reveals dynamic evolution of the poly(A)-binding protein gene family in plants.

    PubMed

    Gallie, Daniel R; Liu, Renyi

    2014-11-25

    The poly(A)-binding protein (PABP) binds the poly(A) tail of eukaryotic mRNAs and functions to maintain the integrity of the mRNA while promoting protein synthesis through its interaction with eukaryotic translation initiation factor (eIF) 4G and eIF4B. PABP is encoded by a single gene in yeast and marine algae but during plant evolution the PABP gene family expanded substantially, underwent sequence divergence into three subclasses, and acquired tissue-specificity in gene family member expression. Although such changes suggest functional specialization, the size of the family and its sequence divergence have complicated an understanding of which gene family members may be foundational and which may represent more recent expansions of the family to meet the specific needs of speciation. Here, we examine the evolution of the plant PABP gene family to provide insight into these aspects of the family that may yield clues into the function of individual family members. The PABP gene family had expanded to two members by the appearance of fresh water algae and four members in non-vascular plants. In lycophytes, the first sequence divergence yielding a specific class member occurs. The earliest members of the gene family share greatest similarity to those modern members whose expression is confined to reproductive tissues, suggesting that supporting reproductive-associated gene expression is the most conserved function of this family. A family member sharing similarity to modern vegetative-associated members first appears in gymnosperms. Further elaboration of the reproductive-associated and vegetative-associated members occurred during the evolution of flowering plants. Expansion of the plant PABP gene family began prior to the colonization of land. By the evolution of lycophytes, the first class member whose expression is confined to reproductive tissues in higher plants had appeared. A second class member whose expression is vegetative-associated appeared in

  1. Genomic identification, characterization and differential expression analysis of SBP-box gene family in Brassica napus.

    PubMed

    Cheng, Hongtao; Hao, Mengyu; Wang, Wenxiang; Mei, Desheng; Tong, Chaobo; Wang, Hui; Liu, Jia; Fu, Li; Hu, Qiong

    2016-09-08

    SBP-box genes belong to one of the largest families of transcription factors. Though members of this family have been characterized to be important regulators of diverse biological processes, information of SBP-box genes in the third most important oilseed crop Brassica napus is largely undefined. In the present study, by whole genome bioinformatics analysis and transcriptional profiling, 58 putative members of SBP-box gene family in oilseed rape (Brassica napus L.) were identified and their expression pattern in different tissues as well as possible interaction with miRNAs were analyzed. In addition, B. napus lines with contrasting branch angle were used for investigating the involvement of SBP-box genes in plant architecture regulation. Detailed gene information, including genomic organization, structural feature, conserved domain and phylogenetic relationship of the genes were systematically characterized. By phylogenetic analysis, BnaSBP proteins were classified into eight distinct groups representing the clear orthologous relationships to their family members in Arabidopsis and rice. Expression analysis in twelve tissues including vegetative and reproductive organs showed different expression patterns among the SBP-box genes and a number of the genes exhibit tissue specific expression, indicating their diverse functions involved in the developmental process. Forty-four SBP-box genes were ascertained to contain the putative miR156 binding site, with 30 and 14 of the genes targeted by miR156 at the coding and 3'UTR region, respectively. Relative expression level of miR156 is varied across tissues. Different expression pattern of some BnaSBP genes and the negative correlation of transcription levels between miR156 and its target BnaSBP gene were observed in lines with different branch angle. Taken together, this study represents the first systematic analysis of the SBP-box gene family in Brassica napus. The data presented here provides base foundation for

  2. Extensive lineage-specific gene duplication and evolution of the spiggin multi-gene family in stickleback

    PubMed Central

    Kawahara, Ryouka; Nishida, Mutsumi

    2007-01-01

    Background The threespine stickleback (Gasterosteus aculeatus) has a characteristic reproductive mode; mature males build nests using a secreted glue-like protein called spiggin. Although recent studies reported multiple occurrences of genes that encode this glue-like protein spiggin in threespine and ninespine sticklebacks, it is still unclear how many genes compose the spiggin multi-gene family. Results Genome sequence analysis of threespine stickleback showed that there are at least five spiggin genes and two pseudogenes, whereas a single spiggin homolog occurs in the genomes of other fishes. Comparative genome sequence analysis demonstrated that Muc19, a single-copy mucous gene in human and mouse, is an ortholog of spiggin. Phylogenetic and molecular evolutionary analyses of these sequences suggested that an ancestral spiggin gene originated from a member of the mucin gene family as a single gene in the common ancestor of teleosts, and gene duplications of spiggin have occurred in the stickleback lineage. There was inter-population variation in the copy number of spiggin genes and positive selection on some codons, indicating that additional gene duplication/deletion events and adaptive evolution at some amino acid sites may have occurred in each stickleback population. Conclusion A number of spiggin genes exist in the threespine stickleback genome. Our results provide insight into the origin and dynamic evolutionary process of the spiggin multi-gene family in the threespine stickleback lineage. The dramatic evolution of genes for mucous substrates may have contributed to the generation of distinct characteristics such as "bio-glue" in vertebrates. PMID:17980047

  3. Gene Structures, Evolution and Transcriptional Profiling of the WRKY Gene Family in Castor Bean (Ricinus communis L.).

    PubMed

    Zou, Zhi; Yang, Lifu; Wang, Danhua; Huang, Qixing; Mo, Yeyong; Xie, Guishui

    2016-01-01

    WRKY proteins comprise one of the largest transcription factor families in plants and form key regulators of many plant processes. This study presents the characterization of 58 WRKY genes from the castor bean (Ricinus communis L., Euphorbiaceae) genome. Compared with the automatic genome annotation, one more WRKY-encoding locus was identified and 20 out of the 57 predicted gene models were manually corrected. All RcWRKY genes were shown to contain at least one intron in their coding sequences. According to the structural features of the present WRKY domains, the identified RcWRKY genes were assigned to three previously defined groups (I-III). Although castor bean underwent no recent whole-genome duplication event like physic nut (Jatropha curcas L., Euphorbiaceae), comparative genomics analysis indicated that one gene loss, one intron loss and one recent proximal duplication occurred in the RcWRKY gene family. The expression of all 58 RcWRKY genes was supported by ESTs and/or RNA sequencing reads derived from roots, leaves, flowers, seeds and endosperms. Further global expression profiles with RNA sequencing data revealed diverse expression patterns among various tissues. Results obtained from this study not only provide valuable information for future functional analysis and utilization of the castor bean WRKY genes, but also provide a useful reference to investigate the gene family expansion and evolution in Euphorbiaceus plants.

  4. Gene Structures, Evolution and Transcriptional Profiling of the WRKY Gene Family in Castor Bean (Ricinus communis L.)

    PubMed Central

    Huang, Qixing; Mo, Yeyong; Xie, Guishui

    2016-01-01

    WRKY proteins comprise one of the largest transcription factor families in plants and form key regulators of many plant processes. This study presents the characterization of 58 WRKY genes from the castor bean (Ricinus communis L., Euphorbiaceae) genome. Compared with the automatic genome annotation, one more WRKY-encoding locus was identified and 20 out of the 57 predicted gene models were manually corrected. All RcWRKY genes were shown to contain at least one intron in their coding sequences. According to the structural features of the present WRKY domains, the identified RcWRKY genes were assigned to three previously defined groups (I–III). Although castor bean underwent no recent whole-genome duplication event like physic nut (Jatropha curcas L., Euphorbiaceae), comparative genomics analysis indicated that one gene loss, one intron loss and one recent proximal duplication occurred in the RcWRKY gene family. The expression of all 58 RcWRKY genes was supported by ESTs and/or RNA sequencing reads derived from roots, leaves, flowers, seeds and endosperms. Further global expression profiles with RNA sequencing data revealed diverse expression patterns among various tissues. Results obtained from this study not only provide valuable information for future functional analysis and utilization of the castor bean WRKY genes, but also provide a useful reference to investigate the gene family expansion and evolution in Euphorbiaceus plants. PMID:26849139

  5. Saltatory evolution of the ectodermal neural cortex gene family at the vertebrate origin.

    PubMed

    Feiner, Nathalie; Murakami, Yasunori; Breithut, Lisa; Mazan, Sylvie; Meyer, Axel; Kuraku, Shigehiro

    2013-01-01

    The ectodermal neural cortex (ENC) gene family, whose members are implicated in neurogenesis, is part of the kelch repeat superfamily. To date, ENC genes have been identified only in osteichthyans, although other kelch repeat-containing genes are prevalent throughout bilaterians. The lack of elaborate molecular phylogenetic analysis with exhaustive taxon sampling has obscured the possible link of the establishment of this gene family with vertebrate novelties. In this study, we identified ENC homologs in diverse vertebrates by means of database mining and polymerase chain reaction screens. Our analysis revealed that the ENC3 ortholog was lost in the basal eutherian lineage through single-gene deletion and that the triplication between ENC1, -2, and -3 occurred early in vertebrate evolution. Including our original data on the catshark and the zebrafish, our comparison revealed high conservation of the pleiotropic expression pattern of ENC1 and shuffling of expression domains between ENC1, -2, and -3. Compared with many other gene families including developmental key regulators, the ENC gene family is unique in that conventional molecular phylogenetic inference could identify no obvious invertebrate ortholog. This suggests a composite nature of the vertebrate-specific gene repertoire, consisting not only of de novo genes introduced at the vertebrate origin but also of long-standing genes with no apparent invertebrate orthologs. Some of the latter, including the ENC gene family, may be too rapidly evolving to provide sufficient phylogenetic signals marking orthology to their invertebrate counterparts. Such gene families that experienced saltatory evolution likely remain to be explored and might also have contributed to phenotypic evolution of vertebrates.

  6. Saltatory Evolution of the Ectodermal Neural Cortex Gene Family at the Vertebrate Origin

    PubMed Central

    Feiner, Nathalie; Murakami, Yasunori; Breithut, Lisa; Mazan, Sylvie; Meyer, Axel; Kuraku, Shigehiro

    2013-01-01

    The ectodermal neural cortex (ENC) gene family, whose members are implicated in neurogenesis, is part of the kelch repeat superfamily. To date, ENC genes have been identified only in osteichthyans, although other kelch repeat-containing genes are prevalent throughout bilaterians. The lack of elaborate molecular phylogenetic analysis with exhaustive taxon sampling has obscured the possible link of the establishment of this gene family with vertebrate novelties. In this study, we identified ENC homologs in diverse vertebrates by means of database mining and polymerase chain reaction screens. Our analysis revealed that the ENC3 ortholog was lost in the basal eutherian lineage through single-gene deletion and that the triplication between ENC1, -2, and -3 occurred early in vertebrate evolution. Including our original data on the catshark and the zebrafish, our comparison revealed high conservation of the pleiotropic expression pattern of ENC1 and shuffling of expression domains between ENC1, -2, and -3. Compared with many other gene families including developmental key regulators, the ENC gene family is unique in that conventional molecular phylogenetic inference could identify no obvious invertebrate ortholog. This suggests a composite nature of the vertebrate-specific gene repertoire, consisting not only of de novo genes introduced at the vertebrate origin but also of long-standing genes with no apparent invertebrate orthologs. Some of the latter, including the ENC gene family, may be too rapidly evolving to provide sufficient phylogenetic signals marking orthology to their invertebrate counterparts. Such gene families that experienced saltatory evolution likely remain to be explored and might also have contributed to phenotypic evolution of vertebrates. PMID:23843192

  7. The R2R3-MYB Transcription Factor Gene Family in Maize

    PubMed Central

    Du, Hai; Feng, Bo-Run; Yang, Si-Si; Huang, Yu-Bi; Tang, Yi-Xiong

    2012-01-01

    MYB proteins comprise a large family of plant transcription factors, members of which perform a variety of functions in plant biological processes. To date, no genome-wide characterization of this gene family has been conducted in maize (Zea mays). In the present study, we performed a comprehensive computational analysis, to yield a complete overview of the R2R3-MYB gene family in maize, including the phylogeny, expression patterns, and also its structural and functional characteristics. The MYB gene structure in maize and Arabidopsis were highly conserved, indicating that they were originally compact in size. Subgroup-specific conserved motifs outside the MYB domain may reflect functional conservation. The genome distribution strongly supports the hypothesis that segmental and tandem duplication contribute to the expansion of maize MYB genes. We also performed an updated and comprehensive classification of the R2R3-MYB gene families in maize and other plant species. The result revealed that the functions were conserved between maize MYB genes and their putative orthologs, demonstrating the origin and evolutionary diversification of plant MYB genes. Species-specific groups/subgroups may evolve or be lost during evolution, resulting in functional divergence. Expression profile study indicated that maize R2R3-MYB genes exhibit a variety of expression patterns, suggesting diverse functions. Furthermore, computational prediction potential targets of maize microRNAs (miRNAs) revealed that miR159, miR319, and miR160 may be implicated in regulating maize R2R3-MYB genes, suggesting roles of these miRNAs in post-transcriptional regulation and transcription networks. Our comparative analysis of R2R3-MYB genes in maize confirm and extend the sequence and functional characteristics of this gene family, and will facilitate future functional analysis of the MYB gene family in maize. PMID:22719841

  8. "It's good to know": experiences of gene identification and result disclosure in familial epilepsies.

    PubMed

    Vears, Danya F; Dunn, Karen L; Wake, Samantha A; Scheffer, Ingrid E

    2015-05-01

    Recognition of the role of genetics in the epilepsies has increased dramatically, impacting on clinical practice across many epilepsy syndromes. There is limited research investigating the impact of gene identification on individuals and families with epilepsy. While research has focused on the impact of delivering genetic information to families at the time of diagnosis in genetic diseases more broadly, little is known about how genetic results in epileptic diseases influences people's lives many years after it has been conveyed. This study used qualitative methods to explore the experience of receiving a genetic result in people with familial epilepsy. Interviews were conducted with individuals with familial epilepsies in whom the underlying genetic mutation had been identified. Recorded interviews underwent thematic analysis. 20 individuals from three families with different epilepsy syndromes and causative genes were interviewed. Multiple generations within families were studied. The mean time from receiving the genetic result prior to interview was 10.9 years (range 5-14 years). Three major themes were identified: 1) living with epilepsy: an individual's experience of the severity of epilepsy in their family influenced their view. 2) Clinical utility of the test: participants expressed varying reactions to receiving a genetic result. While for some it provided helpful information and relief, others were not surprised by the finding given the familial context. Some valued the use of genetic information for reproductive decision-making, particularly in the setting of severely affected family members. While altruistic reasons for participating in genetic research were discussed, participants emphasised the benefit of participation to them and their families. 3) 'Talking about the family genes': individuals reported poor communication between family members about their epilepsy and its genetic implications. The results provide important insights into the family

  9. Global identification and expression analysis of stress-responsive genes of the Argonaute family in apple.

    PubMed

    Xu, Ruirui; Liu, Caiyun; Li, Ning; Zhang, Shizhong

    2016-12-01

    Argonaute (AGO) proteins, which are found in yeast, animals, and plants, are the core molecules of the RNA-induced silencing complex. These proteins play important roles in plant growth, development, and responses to biotic stresses. The complete analysis and classification of the AGO gene family have been recently reported in different plants. Nevertheless, systematic analysis and expression profiling of these genes have not been performed in apple (Malus domestica). Approximately 15 AGO genes were identified in the apple genome. The phylogenetic tree, chromosome location, conserved protein motifs, gene structure, and expression of the AGO gene family in apple were analyzed for gene prediction. All AGO genes were phylogenetically clustered into four groups (i.e., AGO1, AGO4, MEL1/AGO5, and ZIPPY/AGO7) with the AGO genes of Arabidopsis. These groups of the AGO gene family were statistically analyzed and compared among 31 plant species. The predicted apple AGO genes are distributed across nine chromosomes at different densities and include three segment duplications. Expression studies indicated that 15 AGO genes exhibit different expression patterns in at least one of the tissues tested. Additionally, analysis of gene expression levels indicated that the genes are mostly involved in responses to NaCl, PEG, heat, and low-temperature stresses. Hence, several candidate AGO genes are involved in different aspects of physiological and developmental processes and may play an important role in abiotic stress responses in apple. To the best of our knowledge, this study is the first to report a comprehensive analysis of the apple AGO gene family. Our results provide useful information to understand the classification and putative functions of these proteins, especially for gene members that may play important roles in abiotic stress responses in M. hupehensis.

  10. Multiple independent insertions of 5S rRNA genes in the spliced-leader gene family of trypanosome species.

    PubMed

    Beauparlant, Marc A; Drouin, Guy

    2014-02-01

    Analyses of the 5S rRNA genes found in the spliced-leader (SL) gene repeat units of numerous trypanosome species suggest that such linkages were not inherited from a common ancestor, but were the result of independent 5S rRNA gene insertions. In trypanosomes, 5S rRNA genes are found either in the tandemly repeated units coding for SL genes or in independent tandemly repeated units. Given that trypanosome species where 5S rRNA genes are within the tandemly repeated units coding for SL genes are phylogenetically related, one might hypothesize that this arrangement is the result of an ancestral insertion of 5S rRNA genes into the tandemly repeated SL gene family of trypanosomes. Here, we use the types of 5S rRNA genes found associated with SL genes, the flanking regions of the inserted 5S rRNA genes and the position of these insertions to show that most of the 5S rRNA genes found within SL gene repeat units of trypanosome species were not acquired from a common ancestor but are the results of independent insertions. These multiple 5S rRNA genes insertion events in trypanosomes are likely the result of frequent founder events in different hosts and/or geographical locations in species having short generation times.

  11. [Study of novel mutation of OPTN gene in two primary open angle glaucoma families in northeast China].

    PubMed

    Yuan, Hui-Ping; Xiao, Zheng; Xu, Na; Yang, Bin-Bin; Meng, Qing-Feng; Li, Yuan-Yuan

    2008-02-01

    To identify the mutation gene of two Chinese families with primary open angle glaucoma. It was a case control study. Clinical observation and pedigree analysis were undertaken in two families with primary open angle glaucoma. Venous blood were drawn from 6 affected and 6 unaffected subjects in family L, and from 4 affected and 4 unaffected subjects in family C. Genomic DNA was extracted. Linkage to OPTN gene locus was determined. Mutation of this gene was screened by PCR of OPTN gene exons and direct sequencing. A missense mutation A1274G in exon 10 of OPTN gene was identified in affected members of family L. The corresponding amino acid change was Lys322Glu. This mutation was not found in unaffected family members of family L, all members of family C and 87 unrelated normal controls. A novel mutation of OPTN gene with Lys322Glu change is responsible for the occurrence of primary open angle glaucoma in a Chinese family.

  12. Familial isolated pituitary adenoma caused by a Aip gene mutation not described before in a family context.

    PubMed

    García-Arnés, J A; González-Molero, I; Oriola, J; Mazuecos, N; Luque, R; Castaño, J; Arraez, M A

    2013-12-01

    The cause of familial isolated pituitary adenomas (FIPA) remains unknown in a high percentage of cases, but the AIP gene plays an important role in the etiology. The aim of the study is to describe a family with FIPA syndrome and the results of genomic studies. A 16-year-old man had a giant prolactinoma resistant tomedical treatment with delayed growth and pubertal development. His mother had been previously diagnosed with a nonfunctioning pituitary macroadenoma. Transsphenoidal endoscopic resection was performed and a genetic study revealed a heterozygous mutation in exon 6: 974G>A (p.Arg325Gln). Because the AIP gene is a tumor suppressor gene, we searched for loss of heterozygosity within the AIP gene by amplifying exon 6 from tumor tissue of the patient. In the electropherogram, only the A allele was amplified (hemizygous state), indicating loss of the normal allele. We report a Spanish family with FIPA in whom a mutation in the AIP gene previously unreported in a familiar context was identified.

  13. CRDB: Database of Chemosensory Receptor Gene Families in Vertebrate

    PubMed Central

    Wu, Xiaoli; Zhong, Yang

    2012-01-01

    Chemosensory receptors (CR) are crucial for animals to sense the environmental changes and survive on earth. The emergence of whole-genome sequences provides us an opportunity to identify the entire CR gene repertoires. To completely gain more insight into the evolution of CR genes in vertebrates, we identified the nearly all CR genes in 25 vertebrates using homology-based approaches. Among these CR gene repertoires, nearly half of them were identified for the first time in those previously uncharacterized species, such as the guinea pig, giant panda and elephant, etc. Consistent with previous findings, we found that the numbers of CR genes vary extensively among different species, suggesting an extreme form of ‘birth-and-death’ evolution. For the purpose of facilitating CR gene analysis, we constructed a database with the goals to provide a resource for CR genes annotation and a web tool for exploring their evolutionary patterns. Besides a search engine for the gene extraction from a specific chromosome region, an easy-to-use phylogenetic analysis tool was also provided to facilitate online phylogeny study of CR genes. Our work can provide a rigorous platform for further study on the evolution of CR genes in vertebrates. PMID:22393364

  14. Transcriptional profiling of the human fibrillin/LTBP gene family, key regulators of mesenchymal cell functions

    PubMed Central

    Davis, Margaret R.; Andersson, Robin; Severin, Jessica; de Hoon, Michiel; Bertin, Nicolas; Baillie, J. Kenneth; Kawaji, Hideya; Sandelin, Albin; Forrest, Alistair R.R.; Summers, Kim M.

    2014-01-01

    The fibrillins and latent transforming growth factor binding proteins (LTBPs) form a superfamily of extracellular matrix (ECM) proteins characterized by the presence of a unique domain, the 8-cysteine transforming growth factor beta (TGFβ) binding domain. These proteins are involved in the structure of the extracellular matrix and controlling the bioavailability of TGFβ family members. Genes encoding these proteins show differential expression in mesenchymal cell types which synthesize the extracellular matrix. We have investigated the promoter regions of the seven gene family members using the FANTOM5 CAGE database for human. While the protein and nucleotide sequences show considerable sequence similarity, the promoter regions were quite diverse. Most genes had a single predominant transcription start site region but LTBP1 and LTBP4 had two regions initiating different transcripts. Most of the family members were expressed in a range of mesenchymal and other cell types, often associated with use of alternative promoters or transcription start sites within a promoter in different cell types. FBN3 was the lowest expressed gene, and was found only in embryonic and fetal tissues. The different promoters for one gene were more similar to each other in expression than to promoters of the other family members. Notably expression of all 22 LTBP2 promoters was tightly correlated and quite distinct from all other family members. We located candidate enhancer regions likely to be involved in expression of the genes. Each gene was associated with a unique subset of transcription factors across multiple promoters although several motifs including MAZ, SP1, GTF2I and KLF4 showed overrepresentation across the gene family. FBN1 and FBN2, which had similar expression patterns, were regulated by different transcription factors. This study highlights the role of alternative transcription start sites in regulating the tissue specificity of closely related genes and suggests that

  15. Revisiting the diffusion approximation to estimate evolutionary rates of gene family diversification.

    PubMed

    Gjini, Erida; Haydon, Daniel T; David Barry, J; Cobbold, Christina A

    2014-01-21

    Genetic diversity in multigene families is shaped by multiple processes, including gene conversion and point mutation. Because multi-gene families are involved in crucial traits of organisms, quantifying the rates of their genetic diversification is important. With increasing availability of genomic data, there is a growing need for quantitative approaches that integrate the molecular evolution of gene families with their higher-scale function. In this study, we integrate a stochastic simulation framework with population genetics theory, namely the diffusion approximation, to investigate the dynamics of genetic diversification in a gene family. Duplicated genes can diverge and encode new functions as a result of point mutation, and become more similar through gene conversion. To model the evolution of pairwise identity in a multigene family, we first consider all conversion and mutation events in a discrete manner, keeping track of their details and times of occurrence; second we consider only the infinitesimal effect of these processes on pairwise identity accounting for random sampling of genes and positions. The purely stochastic approach is closer to biological reality and is based on many explicit parameters, such as conversion tract length and family size, but is more challenging analytically. The population genetics approach is an approximation accounting implicitly for point mutation and gene conversion, only in terms of per-site average probabilities. Comparison of these two approaches across a range of parameter combinations reveals that they are not entirely equivalent, but that for certain relevant regimes they do match. As an application of this modelling framework, we consider the distribution of nucleotide identity among VSG genes of African trypanosomes, representing the most prominent example of a multi-gene family mediating parasite antigenic variation and within-host immune evasion. © 2013 Published by Elsevier Ltd. All rights reserved.

  16. Identification and analysis of YELLOW protein family genes in the silkworm, Bombyx mori

    PubMed Central

    Xia, Ai-Hua; Zhou, Qing-Xiang; Yu, Lin-Lin; Li, Wei-Guo; Yi, Yong-Zhu; Zhang, Yao-Zhou; Zhang, Zhi-Fang

    2006-01-01

    Background The major royal jelly proteins/yellow (MRJP/YELLOW) family possesses several physiological and chemical functions in the development of Apis mellifera and Drosophila melanogaster. Each protein of the family has a conserved domain named MRJP. However, there is no report of MRJP/YELLOW family proteins in the Lepidoptera. Results Using the YELLOW protein sequence in Drosophila melanogaster to BLAST silkworm EST database, we found a gene family composed of seven members with a conserved MRJP domain each and named it YELLOW protein family of Bombyx mori. We completed the cDNA sequences with RACE method. The protein of each member possesses a MRJP domain and a putative cleavable signal peptide consisting of a hydrophobic sequence. In view of genetic evolution, the whole Bm YELLOW protein family composes a monophyletic group, which is distinctly separate from Drosophila melanogaster and Apis mellifera. We then showed the tissue expression profiles of Bm YELLOW protein family genes by RT-PCR. Conclusion A Bombyx mori YELLOW protein family is found to be composed of at least seven members. The low homogeneity and unique pattern of gene expression by each member among the family ensure us to prophesy that the members of Bm YELLOW protein family would play some important physiological functions in silkworm development. PMID:16884544

  17. Characterization of a ubiquitous expressed gene family encoding polygalacturonase in Arabidopsis thaliana.

    PubMed

    Torki, M; Mandaron, P; Mache, R; Falconet, D

    2000-01-25

    Pectin, as one of the major components of plant cell wall, has been implicated in many developmental processes occurring during plant growth. Among the different enzymes known to participate in the pectin structure modifications, polygalacturonase (PG) activity has been shown to be associated with fruit ripening, organ abscission and pollen grain development. Until now, sequence analyses of the deduced polypeptides of the plant PG genes allowed their grouping into three clades corresponding to genes involved in one of these three activities. In this study, we report the sequence of three genomic clones encoding PG in Arabidopsis thaliana. These genes, together with 16 other genes present in the databases form a large gene family, ubiquitously expressed, present on the five chromosomes with at least two gene clusters on chromosomes II and V, respectively. Phylogenetic analyses suggest that the A. thaliana gene family contains five classes of genes, with three of them corresponding to the previously defined clades. Comparison of positions and numbers of introns among the A. thaliana genes reveals structural conservation between genes belonging to the same class. The pattern of intron losses that could have given rise to the PG gene family is consistent with a mechanism of intron loss by replacement of an ancestral intron-containing gene with a reverse-transcribed DNA copy of a spliced mRNA. Following this event of intron loss, the acquisition of introns in novel positions is consistent with a mechanism of intron gain at proto-splice sites.

  18. Expression and genome-wide analysis of the xylogen-type gene family.

    PubMed

    Kobayashi, Yuuki; Motose, Hiroyasu; Iwamoto, Kuninori; Fukuda, Hiroo

    2011-06-01

    In higher plants, many extracellular proteins are involved in developmental processes, including cell-cell signaling and cell wall construction. Xylogen is an extracellular arabinogalactan protein (AGP) isolated from Zinnia elegans xylogenic culture medium, which promotes xylem cell differentiation. Xylogen has a unique structure, containing a non-specific lipid transfer protein (nsLTP) domain and AGP domains. We searched for xylogen-type genes in the genomes of land plants, including Arabidopsis thaliana, to further our knowledge of xylogen-type genes as functional extracellular proteins in plants. We found that many xylogen-type genes, including 13 Arabidopsis genes, comprise a gene family in land plants, including Populus trichocarpa, Vitis vinifera, Lotus japonicus, Oryza sativa, Selaginella moellendorffii and Physcomitrella patens. The genes shared an N-terminal signal peptide sequence, a distinct nsLTP domain, one or more AGP domains and a glycosylphosphatidylinositol (GPI)-anchored sequence. We analyzed transgenic plants harboring promoter::GUS (β-glucuronidase) constructs to test expression of the 13 Arabidopsis xylogen-type genes, and detected a diversity of gene family members with related expression patterns. AtXYP2 was the best candidate as the Arabidopsis counterpart of the Zinnia xylogen gene. We observed two distinct expression patterns for several genes, with some anther specific and others preferentially expressed in the endodermis/pericycle. We conclude that xylogen-type genes, which may have diverse functions, form a novel chimeric AGP gene family with a distinct nsLTP domain.

  19. Ultra Large Gene Families: A Matter of Adaptation or Genomic Parasites?

    PubMed Central

    Schiffer, Philipp H.; Gravemeyer, Jan; Rauscher, Martina; Wiehe, Thomas

    2016-01-01

    Gene duplication is an important mechanism of molecular evolution. It offers a fast track to modification, diversification, redundancy or rescue of gene function. However, duplication may also be neutral or (slightly) deleterious, and often ends in pseudo-geneisation. Here, we investigate the phylogenetic distribution of ultra large gene families on long and short evolutionary time scales. In particular, we focus on a family of NACHT-domain and leucine-rich-repeat-containing (NLR)-genes, which we previously found in large numbers to occupy one chromosome arm of the zebrafish genome. We were interested to see whether such a tight clustering is characteristic for ultra large gene families. Our data reconfirm that most gene family inflations are lineage-specific, but we can only identify very few gene clusters. Based on our observations we hypothesise that, beyond a certain size threshold, ultra large gene families continue to proliferate in a mechanism we term “run-away evolution”. This process might ultimately lead to the failure of genomic integrity and drive species to extinction. PMID:27509525

  20. Developmental expression of the N-myc downstream regulated gene (Ndrg) family during Xenopus tropicalis embryogenesis.

    PubMed

    Zhong, Chao; Zhou, Yan-Kuan; Yang, Shan-Shan; Zhao, Jun-Fang; Zhu, Xiao-Long; Chen, Hen-Huang; Chen, Pei-Chao; Huang, Li-Quan; Huang, Xiao

    2015-01-01

    The N-myc downstream regulated gene (Ndrg) family consists of four main members Ndrg1, 2, 3, and 4. The Ndrg genes are involved in many vital biological events including development. However, comprehensive expression patterns of this gene family during vertebrate embryogenesis remain largely unknown. Here, we analyzed the Ndrg family from the evolutionary perspective and examined the expression patterns of the Ndrg genes during Xenopus tropicalis embryogenesis. Different Ndrg family members of vertebrates are separated into different homology clusters which can be further classified into two groups and each Ndrg family member is well conserved during evolution. The temporal and spatial expression patterns of Ndrg1, 2, 3 and 4 are different during early Xenopus tropicalis development. Ndrg1, 2 and 4 are maternally expressed genes while Ndrg3 is a zygotically expressed gene. The Ndrg genes are differentially expressed in the developing central nervous system, the developing sensory organs, and the developing excretory organs. Moreover, they also show other specific expression domains. Our results indicate that the Ndrg genes exhibit specific expression patterns and may play different roles during vertebrate embryogenesis.

  1. Locus for a human hereditary cataract is closely linked to the. gamma. -crystallin gene family

    SciTech Connect

    Lubsen, N.H.; Renwick, J.H.; Tsui, L.C.; Breitman, M.L.; Schoenmakers, J.G.G.

    1987-01-01

    Within the human ..gamma..-crystallin gene cluster polymorphic Taq I sites are present. These give rise to three sets of allelic fragments from the ..gamma..-crystallin genes. Together these restriction fragment length polymorphisms define eight possible haplotypes, three of which (Q, R, and S) were found in the Dutch and English population. A fourth haplotype (P) was detected within a family in which a hereditary Coppock-like cataract of the embryonic lens nucleus occurs in heterozygotes. Haplotype P was found only in family members who suffered from cataract, and all family members who suffered from cataract had haplotype P. The absolute correlation between the presence of haplotype P and cataract within this family shows that the ..gamma..-crystallin gene cluster and the locus for the Coppock-like cataract are closely linked. This linkage provides genetic evidence that the primary cause of a cataract in humans could possibly be a lesion in a crystallin gene.

  2. Exclusion of known gene for enamel development in two Brazilian families with amelogenesis imperfecta.

    PubMed

    Santos, Maria C L G; Hart, P Suzanne; Ramaswami, Mukundhan; Kanno, Cláudia M; Hart, Thomas C; Line, Sergio R P

    2007-01-31

    Amelogenesis imperfecta (AI) is a genetically heterogeneous group of diseases that result in defective development of tooth enamel. Mutations in several enamel proteins and proteinases have been associated with AI. The object of this study was to evaluate evidence of etiology for the six major candidate gene loci in two Brazilian families with AI. Genomic DNA was obtained from family members and all exons and exon-intron boundaries of the ENAM, AMBN, AMELX, MMP20, KLK4 and Amelotin gene were amplified and sequenced. Each family was also evaluated for linkage to chromosome regions known to contain genes important in enamel development. The present study indicates that the AI in these two families is not caused by any of the known loci for AI or any of the major candidate genes proposed in the literature. These findings indicate extensive genetic heterogeneity for non-syndromic AI.

  3. Gene duplication event in family 12 glycosyl hydrolase from Phytophthora spp.

    PubMed

    Costanzo, Stefano; Ospina-Giraldo, M D; Deahl, K L; Baker, C J; Jones, Richard W

    2006-10-01

    A total of 18 paralogs of xyloglucan-specific endoglucanases (EGLs) from the glycosyl hydrolase family 12 were identified and characterized in Phytophthora sojae and Phytophthora ramorum. These genes encode predicted extracellular enzymes, with sizes ranging from 189 to 435 amino acid residues, that would be capable of hydrolyzing the xyloglucan component of the host cell wall. In two cases, four and six functional copies of these genes were found in tight succession within a region of 5 and 18 kb, respectively. The overall gene copy number and relative organization appeared well conserved between P. sojae and P. ramorum, with apparent synteny in this region of their respective genomes. Phylogenetic analyses of Phytophthora endoglucanases of family 12 and other known members of EGL 12, revealed a close relatedness with a fairly conserved gene sub-family containing, among others, sequences from the fungi Emericella desertorum and Aspergillus aculeatus. This is the first report of family 12 EGLs present in plant pathogenic eukaryotes.

  4. Mouse T-cell receptor variable gene segment families

    SciTech Connect

    Arden, B.; Kabelitz, D.; Clark, S.P.; Mak, T.W.

    1995-10-01

    All mouse T-cell receptor {alpha}/{delta}, {beta}, and {gamma} variable (Tcra/d-, b-, and g-V) gene segments were aligned to compare the sequences with one another, to group them into subfamilies, and to derive a name which complies with the standard nomenclature. it was necessary to change the names of some V gene segments because they conflicted with those of other segments. The traditional classification into subfamilies was re-evaluated using a much larger pool of sequences. In the mouse, most V gene segments can be grouped into subfamilies of closely related genes with significantly less similarity between different subfamilies. 118 refs., 11 figs., 4 tabs.

  5. Genome-wide analysis of the MADS-box gene family in Brachypodium distachyon.

    PubMed

    Wei, Bo; Zhang, Rong-Zhi; Guo, Juan-Juan; Liu, Dan-Mei; Li, Ai-Li; Fan, Ren-Chun; Mao, Long; Zhang, Xiang-Qi

    2014-01-01

    MADS-box genes are important transcription factors for plant development, especially floral organogenesis. Brachypodium distachyon is a model for biofuel plants and temperate grasses such as wheat and barley, but a comprehensive analysis of MADS-box family proteins in Brachypodium is still missing. We report here a genome-wide analysis of the MADS-box gene family in Brachypodium distachyon. We identified 57 MADS-box genes and classified them into 32 MIKC(c)-type, 7 MIKC*-type, 9 Mα, 7 Mβ and 2 Mγ MADS-box genes according to their phylogenetic relationships to the Arabidopsis and rice MADS-box genes. Detailed gene structure and motif distribution were then studied. Investigation of their chromosomal localizations revealed that Brachypodium MADS-box genes distributed evenly across five chromosomes. In addition, five pairs of type II MADS-box genes were found on synteny blocks derived from whole genome duplication blocks. We then performed a systematic expression analysis of Brachypodium MADS-box genes in various tissues, particular floral organs. Further detection under salt, drought, and low-temperature conditions showed that some MADS-box genes may also be involved in abiotic stress responses, including type I genes. Comparative studies of MADS-box genes among Brachypodium, rice and Arabidopsis showed that Brachypodium had fewer gene duplication events. Taken together, this work provides useful data for further functional studies of MADS-box genes in Brachypodium distachyon.

  6. MS/MS networking guided analysis of molecule and gene cluster families.

    PubMed

    Nguyen, Don Duy; Wu, Cheng-Hsuan; Moree, Wilna J; Lamsa, Anne; Medema, Marnix H; Zhao, Xiling; Gavilan, Ronnie G; Aparicio, Marystella; Atencio, Librada; Jackson, Chanaye; Ballesteros, Javier; Sanchez, Joel; Watrous, Jeramie D; Phelan, Vanessa V; van de Wiel, Corine; Kersten, Roland D; Mehnaz, Samina; De Mot, René; Shank, Elizabeth A; Charusanti, Pep; Nagarajan, Harish; Duggan, Brendan M; Moore, Bradley S; Bandeira, Nuno; Palsson, Bernhard Ø; Pogliano, Kit; Gutiérrez, Marcelino; Dorrestein, Pieter C

    2013-07-09

    The ability to correlate the production of specialized metabolites to the genetic capacity of the organism that produces such molecules has become an invaluable tool in aiding the discovery of biotechnologically applicable molecules. Here, we accomplish this task by matching molecular families with gene cluster families, making these correlations to 60 microbes at one time instead of connecting one molecule to one organism at a time, such as how it is traditionally done. We can correlate these families through the use of nanospray desorption electrospray ionization MS/MS, an ambient pressure MS technique, in conjunction with MS/MS networking and peptidogenomics. We matched the molecular families of peptide natural products produced by 42 bacilli and 18 pseudomonads through the generation of amino acid sequence tags from MS/MS data of specific clusters found in the MS/MS network. These sequence tags were then linked to biosynthetic gene clusters in publicly accessible genomes, providing us with the ability to link particular molecules with the genes that produced them. As an example of its use, this approach was applied to two unsequenced Pseudoalteromonas species, leading to the discovery of the gene cluster for a molecular family, the bromoalterochromides, in the previously sequenced strain P. piscicida JCM 20779(T). The approach itself is not limited to 60 related strains, because spectral networking can be readily adopted to look at molecular family-gene cluster families of hundreds or more diverse organisms in one single MS/MS network.

  7. Cognitive Functioning in Affected Sibling Pairs with ADHD: Familial Clustering and Dopamine Genes

    ERIC Educational Resources Information Center

    Loo, Sandra K.; Rich, Erika Carpenter; Ishii, Janeen; McGough, James; McCracken, James; Nelson, Stanley; Smalley, Susan L.

    2008-01-01

    Background: This paper examines familiality and candidate gene associations of cognitive measures as potential endophenotypes in attention-deficit/hyperactivity disorder (ADHD). Methods: The sample consists of 540 participants, aged 6 to 18, who were diagnosed with ADHD from 251 families recruited for a larger genetic study of ADHD. All members of…

  8. Cognitive Functioning in Affected Sibling Pairs with ADHD: Familial Clustering and Dopamine Genes

    ERIC Educational Resources Information Center

    Loo, Sandra K.; Rich, Erika Carpenter; Ishii, Janeen; McGough, James; McCracken, James; Nelson, Stanley; Smalley, Susan L.

    2008-01-01

    Background: This paper examines familiality and candidate gene associations of cognitive measures as potential endophenotypes in attention-deficit/hyperactivity disorder (ADHD). Methods: The sample consists of 540 participants, aged 6 to 18, who were diagnosed with ADHD from 251 families recruited for a larger genetic study of ADHD. All members of…

  9. Mutation analysis in F9 gene of 17 families with haemophilia B from Iran.

    PubMed

    Enayat, M S; Karimi, M; Chana, G; Farjadian, S; Theophilus, B D M; Hill, F G H

    2004-11-01

    Seventeen haemophilia B families from Iran were investigated to determine the causative mutation. All the essential regions of the F9 gene were initially screened by conformational sensitive gel electrophoresis and exons with band shift were sequenced. Seven of the 15 mutations identified in these families were novel mutations. The mutations were authenticated in nine families as other affected members or heterozygous female carriers were available for verification.

  10. Molecular Evolution and Expression Divergence of the Aconitase (ACO) Gene Family in Land Plants

    PubMed Central

    Wang, Yi-Ming; Yang, Qi; Liu, Yan-Jing; Yang, Hai-Ling

    2016-01-01

    Aconitase (ACO) is a key enzyme that catalyzes the isomerization of citrate to isocitrate in the tricarboxylic acid (TCA) and glyoxylate cycles. The function of ACOs has been well studied in model plants, such as Arabidopsis. In contrast, the evolutionary patterns of the ACO family in land plants are poorly understood. In this study, we systematically examined the molecular evolution and expression divergence of the ACO gene family in 12 land plant species. Thirty-six ACO genes were identified from the 12 land plant species representing the four major land plant lineages: Bryophytes, lycophytes, gymnosperms, and angiosperms. All of these ACOs belong to the cytosolic isoform. Three gene duplication events contributed to the expansion of the ACO family in angiosperms. The ancestor of angiosperms may have contained only one ACO gene. One gene duplication event split angiosperm ACOs into two distinct clades. Two clades showed a divergence in selective pressure and gene expression patterns. The cis-acting elements that function in light responsiveness were most abundant in the promoter region of the ACO genes, indicating that plant ACO genes might participate in light regulatory pathways. Our findings provide comprehensive insights into the ACO gene family in land plants. PMID:28018410

  11. Genome-wide identification, characterization, and expression analysis of the MLO gene family in Cucumis sativus.

    PubMed

    Zhou, S J; Jing, Z; Shi, J L

    2013-12-11

    Mildew resistance locus o (MLO) is a plant-specific seven-transmembrane (TM) gene family. Several studies have revealed that certain members of the MLO gene family mediate powdery mildew susceptibility in three plant species, namely, Arabidopsis, barley, and tomato. The sequenced cucumber genome provides an opportunity to conduct a comprehensive overview of the MLO gene family. Fourteen genes (designated CsMLO01 through CsMLO14) have been identified within the Cucumis sativus genome by using an in silico cloning method with the MLO amino acid sequences of Arabidopsis thaliana and rice as probes. Sequence alignment revealed that numerous features of the gene family, such as TMs, a calmodulin-binding domain, peptide domains I and II, and 30 important amino acid residues for MLO function, are well conserved. Phylogenetic analysis of the MLO genes from cucumber and other plant species reveals seven different clades (I through VII). Three of these clades comprised MLO genes from A. thaliana, rice, maize, and cucumber, suggesting that these genes may have evolved after the divergence of monocots and dicots. In silico mapping showed that these CsMLOs were located on chromosomes 1, 2, 3, 4, 5, and 6 without any obvious clustering, except CsMLO01. To our knowledge, this paper is the first comprehensive report on MLO genes in C. sativus. These findings will facilitate the functional characterization of the MLOs related to powdery mildew susceptibility and assist in the development of disease resistance in cucumber.

  12. Pax gene diversity in the basal cnidarian Acropora millepora (Cnidaria, Anthozoa): Implications for the evolution of the Pax gene family

    PubMed Central

    Miller, David J.; Hayward, David C.; Reece-Hoyes, John S.; Scholten, Ingo; Catmull, Julian; Gehring, Walter J.; Callaerts, Patrick; Larsen, Jill E.; Ball, Eldon E.

    2000-01-01

    Pax genes encode a family of transcription factors, many of which play key roles in animal embryonic development but whose evolutionary relationships and ancestral functions are unclear. To address these issues, we are characterizing the Pax gene complement of the coral Acropora millepora, an anthozoan cnidarian. As the simplest animals at the tissue level of organization, cnidarians occupy a key position in animal evolution, and the Anthozoa are the basal class within this diverse phylum. We have identified four Pax genes in Acropora: two (Pax-Aam and Pax-Bam) are orthologs of genes identified in other cnidarians; the others (Pax-Cam and Pax-Dam) are unique to Acropora. Pax-Aam may be orthologous with Drosophila Pox neuro, and Pax-Bam clearly belongs to the Pax-2/5/8 class. The Pax-Bam Paired domain binds specifically and preferentially to Pax-2/5/8 binding sites. The recently identified Acropora gene Pax-Dam belongs to the Pax-3/7 class. Clearly, substantial diversification of the Pax family occurred before the Cnidaria/higher Metazoa split. The fourth Acropora Pax gene, Pax-Cam, may correspond to the ancestral vertebrate Pax gene and most closely resembles Pax-6. The expression pattern of Pax-Cam, in putative neurons, is consistent with an ancestral role of the Pax family in neural differentiation and patterning. We have determined the genomic structure of each Acropora Pax gene and show that some splice sites are shared both between the coral genes and between these and Pax genes in triploblastic metazoans. Together, these data support the monophyly of the Pax family and indicate ancient origins of several introns. PMID:10781047

  13. Genome-wide analysis of Aux/IAA and ARF gene families in Populus trichocarpa

    SciTech Connect

    Kalluri, Udaya C; DiFazio, Stephen P; Brunner, A.; Tuskan, Gerald A

    2007-01-01

    Auxin/Indole-3-Acetic Acid (Aux/IAA) and Auxin Response Factor (ARF) transcription factors are key regulators of auxin responses in plants. A total of 35 Aux/IAA and 39 ARF genes were identified in the Populus genome. Comparative phylogenetic analysis revealed that the subgroups PoptrARF2, 6, 9 and 16 and PoptrIAA3, 16, 27 and 29 have differentially expanded in Populus relative to Arabidopsis. Activator ARFs were found to be two fold-overrepresented in the Populus genome. PoptrIAA and PoptrARF gene families appear to have expanded due to high segmental and low tandem duplication events. Furthermore, expression studies showed that genes in the expanded PoptrIAA3 subgroup display differential expression. The gene-family analysis reported here will be useful in conducting future functional genomics studies to understand how the molecular roles of these large gene families translate into a diversity of biologically meaningful auxin effects.

  14. Mutational analysis of PKD1 gene in a Chinese family with autosomal dominant polycystic kidney disease

    PubMed Central

    Liu, Jingyan; Li, Lanrong; Liu, Qingmin

    2015-01-01

    Autosomal dominant polycystic kidney disease (ADPKD) is a hereditary disease and common renal disease. Mutations of PKD genes are responsible for this disease. We analyzed a large Chinese family with ADPKD using Sanger sequencing to identify the mutation responsible for this disease. The family comprised 27 individuals including 10 ADPKD patients. These ADPKD patients had severe renal disease and most of them died very young. We analyzed 6 survival patients gene and found they all had C10529T mutation in exon 35 of PKD1 gene. We did not found gene mutation in any unaffected relatives or 300 unrelated controls. These findings suggested that the C10529T mutation in PKD1 gene might be the pathogenic mutation responsible for the disease in this family. PMID:26722532

  15. Mutational analysis of PKD1 gene in a Chinese family with autosomal dominant polycystic kidney disease.

    PubMed

    Liu, Jingyan; Li, Lanrong; Liu, Qingmin

    2015-01-01

    Autosomal dominant polycystic kidney disease (ADPKD) is a hereditary disease and common renal disease. Mutations of PKD genes are responsible for this disease. We analyzed a large Chinese family with ADPKD using Sanger sequencing to identify the mutation responsible for this disease. The family comprised 27 individuals including 10 ADPKD patients. These ADPKD patients had severe renal disease and most of them died very young. We analyzed 6 survival patients gene and found they all had C10529T mutation in exon 35 of PKD1 gene. We did not found gene mutation in any unaffected relatives or 300 unrelated controls. These findings suggested that the C10529T mutation in PKD1 gene might be the pathogenic mutation responsible for the disease in this family.

  16. Gene-Environment Interplay, Family Relationships, and Child Adjustment

    ERIC Educational Resources Information Center

    Horwitz, Briana N.; Neiderhiser, Jenae M.

    2011-01-01

    This paper reviews behavioral genetic research from the past decade that has moved beyond simply studying the independent influences of genes and environments. The studies considered in this review have instead focused on understanding gene-environment interplay, including genotype-environment correlation (rGE) and genotype x environment…

  17. Gene-Environment Interplay, Family Relationships, and Child Adjustment

    ERIC Educational Resources Information Center

    Horwitz, Briana N.; Neiderhiser, Jenae M.

    2011-01-01

    This paper reviews behavioral genetic research from the past decade that has moved beyond simply studying the independent influences of genes and environments. The studies considered in this review have instead focused on understanding gene-environment interplay, including genotype-environment correlation (rGE) and genotype x environment…

  18. Structure of the omega-gliadin gene family

    USDA-ARS?s Scientific Manuscript database

    The '-gliadins are one of the classes of wheat seed storage proteins, but are the least characterized. In this report, an analysis is made of all available '-gliadin DNA sequences including '-gliadins genes within a large genomic clone, previously reported gene sequences, and ESTs identified from th...

  19. Characterization and Functional Analysis of PEBP Family Genes in Upland Cotton (Gossypium hirsutum L.)

    PubMed Central

    Wang, Congcong; Pang, Chaoyou; Wei, Hengling; Wang, Hantao; Song, Meizhen; Fan, Shuli; Yu, Shuxun

    2016-01-01

    Upland cotton (Gossypium hirsutum L.) is a naturally occurring photoperiod-sensitive perennial plant species. However, sensitivity to the day length was lost during domestication. The phosphatidylethanolamine-binding protein (PEBP) gene family, of which three subclades have been identified in angiosperms, functions to promote and suppress flowering in photoperiod pathway. Recent evidence indicates that PEBP family genes play an important role in generating mobile flowering signals. We isolated homologues of the PEBP gene family in upland cotton and examined their regulation and function. Nine PEBP-like genes were cloned and phylogenetic analysis indicated the genes belonged to four subclades (FT, MFT, TFL1 and PEBP). Cotton PEBP-like genes showed distinct expression patterns in relation to different cotton genotypes, photoperiod responsive and cultivar maturity. The GhFT gene expression of a semi-wild race of upland cotton were strongly induced under short day condition, whereas the GhPEBP2 gene expression was induced under long days. We also elucidated that GhFT but not GhPEBP2 interacted with FD-like bZIP transcription factor GhFD and promote flowering under both long- and short-day conditions. The present result indicated that GhPEBP-like genes may perform different functions. This work corroborates the involvement of PEBP-like genes in photoperiod response and regulation of flowering time in different cotton genotypes, and contributes to an improved understanding of the function of PEBP-like genes in cotton. PMID:27552108

  20. Characterization and Functional Analysis of PEBP Family Genes in Upland Cotton (Gossypium hirsutum L.).

    PubMed

    Zhang, Xiaohong; Wang, Congcong; Pang, Chaoyou; Wei, Hengling; Wang, Hantao; Song, Meizhen; Fan, Shuli; Yu, Shuxun

    2016-01-01

    Upland cotton (Gossypium hirsutum L.) is a naturally occurring photoperiod-sensitive perennial plant species. However, sensitivity to the day length was lost during domestication. The phosphatidylethanolamine-binding protein (PEBP) gene family, of which three subclades have been identified in angiosperms, functions to promote and suppress flowering in photoperiod pathway. Recent evidence indicates that PEBP family genes play an important role in generating mobile flowering signals. We isolated homologues of the PEBP gene family in upland cotton and examined their regulation and function. Nine PEBP-like genes were cloned and phylogenetic analysis indicated the genes belonged to four subclades (FT, MFT, TFL1 and PEBP). Cotton PEBP-like genes showed distinct expression patterns in relation to different cotton genotypes, photoperiod responsive and cultivar maturity. The GhFT gene expression of a semi-wild race of upland cotton were strongly induced under short day condition, whereas the GhPEBP2 gene expression was induced under long days. We also elucidated that GhFT but not GhPEBP2 interacted with FD-like bZIP transcription factor GhFD and promote flowering under both long- and short-day conditions. The present result indicated that GhPEBP-like genes may perform different functions. This work corroborates the involvement of PEBP-like genes in photoperiod response and regulation of flowering time in different cotton genotypes, and contributes to an improved understanding of the function of PEBP-like genes in cotton.

  1. A unified GMDR method for detecting gene-gene interactions in family and unrelated samples with application to nicotine dependence

    PubMed Central

    Chen, Guo-Bo; Liu, Nianjun; Klimentidis, Yann C.; Zhu, Xiaofeng; Zhi, Degui; Wang, Xujing; Lou, Xiang-Yang

    2013-01-01

    Gene-gene and gene-environment interactions govern a substantial portion of the variation in complex traits and diseases. In convention, a set of either unrelated or family samples are used in detection of such interactions; even when both kinds of data are available, the unrelated and the family samples are analyzed separately, potentially leading to loss in statistical power. In this report, to detect gene-gene interactions we propose a generalized multifactor dimensionality reduction method that unifies analyses of nuclear families and unrelated subjects within the same statistical framework. We used principal components as genetic background controls against population stratification, and when sibling data are included, within family control were used to correct for potential spurious association at the tested loci. Through comprehensive simulations, we demonstrate that the proposed method can remarkably increase power by pooling unrelated and offspring’s samples together as compared to individual analysis strategies and the Fisher’s combining p-value method while it retains a controlled type I error rate in the presence of population structure. In application to a real dataset, we detected one significant tetragenic interaction among CHRNA4, CHRNB2, BDNF, and NTRK2 associated with nicotine dependence in the Study of Addiction: Genetics and Environment (SAGE) sample, suggesting the biological role of these genes in nicotine dependence development. PMID:24057800

  2. Duplication, divergence and persistence in the Phytochrome photoreceptor gene family of cottons (Gossypium spp.)

    PubMed Central

    2010-01-01

    Background Phytochromes are a family of red/far-red photoreceptors that regulate a number of important developmental traits in cotton (Gossypium spp.), including plant architecture, fiber development, and photoperiodic flowering. Little is known about the composition and evolution of the phytochrome gene family in diploid (G. herbaceum, G. raimondii) or allotetraploid (G. hirsutum, G. barbadense) cotton species. The objective of this study was to obtain a preliminary inventory and molecular-evolutionary characterization of the phytochrome gene family in cotton. Results We used comparative sequence resources to design low-degeneracy PCR primers that amplify genomic sequence tags (GSTs) for members of the PHYA, PHYB/D, PHYC and PHYE gene sub-families from A- and D-genome diploid and AD-genome allotetraploid Gossypium species. We identified two paralogous PHYA genes (designated PHYA1 and PHYA2) in diploid cottons, the result of a Malvaceae-specific PHYA gene duplication that occurred approximately 14 million years ago (MYA), before the divergence of the A- and D-genome ancestors. We identified a single gene copy of PHYB, PHYC, and PHYE in diploid cottons. The allotetraploid genomes have largely retained the complete gene complements inherited from both of the diploid genome ancestors, with at least four PHYA genes and two genes encoding PHYB, PHYC and PHYE in the AD-genomes. We did not identify a PHYD gene in any cotton genomes examined. Conclusions Detailed sequence analysis suggests that phytochrome genes retained after duplication by segmental duplication and allopolyploidy appear to be evolving independently under a birth-and-death-process with strong purifying selection. Our study provides a preliminary phytochrome gene inventory that is necessary and sufficient for further characterization of the biological functions of each of the cotton phytochrome genes, and for the development of 'candidate gene' markers that are potentially useful for cotton improvement via

  3. Diversification of the ant odorant receptor gene family and positive selection on candidate cuticular hydrocarbon receptors.

    PubMed

    Engsontia, Patamarerk; Sangket, Unitsa; Robertson, Hugh M; Satasook, Chutamas

    2015-08-27

    Chemical communication plays important roles in the social behavior of ants making them one of the most successful groups of animals on earth. However, the molecular evolutionary process responsible for their chemosensory adaptation is still elusive. Recent advances in genomic studies have led to the identification of large odorant receptor (Or) gene repertoires from ant genomes providing fruitful materials for molecular evolution analysis. The aim of this study was to test the hypothesis that diversification of this gene family is involved in olfactory adaptation of each species. We annotated the Or genes from the genome sequences of two leaf-cutter ants, Acromyrmex echinatior and Atta cephalotes (385 and 376 putative functional genes, respectively). These were used, together with Or genes from Camponotus floridanus, Harpegnathos saltator, Pogonomyrmex barbatus, Linepithema humile, Cerapachys biroi, Solenopsis invicta and Apis mellifera, in molecular evolution analysis. Like the Or family in other insects, ant Or genes evolve by the birth-and-death model of gene family evolution. Large gene family expansions involving tandem gene duplications, and gene gains outnumbering losses, are observed. Codon analysis of genes in lineage-specific expansion clades revealed signatures of positive selection on the candidate cuticular hydrocarbon receptor genes (9-exon subfamily) of Cerapachys biroi, Camponotus floridanus, Acromyrmex echinatior and Atta cephalotes. Positively selected amino acid positions are primarily in transmembrane domains 3 and 6, which are hypothesized to contribute to the odor-binding pocket, presumably mediating changing ligand specificity. This study provides support for the hypothesis that some ant lineage-specific Or genes have evolved under positive selection. Newly duplicated genes particularly in the candidate cuticular hydrocarbon receptor clade that have evolved under positive selection may contribute to the highly sophisticated lineage

  4. Duplication of OsHAP family genes and their association with heading date in rice.

    PubMed

    Li, Qiuping; Yan, Wenhao; Chen, Huaxia; Tan, Cong; Han, Zhongmin; Yao, Wen; Li, Guangwei; Yuan, Mengqi; Xing, Yongzhong

    2016-03-01

    Heterotrimeric Heme Activator Protein (HAP) family genes are involved in the regulation of flowering in plants. It is not clear how many HAP genes regulate heading date in rice. In this study, we identified 35 HAP genes, including seven newly identified genes, and performed gene duplication and candidate gene-based association analyses. Analyses showed that segmental duplication and tandem duplication are the main mechanisms of HAP gene duplication. Expression profiling and functional identification indicated that duplication probably diversifies the functions of HAP genes. A nucleotide diversity analysis revealed that 13 HAP genes underwent selection. A candidate gene-based association analysis detected four HAP genes related to heading date. An investigation of transgenic plants or mutants of 23 HAP genes confirmed that overexpression of at least four genes delayed heading date under long-day conditions, including the previously cloned Ghd8/OsHAP3H. Our results indicate that the large number of HAP genes in rice was mainly produced by gene duplication, and a few HAP genes function to regulate heading date. Selection of HAP genes is probably caused by their diverse functions rather than regulation of heading.

  5. Evolutionary Dynamics of the Interferon-Induced Transmembrane Gene Family in Vertebrates

    PubMed Central

    Zhang, Zhao; Liu, Jun; Li, Meng; Yang, Hui; Zhang, Chiyu

    2012-01-01

    Vertebrate interferon-induced transmembrane (IFITM) genes have been demonstrated to have extensive and diverse functions, playing important roles in the evolution of vertebrates. Despite observance of their functionality, the evolutionary dynamics of this gene family are complex and currently unknown. Here, we performed detailed evolutionary analyses to unravel the evolutionary history of the vertebrate IFITM family. A total of 174 IFITM orthologous genes and 112 pseudogenes were identified from 27 vertebrate genome sequences. The vertebrate IFITM family can be divided into immunity-related IFITM (IR-IFITM), IFITM5 and IFITM10 sub-families in phylogeny, implying origins from three different progenitors. In general, vertebrate IFITM genes are located in two loci, one containing the IFITM10 gene, and the other locus containing IFITM5 and various numbers of IR-IFITM genes. Conservation of evolutionary synteny was observed in these IFITM genes. Significant functional divergence was detected among the three IFITM sub-families. No gene duplication or positive selection was found in IFITM5 sub-family, implying the functional conservation of IFITM5 in vertebrate evolution, which is involved in bone formation. No IFITM5 locus was identified in the marmoset genome, suggesting a potential association with the tiny size of this monkey. The IFITM10 sub-family was divided into two groups: aquatic and terrestrial types. Functional divergence was detected between the two groups, and five IFITM10-like genes from frog were dispersed into the two groups. Both gene duplication and positive selection were observed in aquatic vertebrate IFITM10-like genes, indicating that IFITM10 might be associated with the adaptation to aquatic environments. A large number of lineage- and species-specific gene duplications were observed in IR-IFITM sub-family and positive selection was detected in IR-IFITM of primates and rodents. Because primates have experienced a long history of viral infection

  6. Natural Killer Cell Receptor Genes in the Family Equidae: Not only Ly49

    PubMed Central

    Futas, Jan; Horin, Petr

    2013-01-01

    Natural killer (NK) cells have important functions in immunity. NK recognition in mammals can be mediated through killer cell immunoglobulin-like receptors (KIR) and/or killer cell lectin-like Ly49 receptors. Genes encoding highly variable NK cell receptors (NKR) represent rapidly evolving genomic regions. No single conservative model of NKR genes was observed in mammals. Single-copy low polymorphic NKR genes present in one mammalian species may expand into highly polymorphic multigene families in other species. In contrast to other non-rodent mammals, multiple Ly49-like genes appear to exist in the horse, while no functional KIR genes were observed in this species. In this study, Ly49 and KIR were sought and their evolution was characterized in the entire family Equidae. Genomic sequences retrieved showed the presence of at least five highly conserved polymorphic Ly49 genes in horses, asses and zebras. These findings confirmed that the expansion of Ly49 occurred in the entire family. Several KIR-like sequences were also identified in the genome of Equids. Besides a previously identified non-functional KIR-Immunoglobulin-like transcript fusion gene (KIR-ILTA) and two putative pseudogenes, a KIR3DL-like sequence was analyzed. In contrast to previous observations made in the horse, the KIR3DL sequence, genomic organization and mRNA expression suggest that all Equids might produce a functional KIR receptor protein molecule with a single non-mutated immune tyrosine-based inhibition motif (ITIM) domain. No evidence for positive selection in the KIR3DL gene was found. Phylogenetic analysis including rhinoceros and tapir genomic DNA and deduced amino acid KIR-related sequences showed differences between families and even between species within the order Perissodactyla. The results suggest that the order Perissodactyla and its family Equidae with expanded Ly49 genes and with a potentially functional KIR gene may represent an interesting model for evolutionary biology of

  7. Natural killer cell receptor genes in the family Equidae: not only Ly49.

    PubMed

    Futas, Jan; Horin, Petr

    2013-01-01

    Natural killer (NK) cells have important functions in immunity. NK recognition in mammals can be mediated through killer cell immunoglobulin-like receptors (KIR) and/or killer cell lectin-like Ly49 receptors. Genes encoding highly variable NK cell receptors (NKR) represent rapidly evolving genomic regions. No single conservative model of NKR genes was observed in mammals. Single-copy low polymorphic NKR genes present in one mammalian species may expand into highly polymorphic multigene families in other species. In contrast to other non-rodent mammals, multiple Ly49-like genes appear to exist in the horse, while no functional KIR genes were observed in this species. In this study, Ly49 and KIR were sought and their evolution was characterized in the entire family Equidae. Genomic sequences retrieved showed the presence of at least five highly conserved polymorphic Ly49 genes in horses, asses and zebras. These findings confirmed that the expansion of Ly49 occurred in the entire family. Several KIR-like sequences were also identified in the genome of Equids. Besides a previously identified non-functional KIR-Immunoglobulin-like transcript fusion gene (KIR-ILTA) and two putative pseudogenes, a KIR3DL-like sequence was analyzed. In contrast to previous observations made in the horse, the KIR3DL sequence, genomic organization and mRNA expression suggest that all Equids might produce a functional KIR receptor protein molecule with a single non-mutated immune tyrosine-based inhibition motif (ITIM) domain. No evidence for positive selection in the KIR3DL gene was found. Phylogenetic analysis including rhinoceros and tapir genomic DNA and deduced amino acid KIR-related sequences showed differences between families and even between species within the order Perissodactyla. The results suggest that the order Perissodactyla and its family Equidae with expanded Ly49 genes and with a potentially functional KIR gene may represent an interesting model for evolutionary biology of

  8. Genome-Wide Identification and Analysis of the TIFY Gene Family in Grape

    PubMed Central

    Zhang, Yucheng; Gao, Min; Singer, Stacy D.; Fei, Zhangjun; Wang, Hua; Wang, Xiping

    2012-01-01

    Background The TIFY gene family constitutes a plant-specific group of genes with a broad range of functions. This family encodes four subfamilies of proteins, including ZML, TIFY, PPD and JASMONATE ZIM-Domain (JAZ) proteins. JAZ proteins are targets of the SCFCOI1 complex, and function as negative regulators in the JA signaling pathway. Recently, it has been reported in both Arabidopsis and rice that TIFY genes, and especially JAZ genes, may be involved in plant defense against insect feeding, wounding, pathogens and abiotic stresses. Nonetheless, knowledge concerning the specific expression patterns and evolutionary history of plant TIFY family members is limited, especially in a woody species such as grape. Methodology/Principal Findings A total of two TIFY, four ZML, two PPD and 11 JAZ genes were identified in the Vitis vinifera genome. Phylogenetic analysis of TIFY protein sequences from grape, Arabidopsis and rice indicated that the grape TIFY proteins are more closely related to those of Arabidopsis than those of rice. Both segmental and tandem duplication events have been major contributors to the expansion of the grape TIFY family. In addition, synteny analysis between grape and Arabidopsis demonstrated that homologues of several grape TIFY genes were found in the corresponding syntenic blocks of Arabidopsis, suggesting that these genes arose before the divergence of lineages that led to grape and Arabidopsis. Analyses of microarray and quantitative real-time RT-PCR expression data revealed that grape TIFY genes are not a major player in the defense against biotrophic pathogens or viruses. However, many of these genes were responsive to JA and ABA, but not SA or ET. Conclusion The genome-wide identification, evolutionary and expression analyses of grape TIFY genes should facilitate further research of this gene family and provide new insights regarding their evolutionary history and regulatory control. PMID:22984514

  9. High Gene Family Turnover Rates and Gene Space Adaptation in the Compact Genome of the Carnivorous Plant Utricularia gibba.

    PubMed

    Carretero-Paulet, Lorenzo; Librado, Pablo; Chang, Tien-Hao; Ibarra-Laclette, Enrique; Herrera-Estrella, Luis; Rozas, Julio; Albert, Victor A

    2015-05-01

    Utricularia gibba is an aquatic carnivorous plant with highly specialized morphology, featuring fibrous floating networks of branches and leaf-like organs, no recognizable roots, and bladder traps that capture and digest prey. We recently described the compressed genome of U. gibba as sufficient to control the development and reproduction of a complex organism. We hypothesized intense deletion pressure as a mechanism whereby most noncoding DNA was deleted, despite evidence for three independent whole-genome duplications (WGDs). Here, we explore the impact of intense genome fractionation in the evolutionary dynamics of U. gibba's functional gene space. We analyze U. gibba gene family turnover by modeling gene gain/death rates under a maximum-likelihood statistical framework. In accord with our deletion pressure hypothesis, we show that the U. gibba gene death rate is significantly higher than those of four other eudicot species. Interestingly, the gene gain rate is also significantly higher, likely reflecting the occurrence of multiple WGDs and possibly also small-scale genome duplications. Gene ontology enrichment analyses of U. gibba-specific two-gene orthogroups, multigene orthogroups, and singletons highlight functions that may represent adaptations in an aquatic carnivorous plant. We further discuss two homeodomain transcription factor gene families (WOX and HDG/HDZIP-IV) showing conspicuous differential expansions and contractions in U. gibba. Our results 1) reconcile the compactness of the U. gibba genome with its accommodation of a typical number of genes for a plant genome, and 2) highlight the role of high gene family turnover in the evolutionary diversification of U. gibba's functional gene space and adaptations to its unique lifestyle and highly specialized body plan.

  10. Evolution of the insect desaturase gene family with an emphasis on social Hymenoptera.

    PubMed

    Helmkampf, Martin; Cash, Elizabeth; Gadau, Jürgen

    2015-02-01

    Desaturase genes are essential for biological processes, including lipid metabolism, cell signaling, and membrane fluidity regulation. Insect desaturases are particularly interesting for their role in chemical communication, and potential contribution to speciation, symbioses, and sociality. Here, we describe the acyl-CoA desaturase gene families of 15 insects, with a focus on social Hymenoptera. Phylogenetic reconstruction revealed that the insect desaturases represent an ancient gene family characterized by eight subfamilies that differ strongly in their degree of conservation and frequency of gene gain and loss. Analyses of genomic organization showed that five of these subfamilies are represented in a highly microsyntenic region conserved across holometabolous insect taxa, indicating an ancestral expansion during early insect evolution. In three subfamilies, ants exhibit particularly large expansions of genes. Despite these expansions, however, selection analyses showed that desaturase genes in all insect lineages are predominantly undergoing strong purifying selection. Finally, for three expanded subfamilies, we show that ants exhibit variation in gene expression between species, and more importantly, between sexes and castes within species. This suggests functional differentiation of these genes and a role in the regulation of reproductive division of labor in ants. The dynamic pattern of gene gain and loss of acyl-CoA desaturases in ants may reflect changes in response to ecological diversification and an increased demand for chemical signal variability. This may provide an example of how gene family expansions can contribute to lineage-specific adaptations through structural and regulatory changes acting in concert to produce new adaptive phenotypes.

  11. Comparative Genome-Wide Analysis of the Malate Dehydrogenase Gene Families in Cotton

    PubMed Central

    Imran, Muhammad; Tang, Kai; Liu, Jin-Yuan

    2016-01-01

    Malate dehydrogenases (MDHs) play crucial roles in the physiological processes of plant growth and development. In this study, 13 and 25 MDH genes were identified from Gossypium raimondii and Gossypium hirsutum, respectively. Using these and 13 previously reported Gossypium arboretum MDH genes, a comparative molecular analysis between identified MDH genes from G. raimondii, G. hirsutum, and G. arboretum was performed. Based on multiple sequence alignments, cotton MDHs were divided into five subgroups: mitochondrial MDH, peroxisomal MDH, plastidial MDH, chloroplastic MDH and cytoplasmic MDH. Almost all of the MDHs within the same subgroup shared similar gene structure, amino acid sequence, and conserved motifs in their functional domains. An analysis of chromosomal localization suggested that segmental duplication played a major role in the expansion of cotton MDH gene families. Additionally, a selective pressure analysis indicated that purifying selection acted as a vital force in the evolution of MDH gene families in cotton. Meanwhile, an expression analysis showed the distinct expression profiles of GhMDHs in different vegetative tissues and at different fiber developmental stages, suggesting the functional diversification of these genes in cotton growth and fiber development. Finally, a promoter analysis indicated redundant but typical cis-regulatory elements for the potential functions and stress activity of many MDH genes. This study provides fundamental information for a better understanding of cotton MDH gene families and aids in functional analyses of the MDH genes in cotton fiber development. PMID:27829020

  12. Evolution of the Insect Desaturase Gene Family with an Emphasis on Social Hymenoptera

    PubMed Central

    Helmkampf, Martin; Cash, Elizabeth; Gadau, Jürgen

    2015-01-01

    Desaturase genes are essential for biological processes, including lipid metabolism, cell signaling, and membrane fluidity regulation. Insect desaturases are particularly interesting for their role in chemical communication, and potential contribution to speciation, symbioses, and sociality. Here, we describe the acyl-CoA desaturase gene families of 15 insects, with a focus on social Hymenoptera. Phylogenetic reconstruction revealed that the insect desaturases represent an ancient gene family characterized by eight subfamilies that differ strongly in their degree of conservation and frequency of gene gain and loss. Analyses of genomic organization showed that five of these subfamilies are represented in a highly microsyntenic region conserved across holometabolous insect taxa, indicating an ancestral expansion during early insect evolution. In three subfamilies, ants exhibit particularly large expansions of genes. Despite these expansions, however, selection analyses showed that desaturase genes in all insect lineages are predominantly undergoing strong purifying selection. Finally, for three expanded subfamilies, we show that ants exhibit variation in gene expression between species, and more importantly, between sexes and castes within species. This suggests functional differentiation of these genes and a role in the regulation of reproductive division of labor in ants. The dynamic pattern of gene gain and loss of acyl-CoA desaturases in ants may reflect changes in response to ecological diversification and an increased demand for chemical signal variability. This may provide an example of how gene family expansions can contribute to lineage-specific adaptations through structural and regulatory changes acting in concert to produce new adaptive phenotypes. PMID:25425561

  13. The Classical Arabinogalactan Protein Gene Family of Arabidopsis

    PubMed Central

    Schultz, Carolyn J.; Johnson, Kim L.; Currie, Graeme; Bacic, Antony

    2000-01-01

    Arabinogalactan proteins (AGPs) are extracellular proteoglycans implicated in plant growth and development. We searched for classical AGPs in Arabidopsis by identifying expressed sequence tags based on the conserved domain structure of the predicted protein backbone. To confirm that these genes encoded bona fide AGPs, we purified native AGPs and then deglycosylated and deblocked them for N-terminal protein sequencing. In total, we identified 15 genes encoding the protein backbones of classical AGPs, including genes for AG peptides—AGPs with very short backbones (10 to 13 amino acid residues). Seven of the AGPs were verified as AGPs by protein sequencing. A gene encoding a putative cell adhesion molecule with AGP-like domains was also identified. This work provides a firm foundation for beginning functional analysis by using a genetic approach. PMID:11006345

  14. Cloning and expression analysis of novel Aux/IAA family genes in Gossypium hirsutum

    USDA-ARS?s Scientific Manuscript database

    Members of the auxin/indole-3-acetic acid (Aux/IAA) gene family encode proteins to mediate the responses of auxin gene expression and to regulate various aspects of plant morphological development. In this paper, we report the identification of nine cDNAs that contain complete open reading frame (OR...

  15. Variation in the nucleotide sequence of a prolamin gene family in wild rice.

    PubMed

    Barbier, P; Ishihama, A

    1990-07-01

    Variation in the DNA sequence of the 10 kDa prolamin gene family within the wild rice species Oryza rufipogon was probed using the direct sequencing of PCR-amplified genes. A comparison of the nucleotide and deduced amino-acid sequences of eight Asian strains of O. rufipogon and one strain of the related African species O. longistaminata is presented.

  16. Genome-wide identification and phylogenetic analysis of the SBP-box gene family in melons.

    PubMed

    Ma, Y; Guo, J W; Bade, R; Men, Z H; Hasi, A

    2014-10-27

    The SBP-box gene family is specific to plants and encodes a class of zinc finger-containing transcription factors with a broad range of functions. Although SBP-box genes have been identified in numerous plants, including green algae, moss, silver birch, snapdragon, Arabidopsis, rice, and maize, there is little information concerning SBP-box genes, or the corresponding miR156/157, function in melon. Using the highly conserved sequence of the Arabidopsis thaliana SBP-box domain protein as a probe of information sequence, the genome-wide protein database of melon was explored to obtain 13 SBP-box protein sequences, which were further divided into 4 groups, based on phylogenetic analysis. A further analysis centered on the melon SBP-box genetic family's phylogenetic evolution, sequence similarities, gene structure, and miR156 target sequence was also conducted. Analysis of all the expression patterns of melon SBP-box family genes showed that the SBP-box genes were detected in 7 kinds of tissue, and fruit had the highest expression level. CmSBP11 tends to present its specific expression in melon fruit and root. CmSBP09 expression was the highest in flower. Overall, the molecular evolution and expression pattern of the melon SBP-box gene family, revealed by these results, suggest its function differentiation that followed gene duplication.

  17. Basic Helix-Loop-Helix Transcription Factor Gene Family Phylogenetics and Nomenclature

    PubMed Central

    Skinner, Michael K.; Rawls, Alan; Wilson-Rawls, Jeanne; Roalson, Eric H.

    2010-01-01

    A phylogenetic analysis of the basic helix-loop-helix (bHLH) gene superfamily was performed using seven different species (human, mouse, rat, worm, fly, yeast, and plant Arabidopsis) and involving over 600 bHLH genes [1]. All bHLH genes were identified in the genomes of the various species, including expressed sequence tags, and the entire coding sequence was used in the analysis. Nearly 15% of the gene family has been updated or added since the original publication. A super-tree involving six clades and all structural relationships was established and is now presented for four of the species. The wealth of functional data available for members of the bHLH gene superfamily provides us with the opportunity to use this exhaustive phylogenetic tree to predict potential functions of uncharacterized members of the family. This phylogenetic and genomic analysis of the bHLH gene family has revealed unique elements of the evolution and functional relationships of the different genes in the bHLH gene family. PMID:20219281

  18. Gene structure, phylogeny and expression profile of the sucrose synthase gene family in cacao (Theobroma cacao L.).

    PubMed

    Li, Fupeng; Hao, Chaoyun; Yan, Lin; Wu, Baoduo; Qin, Xiaowei; Lai, Jianxiong; Song, Yinghui

    2015-09-01

    In higher plants, sucrose synthase (Sus, EC 2.4.1.13) is widely considered as a key enzyme involved in sucrose metabolism. Although, several paralogous genes encoding different isozymes of Sus have been identified and characterized in multiple plant genomes, to date detailed information about the Sus genes is lacking for cacao. This study reports the identification of six novel Sus genes from economically important cacao tree. Analyses of the gene structure and phylogeny of the Sus genes demonstrated evolutionary conservation in the Sus family across cacao and other plant species. The expression of cacao Sus genes was investigated via real-time PCR in various tissues, different developmental phases of leaf, flower bud and pod. The Sus genes exhibited distinct but partially redundant expression profiles in cacao, with TcSus1, TcSus5 and TcSus6, being the predominant genes in the bark with phloem, TcSus2 predominantly expressing in the seed during the stereotype stage. TcSus3 and TcSus4 were significantly detected more in the pod husk and seed coat along the pod development, and showed development dependent expression profiles in the cacao pod. These results provide new insights into the evolution, and basic information that will assist in elucidating the functions of cacao Sus gene family.

  19. The Wall-associated Kinase gene family in rice genomes.

    PubMed

    de Oliveira, Luiz Felipe Valter; Christoff, Ana Paula; de Lima, Júlio Cesar; de Ross, Bruno Comparsi Feijó; Sachetto-Martins, Gilberto; Margis-Pinheiro, Marcia; Margis, Rogerio

    2014-12-01

    The environment is a dynamic system in which life forms adapt. Wall-Associated Kinases (WAK) are a subfamily of receptor-like kinases associated with the cell wall. These genes have been suggested as sensors of the extracellular environment and triggers of intracellular signals. They belong to the ePK superfamily with or without a conserved arginine before the catalytic subdomain VIB, which characterizes RD and non-RD WAKs. WAK is a large subfamily in rice. We performed an extensive comparison of WAK genes from A. thaliana (AtWAK), O. sativa japonica and indica subspecies (OsWAK). Phylogenetic studies and WAK domain characterization allowed for the identification of two distinct groups of WAK genes in Arabidopsis and rice. One group corresponds to a cluster containing only OsWAKs that most likely expanded after the monocot-dicot separation, which evolved into a non-RD kinase class. The other group comprises classical RD-kinases with both AtWAK and OsWAK representatives. Clusterization analysis using extracellular and kinase domains demonstrated putative functional redundancy for some genes, but also highlighted genes that could recognize similar extracellular stimuli and activate different cascades. The gene expression pattern of WAKs in response to cold suggests differences in the regulation of the OsWAK genes in the indica and japonica subspecies. Our results also confirm the hypothesis of functional diversification between A. thaliana and O. sativa WAK genes. Furthermore, we propose that plant WAKs constitute two evolutionarily related but independent subfamilies: WAK-RD and WAK-nonRD. Recognition of this structural division will further provide insights to understanding WAK functions and regulations.

  20. Familial migraine: Exclusion of the susceptibility gene from the reported locus of familial hemiplegic migraine on 19p

    SciTech Connect

    Hovatta, I.; Peltonen, L.; Kallela, M.; Faerkkilae, M.

    1994-10-01

    Genetic isolates are highly useful in analyses of the molecular background of complex diseases since the enrichment of a limited number of predisposing genes can be predicted in representative families or in specific geographical regions. It has been suggested that the pathophysiology and etiology of familial hemiplegic migraine (FHM) and typical migraine with aura are most probably the same. Recent assignment of FHM locus to chromosome 19p in two French families makes it now possible to test this hypothesis. We report here linkage data on four families with multiple cases of migraine disorder originating from the genetically isolated population of Finland. We were interested to discover whether the migraine in these families would also show linkage to the markers on 19p. We could exclude a region of 50 cM, flanking the reported FHM locus, as a site of migraine locus in our four families. It seems evident that locus heterogeneity exists between different diagnostic classes of migraine spectrum of diseases and also between different ethnic groups. 10 refs., 2 figs., 1 tab.

  1. Gene Panel Testing in Epileptic Encephalopathies and Familial Epilepsies

    PubMed Central

    Møller, Rikke S.; Larsen, Line H.G.; Johannesen, Katrine M.; Talvik, Inga; Talvik, Tiina; Vaher, Ulvi; Miranda, Maria J.; Farooq, Muhammad; Nielsen, Jens E.K.; Svendsen, Lene Lavard; Kjelgaard, Ditte B.; Linnet, Karen M.; Hao, Qin; Uldall, Peter; Frangu, Mimoza; Tommerup, Niels; Baig, Shahid M.; Abdullah, Uzma; Born, Alfred P.; Gellert, Pia; Nikanorova, Marina; Olofsson, Kern; Jepsen, Birgit; Marjanovic, Dragan; Al-Zehhawi, Lana I.K.; Peñalva, Sofia J.; Krag-Olsen, Bente; Brusgaard, Klaus; Hjalgrim, Helle; Rubboli, Guido; Pal, Deb K.; Dahl, Hans A.

    2016-01-01

    In recent years, several genes have been causally associated with epilepsy. However, making a genetic diagnosis in a patient can still be difficult, since extensive phenotypic and genetic heterogeneity has been observed in many monogenic epilepsies. This study aimed to analyze the genetic basis of a wide spectrum of epilepsies with age of onset spanning from the neonatal period to adulthood. A gene panel targeting 46 epilepsy genes was used on a cohort of 216 patients consecutively referred for panel testing. The patients had a range of different epilepsies from benign neonatal seizures to epileptic encephalopathies (EEs). Potentially causative variants were evaluated by literature and database searches, submitted to bioinformatic prediction algorithms, and validated by Sanger sequencing. If possible, parents were included for segregation analysis. We identified a presumed disease-causing variant in 49 (23%) of the 216 patients. The variants were found in 19 different genes including SCN1A, STXBP1, CDKL5, SCN2A, SCN8A, GABRA1, KCNA2, and STX1B. Patients with neonatal-onset epilepsies had the highest rate of positive findings (57%). The overall yield for patients with EEs was 32%, compared to 17% among patients with generalized epilepsies and 16% in patients with focal or multifocal epilepsies. By the use of a gene panel consisting of 46 epilepsy genes, we were able to find a disease-causing genetic variation in 23% of the analyzed patients. The highest yield was found among patients with neonatal-onset epilepsies and EEs. PMID:27781031

  2. Differential expression of a protease gene family in African Trypanosomes

    PubMed Central

    Helm, Jared R.; Wilson, Mary E.; Donelson, John E.

    2008-01-01

    During their life cycle African trypanosomes must quickly adapt to the different environments of the tsetse fly midgut and the mammalian bloodstream by modulating expression of many of their genes. One group of these differentially expressed genes encodes different forms of a major surface protease. Using a luciferase reporter gene transiently or permanently transfected into trypanosomes, we show here that the 3′-UTRs of these protease genes are responsible for their differential expression. Deletion analysis of the 389-bp 3′-UTR of one of the protease genes, MSP-B, demonstrated that it contains a U-rich regulatory region of about 23 bp (UCGUCUGUUAUUUCUUAGUCCAG), which suppresses expression of the reporter protein in bloodstream trypanosomes by as much as 25-fold, but has little effect on the reporter expression in procyclic (tsetse fly) trypanosomes. Replacing the entire 3′-UTR with just this 23-bp element mimicked most of the suppression effect of the complete 3′-UTR. Northern blots showed that the 23-bp element influences the steady state RNA level, but not enough to account for the 25-fold suppression effect. Polysome analyses showed that in procyclic trypanosomes more of the total protease mRNA is associated with intermediate-sized and large polysomes than in bloodstream trypanosomes. Thus, the 23-bp element of this protease gene affects both the level of RNA and its translation. PMID:18848586

  3. The SOD Gene Family in Tomato: Identification, Phylogenetic Relationships, and Expression Patterns.

    PubMed

    Feng, Kun; Yu, Jiahong; Cheng, Yuan; Ruan, Meiying; Wang, Rongqing; Ye, Qingjing; Zhou, Guozhi; Li, Zhimiao; Yao, Zhuping; Yang, Yuejian; Zheng, Qingsong; Wan, Hongjian

    2016-01-01

    Superoxide dismutases (SODs) are critical antioxidant enzymes that protect organisms from reactive oxygen species (ROS) caused by adverse conditions, and have been widely found in the cytoplasm, chloroplasts, and mitochondria of eukaryotic and prokaryotic cells. Tomato (Solanum lycopersicum L.) is an important economic crop and is cultivated worldwide. However, abiotic and biotic stresses severely hinder growth and development of the plant, which affects the production and quality of the crop. To reveal the potential roles of SOD genes under various stresses, we performed a systematic analysis of the tomato SOD gene family and analyzed the expression patterns of SlSOD genes in response to abiotic stresses at the whole-genome level. The characteristics of the SlSOD gene family were determined by analyzing gene structure, conserved motifs, chromosomal distribution, phylogenetic relationships, and expression patterns. We determined that there are at least nine SOD genes in tomato, including four Cu/ZnSODs, three FeSODs, and one MnSOD, and they are unevenly distributed on 12 chromosomes. Phylogenetic analyses of SOD genes from tomato and other plant species were separated into two groups with a high bootstrap value, indicating that these SOD genes were present before the monocot-dicot split. Additionally, many cis-elements that respond to different stresses were found in the promoters of nine SlSOD genes. Gene expression analysis based on RNA-seq data showed that most genes were expressed in all tested tissues, with the exception of SlSOD6 and SlSOD8, which were only expressed in young fruits. Microarray data analysis showed that most members of the SlSOD gene family were altered under salt- and drought-stress conditions. This genome-wide analysis of SlSOD genes helps to clarify the function of SlSOD genes under different stress conditions and provides information to aid in further understanding the evolutionary relationships of SOD genes in plants.

  4. The SOD Gene Family in Tomato: Identification, Phylogenetic Relationships, and Expression Patterns

    PubMed Central

    Feng, Kun; Yu, Jiahong; Cheng, Yuan; Ruan, Meiying; Wang, Rongqing; Ye, Qingjing; Zhou, Guozhi; Li, Zhimiao; Yao, Zhuping; Yang, Yuejian; Zheng, Qingsong; Wan, Hongjian

    2016-01-01

    Superoxide dismutases (SODs) are critical antioxidant enzymes that protect organisms from reactive oxygen species (ROS) caused by adverse conditions, and have been widely found in the cytoplasm, chloroplasts, and mitochondria of eukaryotic and prokaryotic cells. Tomato (Solanum lycopersicum L.) is an important economic crop and is cultivated worldwide. However, abiotic and biotic stresses severely hinder growth and development of the plant, which affects the production and quality of the crop. To reveal the potential roles of SOD genes under various stresses, we performed a systematic analysis of the tomato SOD gene family and analyzed the expression patterns of SlSOD genes in response to abiotic stresses at the whole-genome level. The characteristics of the SlSOD gene family were determined by analyzing gene structure, conserved motifs, chromosomal distribution, phylogenetic relationships, and expression patterns. We determined that there are at least nine SOD genes in tomato, including four Cu/ZnSODs, three FeSODs, and one MnSOD, and they are unevenly distributed on 12 chromosomes. Phylogenetic analyses of SOD genes from tomato and other plant species were separated into two groups with a high bootstrap value, indicating that these SOD genes were present before the monocot-dicot split. Additionally, many cis-elements that respond to different stresses were found in the promoters of nine SlSOD genes. Gene expression analysis based on RNA-seq data showed that most genes were expressed in all tested tissues, with the exception of SlSOD6 and SlSOD8, which were only expressed in young fruits. Microarray data analysis showed that most members of the SlSOD gene family were altered under salt- and drought-stress conditions. This genome-wide analysis of SlSOD genes helps to clarify the function of SlSOD genes under different stress conditions and provides information to aid in further understanding the evolutionary relationships of SOD genes in plants. PMID:27625661

  5. Characterization of three members of the ACC synthase gene family in Solanum tuberosum L.

    PubMed

    Destéfano-Beltrán, L J; van Caeneghem, W; Gielen, J; Richard, L; van Montagu, M; van der Straeten, D

    1995-02-20

    Two genomic clones corresponding to three members of the 1-aminocyclopropane-1-carboxylic acid (ACC) synthase gene family in potato (Solanum tuberosum L.) have been isolated and sequenced. Two highly homologous genes, ST-ACS1A and ST-ACS1B, transcribed in opposite directions were found in an 8.9 kb region. Their coding sequences are interrupted by two introns at identical positions. Their closest relative in tomato is the LE-ACS3 gene. The third gene in potato, ST-ACS2, was found in a 4 kb region and shows a gene structure similar to that of the tomato LE-ACS4 gene and to the mung bean VR-ACS4 and VR-ACS5 genes. Based on its lack of significant homology to the tomato gene family and its closeness to the VR-ACS4 and VR-ACS5 genes, we propose that LE-ACS7 represents an additional isoform in the tomato genome. Moreover, in a phylogenetic comparison of known ACC synthases, the ST-ACS2 isoform was grouped in a separate lineage together with the mung bean VR-ACS4 and VR-ACS5, and the moth orchid DS-ACS1A and DS-ACS1B gene products. Expression of the three potato genes was studied by reverse transcription-polymerase chain reaction on total RNA. The twin genes are positively regulated by indole-3-acetic acid in hypocotyls and expression is modulated by wounding in the leaves. The third gene is responsive to ethylene and wounding mainly in tubers. The roles of these three genes and of other members of the ACC synthase gene family in vegetative processes of potato such as tuberization, dormancy, and sprouting have yet to be determined.

  6. Atypical Protein Phosphatase 2A Gene Families Do Not Expand via Paleopolyploidization1[OPEN

    PubMed Central

    2017-01-01

    Protein phosphatase 2A (PP2A) presents unique opportunities for analyzing molecular mechanisms of functional divergence between gene family members. The canonical PP2A holoenzyme regulates multiple eukaryotic signaling pathways by dephosphorylating target proteins and contains a catalytic (C) subunit, a structural/scaffolding (A) subunit, and a regulatory (B) subunit. Genes encoding PP2A subunits have expanded into multigene families in both flowering plants and mammals, and the extent to which different isoform functions may overlap is not clearly understood. To gain insight into the diversification of PP2A subunits, we used phylogenetic analyses to reconstruct the evolutionary histories of PP2A gene families in Arabidopsis (Arabidopsis thaliana). Genes encoding PP2A subunits in mammals represent ancient lineages that expanded early in vertebrate evolution, while flowering plant PP2A subunit lineages evolved much more recently. Despite this temporal difference, our data indicate that the expansion of PP2A subunit gene families in both flowering plants and animals was driven by whole-genome duplications followed by nonrandom gene loss. Selection analysis suggests that the expansion of one B subunit gene family (B56/PPP2R5) was driven by functional diversification rather than by the maintenance of gene dosage. We also observed reduced expansion rates in three distinct B subunit subclades. One of these subclades plays a highly conserved role in cell division, while the distribution of a second subclade suggests a specialized function in supporting beneficial microbial associations. Thus, while whole-genome duplications have driven the expansion and diversification of most PP2A gene families, members of functionally specialized subclades quickly revert to singleton status after duplication events. PMID:28034953

  7. Interferon induced IFIT family genes in host antiviral defense

    USDA-ARS?s Scientific Manuscript database

    Secretion of interferons (IFNs) from virus-infected cells is a hallmark of host antiviral immunity and in fact, IFNs exert their antiviral activities through the induction of antiviral proteins. The IFN-induced protein with tetratricopeptide repeats (IFITs) family is among hundreds of IF stimulated ...

  8. MS/MS networking guided analysis of molecule and gene cluster families

    PubMed Central

    Nguyen, Don Duy; Wu, Cheng-Hsuan; Moree, Wilna J.; Lamsa, Anne; Medema, Marnix H.; Zhao, Xiling; Gavilan, Ronnie G.; Aparicio, Marystella; Atencio, Librada; Jackson, Chanaye; Ballesteros, Javier; Sanchez, Joel; Watrous, Jeramie D.; Phelan, Vanessa V.; van de Wiel, Corine; Kersten, Roland D.; Mehnaz, Samina; De Mot, René; Shank, Elizabeth A.; Charusanti, Pep; Nagarajan, Harish; Duggan, Brendan M.; Moore, Bradley S.; Bandeira, Nuno; Palsson, Bernhard Ø.; Pogliano, Kit; Gutiérrez, Marcelino; Dorrestein, Pieter C.

    2013-01-01

    The ability to correlate the production of specialized metabolites to the genetic capacity of the organism that produces such molecules has become an invaluable tool in aiding the discovery of biotechnologically applicable molecules. Here, we accomplish this task by matching molecular families with gene cluster families, making these correlations to 60 microbes at one time instead of connecting one molecule to one organism at a time, such as how it is traditionally done. We can correlate these families through the use of nanospray desorption electrospray ionization MS/MS, an ambient pressure MS technique, in conjunction with MS/MS networking and peptidogenomics. We matched the molecular families of peptide natural products produced by 42 bacilli and 18 pseudomonads through the generation of amino acid sequence tags from MS/MS data of specific clusters found in the MS/MS network. These sequence tags were then linked to biosynthetic gene clusters in publicly accessible genomes, providing us with the ability to link particular molecules with the genes that produced them. As an example of its use, this approach was applied to two unsequenced Pseudoalteromonas species, leading to the discovery of the gene cluster for a molecular family, the bromoalterochromides, in the previously sequenced strain P. piscicida JCM 20779T. The approach itself is not limited to 60 related strains, because spectral networking can be readily adopted to look at molecular family–gene cluster families of hundreds or more diverse organisms in one single MS/MS network. PMID:23798442

  9. Domain organization, genomic structure, evolution, and regulation of expression of the aggrecan gene family.

    PubMed

    Schwartz, N B; Pirok, E W; Mensch, J R; Domowicz, M S

    1999-01-01

    Proteoglycans are complex macromolecules, consisting of a polypeptide backbone to which are covalently attached one or more glycosaminoglycan chains. Molecular cloning has allowed identification of the genes encoding the core proteins of various proteoglycans, leading to a better understanding of the diversity of proteoglycan structure and function, as well as to the evolution of a classification of proteoglycans on the basis of emerging gene families that encode the different core proteins. One such family includes several proteoglycans that have been grouped with aggrecan, the large aggregating chondroitin sulfate proteoglycan of cartilage, based on a high number of sequence similarities within the N- and C-terminal domains. Thus far these proteoglycans include versican, neurocan, and brevican. It is now apparent that these proteins, as a group, are truly a gene family with shared structural motifs on the protein and nucleotide (mRNA) levels, and with nearly identical genomic organizations. Clearly a common ancestral origin is indicated for the members of the aggrecan family of proteoglycans. However, differing patterns of amplification and divergence have also occurred within certain exons across species and family members, leading to the class-characteristic protein motifs in the central carbohydrate-rich region exclusively. Thus the overall domain organization strongly suggests that sequence conservation in the terminal globular domains underlies common functions, whereas differences in the central portions of the genes account for functional specialization among the members of this gene family.

  10. Receptor-like kinases from Arabidopsis form a monophyletic gene family related to animal receptor kinases

    PubMed Central

    Shiu, Shin-Han; Bleecker, Anthony B.

    2001-01-01

    Plant receptor-like kinases (RLKs) are proteins with a predicted signal sequence, single transmembrane region, and cytoplasmic kinase domain. Receptor-like kinases belong to a large gene family with at least 610 members that represent nearly 2.5% of Arabidopsis protein coding genes. We have categorized members of this family into subfamilies based on both the identity of the extracellular domains and the phylogenetic relationships between the kinase domains of subfamily members. Surprisingly, this structurally defined group of genes is monophyletic with respect to kinase domains when compared with the other eukaryotic kinase families. In an extended analysis, animal receptor kinases, Raf kinases, plant RLKs, and animal receptor tyrosine kinases form a well supported group sharing a common origin within the superfamily of serine/threonine/tyrosine kinases. Among animal kinase sequences, Drosophila Pelle and related cytoplasmic kinases fall within the plant RLK clade, which we now define as the RLK/Pelle family. A survey of expressed sequence tag records for land plants reveals that mosses, ferns, conifers, and flowering plants have similar percentages of expressed sequence tags representing RLK/Pelle homologs, suggesting that the size of this gene family may have been close to the present-day level before the diversification of land plant lineages. The distribution pattern of four RLK subfamilies on Arabidopsis chromosomes indicates that the expansion of this gene family is partly a consequence of duplication and reshuffling of the Arabidopsis genome and of the generation of tandem repeats. PMID:11526204

  11. Polymorphism and selection in the major histocompatibility complex DRA and DQA genes in the family Equidae.

    PubMed

    Janova, Eva; Matiasovic, Jan; Vahala, Jiri; Vodicka, Roman; Van Dyk, Enette; Horin, Petr

    2009-07-01

    The major histocompatibility complex genes coding for antigen binding and presenting molecules are the most polymorphic genes in the vertebrate genome. We studied the DRA and DQA gene polymorphism of the family Equidae. In addition to 11 previously reported DRA and 24 DQA alleles, six new DRA sequences and 13 new DQA alleles were identified in the genus Equus. Phylogenetic analysis of both DRA and DQA sequences provided evidence for trans-species polymorphism in the family Equidae. The phylogenetic trees differed from species relationships defined by standard taxonomy of Equidae and from trees based on mitochondrial or neutral gene sequence data. Analysis of selection showed differences between the less variable DRA and more variable DQA genes. DRA alleles were more often shared by more species. The DQA sequences analysed showed strong amongst-species positive selection; the selected amino acid positions mostly corresponded to selected positions in rodent and human DQA genes.

  12. The ZIC gene family encodes multi-functional proteins essential for patterning and morphogenesis.

    PubMed

    Houtmeyers, Rob; Souopgui, Jacob; Tejpar, Sabine; Arkell, Ruth

    2013-10-01

    The zinc finger of the cerebellum gene (ZIC) discovered in Drosophila melanogaster (odd-paired) has five homologs in Xenopus, chicken, mice, and humans, and seven in zebrafish. This pattern of gene copy expansion is accompanied by a divergence in gene and protein structure, suggesting that Zic family members share some, but not all, functions. ZIC genes are implicated in neuroectodermal development and neural crest cell induction. All share conserved regions encoding zinc finger domains, however their heterogeneity and specification remain unexplained. In this review, the evolution, structure, and expression patterns of the ZIC homologs are described; specific functions attributable to individual family members are supported. A review of data from functional studies in Xenopus and murine models suggest that ZIC genes encode multifunctional proteins operating in a context-specific manner to drive critical events during embryogenesis. The identification of ZIC mutations in congenital syndromes highlights the relevance of these genes in human development.

  13. Identification of a new, unorthodox member of the MAGE gene family.

    PubMed

    Põld, M; Zhou, J; Chen, G L; Hall, J M; Vescio, R A; Berenson, J R

    1999-07-15

    Several tumor-associated antigen families, such as MAGE, GAGE/PAGE, PRAME, BAGE, and LAGE/NY-ESO-1, exist. These antigens are of particular interest in tumor immunology, because their expression, with exception of testis and fetal tissues, seems to be restricted to tumor cells only. We have identified a novel member of the MAGE gene family, MAGED1. Northern hybridization and RT-PCR demonstrated that the expression level of MAGED1 in different normal adult tissues is comparable to that in testis and fetal liver. Thus, MAGED1 does not possess an expression pattern characteristic of previously identified MAGE family genes, suggesting that the biology of the MAGE-family genes is more complex than previously thought. Chromosome mapping linked MAGED1 to marker AFM119xd6 (DXS1039) on chromosome Xp11.23.

  14. [FGFR2 gene mutation in a family with Crouzon syndrome and a sporadic Crouzon syndrome patient].

    PubMed

    Guo, Lu; Lai, Yan-ni; Li, Lian-xi

    2008-04-01

    To detect the gene mutation of fibroblast growth factor receptor (FGFR2)in a Crouzon syndrome family and a sporadic patient. The genomic DNA from 10 members in the Crouzon syndrome family, as well as a sporadic patient, was extracted. Then exons 8 and 10 of FGFR2 gene and their flanking sequences were amplified by polymerase chain reaction. Some of the family members were studied by only amplifying exon 8. Finally, the PCR products were purified and sequenced. The G to T transversion mutation (heterozygote) at nucleotide 833 in exon 8 of FGFR2 (C278F), was found both in the patients of the family and the sporadic patient. FGFR2 gene mutation is responsible for the pathogenesis of Crouzon syndrome in these patients.

  15. Identification of two novel mutations in the GALNT3 gene in a Chinese family with hyperphosphatemic familial tumoral calcinosis

    PubMed Central

    Sun, Lihao; Zhao, Lin; Du, Lianjun; Zhang, Peipei; Zhang, Minjia; Li, Min; Liu, Tingting; Ye, Lei; Tao, Bei; Zhao, Hongyan; Liu, Jianmin; Ding, Xiaoyi

    2016-01-01

    Hyperphosphatemic familial tumoral calcinosis (HFTC) is a rare, autosomal recessive genetic disease. This disease is characterized by the progressive calcification of soft tissues leading to symptoms of pressure and hyperphosphatemia but normal concentrations of serum calcium with or without an elevation of 1,25-dihydroxyvitamin D3 levels.HFTC is caused by loss-of-function mutations in the GALNT3, FGF23 or KL genes. Here, we identified two novel mutations in the GALNT3 gene in a Chinese family with HFTC. Identification of a novel genotype in HFTC provides clues for understanding the phenotype–genotype relationships in HFTC and may assist not only in the clinical diagnosis of HFTC but also in the interpretation of the genetic information used for prenatal diagnosis and genetic counseling. PMID:27867679

  16. Identification of two novel mutations in the GALNT3 gene in a Chinese family with hyperphosphatemic familial tumoral calcinosis.

    PubMed

    Sun, Lihao; Zhao, Lin; Du, Lianjun; Zhang, Peipei; Zhang, Minjia; Li, Min; Liu, Tingting; Ye, Lei; Tao, Bei; Zhao, Hongyan; Liu, Jianmin; Ding, Xiaoyi

    2016-01-01

    Hyperphosphatemic familial tumoral calcinosis (HFTC) is a rare, autosomal recessive genetic disease. This disease is characterized by the progressive calcification of soft tissues leading to symptoms of pressure and hyperphosphatemia but normal concentrations of serum calcium with or without an elevation of 1,25-dihydroxyvitamin D3 levels.HFTC is caused by loss-of-function mutations in the GALNT3, FGF23 or KL genes. Here, we identified two novel mutations in the GALNT3 gene in a Chinese family with HFTC. Identification of a novel genotype in HFTC provides clues for understanding the phenotype-genotype relationships in HFTC and may assist not only in the clinical diagnosis of HFTC but also in the interpretation of the genetic information used for prenatal diagnosis and genetic counseling.

  17. [Expression of the genes encoding RhtB family proteins depends on global regulator Lrp].

    PubMed

    Kutukova, E A; Zakataeva, N P; Livshits, V A

    2005-01-01

    In the present work, further study of the genes encoding RhtB family proteins is presented. In our previous work the involvement of two family members, RhtB and RhtC, in efflux of amino acids was demonstrated. Now we investigated regulation of expression of the rhtB, rhtC, yeaS and yahN genes. It is shown that expression of these genes is under control of the global regulator Lrp, depends on the presence of some amino acids in growth medium, and increases during different physiological stresses.

  18. A new family of cytochrome P450 genes (CYP41) from the cattle tick, Boophilus microplus.

    PubMed

    Crampton, A L; Baxter, G D; Barker, S C

    1999-09-01

    We isolated and sequenced a cytochrome P450 (CYP) gene that is sufficiently different from other CYP genes that a new CYP family, CYP41 was created. CYP41 encodes a protein of 518 residues and is most similar to genes from the family CYP3; it is 36% identical to CYP3A2 and 34% identical to CYP3A28. We hypothesise that CYP41 encodes an enzyme that metabolizes xenobiotic compounds i.e. compounds that are foreign to the cattle tick. The phylogenetic position of CYP41 could not be resolved because of the high level of sequence divergence at both the nucleotide and amino acid levels.

  19. From manual curation to visualization of gene families and networks across Solanaceae plant species

    PubMed Central

    Pujar, Anuradha; Menda, Naama; Bombarely, Aureliano; Edwards, Jeremy D.; Strickler, Susan R.; Mueller, Lukas A.

    2013-01-01

    High-quality manual annotation methods and practices need to be scaled to the increased rate of genomic data production. Curation based on gene families and gene networks is one approach that can significantly increase both curation efficiency and quality. The Sol Genomics Network (SGN; http://solgenomics.net) is a comparative genomics platform, with genetic, genomic and phenotypic information of the Solanaceae family and its closely related species that incorporates a community-based gene and phenotype curation system. In this article, we describe a manual curation system for gene families aimed at facilitating curation, querying and visualization of gene interaction patterns underlying complex biological processes, including an interface for efficiently capturing information from experiments with large data sets reported in the literature. Well-annotated multigene families are useful for further exploration of genome organization and gene evolution across species. As an example, we illustrate the system with the multigene transcription factor families, WRKY and Small Auxin Up-regulated RNA (SAUR), which both play important roles in responding to abiotic stresses in plants. Database URL: http://solgenomics.net/ PMID:23681907

  20. From manual curation to visualization of gene families and networks across Solanaceae plant species.

    PubMed

    Pujar, Anuradha; Menda, Naama; Bombarely, Aureliano; Edwards, Jeremy D; Strickler, Susan R; Mueller, Lukas A

    2013-01-01

    High-quality manual annotation methods and practices need to be scaled to the increased rate of genomic data production. Curation based on gene families and gene networks is one approach that can significantly increase both curation efficiency and quality. The Sol Genomics Network (SGN; http://solgenomics.net) is a comparative genomics platform, with genetic, genomic and phenotypic information of the Solanaceae family and its closely related species that incorporates a community-based gene and phenotype curation system. In this article, we describe a manual curation system for gene families aimed at facilitating curation, querying and visualization of gene interaction patterns underlying complex biological processes, including an interface for efficiently capturing information from experiments with large data sets reported in the literature. Well-annotated multigene families are useful for further exploration of genome organization and gene evolution across species. As an example, we illustrate the system with the multigene transcription factor families, WRKY and Small Auxin Up-regulated RNA (SAUR), which both play important roles in responding to abiotic stresses in plants. Database URL: http://solgenomics.net/

  1. Duplications and losses in gene families of rust pathogens highlight putative effectors

    PubMed Central

    Pendleton, Amanda L.; Smith, Katherine E.; Feau, Nicolas; Martin, Francis M.; Grigoriev, Igor V.; Hamelin, Richard; Nelson, C. Dana; Burleigh, J. Gordon; Davis, John M.

    2014-01-01

    Rust fungi are a group of fungal pathogens that cause some of the world's most destructive diseases of trees and crops. A shared characteristic among rust fungi is obligate biotrophy, the inability to complete a lifecycle without a host. This dependence on a host species likely affects patterns of gene expansion, contraction, and innovation within rust pathogen genomes. The establishment of disease by biotrophic pathogens is reliant upon effector proteins that are encoded in the fungal genome and secreted from the pathogen into the host's cell apoplast or within the cells. This study uses a comparative genomic approach to elucidate putative effectors and determine their evolutionary histories. We used OrthoMCL to identify nearly 20,000 gene families in proteomes of 16 diverse fungal species, which include 15 basidiomycetes and one ascomycete. We inferred patterns of duplication and loss for each gene family and identified families with distinctive patterns of expansion/contraction associated with the evolution of rust fungal genomes. To recognize potential contributors for the unique features of rust pathogens, we identified families harboring secreted proteins that: (i) arose or expanded in rust pathogens relative to other fungi, or (ii) contracted or were lost in rust fungal genomes. While the origin of rust fungi appears to be associated with considerable gene loss, there are many gene duplications associated with each sampled rust fungal genome. We also highlight two putative effector gene families that have expanded in Cqf that we hypothesize have roles in pathogenicity. PMID:25018762

  2. Functional Divergence of a Syntenic Invertase Gene Family in Tomato, Potato, and Arabidopsis1

    PubMed Central

    Fridman, Eyal; Zamir, Dani

    2003-01-01

    Comparative analysis of complex developmental pathways depends on our ability to resolve the function of members of gene families across taxonomic groups. LIN5, which belongs to a small gene family of apoplastic invertases in tomato (Lycopersicon esculentum), is a quantitative trait locus that modifies fruit sugar composition. We have compared the genomic organization and expression of this gene family in the two distantly related species: tomato and Arabidopsis. Invertase family members reside on segmental duplications in the near-colinear genomes of tomato and potato (Solanum tuberosum). These chromosomal segments are syntenically duplicated in the model plant Arabidopsis. On the basis of phylogenetic analysis of genes in the microsyntenic region, we conclude that these segmental duplications arose independently after the separation of the tomato/potato clade from Arabidopsis. Rapid regulatory divergence is characteristic of the invertase family. Interestingly, although the processes of gene duplication and specialization of expression occurred separately in the two species, synteny-based orthologs from both clades acquired similar organ-specific expression. This similar expression pattern of the genes is evidence of comparable evolutionary constraints (parallel evolution) rather than of functional orthology. The observation that functional orthology cannot be identified through analysis of expression similarity highlights the caution that needs to be exercised in extrapolating developmental networks from a model organism. PMID:12586884

  3. Genomic characterization of the LEED..PEEDs, a gene family unique to the medicago lineage.

    PubMed

    Trujillo, Diana I; Silverstein, Kevin A T; Young, Nevin D

    2014-08-25

    The LEED..PEED (LP) gene family in Medicago truncatula (A17) is composed of 13 genes coding small putatively secreted peptides with one to two conserved domains of negatively charged residues. This family is not present in the genomes of Glycine max, Lotus japonicus, or the IRLC species Cicer arietinum. LP genes were also not detected in a Trifolium pratense draft genome or Pisum sativum nodule transcriptome, which were sequenced de novo in this study, suggesting that the LP gene family arose within the past 25 million years. M. truncatula accession HM056 has 13 LP genes with high similarity to those in A17, whereas M. truncatula ssp. tricycla (R108) and M. sativa have 11 and 10 LP gene copies, respectively. In M. truncatula A17, 12 LP genes are located on chromosome 7 within a 93-kb window, whereas one LP gene copy is located on chromosome 4. A phylogenetic analysis of the gene family is consistent with most gene duplications occurring prior to Medicago speciation events, mainly through local tandem duplications and one distant duplication across chromosomes. Synteny comparisons between R108 and A17 confirm that gene order is conserved between the two subspecies, although a further duplication occurred solely in A17. In M. truncatula A17, all 13 LPs are exclusively transcribed in nodules and absent from other plant tissues, including roots, leaves, flowers, seeds, seed shells, and pods. The recent expansion of LP genes in Medicago spp. and their timing and location of expression suggest a novel function in nodulation, possibly as an aftermath of the evolution of bacteroid terminal differentiation or potentially associated with rhizobial-host specificity. Copyright © 2014 Trujillo et al.

  4. Genomic Characterization of the LEED..PEEDs, a Gene Family Unique to the Medicago Lineage

    PubMed Central

    Trujillo, Diana I.; Silverstein, Kevin A. T.; Young, Nevin D.

    2014-01-01

    The LEED..PEED (LP) gene family in Medicago truncatula (A17) is composed of 13 genes coding small putatively secreted peptides with one to two conserved domains of negatively charged residues. This family is not present in the genomes of Glycine max, Lotus japonicus, or the IRLC species Cicer arietinum. LP genes were also not detected in a Trifolium pratense draft genome or Pisum sativum nodule transcriptome, which were sequenced de novo in this study, suggesting that the LP gene family arose within the past 25 million years. M. truncatula accession HM056 has 13 LP genes with high similarity to those in A17, whereas M. truncatula ssp. tricycla (R108) and M. sativa have 11 and 10 LP gene copies, respectively. In M. truncatula A17, 12 LP genes are located on chromosome 7 within a 93-kb window, whereas one LP gene copy is located on chromosome 4. A phylogenetic analysis of the gene family is consistent with most gene duplications occurring prior to Medicago speciation events, mainly through local tandem duplications and one distant duplication across chromosomes. Synteny comparisons between R108 and A17 confirm that gene order is conserved between the two subspecies, although a further duplication occurred solely in A17. In M. truncatula A17, all 13 LPs are exclusively transcribed in nodules and absent from other plant tissues, including roots, leaves, flowers, seeds, seed shells, and pods. The recent expansion of LP genes in Medicago spp. and their timing and location of expression suggest a novel function in nodulation, possibly as an aftermath of the evolution of bacteroid terminal differentiation or potentially associated with rhizobial–host specificity. PMID:25155275

  5. Comparative genome analysis of lignin biosynthesis gene families across the plant kingdom

    PubMed Central

    2009-01-01

    Background As a major component of plant cell wall, lignin plays important roles in mechanical support, water transport, and stress responses. As the main cause for the recalcitrance of plant cell wall, lignin modification has been a major task for bioenergy feedstock improvement. The study of the evolution and function of lignin biosynthesis genes thus has two-fold implications. First, the lignin biosynthesis pathway provides an excellent model to study the coordinative evolution of a biochemical pathway in plants. Second, understanding the function and evolution of lignin biosynthesis genes will guide us to develop better strategies for bioenergy feedstock improvement. Results We analyzed lignin biosynthesis genes from fourteen plant species and one symbiotic fungal species. Comprehensive comparative genome analysis was carried out to study the distribution, relatedness, and family expansion of the lignin biosynthesis genes across the plant kingdom. In addition, we also analyzed the comparative synteny map between rice and sorghum to study the evolution of lignin biosynthesis genes within the Poaceae family and the chromosome evolution between the two species. Comprehensive lignin biosynthesis gene expression analysis was performed in rice, poplar and Arabidopsis. The representative data from rice indicates that different fates of gene duplications exist for lignin biosynthesis genes. In addition, we also carried out the biomass composition analysis of nine Arabidopsis mutants with both MBMS analysis and traditional wet chemistry methods. The results were analyzed together with the genomics analysis. Conclusion The research revealed that, among the species analyzed, the complete lignin biosynthesis pathway first appeared in moss; the pathway is absent in green algae. The expansion of lignin biosynthesis gene families correlates with substrate diversity. In addition, we found that the expansion of the gene families mostly occurred after the divergence of monocots

  6. Human T-cell receptor variable gene segment families

    SciTech Connect

    Arden, B.; Kabelitz, D.; Clark, S.P.; Mak, T.W.

    1995-10-01

    Multiple DNA and protein sequence alignments have been constructed for the human T-cell receptor {alpha}/{delta}, {beta}, and {gamma} (TCRA/D, B, and G) variable (V) gene segments. The traditional classification into subfamilies was confirmed using a much larger pool of sequences. For each sequence, a name was derived which complies with the standard nomenclature. The traditional numbering of V gene segments in the order of their discovery was continued and changed when in conflict with names of other segments. By discriminating between alleles at the same locus versus genes from different loci, we were able to reduce the number of more than 150 different TCRBV sequences in the database to a repertoire of only 47 functional TCRBV gene segments. An extension of this analysis to the over 100 TCRAV sequences results in a predicted repertoire of 42 functional TCRAV gene segments. Our alignment revealed two residues that distinguish between the highly homologous V{delta} and V{alpha}, one at a site that in V{sub H} contacts the constant region, the other at the interface between immunoglobulin V{sub H} and V{sub L}. This site may be responsible for restricted pairing between certain V{delta} and V{gamma} chains. On the other hand, V{beta} and V{gamma} appear to be related by the fact that their CDR2 length is increased by four residues as compared with that of V{alpha}/{delta} peptides. 150 refs., 12 figs., 5 tabs.

  7. Conservation and diversity of gene families explored using the CODEHOP strategy in higher plants

    PubMed Central

    Morant, Marc; Hehn, Alain; Werck-Reichhart, Danièle

    2002-01-01

    Background Availability of genomewide information on an increasing but still limited number of plants offers the possibility of identifying orthologues, or related genes, in species with major economical impact and complex genomes. In this paper we exploit the recently described CODEHOP primer design and PCR strategy for targeted isolation of homologues in large gene families. Results The method was tested with two different objectives. The first was to analyze the evolution of the CYP98 family of cytochrome P450 genes involved in 3-hydroxylation of phenolic compounds and lignification in a broad range of plant species. The second was to isolate an orthologue of the sorghum glucosyl transferase UGT85B1 and to determine the complexity of the UGT85 family in wheat. P450s of the CYP98 family or closely related sequences were found in all vascular plants. No related sequence was found in moss. Neither extensive duplication of the CYP98 genes nor an orthologue of UGT85B1 were found in wheat. The UGT85A subfamily was however found to be highly variable in wheat. Conclusions Our data are in agreement with the implication of CYP98s in lignification and the evolution of 3-hydroxylation of lignin precursors with vascular plants. High conservation of the CYP98 family strongly argues in favour of an essential function in plant development. Conversely, high duplication and diversification of the UGT85A gene family in wheat suggests its involvement in adaptative response and provides a valuable pool of genes for biotechnological applications. This work demonstrates the high potential of the CODEHOP strategy for the exploration of large gene families in plants. PMID:12153706

  8. Gene tree parsimony of multilocus snake venom protein families reveals species tree conflict as a result of multiple parallel gene loss.

    PubMed

    Casewell, Nicholas R; Wagstaff, Simon C; Harrison, Robert A; Wüster, Wolfgang

    2011-03-01

    The proliferation of gene data from multiple loci of large multigene families has been greatly facilitated by considerable recent advances in sequence generation. The evolution of such gene families, which often undergo complex histories and different rates of change, combined with increases in sequence data, pose complex problems for traditional phylogenetic analyses, and in particular, those that aim to successfully recover species relationships from gene trees. Here, we implement gene tree parsimony analyses on multicopy gene family data sets of snake venom proteins for two separate groups of taxa, incorporating Bayesian posterior distributions as a rigorous strategy to account for the uncertainty present in gene trees. Gene tree parsimony largely failed to infer species trees congruent with each other or with species phylogenies derived from mitochondrial and single-copy nuclear sequences. Analysis of four toxin gene families from a large expressed sequence tag data set from the viper genus Echis failed to produce a consistent topology, and reanalysis of a previously published gene tree parsimony data set, from the family Elapidae, suggested that species tree topologies were predominantly unsupported. We suggest that gene tree parsimony failure in the family Elapidae is likely the result of unequal and/or incomplete sampling of paralogous genes and demonstrate that multiple parallel gene losses are likely responsible for the significant species tree conflict observed in the genus Echis. These results highlight the potential for gene tree parsimony analyses to be undermined by rapidly evolving multilocus gene families under strong natural selection.

  9. The Vertebrate RCAN Gene Family: Novel Insights into Evolution, Structure and Regulation

    PubMed Central

    Serrano-Candelas, Eva; Farré, Domènec; Aranguren-Ibáñez, Álvaro; Martínez-Høyer, Sergio; Pérez-Riba, Mercè

    2014-01-01

    Recently there has been much interest in the Regulators of Calcineurin (RCAN) proteins which are important endogenous modulators of the calcineurin-NFATc signalling pathway. They have been shown to have a crucial role in cellular programmes such as the immune response, muscle fibre remodelling and memory, but also in pathological processes such as cardiac hypertrophy and neurodegenerative diseases. In vertebrates, the RCAN family form a functional subfamily of three members RCAN1, RCAN2 and RCAN3 whereas only one RCAN is present in the rest of Eukarya. In addition, RCAN genes have been shown to collocate with RUNX and CLIC genes in ACD clusters (ACD21, ACD6 and ACD1). How the RCAN genes and their clustering in ACDs evolved is still unknown. After analysing RCAN gene family evolution using bioinformatic tools, we propose that the three RCAN vertebrate genes within the ACD clusters, which evolved from single copy genes present in invertebrates and lower eukaryotes, are the result of two rounds of whole genome duplication, followed by a segmental duplication. This evolutionary scenario involves the loss or gain of some RCAN genes during evolution. In addition, we have analysed RCAN gene structure and identified the existence of several characteristic features that can be involved in RCAN evolution and gene expression regulation. These included: several transposable elements, CpG islands in the 5′ region of the genes, the existence of antisense transcripts (NAT) associated with the three human genes, and considerable evidence for bidirectional promoters that regulate RCAN gene expression. Furthermore, we show that the CpG island associated with the RCAN3 gene promoter is unmethylated and transcriptionally active. All these results provide timely new insights into the molecular mechanisms underlying RCAN function and a more in depth knowledge of this gene family whose members are obvious candidates for the development of future therapies. PMID:24465593

  10. Identification and expression of nor efflux family genes in Staphylococcus epidermidis that act against gatifloxacin.

    PubMed

    Juárez-Verdayes, Marco A; Parra-Ortega, Berenice; Hernández-Rodríguez, César; Betanzos-Cabrera, Gabriel; Rodríguez-Martínez, Sandra; Cancino-Diaz, Mario E; Cancino-Diaz, Juan C

    2012-06-01

    NorA, NorB, and NorC are efflux proteins in the Nor family that regulate the secretion of fluoroquinolones, and MgrA/NorR is a transcription factor of the Nor family. Overexpression of Nor family proteins provides fluoroquinolone resistance in Staphylococcus aureus. However, in coagulase-negative staphylococci (CNS), members of the Nor family had not been identified. In this work, the presence of Nor family proteins in Staphylococcus spp. and the expression of Nor family in gatifloxacin resistant S. epidermidis strains obtained from ocular infections (OI) were identified and analyzed. S. epidermidis strains from OIs (n = 44) and healthy skin (HS; n = 52) were isolated. The nor family genes were identified in CNS using PCR, sequencing and phylogenetic approaches. Nor family expression was determined by RT-PCR. NorA efflux activity was determined using the automated ethidium bromide method. In-silico analysis showed that norA, mgrA/norR, and "norB-like" and "norC-like" (norB/norC) genes are present in CNS. The nor family genes were distributed and constitutively expressed in all S. epidermidis strains studied. In one gatifloxacin resistant strain isolated from the endophthalmitis, treatment with gatifloxacin induced overexpression of the norA gene and resulted in high activity of NorA efflux. These results indicate that the Nor family of proteins is present in CNS, and the NorA efflux mechanism for gatifloxacin response occurs in at least one strain of S. epidermidis, contributing to gatifloxacin resistance.

  11. The banana E2 gene family: Genomic identification, characterization, expression profiling analysis.

    PubMed

    Dong, Chen; Hu, Huigang; Jue, Dengwei; Zhao, Qiufang; Chen, Hongliang; Xie, Jianghui; Jia, Liqiang

    2016-04-01

    The E2 is at the center of a cascade of Ub1 transfers, and it links activation of the Ub1 by E1 to its eventual E3-catalyzed attachment to substrate. Although the genome-wide analysis of this family has been performed in some species, little is known about analysis of E2 genes in banana. In this study, 74 E2 genes of banana were identified and phylogenetically clustered into thirteen subgroups. The predicted banana E2 genes were distributed across all 11 chromosomes at different densities. Additionally, the E2 domain, gene structure and motif compositions were analyzed. The expression of all of the banana E2 genes was analyzed in the root, stem, leaf, flower organs, five stages of fruit development and under abiotic stresses. All of the banana E2 genes, with the exception of few genes in each group, were expressed in at least one of the organs and fruit developments, which indicated that the E2 genes might involve in various aspects of the physiological and developmental processes of the banana. Quantitative RT-PCR (qRT-PCR) analysis identified that 45 E2s under drought and 33 E2s under salt were induced. To the best of our knowledge, this report describes the first genome-wide analysis of the banana E2 gene family, and the results should provide valuable information for understanding the classification, cloning and putative functions of this family.

  12. Mimiviridae: clusters of orthologous genes, reconstruction of gene repertoire evolution and proposed expansion of the giant virus family

    PubMed Central

    2013-01-01

    Background The family Mimiviridae belongs to the large monophyletic group of Nucleo-Cytoplasmic Large DNA Viruses (NCLDV; proposed order Megavirales) and encompasses giant viruses infecting amoeba and probably other unicellular eukaryotes. The recent discovery of the Cafeteria roenbergensis virus (CroV), a distant relative of the prototype mimiviruses, led to a substantial expansion of the genetic variance within the family Mimiviridae. In the light of these findings, a reassessment of the relationships between the mimiviruses and other NCLDV and reconstruction of the evolution of giant virus genomes emerge as interesting and timely goals. Results Database searches for the protein sequences encoded in the genomes of several viruses originally classified as members of the family Phycodnaviridae, in particular Organic Lake phycodnaviruses and Phaeocystis globosa viruses (OLPG), revealed a greater number of highly similar homologs in members of the Mimiviridae than in phycodnaviruses. We constructed a collection of 898 Clusters of Orthologous Genes for the putative expanded family Mimiviridae (MimiCOGs) and used these clusters for a comprehensive phylogenetic analysis of the genes that are conserved in most of the NCLDV. The topologies of the phylogenetic trees for these conserved viral genes strongly support the monophyly of the OLPG and the mimiviruses. The same tree topology was obtained by analysis of the phyletic patterns of conserved viral genes. We further employed the mimiCOGs to obtain a maximum likelihood reconstruction of the history of genes losses and gains among the giant viruses. The results reveal massive gene gain in the mimivirus branch and modest gene gain in the OLPG branch. Conclusions These phylogenomic results reported here suggest a substantial expansion of the family Mimiviridae. The proposed expanded family encompasses a greater diversity of viruses including a group of viruses with much smaller genomes than those of the original members of

  13. Mimiviridae: clusters of orthologous genes, reconstruction of gene repertoire evolution and proposed expansion of the giant virus family.

    PubMed

    Yutin, Natalya; Colson, Philippe; Raoult, Didier; Koonin, Eugene V

    2013-04-04

    The family Mimiviridae belongs to the large monophyletic group of Nucleo-Cytoplasmic Large DNA Viruses (NCLDV; proposed order Megavirales) and encompasses giant viruses infecting amoeba and probably other unicellular eukaryotes. The recent discovery of the Cafeteria roenbergensis virus (CroV), a distant relative of the prototype mimiviruses, led to a substantial expansion of the genetic variance within the family Mimiviridae. In the light of these findings, a reassessment of the relationships between the mimiviruses and other NCLDV and reconstruction of the evolution of giant virus genomes emerge as interesting and timely goals. Database searches for the protein sequences encoded in the genomes of several viruses originally classified as members of the family Phycodnaviridae, in particular Organic Lake phycodnaviruses and Phaeocystis globosa viruses (OLPG), revealed a greater number of highly similar homologs in members of the Mimiviridae than in phycodnaviruses. We constructed a collection of 898 Clusters of Orthologous Genes for the putative expanded family Mimiviridae (MimiCOGs) and used these clusters for a comprehensive phylogenetic analysis of the genes that are conserved in most of the NCLDV. The topologies of the phylogenetic trees for these conserved viral genes strongly support the monophyly of the OLPG and the mimiviruses. The same tree topology was obtained by analysis of the phyletic patterns of conserved viral genes. We further employed the mimiCOGs to obtain a maximum likelihood reconstruction of the history of genes losses and gains among the giant viruses. The results reveal massive gene gain in the mimivirus branch and modest gene gain in the OLPG branch. These phylogenomic results reported here suggest a substantial expansion of the family Mimiviridae. The proposed expanded family encompasses a greater diversity of viruses including a group of viruses with much smaller genomes than those of the original members of the Mimiviridae. If the OLPG

  14. Characterization of the laminin gene family and evolution in zebrafish.

    PubMed

    Sztal, Tamar; Berger, Silke; Currie, Peter D; Hall, Thomas E

    2011-02-01

    Laminins are essential components of all basement membranes and are fundamental to tissue development and homeostasis. Humans possess at least 16 different heterotrimeric laminin complexes formed through different combinations of alpha, beta, and gamma chains. Individual chains appear to exhibit unique expression patterns, leading to the notion that overlap between expression domains governs the constitution of complexes found within particular tissues. However, the spatial and temporal expression of laminin genes has not been comprehensively analyzed in any vertebrate model to date. Here, we describe the tissue-specific expression patterns of all laminin genes in the zebrafish, throughout embryonic development and into the "post-juvenile" period, which is representative of the adult body form. In addition, we present phylogenetic and microsynteny analyses, which demonstrate that the majority of our zebrafish sequences are orthologous to human laminin genes. Together, these data represent a fundamental resource for the study of vertebrate laminins.

  15. The ac53, ac78, ac101, and ac103 Genes Are Newly Discovered Core Genes in the Family Baculoviridae

    PubMed Central

    Garavaglia, Matías Javier; Miele, Solange Ana Belén; Iserte, Javier Alonso; Belaich, Mariano Nicolás

    2012-01-01

    The family Baculoviridae is a large group of insect viruses containing circular double-stranded DNA genomes of 80 to 180 kbp, which have broad biotechnological applications. A key feature to understand and manipulate them is the recognition of orthology. However, the differences in gene contents and evolutionary distances among the known members of this family make it difficult to assign sequence orthology. In this study, the genome sequences of 58 baculoviruses were analyzed, with the aim to detect previously undescribed core genes because of their remote homology. A routine based on Multi PSI-Blast/tBlastN and Multi HaMStR allowed us to detect 31 of 33 accepted core genes and 4 orthologous sequences in the Baculoviridae which were not described previously. Our results show that the ac53, ac78, ac101 (p40), and ac103 (p48) genes have orthologs in all genomes and should be considered core genes. Accordingly, there are 37 orthologous genes in the family Baculoviridae. PMID:22933288

  16. Systematic analysis and identification of stress-responsive genes of the NAC gene family in Brachypodium distachyon.

    PubMed

    You, Jun; Zhang, Lihua; Song, Bo; Qi, Xiaoquan; Chan, Zhulong

    2015-01-01

    Plant-specific NAC proteins are one of the largest families of transcription factors in plants, and members of this family have been characterized with roles in the regulation of diverse biological processes, including development and stress responses. In the present study, we identified 101 putative NAC domain-encoding genes (BdNACs) through systematic sequence analysis in Brachypodium distachyon, a new model plant of family Poaceae. BdNAC proteins were phylogenetically clustered into 13 groups, and each group possesses similar motif compositions. Phylogenetic analysis using known stress-related NACs from Arabidopsis and rice as query sequences identified 18 BdNACs as putative stress-responsive genes. In silico promoter analysis showed that almost all BdNAC genes contain putative stress-related cis-elements in their promoter regions. Expression profile of BdNAC genes in response to abiotic stresses and phytohormones was analyzed by quantitative real-time RT-PCR. Several putative stress-responsive BdNAC genes, including BdNAC003 and BdNAC044 which is ortholog of known stress-responsive rice gene SNAC1 and SNAC2, respectively, were highly regulated by multiple abiotic stresses and stress-related phytohormone treatments. Taken together, our results presented here would be helpful in laying the foundation for understanding of the complex mechanisms of NAC mediated abiotic stress signaling transduction pathways in B. distachyon.

  17. Tandem repeat distribution of gene transcripts in three plant families

    PubMed Central

    2009-01-01

    Tandem repeats (microsatellites or SSRs) are molecular markers with great potential for plant genetic studies. Modern strategies include the transfer of these markers among widely studied and orphan species. In silico analyses allow for studying distribution patterns of microsatellites and predicting which motifs would be more amenable to interspecies transfer. Transcribed sequences (Unigene) from ten species of three plant families were surveyed for the occurrence of micro and minisatellites. Transcripts from different species displayed different rates of tandem repeat occurrence, ranging from 1.47% to 11.28%. Both similar and different patterns were found within and among plant families. The results also indicate a lack of association between genome size and tandem repeat fractions in expressed regions. The conservation of motifs among species and its implication on genome evolution and dynamics are discussed. PMID:21637460

  18. Genome-wide identification of the TIFY gene family in three cultivated Gossypium species and the expression of JAZ genes

    PubMed Central

    Sun, Quan; Wang, Guanghao; Zhang, Xiao; Zhang, Xiangrui; Qiao, Peng; Long, Lu; Yuan, Youlu; Cai, Yingfan

    2017-01-01

    TIFY proteins are plant-specific proteins containing TIFY, JAZ, PPD and ZML subfamilies. A total of 50, 54 and 28 members of the TIFY gene family in three cultivated cotton species—Gossypium hirsutum, Gossypium barbadense and Gossypium arboretum—were identified, respectively. The results of phylogenetic analysis showed that these TIFY genes were divided into eight clusters. The different clusters of gene family members often have similar gene structures, including the number of exons. The results of quantitative reverse transcription polymerase chain reaction (qRT-PCR) showed that different JAZ genes displayed distinct expression patterns in the leaves of upland cotton under treatment with Gibberellin (GA), methyl jasmonate (MeJA), Jasmonic acid (JA) and abscisic acid (ABA). Different groups of JAZ genes exhibited different expression patterns in cotton leaves infected with Verticillium dahliae. The results of the comparative analysis of TIFY genes in the three cultivated species will be useful for understanding the involvement of these genes in development and stress resistance in cotton. PMID:28186193

  19. Fifteen million years of evolution in the Oryza genus shows extensive gene family expansion.

    PubMed

    Jacquemin, Julie; Ammiraju, Jetty S S; Haberer, Georg; Billheimer, Dean D; Yu, Yeisoo; Liu, Liana C; Rivera, Luis F; Mayer, Klaus; Chen, Mingsheng; Wing, Rod A

    2014-04-01

    In analyzing gene families in the whole-genome sequences available for O. sativa (AA), O. glaberrima (AA), and O. brachyantha (FF), we observed large size expansions in the AA genomes compared to FF genomes for the super-families F-box and NB-ARC, and five additional families: the Aspartic proteases, BTB/POZ proteins (BTB), Glutaredoxins, Trypsin α-amylase inhibitor proteins, and Zf-Dof proteins. Their evolutionary dynamic was investigated to understand how and why such important size variations are observed between these closely related species. We show that expansions resulted from both amplification, largely by tandem duplications, and contraction by gene losses. For the F-box and NB-ARC gene families, the genes conserved in all species were under strong purifying selection while expanded orthologous genes were under more relaxed purifying selection. In F-box, NB-ARC, and BTB, the expanded groups were enriched in genes with little evidence of expression, in comparison with conserved groups. We also detected 87 loci under positive selection in the expanded groups. These results show that most of the duplicated copies in the expanded groups evolve neutrally after duplication because of functional redundancy but a fraction of these genes were preserved following neofunctionalization. Hence, the lineage-specific expansions observed between Oryza species were partly driven by directional selection.

  20. Genome-Wide Identification of the Invertase Gene Family in Populus.

    PubMed

    Chen, Zhong; Gao, Kai; Su, Xiaoxing; Rao, Pian; An, Xinmin

    2015-01-01

    Invertase plays a crucial role in carbohydrate partitioning and plant development as it catalyses the irreversible hydrolysis of sucrose into glucose and fructose. The invertase family in plants is composed of two sub-families: acid invertases, which are targeted to the cell wall and vacuole; and neutral/alkaline invertases, which function in the cytosol. In this study, 5 cell wall invertase genes (PtCWINV1-5), 3 vacuolar invertase genes (PtVINV1-3) and 16 neutral/alkaline invertase genes (PtNINV1-16) were identified in the Populus genome and found to be distributed on 14 chromosomes. A comprehensive analysis of poplar invertase genes was performed, including structures, chromosome location, phylogeny, evolutionary pattern and expression profiles. Phylogenetic analysis indicated that the two sub-families were both divided into two clades. Segmental duplication is contributed to neutral/alkaline sub-family expansion. Furthermore, the Populus invertase genes displayed differential expression in roots, stems, leaves, leaf buds and in response to salt/cold stress and pathogen infection. In addition, the analysis of enzyme activity and sugar content revealed that invertase genes play key roles in the sucrose metabolism of various tissues and organs in poplar. This work lays the foundation for future functional analysis of the invertase genes in Populus and other woody perennials.

  1. Genome-Wide Identification of the Invertase Gene Family in Populus

    PubMed Central

    Su, Xiaoxing; Rao, Pian; An, Xinmin

    2015-01-01

    Invertase plays a crucial role in carbohydrate partitioning and plant development as it catalyses the irreversible hydrolysis of sucrose into glucose and fructose. The invertase family in plants is composed of two sub-families: acid invertases, which are targeted to the cell wall and vacuole; and neutral/alkaline invertases, which function in the cytosol. In this study, 5 cell wall invertase genes (PtCWINV1-5), 3 vacuolar invertase genes (PtVINV1-3) and 16 neutral/alkaline invertase genes (PtNINV1-16) were identified in the Populus genome and found to be distributed on 14 chromosomes. A comprehensive analysis of poplar invertase genes was performed, including structures, chromosome location, phylogeny, evolutionary pattern and expression profiles. Phylogenetic analysis indicated that the two sub-families were both divided into two clades. Segmental duplication is contributed to neutral/alkaline sub-family expansion. Furthermore, the Populus invertase genes displayed differential expression in roots, stems, leaves, leaf buds and in response to salt/cold stress and pathogen infection. In addition, the analysis of enzyme activity and sugar content revealed that invertase genes play key roles in the sucrose metabolism of various tissues and organs in poplar. This work lays the foundation for future functional analysis of the invertase genes in Populus and other woody perennials. PMID:26393355

  2. Eleven ancestral gene families lost in mammals and vertebrates while otherwise universally conserved in animals

    PubMed Central

    Danchin, Etienne GJ; Gouret, Philippe; Pontarotti, Pierre

    2006-01-01

    Background Gene losses played a role which may have been as important as gene and genome duplications and rearrangements, in modelling today species' genomes from a common ancestral set of genes. The set and diversity of protein-coding genes in a species has direct output at the functional level. While gene losses have been reported in all the major lineages of the metazoan tree of life, none have proposed a focus on specific losses in the vertebrates and mammals lineages. In contrast, genes lost in protostomes (i.e. arthropods and nematodes) but still present in vertebrates have been reported and extensively detailed. This probable over-anthropocentric way of comparing genomes does not consider as an important phenomena, gene losses in species that are usually described as "higher". However reporting universally conserved genes throughout evolution that have recently been lost in vertebrates and mammals could reveal interesting features about the evolution of our genome, particularly if these losses can be related to losses of capability. Results We report 11 gene families conserved throughout eukaryotes from yeasts (such as Saccharomyces cerevisiae) to bilaterian animals (such as Drosophila melanogaster or Caenorhabditis elegans). This evolutionarily wide conservation suggests they were present in the last common ancestors of fungi and metazoan animals. None of these 11 gene families are found in human nor mouse genomes, and their absence generally extends to all vertebrates. A total of 8 out of these 11 gene families have orthologs in plants, suggesting they were present in the Last Eukaryotic Common Ancestor (LECA). We investigated known functional information for these 11 gene families. This allowed us to correlate some of the lost gene families to loss of capabilities. Conclusion Mammalian and vertebrate genomes lost evolutionary conserved ancestral genes that are probably otherwise not dispensable in eukaryotes. Hence, the human genome, which is generally

  3. Evolutionary analysis of the jacalin-related lectin family genes in 11 fishes.

    PubMed

    Cao, Jun; Lv, Yueqing

    2016-09-01

    Jacalin-related lectins are a type of carbohydrate-binding proteins, which are distributed across a wide variety of organisms and involved in some important biological processes. The evolution of this gene family in fishes is unknown. Here, 47 putative jacalin genes in 11 fish species were identified and divided into 4 groups through phylogenetic analysis. Conserved gene organization and motif distribution existed in each group, suggesting their functional conservation. Some fishes have eleven jacalin genes, while others have only one or zero gene in their genomes, suggesting dynamic changes in the number of jacalin genes during the evolution of fishes. Intragenic recombination played a key role in the evolution of jacalin genes. Synteny analyses of jacalin genes in some fishes implied conserved and dynamic evolution characteristics of this gene family and related genome segments. Moreover, a few functional divergence sites were identified within each group pairs. Divergent expression profiles of the zebra fish jacalin genes were further investigated in different stresses. The results provided a foundation for exploring the characterization of the jacalin genes in fishes and will offer insights for additional functional studies.

  4. The phylogeny and evolutionary history of the Lesion Simulating Disease (LSD) gene family in Viridiplantae.

    PubMed

    Cabreira, Caroline; Cagliari, Alexandro; Bücker-Neto, Lauro; Margis-Pinheiro, Márcia; de Freitas, Loreta B; Bodanese-Zanettini, Maria Helena

    2015-12-01

    The Lesion Simulating Disease (LSD) genes encode a family of zinc finger proteins that play a role in programmed cell death (PCD) and other biological processes, such as plant growth and photosynthesis. In the present study, we report the reconstruction of the evolutionary history of the LSD gene family in Viridiplantae. Phylogenetic analysis revealed that the monocot and eudicot genes were distributed along the phylogeny, indicating that the expansion of the family occurred prior to the diversification between these clades. Sequences encoding proteins that present one, two, or three LSD domains formed separate groups. The secondary structure of these different LSD proteins presented a similar composition, with the β-sheets being their main component. The evolution by gene duplication was identified only to the genes that contain three LSD domains, which generated proteins with equal structure. Moreover, genes encoding proteins with one or two LSD domains evolved as single-copy genes and did not result from loss or gain in LSD domains. These results were corroborated by synteny analysis among regions containing paralogous/orthologous genes in Glycine max and Populus trichocarpa. The Ka/Ks ratio between paralogous/orthologous genes revealed that a subfunctionalization process possibly could be occurring with the LSD genes, explaining the involvement of LSD members in different biological processes, in addition to the negative regulation of PCD. This study presents important novelty in the evolutionary history of the LSD family and provides a basis for future research on individual LSD genes and their involvement in important pathway networks in plants.

  5. Transcriptomic and phylogenetic analysis of Culex pipiens quinquefasciatus for three detoxification gene families

    PubMed Central

    2012-01-01

    Background The genomes of three major mosquito vectors of human diseases, Anopheles gambiae, Aedes aegypti, and Culex pipiens quinquefasciatus, have been previously sequenced. C. p. quinquefasciatus has the largest number of predicted protein-coding genes, which partially results from the expansion of three detoxification gene families: cytochrome P450 monooxygenases (P450), glutathione S-transferases (GST), and carboxyl/cholinesterases (CCE). However, unlike An. gambiae and Ae. aegypti, which have large amounts of gene expression data, C. p. quinquefasciatus has limited transcriptomic resources. Knowledge of complete gene expression information is very important for the exploration of the functions of genes involved in specific biological processes. In the present study, the three detoxification gene families of C. p. quinquefasciatus were analyzed for phylogenetic classification and compared with those of three other dipteran insects. Gene expression during various developmental stages and the differential expression responsible for parathion resistance were profiled using the digital gene expression (DGE) technique. Results A total of 302 detoxification genes were found in C. p. quinquefasciatus, including 71 CCE, 196 P450, and 35 cytosolic GST genes. Compared with three other dipteran species, gene expansion in Culex mainly occurred in the CCE and P450 families, where the genes of α-esterases, juvenile hormone esterases, and CYP325 of the CYP4 subfamily showed the most pronounced expansion on the genome. For the five DGE libraries, 3.5-3.8 million raw tags were generated and mapped to 13314 reference genes. Among 302 detoxification genes, 225 (75%) were detected for expression in at least one DGE library. One fourth of the CCE and P450 genes were detected uniquely in one stage, indicating potential developmentally regulated expression. A total of 1511 genes showed different expression levels between a parathion-resistant and a susceptible strain. Fifteen

  6. The zebrafish progranulin gene family and antisense transcripts

    PubMed Central

    Cadieux, Benoît; Chitramuthu, Babykumari P; Baranowski, David; Bennett, Hugh PJ

    2005-01-01

    Background Progranulin is an epithelial tissue growth factor (also known as proepithelin, acrogranin and PC-cell-derived growth factor) that has been implicated in development, wound healing and in the progression of many cancers. The single mammalian progranulin gene encodes a glycoprotein precursor consisting of seven and one half tandemly repeated non-identical copies of the cystine-rich granulin motif. A genome-wide duplication event hypothesized to have occurred at the base of the teleost radiation predicts that mammalian progranulin may be represented by two co-orthologues in zebrafish. Results The cDNAs encoding two zebrafish granulin precursors, progranulins-A and -B, were characterized and found to contain 10 and 9 copies of the granulin motif respectively. The cDNAs and genes encoding the two forms of granulin, progranulins-1 and -2, were also cloned and sequenced. Both latter peptides were found to be encoded by precursors with a simplified architecture consisting of one and one half copies of the granulin motif. A cDNA encoding a chimeric progranulin which likely arises through the mechanism of trans-splicing between grn1 and grn2 was also characterized. A non-coding RNA gene with antisense complementarity to both grn1 and grn2 was identified which may have functional implications with respect to gene dosage, as well as in restricting the formation of the chimeric form of progranulin. Chromosomal localization of the four progranulin (grn) genes reveals syntenic conservation for grna only, suggesting that it is the true orthologue of mammalian grn. RT-PCR and whole-mount in situ hybridization analysis of zebrafish grns during development reveals that combined expression of grna and grnb, but not grn1 and grn2, recapitulate many of the expression patterns observed for the murine counterpart. This includes maternal deposition, widespread central nervous system distribution and specific localization within the epithelial compartments of various organs

  7. Genome-wide analysis of the MADS-box gene family in Brassica rapa (Chinese cabbage).

    PubMed

    Duan, Weike; Song, Xiaoming; Liu, Tongkun; Huang, Zhinan; Ren, Jun; Hou, Xilin; Li, Ying

    2015-02-01

    The MADS-box gene family is an ancient and well-studied transcription factor family that functions in almost every developmental process in plants. There are a number of reports about the MADS-box family in different plant species, but systematic analysis of the MADS-box transcription factor family in Brassica rapa (Chinese cabbage) is still lacking. In this study, 160 MADS-box transcription factors were identified from the entire Chinese cabbage genome and compared with the MADS-box factors from 21 other representative plant species. A detailed list of MADS proteins from these 22 species was sorted. Phylogenetic analysis of the BrMADS genes, together with their Arabidopsis and rice counterparts, showed that the BrMADS genes were categorised into type I (Mα, Mβ, Mγ) and type II (MIKC(C), MIKC*) groups, and the MIKC(C) proteins were further divided into 13 subfamilies. The Chinese cabbage type II group has 95 members, which is twice as much as the Arabidopsis type II group, indicating that the Chinese cabbage type II genes have been retained more frequently than the type I genes. Finally, RNA-seq transcriptome data and quantitative real-time PCR analysis revealed that BrMADS genes are expressed in a tissue-specific manner similar to Arabidopsis. Interestingly, a number of BrMIKC genes showed responses to different abiotic stress treatments, suggesting a function for some of the genes in these processes as well. Taken together, the characterization of the B. rapa MADS-box family presented here, will certainly help in the selection of appropriate candidate genes and further facilitate functional studies in Chinese cabbage.

  8. The Protein Disulfide Isomerase gene family in bread wheat (T. aestivum L.)

    PubMed Central

    2010-01-01

    Background The Protein Disulfide Isomerase (PDI) gene family encodes several PDI and PDI-like proteins containing thioredoxin domains and controlling diversified metabolic functions, including disulfide bond formation and isomerisation during protein folding. Genomic, cDNA and promoter sequences of the three homoeologous wheat genes encoding the "typical" PDI had been cloned and characterized in a previous work. The purpose of present research was the cloning and characterization of the complete set of genes encoding PDI and PDI like proteins in bread wheat (Triticum aestivum cv Chinese Spring) and the comparison of their sequence, structure and expression with homologous genes from other plant species. Results Eight new non-homoeologous wheat genes were cloned and characterized. The nine PDI and PDI-like sequences of wheat were located in chromosome regions syntenic to those in rice and assigned to eight plant phylogenetic groups. The nine wheat genes differed in their sequences, genomic organization as well as in the domain composition and architecture of their deduced proteins; conversely each of them showed high structural conservation with genes from other plant species in the same phylogenetic group. The extensive quantitative RT-PCR analysis of the nine genes in a set of 23 wheat samples, including tissues and developmental stages, showed their constitutive, even though highly variable expression. Conclusions The nine wheat genes showed high diversity, while the members of each phylogenetic group were highly conserved even between taxonomically distant plant species like the moss Physcomitrella patens. Although constitutively expressed the nine wheat genes were characterized by different expression profiles reflecting their different genomic organization, protein domain architecture and probably promoter sequences; the high conservation among species indicated the ancient origin and diversification of the still evolving gene family. The comprehensive

  9. The GLI-Kruppel family of human genes

    SciTech Connect

    Ruppert, J.M.; Kinzler, K.W.; Wong, A.J.; Bigner, S.H.; Kao, F.T.; Law, M.L.; Seuanez, H.N.; O'Brien, S.J.; Vogelstein, B.

    1988-08-01

    Previous characterization of GLI, a gene found to be amplified and expressed in a subset of human brain tumors, revealed the presence of five tandem fingers related to those of Kruppel (Kr), a Drosophila segmentation gene of the gap class. The authors have used the GLI cDNA as a molecular probe to isolate related sequences from the human genome. Partial characterization of six related loci, including sequence determination, expression studies, and chromosome localization, revealed that each locus could encode a separate finger protein. The predicted proteins all had similar H-C links, i.e., a conserved stretch of 9 amino acids connecting the C-terminal histidine of one finger to the N-terminal cysteine of the next. On the basis of amino acid sequence and intron-exon organization, the genes could be placed into one of two subgroups: the GLI subgroup (with the consensus finger amino acid sequence (Y/F)XCX/sub 3/GCX/sub 3/(F/Y)X/sub 5/LX/sub 2/HX/sub 3-4/H(T/X)GEKP) or the Kr subgroup (with the consensus finger amino acid sequence (Y/F)XCX/sub 2/CX/sub 3/FX/sub 5/LX/sub 2/HXRXHTGEKP). Unlike GLI or Kr, most of the newly isolated genes were expressed in many adult tissues. The predicted proteins probably control the expression of other genes and, by analogy with Kr and GLI, may be important in human development, tissue-specific differentiation, or neoplasia.

  10. Large, rapidly evolving gene families are at the forefront of host-parasite interactions in Apicomplexa.

    PubMed

    Reid, Adam J

    2015-02-01

    The Apicomplexa is a phylum of parasitic protozoa, which includes the malaria parasite Plasmodium, amongst other species that can devastate human and animal health. The past decade has seen the release of genome sequences for many of the most important apicomplexan species, providing an excellent basis for improving our understanding of their biology. One of the key features of each genome is a unique set of large, variant gene families. Although closely related species share the same families, even different types of malaria parasite have distinct families. In some species they tend to be found at the ends of chromosomes, which may facilitate aspects of gene expression regulation and generation of sequence diversity. In others they are scattered apparently randomly across chromosomes. For some families there is evidence they are involved in antigenic variation, immune regulation and immune evasion. For others there are no known functions. Even where function is unknown these families are most often predicted to be exposed to the host, contain much sequence diversity and evolve rapidly. Based on these properties it is clear that they are at the forefront of host-parasite interactions. In this review I compare and contrast the genomic context, gene structure, gene expression, protein localization and function of these families across different species.

  11. Multi-gene panel testing for hereditary cancer susceptibility in a rural Familial Cancer Program.

    PubMed

    Hermel, David J; McKinnon, Wendy C; Wood, Marie E; Greenblatt, Marc S

    2017-01-01

    This study explores our Familial Cancer Program's experience implementing multi-gene panel testing in a largely rural patient population. We conducted a retrospective review of patients undergoing panel testing between May 2011 and August 2015. Our goal was to evaluate factors that might be predictors of identifying variants (pathogenic or uncertain significance) and to assess clinical management changes due to testing. We utilized a structured family history tool to determine the significance of patient's family histories with respect to identification of genetic variants. A total of 227 patients underwent panel testing at our center and 67 patients (29.5 %) had variants identified, with 8 (3.5 %) having multiple variants. Overall, 44 patients (19.4 %) had a variant of uncertain significance (VUS) and 28 patients (12.3 %) had a pathogenic variant detected, with 10 (4.4 %) having pathogenic variants in highly penetrant genes. We found no statistical difference in patient familial and personal cancer history, age, rural status, Ashkenazi Jewish ancestry, insurance coverage and prior single-gene testing among those with pathogenic, VUS and negative panel testing results. There were no predictors of pathogenic variants on regression analysis. Panel testing changed cancer screening and management guidelines from that expected based on family history alone in 13.2 % of patients. Ultimately, cancer panel testing does yield critical information not identified by traditional single gene testing but maximal utility through a broad range of personal and family histories requires improved interpretation of variants.

  12. Clade classification of monolignol biosynthesis gene family members reveals target genes to decrease lignin in Lolium perenne.

    PubMed

    van Parijs, F R D; Ruttink, T; Boerjan, W; Haesaert, G; Byrne, S L; Asp, T; Roldán-Ruiz, I; Muylle, H

    2015-07-01

    In monocots, lignin content has a strong impact on the digestibility of the cell wall fraction. Engineering lignin biosynthesis requires a profound knowledge of the role of paralogues in the multigene families that constitute the monolignol biosynthesis pathway. We applied a bioinformatics approach for genome-wide identification of candidate genes in Lolium perenne that are likely to be involved in the biosynthesis of monolignols. More specifically, we performed functional subtyping of phylogenetic clades in four multigene families: 4CL, COMT, CAD and CCR. Essential residues were considered for functional clade delineation within these families. This classification was complemented with previously published experimental evidence on gene expression, gene function and enzymatic activity in closely related crops and model species. This allowed us to assign functions to novel identified L. perenne genes, and to assess functional redundancy among paralogues. We found that two 4CL paralogues, two COMT paralogues, three CCR paralogues and one CAD gene are prime targets for genetic studies to engineer developmentally regulated lignin in this species. Based on the delineation of sequence conservation between paralogues and a first analysis of allelic diversity, we discuss possibilities to further study the roles of these paralogues in lignin biosynthesis, including expression analysis, reverse genetics and forward genetics, such as association mapping. We propose criteria to prioritise paralogues within multigene families and certain SNPs within these genes for developing genotyping assays or increasing power in association mapping studies. Although L. perenne was the target of the analyses presented here, this functional subtyping of phylogenetic clades represents a valuable tool for studies investigating monolignol biosynthesis genes in other monocot species.

  13. Unique Loss of the PYHIN Gene Family in Bats Amongst Mammals: Implications for Inflammasome Sensing

    PubMed Central

    Ahn, Matae; Cui, Jie; Irving, Aaron T.; Wang, Lin-Fa

    2016-01-01

    Recent genomic analysis of two bat species (Pteropus alecto and Myotis davidii) revealed the absence of the PYHIN gene family. This family is recognized as important immune sensors of intracellular self and foreign DNA and activators of the inflammasome and/or interferon pathways. Further assessment of a wider range of bat genomes was necessary to determine if this is a universal pattern for this large mammalian group. Here we expanded genomic analysis of this gene family to include ten bat species. We confirmed the complete loss of this gene family, with only a truncated AIM2 remaining in one species (Pteronotus parnellii). Divergence of the PYHIN gene loci between the bat lineages infers different loss-of-function histories during bat evolution. While all other major groups of placental mammals have at least one gene member, only bats have lost the entire family. This removal of inflammasome DNA sensors may indicate an important adaptation that is flight-induced and related, at least in part, to pathogen-host co-existence. PMID:26906452

  14. Sequence variants in four genes underlying Bardet-Biedl syndrome in consanguineous families

    PubMed Central

    Ullah, Asmat; Umair, Muhammad; Yousaf, Maryam; Khan, Sher Alam; Nazim-ud-din, Muhammad; Shah, Khadim; Ahmad, Farooq; Azeem, Zahid; Ali, Ghazanfar; Alhaddad, Bader; Rafique, Afzal; Jan, Abid; Haack, Tobias B.; Strom, Tim M.; Meitinger, Thomas; Ghous, Tahseen

    2017-01-01

    Purpose To investigate the molecular basis of Bardet-Biedl syndrome (BBS) in five consanguineous families of Pakistani origin. Methods Linkage in two families (A and B) was established to BBS7 on chromosome 4q27, in family C to BBS8 on chromosome 14q32.1, and in family D to BBS10 on chromosome 12q21.2. Family E was investigated directly with exome sequence analysis. Results Sanger sequencing revealed two novel mutations and three previously reported mutations in the BBS genes. These mutations include two deletions (c.580_582delGCA, c.1592_1597delTTCCAG) in the BBS7 gene, a missense mutation (p.Gln449His) in the BBS8 gene, a frameshift mutation (c.271_272insT) in the BBS10 gene, and a nonsense mutation (p.Ser40*) in the MKKS (BBS6) gene. Conclusions Two novel mutations and three previously reported variants, identified in the present study, further extend the body of evidence implicating BBS6, BBS7, BBS8, and BBS10 in causing BBS. PMID:28761321

  15. Cross-species gene-family fluctuations reveal the dynamics of horizontal transfers.

    PubMed

    Grilli, Jacopo; Romano, Mariacristina; Bassetti, Federico; Cosentino Lagomarsino, Marco

    2014-06-01

    Prokaryotes vary their protein repertoire mainly through horizontal transfer and gene loss. To elucidate the links between these processes and the cross-species gene-family statistics, we perform a large-scale data analysis of the cross-species variability of gene-family abundance (the number of members of the family found on a given genome). We find that abundance fluctuations are related to the rate of horizontal transfers. This is rationalized by a minimal theoretical model, which predicts this link. The families that are not captured by the model show abundance profiles that are markedly peaked around a mean value, possibly because of specific abundance selection. Based on these results, we define an abundance variability index that captures a family's evolutionary behavior (and thus some of its relevant functional properties) purely based on its cross-species abundance fluctuations. Analysis and model, combined, show a quantitative link between cross-species family abundance statistics and horizontal transfer dynamics, which can be used to analyze genome 'flux'. Groups of families with different values of the abundance variability index correspond to genome sub-parts having different plasticity in terms of the level of horizontal exchange allowed by natural selection. © The Author(s) 2014. Published by Oxford University Press on behalf of Nucleic Acids Research.

  16. Cross-species gene-family fluctuations reveal the dynamics of horizontal transfers

    PubMed Central

    Grilli, Jacopo; Romano, Mariacristina; Bassetti, Federico; Cosentino Lagomarsino, Marco

    2014-01-01

    Prokaryotes vary their protein repertoire mainly through horizontal transfer and gene loss. To elucidate the links between these processes and the cross-species gene-family statistics, we perform a large-scale data analysis of the cross-species variability of gene-family abundance (the number of members of the family found on a given genome). We find that abundance fluctuations are related to the rate of horizontal transfers. This is rationalized by a minimal theoretical model, which predicts this link. The families that are not captured by the model show abundance profiles that are markedly peaked around a mean value, possibly because of specific abundance selection. Based on these results, we define an abundance variability index that captures a family's evolutionary behavior (and thus some of its relevant functional properties) purely based on its cross-species abundance fluctuations. Analysis and model, combined, show a quantitative link between cross-species family abundance statistics and horizontal transfer dynamics, which can be used to analyze genome ‘flux’. Groups of families with different values of the abundance variability index correspond to genome sub-parts having different plasticity in terms of the level of horizontal exchange allowed by natural selection. PMID:24829449

  17. A family of Turandot-related genes in the humoral stress response of Drosophila.

    PubMed

    Ekengren, S; Hultmark, D

    2001-06-22

    The Drosophila Turandot A (TotA) gene was recently shown to encode a stress-induced humoral factor which gives increased resistance to the lethal effects of high temperature. Here we show that TotA belongs to a family of eight Tot genes distributed at three different sites in the Drosophila genome. All Tot genes are induced under stressful conditions such as bacterial infection, heat shock, paraquat feeding or exposure to ultraviolet light, suggesting that all members of this family play a role in Drosophila stress tolerance. The induction of the Tot genes differs in important respects from the heat shock response, such as the strong but delayed response to bacterial infection seen for several of the genes.

  18. The Origins and Evolution of the p53 Family of Genes

    PubMed Central

    Belyi, Vladimir A.; Ak, Prashanth; Markert, Elke; Wang, Haijian; Hu, Wenwei; Puzio-Kuter, Anna; Levine, Arnold J.

    2010-01-01

    A common ancestor to the three p53 family members of human genes p53, p63, and p73 is first detected in the evolution of modern‐day sea anemones, in which both structurally and functionally it acts to protect the germ line from genomic instabilities in response to stresses. This p63/p73 common ancestor gene is found in almost all invertebrates and first duplicates to produce a p53 gene and a p63/p73 ancestor in cartilaginous fish. Bony fish contain all three genes, p53, p63, and p73, and the functions of these three transcription factors diversify in the higher vertebrates. Thus, this gene family has preserved its structural features and functional activities for over one billion years of evolution. PMID:20516129

  19. Sessile snails, dynamic genomes: gene rearrangements within the mitochondrial genome of a family of caenogastropod molluscs.

    PubMed

    Rawlings, Timothy A; MacInnis, Martin J; Bieler, Rüdiger; Boore, Jeffrey L; Collins, Timothy M

    2010-07-19

    Widespread sampling of vertebrates, which comprise the majority of published animal mitochondrial genomes, has led to the view that mitochondrial gene rearrangements are relatively rare, and that gene orders are typically stable across major taxonomic groups. In contrast, more limited sampling within the Phylum Mollusca has revealed an unusually high number of gene order arrangements. Here we provide evidence that the lability of the molluscan mitochondrial genome extends to the family level by describing extensive gene order changes that have occurred within the Vermetidae, a family of sessile marine gastropods that radiated from a basal caenogastropod stock during the Cenozoic Era. Major mitochondrial gene rearrangements have occurred within this family at a scale unexpected for such an evolutionarily young group and unprecedented for any caenogastropod examined to date. We determined the complete mitochondrial genomes of four species (Dendropoma maximum, D. gregarium, Eualetes tulipa, and Thylacodes squamigerus) and the partial mitochondrial genomes of two others (Vermetus erectus and Thylaeodus sp.). Each of the six vermetid gastropods assayed possessed a unique gene order. In addition to the typical mitochondrial genome complement of 37 genes, additional tRNA genes were evident in D. gregarium (trnK) and Thylacodes squamigerus (trnV, trnLUUR). Three pseudogenes and additional tRNAs found within the genome of Thylacodes squamigerus provide evidence of a past duplication event in this taxon. Likewise, high sequence similarities between isoaccepting leucine tRNAs in Thylacodes, Eualetes, and Thylaeodus suggest that tRNA remolding has been rife within this family. While vermetids exhibit gene arrangements diagnostic of this family, they also share arrangements with littorinimorph caenogastropods, with which they have been linked based on sperm morphology and primary sequence-based phylogenies. We have uncovered major changes in gene order within a family of

  20. Identification and characterization of the SET domain gene family in maize.

    PubMed

    Qian, Yexiong; Xi, Yilong; Cheng, Beijiu; Zhu, Suwen; Kan, Xianzhao

    2014-03-01

    Histone lysine methylation plays a pivotal role in a variety of developmental and physiological processes through modifying chromatin structure and thereby regulating eukaryotic gene transcription. The SET domain proteins represent putative candidates for lysine methyltransferases containing the evolutionarily-conserved SET domain, and important epigenetic regulators present in eukaryotes. In recent years, increasing evidence reveals that SET domain proteins are encoded by a large multigene family in plants and investigation of the SET domain gene family will serve to elucidate the epigenetic mechanism diversity in plants. Although the SET domain gene family has been thoroughly characterized in multiple plant species including two model plant systems, Arabidopsis and rice, through their sequenced genomes, analysis of the entire SET domain gene family in maize was not completed following maize (B73) genome sequencing project. Here, we performed a genome-wide structural and evolutionary analysis of maize SET domain genes from the latest version of the maize (B73) genome. A complete set of 43 SET domain genes (Zmset1-43) were identified in the maize genome using Blast search tools and categorized into seven classes (Class I-VII) based on phylogeny. Chromosomal location of these genes revealed that they are unevenly distributed on all ten chromosomes with seven segmental duplication events, suggesting that segmental duplication played a key role in expansion of the maize SET domain gene family. EST expression data mining revealed that these newly identified genes had temporal and spatial expression pattern and suggested that many maize SET domain genes play functional developmental roles in multiple tissues. Furthermore, the transcripts of the 18 genes (the Class V subfamily) were detected in the leaves by two different abiotic stress treatments using semi-quantitative RT-PCR. The data demonstrated that these genes exhibited different expression levels in stress

  1. Sessile snails, dynamic genomes: gene rearrangements within the mitochondrial genome of a family of caenogastropod molluscs

    PubMed Central

    2010-01-01

    Background Widespread sampling of vertebrates, which comprise the majority of published animal mitochondrial genomes, has led to the view that mitochondrial gene rearrangements are relatively rare, and that gene orders are typically stable across major taxonomic groups. In contrast, more limited sampling within the Phylum Mollusca has revealed an unusually high number of gene order arrangements. Here we provide evidence that the lability of the molluscan mitochondrial genome extends to the family level by describing extensive gene order changes that have occurred within the Vermetidae, a family of sessile marine gastropods that radiated from a basal caenogastropod stock during the Cenozoic Era. Results Major mitochondrial gene rearrangements have occurred within this family at a scale unexpected for such an evolutionarily young group and unprecedented for any caenogastropod examined to date. We determined the complete mitochondrial genomes of four species (Dendropoma maximum, D. gregarium, Eualetes tulipa, and Thylacodes squamigerus) and the partial mitochondrial genomes of two others (Vermetus erectus and Thylaeodus sp.). Each of the six vermetid gastropods assayed possessed a unique gene order. In addition to the typical mitochondrial genome complement of 37 genes, additional tRNA genes were evident in D. gregarium (trnK) and Thylacodes squamigerus (trnV, trnLUUR). Three pseudogenes and additional tRNAs found within the genome of Thylacodes squamigerus provide evidence of a past duplication event in this taxon. Likewise, high sequence similarities between isoaccepting leucine tRNAs in Thylacodes, Eualetes, and Thylaeodus suggest that tRNA remolding has been rife within this family. While vermetids exhibit gene arrangements diagnostic of this family, they also share arrangements with littorinimorph caenogastropods, with which they have been linked based on sperm morphology and primary sequence-based phylogenies. Conclusions We have uncovered major changes in gene

  2. Multispecies Analysis of Expression Pattern Diversification in the Recently Expanded Insect Ly6 Gene Family

    PubMed Central

    Tanaka, Kohtaro; Hazbun, Alexis; Hijazi, Assia; Vreede, Barbara; Sucena, Élio

    2015-01-01

    Gene families often consist of members with diverse expression domains reflecting their functions in a wide variety of tissues. However, how the expression of individual members, and thus their tissue-specific functions, diversified during the course of gene family expansion is not well understood. In this study, we approached this question through the analysis of the duplication history and transcriptional evolution of a rapidly expanding subfamily of insect Ly6 genes. We analyzed different insect genomes and identified seven Ly6 genes that have originated from a single ancestor through sequential duplication within the higher Diptera. We then determined how the original embryonic expression pattern of the founding gene diversified by characterizing its tissue-specific expression in the beetle Tribolium castaneum, the butterfly Bicyclus anynana, and the mosquito Anopheles stephensi and those of its duplicates in three higher dipteran species, representing various stages of the duplication history (Megaselia abdita, Ceratitis capitata, and Drosophila melanogaster). Our results revealed that frequent neofunctionalization episodes contributed to the increased expression breadth of this subfamily and that these events occurred after duplication and speciation events at comparable frequencies. In addition, at each duplication node, we consistently found asymmetric expression divergence. One paralog inherited most of the tissue-specificities of the founder gene, whereas the other paralog evolved drastically reduced expression domains. Our approach attests to the power of combining a well-established duplication history with a comprehensive coverage of representative species in acquiring unequivocal information about the dynamics of gene expression evolution in gene families. PMID:25743545

  3. Recombination between diverged clusters of the tomato Cf-9 plant disease resistance gene family

    PubMed Central

    Parniske, Martin; Jones, Jonathan D. G.

    1999-01-01

    The tomato Cf-4 and Cf-9 genes are the founder members of a large gene family of homologues of Cladosporium fulvum resistance gene Cf-9 (Hcr9 genes), several of which confer resistance against C. fulvum through recognition of different pathogen-encoded avirulence determinants. Three loci of tandemly repeated Hcr9 genes—Southern Cross (SC), Milky Way (MW), and Northern Lights (NL)—are located on the short arm of tomato chromosome 1. Comparisons between 2 SC-Hcr9s, 11 from MW, and 5 from NL implicated sequence exchange between gene family members in their evolution. The extent to which novel variants can be generated by recombination depends on the degree of sequence polymorphism available within the gene family. Here we show that physical separation of Hcr9 genes can be associated with elevated sequence divergence. Two diverged subclasses of Hcr9s could be defined. These are physically separated from each other, with members of one class exclusively residing at Northern Lights. One exceptional Hcr9 at Northern Lights carried sequence features specific for Hcr9s at other loci, suggesting a recent transfer of this gene by an interlocus recombination event. As members of diverged subclasses are brought into physical vicinity within a tandem repeat, a larger spectrum of sequence variants can potentially be generated by subsequent interhomologue sequence exchange. PMID:10318973

  4. Real-Time Evolution of a Subtelomeric Gene Family in Candida albicans

    PubMed Central

    Anderson, Matthew Z.; Wigen, Lauren J.; Burrack, Laura S.; Berman, Judith

    2015-01-01

    Subtelomeric regions of the genome are notable for high rates of sequence evolution and rapid gene turnover. Evidence of subtelomeric evolution has relied heavily on comparisons of historical evolutionary patterns to infer trends and frequencies of these events. Here, we describe evolution of the subtelomeric TLO gene family in Candida albicans during laboratory passaging for over 4000 generations. C. albicans is a commensal and opportunistic pathogen of humans and the TLO gene family encodes a subunit of the Mediator complex that regulates transcription and affects a range of virulence factors. We identified 16 distinct subtelomeric recombination events that altered the TLO repertoire. Ectopic recombination between subtelomeres on different chromosome ends occurred approximately once per 5000 generations and was often followed by loss of heterozygosity, resulting in the complete loss of one TLO gene sequence with expansion of another. In one case, recombination within TLO genes produced a novel TLO gene sequence. TLO copy number changes were biased, with some TLOs preferentially being copied to novel chromosome arms and other TLO genes being frequently lost. The majority of these nonreciprocal recombination events occurred either within the 3′ end of the TLO coding sequence or within a conserved 50-bp sequence element centromere-proximal to TLO coding sequence. Thus, subtelomeric recombination is a rapid mechanism of generating genotypic diversity through alterations in the number and sequence of related gene family members. PMID:25956943

  5. Genome-wide evolutionary characterization and expression analyses of WRKY family genes in Brachypodium distachyon.

    PubMed

    Wen, Feng; Zhu, Hong; Li, Peng; Jiang, Min; Mao, Wenqing; Ong, Chermaine; Chu, Zhaoqing

    2014-06-01

    Members of plant WRKY gene family are ancient transcription factors that function in plant growth and development and respond to biotic and abiotic stresses. In our present study, we have investigated WRKY family genes in Brachypodium distachyon, a new model plant of family Poaceae. We identified a total of 86 WRKY genes from B. distachyon and explored their chromosomal distribution and evolution, domain alignment, promoter cis-elements, and expression profiles. Combining the analysis of phylogenetic tree of BdWRKY genes and the result of expression profiling, results showed that most of clustered gene pairs had higher similarities in the WRKY domain, suggesting that they might be functionally redundant. Neighbour-joining analysis of 301 WRKY domains from Oryza sativa, Arabidopsis thaliana, and B. distachyon suggested that BdWRKY domains are evolutionarily more closely related to O. sativa WRKY domains than those of A. thaliana. Moreover, tissue-specific expression profile of BdWRKY genes and their responses to phytohormones and several biotic or abiotic stresses were analysed by quantitative real-time PCR. The results showed that the expression of BdWRKY genes was rapidly regulated by stresses and phytohormones, and there was a strong correlation between promoter cis-elements and the phytohormones-induced BdWRKY gene expression.

  6. Dichotomy in the NRT Gene Families of Dicots and Grass Species

    PubMed Central

    Plett, Darren; Toubia, John; Garnett, Trevor; Tester, Mark; Kaiser, Brent N.; Baumann, Ute

    2010-01-01

    A large proportion of the nitrate (NO3−) acquired by plants from soil is actively transported via members of the NRT families of NO3− transporters. In Arabidopsis, the NRT1 family has eight functionally characterised members and predominantly comprises low-affinity transporters; the NRT2 family contains seven members which appear to be high-affinity transporters; and there are two NRT3 (NAR2) family members which are known to participate in high-affinity transport. A modified reciprocal best hit (RBH) approach was used to identify putative orthologues of the Arabidopsis NRT genes in the four fully sequenced grass genomes (maize, rice, sorghum, Brachypodium). We also included the poplar genome in our analysis to establish whether differences between Arabidopsis and the grasses may be generally applicable to monocots and dicots. Our analysis reveals fundamental differences between Arabidopsis and the grass species in the gene number and family structure of all three families of NRT transporters. All grass species possessed additional NRT1.1 orthologues and appear to lack NRT1.6/NRT1.7 orthologues. There is significant separation in the NRT2 phylogenetic tree between NRT2 genes from dicots and grass species. This indicates that determination of function of NRT2 genes in grass species will not be possible in cereals based simply on sequence homology to functionally characterised Arabidopsis NRT2 genes and that proper functional analysis will be required. Arabidopsis has a unique NRT3.2 gene which may be a fusion of the NRT3.1 and NRT3.2 genes present in all other species examined here. This work provides a framework for future analysis of NO3− transporters and NO3− transport in grass crop species. PMID:21151904

  7. Genome-Wide Analysis of the Aquaporin Gene Family in Chickpea (Cicer arietinum L.).

    PubMed

    Deokar, Amit A; Tar'an, Bunyamin

    2016-01-01

    Aquaporins (AQPs) are essential membrane proteins that play critical role in the transport of water and many other solutes across cell membranes. In this study, a comprehensive genome-wide analysis identified 40 AQP genes in chickpea (Cicer arietinum L.). A complete overview of the chickpea AQP (CaAQP) gene family is presented, including their chromosomal locations, gene structure, phylogeny, gene duplication, conserved functional motifs, gene expression, and conserved promoter motifs. To understand AQP's evolution, a comparative analysis of chickpea AQPs with AQP orthologs from soybean, Medicago, common bean, and Arabidopsis was performed. The chickpea AQP genes were found on all of the chickpea chromosomes, except chromosome 7, with a maximum of six genes on chromosome 6, and a minimum of one gene on chromosome 5. Gene duplication analysis indicated that the expansion of chickpea AQP gene family might have been due to segmental and tandem duplications. CaAQPs were grouped into four subfamilies including 15 NOD26-like intrinsic proteins (NIPs), 13 tonoplast intrinsic proteins (TIPs), eight plasma membrane intrinsic proteins (PIPs), and four small basic intrinsic proteins (SIPs) based on sequence similarities and phylogenetic position. Gene structure analysis revealed a highly conserved exon-intron pattern within CaAQP subfamilies supporting the CaAQP family classification. Functional prediction based on conserved Ar/R selectivity filters, Froger's residues, and specificity-determining positions suggested wide differences in substrate specificity among the subfamilies of CaAQPs. Expression analysis of the AQP genes indicated that some of the genes are tissue-specific, whereas few other AQP genes showed differential expression in response to biotic and abiotic stresses. Promoter profiling of CaAQP genes for conserved cis-acting regulatory elements revealed enrichment of cis-elements involved in circadian control, light response, defense and stress responsiveness

  8. Genome-Wide Analysis of the Aquaporin Gene Family in Chickpea (Cicer arietinum L.)

    PubMed Central

    Deokar, Amit A.; Tar'an, Bunyamin

    2016-01-01

    Aquaporins (AQPs) are essential membrane proteins that play critical role in the transport of water and many other solutes across cell membranes. In this study, a comprehensive genome-wide analysis identified 40 AQP genes in chickpea (Cicer arietinum L.). A complete overview of the chickpea AQP (CaAQP) gene family is presented, including their chromosomal locations, gene structure, phylogeny, gene duplication, conserved functional motifs, gene expression, and conserved promoter motifs. To understand AQP's evolution, a comparative analysis of chickpea AQPs with AQP orthologs from soybean, Medicago, common bean, and Arabidopsis was performed. The chickpea AQP genes were found on all of the chickpea chromosomes, except chromosome 7, with a maximum of six genes on chromosome 6, and a minimum of one gene on chromosome 5. Gene duplication analysis indicated that the expansion of chickpea AQP gene family might have been due to segmental and tandem duplications. CaAQPs were grouped into four subfamilies including 15 NOD26-like intrinsic proteins (NIPs), 13 tonoplast intrinsic proteins (TIPs), eight plasma membrane intrinsic proteins (PIPs), and four small basic intrinsic proteins (SIPs) based on sequence similarities and phylogenetic position. Gene structure analysis revealed a highly conserved exon-intron pattern within CaAQP subfamilies supporting the CaAQP family classification. Functional prediction based on conserved Ar/R selectivity filters, Froger's residues, and specificity-determining positions suggested wide differences in substrate specificity among the subfamilies of CaAQPs. Expression analysis of the AQP genes indicated that some of the genes are tissue-specific, whereas few other AQP genes showed differential expression in response to biotic and abiotic stresses. Promoter profiling of CaAQP genes for conserved cis-acting regulatory elements revealed enrichment of cis-elements involved in circadian control, light response, defense and stress responsiveness

  9. Characterization of resistance gene analogues (RGAs) in Apple (Malus 6domestica Borkh.) and their evolutionary history of the Rosaceae family

    USDA-ARS?s Scientific Manuscript database

    The family of resistance gene analogues (RGAs) with a nucleotide-binding site (NBS) domain accounts for the largest number of disease resistance genes and is one of the largest gene families in plants. We have identified 868 RGAs in the genome of the apple (Malus × domestica Borkh.) cultivar ‘Golden...

  10. Expression and phylogenetic analysis of the zic gene family in the evolution and development of metazoans

    PubMed Central

    2010-01-01

    Background zic genes are members of the gli/glis/nkl/zic super-family of C2H2 zinc finger (ZF) transcription factors. Homologs of the zic family have been implicated in patterning neural and mesodermal tissues in bilaterians. Prior to this study, the origin of the metazoan zic gene family was unknown and expression of zic gene homologs during the development of early branching metazoans had not been investigated. Results Phylogenetic analyses of novel zic candidate genes identified a definitive zic homolog in the placozoan Trichoplax adhaerens, two gli/glis/nkl-like genes in the ctenophore Mnemiopsis leidyi, confirmed the presence of three gli/glis/nkl-like genes in Porifera, and confirmed the five previously identified zic genes in the cnidarian Nematostella vectensis. In the cnidarian N. vectensis, zic homologs are expressed in ectoderm and the gastrodermis (a bifunctional endomesoderm), in presumptive and developing tentacles, and in oral and sensory apical tuft ectoderm. The Capitella teleta zic homolog (Ct-zic) is detectable in a subset of the developing nervous system, the foregut, and the mesoderm associated with the segmentally repeated chaetae. Lastly, expression of gli and glis homologs in Mnemiopsis. leidyi is detected exclusively in neural cells in floor of the apical organ. Conclusions Based on our analyses, we propose that the zic gene family arose in the common ancestor of the Placozoa, Cnidaria and Bilateria from a gli/glis/nkl-like gene and that both ZOC and ZF-NC domains evolved prior to cnidarian-bilaterian divergence. We also conclude that zic expression in neural ectoderm and developing neurons is pervasive throughout the Metazoa and likely evolved from neural expression of an ancestral gli/glis/nkl/zic gene. zic expression in bilaterian mesoderm may be related to the expression in the gastrodermis of a cnidarian-bilaterian common ancestor. PMID:21054859

  11. Expression and phylogenetic analysis of the zic gene family in the evolution and development of metazoans.

    PubMed

    Layden, Michael J; Meyer, Néva P; Pang, Kevin; Seaver, Elaine C; Martindale, Mark Q

    2010-11-05

    zic genes are members of the gli/glis/nkl/zic super-family of C2H2 zinc finger (ZF) transcription factors. Homologs of the zic family have been implicated in patterning neural and mesodermal tissues in bilaterians. Prior to this study, the origin of the metazoan zic gene family was unknown and expression of zic gene homologs during the development of early branching metazoans had not been investigated. Phylogenetic analyses of novel zic candidate genes identified a definitive zic homolog in the placozoan Trichoplax adhaerens, two gli/glis/nkl-like genes in the ctenophore Mnemiopsis leidyi, confirmed the presence of three gli/glis/nkl-like genes in Porifera, and confirmed the five previously identified zic genes in the cnidarian Nematostella vectensis. In the cnidarian N. vectensis, zic homologs are expressed in ectoderm and the gastrodermis (a bifunctional endomesoderm), in presumptive and developing tentacles, and in oral and sensory apical tuft ectoderm. The Capitella teleta zic homolog (Ct-zic) is detectable in a subset of the developing nervous system, the foregut, and the mesoderm associated with the segmentally repeated chaetae. Lastly, expression of gli and glis homologs in Mnemiopsis. leidyi is detected exclusively in neural cells in floor of the apical organ. Based on our analyses, we propose that the zic gene family arose in the common ancestor of the Placozoa, Cnidaria and Bilateria from a gli/glis/nkl-like gene and that both ZOC and ZF-NC domains evolved prior to cnidarian-bilaterian divergence. We also conclude that zic expression in neural ectoderm and developing neurons is pervasive throughout the Metazoa and likely evolved from neural expression of an ancestral gli/glis/nkl/zic gene. zic expression in bilaterian mesoderm may be related to the expression in the gastrodermis of a cnidarian-bilaterian common ancestor.

  12. A novel mutation of the apolipoprotein A-I gene in a family with familial combined hyperlipidemia.

    PubMed

    Pisciotta, Livia; Fasano, Tommaso; Calabresi, Laura; Bellocchio, Antonella; Fresa, Raffaele; Borrini, Claudia; Calandra, Sebastiano; Bertolini, Stefano

    2008-05-01

    We report a large family in which four members showed a plasma lipid profile consistent with the clinical diagnosis of familial combined hyperlipidemia (FCHL). One of these patients was found to have markedly reduced HDL cholesterol (HDL-C) (0.72 mmol/l) and Apo A-I (72 mg/dl) levels, a condition suggestive of the presence of a mutation in one of the HDL-related genes. The analysis of APOA1 gene revealed that this patient was heterozygous for a cytosine insertion in exon 3 (c.49-50 ins C), resulting in a frame-shift and premature stop codon at position 26 of pro-Apo A-I (Q17PFsX10). This novel mutation, which prevents the synthesis of Apo A-I, was also found in four family members, including three siblings and the daughter of the proband. Carriers of Apo A-I mutation had significantly lower HDL-C and Apo A-I than non-carriers family members (0.77+/-0.15 mmol/l vs. 1.15+/-0.20 mmol/l, P<0.005; 71.4+/-9.1mg/dl vs. 134.0+/-14.7 mg/dl, P<0.005, respectively). Two of the APOA1 mutation carriers, who were also heavy smokers, had fibrous plaques in the carotid arteries causing mild stenosis (20%). The intimal-media thickness in the two other adult carriers was within the normal range. The other non-carriers family members with FCHL had either overt vascular disease or carotid atherosclerosis at ultrasound examination. This observation suggests that the low HDL-C/low Apo A-I phenotype may result from a genetic defect directly affecting HDL metabolism, even in the context of a dyslipidemia which, like FCHL, is associated with low plasma HDL-C.

  13. Genome-wide analysis of the WRKY gene family in physic nut (Jatropha curcas L.).

    PubMed

    Xiong, Wangdan; Xu, Xueqin; Zhang, Lin; Wu, Pingzhi; Chen, Yaping; Li, Meiru; Jiang, Huawu; Wu, Guojiang

    2013-07-25

    The WRKY proteins, which contain highly conserved WRKYGQK amino acid sequences and zinc-finger-like motifs, constitute a large family of transcription factors in plants. They participate in diverse physiological and developmental processes. WRKY genes have been identified and characterized in a number of plant species. We identified a total of 58 WRKY genes (JcWRKY) in the genome of the physic nut (Jatropha curcas L.). On the basis of their conserved WRKY domain sequences, all of the JcWRKY proteins could be assigned to one of the previously defined groups, I-III. Phylogenetic analysis of JcWRKY genes with Arabidopsis and rice WRKY genes, and separately with castor bean WRKY genes, revealed no evidence of recent gene duplication in JcWRKY gene family. Analysis of transcript abundance of JcWRKY gene products were tested in different tissues under normal growth condition. In addition, 47 WRKY genes responded to at least one abiotic stress (drought, salinity, phosphate starvation and nitrogen starvation) in individual tissues (leaf, root and/or shoot cortex). Our study provides a useful reference data set as the basis for cloning and functional analysis of physic nut WRKY genes.

  14. Genome-wide investigation and transcriptome analysis of the WRKY gene family in Gossypium.

    PubMed

    Ding, Mingquan; Chen, Jiadong; Jiang, Yurong; Lin, Lifeng; Cao, YueFen; Wang, Minhua; Zhang, Yuting; Rong, Junkang; Ye, Wuwei

    2015-02-01

    WRKY transcription factors play important roles in various stress responses in diverse plant species. In cotton, this family has not been well studied, especially in relation to fiber development. Here, the genomes and transcriptomes of Gossypium raimondii and Gossypium arboreum were investigated to identify fiber development related WRKY genes. This represents the first comprehensive comparative study of WRKY transcription factors in both diploid A and D cotton species. In total, 112 G. raimondii and 109 G. arboreum WRKY genes were identified. No significant gene structure or domain alterations were detected between the two species, but many SNPs distributed unequally in exon and intron regions. Physical mapping revealed that the WRKY genes in G. arboreum were not located in the corresponding chromosomes of G. raimondii, suggesting great chromosome rearrangement in the diploid cotton genomes. The cotton WRKY genes, especially subgroups I and II, have expanded through multiple whole genome duplications and tandem duplications compared with other plant species. Sequence comparison showed many functionally divergent sites between WRKY subgroups, while the genes within each group are under strong purifying selection. Transcriptome analysis suggested that many WRKY genes participate in specific fiber development processes such as fiber initiation, elongation and maturation with different expression patterns between species. Complex WRKY gene expression such as differential Dt and At allelic gene expression in G. hirsutum and alternative splicing events were also observed in both diploid and tetraploid cottons during fiber development process. In conclusion, this study provides important information on the evolution and function of WRKY gene family in cotton species.

  15. Challenges and solutions for gene identification in the presence of familial locus heterogeneity

    PubMed Central

    Rehman, Atteeq U; Santos-Cortez, Regie Lyn P; Drummond, Meghan C; Shahzad, Mohsin; Lee, Kwanghyuk; Morell, Robert J; Ansar, Muhammad; Jan, Abid; Wang, Xin; Aziz, Abdul; Riazuddin, Saima; Smith, Joshua D; Wang, Gao T; Ahmed, Zubair M; Gul, Khitab; Shearer, A Eliot; Smith, Richard J H; Shendure, Jay; Bamshad, Michael J; Nickerson, Deborah A; Hinnant, John; Khan, Shaheen N; Fisher, Rachel A; Ahmad, Wasim; Friderici, Karen H; Riazuddin, Sheikh; Friedman, Thomas B; Wilch, Ellen S; Leal, Suzanne M

    2015-01-01

    Next-generation sequencing (NGS) of exomes and genomes has accelerated the identification of genes involved in Mendelian phenotypes. However, many NGS studies fall short of identifying causal variants, with estimates for success rates as low as 25% for uncovering the pathological variant underlying disease etiology. An important reason for such failures is familial locus heterogeneity, where within a single pedigree causal variants in two or more genes underlie Mendelian trait etiology. As examples of intra- and inter-sibship familial locus heterogeneity, we present 10 consanguineous Pakistani families segregating hearing impairment due to homozygous variants in two different hearing impairment genes and a European-American pedigree in which hearing impairment is caused by four variants in three different genes. We have identified 41 additional pedigrees with syndromic and nonsyndromic hearing impairment for which a single previously reported hearing impairment gene has been identified but only segregates with the phenotype in a subset of affected pedigree members. We estimate that locus heterogeneity occurs in 15.3% (95% confidence interval: 11.9%, 19.9%) of the families in our collection. We demonstrate novel approaches to apply linkage analysis and homozygosity mapping (for autosomal recessive consanguineous pedigrees), which can be used to detect locus heterogeneity using either NGS or SNP array data. Results from linkage analysis and homozygosity mapping can also be used to group sibships or individuals most likely to be segregating the same causal variants and thereby increase the success rate of gene identification. PMID:25491636

  16. Chicken genome analysis reveals novel genes encoding biotin-binding proteins related to avidin family

    PubMed Central

    Niskanen, Einari A; Hytönen, Vesa P; Grapputo, Alessandro; Nordlund, Henri R; Kulomaa, Markku S; Laitinen, Olli H

    2005-01-01

    Background A chicken egg contains several biotin-binding proteins (BBPs), whose complete DNA and amino acid sequences are not known. In order to identify and characterise these genes and proteins we studied chicken cDNAs and genes available in the NCBI database and chicken genome database using the reported N-terminal amino acid sequences of chicken egg-yolk BBPs as search strings. Results Two separate hits showing significant homology for these N-terminal sequences were discovered. For one of these hits, the chromosomal location in the immediate proximity of the avidin gene family was found. Both of these hits encode proteins having high sequence similarity with avidin suggesting that chicken BBPs are paralogous to avidin family. In particular, almost all residues corresponding to biotin binding in avidin are conserved in these putative BBP proteins. One of the found DNA sequences, however, seems to encode a carboxy-terminal extension not present in avidin. Conclusion We describe here the predicted properties of the putative BBP genes and proteins. Our present observations link BBP genes together with avidin gene family and shed more light on the genetic arrangement and variability of this family. In addition, comparative modelling revealed the potential structural elements important for the functional and structural properties of the putative BBP proteins. PMID:15777476

  17. Chicken genome analysis reveals novel genes encoding biotin-binding proteins related to avidin family.

    PubMed

    Niskanen, Einari A; Hytönen, Vesa P; Grapputo, Alessandro; Nordlund, Henri R; Kulomaa, Markku S; Laitinen, Olli H

    2005-03-18

    A chicken egg contains several biotin-binding proteins (BBPs), whose complete DNA and amino acid sequences are not known. In order to identify and characterise these genes and proteins we studied chicken cDNAs and genes available in the NCBI database and chicken genome database using the reported N-terminal amino acid sequences of chicken egg-yolk BBPs as search strings. Two separate hits showing significant homology for these N-terminal sequences were discovered. For one of these hits, the chromosomal location in the immediate proximity of the avidin gene family was found. Both of these hits encode proteins having high sequence similarity with avidin suggesting that chicken BBPs are paralogous to avidin family. In particular, almost all residues corresponding to biotin binding in avidin are conserved in these putative BBP proteins. One of the found DNA sequences, however, seems to encode a carboxy-terminal extension not present in avidin. We describe here the predicted properties of the putative BBP genes and proteins. Our present observations link BBP genes together with avidin gene family and shed more light on the genetic arrangement and variability of this family. In addition, comparative modelling revealed the potential structural elements important for the functional and structural properties of the putative BBP proteins.

  18. Distribution of mutations in the PEX gene in families with X-linked hypophosphataemic rickets (HYP).

    PubMed

    Rowe, P S; Oudet, C L; Francis, F; Sinding, C; Pannetier, S; Econs, M J; Strom, T M; Meitinger, T; Garabedian, M; David, A; Macher, M A; Questiaux, E; Popowska, E; Pronicka, E; Read, A P; Mokrzycki, A; Glorieux, F H; Drezner, M K; Hanauer, A; Lehrach, H; Goulding, J N; O'Riordan, J L

    1997-04-01

    Mutations in the PEX gene at Xp22.1 (phosphate-regulating gene with homologies to endopeptidases, on the X-chromosome), are responsible for X-linked hypophosphataemic rickets (HYP). Homology of PEX to the M13 family of Zn2+ metallopeptidases which include neprilysin (NEP) as prototype, has raised important questions regarding PEX function at the molecular level. The aim of this study was to analyse 99 HYP families for PEX gene mutations, and to correlate predicted changes in the protein structure with Zn2+ metallopeptidase gene function. Primers flanking 22 characterised exons were used to amplify DNA by PCR, and SSCP was then used to screen for mutations. Deletions, insertions, nonsense mutations, stop codons and splice mutations occurred in 83% of families screened for in all 22 exons, and 51% of a separate set of families screened in 17 PEX gene exons. Missense mutations in four regions of the gene were informative regarding function, with one mutation in the Zn2+-binding site predicted to alter substrate enzyme interaction and catalysis. Computer analysis of the remaining mutations predicted changes in secondary structure, N-glycosylation, protein phosphorylation and catalytic site molecular structure. The wide range of mutations that align with regions required for protease activity in NEP suggests that PEX also functions as a protease, and may act by processing factor(s) involved in bone mineral metabolism.

  19. Evolutionary aspects of functional and pseudogene members of the phytochrome gene family in Scots pine.

    PubMed

    García-Gil, Maria Rosario

    2008-08-01

    According to the neutral theory of evolution, mutation and genetic drift are the only forces that shape unconstrained, neutral, gene evolution. Thus, pseudogenes (which often evolve neutrally) provide opportunities to obtain direct estimates of mutation rates that are not biased by selection, and gene families comprising functional and pseudogene members provide useful material for both estimating neutral mutation rates and identifying sites that appear to be under positive or negative selection pressures. Conifers could be very useful for such analyses since they have large and complex genomes. There is evidence that pseudogenes make significant contributions to the size and complexity of gene families in pines, although few studies have examined the composition and evolution of gene families in conifers. In this work, I examine the complexity and rates of mutation of the phytochrome gene family in Pinus sylvestris and show that it includes not only functional genes but also pseudogenes. As expected, the functional PHYO does not appear to have evolved neutrally, while phytochrome pseudogenes show signs of unconstrained evolution.

  20. [PAX3 gene mutation analysis for two Waardenburg syndrome type Ⅰ families and their prenatal diagnosis].

    PubMed

    Bai, Y; Liu, N; Kong, X D; Yan, J; Qin, Z B; Wang, B

    2016-12-07

    Objective: To analyze the mutations of PAX3 gene in two Waardenburg syndrome type Ⅰ (WS1) pedigrees and make prenatal diagnosis for the high-risk 18-week-old fetus. Methods:PAX3 gene was first analyzed by Sanger sequencing and multiplex ligation-dependent probe amplification(MLPA) for detecting pathogenic mutation of the probands of the two pedigrees. The mutations were confirmed by MLPA and Sanger in parents and unrelated healthy individuals.Prenatal genetic diagnosis for the high-risk fetus was performed by amniotic fluid cell after genotyping. Results: A heterozygous PAX3 gene gross deletion (E7 deletion) was identified in all patients from WS1-01 family, and not found in 20 healthy individuals.Prenatal diagnosis in WS1-01 family indicated that the fetus was normal. Molecular studies identified a novel deletion mutation c. 1385_1386delCT within the PAX3 gene in all affected WS1-02 family members, but in none of the unaffected relatives and 200 healthy individuals. Conclusions:PAX3 gene mutation is etiological for two WS1 families. Sanger sequencing plus MLPA is effective and accurate for making gene diagnosis and prenatal diagnosis.

  1. Genome-wide identification and analysis of the MADS-box gene family in sesame.

    PubMed

    Wei, Xin; Wang, Linhai; Yu, Jingyin; Zhang, Yanxin; Li, Donghua; Zhang, Xiurong

    2015-09-10

    MADS-box genes encode transcription factors that play crucial roles in plant growth and development. Sesame (Sesamum indicum L.) is an oil crop that contributes to the daily oil and protein requirements of almost half of the world's population; therefore, a genome-wide analysis of the MADS-box gene family is needed. Fifty-seven MADS-box genes were identified from 14 linkage groups of the sesame genome. Analysis of phylogenetic relationships with Arabidopsis thaliana, Utricularia gibba and Solanum lycopersicum MADS-box genes was performed. Sesame MADS-box genes were clustered into four groups: 28 MIKC(c)-type, 5 MIKC(⁎)-type, 14 Mα-type and 10 Mγ-type. Gene structure analysis revealed from 1 to 22 exons of sesame MADS-box genes. The number of exons in type II MADS-box genes greatly exceeded the number in type I genes. Motif distribution analysis of sesame MADS-box genes also indicated that type II MADS-box genes contained more motifs than type I genes. These results suggested that type II sesame MADS-box genes had more complex structures. By analyzing expression profiles of MADS-box genes in seven sesame transcriptomes, we determined that MIKC(C)-type MADS-box genes played significant roles in sesame flower and seed development. Although most MADS-box genes in the same clade showed similar expression features, some gene functions were diversified from the orthologous Arabidopsis genes. This research will contribute to uncovering the role of MADS-box genes in sesame development.

  2. Phylogenomic analysis reveals dynamic evolutionary history of the Drosophila heterochromatin protein 1 (HP1) gene family.

    PubMed

    Levine, Mia T; McCoy, Connor; Vermaak, Danielle; Lee, Yuh Chwen G; Hiatt, Mary Alice; Matsen, Frederick A; Malik, Harmit S

    2012-01-01

    Heterochromatin is the gene-poor, satellite-rich eukaryotic genome compartment that supports many essential cellular processes. The functional diversity of proteins that bind and often epigenetically define heterochromatic DNA sequence reflects the diverse functions supported by this enigmatic genome compartment. Moreover, heterogeneous signatures of selection at chromosomal proteins often mirror the heterogeneity of evolutionary forces that act on heterochromatic DNA. To identify new such surrogates for dissecting heterochromatin function and evolution, we conducted a comprehensive phylogenomic analysis of the Heterochromatin Protein 1 gene family across 40 million years of Drosophila evolution. Our study expands this gene family from 5 genes to at least 26 genes, including several uncharacterized genes in Drosophila melanogaster. The 21 newly defined HP1s introduce unprecedented structural diversity, lineage-restriction, and germline-biased expression patterns into the HP1 family. We find little evidence of positive selection at these HP1 genes in both population genetic and molecular evolution analyses. Instead, we find that dynamic evolution occurs via prolific gene gains and losses. Despite this dynamic gene turnover, the number of HP1 genes is relatively constant across species. We propose that karyotype evolution drives at least some HP1 gene turnover. For example, the loss of the male germline-restricted HP1E in the obscura group coincides with one episode of dramatic karyotypic evolution, including the gain of a neo-Y in this lineage. This expanded compendium of ovary- and testis-restricted HP1 genes revealed by our study, together with correlated gain/loss dynamics and chromosome fission/fusion events, will guide functional analyses of novel roles supported by germline chromatin.

  3. Familial congenital bilateral vocal fold paralysis: a novel gene translocation.

    PubMed

    Hsu, Amy K; Rosow, David E; Wallerstein, Robert J; April, Max M

    2015-03-01

    True vocal fold (TVF) paralysis is a common cause of neonatal stridor and airway obstruction, though bilateral TVF paralysis is seen less frequently. Rare cases of familial congenital TVF paralysis have been described with implied genetic origin, but few genetic abnormalities have been discovered to date. The purpose of this study is to describe a novel chromosomal translocation responsible for congenital bilateral TVF immobility. The charts of three patients were retrospectively reviewed: a 35 year-old woman and her two children. The mother had bilateral TVF paralysis at birth requiring tracheotomy. Her oldest child had a similar presentation at birth and also required tracheotomy, while the younger child had laryngomalacia without TVF paralysis. Standard karyotype analysis was done using samples from all three patients and the parents of the mother, to assess whether a chromosomal abnormality was responsible. Karyotype analysis revealed the same balanced translocation between chromosomes 5 and 14, t(5;14) (p15.3, q11.2) in the mother and her two daughters. No other genetic abnormalities were identified. Neither maternal grandparent had the translocation, which appeared to be a spontaneous mutation in the mother with autosomal dominant inheritance and variable penetrance. A novel chromosomal translocation was identified that appears to be responsible for familial congenital bilateral TVF paralysis. While there are other reports of genetic abnormalities responsible for this condition, we believe this is the first describing this particular translocation. Copyright © 2014 Elsevier Ireland Ltd. All rights reserved.

  4. Analysis of factor VIII gene inversions in 164 unrelated hemophilia A families

    SciTech Connect

    Vnencak-Jones, L.; Phillips, J.A. III; Janco, R.L.

    1994-09-01

    Hemophilia A is an X-linked recessive disease with variable phenotype and both heterogeneous and wide spread mutations in the factor VIII (F8) gene. As a result, diagnostic carrier or prenatal testing often relies upon laborious DNA linkage analysis. Recently, inversion mutations resulting from an intrachromosomal recombination between DNA sequences in one of two A genes {approximately}500 kb upstream from the F8 gene and a homologous A gene in intron 22 of the F8 gene were identified and found in 45% of severe hemophiliacs. We have analyzed banked DNA collected since 1986 from affected males or obligate carrier females representing 164 unrelated hemophilia A families. The disease was sporadic in 37%, familial in 54% and in 10% of families incomplete information was given. A unique deletion was identified in 1/164, a normal pattern was observed in 110/164 (67%), and 53/164 (32%) families had inversion mutations with 43/53 (81%) involving the distal A gene (R3 pattern) and 10/53 (19%) involving the proximal A gene (R2 pattern). While 19% of all rearrangements were R2, in 35 families with severe disease (< 1% VIII:C activity) all 16 rearrangements seen were R3. In 18 families with the R3 pattern and known activities, 16 (89%) had levels < 1%, with the remaining 2 families having {le} 2.4% activity. Further, 18 referrals specifically noted the production of inhibitors and 8/18 (45%) had the R3 pattern. Our findings demonstrate that the R3 inversion mutation patterns is (1) only seen with VIII:C activity levels of {le} 2.4%, (2) seen in 46% of families with severe hemophilia, (3) seen in 45% of hemophiliacs known to have inhibitors, (4) not correlated with sporadic or familial disease and (5) not in disequilibrium with the Bcl I or Taq I intron 18 or ST14 polymorphisms. Finally, in families positive for an inversion mutation, direct testing offers a highly accurate and less expensive alternative to DNA linkage analysis.

  5. Genome-Wide Analysis of the NADK Gene Family in Plants

    PubMed Central

    Li, Wen-Yan; Wang, Xiang; Li, Ri; Li, Wen-Qiang; Chen, Kun-Ming

    2014-01-01

    Background NAD(H) kinase (NADK) is the key enzyme that catalyzes de novo synthesis of NADP(H) from NAD(H) for NADP(H)-based metabolic pathways. In plants, NADKs form functional subfamilies. Studies of these families in Arabidopsis thaliana indicate that they have undergone considerable evolutionary selection; however, the detailed evolutionary history and functions of the various NADKs in plants are not clearly understood. Principal Findings We performed a comparative genomic analysis that identified 74 NADK gene homologs from 24 species representing the eight major plant lineages within the supergroup Plantae: glaucophytes, rhodophytes, chlorophytes, bryophytes, lycophytes, gymnosperms, monocots and eudicots. Phylogenetic and structural analysis classified these NADK genes into four well-conserved subfamilies with considerable variety in the domain organization and gene structure among subfamily members. In addition to the typical NAD_kinase domain, additional domains, such as adenylate kinase, dual-specificity phosphatase, and protein tyrosine phosphatase catalytic domains, were found in subfamily II. Interestingly, NADKs in subfamily III exhibited low sequence similarity (∼30%) in the kinase domain within the subfamily and with the other subfamilies. These observations suggest that gene fusion and exon shuffling may have occurred after gene duplication, leading to specific domain organization seen in subfamilies II and III, respectively. Further analysis of the exon/intron structures showed that single intron loss and gain had occurred, yielding the diversified gene structures, during the process of structural evolution of NADK family genes. Finally, both available global microarray data analysis and qRT-RCR experiments revealed that the NADK genes in Arabidopsis and Oryza sativa show different expression patterns in different developmental stages and under several different abiotic/biotic stresses and hormone treatments, underscoring the functional diversity

  6. OAS Gene Family Expression Is Associated with HIV-Related Neurocognitive Disorders.

    PubMed

    Sanfilippo, C; Pinzone, M R; Cambria, D; Longo, A; Palumbo, M; Di Marco, R; Condorelli, F; Nunnari, G; Malaguarnera, L; Di Rosa, M

    2017-02-24

    HIV-associated neurocognitive disorders are common in HIV-infected individuals, even in the combination antiretroviral therapy (c-ART) era. Several mechanisms are involved in neuronal damage, including chronic inflammation immune activation. Mammalian 2'-5'-oligoadenylate synthetase (OAS) genes are produced in response to interferon (IFN), mainly by monocytes, and exert their antiviral functions by activation of RNase L that degrades viral and cellular RNAs. In this study, we aimed at exploring OAS gene family RNA expression in simian immunodeficiency virus encephalitis (SIVE), in HIV-associated neurocognitive disorders (HAND), and in HIV-associate dementia (HAD). We analyzed three microarray datasets obtained from the NCBI in order to assess the expression levels of OAS gene family network in brain biopsies of macaques with SIVE vs uninfected animals, as well as post-mortem brain of individuals with HAND (on or off ART) vs uninfected controls and three brain regions of HIV-infected individuals with both neurocognitive impairment (HAD) and encephalitis (HIVE). All OAS genes were upregulated both in SIVE and in HAND. OAS expression was significantly higher in high-viremic individuals; increased expression levels persisted in cART subjects when compared to healthy controls. OAS gene network analysis showed that several genes belonging to the type I IFN pathway, especially CXCL10 and IFIT3, were similarly upregulated in SIVE/HAND. Furthermore, we identified a significant upregulation of OAS gene family RNA expression in basal ganglia, white matter, and frontal cortex of HIV-1, HAD, and HAD/HIVE patients compared to healthy subjects. OAS gene family expression is increased in brain sections from individuals with HAND, HAD, and HIVE as well as macaques with SIVE. OAS family expression is likely to be induced by IFN as a consequence of viral replication in the CNS. Its long-term upregulation may contribute to the chronic inflammatory status and neurocognitive impairment

  7. Mutation analysis of pre-mRNA splicing genes in Chinese families with retinitis pigmentosa

    PubMed Central

    Pan, Xinyuan; Chen, Xue; Liu, Xiaoxing; Gao, Xiang; Kang, Xiaoli; Xu, Qihua; Chen, Xuejuan; Zhao, Kanxing; Zhang, Xiumei; Chu, Qiaomei; Wang, Xiuying

    2014-01-01

    Purpose Seven genes involved in precursor mRNA (pre-mRNA) splicing have been implicated in autosomal dominant retinitis pigmentosa (adRP). We sought to detect mutations in all seven genes in Chinese families with RP, to characterize the relevant phenotypes, and to evaluate the prevalence of mutations in splicing genes in patients with adRP. Methods Six unrelated families from our adRP cohort (42 families) and two additional families with RP with uncertain inheritance mode were clinically characterized in the present study. Targeted sequence capture with next-generation massively parallel sequencing (NGS) was performed to screen mutations in 189 genes including all seven pre-mRNA splicing genes associated with adRP. Variants detected with NGS were filtered with bioinformatics analyses, validated with Sanger sequencing, and prioritized with pathogenicity analysis. Results Mutations in pre-mRNA splicing genes were identified in three individual families including one novel frameshift mutation in PRPF31 (p.Leu366fs*1) and two known mutations in SNRNP200 (p.Arg681His and p.Ser1087Leu). The patients carrying SNRNP200 p.R681H showed rapid disease progression, and the family carrying p.S1087L presented earlier onset ages and more severe phenotypes compared to another previously reported family with p.S1087L. In five other families, we identified mutations in other RP-related genes, including RP1 p. Ser781* (novel), RP2 p.Gln65* (novel) and p.Ile137del (novel), IMPDH1 p.Asp311Asn (recurrent), and RHO p.Pro347Leu (recurrent). Conclusions Mutations in splicing genes identified in the present and our previous study account for 9.5% in our adRP cohort, indicating the important role of pre-mRNA splicing deficiency in the etiology of adRP. Mutations in the same splicing gene, or even the same mutation, could correlate with different phenotypic severities, complicating the genotype–phenotype correlation and clinical prognosis. PMID:24940031

  8. Novel paralogous gene families with potential function in legume nodules and seeds.

    PubMed

    Silverstein, Kevin A T; Graham, Michelle A; VandenBosch, Kathryn A

    2006-04-01

    Within the plant kingdom, legumes are unusual in their ability to form nitrogen-fixing nodules in symbiosis with certain bacteria in the family Rhizobiaceae (rhizhobia). Genes that are required for signaling between plant and symbiont, and for the development and maintenance of the nodule, were either created de novo or adopted from other plant pathways. Only in recent years have genome-scale sequence data from legumes made it possible to identify large, novel families of genes probably evolved to function in nodulation. Members of these novel families are expressed in seeds or nodules, and are homologous to defense-related proteins. Perhaps the most striking example is a large family (of more than 340 members) of cysteine cluster proteins that have homology to plant defensins.

  9. Novel mutation of the NOTCH3 gene in a Polish family with CADASIL.

    PubMed

    Buczek, Julia; Błażejewska-Hyżorek, Beata; Cudna, Agnieszka; Lusawa, Małgorzata; Lewandowska, Eliza; Kurkowska-Jastrzębska, Iwona; Członkowska, Anna

    2016-01-01

    Cerebral autosomal dominant arteriopathy with subcortical infarcts and leukoencephalopathy (CADASIL) is an inherited small blood vessels disease caused by mutations in the gene encoding the neurogenic locus notch homolog protein 3 (NOTCH 3). We present a Polish family with a previously unreported novel mutation in exon 12 c.1851C>C/G of the NOTCH3 gene and varying disease expression. One of the two family members with the confirmed mutation presented with all the main CADASIL symptoms; while, his affected father was nearly asymptomatic. Both family members had epilepsy, coronary artery disease, and abdominal aorta aneurysm. Our observation confirms there is phenotypic variability in CADASIL not only between, but also within, families carrying the same mutation.

  10. Phylogenetic conservation and physical mapping of members of the H6 homeobox gene family.

    PubMed

    Stadler, H S; Murray, J C; Leysens, N J; Goodfellow, P J; Solursh, M

    1995-06-01

    Homeobox genes represent a class of transcription factors that play key roles in the regulation of embryogenesis and development. Here we report the identification of a homeobox-containing gene family that is highly conserved at both the nucleotide and amino acid levels in a diverse number of species. These species encompass both vertebrate and invertebrate phylogenies, ranging from Homo sapiens to Drosophila melanogaster. In humans, at least two homeobox sequences from this family were identified representing a previously reported member of this family as well as a novel homeobox sequence that we physically mapped to the 10q25.2-q26.3 region of human Chromosome (Chr) 10. Multiple members of this family were also detected in three additional vertebrate species including Equus caballus (horse), Gallus gallus (Chicken), and Mus musculus (mouse), whereas only single members were detected in Tripneustes gratilla (sea urchin), Petromyzon marinus (lamprey), Salmo salar (salmon), Ovis aries (sheep), and D. melanogaster (fruit fly).

  11. [Mutation analysis of FGFR3 gene in a family featuring hereditary dwarfism].

    PubMed

    Zhang, Qiong; Jiang, Hai-ou; Quan, Qing-li; Li, Jun; He, Ting; Huang, Xue-shuang

    2011-12-01

    To investigate the clinical symptoms and potential mutation in FGFR3 gene for a family featuring hereditary dwarfism in order to attain diagnosis and provide prenatal diagnosis. Five patients and two unaffected relatives from the family, in addition with 100 healthy controls, were recruited. Genome DNA was extracted. Exons 10 and 13 of the FGFR3 gene were amplified using polymerase chain reaction (PCR). PCR products were sequenced in both directions. All patients had similar features including short stature, short limbs, lumbar hyperlordosis but normal craniofacial features. A heterozygous mutation G1620T (N540K) was identified in the cDNA from all patients but not in the unaffected relatives and 100 control subjects. A heterozygous G380R mutation was excluded. The hereditary dwarfism featured by this family has been caused by hypochondroplasia (HCH) due to a N540K mutation in the FGFR3 gene.

  12. A nonsense mutation in the LDL receptor gene leads to familial hypercholesterolemia in the Druze sect

    SciTech Connect

    Landsberger, D.; Meiner, V.; Reshef, A.; Leitersdorf, E. ); Levy, Yishai ); Westhytzen, D.R. van der; Coetzee, G.A. )

    1992-02-01

    Familial hypercholesterolemia (FH) is an autosomal dominant disease caused by mutations in the LDL receptor gene. Here the authors characterize and LDL receptor mutation that is associated with a distinct haplotype and causes FH in the Druze, a small Middle Eastern Islamic sect with a high degree of inbreeding. The mutation was found in FH families from two distinct Druze villages from the Golan Heights (northern Israel). It was not found either in another Druze FH family residing in a different geographical area nor in eight Arab and four Jewish FH heterozygote index cases whose hypercholesterolemia cosegregates with an identical LDL receptor gene haplotype. The mutation, a single-base substitution, results in a termination codon in exon 4 of the LDL receptor gene that encodes for the fourth repeat of the binding domain of the mature receptor. It can be diagnosed by allele-specific oligonucleotide hybridization of PCR-amplified DNA from FH patients.

  13. Cross-Family Transcription Factor Interactions: An Additional Layer of Gene Regulation.

    PubMed

    Bemer, Marian; van Dijk, Aalt D J; Immink, Richard G H; Angenent, Gerco C

    2017-01-01

    Specific and dynamic gene expression strongly depends on transcription factor (TF) activity and most plant TFs function in a combinatorial fashion. They can bind to DNA and control the expression of the corresponding gene in an additive fashion or cooperate by physical interactions, forming larger protein complexes. The importance of protein-protein interactions between members of a particular plant TF family has long been recognised; however, a significant number of interfamily TF interactions has recently been reported. The biological implications and the molecular mechanisms involved in cross-family interactions have now started to be elucidated and the examples illustrate potential roles in the bridging of biological processes. Hence, cross-family TF interactions expand the molecular toolbox for plants with additional mechanisms to control and fine-tune robust gene expression patterns and to adapt to their continuously changing environment.

  14. New genes, new dilemmas: FTLD genetics and its implications for families.

    PubMed

    Goldman, Jill S; Adamson, Jennifer; Karydas, Anna; Miller, Bruce L; Hutton, Mike

    After Alzheimer's disease, frontotemporal lobar degeneration (FTLD) is the second leading cause of dementia in persons less than 65 years of age. Up to 40% of FTLD cases have a positive family history. Research on these families has led to the discovery of four disease-causing genes: microtubule-associated protein tau (MAPT), progranulin (PGRN), valosin-containing protein (VCP), and charged multivesicular body protein 2B (CHMP2B). MAPT and PGRN are responsible for the largest number of familial cases. Each of these genes differs by disease mechanism. Moreover mutations in both genes are associated with significant interfamilial and intrafamilial phenotypic variation. Genetic counseling needs to address the differences between the PGRN and MAPT mutations as well as the variation in clinical symptoms. The aims of this article are to describe the genetics of the FTLD spectrum and aid in the genetic counseling of individuals who may carry genetic mutations.

  15. Chlorogenic acid protects MSCs against oxidative stress by altering FOXO family genes and activating intrinsic pathway.

    PubMed

    Li, Shiyong; Bian, Hetao; Liu, Zhe; Wang, Ye; Dai, Jianghua; He, Wenfeng; Liao, Xingen; Liu, Rongrong; Luo, Jun

    2012-01-15

    Chlorogenic acid as an antioxidant exists widely in edible and medicinal plants, and can protect cell against apoptosis induced by oxidative stress. However, its molecular mechanisms remain largely unknown. Here, we showed that Chlorogenic acid suppressed reactive oxygen species increase by activation of Akt phosphorylation,and increased FOXO family genes and anti-apoptotic protein Bcl-2 expression in MSCs culturing under oxidative stress. In addition, PI-3Kinase Inhibitor (2-(4-Morpholinyl)-8-phenyl-4H-1-benzopyran-4-one, LY294002) could suppress the Chlorogenic acid-induced: (1) the cellular protective role, (2) the increase of the FOXO family genes expression, (3) increased expression of Bcl-2. These results suggested that Chlorogenic acid protected MSCs against apoptosis via PI3K/AKT signal and FOXO family genes. Copyright © 2011 Elsevier B.V. All rights reserved.

  16. TM4SF2 gene involvement reconsidered in an XLMR family after neuropsychological assessment.

    PubMed

    Gomot, Marie; Ronce, Nathalie; Dessay, Sabine; Zemni, Ramzi; Ayrault, Anne-Dominique; Moizard, Marie-Pierre; Nivelon, Annie; Gilgenkrantz, Simone; Dourlens, Julliette; Des Portes, Vincent; Chelly, Jamel; Moraine, Claude

    2002-11-01

    The TM4SF2 gene (localized at Xp11.4 between the loci DXS564 and DXS556) has been found to be mutated in one MRX family. In order to define the corresponding behavioral phenotype, global IQ and specific cognitive skills were assessed in seven males and three females of this family, independent of subject status. Mental retardation (MR) was mild in three patients and moderate in three others. Despite the broad variability of severity of MR, a cognitive profile specific to the MR in this family was documented. It was characterized by language disorder that was more marked in the articulatory component and spatial/verbal short-term memory dissociation with larger mnemonic span for spatial than for verbal cues. Linkage analysis was then performed on the basis of the cognitively determined status. Recombinations were observed with the loci DXS556 at Xp11.4 and DXS441 at Xq13.2 (maximum LOD score = 2.23 at theta = 0 for ALAS2). This localization region does not include the TM4SF2 gene that has been found mutated in both patients with MR and in one non-MR male subject of this family. The present results suggest two main hypotheses. First, TM4SF2 gene mutation could be involved in MR in this family, therefore representing accentuated intra familial phenotypic variability. Second, the structural particularity detected in the TM4SF2 gene might reflect a rare polymorphism rather than a pathogenic mutation, with the gene responsible for MR in this family being therefore more likely to be searched for in the pericentromeric region of the X chromosome. Copyright 2002 Wiley-Liss, Inc.

  17. Ancestral and novel roles of Pax family genes in mollusks.

    PubMed

    Scherholz, Maik; Redl, Emanuel; Wollesen, Tim; de Oliveira, André Luiz; Todt, Christiane; Wanninger, Andreas

    2017-03-16

    Pax genes are transcription factors with significant roles in cell fate specification and tissue differentiation during animal ontogeny. Most information on their tempo-spatial mode of expression is available from well-studied model organisms where the Pax-subfamilies Pax2/5/8, Pax6, and Paxα/β are mainly involved in the development of the central nervous system (CNS), the eyes, and other sensory organs. In certain taxa, Pax2/5/8 seems to be additionally involved in the development of excretion organs. Data on expression patterns in lophotrochozoans, and in particular in mollusks, are very scarce for all the above-mentioned Pax-subfamilies, which hampers reconstruction of their putative ancestral roles in bilaterian animals. Thus, we studied the developmental expression of Pax2/5/8, Pax6, and the lophotrochozoan-specific Paxβ in the worm-shaped mollusk Wirenia argentea, a member of Aplacophora that together with Polyplacophora forms the Aculifera, the proposed sister taxon to all primarily single-shelled mollusks (Conchifera). All investigated Pax genes are expressed in the developing cerebral ganglia and in the ventral nerve cords, but not in the lateral nerve cords of the tetraneural nervous system. Additionally, Pax2/5/8 is expressed in epidermal spicule-secreting or associated cells of the larval trunk and in the region of the developing protonephridia. We found no indication for an involvement of the investigated Pax genes in the development of larval or adult sensory organs of Wirenia argentea. Pax2/5/8 seems to have a conserved role in the development of the CNS, whereas expression in the spicule-secreting tissues of aplacophorans and polyplacophorans suggests co-option in aculiferan skeletogenesis. The Pax6 expression pattern in Aculifera largely resembles the common bilaterian expression during CNS development. All data available on Paxβ expression argue for a common role in lophotrochozoan neurogenesis.

  18. The ABC transporter gene family of Daphnia pulex

    PubMed Central

    Sturm, Armin; Cunningham, Phil; Dean, Michael

    2009-01-01

    Background The large gene superfamily of ABC (ATP-binding cassette) transporters encodes membrane proteins involved in trafficking processes across biological membranes and further essential cell biological functions. ABC transporters are evolutionary ancient and involved in the biochemical defence against toxicants. We report here a genome-wide survey of ABC proteins of Daphnia pulex, providing for the first time information on ABC proteins in crustacea, a primarily aquatic arthropod subphylum of high ecological and economical importance. Results We identified 64 ABC proteins in the Daphnia genome, which possesses members of all current ABC subfamilies A to H. To unravel phylogenetic relationships, ABC proteins of Daphnia were compared to those from yeast, worm, fruit fly and human. A high conservation of Daphnia of ABC transporters was observed for proteins involved in fundamental cellular processes, including the mitochondrial half transporters of the ABCB subfamily, which function in iron metabolism and transport of Fe/S protein precursors, and the members of subfamilies ABCD, ABCE and ABCF, which have roles in very long chain fatty acid transport, initiation of gene transcription and protein translation, respectively. A number of Daphnia proteins showed one-to-one orthologous relationships to Drosophila ABC proteins including the sulfonyl urea receptor (SUR), the ecdysone transporter ET23, and the eye pigment precursor transporter scarlet. As the fruit fly, Daphnia lacked homologues to the TAP protein, which plays a role in antigene processing, and the cystic fibrosis transmembrane conductance regulator (CFTR), which functions as a chloride channel. Daphnia showed two proteins homologous to MDR (multidrug resistance) P-glycoproteins (ABCB subfamily) and six proteins homologous to MRPs (multidrug resistance-associated proteins) (ABCC subfamily). However, lineage specific gene duplications in the ABCB and ABCC subfamilies complicated the inference of function. A

  19. Familial basilar migraine associated with a new mutation in the ATP1A2 gene.

    PubMed

    Ambrosini, A; D'Onofrio, M; Grieco, G S; Di Mambro, A; Montagna, G; Fortini, D; Nicoletti, F; Nappi, G; Sances, G; Schoenen, J; Buzzi, M G; Santorelli, F M; Pierelli, F

    2005-12-13

    Basilar migraine (BM), familial hemiplegic migraine (FHM), and sporadic hemiplegic migraine (SHM) are phenotypically similar subtypes of migraine with aura, differentiated only by motor symptoms, which are absent in BM. Mutations in CACNA1A and ATP1A2 have been found in FHM. The authors detected a novel mutation in the ATP1A2 gene (R548H) in members of a family with BM, suggesting that BM and FHM may be allelic disorders.

  20. The Evolutionary Dynamics of the Odorant Receptor Gene Family in Corbiculate Bees.

    PubMed

    Brand, Philipp; Ramírez, Santiago R

    2017-08-01

    Insects rely on chemical information to locate food, choose mates, and detect potential predators. It has been hypothesized that adaptive changes in the olfactory system facilitated the diversification of numerous insect lineages. For instance, evolutionary changes of Odorant Receptor (OR) genes often occur in parallel with modifications in life history strategies. Corbiculate bees display a diverse array of behaviors that are controlled through olfaction, including varying degrees of social organization, and manifold associations with floral resources. Here we investigated the molecular mechanisms driving the evolution of the OR gene family in corbiculate bees in comparison to other chemosensory gene families. Our results indicate that the genomic organization of the OR gene family has remained highly conserved for ∼80 Myr, despite exhibiting major changes in repertoire size among bee lineages. Moreover, the evolution of OR genes appears to be driven mostly by lineage-specific gene duplications in few genomic regions that harbor large numbers of OR genes. A selection analysis revealed that OR genes evolve under positive selection, with the strongest signals detected in recently duplicated copies. Our results indicate that chromosomal translocations had a minimal impact on OR evolution, and instead local molecular mechanisms appear to be main drivers of OR repertoire size. Our results provide empirical support to the longstanding hypothesis that positive selection shaped the diversification of the OR gene family. Together, our results shed new light on the molecular mechanisms underlying the evolution of olfaction in insects. © The Author 2017. Published by Oxford University Press on behalf of the Society for Molecular Biology and Evolution.

  1. Cloning and characterization of a second member of the mouse mdr gene family.

    PubMed Central

    Gros, P; Raymond, M; Bell, J; Housman, D

    1988-01-01

    The mammalian mdr gene family comprises a small number of closely related genes. Previously, we have shown that one member, mdr1, has the capacity to convey multidrug resistance to drug-sensitive recipient cells in a gene transfer protocol. However, the functional characteristics of other members of this gene family have not been examined. In this report, we characterize a second member of the mdr gene family which we designated mdr2. We determined the nucleotide sequence corresponding to the complete coding region of this mdr2 transcript. The predicted amino acid sequence of this protein (1,276 amino acids) showed that it is a membrane glycoprotein highly homologous to mdr1 (85%), strongly suggesting that both genes originate from a common ancestor. Regions of divergence between mdr1 and mdr2 proteins are concentrated in two discrete segments of the predicted polypeptides, each approximately 100 residues in length. The mdr2 protein appears to be formed by the duplication of a structural unit which encodes three putative transmembrane loops and a predicted nucleotide-binding fold and is highly homologous to bacterial transport proteins such as hlyB. This strong homology suggests that mdr2 also participates in an energy-dependent membrane transport process. However, the direct relationship, if any, of this new member of the mdr family to multidrug resistance remains to be established. Knowledge of the complete nucleotide sequence and predicted amino acid sequence of the mdr2 gene product will enable the preparation of gene-specific probes and antibodies necessary to study the functional role of this gene in multidrug resistance and normal physiological processes. PMID:3405218

  2. Evolutionary mechanisms driving the evolution of a large polydnavirus gene family coding for protein tyrosine phosphatases

    PubMed Central

    2012-01-01

    Background Gene duplications have been proposed to be the main mechanism involved in genome evolution and in acquisition of new functions. Polydnaviruses (PDVs), symbiotic viruses associated with parasitoid wasps, are ideal model systems to study mechanisms of gene duplications given that PDV genomes consist of virulence genes organized into multigene families. In these systems the viral genome is integrated in a wasp chromosome as a provirus and virus particles containing circular double-stranded DNA are injected into the parasitoids’ hosts and are essential for parasitism success. The viral virulence factors, organized in gene families, are required collectively to induce host immune suppression and developmental arrest. The gene family which encodes protein tyrosine phosphatases (PTPs) has undergone spectacular expansion in several PDV genomes with up to 42 genes. Results Here, we present strong indications that PTP gene family expansion occurred via classical mechanisms: by duplication of large segments of the chromosomally integrated form of the virus sequences (segmental duplication), by tandem duplications within this form and by dispersed duplications. We also propose a novel duplication mechanism specific to PDVs that involves viral circle reintegration into the wasp genome. The PTP copies produced were shown to undergo conservative evolution along with episodes of adaptive evolution. In particular recently produced copies have undergone positive selection in sites most likely involved in defining substrate selectivity. Conclusion The results provide evidence about the dynamic nature of polydnavirus proviral genomes. Classical and PDV-specific duplication mechanisms have been involved in the production of new gene copies. Selection pressures associated with antagonistic interactions with parasitized hosts have shaped these genes used to manipulate lepidopteran physiology with evidence for positive selection involved in adaptation to host targets. PMID

  3. A new family of adenylyl cyclase genes in the male germline of Drosophila melanogaster.

    PubMed

    Cann, M J; Chung, E; Levin, L R

    2000-04-01

    We describe the cloning and characterization of a new gene family of adenylyl cyclase related genes in Drosophila. The five adenylyl cyclase-like genes that define this family are clearly distinct from previously known adenylyl cyclases. One member forms a unique locus on chromosome 3 whereas the other four members form a tightly clustered, tandemly repeated array on chromosome 2. The genes on chromosome 2 are transcribed in the male germline in a doublesex dependent manner and are expressed in postmitotic, meiotic, and early differentiating sperm. These genes therefore provide the first evidence for a role for the cAMP signaling pathway in Drosophila spermatogenesis. Expression from this locus is under the control of the always early, cannonball, meiosis arrest, and spermatocyte arrest genes that are required for the G2/M transition of meiosis I during spermatogenesis, implying a mechanism for the coordination of differentiation and proliferation. Evidence is also provided for positive selection at the locus on chromosome 2 which suggests this gene family is actively evolving and may play a novel role in spermatogenesis.

  4. Rapid evolution of the family of CONSTANS LIKE genes in plants.

    PubMed

    Lagercrantz, U; Axelsson, T

    2000-10-01

    A family of CONSTANS LIKE genes (COLs) has recently been identified in Arabidopsis thaliana and other plant species. CONSTANS, the first isolated member, is a putative zinc finger transcription factor that promotes the induction of flowering in A. thaliana in long photoperiods. Phylogenetic analysis of the COL family demonstrated that it is organized into a few distinct groups, some of which evolved before the divergence of gymnosperms and angiosperms. Molecular evolutionary analyses showed that COL genes within the Brassicaceae family evolve rapidly. The number of nonsynonymous substitutions was larger, and the ratio of nonsynonymous to synonymous substitutions was higher. The analysis also indicated that the rate of evolution is heterogeneous between different domains in the COL genes. The results support previous data indicating that plant regulatory genes evolve relatively fast and that the rate of evolution varies significantly between different regions of those genes. The rate of evolution of COL genes seems to have accelerated during later stages of evolution, possibly as an effect of frequent gene duplications.

  5. Evolutionary Pattern and Regulation Analysis to Support Why Diversity Functions Existed within PPAR Gene Family Members.

    PubMed

    Zhou, Tianyu; Yan, Xiping; Wang, Guosong; Liu, Hehe; Gan, Xiang; Zhang, Tao; Wang, Jiwen; Li, Liang

    2015-01-01

    Peroxisome proliferators-activated receptor (PPAR) gene family members exhibit distinct patterns of distribution in tissues and differ in functions. The purpose of this study is to investigate the evolutionary impacts on diversity functions of PPAR members and the regulatory differences on