Science.gov

Sample records for pseudomonas putida zwl73

  1. Methylmercury degradation by Pseudomonas putida V1.

    PubMed

    Cabral, Lucélia; Yu, Ri-Qing; Crane, Sharron; Giovanella, Patricia; Barkay, Tamar; Camargo, Flávio A O

    2016-08-01

    Environmental contamination of mercury (Hg) has caused public health concerns with focuses on the neurotoxic substance methylmercury, due to its bioaccumulation and biomagnification in food chains. The goals of the present study were to examine: (i) the transformation of methylmercury, thimerosal, phenylmercuric acetate and mercuric chloride by cultures of Pseudomonas putida V1, (ii) the presence of the genes merA and merB in P. putida V1, and (iii) the degradation pathways of methylmercury by P. putida V1. Strain V1 cultures readily degraded methylmercury, thimerosal, phenylmercury acetate, and reduced mercuric chloride into gaseous Hg(0). However, the Hg transformation in LB broth by P. putida V1 was influenced by the type of Hg compounds. The merA gene was detected in P. putida V1, on the other hand, the merB gene was not detected. The sequencing of this gene, showed high similarity (100%) to the mercuric reductase gene of other Pseudomonas spp. Furthermore, tests using radioactive (14)C-methylmercury indicated an uncommon release of (14)CO2 concomitant with the production of Hg(0). The results of the present work suggest that P. putida V1 has the potential to remove methylmercury from contaminated sites. More studies are warranted to determine the mechanism of removal of methylmercury by P. putida V1.

  2. Chemotaxis of Pseudomonas putida toward chlorinated benzoates

    SciTech Connect

    Harwood, C.S.; Parales, R.E.; Dispensa, M. )

    1990-05-01

    The chlorinated aromatic acids 3-chlorobenzoate and 4-chlorobenzoate are chemoattractants for Pseudomonas putida PRS2000. These compounds are detected by a chromosomally encoded chemotactic response to benzoate which is inducible by {beta}-ketoadipate, and intermediate of benzoate catabolism. Plasmid pAC27, encoding enzymes for 3-chlorobenzoate degradation, does not appear to carry genes for chemotaxis toward chlorinated compounds.

  3. Ethylene Glycol Metabolism by Pseudomonas putida

    PubMed Central

    Mückschel, Björn; Simon, Oliver; Klebensberger, Janosch; Graf, Nadja; Rosche, Bettina; Altenbuchner, Josef; Pfannstiel, Jens; Huber, Armin

    2012-01-01

    In this study, we investigated the metabolism of ethylene glycol in the Pseudomonas putida strains KT2440 and JM37 by employing growth and bioconversion experiments, directed mutagenesis, and proteome analysis. We found that strain JM37 grew rapidly with ethylene glycol as a sole source of carbon and energy, while strain KT2440 did not grow within 2 days of incubation under the same conditions. However, bioconversion experiments revealed metabolism of ethylene glycol by both strains, with the temporal accumulation of glycolic acid and glyoxylic acid for strain KT2440. This accumulation was further increased by targeted mutagenesis. The key enzymes and specific differences between the two strains were identified by comparative proteomics. In P. putida JM37, tartronate semialdehyde synthase (Gcl), malate synthase (GlcB), and isocitrate lyase (AceA) were found to be induced in the presence of ethylene glycol or glyoxylic acid. Under the same conditions, strain KT2440 showed induction of AceA only. Despite this difference, the two strains were found to use similar periplasmic dehydrogenases for the initial oxidation step of ethylene glycol, namely, the two redundant pyrroloquinoline quinone (PQQ)-dependent enzymes PedE and PedH. From these results we constructed a new pathway for the metabolism of ethylene glycol in P. putida. Furthermore, we conclude that Pseudomonas putida might serve as a useful platform from which to establish a whole-cell biocatalyst for the production of glyoxylic acid from ethylene glycol. PMID:23023748

  4. Ethylene glycol metabolism by Pseudomonas putida.

    PubMed

    Mückschel, Björn; Simon, Oliver; Klebensberger, Janosch; Graf, Nadja; Rosche, Bettina; Altenbuchner, Josef; Pfannstiel, Jens; Huber, Armin; Hauer, Bernhard

    2012-12-01

    In this study, we investigated the metabolism of ethylene glycol in the Pseudomonas putida strains KT2440 and JM37 by employing growth and bioconversion experiments, directed mutagenesis, and proteome analysis. We found that strain JM37 grew rapidly with ethylene glycol as a sole source of carbon and energy, while strain KT2440 did not grow within 2 days of incubation under the same conditions. However, bioconversion experiments revealed metabolism of ethylene glycol by both strains, with the temporal accumulation of glycolic acid and glyoxylic acid for strain KT2440. This accumulation was further increased by targeted mutagenesis. The key enzymes and specific differences between the two strains were identified by comparative proteomics. In P. putida JM37, tartronate semialdehyde synthase (Gcl), malate synthase (GlcB), and isocitrate lyase (AceA) were found to be induced in the presence of ethylene glycol or glyoxylic acid. Under the same conditions, strain KT2440 showed induction of AceA only. Despite this difference, the two strains were found to use similar periplasmic dehydrogenases for the initial oxidation step of ethylene glycol, namely, the two redundant pyrroloquinoline quinone (PQQ)-dependent enzymes PedE and PedH. From these results we constructed a new pathway for the metabolism of ethylene glycol in P. putida. Furthermore, we conclude that Pseudomonas putida might serve as a useful platform from which to establish a whole-cell biocatalyst for the production of glyoxylic acid from ethylene glycol.

  5. Binding of germanium of Pseudomonas putida cells

    SciTech Connect

    Klapcinska, B.; Chmielowski, J.

    1986-05-01

    The binding of germanium to Pseudomonas putida ATCC 33015 was investigated by using whole intact cells grown in a medium supplemented with GeO/sub 2/ and catechol or acetate. Electron-microscopic examination of the control and metal-loaded samples revealed that germanium was bound within the cell envelope. A certain number of small electron-dense deposits of the bound element were found in the cytoplasm when the cells were grown in the presence of GeO/sub 2/ and catechol. The study of germanium distribution in cellular fractions revealed that catechol facilitated the intracellular accumulation of this element.

  6. Regulation of Leucine Catabolism in Pseudomonas putida

    PubMed Central

    Massey, Linda K.; Conrad, Robert S.; Sokatch, John R.

    1974-01-01

    The generation time of Pseudomonas putida with l-leucine was 20 h in synthetic media but only 3 h with d-leucine. Slow growth in the presence of l-leucine was partially overcome by addition of 0.1 mM amounts of either d-valine, l-valine, or 2-ketoisovalerate. The activities of five enzymes which take part in the oxidation of leucine by P. putida were measured under various conditions of growth. Four enzymes were induced by growth with dl-leucine as sole source of carbon: d-amino acid dehydrogenase, branched-chain keto acid dehydrogenase, 3-methylcrotonyl-coenzyme A carboxylase, and 3-hydroxy-3-methylglutaryl-coenzyme A lyase. The segment of the pathway required for oxidation of 3-methylcrotonate was induced by growth on isovalerate or 3-methylcrotonate without formation of the preceding enzymes. The synthesis of carboxylase and lyase appeared to have been repressed by the addition of l-glutamate or glucose to cells growing on dl-leucine as the sole carbon source. Mutants unable to grow at the expense of isovalerate had reduced levels of carboxylase and lyase, whereas the levels of three enzymes common to the catabolism of all three branched-chain amino acids and those of two isoleucine catabolic enzymes were normal. PMID:4150714

  7. Regulation of alkane oxidation in Pseudomonas putida.

    PubMed Central

    Grund, A; Shapiro, J; Fennewald, M; Bacha, P; Leahy, J; Markbreiter, K; Nieder, M; Toepfer, M

    1975-01-01

    We have studied the appearance of whole-cell oxidizing activity for n-alkanes and their oxidation products in strains of Pseudomonas putida carrying the OCT plasmid. Our results indicate that the OCT plasmid codes for inducible alkane-hydroxylating and primary alcohol-dehydrogenating activities and that the chromosome codes for constitutive oxidizing activities for primary alcohols, aliphatic aldehydes, and fatty acids. Mutant isolation confirms the presence of an alcohol dehydrogenase locus on the OCT plasmid and indicated the presence of multiple alcohol and aldehyde dehydrogenase loci on the P. putida chromosome. Induction tests with various compounds indicate that inducer recognition has specificity for chain length and can be affected by the degree of oxidation of the carbon chain. Some inducers are neither growth nor respiration substrates. Growth tests with and without a gratuitous inducer indicate that undecane is not a growth substrate because it does not induce alkane hydroxylase activity. Using a growth test for determining induction of the plasmid alcohol dehydrogenase it is possible to show that heptane induces this activity in hydroxylase-negative mutants. This suggests that unoxidized alkane molecules are the physiological inducers of both plasmid activities. PMID:1150626

  8. Phospholipid biosynthesis and solvent tolerance in Pseudomonas putida strains.

    PubMed

    Pinkart, H C; White, D C

    1997-07-01

    The role of the cell envelope in the solvent tolerance mechanisms of Pseudomonas putida was investigated. The responses of a solvent-tolerant strain, P. putida Idaho, and a solvent-sensitive strain, P. putida MW1200, were examined in terms of phospholipid content and composition and of phospholipid biosynthetic rate following exposure to a nonmetabolizable solvent, o-xylene. Following o-xylene exposure, P. putida MW1200 exhibited a decrease in total phospholipid content. In contrast, P. putida Idaho demonstrated an increase in phospholipid content 1 to 6 h after exposure. Analysis of phospholipid biosynthesis showed P. putida Idaho to have a higher basal rate of phospholipid synthesis than MW1200. This rate increased significantly following exposure to xylene. Both strains showed little significant turnover of phospholipid in the absence of xylene. In the presence of xylene, both strains showed increased phospholipid turnover. The rate of turnover was significantly greater in P. putida Idaho than in P. putida MW1200. These results suggest that P. putida Idaho has a greater ability than the solvent-sensitive strain MW1200 to repair damaged membranes through efficient turnover and increased phospholipid biosynthesis.

  9. Phospholipid biosynthesis and solvent tolerance in Pseudomonas putida strains.

    PubMed Central

    Pinkart, H C; White, D C

    1997-01-01

    The role of the cell envelope in the solvent tolerance mechanisms of Pseudomonas putida was investigated. The responses of a solvent-tolerant strain, P. putida Idaho, and a solvent-sensitive strain, P. putida MW1200, were examined in terms of phospholipid content and composition and of phospholipid biosynthetic rate following exposure to a nonmetabolizable solvent, o-xylene. Following o-xylene exposure, P. putida MW1200 exhibited a decrease in total phospholipid content. In contrast, P. putida Idaho demonstrated an increase in phospholipid content 1 to 6 h after exposure. Analysis of phospholipid biosynthesis showed P. putida Idaho to have a higher basal rate of phospholipid synthesis than MW1200. This rate increased significantly following exposure to xylene. Both strains showed little significant turnover of phospholipid in the absence of xylene. In the presence of xylene, both strains showed increased phospholipid turnover. The rate of turnover was significantly greater in P. putida Idaho than in P. putida MW1200. These results suggest that P. putida Idaho has a greater ability than the solvent-sensitive strain MW1200 to repair damaged membranes through efficient turnover and increased phospholipid biosynthesis. PMID:9209036

  10. Biological manganese oxidation by Pseudomonas putida in trickling filters.

    PubMed

    McKee, Kyle P; Vance, Cherish C; Karthikeyan, Raghupathy

    2016-01-01

    Biological oxidation has been researched as a viable alternative for treating waters with high manganese (Mn) concentrations, typically found in mine drainage or in some geological formations. In this study, laboratory-scale trickling filters were constructed to compare the Mn removal efficiency between filters inoculated with the Mn oxidizing bacteria, Pseudomonas putida, and filters without inoculation. Manganese oxidation and removal was found to be significantly greater in trickling filters with Pseudomonas putida after startup times of only 48 h. Mn oxidation in Pseudomonas putida inoculated trickling filters was up to 75% greater than non-inoculated filters. One-dimensional advective-dispersive models were formulated to describe the transport of Mn in trickling filter porous media. Based on the experimental transport parameters obtained, the model predicted that a filter depth of only 16 cm is needed to reduce influent concentration of 10 mg L(-1) to 0.05 mg L(-1).

  11. Analysis of the core genome and pangenome of Pseudomonas putida.

    PubMed

    Udaondo, Zulema; Molina, Lázaro; Segura, Ana; Duque, Estrella; Ramos, Juan L

    2016-10-01

    Pseudomonas putida are strict aerobes that proliferate in a range of temperate niches and are of interest for environmental applications due to their capacity to degrade pollutants and ability to promote plant growth. Furthermore solvent-tolerant strains are useful for biosynthesis of added-value chemicals. We present a comprehensive comparative analysis of nine strains and the first characterization of the Pseudomonas putida pangenome. The core genome of P. putida comprises approximately 3386 genes. The most abundant genes within the core genome are those that encode nutrient transporters. Other conserved genes include those for central carbon metabolism through the Entner-Doudoroff pathway, the pentose phosphate cycle, arginine and proline metabolism, and pathways for degradation of aromatic chemicals. Genes that encode transporters, enzymes and regulators for amino acid metabolism (synthesis and degradation) are all part of the core genome, as well as various electron transporters, which enable aerobic metabolism under different oxygen regimes. Within the core genome are 30 genes for flagella biosynthesis and 12 key genes for biofilm formation. Pseudomonas putida strains share 85% of the coding regions with Pseudomonas aeruginosa; however, in P. putida, virulence factors such as exotoxins and type III secretion systems are absent.

  12. Regiochemistry of Camphor Analog Oxidation by Pseudomonas putida

    PubMed Central

    Banerjee, Sujit; Dombrowski, Anne E.; Scala, Anthony J.

    1983-01-01

    Pseudomonas putida cooxidized norcamphor and pericyclocamphanone to hydroxylated and lactonized products during growth on camphor. Norcamphor was hydroxylated at the 5 position, similar to the corresponding process in camphor, but pericyclocamphanone was oxidized at the 6 position. We conclude that the regiochemistry of the hydroxylation may be substrate controlled. PMID:16346279

  13. Engineering the Soil Bacterium Pseudomonas putida for Arsenic Methylation

    PubMed Central

    Chen, Jian; Qin, Jie; Zhu, Yong-Guan; de Lorenzo, Víctor

    2013-01-01

    Accumulation of arsenic has potential health risks through consumption of food. Here, we inserted the arsenite [As(III)] S-adenosylmethionine methyltransferase (ArsM) gene into the chromosome of Pseudomonas putida KT2440. Recombinant bacteria methylate inorganic arsenic into less toxic organoarsenicals. This has the potential for bioremediation of environmental arsenic and reducing arsenic contamination in food. PMID:23645194

  14. Decolorization of anaerobically digested molasses spent wash by Pseudomonas putida.

    PubMed

    Ghosh, M; Ganguli, A; Tripathi, A K

    2009-01-01

    The distillery wastewater (spent wash) contains dark-brown colored recalcitrant organic compounds that are not amenable to conventional biological treatment. The characteristic recalcitrance to decolorization is due to the presence of brown melanoidin polymers. In the present study, feasibility of using Pseudomonas putida strain U for decolorization of spent wash was demonstrated. Batch cultures of P. putida decolourized spent wash by 24%, 2- fold higher decolorization was achieved following immobilization in calcium alginate beads. Glucose concentration was critical for decolourization and improved color removal efficiency was obtained by periodic replenishment of glucose. Decolourization was also observed with lactose or whey as alternative carbon sources. The results of our study suggest that P. putida could be used for biological decolorization of molasses spent washes and that supplementation with whey (a by-product from cheese industry) can offer economical viability to the process.

  15. Mechanisms of resistance to fluoroquinolones and carbapenems in Pseudomonas putida.

    PubMed

    Horii, Toshinobu; Muramatsu, Hideaki; Iinuma, Yoshitsugu

    2005-10-01

    Pseudomonas putida is an uncommon opportunistic pathogen, usually susceptible to antimicrobial agents. Data concerning resistance to antimicrobial agents in clinical P. putida isolates are limited. Susceptibilities to fluoroquinolones, carbapenems and other antibiotics were characterized in five clinical isolates of P. putida recovered from different patients with urinary tract infections as causative pathogens. Fluoroquinolone and carbapenem resistance were characterized genetically by the methods of PCR and DNA sequencing. Outer membrane protein (OMP) profiles were characterized by SDS-PAGE. Four of five isolates were resistant or intermediate to both fluoroquinolones and carbapenems. Nucleotide sequences in the quinolone resistance-determining regions suggested that amino acid mutations such as Thr-83-->Ile in GyrA and Glu-469-->Asp in GyrB may contribute to high resistance to fluoroquinolones. Four metallo-beta-lactamase-producing isolates that showed resistance to carbapenems carried the IMP-type metallo-beta-lactamase genes. A combined effect of reduced production of 46 kDa OMP and metallo-beta-lactamase production was shown by a P. putida isolate exhibiting the highest MICs of carbapenems. This study identified mechanisms of resistance to fluoroquinolones and carbapenems in clinical P. putida isolates.

  16. Bioremediation of p-Nitrophenol by Pseudomonas putida 1274 strain

    PubMed Central

    2014-01-01

    Background p-Nitrophenol (PNP) occurs as contaminants of industrial effluents and it is the most important environmental pollutant and causes significant health and environmental risks, because it is toxic to many living organisms. Nevertheless, the information regarding PNP degradation pathways and their enzymes remain limited. Objective To evaluate the efficacy of the Pseudomonas Putida 1274 for removal of PNP. Methods P. putida MTCC 1274 was obtained from MTCC Chandigarh, India and cultured in the minimal medium in the presence of PNP. PNP degradation efficiency was compared under different pH and temperature ranges. The degraded product was isolated and analyzed with different chromatographic and spectroscopic techniques. Results P. putida 1274 shows good growth and PNP degradation at 37°C in neutral pH. Acidic and alkali pH retarded the growth of P. putida as well as the PNP degradation. On the basis of specialized techniques, hydroquinone was identified as major degraded product. The pathway was identified for the biodegradation of PNP. It involved initial removal of the nitrate group and formation of hydroquinone as one of the intermediates. Conclusion Our results suggested that P. putida 1274 strain would be a suitable aspirant for bioremediation of nitro-aromatic compounds contaminated sites in the environment. PMID:24581307

  17. Production of selenium nanoparticles in Pseudomonas putida KT2440.

    PubMed

    Avendaño, Roberto; Chaves, Nefertiti; Fuentes, Paola; Sánchez, Ethel; Jiménez, Jose I; Chavarría, Max

    2016-11-15

    Selenium (Se) is an essential element for the cell that has multiple applications in medicine and technology; microorganisms play an important role in Se transformations in the environment. Here we report the previously unidentified ability of the soil bacterium Pseudomonas putida KT2440 to synthesize nanoparticles of elemental selenium (nano-Se) from selenite. Our results show that P. putida is able to reduce selenite aerobically, but not selenate, to nano-Se. Kinetic analysis indicates that, in LB medium supplemented with selenite (1 mM), reduction to nano-Se occurs at a rate of 0.444 mmol L(-1) h(-1) beginning in the middle-exponential phase and with a final conversion yield of 89%. Measurements with a transmission electron microscope (TEM) show that nano-Se particles synthesized by P. putida have a size range of 100 to 500 nm and that they are located in the surrounding medium or bound to the cell membrane. Experiments involving dynamic light scattering (DLS) show that, in aqueous solution, recovered nano-Se particles have a size range of 70 to 360 nm. The rapid kinetics of conversion, easy retrieval of nano-Se and the metabolic versatility of P. putida offer the opportunity to use this model organism as a microbial factory for production of selenium nanoparticles.

  18. Production of selenium nanoparticles in Pseudomonas putida KT2440

    PubMed Central

    Avendaño, Roberto; Chaves, Nefertiti; Fuentes, Paola; Sánchez, Ethel; Jiménez, Jose I.; Chavarría, Max

    2016-01-01

    Selenium (Se) is an essential element for the cell that has multiple applications in medicine and technology; microorganisms play an important role in Se transformations in the environment. Here we report the previously unidentified ability of the soil bacterium Pseudomonas putida KT2440 to synthesize nanoparticles of elemental selenium (nano-Se) from selenite. Our results show that P. putida is able to reduce selenite aerobically, but not selenate, to nano-Se. Kinetic analysis indicates that, in LB medium supplemented with selenite (1 mM), reduction to nano-Se occurs at a rate of 0.444 mmol L−1 h−1 beginning in the middle-exponential phase and with a final conversion yield of 89%. Measurements with a transmission electron microscope (TEM) show that nano-Se particles synthesized by P. putida have a size range of 100 to 500 nm and that they are located in the surrounding medium or bound to the cell membrane. Experiments involving dynamic light scattering (DLS) show that, in aqueous solution, recovered nano-Se particles have a size range of 70 to 360 nm. The rapid kinetics of conversion, easy retrieval of nano-Se and the metabolic versatility of P. putida offer the opportunity to use this model organism as a microbial factory for production of selenium nanoparticles. PMID:27845437

  19. Efficient recombinant production of prodigiosin in Pseudomonas putida

    PubMed Central

    Domröse, Andreas; Klein, Andreas S.; Hage-Hülsmann, Jennifer; Thies, Stephan; Svensson, Vera; Classen, Thomas; Pietruszka, Jörg; Jaeger, Karl-Erich; Drepper, Thomas; Loeschcke, Anita

    2015-01-01

    Serratia marcescens and several other bacteria produce the red-colored pigment prodigiosin which possesses bioactivities as an antimicrobial, anticancer, and immunosuppressive agent. Therefore, there is a great interest to produce this natural compound. Efforts aiming at its biotechnological production have so far largely focused on the original producer and opportunistic human pathogen S. marcescens. Here, we demonstrate efficient prodigiosin production in the heterologous host Pseudomonas putida. Random chromosomal integration of the 21 kb prodigiosin biosynthesis gene cluster of S. marcescens in P. putida KT2440 was employed to construct constitutive prodigiosin production strains. Standard cultivation parameters were optimized such that titers of 94 mg/L culture were obtained upon growth of P. putida at 20°C using rich medium under high aeration conditions. Subsequently, a novel, fast and effective protocol for prodigiosin extraction and purification was established enabling the straightforward isolation of prodigiosin from P. putida growth medium. In summary, we describe here a highly efficient method for the heterologous biosynthetic production of prodigiosin which may serve as a basis to produce large amounts of this bioactive natural compound and may provide a platform for further in-depth studies of prodiginine biosynthesis. PMID:26441905

  20. Acyloin formation by benzoylformate decarboxylase from Pseudomonas putida.

    PubMed Central

    Wilcocks, R; Ward, O P; Collins, S; Dewdney, N J; Hong, Y; Prosen, E

    1992-01-01

    Whole cells and cell extracts of Pseudomonas putida grown in a medium containing ammonium mandelate have the capacity to produce the acyloin compound 2-hydroxypropiophenone when incubated with benzoylformate and acetaldehyde. Benzaldehyde and benzyl alcohol were formed as reaction by-products. The enantiomeric excess of the 2-hydroxypropiophenone product was found to be 91 to 92%. The absolute configuration of the enzymatically prepared product at the carbinol carbon was found to be S. The thiamine PPi-linked enzyme benzoylformate decarboxylase, purified to give a single protein band on polyacrylamide gel electrophoresis, was shown to be responsible for the catalysis of this novel condensation reaction. Images PMID:1622241

  1. Specific Gene Loci of Clinical Pseudomonas putida Isolates

    PubMed Central

    Molina, Lázaro; Udaondo, Zulema; Duque, Estrella; Fernández, Matilde; Bernal, Patricia; Roca, Amalia; de la Torre, Jesús; Ramos, Juan Luis

    2016-01-01

    Pseudomonas putida are ubiquitous inhabitants of soils and clinical isolates of this species have been seldom described. Clinical isolates show significant variability in their ability to cause damage to hosts because some of them are able to modulate the host’s immune response. In the current study, comparisons between the genomes of different clinical and environmental strains of P. putida were done to identify genetic clusters shared by clinical isolates that are not present in environmental isolates. We show that in clinical strains specific genes are mostly present on transposons, and that this set of genes exhibit high identity with genes found in pathogens and opportunistic pathogens. The set of genes prevalent in P. putida clinical isolates, and absent in environmental isolates, are related with survival under oxidative stress conditions, resistance against biocides, amino acid metabolism and toxin/antitoxin (TA) systems. This set of functions have influence in colonization and survival within human tissues, since they avoid host immune response or enhance stress resistance. An in depth bioinformatic analysis was also carried out to identify genetic clusters that are exclusive to each of the clinical isolates and that correlate with phenotypical differences between them, a secretion system type III-like was found in one of these clinical strains, a determinant of pathogenicity in Gram-negative bacteria. PMID:26820467

  2. Genome features of Pseudomonas putida LS46, a novel polyhydroxyalkanoate producer and its comparison with other P. putida strains

    PubMed Central

    2014-01-01

    A novel strain of Pseudomonas putida LS46 was isolated from wastewater on the basis of its ability to synthesize medium chain-length polyhydroxyalkanoates (mcl-PHAs). P.putida LS46 was differentiated from other P.putida strains on the basis of cpn60 (UT). The complete genome of P.putida LS46 was sequenced and annotated. Its chromosome is 5,86,2556 bp in size with GC ratio of 61.69. It is encoding 5316 genes, including 7 rRNA genes and 76 tRNA genes. Nucleotide sequence data of the complete P. putida LS46 genome was compared with nine other P. putida strains (KT2440, F1, BIRD-1, S16, ND6, DOT-T1E, UW4, W619 and GB-1) identified either as biocontrol agents or as bioremediation agents and isolated from different geographical region and different environment. BLASTn analysis of whole genome sequences of the ten P. putida strains revealed nucleotide sequence identities of 86.54 to 97.52%. P.putida genome arrangement was LS46 highly similar to P.putida BIRD1 and P.putida ND6 but was markedly different than P.putida DOT-T1E, P.putida UW4 and P.putida W619. Fatty acid biosynthesis (fab), fatty acid degradation (fad) and PHA synthesis genes were highly conserved among biocontrol and bioremediation P.putida strains. Six genes in pha operon of P. putida LS46 showed >98% homology at gene and proteins level. It appears that polyhydroxyalkanoate (PHA) synthesis is an intrinsic property of P. putida and was not affected by its geographic origin. However, all strains, including P. putida LS46, were different from one another on the basis of house keeping genes, and presence of plasmid, prophages, insertion sequence elements and genomic islands. While P. putida LS46 was not selected for plant growth promotion or bioremediation capacity, its genome also encoded genes for root colonization, pyoverdine synthesis, oxidative stress (present in other soil isolates), degradation of aromatic compounds, heavy metal resistance and nicotinic acid degradation, manganese (Mn II) oxidation

  3. Repeated batch and continuous degradation of chlorpyrifos by Pseudomonas putida.

    PubMed

    Pradeep, Vijayalakshmi; Subbaiah, Usha Malavalli

    2015-01-01

    The present study was undertaken with the objective of studying repeated batch and continuous degradation of chlorpyrifos (O,O-diethyl O-3,5,6-trichloropyridin-2-yl phosphorothioate) using Ca-alginate immobilized cells of Pseudomonas putida isolated from an agricultural soil, and to study the genes and enzymes involved in degradation. The study was carried out to reduce the toxicity of chlorpyrifos by degrading it to less toxic metabolites. Long-term stability of pesticide degradation was studied during repeated batch degradation of chlorpyrifos, which was carried out over a period of 50 days. Immobilized cells were able to show 65% degradation of chlorpyrifos at the end of the 50th cycle with a cell leakage of 112 × 10(3) cfu mL(-1). During continuous treatment, 100% degradation was observed at 100 mL h(-1) flow rate with 2% chlorpyrifos, and with 10% concentration of chlorpyrifos 98% and 80% degradation was recorded at 20 mL h(-1) and 100 mL h(-1) flow rate respectively. The products of degradation detected by liquid chromatography-mass spectrometry analysis were 3,5,6-trichloro-2-pyridinol and chlorpyrifos oxon. Plasmid curing experiments with ethidium bromide indicated that genes responsible for the degradation of chlorpyrifos are present on the chromosome and not on the plasmid. The results of Polymerase chain reaction indicate that a ~890-bp product expected for mpd gene was present in Ps. putida. Enzymatic degradation studies indicated that the enzymes involved in the degradation of chlorpyrifos are membrane-bound. The study indicates that immobilized cells of Ps. putida have the potential to be used in bioremediation of water contaminated with chlorpyrifos.

  4. Identification and transcriptional profiling of Pseudomonas putida genes involved in furoic acid metabolism

    USDA-ARS?s Scientific Manuscript database

    Furfural (2-furaldehyde) is a furan formed by dehydration of pentose sugars. Pseudomonas putida Fu1 metabolizes furfural through a pathway involving conversion to 2-oxoglutarate, via 2-furoic acid and Coenzyme A intermediates. To identify genes involved in furan metabolism, two P. putida transposo...

  5. Adaptation of Pseudomonas putida S12 to high concentrations of styrene and other organic solvents.

    PubMed Central

    Weber, F J; Ooijkaas, L P; Schemen, R M; Hartmans, S; de Bont, J A

    1993-01-01

    Pseudomonas putida S12 could adapt to grow on styrene in a two-phase styrene-water system. Acetate was toxic for P. putida S12, but cells were similarly able to adapt to higher acetate concentrations. Only by using these acetate-adapted cells was growth observed in the presence of supersaturating concentrations of toxic nonmetabolizable solvents such as toluene. PMID:8250572

  6. Conversion of levoglucosan and cellobiosan by Pseudomonas putida KT2440

    DOE PAGES

    Linger, Jeffrey G.; Hobdey, Sarah E.; Franden, Mary Ann; ...

    2016-02-02

    Pyrolysis offers a straightforward approach for the deconstruction of plant cell wall polymers into bio-oil. Recently, there has been substantial interest in bio-oil fractionation and subsequent use of biological approaches to selectively upgrade some of the resulting fractions. A fraction of particular interest for biological upgrading consists of polysaccharide-derived substrates including sugars and sugar dehydration products such as levoglucosan and cellobiosan, which are two of the most abundant pyrolysis products of cellulose. Levoglucosan can be converted to glucose-6-phosphate through the use of a levoglucosan kinase (LGK), but to date, the mechanism for cellobiosan utilization has not been demonstrated. Here, wemore » engineer the microbe Pseudomonas putida KT2440 to use levoglucosan as a sole carbon and energy source through LGK integration. Furthermore, we demonstrate that cellobiosan can be enzymatically converted to levoglucosan and glucose with β-glucosidase enzymes from both Glycoside Hydrolase Family 1 and Family 3. β-glucosidases are commonly used in both natural and industrial cellulase cocktails to convert cellobiose to glucose to relieve cellulase product inhibition and to facilitate microbial uptake of glucose. Using an exogenous β-glucosidase, we demonstrate that the engineered strain of P. putida can grow on levoglucosan up to 60 g/L and can also utilize cellobiosan. Overall, this study elucidates the biological pathway to co-utilize levoglucosan and cellobiosan, which will be a key transformation for the biological upgrading of pyrolysis-derived substrates.« less

  7. Toluene Diffusion and Reaction in Unsaturated Pseudomonas putida Biofilms

    PubMed Central

    Holden, Patricia A.; Hunt, James R.; Firestone, Mary K.

    2010-01-01

    Biofilms are frequently studied in the context of submerged or aquatic systems. However, much less is known about biofilms in unsaturated systems, despite their importance to such processes as food spoilage, terrestrial nutrient cycling, and biodegradation of environmental pollutants in soils. Using modeling and experimentation, we have described the biodegradation of toluene in unsaturated media by bacterial biofilms as a function of matric water potential, a dominant variable in unsaturated systems. We experimentally determined diffusion and kinetic parameters for Pseudomonas putida biofilms, then predicted biodegradation rates over a range of matric water potentials. For validation, we measured the rate of toluene depletion by intact biofilms and found the results to reasonably follow the model predictions. The diffusion coefficient for toluene through unsaturated P. putida biofilm averaged 1.3 × 10−7 cm2/s, which is approximately two orders of magnitude lower than toluene diffusivity in water. Our studies show that, at the scale of the microbial biofilm, the diffusion of toluene to biodegrading bacteria can limit the overall rate of biological toluene depletion in unsaturated systems. PMID:18642338

  8. Biofilm formation-defective mutants in Pseudomonas putida.

    PubMed

    López-Sánchez, Aroa; Leal-Morales, Antonio; Jiménez-Díaz, Lorena; Platero, Ana I; Bardallo-Pérez, Juan; Díaz-Romero, Alberto; Acemel, Rafael D; Illán, Juan M; Jiménez-López, Julia; Govantes, Fernando

    2016-07-01

    Out of 8000 candidates from a genetic screening for Pseudomonas putida KT2442 mutants showing defects in biofilm formation, 40 independent mutants with diminished levels of biofilm were analyzed. Most of these mutants carried insertions in genes of the lap cluster, whose products are responsible for synthesis, export and degradation of the adhesin LapA. All mutants in this class were strongly defective in biofilm formation. Mutants in the flagellar regulatory genes fleQ and flhF showed similar defects to that of the lap mutants. On the contrary, transposon insertions in the flagellar structural genes fliP and flgG, that also impair flagellar motility, had a modest defect in biofilm formation. A mutation in gacS, encoding the sensor element of the GacS/GacA two-component system, also had a moderate effect on biofilm formation. Additional insertions targeted genes involved in cell envelope function: PP3222, encoding the permease element of an ABC-type transporter and tolB, encoding the periplasmic component of the Tol-OprL system required for outer membrane stability. Our results underscore the central role of LapA, suggest cross-regulation between motility and adhesion functions and provide insights on the role of cell envelope trafficking and maintenance for biofilm development in P. putida.

  9. Camphor Plasmid-Mediated Chromosomal Transfer in Pseudomonas putida

    PubMed Central

    Shaham, M.; Chakrabarty, A. M.; Gunsalus, I. C.

    1973-01-01

    Camphor-utilizing strains of Pseudomonas putida have been shown to carry the genetic information required for camphor degradation on a plasmid. The plasmid-carrying strains can serve as donors of both plasmid-borne and chromosomal genes. As recipients, plasmid-deleted strains are much superior to those carrying the camphor pathway genes. The transfer frequency of chromosomal, but not plasmid-borne, genes is markedly enhanced if the donor cells are irradiated with ultraviolet light followed by 3-h of growth on a rich medium in the dark. Recombinants selected for prototrophy are stable and most acquire the camphor (CAM) plasmid concomitantly; only a few of the Cam+ recombinants inherit the donor's ability to transfer chromosomal genes at a high frequency. Transfer-defective mutations occur on the CAM plasmid, affecting both CAM and chromosomal gene transfer. PMID:4745436

  10. Responses of Pseudomonas putida to toxic aromatic carbon sources.

    PubMed

    Krell, Tino; Lacal, Jesús; Guazzaroni, M Eugenia; Busch, Andreas; Silva-Jiménez, Hortencia; Fillet, Sandy; Reyes-Darías, José A; Muñoz-Martínez, Francisco; Rico-Jiménez, Miriam; García-Fontana, Cristina; Duque, Estrella; Segura, Ana; Ramos, Juan-Luis

    2012-07-31

    A number of bacteria can use toxic compounds as carbon sources and have developed complex regulatory networks to protect themselves from the toxic effects of these compounds as well as to benefit from their nutritious properties. As a model system we have studied the responses of Pseudomonas putida strains to toluene. Although this compound is highly toxic, several strains are able to use it for growth. Particular emphasis was given to the responses in the context of taxis, resistance and toluene catabolism. P. putida strains analysed showed chemotactic movements towards toluene. Strain DOT-T1E was characterised by an extreme form of chemotaxis, termed hyperchemotaxis, which is mediated by the McpT chemoreceptor encoded by plasmid pGRT1. Close McpT homologs are found in a number of other plasmids encoding degradation pathways of toxic compounds. The pGRT1 plasmid harbours also the genes for the TtgGHI efflux pump which was identified as the primary determinant for the resistance of strain DOT-T1E towards toluene. Pump expression is controlled by the TtgV repressor in response to a wide range of different mono- and biaromatic compounds. Strain DOT-T1E is able to degrade toluene, benzene and ethylbenzene via the toluene dioxygenase (TOD) pathway. The expression of the pathway operon is controlled by the TodS/T two component system. The sensor kinase TodS recognizes toluene with nanomolar affinity, which in turn triggers an increase in its autophosphorylation and consequently transcriptional activation. Data suggest that transcriptional activation of the TOD pathway occurs at very low toluene concentrations whereas TtgV mediated induction of pump expression sets in as the toluene concentration further increases.

  11. Isolation and characterization of group II introns from Pseudomonas alcaligenes and Pseudomonas putida.

    PubMed

    Yeo, C C; Yiin, S; Tan, B H; Poh, C L

    2001-05-01

    Group II introns isolated from Pseudomonas alcaligenes NCIB 9867, Pseudomonas putida NCIB 9869, and P. putida KT2440 were closely related with nucleotide sequence identities of between 87 and 96%. The genome of P. alcaligenes also harbored a truncated group II intron of 682 bp that lacks the gene for the intron-encoded protein (IEP). Unlike most bacterial group II introns, the Pseudomonas introns were found to lack the Zn domains in their IEPs, did not appear to interrupt any genes, and were located downstream of open reading frames which were adjacent to hairpin loop structures that resemble rho-independent terminators. These structures also contain the intron binding sites 1 and 2 (IBS1 and IBS2 sequences) that were required for intron target site recognition in transposition. One of the group II introns found in P. alcaligenes, Xln3, was shown to have transposed from the chromosome to the endogenous pRA2 plasmid at a site adjacent to IBS1- and IBS2-like sequences.

  12. Characterization of Pseudomonas putida Genes Responsive to Nutrient Limitation

    SciTech Connect

    Syn, Chris K.; Magnuson, Jon K.; Kingsley, Mark T.; Swarup, Sanjay

    2004-06-01

    The low bioavailability of nutrients and oxygen in the soil environment has hampered successful expression of biodegradation/biocontrol genes that are driven by promoters highly active during routine laboratory conditions of high nutrient- and oxygen-availability. Hence, in the present study, expression of the gus-tagged genes in 12 Tn5-gus mutants of the soil microbe Pseudomonas putida PNL-MK25 was examined under various conditions chosen to mimic the soil environment: low carbon, phosphate, nitrate, or oxygen, and in the rhizosphere. Based on their expression profiles, three nutrient-responsive mutant (NRM) strains, NRM5, NRM7, and NRM17, were selected for identification of the tagged genes. In the mutant strain NRM5, expression of the glutamate dehydrogenase (gdhA) gene was increased between 4.9- to 26.4-fold under various low nutrient conditions. In NRM7, expression of the novel NADPH:quinone oxidoreductase-like (nql) gene was consistently amongst the highest and was synergistically upregulated by low nutrient and anoxic conditions. The cyoD gene in NRM17, which encodes the fourth subunit of the cytochrome o ubiquinol oxidase complex, had decreased expression in low nutrient conditions but its absolute expression levels was still amongst the highest. Additionally, it was independent of oxygen availability, in contrast to that in E. coli.

  13. Physical Morphology and Surface Properties of Unsaturated Pseudomonas putida Biofilms

    PubMed Central

    Auerbach, Ilene D.; Sorensen, Cody; Hansma, Helen G.; Holden, Patricia A.

    2000-01-01

    Unsaturated biofilms of Pseudomonas putida, i.e., biofilms grown in humid air, were analyzed by atomic force microscopy to determine surface morphology, roughness, and adhesion forces in the outer and basal cell layers of fresh and desiccated biofilms. Desiccated biofilms were equilibrated with a 75.5% relative humidity atmosphere, which is far below the relative humidity of 98 to 99% at which these biofilms were cultured. In sharp contrast to the effects of drying on biofilms grown in fluid, we observed that drying caused little change in morphology, roughness, or adhesion forces in these unsaturated biofilms. Surface roughness for moist and dry biofilms increased approximately linearly with increasing scan sizes. This indicated that the divides between bacteria contributed more to overall roughness than did extracellular polymeric substances (EPS) on individual bacteria. The EPS formed higher-order structures we termed mesostructures. These mesostructures are much larger than the discrete polymers of glycolipids and proteins that have been previously characterized on the outer surface of these gram-negative bacteria. PMID:10850998

  14. A holistic view of polyhydroxyalkanoate metabolism in Pseudomonas putida.

    PubMed

    Prieto, Auxiliadora; Escapa, Isabel F; Martínez, Virginia; Dinjaski, Nina; Herencias, Cristina; de la Peña, Fernando; Tarazona, Natalia; Revelles, Olga

    2016-02-01

    Polyhydroxyalkanoate (PHA) metabolism has been traditionally considered as a futile cycle involved in carbon and energy storage. The use of cutting-edge technologies linked to systems biology has improved our understanding of the interaction between bacterial physiology, PHA metabolism and other cell functions in model bacteria such as Pseudomonas putida KT2440. PHA granules or carbonosomes are supramolecular complexes of biopolyester and proteins that are essential for granule segregation during cell division, and for the functioning of the PHA metabolic route as a continuous cycle. The simultaneous activities of PHA synthase and depolymerase ensure the carbon flow to the transient demand for metabolic intermediates to balance the storage and use of carbon and energy. PHA cycle also determines the number and size of bacterial cells. The importance of PHAs as nutrients for members of the microbial community different to those that produce them is illustrated here via examples of bacterial predators such as Bdellovibrio bacteriovorus that prey on PHA producers and produces specific extra-cellular depolymerases. PHA hydrolysis confers Bdellovibrio ecological advantages in terms of motility and predation efficiency, demonstrating the importance of PHA producers predation in population dynamics. Metabolic modulation strategies for broadening the portfolio of PHAs are summarized and their properties are compiled.

  15. Comparative genomics and functional analysis of niche-specific adaptation in Pseudomonas putida

    PubMed Central

    Wu, Xiao; Monchy, Sébastien; Taghavi, Safiyh; Zhu, Wei; Ramos, Juan; van der Lelie, Daniel

    2011-01-01

    Pseudomonas putida is a gram-negative rod-shaped gammaproteobacterium that is found throughout various environments. Members of the species P. putida show a diverse spectrum of metabolic activities, which is indicative of their adaptation to various niches, which includes the ability to live in soils and sediments contaminated with high concentrations of heavy metals and organic contaminants. Pseudomonas putida strains are also found as plant growth-promoting rhizospheric and endophytic bacteria. The genome sequences of several P. putida species have become available and provide a unique tool to study the specific niche adaptation of the various P. putida strains. In this review, we compare the genomes of four P. putida strains: the rhizospheric strain KT2440, the endophytic strain W619, the aromatic hydrocarbon-degrading strain F1 and the manganese-oxidizing strain GB-1. Comparative genomics provided a powerful tool to gain new insights into the adaptation of P. putida to specific lifestyles and environmental niches, and clearly demonstrated that horizontal gene transfer played a key role in this adaptation process, as many of the niche-specific functions were found to be encoded on clearly defined genomic islands. PMID:20796030

  16. Comparative genomics and functional analysis of niche-specific adaptation in Pseudomonas putida

    SciTech Connect

    Wu X.; van der Lelie D.; Monchy, S.; Taghavi, S.; Zhu, W.; Ramos, J.

    2011-03-01

    Pseudomonas putida is a gram-negative rod-shaped gammaproteobacterium that is found throughout various environments. Members of the species P. putida show a diverse spectrum of metabolic activities, which is indicative of their adaptation to various niches, which includes the ability to live in soils and sediments contaminated with high concentrations of heavy metals and organic contaminants. Pseudomonas putida strains are also found as plant growth-promoting rhizospheric and endophytic bacteria. The genome sequences of several P. putida species have become available and provide a unique tool to study the specific niche adaptation of the various P. putida strains. In this review, we compare the genomes of four P. putida strains: the rhizospheric strain KT2440, the endophytic strain W619, the aromatic hydrocarbon-degrading strain F1 and the manganese-oxidizing strain GB-1. Comparative genomics provided a powerful tool to gain new insights into the adaptation of P. putida to specific lifestyles and environmental niches, and clearly demonstrated that horizontal gene transfer played a key role in this adaptation process, as many of the niche-specific functions were found to be encoded on clearly defined genomic islands.

  17. Survival of rifampin-resistant mutants of Pseudomonas fluorescens and Pseudomonas putida in soil systems.

    PubMed Central

    Compeau, G; Al-Achi, B J; Platsouka, E; Levy, S B

    1988-01-01

    The fate of spontaneous chromosomal rifampin-resistant (Rifr) mutants of Pseudomonas putida and Pseudomonas fluorescens in sterile and live organic soil from which they were isolated was studied. In sterile native-soil assays, a Rifr mutant of P. putida showed no decrease in competitive fitness when compared with the wild-type parent. However, mutants of P. fluorescens were of two general categories. Group 1 showed no difference from the wild type in terms of growth rate, competitive fitness, and membrane protein composition. Group 2 showed a slower growth rate in both minimal and enriched media and an altered membrane protein profile. These mutants also demonstrated decreased competitive fitness compared with the wild-type strain. In live soil, the Rifr P. putida strain persisted throughout the 38-day test period with a decay rate of 0.7 log10 CFU/g of soil per 10 days. A group 1 Rifr P. fluorescens mutant maintained its inoculated titer for 7 to 10 days and then decayed at a rate of 0.2 to 0.4 log10 CFU/g of soil per 10 days. A group 2 Rifr P. fluorescens mutant remained at its titer for 1 to 5 days before decaying at a two- to threefold-faster rate. These findings indicate that rifampin resistance may not be an innocuous mutation in some pseudomonads and that marked strains should be compared with wild-type parents before being used as monitors of parental strain survival. Colonization of sterile soil with either the wild-type or mutant strain precluded normal colonization of the second added strain.(ABSTRACT TRUNCATED AT 250 WORDS) Images PMID:3144244

  18. Physical Forces Shape Group Identity of Swimming Pseudomonas putida Cells

    PubMed Central

    Espeso, David R.; Martínez-García, Esteban; de Lorenzo, Víctor; Goñi-Moreno, Ángel

    2016-01-01

    The often striking macroscopic patterns developed by motile bacterial populations on agar plates are a consequence of the environmental conditions where the cells grow and spread. Parameters such as medium stiffness and nutrient concentration have been reported to alter cell swimming behavior, while mutual interactions among populations shape collective patterns. One commonly observed occurrence is the mutual inhibition of clonal bacteria when moving toward each other, which results in a distinct halt at a finite distance on the agar matrix before having direct contact. The dynamics behind this phenomenon (i.e., intolerance to mix in time and space with otherwise identical others) has been traditionally explained in terms of cell-to-cell competition/cooperation regarding nutrient availability. In this work, the same scenario has been revisited from an alternative perspective: the effect of the physical mechanics that frame the process, in particular the consequences of collisions between moving bacteria and the semi-solid matrix of the swimming medium. To this end, we set up a simple experimental system in which the swimming patterns of Pseudomonas putida were tested with different geometries and agar concentrations. A computational analysis framework that highlights cell-to-medium interactions was developed to fit experimental observations. Simulated outputs suggested that the medium is compressed in the direction of the bacterial front motion. This phenomenon generates what was termed a compression wave that goes through the medium preceding the swimming population and that determines the visible high-level pattern. Taken together, the data suggested that the mechanical effects of the bacteria moving through the medium created a factual barrier that impedes to merge with neighboring cells swimming from a different site. The resulting divide between otherwise clonal bacteria is thus brought about by physical forces—not genetic or metabolic programs. PMID

  19. Stabilization of creatinase from Pseudomonas putida by random mutagenesis.

    PubMed

    Schumann, J; Böhm, G; Schumacher, G; Rudolph, R; Jaenicke, R

    1993-10-01

    Creatinase (creatine amidinohydrolase, EC 3.5.3.3) from Pseudomonas putida is a homodimer of 45 kDa subunit molecular mass, the three-dimensional structure of which is known at 1.9 A resolution. Three point mutants, A109V, V355M, and V182I, as well as one double mutant combining A109V and V355M, and the triple mutant with all three replacements, were compared with wild-type creatinase regarding their physical and enzymological properties. High-resolution crystal data for wild-type creatinase and the first two mutants suggest isomorphism at least for these three proteins (R. Huber, pers. comm.). Physicochemical measurements confirm this prediction, showing that the mutations have no effect either on the quaternary structure and gross conformation or the catalytic properties as compared to wild-type creatinase. The replacement of V182 (at the solvent-exposed end of the first helix of the C-terminal domain) does not cause significant differences in comparison with the wild-type enzyme. The other point mutations stabilize the first step in the biphasic denaturation transition without affecting the second one. In sum, the enhanced stability seems to reflect slight improvements in the local packing without creating new well-defined bonds. The increase in hydrophobicity generated by the introduction of additional methyl groups (A109V, V182I) must be compensated by minor readjustments of the global structure. Secondary or quaternary interactions are not affected. In going from single to double and triple mutants, to a first approximation, the increments of stabilization are additive.

  20. Stabilization of creatinase from Pseudomonas putida by random mutagenesis.

    PubMed Central

    Schumann, J.; Böhm, G.; Schumacher, G.; Rudolph, R.; Jaenicke, R.

    1993-01-01

    Creatinase (creatine amidinohydrolase, EC 3.5.3.3) from Pseudomonas putida is a homodimer of 45 kDa subunit molecular mass, the three-dimensional structure of which is known at 1.9 A resolution. Three point mutants, A109V, V355M, and V182I, as well as one double mutant combining A109V and V355M, and the triple mutant with all three replacements, were compared with wild-type creatinase regarding their physical and enzymological properties. High-resolution crystal data for wild-type creatinase and the first two mutants suggest isomorphism at least for these three proteins (R. Huber, pers. comm.). Physicochemical measurements confirm this prediction, showing that the mutations have no effect either on the quaternary structure and gross conformation or the catalytic properties as compared to wild-type creatinase. The replacement of V182 (at the solvent-exposed end of the first helix of the C-terminal domain) does not cause significant differences in comparison with the wild-type enzyme. The other point mutations stabilize the first step in the biphasic denaturation transition without affecting the second one. In sum, the enhanced stability seems to reflect slight improvements in the local packing without creating new well-defined bonds. The increase in hydrophobicity generated by the introduction of additional methyl groups (A109V, V182I) must be compensated by minor readjustments of the global structure. Secondary or quaternary interactions are not affected. In going from single to double and triple mutants, to a first approximation, the increments of stabilization are additive. PMID:8251936

  1. Siderotyping of fluorescent pseudomonads: characterization of pyoverdines of Pseudomonas fluorescens and Pseudomonas putida strains from Antarctica.

    PubMed

    Meyer, J M; Stintzi, A; Coulanges, V; Shivaji, S; Voss, J A; Taraz, K; Budzikiewicz, H

    1998-11-01

    Five independent fluorescent pseudomonad isolates originating from Antarctica were analysed for their pyoverdine systems. A pyoverdine-related siderotyping, which involved pyoverdine-induced growth stimulation, pyoverdine-mediated iron uptake, pyoverdine analysis by electrophoresis and isoelectric focusing, revealed three different pyoverdine-related siderotypes among the five isolates. One siderotype, including Pseudomonas fluorescens 1W and P. fluorescens 10CW, was identical to that of P. fluorescens ATCC 13525. Two other strains, P. fluorescens 9AW and Pseudomonas putida 9BW, showed identical pyoverdine-related behaviour to each other, whereas the fifth strain, P. fluorescens 51W, had unique features compared to the other strains or to a set of 12 fluorescent Pseudomonas strains used as comparison material. Elucidation of the structure of the pyoverdines produced by the Antarctic strains supported the accuracy of the siderotyping methodology by confirming that pyoverdines from strains 1W and 10CW had the same structures as the P. fluorescens ATCC 13525 pyoverdine, whereas the 9AW and 9BW pyoverdines are probably identical with the pyoverdine of P. fluorescens strain 244. Pyoverdine from strain 51W appeared to be a novel pyoverdine since its structure was different from all previously established pyoverdine structures. Together with the conclusion that the Antarctic Pseudomonas strains have no special features at the level of their pyoverdines and pyoverdine-mediated iron metabolism compared to worldwide strains, the present work demonstrates that siderotyping provides a rapid means of screening for novel pyoverdines.

  2. Proteomic characterization of the outer membrane vesicle of Pseudomonas putida KT2440.

    PubMed

    Choi, Chi-Won; Park, Edmond Changkyun; Yun, Sung Ho; Lee, Sang-Yeop; Lee, Yeol Gyun; Hong, Yeonhee; Park, Kyeong Ryang; Kim, Sang-Hyun; Kim, Gun-Hwa; Kim, Seung Il

    2014-10-03

    Outer membrane vesicles (OMVs) are produced by various pathogenic Gram-negative bacteria such as Escherichia coli, Pseudomonas aeruginosa, and Acinetobacter baumannii. In this study, we isolated OMVs from a representative soil bacterium, Pseudomonas putida KT2440, which has a biodegradative activity toward various aromatic compounds. Proteomic analysis identified the outer membrane proteins (OMPs) OprC, OprD, OprE, OprF, OprH, OprG, and OprW as major components of the OMV of P. putida KT2440. The production of OMVs was dependent on the nutrient availability in the culture media, and the up- or down-regulation of specific OMPs was observed according to the culture conditions. In particular, porins (e.g., benzoate-specific porin, BenF-like porin) and enzymes (e.g., catechol 1,2-dioxygenase, benzoate dioxygenase) for benzoate degradation were uniquely found in OMVs prepared from P. putida KT2440 that were cultured in media containing benzoate as the energy source. OMVs of P. putida KT2440 showed low pathological activity toward cultured cells that originated from human lung cells, which suggests their potential as adjuvants or OMV vaccine carriers. Our results suggest that the protein composition of the OMVs of P. putida KT2440 reflects the characteristics of the total proteome of P. putida KT2440.

  3. De novo production of the monoterpenoid geranic acid by metabolically engineered Pseudomonas putida.

    PubMed

    Mi, Jia; Becher, Daniela; Lubuta, Patrice; Dany, Sarah; Tusch, Kerstin; Schewe, Hendrik; Buchhaupt, Markus; Schrader, Jens

    2014-12-04

    Production of monoterpenoids as valuable chemicals using recombinant microbes is a growing field of interest. Unfortunately, antimicrobial activity of most monoterpenoids hampers a wide application of microorganisms for their production. Strains of Pseudomonas putida, a fast growing and metabolically versatile bacterium, often show an outstanding high tolerance towards organic solvents and other toxic compounds. Therefore, Pseudomonas putida constitutes an attractive alternative host in comparison to conventionally used microorganisms. Here, metabolic engineering of solvent tolerant Pseudomonas putida as a novel microbial cell factory for de novo production of monoterpenoids is reported for the first time, exemplified by geranic acid production from glycerol as carbon source. The monoterpenoic acid is an attractive compound for application in the flavor, fragrance, cosmetics and agro industries. A comparison between Escherichia coli, Saccharomyces cerevisiae and Pseudomonas putida concerning the ability to grow in the presence of geranic acid revealed that the pseudomonad bears a superior resilience compared to the conventionally used microbes. Moreover, Pseudomonas putida DSM 12264 wildtype strain efficiently oxidized externally added geraniol to geranic acid with no further degradation. Omitting external dosage of geraniol but functionally expressing geraniol synthase (GES) from Ocimum basilicum, a first proof-of-concept for de novo biosynthesis of 1.35 mg/L geranic acid in P. putida DSM 12264 was achieved. Doubling the amount of glycerol resulted in twice the amount of product. Co-expression of the six genes of the mevalonate pathway from Myxococcus xanthus to establish flux from acetyl-CoA to the universal terpenoid precursor isopentenylpyrophosphate yielded 36 mg/L geranic acid in shake flask experiments. In the bioreactor, the recombinant strain produced 193 mg/L of geranic acid under fed-batch conditions within 48 h. Metabolic engineering turned Pseudomonas

  4. Iron Uptake Analysis in a Set of Clinical Isolates of Pseudomonas putida

    PubMed Central

    Molina, Lázaro; Geoffroy, Valérie A.; Segura, Ana; Udaondo, Zulema; Ramos, Juan-Luis

    2016-01-01

    Pseudomonas putida strains are frequent inhabitants of soil and aquatic niches and they are occasionally isolated from hospital environments. As the available iron sources in human tissues, edaphic, and aquatic niches are different, we have analyzed iron-uptake related genes in different P. putida strains that were isolated from all these environments. We found that these isolates can be grouped into different clades according to the genetics of siderophore biosynthesis and recycling. The pyoverdine locus of the six P. putida clinical isolates that have so far been completely sequenced, are not closely related; three strains (P. putida HB13667, HB3267, and NBRC14164T) are grouped in Clade I and the other three in Clade II, suggesting possible different origins and evolution. In one clinical strain, P. putida HB4184, the production of siderophores is induced under high osmolarity conditions. The pyoverdine locus in this strain is closely related to that of strain P. putida HB001 which was isolated from sandy shore soil of the Yellow Sea in Korean marine sand, suggesting their possible origin, and evolution. The acquisition of two unique TonB-dependent transporters for xenosiderophore acquisition, similar to those existing in the opportunistic pathogen P. aeruginosa PAO, is an interesting adaptation trait of the clinical strain P. putida H8234 that may confer adaptive advantages under low iron availability conditions. PMID:28082966

  5. Iron Uptake Analysis in a Set of Clinical Isolates of Pseudomonas putida.

    PubMed

    Molina, Lázaro; Geoffroy, Valérie A; Segura, Ana; Udaondo, Zulema; Ramos, Juan-Luis

    2016-01-01

    Pseudomonas putida strains are frequent inhabitants of soil and aquatic niches and they are occasionally isolated from hospital environments. As the available iron sources in human tissues, edaphic, and aquatic niches are different, we have analyzed iron-uptake related genes in different P. putida strains that were isolated from all these environments. We found that these isolates can be grouped into different clades according to the genetics of siderophore biosynthesis and recycling. The pyoverdine locus of the six P. putida clinical isolates that have so far been completely sequenced, are not closely related; three strains (P. putida HB13667, HB3267, and NBRC14164T) are grouped in Clade I and the other three in Clade II, suggesting possible different origins and evolution. In one clinical strain, P. putida HB4184, the production of siderophores is induced under high osmolarity conditions. The pyoverdine locus in this strain is closely related to that of strain P. putida HB001 which was isolated from sandy shore soil of the Yellow Sea in Korean marine sand, suggesting their possible origin, and evolution. The acquisition of two unique TonB-dependent transporters for xenosiderophore acquisition, similar to those existing in the opportunistic pathogen P. aeruginosa PAO, is an interesting adaptation trait of the clinical strain P. putida H8234 that may confer adaptive advantages under low iron availability conditions.

  6. Comparative genomics of an endophytic Pseudomonas putida isolated from mango orchard.

    PubMed

    Asif, Huma; Studholme, David J; Khan, Asifullah; Aurongzeb, M; Khan, Ishtiaq A; Azim, M Kamran

    2016-01-01

    We analyzed the genome sequence of an endophytic bacterial strain Pseudomonas putida TJI51 isolated from mango bark tissues. Next generation DNA sequencing and short read de novo assembly generated the 5,805,096 bp draft genome of P. putida TJI51. Out of 6,036 protein coding genes in P. putida TJI51 sequences, 4,367 (72%) were annotated with functional specifications, while the remaining encoded hypothetical proteins. Comparative genome sequence analysis revealed that the P. putida TJI51genome contains several regions, not identified in so far sequenced P. putida genomes. Some of these regions were predicted to encode enzymes, including acetylornithine deacetylase, betaine aldehyde dehydrogenase, aldehyde dehydrogenase, benzoylformate decarboxylase, hydroxyacylglutathione hydrolase, and uroporphyrinogen decarboxylase. The genome of P. putida TJI51 contained three nonribosomal peptide synthetase gene clusters. Genome sequence analysis of P. putidaTJI51 identified this bacterium as an endophytic resident. The endophytic fitness might be linked with alginate, which facilitates bacterial colonization in plant tissues. Genome sequence analysis shed light on the presence of a diverse spectrum of metabolic activities and adaptation of this isolate to various niches.

  7. Comparative genomics of an endophytic Pseudomonas putida isolated from mango orchard

    PubMed Central

    Asif, Huma; Studholme, David J.; Khan, Asifullah; Aurongzeb, M.; Khan, Ishtiaq A.; Azim, M. Kamran

    2016-01-01

    Abstract We analyzed the genome sequence of an endophytic bacterial strain Pseudomonas putida TJI51 isolated from mango bark tissues. Next generation DNA sequencing and short read de novo assembly generated the 5,805,096 bp draft genome of P. putida TJI51. Out of 6,036 protein coding genes in P. putida TJI51 sequences, 4,367 (72%) were annotated with functional specifications, while the remaining encoded hypothetical proteins. Comparative genome sequence analysis revealed that the P. putida TJI51genome contains several regions, not identified in so far sequenced P. putida genomes. Some of these regions were predicted to encode enzymes, including acetylornithine deacetylase, betaine aldehyde dehydrogenase, aldehyde dehydrogenase, benzoylformate decarboxylase, hydroxyacylglutathione hydrolase, and uroporphyrinogen decarboxylase. The genome of P. putida TJI51 contained three nonribosomal peptide synthetase gene clusters. Genome sequence analysis of P. putidaTJI51 identified this bacterium as an endophytic resident. The endophytic fitness might be linked with alginate, which facilitates bacterial colonization in plant tissues. Genome sequence analysis shed light on the presence of a diverse spectrum of metabolic activities and adaptation of this isolate to various niches. PMID:27560648

  8. Acute toxic effects of three pesticides on Pseudomonas putida monitored by microcalorimeter.

    PubMed

    Chen, Hui-Lun; Yao, Jun; Wang, Fei; Bramanti, Emilia; Maskow, Thomas; Zaray, Gyula

    2009-02-01

    A series of calorimetric experiments were performed to investigate the toxic effects of beta-cypermethrin (BCP), bensulfuron-methyl (BSM) and prometryne (PM) on Pseudomonas putida (P. putida). The metabolic action of P. putida on the three pesticides was studied by obtaining power-time curves. The growth of P. putida was inhibited completely in each case when the concentrations of pesticides were up to 80 micro g mL(- 1). The relationships between the inhibitory ratio (k) and doses of contaminants were approximately linear for the three pesticides. The total heat dissipated per milliliter (Q(total)) for the pesticides decreased during the course of the experiment. The OD(600) of P. putida growth in the absence and presence of pesticides was also obtained. The power-time curves of P. putida growth coincided with its turbidity curves. This elucidates that microcalorimetric method agrees well with the routine microbiological method. Among these three pesticides, BSM was found to be the most toxic with an IC(50) of 19.24 micro g mL(- 1) against P. putida. PM exhibited moderate virulence with an IC(50) of 27.86 micro g mL(- 1) and BCP had the lowest toxicity with an IC(50) of 39.64 micro g mL(- 1).

  9. Engineering mediator-based electroactivity in the obligate aerobic bacterium Pseudomonas putida KT2440

    PubMed Central

    Schmitz, Simone; Nies, Salome; Wierckx, Nick; Blank, Lars M.; Rosenbaum, Miriam A.

    2015-01-01

    Pseudomonas putida strains are being developed as microbial production hosts for production of a range of amphiphilic and hydrophobic biochemicals. P. putida's obligate aerobic growth thereby can be an economical and technical challenge because it requires constant rigorous aeration and often causes reactor foaming. Here, we engineered a strain of P. putida KT2440 that can produce phenazine redox-mediators from Pseudomonas aeruginosa to allow partial redox balancing with an electrode under oxygen-limited conditions. P. aeruginosa is known to employ its phenazine-type redox mediators for electron exchange with an anode in bioelectrochemical systems (BES). We transferred the seven core phenazine biosynthesis genes phzA-G and the two specific genes phzM and phzS required for pyocyanin synthesis from P. aeruginosa on two inducible plasmids into P. putida KT2440. The best clone, P. putida pPhz, produced 45 mg/L pyocyanin over 25 h of growth, which was visible as blue color formation and is comparable to the pyocyanin production of P. aeruginosa. This new strain was then characterized under different oxygen-limited conditions with electrochemical redox control and changes in central energy metabolism were evaluated in comparison to the unmodified P. putida KT2440. In the new strain, phenazine synthesis with supernatant concentrations up to 33 μg/mL correlated linearly with the ability to discharge electrons to an anode, whereby phenazine-1-carboxylic acid served as the dominating redox mediator. P. putida pPhz sustained strongly oxygen-limited metabolism for up to 2 weeks at up to 12 μA/cm2 anodic current density. Together, this work lays a foundation for future oxygen-limited biocatalysis with P. putida strains. PMID:25914687

  10. Comparative genomic and functional analyses: unearthing the diversity and specificity of nematicidal factors in Pseudomonas putida strain 1A00316

    PubMed Central

    Guo, Jing; Jing, Xueping; Peng, Wen-Lei; Nie, Qiyu; Zhai, Yile; Shao, Zongze; Zheng, Longyu; Cai, Minmin; Li, Guangyu; Zuo, Huaiyu; Zhang, Zhitao; Wang, Rui-Ru; Huang, Dian; Cheng, Wanli; Yu, Ziniu; Chen, Ling-Ling; Zhang, Jibin

    2016-01-01

    We isolated Pseudomonas putida (P. putida) strain 1A00316 from Antarctica. This bacterium has a high efficiency against Meloidogyne incognita (M. incognita) in vitro and under greenhouse conditions. The complete genome of P. putida 1A00316 was sequenced using PacBio single molecule real-time (SMRT) technology. A comparative genomic analysis of 16 Pseudomonas strains revealed that although P. putida 1A00316 belonged to P. putida, it was phenotypically more similar to nematicidal Pseudomonas fluorescens (P. fluorescens) strains. We characterized the diversity and specificity of nematicidal factors in P. putida 1A00316 with comparative genomics and functional analysis, and found that P. putida 1A00316 has diverse nematicidal factors including protein alkaline metalloproteinase AprA and two secondary metabolites, hydrogen cyanide and cyclo-(l-isoleucyl-l-proline). We show for the first time that cyclo-(l-isoleucyl-l-proline) exhibit nematicidal activity in P. putida. Interestingly, our study had not detected common nematicidal factors such as 2,4-diacetylphloroglucinol (2,4-DAPG) and pyrrolnitrin in P. putida 1A00316. The results of the present study reveal the diversity and specificity of nematicidal factors in P. putida strain 1A00316. PMID:27384076

  11. Effect of culture medium on biocalcification by Pseudomonas Putida, Lysinibacillus Sphaericus and Bacillus Subtilis.

    PubMed

    Shirakawa, Márcia Aiko; Cincotto, Maria Alba; Atencio, Daniel; Gaylarde, Christine C; John, Vanderley M

    2011-04-01

    The objective of this study is to investigate the efficiency of calcium carbonate bioprecipitation by Lysinibacillus sphaericus, Bacillus subtilis and Pseudomonas putida, obtained from the Coleção de Culturas do Instituto Nacional de Controle de Qualidade em Saúde (INCQS), as a first step in determining their potential to protect building materials against water uptake. Two culture media were studied: modified B4 containing calcium acetate and 295 with calcium chloride. Calcium consumption in the two media after incubation with and without the bacterial inoculum was determined by atomic absorption analysis. Modified B4 gave the best results and in this medium Pseudomonas putida INQCS 113 produced the highest calcium carbonate precipitation, followed by Lysinibacillus sphaericus INQCS 414; the lowest precipitation was produced by Bacillus subtilis INQCS 328. In this culture medium XRD analysis showed that Pseudomonas putida and Bacillus subtilis precipitated calcite and vaterite polymorphs while Lysinibacillus sphaericus produced only vaterite. The shape and size of the crystals were affected by culture medium, bacterial strain and culture conditions, static or shaken. In conclusion, of the three strains Pseudomonas putida INQCS 113 in modified B4 medium gave the best results precipitating 96% of the calcium, this strain thus has good potential for use on building materials.

  12. ACTIVE EFFLUX OF ORGANIC SOLVENTS BY PSEUDOMONAS PUTIDA S12 IS INDUCED BY SOLVENTS

    EPA Science Inventory

    Induction of the membrane-associated organic solvent efflux system SrpABC of Pseudomonas putida S12 was examined by cloning a 312-bp DNA fragment, containing the srp promoter, in the broad-host-range reporter vector pKRZ-1. Compounds that are capable of inducing expression of the...

  13. Using "Pseudomonas Putida xylE" Gene to Teach Molecular Cloning Techniques for Undergraduates

    ERIC Educational Resources Information Center

    Dong, Xu; Xin, Yi; Ye, Li; Ma, Yufang

    2009-01-01

    We have developed and implemented a serial experiment in molecular cloning laboratory course for undergraduate students majored in biotechnology. "Pseudomonas putida xylE" gene, encoding catechol 2, 3-dioxygenase, was manipulated to learn molecular biology techniques. The integration of cloning, expression, and enzyme assay gave students…

  14. Using "Pseudomonas Putida xylE" Gene to Teach Molecular Cloning Techniques for Undergraduates

    ERIC Educational Resources Information Center

    Dong, Xu; Xin, Yi; Ye, Li; Ma, Yufang

    2009-01-01

    We have developed and implemented a serial experiment in molecular cloning laboratory course for undergraduate students majored in biotechnology. "Pseudomonas putida xylE" gene, encoding catechol 2, 3-dioxygenase, was manipulated to learn molecular biology techniques. The integration of cloning, expression, and enzyme assay gave students…

  15. Propane and n-Butane Oxidation by Pseudomonas putida GPo1

    PubMed Central

    Johnson, Erika L.; Hyman, Michael R.

    2006-01-01

    Propane and n-butane inhibit methyl tertiary butyl ether oxidation by n-alkane-grown Pseudomonas putida GPo1. Here we demonstrate that these gases are oxidized by this strain and support cell growth. Both gases induced alkane hydroxylase activity and appear to be oxidized by the same enzyme system used for the oxidation of n-octane. PMID:16391142

  16. Complete Genome of the Plant Growth-Promoting Rhizobacterium Pseudomonas putida BIRD-1

    SciTech Connect

    Matilla, M.A.; van der Lelie, D.; Pizarro-Tobias, P.; Roca, A.; Fernandez, M.; Duque, E.; Molina, L.; Wu, X.; Gomez, M. J.; Segura, A.; Ramos, J.-L.

    2011-03-01

    We report the complete sequence of the 5.7-Mbp genome of Pseudomonas putida BIRD-1, a metabolically versatile plant growth-promoting rhizobacterium that is highly tolerant to desiccation and capable of solubilizing inorganic phosphate and iron and of synthesizing phytohormones that stimulate seed germination and plant growth.

  17. Complete Genome Sequence of a Pseudomonas putida Clinical Isolate, Strain H8234

    PubMed Central

    Bernal, Patricia; Udaondo, Zulema; Segura, Ana; Ramos, Juan-Luis

    2013-01-01

    We report the complete genome sequence of Pseudomonas putida strain H8234, which was isolated from a hospital patient presenting with bacteremia. This strain has a single chromosome (6,870,827 bp) that contains 6,305 open reading frames. The strain is not a pathogen but exhibits multidrug resistance associated with 40 genomic islands. PMID:23868128

  18. Complete Genome Sequence of a Pseudomonas putida Clinical Isolate, Strain H8234.

    PubMed

    Molina, Lázaro; Bernal, Patricia; Udaondo, Zulema; Segura, Ana; Ramos, Juan-Luis

    2013-07-18

    We report the complete genome sequence of Pseudomonas putida strain H8234, which was isolated from a hospital patient presenting with bacteremia. This strain has a single chromosome (6,870,827 bp) that contains 6,305 open reading frames. The strain is not a pathogen but exhibits multidrug resistance associated with 40 genomic islands.

  19. ACTIVE EFFLUX OF ORGANIC SOLVENTS BY PSEUDOMONAS PUTIDA S12 IS INDUCED BY SOLVENTS

    EPA Science Inventory

    Induction of the membrane-associated organic solvent efflux system SrpABC of Pseudomonas putida S12 was examined by cloning a 312-bp DNA fragment, containing the srp promoter, in the broad-host-range reporter vector pKRZ-1. Compounds that are capable of inducing expression of the...

  20. Effect of culture medium on biocalcification by Pseudomonas Putida, Lysinibacillus Sphaericus and Bacillus Subtilis

    PubMed Central

    Shirakawa, Márcia Aiko; Cincotto, Maria Alba; Atencio, Daniel; Gaylarde, Christine C.; John, Vanderley M.

    2011-01-01

    The objective of this study is to investigate the efficiency of calcium carbonate bioprecipitation by Lysinibacillus sphaericus, Bacillus subtilis and Pseudomonas putida, obtained from the Coleção de Culturas do Instituto Nacional de Controle de Qualidade em Saúde (INCQS), as a first step in determining their potential to protect building materials against water uptake. Two culture media were studied: modified B4 containing calcium acetate and 295 with calcium chloride. Calcium consumption in the two media after incubation with and without the bacterial inoculum was determined by atomic absorption analysis. Modified B4 gave the best results and in this medium Pseudomonas putida INQCS 113 produced the highest calcium carbonate precipitation, followed by Lysinibacillus sphaericus INQCS 414; the lowest precipitation was produced by Bacillus subtilis INQCS 328. In this culture medium XRD analysis showed that Pseudomonas putida and Bacillus subtilis precipitated calcite and vaterite polymorphs while Lysinibacillus sphaericus produced only vaterite. The shape and size of the crystals were affected by culture medium, bacterial strain and culture conditions, static or shaken. In conclusion, of the three strains Pseudomonas putida INQCS 113 in modified B4 medium gave the best results precipitating 96% of the calcium, this strain thus has good potential for use on building materials. PMID:24031661

  1. Manganese (Mn) Oxidation Increases Intracellular Mn in Pseudomonas putida GB-1

    PubMed Central

    Banh, Andy; Chavez, Valarie; Doi, Julia; Nguyen, Allison; Hernandez, Sophia; Ha, Vu; Jimenez, Peter; Espinoza, Fernanda; Johnson, Hope A.

    2013-01-01

    Bacterial manganese (Mn) oxidation plays an important role in the global biogeochemical cycling of Mn and other compounds, and the diversity and prevalence of Mn oxidizers have been well established. Despite many hypotheses of why these bacteria may oxidize Mn, the physiological reasons remain elusive. Intracellular Mn levels were determined for Pseudomonas putida GB-1 grown in the presence or absence of Mn by inductively coupled plasma mass spectrometry (ICP-MS). Mn oxidizing wild type P. putida GB-1 had higher intracellular Mn than non Mn oxidizing mutants grown under the same conditions. P. putida GB-1 had a 5 fold increase in intracellular Mn compared to the non Mn oxidizing mutant P. putida GB-1-007 and a 59 fold increase in intracellular Mn compared to P. putida GB-1 ∆2665 ∆2447. The intracellular Mn is primarily associated with the less than 3 kDa fraction, suggesting it is not bound to protein. Protein oxidation levels in Mn oxidizing and non oxidizing cultures were relatively similar, yet Mn oxidation did increase survival of P. putida GB-1 when oxidatively stressed. This study is the first to link Mn oxidation to Mn homeostasis and oxidative stress protection. PMID:24147089

  2. Characterization of type IV pilus genes in plant growth-promoting Pseudomonas putida WCS358.

    PubMed Central

    de Groot, A; Heijnen, I; de Cock, H; Filloux, A; Tommassen, J

    1994-01-01

    In a search for factors that could contribute to the ability of the plant growth-stimulating Pseudomonas putida WCS358 to colonize plant roots, the organism was analyzed for the presence of genes required for pilus biosynthesis. The pilD gene of Pseudomonas aeruginosa, which has also been designated xcpA, is involved in protein secretion and in the biogenesis of type IV pili. It encodes a peptidase that processes the precursors of the pilin subunits and of several components of the secretion apparatus. Prepilin processing activity could be demonstrated in P. putida WCS358, suggesting that this nonpathogenic strain may contain type IV pili as well. A DNA fragment containing the pilD (xcpA) gene of P. putida was cloned and found to complement a pilD (xcpA) mutation in P. aeruginosa. Nucleotide sequencing revealed, next to the pilD (xcpA) gene, the presence of two additional genes, pilA and pilC, that are highly homologous to genes involved in the biogenesis of type IV pili. The pilA gene encodes the pilin subunit, and pilC is an accessory gene, required for the assembly of the subunits into pili. In comparison with the pil gene cluster in P. aeruginosa, a gene homologous to pilB is lacking in the P. putida gene cluster. Pili were not detected on the cell surface of P. putida itself, not even when pilA was expressed from the tac promoter on a plasmid, indicating that not all the genes required for pilus biogenesis were expressed under the conditions tested. Expression of pilA of P. putida in P. aeruginosa resulted in the production of pili containing P. putida PilA subunits. Images PMID:7905475

  3. GacS-Dependent Regulation of Polyhydroxyalkanoate Synthesis in Pseudomonas putida CA-3

    PubMed Central

    Ryan, William J.; O'Mahony, Mark; Dobson, Alan D. W.

    2013-01-01

    To date, limited reports are available on the regulatory systems exerting control over bacterial synthesis of the biodegradable polyester group known as polyhydroxyalkanoates (PHAs). In this study, we performed random mini-Tn5 mutagenesis of the Pseudomonas putida CA-3 genome and screened transconjugants on nitrogen-limited medium for reduced PHA accumulation phenotypes. Disruption of a GacS sensor kinase in one such mutant was found to eliminate medium-chain-length PHA production in Pseudomonas putida CA-3. Recombinant expression of wild-type gacS from a pBBRgacS vector fully restored PHA accumulation capacity in the mutant strain. PCR-based screening of the P. putida CA-3 genome identified gene homologues of the GacS/GacA-rsm small RNA (sRNA) regulatory cascade with 96% similarity to published P. putida genomes. However, reverse transcription-PCR (RT-PCR) analyses revealed active transcription of the rsmY and rsmZ sRNAs in gacS-disrupted P. putida CA-3, which is atypical of the commonly reported Gac/Rsm regulatory cascade. Quantitative real-time RT-PCR analyses of the phaC1 synthase responsible for polymer formation in P. putida CA-3 indicated no statistically significant difference in transcript levels between the wild-type and gacS-disrupted strains. Subsequently, SDS-PAGE protein analyses of these strains identified posttranscriptional control of phaC1 synthase as a key aspect in the regulation of PHA synthesis by P. putida CA-3. PMID:23291549

  4. Draft Genome Sequence of Pseudomonas putida Strain GM4FR, an Endophytic Bacterium Isolated from Festuca rubra L.

    PubMed Central

    Hollensteiner, Jacqueline; Granzow, Sandra; Daniel, Rolf; Vidal, Stefan; Wemheuer, Bernd

    2017-01-01

    ABSTRACT Pseudomonas putida GM4FR is an endophytic bacterium isolated from aerial plant tissues of Festuca rubra L. Functional annotation of the draft genome (7.1 Mb) revealed 6,272 predicted protein-encoding genes. The genome provides insights into the biocontrol and plant growth-promoting potential of P. putida GM4FR. PMID:28360162

  5. Optimization Production of Biosurfactant by Pseudomonas putida Using Crude Palm Oil (CPO) as Substrate

    NASA Astrophysics Data System (ADS)

    Suryanti, V.; Handayani, D. S.; Masykur, A.; Lindasari

    2017-07-01

    The production of biosurfactant by Pseudomonas putida has been studied. P. putida FNCC 0071 was grown in the nutrient broth medium supplemented with NaCl and crude palm oil (CPO). The effect of CPO concentration and fermentation time on the biosurfactant production were evaluated. The biosurfactant production was evaluated every 24 h for 10 days by optical density, surface tension and emulsification index. The best culture medium was found to be medium containing 5% v/v of CPO with 5 days of incubation time. The biosurfactant was identified as rhamnolipids.

  6. Growth, nitrogen fixation and mineral acquisition of Alnus sieboldiana after inoculation of Frankia together with Gigaspora margarita and Pseudomonas putida.

    Treesearch

    Takashi Yamanaka; Akio Akama; Ching-Yan Li; Hiroaki. Okabe

    2005-01-01

    The role of tetrapartite associations among Frankia, Gigaspora margarita (an arbuscular mycorrhizal fungus), Pseudomonas putida (rhizobacterium), and Alnus sieboldiana in growth, nitrogen fixation, and mineral acquisition of A. sieboldiana was investigated....

  7. Trichloroethylene degradation by Escherichia coli containing the cloned Pseudomonas putida F1 toluene dioxygenase genes

    SciTech Connect

    Zylstra, G.J.; Gibson, D.T. ); Wackett, L.P. )

    1989-12-01

    Toluene dioxygenase from Pseudomonas putida F1 has been implicated as an enzyme capable of degrading trichloroethylene. This has now been confirmed with Escherichia coli JM109(pDTG601) that contains the structural genes (todC1C2BA) of toluene dioxygenase under the control of the tac promoter. The extent of trichloroethylene degradation by the recombinant organism depended on the cell concentration and the concentration of trichloroethylene. A linear rate of trichloroethylene degradation was observed with the E. coli recombinant strain. In contrast, P. putida F39/D, a mutant strain of P. putida F1 that does not contain cis-toluene dihydrodiol dehydrogenase, showed a much faster initial rate of trichloroethylene degradation which decreased over time.

  8. Quantitative analysis of cellular proteome alterations of Pseudomonas putida to naphthalene-induced stress.

    PubMed

    Li, Shan-Shan; Hu, Xiao; Zhao, Hong; Li, Ya-Xiao; Zhang, Li; Gong, Li-Jun; Guo, Jin; Zhao, Hua-Bing

    2015-08-01

    To investigate whether genes other than the operons nahAaAbAcAdBFCED and nahGTHINLOMKJ of Pseudomonas putida are involved in the tolerance of the bacterium to naphthalene. Cellular responses of P. putida ND6 grown with 2 and 4 g naphthalene/l were investigated using a quantitative proteomic-based approach. Comparative analysis of the proteome data identified that the expression levels of 22 proteins involved in heat shock and universal stress response, naphthalene degradation, cell envelope synthesis, and motility were up-regulated; while the expression levels of 26 proteins involved in protein and fatty acid synthesis, carbon compound, nucleotide, and amino acid metabolism, and small molecule transport were down-regulated. Our findings offer insights into the cellular response of P. putida to high naphthalene concentrations at the protein level.

  9. Expression analysis of the fpr (ferredoxin-NADP{sup +} reductase) gene in Pseudomonas putida KT2440

    SciTech Connect

    Lee, Yunho; Pena-Llopis, Samuel; Kang, Yoon-Suk; Shin, Hyeon-Dong; Demple, Bruce; Madsen, Eugene L.; Jeon, Che Ok; Park, Woojun . E-mail: wpark@korea.ac.kr

    2006-01-27

    The ferredoxin-NADP{sup +} reductase (fpr) participates in cellular defense against oxidative damage. The fpr expression in Pseudomonas putida KT2440 is induced by oxidative and osmotic stresses. FinR, a LysR-type transcriptional factor near the fpr gene in the P. putida KT2440 genome, is required for induction of the fpr under both conditions. We have shown that the fpr and finR gene products can counteract the effects of oxidative and osmotic stresses. Interestingly, FinR-independent expression occurs either during a long period of incubation with paraquat or with high concentrations of oxidative stress agent. This result indicates that there may be additional regulators present in the P. putida KT2440 genome. In contrast to in vivo expression kinetics of fpr from the plant pathogen, Pseudomonas syringae, the fpr gene from P. putida KT2440 exhibited unusually prolonged expression after oxidative stress. Transcriptional fusion and Northern blot analysis studies indicated that the FinR is negatively autoregulated. Expression of the fpr promoter was higher in minimal media than in rich media during exponential phase growth. Consistent with this result, the fpr and finR mutants had a long lag phase in minimal media in contrast to wild-type growth characteristics. Antioxidants such as ascorbate could increase the growth rate of all tested strains in minimal media. This result confirmed that P. putida KT2440 experienced more oxidative stress during exponential growth in minimal media than in rich media. Endogenous promoter activity of the fpr gene is much higher during exponential growth than during stationary growth. These findings demonstrate new relationships between fpr, finR, and the physiology of oxidative stress in P. putida KT2440.

  10. Benzoxazinoids in Root Exudates of Maize Attract Pseudomonas putida to the Rhizosphere

    PubMed Central

    Neal, Andrew L.; Ahmad, Shakoor; Gordon-Weeks, Ruth; Ton, Jurriaan

    2012-01-01

    Benzoxazinoids, such as 2,4-dihydroxy-7-methoxy-2H-1,4-benzoxazin-3(4H)-one (DIMBOA), are secondary metabolites in grasses. In addition to their function in plant defence against pests and diseases above-ground, benzoxazinoids (BXs) have also been implicated in defence below-ground, where they can exert allelochemical or antimicrobial activities. We have studied the impact of BXs on the interaction between maize and Pseudomonas putida KT2440, a competitive coloniser of the maize rhizosphere with plant-beneficial traits. Chromatographic analyses revealed that DIMBOA is the main BX compound in root exudates of maize. In vitro analysis of DIMBOA stability indicated that KT2440 tolerance of DIMBOA is based on metabolism-dependent breakdown of this BX compound. Transcriptome analysis of DIMBOA-exposed P. putida identified increased transcription of genes controlling benzoate catabolism and chemotaxis. Chemotaxis assays confirmed motility of P. putida towards DIMBOA. Moreover, colonisation essays in soil with Green Fluorescent Protein (GFP)-expressing P. putida showed that DIMBOA-producing roots of wild-type maize attract significantly higher numbers of P. putida cells than roots of the DIMBOA-deficient bx1 mutant. Our results demonstrate a central role for DIMBOA as a below-ground semiochemical for recruitment of plant-beneficial rhizobacteria during the relatively young and vulnerable growth stages of maize. PMID:22545111

  11. The Pseudomonas putida T6SS is a plant warden against phytopathogens.

    PubMed

    Bernal, Patricia; Allsopp, Luke P; Filloux, Alain; Llamas, María A

    2017-04-01

    Bacterial type VI secretion systems (T6SSs) are molecular weapons designed to deliver toxic effectors into prey cells. These nanomachines have an important role in inter-bacterial competition and provide advantages to T6SS active strains in polymicrobial environments. Here we analyze the genome of the biocontrol agent Pseudomonas putida KT2440 and identify three T6SS gene clusters (K1-, K2- and K3-T6SS). Besides, 10 T6SS effector-immunity pairs were found, including putative nucleases and pore-forming colicins. We show that the K1-T6SS is a potent antibacterial device, which secretes a toxic Rhs-type effector Tke2. Remarkably, P. putida eradicates a broad range of bacteria in a K1-T6SS-dependent manner, including resilient phytopathogens, which demonstrates that the T6SS is instrumental to empower P. putida to fight against competitors. Furthermore, we observed a drastically reduced necrosis on the leaves of Nicotiana benthamiana during co-infection with P. putida and Xanthomonas campestris. Such protection is dependent on the activity of the P. putida T6SS. Many routes have been explored to develop biocontrol agents capable of manipulating the microbial composition of the rhizosphere and phyllosphere. Here we unveil a novel mechanism for plant biocontrol, which needs to be considered for the selection of plant wardens whose mission is to prevent phytopathogen infections.

  12. Solvent resistance pumps of Pseudomonas putida S12: Applications in 1-naphthol production and biocatalyst engineering.

    PubMed

    Janardhan Garikipati, S V B; Peeples, Tonya L

    2015-09-20

    The solvent resistance capacity of Pseudomonas putida S12 was applied by using the organism as a host for biocatalysis and through cloning and expressing solvent resistant pump genes into Escherichia coli. P. putida S12 expressing toluene ortho mononooxygenase (TOM-Green) was used for 1-naphthol production in a water-organic solvent biphasic system. Application of P. putida S12 improved 1-naphthol production per gram cell dry weight by approximately 42% compared to E. coli. Moreover, P. putida S12 enabled the use of a less expensive solvent, decanol, for 1-naphthol production. The solvent resistant pump (srpABC) genes of P. putida S12 were cloned into a solvent sensitive E. coli strain to transfer solvent tolerance. Recombinant strains bearing srpABC genes in either a low-copy number or a high-copy number plasmid grew in the presence of saturated concentration of toluene. Both of the recombinant strains were more tolerant to 1% v/v of toxic solvents, decanol and hexane, reaching similar cell density as the no-solvent control. Reverse-transcriptase analysis revealed that the srpABC genes were transcribed in engineered strains. The results demonstrate successful transfer of the proton-dependent solvent resistance mechanism and suggest that the engineered strain could serve as more robust biocatalysts in media with organic solvents. Copyright © 2015 Elsevier B.V. All rights reserved.

  13. Redundancy in putrescine catabolism in solvent tolerant Pseudomonas putida S12.

    PubMed

    Bandounas, Luaine; Ballerstedt, Hendrik; de Winde, Johannes H; Ruijssenaars, Harald J

    2011-06-10

    Pseudomonas putida S12 is a promising platform organism for the biological production of substituted aromatic compounds due to its extreme tolerance towards toxic chemicals. Solvent or aromatic stress tolerance may be due to membrane modifications and efflux pumps; however in general, polyamines have also been implicated in stressed cells. Previous transcriptomics results of P. putida strains producing an aromatic compound, or being exposed to the solvent toluene, indicated differentially expressed genes involved in polyamine transport and metabolism. Therefore, the metabolism of the polyamine, putrescine was investigated in P. putida S12, as no putrescine degradation pathways have been described for this strain. Via transcriptome analysis various, often redundant, putrescine-induced genes were identified as being potentially involved in putrescine catabolism via oxidative deamination and transamination. A series of knockout mutants were constructed in which up to six of these genes were sequentially deleted, and although putrescine degradation was affected in some of these mutants, complete elimination of putrescine degradation in P. putida S12 was not achieved. Evidence was found for the presence of an alternative pathway for putrescine degradation involving γ-glutamylation. The occurrence of multiple putrescine degradation routes in the solvent-tolerant P. putida S12 is indicative of the importance of controlling polyamine homeostasis, as well as of the high metabolic flexibility exhibited by this microorganism. Copyright © 2011 Elsevier B.V. All rights reserved.

  14. Toxicity of graphene oxide on growth and metabolism of Pseudomonas putida.

    PubMed

    Combarros, R G; Collado, S; Díaz, M

    2016-06-05

    The increasing consumption of graphene derivatives leads to greater presence of these materials in wastewater treatment plants and ecological systems. The toxicity effect of graphene oxide (GO) on the microbial functions involved in the biological wastewater treatment process is studied, using Pseudomonas putida and salicylic acid (SA) as bacterial and pollutant models. A multiparametric flow cytometry (FC) method has been developed to measure the metabolic activity and viability of P. putida in contact with GO. A continuous reduction in the percentages of viable cells and a slight increase, lower than 5%, in the percentages of damaged and dead cells, suggest that P. putida in contact with GO loses the membrane integrity but preserves metabolic activity. The growth of P. putida was strongly inhibited by GO, since 0.05mgmL(-1) of GO reduced the maximum growth by a third, and the inhibition was considerably greater for GO concentrations higher than 0.1mgmL(-1). The specific SA removal rate decreased with GO concentration up to 0.1mgmL(-1) indicating that while GO always reduces the growth of P. putida, for concentrations higher than 0.1mgmL(-1), it also reduces its activity. Similar behaviour is observed using simulated urban and industrial wastewaters, the observed effects being more acute in the industrial wastewaters. Copyright © 2016 Elsevier B.V. All rights reserved.

  15. 2D motility tracking of Pseudomonas putida KT2440 in growth phases using video microscopy

    PubMed Central

    Davis, Michael L.; Mounteer, Leslie C.; Stevens, Lindsey K.; Miller, Charles D.; Zhou, Anhong

    2011-01-01

    Pseudomonas putida KT2440 is a gram negative motile soil bacterium important in bioremediation and biotechnology. Thus, it is important to understand its motility characteristics as individuals and in populations. Population characteristics were determined using a modified Gompertz model. Video microscopy and imaging software were utilized to analyze two dimensional (2D) bacteria movement tracks to quantify individual bacteria behavior. It was determined that inoculum density increased the lag time as seeding densities decreased, and that the maximum specific growth rate decreased as seeding densities increased. Average bacterial velocity remained relatively similar throughout exponential growth phase (~20.9 µm/sec), while maximum velocities peak early in exponential growth phase at a velocity of 51.2 µm/sec. Pseudomonas putida KT2440 also favor smaller turn angles indicating they often continue in the same direction after a change in flagella rotation throughout the exponential growth phase. PMID:21334971

  16. Diabetic Foot Gangrene Patient with Multi-drug Resistant Pseudomonas Putida Infection in Karawaci District, Indonesia

    PubMed Central

    Hardjo Lugito, Nata Pratama; Nawangsih, Cucu; Moksidy, Jevany Claudia; Kurniawan, Andree; Tjiang, Margaret Merlyn

    2015-01-01

    Pseudomonas putida is a rod-shaped, non fermenting Gram-negative organism frequently found in the environment that utilizes aerobic metabolism, previously thought to be of low pathogenicity. It had been reported as cause of skin and soft tissue infection, especially in immunocompromised patients. A female green grocer, 51 year-old came to internal medicine out-patient clinic with gangrene and osteomyelitis on her 1st, 2nd and 3rd digit and wound on the sole of the right foot since 1 month prior. The patient had history of uncontrolled diabetes since a year ago. She was given ceftriaxone 2 grams b.i.d, metronidazole 500 mg t.i.d empirically and then amikacin 250 mg b.i.d, followed by amputation of the digits and wound debridement. The microorganism's culture from pus revealed multi drug resistant Pseudomonas putida. She recovered well after antibiotics and surgery. PMID:25722620

  17. Enhanced Tolerance to Naphthalene and Enhanced Rhizoremediation Performance for Pseudomonas putida KT2440 via the NAH7 Catabolic Plasmid

    PubMed Central

    Fernández, Matilde; Niqui-Arroyo, José Luis; Conde, Susana; Duque, Estrella

    2012-01-01

    In this work, we explore the potential use of the Pseudomonas putida KT2440 strain for bioremediation of naphthalene-polluted soils. Pseudomonas putida strain KT2440 thrives in naphthalene-saturated medium, establishing a complex response that activates genes coding for extrusion pumps and cellular damage repair enzymes, as well as genes involved in the oxidative stress response. The transfer of the NAH7 plasmid enables naphthalene degradation by P. putida KT2440 while alleviating the cellular stress brought about by this toxic compound, without affecting key functions necessary for survival and colonization of the rhizosphere. Pseudomonas putida KT2440(NAH7) efficiently expresses the Nah catabolic pathway in vitro and in situ, leading to the complete mineralization of [14C]naphthalene, measured as the evolution of 14CO2, while the rate of mineralization was at least 2-fold higher in the rhizosphere than in bulk soil. PMID:22582075

  18. Properties of the iron--sulphur proteins of the benzene dioxygenase system from Pseudomonas putida.

    PubMed Central

    Crutcher, S E; Geary, P J

    1979-01-01

    A purification procedure was developed to stabilize the iron-sulphur proteins of the benzene dioxygenase system from Pseudomonas putida. The intermediate electron-carrying protein has a mol. wt. of 12300 and possesses one (2Fe--2S) cluster, whereas the terminal dioxygenase has a mol.wt. of 215300 and possesses two (2Fe--2S) clusters. The order and stoicheiometry of electron transfer and of the whole system are described. Images Fig. 2. PMID:435241

  19. Identification of nah-1 genes of the Pseudomonas putida naphthalene-degrading NPL-41 plasmid operon.

    PubMed

    Serebriiskaya, T S; Lenets, A A; Goldenkova, I V; Kobets, N S; Piruzian, E S

    1999-01-01

    Pseudomonas putida BS202 degrades naphthalene via a plasmid-encoded catabolic pathway. The nucleotide sequence of the nahC gene encoding one of this pathway enzymes, 1,2-dihydroxynaphthalene dioxygenase, has been determined. Analysis of nucleotide sequence of its flanking regions identified partially the nahF and putative nahQ genes. Comparison of these three genes with corresponding ones in the NAH7 plasmid and DOX operon showed a high degree of homology.

  20. A bioluminescent derivative of Pseudomonas putida KT2440 for deliberate release into the environment.

    PubMed

    Ramos; Molina; Mølbak; Ramos; Molin

    2000-12-01

    Recombinant derivatives of Pseudomonas putida strain KT2440 are of potential interest as microbial inoculants to be deliberately released for agricultural applications. To facilitate tracking of this strain and its derivatives after introduction into the environment, a mini-Tn5-'luxAB transposon was introduced into the chromosome of P. putida KT2440, yielding strain P. putida S1B1. Sequencing of the DNA region located upstream of the 'luxAB genes and similarity search with the P. putida KT2440 genome sequence, localized the transposon within a 3021-bp open reading frame (ORF), whose translated sequence showed significant similarity with the hypothetical YdiJ proteins from Escherichia coli and Haemophilus influenzae. A second ORF adjacent to and divergent from the ydiJ sequence was also found and showed significant homology with various LysR-type transcriptional activator proteins from several bacteria. Disruption of the ydiJ locus in P. putida S1B1 did not affect the survival of the strain in unvegetated or vegetated soils. Bioluminescent detection of P. putida S1B1 cells enriched in selective media directly from soil allowed detection of culturable cells in soil samples over a period of at least 8 months. The addition of the luxAB biomarker facilitates tracking in the root system of several plant species grown under sterile and non-sterile conditions. The correlation of the bioluminescent phenotype with the growth activity of P. putida S1B1 cells colonizing the root system of barley and corn plants was estimated by monitoring ribosomal contents using quantitative hybridization with fluorescence-labeled ribosomal RNA probes. A correlation between inoculum density, light output, and ribosomal contents was found for P. putida cells colonizing the root system of barley seedlings grown under sterile conditions. Although ribosomal contents, and therefore growth activity, of P. putida S1B1 cells extracted from the rhizosphere of corn plants grown in non-sterile soil were

  1. The Ssr protein (T1E_1405) from Pseudomonas putida DOT-T1E enables oligonucleotide-based recombineering in platform strain P. putida EM42.

    PubMed

    Aparicio, Tomás; Jensen, Sheila I; Nielsen, Alex T; de Lorenzo, Victor; Martínez-García, Esteban

    2016-10-01

    Some strains of the soil bacterium Pseudomonas putida have become in recent years platforms of choice for hosting biotransformations of industrial interest. Despite availability of many genetic tools for this microorganism, genomic editing of the cell factory P. putida EM42 (a derivative of reference strain KT2440) is still a time-consuming endeavor. In this work we have investigated the in vivo activity of the Ssr protein encoded by the open reading frame T1E_1405 from Pseudomonas putida DOT-T1E, a plausible functional homologue of the β protein of the Red recombination system of λ phage of Escherichia coli. A test based on the phenotypes of pyrF mutants of P. putida (the yeast's URA3 ortholog) was developed for quantifying the ability of Ssr to promote invasion of the genomic DNA replication fork by synthetic oligonucleotides. The efficiency of the process was measured by monitoring the inheritance of the changes entered into pyrF by oligonucleotides bearing mutated sequences. Ssr fostered short and long genomic deletions/insertions at considerable frequencies as well as single-base swaps not affected by mismatch repair. These results not only demonstrate the feasibility of recombineering in P. putida, but they also enable a suite of multiplexed genomic manipulations in this biotechnologically important bacterium.

  2. Continuous cultures of Pseudomonas putida mt-2 overcome catabolic function loss under real case operating conditions.

    PubMed

    Muñoz, Raúl; Hernández, María; Segura, Ana; Gouveia, Joao; Rojas, Antonia; Ramos, Juan Luis; Villaverde, Santiago

    2009-05-01

    The long-term performance and stability of Pseudomonas putida mt-2 cultures, a toluene-sensitive strain harboring the genes responsible for toluene biodegradation in the archetypal plasmid pWW0, was investigated in a chemostat bioreactor functioning under real case operating conditions. The process was operated at a dilution rate of 0.1 h(-1) under toluene loading rates of 259 +/- 23 and 801 +/- 78 g m(-3) h(-1) (inlet toluene concentrations of 3.5 and 10.9 g m(-3), respectively). Despite the deleterious effects of toluene and its degradation intermediates, the phenotype of this sensitive P. putida culture rapidly recovered from a 95% Tol(-) population at day 4 to approx. 100% Tol(+) cells from day 13 onward, sustaining elimination capacities of 232 +/- 10 g m(-3) h(-1) at 3.5 g Tol m(-3) and 377 +/- 13 g m(-3) h(-1) at 10.9 g Tol m(-3), which were comparable to those achieved by highly tolerant strains such as P. putida DOT T1E and P. putida F1 under identical experimental conditions. Only one type of Tol(-) variant, harboring a TOL-like plasmid with a 38.5 kb deletion (containing the upper and meta operons for toluene biodegradation), was identified.

  3. Biosorption of aluminum through the use of non-viable biomass of Pseudomonas putida.

    PubMed

    Boeris, Paola Sabrina; Agustín, María Del Rosario; Acevedo, Diego Fernando; Lucchesi, Gloria Inés

    2016-10-20

    Living and non-living biomass of Pseudomonas putida A (ATCC 12633) was used as biosorbent for the removing of Al(3+) from aqueous solutions. The process was stable with time, efficient at pH 4.3 and between 15°C and 42°C. Two isotherms models were applied to describe the interaction between the biosorbent and Al(3+). Non-living biomass of P. putida A (ATCC 12633) was found to be the most efficient at adsorbing Al(3+) with a maximum sorption capacity of 0.55mg Al(3+)/gr adsorbent and with 36×10(5) binding sites of Al(3+)/microorganisms. Infrared spectroscopy analysis shows that the biosorbent present some vibrational band of functional groups that change in presence of Al(3+): hydroxyl, carboxyl and phosphate. Considering that Al(3+) binds to the phosphate group of phosphatidylcholine, non-viable biomass of P. putida PB01 (mutant lacking phosphatidylcholine) was used. Aluminum adsorption of the parental strain was 30 times higher than values registered in P. putida PB01 (36×10(5) sites/microorganism vs 1.2×10(5) sites/microorganism, respectively). This result evidenced that the absence of phosphatidylcholine significantly affected the availability of the binding sites and consequently the efficiency of the biomass to adsorb Al(3+).

  4. Effect of Pseudomonas putida on Growth and Anthocyanin Pigment in Two Poinsettia (Euphorbia pulcherrima) Cultivars

    PubMed Central

    Zulueta-Rodriguez, Ramon; Cordoba-Matson, Miguel Victor; Hernandez-Montiel, Luis Guillermo; Murillo-Amador, Bernardo; Rueda-Puente, Edgar; Lara, Liliana

    2014-01-01

    Pseudomonas putida is plant growth promoting rhizobacteria (PGPR) that have the capacity to improve growth in plants. The purpose of this study was to determine growth and anthocyanin pigmentation of the bracts in two poinsettia Euphorbia pulcherrima cultivars (Prestige and Sonora Marble) using three strains of P. putida, as well as a mixture of the three (MIX). Comparison with the control group indicated for the most part that Prestige grew better than the Sonora Marble cultivars with the PGPR strains. Prestige with the MIX strain grew better compared to control for the number of cyathia (83 versus 70.4), volume of roots (45 versus 35 cm3), number of leaves (78 versus 58), and area of leaf (1,788 versus 1,331 cm2), except for the number of flowers (8.8 versus 11.6). To the naked eye, coloration of plants appeared identical in color compared to the control group. For all plants with P. putida strains, there was less anthocyanin pigment, but biomass was always greater with PGPR strains. Nevertheless, to the naked eye, the coloration of the plants appeared identical in color compared to the control group. This is the first study reporting the positive effects of P. putida rhizobacteria treatments on growth of poinsettia cultivars. PMID:25097888

  5. [Influence of microcystin-LR on cell viability and surface characteristics of Pseudomonas putida].

    PubMed

    Deng, Ting-jin; Ye, Jin-shao; Peng, Hui; Liu, Zhi-chen; Liu, Ze-hua; Yin, Hua; Chen, Shuo-na

    2015-01-01

    In microcystin-LR (MC-LR) degradation system, the change in surface characteristics and cell viability of Pseudomonas putida was studied. The purpose of this study was to reveal the influence of MC-LR on P. putida and elucidate the toxicity of MC-LR on microorganisms. The result demonstrated that MC-LR enhanced the cytoplasmic membrane permeability, as well as affected the ion metabolism and protein release of P. putida. The soluble sugar and Na+, Cl-release increased with the rising concentration of MC-LR ranging from 0 mg x L(-1) to 2.0 mg x L(-1). Flow Cytometry Method(FCM) analysis revealed that MC-LR accelerated the death of P. putida, and the death rate increased with the ascending concentration of MC-LR. Compared with the control, the death rate on day 5 increased by nearly 30% when 2.5 mg x L(-1) MC-LR was added. Scanning electron microscopy (SEM) analysis showed that the cells were deformed under the toxicity of MC-LR. After 5-day exposure to 2.5 mg x L(-1) MC-LR, the majority of the cells were ruptured and the intracellular materials flew out. The cellular structure was severely damaged under this condition.

  6. Fis regulates the competitiveness of Pseudomonas putida on barley roots by inducing biofilm formation.

    PubMed

    Jakovleva, Julia; Teppo, Annika; Velts, Anna; Saumaa, Signe; Moor, Hanna; Kivisaar, Maia; Teras, Riho

    2012-03-01

    An important link between the environment and the physiological state of bacteria is the regulation of the transcription of a large number of genes by global transcription factors. One of the global regulators, Fis (factor for inversion stimulation), is well studied in Escherichia coli, but the role of this protein in pseudomonads has only been examined briefly. According to studies in Enterobacteriaceae, Fis regulates positively the flagellar movement of bacteria. In pseudomonads, flagellar movement is an important trait for the colonization of plant roots. Therefore we were interested in the role of the Fis protein in Pseudomonas putida, especially the possible regulation of the colonization of plant roots. We observed that Fis reduced the migration of P. putida onto the apices of barley roots and thereby the competitiveness of bacteria on the roots. Moreover, we observed that overexpression of Fis drastically reduced swimming motility and facilitated P. putida biofilm formation, which could be the reason for the decreased migration of bacteria onto the root apices. It is possible that the elevated expression of Fis is important in the adaptation of P. putida during colonization of plant roots by promoting biofilm formation when the migration of bacteria is no longer favoured.

  7. Identification of a Third Mn(II) Oxidase Enzyme in Pseudomonas putida GB-1.

    PubMed

    Geszvain, Kati; Smesrud, Logan; Tebo, Bradley M

    2016-07-01

    The oxidation of soluble Mn(II) to insoluble Mn(IV) is a widespread bacterial activity found in a diverse array of microbes. In the Mn(II)-oxidizing bacterium Pseudomonas putida GB-1, two Mn(II) oxidase genes, named mnxG and mcoA, were previously identified; each encodes a multicopper oxidase (MCO)-type enzyme. Expression of these two genes is positively regulated by the response regulator MnxR. Preliminary investigation into putative additional regulatory pathways suggested that the flagellar regulators FleN and FleQ also regulate Mn(II) oxidase activity; however, it also revealed the presence of a third, previously uncharacterized Mn(II) oxidase activity in P. putida GB-1. A strain from which both of the Mn(II) oxidase genes and fleQ were deleted exhibited low levels of Mn(II) oxidase activity. The enzyme responsible was genetically and biochemically identified as an animal heme peroxidase (AHP) with domain and sequence similarity to the previously identified Mn(II) oxidase MopA. In the ΔfleQ strain, P. putida GB-1 MopA is overexpressed and secreted from the cell, where it actively oxidizes Mn. Thus, deletion of fleQ unmasked a third Mn(II) oxidase activity in this strain. These results provide an example of an Mn(II)-oxidizing bacterium utilizing both MCO and AHP enzymes. The identity of the Mn(II) oxidase enzyme in Pseudomonas putida GB-1 has been a long-standing question in the field of bacterial Mn(II) oxidation. In the current work, we demonstrate that P. putida GB-1 employs both the multicopper oxidase- and animal heme peroxidase-mediated pathways for the oxidation of Mn(II), rendering this model organism relevant to the study of both types of Mn(II) oxidase enzymes. The presence of three oxidase enzymes in P. putida GB-1 deepens the mystery of why microorganisms oxidize Mn(II) while providing the field with the tools necessary to address this question. The initial identification of MopA as a Mn(II) oxidase in this strain required the deletion of FleQ, a

  8. Identification of a Third Mn(II) Oxidase Enzyme in Pseudomonas putida GB-1

    PubMed Central

    Smesrud, Logan; Tebo, Bradley M.

    2016-01-01

    ABSTRACT The oxidation of soluble Mn(II) to insoluble Mn(IV) is a widespread bacterial activity found in a diverse array of microbes. In the Mn(II)-oxidizing bacterium Pseudomonas putida GB-1, two Mn(II) oxidase genes, named mnxG and mcoA, were previously identified; each encodes a multicopper oxidase (MCO)-type enzyme. Expression of these two genes is positively regulated by the response regulator MnxR. Preliminary investigation into putative additional regulatory pathways suggested that the flagellar regulators FleN and FleQ also regulate Mn(II) oxidase activity; however, it also revealed the presence of a third, previously uncharacterized Mn(II) oxidase activity in P. putida GB-1. A strain from which both of the Mn(II) oxidase genes and fleQ were deleted exhibited low levels of Mn(II) oxidase activity. The enzyme responsible was genetically and biochemically identified as an animal heme peroxidase (AHP) with domain and sequence similarity to the previously identified Mn(II) oxidase MopA. In the ΔfleQ strain, P. putida GB-1 MopA is overexpressed and secreted from the cell, where it actively oxidizes Mn. Thus, deletion of fleQ unmasked a third Mn(II) oxidase activity in this strain. These results provide an example of an Mn(II)-oxidizing bacterium utilizing both MCO and AHP enzymes. IMPORTANCE The identity of the Mn(II) oxidase enzyme in Pseudomonas putida GB-1 has been a long-standing question in the field of bacterial Mn(II) oxidation. In the current work, we demonstrate that P. putida GB-1 employs both the multicopper oxidase- and animal heme peroxidase-mediated pathways for the oxidation of Mn(II), rendering this model organism relevant to the study of both types of Mn(II) oxidase enzymes. The presence of three oxidase enzymes in P. putida GB-1 deepens the mystery of why microorganisms oxidize Mn(II) while providing the field with the tools necessary to address this question. The initial identification of MopA as a Mn(II) oxidase in this strain required the

  9. Metal Inhibition of Growth and Manganese Oxidation in Pseudomonas putida GB-1

    NASA Astrophysics Data System (ADS)

    Pena, J.; Sposito, G.

    2009-12-01

    Biogenic manganese oxides (MnO2) are ubiquitous nanoparticulate minerals that contribute to the adsorption of nutrient and toxicant metals, the oxidative degradation of various organic compounds, and the respiration of metal-reducing bacteria in aquatic and terrestrial environments. The formation of these minerals is catalyzed by a diverse and widely-distributed group of bacteria and fungi, often through the enzymatic oxidation of aqueous Mn(II) to Mn(IV). In metal-impacted ecosystems, toxicant metals may alter the viability and metabolic activity of Mn-oxidizing organisms, thereby limiting the conditions under which biogenic MnO2 can form and diminishing their potential as adsorbent materials. Pseudomonas putida GB-1 (P. putida GB-1) is a model Mn-oxidizing laboratory culture representative of freshwater and soil biofilm-forming bacteria. Manganese oxidation in P. putida GB-1 occurs via two single-electron-transfer reactions, involving a multicopper oxidase enzyme found on the bacterial outer membrane surface. Near the onset of the stationary phase of growth, dark brown MnO2 particles are deposited in a matrix of bacterial cells and extracellular polymeric substances, thus forming heterogeneous biomineral assemblages. In this study, we assessed the influence of various transition metals on microbial growth and manganese oxidation capacity in a P. putida GB-1 culture propagated in a nutrient-rich growth medium. The concentration-response behavior of actively growing P. putida GB-1 cells was investigated for Fe, Co, Ni, Cu and Zn at pH ≈ 6 in the presence and absence of 1 mM Mn. Toxicity parameters such as EC0, EC50 and Hillslope, and EC100 were obtained from the sigmoidal concentration-response curves. The extent of MnO2 formation in the presence of the various metal cations was documented 24, 50, 74 and 104 h after the metal-amended medium was inoculated. Toxicity values were compared to twelve physicochemical properties of the metals tested. Significant

  10. Chromosomal gene capture mediated by the Pseudomonas putida TOL catabolic plasmid.

    PubMed Central

    Ramos-González, M I; Ramos-Díaz, M A; Ramos, J L

    1994-01-01

    The Pseudomonas putida TOL plasmid pWW0 is able to mediate chromosomal mobilization in the canonical unidirectional way, i.e., from donor to recipient cells, and bidirectionally, i.e., donor-->recipient-->donor (retrotransfer). Transconjugants are recipient cells that have received DNA from donor cells, whereas retrotransconjugants are donor bacteria that have received DNA from a recipient. The TOL plasmid pWW0 is able to directly mobilize and retromobilize a kanamycin resistance marker integrated into the chromosome of other P. putida strains, a process that appears to involve a single conjugational event. The rate of retrotransfer (as well as of direct transfer) of the chromosomal marker is influenced by the location of the kanamycin marker on the chromosome and ranges from 10(-3) to less than 10(-8) retrotransconjugants per donor (transconjugants per recipient). The mobilized DNA is incorporated into the chromosome of the retrotransconjugants (transconjugants) in a process that seems to occur through recombination of highly homologous flanking regions. No interspecific mobilization of the chromosomal marker in matings involving P. putida and the closely related Pseudomonas fluorescens, which belongs to rRNA group I, was observed. Images PMID:8045894

  11. Response of plant-colonizing pseudomonads to hydrogen peroxide. [Pseudomonas putida

    SciTech Connect

    Katsuwon, J.; Anderson, A.J. )

    1989-11-01

    Colonization of plant root surfaces by Pseudomonas putida may require mechanisms that protect this bacterium against superoxide anion and hydrogen peroxide produced by the root. Catalase and superoxide dismutase may be important in this bacterial defense system. Stationary-phase cells of P. putida were not killed by hydrogen peroxide (H{sub 2}O{sub 2}) at concentrations up to 10 mM, and extracts from these cells possessed three isozymic bands (A, B, and C) of catalase activity in native polyacrylamide gel electrophoresis. Logarithmic-phase cells exposed directly to hydrogen peroxide concentrations above 1 mM were killed. Extracts of logarithmic-phase cells displayed only band A catalase activity. Protection against 5 mM H{sub 2}O{sub 2} was apparent after previous exposure of the logarithmic-phase cells to nonlethal concentrations (30 to 300 {mu}M) of H{sub 2}O{sub 2}. Extracts of these protected cells possessed enhanced catalase activity of band A and small amounts of bands B and C. A single form of superoxide dismutase and isoforms of catalase were apparent in extracts from a foliar intercellular pathogen, Pseudomonas syringae pv. phaseolicola. The mobilities of these P. syringae enzymes were distinct from those of enzymes in P. putida extracts.

  12. Mannitol, a novel bacterial compatible solute in Pseudomonas putida S12.

    PubMed Central

    Kets, E P; Galinski, E A; de Wit, M; de Bont, J A; Heipieper, H J

    1996-01-01

    The aim of this study was to identify the compatible solutes accumulated by Pseudomonas putida S12 subjected to osmotic stress. In response to reduced water activity, P. putida S12 accumulated Nalpha-acetylglutaminylglutamine amide (NAGGN) simultaneously with a novel compatible solute identified as mannitol (using 13C- and 1H-nuclear magnetic resonance, liquid chromatography-mass spectroscopy and high-performance liquid chromatography methods) to maximum concentrations of 74 and 258 micromol g (dry weight) of cells(-1), respectively. The intracellular amounts of each solute varied with both the type and amount of osmolyte applied to induce osmotic stress in the medium. Both solutes were synthesized de novo. Addition of betaine to the medium resulted in accumulation of this compound and depletion of both NAGGN and mannitol. Mannitol and NAGGN were accumulated when sucrose instead of salts was used to reduce the medium water activity. Furthermore, both compatible solutes were accumulated when glucose was substituted by other carbon sources. However, the intracellular quantities of mannitol decreased when fructose, succinate, or lactate were applied as a carbon source. Mannitol was also raised to high intracellular concentrations by other salt-stressed Pseudomonas putida strains. This is the first study demonstrating a principal role for the de novo-synthesized polyol mannitol in osmoadaptation of a heterotrophic eubacterium. PMID:8955280

  13. Induction of the tod operon by trichloroethylene in Pseudomonas putida TVA8

    SciTech Connect

    Shingleton, J.T.; Applegate, B.M.; Nagel, A.C.; Bienkowski, P.R.; Sayler, G.S.

    1998-12-01

    Bioluminescence, mRNA levels, and toluene degradation rates in Pseudomonas putida TVA8 were measured as a function of various concentrations of toluene and trichloroethylene (TCE). TVA8 showed an increasing bioluminescence response to increasing TCE and toluene concentrations. Compared to uninduced TVA8 cultures, todC1 mRNA levels increased 11-fold for TCE-treated cultures and 13-fold for toluene-treated cultures. Compared to uninduced P. putida F1 cultures, todC1 mRNA levels increased 4,4-fold for TCE-induced cultures and 4.9-fold for toluene-induced cultures. Initial toluene degradation rates were linearly correlated with specific bioluminescence in TVA8 cultures.

  14. Induction of the tod Operon by Trichloroethylene in Pseudomonas putida TVA8

    PubMed Central

    Shingleton, Justin T.; Applegate, Bruce M.; Nagel, Aaron C.; Bienkowski, Paul R.; Sayler, Gary S.

    1998-01-01

    Bioluminescence, mRNA levels, and toluene degradation rates in Pseudomonas putida TVA8 were measured as a function of various concentrations of toluene and trichloroethylene (TCE). TVA8 showed an increasing bioluminescence response to increasing TCE and toluene concentrations. Compared to uninduced TVA8 cultures, todC1 mRNA levels increased 11-fold for TCE-treated cultures and 13-fold for toluene-treated cultures. Compared to uninduced P. putida F1 cultures, todC1 mRNA levels increased 4.4-fold for TCE-induced cultures and 4.9-fold for toluene-induced cultures. Initial toluene degradation rates were linearly correlated with specific bioluminescence in TVA8 cultures. PMID:9835608

  15. High-titer production of monomeric hydroxyvalerates from levulinic acid in Pseudomonas putida.

    PubMed

    Martin, Collin H; Prather, Kristala L Jones

    2009-01-01

    Hydroxyacids represent an important class of compounds that see application in the production of polyesters, biodegradable plastics and antibiotics, and that serve as useful chiral synthetic building blocks for other fine chemicals and pharmaceuticals. An economical, high-titer method for the production of 4-hydroxyvalerate (4HV) and 3-hydroxyvalerate (3HV) from the inexpensive and renewable carbon source levulinic acid was developed. These hydroxyvalerates were produced by periodically feeding levulinate to Pseudomonas putida KT2440 expressing a recombinant thioesterase II (tesB) gene from Escherichia coli K12. The titer of 4HV in shake flask culture reached 13.9+/-1.2 g L(-1) from P. putida tesB(+) cultured at 32 degrees C in LB medium periodically supplemented with glucose and levulinate. The highest 3HV titer obtained was 5.3+/-0.1 g L(-1) in M9 minimal medium supplemented with glucose and levulinate.

  16. LapF and Its Regulation by Fis Affect the Cell Surface Hydrophobicity of Pseudomonas putida

    PubMed Central

    Lahesaare, Andrio; Ainelo, Hanna; Teppo, Annika; Kivisaar, Maia; Heipieper, Hermann J.; Teras, Riho

    2016-01-01

    The ability of bacteria to regulate cell surface hydrophobicity is important for the adaptation to different environmental conditions. The hydrophobicity of cell surface can be determined by several factors, including outer membrane and surface proteins. In this study, we report that an adhesin LapF influences cell surface hydrophobicity of Pseudomonas putida. Cells lacking LapF are less hydrophobic than wild-type cells in stationary growth phase. Moreover, the overexpression of the global regulator Fis decreases surface hydrophobicity by repressing the expression of lapF. Flow cytometry analysis revealed that bacteria producing LapF are more viable when confronted with methanol (a hydrophilic compound) but are more susceptible to 1-octanol (a hydrophobic compound). Thus, these results revealed that LapF is the hydrophobicity factor for the cell surface of P. putida. PMID:27812186

  17. Stereospecific hydroxylation of indan by Escherichia coli containing the cloned toluene dioxygenase genes from Pseudomonas putida F1

    SciTech Connect

    Brand, J.M.; Cruden, D.L.; Zylstra, G.J.; Gibson, D.T. )

    1992-10-01

    Escheria coli JM109(pDTG601), containing the todC1C2BA genes encoding toluene dioxygenase from Pseudomonas putida F1, oxides indan to (-)-(1R)-indanol (83{percent} R) and trans-1,3-indandiol. Under similar conditions, P.putida F39/D oxidizes indan to (-)-(1R)-indanol (96{percent}R), 1-indanone, and trans-1,3-indandiol. The differences in the enantiomeric composition of the 1-indanols formed by the two organisms are due to the presence of a 1-indanol dehydrogenase in P.putida F39/D that preferentially oxidizes (+)-(1S)-indanol.

  18. Cytosine chemoreceptor McpC in Pseudomonas putida F1 also detects nicotinic acid.

    PubMed

    Parales, Rebecca E; Nesteryuk, Vasyl; Hughes, Jonathan G; Luu, Rita A; Ditty, Jayna L

    2014-12-01

    Soil bacteria are generally capable of growth on a wide range of organic chemicals, and pseudomonads are particularly adept at utilizing aromatic compounds. Pseudomonads are motile bacteria that are capable of sensing a wide range of chemicals, using both energy taxis and chemotaxis. Whilst the identification of specific chemicals detected by the ≥26 chemoreceptors encoded in Pseudomonas genomes is ongoing, the functions of only a limited number of Pseudomonas chemoreceptors have been revealed to date. We report here that McpC, a methyl-accepting chemotaxis protein in Pseudomonas putida F1 that was previously shown to function as a receptor for cytosine, was also responsible for the chemotactic response to the carboxylated pyridine nicotinic acid.

  19. Cloning of a creatinase gene from Pseudomonas putida in Escherichia coli by using an indicator plate.

    PubMed Central

    Chang, M C; Chang, C C; Chang, J C

    1992-01-01

    A genomic library of Pseudomonas putida DNA was constructed by using plasmid pBR322. Transformants of Escherichia coli in combination with Proteus mirabilis cells grown on creatinase test plates were screened for creatinase activity; transformants were considered positive for creatinase activity if a red-pink zone appeared around the colonies. One creatinase-positive clone was further analyzed, and the gene was reduced to a 2.7-kb DNA fragment. A unique protein band (with a molecular weight of approximately 50,000) was observed in recombinant E. coli by minicell analysis. Images PMID:1444379

  20. Nucleotide sequencing and characterization of the genes encoding benzene oxidation enzymes of Pseudomonas putida.

    PubMed Central

    Irie, S; Doi, S; Yorifuji, T; Takagi, M; Yano, K

    1987-01-01

    The nucleotide sequence of the genes from Pseudomonas putida encoding oxidation of benzene to catechol was determined. Five open reading frames were found in the sequence. Four corresponding protein molecules were detected by a DNA-directed in vitro translation system. Escherichia coli cells containing the fragment with the four open reading frames transformed benzene to cis-benzene glycol, which is an intermediate of the oxidation of benzene to catechol. The relation between the product of each cistron and the components of the benzene oxidation enzyme system is discussed. Images PMID:3667527

  1. Trichloroethylene removal and oxidation toxicity mediated by toluene dioxygenase of Pseudomonas putida

    SciTech Connect

    Heald, S.; Jenkins, R.O.

    1994-12-01

    Trichloroethylene (TCE) is a major ground water contaminant and potential health hazard in drinking water. This paper reports on the cometabolism of TCE by a wild-type strain of Pseudomonas putida containing an inducible toluene dioxygenase enzyme. The results show rapid TCE removal by the strain but severe oxidation toxicity and rapid cell death. This is also the first report of enhanced capacity of bacterial cells to remove TCE in the presence of dithiothreitol. Presented also is evidence for induction of toluene degradation by TCE. 17 refs., 2 figs., 2 tabs.

  2. Degradation of Chloronitrobenzenes by a Coculture of Pseudomonas putida and a Rhodococcus sp.

    PubMed Central

    Park, Hee-Sung; Lim, Sung-Jin; Chang, Young Keun; Livingston, Andrew G.; Kim, Hak-Sung

    1999-01-01

    A single microorganism able to mineralize chloronitrobenzenes (CNBs) has not been reported, and degradation of CNBs by coculture of two microbial strains was attempted. Pseudomonas putida HS12 was first isolated by analogue enrichment culture using nitrobenzene (NB) as the substrate, and this strain was observed to possess a partial reductive pathway for the degradation of NB. From high-performance liquid chromatography-mass spectrometry and 1H nuclear magnetic resonance analyses, NB-grown cells of P. putida HS12 were found to convert 3- and 4-CNBs to the corresponding 5- and 4-chloro-2-hydroxyacetanilides, respectively, by partial reduction and subsequent acetylation. For the degradation of CNBs, Rhodococcus sp. strain HS51, which degrades 4- and 5-chloro-2-hydroxyacetanilides, was isolated and combined with P. putida HS12 to give a coculture. This coculture was confirmed to mineralize 3- and 4-CNBs in the presence of an additional carbon source. A degradation pathway for 3- and 4-CNBs by the two isolated strains was also proposed. PMID:10049867

  3. Metabolic engineering of Pseudomonas putida for production of docosahexaenoic acid based on a myxobacterial PUFA synthase.

    PubMed

    Gemperlein, Katja; Zipf, Gregor; Bernauer, Hubert S; Müller, Rolf; Wenzel, Silke C

    2016-01-01

    Long-chain polyunsaturated fatty acids (LC-PUFAs) can be produced de novo via polyketide synthase-like enzymes known as PUFA synthases, which are encoded by pfa biosynthetic gene clusters originally discovered from marine microorganisms. Recently similar gene clusters were detected and characterized in terrestrial myxobacteria revealing several striking differences. As the identified myxobacterial producers are difficult to handle genetically and grow very slowly we aimed to establish heterologous expression platforms for myxobacterial PUFA synthases. Here we report the heterologous expression of the pfa gene cluster from Aetherobacter fasciculatus (SBSr002) in the phylogenetically distant model host bacteria Escherichia coli and Pseudomonas putida. The latter host turned out to be the more promising PUFA producer revealing higher production rates of n-6 docosapentaenoic acid (DPA) and docosahexaenoic acid (DHA). After several rounds of genetic engineering of expression plasmids combined with metabolic engineering of P. putida, DHA production yields were eventually increased more than threefold. Additionally, we applied synthetic biology approaches to redesign and construct artificial versions of the A. fasciculatus pfa gene cluster, which to the best of our knowledge represents the first example of a polyketide-like biosynthetic gene cluster modulated and synthesized for P. putida. Combination with the engineering efforts described above led to a further increase in LC-PUFA production yields. The established production platform based on synthetic DNA now sets the stage for flexible engineering of the complex PUFA synthase. Copyright © 2015 International Metabolic Engineering Society. Published by Elsevier Inc. All rights reserved.

  4. Metabolic Engineering of Pseudomonas putida KT2440 to Produce Anthranilate from Glucose

    PubMed Central

    Kuepper, Jannis; Dickler, Jasmin; Biggel, Michael; Behnken, Swantje; Jäger, Gernot; Wierckx, Nick; Blank, Lars M.

    2015-01-01

    The Pseudomonas putida KT2440 strain was engineered in order to produce anthranilate (oAB, ortho-aminobenzoate), a precursor of the aromatic amino acid tryptophan, from glucose as sole carbon source. To enable the production of the metabolic intermediate oAB, the trpDC operon encoding an anthranilate phosphoribosyltransferase (TrpD) and an indole-3-glycerol phosphate synthase (TrpC), were deleted. In addition, the chorismate mutase (pheA) responsible for the conversion of chorismate over prephenate to phenylpyruvate was deleted in the background of the deletion of trpDC to circumvent a potential drain of precursor. To further increase the oAB production, a feedback insensitive version of 3-deoxy-D-arabino-heptulosonate-7-phosphate synthase encoded by the aroGD146N gene and an anthranilate synthase (trpES40FG) were overexpressed separately and simultaneously in the deletion mutants. With optimized production conditions in a tryptophan-limited fed-batch process a maximum of 1.54 ± 0.3 g L-1 (11.23 mM) oAB was obtained with the best performing engineered P. putida KT2440 strain (P. putida ΔtrpDC pSEVA234_aroGD146N_trpES40FG). PMID:26635771

  5. Antibiotic Resistance Determinants in a Pseudomonas putida Strain Isolated from a Hospital

    PubMed Central

    Duque, Estrella; Fernández, Matilde; Molina-Santiago, Carlos; Roca, Amalia; Porcel, Mario; de la Torre, Jesús; Segura, Ana; Plesiat, Patrick; Jeannot, Katy; Ramos, Juan-Luis

    2014-01-01

    Environmental microbes harbor an enormous pool of antibiotic and biocide resistance genes that can impact the resistance profiles of animal and human pathogens via horizontal gene transfer. Pseudomonas putida strains are ubiquitous in soil and water but have been seldom isolated from humans. We have established a collection of P. putida strains isolated from in-patients in different hospitals in France. One of the isolated strains (HB3267) kills insects and is resistant to the majority of the antibiotics used in laboratories and hospitals, including aminoglycosides, ß-lactams, cationic peptides, chromoprotein enediyne antibiotics, dihydrofolate reductase inhibitors, fluoroquinolones and quinolones, glycopeptide antibiotics, macrolides, polyketides and sulfonamides. Similar to other P. putida clinical isolates the strain was sensitive to amikacin. To shed light on the broad pattern of antibiotic resistance, which is rarely found in clinical isolates of this species, the genome of this strain was sequenced and analysed. The study revealed that the determinants of multiple resistance are both chromosomally-borne as well as located on the pPC9 plasmid. Further analysis indicated that pPC9 has recruited antibiotic and biocide resistance genes from environmental microorganisms as well as from opportunistic and true human pathogens. The pPC9 plasmid is not self-transmissible, but can be mobilized by other bacterial plasmids making it capable of spreading antibiotic resistant determinants to new hosts. PMID:24465371

  6. The c-di-GMP phosphodiesterase BifA regulates biofilm development in Pseudomonas putida.

    PubMed

    Jiménez-Fernández, Alicia; López-Sánchez, Aroa; Calero, Patricia; Govantes, Fernando

    2015-02-01

    We previously showed the isolation of biofilmpersistent Pseudomonas putida mutants that fail to undergo biofilm dispersal upon entry in stationary phase. Two such mutants were found to bear insertions in PP0914, encoding a GGDEF/EAL domain protein with high similarity to Pseudomon asaeruginosa BifA. Here we show the phenotypic characterization of a ΔbifA mutant in P. putida KT2442.This mutant displayed increased biofilm and pellicle formation, cell aggregation in liquid medium and decreased starvation-induced biofilm dispersal relative to the wild type. Unlike its P. aeruginosa counterpart, P. putida BifA did not affect swarming motility. The hyperadherent phenotype of the ΔbifA mutant correlates with a general increase in cyclic diguanylate (c-di-GMP) levels, Congo Red-binding exopolyaccharide production and transcription of the adhesin-encoding lapA gene. Integrity of the EAL motif and a modified GGDEF motif (altered to GGDQF)were crucial for BifA activity, and c-di-GMP depletion by overexpression of a heterologous c-di-GMP phosphodiesterase in the ΔbifA mutant restored wild-type biofilm dispersal and lapA expression.Our results indicate that BifA is a phosphodiesterase involved in the regulation of the c-di-GMP pool and required for the generation of the low c-di-GMP signal that triggers starvation-induced biofilm dispersal.

  7. Controlled autolysis facilitates the polyhydroxyalkanoate recovery in Pseudomonas putida KT2440

    PubMed Central

    Martínez, Virginia; García, Pedro; García, José Luis; Prieto, María Auxiliadora

    2011-01-01

    Summary The development of efficient recovery processes is essential to reduce the cost of polyhydroxyalkanoates (PHAs) production. In this work, a programmed self‐disruptive Pseudomonas putida BXHL strain, derived from the prototype medium‐chain‐length PHA producer bacterium P. putida KT2440, was constructed as a proof of concept for exploring the possibility to control and facilitate the release of PHA granules to the extracellular medium. The new autolytic cell disruption system is based on two simultaneous strategies: the coordinated action of two proteins from the pneumococcal bacteriophage EJ‐1, an endolysin (Ejl) and a holin (Ejh), and the mutation of the tolB gene, which exhibits alterations in outer membrane integrity that induce lysis hypersensitivity. The ejl and ejh coding genes were expressed under a XylS/Pm monocopy expression system inserted into the chromosome of the tolB mutant strain, in the presence of 3‐methylbenzoate as inducer molecule. Our results demonstrate that the intracellular presence of PHA granules confers resistance to cell envelope. Conditions to control the cell autolysis in P. putida BXHL in terms of optimal fermentation, PHA content and PHA recovery have been set up by exploring the sensitivity to detergents, chelating agents and wet biomass solubility in organic solvents such as ethyl acetate. PMID:21418544

  8. Degradation of chloronitrobenzenes by a coculture of Pseudomonas putida and a Rhodococcus sp.

    SciTech Connect

    Park, H.S.; Lim, S.J.; Chang, Y.K.; Kim, H.S.; Livingston, A.G.

    1999-03-01

    A single microorganism able to mineralize chloronitrobenzenes (CNBs) has not been reported, and degradation of CNBs of coculture of two microbial strains was attempted. Pseudomonas putida HS12 was first isolated by analogue enrichment culture using nitrobenzene (NB) as the substrate, and this strain was observed to possess a partial reductive pathway for the degradation of NB. From high-performance liquid chromatography-mass spectrometry and {sup 1}H nuclear magnetic resonance analyses, NB-grown cells of P. putida HS12 were found to convert 3- and 4-CNBs to the corresponding 5- and 4-chloro-2-hydroxyacetanilides, respectively, by partial reduction and subsequent acetylation. For the degradation of CNBs, Rhodococcus sp. strain HS51, which degrades 4- and 5-chloro-2-hydroxyacetanilides, was isolated and combined with P. putida HS12 to give a coculture. This coculture was confirmed to mineralize 3- and 4-CNBs in the presence of an additional carbon source. A degradation pathway for 3- and 4-CNBs by the two isolated strains was also proposed.

  9. Engineering of Solvent-Tolerant Pseudomonas putida S12 for Bioproduction of Phenol from Glucose

    PubMed Central

    Wierckx, Nick J. P.; Ballerstedt, Hendrik; de Bont, Jan A. M.; Wery, Jan

    2005-01-01

    Efficient bioconversion of glucose to phenol via the central metabolite tyrosine was achieved in the solvent-tolerant strain Pseudomonas putida S12. The tpl gene from Pantoea agglomerans, encoding tyrosine phenol lyase, was introduced into P. putida S12 to enable phenol production. Tyrosine availability was a bottleneck for efficient production. The production host was optimized by overexpressing the aroF-1 gene, which codes for the first enzyme in the tyrosine biosynthetic pathway, and by random mutagenesis procedures involving selection with the toxic antimetabolites m-fluoro-dl-phenylalanine and m-fluoro-l-tyrosine. High-throughput screening of analogue-resistant mutants obtained in this way yielded a P. putida S12 derivative capable of producing 1.5 mM phenol in a shake flask culture with a yield of 6.7% (mol/mol). In a fed-batch process, the productivity was limited by accumulation of 5 mM phenol in the medium. This toxicity was overcome by use of octanol as an extractant for phenol in a biphasic medium-octanol system. This approach resulted in accumulation of 58 mM phenol in the octanol phase, and there was a twofold increase in the overall production compared to a single-phase fed batch. PMID:16332806

  10. Three Pseudomonas putida FNR Family Proteins with Different Sensitivities to O2.

    PubMed

    Ibrahim, Susan A; Crack, Jason C; Rolfe, Matthew D; Borrero-de Acuña, José Manuel; Thomson, Andrew J; Le Brun, Nick E; Schobert, Max; Stapleton, Melanie R; Green, Jeffrey

    2015-07-03

    The Escherichia coli fumarate-nitrate reduction regulator (FNR) protein is the paradigm for bacterial O2-sensing transcription factors. However, unlike E. coli, some bacterial species possess multiple FNR proteins that presumably have evolved to fulfill distinct roles. Here, three FNR proteins (ANR, PP_3233, and PP_3287) from a single bacterial species, Pseudomonas putida KT2440, have been analyzed. Under anaerobic conditions, all three proteins had spectral properties resembling those of [4Fe-4S] proteins. The reactivity of the ANR [4Fe-4S] cluster with O2 was similar to that of E. coli FNR, and during conversion to the apo-protein, via a [2Fe-2S] intermediate, cluster sulfur was retained. Like ANR, reconstituted PP_3233 and PP_3287 were converted to [2Fe-2S] forms when exposed to O2, but their [4Fe-4S] clusters reacted more slowly. Transcription from an FNR-dependent promoter with a consensus FNR-binding site in P. putida and E. coli strains expressing only one FNR protein was consistent with the in vitro responses to O2. Taken together, the experimental results suggest that the local environments of the iron-sulfur clusters in the different P. putida FNR proteins influence their reactivity with O2, such that ANR resembles E. coli FNR and is highly responsive to low concentrations of O2, whereas PP_3233 and PP_3287 have evolved to be less sensitive to O2.

  11. Pseudomonas putida F1 uses energy taxis to sense hydroxycinnamic acids.

    PubMed

    Hughes, Jonathan G; Zhang, Xiangsheng; Parales, Juanito V; Ditty, Jayna L; Parales, Rebecca E

    2017-09-28

    Soil bacteria such as pseudomonads are widely studied due to their diverse metabolic capabilities, particularly the ability to degrade both naturally occurring and xenobiotic aromatic compounds. Chemotaxis, the directed movement of cells in response to chemical gradients, is common in motile soil bacteria and the wide range of chemicals detected often mirrors the metabolic diversity observed. Pseudomonas putida F1 is a soil isolate capable of chemotaxis toward, and degradation of, numerous aromatic compounds. We showed that P. putida F1 is capable of degrading members of a class of naturally occurring aromatic compounds known as hydroxycinnamic acids, which are components of lignin and are ubiquitous in the soil environment. We also demonstrated the ability of P. putida F1 to sense three hydroxycinnamic acids: p-coumaric, caffeic and ferulic acids. The chemotaxis response to hydroxycinnamic acids was induced during growth in the presence of hydroxycinnamic acids and was negatively regulated by HcaR, the repressor of the hydroxycinnamic acid catabolic genes. Chemotaxis to the three hydroxycinnamic acids was dependent on catabolism, as a mutant lacking the gene encoding feruloyl-CoA synthetase (Fcs), which catalyzes the first step in hydroxycinnamic acid degradation, was unable to respond chemotactically toward p-coumaric, caffeic, or ferulic acids. We tested whether an energy taxis mutant could detect hydroxycinnamic acids and determined that hydroxycinnamic acid sensing is mediated by the energy taxis receptor Aer2.

  12. Repression of Pseudomonas putida phenanthrene-degrading activity by plant root extracts and exudates.

    PubMed

    Rentz, Jeremy A; Alvarez, Pedro J J; Schnoor, Jerald L

    2004-06-01

    The phenanthrene-degrading activity (PDA) of Pseudomonas putida ATCC 17484 was repressed after incubation with plant root extracts of oat (Avena sativa), osage orange (Maclura pomifera), hybrid willow (Salix alba x matsudana), kou (Cordia subcordata) and milo (Thespesia populnea) and plant root exudates of oat (Avena sativa) and hybrid poplar (Populus deltoides x nigra DN34). Total organic carbon content of root extracts ranged from 103 to 395 mg l(-1). Characterization of root extracts identified acetate (not detectable to 8.0 mg l(-1)), amino acids (1.7-17.3 mg l(-1)) and glucose (1.6-14.0 mg l(-1)), indicating a complex mixture of substrates. Repression was also observed after exposure to potential root-derived substrates, including organic acids, glucose (carbohydrate) and glutamate (amino acid). Carbon source regulation (e.g. catabolite repression) was apparently responsible for the observed repression of P. putida PDA by root extracts. However, we showed that P. putida grows on root extracts and exudates as sole carbon and energy sources. Enhanced growth on root products may compensate for partial repression, because larger microbial populations are conducive to faster degradation rates. This would explain the commonly reported increase in phenanthrene removal in the rhizosphere.

  13. Effect of gravity on Pseudomonas putida and kaolinite cotransport in water saturated porous media

    NASA Astrophysics Data System (ADS)

    Vasiliadou, Ioanna A.; Chrysikopoulos, Constantinos V.

    2013-04-01

    Bacterial transport in porous media can be affected by several factors, such as cell concentration, water velocity, and attachment onto the solid matrix or suspended in the aqueous phase soil particles (e.g. clays). Gravity, also may significantly influence bacterial transport behavior in the subsurface. The present study aims to determine the gravity effect on transport and cotransport of bacteria species Pseudomonas (P.) putida and kaolinite colloid particles in porous media. Transport experiments were conducted under horizontal-, up- and down-flow conditions in water saturated columns packed with glass beads. These different flow modes represent different gravity effects, namely: no-, negative- and positive-gravity effect. Initial experiments were performed with bacteria and kaolinite alone in order to evaluate the effect of gravity on their individual transport characteristics. No significant gravity effect was observed on the transport of individual bacterial cells. In contrary, each different flow mode was found to differently affect kaolinite transport. Compared to the horizontal-flow mode, the kaolinite mass recovery was decreased during the up-flow mode, and increased during the down-flow mode. Finally, P. putida and kaolinite particles were injected simultaneously into the packed column in order to investigate their cotransport behavior under different flow modes. The experimental data indicated that the kaolinite-P. putida cotransport behavior was similar to that observed for the transport of individual kaolinite particles. It was observed that the P. putida mass recovery decreased during down-flow conditions. This phenomenon may be caused by the attachment of bacteria onto kaolinite particles, which were adsorbed onto the solid matrix.

  14. Entner–Doudoroff pathway for sulfoquinovose degradation in Pseudomonas putida SQ1

    PubMed Central

    Felux, Ann-Katrin; Spiteller, Dieter; Klebensberger, Janosch; Schleheck, David

    2015-01-01

    Sulfoquinovose (SQ; 6-deoxy-6-sulfoglucose) is the polar head group of the plant sulfolipid SQ-diacylglycerol, and SQ comprises a major proportion of the organosulfur in nature, where it is degraded by bacteria. A first degradation pathway for SQ has been demonstrated recently, a “sulfoglycolytic” pathway, in addition to the classical glycolytic (Embden–Meyerhof) pathway in Escherichia coli K-12; half of the carbon of SQ is abstracted as dihydroxyacetonephosphate (DHAP) and used for growth, whereas a C3-organosulfonate, 2,3-dihydroxypropane sulfonate (DHPS), is excreted. The environmental isolate Pseudomonas putida SQ1 is also able to use SQ for growth, and excretes a different C3-organosulfonate, 3-sulfolactate (SL). In this study, we revealed the catabolic pathway for SQ in P. putida SQ1 through differential proteomics and transcriptional analyses, by in vitro reconstitution of the complete pathway by five heterologously produced enzymes, and by identification of all four organosulfonate intermediates. The pathway follows a reaction sequence analogous to the Entner–Doudoroff pathway for glucose-6-phosphate: It involves an NAD+-dependent SQ dehydrogenase, 6-deoxy-6-sulfogluconolactone (SGL) lactonase, 6-deoxy-6-sulfogluconate (SG) dehydratase, and 2-keto-3,6-dideoxy-6-sulfogluconate (KDSG) aldolase. The aldolase reaction yields pyruvate, which supports growth of P. putida, and 3-sulfolactaldehyde (SLA), which is oxidized to SL by an NAD(P)+-dependent SLA dehydrogenase. All five enzymes are encoded in a single gene cluster that includes, for example, genes for transport and regulation. Homologous gene clusters were found in genomes of other P. putida strains, in other gamma-Proteobacteria, and in beta- and alpha-Proteobacteria, for example, in genomes of Enterobacteria, Vibrio, and Halomonas species, and in typical soil bacteria, such as Burkholderia, Herbaspirillum, and Rhizobium. PMID:26195800

  15. Entner-Doudoroff pathway for sulfoquinovose degradation in Pseudomonas putida SQ1.

    PubMed

    Felux, Ann-Katrin; Spiteller, Dieter; Klebensberger, Janosch; Schleheck, David

    2015-08-04

    Sulfoquinovose (SQ; 6-deoxy-6-sulfoglucose) is the polar head group of the plant sulfolipid SQ-diacylglycerol, and SQ comprises a major proportion of the organosulfur in nature, where it is degraded by bacteria. A first degradation pathway for SQ has been demonstrated recently, a "sulfoglycolytic" pathway, in addition to the classical glycolytic (Embden-Meyerhof) pathway in Escherichia coli K-12; half of the carbon of SQ is abstracted as dihydroxyacetonephosphate (DHAP) and used for growth, whereas a C3-organosulfonate, 2,3-dihydroxypropane sulfonate (DHPS), is excreted. The environmental isolate Pseudomonas putida SQ1 is also able to use SQ for growth, and excretes a different C3-organosulfonate, 3-sulfolactate (SL). In this study, we revealed the catabolic pathway for SQ in P. putida SQ1 through differential proteomics and transcriptional analyses, by in vitro reconstitution of the complete pathway by five heterologously produced enzymes, and by identification of all four organosulfonate intermediates. The pathway follows a reaction sequence analogous to the Entner-Doudoroff pathway for glucose-6-phosphate: It involves an NAD(+)-dependent SQ dehydrogenase, 6-deoxy-6-sulfogluconolactone (SGL) lactonase, 6-deoxy-6-sulfogluconate (SG) dehydratase, and 2-keto-3,6-dideoxy-6-sulfogluconate (KDSG) aldolase. The aldolase reaction yields pyruvate, which supports growth of P. putida, and 3-sulfolactaldehyde (SLA), which is oxidized to SL by an NAD(P)(+)-dependent SLA dehydrogenase. All five enzymes are encoded in a single gene cluster that includes, for example, genes for transport and regulation. Homologous gene clusters were found in genomes of other P. putida strains, in other gamma-Proteobacteria, and in beta- and alpha-Proteobacteria, for example, in genomes of Enterobacteria, Vibrio, and Halomonas species, and in typical soil bacteria, such as Burkholderia, Herbaspirillum, and Rhizobium.

  16. Anoxic metabolism and biochemical production in Pseudomonas putida F1 driven by a bioelectrochemical system.

    PubMed

    Lai, Bin; Yu, Shiqin; Bernhardt, Paul V; Rabaey, Korneel; Virdis, Bernardino; Krömer, Jens O

    2016-01-01

    Pseudomonas putida is a promising host for the bioproduction of chemicals, but its industrial applications are significantly limited by its obligate aerobic character. The aim of this paper is to empower the anoxic metabolism of wild-type Pseudomonas putida to enable bioproduction anaerobically, with the redox power from a bioelectrochemical system (BES). The obligate aerobe Pseudomonas putida F1 was able to survive and produce almost exclusively 2-Keto-gluconate from glucose under anoxic conditions due to redox balancing with electron mediators in a BES. 2-Keto-gluconate, a precursor for industrial anti-oxidant production, was produced at an overall carbon yield of over 90 % based on glucose. Seven different mediator compounds were tested, and only those with redox potential above 0.207 V (vs standard hydrogen electrode) showed interaction with the cells. The productivity increased with the increasing redox potential of the mediator, indicating this was a key factor affecting the anoxic production process. P. putida cells survived under anaerobic conditions, and limited biofilm formation could be observed on the anode's surface. Analysis of the intracellular pools of ATP, ADP and AMP showed that cells had an increased adenylate energy charge suggesting that cells were able to generate energy using the anode as terminal electron acceptor. The analysis of NAD(H) and NADP(H) showed that in the presence of specific extracellular electron acceptors, the NADP(H) pool was more oxidised, while the NAD(H) pool was unchanged. This implies a growth limitation under anaerobic conditions due to a shortage of NADPH and provides a way to limit biomass formation, while allowing cell maintenance and catalysis at high purity and yield. For the first time, this study proved the principle that a BES-driven bioconversion of glucose can be achieved for a wild-type obligate aerobe. This non-growth bioconversion was in high yields, high purity and also could deliver the necessary

  17. Attachment of Pseudomonas putida onto differently structured kaolinite minerals: a combined ATR-FTIR and 1H NMR study.

    PubMed

    Vasiliadou, Ioanna A; Papoulis, Dimitris; Chrysikopoulos, Constantinos V; Panagiotaras, Dionisios; Karakosta, Eleni; Fardis, Michael; Papavassiliou, Georgios

    2011-06-01

    The attachment of Pseudomonas (P.) putida onto well (KGa-1) and poorly (KGa-2) crystallized kaolinite was investigated in this study. Batch experiments were carried out to determine the attachment isotherms of P. putida onto both types of kaolinite particles. The attachment process of P. putida onto KGa-1 and KGa-2 was adequately described by a Langmuir isotherm. Attenuated Total Reflection Fourier Transform Infrared Spectroscopy and Nuclear Magnetic Resonance were employed to study the attachment mechanisms of P. putida. Experimental results indicated that KGa-2 presented higher affinity and attachment capacity than KGa-1. It was shown that electrostatic interactions and clay mineral structural disorders can influence the attachment capacity of clay mineral particles.

  18. Temperature and pyoverdine-mediated iron acquisition control surface motility of Pseudomonas putida.

    PubMed

    Matilla, Miguel A; Ramos, Juan L; Duque, Estrella; de Dios Alché, Juan; Espinosa-Urgel, Manuel; Ramos-González, María Isabel

    2007-07-01

    Pseudomonas putida KT2440 is unable to swarm at its common temperature of growth in the laboratory (30 degrees C) but exhibits surface motility similar to swarming patterns in other Pseudomonas between 18 degrees C and 28 degrees C. These motile cells show differentiation, consisting on elongation and the presence of surface appendages. Analysis of a collection of mutants to define the molecular determinants of this type of surface movement in KT2440 shows that while type IV pili and lipopolysaccharide O-antigen are requisites flagella are not. Although surface motility of flagellar mutants was macroscopically undistinguishable from that of the wild type, microscopy analysis revealed that these mutants move using a distinct mechanism to that of the wild-type strain. Mutants either in the siderophore pyoverdine (ppsD) or in the FpvA siderophore receptor were also unable to spread on surfaces. Motility in the ppsD strain was totally restored with pyoverdine and partially with the wild-type ppsD allele. Phenotype of the fpvA strain was not complemented by this siderophore. We discuss that iron influences surface motility and that it can be an environmental cue for swarming-like movement in P. putida. This study constitutes the first report assigning an important role to pyoverdine iron acquisition in en masse bacterial surface movement.

  19. Mechanisms of solvent resistance mediated by interplay of cellular factors in Pseudomonas putida.

    PubMed

    Ramos, Juan-Luis; Sol Cuenca, Maria; Molina-Santiago, Carlos; Segura, Ana; Duque, Estrella; Gómez-García, María R; Udaondo, Zulema; Roca, Amalia

    2015-07-01

    A number of microorganisms have the ability to thrive in the presence of a range of toxic solvents. Tolerance to these chemicals is a multifactorial process, meaning that bacterial cells use a set of physiological and gene expression changes to overcome the damage imparted by these chemicals. This review focuses mainly on issues related to tolerance to aromatic hydrocarbons and butanol in Pseudomonas, although other microorganisms are also discussed. Pseudomonas putida strains contain a circular chromosome of approximately 6 Mbp which encodes about 5300 genes. A combination of physiological and biochemical assays, a genome-wide collection of mutants and several omics approaches have provided useful information to help identify functions involved in solvent tolerance in P. putida. The solvent response involves fine-tuning of lipid fluidity to adjust membrane functions including impermeabilization, activation of a general stress-response system, increased energy generation and induction of specific efflux pumps that extrude solvents to the medium. These responses are modulated at the transcriptional level by local and global regulators as well as by a number of sRNAs whose levels fluctuate with the presence of solvents in the environment. Taken as a whole these regulatory inputs orchestrate the complex network of metabolic responses observed after solvent addition.

  20. Novel AroA from Pseudomonas putida Confers Tobacco Plant with High Tolerance to Glyphosate

    PubMed Central

    Yan, Hai-Qin; Chang, Su-Hua; Tian, Zhe-Xian; Zhang, Le; Sun, Yi-Cheng; Li, Yan; Wang, Jing; Wang, Yi-Ping

    2011-01-01

    Glyphosate is a non-selective broad-spectrum herbicide that inhibits 5-enolpyruvylshikimate-3-phosphate synthase (EPSPS, also designated as AroA), a key enzyme in the aromatic amino acid biosynthesis pathway in microorganisms and plants. Previously, we reported that a novel AroA (PpAroA1) from Pseudomonas putida had high tolerance to glyphosate, with little homology to class I or class II glyphosate-tolerant AroA. In this study, the coding sequence of PpAroA1 was optimized for tobacco. For maturation of the enzyme in chloroplast, a chloroplast transit peptide coding sequence was fused in frame with the optimized aroA gene (PparoA1optimized) at the 5′ end. The PparoA1optimized gene was introduced into the tobacco (Nicotiana tabacum L. cv. W38) genome via Agrobacterium-mediated transformation. The transformed explants were first screened in shoot induction medium containing kanamycin. Then glyphosate tolerance was assayed in putative transgenic plants and its T1 progeny. Our results show that the PpAroA1 from Pseudomonas putida can efficiently confer tobacco plants with high glyphosate tolerance. Transgenic tobacco overexpressing the PparoA1optimized gene exhibit high tolerance to glyphosate, which suggest that the novel PpAroA1 is a new and good candidate applied in transgenic crops with glyphosate tolerance in future. PMID:21611121

  1. [Removal of toluene waste gas by Pseudomonas putida with a bio-trickling filter].

    PubMed

    Zhang, Shu-Jing; Li, Jian; Li, Yi-Li; Jin, Yu-Quan; Sun, Li

    2007-08-01

    In transient conditions close to the industrialized application situation, the removal of toluene was investigated with a lab-scale bio-trickling filter inoculated with pure bacterial culture (Pseudomonas putida). The start-up process and the ability of resisting different toluene loading in the steady state on the performance of the bio-trickling filter were studied. The microstructure of biofilm in the filter was also observed. With inlet concentration range from 544 to 1044 mg x m(-3) at the temperature ranging from 17 to 26 degrees C, the removal efficiency of toluene was almost 100% at the residence time of 54 s and 43.2 s. The maximum volumetric removal loading of 105.35 g x (m3 x h)(-1) was achieved. The results indicate that it was feasible to remove toluene by Pseudomonas putida which had not be acclimated by toluene. In the steady state, the bio-trickling filter had a high flexibility for the load change and the removal efficiency of the reactor was not influenced by the variance of residence time and inlet concentration. The rapid increase of biofilm can be controlled by adjusting the interval of nutrition liquid accession. There were some changes in bacterial community, and lots of micro-pore existed in the biofilm. It was proved that the absorption of the biofilm was an important precondition for the biodegradation of toluene.

  2. Cloning and sequence analysis of the LPD-glc structural gene of Pseudomonas putida.

    PubMed Central

    Palmer, J A; Hatter, K; Sokatch, J R

    1991-01-01

    Pseudomonas putida is able to produce three lipoamide dehydrogenases: (i) LPD-glc, which is the E3 component of the pyruvate and 2-ketoglutarate dehydrogenase complexes and the L-factor for the glycine oxidation system; (ii) LPD-val, which is the specific E3 component of the branched-chain keto acid dehydrogenase complex and is induced by growth on leucine, isoleucine, or valine; and (iii) LPD-3, which was discovered in a lpdG mutant and whose role is unknown. Southern hybridization with an oligonucleotide probe encoding the highly conserved redox-active site produced three bands corresponding to the genes encoding these three lipoamide dehydrogenases. The complete structural gene for LPD-glc, lpdG, was isolated, and its nucleotide sequence was determined. The latter consists of 476 codons plus a stop codon, TAA. The structural gene for LPD-glc is preceded by a partial open reading frame with strong similarity to the E2 component of 2-ketoglutarate dehydrogenase of Escherichia coli. This suggests that lpdG is part of the 2-ketoglutarate dehydrogenase operon. LPD-glc was expressed in Pseudomonas putida JS348 from pHP4 which contains a partial open reading frame corresponding to the E2 component, 94 bases of noncoding DNA, and the structural gene for lpdG. This result indicates that lpdG can be expressed separately from the other genes of the operon. Images PMID:1902462

  3. Interspecies signalling: Pseudomonas putida efflux pump TtgGHI is activated by indole to increase antibiotic resistance.

    PubMed

    Molina-Santiago, Carlos; Daddaoua, Abdelali; Fillet, Sandy; Duque, Estrella; Ramos, Juan-Luis

    2014-05-01

    In Gram-negative bacteria, multidrug efflux pumps are responsible for the extrusion of chemicals that are deleterious for growth. Some of these efflux pumps are induced by endogenously produced effectors, while abiotic or biotic signals induce the expression of other efflux pumps. In Pseudomonas putida, the TtgABC efflux pump is the main antibiotic extrusion system that respond to exogenous antibiotics through the modulation of the expression of this operon mediated by TtgR. The plasmid-encoded TtgGHI efflux pump in P. putida plays a minor role in antibiotic resistance in the parental strain; however, its role is critical in isogenic backgrounds deficient in TtgABC. Expression of ttgGHI is repressed by the TtgV regulator that recognizes indole as an effector, although P. putida does not produce indole itself. Because indole is not produced by Pseudomonas, the indole-dependent antibiotic resistance seems to be part of an antibiotic resistance programme at the community level. Pseudomonas putida recognizes indole added to the medium or produced by Escherichia coli in mixed microbial communities. Transcriptomic analyses revealed that the indole-specific response involves activation of 43 genes and repression of 23 genes. Indole enhances not only the expression of the TtgGHI pump but also a set of genes involved in iron homeostasis, as well as genes for amino acid catabolism. In a ttgABC-deficient P. putida, background ampicillin and other bactericidal compounds lead to cell death. Co-culture of E. coli and P. putida ΔttgABC allowed growth of the P. putida mutant in the presence of ampicillin because of induction of the indole-dependent efflux pump.

  4. Molecular cloning of the Pseudomonas carboxypeptidase G2 gene and its expression in Escherichia coli and Pseudomonas putida.

    PubMed Central

    Minton, N P; Atkinson, T; Sherwood, R F

    1983-01-01

    The gene coding for carboxypeptidase G2 was cloned from Pseudomonas sp. strain RS-16 into Escherichia coli W5445 by inserting Sau3A-generated DNA fragments into the BamHI site of pBR322. The plasmid isolated, pNM1, was restriction mapped, and the position of the gene on the 5.8-megadalton insert was pinpointed by subcloning. The expression of carboxypeptidase in E. coli was 100-fold lower than in the Pseudomonas sp. strain. When the cloned gene was subcloned into the Pseudomonas vector pKT230 and introduced into Pseudomonas putida 2440, a 30-fold increase in expression over that obtained in E. coli was observed. High expression (up to 5% soluble protein) was obtained in E. coli by subcloning a 3.1-megadalton Bg/II fragment into the BamHI site of pAT153. The increased expression was orientation dependent and is presumed to be due to transcriptional readthrough from the Tc promoter of the vector. Production of carboxypeptidase was shown to be induced (two-fold) by the presence of folic acid, and the mature protein was shown to be located in the periplasmic space of E. coli. Images PMID:6358192

  5. Enhanced production of medium-chain-length polyhydroxyalkanoates (PHA) by PHA depolymerase knockout mutant of Pseudomonas putida KT2442.

    PubMed

    Cai, Lei; Yuan, Mei-Qing; Liu, Feng; Jian, Jia; Chen, Guo-Qiang

    2009-04-01

    Pseudomonas putida KT2442 is a medium-chain-length polyhydroxyalkanoates (PHA) producer. One of the main shortages in the production of PHA has been the intracellular PHA degradation caused by its endogenous PHA depolymerase. The aim of this study was to improve PHA production via removing the PHA degradation mechanism. PHA depolymerase phaZ knockout mutant P. putida KTMQ01 was successfully constructed, which accumulated 86 wt% medium-chain-length PHA (mcl PHA) when cultured in mineral medium containing sodium octanoate as the carbon source compared with P. putida KT2442 which produced only 66 wt% of its cell dry weight (CDW). P. putida KTMQ01 cultured over a five-day period on sodium octanoate produced 4.5 g L(-1)-4.0 g L(-1) CDW containing approximately 80 wt% PHA without degradation. In contrast, P. putida KT2442 was observed with decreasing CDW and PHA from over 4 to less than 2 g L(-1) over the same period of time, indicating the function of PHA depolymerases which reduced the amount of PHA from around 50 wt% to none over the incubation period. RT-PCR analysis showed that phaC2 transcriptional level of P. putida KTMQ01 was higher than that of P. putida KT2442, indicating the possibility of relief on negative control of phaC2 transcription by the deletion of phaZ, which combined with the lack of in vivo PHA degradation, led to more PHA accumulation. P. putida KTMQ01 contained PHA granules with larger sizes and smaller numbers than those of P. putida KT2442.

  6. Draft Genome Sequence of Pseudomonas putida BW11M1, a Banana Rhizosphere Isolate with a Diversified Antimicrobial Armamentarium

    PubMed Central

    Swings, Toon; Michiels, Jan; Gross, Harald; De Mot, René

    2016-01-01

    In this study, we report the draft genome of Pseudomonas putida BW11M1, a banana rhizosphere isolate producing various antimicrobial compounds, including a lectin-like bacteriocin, an R-type tailocin, the cyclic lipopeptide xantholysin, and the fatty acid–derived pseudopyronine. PMID:27081131

  7. Characterization of Phenotypic Changes in Pseudomonas putida in Response to Surface-Associated Growth

    PubMed Central

    Sauer, Karin; Camper, Anne K.

    2001-01-01

    The formation of complex bacterial communities known as biofilms begins with the interaction of planktonic cells with a surface. A switch between planktonic and sessile growth is believed to result in a phenotypic change in bacteria. In this study, a global analysis of physiological changes of the plant saprophyte Pseudomonas putida following 6 h of attachment to a silicone surface was carried out by analysis of protein profiles and by mRNA expression patterns. Two-dimensional (2-D) gel electrophoresis revealed 15 proteins that were up-regulated following bacterial adhesion and 30 proteins that were down-regulated. N-terminal sequence analyses of 11 of the down-regulated proteins identified a protein with homology to the ABC transporter, PotF; an outer membrane lipoprotein, NlpD; and five proteins that were homologous to proteins involved in amino acid metabolism. cDNA subtractive hybridization revealed 40 genes that were differentially expressed following initial attachment of P. putida. Twenty-eight of these genes had known homologs. As with the 2-D gel analysis, NlpD and genes involved in amino acid metabolism were identified by subtractive hybridization and found to be down-regulated following surface-associated growth. The gene for PotB was up-regulated, suggesting differential expression of ABC transporters following attachment to this surface. Other genes that showed differential regulation were structural components of flagella and type IV pili, as well as genes involved in polysaccharide biosynthesis. Immunoblot analysis of PilA and FliC confirmed the presence of flagella in planktonic cultures but not in 12- or 24-h biofilms. In contrast, PilA was observed in 12-h biofilms but not in planktonic culture. Recent evidence suggests that quorum sensing by bacterial homoserine lactones (HSLs) may play a regulatory role in biofilm development. To determine if similar protein profiles occurred during quorum sensing and during early biofilm formation, HSLs

  8. Growth independent rhamnolipid production from glucose using the non-pathogenic Pseudomonas putida KT2440.

    PubMed

    Wittgens, Andreas; Tiso, Till; Arndt, Torsten T; Wenk, Pamela; Hemmerich, Johannes; Müller, Carsten; Wichmann, Rolf; Küpper, Benjamin; Zwick, Michaela; Wilhelm, Susanne; Hausmann, Rudolf; Syldatk, Christoph; Rosenau, Frank; Blank, Lars M

    2011-10-17

    Rhamnolipids are potent biosurfactants with high potential for industrial applications. However, rhamnolipids are currently produced with the opportunistic pathogen Pseudomonas aeruginosa during growth on hydrophobic substrates such as plant oils. The heterologous production of rhamnolipids entails two essential advantages: Disconnecting the rhamnolipid biosynthesis from the complex quorum sensing regulation and the opportunity of avoiding pathogenic production strains, in particular P. aeruginosa. In addition, separation of rhamnolipids from fatty acids is difficult and hence costly. Here, the metabolic engineering of a rhamnolipid producing Pseudomonas putida KT2440, a strain certified as safety strain using glucose as carbon source to avoid cumbersome product purification, is reported. Notably, P. putida KT2440 features almost no changes in growth rate and lag-phase in the presence of high concentrations of rhamnolipids (> 90 g/L) in contrast to the industrially important bacteria Bacillus subtilis, Corynebacterium glutamicum, and Escherichia coli. P. putida KT2440 expressing the rhlAB-genes from P. aeruginosa PAO1 produces mono-rhamnolipids of P. aeruginosa PAO1 type (mainly C(10):C(10)). The metabolic network was optimized in silico for rhamnolipid synthesis from glucose. In addition, a first genetic optimization, the removal of polyhydroxyalkanoate formation as competing pathway, was implemented. The final strain had production rates in the range of P. aeruginosa PAO1 at yields of about 0.15 g/g(glucose) corresponding to 32% of the theoretical optimum. What's more, rhamnolipid production was independent from biomass formation, a trait that can be exploited for high rhamnolipid production without high biomass formation. A functional alternative to the pathogenic rhamnolipid producer P. aeruginosa was constructed and characterized. P. putida KT24C1 pVLT31_rhlAB featured the highest yield and titer reported from heterologous rhamnolipid producers with glucose as

  9. Growth independent rhamnolipid production from glucose using the non-pathogenic Pseudomonas putida KT2440

    PubMed Central

    2011-01-01

    Background Rhamnolipids are potent biosurfactants with high potential for industrial applications. However, rhamnolipids are currently produced with the opportunistic pathogen Pseudomonas aeruginosa during growth on hydrophobic substrates such as plant oils. The heterologous production of rhamnolipids entails two essential advantages: Disconnecting the rhamnolipid biosynthesis from the complex quorum sensing regulation and the opportunity of avoiding pathogenic production strains, in particular P. aeruginosa. In addition, separation of rhamnolipids from fatty acids is difficult and hence costly. Results Here, the metabolic engineering of a rhamnolipid producing Pseudomonas putida KT2440, a strain certified as safety strain using glucose as carbon source to avoid cumbersome product purification, is reported. Notably, P. putida KT2440 features almost no changes in growth rate and lag-phase in the presence of high concentrations of rhamnolipids (> 90 g/L) in contrast to the industrially important bacteria Bacillus subtilis, Corynebacterium glutamicum, and Escherichia coli. P. putida KT2440 expressing the rhlAB-genes from P. aeruginosa PAO1 produces mono-rhamnolipids of P. aeruginosa PAO1 type (mainly C10:C10). The metabolic network was optimized in silico for rhamnolipid synthesis from glucose. In addition, a first genetic optimization, the removal of polyhydroxyalkanoate formation as competing pathway, was implemented. The final strain had production rates in the range of P. aeruginosa PAO1 at yields of about 0.15 g/gglucose corresponding to 32% of the theoretical optimum. What's more, rhamnolipid production was independent from biomass formation, a trait that can be exploited for high rhamnolipid production without high biomass formation. Conclusions A functional alternative to the pathogenic rhamnolipid producer P. aeruginosa was constructed and characterized. P. putida KT24C1 pVLT31_rhlAB featured the highest yield and titer reported from heterologous rhamnolipid

  10. First detection in Europe of the metallo-β-lactamase IMP-15 in clinical strains of Pseudomonas putida and Pseudomonas aeruginosa.

    PubMed

    Gilarranz, R; Juan, C; Castillo-Vera, J; Chamizo, F J; Artiles, F; Álamo, I; Oliver, A

    2013-09-01

    In a prospective study (2009-2011) in healthcare institutions from the Canary Islands (Spain), 6 out of 298 carbapenem non-susceptible Pseudomonas aeruginosa isolates produced a metallo-β-lactamase: four IMP-15, two VIM-2 (including one IMP-15-positive isolate) and one VIM-1. Multilocus sequence typing identified the single VIM-1-producing isolate as clone ST111 and two IMP-15-producing isolates as ST606, but, strikingly, bacterial re-identification revealed that the other three isolates (producing IMP-15 and/or VIM-2) were actually Pseudomonas putida. Further retrospective analysis revealed a very high prevalence (close to 50%) of carbapenem resistance in this environmental species. Hence, we report the simultaneous emergence in hospitals on the Canary Islands of P. putida and P. aeruginosa strains producing IMP-15, a metallo-β-lactamase not previously detected in Europe, and suggest an underestimated role of P. putida as a nosocomial reservoir of worrying transferable resistance determinants.

  11. Self-Regulation and Interplay of Rsm Family Proteins Modulate the Lifestyle of Pseudomonas putida

    PubMed Central

    2016-01-01

    ABSTRACT In the plant-beneficial bacterium Pseudomonas putida KT2440, three genes have been identified that encode posttranscriptional regulators of the CsrA/RsmA family. Their regulatory roles in the motile and sessile lifestyles of P. putida have been investigated by generating single-, double-, and triple-null mutants and by overexpressing each protein (RsmA, RsmE, and RsmI) in different genetic backgrounds. The rsm triple mutant shows reduced swimming and swarming motilities and increased biofilm formation, whereas overexpression of RsmE or RsmI results in reduced bacterial attachment. However, biofilms formed on glass surfaces by the triple mutant are more labile than those of the wild-type strain and are easily detached from the surface, a phenomenon that is not observed on plastic surfaces. Analysis of the expression of adhesins and exopolysaccharides in the different genetic backgrounds suggests that the biofilm phenotypes are due to alterations in the composition of the extracellular matrix and in the timing of synthesis of its elements. We have also studied the expression patterns of Rsm proteins and obtained data that indicate the existence of autoregulation mechanisms. IMPORTANCE Proteins of the CsrA/RsmA family function as global regulators in different bacteria. More than one of these proteins is present in certain species. In this study, all of the RsmA homologs in P. putida are characterized and globally taken into account to investigate their roles in controlling bacterial lifestyles and the regulatory interactions among them. The results offer new perspectives on how biofilm formation is modulated in this environmentally relevant bacterium. PMID:27422830

  12. Screening and optimization of low-cost medium for Pseudomonas putida Rs-198 culture using RSM.

    PubMed

    Peng, Yanjie; He, Yanhui; Wu, Zhansheng; Lu, Jianjiang; Li, Chun

    2014-01-01

    The plant growth-promoting rhizobacterial strain Pseudomonas putida Rs-198 was isolated from salinized soils from Xinjiang Province. We optimized the composition of the low-cost medium of P. putida Rs-198 based on its bacterial concentration, as well as its phosphate-dissolving and indole acetic acid (IAA)-producing capabilities using the response surface methodology (RSM), and a mathematical model was developed to show the effect of each medium component and its interactions on phosphate dissolution and IAA production. The model predicted a maximum phosphate concentration in medium containing 63.23 mg/L inorganic phosphate with 49.22 g/L corn flour, 14.63 g/L soybean meal, 2.03 g/L K₂HPO₄, 0.19 g/L MnSO₄ and 5.00 g/L NaCl. The maximum IAA concentration (18.73 mg/L) was predicted in medium containing 52.41 g/L corn flour, 15.82 g/L soybean meal, 2.40 g/L K₂HPO₄, 0.17 g/L MnSO₄ and 5.00 g/L NaCl. These predicted values were also verified through experiments, with a cell density of 10(13) cfu/mL, phosphate dissolution of 64.33 mg/L, and IAA concentration of 18.08 mg/L. The excellent correlation between predicted and measured values of each model justifies the validity of both the response models. The study aims to provide a basis for industrialized fermentation using P. putida Rs-198.

  13. Screening and optimization of low-cost medium for Pseudomonas putida Rs-198 culture using RSM

    PubMed Central

    Peng, Yanjie; He, Yanhui; Wu, Zhansheng; Lu, Jianjiang; Li, Chun

    2014-01-01

    The plant growth-promoting rhizobacterial strain Pseudomonas putida Rs-198 was isolated from salinized soils from Xinjiang Province. We optimized the composition of the low-cost medium of P. putida Rs-198 based on its bacterial concentration, as well as its phosphate-dissolving and indole acetic acid (IAA)-producing capabilities using the response surface methodology (RSM), and a mathematical model was developed to show the effect of each medium component and its interactions on phosphate dissolution and IAA production. The model predicted a maximum phosphate concentration in medium containing 63.23 mg/L inorganic phosphate with 49.22 g/L corn flour, 14.63 g/L soybean meal, 2.03 g/L K2HPO4, 0.19 g/L MnSO4 and 5.00 g/L NaCl. The maximum IAA concentration (18.73 mg/L) was predicted in medium containing 52.41 g/L corn flour, 15.82 g/L soybean meal, 2.40 g/L K2HPO4, 0.17 g/L MnSO4 and 5.00 g/L NaCl. These predicted values were also verified through experiments, with a cell density of 1013 cfu/mL, phosphate dissolution of 64.33 mg/L, and IAA concentration of 18.08 mg/L. The excellent correlation between predicted and measured values of each model justifies the validity of both the response models. The study aims to provide a basis for industrialized fermentation using P. putida Rs-198. PMID:25763026

  14. New insights on the reorganization of gene transcription in Pseudomonas putida KT2440 at elevated pressure

    PubMed Central

    2013-01-01

    Background Elevated pressure, elevated oxygen tension (DOT) and elevated carbon dioxide tension (DCT) are readily encountered at the bottom of large industrial bioreactors and during bioprocesses where pressure is applied for enhancing the oxygen transfer. Yet information about their effect on bacteria and on the gene expression thereof is scarce. To shed light on the cellular functions affected by these specific environmental conditions, the transcriptome of Pseudomonas putida KT2440, a bacterium of great relevance for the production of medium-chain-length polyhydroxyalkanoates, was thoroughly investigated using DNA microarrays. Results Very well defined chemostat cultivations were carried out with P. putida to produce high quality RNA samples and ensure that differential gene expression was caused exclusively by changes of pressure, DOT and/or DCT. Cellular stress was detected at 7 bar and elevated DCT in the form of heat shock and oxidative stress-like responses, and indicators of cell envelope perturbations were identified as well. Globally, gene transcription was not considerably altered when DOT was increased from 40 ± 5 to 235 ± 20% at 7 bar and elevated DCT. Nevertheless, differential transcription was observed for a few genes linked to iron-sulfur cluster assembly, terminal oxidases, glutamate metabolism and arginine deiminase pathway, which shows their particular sensitivity to variations of DOT. Conclusions This study provides a comprehensive overview on the changes occurring in the transcriptome of P. putida upon mild variations of pressure, DOT and DCT. Interestingly, whereas the changes of gene transcription were widespread, the cell physiology was hardly affected, which illustrates how efficient reorganization of the gene transcription is for dealing with environmental changes that may otherwise be harmful. Several particularly sensitive cellular functions were identified, which will certainly contribute to the understanding of the

  15. Detection of phenolic compounds by thick film sensors based on Pseudomonas putida.

    PubMed

    Timur, Suna; Pazarlioğlu, Nurdan; Pilloton, Roberto; Telefoncu, Azmi

    2003-10-17

    Amperometric biosensors using bacterial cells were developed for the determination of phenolic compounds and the measurement was based on the respiratory activity of the cells. For this purpose, Pseudomonas putida DSM 50026 which is one of the well-known phenol degrading organisms, was used as a biological component. The cells were grown in the presence of phenol as the sole source of organic carbon. As well as phenol adapted cells, the bacterium which used the glucose as the major carbon source, was also used to obtain another type of biosensor for the comparison of the responses and specificities towards different xenobiotics. The commercial oxygen electrode was used as a transducer to test the sensor responses for both induced and non-induced cells. Our results showed that the adaptation step enable us to obtain biosensor devices with different substrate specificity. Moreover, P. putida was immobilized on the surface of thick film working electrodes made of gold by using gelatin membrane cross-linked with glutaraldehyde. The biosensors were calibrated for different phenolic substances. Furthermore, phenol detection was performed in synthetic wastewater samples.

  16. The revisited genome of Pseudomonas putida KT2440 enlightens its value as a robust metabolic chassis.

    PubMed

    Belda, Eugeni; van Heck, Ruben G A; José Lopez-Sanchez, Maria; Cruveiller, Stéphane; Barbe, Valérie; Fraser, Claire; Klenk, Hans-Peter; Petersen, Jörn; Morgat, Anne; Nikel, Pablo I; Vallenet, David; Rouy, Zoé; Sekowska, Agnieszka; Martins Dos Santos, Vitor A P; de Lorenzo, Víctor; Danchin, Antoine; Médigue, Claudine

    2016-10-01

    By the time the complete genome sequence of the soil bacterium Pseudomonas putida KT2440 was published in 2002 (Nelson et al., ) this bacterium was considered a potential agent for environmental bioremediation of industrial waste and a good colonizer of the rhizosphere. However, neither the annotation tools available at that time nor the scarcely available omics data-let alone metabolic modeling and other nowadays common systems biology approaches-allowed them to anticipate the astonishing capacities that are encoded in the genetic complement of this unique microorganism. In this work we have adopted a suite of state-of-the-art genomic analysis tools to revisit the functional and metabolic information encoded in the chromosomal sequence of strain KT2440. We identified 242 new protein-coding genes and re-annotated the functions of 1548 genes, which are linked to almost 4900 PubMed references. Catabolic pathways for 92 compounds (carbon, nitrogen and phosphorus sources) that could not be accommodated by the previously constructed metabolic models were also predicted. The resulting examination not only accounts for some of the known stress tolerance traits known in P. putida but also recognizes the capacity of this bacterium to perform difficult redox reactions, thereby multiplying its value as a platform microorganism for industrial biotechnology. © 2016 The Authors. Environmental Microbiology published by Society for Applied Microbiology and John Wiley & Sons Ltd.

  17. Induction Specificity and Catabolite Repression of the Early Enzymes in Camphor Degradation by Pseudomonas putida

    PubMed Central

    Hartline, Richard A.; Gunsalus, I. C.

    1971-01-01

    The ability of bornane and substituted bornanes to induce the early enzymes for d(+)-camphor degradation and control of these enzymes by catabolite repression were studied in a strain of a Pseudomonas putida. Bornane and 20 substituted bornane compounds showed induction. Of these 21 compounds, bornane and 8 of the substituted bornanes provided induction without supporting growth. Oxygen, but not nitrogen, enhanced the inductive potency of the unsubstituted bornane ring. All bornanedione isomers caused induction, and those with substituents on each of the three consecutive carbon atoms, including the methyl group at the bridgehead carbon, showed induction without supporting growth. Although it was not possible to obtain experimental data for a case of absolute gratuitous induction by compounds not supporting growth, indirect evidence in support of gratuitous induction is presented. It is proposed that the ability of P. putida to tolerate the unusually high degree of possible gratuitous induction observed for camphor catabolism may be related to the infrequent occurrence of bicyclic ring structures in nature. Survival of an organism with a broad specificity for gratuitous induction is discussed. Glucose and succinate, but not glutamate, produced catabolite repression of the early camphor-degrading enzymes. Pathway enzymes differ in their degree of sensitivity to succinate-provoked catabolite repression. The ability of a compound to produce catabolite repression is not, however, directly related to the duration of the lag period (diauxic lag) between growth on camphor and growth on the repressing compound. PMID:5573731

  18. Tracing explosives in soil with transcriptional regulators of Pseudomonas putida evolved for responding to nitrotoluenes

    PubMed Central

    Garmendia, Junkal; De Las Heras, Aitor; Galvão, Teca Calcagno; De Lorenzo, Víctor

    2008-01-01

    Summary Although different biological approaches for detection of anti‐personnel mines and other unexploded ordnance (UXO) have been entertained, none of them has been rigorously documented thus far in the scientific literature. The industrial 2,4,6 trinitrotoluene (TNT) habitually employed in the manufacturing of mines is at all times tainted with a small but significant proportion of the more volatile 2,4 dinitrotoluene (2,4 DNT) and other nitroaromatic compounds. By using mutation‐prone PCR and DNA sequence shuffling we have evolved in vitro and selected in vivo variants of the effector recognition domain of the toluene‐responsive XylR regulator of the soil bacterium Pseudomonas putida that responds to mono‐, bi‐ and trinitro substituted toluenes. Re‐introduction of such variants in P. putida settled the transcriptional activity of the cognate promoters (Po and Pu) as a function of the presence of nitrotoluenes in the medium. When strains bearing transcriptional fusions to reporters with an optical output (luxAB, GFP) were spread on soil spotted with nitrotoluenes, the signal triggered by promoter activation allowed localization of the target compounds on the soil surface. Our data provide a proof of concept that non‐natural transcription factors evolved to respond to nitroaromatics can be engineered in soil bacteria and inoculated on a target site to pinpoint the presence of explosives. This approach thus opens new ways to tackle this gigantic humanitarian problem. PMID:21261843

  19. Removal of Mercury from Chloralkali Electrolysis Wastewater by a Mercury-Resistant Pseudomonas putida Strain

    PubMed Central

    von Canstein, H.; Li, Y.; Timmis, K. N.; Deckwer, W.-D.; Wagner-Döbler, I.

    1999-01-01

    A mercury-resistant bacterial strain which is able to reduce ionic mercury to metallic mercury was used to remediate in laboratory columns mercury-containing wastewater produced during electrolytic production of chlorine. Factory effluents from several chloralkali plants in Europe were analyzed, and these effluents contained total mercury concentrations between 1.6 and 7.6 mg/liter and high chloride concentrations (up to 25 g/liter) and had pH values which were either acidic (pH 2.4) or alkaline (pH 13.0). A mercury-resistant bacterial strain, Pseudomonas putida Spi3, was isolated from polluted river sediments. Biofilms of P. putida Spi3 were grown on porous carrier material in laboratory column bioreactors. The bioreactors were continuously fed with sterile synthetic model wastewater or nonsterile, neutralized, aerated chloralkali wastewater. We found that sodium chloride concentrations up to 24 g/liter did not inhibit microbial mercury retention and that mercury concentrations up to 7 mg/liter could be treated with the bacterial biofilm with no loss of activity. When wastewater samples from three different chloralkali plants in Europe were used, levels of mercury retention efficiency between 90 and 98% were obtained. Thus, microbial mercury removal is a potential biological treatment for chloralkali electrolysis wastewater. PMID:10583977

  20. A Pseudomonas putida strain genetically engineered for 1,2,3-trichloropropane bioremediation.

    PubMed

    Samin, Ghufrana; Pavlova, Martina; Arif, M Irfan; Postema, Christiaan P; Damborsky, Jiri; Janssen, Dick B

    2014-09-01

    1,2,3-Trichloropropane (TCP) is a toxic compound that is recalcitrant to biodegradation in the environment. Attempts to isolate TCP-degrading organisms using enrichment cultivation have failed. A potential biodegradation pathway starts with hydrolytic dehalogenation to 2,3-dichloro-1-propanol (DCP), followed by oxidative metabolism. To obtain a practically applicable TCP-degrading organism, we introduced an engineered haloalkane dehalogenase with improved TCP degradation activity into the DCP-degrading bacterium Pseudomonas putida MC4. For this purpose, the dehalogenase gene (dhaA31) was cloned behind the constitutive dhlA promoter and was introduced into the genome of strain MC4 using a transposon delivery system. The transposon-located antibiotic resistance marker was subsequently removed using a resolvase step. Growth of the resulting engineered bacterium, P. putida MC4-5222, on TCP was indeed observed, and all organic chlorine was released as chloride. A packed-bed reactor with immobilized cells of strain MC4-5222 degraded >95% of influent TCP (0.33 mM) under continuous-flow conditions, with stoichiometric release of inorganic chloride. The results demonstrate the successful use of a laboratory-evolved dehalogenase and genetic engineering to produce an effective, plasmid-free, and stable whole-cell biocatalyst for the aerobic bioremediation of a recalcitrant chlorinated hydrocarbon. Copyright © 2014, American Society for Microbiology. All Rights Reserved.

  1. A Pseudomonas putida Strain Genetically Engineered for 1,2,3-Trichloropropane Bioremediation

    PubMed Central

    Samin, Ghufrana; Pavlova, Martina; Arif, M. Irfan; Postema, Christiaan P.; Damborsky, Jiri

    2014-01-01

    1,2,3-Trichloropropane (TCP) is a toxic compound that is recalcitrant to biodegradation in the environment. Attempts to isolate TCP-degrading organisms using enrichment cultivation have failed. A potential biodegradation pathway starts with hydrolytic dehalogenation to 2,3-dichloro-1-propanol (DCP), followed by oxidative metabolism. To obtain a practically applicable TCP-degrading organism, we introduced an engineered haloalkane dehalogenase with improved TCP degradation activity into the DCP-degrading bacterium Pseudomonas putida MC4. For this purpose, the dehalogenase gene (dhaA31) was cloned behind the constitutive dhlA promoter and was introduced into the genome of strain MC4 using a transposon delivery system. The transposon-located antibiotic resistance marker was subsequently removed using a resolvase step. Growth of the resulting engineered bacterium, P. putida MC4-5222, on TCP was indeed observed, and all organic chlorine was released as chloride. A packed-bed reactor with immobilized cells of strain MC4-5222 degraded >95% of influent TCP (0.33 mM) under continuous-flow conditions, with stoichiometric release of inorganic chloride. The results demonstrate the successful use of a laboratory-evolved dehalogenase and genetic engineering to produce an effective, plasmid-free, and stable whole-cell biocatalyst for the aerobic bioremediation of a recalcitrant chlorinated hydrocarbon. PMID:24973068

  2. Removal of mercury from chloralkali electrolysis wastewater by a mercury-resistant Pseudomonas putida strain

    SciTech Connect

    Canstein, H. von; Li, Y.; Timmis, K.N.; Deckwer, W.D.; Wagner-Doebler, I.

    1999-12-01

    A mercury-resistant bacterial strain which is able to reduce ionic mercury to metallic mercury was used to remediate in laboratory columns mercury-containing wastewater produced during electrolytic production of chlorine. Factory effluents from several chloralkali plants in Europe were analyzed, and these effluents contained total mercury concentrations between 1.6 and 7.6 mg/liter and high chloride concentrations and had pH values which were either acidic or alkaline. A mercury-resistant bacterial strain, Pseudomonas putida Spi3, was isolated from polluted river sediments. Biofilms of P.putida Spi3 were grown on porous carrier material in laboratory column bioreactors. The bioreactors were continuously fed with sterile synthetic model wastewater or nonsterile, neutralized, aerated chloralkali wastewater. The authors found that sodium chloride concentrations up to 24 g/liter did not inhibit microbial mercury retention and that mercury concentrations up to 7 mg/liter could be treated with the bacterial biofilm with no loss of activity. When wastewater samples from three different chloralkali plants in Europe were used, levels of mercury retention efficiency between 90 and 98% were obtained. Thus, microbial mercury removal is a potential biological treatment for chloralkali electrolysis wastewater.

  3. Phenotypic variation of Pseudomonas putida and P. tolaasii affects attachment to Agaricus bisporus mycelium.

    PubMed

    Rainey, P B

    1991-12-01

    The effect of phenotypic variation on attachment of Pseudomonas tolaasii and P. putida to Agaricus bisporus mycelium was investigated. Quantitative studies demonstrated the ability of each isolate to attach rapidly and firmly to A. bisporus mycelium and significant differences in attachment of wild-type and phenotypic variant strains were observed. This was most pronounced in P. tolaasii, where the percentage attachment of the wild-type form was always greater than that of the phenotypic variant. The medium upon which the bacteria were cultured, prior to conducting an attachment assay, had a significant effect on their ability to attach. Attachment of the wild-type form of P. putida was enhanced when the assay was performed in the presence of CaCl2, suggesting the involvement of electrostatic forces. No correlation was observed between bacterial hydrophobicity and ability to attach to A. bisporus mycelium. Scanning electron microscopy confirmed the results obtained from the quantitative studies and provided further evidence for marked differences in the ability of the pseudomonads to attach to mycelium. Fibrillar structures and amorphous material were frequently associated with attached cells and appeared to anchor bacteria to each other and to the hyphal surface. A time-course study of attachment using transmission electron microscopy revealed the presence of uneven fibrillar material on the surface of cells. This material stained positive for polysaccharide and may be involved in ensuring rapid, firm attachment of the cells.

  4. The cytochrome c maturation operon is involved in manganese oxidation in Pseudomonas putida GB-1

    SciTech Connect

    Vrind, J.P.M. de; Brouwers, G.J.; Corstijens, P.L.A.M.; Dulk, J. den; Vrind-de Jong, E.W. de

    1998-10-01

    A Pseudomonas putida strain, strain GB-1, oxidizes Mn{sup 2+} to Mn oxide in the early stationary growth phase. It also secretes a siderophore (identified as pyoverdine) when it is subjected to iron limitation. After transposon (Tn5) mutagenesis several classes of mutants with differences in Mn{sup 2+} oxidation and/or secretion of the Mn{sup 2+}-oxidizing activity were identified. Preliminary analysis of the Tn5 insertion site in one of the nonoxidizing mutants suggested that a multicopper oxidase-related enzyme is involved in Mn{sup 2+} oxidation. The insertion site in another mutant was preliminarily identified as a gene involved in the general protein secretion pathway. Two mutants defective in Mn{sup 2+}-oxidizing activity also secreted porphyrins into the medium and appeared to be derepressed for pyoverdine production. These strains were chosen for detailed analysis. Both mutants were shown to contain Tn5 insertions in the ccmF gene, which is part of the cytochrome c maturation operon. They were cytochrome oxidase negative and did not contain c-type cytochromes. Complementation with part of the ccm operon isolated from the wild type restored the phenotype of the parent strain. These results indicate that a functional ccm operon is required for Mn{sup 2+} oxidation in P. putida GB-1. A possible relationship between porphyrin secretion resulting from the ccm mutation and stimulation of pyoverdine production is discussed.

  5. Pseudomonas putida as a platform for the synthesis of aromatic compounds.

    PubMed

    Molina-Santiago, Carlos; Cordero, Baldo F; Daddaoua, Abdelali; Udaondo, Zulema; Manzano, Javier; Valdivia, Miguel; Segura, Ana; Ramos, Juan-Luis; Duque, Estrella

    2016-09-01

    Aromatic compounds such as l-phenylalanine, 2-phenylethanol and trans-cinnamate are aromatic compounds of industrial interest. Current trends support replacement of chemical synthesis of these compounds by 'green' alternatives produced in microbial cell factories. The solvent-tolerant Pseudomonas putida DOT-T1E strain was genetically modified to produce up to 1 g l-1 of l-phenylalanine. In order to engineer this strain, we carried out the following stepwise process: (1) we selected random mutants that are resistant to toxic phenylalanine analogues; (2) we then deleted up to five genes belonging to phenylalanine metabolism pathways, which greatly diminished the internal metabolism of phenylalanine; and (3) in these mutants, we overexpressed the pheAfbr gene, which encodes a recombinant variant of PheA that is insensitive to feedback inhibition by phenylalanine. Furthermore, by introducing new genes, we were able to further extend the diversity of compounds produced. Introduction of histidinol phosphate transferase (PP_0967), phenylpyruvate decarboxylase (kdc) and an alcohol dehydrogenase (adh) enabled the strain to produce up to 180 mg l-1 2-phenylethanol. When phenylalanine ammonia lyase (pal) was introduced, the resulting strain produced up to 200 mg l-1 of trans-cinnamate. These results demonstrate that P. putida can serve as a promising microbial cell factory for the production of l-phenylalanine and related compounds.

  6. Bacterial effects and interfacial inactivation mechanism of nZVI/Pd on Pseudomonas putida strain.

    PubMed

    Lv, Yuancai; Niu, Zhuyu; Chen, Yuancai; Hu, Yongyou

    2017-05-15

    With the introduction of nano zero valent iron (nZVI) technology into our environment, its potential environmental risk to environmental microorganisms has attracted considerable attention. In this study, Pseudomonas putida was chosen as a typical strain to study the bacterial toxicity of nZVI/Pd. The CFU assay results indicated that nZVI/Pd was toxic to P. putida cells but the toxicity decreased with an increase in DO. The experiments isolated by dialysis bag and flow cytometry analysis suggested that both membrane disruption caused by direct contact and oxidative stress were the main bactericidal mechanisms under the aerobic condition, while membrane disruption resulting from direct contact was the primary bactericidal mechanism in the anaerobic system. Furthermore, according to TEM, SEM, EDS, XRD, FTIR and XPS, it was indicated that in the aerobic system, the reactive oxygen species (ROS) generated by nZVI/Pd could oxidize the amide and hydroxyl groups into carboxyl groups, resulting in a decline in peptides and increase in polysaccharides. In addition, the ROS also accumulated inside the cell and caused cell inactivation via oxidative stress. In the anaerobic system, the adhered nZVI/Pd particles would attack the functional groups such as carboxyl, ester and amide, leading to the decline in proteins and polysaccharides and subsequent damage of the membrane. The findings provide a significant guide for the application of nano-bio combined technology.

  7. A carbon starvation survival gene of Pseudomonas putida is regulated by sigma 54.

    PubMed

    Kim, Y; Watrud, L S; Matin, A

    1995-04-01

    By using mini-Tn5 transposon mutagenesis, two mutants of Pseudomonas putida ATCC 12633 were isolated which showed a marked increase in their sensitivity to carbon starvation; these mutants are presumably affected in the Pex type of proteins that P. putida induces upon carbon starvation (M. Givskov, L. Eberl, and S. Molin, J. Bacteriol. 176:4816-4824, 1994). The affected genes in our mutants were induced about threefold upon carbon starvation. The promoter region of the starvation gene in the mutant MK107 possessed a strong sigma 54-type-promoter sequence, and deletion analysis suggested that this was the major promoter regulating expression; this was confirmed by transcript mapping in rpoN+ and rpoN mutant backgrounds. The deletion analysis implicated a sequence upstream of the sigma 54 promoter, as well as a region downstream of the transcription start site, in the functioning of the promoter. Two sigma 70-type Pribnow boxes were also detected in the promoter region, but their transcriptional activity in the wild type was very weak. However, in a sigma 54-deficient background, these promoters became stronger. The mechanism and possible physiological role of this phenomenon and the possibility that the sequence upstream of the sigma 54 promoter may have a role in carbon sensing are discussed.

  8. Genetic and phenotypic characterization of the heat shock response in Pseudomonas putida

    PubMed Central

    Ito, Fumihiro; Tamiya, Takayuki; Ohtsu, Iwao; Fujimura, Makoto; Fukumori, Fumiyasu

    2014-01-01

    Molecular chaperones function in various important physiological processes. Null mutants of genes for the molecular chaperone ClpB (Hsp104), and those that encode J-domain proteins (DnaJ, CbpA, and DjlA), which may act as Hsp40 co-chaperones of DnaK (Hsp70), were constructed from Pseudomonas putida KT2442 (KT) to elucidate their roles. The KTΔclpB mutant showed the same heat shock response (HSR) as the wild-type, both in terms of heat-shock protein (Hsp) synthesis (other than ClpB) and in hsp gene expression; however, the mutant was quite sensitive to high temperatures and was unable to disaggregate into thermo-mediated protein aggregates, indicating that ClpB is important for cell survival after heat stress and essential for solubilization of protein aggregates. On the other hand, the KTΔdnaJ mutant was temperature-sensitive, and formed more protein aggregates (especially of high molecular weight) upon heat stress than did KT. P. putida CbpA, a probable Hsp, partially substituted the functions of DnaJ in cell growth and solubilization of thermo-mediated protein aggregates, and might be involved in the HSR which was regulated by a fine-tuning system(s) that could sense subtle changes in the ambient temperature and control the levels of σ32 activity and quantity, as well as the mRNA levels of hsp genes. PMID:25303383

  9. Biodegradation of phenol by Pseudomonas putida immobilized in polyvinyl alcohol (PVA) gel.

    PubMed

    El-Naas, Muftah H; Al-Muhtaseb, Shaheen A; Makhlouf, Souzan

    2009-05-30

    Batch experiments were carried out to evaluate the biodegradation of phenol by Pseudomonas putida immobilized in polyvinyl alcohol (PVA) gel pellets in a bubble column bioreactor at different conditions. The bacteria were activated and gradually acclimatized to high concentrations of phenol of up to 300 mg/l. The experimental results indicated that the biodegradation capabilities of P. putida are highly affected by temperature, pH, initial phenol concentration and the abundance of the biomass. The biodegradation rate is optimized at 30 degrees C, a pH of 7 and phenol concentration of 75 mg/l. Higher phenol concentrations inhibited the biomass and reduced the biodegradation rate. At high phenol concentration, the PVA particle size was found to have negligible effect on the biodegradation rate. However, for low concentrations, the biodegradation rate increased slightly with decreasing particle size. Other contaminants such heavy metals and sulfates showed no effect on the biodegradation process. Modeling of the biodegradation of phenol indicated that the Haldane inhibitory model gave better fit of the experimental data than the Monod model, which ignores the inhibitory effects of phenol.

  10. Metabolic Engineering of Pseudomonas putida KT2440 for the Production of para-Hydroxy Benzoic Acid.

    PubMed

    Yu, Shiqin; Plan, Manuel R; Winter, Gal; Krömer, Jens O

    2016-01-01

    para-Hydroxy benzoic acid (PHBA) is the key component for preparing parabens, a common preservatives in food, drugs, and personal care products, as well as high-performance bioplastics such as liquid crystal polymers. Pseudomonas putida KT2440 was engineered to produce PHBA from glucose via the shikimate pathway intermediate chorismate. To obtain the PHBA production strain, chorismate lyase UbiC from Escherichia coli and a feedback resistant 3-deoxy-d-arabino-heptulosonate-7-phosphate synthase encoded by gene aroG(D146N) were overexpressed individually and simultaneously. In addition, genes related to product degradation (pobA) or competing for the precursor chorismate (pheA and trpE) were deleted from the genome. To further improve PHBA production, the glucose metabolism repressor hexR was knocked out in order to increase erythrose 4-phosphate and NADPH supply. The best strain achieved a maximum titer of 1.73 g L(-1) and a carbon yield of 18.1% (C-mol C-mol(-1)) in a non-optimized fed-batch fermentation. This is to date the highest PHBA concentration produced by P. putida using a chorismate lyase.

  11. Assessing the safety of Pseudomonas putida introduction in the environment: an overview of ecotoxicological tests.

    PubMed

    de Castro, Vera Lúcia S S; Jonsson, Cláudio Martin; Silva, Célia Maria M; de Holanda Nunes Maia, Aline

    2010-04-01

    Risk assessment guidelines for the environmental release of microbial agents are performed in a tiered sequence which includes evaluation of exposure effects on non-target organisms. However, it becomes important to verify whether environmental risk assessment from temperate studies is applicable to tropical countries, as Brazil. Pseudomonas putida is a bacteria showing potential to be used for environmental applications as bioremediation and plant disease control. This study investigates the effects of this bacteria exposure on rodents and aquatic organisms (Daphnia similis) that are recommended to be used as non-target organism in environmental risk assessments. Also, the microbial activity in three different soils under P. putida exposure was evaluated. Rats did not show clinical alterations, although the agent was recovered 16h after the exposure in lung homogenates. The bacteria did not reduce significantly the reproduction and survival of D. similis. The soil enzymatic activities presented fluctuating values after inoculation with bacteria. The measurement of perturbations in soil biochemical characteristics is presented as an alternative way of monitoring the overall effects of the microbial agent to be introduced even in first stage (Tier I) of the risk assessment in tropical ecosystems.

  12. Biodegradation of 1-allyloxy-4-propoxybenzene by selected strains of Pseudomonas putida.

    PubMed

    Ebrahimi, Parisa; Plettner, Erika

    2014-02-01

    Dialkoxybenzenes constitute a class of organic compounds with anti feeding and oviposition effects on the cabbage looper, Trichoplusia ni. Among them, 1-allyloxy-4-propoxybenzene has the highest feeding deterrence activity and potential for development as commercial insect control agent. To develop this compound, its fate in the environment needs to be studied. The fate of organic compounds in the environment depends on their biodegradability in the soil. We present results of laboratory biodegradation experiments of 1-allyloxy-4-propoxybenzene with three strains of Pseudomonas putida. Two of the three strains of P. putida tested were able to metabolize 1-allyloxy-4-propoxybenzene. Both strains required induction of the catabolic pathway. Specifically, strain ATCC 17453 (which contains the CAM plasmid) metabolized 1-allyloxy-4-propoxybenzene by first dealkylating. This gave both possible monoalkoxy phenols after five days, followed by dihydroquinone after 8 days. In vitro tests with CYP101A1 (cytochrome P450cam, a camphor hydroxylase), revealed that the dealkylation is catalyzed by this enzyme.

  13. Metabolic Engineering of Pseudomonas putida KT2440 for the Production of para-Hydroxy Benzoic Acid

    PubMed Central

    Yu, Shiqin; Plan, Manuel R.; Winter, Gal; Krömer, Jens O.

    2016-01-01

    para-Hydroxy benzoic acid (PHBA) is the key component for preparing parabens, a common preservatives in food, drugs, and personal care products, as well as high-performance bioplastics such as liquid crystal polymers. Pseudomonas putida KT2440 was engineered to produce PHBA from glucose via the shikimate pathway intermediate chorismate. To obtain the PHBA production strain, chorismate lyase UbiC from Escherichia coli and a feedback resistant 3-deoxy-d-arabino-heptulosonate-7-phosphate synthase encoded by gene aroGD146N were overexpressed individually and simultaneously. In addition, genes related to product degradation (pobA) or competing for the precursor chorismate (pheA and trpE) were deleted from the genome. To further improve PHBA production, the glucose metabolism repressor hexR was knocked out in order to increase erythrose 4-phosphate and NADPH supply. The best strain achieved a maximum titer of 1.73 g L−1 and a carbon yield of 18.1% (C-mol C-mol−1) in a non-optimized fed-batch fermentation. This is to date the highest PHBA concentration produced by P. putida using a chorismate lyase. PMID:27965953

  14. The effect of oxygen on chemotaxis to naphthalene by Pseudomonas putida G7.

    PubMed

    Law, Aaron M J; Aitken, Michael D

    2006-02-20

    Chemotactic bacteria can be attracted to electron donors they consume. In systems where donor is heterogeneously distributed, chemotaxis can lead to enhanced removal of donor relative to that achieved in the absence of chemotaxis. However, simultaneous consumption of an electron acceptor may result in the formation of an acceptor gradient to which the bacteria also respond, thus diminishing the positive effect of chemotaxis. Depletion of an electron acceptor can also reduce the rate of electron donor consumption in addition to its effect on chemotaxis. In this study, we examined the effect of oxygen on chemotaxis to naphthalene and on naphthalene consumption by Pseudomonas putida G7. The organism was able to move up an oxygen gradient when there was a naphthalene gradient in the opposite direction. In the absence of an oxygen gradient, low levels of oxygen attenuated chemotaxis to naphthalene but did not affect random motility. The rate of naphthalene consumption decreased at dissolved oxygen concentrations similar to those at which chemotaxis was attenuated. These results suggest that low dissolved oxygen concentrations can reduce naphthalene removal by P. putida G7 in systems where naphthalene is heterogeneously distributed by simultaneously attenuating chemotactic motion toward naphthalene and decreasing the rate of naphthalene degradation. Copyright 2005 Wiley Periodicals, Inc.

  15. Conversion of levoglucosan and cellobiosan by Pseudomonas putida KT2440

    SciTech Connect

    Linger, Jeffrey G.; Hobdey, Sarah E.; Franden, Mary Ann; Fulk, Emily M.; Beckham, Gregg T.

    2016-02-02

    Pyrolysis offers a straightforward approach for the deconstruction of plant cell wall polymers into bio-oil. Recently, there has been substantial interest in bio-oil fractionation and subsequent use of biological approaches to selectively upgrade some of the resulting fractions. A fraction of particular interest for biological upgrading consists of polysaccharide-derived substrates including sugars and sugar dehydration products such as levoglucosan and cellobiosan, which are two of the most abundant pyrolysis products of cellulose. Levoglucosan can be converted to glucose-6-phosphate through the use of a levoglucosan kinase (LGK), but to date, the mechanism for cellobiosan utilization has not been demonstrated. Here, we engineer the microbe Pseudomonas putida KT2440 to use levoglucosan as a sole carbon and energy source through LGK integration. Furthermore, we demonstrate that cellobiosan can be enzymatically converted to levoglucosan and glucose with β-glucosidase enzymes from both Glycoside Hydrolase Family 1 and Family 3. β-glucosidases are commonly used in both natural and industrial cellulase cocktails to convert cellobiose to glucose to relieve cellulase product inhibition and to facilitate microbial uptake of glucose. Using an exogenous β-glucosidase, we demonstrate that the engineered strain of P. putida can grow on levoglucosan up to 60 g/L and can also utilize cellobiosan. Overall, this study elucidates the biological pathway to co-utilize levoglucosan and cellobiosan, which will be a key transformation for the biological upgrading of pyrolysis-derived substrates.

  16. Amplification of the groESL operon in Pseudomonas putida increases siderophore gene promoter activity.

    PubMed

    Venturi, V; Wolfs, K; Leong, J; Weisbeek, P J

    1994-10-17

    Pseudobactin 358 is the yellow-green fluorescent siderophore [microbial iron(III) transport agent] produced by Pseudomonas putida WCS358 under iron-limiting conditions. The genes encoding pseudobactin 358 biosynthesis are iron-regulated at the level of transcription. In this study, the molecular characterization is reported of a cosmid clone of WCS358 DNA that can stimulate, in an iron-dependent manner, the activity of a WCS358 siderophore gene promoter in the heterologous Pseudomonas strain A225. The functional region in the clone was identified by subcloning, transposon mutagenesis and DNA sequencing as the groESL operon of strain WCS358. This increase in promoter activity was not observed when the groESL genes of strain WCS358 were integrated via a transposon vector into the genome of Pseudomonas A225, indicating that multiple copies of the operon are necessary for the increase in siderophore gene promoter activity. Amplification of the Escherichia coli and WCS358 groESL genes also increased iron-regulated promoter activity in the parent strain WCS358. The groESL operon codes for the chaperone proteins GroES and GroEL, which are responsible for mediating the folding and assembly of many proteins.

  17. Bypasses in intracellular glucose metabolism in iron-limited Pseudomonas putida.

    PubMed

    Sasnow, Samantha S; Wei, Hua; Aristilde, Ludmilla

    2016-02-01

    Decreased biomass growth in iron (Fe)-limited Pseudomonas is generally attributed to downregulated expression of Fe-requiring proteins accompanied by an increase in siderophore biosynthesis. Here, we applied a stable isotope-assisted metabolomics approach to explore the underlying carbon metabolism in glucose-grown Pseudomonas putida KT2440. Compared to Fe-replete cells, Fe-limited cells exhibited a sixfold reduction in growth rate but the glucose uptake rate was only halved, implying an imbalance between glucose uptake and biomass growth. This imbalance could not be explained by carbon loss via siderophore production, which accounted for only 10% of the carbon-equivalent glucose uptake. In lieu of the classic glycolytic pathway, the Entner-Doudoroff (ED) pathway in Pseudomonas is the principal route for glucose catabolism following glucose oxidation to gluconate. Remarkably, gluconate secretion represented 44% of the glucose uptake in Fe-limited cells but only 2% in Fe-replete cells. Metabolic (13) C flux analysis and intracellular metabolite levels under Fe limitation indicated a decrease in carbon fluxes through the ED pathway and through Fe-containing metabolic enzymes. The secreted siderophore was found to promote dissolution of Fe-bearing minerals to a greater extent than the high extracellular gluconate. In sum, bypasses in the Fe-limited glucose metabolism were achieved to promote Fe availability via siderophore secretion and to reroute excess carbon influx via enhanced gluconate secretion.

  18. Quorum sensing triggers the stochastic escape of individual cells from Pseudomonas putida biofilms.

    PubMed

    Cárcamo-Oyarce, Gerardo; Lumjiaktase, Putthapoom; Kümmerli, Rolf; Eberl, Leo

    2015-01-16

    The term 'quorum sensing' (QS) is generally used to describe the phenomenon that bacteria release and perceive signal molecules to coordinate cooperative behaviour in response to their population size. QS-based communication has therefore been considered a social trait. Here we show that QS signals (N-acyl-homoserine lactones, AHLs) are stochastically produced in young biofilms of Pseudomonas putida and act mainly as self-regulatory signals rather than inducing neighbouring cells. We demonstrate that QS induces the expression of putisolvin biosurfactants that are not public goods, thereby triggering asocial motility of induced cells out of microcolonies. Phenotypic heterogeneity is most prominent in the early stages of biofilm development, whereas at later stages behaviour patterns across cells become more synchronized. Our findings broaden our perspective on QS by showing that AHLs can control the expression of asocial (self-directed) traits, and that heterogeneity in QS can serve as a mechanism to drive phenotypic heterogeneity in self-directed behaviour.

  19. Purification and properties of cis-toluene dihydrodiol dehydrogenase from Pseudomonas putida.

    PubMed Central

    Rogers, J E; Gibson, D T

    1977-01-01

    The purification of (+)-cis-1(S),2(R)-dihydroxy-3-methylcyclohexa-3,5-diene dehydrogenase from cells of Pseudomonas putida grown with toluene as the sole source of carbon and energy is reported. The molecular weight of the enzyme is 104,000 at pH 9.7. The enzyme is composed of four apparently identical subunits with molecular weights of 27,000. The enzyme is specific for nicotinamide adenine dinucleotide and oxidizes a number of cis-dihydrodiols. Both enantiomers of a racemic mixture of cis-1,2-dihydroxyl-1,2-dihydronaphthalene dihydrodiol are oxidized by the enzyme. No enzymatic activity is observed with trans-1,2-dihydroxyl-1,2-dihydronaphthalene dihydrodiol. PMID:16865

  20. Bioaccumulation of germanium by Pseudomonas putida in the presence of two selected substrates

    SciTech Connect

    Chmielowski, J.; Klapcinska, B.

    1986-05-01

    The uptake of germanium by Pseudomonas putida ATCC 33015 was studied in the presence of catechol or acetate or both as representative substrates differing in their ability to form complexes with this element. The bacteria were taken from a batch culture grown on acetate as the sole carbon source. Cells introduced into a medium containing germanium and either catechol or a mixture of catechol and acetate accumulated germanium in a biphasic way. After a lower level of accumulation that corresponded to the value obtained in the presence of acetate was reached, a further increase in the germanium content up to a higher saturation level was observed. The appearance of the second step of accumulation, which corresponded to the linear degradation of catechol, proved that catechol facilitated the transport of germanium into the cells through the nonspecific uptake of the germanium-catechol complex by an inducible catechol transport system.

  1. Silver nanotoxicity using a light-emitting biosensor Pseudomonas putida isolated from a wastewater treatment plant.

    PubMed

    Dams, R I; Biswas, A; Olesiejuk, A; Fernandes, T; Christofi, N

    2011-11-15

    The effect of silver ions, nano- and micro-particles on a luminescent biosensor bacterium Pseudomonas putida originally isolated from activated sludge was assessed. The bacterium carrying a stable chromosomal copy of the lux operon (luxCDABE) was able to detect toxicity of ionic and particulate silver over short term incubations ranging from 30 to 240 min. The IC(50) values obtained at different time intervals showed that highest toxicity (lowest IC(50)) was obtained after 90 min incubation for all toxicants and this is considered the optimum incubation for testing. The data show that ionic silver is the most toxic followed by nanosilver particles with microsilver particles being least toxic. Release of nanomaterials is likely to have an effect on the activated sludge process as indicated by the study using a common sludge bacterium involved in biodegradation of organic wastes.

  2. The crystal structure of Pseudomonas putida azoreductase - the active site revisited.

    PubMed

    Gonçalves, Ana Maria D; Mendes, Sónia; de Sanctis, Daniele; Martins, Lígia O; Bento, Isabel

    2013-12-01

    The enzymatic degradation of azo dyes begins with the reduction of the azo bond. In this article, we report the crystal structures of the native azoreductase from Pseudomonas putida MET94 (PpAzoR) (1.60 Å), of PpAzoR in complex with anthraquinone-2-sulfonate (1.50 Å), and of PpAzoR in complex with Reactive Black 5 dye (1.90 Å). These structures reveal the residues and subtle changes that accompany substrate binding and release. Such changes highlight the fine control of access to the catalytic site that is required by the ping-pong mechanism, and in turn the specificity offered by the enzyme towards different substrates. The topology surrounding the active site shows novel features of substrate recognition and binding that help to explain and differentiate the substrate specificity observed among different bacterial azoreductases.

  3. Novel polyhydroxyalkanoate copolymers produced in Pseudomonas putida by metagenomic polyhydroxyalkanoate synthases.

    PubMed

    Cheng, Jiujun; Charles, Trevor C

    2016-09-01

    Bacterially produced biodegradable polyhydroxyalkanoates (PHAs) with versatile properties can be achieved using different PHA synthases (PhaCs). This work aims to expand the diversity of known PhaCs via functional metagenomics and demonstrates the use of these novel enzymes in PHA production. Complementation of a PHA synthesis-deficient Pseudomonas putida strain with a soil metagenomic cosmid library retrieved 27 clones expressing either class I, class II, or unclassified PHA synthases, and many did not have close sequence matches to known PhaCs. The composition of PHA produced by these clones was dependent on both the supplied growth substrates and the nature of the PHA synthase, with various combinations of short-chain-length (SCL) and medium-chain-length (MCL) PHA. These data demonstrate the ability to isolate diverse genes for PHA synthesis by functional metagenomics and their use for the production of a variety of PHA polymer and copolymer mixtures.

  4. Soil bacteria Pseudomonas putida and Alcaligenes xylosoxidans subsp. denitrificans inactivate triclosan in liquid and solid substrates.

    PubMed

    Meade, M J; Waddell, R L; Callahan, T M

    2001-10-16

    Triclosan is a broad-spectrum antimicrobial agent that has been incorporated into many household and medical products. Bacteria with high levels of triclosan resistance were isolated from compost, water, and soil samples. Two of these bacteria, Pseudomonas putida TriRY and Alcaligenes xylosoxidans subsp. denitrificans TR1, were able to use triclosan as a sole carbon source and clear particulate triclosan from agar. A decrease in triclosan concentration was measured by HPLC within 6 h of inoculation with strain TriRY and 24 h with strain TR1. Bioassays demonstrated that triclosan was inactivated in liquid cultures and/or embedded in plastic by the growth of strain TriRY and strain TR1, permitting the growth of triclosan-sensitive bacteria.

  5. Spatial and temporal distribution of a bioluminescent-marked Pseudomonas putida on soybean root.

    PubMed

    Beauchamp, Chantal J; Kloepper, Joseph W

    2003-01-01

    The ability of rhizobacteria to compete with other microorganisms for root colonization may be critical for its establishment on a root. Over a 6 day period, visualization of the spatial and temporal rhizosphere distribution of a bioluminescent-marked rhizobacterium, Pseudomonas putida, strain GR7.4lux, was examined on soybean grown in non-sterile soil conditions. Luminometry technologies showed a rapid root distribution of rhizobacteria where bioluminescence was particularly intense on the seed and upper root parts. The results provide new information on rhizobial root distribution, where, using enrichment broth, 50% of the root tips were still colonized by rhizobacteria up to 6 days after sowing. This suggests that rhizobial enrichment is required to detect low populations at the root tip. Bioluminescent technology represents a promising alternative to previous methods for studying rhizobial growth and distribution on roots. Copyright 2003 John Wiley & Sons, Ltd.

  6. Characterization of Pseudooxynicotine Amine Oxidase of Pseudomonas putida S16 that Is Crucial for Nicotine Degradation.

    PubMed

    Hu, Haiyang; Wang, Weiwei; Tang, Hongzhi; Xu, Ping

    2015-12-04

    Pseudooxynicotine amine oxidase (Pnao) is essential to the pyrrolidine pathway of nicotine degradation of Pseudomonas putida strain S16, which is significant for the detoxification of nicotine, through removing the CH3NH2 group. However, little is known about biochemical mechanism of this enzyme. Here, we characterized its properties and biochemical mechanism. Isotope labeling experiments provided direct evidence that the newly introduced oxygen atom in 3-succinoylsemialdehyde-pyridine is derived from H2O, but not from O2. Pnao was very stable at temperatures below 50 °C; below this temperature, the enzyme activity increased as temperature rose. Site-directed mutagenesis studies showed that residue 180 is important for its thermal stability. In addition, tungstate may enhance the enzyme activity, which has rarely been reported before. Our findings make a further understanding of the crucial Pnao in nicotine degradation.

  7. Ultrasonic disruption of Pseudomonas putida for the release of arginine deiminase: Kinetics and predictive models.

    PubMed

    Patil, Mahesh D; Dev, Manoj J; Tangadpalliwar, Sujit; Patel, Gopal; Garg, Prabha; Chisti, Yusuf; Banerjee, Uttam Chand

    2017-06-01

    The responses of the ultrasound-mediated disruption of Pseudomonas putida KT2440 were modelled as the function of biomass concentration in the cell suspension; the treatment time of sonication; the duty cycle and the acoustic power of the sonicator. For the experimental data, the response surface (RSM), the artificial neural network (ANN) and the support vector machine (SVM) models were compared for their ability to predict the performance parameters. The satisfactory prediction of the unseen data of the responses implied the proficient generalization capabilities of ANN. The extent of the cell disruption was mainly dependent on the acoustic power and the biomass concentration. The cellmass concentration in the slurry most strongly influenced the ADI and total protein release. Nearly 28U/mL ADI was released when a biomass concentration of 300g/L was sonicated for 6min with an acoustic power of 187.5W at 40% duty cycle. Cell disruption obeyed first-order kinetics.

  8. Oxidative stress in bacteria (Pseudomonas putida) exposed to nanostructures of silicon carbide.

    PubMed

    Borkowski, Andrzej; Szala, Mateusz; Kowalczyk, Paweł; Cłapa, Tomasz; Narożna, Dorota; Selwet, Marek

    2015-09-01

    Silicon carbide (SiC) nanostructures produced by combustion synthesis can cause oxidative stress in the bacterium Pseudomonas putida. The results of this study showed that SiC nanostructures damaged the cell membrane, which can lead to oxidative stress in living cells and to the loss of cell viability. As a reference, micrometric SiC was also used, which did not exhibit toxicity toward cells. Oxidative stress was studied by analyzing the activity of peroxidases, and the expression of the glucose-6-phosphate dehydrogenase gene (zwf1) using real-time PCR and northern blot techniques. Damage to nucleic acid was studied by isolating and hydrolyzing plasmids with the formamidopyrimidine [fapy]-DNA glycosylase (also known as 8-oxoguanine DNA glycosylase) (Fpg), which is able to detect damaged DNA. The level of viable microbial cells was investigated by propidium iodide and acridine orange staining. Copyright © 2015 Elsevier Ltd. All rights reserved.

  9. c-Type cytochromes and manganese oxidation in Pseudomonas putida MnB1

    SciTech Connect

    Caspi, R.; Tebo, B.M.; Haygood, M.G.

    1998-10-01

    Pseudomonas putida MnB1 is an isolate from an Mn oxide-encrusted pipeline that can oxidize Mn(II) to Mn oxides. The authors used transposon mutagenesis to construct mutants of strain MnB1 that are unable to oxidize manganese, and they characterized some of these mutants. The mutants were divided into three groups: mutants defective in the biogenesis of c-type cytochromes, mutants defective in genes that encode key enzymes of the tricarboxylic acid cycle, and mutants defective in the biosynthesis of tryptophan. The mutants in the first two groups were cytochrome c oxidase negative and did not contain c-type cytochromes. Mn(II) oxidation capability could be recovered in a c-type cytochrome biogenesis-defective mutant by complementation of the mutation.

  10. Characterization of Pseudooxynicotine Amine Oxidase of Pseudomonas putida S16 that Is Crucial for Nicotine Degradation

    PubMed Central

    Hu, Haiyang; Wang, Weiwei; Tang, Hongzhi; Xu, Ping

    2015-01-01

    Pseudooxynicotine amine oxidase (Pnao) is essential to the pyrrolidine pathway of nicotine degradation of Pseudomonas putida strain S16, which is significant for the detoxification of nicotine, through removing the CH3NH2 group. However, little is known about biochemical mechanism of this enzyme. Here, we characterized its properties and biochemical mechanism. Isotope labeling experiments provided direct evidence that the newly introduced oxygen atom in 3-succinoylsemialdehyde-pyridine is derived from H2O, but not from O2. Pnao was very stable at temperatures below 50 °C; below this temperature, the enzyme activity increased as temperature rose. Site-directed mutagenesis studies showed that residue 180 is important for its thermal stability. In addition, tungstate may enhance the enzyme activity, which has rarely been reported before. Our findings make a further understanding of the crucial Pnao in nicotine degradation. PMID:26634650

  11. [The role of mineral phosphorus compounds in naphthalene biodegradation by Pseudomonas putida].

    PubMed

    Puntus, I F; Ryazanova, L P; Zvonarev, A N; Funtikova, T V; Kulakovskaya, T V

    2015-01-01

    The effect of phosphate concentration in the culture medium on the growth and naphthalene degradation by Pseudomonas putida BS 3701 was studied. The limiting concentration of phosphate was 0.4 mM and 0.1 mM under cultivation in media with naphthalene and glucose, respectively The phosphate deficiency correlated with a decrease in the activities of naphthalene dioxygenase and salicylate hydroxylase and with salicylate accumulation in the culture medium. We suggest that this fact indicates the impaired regulation of gene expression of "upper" and "lower" pathways of naphthalene oxidation. Under naphthalene degradation, the cells accumulated three times more inorganic polyphosphates as compared with the consumption of glucose. The involvement of polyphosphates in the regulation of naphthalene metabolism has been considered.

  12. Isotope fractionation associated with the simultaneous biodegradation of multiple nitrophenol isomers by Pseudomonas putida B2.

    PubMed

    Wijker, Reto S; Zeyer, Josef; Hofstetter, Thomas B

    2017-05-24

    Quantifying the extent of biodegradation of nitroaromatic compounds (NACs) in contaminated soils and sediments is challenging because of competing oxidative and reductive reaction pathways. We have previously shown that the stable isotope fractionation of NACs reveals the routes of degradation even if it is simultaneously caused by different bacteria. However, it is unclear whether compound-specific isotope analysis (CSIA) can be applied in situations where multiple pollutants are biodegraded by only one microorganism under multi-substrate conditions. Here we examined the C and N isotope fractionation of 2-nitrophenol (2-NP) and 3-nitrophenol (3-NP) during biodegradation by Pseudomonas putida B2 through monooxygenation and partial reductive pathways, respectively, in the presence of single substrates vs. binary substrate mixtures. Laboratory experiments showed that the reduction of 3-NP by Pseudomonas putida B2 is associated with large N and minor C isotope fractionation with C and N isotope enrichment factors, εC and εN, of -0.3 ± 0.1‰ and -22 ± 0.2‰, respectively. The opposite isotope fractionation trends were found for 2-NP monooxygenation. In the simultaneous presence of 2-NP and 3-NP, 2-NP is biodegraded at identical rate constants and εC and εN values (-1.0 ± 0.1‰ and -1.3 ± 0.2‰) to those found for the monooxygenation of 2-NP in single substrate experiments. While the pathway and N isotope fractionation of 3-NP reduction (εN = -24 ± 1.1‰) are independent of the presence of 2-NP, intermediates of 2-NP monooxygenation interfere with 3-NP reduction. Because neither pH, substrate uptake, nor aromatic substituents affected the kinetic isotope effects of nitrophenol biodegradation, our study illustrates that CSIA provides robust scientific evidence for the assessment of natural attenuation processes.

  13. Understanding butanol tolerance and assimilation in Pseudomonas putida BIRD-1: an integrated omics approach.

    PubMed

    Cuenca, María del Sol; Roca, Amalia; Molina-Santiago, Carlos; Duque, Estrella; Armengaud, Jean; Gómez-Garcia, María R; Ramos, Juan L

    2016-01-01

    Pseudomonas putida BIRD-1 has the potential to be used for the industrial production of butanol due to its solvent tolerance and ability to metabolize low-cost compounds. However, the strain has two major limitations: it assimilates butanol as sole carbon source and butanol concentrations above 1% (v/v) are toxic. With the aim of facilitating BIRD-1 strain design for industrial use, a genome-wide mini-Tn5 transposon mutant library was screened for clones exhibiting increased butanol sensitivity or deficiency in butanol assimilation. Twenty-one mutants were selected that were affected in one or both of the processes. These mutants exhibited insertions in various genes, including those involved in the TCA cycle, fatty acid metabolism, transcription, cofactor synthesis and membrane integrity. An omics-based analysis revealed key genes involved in the butanol response. Transcriptomic and proteomic studies were carried out to compare short and long-term tolerance and assimilation traits. Pseudomonas putida initiates various butanol assimilation pathways via alcohol and aldehyde dehydrogenases that channel the compound to central metabolism through the glyoxylate shunt pathway. Accordingly, isocitrate lyase - a key enzyme of the pathway - was the most abundant protein when butanol was used as the sole carbon source. Upregulation of two genes encoding proteins PPUBIRD1_2240 and PPUBIRD1_2241 (acyl-CoA dehydrogenase and acyl-CoA synthetase respectively) linked butanol assimilation with acyl-CoA metabolism. Butanol tolerance was found to be primarily linked to classic solvent defense mechanisms, such as efflux pumps, membrane modifications and control of redox state. Our results also highlight the intensive energy requirements for butanol production and tolerance; thus, enhancing TCA cycle operation may represent a promising strategy for enhanced butanol production.

  14. Characterization of an Inducible Phenylserine Aldolase from Pseudomonas putida 24-1

    PubMed Central

    Misono, Haruo; Maeda, Hiroshi; Tuda, Kouiti; Ueshima, Sakuko; Miyazaki, Naoto; Nagata, Shinji

    2005-01-01

    An inducible phenylserine aldolase (l-threo-3-phenylserine benzaldehyde-lyase, EC 4.1.2.26), which catalyzes the cleavage of l-3-phenylserine to yield benzaldehyde and glycine, was purified to homogeneity from a crude extract of Pseudomonas putida 24-1 isolated from soil. The enzyme was a hexamer with the apparent subunit molecular mass of 38 kDa and contained 0.7 mol of pyridoxal 5′ phosphate per mol of the subunit. The enzyme exhibited absorption maxima at 280 and 420 nm. The maximal activity was obtained at about pH 8.5. The enzyme acted on l-threo-3-phenylserine (Km, 1.3 mM), l-erythro-3-phenylserine (Km, 4.6 mM), l-threonine (Km, 29 mM), and l-allo-threonine (Km, 22 mM). In the reverse reaction, threo- and erythro- forms of l-3-phenylserine were produced from benzaldehyde and glycine. The optimum pH for the reverse reaction was 7.5. The structural gene coding for the phenylserine aldolase from Pseudomonas putida 24-1 was cloned and overexpressed in Escherichia coli cells. The nucleotide sequence of the phenylserine aldolase gene encoded a peptide containing 357 amino acids with a calculated molecular mass of 37.4 kDa. The recombinant enzyme was purified and characterized. Site-directed mutagenesis experiments showed that replacement of K213 with Q resulted in a loss of the enzyme activity, with a disappearance of the absorption maximum at 420 nm. Thus, K213 of the enzyme probably functions as an essential catalytic residue, forming a Schiff base with pyridoxal 5′-phosphate. PMID:16085854

  15. Pyoverdine synthesis by the Mn(II)-oxidizing bacterium Pseudomonas putida GB-1.

    PubMed

    Parker, Dorothy L; Lee, Sung-Woo; Geszvain, Kati; Davis, Richard E; Gruffaz, Christelle; Meyer, Jean-Marie; Torpey, Justin W; Tebo, Bradley M

    2014-01-01

    When iron-starved, the Mn(II)-oxidizing bacteria Pseudomonas putida strains GB-1 and MnB1 produce pyoverdines (PVDGB-1 and PVDMnB1), siderophores that both influence iron uptake and inhibit manganese(II) oxidation by these strains. To explore the properties and genetics of a PVD that can affect manganese oxidation, LC-MS/MS, and various siderotyping techniques were used to identify the peptides of PVDGB-1 and PVDMnB1 as being (for both PVDs): chromophore-Asp-Lys-OHAsp-Ser-Gly-aThr-Lys-cOHOrn, resembling a structure previously reported for P. putida CFML 90-51, which does not oxidize Mn. All three strains also produced an azotobactin and a sulfonated PVD, each with the peptide sequence above, but with unknown regulatory or metabolic effects. Bioinformatic analysis of the sequenced genome of P. putida GB-1 suggested that a particular non-ribosomal peptide synthetase (NRPS), coded by the operon PputGB1_4083-4086, could produce the peptide backbone of PVDGB-1. To verify this prediction, plasmid integration disruption of PputGB1_4083 was performed and the resulting mutant failed to produce detectable PVD. In silico analysis of the modules in PputGB1_4083-4086 predicted a peptide sequence of Asp-Lys-Asp-Ser-Ala-Thr-Lsy-Orn, which closely matches the peptide determined by MS/MS. To extend these studies to other organisms, various Mn(II)-oxidizing and non-oxidizing isolates of P. putida, P. fluorescens, P. marincola, P. fluorescens-syringae group, P. mendocina-resinovorans group, and P. stutzerii group were screened for PVD synthesis. The PVD producers (12 out of 16 tested strains) were siderotyped and placed into four sets of differing PVD structures, some corresponding to previously characterized PVDs and some to novel PVDs. These results combined with previous studies suggested that the presence of OHAsp or the flexibility of the pyoverdine polypeptide may enable efficient binding of Mn(III).

  16. Insights into the genomic basis of niche specificity of Pseudomonas putida KT2440.

    PubMed

    Dos Santos, V A P Martins; Heim, S; Moore, E R B; Strätz, M; Timmis, K N

    2004-12-01

    A major challenge in microbiology is the elucidation of the genetic and ecophysiological basis of habitat specificity of microbes. Pseudomonas putida is a paradigm of a ubiquitous metabolically versatile soil bacterium. Strain KT2440, a safety strain that has become a laboratory workhorse worldwide, has been recently sequenced and its genome annotated. By drawing on both published information and on original in silico analysis of its genome, we address here the question of what genomic features of KT2440 could explain or are consistent with its ubiquity, metabolic versatility and adaptability. The genome of KT2440 exhibits combinations of features characteristic of terrestrial, rhizosphere and aquatic bacteria, which thrive in either copiotrophic or oligotrophic habitats, and suggests that P. putida has evolved and acquired functions that equip it to thrive in diverse, often inhospitable environments, either free-living, or in close association with plants. The high diversity of protein families encoded by its genome, the large number and variety of small aralogous families, insertion elements, repetitive extragenic palindromic sequences, as well as the mosaic structure of the genome (with many regions of 'atypical' composition) and the multiplicity of mobile elements, reflect a high functional diversity in P. putida and are indicative of its evolutionary trajectory and adaptation to the diverse habitats in which it thrives. The unusual wealth of determinants for high affinity nutrient acquisition systems, mono- and di-oxygenases, oxido-reductases, ferredoxins and cytochromes, dehydrogenases, sulfur metabolism proteins, for efflux pumps and glutathione-S-transfereases, and for the extensive array of extracytoplasmatic function sigma factors, regulators, and stress response systems, constitute the genomic basis for the exceptional nutritional versatility and opportunism of P. putida , its ubiquity in diverse soil, rhizosphere and aquatic systems, and its renowned

  17. Draft genome sequence analysis of a Pseudomonas putida W15Oct28 strain with antagonistic activity to Gram-positive and Pseudomonas sp. pathogens.

    PubMed

    Ye, Lumeng; Hildebrand, Falk; Dingemans, Jozef; Ballet, Steven; Laus, George; Matthijs, Sandra; Berendsen, Roeland; Cornelis, Pierre

    2014-01-01

    Pseudomonas putida is a member of the fluorescent pseudomonads known to produce the yellow-green fluorescent pyoverdine siderophore. P. putida W15Oct28, isolated from a stream in Brussels, was found to produce compound(s) with antimicrobial activity against the opportunistic pathogens Staphylococcus aureus, Pseudomonas aeruginosa, and the plant pathogen Pseudomonas syringae, an unusual characteristic for P. putida. The active compound production only occurred in media with low iron content and without organic nitrogen sources. Transposon mutants which lost their antimicrobial activity had the majority of insertions in genes involved in the biosynthesis of pyoverdine, although purified pyoverdine was not responsible for the antagonism. Separation of compounds present in culture supernatants revealed the presence of two fractions containing highly hydrophobic molecules active against P. aeruginosa. Analysis of the draft genome confirmed the presence of putisolvin biosynthesis genes and the corresponding lipopeptides were found to contribute to the antimicrobial activity. One cluster of ten genes was detected, comprising a NAD-dependent epimerase, an acetylornithine aminotransferase, an acyl CoA dehydrogenase, a short chain dehydrogenase, a fatty acid desaturase and three genes for a RND efflux pump. P. putida W15Oct28 genome also contains 56 genes encoding TonB-dependent receptors, conferring a high capacity to utilize pyoverdines from other pseudomonads. One unique feature of W15Oct28 is also the presence of different secretion systems including a full set of genes for type IV secretion, and several genes for type VI secretion and their VgrG effectors.

  18. A Metabolic Widget Adjusts the Phosphoenolpyruvate-Dependent Fructose Influx in Pseudomonas putida

    PubMed Central

    Chavarría, Max; Goñi-Moreno, Ángel

    2016-01-01

    ABSTRACT Fructose uptake in the soil bacterium Pseudomonas putida occurs through a canonical phosphoenolpyruvate (PEP)-dependent sugar transport system (PTSFru). The logic of the genetic circuit that rules its functioning is puzzling: the transcription of the fruBKA operon, encoding all the components of PTSFru, can escape the repression exerted by the catabolite repressor/activator protein Cra solely in the presence of intracellular fructose-1-P, an agonist formed only when fructose has been already transported. To study this apparently incongruous regulatory architecture, the changes in the transcriptome brought about by a seamless Δcra deletion in P. putida strain KT2440 were inspected under different culture conditions. The few genes found to be upregulated in the cra mutant unexpectedly included PP_3443, encoding a bona fide glyceraldehyde-3-P dehydrogenase. An in silico model was developed to explore emergent properties that could result from such connections between sugar uptake with Cra and PEP. Simulation of fructose transport revealed that sugar uptake called for an extra supply of PEP (obtained through the activity of PP_3443) that was kept (i.e., memorized) even when the carbohydrate disappeared from the medium. This feature was traced to the action of two sequential inverters that connect the availability of exogenous fructose to intracellular PEP levels via Cra/PP_3443. The loss of such memory caused a much longer lag phase in cells shifted from one growth condition to another. The term “metabolic widget” is proposed to describe a merged biochemical and regulatory patch that tailors a given node of the cell molecular network to suit species-specific physiological needs. IMPORTANCE The regulatory nodes that govern metabolic traffic in bacteria often show connectivities that could be deemed unnecessarily complex at a first glance. Being a soil dweller and plant colonizer, Pseudomonas putida frequently encounters fructose in the niches that it

  19. Isolation of NDM-1-producing multidrug-resistant Pseudomonas putida from a paediatric case of acute gastroenteritis, India.

    PubMed

    Bhattacharya, D; Dey, S; Kadam, S; Kalal, S; Jali, S; Koley, H; Sinha, R; Nag, D; Kholkute, S D; Roy, S

    2015-05-01

    Pseudomonas putida is an uncommon opportunistic pathogen, usually susceptible to antimicrobial agents. Data concerning resistance to antimicrobial agents in clinical P. putida isolates are limited. To the best of our knowledge we report for the first time the isolation of NDM-1-producing multidrug-resistant P. putida from a case of acute gastroenteritis. The isolate showed resistance to a wide range of antimicrobials, including fluoroquinolones, third-generation cephalosporins and carbapenems. The isolate also exhibited multiple mutations in the quinolone resistance determining region and showed the presence of qepA, bla TEM , bla OXA1 and bla OXA7 genes. The present study highlights the importance of looking for the relatively rare aetiological agents in clinical samples that do not yield common pathogens.

  20. A kinetic study on the bioremediation of sodium cyanide and acetonitrile by free and immobilized cells of pseudomonas putida

    SciTech Connect

    Chapatwala, K.D.; Babu, G.R.V.; Armstead, E.R.

    1995-12-31

    Pseudomonas putida capable of utilizing organic nitrile (acetonitrile) and inorganic cyanide (sodium cyanide) as the sole source of carbon and nitrogen was isolated from contaminated industrial sites and waste water. The bacterium possesses nitrile aminohydrolase (EC 3.5.5.1) and amidase (EC 3.5.1.4), which are involved in the transformation of cyanides and nitrites into ammonia and CO{sub 2} through the formation of amide as an intermediate. Both of the enzymes have a high selectivity and affinity toward the {sup -}CN group. The rate of degradation of acetonitrile and sodium cyanide to ammonia and CO{sub 2} by the calcium-alginate immobilized cells of P. putida was studied. The rate of reaction during the biodegradation of acetonitrile and sodium cyanide, and the substrate- and product-dependent kinetics of these toxic compounds were studied using free and immobilized cells of P. putida and modeled using a simple Michaelis-Menten equation.

  1. Effect of high temperature on Pseudomonas putida NBRI0987 biofilm formation and expression of stress sigma factor RpoS.

    PubMed

    Srivastava, S; Yadav, A; Seem, K; Mishra, S; Chaudhary, V; Nautiyal, C S

    2008-05-01

    Pseudomonas is an efficient plant growth-promoting rhizobacteria; however, among the limiting factors for its commercialization, tolerance for high temperature is the most critical one. After screening 2,500 Pseudomnas sp. strains, a high temperature tolerant-strain Pseudomonas putida NBRI0987 was isolated from the drought-exposed rhizosphere of chickpea (Cicer arietinum L. cv. Radhey), which was grown under rain-fed conditions. P. putida NBRI0987 tolerated a temperature of 40 degrees C for < or = 5 days. To the best of our knowledge, this is the first report of a Pseudomnas sp. demonstrating survival estimated by counting viable cells under such a high temperature. P. putida NBRI0987 colony-forming unit (CFU)/ml on day 10 in both the absence and presence of MgSO4 x 7H2O (MgSO4) in combination with glycerol at 40 degrees C were 0.0 and 1.7 x 10(11), respectively. MgSO4 plus glycerol also enhanced the ability of P. putida NBRI0987 to tolerate high temperatures by inducing its ability to form biofilm. However, production of alginate was not critical for biofilm formation. The present study demonstrates overexpression of stress sigma factor sigma(S) (RpoS) when P. putida NBRI0987 is grown under high-temperature stress at 40 degrees C compared with 30 degrees C. We present evidence, albeit indirect, that the adaptation of P. putida NBRI0987 to high temperatures is a complex multilevel regulatory process in which many different genes can be involved.

  2. Simultaneous biodegradation of phenol and cyanide present in coke-oven effluent using immobilized Pseudomonas putida and Pseudomonas stutzeri.

    PubMed

    Singh, Utkarsh; Arora, Naveen Kumar; Sachan, Preeti

    2017-09-04

    Discharge of coke-oven wastewater to the environment may cause severe contamination to it and also threaten the flora and fauna, including human beings. Hence before dumping it is necessary to treat this dangerous effluent in order to minimize the damage to the environment. Conventional technologies have inherent drawbacks however, biological treatment is an advantageous alternative method. In the present study, bacteria were isolated from the soil collected from the sites contaminated by coke-oven effluent rich in phenol and cyanide. Nucleotides sequence alignment and phylogenetic analysis showed the identity of the selected phenol and cyanide degrading isolates NAUN-16 and NAUN-1B as Pseudomonas putida and Pseudomonas stutzeri, respectively. These two isolates tolerated phenol up to 1800mgL(-1) and cyanide up to 340mgL(-1) concentrations. The isolates were immobilized on activated charcoal, saw dust and fly ash. The effluent was passed through the column packed with immobilized cells with a flow rate of 5mLmin(-1). The isolates showed degradation of phenol up to 80.5% and cyanide up to 80.6% and also had the ability to reduce biological oxygen demand, chemical oxygen demand and lower the pH of effluent from alkaline to near neutral. The study suggests the utilization of such potential bacterial strains in treating industrial effluent containing phenol and cyanide, before being thrown in any ecosystem. Copyright © 2017 Sociedade Brasileira de Microbiologia. Published by Elsevier Editora Ltda. All rights reserved.

  3. In situ biosurfactant production and hydrocarbon removal by Pseudomonas putida CB-100 in bioaugmented and biostimulated oil-contaminated soil.

    PubMed

    Ángeles, Martínez-Toledo; Refugio, Rodríguez-Vázquez

    2013-01-01

    In situ biosurfactant (rhamnolipid) production by Pseudomonas putida CB-100 was achieved during a bioaugmented and biostimulated treatment to remove hydrocarbons from aged contaminated soil from oil well drilling operations. Rhamnolipid production and contaminant removal were determined for several treatments of irradiated and non-irradiated soils: nutrient addition (nitrogen and phosphorus), P. putida addition, and addition of both (P. putida and nutrients). The results were compared against a control treatment that consisted of adding only sterilized water to the soils. In treatment with native microorganisms (non-irradiated soils) supplemented with P. putida, the removal of total petroleum hydrocarbons (TPH) was 40.6%, the rhamnolipid production was 1.54 mg/kg, and a surface tension of 64 mN/m was observed as well as a negative correlation (R = -0.54; p < 0.019) between TPH concentration (mg/kg) and surface tension (mN/m), When both bacteria and nutrients were involved, TPH levels were lowered to 33.7%, and biosurfactant production and surface tension were 2.03 mg/kg and 67.3 mN/m, respectively. In irradiated soil treated with P. putida, TPH removal was 24.5% with rhamnolipid generation of 1.79 mg/kg and 65.6 mN/m of surface tension, and a correlation between bacterial growth and biosurfactant production (R = -0.64; p < 0.009) was observed. When the nutrients and P. putida were added, TPH removal was 61.1%, 1.85 mg/kg of biosurfactants were produced, and the surface tension was 55.6 mN/m. In summary, in irradiated and non-irradiated soils, in situ rhamnolipid production by P. putida enhanced TPH decontamination of the soil.

  4. In situ biosurfactant production and hydrocarbon removal by Pseudomonas putida CB-100 in bioaugmented and biostimulated oil-contaminated soil

    PubMed Central

    Ángeles, Martínez-Toledo; Refugio, Rodríguez-Vázquez

    2013-01-01

    In situ biosurfactant (rhamnolipid) production by Pseudomonas putida CB-100 was achieved during a bioaugmented and biostimulated treatment to remove hydrocarbons from aged contaminated soil from oil well drilling operations. Rhamnolipid production and contaminant removal were determined for several treatments of irradiated and non-irradiated soils: nutrient addition (nitrogen and phosphorus), P. putida addition, and addition of both (P. putida and nutrients). The results were compared against a control treatment that consisted of adding only sterilized water to the soils. In treatment with native microorganisms (non-irradiated soils) supplemented with P. putida, the removal of total petroleum hydrocarbons (TPH) was 40.6%, the rhamnolipid production was 1.54 mg/kg, and a surface tension of 64 mN/m was observed as well as a negative correlation (R = −0.54; p < 0.019) between TPH concentration (mg/kg) and surface tension (mN/m), When both bacteria and nutrients were involved, TPH levels were lowered to 33.7%, and biosurfactant production and surface tension were 2.03 mg/kg and 67.3 mN/m, respectively. In irradiated soil treated with P. putida, TPH removal was 24.5% with rhamnolipid generation of 1.79 mg/kg and 65.6 mN/m of surface tension, and a correlation between bacterial growth and biosurfactant production (R = −0.64; p < 0.009) was observed. When the nutrients and P. putida were added, TPH removal was 61.1%, 1.85 mg/kg of biosurfactants were produced, and the surface tension was 55.6 mN/m. In summary, in irradiated and non-irradiated soils, in situ rhamnolipid production by P. putida enhanced TPH decontamination of the soil. PMID:24294259

  5. Identification of camphor oxidation and reduction products in Pseudomonas putida: new activity of the cytochrome P450cam system.

    PubMed

    Prasad, Brinda; Rojubally, Adina; Plettner, Erika

    2011-06-01

    P450 enzymes are known for catalyzing hydroxylation reactions of non-activated C-H bonds. For example, P450(cam) from Pseudomonas putida oxidizes (1R)-(+)-camphor to 5-exo-hydroxy camphor and further to 5-ketocamphor. This hydroxylation reaction proceeds via a catalytic cycle in which the reduction of dioxygen (O(2)) is coupled to the oxidation of the substrate. We have observed that under conditions of low oxygen, P. putida and isolated P450(cam) reduce camphor to borneol. We characterized the formation of borneol under conditions of low oxygen or when the catalytic cycle is shunted by artificial oxidants like m-chloro perbenzoic acid, cumene hydroperoxide, etc. We also tested the toxicity of camphor and borneol with P. putida and Escherichia coli. We have found that in P. putida borneol is less toxic than camphor, whereas in E. coli borneol is more toxic than camphor. We discuss a potental ecological advantage of the camphor reduction reaction for P. putida.

  6. Crude glycerol as feedstock for the sustainable production of p-hydroxybenzoate by Pseudomonas putida S12.

    PubMed

    Verhoef, Suzanne; Gao, Nisi; Ruijssenaars, Harald J; de Winde, Johannes H

    2014-01-25

    Crude glycerol is a promising renewable feedstock in bioconversion processes for the production of fuels and chemicals. Impurities present in crude glycerol can however, negatively impact the fermentation process. Successful crude glycerol utilization requires robust microbial production hosts that tolerate and preferably, can utilize such impurities. We investigated utilization of crude, unpurified glycerol as a substrate for the production of aromatic compounds by solvent tolerant Pseudomonas putida S12. In high-cell density fed-batch fermentations, P. putida S12 surprisingly performed better on crude glycerol than on purified glycerol. By contrast, growth of Escherichia coli was severely compromised under these high cell density cultivation conditions on crude glycerol. For P. putida S12 the biomass-to-substrate yield, maximum biomass production rate and substrate uptake rate were consistently higher on crude glycerol. Moreover, production of p-hydroxybenzoate by engineered P. putida S12palB5 on crude glycerol showed a 10% yield improvement over production on purified glycerol. P. putida S12 is a favorable host for bioconversion processes utilizing crude glycerol as a substrate. Its intrinsic stress-tolerance properties provide the robustness required for efficient growth and metabolism on this renewable substrate.

  7. The Role of CzcRS Two-Component Systems in the Heavy Metal Resistance of Pseudomonas putida X4

    PubMed Central

    Liu, Pulin; Chen, Xi; Huang, Qiaoyun; Chen, Wenli

    2015-01-01

    The role of different czcRS genes in metal resistance and the cross-link between czcRS and czcCBA in Pseudomonas putida X4 were studied to advance understanding of the mechanisms by which P. putida copes with metal stress. Similar to P. putida KT2440, two complete czcRS1 and czcRS2 two-component systems, as well as a czcR3 without the corresponding sensing component were amplified in P. putida X4. The histidine kinase genes czcS1 and czcS2 were inactivated and fused to lacZ by homologous recombination. The lacZ fusion assay revealed that Cd2+ and Zn2+ caused a decrease in the transcription of czcRS1, whereas Cd2+ treatment enhanced the transcription of czcRS2. The mutation of different czcRSs showed that all czcRSs are necessary to facilitate full metal resistance in P. putida X4. A putative gene just downstream of czcR3 is related to metal ion resistance, and its transcription was activated by Zn2+. Data from quantitative real-time polymerase chain reaction (qRT-PCR) strongly suggested that czcRSs regulate the expression of czcCBA, and a cross-link exists between different czcRSs. PMID:26225958

  8. Integrated foam fractionation for heterologous rhamnolipid production with recombinant Pseudomonas putida in a bioreactor.

    PubMed

    Beuker, Janina; Steier, Anke; Wittgens, Andreas; Rosenau, Frank; Henkel, Marius; Hausmann, Rudolf

    2016-03-01

    Heterologeous production of rhamnolipids in Pseudomonas putida is characterized by advantages of a non-pathogenic host and avoidance of the native quorum sensing regulation in Pseudomonas aeruginosa. Yet, downstream processing is a major problem in rhamnolipid production and increases in complexity at low rhamnolipid titers and when using chemical foam control. This leaves the necessity of a simple concentrating and purification method. Foam fractionation is an elegant method for in situ product removal when producing microbial surfactants. However, up to now in situ foam fractionation is nearly exclusively reported for the production of surfactin with Bacillus subtilis. So far no cultivation integrated foam fractionation process for rhamnolipid production has been reported. This is probably due to excessive bacterial foam enrichment in that system. In this article a simple integrated foam fractionation process is reported for heterologous rhamnolipid production in a bioreactor with easily manageable bacterial foam enrichments. Rhamnolipids were highly concentrated in the foam during the cultivation process with enrichment factors up to 200. The described process was evaluated at different pH, media compositions and temperatures. Foam fractionation processes were characterized by calculating procedural parameter including rhamnolipid and bacterial enrichment, rhamnolipid recovery, YX/S, YP/X, and specific as well as volumetric productivities. Comparing foam fractionation parameters of the rhamnolipid process with the surfactin process a high effectiveness of the integrated foam fractionation for rhamnolipid production was demonstrated.

  9. The coordinate regulation of multiple terminal oxidases by the Pseudomonas putida ANR global regulator.

    PubMed

    Ugidos, Ana; Morales, Gracia; Rial, Eduardo; Williams, Huw D; Rojo, Fernando

    2008-07-01

    Pseudomonas putida KT2440 contains a branched aerobic respiratory chain with multiple terminal oxidases. Their relative proportion varies according to environmental conditions. The role of the oxygen-responsive ANR global regulator on expression of these terminal oxidases was analysed. During exponential growth in a highly aerated complete medium, ANR activated expression of the Cbb3-1 terminal oxidase (equivalent to Pseudomonas aeruginosa Cbb3-2), but had little role on expression of other terminal oxidases. In early stationary phase, or under oxygen limitation, inactivation of the anr gene led to increased expression of the bo(3)-type cytochrome (Cyo) and cyanide-insensitive (CIO) terminal oxidases, and to a much lower expression of Cbb3-1. DNase I footprints identified ANR binding sites at the promoters for these oxidases. Their location suggests that ANR is a transcriptional activator of Cbb3-1 genes and a repressor of CIO genes, consistent with expression data. ANR binding sites at the promoter for Cyo genes suggests a complex regulation in combination with other factors. Therefore, ANR coordinates expression of Cyo, CIO and Cbb3-1, but does not influence cytochrome aa3 and Cbb3-2 terminal oxidases under the conditions analysed. Functional assays showed that Cyo has a leading role during aerobic exponential growth, while Cbb3-1 becomes very important in stationary phase.

  10. Cell Envelope Changes in Solvent-Tolerant and Solvent-Sensitive Pseudomonas putida Strains following Exposure to o-Xylene.

    PubMed

    Pinkart, H C; Wolfram, J W; Rogers, R; White, D C

    1996-03-01

    Solvent-tolerant and -sensitive Pseudomonas putida strains were studied to determine their cell envelope changes following exposure to o-xylene. Both strains produced trans-unsaturated fatty acids. The tolerant strain showed an increase in total fatty acids, an increase in saturated fatty acids, and modified lipopolysaccharide. It is suggested that these envelope modifications aid in survival at high concentrations of organic solvents.

  11. Cell Envelope Changes in Solvent-Tolerant and Solvent-Sensitive Pseudomonas putida Strains following Exposure to o-Xylene

    PubMed Central

    Pinkart, H. C.; Wolfram, J. W.; Rogers, R.; White, D. C.

    1996-01-01

    Solvent-tolerant and -sensitive Pseudomonas putida strains were studied to determine their cell envelope changes following exposure to o-xylene. Both strains produced trans-unsaturated fatty acids. The tolerant strain showed an increase in total fatty acids, an increase in saturated fatty acids, and modified lipopolysaccharide. It is suggested that these envelope modifications aid in survival at high concentrations of organic solvents. PMID:16535264

  12. The Regulation of para-Nitrophenol Degradation in Pseudomonas putida DLL-E4.

    PubMed

    Chen, Qiongzhen; Tu, Hui; Luo, Xue; Zhang, Biying; Huang, Fei; Li, Zhoukun; Wang, Jue; Shen, Wenjing; Wu, Jiale; Cui, Zhongli

    2016-01-01

    Pseudomonas putida DLL-E4 can efficiently degrade para-nitrophenol and its intermediate metabolite hydroquinone. The regulation of para-nitrophenol degradation was studied, and PNP induced a global change in the transcriptome of P. putida DLL-E4. When grown on PNP, the wild-type strain exhibited significant downregulation of 2912 genes and upregulation of 845 genes, whereas 2927 genes were downregulated and 891 genes upregulated in a pnpR-deleted strain. Genes related to two non-coding RNAs (ins1 and ins2), para-nitrophenol metabolism, the tricarboxylic acid cycle, the outer membrane porin OprB, glucose dehydrogenase Gcd, and carbon catabolite repression were significantly upregulated when cells were grown on para-nitrophenol plus glucose. pnpA, pnpR, pnpC1C2DECX1X2, and pnpR1 are key genes in para-nitrophenol degradation, whereas pnpAb and pnpC1bC2bDbEbCbX1bX2b have lost the ability to degrade para-nitrophenol. Multiple components including transcriptional regulators and other unknown factors regulate para-nitrophenol degradation, and the transcriptional regulation of para-nitrophenol degradation is complex. Glucose utilization was enhanced at early stages of para-nitrophenol supplementation. However, it was inhibited after the total consumption of para-nitrophenol. The addition of glucose led to a significant enhancement in para-nitrophenol degradation and up-regulation in the expression of genes involved in para-nitrophenol degradation and carbon catabolite repression (CCR). It seemed that para-nitrophenol degradation can be regulated by CCR, and relief of CCR might contribute to enhanced para-nitrophenol degradation. In brief, the regulation of para-nitrophenol degradation seems to be controlled by multiple factors and requires further study.

  13. The Functional Structure of Central Carbon Metabolism in Pseudomonas putida KT2440

    PubMed Central

    Sudarsan, Suresh; Dethlefsen, Sarah; Blank, Lars M.; Siemann-Herzberg, Martin

    2014-01-01

    What defines central carbon metabolism? The classic textbook scheme of central metabolism includes the Embden-Meyerhof-Parnas (EMP) pathway of glycolysis, the pentose phosphate pathway, and the citric acid cycle. The prevalence of this definition of central metabolism is, however, equivocal without experimental validation. We address this issue using a general experimental approach that combines the monitoring of transcriptional and metabolic flux changes between steady states on alternative carbon sources. This approach is investigated by using the model bacterium Pseudomonas putida with glucose, fructose, and benzoate as carbon sources. The catabolic reactions involved in the initial uptake and metabolism of these substrates are expected to show a correlated change in gene expressions and metabolic fluxes. However, there was no correlation for the reactions linking the 12 biomass precursor molecules, indicating a regulation mechanism other than mRNA synthesis for central metabolism. This result substantiates evidence for a (re)definition of central carbon metabolism including all reactions that are bound to tight regulation and transcriptional invariance. Contrary to expectations, the canonical Entner-Doudoroff and EMP pathways sensu stricto are not a part of central carbon metabolism in P. putida, as they are not regulated differently from the aromatic degradation pathway. The regulatory analyses presented here provide leads on a qualitative basis to address the use of alternative carbon sources by deregulation and overexpression at the transcriptional level, while rate improvements in central carbon metabolism require careful adjustment of metabolite concentrations, as regulation resides to a large extent in posttranslational and/or metabolic regulation. PMID:24951791

  14. The functional structure of central carbon metabolism in Pseudomonas putida KT2440.

    PubMed

    Sudarsan, Suresh; Dethlefsen, Sarah; Blank, Lars M; Siemann-Herzberg, Martin; Schmid, Andreas

    2014-09-01

    What defines central carbon metabolism? The classic textbook scheme of central metabolism includes the Embden-Meyerhof-Parnas (EMP) pathway of glycolysis, the pentose phosphate pathway, and the citric acid cycle. The prevalence of this definition of central metabolism is, however, equivocal without experimental validation. We address this issue using a general experimental approach that combines the monitoring of transcriptional and metabolic flux changes between steady states on alternative carbon sources. This approach is investigated by using the model bacterium Pseudomonas putida with glucose, fructose, and benzoate as carbon sources. The catabolic reactions involved in the initial uptake and metabolism of these substrates are expected to show a correlated change in gene expressions and metabolic fluxes. However, there was no correlation for the reactions linking the 12 biomass precursor molecules, indicating a regulation mechanism other than mRNA synthesis for central metabolism. This result substantiates evidence for a (re)definition of central carbon metabolism including all reactions that are bound to tight regulation and transcriptional invariance. Contrary to expectations, the canonical Entner-Doudoroff and EMP pathways sensu stricto are not a part of central carbon metabolism in P. putida, as they are not regulated differently from the aromatic degradation pathway. The regulatory analyses presented here provide leads on a qualitative basis to address the use of alternative carbon sources by deregulation and overexpression at the transcriptional level, while rate improvements in central carbon metabolism require careful adjustment of metabolite concentrations, as regulation resides to a large extent in posttranslational and/or metabolic regulation.

  15. The Regulation of para-Nitrophenol Degradation in Pseudomonas putida DLL-E4

    PubMed Central

    Chen, Qiongzhen; Tu, Hui; Luo, Xue; Zhang, Biying; Huang, Fei; Li, Zhoukun; Wang, Jue; Shen, Wenjing; Wu, Jiale; Cui, Zhongli

    2016-01-01

    Pseudomonas putida DLL-E4 can efficiently degrade para-nitrophenol and its intermediate metabolite hydroquinone. The regulation of para-nitrophenol degradation was studied, and PNP induced a global change in the transcriptome of P. putida DLL-E4. When grown on PNP, the wild-type strain exhibited significant downregulation of 2912 genes and upregulation of 845 genes, whereas 2927 genes were downregulated and 891 genes upregulated in a pnpR-deleted strain. Genes related to two non-coding RNAs (ins1 and ins2), para-nitrophenol metabolism, the tricarboxylic acid cycle, the outer membrane porin OprB, glucose dehydrogenase Gcd, and carbon catabolite repression were significantly upregulated when cells were grown on para-nitrophenol plus glucose. pnpA, pnpR, pnpC1C2DECX1X2, and pnpR1 are key genes in para-nitrophenol degradation, whereas pnpAb and pnpC1bC2bDbEbCbX1bX2b have lost the ability to degrade para-nitrophenol. Multiple components including transcriptional regulators and other unknown factors regulate para-nitrophenol degradation, and the transcriptional regulation of para-nitrophenol degradation is complex. Glucose utilization was enhanced at early stages of para-nitrophenol supplementation. However, it was inhibited after the total consumption of para-nitrophenol. The addition of glucose led to a significant enhancement in para-nitrophenol degradation and up-regulation in the expression of genes involved in para-nitrophenol degradation and carbon catabolite repression (CCR). It seemed that para-nitrophenol degradation can be regulated by CCR, and relief of CCR might contribute to enhanced para-nitrophenol degradation. In brief, the regulation of para-nitrophenol degradation seems to be controlled by multiple factors and requires further study. PMID:27191401

  16. Physiological and transcriptomic characterization of a fliA mutant of Pseudomonas putida KT2440.

    PubMed

    Rodríguez-Herva, José Juan; Duque, Estrella; Molina-Henares, María Antonia; Navarro-Avilés, Gloria; Van Dillewijn, Pieter; De La Torre, Jesús; Molina-Henares, Antonio J; La Campa, Ana Sánchez-de; Ran, F Ann; Segura, Ana; Shingler, Victoria; Ramos, Juan-Luis

    2010-06-01

    Pseudomonas putida KT2440 encodes 23 alternative sigma factors. The fliA gene, which encodes σ(28) , is in a cluster with other genes involved in flagella biosynthesis and chemotaxis. Reverse transcriptase-PCR revealed that this cluster is comprised of four independent transcriptional units: flhAF, fleNfliA, cheYZA and cheBmotAB. We generated a nonpolar fliA mutant by homologous recombination and tested its motility, adhesion to biotic and abiotic surfaces, and responses to various stress conditions. The mutant strain was nonmotile and exhibited decreased capacity to bind to corn seeds, although its ability to colonize the rhizosphere of plants was unaffected. The mutant was also affected in binding to abiotic surfaces and its ability to form biofilms decreased by almost threefold. In the fliA mutant background expression of 25 genes was affected: two genes were upregulated and 23 genes were downregulated. In addition to a number of motility and chemotaxis genes, the fliA gene product is also necessary for the expression of some genes potentially involved in amino acid utilization or stress responses; however, we were unable to assign specific phenotypes linked to these genes since the fliA mutant used the same range of amino acids as the parental strain, and was as tolerant as the wild type to stress imposed by heat, antibiotics, NaCl, sodium dodecyl sulfate, H2 O2 and benzoate. Based on the sequence alignment of promoters recognized by FliA and genome in silico analysis, we propose that P. putidaσ(28) recognizes a TCAAG-t-N12 -GCCGATA consensus sequence located between -34 and -8 and that this sequence is preferentially associated with an AT-rich upstream region.

  17. Purification and properties of 2-furoyl-coenzyme A hydroxylase from Pseudomonas putida F2

    PubMed Central

    Kitcher, J. P.; Trudgill, P. W.; Rees, J. S.

    1972-01-01

    1. 2-Furoyl-CoA hydroxylase of Pseudomonas putida F2 has been purified 60-fold by a combination of (NH4)2SO4 fractionation, DEAE-cellulose chromatography and agarose chromatography. 2. The purified enzyme catalyses the formation of 5-hydroxy-2-furoyl-CoA, which tautomerizes to form 5-oxo-Δ2-dihydro-2-furoyl-CoA. 3. The enzyme has a requirement for an electron acceptor that can be satisfied by a membrane preparation from 2-furoate-grown Ps. putida F2 or by artificial electron acceptors, and so presumably the incorporated oxygen atom is derived from water rather than molecular oxygen. 4. The enzyme is a large protein with a molecular weight of 3.27×106 and is disrupted to form inactive subunits in the presence of 0.2% (w/v) sodium dodecyl sulphate. It has a pH optimum of 8.5–9.5, a Km for 2-furoyl-CoA of 20.2μm and an absorption spectrum with a trough at 265nm and a single peak at 273nm. No absorption peaks are detectable in the visible region of the spectrum. 5. The enzyme is resistant to the effects of a wide range of potential inhibitors, but is inhibited by the copper-chelating agents bathocuproin and cuprizone, though not by sodium diethyldithiocarbamate. 6. Flavins are absent and the iron content does not show a sustained increase during purification. The copper content of the protein increases in close correlation with the increase in specific activity during purification. 7. A catalytic sequence for the hydroxylation of 2-furoyl-CoA by a copper protein is proposed. PMID:4655411

  18. Genetic and phenotypic characterization of the heat shock response in Pseudomonas putida.

    PubMed

    Ito, Fumihiro; Tamiya, Takayuki; Ohtsu, Iwao; Fujimura, Makoto; Fukumori, Fumiyasu

    2014-12-01

    Molecular chaperones function in various important physiological processes. Null mutants of genes for the molecular chaperone ClpB (Hsp104), and those that encode J-domain proteins (DnaJ, CbpA, and DjlA), which may act as Hsp40 co-chaperones of DnaK (Hsp70), were constructed from Pseudomonas putida KT2442 (KT) to elucidate their roles. The KTΔclpB mutant showed the same heat shock response (HSR) as the wild-type, both in terms of heat-shock protein (Hsp) synthesis (other than ClpB) and in hsp gene expression; however, the mutant was quite sensitive to high temperatures and was unable to disaggregate into thermo-mediated protein aggregates, indicating that ClpB is important for cell survival after heat stress and essential for solubilization of protein aggregates. On the other hand, the KTΔdnaJ mutant was temperature-sensitive, and formed more protein aggregates (especially of high molecular weight) upon heat stress than did KT. P. putida CbpA, a probable Hsp, partially substituted the functions of DnaJ in cell growth and solubilization of thermo-mediated protein aggregates, and might be involved in the HSR which was regulated by a fine-tuning system(s) that could sense subtle changes in the ambient temperature and control the levels of σ(32) activity and quantity, as well as the mRNA levels of hsp genes. © 2014 The Authors. MicrobiologyOpen published by John Wiley & Sons Ltd.

  19. Proteomics reveals a core molecular response of Pseudomonas putida F1 to acute chromate challenge

    PubMed Central

    2010-01-01

    Background Pseudomonas putida is a model organism for bioremediation because of its remarkable metabolic versatility, extensive biodegradative functions, and ubiquity in contaminated soil environments. To further the understanding of molecular pathways responding to the heavy metal chromium(VI) [Cr(VI)], the proteome of aerobically grown, Cr(VI)-stressed P. putida strain F1 was characterized within the context of two disparate nutritional environments: rich (LB) media and minimal (M9L) media containing lactate as the sole carbon source. Results Growth studies demonstrated that F1 sensitivity to Cr(VI) was impacted substantially by nutrient conditions, with a carbon-source-dependent hierarchy (lactate > glucose >> acetate) observed in minimal media. Two-dimensional HPLC-MS/MS was employed to identify differential proteome profiles generated in response to 1 mM chromate under LB and M9L growth conditions. The immediate response to Cr(VI) in LB-grown cells was up-regulation of proteins involved in inorganic ion transport, secondary metabolite biosynthesis and catabolism, and amino acid metabolism. By contrast, the chromate-responsive proteome derived under defined minimal growth conditions was characterized predominantly by up-regulated proteins related to cell envelope biogenesis, inorganic ion transport, and motility. TonB-dependent siderophore receptors involved in ferric iron acquisition and amino acid adenylation domains characterized up-regulated systems under LB-Cr(VI) conditions, while DNA repair proteins and systems scavenging sulfur from alternative sources (e.g., aliphatic sulfonates) tended to predominate the up-regulated proteome profile obtained under M9L-Cr(VI) conditions. Conclusions Comparative analysis indicated that the core molecular response to chromate, irrespective of the nutritional conditions tested, comprised seven up-regulated proteins belonging to six different functional categories including transcription, inorganic ion transport

  20. Three distinct quinoprotein alcohol dehydrogenases are expressed when Pseudomonas putida is grown on different alcohols.

    PubMed Central

    Toyama, H; Fujii, A; Matsushita, K; Shinagawa, E; Ameyama, M; Adachi, O

    1995-01-01

    A bacterial strain that can utilize several kinds of alcohols as its sole carbon and energy sources was isolated from soil and tentatively identified as Pseudomonas putida HK5. Three distinct dye-linked alcohol dehydrogenases (ADHs), each of which contained the prosthetic group pyrroloquinoline quinone (PQQ), were formed in the soluble fractions of this strain grown on different alcohols. ADH I was formed most abundantly in the cells grown on ethanol and was similar to the quinoprotein ADH reported for P. putida (H. Görisch and M. Rupp, Antonie Leeuwenhoek 56:35-45, 1989) except for its isoelectric point. The other two ADHs, ADH IIB and ADH IIG, were formed separately in the cells grown on 1-butanol and 1,2-propanediol, respectively. Both of these enzymes contained heme c in addition to PQQ and functioned as quinohemoprotein dehydrogenases. Potassium ferricyanide was an available electron acceptor for ADHs IIB and IIG but not for ADH I. The molecular weights were estimated to be 69,000 for ADH IIB and 72,000 for ADH IIG, and both enzymes were shown to be monomers. Antibodies raised against each of the purified ADHs could distinguish the ADHs from one another. Immunoblot analysis showed that ADH I was detected in cells grown on each alcohol tested, but ethanol was the most effective inducer. ADH IIB was formed in the cells grown on alcohols of medium chain length and also on 1,3-butanediol. Induction of ADH IIG was restricted to 1,2-propanediol or glycerol, of which the former alcohol was more effective. These results from immunoblot analysis correlated well with the substrate specificities of the respective enzymes. Thus, three distinct quinoprotein ADHs were shown to be synthesized by a single bacterium under different growth conditions. PMID:7730276

  1. The T7-Related Pseudomonas putida Phage ϕ15 Displays Virion-Associated Biofilm Degradation Properties

    PubMed Central

    Cornelissen, Anneleen; Ceyssens, Pieter-Jan; T'Syen, Jeroen; Van Praet, Helena; Noben, Jean-Paul; Shaburova, Olga V.; Krylov, Victor N.; Volckaert, Guido; Lavigne, Rob

    2011-01-01

    Formation of a protected biofilm environment is recognized as one of the major causes of the increasing antibiotic resistance development and emphasizes the need to develop alternative antibacterial strategies, like phage therapy. This study investigates the in vitro degradation of single-species Pseudomonas putida biofilms, PpG1 and RD5PR2, by the novel phage ϕ15, a ‘T7-like virus’ with a virion-associated exopolysaccharide (EPS) depolymerase. Phage ϕ15 forms plaques surrounded by growing opaque halo zones, indicative for EPS degradation, on seven out of 53 P. putida strains. The absence of haloes on infection resistant strains suggests that the EPS probably act as a primary bacterial receptor for phage infection. Independent of bacterial strain or biofilm age, a time and dose dependent response of ϕ15-mediated biofilm degradation was observed with generally a maximum biofilm degradation 8 h after addition of the higher phage doses (104 and 106 pfu) and resistance development after 24 h. Biofilm age, an in vivo very variable parameter, reduced markedly phage-mediated degradation of PpG1 biofilms, while degradation of RD5PR2 biofilms and ϕ15 amplification were unaffected. Killing of the planktonic culture occurred in parallel with but was always more pronounced than biofilm degradation, accentuating the need for evaluating phages for therapeutic purposes in biofilm conditions. EPS degrading activity of recombinantly expressed viral tail spike was confirmed by capsule staining. These data suggests that the addition of high initial titers of specifically selected phages with a proper EPS depolymerase are crucial criteria in the development of phage therapy. PMID:21526174

  2. Active monomeric and dimeric forms of Pseudomonas putida glyoxalase I: evidence for 3D domain swapping.

    PubMed

    Saint-Jean, A P; Phillips, K R; Creighton, D J; Stone, M J

    1998-07-21

    3D domain swapping of proteins involves the interconversion of a monomer containing a single domain-domain interface and a 2-fold symmetrical dimer containing two equivalent intermolecular interfaces. Human glyoxalase I has the structure of a domain-swapped dimer [Cameron, A. D., Olin, B., Ridderström, M., Mannervik, B., and Jones, T. A. (1997) EMBO J. 16, 3386-3395] but Pseudomonas putida glyoxalase I has been reported to be monomeric [Rhee, H.-I., Murata, K., and Kimura, A. (1986) Biochem. Biophys. Res. Commun. 141, 993-999]. We show here that recombinant P. putida glyoxalase I is an active dimer (kcat approximately 500 +/- 100 s-1; KM approximately 0.4 +/- 0.2 mM) with two zinc ions per dimer. The zinc is required for structure and function. However, treatment of the dimer with glutathione yields an active monomer (kcat approximately 115 +/- 40 s-1; KM approximately 1.4 +/- 0.4 mM) containing a single zinc ion. The monomer is metastable and slowly reverts to the active dimer in the absence of glutathione. Thus, glyoxalase I appears to be a novel example of a single protein able to exist in two alternative domain-swapped forms. It is unique among domain-swapped proteins in that the active site and an essential metal binding site are apparently disassembled and reassembled by the process of domain swapping. Furthermore, it is the only example to date in which 3D domain swapping can be regulated by a small organic ligand.

  3. Potential of Pseudomonas putida PCI2 for the Protection of Tomato Plants Against Fungal Pathogens.

    PubMed

    Pastor, Nicolás; Masciarelli, Oscar; Fischer, Sonia; Luna, Virginia; Rovera, Marisa

    2016-09-01

    Tomato is one of the most economically attractive vegetable crops due to its high yields. Diseases cause significant losses in tomato production worldwide. We carried out Polymerase Chain Reaction studies to detect the presence of genes encoding antifungal compounds in the DNA of Pseudomonas putida strain PCI2. We also used liquid chromatography-electrospray tandem mass spectrometry to detect and quantify the production of compounds that increase the resistance of plants to diseases from culture supernatants of PCI2. In addition, we investigated the presence of 1-aminocyclopropane-1-carboxylic acid (ACC) deaminase in PCI2. Finally, PCI2 was used for inoculation of tomato seeds to study its potential biocontrol activity against Fusarium oxysporum MR193. The obtained results showed that no fragments for the encoding genes of hydrogen cyanide, pyoluteorin, 2,4-diacetylphloroglucinol, pyrrolnitrin, or phenazine-1-carboxylic acid were amplified from the DNA of PCI2. On the other hand, PCI2 produced salicylic acid and jasmonic acid in Luria-Bertani medium and grew in a culture medium containing ACC as the sole nitrogen source. We observed a reduction in disease incidence from 53.33 % in the pathogen control to 30 % in tomato plants pre-inoculated with PCI2 as well as increases in shoot and root dry weights in inoculated plants, as compared to the pathogenicity control. This study suggests that inoculation of tomato seeds with P. putida PCI2 increases the resistance of plants to root rot caused by F. oxysporum and that PCI2 produces compounds that may be involved at different levels in increasing such resistance. Thus, PCI2 could represent a non-contaminating management strategy potentially applicable in vegetable crops such as tomato.

  4. Metabolic and Regulatory Rearrangements Underlying Efficient d-Xylose Utilization in Engineered Pseudomonas putida S12*

    PubMed Central

    Meijnen, Jean-Paul; de Winde, Johannes H.; Ruijssenaars, Harald J.

    2012-01-01

    Previously, an efficient d-xylose utilizing Pseudomonas putida S12 strain was obtained by introducing the d-xylose isomerase pathway from Escherichia coli, followed by evolutionary selection. In the present study, systemic changes associated with the evolved phenotype were identified by transcriptomics, enzyme activity analysis, and inverse engineering. A key element in improving the initially poor d-xylose utilization was the redistribution of 6-phospho-d-gluconate (6-PG) between the Entner-Doudoroff pathway and the oxidative pentose phosphate (PP) pathway. This redistribution increased the availability of 6-PG for oxidative decarboxylation to d-ribose-5-phosphate, which is essential for the utilization of d-xylose via the nonoxidative PP pathway. The metabolic redistribution of 6-PG was procured by modified HexR regulation, which in addition appeared to control periplasmic sugar oxidation. Because the absence of periplasmic d-xylonate formation was previously demonstrated to be essential for achieving a high biomass yield on d-xylose, the aberrant HexR control appeared to underlie both the improved growth rate and biomass yield of the evolved d-xylose utilizing P. putida strain. The increased oxidative PP pathway activity furthermore resulted in an elevated NADH/NAD+ ratio that caused the metabolic flux to be redirected from the TCA cycle to the glyoxylate shunt, which was also activated transcriptionally. Clearly, these findings may serve as an important case in point to engineer and improve the utilization of non-natural carbon sources in a wide range of industrial microorganisms. PMID:22416130

  5. Regulatory tasks of the phosphoenolpyruvate-phosphotransferase system of Pseudomonas putida in central carbon metabolism.

    PubMed

    Chavarría, Max; Kleijn, Roelco J; Sauer, Uwe; Pflüger-Grau, Katharina; de Lorenzo, Víctor

    2012-01-01

    Two branches of the phosphoenolpyruvate-phosphotransferase system (PTS) operate in the soil bacterium Pseudomonas putida KT2440. One branch encompasses a complete set of enzymes for fructose intake (PTS(Fru)), while the other (N-related PTS, or PTS(Ntr)) controls various cellular functions unrelated to the transport of carbohydrates. The potential of these two systems for regulating central carbon catabolism has been investigated by measuring the metabolic fluxes of isogenic strains bearing nonpolar mutations in PTS(Fru) or PTS(Ntr) genes and grown on either fructose (a PTS substrate) or glucose, the transport of which is not governed by the PTS in this bacterium. The flow of carbon from each sugar was distinctly split between the Entner-Doudoroff, pentose phosphate, and Embden-Meyerhof-Parnas pathways in a ratio that was maintained in each of the PTS mutants examined. However, strains lacking PtsN (EIIA(Ntr)) displayed significantly higher fluxes in the reactions of the pyruvate shunt, which bypasses malate dehydrogenase in the TCA cycle. This was consistent with the increased activity of the malic enzyme and the pyruvate carboxylase found in the corresponding PTS mutants. Genetic evidence suggested that such a metabolic effect of PtsN required the transfer of high-energy phosphate through the system. The EIIA(Ntr) protein of the PTS(Ntr) thus helps adjust central metabolic fluxes to satisfy the anabolic and energetic demands of the overall cell physiology. This study demonstrates that EIIA(Ntr) influences the biochemical reactions that deliver carbon between the upper and lower central metabolic domains for the consumption of sugars by P. putida. These findings indicate that the EIIA(Ntr) protein is a key player for orchestrating the fate of carbon in various physiological destinations in this bacterium. Additionally, these results highlight the importance of the posttranslational regulation of extant enzymatic complexes for increasing the robustness of the

  6. Structures and characteristics of novel siderophores from plant deleterious Pseudomonas fluorescens A225 and Pseudomonas putida ATCC 39167.

    PubMed

    Khalil-Rizvi, S; Toth, S I; van der Helm, D; Vidavsky, I; Gross, M L

    1997-04-08

    When Pseudomonas putida ATCC 39167 and plant-deleterious Pseudomonas fluorescens A225 were grown in an iron-deficient culture medium, they each produced two different novel yellow-green fluorescent pseudobactins: P39167-I, II and PA225-I, II. Pseudobactin P39167-I has a molecular formula of C46H65O23N13 and is monoanionic at neutral pH. P39167-II has the molecular formula of C46H63O22N13 and no charge at neutral pH. Pseudobactin PA225-I has a molecular formula of C46H65O24N13 and is monoanionic at neutral pH whereas pseudobactin PA225-II has the molecular formula of C46H63O23N13 and no charge at neutral pH. All four of the pseudobactins contain a dihydroxyquinoline-based chromophore. The amino acid sequence for the octapeptide in case of pseudobactins from P. putida ATCC 39167 is Chr-Ser(1)-Ala(1)-AcOHOrn-Gly-Ala(2)-OHAsp-Ser(2)-Thr. In case of pseudobactins from P. fluorescens A225, the octapeptide has the sequence Chr-Ser(1)-Ala-AcOHOrn-Gly-Ser(2)-OHAsp-Ser(3)-Thr. For all four pseudobactins (P39167-I, II and PA225-I, II), the serine(1) residue of the octapeptide is attached to the carboxylic acid group on the C-11 of the fluorescent quinoline via an amide bond. Additionally, for pseudobactin P39167-II and PA225-II, the hydroxyl group of the serine(1) residue is also attached to the carboxyl group of threonine residue at the carboxy terminus of the peptide via an ester bond, resulting in a cyclic depsipeptide in contrast to the linear peptide chain of P39167-I and PA225-I. For all four pseudobactins, a malamide group is attached to the C-3 of the quinoline derived chromophore. The three bidentate iron(III) chelating groups in all four pseudobactins consist of a 1,2-dihydroxy aromatic group of the fluorescent chromophore, a hydroxy acid group of beta-hydroxy aspartic acid, and a hydroxamate group from the acylated Ndelta-hydroxyornithine. The amino acid constituents of the pseudobactins P39167 I, II are the same as those in pseudobactin A214, whereas those in A225

  7. The glycerophospholipid inventory of Pseudomonas putida is conserved between strains and enables growth condition‐related alterations

    PubMed Central

    Rühl, Jana; Hein, Eva‐Maria; Hayen, Heiko; Schmid, Andreas; Blank, Lars M.

    2012-01-01

    Summary Microorganisms, such as Pseudomonas putida, utilize specific physical properties of cellular membrane constituents, mainly glycerophospholipids, to (re‐)adjust the membrane barrier to environmental stresses. Building a basis for membrane composition/function studies, we inventoried the glycerophospholipids of different Pseudomonas and challenged membranes of growing cells with n‐butanol. Using a new high‐resolution liquid chromatography/mass spectrometry (LC/MS) method, 127 glycerophospholipid species [e.g. phosphatidylethanolamine PE(32:1)] with up to five fatty acid combinations were detected. The glycerophospholipid inventory consists of 305 distinct glycerophospholipids [e.g. PE(16:0/16:1)], thereof 14 lyso‐glycerophospholipids, revealing conserved compositions within the four investigated pseudomonads P. putida KT2440, DOT‐T1E, S12 and Pseudomonas sp. strain VLB120. Furthermore, we addressed the influence of environmental conditions on the glycerophospholipid composition of Pseudomonas via long‐time exposure to the sublethal n‐butanol concentration of 1% (v/v), focusing on: (i) relative amounts of glycerophospholipid species, (ii) glycerophospholipid head group composition, (iii) fatty acid chain length, (iv) degree of saturation and (v) cis/trans isomerization of unsaturated fatty acids. Observed alterations consist of changing head group compositions and for the solvent‐sensitive strain KT2440 diminished fatty acid saturation degrees. Minor changes in the glycerophospholipid composition of the solvent‐tolerant strains P. putida S12 and Pseudomonas sp. VLB120 suggest different strategies of the investigated Pseudomonas to maintain the barrier function of cellular membranes. PMID:21895997

  8. Decolorization of industrial synthetic dyes using engineered Pseudomonas putida cells with surface-immobilized bacterial laccase

    PubMed Central

    2012-01-01

    Background Microbial laccases are highly useful in textile effluent dye biodegradation. However, the bioavailability of cellularly expressed or purified laccases in continuous operations is usually limited by mass transfer impediment or enzyme regeneration difficulty. Therefore, this study develops a regenerable bacterial surface-displaying system for industrial synthetic dye decolorization, and evaluates its effects on independent and continuous operations. Results A bacterial laccase (WlacD) was engineered onto the cell surface of the solvent-tolerant bacterium Pseudomonas putida to construct a whole-cell biocatalyst. Ice nucleation protein (InaQ) anchor was employed, and the ability of 1 to 3 tandemly aligned N-terminal repeats to direct WlacD display were compared. Immobilized WlacD was determined to be surface-displayed in functional form using Western blot analysis, immunofluorescence microscopy, flow cytometry, and whole-cell enzymatic activity assay. Engineered P. putida cells were then applied to decolorize the anthraquinone dye Acid Green (AG) 25 and diazo-dye Acid Red (AR) 18. The results showed that decolorization of both dyes is Cu2+- and mediator-independent, with an optimum temperature of 35°C and pH of 3.0, and can be stably performed across a temperature range of 15°C to 45°C. A high activity toward AG25 (1 g/l) with relative decolorization values of 91.2% (3 h) and 97.1% (18 h), as well as high activity to AR18 (1 g/l) by 80.5% (3 h) and 89.0% (18 h), was recorded. The engineered system exhibited a comparably high activity compared with those of separate dyes in a continuous three-round shake-flask decolorization of AG25/AR18 mixed dye (each 1 g/l). No significant decline in decolorization efficacy was noted during first two-rounds but reaction equilibriums were elongated, and the residual laccase activity eventually decreased to low levels. However, the decolorizing capacity of the system was easily retrieved via a subsequent 4-h

  9. Decolorization of industrial synthetic dyes using engineered Pseudomonas putida cells with surface-immobilized bacterial laccase.

    PubMed

    Wang, Wei; Zhang, Zhen; Ni, Hong; Yang, Xiaomeng; Li, Qianqian; Li, Lin

    2012-06-11

    Microbial laccases are highly useful in textile effluent dye biodegradation. However, the bioavailability of cellularly expressed or purified laccases in continuous operations is usually limited by mass transfer impediment or enzyme regeneration difficulty. Therefore, this study develops a regenerable bacterial surface-displaying system for industrial synthetic dye decolorization, and evaluates its effects on independent and continuous operations. A bacterial laccase (WlacD) was engineered onto the cell surface of the solvent-tolerant bacterium Pseudomonas putida to construct a whole-cell biocatalyst. Ice nucleation protein (InaQ) anchor was employed, and the ability of 1 to 3 tandemly aligned N-terminal repeats to direct WlacD display were compared. Immobilized WlacD was determined to be surface-displayed in functional form using Western blot analysis, immunofluorescence microscopy, flow cytometry, and whole-cell enzymatic activity assay. Engineered P. putida cells were then applied to decolorize the anthraquinone dye Acid Green (AG) 25 and diazo-dye Acid Red (AR) 18. The results showed that decolorization of both dyes is Cu(2+)- and mediator-independent, with an optimum temperature of 35°C and pH of 3.0, and can be stably performed across a temperature range of 15°C to 45°C. A high activity toward AG25 (1 g/l) with relative decolorization values of 91.2% (3 h) and 97.1% (18 h), as well as high activity to AR18 (1 g/l) by 80.5% (3 h) and 89.0% (18 h), was recorded. The engineered system exhibited a comparably high activity compared with those of separate dyes in a continuous three-round shake-flask decolorization of AG25/AR18 mixed dye (each 1 g/l). No significant decline in decolorization efficacy was noted during first two-rounds but reaction equilibriums were elongated, and the residual laccase activity eventually decreased to low levels. However, the decolorizing capacity of the system was easily retrieved via a subsequent 4-h cell culturing

  10. Effects of Cobalt on Manganese Oxidation by Pseudomonas putida MnB1

    NASA Astrophysics Data System (ADS)

    Pena, J.; Bargar, J.; Sposito, G.

    2005-12-01

    The oxidation of Mn(II) in the environment is thought to occur predominantly through biologically mediated pathways. During the stationary phase of growth, the well-characterized freshwater and soil bacterium Pseudomonas putida MnB1 oxidizes soluble Mn(II) to a poorly crystalline layer type Mn(IV) oxide. These Mn oxide particles (2 - 5 nm thickness) are deposited in a matrix of extracellular polymeric substances (EPS) surrounding the cell, creating a multi-component system distinct from commonly studied synthetic Mn oxides. Accurate characterization of the reactivity of these biomineral assemblages is essential to understanding trace metal biogeochemistry in natural waters and sediments. Moreover, these biogenic oxides may potentially be used for the remediation of surface and ground waters impacted by mining, industrial pollution, and other anthropogenic activities. In this study, we consider the interactions between Co, P. putida MnB1, and its biogenic Mn oxide. Cobalt is a redox-active transition metal which exists in the environment as Co(II) and Co(III). While Co is not generally found in the environment at toxic concentrations, it may be released as a byproduct of mining activities (e.g. levels of up to 20 μM are found in Pinal Creek, AZ, a stream affected by copper mining). In addition, the radionuclide 60Co, formed by neutron activation in nuclear reactors, is of concern at Department of Energy sites, such as that at Hanford, and has several industrial applications, including radiotherapy. We address the following questions: Do high levels of Co inhibit enzymatic processes such as Mn(II) oxidation? Can the multicopper oxidase enzyme involved in Mn(II) oxidation facilitate Co(II) oxidation? Lastly, does the organic matter surrounding the oxides affect Co or Mn oxide reactivity? These issues were approached via wet chemical analysis, synchrotron radiation X-ray diffraction (SR-XRD), and extended X-ray absorption fine structure (EXAFS) spectroscopy. In the

  11. Comparative proteomic analysis reveals mechanistic insights into Pseudomonas putida F1 growth on benzoate and citrate

    PubMed Central

    2013-01-01

    Pseudomonas species are capable to proliferate under diverse environmental conditions and thus have a significant bioremediation potential. To enhance our understanding of their metabolic versatility, this study explores the changes in the proteome and physiology of Pseudomonas putida F1 resulting from its growth on benzoate, a moderate toxic compound that can be catabolized, and citrate, a carbon source that is assimilated through central metabolic pathways. A series of repetitive batch cultivations were performed to ensure a complete adaptation of the bacteria to each of these contrasting carbon sources. After several growth cycles, cell growth stabilized at the maximum level and exhibited a reproducible growth profile. The specific growth rates measured for benzoate (1.01 ± 0.11 h-1) and citrate (1.11 ± 0.12 h-1) were similar, while a higher yield was observed for benzoate (0.6 and 0.3 g cell mass per g of benzoate and citrate, respectively), reflecting the different degrees of carbon reduction in the two substrates. Comparative proteomic analysis revealed an enrichment of several oxygenases/dehydrogenases in benzoate-grown cells, indicative of the higher carbon reduction of benzoate. Moreover, the upregulation of all 14 proteins implicated in benzoate degradation via the catechol ortho-cleavage pathway was observed, while several stress-response proteins were increased to aid cells to cope with benzoate toxicity. Unexpectedly, citrate posed more challenges than benzoate in the maintenance of pH homeostasis, as indicated by the enhancement of the Na+/H+ antiporter and carbonic anhydrase. The study provides important mechanistic insights into Pseudomonas adaptation to varying carbon sources that are of great relevance to bioremediation efforts. PMID:24156539

  12. Cloning and high-level expression of the glutathione-independent formaldehyde dehydrogenase gene from Pseudomonas putida.

    PubMed Central

    Ito, K; Takahashi, M; Yoshimoto, T; Tsuru, D

    1994-01-01

    A DNA fragment of 485 bp was specifically amplified by PCR with primers based on the N-terminal sequence of the purified formaldehyde dehydrogenase (EC 1.2.1.46) from Pseudomonas putida and on that of a cyanogen bromide-derived peptide. With this product as a probe, a gene coding for formaldehyde dehydrogenase (fdhA) in P. putida chromosomal DNA was cloned in Escherichia coli DH5 alpha. Sequencing analysis revealed that the fdhA gene contained 1,197-bp open reading frame, encoding a protein composed of 399 amino acid residues whose calculated molecular weight was 42,082. The transformant of E. coli DH5 alpha harboring the hybrid plasmid, pFDHK3DN71, showed about 50-fold-higher formaldehyde dehydrogenase activity than P. putida. The predicted amino acid sequence contained several features characteristic of the zinc-containing medium-chain alcohol dehydrogenase (ADH) family. Most of the glycine residues strictly conserved within the family, including a Gly-Xaa-Gly-Xaa-Xaa-Gly pattern in the coenzyme binding domain, were well conserved in this enzyme. Regions around both the catalytic and the structural zinc atoms were also conserved. Analyses of structural and enzymatic characteristics indicated that P. putida FDH belongs to the medium-chain ADH family, with mixed properties of mammalian class I and III ADHs. Images PMID:8169197

  13. Engineering Pseudomonas putida KT2440 for simultaneous degradation of organophosphates and pyrethroids and its application in bioremediation of soil.

    PubMed

    Zuo, Zhenqiang; Gong, Ting; Che, You; Liu, Ruihua; Xu, Ping; Jiang, Hong; Qiao, Chuanling; Song, Cunjiang; Yang, Chao

    2015-06-01

    Agricultural soils are usually co-contaminated with organophosphate (OP) and pyrethroid pesticides. To develop a stable and marker-free Pseudomonas putida for co-expression of two pesticide-degrading enzymes, we constructed a suicide plasmid with expression cassettes containing a constitutive promoter J23119, an OP-degrading gene (mpd), a pyrethroid-hydrolyzing carboxylesterase gene (pytH) that utilizes the upp gene as a counter-selectable marker for upp-deficient P. putida. By introduction of suicide plasmid and two-step homologous recombination, both mpd and pytH genes were integrated into the chromosome of a robust soil bacterium P. putida KT2440 and no selection marker was left on chromosome. Functional expression of mpd and pytH in P. putida KT2440 was demonstrated by Western blot analysis and enzyme activity assays. Degradation experiments with liquid cultures showed that the mixed pesticides including methyl parathion, fenitrothion, chlorpyrifos, permethrin, fenpropathrin, and cypermethrin (0.2 mM each) were degraded completely within 48 h. The inoculation of engineered strain (10(6) cells/g) to soils treated with the above mixed pesticides resulted in a higher degradation rate than in noninoculated soils. All six pesticides could be degraded completely within 15 days in fumigated and nonfumigated soils with inoculation. Theses results highlight the potential of the engineered strain to be used for in situ bioremediation of soils co-contaminated with OP and pyrethroid pesticides.

  14. [Stability of the NPL-1 and NPL-41 plasmids of naphthalene biodegradation in Pseudomonas putida populations in continuous culture].

    PubMed

    Boronin, A M; Filonov, A E; Balakshina, V V; Kulakova, A N

    1985-01-01

    The stability of biodegradation plasmids NPL-1 and NPL-41, which control the synthesis of enzymes for naphthalene oxidation to salicylate, was studied in Pseudomonas putida BSA under the conditions of its continuous cultivation with limitation in glucose or salicylate in the chemostat regime and without limitation in the pH-stat regime. Plasmid NPL-1, which controls the inducible synthesis of naphthalene oxygenase, is stable in the population of P. putida cells under the conditions of continuous cultivation on glucose, but is not stable in the course of cultivation on salicylate, an inductor of the naphthalene oxygenase synthesis. Plasmid NPL-41, which controls the constitutive synthesis of naphthalene oxygenase, is not stable in the population of P. putida cells under the conditions of continuous cultivation on glucose. The operation of genes, which control the oxidation of naphthalene to salicylate (nah), makes plasmids NPL-1 and NPL-41 unstable under the conditions of continuous cultivation in the absence of naphthalene from the medium, i.e. under the conditions when the expression of these genes is not necessary. In that case, cells containing plasmids with a deletion of nah-genes as well as cells without plasmids appear in the population of P. putida, which causes a decline in its futile energy and metabolic processes.

  15. Pseudomonas putida KT2442 as a platform for the biosynthesis of polyhydroxyalkanoates with adjustable monomer contents and compositions.

    PubMed

    Tripathi, Lakshmi; Wu, Lin-Ping; Dechuan, Meng; Chen, Jinchun; Wu, Qiong; Chen, Guo-Qiang

    2013-08-01

    The β-oxidation weakened Pseudomonas putida were established as a platform for the production of polyhydroxyalkanoates (PHA) with adjustable monomer compositions and micro-structures. When mutant P. putida KTOYO6ΔC (phaPCJA.c) was cultivated on mixtures of sodium butyrate and sodium hexanoate (C4:C6), random copolymers of P(3HB-co-3HHx) consisting of 3-hydroxybutyrate (3HB), 3-hydroxyhexanoate (3HHx), were accumulated with 3HHx content ranged from 19 mol% to 75 mol%. While recombinant P. putida KTQQ20 grown on mixtures of sodium hexanoate and decanoic acid (C6:C10), produced random copolymers of P(3HHx-co-3HD) consisting of 3-hydroxyhexanoate (3HHx) and 3-hydroxydecanoate (3HD), the monomer fraction of 3HHx ranged from 16 mol% to 63 mol%. The comonomer compositions were easily regulated by varying the fatty acid concentrations. P. putida KTQQ20 produced a novel diblock copolymer P3HHx-b-P(3HD-co-3HDD) consisting of 49 mol% P3HHx and 51 mol% P(3HD-co-3HDD) [35.25 mol% 3HDD (3-hydroxydodecanoate)], which was characterized by (13)C NMR, HMBC NMR, DSC, GPC and universal testing machine. Copyright © 2013 Elsevier Ltd. All rights reserved.

  16. Microbial dechlorination of chloroorganics and simultaneous decolorization of pulp-paper mill effluent by Pseudomonas putida MTCC 10510 augmentation.

    PubMed

    Garg, Satyendra Kumar; Tripathi, Manikant; Kumar, Shailendra; Singh, Santosh Kumar; Singh, Sanjay Kumar

    2012-09-01

    The physicochemical analyses of pulp-paper mill effluent revealed that it was dark brown with 1761 ± 2.3 color PtCo units having slightly alkaline pH, high biological oxygen demand and chemical oxygen demand values, and contained large quantities of organic and inorganic constituents, well above the prescribed standards. The bacterial growth, color reduction, and dechlorination were evident in all the four sets of experiments with different possible combinations of nutrient supplementation and Pseudomonas putida augmentation. A high degree of decolorization at 29.7% and 27.4% was observed by the effluent native microflora during 48 and 24 h, in unaugmented effluent supplemented with glucose + yeast extract and glucose + peptone, respectively. The extent of decolorization in glucose + yeast extract unaugmented effluent also corresponded with high degree of dechlorination (59.3%) during 60-h incubation (SET III). An appreciable level of growth, decolorization, and dechlorination was evident in nutrient unsupplemented P. putida augmented effluent as well as in the control natural effluent. However, a maximum level of growth response (OD 1.641-1.902) during 36-48 h, removal of color (39.72-48.2%) during 24-36 h, and chloride ions (80.1-83.5%) during 36 h was achieved in P. putida augmented effluent supplemented with glucose + yeast extract or peptone. Therefore, supplementation of effluent with glucose and yeast extract or peptone and concomitant augmentation with P. putida is required for efficient effluent decolorization and detoxification.

  17. Simultaneous chromium reduction and phenol degradation in a coculture of Escherichia coli ATCC 33456 and Pseudomonas putida DMP-1

    SciTech Connect

    Shen, Hai; Wang, Yi-Tin

    1995-07-01

    In a defined coculture of a Cr(VI) reducer, Escherichia coli ATCC 33456, and a phenol degrader, Pseudomonas putida DMP-1, simultaneous reduction of Cr(VI) and degradation of phenol was observed. When Cr(VI) was present in the coculture, quantitative transformation of Cr(VI) into Cr(III) proceeded with simultaneous degradation of phenol. Cr(VI) reduction was correlated to phenol degradation in the coculture as demonstrated by a regression analysis of the cumulative Cr(VI) reduction and the cumulative phenol degradation. Both the rate and extent of Cr(VI) reduction and phenol degradation were significantly influenced by the population composition of the coculture. Although Cr(VI) reduction occurred as a result of E. coli metabolism, the rate of phenol degradation by P. putida may become a rate-limiting factor for Cr(VI) reduction at a low population ratio of P. putida to E. coli. Phenol degradation by P. putida was very susceptible to the presence of Cr(VI), whereas Cr(VI) reduction by E. coli was significantly influenced by phenol only when phenol was present at high concentrations (>9 mM). 32 refs., 7 figs., 1 tab.

  18. Effect of Organic Solvents on the Yield of Solvent-Tolerant Pseudomonas putida S12

    PubMed Central

    Isken, Sonja; Derks, Antoine; Wolffs, Petra F. G.; de Bont, Jan A. M.

    1999-01-01

    Solvent-tolerant microorganisms are useful in biotransformations with whole cells in two-phase solvent-water systems. The results presented here describe the effects that organic solvents have on the growth of these organisms. The maximal growth rate of Pseudomonas putida S12, 0.8 h−1, was not affected by toluene in batch cultures, but in chemostat cultures the solvent decreased the maximal growth rate by nearly 50%. Toluene, ethylbenzene, propylbenzene, xylene, hexane, and cyclohexane reduced the biomass yield, and this effect depended on the concentration of the solvent in the bacterial membrane and not on its chemical structure. The dose response to solvents in terms of yield was linear up to an approximately 200 mM concentration of solvent in the bacterial membrane, both in the wild type and in a mutant lacking an active efflux system for toluene. Above this critical concentration the yield of the wild type remained constant at 0.2 g of protein/g of glucose with increasing concentrations of toluene. The reduction of the yield in the presence of solvents is due to a maintenance higher by a factor of three or four as well as to a decrease of the maximum growth yield by 33%. Therefore, energy-consuming adaptation processes as well as the uncoupling effect of the solvents reduce the yield of the tolerant cells. PMID:10347053

  19. Use of response surface method for maximizing the production of arginine deiminase by Pseudomonas putida.

    PubMed

    Patil, Mahesh D; Shinde, Kiran D; Patel, Gopal; Chisti, Yusuf; Banerjee, Uttam Chand

    2016-06-01

    Statistically designed experiments were used to optimize the production of arginine deiminase (ADI) by Pseudomonas putida KT2440 in batch culture. A Plackett-Burman design involving eleven factors showed that ADI production was most influenced by the initial pH and the initial concentrations of glucose and yeast extract. A central composite experimental design showed that the optimal values of these factors were 8.0, 10 g/L and 12.5 g/L, respectively. The other components of the optimal culture medium were bacto peptone 7.5 g/L, Triton X-100 0.30% (v/v), and arginine 3 g/L, for a culture temperature of 25 °C. Compared with the basal medium, the ADI activity in the optimized medium had nearly 4.5-fold increase (4.31 U/mL). The optimized medium was then used for a further study of ADI production in a 14 L stirred tank bioreactor. The agitation speed and the aeration rates were varied to determine suitable values of these variables.

  20. Synergistic effect of Pseudomonas putida and Bacillus amyloliquefaciens ameliorates drought stress in chickpea (Cicer arietinum L.)

    PubMed Central

    Kumar, Manoj; Mishra, Sankalp; Dixit, Vijaykant; Kumar, Manoj; Agarwal, Lalit; Chauhan, Puneet Singh; Nautiyal, Chandra Shekhar

    2016-01-01

    Two plant growth promoting rhizobacteria (PGPR) Pseudomonas putida NBRIRA and Bacillus amyloliquefaciens NBRISN13 with ability to tolerate abiotic stress along with multiple PGP traits like ACC deaminase activity, minerals solubilisation, hormones production, biofilm formation, siderophore activity were evaluated for their synergistic effect to ameliorate drought stress in chickpea. Earlier we have reported both the strains individually for their PGP attributes and stress amelioration in host plants. The present study explains in detail the possibilities and benefits of utilizing these 2 PGPR in consortium for improving the chickpea growth under control and drought stressed condition. In vitro results clearly demonstrate that both the PGPR strains are compatible to each other and their synergistic growth enhances the PGP attributes. Greenhouse experiments were conducted to evaluate the effect of inoculation of both strains individually and consortia in drought tolerant and sensitive cultivars (BG362 and P1003). The growth parameters were observed significantly higher in consortium as compared to individual PGPR. Colonization of both PGPR in chickpea rhizosphere has been visualized by using gfp labeling. Apart from growth parameters, defense enzymes, soil enzymes and microbial diversity were significantly modulated in individually PGPR and in consortia inoculated plants. Negative effects of drought stress has been ameliorated and apparently seen by higher biomass and reversal of stress indicators in chickpea cultivars treated with PGPR individually or in consortia. Findings from the present study demonstrate that synergistic application has better potential to improve plant growth promotion under drought stress conditions. PMID:26362119

  1. Synergistic effect of Pseudomonas putida and Bacillus amyloliquefaciens ameliorates drought stress in chickpea (Cicer arietinum L.).

    PubMed

    Kumar, Manoj; Mishra, Sankalp; Dixit, Vijaykant; Kumar, Manoj; Agarwal, Lalit; Chauhan, Puneet Singh; Nautiyal, Chandra Shekhar

    2016-01-01

    Two plant growth promoting rhizobacteria (PGPR) Pseudomonas putida NBRIRA and Bacillus amyloliquefaciens NBRISN13 with ability to tolerate abiotic stress along with multiple PGP traits like ACC deaminase activity, minerals solubilisation, hormones production, biofilm formation, siderophore activity were evaluated for their synergistic effect to ameliorate drought stress in chickpea. Earlier we have reported both the strains individually for their PGP attributes and stress amelioration in host plants. The present study explains in detail the possibilities and benefits of utilizing these 2 PGPR in consortium for improving the chickpea growth under control and drought stressed condition. In vitro results clearly demonstrate that both the PGPR strains are compatible to each other and their synergistic growth enhances the PGP attributes. Greenhouse experiments were conducted to evaluate the effect of inoculation of both strains individually and consortia in drought tolerant and sensitive cultivars (BG362 and P1003). The growth parameters were observed significantly higher in consortium as compared to individual PGPR. Colonization of both PGPR in chickpea rhizosphere has been visualized by using gfp labeling. Apart from growth parameters, defense enzymes, soil enzymes and microbial diversity were significantly modulated in individually PGPR and in consortia inoculated plants. Negative effects of drought stress has been ameliorated and apparently seen by higher biomass and reversal of stress indicators in chickpea cultivars treated with PGPR individually or in consortia. Findings from the present study demonstrate that synergistic application has better potential to improve plant growth promotion under drought stress conditions.

  2. Less is more: reduced catechol production permits Pseudomonas putida F1 to grow on styrene.

    PubMed

    George, Kevin W; Hay, Anthony

    2012-11-01

    Pseudomonas putida F1 is unable to grow on styrene due to the accumulation of 3-vinylcatechol, a toxic metabolite that is produced through the toluene degradation (tod) pathway and causes catechol-2,3-dioxygenase (C23O) inactivation. In this study, we characterized a spontaneous F1 mutant, designated SF1, which acquired the ability to grow on styrene and did not accumulate 3-vinylcatechol. Whereas adaptation to new aromatic substrates has typically been shown to involve increased C23O activity or the acquisition of resistance to C23O inactivation, SF1 retained wild-type C23O activity. Surprisingly, SF1 grew more slowly on toluene, its native substrate, and exhibited reduced toluene dioxygenase (TDO) activity (approximately 50 % of that of F1), the enzyme responsible for ring hydroxylation and subsequent production of 3-vinylcatechol. DNA sequence analysis of the tod operon of SF1 revealed a single base pair mutation in todA (C479T), a gene encoding the reductase component of TDO. Replacement of the wild-type todA allele in F1 with todA(C479T) reduced TDO activity to SF1 levels, obviated vinylcatechol accumulation, and conferred the ability to grow on styrene. This novel 'less is more' strategy - reduced catechol production as a means to expand growth substrate range - sheds light on an alternative approach for managing catechol toxicity during the metabolism of aromatic compounds.

  3. Electricity Generation and Wastewater Treatment of Oil Refinery in Microbial Fuel Cells Using Pseudomonas putida

    PubMed Central

    Majumder, Dip; Maity, Jyoti Prakash; Tseng, Min-Jen; Nimje, Vanita Roshan; Chen, Hau-Ren; Chen, Chien-Cheng; Chang, Young-Fo; Yang, Tsui-Chu; Chen, Chen-Yen

    2014-01-01

    Microbial fuel cells (MFCs) represent a novel platform for treating wastewater and at the same time generating electricity. Using Pseudomonas putida (BCRC 1059), a wild-type bacterium, we demonstrated that the refinery wastewater could be treated and also generate electric current in an air-cathode chamber over four-batch cycles for 63 cumulative days. Our study indicated that the oil refinery wastewater containing 2213 mg/L (ppm) chemical oxygen demand (COD) could be used as a substrate for electricity generation in the reactor of the MFC. A maximum voltage of 355 mV was obtained with the highest power density of 0.005 mW/cm2 in the third cycle with a maximum current density of 0.015 mA/cm2 in regard to the external resistor of 1000 Ω. A maximum coulombic efficiency of 6 × 10−2% was obtained in the fourth cycle. The removal efficiency of the COD reached 30% as a function of time. Electron transfer mechanism was studied using cyclic voltammetry, which indicated the presence of a soluble electron shuttle in the reactor. Our study demonstrated that oil refinery wastewater could be used as a substrate for electricity generation. PMID:25247576

  4. Environmental stress speeds up DNA replication in Pseudomonas putida in chemostat cultivations.

    PubMed

    Lieder, Sarah; Jahn, Michael; Koepff, Joachim; Müller, Susann; Takors, Ralf

    2016-01-01

    Cellular response to different types of stress is the hallmark of the cell's strategy for survival. How organisms adjust their cell cycle dynamics to compensate for changes in environmental conditions is an important unanswered question in bacterial physiology. A cell using binary fission for reproduction passes through three stages during its cell cycle: a stage from cell birth to initiation of replication, a DNA replication phase and a period of cell division. We present a detailed analysis of durations of cell cycle phases, investigating their dynamics under environmental stress conditions. Applying continuous steady state cultivations (chemostats), the DNA content of a Pseudomonas putida KT2440 population was quantified with flow cytometry at distinct growth rates. Data-driven modeling revealed that under stress conditions, such as oxygen deprivation, solvent exposure and decreased iron availability, DNA replication was accelerated correlated to the severity of the imposed stress (up to 1.9-fold). Cells maintained constant growth rates by balancing the shortened replication phase with extended cell cycle phases before and after replication. Transcriptome data underpin the transcriptional upregulation of crucial genes of the replication machinery. Hence adaption of DNA replication speed appears to be an important strategy to withstand environmental stress.

  5. Examining the fate of released Pseudomonas putida F1 in rhizosphere environments

    SciTech Connect

    Wu, X.; Davis, L.C.; Erickson, L.E.

    1997-12-31

    Bioremediation, especially plant-based bioremediation, is receiving increasing attention because compared to traditional soil and groundwater remediation techniques, it is rapid, safe, and cost-effective. A soil microcosm study was conducted to see the fate of released bacterial strain Pseudomonas putida F1 in soil. Although the P. p F1 population died off to low levels within the experimental period, the presence of alfalfa and poplar trees helped the survival of P. p F1 in soil. The P. p F1 populations were significantly higher (p = 0.05) in soil samples from the poplar tree soil microcosms than from unplanted control soil microcosms. There was no significant difference observed between soil microcosms planted with alfalfa and unplanted control. The better survival of P. p F1 in planted soil is due to the rhizosphere effect, and therefore, is dependent on the root density in soil. This study shows the beneficial effect of vegetation on the survival of a laboratory cultured strain under conditions close to field condition.

  6. TOL plasmid carriage enhances biofilm formation and increases extracellular DNA content in Pseudomonas putida KT2440.

    PubMed

    D'Alvise, Paul W; Sjøholm, Ole R; Yankelevich, Tatiana; Jin, Yujie; Wuertz, Stefan; Smets, Barth F

    2010-11-01

    Adherent growth of Pseudomonas putida KT2440 with and without the TOL plasmid (pWWO) at the solid-liquid and air-liquid interface was examined. We compared biofilm formation on glass in flow cells, and assayed pellicle (air-liquid interface biofilm) formation in stagnant liquid cultures by confocal laser scanning microscopy. The TOL-carrying strains formed pellicles and thick biofilms, whereas the same strains without the plasmid displayed little adherent growth. Microscopy using fluorescent nucleic acid-specific stains revealed differences in the production of extracellular polymeric substances: TOL carriage leads to more extracellular DNA (eDNA) in pellicles and biofilms. Pellicles were dissolved by DNase I treatment. Enhanced cell lysis due to plasmid carriage was ruled out as the mechanism for eDNA release. We report, for the first time, that carriage of a conjugative plasmid leads to increased biofilm formation by production of eDNA. © 2010 Federation of European Microbiological Societies. Published by Blackwell Publishing Ltd. All rights reserved.

  7. Formaldehyde dismutase, a novel NAD-binding oxidoreductase from Pseudomonas putida F61.

    PubMed

    Kato, N; Yamagami, T; Shimao, M; Sakazawa, C

    1986-04-01

    A novel enzyme, formaldehyde dismutase, was purified and crystallized from the cell extract of an isolated bacterium, Pseudomonas putida F61. The enzyme catalyzes the dismutation of aldehydes and alcohol:aldehyde oxidoreduction in the absence of an exogenous electron acceptor. The enzyme is composed of four identical subunits with a Mr of 44 000. Each subunit contains 1 mol NAD(H) and 2 mol zinc/mol. The ratio of NAD+ and NADH in a crystalline preparation of the enzyme was about 7:3. The enzyme-bound coenzyme was completely reduced and oxidized on the addition of a large amount of an alcohol and an aldehyde respectively. Both the oxidized and reduced enzymes catalyzed the dismutation reaction to the same extent. Steady-state kinetics of the enzyme were investigated using an oxidoreduction reaction between an alcohol and p-nitroso-N, N-dimethylaniline. The enzyme obeys a ping-pong mechanism and is competitively inhibited by an alcoholic substrate analogue, pyrazole, but not coenzyme analogues, such as AMP, N-methylnicotinamide. These results indicate that NAD(H) binds firmly (but not covalently) at each active site. The enzyme-bound NAD(H) was reduced and oxidized only by the added second substrates, alcohol and aldehyde respectively, and not by exogenous electron acceptors [including NAD(H)].

  8. Toxicity Testing of Pristine and Aged Silver Nanoparticles in Real Wastewaters Using Bioluminescent Pseudomonas putida

    PubMed Central

    Mallevre, Florian; Alba, Camille; Milne, Craig; Gillespie, Simon; Fernandes, Teresa F.; Aspray, Thomas J.

    2016-01-01

    Impact of aging on nanoparticle toxicity in real matrices is scarcely investigated due to a lack of suitable methodologies. Herein, the toxicity of pristine and aged silver nanoparticles (Ag NPs) to a bioluminescent Pseudomonas putida bioreporter was measured in spiked crude and final wastewater samples (CWs and FWs, respectively) collected from four wastewater treatment plants (WWTPs). Results showed lower toxicity of pristine Ag NPs in CWs than in FWs. The effect of the matrix on the eventual Ag NP toxicity was related to multiple physico-chemical parameters (biological oxygen demand (BOD), chemical oxygen demand (COD), total suspended solids (TSS) pH, ammonia, sulfide and chloride) based on a multivariate analysis. However, no collection site effect was concluded. Aged Ag NPs (up to eight weeks) were found less toxic than pristine Ag NPs in CWs; evident increased aggregation and decreased dissolution were associated with aging. However, Ag NPs exhibited consistent toxicity in FWs despite aging; comparable results were obtained in artificial wastewater (AW) simulating effluent. The study demonstrates the potency of performing nanoparticle acute toxicity testing in real and complex matrices such as wastewaters using relevant bacterial bioreporters. PMID:28344306

  9. Characterization of a plasmid-specified pathway for catabolism of isopropylbenzene in Pseudomonas putida RE204

    SciTech Connect

    Eaton, R.W.; Timmis, K.N.

    1986-10-01

    A Pseudomonas putida strain designated RE204, able to utilize isopropylbenzene as the sole carbon and energy source, was isolated. Tn5 transposon mutagenesis by means of the suicide transposon donor plasmid pLG221 yielded mutant derivatives defective in isopropylbenzene metabolism. These were characterized by the identification of the products which they accumulated when grown in the presence of isopropylbenzene and by the assay of enzyme activities in cell extracts. Based on the results obtained, the following metabolic pathway is proposed: isopropylbenzene ..-->.. 2,3-dihydro-2,3-dihydroxyisopropylbenzene ..-->.. 3-isopropylcatechol ..-->.. 2-hydroxy-6-oxo-7-methylocta-2,4-dienoate ..-->.. isobutyrate + 2-oxopent-4-enoate ..-->.. amphibolic intermediates. Plasmid DNA was isolated from strain RE204 and mutant derivatives and characterized by restriction enzyme cleavage analysis. Isopropylbenzene-negative isolates carried a Tn5 insert within a 15-kilobase region of a 105-kilobase plasmid designated pRE4. DNA fragments of pRE4 carrying genes encoding isopropylbenzene catabolic enzymes were cloned in Escherichia coli with various plasmid vectors. These clones were subsequently used to generate a transposon insertion and restriction enzyme cleavage map of the isopropylbenzene metabolic region of pRE4.

  10. Suicide inactivation of catechol 2,3-dioxygenase from Pseudomonas putida mt-2 by 3-halocatechols

    SciTech Connect

    Bartels, I.; Knackmuss, H.J.; Reineke, W.

    1984-03-01

    The inactivation of catechol 2,3-dioxygenase from Pseudomonas putida mt-2 by 3-chloro- and 3-fluorocatechol and the iron-chelating agent Tiron (catechol-3,5-disulfonate) was studied. Whereas inactivation by Tiron is an oxygen-independent and mostly reversible process, inactivation by the 3-halocatechols was only observed in the presence of oxygen and was largely irreversible. The rate constants for inactivation (K/sub 2/) were 1.62 x 10/sup -3/ sec/sup -1/ for 3-chlorocatechol and 2.38 x 10/sup -3/ sec/sup -1/ for 3-fluorocatechol. The inhibitor constants (K/sub i/) were 23 ..mu..M for 3-chlorocatechol and 17 ..mu..M for 3-fluorocatechol. The kinetic data for 3-fluorocatechol could only be obtained in the presence of 2-mercaptoethanol. Besides inactivated enzyme, some 2-hydroxyhexa-2,4-dienoic acid as the actual suicide product of meta-cleavage. A side product of 3-fluorocatechol cleavage is a yellow compound with the spectral characteristics of a 2-hydroxy-6-oxohexa-2,4-dienoci acid indicating 1,6-cleavage. Rates of inactivation by 3-fluorocatechol were reduced in the presence of superoxide dismutase, catalase, formate, and mannitol, which implies that superoxide anion, hydrogen peroxide, and hydroxyl radical exhibit additional inactivation. 64 references.

  11. Purification to Homogeneity and Characterization of a Novel Pseudomonas putida Chromate Reductase

    PubMed Central

    Park, C. H.; Keyhan, M.; Wielinga, B.; Fendorf, S.; Matin, A.

    2000-01-01

    Cr(VI) (chromate) is a widespread environmental contaminant. Bacterial chromate reductases can convert soluble and toxic chromate to the insoluble and less toxic Cr(III). Bioremediation can therefore be effective in removing chromate from the environment, especially if the bacterial propensity for such removal is enhanced by genetic and biochemical engineering. To clone the chromate reductase-encoding gene, we purified to homogeneity (>600-fold purification) and characterized a novel soluble chromate reductase from Pseudomonas putida, using ammonium sulfate precipitation (55 to 70%), anion-exchange chromatography (DEAE Sepharose CL-6B), chromatofocusing (Polybuffer exchanger 94), and gel filtration (Superose 12 HR 10/30). The enzyme activity was dependent on NADH or NADPH; the temperature and pH optima for chromate reduction were 80°C and 5, respectively; and the Km was 374 μM, with a Vmax of 1.72 μmol/min/mg of protein. Sulfate inhibited the enzyme activity noncompetitively. The reductase activity remained virtually unaltered after 30 min of exposure to 50°C; even exposure to higher temperatures did not immediately inactivate the enzyme. X-ray absorption near-edge-structure spectra showed quantitative conversion of chromate to Cr(III) during the enzyme reaction. PMID:10788340

  12. Structural and mechanistic insight into alkane hydroxylation by Pseudomonas putida AlkB.

    PubMed

    Alonso, Hernan; Kleifeld, Oded; Yeheskel, Adva; Ong, Poh C; Liu, Yu C; Stok, Jeanette E; De Voss, James J; Roujeinikova, Anna

    2014-06-01

    Pseudomonas putida GPo1 alkane hydroxylase (AlkB) is an integral membrane protein that catalyses the hydroxylation of medium-chain alkanes (C3-C12). 1-Octyne irreversibly inhibits this non-haem di-iron mono-oxygenase under turnover conditions, suggesting that it acts as a mechanism-based inactivator. Upon binding to the active site, 1-octyne is postulated to be oxidized to an oxirene that rapidly rearranges to a reactive ketene which covalently acylates nearby residues, resulting in enzyme inactivation. In analysis of inactivated AlkB by LC-MS/MS, several residues exhibited a mass increase of 126.1 Da, corresponding to the octanoyl moiety derived from oxidative activation of 1-octyne. Mutagenesis studies of conserved acylated residues showed that Lys18 plays a critical role in enzyme function, as a single-point mutation of Lys18 to alanine (K18A) completely abolished enzymatic activity. Finally, we present a computational 3D model structure of the transmembrane domain of AlkB, which revealed the overall packing arrangement of the transmembrane helices within the lipid bilayer and the location of the active site mapped by the 1-octyne modifications.

  13. Functional analysis of aromatic biosynthetic pathways in Pseudomonas putida KT2440

    PubMed Central

    Molina‐Henares, M. Antonia; García‐Salamanca, Adela; Molina‐Henares, A. Jesús; De La Torre, Jesús; Herrera, M. Carmen; Ramos, Juan L.; Duque, Estrella

    2009-01-01

    Summary Pseudomonas putida KT2440 is a non‐pathogenic prototrophic bacterium with high potential for biotechnological applications. Despite all that is known about this strain, the biosynthesis of essential chemicals has not been fully analysed and auxotroph mutants are scarce. We carried out massive mini‐Tn5 random mutagenesis and screened for auxotrophs that require aromatic amino acids. The biosynthesis of aromatic amino acids was analysed in detail including physical and transcriptional organization of genes, complementation assays and feeding experiments to establish pathway intermediates. There is a single pathway from chorismate leading to the biosynthesis of tryptophan, whereas the biosynthesis of phenylalanine and tyrosine is achieved through multiple convergent pathways. Genes for tryptophan biosynthesis are grouped in unlinked regions with the trpBA and trpGDE genes organized as operons and the trpI, trpE and trpF genes organized as single transcriptional units. The pheA and tyrA gene‐encoding multifunctional enzymes for phenylalanine and tyrosine biosynthesis are linked in the chromosome and form an operon with the serC gene involved in serine biosynthesis. The last step in the biosynthesis of these two amino acids requires an amino transferase activity for which multiple tyrB‐like genes are present in the host chromosome. PMID:21261884

  14. Structural and kinetic characterization of recombinant 2-hydroxymuconate semialdehyde dehydrogenase from Pseudomonas putida G7.

    PubMed

    Araújo, Simara Semíramis de; Neves, Cíntia Mara Leal; Guimarães, Samuel Leite; Whitman, Christian P; Johnson, William H; Aparicio, Ricardo; Nagem, Ronaldo Alves Pinto

    2015-08-01

    The first enzyme in the oxalocrotonate branch of the naphthalene-degradation lower pathway in Pseudomonas putida G7 is NahI, a 2-hydroxymuconate semialdehyde dehydrogenase which converts 2-hydroxymuconate semialdehyde to 2-hydroxymuconate in the presence of NAD(+). NahI is in family 8 (ALDH8) of the NAD(P)(+)-dependent aldehyde dehydrogenase superfamily. In this work, we report the cloning, expression, purification and preliminary structural and kinetic characterization of the recombinant NahI. The nahI gene was subcloned into a T7 expression vector and the enzyme was overexpressed in Escherichia coli ArcticExpress as a hexa-histidine-tagged fusion protein. After purification by affinity and size-exclusion chromatography, dynamic light scattering and small-angle X-ray scattering experiments were conducted to analyze the oligomeric state and the overall shape of the enzyme in solution. The protein is a tetramer in solution and has nearly perfect 222 point group symmetry. Protein stability and secondary structure content were evaluated by a circular dichroism spectroscopy assay under different thermal conditions. Furthermore, kinetic assays were conducted and, for the first time, KM (1.3±0.3μM) and kcat (0.9s(-1)) values were determined at presumed NAD(+) saturation. NahI is highly specific for its biological substrate and has no activity with salicylaldehyde, another intermediate in the naphthalene-degradation pathway.

  15. Effect of silver nanoparticles on Pseudomonas putida biofilms at different stages of maturity.

    PubMed

    Thuptimdang, Pumis; Limpiyakorn, Tawan; McEvoy, John; Prüß, Birgit M; Khan, Eakalak

    2015-06-15

    This study determined the effect of silver nanoparticles (AgNPs) on Pseudomonas putida KT2440 biofilms at different stages of maturity. Three biofilm stages (1-3, representing early to late stages of development) were identified from bacterial adenosine triphosphate (ATP) activity under static (96-well plate) and dynamic conditions (Center for Disease Control and Prevention biofilm reactor). Extracellular polymeric substance (EPS) levels, measured using crystal violet and total carbohydrate assays, and expression of the EPS-associated genes, csgA and alg8, supported the conclusion that biofilms at later stages were older than those at earlier stages. More mature biofilms (stages 2 and 3) showed little to no reduction in ATP activity following exposure to AgNPs. In contrast, the same treatment reduced ATP activity by more than 90% in the less mature stage 1 biofilms. Regardless of maturity, biofilms with EPS stripped off were more susceptible to AgNPs than controls with intact EPS, demonstrating that EPS is critical for biofilm tolerance of AgNPs. The findings from this study show that stage of maturity is an important factor to consider when studying effect of AgNPs on biofilms. Copyright © 2015 Elsevier B.V. All rights reserved.

  16. An improved procedure for the purification of catalytically active alkane hydroxylase from Pseudomonas putida GPo1.

    PubMed

    Xie, Meng; Alonso, Hernan; Roujeinikova, Anna

    2011-10-01

    Bacterial alkane hydroxylases are of high interest for bioremediation applications as they allow some bacteria to grow in oil-contaminated environments. Furthermore, they have tremendous biotechnological potential as they catalyse the stereo- and regio-specific hydroxylation of chemically inert alkanes, which can then be used in the synthesis of pharmaceuticals and other high-cost chemicals. Despite their potential, progress on the detailed characterization of these systems has so far been slow mainly due to the lack of a robust procedure to purify its membrane protein component, monooxygenase AlkB, in a stable and active form. This study reports a new method for isolating milligramme amounts of recombinant Pseudomonas putida GPo1 AlkB in a folded, catalytically active form to purity levels above 90%. AlkB solubilised and purified in the detergent lauryldimethylamine oxide was demonstrated to be active in catalysing the epoxidation reaction of 1-octene with an estimated K (m) value of 0.2 mM.

  17. Purification and characterization of morphinone reductase from Pseudomonas putida M10.

    PubMed

    French, C E; Bruce, N C

    1994-07-01

    The NADH-dependent morphinone reductase from Pseudomonas putida M10 catalyses the reduction of morphinone and codeinone to hydromorphone and hydrocodone respectively. Morphinone reductase was purified from crude cell extracts to apparent homogeneity in a single affinity-chromatography step using Mimetic Yellow 2. The purified enzyme was a dimeric flavoprotein with two identical subunits of M(r) 41,100, binding non-covalently one molecule of FMN per subunit. The N-terminal sequence was PDTSFSNPGLFTPLQ. Morphinone reductase was active against morphinone, codeinone, neopinone and 2-cyclohexen-1-one, but not against morphine, codeine or isocodeine. The apparent Km values for codeinone and 2-cyclohexen-1-one were 0.26 mM and 5.5 mM respectively. The steroids progesterone and cortisone were potent competitive inhibitors; the apparent K1 for cortisone was 35 microM. The pH optimum for codeinone reduction was 8.0 in phosphate buffer. No reverse reaction could be detected, and NADPH could not be used as a reducing substrate in place of NADH. Morphinone reductase activity was strongly inhibited by 0.01 mM CuSO4 and p-hydroxymercuribenzoate, suggesting the presence of a vital thiol group. Steady-state kinetic studies suggested a Ping Pong (substituted enzyme) kinetic mechanism; however, product-inhibition patterns were inconsistent with a classical Ping Pong mechanism. Morphinone reductase may, like several other flavoprotein dehydrogenases, operate by a hybrid two-site Ping Pong mechanism.

  18. Toxicity Testing of Pristine and Aged Silver Nanoparticles in Real Wastewaters Using Bioluminescent Pseudomonas putida.

    PubMed

    Mallevre, Florian; Alba, Camille; Milne, Craig; Gillespie, Simon; Fernandes, Teresa F; Aspray, Thomas J

    2016-03-11

    Impact of aging on nanoparticle toxicity in real matrices is scarcely investigated due to a lack of suitable methodologies. Herein, the toxicity of pristine and aged silver nanoparticles (Ag NPs) to a bioluminescent Pseudomonas putida bioreporter was measured in spiked crude and final wastewater samples (CWs and FWs, respectively) collected from four wastewater treatment plants (WWTPs). Results showed lower toxicity of pristine Ag NPs in CWs than in FWs. The effect of the matrix on the eventual Ag NP toxicity was related to multiple physico-chemical parameters (biological oxygen demand (BOD), chemical oxygen demand (COD), total suspended solids (TSS) pH, ammonia, sulfide and chloride) based on a multivariate analysis. However, no collection site effect was concluded. Aged Ag NPs (up to eight weeks) were found less toxic than pristine Ag NPs in CWs; evident increased aggregation and decreased dissolution were associated with aging. However, Ag NPs exhibited consistent toxicity in FWs despite aging; comparable results were obtained in artificial wastewater (AW) simulating effluent. The study demonstrates the potency of performing nanoparticle acute toxicity testing in real and complex matrices such as wastewaters using relevant bacterial bioreporters.

  19. Complete biodegradation of chlorpyrifos by engineered Pseudomonas putida cells expressing surface-immobilized laccases.

    PubMed

    Liu, Jin; Tan, Luming; Wang, Jing; Wang, Zhiyong; Ni, Hong; Li, Lin

    2016-08-01

    The long-term abuse use of chlorpyrifos-like pesticides in agriculture and horticulture has resulted in significant soil or water contamination and a worldwide ecosystem threat. In this study, the ability of a solvent-tolerant bacterium, Pseudomonas putida MB285, with surface-displayed bacterial laccase, to biodegrade chlorpyrifos was investigated. The results of compositional analyses of the degraded products demonstrate that the engineered MB285 was capable of completely eliminating chlorpyrifos via direct biodegradation, as determined by high-performance liquid chromatography and gas chromatography-mass spectrometry assays. Two intermediate metabolites, namely 3,5,6-trichloro-2-pyridinol (TCP) and diethyl phosphate, were temporarily detectable, verifying the joint and stepwise degradation of chlorpyrifos by surface laccases and certain cellular enzymes, whereas the purified free laccase incompletely degraded chlorpyrifos into TCP. The degradation reaction can be conducted over a wide range of pH values (2-7) and temperatures (5-55 °C) without the need for Cu(2+). Bioassays using Caenorhabditis elegans as an indicator organism demonstrated that the medium was completely detoxified of chlorpyrifos by degradation. Moreover, the engineered cells exhibited a high capacity of repeated degradation and good performance in continuous degradation cycles, as well as a high capacity to degrade real effluents containing chlorpyrifos. Therefore, the developed system exhibited a high degradation capacity and performance and constitutes an improved approach to address chlorpyrifos contamination in chlorpyrifos-remediation practice.

  20. Physiological states and energetic adaptation during growth of Pseudomonas putida mt-2 on glucose.

    PubMed

    Latrach Tlemçani, Leith; Corroler, David; Barillier, Daniel; Mosrati, Ridha

    2008-08-01

    Kinetic study of growth of Pseudomonas putida mt-2 was investigated in batch culture under aerobic conditions, on glucose as initial carbon and energy source. Cell growth was continuous and three phases were found regarding accumulation of intermediates: (1) glucose was largely converted to gluconate and 2-ketogluconate, (2) then gluconate was converted to 2-ketogluconate and (3) the latter was consumed after gluconate depletion. Examination of growth kinetics and yields showed that glucose flux was mainly oriented to oxidation reduction in the periplasm and less towards biosynthesis. Values of respiratory quotient and of CO2/biomass and O2/biomass yields were characteristic of each phase. Main enzymatic activities involved in the use of these substrates were always detected meaning that concomitant assimilation is possible. However the levels of these activities varied during growth. Membrane conversions seem to have a significant energetic contribution explaining the higher specific growth rate obtained in glucose phase compared to gluconate and 2-ketogluconate ones. This is also noticeable through the evolution of the yields Y(O2)/X and Y(CO2)/X. Although the three convergent pathways are operational and can be genetically controlled, the progression of the culture in successive phases highlights an overall level of regulation in response to the energetic needs.

  1. Purification to homogeneity and characterization of a novel Pseudomonas putida chromate reductase

    SciTech Connect

    Park, C.H.; Keyhan, M.; Wielinga, B.; Fendorf, S.; Matin, A.

    2000-05-01

    Cr(VI) (chromate) is a widespread environmental contaminant. Bacterial chromate reductases can convert soluble and toxic chromate to the insoluble and less toxic Cr(III). Bioremediation can therefore be effective in removing chromate from the environment, especially if the bacterial propensity for such removal is enhanced by genetic and biochemical engineering. To clone the chromate reductase-encoding gene, the authors purified to homogeneity and characterized a novel soluble chromate reductase from Pseudomonas putida, using ammonium sulfate precipitation, anion-exchange chromatography, chromatofocusing, and gel filtration. The enzyme activity was dependent on NADH or NADPH; the temperature and pH optima for chromate reduction were 80 C and 5, respectively; and the K{sub m} was 374 {micro}M, with a V{sub max} of 1.72 {micro}mol/min/mg of protein. Sulfate inhibited the enzyme activity noncompetitively. The reductase activity remained virtually unaltered after 30 min of exposure to 50 C; even exposure to higher temperatures did not immediately inactivate the enzyme. X-ray absorption near-edge-structure spectra showed quantitative conversion of chromate to Cr(III) during the enzyme reaction.

  2. Purification and characterization of benzyl alcohol- and benzaldehyde- dehydrogenase from Pseudomonas putida CSV86.

    PubMed

    Shrivastava, Rahul; Basu, Aditya; Phale, Prashant S

    2011-08-01

    Pseudomonas putida CSV86 utilizes benzyl alcohol via catechol and methylnaphthalenes through detoxification pathway via hydroxymethylnaphthalenes and naphthaldehydes. Based on metabolic studies, benzyl alcohol dehydrogenase (BADH) and benzaldehyde dehydrogenase (BZDH) were hypothesized to be involved in the detoxification pathway. BADH and BZDH were purified to apparent homogeneity and were (1) homodimers with subunit molecular mass of 38 and 57 kDa, respectively, (2) NAD(+) dependent, (3) broad substrate specific accepting mono- and di-aromatic alcohols and aldehydes but not aliphatic compounds, and (4) BADH contained iron and magnesium, while BZDH contained magnesium. BADH in the forward reaction converted alcohol to aldehyde and required NAD(+), while in the reverse reaction it reduced aldehyde to alcohol in NADH-dependent manner. BZDH showed low K (m) value for benzaldehyde as compared to BADH reverse reaction. Chemical cross-linking studies revealed that BADH and BZDH do not form multi-enzyme complex. Thus, the conversion of aromatic alcohol to acid is due to low K (m) and high catalytic efficiency of BZDH. Phylogenetic analysis revealed that BADH is a novel enzyme and diverged during the evolution to gain the ability to utilize mono- and di-aromatic compounds. The wide substrate specificity of these enzymes enables strain to detoxify methylnaphthalenes to naphthoic acids efficiently.

  3. Addition of Aromatic Substrates Restores Trichloroethylene Degradation Activity in Pseudomonas putida F1

    PubMed Central

    Morono, Yuki; Unno, Hajime; Tanji, Yasunori; Hori, Katsutoshi

    2004-01-01

    The rate of trichloroethylene (TCE) degradation by toluene dioxygenase (TDO) in resting cells of Pseudomonas putida F1 gradually decreased and eventually stopped within 1.5 h, as in previous reports. However, the subsequent addition of toluene, which is the principal substrate of TDO, resulted in its immediate degradation without a lag phase. After the consumption of toluene, degradation of TCE restarted at a rate similar to its initial degradation, suggesting that this degradation was mediated by TDO molecules that were present before the cessation of TCE degradation. The addition of benzene and cumene, which are also substrates of TDO, also caused restoration of TCE degradation activity: TCE was degraded simultaneously with cumene, and a larger amount of TCE was degraded after cumene was added than after toluene or benzene was added. But substrates that were expected to supply the cells with NADH or energy did not restore TCE degradation activity. This cycle of pseudoinactivation and restoration of TCE degradation was observed repeatedly without a significant decrease in the number of viable cells, even after six additions of toluene spread over 30 h. The results obtained in this study demonstrate a new type of restoration of TCE degradation that has not been previously reported. PMID:15128539

  4. Regulatory Tasks of the Phosphoenolpyruvate-Phosphotransferase System of Pseudomonas putida in Central Carbon Metabolism

    PubMed Central

    Chavarría, Max; Kleijn, Roelco J.; Sauer, Uwe; Pflüger-Grau, Katharina; de Lorenzo, Víctor

    2012-01-01

    ABSTRACT Two branches of the phosphoenolpyruvate-phosphotransferase system (PTS) operate in the soil bacterium Pseudomonas putida KT2440. One branch encompasses a complete set of enzymes for fructose intake (PTSFru), while the other (N-related PTS, or PTSNtr) controls various cellular functions unrelated to the transport of carbohydrates. The potential of these two systems for regulating central carbon catabolism has been investigated by measuring the metabolic fluxes of isogenic strains bearing nonpolar mutations in PTSFru or PTSNtr genes and grown on either fructose (a PTS substrate) or glucose, the transport of which is not governed by the PTS in this bacterium. The flow of carbon from each sugar was distinctly split between the Entner-Doudoroff, pentose phosphate, and Embden-Meyerhof-Parnas pathways in a ratio that was maintained in each of the PTS mutants examined. However, strains lacking PtsN (EIIANtr) displayed significantly higher fluxes in the reactions of the pyruvate shunt, which bypasses malate dehydrogenase in the TCA cycle. This was consistent with the increased activity of the malic enzyme and the pyruvate carboxylase found in the corresponding PTS mutants. Genetic evidence suggested that such a metabolic effect of PtsN required the transfer of high-energy phosphate through the system. The EIIANtr protein of the PTSNtr thus helps adjust central metabolic fluxes to satisfy the anabolic and energetic demands of the overall cell physiology. PMID:22434849

  5. Electricity generation and wastewater treatment of oil refinery in microbial fuel cells using Pseudomonas putida.

    PubMed

    Majumder, Dip; Maity, Jyoti Prakash; Tseng, Min-Jen; Nimje, Vanita Roshan; Chen, Hau-Ren; Chen, Chien-Cheng; Chang, Young-Fo; Yang, Tsui-Chu; Chen, Chen-Yen

    2014-09-22

    Microbial fuel cells (MFCs) represent a novel platform for treating wastewater and at the same time generating electricity. Using Pseudomonas putida (BCRC 1059), a wild-type bacterium, we demonstrated that the refinery wastewater could be treated and also generate electric current in an air-cathode chamber over four-batch cycles for 63 cumulative days. Our study indicated that the oil refinery wastewater containing 2213 mg/L (ppm) chemical oxygen demand (COD) could be used as a substrate for electricity generation in the reactor of the MFC. A maximum voltage of 355 mV was obtained with the highest power density of 0.005 mW/cm² in the third cycle with a maximum current density of 0.015 mA/cm² in regard to the external resistor of 1000 Ω. A maximum coulombic efficiency of 6 × 10⁻²% was obtained in the fourth cycle. The removal efficiency of the COD reached 30% as a function of time. Electron transfer mechanism was studied using cyclic voltammetry, which indicated the presence of a soluble electron shuttle in the reactor. Our study demonstrated that oil refinery wastewater could be used as a substrate for electricity generation.

  6. Immobilization and characterization of benzoylformate decarboxylase from Pseudomonas putida on spherical silica carrier.

    PubMed

    Peper, Stephanie; Kara, Selin; Long, Wei Sing; Liese, Andreas; Niemeyer, Bernd

    2011-08-01

    If an adequate biocatalyst is identified for a specific reaction, immobilization is one possibility to further improve its properties. The immobilization allows easy recycling, improves the enzyme performance, and it often enhances the stability of the enzyme. In this work, the immobilization of the benzoylformate decarboxylase (BFD) variant, BFD A460I-F464I, from Pseudomonas putida was accomplished on spherical silica. Silicagel is characterized by its high mechanical stability, which allows its application in different reactor types without restrictions. The covalently bound enzyme was characterized in terms of its activity, stability, and kinetics for the formation of chiral 2-hydroxypropiophenone (2-HPP) from benzaldehyde and acetaldehyde. Moreover, temperature as well as pressure dependency of immobilized BFD A460I-F464I activity and enantioselectivity were analyzed. The used wide-pore silicagel shows a good accessibility of the immobilized enzyme. The activity of the immobilized BFD A460I-F464I variant was determined to be 70% related to the activity of the free enzyme. Thereby, the enantioselectivity of the enzyme was not influenced by the immobilization. In addition, a pressure-induced change in stereoselectivity was found both for the free and for the immobilized enzyme. With increasing pressure, the enantiomeric excess (ee) of (R)-2-HPP can be increased from 44% (0.1 MPa) to 76% (200 MPa) for the free enzyme and from 43% (0.1 MPa) to 66% (200 MPa) for the immobilized enzyme.

  7. Plasmolysis induced by toluene in a cyoB mutant of Pseudomonas putida.

    PubMed

    Duque, Estrella; García, Vanina; de la Torre, Jesús; Godoy, Patricia; Bernal, Patricia; Ramos, Juan-Luis

    2004-10-01

    The cyoABCDE gene cluster of Pseudomonas putida DOT-T1E encodes a terminal cytochrome oxidase. A 500-bp 'cyoB' DNA fragment was cloned in pCHESI Omega Km and used to generate a cyoB knock-out mutant in vivo. The mutant strain was not limited in the generation of proton-motif force, although when grown on minimal medium with glucose or citrate, the CyoB mutant exhibited a slight increase in duplication time with respect to the wild-type strain. This effect was even more pronounced when toluene was supplied in the gas phase. In consonance with the negative effect of toluene on the growth was the finding that the CyoB mutant was hypersensitive to sudden 0.3% (v/v) toluene shocks, in contrast with the wild-type strain. This effect was particularly exacerbated in cells that reached the stationary phase. The increased sensitivity to solvents of the CyoB mutant did not appear to be related to the inability of the cells to strengthen the membrane package or to induce the efflux pumps in response to the solvent, but rather to solvent-induced plasmolysis that may be triggered by wrinkles in the cytoplasmic membrane at the poles of the mutant cells, and invagination of the outer membranes, which eventually lead to cell death.

  8. Quorum sensing triggers the stochastic escape of individual cells from Pseudomonas putida biofilms

    PubMed Central

    Cárcamo-Oyarce, Gerardo; Lumjiaktase, Putthapoom; Kümmerli, Rolf; Eberl, Leo

    2015-01-01

    The term ‘quorum sensing’ (QS) is generally used to describe the phenomenon that bacteria release and perceive signal molecules to coordinate cooperative behaviour in response to their population size. QS-based communication has therefore been considered a social trait. Here we show that QS signals (N-acyl-homoserine lactones, AHLs) are stochastically produced in young biofilms of Pseudomonas putida and act mainly as self-regulatory signals rather than inducing neighbouring cells. We demonstrate that QS induces the expression of putisolvin biosurfactants that are not public goods, thereby triggering asocial motility of induced cells out of microcolonies. Phenotypic heterogeneity is most prominent in the early stages of biofilm development, whereas at later stages behaviour patterns across cells become more synchronized. Our findings broaden our perspective on QS by showing that AHLs can control the expression of asocial (self-directed) traits, and that heterogeneity in QS can serve as a mechanism to drive phenotypic heterogeneity in self-directed behaviour. PMID:25592773

  9. Evaluation of Zosteric Acid for Mitigating Biofilm Formation of Pseudomonas putida Isolated from a Membrane Bioreactor System

    PubMed Central

    Polo, Andrea; Foladori, Paola; Ponti, Benedetta; Bettinetti, Roberta; Gambino, Michela; Villa, Federica; Cappitelli, Francesca

    2014-01-01

    This study provides data to define an efficient biocide-free strategy based on zosteric acid to counteract biofilm formation on the membranes of submerged bioreactor system plants. 16S rRNA gene phylogenetic analysis showed that gammaproteobacteria was the prevalent taxa on fouled membranes of an Italian wastewater plant. Pseudomonas was the prevalent genus among the cultivable membrane-fouler bacteria and Pseudomonas putida was selected as the target microorganism to test the efficacy of the antifoulant. Zosteric acid was not a source of carbon and energy for P. putida cells and, at 200 mg/L, it caused a reduction of bacterial coverage by 80%. Biofilm experiments confirmed the compound caused a significant decrease in biomass (−97%) and thickness (−50%), and it induced a migration activity of the peritrichous flagellated P. putida over the polycarbonate surface not amenable to a biofilm phenotype. The low octanol-water partitioning coefficient and the high water solubility suggested a low bioaccumulation potential and the water compartment as its main environmental recipient and capacitor. Preliminary ecotoxicological tests did not highlight direct toxicity effects toward Daphnia magna. For green algae Pseudokirchneriella subcapitata an effect was observed at concentrations above 100 mg/L with a significant growth of protozoa that may be connected to a concurrent algal growth inhibition. PMID:24879523

  10. Indole-Induced Activities of β-Lactamase and Efflux Pump Confer Ampicillin Resistance in Pseudomonas putida KT2440

    PubMed Central

    Kim, Jisun; Shin, Bora; Park, Chulwoo; Park, Woojun

    2017-01-01

    Indole, which is widespread in microbial communities, has received attention because of its effects on bacterial physiology. Pseudomonas putida and Pseudomonas aeruginosa can acquire ampicillin (Amp) resistance during growth on indole-Amp agar. Transcriptome, mutant, and inhibitor studies have suggested that Amp resistance induced by indole can be attributed to increased gene expression of ttgAB encoding two genes of RND-type multidrug efflux operons and an ampC encoding β-lactamase. Expression, enzyme activities, and mutational analyses indicated that AmpC β-lactamase is important for acquiring Amp resistance of P. putida in the presence of indole. Here, we show, for the first time, that volatile indole increased Amp-resistant cells. Consistent with results of the volatile indole assay, a low concentration of indole in liquid culture promoted growth initially, but led to mutagenesis after indole was depleted, which could not be observed at high indole concentrations. Interestingly, ttgAB and ampC gene expression levels correlate with the concentration of indole, which might explain the low number of Amp-mutated cells in high indole concentrations. The expression levels of genes involved in mutagenesis, namely rpoS, recA, and mutS, were also modulated by indole. Our data indicates that indole reduces Amp-induced heterogeneity by promoting expression of TtgABC or MexAB-OprM efflux pumps and the indole-induced β-lactamase in P. putida and P. aeruginosa. PMID:28352264

  11. Evaluation of zosteric acid for mitigating biofilm formation of Pseudomonas putida isolated from a membrane bioreactor system.

    PubMed

    Polo, Andrea; Foladori, Paola; Ponti, Benedetta; Bettinetti, Roberta; Gambino, Michela; Villa, Federica; Cappitelli, Francesca

    2014-05-28

    This study provides data to define an efficient biocide-free strategy based on zosteric acid to counteract biofilm formation on the membranes of submerged bioreactor system plants. 16S rRNA gene phylogenetic analysis showed that gammaproteobacteria was the prevalent taxa on fouled membranes of an Italian wastewater plant. Pseudomonas was the prevalent genus among the cultivable membrane-fouler bacteria and Pseudomonas putida was selected as the target microorganism to test the efficacy of the antifoulant. Zosteric acid was not a source of carbon and energy for P. putida cells and, at 200 mg/L, it caused a reduction of bacterial coverage by 80%. Biofilm experiments confirmed the compound caused a significant decrease in biomass (-97%) and thickness (-50%), and it induced a migration activity of the peritrichous flagellated P. putida over the polycarbonate surface not amenable to a biofilm phenotype. The low octanol-water partitioning coefficient and the high water solubility suggested a low bioaccumulation potential and the water compartment as its main environmental recipient and capacitor. Preliminary ecotoxicological tests did not highlight direct toxicity effects toward Daphnia magna. For green algae Pseudokirchneriella subcapitata an effect was observed at concentrations above 100 mg/L with a significant growth of protozoa that may be connected to a concurrent algal growth inhibition.

  12. A role for the regulator PsrA in the polyhydroxyalkanoate metabolism of Pseudomonas putida KT2440.

    PubMed

    Fonseca, Pilar; de la Peña, Fernando; Prieto, María Auxiliadora

    2014-11-01

    Pseudomonas putida KT2440 is a Gram-negative bacterium capable of producing medium-chain-length-polyhydroxyalkanoates (mcl-PHA). When fatty acids are used as growth and polymer precursors, the biosynthesis is linked to fatty acid metabolism via ß-oxidation route. In the close-related Pseudomonas aeruginosa, the transcriptional repressor PsrA regulates the ß-oxidation, but little is known about the regulatory system in P. putida. To analyze the effect of the absence of psrA gene on the growth and PHA production in P. putida, a set of different carbon sources were assayed in the wild type strain and in a generated psrA deficient strain (KT40P). The growth rates were in all cases, lower for the mutant. The amount of PHA produced by the mutant strain is lower than the wild type. Moreover, the monomeric composition seems to be different among the strains, as there is enrichment in monomers with shorter carbon length in the mutant strain. To understand the role of the psrA gene on the metabolism of fatty acids, we have determined the expression profile of several genes related to fatty acid metabolism in the wild type and in the mutant strain. The results indicated that PsrA mostly negatively regulate genes related to fatty acid metabolism.

  13. From dirt to industrial applications: Pseudomonas putida as a Synthetic Biology chassis for hosting harsh biochemical reactions.

    PubMed

    Nikel, Pablo I; Chavarría, Max; Danchin, Antoine; de Lorenzo, Víctor

    2016-10-01

    The soil bacterium Pseudomonas putida is endowed with a central carbon metabolic network capable of fulfilling high demands of reducing power. This situation arises from a unique metabolic architecture that encompasses the partial recycling of triose phosphates to hexose phosphates-the so-called EDEMP cycle. In this article, the value of P. putida as a bacterial chassis of choice for contemporary, industrially-oriented metabolic engineering is addressed. The biochemical properties that make this bacterium adequate for hosting biotransformations involving redox reactions as well as toxic compounds and intermediates are discussed. Finally, novel developments and open questions in the continuous quest for an optimal microbial cell factory are presented at the light of current and future needs in the area of biocatalysis. Copyright © 2016 Elsevier Ltd. All rights reserved.

  14. Bioremoval of Basic Violet 3 and Acid Blue 93 by Pseudomonas putida and its adsorption isotherms and kinetics.

    PubMed

    Arunarani, A; Chandran, Preethy; Ranganathan, B V; Vasanthi, N S; Sudheer Khan, S

    2013-02-01

    Basic Violet 3 and Acid Blue 93 are the most important group of synthetic colourants extensively used in textile industries for dyeing cotton, wool, silk and nylon. Release of these dye pollutants in to the environment adversely affects the human health and aquatic organisms. The present study we used Pseudomonas putida MTCC 4910 for the adsorptive removal of Basic Violet 3 and Acid Blue 93 from the aqueous solutions. The pH (4-9) and NaCl concentrations (1mM-1M) did not influence the adsorption process. The equilibrium adsorption process fitted well to Freundlich model than Langmuir model. The kinetics of adsorption fitted well by pseudo-second-order. Thus in the present study an attempt has been made to exploit the dye removal capability of P. putida MTCC 4910, and it was found to be an efficient microbe that could be used for bio removal of dyes from textile effluents.

  15. Nitrogen Removal Characteristics of Pseudomonas putida Y-9 Capable of Heterotrophic Nitrification and Aerobic Denitrification at Low Temperature

    PubMed Central

    He, Tengxia; Ye, Qing; Chen, Yanli; Xie, Enyu; Zhang, Xue

    2017-01-01

    The cold-adapted bacterium Pseudomonas putida Y-9 was investigated and exhibited excellent capability for nitrogen removal at 15°C. The strain capable of heterotrophic nitrification and aerobic denitrification could efficiently remove ammonium, nitrate, and nitrite at an average removal rate of 2.85 mg, 1.60 mg, and 1.83 mg NL−1 h−1, respectively. Strain Y-9 performed nitrification in preference to denitrification when ammonium and nitrate or ammonium and nitrite coexisted in the solution. Meantime, the presence of nitrate had no effect on the ammonium removal rate of strain Y-9, and yet the presence of high concentration of nitrite would inhibit the cell growth and decrease the nitrification rate. The experimental results indicate that P. putida Y-9 has potential application for the treatment of wastewater containing high concentrations of ammonium along with its oxidation products at low temperature. PMID:28293626

  16. NahY, a Catabolic Plasmid-Encoded Receptor Required for Chemotaxis of Pseudomonas putida to the Aromatic Hydrocarbon Naphthalene

    PubMed Central

    Grimm, Ann C.; Harwood, Caroline S.

    1999-01-01

    Pseudomonas putida G7 exhibits chemotaxis to naphthalene, but the molecular basis for this was not known. A new gene, nahY, was found to be cotranscribed with meta cleavage pathway genes on the NAH7 catabolic plasmid for naphthalene degradation. The nahY gene encodes a 538-amino-acid protein with a membrane topology and a C-terminal region that resemble those of chemotaxis transducer proteins. A P. putida G7 nahY mutant grew on naphthalene but was not chemotactic to this aromatic hydrocarbon. The protein NahY thus appears to function as a chemoreceptor for naphthalene or a related compound. The presence of nahY on a catabolic plasmid implies that chemotaxis may facilitate biodegradation. PMID:10322041

  17. The contribution of proteomics to the unveiling of the survival strategies used by Pseudomonas putida in changing and hostile environments.

    PubMed

    Moreno, Renata; Rojo, Fernando

    2013-10-01

    Pseudomonas putida is a ubiquitous, metabolically very versatile, Gram-negative bacterium adapted to habitats as diverse as soil, water and the rhizosphere. Most strains are nonpathogenic, many are used as experimental models, and many others have biotechnological applications in the areas of agriculture, bioremediation, biocatalysis, and the production of bioplastics. This review summarizes the contribution of proteomic technologies to our understanding of how P. putida responds to different carbon sources, how it adapts to living at suboptimal temperatures or attached to surfaces, and how it responds to the presence of toxic compounds such as aromatic molecules and heavy metals. The examples described illustrate the value of proteomics in furthering our knowledge of the physiology and behavior of bacteria, knowledge that is important for understanding how they behave in their natural habitats and for optimizing their behavior in biotechnological applications.

  18. Insights into Pseudomonas putida KT2440 response to phenol-induced stress by quantitative proteomics.

    PubMed

    Santos, Pedro M; Benndorf, Dirk; Sá-Correia, Isabel

    2004-09-01

    To gain insight into the global mechanism underlying phenol toxicity and tolerance in bacteria, we have generated a two-dimensional protein reference map and used it to identify variations in protein expression levels in Pseudomonas putida KT2440 following exposure to sub-lethal inhibitory concentrations of this solvent. Inspection of the two-dimensional gel electrophoresis gels revealed that 1 h following sudden cell exposure to two different concentrations of phenol, leading to the inhibition of exponential growth (600 mg/L) or to growth arrest for, at least, 4 h before inhibited growth resumption (800 mg/L), the amount of 68 proteins was increased while the amount of 13 proteins was reduced. The up-regulated proteins include proteins involved in the: (i) oxidative stress response (AhpC, SodB,Tpx and Dsb); (ii) general stress reponse (UspA, HtpG, GrpE and Tig); (iii) energetic metabolism (AcnB, AtpH, Fpr, AceA, NuoE, and MmsA-1); (iv) fatty acid biosynthesis (FabB, AccC-1 and FabBx1); (v) inhibition of cell division (MinD); (vi) cell envelope biosynthesis (LpxC, VacJ, and MurA); (vii) transcription regulation (OmpR and Fur); and (viii) transport of small molecules (TolC, BraC, AotJ, AapJ, FbpA and OprQ). Among the down-regulated proteins are those involved in nucleotide biosynthesis (PurM, PurL, PyrH and Dcd) and cell motility (FliC). The information emerging from this genome expression profiling and the detailed investigation of the biological role of candidate genes, as targets of phenol toxicity or as determinants of phenol resistance in P. putida KT2440, will allow more rationale strategies for developing bacteria with greater solvent tolerance with impact in bioremediation and whole-cell biotransformations in media with organic solvents.

  19. Global Regulation of Food Supply by Pseudomonas putida DOT-T1E▿ †

    PubMed Central

    Daniels, Craig; Godoy, Patricia; Duque, Estrella; Molina-Henares, M. Antonia; de la Torre, Jesús; del Arco, José María; Herrera, Carmen; Segura, Ana; Guazzaroni, M. Eugenia; Ferrer, Manuel; Ramos, Juan Luis

    2010-01-01

    Pseudomonas putida DOT-T1E was used as a model to develop a “phenomics” platform to investigate the ability of P. putida to grow using different carbon, nitrogen, and sulfur sources and in the presence of stress molecules. Results for growth of wild-type DOT-T1E on 90 different carbon sources revealed the existence of a number of previously uncharted catabolic pathways for compounds such as salicylate, quinate, phenylethanol, gallate, and hexanoate, among others. Subsequent screening on the subset of compounds on which wild-type DOT-TIE could grow with four knockout strains in the global regulatory genes Δcrc, Δcrp, ΔcyoB, and ΔptsN allowed analysis of the global response to nutrient supply and stress. The data revealed that most global regulator mutants could grow in a wide variety of substrates, indicating that metabolic fluxes are physiologically balanced. It was found that the Crc mutant did not differ much from the wild-type regarding the use of carbon sources. However, certain pathways are under the preferential control of one global regulator, i.e., metabolism of succinate and d-fructose is influenced by CyoB, and l-arginine is influenced by PtsN. Other pathways can be influenced by more than one global regulator; i.e., l-valine catabolism can be influenced by CyoB and Crp (cyclic AMP receptor protein) while phenylethylamine is affected by Crp, CyoB, and PtsN. These results emphasize the cross talk required in order to ensure proper growth and survival. With respect to N sources, DOT-T1E can use a wide variety of inorganic and organic nitrogen sources. As with the carbon sources, more than one global regulator affected growth with some nitrogen sources; for instance, growth with nucleotides, dipeptides, d-amino acids, and ethanolamine is influenced by Crp, CyoB, and PtsN. A surprising finding was that the Crp mutant was unable to flourish on ammonium. Results for assayed sulfur sources revealed that CyoB controls multiple points in methionine

  20. An upp-based markerless gene replacement method for genome reduction and metabolic pathway engineering in Pseudomonas mendocina NK-01 and Pseudomonas putida KT2440.

    PubMed

    Wang, Yuanyuan; Zhang, Chi; Gong, Ting; Zuo, Zhenqiang; Zhao, Fengjie; Fan, Xu; Yang, Chao; Song, Cunjiang

    2015-06-01

    A markerless gene replacement method was adapted by combining a suicide plasmid, pEX18Tc, with a counterselectable marker, the upp gene encoding uracil phosphoribosyltransferase (UPRTase), for the medium-chain length polyhydroxyalkanoates (PHA(MCL))-producing strain Pseudomonas mendocina NK-01. An NK-01 5-fluorouracil (5-FU) resistant background strain was first constructed by deleting the chromosomal upp gene. The suicide plasmid pEX18Tc, carrying a functional allele of the upp gene of P. mendocina NK-01, was used to construct the vectors to delete the algA (encoding mannose-1-phosphate guanylyltransferase) and phaZ (encoding PHA(MCL) depolymerase) genes, and a 30 kb chromosomal fragment in the 5-FU resistant background host. The genes were removed efficiently from the genome of P. mendocina NK-01 and left a markerless chromosomal mutant. In addition, two exogenous genes were inserted into the phaC1 (PHA(MCL) polymerase) loci of Pseudomonas putida KT-∆UPP simultaneously. Thus, we constructed a genetically stable and marker-free P. putida KT2440 mutant with integrated mpd (encoding methyl parathion hydrolase (MPH)) and pytH (encoding a pyrethroid-hydrolyzing carboxylesterase (PytH)) gene on the chromosome. The upp-based counterselection system could be further adapted for P. mendocina NK-01 and P. putida KT2440 and used for genome reduction and metabolic pathway engineering.

  1. Identification and characterization of a siderophore regulatory gene (pfrA) of Pseudomonas putida WCS358: homology to the alginate regulatory gene algQ of Pseudomonas aeruginosa.

    PubMed

    Venturi, V; Ottevanger, C; Leong, J; Weisbeek, P J

    1993-10-01

    Genes encoding biosynthesis of pseudobactin 358 (a microbial iron transport agent) and its cognate outer membrane receptor protein, PupA, are transcribed only under iron limitation in plant growth-promoting Pseudomonas putida WCS358. Two cosmid clones were identified from a gene bank of WCS358 DNA which could independently and in an iron-dependent manner activate transcription from a WCS358 siderophore gene promoter in heterologous Pseudomonas strain A225. The functional region of one of the clones was localized by subcloning, transposon Tn3Gus mutagenesis, and DNA sequencing. Genomic transposon insertion mutants in the functional region lost the capacity to activate a siderophore gene promoter fusion transcriptionally; furthermore, these mutants no longer produced pseudobactin 358. The activating region consisted of a single gene designated pfrA (Pseudomonas ferric regulator). The pfrA gene codes for a single polypeptide, PfrA, of approximately 18 kDa, which has 58% identity to AlgQ (also known as AlgR2), a positive regulator involved in transcriptionally regulating alginate biosynthesis in Pseudomonas aeruginosa. Cross-complementation studies between the pfrA gene of P. putida and the algQ gene of P. aeruginosa revealed that pfrA can restore mucoidy (alginate production) in an algQ mutant and that algQ could poorly complement a pfrA genomic mutant. It is concluded that PfrA is involved in the positive regulation of siderophore biosynthetic genes in response to iron limitation; furthermore, pfrA and algQ appeared to be interchangeable between P. putida and P. aeruginosa.

  2. blaVIM-2 Cassette-Containing Novel Integrons in Metallo-β-Lactamase-Producing Pseudomonas aeruginosa and Pseudomonas putida Isolates Disseminated in a Korean Hospital

    PubMed Central

    Lee, Kyungwon; Lim, Jong Back; Yum, Jong Hwa; Yong, Dongeun; Chong, Yunsop; Kim, June Myung; Livermore, David M.

    2002-01-01

    We investigated the phenotypic and genetic properties of metallo-β-lactamase-producing Pseudomonas isolates collected at a tertiary-care hospital in Korea since 1995. The prevalence of imipenem resistance among Pseudomonas aeruginosa isolates reached 16% in 1997, when 9% of the resistant organisms were found to produce VIM-2 β-lactamase, a class B enzyme previously found only in P. aeruginosa isolates from Europe. VIM-2-producing isolates of Pseudomonas putida were also detected. Resistance was transferable from both these species to P. aeruginosa PAO4089Rp by filter mating, although the resistance determinant could not be found on any detectable plasmid. Serotyping showed that many of the VIM-2-producing P. aeruginosa isolates belonged to serotypes O:11 and O:12, and pulsed-field gel electrophoresis of XbaI-digested genomic DNA revealed that many had identical profiles, whereas the P. putida isolates were diverse. Sequencing showed that the blaVIM-2 genes resided as cassettes in class 1 integrons. In contrast to previous VIM-encoding integrons, the integron sequenced from a P. aeruginosa isolate had blaVIM located downstream of a variant of aacA4. blaVIM also lay in a class 1 integron in a representative P. putida strain, but the organization of this integron was different from that sequenced from the P. aeruginosa strain. In conclusion, the metallo-β-lactamase produced by these imipenem-resistant Pseudomonas isolates was VIM-2, and the accumulation of producers reflected clonal dissemination as well as horizontal spread. Strict measures are required in order to control a further spread of resistance. PMID:11897589

  3. Purification and characterization of gentisate 1,2-dioxygenases from Pseudomonas alcaligenes NCIB 9867 and Pseudomonas putida NCIB 9869.

    PubMed

    Feng, Y; Khoo, H E; Poh, C L

    1999-03-01

    Two 3-hydroxybenzoate-inducible gentisate 1,2-dioxygenases were purified to homogeneity from Pseudomonas alcaligenes NCIB 9867 (P25X) and Pseudomonas putida NCIB 9869 (P35X), respectively. The estimated molecular mass of the purified P25X gentisate 1, 2-dioxygenase was 154 kDa, with a subunit mass of 39 kDa. Its structure is deduced to be a tetramer. The pI of this enzyme was established to be 4.8 to 5.0. The subunit mass of P35X gentisate 1, 2-dioxygenase was 41 kDa, and this enzyme was deduced to exist as a dimer, with a native molecular mass of about 82 kDa. The pI of P35X gentisate 1,2-dioxygenase was around 4.6 to 4.8. Both of the gentisate 1,2-dioxygenases exhibited typical saturation kinetics and had apparent Kms of 92 and 143 microM for gentisate, respectively. Broad substrate specificities were exhibited towards alkyl and halogenated gentisate analogs. Both enzymes had similar kinetic turnover characteristics for gentisate, with kcat/Km values of 44.08 x 10(4) s-1 M-1 for the P25X enzyme and 39.34 x 10(4) s-1 M-1 for the P35X enzyme. Higher kcat/Km values were expressed by both enzymes against the substituted gentisates. Significant differences were observed between the N-terminal sequences of the first 23 amino acid residues of the P25X and P35X gentisate 1,2-dioxygenases. The P25X gentisate 1,2-dioxygenase was stable between pH 5.0 and 7.5, with the optimal pH around 8.0. The P35X enzyme showed a pH stability range between 7.0 and 9.0, and the optimum pH was also 8.0. The optimal temperature for both P25X and P35X gentisate 1, 2-dioxygenases was around 50 degrees C, but the P35X enzyme was more heat stable than that from P25X. Both enzymes were strongly stimulated by 0.1 mM Fe2+ but were completely inhibited by the presence of 5 mM Cu2+. Partial inhibition of both enzymes was also observed with 5 mM Mn2+, Zn2+, and EDTA.

  4. Draft Genome Sequences of Pseudomonas fluorescens Strains PA4C2 and PA3G8 and Pseudomonas putida PA14H7, Three Biocontrol Bacteria against Dickeya Phytopathogens

    PubMed Central

    Cigna, Jérémy; Raoul des Essarts, Yannick; Mondy, Samuel; Hélias, Valérie; Beury-Cirou, Amélie

    2015-01-01

    Pseudomonas fluorescens strains PA4C2 and PA3G8 and Pseudomonas putida strain PA14H7 were isolated from potato rhizosphere and show an ability to inhibit the growth of Dickeya phytopathogens. Here, we report their draft genome sequences, which provide a basis for understanding the molecular mechanisms involved in antibiosis against Dickeya. PMID:25635023

  5. Enhanced Exopolymer Production and Chromium Stabilization in Pseudomonas putida Unsaturated Biofilms

    PubMed Central

    Priester, John H.; Olson, Scott G.; Webb, Samuel M.; Neu, Mary P.; Hersman, Larry E.; Holden, Patricia A.

    2006-01-01

    Chromium-contaminated soils threaten surface and groundwater quality at many industrial sites. In vadose zones, indigenous bacteria can reduce Cr(VI) to Cr(III), but the subsequent fate of Cr(III) and the roles of bacterial biofilms are relatively unknown. To investigate, we cultured Pseudomonas putida, a model organism for vadose zone bioremediation, as unsaturated biofilms on membranes overlaying iron-deficient solid media either containing molecular dichromate from potassium dichromate (Cr-only treatment) or with deposits of solid, dichromate-coated hematite (Fe+Cr treatment) to simulate vadose zone conditions. Controls included iron-deficient solid medium and an Fe-only treatment using solid hematite deposits. Under iron-deficient conditions, chromium exposure resulted in lower cell yield and lower amounts of cellular protein and carbohydrate, but providing iron in the form of hematite overcame these toxic effects of Cr. For the Cr and Fe+Cr treatments, Cr(VI) was completely reduced to Cr(III) that accumulated on biofilm cells and extracellular polymeric substances (EPSs). Chromium exposure resulted in elevated extracellular carbohydrates, protein, DNA, and EPS sugars that were relatively enriched in N-acetyl-glucosamine, rhamnose, glucose, and mannose. The proportions of EPS protein and carbohydrate relative to intracellular pools suggested Cr toxicity-mediated cell lysis as the origin. However, DNA accumulated extracellularly in amounts far greater than expected from cell lysis, and Cr was liberated when extracted EPS was treated with DNase. These results demonstrate that Cr accumulation in unsaturated biofilms occurs with enzymatic reduction of Cr(VI), cellular lysis, cellular association, and extracellular DNA binding of Cr(III), which altogether can facilitate localized biotic stabilization of Cr in contaminated vadose zones. PMID:16517647

  6. Structural and kinetic characterization of recombinant 2-hydroxymuconate semialdehyde dehydrogenase from Pseudomonas putida G7

    PubMed Central

    de Araújo, Simara Semíramis; Neves, Cíntia Mara Leal; Guimarães, Samuel Leite; Whitman, Christian P.; Johnson, William H.; Aparicio, Ricardo; Nagem, Ronaldo Alves Pinto

    2016-01-01

    The first enzyme in the oxalocrotonate branch of the naphthalene-degradation lower pathway in Pseudomonas putida G7 is NahI, a 2-hydroxymuconate semialdehyde dehydrogenase required for conversion of 2-hydroxymuconate semialdehyde to 2-hydroxymuconate in the presence of NAD+. NahI is in one family of the NAD(P)+-dependent aldehyde dehydrogenase superfamily (ALDH8). In this work, we report the cloning, expression, purification and preliminary structural and kinetic characterization of the recombinant NahI. The nahI gene was subcloned into a T7 expression vector and the enzyme was overexpressed in Escherichia coli ArcticExpress at 12 ºC as an N-terminal hexa-histidine-tagged fusion protein (6xHis-NahI). After the soluble protein was purified by affinity and size-exclusion chromatography, dynamic light scattering and small-angle X-ray scattering experiments were conducted to analyze the oligomeric state and the overall shape of the enzyme in solution. The protein is a tetramer in solution and has nearly perfect 222 point group symmetry. Protein stability and secondary structure content were also evaluated by a circular dichroism spectroscopy assay under different thermal conditions. Furthermore, kinetic assays were conducted for the recombinant enzyme and, for the first time, KM (1.3 ± 0.3 μM) and kcat (0.9 s−1) values were determined for this enzyme (at presumed NAD+ saturation). NahI is highly specific for its biological substrate (2-hydroxymuconate semialdehyde) and has no activity with salicylaldehyde, another intermediate in the naphthalene-degradation pathway. PMID:26032336

  7. Enhanced 3-methylcatechol production by Pseudomonas putida TODE1 in a two-phase biotransformation system.

    PubMed

    Kongpol, Ajiraporn; Kato, Junichi; Tajima, Takahisa; Pongtharangkul, Thunyarat; Vangnai, Alisa S

    2014-01-01

    In this study, genetically engineered Pseudomonas putida TODE1 served as a biocatalyst for the bioproduction of valuable 3-methylcatechol (3MC) from toluene in an aqueous-organic two-phase system. The two-phase system was used as an approach to increase the biocatalyst efficiency. Among the organic solvent tested, n-decanol offered several benefits including having the highest partitioning of 3MC, with a high 3MC yield and low cell toxicity. The effect of media supplementation with carbon/energy sources (glucose, glycerol, acetate and succinate), divalent metal cations (Mg(2+), Ca(2+), Mn(2+) and Fe(2+)), and short-chain alcohols (ethanol, n-propanol and n-butanol) as a cofactor regeneration system on the toluene dioxygenase (TDO) activity, cell viability, and overall 3MC yield were evaluated. Along with the two-step cell preparation protocol, supplementation of the medium with 4 mM glycerol as a carbon/energy source, and 0.4 mM Fe(2+) as a cofactor for TDO significantly enhanced the 3MC production level. When in combination with the use of n-decanol and n-butanol as the organic phase, a maximum overall 3MC concentration of 31.8 mM (166 mM in the organic phase) was obtained in a small-scale production, while it was at 160.5 mM (333.2 mM in the organic phase) in a 2-L scale. To our knowledge, this is the highest 3MC yield obtained from a TDO-based system so far.

  8. Mechanism for Biotransformation of Nonylphenol Polyethoxylates to Xenoestrogens in Pseudomonas putida

    PubMed Central

    John, Dominic M.; White, Graham F.

    1998-01-01

    A strain of Pseudomonas putida isolated from activated sewage grew aerobically on the xenoestrogen precursor, nonylphenol polyethoxylate (NPEOx, where x is the number of ethoxylate units) as sole carbon source. Comparative growth yields on NPEOav6, NPEOav9, and NPEOav20 (mixtures with average ethoxylate numbers as indicated) were consistent with utilization of all but two ethoxylate units, and the final accumulating metabolite was identified by gas chromatography-mass spectroscopy as nonylphenol diethoxylate (NPEO2). There was no growth on nonylphenol or polyethylene glycols, and there was no evidence for production of carboxylic acid analogs of NPEOx. Biodegradation kinetics measured by high-pressure liquid chromatography (HPLC) for each component in NPEOx mixtures showed that biodegradation proceeded via successive exoscission of the ethoxylate chain and not by direct scission between the second and third ethoxylate residues. The NPEOx-degrading activity was inducible by substrate, and cell extracts of NPEOav9-induced cells were also active on the pure alcohol ethoxylate, dodecyl octaethoxylate (AEO8), producing sequentially, under either aerobic or anaerobic conditions, AEO7, AEO6, AEO5, etc., thus demonstrating that the pathway involved removal of single ethoxylate units. HPLC analysis of 2,4-dinitrophenylhydrazone derivatives revealed acetaldehyde (ethanal) as the sole aldehydic product from either NPEOav9 or AEO8 under either aerobic or anaerobic conditions. We propose a mechanism for biotransformation which involves an oxygen-independent hydroxyl shift from the terminal to the penultimate carbon of the terminal ethoxylate unit of NPEOx and dissociation of the resulting hemiacetal to release acetaldehyde and the next-lower homolog, NPEOx−1, which then undergoes further cycles of the same reaction until x = 2. PMID:9721266

  9. Mechanism for biotransformation of nonylphenol polyethoxylates to Xenoestrogens in Pseudomonas putida.

    PubMed

    John, D M; White, G F

    1998-09-01

    A strain of Pseudomonas putida isolated from activated sewage grew aerobically on the xenoestrogen precursor, nonylphenol polyethoxylate (NPEOx, where x is the number of ethoxylate units) as sole carbon source. Comparative growth yields on NPEOav6, NPEOav9, and NPEOav20 (mixtures with average ethoxylate numbers as indicated) were consistent with utilization of all but two ethoxylate units, and the final accumulating metabolite was identified by gas chromatography-mass spectroscopy as nonylphenol diethoxylate (NPEO2). There was no growth on nonylphenol or polyethylene glycols, and there was no evidence for production of carboxylic acid analogs of NPEOx. Biodegradation kinetics measured by high-pressure liquid chromatography (HPLC) for each component in NPEOx mixtures showed that biodegradation proceeded via successive exoscission of the ethoxylate chain and not by direct scission between the second and third ethoxylate residues. The NPEOx-degrading activity was inducible by substrate, and cell extracts of NPEOav9-induced cells were also active on the pure alcohol ethoxylate, dodecyl octaethoxylate (AEO8), producing sequentially, under either aerobic or anaerobic conditions, AEO7, AEO6, AEO5, etc., thus demonstrating that the pathway involved removal of single ethoxylate units. HPLC analysis of 2,4-dinitrophenylhydrazone derivatives revealed acetaldehyde (ethanal) as the sole aldehydic product from either NPEOav9 or AEO8 under either aerobic or anaerobic conditions. We propose a mechanism for biotransformation which involves an oxygen-independent hydroxyl shift from the terminal to the penultimate carbon of the terminal ethoxylate unit of NPEOx and dissociation of the resulting hemiacetal to release acetaldehyde and the next-lower homolog, NPEOx-1, which then undergoes further cycles of the same reaction until x = 2.

  10. Chromate-Reducing Properties of Soluble Flavoproteins from Pseudomonas putida and Escherichia coli

    PubMed Central

    Ackerley, D. F.; Gonzalez, C. F.; Park, C. H.; Blake, R.; Keyhan, M.; Matin, A.

    2004-01-01

    Cr(VI) (chromate) is a toxic, soluble environmental contaminant. Bacteria can reduce chromate to the insoluble and less toxic Cr(III), and thus chromate bioremediation is of interest. Genetic and protein engineering of suitable enzymes can improve bacterial bioremediation. Many bacterial enzymes catalyze one-electron reduction of chromate, generating Cr(V), which redox cycles, generating excessive reactive oxygen species (ROS). Such enzymes are not appropriate for bioremediation, as they harm the bacteria and their primary end product is not Cr(III). In this work, the chromate reductase activities of two electrophoretically pure soluble bacterial flavoproteins—ChrR (from Pseudomonas putida) and YieF (from Escherichia coli)—were examined. Both are dimers and reduce chromate efficiently to Cr(III) (kcat/Km = ∼2 × 104 M−1 · s−1). The ChrR dimer generated a flavin semiquinone during chromate reduction and transferred >25% of the NADH electrons to ROS. However, the semiquinone was formed transiently and ROS diminished with time. Thus, ChrR probably generates Cr(V), but only transiently. Studies with mutants showed that ChrR protects against chromate toxicity; this is possibly because it preempts chromate reduction by the cellular one-electron reducers, thereby minimizing ROS generation. ChrR is thus a suitable enzyme for further studies. During chromate reduction by YieF, no flavin semiquinone was generated and only 25% of the NADH electrons were transferred to ROS. The YieF dimer may therefore be an obligatory four-electron chromate reducer which in one step transfers three electrons to chromate and one to molecular oxygen. As a mutant lacking this enzyme could not be obtained, the role of YieF in chromate protection could not be directly explored. The results nevertheless suggest that YieF may be an even more suitable candidate for further studies than ChrR. PMID:14766567

  11. Protective role of glycerol against benzene stress: insights from the Pseudomonas putida proteome.

    PubMed

    Bhaganna, Prashanth; Bielecka, Agata; Molinari, Gabriella; Hallsworth, John E

    2016-05-01

    Chemical activities of hydrophobic substances can determine the windows of environmental conditions over which microbial systems function and the metabolic inhibition of microorganisms by benzene and other hydrophobes can, paradoxically, be reduced by compounds that protect against cellular water stress (Bhaganna et al. in Microb Biotechnol 3:701-716, 2010; Cray et al. in Curr Opin Biotechnol 33:228-259, 2015a). We hypothesized that this protective effect operates at the macromolecule structure-function level and is facilitated, in part at least, by genome-mediated adaptations. Based on proteome profiling of the soil bacterium Pseudomonas putida, we present evidence that (1) benzene induces a chaotrope-stress response, whereas (2) cells cultured in media supplemented with benzene plus glycerol were protected against chaotrope stress. Chaotrope-stress response proteins, such as those involved in lipid and compatible-solute metabolism and removal of reactive oxygen species, were increased by up to 15-fold in benzene-stressed cells relative to those of control cultures (no benzene added). By contrast, cells grown in the presence of benzene + glycerol, even though the latter grew more slowly, exhibited only a weak chaotrope-stress response. These findings provide evidence to support the hypothesis that hydrophobic substances induce a chaotropicity-mediated water stress, that cells respond via genome-mediated adaptations, and that glycerol protects the cell's macromolecular systems. We discuss the possibility of using compatible solutes to mitigate hydrocarbon-induced stresses in lignocellulosic biofuel fermentations and for industrial and environmental applications.

  12. Phenol biodegradation by immobilized Pseudomonas putida FNCC-0071 cells in alginate beads

    NASA Astrophysics Data System (ADS)

    Hakim, Lukman Nul; Rochmadi, Sutijan

    2017-06-01

    Phenol is one of industrial liquid waste which is harmful to the environment, so it must be degraded. It can be degraded by immobilized Pseudomonas putida FNCC-0071 cells. It needs the kinetics and mass transfer data to design this process which can be estimated by the proposed dynamic model in this study. This model involves simultaneous diffusion and reaction in the alginate bead and liquid bulk. The preliminary stage of phenol biodegradation process was acclimatization cells. This is the stage where cells were acclimated to phenol as carbon source (substrate). Then the acclimated cells were immobilized in alginate beads by extrusion method. The variation of the initial phenol concentration in the solution is 350 to 850 ppm where 60 g alginate bead contained by cells loaded into its solution in reactor batch, so then biodegradation occurs. In this study, the average radius of alginate bead was 0.152 cm. The occurred kinetic reaction process can be explained by Blanch kinetic model with the decreasing of parameter μmax' while the increasing values of initial phenol concentration in the same time, but the parameters KM, KM', and kt were increasing by the rising values of initial phenol concentration. The value of the parameter β is almost zero. Effective diffusivity of phenol and cells are 1.11 × 10-5±4.5% cm2 s-1 and 1.39 × 10-7± 0.04% cm2 s-1. The partition coefficient of phenol and cells are 0.39 ± 15% and 2.22 ± 18%.

  13. Identification and characterization of the PhhR regulon in Pseudomonas putida.

    PubMed

    Herrera, M Carmen; Duque, Estrella; Rodríguez-Herva, José J; Fernández-Escamilla, Ana M; Ramos, Juan L

    2010-06-01

    Pseudomonas putida is a soil microorganism that utilizes aromatic amino acids present in root exudates as a nitrogen source. We have previously shown that the PhhR transcriptional regulator induces phhAB genes encoding a phenylalanine hydroxylase. In this study we show, using microarray assays and promoter fusions, that PhhR is a global regulator responsible for the activation of genes essential for phenylalanine degradation, phenylalanine homeostasis and other genes of unknown function. Recently, it has been shown that phenylalanine catabolism occurs through more than one pathway. One of these possible pathways involves the metabolism of phenylalanine via tyrosine, p-hydroxyphenylpyruvate, and homogentisate. We identified two genes within this pathway that encode an acyl-CoA transferase involved in the metabolism of acetoacetate. All genes in this pathway were induced in response to phenylalanine in a PhhR-proficient background. The second potential degradative pathway involves the degradation of phenylalanine to produce phenylpyruvate, which seems to be degraded via phenylacetyl-CoA. A number of mutants in the paa genes encoding phenylacetyl-CoA degradation enzymes fail to grow on phenylpyruvate or phenylacetate, further supporting the existence of this second pathway. We found that the PhhR regulon also includes genes involved in the biosynthesis of aromatic amino acids that are repressed in the presence of phenylalanine, suggesting the possibility of feedback at the transcriptional level. In addition, we found that PhhR modulates the level of expression of the broad-substrate-specificity MexEF/OprN efflux pump. Expression from this pump is under the control of mexT gene product because phenylalanine-dependent transcription from the mexE promoter does not occur in a mexT mutant background. These results place PhhR as an important regulator in the control of bacterial responses to aromatic amino acids.

  14. A Novel Insertion Sequence Derepresses Efflux Pump Expression and Preadapts Pseudomonas putida S12 for Extreme Solvent Stress▿

    PubMed Central

    Sun, Xu; Dennis, Jonathan J.

    2009-01-01

    A multidrug efflux pump, SrpABC, plays a key role in Pseudomonas putida S12 tolerance to toxic organic solvents. SrpRS are putative regulators of the SrpABC efflux pump encoded upstream of the srpABC structural genes, and previous studies suggest that SrpS is a repressor of SrpABC expression. An S12 isolate able to withstand extreme solvent stress carries a novel insertion sequence, ISPpu21, interrupting srpS. This insertion preadapts S12 to extreme solvent conditions through constitutive SrpABC expression. PMID:19717594

  15. Metabolite Profiling Reveals Abiotic Stress Tolerance in Tn5 Mutant of Pseudomonas putida

    PubMed Central

    Chaudhry, Vasvi; Bhatia, Anil; Bharti, Santosh Kumar; Mishra, Shashank Kumar; Chauhan, Puneet Singh; Mishra, Aradhana; Sidhu, Om Prakash; Nautiyal, Chandra Shekhar

    2015-01-01

    Pseudomonas is an efficient plant growth–promoting rhizobacteria (PGPR); however, intolerance to drought and high temperature limit its application in agriculture as a bioinoculant. Transposon 5 (Tn5) mutagenesis was used to generate a stress tolerant mutant from a PGPR Pseudomonas putida NBRI1108 isolated from chickpea rhizosphere. A mutant NBRI1108T, selected after screening of nearly 10,000 transconjugants, exhibited significant tolerance towards high temperature and drought. Southern hybridization analysis of EcoRI and XhoI restricted genomic DNA of NBRI1108T confirmed that it had a single Tn5 insertion. The metabolic changes in the polar and non-polar extracts of NBRI1108 and NBRI1108T were examined using 1H, 31P nuclear magnetic resonance (NMR) spectroscopy and gas chromatography-mass spectrometry (GC-MS). Thirty six chemically diverse metabolites consisting of amino acids, fatty acids and phospholipids were identified and quantified. Insertion of Tn5 influenced amino acid and phospholipid metabolism and resulted in significantly higher concentration of aspartic acid, glutamic acid, glycinebetaine, glycerophosphatidylcholine (GPC) and putrescine in NBRI1108T as compared to that in NBRI1108. The concentration of glutamic acid, glycinebetaine and GPC increased by 34%, 95% and 100%, respectively in the NBRI1108T as compared to that in NBRI1108. High concentration of glycerophosphatidylethanolamine (GPE) and undetected GPC in NBRI1108 indicates that biosynthesis of GPE may have taken place via the methylation pathway of phospholipid biosynthesis. However, high GPC and low GPE concentration in NBRI1108T suggest that methylation pathway and phosphatidylcholine synthase (PCS) pathway of phospholipid biosynthesis are being followed in the NBRI1108T. Application of multivariate principal component analysis (PCA) on the quantified metabolites revealed clear variations in NBRI1108 and NBRI1108T in polar and non-polar metabolites. Identification of abiotic stress

  16. High-rate 3-methylcatechol production in Pseudomonas putida strains by means of a novel expression system.

    PubMed

    Hüsken, L E; Beeftink, R; de Bont, J A; Wery, J

    2001-05-01

    The bioconversion of toluene into 3-methylcatechol was studied as a model system for the production of valuable 3-substituted catechols in general. For this purpose, an improved microbial system for the production of 3-methylcatechol was obtained. Pseudomonas putida strains containing the todC1C2BAD genes involved in the conversion of toluene into 3-methylcatechol were used as hosts for introducing extra copies of these genes by means of a novel integrative expression system. A construct was made containing an expression cassette with the todC1C2BAD genes cloned under the control of the inducible regulatory control region for naphthalene and phenanthrene degradation, nagR. Introducing this construct into wild-type P. putida F1, which degrades toluene via 3-methylcatechol, or into mutant P. putida F107, which accumulates 3-methylcatechol, yielded biocatalysts carrying multiple copies of the expression cassette. As a result, up to 14 mM (1.74 g l(-1)) of 3-methylcatechol was accumulated and the specific production rate reached a level of 105 micromol min(-1) g(-1) cell dry weight, which is four times higher than other catechol production systems. It was shown that these properties were kept stable in the biocatalysts without the need for antibiotics in the production process. This is an important step for obtaining designer biocatalysts.

  17. The response of aggregated Pseudomonas putida CP1 cells to UV-C and UV-A/B disinfection.

    PubMed

    Maganha de Almeida, Ana C; Quilty, Bríd

    2016-11-01

    UV radiation is a spread method used worldwide for the disinfection of water. However, much of the research on the disinfection of bacterial cells by UV has focused on planktonic cells. Many bacterial cells in nature are present in clumps or aggregates, and these aggregates, which are more resistant to disinfection than their planktonic counterparts, can be problematic in engineered water systems. The current research used Pseudomonas putida (P. putida) CP1, an environmental and non-pathogenic microorganism which autoaggregates when grown under certain conditions, as a model organism to simulate aggregated cells. The study investigated the response of both the planktonic and the aggregated forms of the bacterium to UV-C (λ = 253.7 nm) and UV-A/B (λ > 300 nm) disinfection at laboratory scale in a minimal medium. The planktonic cells of P. putida CP1 were inactivated within 60 s by UV-C and in 60 min by UV-A/B; however, the aggregated cells required 120 min of UV-C treatment and 240 min of UV-A/B radiation to become inactive. The size of the aggregate was reduced following UV treatment. Although all the cells had lost culturability, viability as measured by the LIVE/DEAD(®) stain and epifluorescence microscopy was not completely lost and the cells all demonstrated regrowth after overnight incubation in the dark.

  18. Biosorption of copper(II) and zinc(II) from aqueous solution by Pseudomonas putida CZ1.

    PubMed

    Chen, Xin Cai; Wang, Yuan Peng; Lin, Qi; Shi, Ji Yan; Wu, Wei Xiang; Chen, Ying Xu

    2005-12-10

    To study Pseudomonas putida CZ1, having high tolerance to copper and zinc on the removal of toxic metals from aqueous solutions, the biosorption of Cu(II) and Zn(II) by living and nonliving P. putida CZ1 were studied as functions of reaction time, initial pH of the solution and metal concentration. It was found that the optimum pH for Zn(II) removal by living and nonliving cells was 5.0, while it was 5.0 and 4.5, respectively, for Cu(II) removal. At the optimal conditions, metal ion biosorption was increased as the initial metal concentration increased. The adsorption data with respect to both metals provide an excellent fit to the Langmuir isotherm. The binding capacity of living cells is significantly higher than that of nonliving cells at tested conditions. It demonstrated that about 40-50% of the metals were actively taken up by P. putida CZ1, with the remainder being passively bound to the bacterium. Moreover, desorption efficiency of Cu(II) and Zn(II) by living cells was 72.5 and 45.6% under 0.1M HCl and it was 95.3 and 83.8% by nonliving cells, respectively. It may be due to Cu(II) and Zn(II) uptake by the living cells enhanced by intracellular accumulation.

  19. Bioconversion of Styrene to Poly(hydroxyalkanoate) (PHA) by the New Bacterial Strain Pseudomonas putida NBUS12

    PubMed Central

    Tan, Giin-Yu Amy; Chen, Chia-Lung; Ge, Liya; Li, Ling; Tan, Swee Ngin; Wang, Jing-Yuan

    2015-01-01

    Styrene is a toxic pollutant commonly found in waste effluents from plastic processing industries. We herein identified and characterized microorganisms for bioconversion of the organic eco-pollutant styrene into a valuable biopolymer medium-chain-length poly(hydroxyalkanoate) (mcl-PHA). Twelve newly-isolated styrene-degrading Pseudomonads were obtained and partial phaC genes were detected by PCR in these isolates. These isolates assimilated styrene to produce mcl-PHA, forming PHA contents between 0.05±0.00 and 23.10±3.25% cell dry mass (% CDM). The best-performing isolate was identified as Pseudomonas putida NBUS12. A genetic analysis of 16S rDNA and phaZ genes revealed P. putida NBUS12 as a genetically-distinct strain from existing phenotypically-similar bacterial strains. This bacterium achieved a final biomass of 1.28±0.10 g L−1 and PHA content of 32.49±2.40% CDM. The extracted polymer was mainly comprised of 3-hydroxyhexanoate (C6 ), 3-hydroxyoctanoate (C8 ), 3-hydroxydecanoate (C10 ), 3-hydroxydodecanoate (C12 ), and 3-hydroxytetradecanoate (C14 ) monomers at a ratio of 2:42:1257:17:1. These results collectively suggested that P. putida NBUS12 is a promising candidate for the biotechnological conversion of styrene into mcl-PHA. PMID:25740622

  20. Experimental and kinetic study on the cometabolic biodegradation of phenol and 4-chlorophenol by psychrotrophic Pseudomonas putida LY1.

    PubMed

    Wang, Qing; Li, Yi; Li, Jing; Wang, Yuming; Wang, Chao; Wang, Peifang

    2015-01-01

    This study investigated the kinetics of phenol and 4-chlorophenol (4-CP) biodegradation by a cold-adapted bacteria, Pseudomonas putida LY1, isolated from Songhua River sediment. The results showed that P. putida LY1 cannot grow on 4-CP as a sole carbon source. P. putida LY1 had the potential to cometabolic biodegrade phenol and 4-CP in a wide range of temperature (varying from 5 to 35 °C) with the optimal temperature around 25 °C. Mixture of phenol and 4-CP were completely removed at two 4-CP concentrations (15 and 40 mg/L) over a wide range of phenol (20-400 mg/L) concentrations, whereby the ratio of 4-CP/biomass (S 2/X) was lower than 0.03. The kinetic models of cometabolic biodegradation of phenol and 4-CP were proposed, considering the growth and nongrowth substrate inhibition. These models successfully simulate the processes of cometabolic degradation of phenol and 4-CP.

  1. Effect of the introduction of the nitrogen-fixing bacteria Pseudomonas putida 23 on the nitrogen balance in soil

    NASA Astrophysics Data System (ADS)

    Shabayev, V. P.

    2010-04-01

    The inoculation of red beets with the nitrogen-fixing bacteria Pseudomonas putida 23 increased the activity of the nitrogen fixation in the rhizosphere of the plants grown on meadow soil in the central part of the Oka River floodplain. The yield of the red beets and the uptake by plants of nitrogen from the soil and from the 15N-labeled nitrogen fertilizer applied on the trial microplot increased significantly. A statistically significant additional fixation of nitrogen from the atmosphere and a positive balance of nitrogen in the soil-plant system without significant changes in the bulk content of the soil nitrogen after the plant growing were found in a greenhouse experiment with the application of P. putida. It can be supposed that the excessive nitrogen determined in this system is related to the incorporation into plants of atmospheric nitrogen fixed in the rhizosphere of the inoculated plants. The application of P. putida 23 makes it possible to decrease the rates of NPK fertilizer by two times without losses in the yield of red beets.

  2. Evaluation of medium-chain-length polyhydroxyalkanoate production by Pseudomonas putida LS46 using biodiesel by-product streams.

    PubMed

    Fu, Jilagamazhi; Sharma, Umesh; Sparling, Richard; Cicek, Nazim; Levin, David B

    2014-07-01

    Medium-chain-length polyhydroxyalkanoate (mcl-PHA) production by Pseudomonas putida LS46 was analyzed in shake-flask-based batch reactions, using pure chemical-grade glycerol (PG), biodiesel-derived "waste" glycerol (WG), and biodiesel-derived "waste" free fatty acids (WFA). Cell growth, substrate consumption, mcl-PHA accumulation within the cells, and the monomer composition of the synthesized biopolymers were monitored. The patterns of mcl-PHA synthesis in P. putida LS46 cells grown on PG and WG were similar but differed from that of cells grown with WFA. Polymer accumulation in glycerol-based cultures was stimulated by nitrogen limitation and plateaued after 48 h in both PG and WG cultures, with a total accumulation of 17.9% cell dry mass and 16.3% cell dry mass, respectively. In contrast, mcl-PHA synthesis was independent of nitrogen concentration in P. putida LS46 cells cultured with WFA, which accumulated to 29% cell dry mass. In all cases, the mcl-PHAs synthesized consisted primarily of 3-hydroxyoctanoate (C(8)) and 3-hydroxydecanoate (C(10)). WG and WFA supported similar or greater cell growth and mcl-PHA accumulation than PG under the experimental conditions used. These results suggest that biodiesel by-product streams could be used as low-cost carbon sources for sustainable mcl-PHA production.

  3. Pumping iron to keep fit: modulation of siderophore secretion helps efficient aromatic utilization in Pseudomonas putida KT2440.

    PubMed

    Joshi, Hiren; Dave, Rachna; Venugopalan, V P

    2014-07-01

    Studies of biotechnology applications of Pseudomonas putida KT2440 have been predominantly focused on regulation and expression of the toluene degradation (TOL) pathway. Unfortunately, there is limited information on the role of other physiological factors influencing aromatic utilization. In this report, we demonstrate that P. putida KT2440 increases its siderophore secretion in response to the availability of benzyl alcohol, a model aromatic substrate. It is argued that accelerated siderophore secretion in response to aromatic substrates provides an iron 'boost' which is required for the effective functioning of the iron-dependent oxygenases responsible for ring opening. Direct evidence for the cardinal role of siderophores in aromatic utilization is provided by evaluation of per capita siderophore secretion and comparative growth assessments of wild-type and siderophore-negative mutant strains grown on an alternative carbon source. Accelerated siderophore secretion can be viewed as a compensatory mechanism in P. putida in the context of its inability to secrete more than one type of siderophore (pyoverdine) or to utilize heterologous siderophores. Stimulated siderophore secretion might be a key factor in successful integration and proliferation of this organism as a bio-augmentation agent for aromatic degradation. It not only facilitates efficient aromatic utilization, but also provides better opportunities for iron assimilation amongst diverse microbial communities, thereby ensuring better survival and proliferation.

  4. Bioconversion of styrene to poly(hydroxyalkanoate) (PHA) by the new bacterial strain Pseudomonas putida NBUS12.

    PubMed

    Tan, Giin-Yu Amy; Chen, Chia-Lung; Ge, Liya; Li, Ling; Tan, Swee Ngin; Wang, Jing-Yuan

    2015-01-01

    Styrene is a toxic pollutant commonly found in waste effluents from plastic processing industries. We herein identified and characterized microorganisms for bioconversion of the organic eco-pollutant styrene into a valuable biopolymer medium-chain-length poly(hydroxyalkanoate) (mcl-PHA). Twelve newly-isolated styrene-degrading Pseudomonads were obtained and partial phaC genes were detected by PCR in these isolates. These isolates assimilated styrene to produce mcl-PHA, forming PHA contents between 0.05±0.00 and 23.10±3.25% cell dry mass (% CDM). The best-performing isolate was identified as Pseudomonas putida NBUS12. A genetic analysis of 16S rDNA and phaZ genes revealed P. putida NBUS12 as a genetically-distinct strain from existing phenotypically-similar bacterial strains. This bacterium achieved a final biomass of 1.28±0.10 g L(-1) and PHA content of 32.49±2.40% CDM. The extracted polymer was mainly comprised of 3-hydroxyhexanoate (C6 ), 3-hydroxyoctanoate (C8 ), 3-hydroxydecanoate (C10 ), 3-hydroxydodecanoate (C12 ), and 3-hydroxytetradecanoate (C14 ) monomers at a ratio of 2:42:1257:17:1. These results collectively suggested that P. putida NBUS12 is a promising candidate for the biotechnological conversion of styrene into mcl-PHA.

  5. Suitability of recombinant Escherichia coli and Pseudomonas putida strains for selective biotransformation of m-nitrotoluene by xylene monooxygenase.

    PubMed

    Meyer, Daniel; Witholt, Bernard; Schmid, Andreas

    2005-11-01

    Escherichia coli JM101(pSPZ3), containing xylene monooxygenase (XMO) from Pseudomonas putida mt-2, catalyzes specific oxidations and reductions of m-nitrotoluene and derivatives thereof. In addition to reactions catalyzed by XMO, we focused on biotransformations by native enzymes of the E. coli host and their effect on overall biocatalyst performance. While m-nitrotoluene was consecutively oxygenated to m-nitrobenzyl alcohol, m-nitrobenzaldehyde, and m-nitrobenzoic acid by XMO, the oxidation was counteracted by an alcohol dehydrogenase(s) from the E. coli host, which reduced m-nitrobenzaldehyde to m-nitrobenzyl alcohol. Furthermore, the enzymatic background of the host reduced the nitro groups of the reactants resulting in the formation of aromatic amines, which were shown to effectively inhibit XMO in a reversible fashion. Host-intrinsic oxidoreductases and their reaction products had a major effect on the activity of XMO during biocatalysis of m-nitrotoluene. P. putida DOT-T1E and P. putida PpS81 were compared to E. coli JM101 as alternative hosts for XMO. These promising strains contained an additional dehydrogenase that oxidized m-nitrobenzaldehyde to the corresponding acid but catalyzed the formation of XMO-inhibiting aromatic amines at a significantly lower level than E. coli JM101.

  6. Integrated bioprocessing for the pH-dependent production of 4-valerolactone from levulinate in Pseudomonas putida KT2440.

    PubMed

    Martin, Collin H; Wu, Danyi; Prather, Kristala L Jones

    2010-01-01

    Enzymes are powerful biocatalysts capable of performing specific chemical transformations under mild conditions, yet as catalysts they remain subject to the laws of thermodynamics, namely, that they cannot catalyze chemical reactions beyond equilibrium. Here we report the phenomenon and application of using extracytosolic enzymes and medium conditions, such as pH, to catalyze metabolic pathways beyond their intracellular catalytic limitations. This methodology, termed "integrated bioprocessing" because it integrates intracellular and extracytosolic catalysis, was applied to a lactonization reaction in Pseudomonas putida for the economical and high-titer biosynthesis of 4-valerolactone from the inexpensive and renewable source levulinic acid. Mutant paraoxonase I (PON1) was expressed in P. putida, shown to export from the cytosol in Escherichia coli and P. putida using an N-terminal sequence, and demonstrated to catalyze the extracytosolic and pH-dependent lactonization of 4-hydroxyvalerate to 4-valerolactone. With this production system, the titer of 4-valerolactone was enhanced substantially in acidic medium using extracytosolically expressed lactonase versus an intracellular lactonase: from <0.2 g liter(-1) to 2.1 +/- 0.4 g liter(-1) at the shake flask scale. Based on these results, the production of 4-hydroxyvalerate and 4-valerolactone was examined in a 2-liter bioreactor, and titers of 27.1 g liter(-1) and 8.2 g liter(-1) for the two respective compounds were achieved. These results illustrate the utility of integrated bioprocessing as a strategy for enabling production from novel metabolic pathways and enhancing product titers.

  7. Metabolism of chlorofluorocarbons and polybrominated compounds by Pseudomonas putida G786(pHG-2) via an engineered metabolic pathway.

    PubMed Central

    Hur, H G; Sadowsky, M J; Wackett, L P

    1994-01-01

    The recombinant bacterium Pseudomonas putida G786(pHG-2) metabolizes pentachloroethane to glyoxylate and carbon dioxide, using cytochrome P-450CAM and toluene dioxygenase to catalyze consecutive reductive and oxidative dehalogenation reactions (L.P. Wackett, M.J. Sadowsky, L.N. Newman, H.-G. Hur, and S. Li, Nature [London] 368:627-629, 1994). The present study investigated metabolism of brominated and chlorofluorocarbon compounds by the recombinant strain. Under anaerobic conditions, P. putida G786(pHG-2) reduced 1,1,2,2-tetrabromoethane, 1,2-dibromo-1,2-dichloroethane, and 1,1,1,2-tetrachloro-2,2-difluoroethane to products bearing fewer halogen substituents. Under aerobic conditions, P. putida G786(pHG-2) oxidized cis- and trans-1,2-dibromoethenes, 1,1-dichloro-2,2-difluoroethene, and 1,2-dichloro-1-fluoroethene. Several compounds were metabolized by sequential reductive and oxidative reactions via the constructed metabolic pathway. For example, 1,1,2,2-tetrabromoethane was reduced by cytochrome P-450CAM to 1,2-dibromoethenes, which were subsequently oxidized by toluene dioxygenase. The same pathway metabolized 1,1,1,2-tetrachloro-2,2-difluoroethane to oxalic acid as one of the final products. The results obtained in this study indicate that P. putida G786(pHG-2) metabolizes polyfluorinated, chlorinated, and brominated compounds and further demonstrates the value of using a knowledge of catabolic enzymes and recombinant DNA technology to construct useful metabolic pathways. PMID:7993096

  8. Taxis of Pseudomonas putida F1 toward Phenylacetic Acid Is Mediated by the Energy Taxis Receptor Aer2

    PubMed Central

    Luu, Rita A.; Schneider, Benjamin J.; Ho, Christie C.; Nesteryuk, Vasyl; Ngwesse, Stacy E.; Liu, Xianxian; Parales, Juanito V.; Ditty, Jayna L.

    2013-01-01

    The phenylacetic acid (PAA) degradation pathway is a widely distributed funneling pathway for the catabolism of aromatic compounds, including the environmental pollutants styrene and ethylbenzene. However, bacterial chemotaxis to PAA has not been studied. The chemotactic strain Pseudomonas putida F1 has the ability to utilize PAA as a sole carbon and energy source. We identified a putative PAA degradation gene cluster (paa) in P. putida F1 and demonstrated that PAA serves as a chemoattractant. The chemotactic response was induced during growth with PAA and was dependent on PAA metabolism. A functional cheA gene was required for the response, indicating that PAA is sensed through the conserved chemotaxis signal transduction system. A P. putida F1 mutant lacking the energy taxis receptor Aer2 was deficient in PAA taxis, indicating that Aer2 is responsible for mediating the response to PAA. The requirement for metabolism and the role of Aer2 in the response indicate that P. putida F1 uses energy taxis to detect PAA. We also revealed that PAA is an attractant for Escherichia coli; however, a mutant lacking a functional Aer energy receptor had a wild-type response to PAA in swim plate assays, suggesting that PAA is detected through a different mechanism in E. coli. The role of Aer2 as an energy taxis receptor provides the potential to sense a broad range of aromatic growth substrates as chemoattractants. Since chemotaxis has been shown to enhance the biodegradation of toxic pollutants, the ability to sense PAA gradients may have implications for the bioremediation of aromatic hydrocarbons that are degraded via the PAA pathway. PMID:23377939

  9. Taxis of Pseudomonas putida F1 toward phenylacetic acid is mediated by the energy taxis receptor Aer2.

    PubMed

    Luu, Rita A; Schneider, Benjamin J; Ho, Christie C; Nesteryuk, Vasyl; Ngwesse, Stacy E; Liu, Xianxian; Parales, Juanito V; Ditty, Jayna L; Parales, Rebecca E

    2013-04-01

    The phenylacetic acid (PAA) degradation pathway is a widely distributed funneling pathway for the catabolism of aromatic compounds, including the environmental pollutants styrene and ethylbenzene. However, bacterial chemotaxis to PAA has not been studied. The chemotactic strain Pseudomonas putida F1 has the ability to utilize PAA as a sole carbon and energy source. We identified a putative PAA degradation gene cluster (paa) in P. putida F1 and demonstrated that PAA serves as a chemoattractant. The chemotactic response was induced during growth with PAA and was dependent on PAA metabolism. A functional cheA gene was required for the response, indicating that PAA is sensed through the conserved chemotaxis signal transduction system. A P. putida F1 mutant lacking the energy taxis receptor Aer2 was deficient in PAA taxis, indicating that Aer2 is responsible for mediating the response to PAA. The requirement for metabolism and the role of Aer2 in the response indicate that P. putida F1 uses energy taxis to detect PAA. We also revealed that PAA is an attractant for Escherichia coli; however, a mutant lacking a functional Aer energy receptor had a wild-type response to PAA in swim plate assays, suggesting that PAA is detected through a different mechanism in E. coli. The role of Aer2 as an energy taxis receptor provides the potential to sense a broad range of aromatic growth substrates as chemoattractants. Since chemotaxis has been shown to enhance the biodegradation of toxic pollutants, the ability to sense PAA gradients may have implications for the bioremediation of aromatic hydrocarbons that are degraded via the PAA pathway.

  10. Effects of low-molecular-weight organic ligands and phosphate on adsorption of Pseudomonas putida by clay minerals and iron oxide.

    PubMed

    Wu, Huayong; Jiang, Daihua; Cai, Peng; Rong, Xingmin; Huang, Qiaoyun

    2011-01-01

    Adsorption of Pseudomonas putida on kaolinite, montmorillonite and goethite was studied in the presence of organic ligands and phosphate. Citrate, tartrate, oxalate and phosphate showed inhibitive effect on P. putida adsorption by three minerals in a broad range of anion concentrations. The highest efficiencies of the four ligands in blocking the adsorption of P. putida on goethite, kaolinite and montmorillonite were 58-90%, 35-76% and 20-48%, respectively. The ability of organic ligands in prohibiting the binding of P. putida cells to the minerals followed the sequence of citrate>tartrate>oxalate>acetate. The significant suppressive effects on P. putida adsorption were ascribed to the increased negative charges by adsorbed ligands and the competition of ligands with bacterial surface groups for binding sites. The inhibitive effects on P. putida adsorption by organic ligands were also dependent on the steric hindrance of the molecules. Acetate presented promotive effect on P. putida adsorption by kaolinite and goethite at low anion concentrations. The results obtained in this study suggested that the adsorption of bacteria in soils especially in the rhizosphere can significantly be impacted by various organic and inorganic anions. Copyright © 2010 Elsevier B.V. All rights reserved.

  11. Sustainable production of valuable compound 3-succinoyl-pyridine by genetically engineering Pseudomonas putida using the tobacco waste

    PubMed Central

    Wang, Weiwei; Xu, Ping; Tang, Hongzhi

    2015-01-01

    Treatment of solid and liquid tobacco wastes with high nicotine content remains a longstanding challenge. Here, we explored an environmentally friendly approach to replace tobacco waste disposal with resource recovery by genetically engineering Pseudomonas putida. The biosynthesis of 3-succinoyl-pyridine (SP), a precursor in the production of hypotensive agents, from the tobacco waste was developed using whole cells of the engineered Pseudomonas strain, S16dspm. Under optimal conditions in fed-batch biotransformation, the final concentrations of product SP reached 9.8 g/L and 8.9 g/L from aqueous nicotine solution and crude suspension of the tobacco waste, respectively. In addition, the crystal compound SP produced from aqueous nicotine of the tobacco waste in batch biotransformation was of high purity and its isolation yield on nicotine was 54.2%. This study shows a promising route for processing environmental wastes as raw materials in order to produce valuable compounds. PMID:26574178

  12. Sustainable production of valuable compound 3-succinoyl-pyridine by genetically engineering Pseudomonas putida using the tobacco waste.

    PubMed

    Wang, Weiwei; Xu, Ping; Tang, Hongzhi

    2015-11-17

    Treatment of solid and liquid tobacco wastes with high nicotine content remains a longstanding challenge. Here, we explored an environmentally friendly approach to replace tobacco waste disposal with resource recovery by genetically engineering Pseudomonas putida. The biosynthesis of 3-succinoyl-pyridine (SP), a precursor in the production of hypotensive agents, from the tobacco waste was developed using whole cells of the engineered Pseudomonas strain, S16dspm. Under optimal conditions in fed-batch biotransformation, the final concentrations of product SP reached 9.8 g/L and 8.9 g/L from aqueous nicotine solution and crude suspension of the tobacco waste, respectively. In addition, the crystal compound SP produced from aqueous nicotine of the tobacco waste in batch biotransformation was of high purity and its isolation yield on nicotine was 54.2%. This study shows a promising route for processing environmental wastes as raw materials in order to produce valuable compounds.

  13. Liquid chromatography time of flight mass spectrometry based environmental metabolomics for the analysis of Pseudomonas putida Bacteria in potable water.

    PubMed

    Kouremenos, Konstantinos A; Beale, David J; Antti, Henrik; Palombo, Enzo A

    2014-09-01

    Water supply biofilms have the potential to harbour waterborne diseases, accelerate corrosion, and contribute to the formation of tuberculation in metallic pipes. One particular species of bacteria known to be found in the water supply networks is Pseudomonas sp., with the presence of Pseudomonas putida being isolated to iron pipe tubercles. Current methods for detecting and analysis pipe biofilms are time consuming and expensive. The application of metabolomics techniques could provide an alternative method for assessing biofilm risk more efficiently based on bacterial activity. As such, this paper investigates the application of metabolomic techniques and provides a proof-of-concept application using liquid chromatography coupled with time-of-flight mass spectrometry (LC-ToF-MS) to three biologically independent P. putida samples, across five different growth conditions exposed to solid and soluble iron (Fe). Analysis of the samples in +ESI and -ESI mode yielded 887 and 1789 metabolite features, respectively. Chemometric analysis of the +ESI and -ESI data identified 34 and 39 significant metabolite features, respectively, where features were considered significant if the fold change was greater than 2 and obtained a p-value less than 0.05. Metabolite features were subsequently identified according to the Metabolomics Standard Initiative (MSI) Chemical Analysis Workgroup using analytical standards and standard online LC-MS databases. Possible markers for P. putida growth, with and without being exposed to solid and soluble Fe, were identified from a diverse range of different chemical classes of metabolites including nucleobases, nucleosides, dipeptides, tripeptides, amino acids, fatty acids, sugars, and phospholipids. Copyright © 2014 Elsevier B.V. All rights reserved.

  14. Functional characterization of the quorum sensing regulator RsaL in the plant-beneficial strain Pseudomonas putida WCS358.

    PubMed

    Rampioni, Giordano; Bertani, Iris; Pillai, Cejoice Ramachandran; Venturi, Vittorio; Zennaro, Elisabetta; Leoni, Livia

    2012-02-01

    In many bacteria, quorum sensing (QS) systems rely on a signal receptor and a synthase producing N-acyl-homoserine lactone(s) as the signal molecule(s). In some species, the rsaL gene, located between the signal receptor and synthase genes, encodes a repressor limiting signal synthase expression and hence signal molecule production. Here we investigate the molecular mechanism of action of the RsaL protein in the plant growth-promoting rhizobacterium Pseudomonas putida WCS358 (RsaL(WCS)). In P. putida WCS358, RsaL(WCS) displayed a strong repressive effect on the promoter of the QS signal synthase gene, ppuI, while it did not repress the same promoter in Pseudomonas aeruginosa. DNase I protection assays showed that purified RsaL(WCS) specifically binds to ppuI on a DNA region overlapping the predicted σ(70)-binding site, but such protection was observed only at high protein concentrations. Accordingly, electrophoretic mobility shift assays showed that the RsaL(WCS) protein was not able to form stable complexes efficiently with a probe encompassing the ppuI promoter, while it formed stable complexes with the promoter of lasI, the gene orthologous to ppuI in P. aeruginosa. This difference seems to be dictated by the lower dyad symmetry of the RsaL(WCS)-binding sequence on the ppuI promoter relative to that on the lasI promoter. Comparison of the results obtained in vivo and in vitro suggests that RsaL(WCS) needs a molecular interactor/cofactor specific for P. putida WCS358 to repress ppuI transcription. We also demonstrate that RsaL(WCS) regulates siderophore-mediated growth limitation of plant pathogens and biofilm formation, two processes relevant for plant growth-promoting activity.

  15. Functional Characterization of the Quorum Sensing Regulator RsaL in the Plant-Beneficial Strain Pseudomonas putida WCS358

    PubMed Central

    Rampioni, Giordano; Bertani, Iris; Pillai, Cejoice Ramachandran; Venturi, Vittorio; Zennaro, Elisabetta

    2012-01-01

    In many bacteria, quorum sensing (QS) systems rely on a signal receptor and a synthase producing N-acyl-homoserine lactone(s) as the signal molecule(s). In some species, the rsaL gene, located between the signal receptor and synthase genes, encodes a repressor limiting signal synthase expression and hence signal molecule production. Here we investigate the molecular mechanism of action of the RsaL protein in the plant growth-promoting rhizobacterium Pseudomonas putida WCS358 (RsaLWCS). In P. putida WCS358, RsaLWCS displayed a strong repressive effect on the promoter of the QS signal synthase gene, ppuI, while it did not repress the same promoter in Pseudomonas aeruginosa. DNase I protection assays showed that purified RsaLWCS specifically binds to ppuI on a DNA region overlapping the predicted σ70-binding site, but such protection was observed only at high protein concentrations. Accordingly, electrophoretic mobility shift assays showed that the RsaLWCS protein was not able to form stable complexes efficiently with a probe encompassing the ppuI promoter, while it formed stable complexes with the promoter of lasI, the gene orthologous to ppuI in P. aeruginosa. This difference seems to be dictated by the lower dyad symmetry of the RsaLWCS-binding sequence on the ppuI promoter relative to that on the lasI promoter. Comparison of the results obtained in vivo and in vitro suggests that RsaLWCS needs a molecular interactor/cofactor specific for P. putida WCS358 to repress ppuI transcription. We also demonstrate that RsaLWCS regulates siderophore-mediated growth limitation of plant pathogens and biofilm formation, two processes relevant for plant growth-promoting activity. PMID:22113916

  16. An investigation of the iron-sulphur proteins of benzene dioxygenase from Pseudomonas putida by electron-spin-resonance spectroscopy.

    PubMed Central

    Geary, P J; Saboowalla, F; Patil, D; Cammack, R

    1984-01-01

    Benzene dioxygenase from Pseudomonas putida comprises three components, namely a flavoprotein (NADH:ferredoxin oxidoreductase; Mr 81000), an intermediate electron-transfer protein, or ferredoxin (Mr 12000) with a [2Fe-2S] cluster, and a terminal dioxygenase containing two [2Fe-2S] iron-sulphur clusters (Mr 215000), which requires two additional Fe2+ atoms/molecule for oxygenase activity. The ferredoxin and the dioxygenase give e.s.r. signals in the reduced state with rhombic symmetry and average g values of 1.92 and 1.896 respectively. The mid-point redox potentials were determined by e.s.r. titration at pH 7.0 to be -155 mV and -112 mV respectively. The signal from the dioxygenase shows pronounced g anisotropy and most closely resembles those of 4-methoxybenzoate mono-oxygenase from Pseudomonas putida and the [2Fe-2S] 'Rieske' proteins of the quinone-cytochrome c region of electron-transport chains of respiration and photosynthesis. PMID:6324743

  17. Genetic engineering of Pseudomonas putida KT2440 for rapid and high-yield production of vanillin from ferulic acid.

    PubMed

    Graf, Nadja; Altenbuchner, Josef

    2014-01-01

    Vanillin is one of the most important flavoring agents used today. That is why many efforts have been made on biotechnological production from natural abundant substrates. In this work, the nonpathogenic Pseudomonas putida strain KT2440 was genetically optimized to convert ferulic acid to vanillin. Deletion of the vanillin dehydrogenase gene (vdh) was not sufficient to prevent vanillin degradation. Additional inactivation of a molybdate transporter, identified by transposon mutagenesis, led to a strain incapable to grow on vanillin as sole carbon source. The bioconversion was optimized by enhanced chromosomal expression of the structural genes for feruloyl-CoA synthetase (fcs) and enoyl-CoA hydratase/aldolase (ech) by introduction of the strong tac promoter system. Further genetic engineering led to high initial conversion rates and molar vanillin yields up to 86% within just 3 h accompanied with very low by-product levels. To our knowledge, this represents the highest productivity and molar vanillin yield gained with a Pseudomonas strain so far. Together with its high tolerance for ferulic acid, the developed, plasmid-free P. putida strain represents a promising candidate for the biotechnological production of vanillin.

  18. Novel Dehalogenase Mechanism for 2,3-Dichloro-1-Propanol Utilization in Pseudomonas putida Strain MC4

    PubMed Central

    Arif, Muhammad Irfan; Samin, Ghufrana; van Leeuwen, Jan G. E.; Oppentocht, Jantien

    2012-01-01

    A Pseudomonas putida strain (MC4) that can utilize 2,3-dichloro-1-propanol (DCP) and several aliphatic haloacids and haloalcohols as sole carbon and energy source for growth was isolated from contaminated soil. Degradation of DCP was found to start with oxidation and concomitant dehalogenation catalyzed by a 72-kDa monomeric protein (DppA) that was isolated from cell lysate. The dppA gene was cloned from a cosmid library and appeared to encode a protein equipped with a signal peptide and that possessed high similarity to quinohemoprotein alcohol dehydrogenases (ADHs), particularly ADH IIB and ADH IIG from Pseudomonas putida HK. This novel dehalogenating dehydrogenase has a broad substrate range, encompassing a number of nonhalogenated alcohols and haloalcohols. With DCP, DppA exhibited a kcat of 17 s−1. 1H nuclear magnetic resonance experiments indicated that DCP oxidation by DppA in the presence of 2,6-dichlorophenolindophenol (DCPIP) and potassium ferricyanide [K3Fe(CN)6] yielded 2-chloroacrolein, which was oxidized to 2-chloroacrylic acid. PMID:22752160

  19. Organo-mineral interactions in Pseudomonas putida-birnessite assemblages: Impact on mineral reactivity

    NASA Astrophysics Data System (ADS)

    Simanova, Anna; Kroll, Alexandra; Pena, Jasquelin

    2016-04-01

    The ability of microorganisms to precipitate biogenic birnessite nanoparticles is widely spread in the bacterial and fungal trees of life, with this process accounting largely for the formation of birnessite in nature. Birnessite minerals occur typically as nanoparticles that exhibit significant chemical and structural disorder. Furthermore, the mineral is embedded within a biomass matrix composed of microbial cells and extracellular polymeric substances, where the biomass not only provides reactive surfaces but can mediate electron transfer reactions. The overarching question guiding our research is: How do nanoscale properties and admixing with microbial biomass modify the reactivity of Mn oxide minerals? In this study, we investigate the biomass-birnessite composites of Pseudomonas putida GB-1 biomass and δ-MnO2 nanoparticles. We characterized the structure and composition of the mineral fraction using X-ray diffraction, Mn K-edge X-ray absorption spectroscopy and wet-chemical methods. To characterize the biomass fraction, we employed FTIR spectroscopy and size-exclusion chromatography analysis of the extracellular polymeric substances. Finally, we measured Ni(II) sorption isotherms at pH 6 and Ni K-edge EXAFS spectra to determine the extent and mechanism of Ni sorption in the biomass-mineral composites and in biomass-only and mineral-only systems. This approach provided direct and indirect evidence for the extent of organo-mineral interactions in the composites, as well as a direct measure of sorption reactivity in the composites relative to biomass-only and mineral-only systems. We found that admixing of mineral nanoparticles with biomass reduced the reactivity of the edge sites of birnessite particles towards Ni(II) through the attachment of organic moieties to the mineral particles and/or modification of the assemblage surface charge properties. In addition, the interaction of biomass components with MnO2 particles leads to partial Mn(IV) reduction and

  20. Comprehensive analysis of the metabolome of Pseudomonas putida S12 grown on different carbon sources.

    PubMed

    van der Werf, Mariët J; Overkamp, Karin M; Muilwijk, Bas; Koek, Maud M; van der Werff-van der Vat, Bianca J C; Jellema, Renger H; Coulier, Leon; Hankemeier, Thomas

    2008-04-01

    Metabolomics is an emerging, powerful, functional genomics technology that involves the comparative non-targeted analysis of the complete set of metabolites in an organism. We have set-up a robust quantitative metabolomics platform that allows the analysis of 'snapshot' metabolomes. In this study, we have applied this platform for the comprehensive analysis of the metabolite composition of Pseudomonas putida S12 grown on four different carbon sources, i.e. fructose, glucose, gluconate and succinate. This paper focuses on the microbial aspects of analyzing comprehensive metabolomes, and demonstrates that metabolomes can be analyzed reliably. The technical (i.e. sample work-up and analytical) reproducibility was on average 10%, while the biological reproducibility was approximately 40%. Moreover, the energy charge values of the microbial samples generated were determined, and indicated that no biotic or abiotic changes had occurred during sample work-up and analysis. In general, the metabolites present and their concentrations were very similar after growth on the different carbon sources. However, specific metabolites showed large differences in concentration, especially the intermediates involved in the degradation of the carbon sources studied. Principal component discriminant analysis was applied to identify metabolites that are specific for, i.e. not necessarily the metabolites that show those largest differences in concentration, cells grown on either of these four carbon sources. For selected enzymatic reactions, i.e. the glucose-6-phosphate isomerase, triosephosphate isomerase and phosphoglyceromutase reactions, the apparent equilibrium constants (K(app)) were calculated. In several instances a carbon source-dependent deviation between the apparent equilibrium constant (K(app)) and the thermodynamic equilibrium constant (K(eq)) was observed, hinting towards a potential point of metabolic regulation or towards bottlenecks in biosynthesis routes. For glucose-6

  1. Accumulation of polyhydroxyalkanoate from styrene and phenylacetic acid by Pseudomonas putida CA-3.

    PubMed

    Ward, Patrick G; de Roo, Guy; O'Connor, Kevin E

    2005-04-01

    Pseudomonas putida CA-3 is capable of converting the aromatic hydrocarbon styrene, its metabolite phenylacetic acid, and glucose into polyhydroxyalkanoate (PHA) when a limiting concentration of nitrogen (as sodium ammonium phosphate) is supplied to the growth medium. PHA accumulation occurs to a low level when the nitrogen concentration drops below 26.8 mg/liter and increases rapidly once the nitrogen is no longer detectable in the growth medium. The depletion of nitrogen and the onset of PHA accumulation coincided with a decrease in the rate of substrate utilization and biochemical activity of whole cells grown on styrene, phenylacetic acid, and glucose. However, the efficiency of carbon conversion to PHA dramatically increased once the nitrogen concentration dropped below 26.8 mg/liter in the growth medium. When supplied with 67 mg of nitrogen/liter, the carbon-to-nitrogen (C:N) ratios that result in a maximum yield of PHA (grams of PHA per gram of carbon) for styrene, phenylacetic acid, and glucose are 28:1, 21:1, and 18:1, respectively. In cells grown on styrene and phenylacetic acid, decreasing the carbon-to-nitrogen ratio below 28:1 and 21:1, respectively, by increasing the nitrogen concentration and using a fixed carbon concentration leads to lower levels of PHA per cell and lower levels of PHA per batch of cells. Increasing the carbon-to-nitrogen ratio above 28:1 and 21:1 for cells grown on styrene and phenylacetic acid, respectively, by decreasing the nitrogen concentration and using a fixed carbon concentration increases the level of PHA per cell but results in a lower level of PHA per batch of cells. Increasing the carbon and nitrogen concentrations but maintaining the carbon-to-nitrogen ratio of 28:1 and 21:1 for cells grown on styrene and phenylacetic acid, respectively, results in an increase in the total PHA per batch of cells. The maximum yields for PHA from styrene, phenylacetic acid, and glucose are 0.11, 0.17, and 0.22 g of PHA per g of carbon

  2. Draft Genome Sequence of Hydrocarbon-Degrading Pseudomonas putida Strain KG-4, Isolated from Soil Samples Collected from Krishna-Godavari Basin in India.

    PubMed

    Dawar, Chhavi; Aggarwal, Ramesh K

    2015-06-04

    We report here the 5.58-Mb draft genome of Pseudomonas putida strain KG-4 obtained from the oil fields of the Krishna-Godavari basin, Andhra Pradesh, India. The genome sequence is expected to facilitate identification and understanding of genes associated with hydrocarbon metabolism, which can help in developing strategies for managing oil spills and bioremediation.

  3. Complete Genome Sequence of the Polychlorinated Biphenyl-Degrading Bacterium Pseudomonas putida KF715 (NBRC 110667) Isolated from Biphenyl-Contaminated Soil

    PubMed Central

    Yamazoe, Atsushi; Hosoyama, Akira; Kimura, Nobutada; Hirose, Jun; Watanabe, Takahito; Fujihara, Hidehiko; Futagami, Taiki; Goto, Masatoshi; Furukawa, Kensuke

    2017-01-01

    ABSTRACT Pseudomonas putida KF715 (NBRC 110667) utilizes biphenyl as a sole source of carbon and degrades polychlorinated biphenyls (PCBs). Here, we report a complete genome sequence of the KF715 strain, which comprises a circular chromosome and four plasmids. Biphenyl catabolic genes were located on the largest plasmid, pKF715A. PMID:28209826

  4. Purification and properties of catechol 1,2-dioxygenase (pyrocatechase) from Pseudomonas putida mt-2 in comparison with that from Pseudomonas arvilla C-1.

    PubMed

    Nakai, C; Nakazawa, T; Nozaki, M

    1988-12-01

    Catechol 1,2-dioxygenase (pyrocatechase) has been purified to homogeneity from Pseudomonas putida mt-2. Most properties of this enzyme, such as the absorption spectrum, iron content, pH stability, pH optimum, substrate specificity, Km values, and amino acid composition, were similar to those of catechol 1,2-dioxygenase obtained from Pseudomonas arvilla C-1 [Y. Kojima et al. (1967) J. Biol. Chem. 242, 3270-3278]. These two catechol 1,2-dioxygenases were also found, from the results of Ouchterlony double diffusion, to share several antigenic determinants. The molecular weight of the putida enzyme was estimated to be 66,000 and 64,000 by sedimentation equilibrium analysis and Sephadex G-200 gel filtration, respectively. The enzyme gave a single band on sodium dodecyl sulfate-polyacrylamide gel electrophoresis, corresponding to Mr 32,000. The NH2-terminal sequence, which started with threonine, was determined up to 30 residues by Edman degradation. During the degradation, a single amino acid was released at each step. The NH2-terminal sequence up to 20 residues was identical to that of the beta subunit of the arvilla enzyme, with one exception at step 16, at which arginine was observed instead of glutamine. The COOH-terminal residue was deduced to be arginine on carboxypeptidase A and B digestions and on hydrazinolysis. These results indicate that the putida enzyme consists of two identical subunits, in contrast to the arvilla enzyme which consists of two nonidentical subunits, alpha and beta [C. Nakai et al. (1979) Arch. Biochem. Biophys. 195, 12-22], although these two enzymes have very similar properties.

  5. Integrated analysis of gene expression and metabolic fluxes in PHA-producing Pseudomonas putida grown on glycerol.

    PubMed

    Beckers, Veronique; Poblete-Castro, Ignacio; Tomasch, Jürgen; Wittmann, Christoph

    2016-05-03

    Given its high surplus and low cost, glycerol has emerged as interesting carbon substrate for the synthesis of value-added chemicals. The soil bacterium Pseudomonas putida KT2440 can use glycerol to synthesize medium-chain-length poly(3-hydroxyalkanoates) (mcl-PHA), a class of biopolymers of industrial interest. Here, glycerol metabolism in P. putida KT2440 was studied on the level of gene expression (transcriptome) and metabolic fluxes (fluxome), using precisely adjusted chemostat cultures, growth kinetics and stoichiometry, to gain a systematic understanding of the underlying metabolic and regulatory network. Glycerol-grown P. putida KT2440 has a maintenance energy requirement [0.039 (mmolglycerol (gCDW h)(-1))] that is about sixteen times lower than that of other bacteria, such as Escherichia coli, which provides a great advantage to use this substrate commercially. The shift from carbon (glycerol) to nitrogen (ammonium) limitation drives the modulation of specific genes involved in glycerol metabolism, transport electron chain, sensors to assess the energy level of the cell, and PHA synthesis, as well as changes in flux distribution to increase the precursor availability for PHA synthesis (Entner-Doudoroff pathway and pyruvate metabolism) and to reduce respiration (glyoxylate shunt). Under PHA-producing conditions (N-limitation), a higher PHA yield was achieved at low dilution rate (29.7 wt% of CDW) as compared to a high rate (12.8 wt% of CDW). By-product formation (succinate, malate) was specifically modulated under these regimes. On top of experimental data, elementary flux mode analysis revealed the metabolic potential of P. putida KT2440 to synthesize PHA and identified metabolic engineering targets towards improved production performance on glycerol. This study revealed the complex interplay of gene expression levels and metabolic fluxes under PHA- and non-PHA producing conditions using the attractive raw material glycerol as carbon substrate. This

  6. Toxicity of differently sized and coated silver nanoparticles to the bacterium Pseudomonas putida: risks for the aquatic environment?

    PubMed

    Matzke, Marianne; Jurkschat, Kerstin; Backhaus, Thomas

    2014-07-01

    Aim of this study was to describe the toxicity of a set of different commercially available silver nanoparticles (AgNPs) to the gram-negative bacterium Pseudomonas putida (growth inhibition assay, ISO 10712) in order to contribute to their environmental hazard and risk assessment. Different AgNP sizes and coatings were selected in order to analyze whether those characteristics are determinants of nanoparticle toxicity. Silver nitrate was tested for comparison. In general Pseudomonas putida reacted very sensitive towards the exposure to silver, with an EC05 value of 0.043 μg L−1 for AgNO3 and between 0.13 and 3.41 μg L−1 for the different AgNPs (EC50 values 0.16 μg L−1 for AgNO3, resp. between 0.25 and 13.4 μg L−1 for AgNPs). As the ionic form of silver is clearly the most toxic, an environmental hazard assessment for microorganisms based on total silver concentration and the assumption that AgNPs dissolve is sufficiently protective. Neither specific coatings nor certain sizes could be linked to increasing or decreasing toxicity. The characterization of particle behavior as well as the total and dissolved silver content in the medium during the exposures was not possible due to the high sensitivity of Pseudomonas (test concentrations were below detection limits), indicating the need for further development in the analytical domain. Monitored silver concentrations in the aquatic environment span six orders of magnitude (0.1–120,000 ng L−1), which falls into the span of observed EC05 values and might hence indicate a risk to environmental bacteria.

  7. Production of medium chain length polyhydroxyalkanoate in metabolic flux optimized Pseudomonas putida

    PubMed Central

    2014-01-01

    Background Pseudomnas putida is a natural producer of medium chain length polyhydroxyalkanoates (mcl-PHA), a polymeric precursor of bioplastics. A two-fold increase of mcl-PHA production via inactivation of the glucose dehydrogenase gene gcd, limiting the metabolic flux towards side products like gluconate was achieved before. Here, we investigated the overproduction of enzymes catalyzing limiting steps of mcl-PHA precursor formation. Results A genome-based in silico model for P. putida KT2440 metabolism was employed to identify potential genetic targets to be engineered for the improvement of mcl-PHA production using glucose as sole carbon source. Here, overproduction of pyruvate dehydrogenase subunit AcoA in the P. putida KT2440 wild type and the Δgcd mutant strains led to an increase of PHA production. In controlled bioreactor batch fermentations PHA production was increased by 33% in the acoA overexpressing wild type and 121% in the acoA overexpressing Δgcd strain in comparison to P. putida KT2440. Overexpression of pgl-encoding 6-phosphoglucolactonase did not influence PHA production. Transcriptome analyses of engineered PHA producing P. putida in comparison to its parental strains revealed the induction of genes encoding glucose 6-phosphate dehydrogenase and pyruvate dehydrogenase. In addition, NADPH seems to be quantitatively consumed for efficient PHA synthesis, since a direct relationship between low levels of NADPH and high concentrations of the biopolymer were observed. In contrast, intracellular levels of NADH were found increased in PHA producing organisms. Conclusion Production of mcl-PHAs was enhanced in P. putida when grown on glucose via overproduction of a pyruvate dehydrogenase subunit (AcoA) in combination with a deletion of the glucose dehydrogenase (gcd) gene as predicted by in silico elementary flux mode analysis. PMID:24948031

  8. Contrasting colonization and plant growth promoting capacity between wild type and gfp-derative of the endophyte Pseudomonas putida W619 in hybrid poplar

    SciTech Connect

    Weyens N.; van der Lelie D.; Boulet, J.; Adriaensen, D.; Timmermans, J.-P.; Prinsen, E.; Van Oevelen, S.; D"Haen, J.; Smeets, K.; Taghavi, S.; Vangronsveld, J.

    2011-06-09

    This study aims to investigate the colonization of poplar by the endophyte Pseudomonas putida W619 and its capacity to promote plant growth. Poplar cuttings were inoculated with P. putida W619 (wild-type or gfp-labelled). The colonization of both strains was investigated and morphological, physiological and biochemical parameters were analyzed to evaluate plant growth promotion. Inoculation with P. putida W619 (wild-type) resulted in remarkable growth promotion, decreased activities of antioxidative defence related enzymes, and reduced stomatal resistance, all indicative of improved plant health and growth in comparison with the non-inoculated cuttings. In contrast, inoculation with gfp-labelled P. putida W619 did not promote growth; it even had a negative effect on plant health and growth. Furthermore, compared to the wildtype strain, colonization by the gfp-labelled P. putida W619::gfp1 was much lower; it only colonized the rhizosphere and root cortex while the wild-type strain also colonized the root xylem vessels. Despite the strong plant growth promoting capacity of P. putida W619 (wild-type), after gfp labelling its growth promoting characteristics disappeared and its colonization capacity was strongly influenced; for these reasons gfp labelling should be applied with sufficient caution.

  9. Global Genome Comparative Analysis Reveals Insights of Resistome and Life-Style Adaptation of Pseudomonas putida Strain T2-2 in Oral Cavity

    PubMed Central

    How, Kah Yan; Yin, Wai-Fong; Chan, Kok-Gan

    2014-01-01

    Most Pseudomonas putida strains are environmental microorganisms exhibiting a wide range of metabolic capability but certain strains have been reported as rare opportunistic pathogens and some emerged as multidrug resistant P. putida. This study aimed to assess the drug resistance profile of, via whole genome analysis, P. putida strain T2-2 isolated from oral cavity. At the same time, we also compared the nonenvironmental strain with environmentally isolated P. putida. In silico comparative genome analysis with available reference strains of P. putida shows that T2-2 has lesser gene counts on carbohydrate and aromatic compounds metabolisms, which suggested its little versatility. The detection of its edd gene also suggested T2-2's catabolism of glucose via ED pathway instead of EMP pathway. On the other hand, its drug resistance profile was observed via in silico gene prediction and most of the genes found were in agreement with drug-susceptibility testing in laboratory by automated VITEK 2. In addition, the finding of putative genes of multidrug resistance efflux pump and ATP-binding cassette transporters in this strain suggests a multidrug resistant phenotype. In summary, it is believed that multiple metabolic characteristics and drug resistance in P. putida strain T2-2 helped in its survival in human oral cavity. PMID:25436236

  10. Genome-scale reconstruction and analysis of the Pseudomonas putida KT2440 metabolic network facilitates applications in biotechnology.

    PubMed

    Puchałka, Jacek; Oberhardt, Matthew A; Godinho, Miguel; Bielecka, Agata; Regenhardt, Daniela; Timmis, Kenneth N; Papin, Jason A; Martins dos Santos, Vítor A P

    2008-10-01

    A cornerstone of biotechnology is the use of microorganisms for the efficient production of chemicals and the elimination of harmful waste. Pseudomonas putida is an archetype of such microbes due to its metabolic versatility, stress resistance, amenability to genetic modifications, and vast potential for environmental and industrial applications. To address both the elucidation of the metabolic wiring in P. putida and its uses in biocatalysis, in particular for the production of non-growth-related biochemicals, we developed and present here a genome-scale constraint-based model of the metabolism of P. putida KT2440. Network reconstruction and flux balance analysis (FBA) enabled definition of the structure of the metabolic network, identification of knowledge gaps, and pin-pointing of essential metabolic functions, facilitating thereby the refinement of gene annotations. FBA and flux variability analysis were used to analyze the properties, potential, and limits of the model. These analyses allowed identification, under various conditions, of key features of metabolism such as growth yield, resource distribution, network robustness, and gene essentiality. The model was validated with data from continuous cell cultures, high-throughput phenotyping data, (13)C-measurement of internal flux distributions, and specifically generated knock-out mutants. Auxotrophy was correctly predicted in 75% of the cases. These systematic analyses revealed that the metabolic network structure is the main factor determining the accuracy of predictions, whereas biomass composition has negligible influence. Finally, we drew on the model to devise metabolic engineering strategies to improve production of polyhydroxyalkanoates, a class of biotechnologically useful compounds whose synthesis is not coupled to cell survival. The solidly validated model yields valuable insights into genotype-phenotype relationships and provides a sound framework to explore this versatile bacterium and to

  11. Genome-Scale Reconstruction and Analysis of the Pseudomonas putida KT2440 Metabolic Network Facilitates Applications in Biotechnology

    PubMed Central

    Godinho, Miguel; Bielecka, Agata; Regenhardt, Daniela; Timmis, Kenneth N.

    2008-01-01

    A cornerstone of biotechnology is the use of microorganisms for the efficient production of chemicals and the elimination of harmful waste. Pseudomonas putida is an archetype of such microbes due to its metabolic versatility, stress resistance, amenability to genetic modifications, and vast potential for environmental and industrial applications. To address both the elucidation of the metabolic wiring in P. putida and its uses in biocatalysis, in particular for the production of non-growth-related biochemicals, we developed and present here a genome-scale constraint-based model of the metabolism of P. putida KT2440. Network reconstruction and flux balance analysis (FBA) enabled definition of the structure of the metabolic network, identification of knowledge gaps, and pin-pointing of essential metabolic functions, facilitating thereby the refinement of gene annotations. FBA and flux variability analysis were used to analyze the properties, potential, and limits of the model. These analyses allowed identification, under various conditions, of key features of metabolism such as growth yield, resource distribution, network robustness, and gene essentiality. The model was validated with data from continuous cell cultures, high-throughput phenotyping data, 13C-measurement of internal flux distributions, and specifically generated knock-out mutants. Auxotrophy was correctly predicted in 75% of the cases. These systematic analyses revealed that the metabolic network structure is the main factor determining the accuracy of predictions, whereas biomass composition has negligible influence. Finally, we drew on the model to devise metabolic engineering strategies to improve production of polyhydroxyalkanoates, a class of biotechnologically useful compounds whose synthesis is not coupled to cell survival. The solidly validated model yields valuable insights into genotype–phenotype relationships and provides a sound framework to explore this versatile bacterium and to

  12. Interaction of Pseudomonas putida with kaolinite and montmorillonite: a combination study by equilibrium adsorption, ITC, SEM and FTIR.

    PubMed

    Rong, Xingmin; Huang, Qiaoyun; He, Xiaomin; Chen, Hao; Cai, Peng; Liang, Wei

    2008-06-15

    Equilibrium adsorption along with isothermal titration calorimetry (ITC), Fourier transform infrared spectra (FTIR) and scanning electron microscopy (SEM) techniques were employed to investigate the adsorption of Pseudomonas putida on kaolinite and montmorillonite. A higher affinity as well as larger amounts of adsorption of P. putida was found on kaolinite. The majority of sorbed bacterial cells (88.7%) could be released by water from montmorillonite, while only a small proportion (9.3%) of bacteria desorbed from kaolinite surface. More bacterial cells were observed to form aggregates with kaolinite, while fewer cells were within the larger bacteria-montmorillonite particles. The sorption of bacteria on kaolinite was enthalpically more favorable than that on montmorillonite. Based on our findings, it is proposed that the non-electrostatic forces other than electrostatic force play a more important role in bacterial adsorption by kaolinite and montmorillonite. Adsorption of bacteria on clay minerals resulted in obvious shifts of infrared absorption bands of water molecules, showing the importance of hydrogen bonding in bacteria-clay mineral adsorption. The enthalpies of -4.1+/-2.1 x 10(-8) and -2.5+/-1.4 x 10(-8)mJ cell(-1) for the adsorption of bacteria on kaolinite and montmorillonite, respectively, at 25 degrees C and pH 7.0 were firstly reported in this paper. The enthalpy of bacteria-mineral adsorption was higher than that reported previously for bacteria-biomolecule interaction but lower than that of bacterial coaggregation. The bacteria-mineral adsorption enthalpies increased at higher temperature, suggesting that the enthalpy-entropy compensation mechanism could be involved in the adsorption of P. putida on clay minerals. Data obtained in this study would provide valuable information for a better understanding of the mechanisms of mineral-microorganism interactions in soil and associated environments.

  13. Gibberellin secreting rhizobacterium, Pseudomonas putida H-2-3 modulates the hormonal and stress physiology of soybean to improve the plant growth under saline and drought conditions.

    PubMed

    Kang, Sang-Mo; Radhakrishnan, Ramalingam; Khan, Abdul Latif; Kim, Min-Ji; Park, Jae-Man; Kim, Bo-Ra; Shin, Dong-Hyun; Lee, In-Jung

    2014-11-01

    The physiological changes in tolerant soybean plants under salt and drought stress conditions with Pseudomonas putida H-2-3 were investigated. A bacterial isolate H-2-3 was isolated from soil and identified as Pseudomonas putida H-2-3 by 16S rDNA sequences. The treatment of P. putida H-2-3 significantly increased the length, fresh and dry weight of shoot and chlorophyll content in gibberellins (GAs) deficient mutant Waito-c rice seedlings over the control, it might be the presence of GA1, GA4, GA9 and GA20. The soybean plant growth was retarded in salt (120 mM sodium chloride) and drought (15% polyethylene glycol) stress conditions at 10 days treatments, while P. putida H-2-3 effectively enhanced the shoot length and fresh weight of plants suffered at salt and drought stress. The chlorophyll content was lower in abiotic stress conditions and bacterial inoculant P. putida H-2-3 mitigated the stress effects by an evidence of higher quantity of chlorophyll content in plants exposed to salt and drought. The stress hormonal analysis revealed that individual treatment of P. putida H-2-3, salt and drought significantly enhanced the abscisic acid and salicylic acid content than their control. P. putida H-2-3 applied to salt and drought stressed plants showed a lower level of abscisic acid and salicylic acid and a higher level of jasmonic acid content. Under stress condition induced by salt and drought in plants expressed higher level of total polyphenol, superoxide dismutase and radical scavenging activity and no significant changes in flavonoids. The bio-inoculant, P. putida H-2-3 modulated those antioxidants by declining superoxide dismutase, flavonoids and radical scavenging activity. P. putida H-2-3 induced tolerance against abiotic stress was confirmed by a reduction of Na content in abiotic stressed plants. The results suggest that P. putida H-2-3 application reprograms the chlorophyll, stress hormones and antioxidants expression in abiotic stress affected

  14. Antimicrobial effect of Al2O3, Ag and Al2O3/Ag thin films on Escherichia coli and Pseudomonas putida

    NASA Astrophysics Data System (ADS)

    Angelov, O.; Stoyanova, D.; Ivanova, I.; Todorova, S.

    2016-10-01

    The influence of Al2O3, Ag and Al2O3/Ag thin films on bacterial growth of Gramnegative bacteria Pseudomonas putida and Escherichia coli is studied. The nanostructured thin films are deposited on glass substrates without intentional heating through r.f. magnetron sputtering in Ar atmosphere of Al2O3 and Ag targets or through sequential sputtering of Al2O3 and Ag targets, respectively. The individual Ag thin films (thickness 8 nm) have a weak bacteriostatic effect on Escherichia coli expressed as an extended adaptive phase of the bacteria up to 5 hours from the beginning of the experiment, but the final effect is only 10 times lower bacterial density than in the control. The individual Al2O3 film (20 nm) has no antibacterial effect against two strains E. coli - industrial and pathogenic. The Al2O3/Ag bilayer films (Al2O3 20 nm/Ag 8 nm) have strong bactericidal effect on Pseudomonas putida and demonstrate an effective time of disinfection for 2 hours. The individual films Al2O3 and Ag have not pronounced antibacterial effect on Pseudomonas putida. A synergistic effect of Al2O3/Ag bilayer films in formation of oxidative species on the surface in contact with the bacterial suspension could be a reason for their antimicrobial effect on E. coli and P. putida.

  15. Cloning and Characterization of the pnb Genes, Encoding Enzymes for 4-Nitrobenzoate Catabolism in Pseudomonas putida TW3

    PubMed Central

    Hughes, Michelle A.; Williams, Peter A.

    2001-01-01

    Pseudomonas putida strain TW3 is able to metabolize 4-nitrotoluene via 4-nitrobenzoate (4NBen) and 3, 4-dihydroxybenzoic acid (protocatechuate [PCA]) to central metabolites. We have cloned, sequenced, and characterized a 6-kbp fragment of TW3 DNA which contains five genes, two of which encode the enzymes involved in the catabolism of 4NBen to PCA. In order, they encode a 4NBen reductase (PnbA) which is responsible for catalyzing the direct reduction of 4NBen to 4-hydroxylaminobenzoate with the oxidation of 2 mol of NADH per mol of 4NBen, a reductase-like enzyme (Orf1) which appears to have no function in the pathway, a regulator protein (PnbR) of the LysR family, a 4-hydroxylaminobenzoate lyase (PnbB) which catalyzes the conversion of 4-hydroxylaminobenzoate to PCA and ammonium, and a second lyase-like enzyme (Orf2) which is closely associated with pnbB but appears to have no function in the pathway. The central pnbR gene is transcribed in the opposite direction to the other four genes. These genes complete the characterization of the whole pathway of 4-nitrotoluene catabolism to the ring cleavage substrate PCA in P. putida strain TW3. PMID:11157934

  16. Toxicities effects of pharmaceutical, olive mill and textile wastewaters before and after degradation by Pseudomonas putida mt-2

    PubMed Central

    2012-01-01

    Background Removal of numerous classes of chemical pollutants from the industrial wastewater such as textile, pharmaceutical and olive mill using conventional wastewater treatment, is incomplete and several studies suggested that improvement of this situation would require the application of biological treatment techniques. Dyes, polyphenols and drugs are an environmental pollutants extremely toxics to plants and other living organisms including humans. These effluents were previously treated by Pseudomonas putida. The main of this work was to evaluate the in vivo toxicity of the three wastewaters. Methods Writhes and convulsant effect of effluents were carried out and were compared to the treated effluents. Only pharmaceutical wastewater was exhibited a convulsant effect which observed in mice treated by effluent. On the other hand, all industrial wastewater induced significantly an algogenic effects particularly when mice were treated by the pharmaceutical wastewater (Number of writhes = 44). Conclusion Toxicity was totally removed when mice were treated by the bio remediated effluent. This indicates that P. putida was able to completely detoxify the toxic industrial effluent. PMID:22314194

  17. Regulation of the degradative pathway enzymes coded for by the TOL plasmid (pWWO) from Pseudomonas putida mt-2.

    PubMed Central

    Worsey, M J; Franklin, F C; Williams, P A

    1978-01-01

    Pseudomonas putida mt-2 carries a plasmid (TOL, pWWO) which codes for a single set of enzymes responsible for the catabolism of toluene and m- and p-xylene to central metabolites by way of benzoate and m- and p-toluate, respectively, and subsequently by a meta cleavage pathway. Characterization of strains with mutations in structural genes of this pathway demonstrates that the inducers of the enzymes responsible for further degradation of m-toluate include m-xylene, m-methylbenzyl alcohol, and m-toluate, whereas the inducers of the enzymes responsible for oxidation of m-xylene to m-toluate include m-xylene and m-methylbenzyl alcohol but not m-toluate. A regulatory mutant is described in which m-xylene and m-methylbenzyl alcohol no longer induce any of the pathway enzymes, but m-toluate is still able to induce the enzymes responsible for its own degradation. Among revertants of this mutant are some strains in which all the enzymes are expressed constitutively and are not further induced by m-xylene. A model is proposed for the regulation of the pathway in which the enzymes are in two regulatory blocks, which are under the control of two regulator gene products. The model is essentially the same as proposed earlier for the regulation of the isofunctional pathway on the TOL20 plasmid from P. putida MT20. PMID:659369

  18. Hydrogen formation by an arsenate-reducing Pseudomonas putida, isolated from arsenic-contaminated groundwater in West Bengal, India.

    PubMed

    Freikowski, Dominik; Winter, Josef; Gallert, Claudia

    2010-12-01

    Anaerobic growth of a newly isolated Pseudomonas putida strain WB from an arsenic-contaminated soil in West Bengal, India on glucose, L: -lactate, and acetate required the presence of arsenate, which was reduced to arsenite. During aerobic growth in the presence of arsenite arsenate was formed. Anaerobic growth of P. putida WB on glucose was made possible presumably by the non-energy-conserving arsenate reductase ArsC with energy derived only from substrate level phosphorylation. Two moles of acetate were generated intermediarily and the reducing equivalents of glycolysis and pyruvate decarboxylation served for arsenate reduction or were released as H(2). Anaerobic growth on acetate and lactate was apparently made possible by arsenate reductase ArrA coupled to respiratory electron chain energy conservation. In the presence of arsenate, both substrates were totally oxidized to CO(2) and H(2) with part of the H(2) serving for respiratory arsenate reduction to deliver energy for growth. The growth yield for anaerobic glucose degradation to acetate was Y (Glucose) = 20 g/mol, leading to an energy coefficient of Y (ATP) = 10 g/mol adenosine-5'-triphosphate (ATP), if the Emden-Meyerhof-Parnas pathway with generation of 2 mol ATP/mol glucose was used. During growth on lactate and acetate no substrate chain phosphorylation was possible. The energy gain by reduction of arsenate was Y (Arsenate) = 6.9 g/mol, which would be little less than one ATP/mol of arsenate.

  19. Antimicrobial effects of selected plant essential oils on the growth of a Pseudomonas putida strain isolated from meat.

    PubMed

    Oussalah, Mounia; Caillet, Stéphane; Saucier, Linda; Lacroix, Monique

    2006-06-01

    The inhibitory effect of 60 different essential oils was evaluated on a Pseudomonas putida strain of meat origin, associated with meat spoilage. Essential oils were tested at concentrations from 0.003 to 0.8% (wt/vol) to determine minimum inhibitory and maximal tolerated concentrations (MIC and MTC, respectively) using an agar medium culture. Of the 60 samples tested, Corydothymus capitatus essential oil was the most active showing a MIC of 0.025% and a MTC of 0.06%. Seven essential oils (Cinnamomum cassia, Origanum compactum, Origanum heracleoticum, Satureja hortensis, Satureja montana, Thymus vulgaris carvacroliferum, Thymus vulgaris thymoliferum) have shown a strong antimicrobial activity against P. putida with a MIC of 0.05% and a MTC ranging from 0.013% to 0.025%. Ten other oils (Cinnamomum verum (leaf and bark), Eugenia caryophyllus, Cymbopogon martinii var. motia, Cymbopogon nardus, Melaleuca linariifolia, Origanum majorana, Pimenta dioica, Thymus satureoides, Thymus serpyllum) showed a high antimicrobial activity showing a MIC ranging from 0.1% to 0.4%, while the remaining were less active showing a MIC⩾0.8%.

  20. A Pseudomonas putida double mutant deficient in butanol assimilation: a promising step for engineering a biological biofuel production platform.

    PubMed

    Cuenca, María Del Sol; Molina-Santiago, Carlos; Gómez-García, María R; Ramos, Juan L

    2016-03-01

    Biological production in heterologous hosts is of interest for the production of the C4 alcohol (butanol) and other chemicals. However, some hurdles need to be overcome in order to achieve an economically viable process; these include avoiding the consumption of butanol and maintaining tolerance to this solvent during production. Pseudomonas putida is a potential host for solvent production; in order to further adapt P. putida to this role, we generated mini-Tn5 mutant libraries in strain BIRD-1 that do not consume butanol. We analyzed the insertion site of the mini-Tn5 in a mutant that was deficient in assimilation of butanol using arbitrary PCR followed by Sanger sequencing and found that the transposon was inserted in the malate synthase B gene. Here, we show that in a second round of mutagenesis a double mutant unable to take up butanol had an insertion in a gene coding for a multisensor hybrid histidine kinase. The genetic context of the histidine kinase sensor revealed the presence of a set of genes potentially involved in butanol assimilation; qRT-PCR analysis showed induction of this set of genes in the wild type and the malate synthase mutant but not in the double mutant.

  1. Purification of Pseudomonas putida acyl coenzyme A ligase active with a range of aliphatic and aromatic substrates.

    PubMed Central

    Fernández-Valverde, M; Reglero, A; Martinez-Blanco, H; Luengo, J M

    1993-01-01

    Acyl coenzyme A (acyl-CoA) ligase (acyl-CoA synthetase [ACoAS]) from Pseudomonas putida U was purified to homogeneity (252-fold) after this bacterium was grown in a chemically defined medium containing octanoic acid as the sole carbon source. The enzyme, which has a mass of 67 kDa, showed maximal activity at 40 degrees C in 10 mM K2PO4H-NaPO4H2 buffer (pH 7.0) containing 20% (wt/vol) glycerol. Under these conditions, ACoAS showed hyperbolic behavior against acetate, CoA, and ATP; the Kms calculated for these substrates were 4.0, 0.7, and 5.2 mM, respectively. Acyl-CoA ligase recognizes several aliphatic molecules (acetic, propionic, butyric, valeric, hexanoic, heptanoic, and octanoic acids) as substrates, as well as some aromatic compounds (phenylacetic and phenoxyacetic acids). The broad substrate specificity of ACoAS from P. putida was confirmed by coupling it with acyl-CoA:6-aminopenicillanic acid acyltransferase from Penicillium chrysogenum to study the formation of several penicillins. Images PMID:8476289

  2. The type II secretion system (Xcp) of Pseudomonas putida is active and involved in the secretion of phosphatases.

    PubMed

    Putker, Florian; Tommassen-van Boxtel, Ria; Stork, Michiel; Rodríguez-Herva, José J; Koster, Margot; Tommassen, Jan

    2013-10-01

    The genome of the Gram-negative bacterium Pseudomonas putida harbours a complete set of xcp genes for a type II protein secretion system (T2SS). This study shows that expression of these genes is induced under inorganic phosphate (Pi ) limitation and that the system enables the utilization of various organic phosphate sources. A phosphatase of the PhoX family, previously designated UxpB, was identified, which was produced under low Pi conditions and transported across the cell envelope in an Xcp-dependent manner demonstrating that the xcp genes encode an active T2SS. The signal sequence of UxpB contains a twin-arginine translocation (Tat) motif as well as a lipobox, and both processing by leader peptidase II and Tat dependency were experimentally confirmed. Two different tat gene clusters were detected in the P. putida genome, of which one, named tat-1, is located adjacent to the uxpB and xcp genes. Both Tat systems appeared to be capable of transporting the UxpB protein. However, expression of the tat-1 genes was strongly induced by low Pi levels, indicating a function of this system in survival during Pi starvation.

  3. Characterization of the Pseudomonas putida Mobile Genetic Element ISPpu10: an Occupant of Repetitive Extragenic Palindromic Sequences

    PubMed Central

    Ramos-González, María Isabel; Campos, María Jesús; Ramos, Juan Luis; Espinosa-Urgel, Manuel

    2006-01-01

    We have characterized the Pseudomonas putida KT2440 insertion element ISPpu10. This insertion sequence encodes a transposase which exhibits homology to the transposases and specific recombinases of the Piv/Moov family, and no inverted repeats are present at the borders of its left and right ends, thus constituting a new member of the atypical IS110/IS492 family. ISPpu10 was found in at least seven identical loci in the KT2440 genome, and variants were identified having an extra insertion at distinct loci. ISPpu10 always appeared within the core of specific repetitive extragenic palindromic (REP) sequences TCGCGGGTAAACCCGCTCCTAC, exhibiting high target stringency. One intragenic target was found associated with the truncation of a GGDEF/EAL domain protein. After active in vitro transposition to a plasmid-borne target, a duplication of the CT (underlined above) at the junction as a consequence of the ISPpu10 insertion was experimentally demonstrated for the first time in the IS110/IS492 family. The same duplication was observed after transposition of ISPpu10 from a plasmid to the chromosome of P. putida DOT-T1E, an ISPpu10-free strain with REPs similar to those of strain KT2440. Plasmid ISPpu10-mediated rearrangements were observed in vivo under laboratory conditions and in the plant rhizosphere. PMID:16352819

  4. N-acyl Homoserine Lactone-Producing Pseudomonas putida Strain T2-2 from Human Tongue Surface

    PubMed Central

    Chen, Jian-Woon; Chin, Shenyang; Tee, Kok Keng; Yin, Wai-Fong; Choo, Yeun Mun; Chan, Kok-Gan

    2013-01-01

    Bacterial cell-to-cell communication (quorum sensing) refers to the regulation of bacterial gene expression in response to changes in microbial population density. Quorum sensing bacteria produce, release and respond to chemical signal molecules called autoinducers. Bacteria use two types of autoinducers, namely autoinducer-1 (AI-1) and autoinducer-2 (AI-2) where the former are N-acylhomoserine lactones and the latter is a product of the luxS gene. Most of the reported literatures show that the majority of oral bacteria use AI-2 for quorum sensing but rarely the AI-1 system. Here we report the isolation of Pseudomonas putida strain T2-2 from the oral cavity. Using high resolution mass spectrometry, it is shown that this isolate produced N-octanoylhomoserine lactone (C8-HSL) and N-dodecanoylhomoserine lactone (C12-HSL) molecules. This is the first report of the finding of quorum sensing of P. putida strain T2-2 isolated from the human tongue surface and their quorum sensing molecules were identified. PMID:24084113

  5. A tricistronic heat shock operon is important for stress tolerance of Pseudomonas putida and conserved in many environmental bacteria.

    PubMed

    Krajewski, Stefanie S; Joswig, Matthias; Nagel, Miriam; Narberhaus, Franz

    2014-06-01

    Small heat shock proteins (sHsps) including the well-studied IbpA protein from Escherichia coli are molecular chaperones that bind to non-native proteins and prevent them from aggregation. We discovered an entirely unexplored tricistronic small heat shock gene cluster in Pseudomonas putida. The genes pp3314, pp3313 and pp3312 (renamed to hspX, hspY and hspZ respectively) are transcribed in a single transcript. In addition to σ(32) -dependent transcriptional control, translation of the first and second gene of the operon is controlled by RNA thermometers with novel architectures. Biochemical analysis of HspY, HspZ and P. putida IbpA demonstrated that they assemble into homo-oligomers of different sizes whose quaternary structures alter in a temperature-dependent manner. IbpA and HspY are able to prevent the model substrate citrate synthase from thermal aggregation in vitro. Increased stress sensitivity of a P. putida strain lacking HspX, HspY and HspZ revealed an important role of these sHsps in stress adaptation. The hspXYZ operon is conserved among metabolically related bacteria that live in hostile environments including polluted soils. This heat shock operon might act as a protective system to promote survival in such ecological niches.

  6. Cloning and characterization of the pnb genes, encoding enzymes for 4-nitrobenzoate catabolism in Pseudomonas putida TW3.

    PubMed

    Hughes, M A; Williams, P A

    2001-02-01

    Pseudomonas putida strain TW3 is able to metabolize 4-nitrotoluene via 4-nitrobenzoate (4NBen) and 3, 4-dihydroxybenzoic acid (protocatechuate [PCA]) to central metabolites. We have cloned, sequenced, and characterized a 6-kbp fragment of TW3 DNA which contains five genes, two of which encode the enzymes involved in the catabolism of 4NBen to PCA. In order, they encode a 4NBen reductase (PnbA) which is responsible for catalyzing the direct reduction of 4NBen to 4-hydroxylaminobenzoate with the oxidation of 2 mol of NADH per mol of 4NBen, a reductase-like enzyme (Orf1) which appears to have no function in the pathway, a regulator protein (PnbR) of the LysR family, a 4-hydroxylaminobenzoate lyase (PnbB) which catalyzes the conversion of 4-hydroxylaminobenzoate to PCA and ammonium, and a second lyase-like enzyme (Orf2) which is closely associated with pnbB but appears to have no function in the pathway. The central pnbR gene is transcribed in the opposite direction to the other four genes. These genes complete the characterization of the whole pathway of 4-nitrotoluene catabolism to the ring cleavage substrate PCA in P. putida strain TW3.

  7. Pathway-Consensus Approach to Metabolic Network Reconstruction for Pseudomonas putida KT2440 by Systematic Comparison of Published Models

    PubMed Central

    Yuan, Qianqian; Li, Peishun; Hao, Tong; Li, Feiran; Ma, Hongwu; Wang, Zhiwen; Zhao, Xueming; Chen, Tao; Goryanin, Igor

    2017-01-01

    Over 100 genome-scale metabolic networks (GSMNs) have been published in recent years and widely used for phenotype prediction and pathway design. However, GSMNs for a specific organism reconstructed by different research groups usually produce inconsistent simulation results, which makes it difficult to use the GSMNs for precise optimal pathway design. Therefore, it is necessary to compare and identify the discrepancies among networks and build a consensus metabolic network for an organism. Here we proposed a process for systematic comparison of metabolic networks at pathway level. We compared four published GSMNs of Pseudomonas putida KT2440 and identified the discrepancies leading to inconsistent pathway calculation results. The mistakes in the models were corrected based on information from literature so that all the calculated synthesis and uptake pathways were the same. Subsequently we built a pathway-consensus model and then further updated it with the latest genome annotation information to obtain modelPpuQY1140 for P. putida KT2440, which includes 1140 genes, 1171 reactions and 1104 metabolites. We found that even small errors in a GSMN could have great impacts on the calculated optimal pathways and thus may lead to incorrect pathway design strategies. Careful investigation of the calculated pathways during the metabolic network reconstruction process is essential for building proper GSMNs for pathway design. PMID:28085902

  8. Antimicrobial effect of TiO2 doped with Ag and Cu on Escherichia coli and Pseudomonas putida

    NASA Astrophysics Data System (ADS)

    Angelov, O.; Stoyanova, D.; Ivanova, I.

    2016-10-01

    Antimicrobial effect of TiO2 doped with Ag and Cu on Gram-negative bacteria Escherichia coli and Pseudomonas putida is studied. The thin films are deposited on glass substrates without heating during the deposition by r.f. magnetron co-sputtering of TiO2 target and pieces of Ag and Cu. The studied films, thickness about 65 nm, were as deposited and annealed (5200C, 4h, N2+5%H2, 4Pa). The as deposited thin films TiO2:Ag:Cu have band gap energy of 3.56 eV little higher than the band gap of crystalline anatase TiO2 which can be explained with the quantum effect of the granular structure of r.f. magnetron sputtered films. The annealed samples have band gap of 2.52 eV due to formation of donor levels from Ag and Cu atoms near the bottom of the conduction band. The toxic effect was determined through the classical Koch's method and the optical density measurements at λ=610 nm. The as deposited TiO2:Ag:Cu thin films demonstrate stronger inhibition effect - bactericidal for P. putida and bacteriostatic for E. coli (up to the 6th hour) in comparison with the annealed samples. The both methods of study show the same trends of the bacterial growth independently of their different sensitivity which confirms the observed effect.

  9. N-acyl homoserine lactone-producing Pseudomonas putida strain T2-2 from human tongue surface.

    PubMed

    Chen, Jian-Woon; Chin, Shenyang; Tee, Kok Keng; Yin, Wai-Fong; Choo, Yeun Mun; Chan, Kok-Gan

    2013-09-30

    Bacterial cell-to-cell communication (quorum sensing) refers to the regulation of bacterial gene expression in response to changes in microbial population density. Quorum sensing bacteria produce, release and respond to chemical signal molecules called autoinducers. Bacteria use two types of autoinducers, namely autoinducer-1 (AI-1) and autoinducer-2 (AI-2) where the former are N-acylhomoserine lactones and the latter is a product of the luxS gene. Most of the reported literatures show that the majority of oral bacteria use AI-2 for quorum sensing but rarely the AI-1 system. Here we report the isolation of Pseudomonas putida strain T2-2 from the oral cavity. Using high resolution mass spectrometry, it is shown that this isolate produced N-octanoylhomoserine lactone (C8-HSL) and N-dodecanoylhomoserine lactone (C12-HSL) molecules. This is the first report of the finding of quorum sensing of P. putida strain T2-2 isolated from the human tongue surface and their quorum sensing molecules were identified.

  10. Mechanisms of trace metal sorption in Pseudomonas putida-birnessite assemblages

    NASA Astrophysics Data System (ADS)

    Peña, J.; Kwon, K. D.; Bargar, J. R.; Sposito, G.

    2012-04-01

    Biogenic manganese oxides (MnO2) are ubiquitous nanoparticulate minerals that contribute strongly to the adsorption of nutrient and toxicant metals in aquatic and terrestrial environments. The formation of these minerals is catalyzed by a diverse and widely-distributed group of bacteria and fungi, often through the enzymatic oxidation of aqueous Mn(II) to Mn(IV). The biogenic Mn(IV) oxide found in field settings, as well as that produced by model bacteria in laboratory culture, is typically layer-type hexagonal birnessite containing abundant cation vacancy sites and enmeshed in an organic matrix of bacterial cells and extracellular polymeric substances. In this talk I summarize the results from laboratory-scale research designed to investigate the mechanisms of metal sorption by the bacterial biomass-birnessite assemblages formed by Pseudomonas putida GB-1 when grown in the presence of 1 mM Mn(II) at circumneutral pH values. The goals of this research were first, to identify the structure of the surface complexes formed by trace metals (e.g., Ni, Cu and Zn) on biogenic birnessite and second, to determine the conditions under which the bacterial cell surfaces and extracellular polymeric substances contribute to metal sorption. Macroscopic and spectroscopic experiments were performed at varying pH values (6 - 8) and over a wide-range of metal concentrations. Extended X-ray absorption fine structure (EXAFS) spectroscopy and first-principles calculations based on density functional theory showed that cation vacancy sites in birnessite drive mineral reactivity, but that surface speciation varies from metal to metal. For, Ni we identified two species, Ni bonded to three surface oxygen atoms vacancy sites as a triple-corner-sharing (TCS) complex and Ni incorporated at vacancy sites, with surface speciation varying with pH and surface loading. Zinc formed TCS complexes at vacancy sites, with the proportion of Zn in tetrahedral or octahedral coordination geometry influenced

  11. The solvent-tolerant Pseudomonas putida S12 as host for the production of cinnamic acid from glucose.

    PubMed

    Nijkamp, Karin; van Luijk, Nicole; de Bont, Jan A M; Wery, Jan

    2005-11-01

    A Pseudomonas putida S12 strain was constructed that efficiently produced the fine chemical cinnamic acid from glucose or glycerol via the central metabolite phenylalanine. The gene encoding phenylalanine ammonia lyase from the yeast Rhodosporidium toruloides was introduced. Phenylalanine availability was the main bottleneck in cinnamic acid production, which could not be overcome by the overexpressing enzymes of the phenylalanine biosynthesis pathway. A successful approach in abolishing this limitation was the generation of a bank of random mutants and selection on the toxic phenylalanine anti-metabolite m-fluoro-phenylalanine. Following high-throughput screening, a mutant strain was obtained that, under optimised culture conditions, accumulated over 5 mM of cinnamic acid with a yield (Cmol%) of 6.7%.

  12. [Effect of transposons on expression of genes for naphthalene biodegradation in Pseudomonas putida BS202(NPL-1) and derivative strains].

    PubMed

    Sokolov, S L; Kosheleva, I A; Filonov, A E; Boronin, A M

    2005-01-01

    NPL-1 and its derivative plasmid pBS106, which control the degradation of naphthalene and salicylate, were found to contain class II transposons of the Tn3 family. These transposons are involved in intraplasmid rearrangements, such as deletions and inversions, and can influence the expression of the catabolic and regulatory genes borne by biodegradation plasmids. The formation of a strong NahR-independent constitutive promoter by the inversion of a DNA fragment may be responsible for changing the character of naphthalene dioxygenase synthesis from inducible (in the case of plasmid NPL-1) to constitutive (in the case of plasmid NPL-41). The stability of plasmids NPL-1 and NPL-41 in the Pseudomonas putida strains grown on different substrates depends on the expression of the nah and tnp genes.

  13. Effects of LB broth, naphthalene concentration, and acetone on the naphthalene degradation activities by Pseudomonas putida G7.

    PubMed

    Chang, Su-Yun; Liu, Xue-Gong; Ren, Bi-Qiong; Liu, Bo; Zhang, Kai; Zhang, Honggui; Wan, Yao

    2015-01-01

    Luria-Bertani broth and acetone were usually used in naphthalene degradation experiments as nutrient and solvent. However, their effect on the degradation was seldom mentioned. In this work, we investigated the effect of LB, naphthalene concentration, and acetone on the degradation of naphthalene by Pseudomonas putida G7, which is useful for the degradation of naphthalene on future field remediation. By adding LB, the naphthalene degradation efficiencies and naphthalene dioxygenase were both decreased by 98%, while the catechol dioxygenase was decreased by 90%. Degradation of naphthalene was also inhibited when naphthalene concentration was 56 ppm and higher, which was accompanied with the accumulation of orange-colored metabolism products. However, acetone can stimulate the degradation of naphthalene, and the stimulation was more obvious when naphthalene concentration was lower than 2000 ppm. By assaying the enzyme activities of naphthalene dioxygenase and catechol dioxygenase, it was thought that the degradation efficiency was depending on the more sensitive enzymes on the complicated conditions.

  14. Influence of hydrodynamics on the growth kinetics of glass-adhering Pseudomonas putida cells through a parallel plate flow chamber.

    PubMed

    Mbaye, S; Séchet, P; Pignon, F; Martins, J M F

    2013-01-01

    The objective of this work was to investigate the influence of hydrodynamics on the growth kinetics of surface-adhering Pseudomonas putida cells. The results showed in particular that under non substrate-limiting conditions, the early step of bacterial apparent growth rate is lower than those measured with suspended cells. Contrary to previously cited authors which explain this behavior to the different adhesive properties of the "daughter"-cells (which makes more probable the detachment of these daughter-cells), in our experimental conditions, that explanation does not hold and we show a clear dependence of growth kinetics with flow conditions, due to the formation of boundary layer concentration at low Reynolds number. These results revealed that using Monod law in the modeling of biofilm growth in fixed-biomass processes should be performed with care.

  15. DNA Polymerases ImuC and DinB Are Involved in DNA Alkylation Damage Tolerance in Pseudomonas aeruginosa and Pseudomonas putida

    PubMed Central

    Jatsenko, Tatjana; Sidorenko, Julia; Saumaa, Signe; Kivisaar, Maia

    2017-01-01

    Translesion DNA synthesis (TLS), facilitated by low-fidelity polymerases, is an important DNA damage tolerance mechanism. Here, we investigated the role and biological function of TLS polymerase ImuC (former DnaE2), generally present in bacteria lacking DNA polymerase V, and TLS polymerase DinB in response to DNA alkylation damage in Pseudomonas aeruginosa and P. putida. We found that TLS DNA polymerases ImuC and DinB ensured a protective role against N- and O-methylation induced by N-methyl-N'-nitro-N-nitrosoguanidine (MNNG) in both P. aeruginosa and P. putida. DinB also appeared to be important for the survival of P. aeruginosa and rapidly growing P. putida cells in the presence of methyl methanesulfonate (MMS). The role of ImuC in protection against MMS-induced damage was uncovered under DinB-deficient conditions. Apart from this, both ImuC and DinB were critical for the survival of bacteria with impaired base excision repair (BER) functions upon alkylation damage, lacking DNA glycosylases AlkA and/or Tag. Here, the increased sensitivity of imuCdinB double deficient strains in comparison to single mutants suggested that the specificity of alkylated DNA lesion bypass of DinB and ImuC might also be different. Moreover, our results demonstrated that mutagenesis induced by MMS in pseudomonads was largely ImuC-dependent. Unexpectedly, we discovered that the growth temperature of bacteria affected the efficiency of DinB and ImuC in ensuring cell survival upon alkylation damage. Taken together, the results of our study disclosed the involvement of ImuC in DNA alkylation damage tolerance, especially at low temperatures, and its possible contribution to the adaptation of pseudomonads upon DNA alkylation damage via increased mutagenesis. PMID:28118378

  16. DNA Polymerases ImuC and DinB Are Involved in DNA Alkylation Damage Tolerance in Pseudomonas aeruginosa and Pseudomonas putida.

    PubMed

    Jatsenko, Tatjana; Sidorenko, Julia; Saumaa, Signe; Kivisaar, Maia

    2017-01-01

    Translesion DNA synthesis (TLS), facilitated by low-fidelity polymerases, is an important DNA damage tolerance mechanism. Here, we investigated the role and biological function of TLS polymerase ImuC (former DnaE2), generally present in bacteria lacking DNA polymerase V, and TLS polymerase DinB in response to DNA alkylation damage in Pseudomonas aeruginosa and P. putida. We found that TLS DNA polymerases ImuC and DinB ensured a protective role against N- and O-methylation induced by N-methyl-N'-nitro-N-nitrosoguanidine (MNNG) in both P. aeruginosa and P. putida. DinB also appeared to be important for the survival of P. aeruginosa and rapidly growing P. putida cells in the presence of methyl methanesulfonate (MMS). The role of ImuC in protection against MMS-induced damage was uncovered under DinB-deficient conditions. Apart from this, both ImuC and DinB were critical for the survival of bacteria with impaired base excision repair (BER) functions upon alkylation damage, lacking DNA glycosylases AlkA and/or Tag. Here, the increased sensitivity of imuCdinB double deficient strains in comparison to single mutants suggested that the specificity of alkylated DNA lesion bypass of DinB and ImuC might also be different. Moreover, our results demonstrated that mutagenesis induced by MMS in pseudomonads was largely ImuC-dependent. Unexpectedly, we discovered that the growth temperature of bacteria affected the efficiency of DinB and ImuC in ensuring cell survival upon alkylation damage. Taken together, the results of our study disclosed the involvement of ImuC in DNA alkylation damage tolerance, especially at low temperatures, and its possible contribution to the adaptation of pseudomonads upon DNA alkylation damage via increased mutagenesis.

  17. Toxicity evaluation of selected ammonium-based ionic liquid forms with MCPP and dicamba moieties on Pseudomonas putida.

    PubMed

    Piotrowska, Aleksandra; Syguda, Anna; Wyrwas, Bogdan; Chrzanowski, Łukasz; Heipieper, Hermann J

    2017-01-01

    Combination of the hydrophilic herbicidal anion with hydrophobic, antimicrobial ammonium cation allows to obtain compounds in ionic liquid form with better properties then conventional herbicides. Both cation and anion can be modified by selection of herbicide and the length of alkyl chains in cation structure. However the knowledge of their potential toxic effects are still limited. Furthermore, the relation between hydrophobicity associated with the length of alkyl chains and toxicity for ionic liquids has not been thoroughly studied. Therefore we investigated toxic effects of herbicidal ionic liquid forms on growth inhibition, given as EC50, of the common soil bacterium Pseudomonas putida. We thereby concentrated on quaternary ammonium salts. Analyzed compounds were composed of dicamba or MCPP moieties and cation with various alkyl chain lengths (n = 6,8,10) We compared them with commercial herbicides, and ammonium-based ionic liquids with neutral anion (Br(-)). In addition, cis-trans isomerisation of unsaturated membrane fatty acids in Pseudomonas putida was applied as the proxy for toxicity and membrane activity. We showed that toxicity increased with the length of alkyl chains. However, this correlation is only valid for six and eight carbon atom in alkyl chains, where for n = 10 the EC50 values rise by one order of magnitude. In our studies, the herbicidal ionic liquids [C10,C10,C1,C1N][MCPP] and [C10,C10,C1,C1N][dicamba] showed the lowest toxicity among analyzed quaternary ammonium salts and comparable toxicity with corresponding herbicides. No clear increase in toxicity could be followed by changing the anion moieties for ammonium-based ionic liquid forms.

  18. The role of GlpR repressor in Pseudomonas putida KT2440 growth and PHA production from glycerol.

    PubMed

    Escapa, I F; del Cerro, C; García, J L; Prieto, M A

    2013-01-01

    Pseudomonas putida KT2440 has evolved a tightly regulated system for metabolizing glycerol implying a prolonged growth lag-phase. We have learnt that this fact can be avoided by the addition of small amounts of some growth precursors. The addition of 1 mM octanoic acid as co-feeder completely eliminated the lag-phase, resulting in an improvement, in terms of invested time, of both growth and polyhydroxyalkanoates (PHA) accumulation. To investigate this phenomenon, we have followed co-metabolic approaches combined with mutations of the specific and global regulatory networks that connect glycerol catabolism and PHA synthesis. By using mutant strains in metabolic genes from the PHA and tricarboxylic acid (TCA) cycles, we have demonstrated that the co-feeding effect is independent of PHA accumulation, but driven on active glyoxylate shunt and Entner-Doudoroff (ED) routes. These findings suggested that the effect of octanoate on glycerol metabolism could rely, either on a global activation of the cell energy state, or on the generation of specific metabolites or cofactors needed for the activation of glycerol metabolism. Our results addressed GlpR as the key factor controlling the efficient utilization of glycerol as growth precursor in P. putida KT2440. Accordingly, a glpR knockout mutant of P. putida KT2440 showed an elimination of the lag-phase when cultured on glycerol in the absence of co-feeder. Besides, the production of PHA in this strain was increased near twofold, resulting in a higher final yield in terms of PHA accumulation. The repressor activity of the GlpR protein over the glp genes in the absence of glycerol was finally demonstrated by qRT-PCR. This work contributed to unravel the physiological causes of the long lag-phase produced by glycerol in the model strain P. putida KT2440 that hinders its use as carbon source in biotechnological applications for generating valuable products. © 2012 Society for Applied Microbiology and Blackwell Publishing Ltd.

  19. Physiological function of the Pseudomonas putida PpG6 (Pseudomonas oleovorans) alkane hydroxylase: monoterminal oxidation of alkanes and fatty acids.

    PubMed Central

    Nieder, M; Shapiro, J

    1975-01-01

    Pseudomonas putida PpG6 is able to utilize purified n-alkanes of six to ten carbon atoms for growth. It can also grow on the primary terminal oxidation products of these alkanes and on 1-dodecanol but not on the corresponding 2-ketones or 1,6-hexanediol, adipic acid, or pimelic acid. Revertible point mutants can be isolated which have simultaneously lost the ability to grow on all five n-alkane growth substrates but which can still grow on octanol or nonanol. An acetate-negative mutant defective in isocitrate lysase activity is unable to grow on even-numbered alkanes and fatty acids. Analysis of double mutants defective in acetate and propionate or in acetate and glutarate metabolism shows that alkane carbon is assimilated only via acetyl-coenzyme A and propionyl-coenzyme A. These results support the following conclusions: (i) The n-alkane growth specificity of P. putida PpG6 is due to the substrate specificity of whole-cell alkane hydroxylation; (ii) there is a single alkane hydroxylase enzyme complex; (iii) the physiological role of this complex is to initiate the monoterminal oxidation of alkane chains; and (iv) straight-chain fatty acids from butyric through nonanoic are degraded exclusively by beta-oxidation from the carboxyl end of the molecule. PMID:804473

  20. Confirming Pseudomonas putida as a reliable bioassay for demonstrating biocompatibility enhancement by solar photo-oxidative processes of a biorecalcitrant effluent.

    PubMed

    García-Ripoll, A; Amat, A M; Arques, A; Vicente, R; Ballesteros Martín, M M; Pérez, J A Sánchez; Oller, I; Malato, S

    2009-03-15

    Experiments based on Vibrio fischeri, activated sludge and Pseudomonas putida have been employed to check variation in the biocompatibility of an aqueous solution of a commercial pesticide, along solar photo-oxidative process (TiO(2) and Fenton reagent). Activated sludge-based experiments have demonstrated a complete detoxification of the solution, although important toxicity is still detected according to the more sensitive V. fischeri assays. In parallel, the biodegradability of organic matter is strongly enhanced, with BOD(5)/COD ratio above 0.8. Bioassays run with P. putida have given similar trends, remarking the convenience of using P. putida culture as a reliable and reproducible method for assessing both toxicity and biodegradability, as a substitute to other more time consuming methods.

  1. Functional Identification of a Novel Gene, moaE, for 3-Succinoylpyridine Degradation in Pseudomonas putida S16

    PubMed Central

    Jiang, Yi; Tang, Hongzhi; Wu, Geng; Xu, Ping

    2015-01-01

    Microbial degradation of N-heterocyclic compounds, including xanthine, quinoline, nicotinate, and nicotine, frequently requires molybdenum hydroxylases. The intramolecular electron transfer chain of molybdenum hydroxylases consists of a molybdenum cofactor, two distinct [2Fe-2S] clusters, and flavin adenine dinucleotide. 3-Succinoylpyridine monooxygenase (Spm), responsible for the transformation from 3-succinoylpyridine to 6-hydroxy-3-succinoylpyridine, is a crucial enzyme in the pyrrolidine pathway of nicotine degradation in Pseudomonas. Our previous work revealed that the heterotrimeric enzyme (SpmA, SpmB, and SpmC) requires molybdopterin cytosine dinucleotide as a cofactor for their activities. In this study, we knocked out four genes, including PPS_1556, PPS_2936, PPS_4063, and PPS_4397, and found that a novel gene, PPS_4397 encoding moaE, is necessary for molybdopterin cytosine dinucleotide biosynthesis. Resting cell reactions of the moaE deletion mutant incubated with 3 g l−1 nicotine at 30 °C resulted in accumulation of 3-succinoylpyridine, and the strain complemented by the moaE gene regained the ability to convert 3-succinoylpyridine. In addition, reverse transcription-quantitative polymerase chain reaction analysis indicated that the transcriptional levels of the genes of moaE, spmA, and spmC of Pseudomonas putida S16 were distinctly higher when grown in nicotine medium than in glycerol medium. PMID:26304596

  2. Effect of silver nanoparticles and silver ions on growth and adaptive response mechanisms of Pseudomonas putida mt-2.

    PubMed

    Hachicho, Nancy; Hoffmann, Philipp; Ahlert, Kristin; Heipieper, Hermann J

    2014-06-01

    The distribution and use of nanoparticles increased rapidly during the last years, while the knowledge about mode of action, ecological tolerance and biodegradability of these chemicals is still insufficient. The effect of silver nanoparticles (AgNP) and free silver ions (Ag(+) , AgNO3 ) on Pseudomonas putida mt-2 as one of the best described bacterial strains for stress response were investigated. The effective concentration (EC50) causing 50% growth inhibition for AgNP was about 250 mg L(-1) , whereas this was only 0.175 mg L(-1) for AgNO3 . However, when calculating the amount of free silver ions released from AgNP both tested compounds showed very similar results. Therefore, the antibacterial activity of AgNP can be explained and reduced, respectively, to the amount of silver ions released from the nanoparticles. Both tested compounds showed a strong activation of the unique membrane adaptive response of Pseudomonas strains, the cis-trans isomerization of unsaturated fatty acids, whereas another important adaptive response of these bacteria, changes in cell surface hydrophobicity, measured as water contact angle, was not activated. These results are important informations for the estimation of environmental tolerance of newly developed, active ingredients like silver nanoparticles. © 2014 Federation of European Microbiological Societies. Published by John Wiley & Sons Ltd. All rights reserved.

  3. Global transcriptional response of solvent-sensitive and solvent-tolerant Pseudomonas putida strains exposed to toluene.

    PubMed

    Molina-Santiago, Carlos; Udaondo, Zulema; Gómez-Lozano, María; Molin, Soren; Ramos, Juan-Luis

    2017-02-01

    Pseudomonas putida strains are generally recognized as solvent tolerant, exhibiting varied sensitivity to organic solvents. Pan-genome analysis has revealed that 30% of genes belong to the core-genome of Pseudomonas. Accessory and unique genes confer high degree of adaptability and capabilities for the degradation and synthesis of a wide range of chemicals. For the use of these microbes in bioremediation and biocatalysis, it is critical to understand the mechanisms underlying these phenotypic differences. In this study, RNA-seq analysis compared the short- and long-term responses of the toluene-sensitive KT2440 strain and the highly tolerant DOT-T1E strain. The sensitive strain activates a larger number of genes in a higher magnitude than DOT-T1E. This is expected because KT2440 bears one toluene tolerant pump, while DOT-T1E encodes three of these pumps. Both strains activate membrane modifications to reduce toluene membrane permeability. The KT2440 strain activates the TCA cycle to generate energy, while avoiding energy-intensive processes such as flagellar biosynthesis. This suggests that KT2440 responds to toluene by focusing on survival mechanisms. The DOT-T1E strain activates toluene degradation pathways, using toluene as source of energy. Among the unique genes encoded by DOT-T1E is a 70 kb island composed of genes of unknown function induced in response to toluene. © 2016 Society for Applied Microbiology and John Wiley & Sons Ltd.

  4. Expression of Fap amyloids in Pseudomonas aeruginosa, P. fluorescens, and P. putida results in aggregation and increased biofilm formation

    PubMed Central

    Dueholm, Morten S; Søndergaard, Mads T; Nilsson, Martin; Christiansen, Gunna; Stensballe, Allan; Overgaard, Michael T; Givskov, Michael; Tolker-Nielsen, Tim; Otzen, Daniel E; Nielsen, Per H

    2013-01-01

    The fap operon, encoding functional amyloids in Pseudomonas (Fap), is present in most pseudomonads, but so far the expression and importance for biofilm formation has only been investigated for P. fluorescens strain UK4. In this study, we demonstrate the capacity of P. aeruginosa PAO1, P. fluorescens Pf-5, and P. putida F1 to express Fap fibrils, and investigated the effect of Fap expression on aggregation and biofilm formation. The fap operon in all three Pseudomonas species conferred the ability to express Fap fibrils as shown using a recombinant approach. This Fap overexpression consistently resulted in highly aggregative phenotypes and in increased biofilm formation. Detailed biophysical investigations of purified fibrils confirmed FapC as the main fibril monomer and supported the role of FapB as a minor, nucleating constituent as also indicated by bioinformatic analysis. Bioinformatics analysis suggested FapF and FapD as a potential β-barrel membrane pore and protease, respectively. Manipulation of the fap operon showed that FapA affects monomer composition of the final amyloid fibril, and that FapB is an amyloid protein, probably a nucleator for FapC polymerization. Our study highlights the fap operon as a molecular machine for functional amyloid formation. PMID:23504942

  5. Substrate Selectivity of a 3-Nitrophenol-Induced Metabolic System in Pseudomonas putida 2NP8 Transforming Nitroaromatic Compounds into Ammonia under Aerobic Conditions

    PubMed Central

    Zhao, Jian-Shen; Ward, Owen P.

    2001-01-01

    The 3-nitrophenol-induced enzyme system in cells of Pseudomonas putida 2NP8 manifested a wide substrate range in transforming nitroaromatic compounds through to ammonia production. All of the 30 mono- or dinitroaromatic substrates except 4-nitrophenol, 2,4-dinitrophenol, 2,4,6-trinitrophenol, 3-nitroaniline, 2-nitrobenzoic acid, and 2-nitrofuran were quickly transformed. Ammonia production from most nitroaromatic substrates appeared to be stoichiometric. PMID:11229938

  6. Effect of growth temperature and pH on the aminopeptidase activity of Pseudomonas putida, P. fluorescens and Flavobacterium odoratum; the 4-nitroaniline test is reliable.

    PubMed

    Lopez-Tomas, L A; Ordoñez, J A; Mediavilla, C; Rodriguez-Marin, J L; Sarmiento, P; Zamora, A; Garcia de Fernando, G

    2008-01-01

    No significant difference (p > 0.05) was observed in the specific aminopeptidase activity (SAA) developed by Pseudomonas fluorescens, P. putida and Flavobacterium odoratum either growing at pH 5.0-6.5 or at 7 and 12 degrees C. Nevertheless, a significant difference was found when comparing the SAA of these organisms. The SAA of F. odoratum was lower than those of pseudomonads. The 4-nitroaniline test is reliable to estimate the G(-) load of fresh food products.

  7. Responses of Pseudomonas putida to Zinc Excess Determined at the Proteome Level: Pathways Dependent and Independent of ColRS.

    PubMed

    Mumm, Karl; Ainsaar, Kadi; Kasvandik, Sergo; Tenson, Tanel; Hõrak, Rita

    2016-12-02

    Zinc is an important micronutrient for bacteria, but its excess is toxic. Recently, the ColRS two-component system was shown to detect and respond to zinc excess and to contribute to zinc tolerance of Pseudomonas putida. Here, we applied a label-free whole-cell proteome analysis to compare the zinc-induced responses of P. putida and colR knockout. We identified dozens of proteins that responded to zinc in a ColR-independent manner, among others, known metal efflux systems CzcCBA1, CzcCBA2, CadA2 and CzcD. Nine proteins were affected in a ColR-dependent manner, and besides known ColR targets, four new candidates for ColR regulon were identified. Despite the relatively modest ColR-dependent changes of wild-type, colR deficiency resulted in drastic proteome alterations, with 122 proteins up- and 62 down-regulated by zinc. This zinc-promoted response had remarkable overlap with the alternative sigma factor AlgU-controlled regulon in P. aeruginosa. The most prominent hallmark was a high induction of alginate biosynthesis proteins and regulators. This response likely alleviates the zinc stress, as the AlgU-regulated alginate regulator AmrZ was shown to contribute to zinc tolerance of colR knockout. Thus, the ColRS system is important for zinc homeostasis, and in its absence, alternative stress response pathways are activated to support the zinc tolerance.

  8. Inoculation effects of Pseudomonas putida, Gluconacetobacter azotocaptans, and Azospirillum lipoferum on corn plant growth under greenhouse conditions.

    PubMed

    Mehnaz, Samina; Lazarovits, George

    2006-04-01

    Alcohol production from corn is gaining importance in Ontario, Canada, and elsewhere. A major cost of corn production is the cost of chemical fertilizers and these continue to increase in price. The competitiveness of alcohol with fossil fuels depends on access to low-cost corn that allows growers to earn a sustainable income. In this study we set out to determine if we can identify root-associated microorganisms from Ontario-grown corn that can enhance the nutrient flow to corn roots, directly or indirectly, and help minimize the use of extraneous fertilizer. Bacteria were isolated from corn rhizosphere and screened for their capacity to enhance corn growth. The bacteria were examined for their ability to fix nitrogen, solubilize phosphate, and produce indole acetic acid (IAA) and antifungal substances on potato dextrose agar. Bacterial suspensions were applied to pregerminated seed of four corn varieties (39D82, 39H84, 39M27, and 39T68) planted in sterilized sand and unsterilized cornfield soil. The plants were grown under greenhouse conditions for 30 days. Three isolates were identified as having growth-promoting effect. These bacteria were identified as to species by biochemical tests, fatty acid profiles, and 16S rDNA sequence analysis. Corn rhizosphere isolates, Gluconacetobacter azotocaptans DS1, Pseudomonas putida CQ179, and Azospirillum lipoferum N7, provided significant plant growth promotion expressed as increased root/shoot weight when compared to uninoculated plants, in sand and/or soil. All strains except P. putida CQ179 were capable of nitrogen fixation and IAA production. Azospirillum brasilense, however, produced significantly more IAA than the other isolates. Although several of the strains were also able to solubilize phosphate and produce metabolites inhibitory to various fungal pathogens, these properties are not considered as contributing to growth promotion under the conditions used in this study. These bacteria will undergo field tests for

  9. Integrated organic-aqueous biocatalysis and product recovery for quinaldine hydroxylation catalyzed by living recombinant Pseudomonas putida.

    PubMed

    Ütkür, F Ozde; Thanh Tran, Tan; Collins, Jonathan; Brandenbusch, Christoph; Sadowski, Gabriele; Schmid, Andreas; Bühler, Bruno

    2012-07-01

    In an earlier study, biocatalytic carbon oxyfunctionalization with water serving as oxygen donor, e.g., the bioconversion of quinaldine to 4-hydroxyquinaldine, was successfully achieved using resting cells of recombinant Pseudomonas putida, containing the molybdenum-enzyme quinaldine 4-oxidase, in a two-liquid phase (2LP) system (Ütkür et al. J Ind Microbiol Biotechnol 38:1067-1077, 2011). In the study reported here, key parameters determining process performance were investigated and an efficient and easy method for product recovery was established. The performance of the whole-cell biocatalyst was shown not to be limited by the availability of the inducer benzoate (also serving as growth substrate) during the growth of recombinant P. putida cells. Furthermore, catalyst performance during 2LP biotransformations was not limited by the availability of glucose, the energy source to maintain metabolic activity in resting cells, and molecular oxygen, a possible final electron acceptor during quinaldine oxidation. The product and the organic solvent (1-dodecanol) were identified as the most critical factors affecting biocatalyst performance, to a large extent on the enzyme level (inhibition), whereas substrate effects were negligible. However, none of the 13 alternative solvents tested surpassed 1-dodecanol in terms of toxicity, substrate/product solubility, and partitioning. The use of supercritical carbon dioxide for phase separation and an easy and efficient liquid-liquid extraction step enabled 4-hydroxyquinaldine to be isolated at a purity of >99.9% with recoveries of 57 and 84%, respectively. This study constitutes the first proof of concept on an integrated process for the oxyfunctionalization of toxic substrates with a water-incorporating hydroxylase.

  10. Directed evolution of bright mutants of an oxygen-independent flavin-binding fluorescent protein from Pseudomonas putida

    PubMed Central

    2012-01-01

    Background Fluorescent reporter proteins have revolutionized our understanding of cellular bioprocesses by enabling live cell imaging with exquisite spatio-temporal resolution. Existing fluorescent proteins are predominantly based on the green fluorescent protein (GFP) and related analogs. However, GFP-family proteins strictly require molecular oxygen for maturation of fluorescence, which precludes their application for investigating biological processes in low-oxygen environments. A new class of oxygen-independent fluorescent reporter proteins was recently reported based on flavin-binding photosensors from Bacillus subtilis and Pseudomonas putida. However, flavin-binding fluorescent proteins show very limited brightness, which restricts their utility as biological imaging probes. Results In this work, we report the discovery of bright mutants of a flavin-binding fluorescent protein from P. putida using directed evolution by site saturation mutagenesis. We discovered two mutations at a chromophore-proximal amino acid (F37S and F37T) that confer a twofold enhancement in brightness relative to the wild type fluorescent protein through improvements in quantum yield and holoprotein fraction. In addition, we observed that substitution with other aromatic amino acids at this residue (F37Y and F37W) severely diminishes fluorescence emission. Therefore, we identify F37 as a key amino acid residue in determining fluorescence. Conclusions To increase the scope and utility of flavin-binding fluorescent proteins as practical fluorescent reporters, there is a strong need for improved variants of the wild type protein. Our work reports on the application of site saturation mutagenesis to isolate brighter variants of a flavin-binding fluorescent protein, which is a first-of-its-kind approach. Overall, we anticipate that the improved variants will find pervasive use as fluorescent reporters for biological studies in low-oxygen environments. PMID:23095243

  11. Encapsulated Pseudomonas putida for phenol biodegradation: Use of a structural membrane for construction of a well-organized confined particle.

    PubMed

    Kurzbaum, Eyal; Raizner, Yasmin; Cohen, Oded; Suckeveriene, Ran Y; Kulikov, Anatoly; Hakimi, Ben; Iasur Kruh, Lilach; Armon, Robert; Farber, Yair; Menashe, Ofir

    2017-09-15

    Phenols are toxic byproducts from a wide range of industry sectors. If not treated, they form effluents that are very hazardous to the environment. This study presents the use of a Pseudomonas putida F1 culture encapsulated within a confined environment particle as an efficient technique for phenol biodegradation. The innovative encapsulation technique method, named the "Small Bioreactor Platform" (SBP) technology, enables the use of a microfiltration membrane constructed as a physical barrier for creating a confined environment for the encapsulated culture. The phenol biodegradation rate of the encapsulated culture was compared to its suspended state in order to evaluate the effectiveness of the encapsulation technique for phenol biodegradation. A maximal phenol biodegradation rate (q) of 2.12/d was exhibited by encapsulated P. putida at an initial phenol concentration of 100 mg/L. The biodegradation rate decreased significantly at lower and higher initial phenol concentrations of 50 and up to 3000 mg/L, reaching a rate of 0.1018/d. The results also indicate similar and up to double the degradation rate between the two bacterial states (encapsulated vs. suspended). High resolution scanning electron microscopy images of the SBP capsule's membrane morphology demonstrated a highly porous microfiltration membrane. These results, together with the long-term activity of the SBP capsules and verification that the culture remains pure after 60 days using 16S rRNA gene phylogenetic affiliation tests, provide evidence for a successful application of this new encapsulation technique for bioaugmentation of selected microbial cultures in water treatment processes. Copyright © 2017 Elsevier Ltd. All rights reserved.

  12. Fructose 1-phosphate is the one and only physiological effector of the Cra (FruR) regulator of Pseudomonas putida

    PubMed Central

    Chavarría, Max; Durante-Rodríguez, Gonzalo; Krell, Tino; Santiago, César; Brezovsky, Jan; Damborsky, Jiri; de Lorenzo, Víctor

    2014-01-01

    Fructose-1-phosphate (F1P) is the preferred effector of the catabolite repressor/activator (Cra) protein of the soil bacterium Pseudomonas putida but its ability to bind other metabolic intermediates in vivo is unclear. The Cra protein of this microorganism (CraPP) was submitted to mobility shift assays with target DNA sequences (the PfruB promoter) and candidate effectors fructose-1,6-bisphosphate (FBP), glucose 6-phosphate (G6P), and fructose-6-phosphate (F6P). 1 mM F1P was sufficient to release most of the Cra protein from its operators but more than 10 mM of FBP or G6P was required to free the same complex. However, isothermal titration microcalorimetry failed to expose any specific interaction between CraPP and FBP or G6P. To solve this paradox, transcriptional activity of a PfruB-lacZ fusion was measured in wild-type and ΔfruB cells growing on substrates that change the intracellular concentrations of F1P and FBP. The data indicated that PfruB activity was stimulated by fructose but not by glucose or succinate. This suggested that CraPP represses expression in vivo of the cognate fruBKA operon in a fashion dependent just on F1P, ruling out any other physiological effector. Molecular docking and dynamic simulations of the Cra-agonist interaction indicated that both metabolites can bind the repressor, but the breach in the relative affinity of CraPP for F1P vs FBP is three orders of magnitude larger than the equivalent distance in the Escherichia coli protein. This assigns the Cra protein of P. putida the sole role of transducing the presence of fructose in the medium into a variety of direct and indirect physiological responses. PMID:24918052

  13. Regulation of Pyrroloquinoline Quinone-Dependent Glucose Dehydrogenase Activity in the Model Rhizosphere-Dwelling Bacterium Pseudomonas putida KT2440

    PubMed Central

    An, Ran

    2016-01-01

    ABSTRACT Soil-dwelling microbes solubilize mineral phosphates by secreting gluconic acid, which is produced from glucose by a periplasmic glucose dehydrogenase (GDH) that requires pyrroloquinoline quinone (PQQ) as a redox coenzyme. While GDH-dependent phosphate solubilization has been observed in numerous bacteria, little is known concerning the mechanism by which this process is regulated. Here we use the model rhizosphere-dwelling bacterium Pseudomonas putida KT2440 to explore GDH activity and PQQ synthesis, as well as gene expression of the GDH-encoding gene (gcd) and PQQ biosynthesis genes (pqq operon) while under different growth conditions. We also use reverse transcription-PCR to identify transcripts from the pqq operon to more accurately map the operon structure. GDH specific activity and PQQ levels vary according to growth condition, with the highest levels of both occurring when glucose is used as the sole carbon source and under conditions of low soluble phosphate. Under these conditions, however, PQQ levels limit in vitro phosphate solubilization. GDH specific activity data correlate well with gcd gene expression data, and the levels of expression of the pqqF and pqqB genes mirror the levels of PQQ synthesized, suggesting that one or both of these genes may serve to modulate PQQ levels according to the growth conditions. The pqq gene cluster (pqqFABCDEG) encodes at least two independent transcripts, and expression of the pqqF gene appears to be under the control of an independent promoter and terminator. IMPORTANCE Plant growth promotion can be enhanced by soil- and rhizosphere-dwelling bacteria by a number of different methods. One method is by promoting nutrient acquisition from soil. Phosphorus is an essential nutrient that plants obtain through soil, but in many cases it is locked up in forms that are not available for plant uptake. Bacteria such as the model bacterium Pseudomonas putida KT2440 can solubilize insoluble soil phosphates by secreting

  14. Potential of the TCE-degrading endophyte Pseudomonas putida W619-TCE to improve plant growth and reduce TCE phytotoxicity and evapotranspiration in poplar cuttings

    SciTech Connect

    Weyens, N.; van der Lelie, D.; Truyens, S.; Dupae, J.; Newman, L.; Taghavi, S.; Carleer, R.; Vangronsveld, J.

    2010-09-01

    The TCE-degrading poplar endophyte Pseudomonas putida W619-TCE was inoculated in poplar cuttings, exposed to 0, 200 and 400 mg l{sup -1} TCE, that were grown in two different experimental setups. During a short-term experiment, plants were grown hydroponically in half strength Hoagland nutrient solution and exposed to TCE for 3 days. Inoculation with P. putida W619-TCE promoted plant growth, reduced TCE phytotoxicity and reduced the amount of TCE present in the leaves. During a mid-term experiment, plants were grown in potting soil and exposed to TCE for 3 weeks. Here, inoculation with P. putida W619-TCE had a less pronounced positive effect on plant growth and TCE phytotoxicity, but resulted in strongly reduced amounts of TCE in leaves and roots of plants exposed to 400 mg l{sup -1} TCE, accompanied by a lowered evapotranspiration of TCE. Dichloroacetic acid (DCAA) and trichloroacetic acid (TCAA), which are known intermediates of TCE degradation, were not detected. The endophyte P. putida W619-TCE degrades TCE during its transport through the xylem, leading to reduced TCE concentrations in poplar, and decreased TCE evapotranspiration.

  15. Volatilization of Arsenic from Polluted Soil by Pseudomonas putida Engineered for Expression of the arsM Arsenic(III) S-Adenosine Methyltransferase Gene

    PubMed Central

    2015-01-01

    Even though arsenic is one of the most widespread environmental carcinogens, methods of remediation are still limited. In this report we demonstrate that a strain of Pseudomonas putida KT2440 endowed with chromosomal expression of the arsM gene encoding the As(III) S-adenosylmethionine (SAM) methyltransfase from Rhodopseudomonas palustris to remove arsenic from contaminated soil. We genetically engineered the P. putida KT2440 with stable expression of an arsM-gfp fusion gene (GE P. putida), which was inserted into the bacterial chromosome. GE P. putida showed high arsenic methylation and volatilization activity. When exposed to 25 μM arsenite or arsenate overnight, most inorganic arsenic was methylated to the less toxic methylated arsenicals methylarsenate (MAs(V)), dimethylarsenate (DMAs(V)) and trimethylarsine oxide (TMAs(V)O). Of total added arsenic, the species were about 62 ± 2.2% DMAs(V), 25 ± 1.4% MAs(V) and 10 ± 1.2% TMAs(V)O. Volatilized arsenicals were trapped, and the predominant species were dimethylarsine (Me2AsH) (21 ± 1.0%) and trimethylarsine (TMAs(III)) (10 ± 1.2%). At later times, more DMAs(V) and volatile species were produced. Volatilization of Me2AsH and TMAs(III) from contaminated soil is thus possible with this genetically engineered bacterium and could be instrumental as an agent for reducing the inorganic arsenic content of soil and agricultural products. PMID:25122054

  16. Volatilization of arsenic from polluted soil by Pseudomonas putida engineered for expression of the arsM Arsenic(III) S-adenosine methyltransferase gene.

    PubMed

    Chen, Jian; Sun, Guo-Xin; Wang, Xiao-Xue; Lorenzo, Víctor de; Rosen, Barry P; Zhu, Yong-Guan

    2014-09-02

    Even though arsenic is one of the most widespread environmental carcinogens, methods of remediation are still limited. In this report we demonstrate that a strain of Pseudomonas putida KT2440 endowed with chromosomal expression of the arsM gene encoding the As(III) S-adenosylmethionine (SAM) methyltransfase from Rhodopseudomonas palustris to remove arsenic from contaminated soil. We genetically engineered the P. putida KT2440 with stable expression of an arsM-gfp fusion gene (GE P. putida), which was inserted into the bacterial chromosome. GE P. putida showed high arsenic methylation and volatilization activity. When exposed to 25 μM arsenite or arsenate overnight, most inorganic arsenic was methylated to the less toxic methylated arsenicals methylarsenate (MAs(V)), dimethylarsenate (DMAs(V)) and trimethylarsine oxide (TMAs(V)O). Of total added arsenic, the species were about 62 ± 2.2% DMAs(V), 25 ± 1.4% MAs(V) and 10 ± 1.2% TMAs(V)O. Volatilized arsenicals were trapped, and the predominant species were dimethylarsine (Me2AsH) (21 ± 1.0%) and trimethylarsine (TMAs(III)) (10 ± 1.2%). At later times, more DMAs(V) and volatile species were produced. Volatilization of Me2AsH and TMAs(III) from contaminated soil is thus possible with this genetically engineered bacterium and could be instrumental as an agent for reducing the inorganic arsenic content of soil and agricultural products.

  17. Medium-chain-length polyhydroxyalkanoates synthesis by Pseudomonas putida KT2440 relA/spoT mutant: bioprocess characterization and transcriptome analysis.

    PubMed

    Mozejko-Ciesielska, Justyna; Dabrowska, Dorota; Szalewska-Palasz, Agnieszka; Ciesielski, Slawomir

    2017-12-01

    Pseudomonas putida KT2440 is a model bacteria used commonly for medium-chain-length polyhydroxyalkanoates (mcl-PHAs) production using various substrates. However, despite many studies conducted on P. putida KT2440 strain, the molecular mechanisms of leading to mcl-PHAs synthesis in reaction to environmental stimuli are still not clear. The rearrangement of the metabolism in response to environmental stress could be controlled by stringent response that modulates the transcription of many genes in order to promote survival under nutritional deprivation conditions. Therefore, in this work we investigated the relation between mcl-PHAs synthesis and stringent response. For this study, a relA/spoT mutant of P. putida KT2440, unable to induce the stringent response, was used. Additionally, the transcriptome of this mutant was analyzed using RNA-seq in order to examine rearrangements of the metabolism during cultivation. The results show that the relA/spoT mutant of P. putida KT2440 is able to accumulate mcl-PHAs in both optimal and nitrogen limiting conditions. Nitrogen starvation did not change the efficiency of mcl-PHAs synthesis in this mutant. The transition from exponential growth to stationary phase caused significant upregulation of genes involved in transport system and nitrogen metabolism. Transcriptional regulators, including rpoS, rpoN and rpoD, did not show changes in transcript abundance when entering the stationary phase, suggesting their limited role in mcl-PHAs accumulation during stationary phase.

  18. Overexpression and characterization of medium-chain-length polyhydroxyalkanoate granule bound polymerases from Pseudomonas putida GPo1

    PubMed Central

    2009-01-01

    Background Polyhydroxyalkanoates (PHA) are synthesized by many bacteria in the cytoplasm as storage compounds for energy and carbon. The key enzymes for PHA biosynthesis are PHA polymerases, which catalyze the covalent linkage of 3-hydroxyacyl coenzymeA thioesters by transesterification with concomitant release of CoA. Pseudomonas putida GPo1 and many other Pseudomonas species contain two different class II polymerases, encoded by phaC1 and phaC2. Although numerous studies have been carried out on PHA polymerases and they are well characterized at the molecular level, the biochemical properties of the class II polymerases have not been studied in detail. Previously we and other groups purified the polymerases, however, the activities of the purified enzymes were several magnitude lower than the granule-bound enzymes. It is problematic to study the intrinsic properties of these enzymes with such low activities, although they are pure. Results PHA polymerase 1 (PhaC1) and PHA polymerase 2 (PhaC2) from P. putida GPo1 were overexpressed in the PHA-negative host P. putida GPp104 and purified from isolated PHA granules. Only minor activity (two to three orders of magnitude lower than that of the granule bound proteins) could be recovered when the enzymes were purified to homogeneity. Therefore, kinetic properties and substrate ranges were determined for the granule bound polymerases. The polymerases differed significantly with respect to their association with PHA granules, enzyme kinetics and substrate specificity. PhaC2 appeared to bind PHA granules more tightly than PhaC1. When R-3-hydroxyoctanoic acid was used as substrate, the granule-bound PhaC1 exhibited a Km of 125 (± 35) μM and a Vmax of 40.8 (± 6.2) U/mg PhaC1, while a Km of 37 (± 10) μM and a Vmax of 2.7 (± 0.7) U/mg PhaC2 could be derived for the granule-bound PhaC2. Granule-bound PhaC1 showed a strong preference for medium chain length (mcl-) 3-hydroxyacly-CoAs, with highest affinity towards 3

  19. Effect of Environmental Factors on the trans/cis Ratio of Unsaturated Fatty Acids in Pseudomonas putida S12

    PubMed Central

    Heipieper, H. J.; Meulenbeld, G.; van Oirschot, Q.; de Bont, J.

    1996-01-01

    The membrane reactions of Pseudomonas putida S12 to environmental stress were investigated. Cells reacted to the addition of six different heavy metals with an increase in the ratio of trans to cis unsaturated fatty acids. A correlation among the increase in the trans/cis ratio, the toxic effects of the heavy metals, and nonspecific permeabilization of the cytoplasmic membrane, as indicated by an efflux of potassium ions, was measured. Cells previously adapted to toxic concentrations of toluene exhibited increased tolerance to all applied concentrations of zinc compared with nonadapted cells. Cells exposed to different temperatures grew optimally at 30(deg)C. The degree of saturation of the membrane fatty acids of these cells decreased with decreasing temperature. An increase in the trans/cis ratio of unsaturated fatty acids took place only at higher temperatures. Osmotic stress, expressed as reduced water activity, was obtained by using different types of solutes. Only in the presence of toxic concentrations of sodium chloride or sucrose did the trans/cis ratio increase. At no applied water activity a significant effect of glycerol on the trans/cis ratio was measured. When cells were exposed to different pHs, a distinct optimum cis/trans isomerase activity was measured at pHs between 4.0 and 5.0, whereas at higher or lower pHs no reaction occurred. This optimum coincided with a loss of viability between pH 4 and 5. PMID:16535373

  20. Flavin-Dependent Redox Transfers by the Two-Component Diketocamphane Monooxygenases of Camphor-Grown Pseudomonas putida NCIMB 10007

    PubMed Central

    Willetts, Andrew; Kelly, David

    2016-01-01

    The progressive titres of key monooxygenases and their requisite native donors of reducing power were used to assess the relative contribution of various camphor plasmid (CAM plasmid)- and chromosome-coded activities to biodegradation of (rac)-camphor at successive stages throughout growth of Pseudomonas putida NCIMB 10007 on the bicylic monoterpenoid. A number of different flavin reductases (FRs) have the potential to supply reduced flavin mononucleotide to both 2,5- and 3,6-diketocamphane monooxygenase, the key isoenzymic two-component monooxygenases that delineate respectively the (+)- and (−)-camphor branches of the convergent degradation pathway. Two different constitutive chromosome-coded ferric reductases able to act as FRs can serve such as role throughout all stages of camphor-dependent growth, whereas Fred, a chromosome-coded inducible FR can only play a potentially significant role in the relatively late stages. Putidaredoxin reductase, an inducible CAM plasmid-coded flavoprotein that serves an established role as a redox intermediate for plasmid-coded cytochrome P450 monooxygenase also has the potential to serve as an important FR for both diketocamphane monooxygenases (DKCMOs) throughout most stages of camphor-dependent growth. PMID:27754389

  1. LapF, the second largest Pseudomonas putida protein, contributes to plant root colonization and determines biofilm architecture.

    PubMed

    Martínez-Gil, Marta; Yousef-Coronado, Fátima; Espinosa-Urgel, Manuel

    2010-08-01

    We have investigated the role of LapF, one of the two largest proteins encoded in the genome of Pseudomonas putida KT2440, in bacterial colonization of solid surfaces. LapF is 6310 amino acids long, and is localized on the cell surface. The C-terminal region of the protein is essential for its secretion, which presumably requires the ABC transporter encoded by an operon (lapHIJ) adjacent to the lapF gene. Although the initial attachment stages are not different between the wild type and a lapF mutant, microcolony formation and subsequent development of a mature biofilm is impaired in the mutant. This is consistent with the expression pattern of lapF; activation of its promoter takes place at late stages of growth and is regulated by the alternative sigma factor RpoS. A lapF mutant is also affected in individual and competitive plant root colonization. In these assays, mixed microcolonies formed by cells of both the wild-type and the mutant strains could be observed but microcolonies of the mutant alone were not found. These data and the localization of the protein at discrete spots in areas of contact between cells in biofilms suggest that LapF determines the establishment of cell-cell interactions during sessile growth.

  2. Stability of a Pseudomonas putida KT2440 bacteriophage-carried genomic island and its impact on rhizosphere fitness.

    PubMed

    Quesada, Jose M; Soriano, María Isabel; Espinosa-Urgel, Manuel

    2012-10-01

    The stability of seven genomic islands of Pseudomonas putida KT2440 with predicted potential for mobilization was studied in bacterial populations associated with the rhizosphere of corn plants by multiplex PCR. DNA rearrangements were detected for only one of them (GI28), which was lost at high frequency. This genomic island of 39.4 kb, with 53 open reading frames, shows the characteristic organization of genes belonging to tailed phages. We present evidence indicating that it corresponds to the lysogenic state of a functional bacteriophage that we have designated Pspu28. Integrated and rarely excised forms of Pspu28 coexist in KT2440 populations. Pspu28 is self-transmissible, and an excisionase is essential for its removal from the bacterial chromosome. The excised Pspu28 forms a circular element that can integrate into the chromosome at a specific location, att sites containing a 17-bp direct repeat sequence. Excision/insertion of Pspu28 alters the promoter sequence and changes the expression level of PP_1531, which encodes a predicted arsenate reductase. Finally, we show that the presence of Pspu28 in the lysogenic state has a negative effect on bacterial fitness in the rhizosphere under conditions of intraspecific competition, thus explaining why clones having lost this mobile element are recovered from that environment.

  3. Extracellular expression of natural cytosolic arginine deiminase from Pseudomonas putida and its application in the production of L-citrulline.

    PubMed

    Su, Lingqia; Ma, Yue; Wu, Jing

    2015-11-01

    The Pseudomonas putida arginine deiminase (ADI), a natural cytosolic enzyme, and Thermobifida fusca cutinase were co-expressed in Escherichia coli, and the optimized cutinase gene was used for increasing its expression level. 90.9% of the total ADI protein was released into culture medium probably through a nonspecific leaking mechanism caused by the co-expressed cutinase. The enzymatic properties of the extracellular ADI were found to be similar to those of ADI prepared by conventional cytosolic expression. Extracellular production of ADI was further scaled up in a 3-L fermentor. When the protein expression was induced by IPTG (25.0μM) and lactose (0.1gL(-1)h(-1)) at 30°C, the extracellular ADI activity reached 101.2UmL(-1), which represented the highest ADI production ever reported. In addition, the enzymatic synthesis of l-citrulline was performed using the extracellularly expressed ADI, and the conversion rate reached 100% with high substrate concentration at 650gL(-1).

  4. Growth stimulation of Bacillus cereus and Pseudomonas putida using nanostructured ZnO thin film as transducer element

    NASA Astrophysics Data System (ADS)

    Loukanov, Alexandre; Filipov, Chavdar; Valcheva, Violeta; Lecheva, Marta; Emin, Saim

    2015-04-01

    The semiconductor zinc oxide nanomaterial (ZnO or ZnO:H) is widely used in advanced biosensor technology for the design of highly-sensitive detector elements for various applications. In the attempt to evaluate its effect on common microorganisms, two types of nanostructured transducer films have been used (average diameter 600-1000 nm). They have been prepared by using both wet sol-gel method and magnetron sputtering. Their polycrystalline structure and specific surface features have been analyzed by X-ray diffraction (XRD), scanning electron microscope, and atomic force microscope. The assessment of growth stimulation of bacteria was determined using epifluorescent microscope by cell staining with Live/Dead BacLight kit. In our experiments, the growth stimulation of Gram-positive and Gram-negative bacteria on nanostructured ZnO film is demonstrated by Bacillus cereus and Pseudomonas putida. These two bacterial species have been selected, because they are well known and studied in biosensor technologies, with structural difference of their cell walls. These pathogens are easy for with common source in the liquid food or some commercial products. Our data has revealed that the method of transducer film preparation influences strongly bacterial inhibition and division. These results present the transforming signal precisely, when ZnO is used in biosensor applications.

  5. Use of microcalorimetry to determine the costs and benefits to Pseudomonas putida strain KT2440 of harboring cadmium efflux genes.

    PubMed

    Gibbons, Sean M; Feris, Kevin; McGuirl, Michele A; Morales, Sergio E; Hynninen, Anu; Ramsey, Philip W; Gannon, James E

    2011-01-01

    A novel microcalorimetric approach was used to analyze the responses of a metal-tolerant soil bacterium (Pseudomonas putida strain KT2440) to metal resistance gene deletions in cadmium-amended media. As hypothesized, under cadmium stress, the wild-type strain benefited from the resistance genes by entering the exponential growth phase earlier than two knockout strains. In the absence of cadmium, strain KT1, carrying a deletion in the main component (czcA1) of a Cd/Zn chemiosmotic efflux transporter (CzcCBA1), grew more efficiently than the wild type and released ∼700 kJ (per mole of biomass carbon) less heat than the wild-type strain, showing the energetic cost of maintaining CzcCBA1 in the absence of cadmium. A second mutant strain (KT4) carrying a different gene deletion, ΔcadA2, which encodes the main Cd/Pb efflux transporter (a P-type ATPase), did not survive beyond moderate cadmium concentrations and exhibited a decreased growth yield in the absence of cadmium. Therefore, CadA2 plays an essential role in cadmium resistance and perhaps serves an additional function. The results of this study provide direct evidence that heavy metal cation efflux mechanisms facilitate shorter lag phases in the presence of metals and that the maintenance and expression of tolerance genes carry quantifiable energetic costs and benefits.

  6. Metabolism of naphthalene, fluorene, and phenanthrene: preliminary characterization of a cloned gene cluster from Pseudomonas putida NCIB 9816.

    PubMed Central

    Yang, Y; Chen, R F; Shiaris, M P

    1994-01-01

    A modified cloning procedure was used to obtain large DNA insertions (20 to 30 kb) from Pseudomonas putida NCIB 9816 that expressed polycyclic aromatic hydrocarbon (PAH) transformation activity in Escherichia coli HB101. Four subclones (16 [in both orientations], 12, and 8.5 kb in size) were constructed from the initial clones. Naphthalene, fluorene, and phenanthrene transformations were investigated in these eight NCIB 9816 clones by a simple agar plate assay method, which was developed to detect and identify potential PAH metabolites. Results indicated that the necessary genes encoding the initial ring fission of the three PAHs in E. coli cells are located in an 8.5-kb EcoRI-XhoI portion, but the lower-pathway genes are not present in a 38-kb neighborhood region. These NCIB 9816 clones could transform naphthalene and phenanthrene to salicylic acid and 1-hydroxy-2-naphthoic acid, respectively. With the same clones, fluorene was degraded to 9-hydroxyfluorene, 9-fluorenone, and two unidentified compounds. Genetic similarity between the NAH7 upper-pathway genes and the cloned NCIB 9816 genes was confirmed by Southern blot DNA-DNA hybridization. In spite of this genetic similarity, the abilities of the two clusters to transform multiple PAHs were different. Under our experimental conditions, only the metabolites from naphthalene transformation by the NAH7 clone (pE317) were detected, whereas the NCIB 9816 clones produced metabolites from all three PAHs. Images PMID:8157584

  7. A Set of Activators and Repressors Control Peripheral Glucose Pathways in Pseudomonas putida To Yield a Common Central Intermediate▿

    PubMed Central

    del Castillo, Teresa; Duque, Estrella; Ramos, Juan L.

    2008-01-01

    Pseudomonas putida KT2440 channels glucose to the central Entner-Doudoroff intermediate 6-phosphogluconate through three convergent pathways. The genes for these convergent pathways are clustered in three independent regions on the host chromosome. A number of monocistronic units and operons coexist within each of these clusters, favoring coexpression of catabolic enzymes and transport systems. Expression of the three pathways is mediated by three transcriptional repressors, HexR, GnuR, and PtxS, and by a positive transcriptional regulator, GltR-2. In this study, we generated mutants in each of the regulators and carried out transcriptional assays using microarrays and transcriptional fusions. These studies revealed that HexR controls the genes that encode glucokinase/glucose 6-phosphate dehydrogenase that yield 6-phosphogluconate; the genes for the Entner-Doudoroff enzymes that yield glyceraldehyde-3-phosphate and pyruvate; and gap-1, which encodes glyceraldehyde-3-phosphate dehydrogenase. GltR-2 is the transcriptional regulator that controls specific porins for the entry of glucose into the periplasmic space, as well as the gtsABCD operon for glucose transport through the inner membrane. GnuR is the repressor of gluconate transport and gluconokinase responsible for the conversion of gluconate into 6-phosphogluconate. PtxS, however, controls the enzymes for oxidation of gluconate to 2-ketogluconate, its transport and metabolism, and a set of genes unrelated to glucose metabolism. PMID:18245293

  8. Degradation of phenol by Pseudomonas putida ATCC 11172 in continuous culture at different ratios of biofilm surface to culture volume

    SciTech Connect

    Molin, G.; Nilsson, I.

    1985-10-01

    Pseudomonas putida ATCC 11172 was grown in continuous culture with phenol as the only carbon and energy source; a culture practically without biofilm was compared with biofilm cultures of differing surface area/volume ratios. The biofilm did not significantly affect the maximal suspended cell concentration in the effluent, but it increased the maximal phenol reduction rate from 0.23 g/liter per h (without biofilm) to 0.72 g/liter per h at the highest biofilm level (5.5 cm/sup 2/ of biofilm surface per ml of reactor volume). The increase in phenol reduction rate was linear up to the surface area/volume ratio of 1.4 cm/sup 2//ml. The continuous cultures with biofilms could tolerate a higher phenol concentration of the medium (3.0 g/liter) than the nonbiofilm system (2.5 g/liter). At higher dilution rates an intermediate product, 2-hydroxymuconic semialdehyde, accumulated in the culture. When the biomass of the effluent started to decrease, the concentration of 2-hydroxymuconic semialdehyde, accumulated in the culture. When the biomass of the effluent started to decrease, the concentration of 2-hydroxymuconic semialdehyde reached a peak value. The authors conclude that biofilms in continuous culture have the potential to enhance the aerobic degradation of aromatic compounds.

  9. Molecular modelling and quantum biochemistry computations of a naturally occurring bioremediation enzyme: Alkane hydroxylase from Pseudomonas putida P1.

    PubMed

    de Sousa, B G; Oliveira, J I N; Albuquerque, E L; Fulco, U L; Amaro, V E; Blaha, C A G

    2017-09-01

    Many species of bacteria involved in degradation of n-alkanes have an important constitutional metabolic enzyme, the alkane hydroxylase called AlkB, specialized in the conversion of hydrocarbons molecules that can be used as carbon and/or energy source. This enzyme plays an important role in the microbial degradation of oil, chlorinated hydrocarbons, fuel additives, and many other compounds. A number of these enzymes has been biochemically characterized in detail because the potential of alkane hydroxylases to catalyse high added-value reactions is widely recognized. Nevertheless, the industrial and process bioremediation application of them is restricted, owing to their complex biochemistry, challenging process requirements, and the limited number of their three-dimensional structures. Furthermore, AlkB has great potential as biocatalysts for selective transformation of a wide range of chemically inert unreactive alkanes into reactive chemical precursors that can be used as tools for bioremediation and bioprocesses. Aiming to understand the possible ways the AlkB enzyme Pseudomonas putida P1 interacts with octane, octanol and 1-octyne, we consider its suitable biochemical structure taking into account a 3-D homology modelling. Besides, by using a quantum chemistry computational model based on the density functional theory (DFT), we determine possible protein-substrate interaction regions measured by means of its binding energy simulated throughout the Molecular Fractionation with Conjugated Caps (MFCC) approach. Copyright © 2017 Elsevier Inc. All rights reserved.

  10. Preparation and characterization of monodisperse microcapsules with alginate and bentonite via external gelation technique encapsulating Pseudomonas putida Rs-198.

    PubMed

    Li, Xuan; Wu, Zhansheng; He, Yanhui; Ye, Bang-Ce; Wang, Jun

    2017-10-01

    This paper evaluated the external gelation technique for preparing microcapsules. The microcapsules were consisted of Pseudomonas putida Rs-198 (Rs-198) core and sodium alginate (NaAlg)-bentonite (Bent) shell. Different emulsification rotation speeds and core/shell ratios were used to prepare the microcapsules of each formulation. The near-spherical microcapsules were monodisperse with a mean diameter of 25-100 μm and wrinkled surfaces. Fourier transform infrared spectrophotometry (FTIR) and thermogravimetric analysis (TGA) revealed the physical mixture of the wall material and the superior thermal stability of the microcapsules. Percentage yield, water content, and encapsulation efficiency were evaluated and correlated with the changes in emulsification rotation speed and core/shell ratio. In vitro release experiments demonstrated that 60% of the bacteria were released from the NaAlg-Bent microcapsules within three days. Considerably better survival was observed for encapsulated cells compared to free cells, especially in pH 4.0 and 10.0. In summary, the desired properties of microcapsules can be obtained by external gelation technique and the microcapsules on the bacteria had a good protective effect.

  11. Cloning, Expression, Characterization, and Biocatalytic Investigation of the 4-Hydroxyacetophenone Monooxygenase from Pseudomonas putida JD1▿ †

    PubMed Central

    Rehdorf, Jessica; Zimmer, Christian L.; Bornscheuer, Uwe T.

    2009-01-01

    While the number of available recombinant Baeyer-Villiger monooxygenases (BVMOs) has grown significantly over the last few years, there is still the demand for other BVMOs to expand the biocatalytic diversity. Most BVMOs that have been described are dedicated to convert efficiently cyclohexanone and related cyclic aliphatic ketones. To cover a broader range of substrate types and enantio- and/or regioselectivities, new BVMOs have to be discovered. The gene encoding a BVMO identified in Pseudomonas putida JD1 converting aromatic ketones (HAPMO; 4-hydroxyacetophenone monooxygenase) was amplified from genomic DNA using SiteFinding-PCR, cloned, and functionally expressed in Escherichia coli. Furthermore, four other open reading frames could be identified clustered around this HAPMO. It has been suggested that these proteins, including the HAPMO, might be involved in the degradation of 4-hydroxyacetophenone. Substrate specificity studies revealed that a large variety of other arylaliphatic ketones are also converted via Baeyer-Villiger oxidation into the corresponding esters, with preferences for para-substitutions at the aromatic ring. In addition, oxidation of aldehydes and some heteroaromatic compounds was observed. Cycloketones and open-chain ketones were not or poorly accepted, respectively. It was also found that this enzyme oxidizes aromatic ketones such as 3-phenyl-2-butanone with excellent enantioselectivity (E ≫100). PMID:19251889

  12. Expression of benzene dioxygenase from Pseudomonas putida ML2 in cis-1,2-cyclohexanediol-degrading pseudomonads.

    PubMed

    Swift, R J; Carter, S F; Widdowson, D A; Mason, J R; Leak, D J

    2001-06-01

    Benzene dioxygenase (BDO; EC 1.14.12.3) from Pseudomonas putida ML2 dihydroxylates benzene to produce cis-1,2-dihydroxy-cyclohexa-3,5-diene. As well as oxidising benzene and toluene, cell-free extracts of Escherichia coli JM109 expressing recombinant BDO oxidised cyclohexene, 1-methylcyclohexene and 3-methylcyclohexene. In an attempt to construct a novel metabolic pathway for the degradation of cyclohexene (via an initial BDO-mediated dihydroxylation of cyclohexene), cis-1,2-cyclohexanediol-degrading bacteria were isolated by enrichment culture. The bedC1C2BA genes encoding BDO (under the control of the tac promoter) were sub-cloned into pLAFR5, successfully conjugated into seven of the Gram-negative cis-1,2-cyclo-hexanediol-degrading isolates and stably maintained and expressed in three of them. However, despite their ability to grow on cis-1,2-cyclohexanediol as sole carbon source, express an active BDO and oxidise cyclohexene, none of the three strains was able to grow on cyclohexene as sole carbon source. Analysis revealed that BDO oxidised cyclohexene to a mixture of two products, a monohydroxylated (2-cyclohexen-1-ol) product and a dihydroxylated (cis-1,2-cyclohexanediol) product; and failure to grow on cyclohexene was attributed to the toxicity of metabolic intermediates accumulating from the 2-cyclohexen-1-ol metabolism.

  13. Degradation of phenol and toxicity of phenolic compounds: a comparison of cold-tolerant Arthrobacter sp. and mesophilic Pseudomonas putida.

    PubMed

    Margesin, Rosa; Bergauer, Philipp; Gander, Silvia

    2004-06-01

    Phenol degradation efficiency of cold-tolerant Arthrobacter sp. AG31 and mesophilic Pseudomonas putida DSM6414 was compared. The cold-tolerant strain was cultivated at 10 degrees C, while the mesophile was grown at 25 degrees C. Both strains degraded 200 mg and 400 mg phenol/l within 48-72 h of cultivation, but the cold-tolerant strain produced more biomass than the mesophile. Both strains oxidized catechol by the ortho type of ring fission. Catechol 1,2 dioxygenase (C1,2D) activity was found intra- and extracellularly in the absence and in the presence of phenol. In the presence of 200 mg phenol/l, C1,2D activity of the mesophile was about 1.5- to 2-fold higher than that of the cold-tolerant strain. However, an initial phenol concentration of 400 mg/l resulted in a comparable enzyme activity of the cold-tolerant and the mesophilic strain. The two strains differed significantly in their toxicity pattern towards 12 aromatic (mostly phenolic) compounds at different growth temperatures, which was determined via growth inhibition in the presence of nutrients and toxicants. For the cold-tolerant strain, toxicity was significantly lower at 10 degrees C than at 25 degrees C. The mesophile showed a significantly lower susceptibility to high hydrocarbon concentrations when grown at 25 degrees C compared to 10 degrees C.

  14. Growth kinetics, effect of carbon substrate in biosynthesis of mcl-PHA by Pseudomonas putida Bet001

    PubMed Central

    Gumel, A.M.; Annuar, M.S.M.; Heidelberg, T.

    2014-01-01

    Growth associated biosynthesis of medium chain length poly-3-hydroxyalkanoates (mcl-PHA) in Pseudomonas putida Bet001 isolated from palm oil mill effluent was studied. Models with substrate inhibition terms described well the kinetics of its growth. Selected fatty acids (C8:0 to C18:1) and ammonium were used as carbon and nitrogen sources during growth and PHA biosynthesis, resulting in PHA accumulation of about 50 to 69% (w/w) and PHA yields ranging from 10.12 g L−1 to 15.45 g L−1, respectively. The monomer composition of the PHA ranges from C4 to C14, and was strongly influenced by the type of carbon substrate fed. Interestingly, an odd carbon chain length (C7) monomer was also detected when C18:1 was fed. Polymer showed melting temperature (Tm) of 42.0 (± 0.2) °C, glass transition temperature (Tg) of −1.0 (± 0.2) °C and endothermic melting enthalpy of fusion (ΔHf) of 110.3 (± 0.1) J g−1. The molecular weight (Mw) range of the polymer was relatively narrow between 55 to 77 kDa. PMID:25242925

  15. Crystallization and preliminary X-ray diffraction analysis of recombinant chlorocatechol 1,2-­dioxygenase from Pseudomonas putida

    PubMed Central

    Rustiguel, Joane Kathelen; Pinheiro, Matheus Pinto; Araújo, Ana Paula Ulian; Nonato, Maria Cristina

    2011-01-01

    Chlorocatechol 1,2-dioxygenase from the Gram-negative bacterium Pseudomonas putida (Pp 1,2-CCD) is considered to be an important biotechnological tool owing to its ability to process a broad spectrum of organic pollutants. In the current work, the crystallization, crystallographic characterization and phasing of the recombinant Pp 1,2-CCD enzyme are described. Reddish-brown crystals were obtained in the presence of polyethylene glycol and magnesium acetate by utilizing the vapour-diffusion technique in sitting drops. Crystal dehydration was the key step in obtaining data sets, which were collected on the D03B-MX2 beamline at the CNPEM/MCT – LNLS using a MAR CCD detector. Pp 1,2-CCD crystals belonged to space group P6122 and the crystallographic structure of Pp 1,2-CCD has been solved by the MR-SAD technique using Fe atoms as scattering centres and the coordinates of 3-chlorocatechol 1,2-dioxygenase from Rhodococcus opacus (PDB entry 2boy) as the search model. The initial model, which contains three molecules in the asymmetric unit, has been refined to 3.4 Å resolution. PMID:21505253

  16. Isolation and Characterization of Toluene-Sensitive Mutants from the Toluene-Resistant Bacterium Pseudomonas putida GM73

    PubMed Central

    Kim, Kwang; Lee, Sungjin; Lee, Kyunghee; Lim, Dongbin

    1998-01-01

    To understand the mechanism underlying toluene resistance of a toluene-tolerant bacterium, Pseudomonas putida GM73, we carried out Tn5 mutagenesis and isolated eight toluene-sensitive mutants. None of the mutants grew in the presence of 20% (vol/vol) toluene in growth medium but exhibited differential sensitivity to toluene. When wild-type cells were treated with toluene (1% [vol/vol]) for 5 min, about 2% of the cells could form colonies. In the mutants Ttg1, Ttg2, Ttg3, and Ttg8, the same treatment killed more than 99.9999% of cells (survival rate, <10−6). In Ttg4, Ttg5, Ttg6, and Ttg7, about 0.02% of cells formed colonies. We cloned the Tn5-inserted genes, and the DNA sequence flanking Tn5 was determined. From comparison with a sequence database, putative protein products encoded by ttg genes were identified as follows. Ttg1 and Ttg2 are ATP binding cassette (ABC) transporter homologs; Ttg3 is a periplasmic linker protein of a toluene efflux pump; both Ttg4 and Ttg7 are pyruvate dehydrogenase; Ttg5 is a dihydrolipoamide acetyltransferase; and Ttg7 is the negative regulator of the phosphate regulon. The sequences deduced from ttg8 did not show a significant similarity to any DNA or proteins in sequence databases. Characterization of these mutants and identification of mutant genes suggested that active efflux mechanism and efficient repair of damaged membranes were important in toluene resistance. PMID:9658016

  17. Growth kinetics, effect of carbon substrate in biosynthesis of mcl-PHA by Pseudomonas putida Bet001.

    PubMed

    Gumel, A M; Annuar, M S M; Heidelberg, T

    2014-01-01

    Growth associated biosynthesis of medium chain length poly-3-hydroxyalkanoates (mcl-PHA) in Pseudomonas putida Bet001 isolated from palm oil mill effluent was studied. Models with substrate inhibition terms described well the kinetics of its growth. Selected fatty acids (C8:0 to C18:1) and ammonium were used as carbon and nitrogen sources during growth and PHA biosynthesis, resulting in PHA accumulation of about 50 to 69% (w/w) and PHA yields ranging from 10.12 g L(-1) to 15.45 g L(-1), respectively. The monomer composition of the PHA ranges from C4 to C14, and was strongly influenced by the type of carbon substrate fed. Interestingly, an odd carbon chain length (C7) monomer was also detected when C18:1 was fed. Polymer showed melting temperature (T m) of 42.0 (± 0.2) °C, glass transition temperature (T g) of -1.0 (± 0.2) °C and endothermic melting enthalpy of fusion (ΔHf) of 110.3 (± 0.1) J g(-1). The molecular weight (M w) range of the polymer was relatively narrow between 55 to 77 kDa.

  18. Crystallization and Preliminary X-ray Diffraction Analysis of Recombinant Chlorocatechol 1 2-dioxygenase from Pseudomonas Putida

    SciTech Connect

    J Rustiguel; M Pinheiro; A Araujo; M Nonato

    2011-12-31

    Chlorocatechol 1,2-dioxygenase from the Gram-negative bacterium Pseudomonas putida (Pp 1,2-CCD) is considered to be an important biotechnological tool owing to its ability to process a broad spectrum of organic pollutants. In the current work, the crystallization, crystallographic characterization and phasing of the recombinant Pp 1,2-CCD enzyme are described. Reddish-brown crystals were obtained in the presence of polyethylene glycol and magnesium acetate by utilizing the vapor-diffusion technique in sitting drops. Crystal dehydration was the key step in obtaining data sets, which were collected on the D03B-MX2 beamline at the CNPEM/MCT - LNLS using a MAR CCD detector. Pp 1,2-CCD crystals belonged to space group P6{sub 1}22 and the crystallographic structure of Pp 1,2-CCD has been solved by the MR-SAD technique using Fe atoms as scattering centres and the coordinates of 3-chlorocatechol 1,2-dioxygenase from Rhodococcus opacus (PDB entry 2boy) as the search model. The initial model, which contains three molecules in the asymmetric unit, has been refined to 3.4 {angstrom} resolution.

  19. The Repetitive Detection of Toluene with Bioluminescence Bioreporter Pseudomonas putida TVA8 Encapsulated in Silica Hydrogel on an Optical Fiber.

    PubMed

    Kuncová, Gabriela; Ishizaki, Takayuki; Solovyev, Andrey; Trögl, Josef; Ripp, Steven

    2016-06-15

    Living cells of the lux-based bioluminescent bioreporter Pseudomonas putida TVA8 were encapsulated in a silica hydrogel attached to the distal wider end of a tapered quartz fiber. Bioluminescence of immobilized cells was induced with toluene at high (26.5 mg/L) and low (5.3 mg/L) concentrations. Initial bioluminescence maxima were achieved after >12 h. One week after immobilization, a biofilm-like layer of cells had formed on the surface of the silica gel. This resulted in shorter response times and more intensive bioluminescence maxima that appeared as rapidly as 2 h after toluene induction. Considerable second bioluminescence maxima were observed after inductions with 26.5 mg toluene/L. The second and third week after immobilization the biosensor repetitively and semiquantitatively detected toluene in buffered medium. Due to silica gel dissolution and biofilm detachment, the bioluminescent signal was decreasing 20-32 days after immobilization and completely extinguished after 32 days. The reproducible formation of a surface cell layer on the wider end of the tapered optical fiber can be translated to various whole cell bioluminescent biosensor devices and may serve as a platform for in-situ sensors.

  20. Physical, kinetic and spectrophotometric studies of a NAD(P)-dependent benzaldehyde dehydrogenase from Pseudomonas putida ATCC 12633.

    PubMed

    Yeung, Catherine K; Yep, Alejandra; Kenyon, George L; McLeish, Michael J

    2008-09-01

    The mandelate pathway of Pseudomonas putida ATCC 12633 comprises five enzymes and catalyzes the conversion of R- and S-mandelamide to benzoic acid which subsequently enters the beta-ketoadipate pathway. Although the first four enzymes have been extensively characterized the terminal enzyme, a NAD(P)+-dependent benzaldehyde dehydrogenase (BADH), remains largely undescribed. Here we report that BADH is a dimer in solution, and that DTT is necessary both to maintain the activity of BADH and to prevent oligimerization of the enzyme. Site-directed mutagenesis confirms that Cys249 is the catalytic cysteine and identifies Cys140 as the cysteine likely to be involved in inter-monomer disulfide formation. BADH can utilize a range of aromatic substrates and will also operate efficiently with cyclohexanal as well as medium-chain aliphatic aldehydes. The logV and logV/K pH-rate profiles for benzaldehyde with either NAD+ or NADP+ as the coenzyme are both bell-shaped. The pKa values on the ascending limb range from 6.2 to 7.1 while those on the descending limb range from 9.6 to 9.9. A spectrophotometric approach was used to show that the pKa of Cys249 was 8.4, i.e., Cys249 is not responsible for the pKas observed in the pH-rate profiles.

  1. Outer Membrane Changes in a Toluene-Sensitive Mutant of Toluene-Tolerant Pseudomonas putida IH-2000

    PubMed Central

    Kobayashi, Hideki; Takami, Hideto; Hirayama, Hisako; Kobata, Kuniko; Usami, Ron; Horikoshi, Koki

    1999-01-01

    We isolated a toluene-sensitive mutant, named mutant No. 32, which showed unchanged antibiotic resistance levels, from toluene-tolerant Pseudomonas putida IH-2000 by transposon mutagenesis with Tn5. The gene disrupted by insertion of Tn5 was identified as cyoC, which is one of the subunits of cytochrome o. The membrane protein, phospholipid, and lipopolysaccharide (LPS) of IH-2000 and that of mutant No. 32 were examined and compared. Some of the outer membrane proteins showed a decrease in mutant No. 32. The fatty acid components of LPS were found to be dodecanoic acid, 2-hydroxydodecanoic acid, 3-hydroxydodecanoic acid, and 3-hydroxydecanoic acid in both IH-2000 and No. 32; however, the relative proportions of these components differed in the two strains. Furthermore, cell surface hydrophobicity was increased in No. 32. These data suggest that mutation of cyoC caused the decrease in outer membrane proteins and the changing fatty acid composition of LPS. These changes in the outer membrane would cause an increase in cell surface hydrophobicity, and mutant No. 32 is considered to be sensitive to toluene. PMID:10419944

  2. Biosynthesis and Characterization of Polyhydroxyalkanoates Copolymers Produced by Pseudomonas putida Bet001 Isolated from Palm Oil Mill Effluent

    PubMed Central

    Gumel, Ahmad Mohammed; Annuar, Mohamad Suffian Mohamad; Heidelberg, Thorsten

    2012-01-01

    The biosynthesis and characterization of medium chain length poly-3-hydroxyalkanoates (mcl-PHA) produced by Pseudomonas putida Bet001 isolated from palm oil mill effluent was studied. The biosynthesis of mcl-PHA in this newly isolated microorganism follows a growth-associated trend. Mcl-PHA accumulation ranging from 49.7 to 68.9% on cell dry weight (CDW) basis were observed when fatty acids ranging from octanoic acid (C8∶0) to oleic acid (C18∶1) were used as sole carbon and energy source. Molecular weight of the polymer was found to be ranging from 55.7 to 77.7 kDa. Depending on the type of fatty acid used, the 1H NMR and GCMSMS analyses of the chiral polymer showed a composition of even and odd carbon atom chain with monomer length of C4 to C14 with C8 and C10 as the principal monomers. No unsaturated monomer was detected. Thermo-chemical analyses showed the accumulated PHA to be semi-crystalline polymer with good thermal stability, having a thermal degradation temperature (Td) of 264.6 to 318.8 (±0.2) oC, melting temperature (Tm) of 43. (±0.2) oC, glass transition temperature (Tg) of −1.0 (±0.2) oC and apparent melting enthalpy of fusion (ΔHf) of 100.9 (±0.1) J g−1. PMID:23028854

  3. Rhizosphere selection of Pseudomonas putida KT2440 variants with increased fitness associated to changes in gene expression.

    PubMed

    Quesada, José Miguel; Fernández, Matilde; Soriano, María Isabel; Barrientos-Moreno, Laura; Llamas, María Antonia; Espinosa-Urgel, Manuel

    2016-08-03

    As the interface between plant roots and soil, the rhizosphere is a complex environment where nutrients released by the plant promote microbial growth. Increasing evidences indicate that the plant also exerts a selective pressure on microbial populations in the rhizosphere, favouring colonization by certain groups. In this work, we have designed an experimental setup to begin analysing the evolution of a specific bacterial population in the rhizosphere, using Pseudomonas putida KT2440 as model organism. After several rounds of selection without passage through laboratory growth conditions, derivatives of this strain with increased fitness in the rhizosphere were isolated. Detailed analysis of one of these clones indicated that this effect is specific for rhizosphere conditions and derives from changes in its transcriptional profile in this environment, with 43 genes being differentially expressed with respect to the parental strain. Several of these genes belong to functional categories which could affect stress adaptation and availability of particular nutrients. By inactivating two genes identified as upregulated in the selected clone (coding for a stress-response protein and a rRNA modifying protein), these functions were shown to contribute to rhizosphere fitness. Our data also suggest the existence of different evolutionary pathways leading to increased rhizosphere fitness.

  4. Metabolism of toluene and xylenes by Pseudomonas (putida (arvilla) mt-2: evidence for a new function of the TOL plasmid.

    PubMed Central

    Worsey, M J; Williams, P A

    1975-01-01

    Pseudomonas putida (arvilla) mt-2 carries genes for the catabolism of toluene, m-xylene, and p-xylene on a transmissible plasmid, TOL. These compounds are degraded by oxidation of one of the methyl substituents via the corresponding alcohols and aldehydes to benzoate and m- and p-toluates, respectively, which are then further metabolised by the meta pathway, also coded for by the TOL plasmid. The specificities of the benzyl alcohol dehydrogenase and the benzaldehyde dehydrogenase for their three respective substrates are independent of the carbon source used for growth, suggesting that a single set of nonspecific enzymes is responsible for the dissimilation of the breakdown products of toluene and m- and p-xylene. Benzyl alcohol dehydrogenase and benzaldehyde dehydrogenase are coincidently and possible coordinately induced by toluene and the xylenes, and by the corresponding alcohols and aldehydes. They are not induced in cells grown on m-toluate but catechol 2,3-oxygenase can be induced by m-xylene. PMID:1176436

  5. Development of a simplified purification method for a novel formaldehyde dismutase variant from Pseudomonas putida J3.

    PubMed

    Blaschke, Lisa; Wagner, Wenke; Werkmeister, Christina; Wild, Marion; Gihring, Adrian; Rupp, Steffen; Zibek, Susanne

    2017-01-10

    Formaldehyde dismutase (FDM) is a very interesting enzyme, due to the fact that it comprises an internal cofactor regeneration mechanism. The FDM, therefore, is able to catalyze redox reactions independent of exogenous cofactor addition, rendering the enzyme powerful for industrial applications. Currently, only one enzyme of this type has been characterized enzymatically. Furthermore, only one additional DNA-sequence with high homology to FDM has been published. In this work, we identified a new variant of a formaldehyde dismutase gene (fdm) in the Pseudomonas putida J3 strain. To isolate and characterize the enzyme, we developed a simplified method for its purification. This purification is based on a C-terminal 6xHis-tag, which enables functional expression of the enzyme in E. coli and a one-step purification method. In addition, we tested several expression systems for optimal yields and combined this with co-expression of the chaperonins GroESL. Using this simplified and rapid method, we are now able to produce sufficient material in reproducible quality and quantity for application tests with the enzyme. The newly identified enzyme will be applied in a redox cascade for biomethanol production from biogas and shows potential for further industrial biotransformation with integrated cofactor recycling. Copyright © 2016 Elsevier B.V. All rights reserved.

  6. PnrA, a new nitroreductase-family enzyme in the TNT-degrading strain Pseudomonas putida JLR11.

    PubMed

    Caballero, Antonio; Lázaro, Juan J; Ramos, Juan L; Esteve-Núñez, Abraham

    2005-08-01

    Nitroreductases are a group of proteins that catalyse pyridine nucleotide-dependent reduction of nitroaromatics compounds, showing significant human health and environmental implications. In this study we have identified the nitroreductase-family enzymes PnrA and PnrB from the TNT-degrading strain Pseudomonas putida. The enzyme encoded by the pnrA gene was expressed in Escherichia coli, purified to homogeneity and shown to be a flavoprotein that used 2 mol of NADPH to reduce 1 mol of 2,4,6-trinitrotoluene (TNT) to 4-hydroxylamine-2,6-dinitrotoluene, using a ping-pong bi-bi mechanism. The PnrA enzyme also recognized as substrates as a number of other nitroaromatic compounds, i.e. 2,4-dinitrotoluene, 3-nitrotoluene, 3- and 4-nitrobenzoate, 3,5-dinitrobenzamide and 3,5-dinitroaniline expanding the substrates profile from previously described nitroreductases. However, TNT resulted to be the most efficient substrate examined according to the Vmax/Km parameter. Expression analysis of pnrA- and pnrB-mRNA isolated from cells growing on different nitrogen sources suggested that expression of both genes was constitutive and that its level of expression was relatively constant regardless of the growth substrate. This is in agreement with enzyme-specific activity determined with cells growing with different N-sources.

  7. The Crc protein inhibits the production of polyhydroxyalkanoates in Pseudomonas putida under balanced carbon/nitrogen growth conditions.

    PubMed

    La Rosa, Ruggero; de la Peña, Fernando; Prieto, María Axiliadora; Rojo, Fernando

    2014-01-01

    Pseudomonas putida synthesizes polyhydroxyalkanoates (PHAs) as storage compounds. PHA synthesis is more active when the carbon source is in excess and the nitrogen source is limiting, but can also occur at a lower rate under balanced carbon/nitrogen ratios. This work shows that PHA synthesis is controlled by the Crc global regulator, a protein that optimizes carbon metabolism by inhibiting the expression of genes involved in the use of non-preferred carbon sources. Crc acts post-transcriptionally. The mRNAs of target genes contain characteristic catabolite activity (CA) motifs near the ribosome binding site. Sequences resembling CA motifs can be predicted for the phaC1 gene, which codes for a PHA polymerase, and for phaI and phaF, which encode proteins associated to PHA granules. Our results show that Crc inhibits the translation of phaC1 mRNA, but not that of phaI or phaF, reducing the amount of PHA accumulated in the cell. Crc inhibited PHA synthesis during exponential growth in media containing a balanced carbon/nitrogen ratio. No inhibition was seen when the carbon/nitrogen ratio was imbalanced. This extends the role of Crc beyond that of controlling the hierarchical utilization of carbon sources and provides a link between PHA synthesis and the global regulatory networks controlling carbon flow.

  8. Silver, zinc oxide and titanium dioxide nanoparticle ecotoxicity to bioluminescent Pseudomonas putida in laboratory medium and artificial wastewater.

    PubMed

    Mallevre, Florian; Fernandes, Teresa F; Aspray, Thomas J

    2014-12-01

    Bacteria based ecotoxicology assessment of manufactured nanoparticles is largely restricted to Escherichia coli bioreporters in laboratory media. Here, toxicity effects of model OECD nanoparticles (Ag NM-300K, ZnO NM-110 and TiO2 NM-104) were assessed using the switch-off luminescent Pseudomonas putida BS566::luxCDABE bioreporter in Luria Bertani (LB) medium and artificial wastewater (AW). IC50 values ∼4 mg L(-1), 100 mg L(-1) and >200 mg L(-1) at 1 h were observed in LB for Ag NM-300K, ZnO NM-110 and TiO2 NM-104, respectively. Similar results were obtained in AW for Ag NM-300K (IC50∼5 mg L(-1)) and TiO2 NM-104 (IC50>200 mg L(-1)) whereas ZnO NM-110 was significantly higher (IC50>200 mg L(-1)). Lower ZnO NM-110 toxicity in AW compared to LB was associated with differences in agglomeration status and dissolution rate. This work demonstrates the importance of nanoecotoxicological studies in environmentally relevant matrices.

  9. The Escherichia coli rhamnose promoter rhaP(BAD) is in Pseudomonas putida KT2440 independent of Crp-cAMP activation.

    PubMed

    Jeske, Marcel; Altenbuchner, Josef

    2010-02-01

    We developed an expression vector system based on the broad host range plasmid pBBR1MCS2 with the Escherichia coli rhamnose-inducible expression system for applications in Pseudomonas. For validation and comparison to E. coli, enhanced green fluorescent protein (eGFP) was used as a reporter. For further characterization, we also constructed plasmids containing different modifications of the rhaP(BAD) promoter. Induction experiments after the successful transfer of these plasmids into Pseudomonas putida KT2440 wild-type and different knockout strains revealed significant differences. In Pseudomonas, we observed no catabolite repression of the rhaP(BAD) promoter, and in contrast to E. coli, the binding of cyclic adenosine monophosphate (cAMP) receptor protein (Crp)-cAMP to this promoter is not necessary for induction as shown by deletion of the Crp binding site. The crp(-) mutant of P. putida KT2440 lacked eGFP expression, but this is likely due to problems in rhamnose uptake, since this defect was complemented by the insertion of the L-rhamnose-specific transporter rhaT into its genome via transposon mutagenesis. Other global regulators like Crc, PtsN, and CyoB had no or minor effects on rhamnose-induced eGFP expression. Therefore, this expression system may also be generally useful for Pseudomonas and other gamma-proteobacteria.

  10. Identification of cis-diols as intermediates in the oxidation of aromatic acids by a strain of Pseudomonas putida that contains a TOL plasmid.

    PubMed Central

    Whited, G M; McCombie, W R; Kwart, L D; Gibson, D T

    1986-01-01

    Pseudomonas putida BG1 was isolated from soil by enrichment with p-toluate and selection for growth with p-xylene. Other hydrocarbons that served as growth substrates were toluene, m-xylene, 3-ethyltoluene, and 1,2,4-trimethylbenzene. The enzymes responsible for growth on these substrates are encoded by a large plasmid with properties similar to those of TOL plasmids isolated from other strains of Pseudomonas. Treatment of P. putida BG1 with nitrosoguanidine led to the isolation of a mutant strain which, when grown with fructose, oxidized both p-xylene and p-toluate to (-)-cis-1,2-dihydroxy-4-methylcyclohexa-3,5-diene-1-carboxylic acid (cis-p-toluate diol). The structure of the diol was determined by conventional chemical techniques including identification of the products formed by acid-catalyzed dehydration and characterization of a methyl ester derivative. The cis-relative stereochemistry of the hydroxyl groups was determined by the isolation and characterization of an isopropylidene derivative. p-Xylene-grown cells contained an inducible NAD+-dependent dehydrogenase which formed catechols from cis-p-toluate diol and the analogous acid diols formed from the other hydrocarbon substrates listed above. The catechols were converted to meta ring fission products by an inducible catechol-2,3-dioxygenase which was partially purified from p-xylene-grown cells of P. putida BG1. Images PMID:3711022

  11. FleQ of Pseudomonas putida KT2440 is a multimeric cyclic diguanylate binding protein that differentially regulates expression of biofilm matrix components.

    PubMed

    Molina-Henares, María Antonia; Ramos-González, María Isabel; Daddaoua, Abdelali; Fernández-Escamilla, Ana María; Espinosa-Urgel, Manuel

    2017-01-01

    The intracellular signal molecule cyclic di-GMP (c-di-GMP) is an important element in regulation of biofilm formation by bacteria. In Pseudomonas aeruginosa, FleQ functions as a c-di-GMP-dependent transcriptional regulator of expression of flagellar genes and the exopolysaccharide (EPS) Pel, a component of the biofilm extracellular matrix. In the plant-beneficial bacterium Pseudomonas putida KT2440, a mutation in fleQ reduces biofilm formation and colonization of plant surfaces. Using isothermal titration calorimetry and electrophoretic mobility shift assays, we show in this work that FleQ of P. putida interacts with c-di-GMP and directly binds the promoter regions of flagellar and EPS genes. Data obtained by analytical gel filtration and ultracentrifugation indicate that FleQ is in multiple oligomeric states in solution (dimers, tetramers and hexamers), which do not show altered equilibrium in the presence of c-di-GMP. DNA binding is independent of c-diGMP, although it is favored by the second messenger in the case of the promoter of the operon responsible for synthesis of the species-specific EPS Pea. Analysis of expression using transcriptional fusions showed an influence of FleQ upon two of the four EPS operons under regular growth conditions. Finally, a consensus sequence for promoter recognition by FleQ in P. putida is also proposed.

  12. Production of two monomer structures containing medium-chain-length polyhydroxyalkanoates by beta-oxidation-impaired mutant of Pseudomonas putida KT2442.

    PubMed

    Ma, Long; Zhang, Haifeng; Liu, Qian; Chen, Jiong; Zhang, Jing; Chen, Guo-Qiang

    2009-10-01

    Pseudomonas putida KT2442 produces medium-chain-length (MCL) polyhydroxyalkanoates (PHA) from fatty acids. When gene encoding 3-hydroxyacyl-CoA dehydrogenase which catalyzes long-chain-3-hydroxyacyl-CoA to 3-ketoacyl-CoA, was partially or completely deleted in P. putida KTOY08, the PHA accumulated was shown to contain only two different monomer structures dominated by a monomer of the same chain length as that of the fatty acids fed and another monomer two carbon atoms shorter. Among the PHA copolymers, P(44% 3HD-co-3HDD) containing 44% 3HD and 56% 3HDD was demonstrated to have a melting temperature T(m), an apparent heat of fusion DeltaH(m) and a Young's modulus E of 75 degrees C, 51 J g(-1) and 2.0 MPa, respectively, the highest among all the MCL PHA studied.

  13. Influence of growth stage on activities of polyhydroxyalkanoate (PHA) polymerase and PHA depolymerase in Pseudomonas putida U

    PubMed Central

    2010-01-01

    Background Medium chain length (mcl-) polyhydroxyalkanoates (PHA) are synthesized by many bacteria in the cytoplasm as storage compounds for energy and carbon. The key enzymes for PHA metabolism are PHA polymerase (PhaC) and depolymerase (PhaZ). Little is known of how mcl-PHA accumulation and degradation are controlled. It has been suggested that overall PHA metabolism is regulated by the β-oxidation pathway of which the flux is governed by intracellular ratios of [NADH]/[NAD] and [acetyl-CoA]/[CoA]. Another level of control could relate to modulation of the activities of PhaC and PhaZ. In order to investigate the latter, assays for in vitro activity measurements of PhaC and PhaZ in crude cell extracts are necessary. Results Two in vitro assays were developed which allow the measurement of PhaC and PhaZ activities in crude cell extracts of Pseudomonas putida U. Using the assays, it was demonstrated that the activity of PhaC decreased 5-fold upon exponential growth on nitrogen limited medium and octanoate. In contrast, the activity of PhaZ increased only 1.5-fold during growth. One reason for the changes in the enzymatic activity of PhaC and PhaZ could relate to a change in interaction with the phasin surface proteins on the PHA granule. SDS-PAGE analysis of isolated PHA granules demonstrated that during growth, the ratio of [phasins]/[PHA] decreased. In addition, it was found that after eliminating phasins (PhaF and PhaI) from the granules PhaC activity decreased further. Conclusion Using the assays developed in this study, we followed the enzymatic activities of PhaC and PhaZ during growth and correlated them to the amount of phasins on the PHA granules. It was found that in P. putida PhaC and PhaZ are concomitantly active, resulting in parallel synthesis and degradation of PHA. Moreover PhaC activity was found to be decreased, whereas PhaZ activity increased during growth. Availability of phasins on PHA granules affected the activity of PhaC. PMID:20937103

  14. Degradation of phenol and m-toluate in Pseudomonas sp. strain EST1001 and its Pseudomonas putida transconjugants is determined by a multiplasmid system.

    PubMed Central

    Kivisaar, M A; Habicht, J K; Heinaru, A L

    1989-01-01

    The utilization of phenol, m-toluate, and salicylate (Phe+, mTol+, and Sal+ characters, respectively) in Pseudomonas sp. strain EST1001 is determined by the coordinated expression of genes placed in different plasmids, i.e., by a multiplasmid system. The natural multiplasmid strain EST1001 is phenotypically unstable. In its Phe-, mTol-, and Sal- segregants, the plasmid DNA underwent structural rearrangements without a marked loss of plasmid DNA, and the majority of segregants gave revertants. The genes specifying the degradation of phenol and m-toluate were transferable to P. putida PaW340, and in this strain a new multiplasmid system with definite structural changes was formed. The 17-kilobase transposable element, a part of the TOL plasmid pWWO present in the chromosome of PaW340, was inserted into the plasmid DNA in transconjugants. In addition, transconjugant EST1020 shared pWWO-like structures. Enzyme assays demonstrated that ortho-fission reactions were used by bacteria that grew on phenol, whereas m-toluate was catabolized by a meta-fission reaction. Salicylate was a functional inducer of the enzymes of both pathways. The expression of silent metabolic pathways of phenol or m-toluate degradation has been observed in EST1001 Phe- mTol+ and Phe+ mTol- transconjugants. The switchover of phenol degradation from the ortho- to the meta-pathway in EST1033 also showed the flexibility of genetic material in EST1001 transconjugants. Images PMID:2768199

  15. Photoautotrophic production of polyhydroxyalkanoates in a synthetic mixed culture of Synechococcus elongatus cscB and Pseudomonas putida cscAB.

    PubMed

    Löwe, Hannes; Hobmeier, Karina; Moos, Manuel; Kremling, Andreas; Pflüger-Grau, Katharina

    2017-01-01

    One of the major challenges for the present and future generations is to find suitable substitutes for the fossil resources we rely on today. Cyanobacterial carbohydrates have been discussed as an emerging renewable feedstock in industrial biotechnology for the production of fuels and chemicals, showing promising production rates when compared to crop-based feedstock. However, intrinsic capacities of cyanobacteria to produce biotechnological compounds are limited and yields are low. Here, we present an approach to circumvent these problems by employing a synthetic bacterial co-culture for the carbon-neutral production of polyhydroxyalkanoates (PHAs) from CO2. The co-culture consists of two bio-modules: Bio-module I, in which the cyanobacterial strain Synechococcus elongatus cscB fixes CO2, converts it to sucrose, and exports it into the culture supernatant; and bio-module II, where this sugar serves as C-source for Pseudomonas putida cscAB and is converted to PHAs that are accumulated in the cytoplasm. By applying a nitrogen-limited process, we achieved a maximal PHA production rate of 23.8 mg/(L day) and a maximal titer of 156 mg/L. We will discuss the present shortcomings of the process and show the potential for future improvement. These results demonstrate the feasibility of mixed cultures of S. elongatus cscB and P. putida cscAB for PHA production, making room for the cornucopia of possible products that are described for P. putida. The construction of more efficient sucrose-utilizing P. putida phenotypes and the optimization of process conditions will increase yields and productivities and eventually close the gap in the contemporary process. In the long term, the co-culture may serve as a platform process, in which P. putida is used as a chassis for the implementation of synthetic metabolic pathways for biotechnological production of value-added products.

  16. Unusual poly(3-hydroxyalkanoate) (PHA) biosynthesis behavior of Pseudomonas putida Bet001 and Delftia tsuruhatensis Bet002 isolated from palm oil mill effluent.

    PubMed

    Razaif-Mazinah, Mohd Rafais Mohd; Anis, Siti Nor Syairah; Harun, Hazwani Izzati; Rashid, Khairunnisa Abdul; Annuar, Mohamad Suffian Mohamad

    2017-03-01

    Pseudomonas putida Bet001 and Delftia tsuruhatensis Bet002, isolated from palm oil mill effluent, accumulated poly(3-hydroxyalkanoates) (PHAs) when grown on aliphatic fatty acids, sugars, and glycerol. The substrates were supplied at 20:1 C/N mole ratio. Among C-even n-alkanoic acids, myristic acid gave the highest PHA content 26 and 28 wt% in P. putida and D. tsuruhatensis, respectively. Among C-odd n-alkanoic acids, undecanoic gave the highest PHA content at 40 wt% in P. putida and 46 wt% in D. tsuruhatensis on pentadecanoic acid. Sugar and glycerol gave <10 wt% of PHA content for both bacteria. Interestingly, D. tsuruhatensis accumulated both short- and medium-chain length PHA when supplied with n-alkanoic acids ranging from octanoic to lauric, sucrose, and glycerol with 3-hydroxybutyrate as the major monomer unit. In P. putida, the major hydroxyalkanoates unit was 3-hydroxyoctanoate and 3-hydroxydecanoate when grown on C-even acids. Conversely, 3-hydroxyheptanoate, 3-hydrxoynonanoate, and 3-hydroxyundecanoate were accumulated with C-odd acids. Weight-averaged molecular weight (Mw ) was in the range of 53-81 kDa and 107-415 kDa for P. putida and D. tsuruhatensis, respectively. Calorimetric analyses indicated that both bacteria synthesized semicrystalline polymer with good thermal stability with degradation temperature (Td ) ranging from 178 to 282 °C. © 2016 International Union of Biochemistry and Molecular Biology, Inc.

  17. Transcription from Fusion Promoters Generated during Transposition of Transposon Tn4652 Is Positively Affected by Integration Host Factor in Pseudomonas putida

    PubMed Central

    Teras, Riho; Hõrak, Rita; Kivisaar, Maia

    2000-01-01

    We have previously shown that both ends of the Tn3 family transposon Tn4652 contain integration host factor (IHF) binding sites and that IHF positively regulates expression of the Tn4652 transposase gene tnpA in Pseudomonas putida (R. Hõrak, and M. Kivisaar, J. Bacteriol. 180:2822–2829, 1998). Tn4652 can activate silent genes by creating fusion promoters during the transposition. The promoters are created as fusions between the −35 hexamer provided by the terminal inverted repeats of Tn4652 and the −10 hexamers in the target DNA. Two fusion promoters, PRA1 and PLA1, that contain sequences of the right and left termini of Tn4652, respectively, were chosen for the study of mechanisms of transcription activation. Gel mobility shift analysis using crude extracts from P. putida cells allowed us to detect specific binding of P. putida IHF to the ends of the transposon Tn4652. We found that the rate of transcription from the fusion promoter PRA1 is enhanced by IHF. Notably, the positive effect of IHF on transcription from the promoter PRA1 appeared only when cells of P. putida reached the stationary growth phase. We speculate that the intracellular concentration of IHF might be critical for the in vivo effect of IHF on transcription from the fusion promoters in P. putida. In the case of PLA1, the mechanism of transcription modulation by IHF is different than that observed for PRA1. Our results demonstrate that transcription of neighboring genes from outwardly directed promoters at the ends of a mobile DNA element could be influenced by the same factors that control transposition of the element. PMID:10633090

  18. Identification and Characterization of the Conjugal Transfer Region of the pCg1 plasmid from Naphthalene-Degrading Pseudomonas putida Cg1

    PubMed Central

    Park, Woojun; Jeon, Che Ok; Hohnstock-Ashe, Amy M.; Winans, Stephen C.; Zylstra, Gerben J.; Madsen, Eugene L.

    2003-01-01

    Hybridization and restriction fragment length polymorphism data (K. G. Stuart-Keil, A. M. Hohnstock, K. P. Drees, J. B. Herrick, and E. L. Madsen, Appl. Environ. Microbiol. 64:3633-3640, 1998) have shown that pCg1, a naphthalene catabolic plasmid carried by Pseudomonas putida Cg1, is homologous to the archetypal naphthalene catabolic plasmid, pDTG1, in P. putida NCIB 9816-4. Sequencing of the latter plasmid allowed PCR primers to be designed for amplifying and sequencing the conjugal transfer region in pCg1. The mating pair formation (mpf) gene, mpfA encoding the putative precursor of the conjugative pilin subunit from pCg1, was identified along with other trb-like mpf genes. Sequence comparison revealed that the 10 mpf genes in pCg1 and pDTG1 are closely related (61 to 84% identity) in sequence and operon structure to the putative mpf genes of catabolic plasmid pWW0 (TOL plasmid of P. putida) and pM3 (antibiotic resistance plasmid of Pseudomonas. spp). A polar mutation caused by insertional inactivation in mpfA of pCg1 and reverse transcriptase PCR analysis of mRNA showed that this mpf region was involved in conjugation and was transcribed from a promoter located upstream of an open reading frame adjacent to mpfA. lacZ transcriptional fusions revealed that mpf genes of pCg1 were expressed constitutively both in liquid and on solid media. This expression did not respond to host exposure to naphthalene. Conjugation frequency on semisolid media was consistently 10- to 100-fold higher than that in liquid media. Thus, conjugation of pCg1 in P. putida Cg1 was enhanced by expression of genes in the mpf region and by surfaces where conditions fostering stable, high-density cell-to-cell contact are manifest. PMID:12788725

  19. Production of polyhydroxyalkanoates from sludge palm oil using Pseudomonas putida S12.

    PubMed

    Kang, Du-Kyeong; Lee, Cho-Ryong; Lee, Sun Hee; Bae, Jung-Hoon; Park, Young-Kwon; Rhee, Young Ha; Sung, Bong Hyun; Sohn, Jung-Hoon

    2017-03-09

    Polyhydroxyalkanoates (PHAs) are biodegradable plastics produced by bacteria, but their use in diverse applications is prohibited by high production costs. To reduce these costs, the conversion of PHAs from crude sludge palm oil (SPO) as an inexpensive renewable raw material by Pseudomonas strains was tested. Pseudomonasputida S12 was found to produce the highest yield (~41%) of elastomeric medium-chain-length (MCL)-PHAs from SPO. The MCL-PHA characteristics were analyzed by gas-chromatography/mass spectrometry, gel permeation chromatography, and differential scanning calorimetry. These findings may contribute to more widespread use of PHAs by reducing PHA production costs.

  20. Isolation of a Gene Responsible for the Oxidation of trans-Anethole to para-Anisaldehyde by Pseudomonas putida JYR-1 and Its Expression in Escherichia coli

    PubMed Central

    Han, Dongfei; Ryu, Ji-Young; Kanaly, Robert A.

    2012-01-01

    A plasmid, pTA163, in Escherichia coli contained an approximately 34-kb gene fragment from Pseudomonas putida JYR-1 that included the genes responsible for the metabolism of trans-anethole to protocatechuic acid. Three Tn5-disrupted open reading frame 10 (ORF 10) mutants of plasmid pTA163 lost their abilities to catalyze trans-anethole. Heterologously expressed ORF 10 (1,047 nucleotides [nt]) under a T7 promoter in E. coli catalyzed oxidative cleavage of a propenyl group of trans-anethole to an aldehyde group, resulting in the production of para-anisaldehyde, and this gene was designated tao (trans-anethole oxygenase). The deduced amino acid sequence of TAO had the highest identity (34%) to a hypothetical protein of Agrobacterium vitis S4 and likely contained a flavin-binding site. Preferred incorporation of an oxygen molecule from water into p-anisaldehyde using 18O-labeling experiments indicated stereo preference of TAO for hydrolysis of the epoxide group. Interestingly, unlike the narrow substrate range of isoeugenol monooxygenase from Pseudomonas putida IE27 and Pseudomonas nitroreducens Jin1, TAO from P. putida JYR-1 catalyzed isoeugenol, O-methyl isoeugenol, and isosafrole, all of which contain the 2-propenyl functional group on the aromatic ring structure. Addition of NAD(P)H to the ultrafiltered cell extracts of E. coli (pTA163) increased the activity of TAO. Due to the relaxed substrate range of TAO, it may be utilized for the production of various fragrance compounds from plant phenylpropanoids in the future. PMID:22610435

  1. Genetic Dissection of the Regulatory Network Associated with High c-di-GMP Levels in Pseudomonas putida KT2440

    PubMed Central

    Ramos-González, María Isabel; Travieso, María L.; Soriano, María I.; Matilla, Miguel A.; Huertas-Rosales, Óscar; Barrientos-Moreno, Laura; Tagua, Víctor G.; Espinosa-Urgel, Manuel

    2016-01-01

    Most bacteria grow in nature forming multicellular structures named biofilms. The bacterial second messenger cyclic diguanosine monophosphate (c-di-GMP) is a key player in the regulation of the transition from planktonic to sessile lifestyles and this regulation is crucial in the development of biofilms. In Pseudomonas putida KT2440, Rup4959, a multidomain response regulator with diguanylate cyclase activity, when overexpressed causes an increment in the intracellular levels of c-di-GMP that gives rise to a pleiotropic phenotype consisting of increased biofilm formation and crinkly colony morphology. In a broad genomic screen we have isolated mutant derivatives that lose the crinkly morphology, designed as cfc (crinkle free colony). A total of 19 different genes have been identified as being related with the emergence of the cfc phenotype either because the expression or functionality of Rup4959 is compromised, or due to a lack of transduction of the c-di-GMP signal to downstream elements involved in the acquisition of the phenotype. Discernment between these possibilities was investigated by using a c-di-GMP biosensor and by HPLC-MS quantification of the second messenger. Interestingly five of the identified genes encode proteins with AAA+ ATPase domain. Among the bacterial determinants found in this screen are the global transcriptional regulators GacA, AlgU and FleQ and two enzymes involved in the arginine biosynthesis pathway. We present evidences that this pathway seems to be an important element to both the availability of the free pool of the second messenger c-di-GMP and to its further transduction as a signal for biosynthesis of biopolimers. In addition we have identified an uncharacterized hybrid sensor histidine kinase whose phosphoaceptor conserved histidine residue has been shown in this work to be required for in vivo activation of the orphan response regulator Rup4959, which suggests these two elements constitute a two-component phosphorelay system

  2. Isolation and characterization of Pseudomonas putida PpF1 mutants defective in the toluene dioxygenase enzyme system.

    PubMed Central

    Finette, B A; Subramanian, V; Gibson, D T

    1984-01-01

    Pseudomonas putida PpF1 degraded toluene via a dihydrodiol pathway to tricarboxylic acid cycle intermediates. The initial reaction was catalyzed by a multicomponent enzyme, toluene dioxygenase, which oxidized toluene to (+)-cis-1(S),2(R)-dihydroxy-3-methylcyclohexa-3,5-diene (cis-toluene dihydrodiol). The enzyme consisted of three protein components: NADH-ferredoxintol oxidoreductase (reductasetol), ferredoxintol, and a terminal oxygenase which is an iron-sulfur protein (ISPtol). Mutants blocked in each of these components were isolated after mutagenesis with nitrosoguanidine. Mutants occurred as colony morphology variants when grown in the presence of toluene on indicator plates containing agar, mineral salts, a growth-supporting nutrient (arginine), 2,3,5-triphenyltetrazolium chloride (TTC), and Nitro Blue Tetrazolium (NBT). Under these conditions, wild-type colonies appeared large and red as a result of TTC reduction. Colonies of reductasetol mutants were white or white with a light blue center, ferredoxintol strains were light blue with a dark blue center, and strains that lacked ISPtol gave dark blue colonies. Blue color differences in the mutant colonies were due to variations in the extent of NBT reduction. Strains lacking all three components appeared white. Toluene dioxygenase mutants were characterized by assaying toluene dioxygenase activity in crude cell extracts which were complemented with purified preparations of each protein component. Between 40 and 60% of the putative mutants selected from the NBT-TTC indicator plates were unable to grow with toluene as the sole source of carbon and energy. This method should prove extremely useful in isolating mutants in other multicomponent oxygenase enzyme systems. Images PMID:6501223

  3. Spatial Pattern of Copper Phosphate Precipitation Involves in Copper Accumulation and Resistance of Unsaturated Pseudomonas putida CZ1 Biofilm.

    PubMed

    Chen, Guangcun; Lin, Huirong; Chen, Xincai

    2016-12-28

    Bacterial biofilms are spatially structured communities that contain bacterial cells with a wide range of physiological states. The spatial distribution and speciation of copper in unsaturated Pseudomonas putida CZ1 biofilms that accumulated 147.0 mg copper per g dry weight were determined by transmission electron microscopy coupled with energy dispersive X-ray analysis, and micro-X-ray fluorescence microscopy coupled with micro-X-ray absorption near edge structure (micro-XANES) analysis. It was found that copper was mainly precipitated in a 75 μm thick layer as copper phosphate in the middle of the biofilm, while there were two living cell layers in the air-biofilm and biofilm-medium interfaces, respectively, distinguished from the copper precipitation layer by two interfaces. The X-ray absorption fine structure analysis of biofilm revealed that species resembling Cu₃(PO₄)₂ predominated in biofilm, followed by Cu-Citrate- and Cu-Glutathione-like species. Further analysis by micro-XANES revealed that 94.4% of copper were Cu₃(PO₄)₂-like species in the layer next to the air interface, whereas the copper species of the layer next to the medium interface were composed by 75.4% Cu₃(PO₄)₂, 10.9% Cu-Citrate-like species, and 11.2% Cu-Glutathione-like species. Thereby, it was suggested that copper was initially acquired by cells in the biofilm-air interface as a citrate complex, and then transported out and bound by out membranes of cells, released from the copper-bound membranes, and finally precipitated with phosphate in the extracellular matrix of the biofilm. These results revealed a clear spatial pattern of copper precipitation in unsaturated biofilm, which was responsible for the high copper tolerance and accumulation of the biofilm.

  4. Effect of Genetically Modified Pseudomonas putida WCS358r on the Fungal Rhizosphere Microflora of Field-Grown Wheat

    PubMed Central

    Glandorf, Debora C. M.; Verheggen, Patrick; Jansen, Timo; Jorritsma, Jan-Willem; Smit, Eric; Leeflang, Paula; Wernars, Karel; Thomashow, Linda S.; Laureijs, Eric; Thomas-Oates, Jane E.; Bakker, Peter A. H. M.; van Loon, Leendert C.

    2001-01-01

    We released genetically modified Pseudomonas putida WCS358r into the rhizospheres of wheat plants. The two genetically modified derivatives, genetically modified microorganism (GMM) 2 and GMM 8, carried the phz biosynthetic gene locus of strain P. fluorescens 2-79 and constitutively produced the antifungal compound phenazine-1-carboxylic acid (PCA). In the springs of 1997 and 1998 we sowed wheat seeds treated with either GMM 2, GMM 8, or WCS358r (approximately 107 CFU per seed), and measured the numbers, composition, and activities of the rhizosphere microbial populations. During both growing seasons, all three bacterial strains decreased from 107 CFU per g of rhizosphere sample to below the limit of detection (102 CFU per g) 1 month after harvest of the wheat plants. The phz genes were stably maintained, and PCA was detected in rhizosphere extracts of GMM-treated plants. In 1997, but not in 1998, fungal numbers in the rhizosphere, quantified on 2% malt extract agar (total filamentous fungi) and on Komada's medium (mainly Fusarium spp.), were transiently suppressed in GMM 8-treated plants. We also analyzed the effects of the GMMs on the rhizosphere fungi by using amplified ribosomal DNA restriction analysis. Introduction of any of the three bacterial strains transiently changed the composition of the rhizosphere fungal microflora. However, in both 1997 and 1998, GMM-induced effects were distinct from those of WCS358r and lasted for 40 days in 1997 and for 89 days after sowing in 1998, whereas effects induced by WCS358r were detectable for 12 (1997) or 40 (1998) days. None of the strains affected the metabolic activity of the soil microbial population (substrate-induced respiration), soil nitrification potential, cellulose decomposition, plant height, or plant yield. The results indicate that application of GMMs engineered to have improved antifungal activity can exert nontarget effects on the natural fungal microflora. PMID:11472906

  5. Root inoculation with Pseudomonas putida KT2440 induces transcriptional and metabolic changes and systemic resistance in maize plants.

    PubMed

    Planchamp, Chantal; Glauser, Gaetan; Mauch-Mani, Brigitte

    2014-01-01

    Pseudomonas putida KT2440 (KT2440) rhizobacteria colonize a wide range of plants. They have been extensively studied for their capacity to adhere to maize seeds, to tolerate toxic secondary metabolites produced by maize roots and to be attracted by maize roots. However, the response of maize plants to KT2440 colonization has not been investigated yet. Maize roots were inoculated with KT2440 and the local (roots) and systemic (leaves) early plant responses were investigated. The colonization behavior of KT2440 following application to maize seedlings was investigated and transcriptional analysis of stress- and defense-related genes as well as metabolite profiling of local and systemic maize tissues of KT2440-inoculated were performed. The local and systemic responses differed and more pronounced changes were observed in roots compared to leaves. Early in the interaction roots responded via jasmonic acid- and abscisic acid-dependent signaling. Interestingly, during later steps, the salicylic acid pathway was suppressed. Metabolite profiling revealed the importance of plant phospholipids in KT2440-maize interactions. An additional important maize secondary metabolite, a form of benzoxazinone, was also found to be differently abundant in roots 3 days after KT2440 inoculation. However, the transcriptional and metabolic changes observed in bacterized plants early during the interaction were minor and became even less pronounced with time, indicating an accommodation state of the plant to the presence of KT2440. Since the maize plants reacted to the presence of KT2440 in the rhizosphere, we also investigated the ability of these bacteria to trigger induced systemic resistance (ISR) against the maize anthracnose fungus Colletotrichum graminicola. The observed resistance was expressed as strongly reduced leaf necrosis and fungal growth in infected bacterized plants compared to non-bacterized controls, showing the potential of KT2440 to act as resistance inducers.

  6. Pseudomonas putida attunes morphophysiological, biochemical and molecular responses in Cicer arietinum L. during drought stress and recovery.

    PubMed

    Tiwari, Shalini; Lata, Charu; Chauhan, Puneet Singh; Nautiyal, Chandra Shekhar

    2016-02-01

    Drought is one of the most important abiotic stresses that adversely affect plant growth and yield potential. However, some drought resistant rhizosphere competent bacteria are known to improve plant health and promote growth during abiotic stresses. Present study showed the role of Pseudomonas putida MTCC5279 (RA) in ameliorating drought stress on cv. BG-362 (desi) and cv. BG-1003 (kabuli) chickpea cultivars under in vitro and green house conditions. Polyethylene glycol-induced drought stress severely affected seed germination in both cultivars which was considerably improved on RA-inoculation. Drought stress significantly affected various growth parameters, water status, membrane integrity, osmolyte accumulation, ROS scavenging ability and stress-responsive gene expressions, which were positively modulated upon application of RA in both chickpea cultivars. Quantitative real-time (qRT)-PCR analysis showed differential expression of genes involved in transcription activation (DREB1A and NAC1), stress response (LEA and DHN), ROS scavenging (CAT, APX, GST), ethylene biosynthesis (ACO and ACS), salicylic acid (PR1) and jasmonate (MYC2) signalling in both chickpea cultivars exposed to drought stress and recovery in the presence or absence of RA. The observations imply that RA confers drought tolerance in chickpea by altering various physical, physiological and biochemical parameters, as well as by modulating differential expression of at least 11 stress-responsive genes. To the best of our knowledge, this is the first report on detailed analysis of plant growth promotion and stress alleviation in one month old desi and kabuli chickpea subjected to drought stress for 0, 1, 3 and 7 days and recovery in the presence of a PGPR. Copyright © 2015 Elsevier Masson SAS. All rights reserved.

  7. Inactivation of Cytochrome o Ubiquinol Oxidase Relieves Catabolic Repression of the Pseudomonas putida GPo1 Alkane Degradation Pathway

    PubMed Central

    Dinamarca, M. Alejandro; Ruiz-Manzano, Ana; Rojo, Fernando

    2002-01-01

    Expression of the alkane degradation pathway encoded by the OCT plasmid of Pseudomonas putida GPo1 is regulated by two control systems. One relies on the transcriptional regulator AlkS, which activates expression of the pathway in the presence of alkanes. The other, which is a dominant global regulation control, represses the expression of the pathway genes when a preferred carbon source is present in the growth medium in addition to alkanes. This catabolite repression control occurs through a poorly characterized mechanism that ultimately regulates transcription from the two AlkS-activated promoters of the pathway. To identify the factors involved, a screening method was developed to isolate mutants without this control. Several isolates were obtained, all of which contained mutations that mapped to genes encoding cytochrome o ubiquinol oxidase, the main terminal oxidase of the electron transport chain under highly aerobic conditions. Elimination of this terminal oxidase led to a decrease in the catabolic repression observed both in rich Luria-Bertani medium and in a defined medium containing lactate or succinate as the carbon source. This suggests that catabolic repression could monitor the physiological or metabolic status by using information from the electron transport chain or from the redox state of the cell. Since inactivation of the crc gene also reduces catabolic repression in rich medium (although not that observed in a defined medium), a strain was generated lacking both the Crc function and the cytochrome o terminal oxidase. The two mutations had an additive effect in relieving catabolic repression in rich medium. This suggests that crc and cyo belong to different regulation pathways, both contributing to catabolic repression. PMID:12081947

  8. Genetic analysis of plant endophytic Pseudomonas putida BP25 and chemo-profiling of its antimicrobial volatile organic compounds.

    PubMed

    Sheoran, Neelam; Valiya Nadakkakath, Agisha; Munjal, Vibhuti; Kundu, Aditi; Subaharan, Kesavan; Venugopal, Vibina; Rajamma, Suseelabhai; Eapen, Santhosh J; Kumar, Aundy

    2015-04-01

    Black pepper associated bacterium BP25 was isolated from root endosphere of apparently healthy cultivar Panniyur-5 that protected black pepper against Phytophthora capsici and Radopholus similis - the major production constraints. The bacterium was characterized and mechanisms of its antagonistic action against major pathogens are elucidated. The polyphasic phenotypic analysis revealed its identity as Pseudomonas putida. Multi locus sequence typing revealed that the bacterium shared gene sequences with several other isolates representing diverse habitats. Tissue localization assays exploiting green fluorescence protein expression clearly indicated that PpBP25 endophytically colonized not only its host plant - black pepper, but also other distantly related plants such as ginger and arabidopsis. PpBP25 colonies could be enumerated from internal tissues of plants four weeks post inoculation indicated its stable establishment and persistence in the plant system. The bacterium inhibited broad range of pathogens such as Phytophthora capsici, Pythium myriotylum, Giberella moniliformis, Rhizoctonia solani, Athelia rolfsii, Colletotrichum gloeosporioides and plant parasitic nematode, Radopholus similis by its volatile substances. GC/MS based chemical profiling revealed presence of Heneicosane; Tetratetracontane; Pyrrolo [1,2-a] pyrazine-1,4-dione, hexahydro-3-(2-methylpropyl); Tetracosyl heptafluorobutyrate; 1-3-Eicosene, (E)-; 1-Heneicosanol; Octadecyl trifluoroacetate and 1-Pentadecene in PpBP25 metabolite. Dynamic head space GC/MS analysis of airborne volatiles indicated the presence of aromatic compounds such as 1-Undecene;Disulfide dimethyl; Pyrazine, methyl-Pyrazine, 2,5-dimethyl-; Isoamyl alcohol; Pyrazine, methyl-; Dimethyl trisulfide, etc. The work paved way for profiling of broad spectrum antimicrobial VOCs in endophytic PpBP25 for crop protection.

  9. The TOL network of Pseudomonas putida mt-2 processes multiple environmental inputs into a narrow response space.

    PubMed

    Silva-Rocha, Rafael; de Lorenzo, Víctor

    2013-01-01

    The TOL system encoded by plasmid pWW0 of Pseudomonas putida mt-2 is able to sense a large number of both exogenous and endogenous signals as inputs for the genetic and metabolic circuit that determines the biodegradation of m-xylene. However, whether the enormous combinatorial space of inputs is translated into an equally variable response landscape or is processed into very few outcomes remains unclear. To address this question, we set out to define the number of states that can be obtained by a network of a given set of genes under the control of a specified regulatory circuit that is exposed to all possible combinations of inputs. To this end, the TOL network and its regulatory wiring were formalized as a synchronous logic Boolean circuit that had 10 signals (i.e. pathway substrates, temperature, sugars, amino acids, metabolic regimes and global regulators) as possible inputs. The analysis of the attractors of the circuit using a satisfiability (SAT) algorithm revealed that only eight transcriptional states are reached in response to the 1024 possible combinations of stimuli. The experimental validation resulted in a refinement of the model through the addition of a previously unknown interaction that controls the meta catabolic pathway. The full induction of the two xyl operons occurred with only 1.6% of the input combinations, which suggests that the architecture of the network allows the expression of the xyl genes only under a very narrow range of conditions. These data not only explain much of the unusual layout of the TOL circuit but also strengthen the view of the regulatory circuits of environmental bacteria as digital decision-making devices. © 2012 Society for Applied Microbiology and Blackwell Publishing Ltd.

  10. Crystal structure of the leucine aminopeptidase from Pseudomonas putida reveals the molecular basis for its enantioselectivity and broad substrate specificity.

    PubMed

    Kale, Avinash; Pijning, Tjaard; Sonke, Theo; Dijkstra, Bauke W; Thunnissen, Andy-Mark W H

    2010-05-21

    The zinc-dependent leucine aminopeptidase from Pseudomonas putida (ppLAP) is an important enzyme for the industrial production of enantiomerically pure amino acids. To provide a better understanding of its structure-function relationships, the enzyme was studied by X-ray crystallography. Crystal structures of native ppLAP at pH 9.5 and pH 5.2, and in complex with the inhibitor bestatin, show that the overall folding and hexameric organization of ppLAP are very similar to those of the closely related di-zinc leucine aminopeptidases (LAPs) from bovine lens and Escherichia coli. At pH 9.5, the active site contains two metal ions, one identified as Mn(2+) or Zn(2+) (site 1), and the other as Zn(2+) (site 2). By using a metal-dependent activity assay it was shown that site 1 in heterologously expressed ppLAP is occupied mainly by Mn(2+). Moreover, it was shown that Mn(2+) has a significant activation effect when bound to site 1 of ppLAP. At pH 5.2, the active site of ppLAP is highly disordered and the two metal ions are absent, most probably due to full protonation of one of the metal-interacting residues, Lys267, explaining why ppLAP is inactive at low pH. A structural comparison of the ppLAP-bestatin complex with inhibitor-bound complexes of bovine lens LAP, along with substrate modelling, gave clear and new insights into its substrate specificity and high level of enantioselectivity.

  11. Microbial synthesis of poly(beta-hydroxyalkanoates) bearing phenyl groups from pseudomonas putida: chemical structure and characterization.

    PubMed

    Abraham, G A; Gallardo, A; San Roman, J; Olivera, E R; Jodra, R; García, B; Miñambres, B; García, J L; Luengo, J M

    2001-01-01

    New poly(beta-hydroxyalkanoates) having aromatics groups (so-called PHPhAs) from a microbial origin have been characterized. These polymers were produced and accumulated as reserve materials when a beta-oxidation mutant of Pseudomonas putida U, disrupted in the gene that encodes the 3-ketoacyl-CoA thiolase (fadA), was cultured in a chemically defined medium containing different aromatic fatty acids (6-phenylhexanoic acid, 7-phenylheptanoic acid, a mixture of them, or 8-phenyloctanoic acid) as carbon sources. The polymers were extracted from the bacteria, purified and characterized by using (13)C nuclear magnetic resonance spectroscopy (NMR), gel permeation chromatography (GPC), and differential scanning calorimetry (DSC). Structural studies revealed that when 6-phenylhexanoic acid was added to the cultures, an homopolymer (poly-3-hydroxy-6-phenylhexanoate) was accumulated. The feeding with 8-phenyloctanoic acid and 7-phenylheptanoic acid leads to the formation of copolymers of the corresponding units with the n - 2 carbons formed after deacetylation, copoly(3-hydroxy-8-phenyloctanoate-3-hydroxy-6-phenylhexanoate) and copoly(3-hydroxy-7-phenylheptanoate-3-hydroxy-5-phenylvalerate), respectively. The mixture of 6-phenylhexanoic acid and 7-phenylheptanoic acid gave rise to the corresponding terpolymer, copoly(3-hydroxy-7-phenylheptanoate-3-hydroxy-6-phenylhexanoate-3-hydroxy-5-phenylvalerate). Studies on the chemical structure of these three polyesters revealed that they were true copolymers but not a mixture of homopolymers and that the different monomeric units were randomly incorporated in the macromolecular chains. Thermal behavior and molecular weight distribution were also discussed. These compounds had a dual attractive interest in function of (i) their broad use as biodegradable polymers and (ii) their possible biomedical applications.

  12. Maintenance and induction of naphthalene degradation activity in Pseudomonas putida and an Alcaligenes sp. under different culture conditions.

    PubMed

    Guerin, W F; Boyd, S A

    1995-11-01

    The expression of xenobiotic-degradative genes in indigenous bacteria or in bacteria introduced into an ecosystem is essential for the successful bioremediation of contaminated environments. The maintenance of naphthalene utilization activity is studied in Pseudomonas putida (ATCC 17484) and an Alcaligenes sp. (strain NP-Alk) under different batch culture conditions. Levels of activity decreased exponentially in stationary phase with half-lives of 43 and 13 h for strains ATCC 17484 and NP-Alk, respectively. Activity half-lives were 2.7 and 5.3 times longer, respectively, in starved cultures than in stationary-phase cultures following growth on naphthalene. The treatment of starved cultures with chloramphenicol caused a loss of activity more rapid than that measured in untreated starved cultures, suggesting a continued enzyme synthesis in starved cultures in the absence of a substrate. Following growth in nutrient medium, activity decreased to undetectable levels in the Alcaligenes sp. but remained at measurable levels in the pseudomonad even after 9 months. The induction of naphthalene degradation activities in these cultures, when followed by radiorespirometry with 14C-labeled naphthalene as the substrate, was consistent with activity maintenance data. In the pseudomonad, naphthalene degradation activity was present constitutively at low levels under all growth conditions and was rapidly (in approximately 15 min) induced to high levels upon exposure to naphthalene. Adaptation in the uninduced Alcaligenes sp. occurred after many hours of exposure to naphthalene. In vivo labeling with 35S, to monitor the extent of de novo enzyme synthesis by naphthalene-challenged cells, provided an independent confirmation of the results.

  13. Maintenance and induction of naphthalene degradation activity in Pseudomonas putida and an Alcaligenes sp. under different culture conditions

    SciTech Connect

    Guerin, W.F.; Boyd, S.A.

    1995-11-01

    The expression of xenobiotic-degradative genes in indigenous bacteria or in bacteria introduced into an ecosystem is essential for the successful bioremediation of contaminated environments. The maintenance of naphthalene utilization activity is studied in Pseudomonas putida (ATCC 17484) and an Alcaligenes sp. (strain NP-Alk) under different batch culture conditions. Levels of activity decreased exponentially in stationary phase with half-lives of 43 and 13 h for strains ATCC 17484 nad NP-Alk, respectively. Activity half-lives were 2.7 and 5.3 times longer, respectively, in starved cultures than in stationary-phase cultures following growth on naphthalene. The treatment of starved cultures with chloramphenicol caused a loss of activity more rapid than that measured in untreated starved cultures, suggesting a continued enzyme synthesis in starved cultures in the absence of a substrate. Following growth in nutrient medium, activity decreased to undetectable levels in the Alcaligenes sp. but remained at measureable levels int he pseudomonad even after 9 months. The induction of naphthalene degradation activities in these cultures, when followed by radiorespirometry with {sup 14}C-labeled naphthalene as the substrate, was consistent with activity maintenance data. In the pseudomonad, naphthalene degradation activity was present constitutively at low levels under all growth conditions and was rapidly (in approximately 15 min) induced to high levels upon exposure to naphthalene. Adaptation in the uninduced Alcaligenes sp. occurred after many hours of exposure to naphthalene. In vivo labeling with {sup 35}S, to monitor the extent of de novo enzyme synthesis by naphthalene-challenged cells, provided an independent confirmation of the results. 43 refs., 9 figs., 1 tab.

  14. Evidence of the Participation of Remote Residues in the Catalytic Activity of Co-Type Nitrile Hydratase from Pseudomonas putida

    SciTech Connect

    Brodkin, Heather R.; Novak, Walter R.P.; Milne, Amy C.; D’Aquino, J. Alejandro; Karabacak, N.M.; Goldberg, Ilana G.; Agar, Jeffrey N.; Payne, Mark S.; Petsko, Gregory A.; Ondrechen, Mary Jo; Ringe, Dagmar

    2011-09-28

    Active sites may be regarded as layers of residues, whereby the residues that interact directly with substrate also interact with residues in a second shell and these in turn interact with residues in a third shell. These residues in the second and third layers may have distinct roles in maintaining the essential chemical properties of the first-shell catalytic residues, particularly their spatial arrangement relative to the substrate binding pocket, and their electrostatic and dynamic properties. The extent to which these remote residues participate in catalysis and precisely how they affect first-shell residues remains unexplored. To improve our understanding of the roles of second- and third-shell residues in catalysis, we used THEMATICS to identify residues in the second and third shells of the Co-type nitrile hydratase from Pseudomonas putida (ppNHase) that may be important for catalysis. Five of these predicted residues, and three additional, conserved residues that were not predicted, have been conservatively mutated, and their effects have been studied both kinetically and structurally. The eight residues have no direct contact with the active site metal ion or bound substrate. These results demonstrate that three of the predicted second-shell residues ({alpha}-Asp164, {beta}-Glu56, and {beta}-His147) and one predicted third-shell residue ({beta}-His71) have significant effects on the catalytic efficiency of the enzyme. One of the predicted residues ({alpha}-Glu168) and the three residues not predicted ({alpha}-Arg170, {alpha}-Tyr171, and {beta}-Tyr215) do not have any significant effects on the catalytic efficiency of the enzyme.

  15. Effect of genetically modified Pseudomonas putida WCS358r on the fungal rhizosphere microflora of field-grown wheat.

    PubMed

    Glandorf, D C; Verheggen, P; Jansen, T; Jorritsma, J W; Smit, E; Leeflang, P; Wernars, K; Thomashow, L S; Laureijs, E; Thomas-Oates, J E; Bakker, P A; van Loon, L C

    2001-08-01

    We released genetically modified Pseudomonas putida WCS358r into the rhizospheres of wheat plants. The two genetically modified derivatives, genetically modified microorganism (GMM) 2 and GMM 8, carried the phz biosynthetic gene locus of strain P. fluorescens 2-79 and constitutively produced the antifungal compound phenazine-1-carboxylic acid (PCA). In the springs of 1997 and 1998 we sowed wheat seeds treated with either GMM 2, GMM 8, or WCS358r (approximately 10(7) CFU per seed), and measured the numbers, composition, and activities of the rhizosphere microbial populations. During both growing seasons, all three bacterial strains decreased from 10(7) CFU per g of rhizosphere sample to below the limit of detection (10(2) CFU per g) 1 month after harvest of the wheat plants. The phz genes were stably maintained, and PCA was detected in rhizosphere extracts of GMM-treated plants. In 1997, but not in 1998, fungal numbers in the rhizosphere, quantified on 2% malt extract agar (total filamentous fungi) and on Komada's medium (mainly Fusarium spp.), were transiently suppressed in GMM 8-treated plants. We also analyzed the effects of the GMMs on the rhizosphere fungi by using amplified ribosomal DNA restriction analysis. Introduction of any of the three bacterial strains transiently changed the composition of the rhizosphere fungal microflora. However, in both 1997 and 1998, GMM-induced effects were distinct from those of WCS358r and lasted for 40 days in 1997 and for 89 days after sowing in 1998, whereas effects induced by WCS358r were detectable for 12 (1997) or 40 (1998) days. None of the strains affected the metabolic activity of the soil microbial population (substrate-induced respiration), soil nitrification potential, cellulose decomposition, plant height, or plant yield. The results indicate that application of GMMs engineered to have improved antifungal activity can exert nontarget effects on the natural fungal microflora.

  16. Structure and mechanism of benzaldehyde dehydrogenase from Pseudomonas putida ATCC 12633, a member of the Class 3 aldehyde dehydrogenase superfamily.

    PubMed

    Zahniser, Megan P D; Prasad, Shreenath; Kneen, Malea M; Kreinbring, Cheryl A; Petsko, Gregory A; Ringe, Dagmar; McLeish, Michael J

    2017-03-01

    Benzaldehyde dehydrogenase from Pseudomonas putida (PpBADH) belongs to the Class 3 aldehyde dehydrogenase (ALDH) family. The Class 3 ALDHs are unusual in that they are generally dimeric (rather than tetrameric), relatively non-specific and utilize both NAD+ and NADP+. To date, X-ray structures of three Class 3 ALDHs have been determined, of which only two have cofactor bound, both in the NAD+ form. Here we report the crystal structure of PpBADH in complex with NADP+ and a thioacyl intermediate adduct. The overall architecture of PpBADH resembles that of most other members of the ALDH superfamily, and the cofactor binding residues are well conserved. Conversely, the pattern of cofactor binding for the rat Class 3 ALDH differs from that of PpBADH and other ALDHs. This has been interpreted in terms of a different mechanism for the rat enzyme. Comparison with the PpBADH structure, as well as multiple sequence alignments, suggest that one of two conserved glutamates, at positions 215 (209 in rat) and 337 (333 in rat), would act as the general base necessary to hydrolyze the thioacyl intermediate. While the latter is the general base in the rat Class 3 ALDH, site-specific mutagenesis indicates that Glu215 is the likely candidate for PpBADH, a result more typical of the Class 1 and 2 ALDH families. Finally, this study shows that hydride transfer is not rate limiting, lending further credence to the suggestion that PpBADH is more similar to the Class 1 and 2 ALDHs than it is to other Class 3 ALDHs. © The Author 2017. Published by Oxford University Press. All rights reserved. For Permissions, please e-mail: journals.permissions@oup.com.

  17. Tight coupling of polymerization and depolymerization of polyhydroxyalkanoates ensures efficient management of carbon resources in Pseudomonas putida

    PubMed Central

    Arias, Sagrario; Bassas-Galia, Monica; Molinari, Gabriella; Timmis, Kenneth N

    2013-01-01

    Summary Environmental microbes oscillate between feast and famine and need to carefully manage utilization, storage and conversion of reserve products to exploitable sources of carbon and energy. Polyhydroxyalkanoates (PHAs) are storage polymers that serve bacteria as sources of food materials under physiological conditions of carbon demand. In order to obtain insights into the role of PHA depolymerase (PhaZ) and its relationship to a PHA polymerase (PhaC2) in the carbon management activity of Pseudomonas putida strain U, we created a polymerase hyperexpression strain and a depolymerase knockout mutant of this strain, and examined their synthesis of PHA and expression of their PHA genes. This study revealed that hyperexpression of PhaC2 led to the accumulation of higher amounts of PHA (44%wt) than in the wild-type strain (24%wt) after 24 h of cultivation, which then returned to wild-type levels by 48 h, as a result of elevated depolymerization. The phaZ mutant, however, accumulated higher levels of PHA than the parental strain (62%wt), which were maintained for at least 96 h. Transcriptional analysis of the pha cluster by RT-PCR revealed that PHA operon proteins, including depolymerase, are expressed from the beginning of the growth phase. Hyperexpression of the PhaC2 polymerase was accompanied by an increase in the expression of the PhaZ depolymerase and a decrease in expression of another PHA polymerase, PhaC1. This suggests tight regulatory coupling of PHA polymerase and depolymerase activities that act in synergy, and in concert with other PHA proteins, to provide dynamic PHA granule synthesis and remodelling that rapidly and sensitively respond to changes in availability of carbon and the physiological-metabolic needs of the cell, to ensure optimal carbon resource management. PMID:23445364

  18. Degradation and detoxification of cresols in synthetic and industrial wastewater by an indigenous strain of Pseudomonas putida in aerobic reactors.

    PubMed

    Gallego, Alfredo; Gemini, Virginia L; Fortunato, María S; Dabas, Paula; Rossi, Susana L; Gómez, Carlos E; Vescina, Cristina; Planes, Estela I; Korol, Sonia E

    2008-12-01

    We studied the degradation of mixtures of o-cresol, m-cresol, and p-cresol, by Pseudomonas putida isolated from natural sources, and the application of this degradation to the depuration and detoxification of synthetic and industrial wastewater. Biodegradation assays were performed in batch and continuous-flow fixed-bed aerobic reactors. Biodegradation was evaluated by cresol determination using micellar electrokinetic capillary chromatography, UV spectrophotometry, and chemical oxygen demand (COD). Mineralization of cresols was assessed by gas chromatography performed both at the end of the batch process and in the continuous flow reactor effluent. Microbial growth was measured by the plate count method. Scanning electronic microscopy was employed to observe bacterial cells adsorbed on polyvinyl chloride cylinders in the reactor. Detoxification was evaluated by Vibrio fischeri, Pseudokirchneriella subcapitata, and Daphnia magna toxicity tests. Results obtained show that under batch conditions the strain grew exponentially with 100, 200, and 300 mg/L of each of the isomers in synthetic minimal medium within 48 h; in industrial wastewater with 540 mg/L of cresols similar results were obtained. Removal of cresols and COD was higher than 99.9% and 95.0%, respectively. When assays were performed in continuous flow reactor in synthetic wastewater under operating conditions a removal of total cresols and COD of 99.9% and 96.4%, respectively, was achieved. Results of capillary electrophoresis may suggest a concurrent isomers utilization and simultaneous growth on the substrates. Toxicity was neither detected at the end of the batch process nor in the continuous flow reactor effluent. 2008 Wiley Periodicals, Inc.

  19. Inhibited transport of graphene oxide nanoparticles in granular quartz sand coated with Bacillus subtilis and Pseudomonas putida biofilms.

    PubMed

    He, Jian-Zhou; Wang, Deng-Jun; Fang, Huan; Fu, Qing-Long; Zhou, Dong-Mei

    2017-02-01

    Increasing production and use of graphene oxide nanoparticles (GONPs) boost their wide dissemination in the subsurface environments where biofilms occur ubiquitously, representative of the physical and chemical heterogeneities. This study aimed at investigating the influence of Gram-positive Bacillus subtilis (BS) and Gram-negative Pseudomonas putida (PP) biofilms on the transport of GONPs under different ionic strengths (0.1, 0.5, and 1.0 mM CaCl2) at neutral pH 7.2 in water-saturated porous media. Particularly, the X-ray micro-computed tomography was used to quantitatively characterize the pore structures of sand columns in the presence and absence of biofilms. Our results indicated that the presence of biofilms reduced the porosity and narrowed down the pore sizes of packed columns. Transport experiments in biofilm-coated sand showed that biofilms, irrespective of bacterial species, significantly inhibited the mobility of GONPs compared to that in cleaned sand. This could be due to the Ca(2+) complexation, increased surface roughness and charge heterogeneities of collectors, and particularly enhanced physical straining caused by biofilms. The two-site kinetic retention model-fitted value of maximum solid-phase concentration (Smax2) for GONPs was higher for biofilm-coated sand than for cleaned sand, demonstrating that biofilms act as favorable sites for GONPs retention. Our findings presented herein are important to deepen our current understanding on the nature of particle-collector interactions. Copyright © 2016 Elsevier Ltd. All rights reserved.

  20. Caffeine junkie: an unprecedented glutathione S-transferase-dependent oxygenase required for caffeine degradation by Pseudomonas putida CBB5.

    PubMed

    Summers, Ryan M; Seffernick, Jennifer L; Quandt, Erik M; Yu, Chi Li; Barrick, Jeffrey E; Subramanian, Mani V

    2013-09-01

    Caffeine and other N-methylated xanthines are natural products found in many foods, beverages, and pharmaceuticals. Therefore, it is not surprising that bacteria have evolved to live on caffeine as a sole carbon and nitrogen source. The caffeine degradation pathway of Pseudomonas putida CBB5 utilizes an unprecedented glutathione-S-transferase-dependent Rieske oxygenase for demethylation of 7-methylxanthine to xanthine, the final step in caffeine N-demethylation. The gene coding this function is unusual, in that the iron-sulfur and non-heme iron domains that compose the normally functional Rieske oxygenase (RO) are encoded by separate proteins. The non-heme iron domain is located in the monooxygenase, ndmC, while the Rieske [2Fe-2S] domain is fused to the RO reductase gene, ndmD. This fusion, however, does not interfere with the interaction of the reductase with N1- and N3-demethylase RO oxygenases, which are involved in the initial reactions of caffeine degradation. We demonstrate that the N7-demethylation reaction absolutely requires a unique, tightly bound protein complex composed of NdmC, NdmD, and NdmE, a novel glutathione-S-transferase (GST). NdmE is proposed to function as a noncatalytic subunit that serves a structural role in the complexation of the oxygenase (NdmC) and Rieske domains (NdmD). Genome analyses found this gene organization of a split RO and GST gene cluster to occur more broadly, implying a larger function for RO-GST protein partners.

  1. A phthalate family oxygenase reductase supports terpene alcohol oxidation by CYP238A1 from Pseudomonas putida KT2440.

    PubMed

    Bell, Stephen Graham; French, Laura; Rees, Nicholas Huw; Cheng, Sophia Shuyi; Preston, Gail; Wong, Luet-Lok

    2013-01-01

    CYP238A1, one of the two P450 enzymes in the genome of Pseudomonas putida KT2440, has been produced heterologously in Escherichia coli, purified, and found to bind acyclic and cyclic terpene alcohols such as farnesol, nerolidol, linalool, and terpineol. The other P450 enzyme in this organism (gene locus: PP1950) was also produced in E. coli but no substrate has been identified from a limited screen. A phthalate family oxygenase reductase (PFOR) encoded by the PP1957 gene, just downstream of the PP1955 gene for CYP238A1, accepts electrons from the reduced form of both nicotinamide adenine dinucleotide (NADH) and nicotinamide adenine dinucleotide phosphate and is able to support monooxygenase activity of CYP238A1, both in vitro and in E. coli, in which both enzymes are produced. CYP238A1 oxidizes cis- and trans-nerolidol to the 9-hydroxy product, with no evidence of attack at the olefinic double bonds. The NADH turnover rate of 170 nmol(nmol-P450)⁻¹ Min⁻¹ for CYP238A1 with cis-nerolidol as substrate at a PP1957:CYP238A1 concentration ratio of 8:1 suggests that this PFOR could function as the physiological redox partner for CYP238A1. The physiological role of CYP238A1 may be related to the PP1955 gene being part of an island/cluster of inducible genes associated with energy metabolism and response to xenobiotics. © 2013 International Union of Biochemistry and Molecular Biology, Inc.

  2. Measurement of Biologically Available Naphthalene in Gas and Aqueous Phases by Use of a Pseudomonas putida Biosensor

    PubMed Central

    Werlen, Christoph; Jaspers, Marco C. M.; van der Meer, Jan Roelof

    2004-01-01

    Genetically constructed microbial biosensors for measuring organic pollutants are mostly applied in aqueous samples. Unfortunately, the detection limit of most biosensors is insufficient to detect pollutants at low but environmentally relevant concentrations. However, organic pollutants with low levels of water solubility often have significant gas-water partitioning coefficients, which in principle makes it possible to measure such compounds in the gas rather than the aqueous phase. Here we describe the first use of a microbial biosensor for measuring organic pollutants directly in the gas phase. For this purpose, we reconstructed a bioluminescent Pseudomonas putida naphthalene biosensor strain to carry the NAH7 plasmid and a chromosomally inserted gene fusion between the sal promoter and the luxAB genes. Specific calibration studies were performed with suspended and filter-immobilized biosensor cells, in aqueous solution and in the gas phase. Gas phase measurements with filter-immobilized biosensor cells in closed flasks, with a naphthalene-contaminated aqueous phase, showed that the biosensor cells can measure naphthalene effectively. The biosensor cells on the filter responded with increasing light output proportional to the naphthalene concentration added to the water phase, even though only a small proportion of the naphthalene was present in the gas phase. In fact, the biosensor cells could concentrate a larger proportion of naphthalene through the gas phase than in the aqueous suspension, probably due to faster transport of naphthalene to the cells in the gas phase. This led to a 10-fold lower detectable aqueous naphthalene concentration (50 nM instead of 0.5 μM). Thus, the use of bacterial biosensors for measuring organic pollutants in the gas phase is a valid method for increasing the sensitivity of these valuable biological devices. PMID:14711624

  3. Root inoculation with Pseudomonas putida KT2440 induces transcriptional and metabolic changes and systemic resistance in maize plants

    PubMed Central

    Planchamp, Chantal; Glauser, Gaetan; Mauch-Mani, Brigitte

    2014-01-01

    Pseudomonas putida KT2440 (KT2440) rhizobacteria colonize a wide range of plants. They have been extensively studied for their capacity to adhere to maize seeds, to tolerate toxic secondary metabolites produced by maize roots and to be attracted by maize roots. However, the response of maize plants to KT2440 colonization has not been investigated yet. Maize roots were inoculated with KT2440 and the local (roots) and systemic (leaves) early plant responses were investigated. The colonization behavior of KT2440 following application to maize seedlings was investigated and transcriptional analysis of stress- and defense-related genes as well as metabolite profiling of local and systemic maize tissues of KT2440-inoculated were performed. The local and systemic responses differed and more pronounced changes were observed in roots compared to leaves. Early in the interaction roots responded via jasmonic acid- and abscisic acid-dependent signaling. Interestingly, during later steps, the salicylic acid pathway was suppressed. Metabolite profiling revealed the importance of plant phospholipids in KT2440-maize interactions. An additional important maize secondary metabolite, a form of benzoxazinone, was also found to be differently abundant in roots 3 days after KT2440 inoculation. However, the transcriptional and metabolic changes observed in bacterized plants early during the interaction were minor and became even less pronounced with time, indicating an accommodation state of the plant to the presence of KT2440. Since the maize plants reacted to the presence of KT2440 in the rhizosphere, we also investigated the ability of these bacteria to trigger induced systemic resistance (ISR) against the maize anthracnose fungus Colletotrichum graminicola. The observed resistance was expressed as strongly reduced leaf necrosis and fungal growth in infected bacterized plants compared to non-bacterized controls, showing the potential of KT2440 to act as resistance inducers. PMID

  4. Deciphering the genetic determinants for aerobic nicotinic acid degradation: the nic cluster from Pseudomonas putida KT2440.

    PubMed

    Jiménez, José I; Canales, Angeles; Jiménez-Barbero, Jesús; Ginalski, Krzysztof; Rychlewski, Leszek; García, José L; Díaz, Eduardo

    2008-08-12

    The aerobic catabolism of nicotinic acid (NA) is considered a model system for degradation of N-heterocyclic aromatic compounds, some of which are major environmental pollutants; however, the complete set of genes as well as the structural-functional relationships of most of the enzymes involved in this process are still unknown. We have characterized a gene cluster (nic genes) from Pseudomonas putida KT2440 responsible for the aerobic NA degradation in this bacterium and when expressed in heterologous hosts. The biochemistry of the NA degradation through the formation of 2,5-dihydroxypyridine and maleamic acid has been revisited, and some gene products become the prototype of new types of enzymes with unprecedented molecular architectures. Thus, the initial hydroxylation of NA is catalyzed by a two-component hydroxylase (NicAB) that constitutes the first member of the xanthine dehydrogenase family whose electron transport chain to molecular oxygen includes a cytochrome c domain. The Fe(2+)-dependent dioxygenase (NicX) converts 2,5-dihydroxypyridine into N-formylmaleamic acid, and it becomes the founding member of a new family of extradiol ring-cleavage dioxygenases. Further conversion of N-formylmaleamic acid to formic and maleamic acid is catalyzed by the NicD protein, the only deformylase described so far whose catalytic triad is similar to that of some members of the alpha/beta-hydrolase fold superfamily. This work allows exploration of the existence of orthologous gene clusters in saprophytic bacteria and some pathogens, where they might stimulate studies on their role in virulence, and it provides a framework to develop new biotechnological processes for detoxification/biotransformation of N-heterocyclic aromatic compounds.

  5. Identification and characterization of genes encoding polycyclic aromatic hydrocarbon dioxygenase and polycyclic aromatic hydrocarbon dihydrodiol dehydrogenase in Pseudomonas putida OUS82.

    PubMed Central

    Takizawa, N; Kaida, N; Torigoe, S; Moritani, T; Sawada, T; Satoh, S; Kiyohara, H

    1994-01-01

    Naphthalene and phenanthrene are transformed by enzymes encoded by the pah gene cluster of Pseudomonas putida OUS82. The pahA and pahB genes, which encode the first and second enzymes, dioxygenase and cis-dihydrodiol dehydrogenase, respectively, were identified and sequenced. The DNA sequences showed that pahA and pahB were clustered and that pahA consisted of four cistrons, pahAa, pahAb, pahAc, and pahAd, which encode ferredoxin reductase, ferredoxin, and two subunits of the iron-sulfur protein, respectively. PMID:8157615

  6. Cloning and characterization of a chromosomal gene cluster, pah, that encodes the upper pathway for phenanthrene and naphthalene utilization by Pseudomonas putida OUS82.

    PubMed Central

    Kiyohara, H; Torigoe, S; Kaida, N; Asaki, T; Iida, T; Hayashi, H; Takizawa, N

    1994-01-01

    A 25-kb DNA SalI fragment cloned from the chromosomal DNA of Pseudomonas putida OUS82, which utilizes phenanthrene (Phn+) and naphthalene (Nah+), carried all of the genes necessary for upper naphthalene catabolism. Cosmid recombinant pIP7 complemented both the Nah- and Phn- defects of OUS8211 (Trp-Nah-Phn-Sal+[salicylate utilizing]Hna+[1-hydroxy-2-naphthoate utilizing]) and only the Phn- defect of OUS8212 (Trp-Nah-Phn-Sal-Hna+). The results indicate that strain OUS82 uses different pathways after o-hydroxycarboxylic aromatics in the catabolism of naphthalene and phenanthrene. PMID:8157614

  7. Cell-cell and cell-surface interactions mediated by cellulose and a novel exopolysaccharide contribute to Pseudomonas putida biofilm formation and fitness under water-limiting conditions.

    PubMed

    Nielsen, Lindsey; Li, Xiaohong; Halverson, Larry J

    2011-05-01

    The composition of the exopolysaccharide matrix of Pseudomonas putida mt2 biofilms is relatively undefined as well as the contributions of each polymer to ecological fitness. Here, we describe the role of two putative exopolysaccharide gene clusters, putida exopolysaccharide A (pea) and bacterial cellulose (bcs) in biofilm formation and stability, rhizosphere colonization and matrix hydration under water-limiting conditions. Our findings suggest that pea is involved in the production of a novel glucose, galactose, and mannose-rich polymer that contributes to cell-cell interactions necessary for pellicle and biofilm formation and stability. In contrast, Bcs plays a minor role in biofilm formation and stability, although it does contribute to rhizosphere colonization based on a competition assay. We show that pea expression is highly induced transiently under water-limiting conditions but only slightly by high osmolarity, as determined by qRT-PCR. In contrast, both forms of water stress highly induced bcs expression. Cells deficient in making one or more exopolysaccharide experienced greater dehydration-mediated cell-envelope stress, leading to increased alginate promoter activity. However, this did not lead to increased exopolysaccharide production, except in bcs or pea mutants unable to produce alginate, indicating that P. putida compensates by producing, presumably more Pea or Bcs exopolysaccharides, to facilitate biofilm hydration. Collectively, the data suggest that Pea and Bcs contribute to biofilm formation and in turn their presence contributes to fitness under water-limiting conditions, but not to the extent of alginate.

  8. Isolation and preliminary characterization of the subunits of the terminal component of naphthalene dioxygenase from Pseudomonas putida NCIB 9816-4.

    PubMed Central

    Suen, W C; Gibson, D T

    1993-01-01

    The terminal oxygenase component (ISPNAP) of naphthalene dioxygenase from Pseudomonas putida NCIB 9816-4 was purified to homogeneity. The protein contained approximately 4 g-atoms each of iron and acid-labile sulfide per mol of ISPNAP, and enzyme activity was stimulated significantly by addition of exogenous iron. The large (alpha) and small (beta) subunits of ISPNAP were isolated by two different procedures. The NH2-terminal amino acid sequences of the alpha and beta subunits were identical to the deduced amino acid sequences reported for the ndoB and ndoC genes from P. putida NCIB 9816 and almost identical to the NH2-terminal amino acid sequences determined for the large and small subunits of ISPNAP from P. putida G7. Gel filtration in the presence of 6 M urea gave an alpha subunit with an absorption maximum at 325 nm and broad absorption between 420 and 450 nm. The alpha subunit contained approximately 2 g-atoms each of iron and acid-labile sulfide per mol of the subunit. The beta subunit did not contain iron or acid-labile sulfide. These results, taken in conjunction with the deduced amino acid sequences of the large subunits from several iron-sulfur oxygenases, indicate that each alpha subunit of ISPNAP contains a Rieske [2Fe-2S] center. Images PMID:8376335

  9. Cyclopropane fatty acids are involved in organic solvent tolerance but not in acid stress resistance in Pseudomonas putida DOT‐T1E

    PubMed Central

    Pini, Cecilia‐Vanesa; Bernal, Patricia; Godoy, Patricia; Ramos, Juan‐Luis; Segura, Ana

    2009-01-01

    Summary Bacterial membranes constitute the first physical barrier against different environmental stresses. Pseudomonas putida DOT‐T1E accumulates cyclopropane fatty acids (CFAs) in the stationary phase of growth. In this strain the cfaB gene encodes the main cyclopropane synthase responsible of the synthesis of CFAs, and its expression is mediated by RNA polymerase with sigma factor σ38. We generated a cfaB mutant of P. putida DOT‐T1E and studied its response to solvents, acid pH and other stress conditions such as temperature changes, high osmolarity and the presence of antibiotics or heavy metals in the culture medium. A CfaB knockout mutant was more sensitive to solvent stress than the wild‐type strain, but in contrast to Escherichia coli and Salmonella enterica, the P. putida cfaB mutant was as tolerant to acid shock as the wild‐type strain. The cfaB mutant was also as tolerant as the parental strain to a number of drugs, antibiotics and other damaging agents. PMID:21261919

  10. Cloning, nucleotide sequence, and overexpression of the gene coding for delta 5-3-ketosteroid isomerase from Pseudomonas putida biotype B.

    PubMed

    Kim, S W; Kim, C Y; Benisek, W F; Choi, K Y

    1994-11-01

    The structural gene coding for the delta 5-3-ketosteroid isomerase (KSI) of Pseudomonas putida biotype B has been cloned, and its entire nucleotide sequence has been determined by a dideoxynucleotide chain termination method. A 2.1-kb DNA fragment containing the ksi gene was cloned from a P. putida biotype B genomic library in lambda gt11. The open reading frame of ksi encodes 393 nucleotides, and the amino acid sequence deduced from the nucleotide sequence agrees with the directly determined amino acid sequence (K. Linden and W. F. Benisek, J. Biol. Chem. 261:6454-6460, 1986). A putative purine-rich ribosome binding site was found 8 bp upstream of the ATG start codon. Escherichia coli BL21(DE3) transformed with the pKK-KSI plasmid containing the ksi gene expressed a high level of isomerase activity when induced by isopropyl-beta-D-thiogalactopyranoside. KSI was purified to homogeneity by a simple and rapid procedure utilizing fractional precipitation and an affinity column of deoxycholate-ethylenediamine-agarose as a major chromatographic step. The molecular weight of KSI was 14,535 (calculated, 14,536) as determined by electrospray mass spectrometry. The purified KSI showed a specific activity (39,807 mumol min-1 mg-1) and a Km (60 microM) which are close to those of KSI originally obtained from P. putida biotype B.

  11. Cloning, nucleotide sequence, and overexpression of the gene coding for delta 5-3-ketosteroid isomerase from Pseudomonas putida biotype B.

    PubMed Central

    Kim, S W; Kim, C Y; Benisek, W F; Choi, K Y

    1994-01-01

    The structural gene coding for the delta 5-3-ketosteroid isomerase (KSI) of Pseudomonas putida biotype B has been cloned, and its entire nucleotide sequence has been determined by a dideoxynucleotide chain termination method. A 2.1-kb DNA fragment containing the ksi gene was cloned from a P. putida biotype B genomic library in lambda gt11. The open reading frame of ksi encodes 393 nucleotides, and the amino acid sequence deduced from the nucleotide sequence agrees with the directly determined amino acid sequence (K. Linden and W. F. Benisek, J. Biol. Chem. 261:6454-6460, 1986). A putative purine-rich ribosome binding site was found 8 bp upstream of the ATG start codon. Escherichia coli BL21(DE3) transformed with the pKK-KSI plasmid containing the ksi gene expressed a high level of isomerase activity when induced by isopropyl-beta-D-thiogalactopyranoside. KSI was purified to homogeneity by a simple and rapid procedure utilizing fractional precipitation and an affinity column of deoxycholate-ethylenediamine-agarose as a major chromatographic step. The molecular weight of KSI was 14,535 (calculated, 14,536) as determined by electrospray mass spectrometry. The purified KSI showed a specific activity (39,807 mumol min-1 mg-1) and a Km (60 microM) which are close to those of KSI originally obtained from P. putida biotype B. Images PMID:7961420

  12. Effects of impurities in biodiesel-derived glycerol on growth and expression of heavy metal ion homeostasis genes and gene products in Pseudomonas putida LS46.

    PubMed

    Fu, Jilagamazhi; Sharma, Parveen; Spicer, Vic; Krokhin, Oleg V; Zhang, Xiangli; Fristensky, Brian; Wilkins, John A; Cicek, Nazim; Sparling, Richard; Levin, David B

    2015-07-01

    Biodiesel production-derived waste glycerol (WG) was previously investigated as potential carbon source for medium chain length polyhydroxyalkanoate (mcl-PHA) production by Pseudomonas putida LS46. In this study, we evaluated the effect of impurities in the WG on P. putida LS46 physiology during exponential growth and corresponding changes in transcription and protein expression profiles compared with cells grown on pure, reagent grade glycerol. High concentration of metal ions, such as Na(+), and numbers of heavy metals ion, such as copper, ion, zinc, were detected in biodiesel-derived WG. Omics analysis from the corresponding cultures suggested altered expression of genes involved in transport and metabolism of ammonia and heavy metal ions. Expression of three groups of heavy metal homeostasis genes was significantly changed (mostly upregulated) in WG cultures and included the following: copper-responded cluster 1 and 2 genes, primarily containing cusABC; two copies of copAB and heavy metal translocating P-type ATPase; Fur-regulated, TonB-dependent siderophore receptor; and several cobalt/zinc/cadmium transporters. Expression of these genes suggests regulation of intracellular concentrations of heavy metals during growth on biodiesel-derived glycerol. Finally, a number of genes involved in adapting to, or metabolizing free fatty acids and other nonheavy metal contaminants, such as Na(+), were also upregulated in P. putida LS46 grown on biodiesel-derived glycerol.

  13. Control of microorganisms in the rhizosphere of wheat by inoculation of seeds with Pseudomonas putida and by foliar application of urea.

    PubMed

    Vraný, J; Vancura, V; Stanĕk, M

    1981-01-01

    After inoculation of wheat seeds with various bacterial strains germination of plants was usually inhibited at first but growth was stimulated later. After inoculation with Pseudomonas putida K 11 producing physiologically active compounds the total number of bacteria increased together with the bacteria: fungi ratio in the rhizosphere. These characteristic were further increased after foliar application of urea due to increased root exudation. Dry mass of upper wheat parts was about 14--80% higher in green-house experiments, in which the plants were treated in the two above ways. More reliable results were usually obtained by bacterization of P. putida and foliar application of urea as compared with the situation when the seeds were inoculated without the foliar application or, on the contrary, after foliar application without inoculation of the seeds. Only when urea was applied early and ain a soil contaminated with the fungus Gaeumannomyces graminis var. tritici (causing "take-all" of the wheat) no favourable results could be detected. In these cases the foliar application without inoculation of the seeds was more successful. Symptoms of the disease of wheat roots caused by G. graminis were less frequently observed after the inoculation of the seeds with the strain P. putida K 11 and after the foliar application of urea.

  14. The turnover of medium-chain-length polyhydroxyalkanoates in Pseudomonas putida KT2442 and the fundamental role of PhaZ depolymerase for the metabolic balance.

    PubMed

    de Eugenio, Laura Isabel; Escapa, Isabel F; Morales, Valle; Dinjaski, Nina; Galán, Beatriz; García, José Luis; Prieto, María A

    2010-01-01

    Polyhydroxyalkanoates (PHAs) are biodegradable polymers produced by a wide range of bacteria, including Pseudomonads. These polymers are accumulated in the cytoplasm as carbon and energy storage materials when culture conditions are unbalanced and hence, they have been classically considered to act as sinks for carbon and reducing equivalents when nutrients are limited. Bacteria facing carbon excess and nutrient limitation store the extra carbon as PHAs through the PHA polymerase (PhaC). Thereafter, under starvation conditions, PHA depolymerase (PhaZ) degrades PHA and releases R-hydroxyalkanoic acids, which can be used as carbon and energy sources. To study the influence of a deficient PHA metabolism in the growth of Pseudomonas putida KT2442 we have constructed two mutant strains defective in PHA polymerase (phaC1)- and PHA depolymerase (phaZ)-coding genes respectively. By using these mutants we have demonstrated that PHAs play a fundamental role in balancing the stored carbon/biomass/number of cells as function of carbon availability, suggesting that PHA metabolism allows P. putida to adapt the carbon flux of hydroxyacyl-CoAs to cellular demand. Furthermore, we have established that the coordination of PHA synthesis and mobilization pathways configures a functional PHA turnover cycle in P. putida KT2442. Finally, a new strain able to secrete enantiomerically pure R-hydroxyalkanoic acids to the culture medium during cell growth has been engineering by redirecting the PHA cycle to biopolymer hydrolysis.

  15. Potential of the TCE-degrading endophyte Pseudomonas putida W619-TCE to improve plant growth and reduce TCE phytotoxicity and evapotranspiration in poplar cuttings.

    PubMed

    Weyens, Nele; Truyens, Sascha; Dupae, Joke; Newman, Lee; Taghavi, Safiyh; van der Lelie, Daniel; Carleer, Robert; Vangronsveld, Jaco

    2010-09-01

    The TCE-degrading poplar endophyte Pseudomonas putida W619-TCE was inoculated in poplar cuttings, exposed to 0, 200 and 400 mg l(-1) TCE, that were grown in two different experimental setups. During a short-term experiment, plants were grown hydroponically in half strength Hoagland nutrient solution and exposed to TCE for 3 days. Inoculation with P. putida W619-TCE promoted plant growth, reduced TCE phytotoxicity and reduced the amount of TCE present in the leaves. During a mid-term experiment, plants were grown in potting soil and exposed to TCE for 3 weeks. Here, inoculation with P. putida W619-TCE had a less pronounced positive effect on plant growth and TCE phytotoxicity, but resulted in strongly reduced amounts of TCE in leaves and roots of plants exposed to 400 mg l(-1) TCE, accompanied by a lowered evapotranspiration of TCE. Dichloroacetic acid (DCAA) and trichloroacetic acid (TCAA), which are known intermediates of TCE degradation, were not detected.

  16. Metabolism-dependent taxis towards (methyl)phenols is coupled through the most abundant of three polar localized Aer-like proteins of Pseudomonas putida.

    PubMed

    Sarand, Inga; Osterberg, Sofia; Holmqvist, Sofie; Holmfeldt, Per; Skärfstad, Eleonore; Parales, Rebecca E; Shingler, Victoria

    2008-05-01

    Comparatively little is known about directed motility of environmental bacteria to common aromatic pollutants. Here, by expressing different parts of a (methyl)phenol-degradative pathway and the use of specific mutants, we show that taxis of Pseudomonas putida towards (methyl)phenols is dictated by its ability to catabolize the aromatic compound. Thus, in contrast to previously described chemoreceptor-mediated chemotaxis mechanisms towards benzoate, naphthalene and toluene, taxis in response to (methyl)phenols is mediated by metabolism-dependent behaviour. Here we show that P. putida differentially expresses three Aer-like receptors that are all polar-localized through interactions with CheA, and that inactivation of the most abundant Aer2 protein significantly decreases taxis towards phenolics. In addition, the participation of a sensory signal transduction protein composed of a PAS, a GGDEF and an EAL domain in motility towards these compounds is demonstrated. The results are discussed in the context of the versatility of metabolism-dependent coupling and the necessity for P. putida to integrate diverse metabolic signals from its native heterogeneous soil and water environments.

  17. Quantitative ‘Omics Analyses of Medium Chain Length Polyhydroxyalkanaote Metabolism in Pseudomonas putida LS46 Cultured with Waste Glycerol and Waste Fatty Acids

    PubMed Central

    Fu, Jilagamazhi; Sharma, Parveen; Spicer, Vic; Krokhin, Oleg V.; Zhang, Xiangli; Fristensky, Brian; Cicek, Nazim; Sparling, Richard; Levin, David. B.

    2015-01-01

    Transcriptomes and proteomes of Pseudomonas putida LS46 cultured with biodiesel-derived waste glycerol or waste free fatty acids, as sole carbon sources, were compared under conditions that were either permissive or non-permissive for synthesis of medium chain length polyhydroxyalkanoates (mcl-PHA). The objectives of this study were to elucidate mechanisms that influence activation of biopolymer synthesis, intra-cellular accumulation, and monomer composition, and determine if these were physiologically specific to the carbon sources used for growth of P. putida LS46. Active mcl-PHA synthesis by P. putida LS46 was associated with high expression levels of key mcl-PHA biosynthesis genes and/or gene products including monomer-supplying proteins, PHA synthases, and granule-associated proteins. ‘Omics data suggested that expression of these genes were regulated by different genetic mechanisms in P. putida LS46 cells in different physiological states, when cultured on the two waste carbon sources. Optimal polymer production by P. putida LS46 was primarily limited by less efficient glycerol metabolism during mcl-PHA synthesis on waste glycerol. Mapping the ‘Omics data to the mcl-PHA biosynthetic pathway revealed significant variations in gene expression, primarily involved in: 1) glycerol transportation; 2) enzymatic reactions that recycle reducing equivalents and produce key mcl-PHA biosynthesis pathway intermediates (e.g. NADH/NADPH, acetyl-CoA). Active synthesis of mcl-PHAs was observed during exponential phase in cultures with waste free fatty acids, and was associated with the fatty acid beta-oxidation pathway. A putative Thioesterase in the beta-oxidation pathway that may regulate the level of fatty acid beta-oxidation intermediates, and thus carbon flux to mcl-PHA biosynthesis, was highly up-regulated. Finally, the data suggested that differences in expression of selected fatty acid metabolism and mcl-PHA monomer-supplying enzymes may play a role in determining

  18. A reduction in growth rate of Pseudomonas putida KT2442 counteracts productivity advances in medium-chain-length polyhydroxyalkanoate production from gluconate.

    PubMed

    Follonier, Stéphanie; Panke, Sven; Zinn, Manfred

    2011-04-22

    The substitution of plastics based on fossil raw material by biodegradable plastics produced from renewable resources is of crucial importance in a context of oil scarcity and overflowing plastic landfills. One of the most promising organisms for the manufacturing of medium-chain-length polyhydroxyalkanoates (mcl-PHA) is Pseudomonas putida KT2440 which can accumulate large amounts of polymer from cheap substrates such as glucose. Current research focuses on enhancing the strain production capacity and synthesizing polymers with novel material properties. Many of the corresponding protocols for strain engineering rely on the rifampicin-resistant variant, P. putida KT2442. However, it remains unclear whether these two strains can be treated as equivalent in terms of mcl-PHA production, as the underlying antibiotic resistance mechanism involves a modification in the RNA polymerase and thus has ample potential for interfering with global transcription. To assess PHA production in P. putida KT2440 and KT2442, we characterized the growth and PHA accumulation on three categories of substrate: PHA-related (octanoate), PHA-unrelated (gluconate) and poor PHA substrate (citrate). The strains showed clear differences of growth rate on gluconate and citrate (reduction for KT2442 > 3-fold and > 1.5-fold, respectively) but not on octanoate. In addition, P. putida KT2442 PHA-free biomass significantly decreased after nitrogen depletion on gluconate. In an attempt to narrow down the range of possible reasons for this different behavior, the uptake of gluconate and extracellular release of the oxidized product 2-ketogluconate were measured. The results suggested that the reason has to be an inefficient transport or metabolization of 2-ketogluconate while an alteration of gluconate uptake and conversion to 2-ketogluconate could be excluded. The study illustrates that the recruitment of a pleiotropic mutation, whose effects might reach deep into physiological regulation, effectively

  19. A reduction in growth rate of Pseudomonas putida KT2442 counteracts productivity advances in medium-chain-length polyhydroxyalkanoate production from gluconate

    PubMed Central

    2011-01-01

    Background The substitution of plastics based on fossil raw material by biodegradable plastics produced from renewable resources is of crucial importance in a context of oil scarcity and overflowing plastic landfills. One of the most promising organisms for the manufacturing of medium-chain-length polyhydroxyalkanoates (mcl-PHA) is Pseudomonas putida KT2440 which can accumulate large amounts of polymer from cheap substrates such as glucose. Current research focuses on enhancing the strain production capacity and synthesizing polymers with novel material properties. Many of the corresponding protocols for strain engineering rely on the rifampicin-resistant variant, P. putida KT2442. However, it remains unclear whether these two strains can be treated as equivalent in terms of mcl-PHA production, as the underlying antibiotic resistance mechanism involves a modification in the RNA polymerase and thus has ample potential for interfering with global transcription. Results To assess PHA production in P. putida KT2440 and KT2442, we characterized the growth and PHA accumulation on three categories of substrate: PHA-related (octanoate), PHA-unrelated (gluconate) and poor PHA substrate (citrate). The strains showed clear differences of growth rate on gluconate and citrate (reduction for KT2442 > 3-fold and > 1.5-fold, respectively) but not on octanoate. In addition, P. putida KT2442 PHA-free biomass significantly decreased after nitrogen depletion on gluconate. In an attempt to narrow down the range of possible reasons for this different behavior, the uptake of gluconate and extracellular release of the oxidized product 2-ketogluconate were measured. The results suggested that the reason has to be an inefficient transport or metabolization of 2-ketogluconate while an alteration of gluconate uptake and conversion to 2-ketogluconate could be excluded. Conclusions The study illustrates that the recruitment of a pleiotropic mutation, whose effects might reach deep into

  20. Quantitative 'Omics Analyses of Medium Chain Length Polyhydroxyalkanaote Metabolism in Pseudomonas putida LS46 Cultured with Waste Glycerol and Waste Fatty Acids.

    PubMed

    Fu, Jilagamazhi; Sharma, Parveen; Spicer, Vic; Krokhin, Oleg V; Zhang, Xiangli; Fristensky, Brian; Cicek, Nazim; Sparling, Richard; Levin, David B

    2015-01-01

    Transcriptomes and proteomes of Pseudomonas putida LS46 cultured with biodiesel-derived waste glycerol or waste free fatty acids, as sole carbon sources, were compared under conditions that were either permissive or non-permissive for synthesis of medium chain length polyhydroxyalkanoates (mcl-PHA). The objectives of this study were to elucidate mechanisms that influence activation of biopolymer synthesis, intra-cellular accumulation, and monomer composition, and determine if these were physiologically specific to the carbon sources used for growth of P. putida LS46. Active mcl-PHA synthesis by P. putida LS46 was associated with high expression levels of key mcl-PHA biosynthesis genes and/or gene products including monomer-supplying proteins, PHA synthases, and granule-associated proteins. 'Omics data suggested that expression of these genes were regulated by different genetic mechanisms in P. putida LS46 cells in different physiological states, when cultured on the two waste carbon sources. Optimal polymer production by P. putida LS46 was primarily limited by less efficient glycerol metabolism during mcl-PHA synthesis on waste glycerol. Mapping the 'Omics data to the mcl-PHA biosynthetic pathway revealed significant variations in gene expression, primarily involved in: 1) glycerol transportation; 2) enzymatic reactions that recycle reducing equivalents and produce key mcl-PHA biosynthesis pathway intermediates (e.g. NADH/NADPH, acetyl-CoA). Active synthesis of mcl-PHAs was observed during exponential phase in cultures with waste free fatty acids, and was associated with the fatty acid beta-oxidation pathway. A putative Thioesterase in the beta-oxidation pathway that may regulate the level of fatty acid beta-oxidation intermediates, and thus carbon flux to mcl-PHA biosynthesis, was highly up-regulated. Finally, the data suggested that differences in expression of selected fatty acid metabolism and mcl-PHA monomer-supplying enzymes may play a role in determining the

  1. Co-culture with Listeria monocytogenes within a dual-species biofilm community strongly increases resistance of Pseudomonas putida to benzalkonium chloride.

    PubMed

    Giaouris, Efstathios; Chorianopoulos, Nikos; Doulgeraki, Agapi; Nychas, George-John

    2013-01-01

    Biofilm formation is a phenomenon occurring almost wherever microorganisms and surfaces exist in close proximity. This study aimed to evaluate the possible influence of bacterial interactions on the ability of Listeria monocytogenes and Pseudomonas putida to develop a dual-species biofilm community on stainless steel (SS), as well as on the subsequent resistance of their sessile cells to benzalkonium chloride (BC) used in inadequate (sub-lethal) concentration (50 ppm). The possible progressive adaptability of mixed-culture biofilms to BC was also investigated. To accomplish these, 3 strains per species were left to develop mixed-culture biofilms on SS coupons, incubated in daily renewable growth medium for a total period of 10 days, under either mono- or dual-species conditions. Each day, biofilm cells were exposed to disinfection treatment. Results revealed that the simultaneous presence of L. monocytogenes strongly increased the resistance of P. putida biofilm cells to BC, while culture conditions (mono-/dual-species) did not seem to significantly influence the resistance of L. monocytogenes biofilm cells. BC mainly killed L. monocytogenes cells when this was applied against the dual-species sessile community during the whole incubation period, despite the fact that from the 2nd day this community was mainly composed (>90%) of P. putida cells. No obvious adaptation to BC was observed in either L. monocytogenes or P. putida biofilm cells. Pulsed field gel electrophoresis (PFGE) analysis showed that the different strains behaved differently with regard to biofilm formation and antimicrobial resistance. Such knowledge on the physiological behavior of mixed-culture biofilms could provide the information necessary to control their formation.

  2. Co-Culture with Listeria monocytogenes within a Dual-Species Biofilm Community Strongly Increases Resistance of Pseudomonas putida to Benzalkonium Chloride

    PubMed Central

    Giaouris, Efstathios; Chorianopoulos, Nikos; Doulgeraki, Agapi; Nychas, George-John

    2013-01-01

    Biofilm formation is a phenomenon occurring almost wherever microorganisms and surfaces exist in close proximity. This study aimed to evaluate the possible influence of bacterial interactions on the ability of Listeria monocytogenes and Pseudomonas putida to develop a dual-species biofilm community on stainless steel (SS), as well as on the subsequent resistance of their sessile cells to benzalkonium chloride (BC) used in inadequate (sub-lethal) concentration (50 ppm). The possible progressive adaptability of mixed-culture biofilms to BC was also investigated. To accomplish these, 3 strains per species were left to develop mixed-culture biofilms on SS coupons, incubated in daily renewable growth medium for a total period of 10 days, under either mono- or dual-species conditions. Each day, biofilm cells were exposed to disinfection treatment. Results revealed that the simultaneous presence of L. monocytogenes strongly increased the resistance of P. putida biofilm cells to BC, while culture conditions (mono-/dual-species) did not seem to significantly influence the resistance of L. monocytogenes biofilm cells. BC mainly killed L. monocytogenes cells when this was applied against the dual-species sessile community during the whole incubation period, despite the fact that from the 2nd day this community was mainly composed (>90%) of P. putida cells. No obvious adaptation to BC was observed in either L. monocytogenes or P. putida biofilm cells. Pulsed field gel electrophoresis (PFGE) analysis showed that the different strains behaved differently with regard to biofilm formation and antimicrobial resistance. Such knowledge on the physiological behavior of mixed-culture biofilms could provide the information necessary to control their formation. PMID:24130873

  3. Differential gene expression profile in Pseudomonas putida NBRIC19-treated wheat (Triticum aestivum) plants subjected to biotic stress of Parthenium hysterophorus.

    PubMed

    Mishra, Sandhya; Srivastava, Suchi; Nautiyal, Chandra Shekhar

    2014-03-01

    The inoculation of Pseudomonas putida NBRIC19 protected wheat plant from phytotoxic effect of Parthenium hysterophorus (Parthenium) and enhanced root length, shoot length, dry weight, spike length and chlorophyll content. With the aim to screen for genes differentially expressed in P. putida NBRIC19-inoculated wheat grown along with Parthenium (WPT), the suppression subtractive hybridization (SSH) methodology was employed. The SSH analysis was performed with WPC (uninoculated wheat grown along with Parthenium) as driver and WPT as tester. The cDNA library, enriched with differentially expressed ESTs (expressed sequence tags), were constructed from WPT. Following an initial screen of 165 ESTs in our library, 32 ESTs were identified, annotated and further validated by semiquantitative RT-PCR. The differentially expressed ESTs were associated with general stress response, defense response, growth and development, metabolic process, photosynthesis, signal transduction, and some other with unknown function. Five ESTs showing downregulation in expression level in response to Parthenium got upregulated due to P. putida NBRIC19 inoculation and further validated by quantitative real time PCR analysis at different time intervals viz. 15, 30, 45 and 90 days. SSH has been implemented for the first time to gain insights into molecular events underlying successful role of P. putida NBRIC19 in providing protection to wheat against Parthenium. The information generated in this study provides new clues to aid the understanding of genes corresponding to differentially expressed ESTs putatively involved in allelopathic interactions. Further characterization and functional analysis of these genes may provide valuable information for future studies of the molecular mechanism by which plants adapt to allelopathic effect of Parthenium.

  4. Catabolism of pseudocumene and 3-ethyltoluene by Pseudomonas putida (arvilla) mt-2: evidence for new functions of the TOL (pWWO) plasmid.

    PubMed Central

    Kunz, D A; Chapman, P J

    1981-01-01

    Pseudocumene (1,2,4-trimethylbenzene) and 3-ethyltoluene were found to serve as growth substrates for Pseudomonas putida (arvilla) mt-2, in addition to toluene, m-xylene, and p-xylene as previously described. Similar observations were made with several additional P. putida strains also capable of growth with toluene and the xylenes. Additional substrates which supported the growth of these organisms included 3,4-dimethylbenzyl alcohol, 3,4-dimethylbenzoate, and 3-ethylbenzoate. P. putida mt-2 cells grown either with toluene or pseudocumene rapidly oxidized toluene, pseudocumene, and 3-ethyltoluene as well as 3,4-dimethylbenzoate, 3-ethylbenzoate, 3,4-dimethylcatechol, and 3-ethylcatechol. Cell extracts from similarly grown P. putida mt-2 cells catalyzed a meta fission of 3,4-dimethylcatechol and 3-ethylcatechol to compounds having the spectral properties of 2-hydroxy-5-methyl-6-oxo-2,4-heptadienoate and 2-hydroxy-6-ox-2,4-octadienoate, respectively. The further metabolism of these intermediates was shown to be independent of oxidized nicotinamide adenine dinucleotide (NAD+) and resulted in the formation of essentially equimolar amounts of pyruvate, indicating that each ring fission product was degraded via the hydrolytic branch of the meta fission pathway. Treatment of cells with N-methyl-N'-nitro-N-nitrosoguanidine led to the isolation of a mutant, which when grown with succinate in the presence of pseudocumene or 3-ethyltoluene accumulated 3,4-dimethylcatechol or 3-ethylcatechol. Cells unable to utilize toluene, m-xylene, and p-xylene, obtained by growth in benzoate, also lost the ability to utilize pseudocumene and 3-ethyltoluene. The ability to utilize these substrates could be reacquired by incubation with a leucine auxotroph otherwise able to grow on all of the aromatic substrates. PMID:7216999

  5. Metabolomics Analysis Reveals the Participation of Efflux Pumps and Ornithine in the Response of Pseudomonas putida DOT-T1E Cells to Challenge with Propranolol.

    PubMed

    Sayqal, Ali; Xu, Yun; Trivedi, Drupad K; AlMasoud, Najla; Ellis, David I; Rattray, Nicholas J W; Goodacre, Royston

    2016-01-01

    Efflux pumps are critically important membrane components that play a crucial role in strain tolerance in Pseudomonas putida to antibiotics and aromatic hydrocarbons that result in these toxicants being expelled from the bacteria. Here, the effect of propranolol on P. putida was examined by sudden addition of 0.2, 0.4 and 0.6 mg mL-1 of this β-blocker to several strains of P. putida, including the wild type DOT-T1E and the efflux pump knockout mutants DOT-T1E-PS28 and DOT-T1E-18. Bacterial viability measurements reveal that the efflux pump TtgABC plays a more important role than the TtgGHI pump in strain tolerance to propranolol. Mid-infrared (MIR) spectroscopy was then used as a rapid, high-throughput screening tool to investigate any phenotypic changes resulting from exposure to varying levels of propranolol. Multivariate statistical analysis of these MIR data revealed gradient trends in resultant ordination scores plots, which were related to the concentration of propranolol. MIR illustrated phenotypic changes associated with the presence of this drug within the cell that could be assigned to significant changes that occurred within the bacterial protein components. To complement this phenotypic fingerprinting approach metabolic profiling was performed using gas chromatography mass spectrometry (GC-MS) to identify metabolites of interest during the growth of bacteria following toxic perturbation with the same concentration levels of propranolol. Metabolic profiling revealed that ornithine, which was only produced by P. putida cells in the presence of propranolol, presents itself as a major metabolic feature that has important functions in propranolol stress tolerance mechanisms within this highly significant and environmentally relevant species of bacteria.

  6. Metabolomics Analysis Reveals the Participation of Efflux Pumps and Ornithine in the Response of Pseudomonas putida DOT-T1E Cells to Challenge with Propranolol

    PubMed Central

    Sayqal, Ali; Xu, Yun; Trivedi, Drupad K.; AlMasoud, Najla; Ellis, David I.; Rattray, Nicholas J. W.; Goodacre, Royston

    2016-01-01

    Efflux pumps are critically important membrane components that play a crucial role in strain tolerance in Pseudomonas putida to antibiotics and aromatic hydrocarbons that result in these toxicants being expelled from the bacteria. Here, the effect of propranolol on P. putida was examined by sudden addition of 0.2, 0.4 and 0.6 mg mL-1 of this β-blocker to several strains of P. putida, including the wild type DOT-T1E and the efflux pump knockout mutants DOT-T1E-PS28 and DOT-T1E-18. Bacterial viability measurements reveal that the efflux pump TtgABC plays a more important role than the TtgGHI pump in strain tolerance to propranolol. Mid-infrared (MIR) spectroscopy was then used as a rapid, high-throughput screening tool to investigate any phenotypic changes resulting from exposure to varying levels of propranolol. Multivariate statistical analysis of these MIR data revealed gradient trends in resultant ordination scores plots, which were related to the concentration of propranolol. MIR illustrated phenotypic changes associated with the presence of this drug within the cell that could be assigned to significant changes that occurred within the bacterial protein components. To complement this phenotypic fingerprinting approach metabolic profiling was performed using gas chromatography mass spectrometry (GC-MS) to identify metabolites of interest during the growth of bacteria following toxic perturbation with the same concentration levels of propranolol. Metabolic profiling revealed that ornithine, which was only produced by P. putida cells in the presence of propranolol, presents itself as a major metabolic feature that has important functions in propranolol stress tolerance mechanisms within this highly significant and environmentally relevant species of bacteria. PMID:27331395

  7. Elucidation of the flavonoid catabolism pathway in Pseudomonas putida PML2 by comparative metabolic profiling.

    PubMed

    Pillai, Bhinu V S; Swarup, Sanjay

    2002-01-01

    Flavonoids are 15-carbon plant secondary metabolites exuded in the rhizosphere that hosts several flavonoid-degrading bacteria. We studied flavonoid catabolism in a plant growth-promoting rhizobacterial strain of Pseudomonas by using a combination of biochemical and genetic approaches. Transposants carrying mini-Tn5gfp insertions were screened for flavonoid auxotrophy, and these mutant strains were found to be unable to grow in the flavonols naringenin and quercetin, while their growth in glycerol was comparable to that of the parental strain. In order to understand flavonoid catabolism, culture supernatants, whole-cell fractions, cell lysate, and cell debris of the wild-type and mutant strains were analyzed. Intermediates that accumulated intracellularly and those secreted in the medium were identified by a combination of reversed-phase high-pressure liquid chromatography and electrospray ionization-mass spectrometry. Structures of four key intermediates were confirmed by one-dimensional nuclear magnetic resonance spectroscopy. Comparative metabolic profiling of the compounds in the wild-type and mutant strains allowed us to understand the degradation events and to identify six metabolic intermediates. The first step in the pathway involves 3,3'-didehydroxylation, followed by hydrolysis and cleavage of the C-ring, leading via subsequent oxidations to the formation of protocatechuate. This is the first report on quercetin dehydroxylation in aerobic conditions leading to naringenin accumulation.

  8. Gene cloning, expression, and substrate specificity of an imidase from the strain Pseudomonas putida YZ-26.

    PubMed

    Shi, Ya-wei; Cui, Li-fang; Yuan, Jing-ming

    2007-07-01

    A gene-encoding imidase was isolated from Pseudomonas putdia YZ-26 genomic DNA using a combination of polymerase chain reaction and activity screening the recombinant. Analysis of the nucleotide sequence revealed that an open reading frame (ORF) of 879 bp encoded a protein of 293 amino acids with a calculated molecular weight of 33712.6 kDa. The deduced amino-acid sequence showed 78% identity with the imidase from Alcaligenes eutrophus 112R4 and 80% identity with N-terminal 20 amino-acid imidase from Blastobacter sp. A17p-4. Next, the ORF was subcloned into vector pET32a to form recombinant plasmid pEI. The enzyme was overexpressed in Escherichia coli and purified to homogeneity by Ni(2+)-NTA column, with 75% activity recovery. The subunit molecular mass of the recombinant imidase as estimated by sodium dodecyl sulfate-polyacrylamide gel electrophoresis was approximately 36 kDa, whereas its functional unit was approximately 141 kDa with four identical subunits determined by size-exclusion chromatography. The purified enzyme showed the highest activity and affinity toward succinimide, and some other substrates, such as dihydrouracil, hydantoin, succinimide, and maleimde, were investigated.

  9. Microbial degradation of the morphine alkaloids: identification of morphine as an intermediate in the metabolism of morphine by Pseudomonas putida M10.

    PubMed

    Bruce, N C; Wilmot, C J; Jordan, K N; Trebilcock, A E; Gray Stephens, L D; Lowe, C R

    1990-01-01

    A strain of Pseudomonas putida was isolated by selective enrichment with morphine that was capable of utilising morphine as a primary source of carbon and energy for growth. Experiments with whole cells showed that both morphine and codeine, but not thebaine, could be utilised. A novel NADP-dependent dehydrogenase, morphine dehydrogenase, was purified from crude cell extracts and was shown to be capable of oxidising morphine and codeine to morphinone and codeinone, respectively. This NADP-dependent morphine dehydrogenase was not observed in any other species of pseudomonads examined and was quite distinct from the beta-hydroxysteroid dehydrogenase found in Pseudomonas testosteroni, which had previously been shown to have activity against morphine.

  10. Direct determination of p-nitrophenyl substituent organophosphorus nerve agents using a recombinant Pseudomonas putida JS444-modified Clark oxygen electrode.

    PubMed

    Lei, Yu; Mulchandani, Priti; Chen, Wilfred; Mulchandani, Ashok

    2005-02-09

    A microbial biosensor for rapid, sensitive, selective, and cost-effective determination of the total content of organophosphorus nerve agents with p-nitrophenyl substituent is reported. The biosensor consisted of genetically engineered PNP-degrader Pseudomonas putida JS444 expressing organophosphorus hydrolase (OPH) on its cell surface immobilized on a dissolved oxygen electrode. Surface-expressed OPH catalyzed the hydrolysis of organophosphorus pesticides with p-nitrophenyl substituent such as paraoxon, methyl parathion, and parathion to release p-nitrophenol that was oxidized by the enzymatic machinery of Pseudomonas putida JS444 to carbon dioxide while consuming oxygen. The oxygen consumption was measured and correlated to the concentration of organophosphates. The sensor signal and response time were optimized with 0.086 mg dry weight of cell and operating in 50 mM pH 7.5 citrate-phosphate buffer with 50 microM CoCl(2) at room temperature. When operated at optimized conditions, the biosensor measured as low as 55 ppb of paraoxon, 53 ppb of methyl parathion, and 58 ppb of parathion without interference from most phenolic compounds and other commonly used pesticides, such as atrazine, coumaphos, sutan, sevin, and diazinon. The operational life of the microbial biosensor was approximately 5 days when stored in the operating buffer at 4 degrees C.

  11. Biosensor for Direct Determination of Fenitrothion and EPN Using Recombinant Pseudomonas putida JS444 with Surface Expressed Organophosphorus Hydrolase. 1. Modified Clark Oxygen Electrode

    PubMed Central

    Lei, Yu; Mulchandani, Priti; Chen, Wilfred; Mulchandani, Ashok

    2006-01-01

    This paper reports a first microbial biosensor for rapid and cost-effective determination of organophosphorus pesticides fenitrothion and EPN. The biosensor consisted of recombinant PNP-degrading/oxidizing bacteria Pseudomonas putida JS444 anchoring and displaying organophosphorus hydrolase (OPH) on its cell surface as biological sensing element and a dissolved oxygen electrode as the transducer. Surface-expressed OPH catalyzed the hydrolysis of fenitrothion and EPN to release 3-methyl-4-nitrophenol and p-nitrophenol, respectively, which were oxidized by the enzymatic machinery of Pseudomonas putida JS444 to carbon dioxide while consuming oxygen, which was measured and correlated to the concentration of organophosphates. Under the optimum operating conditions, the biosensor was able to measure as low as 277 ppb of fenitrothion and 1.6 ppm of EPN without interference from phenolic compounds and other commonly used pesticides such as carbamate pesticides, triazine herbicides and organophosphate pesticides without nitrophenyl substituent. The applicability of the biosensor to lake water was also demonstrated.

  12. Pb(II) Reactivity in Laboratory Cultures of a Pseudomonas putida MnB1 - Mn(IV) Oxide Ensemble

    NASA Astrophysics Data System (ADS)

    Villalobos, M.; Toner, B.; Bargar, J.; Sposito, G.

    2002-12-01

    Mn(II) oxidation is a widespread biological process in natural aqueous settings. The products are layered Mn(IV) oxide solids that are very reactive due to their high surface areas, negative charges, and reduction potentials. High affinities for heavy metal sorption have been reported for layer Mn(IV) oxides, and preferential associations in contaminated settings have been found between the Mn-oxide fraction and certain trace metals, including Pb(II). The present study investigates the nature of the interaction of Pb(II) with a layer Mn oxide produced by the soil and freshwater bacterial species Pseudomonas putida MnB1 in the laboratory. Wet chemical and X-ray absorption spectroscopy (XAS) techniques were used to elucidate the nature and structure of the sorbed complex in the biogenic Mn(IV) oxide and synthetic analogs. The oxide formed in laboratory culture media appears to be in close physical contact with bacterial cell/biofilm aggregates. In the absence of Mn oxides, Pb(II) was found to associate with organic groups in the biological system, but it preferentially binds to the oxide if present. However, under low ionic strength pretreatment of the ensemble, Pb(II) did not bind to the Mn oxide but was found associated to phosphate or to organic groups depending on equilibration conditions. The complex on the Mn oxide, regardless of loading, is an inner-sphere tridentate complex formed at interlayer positions over vacant sites, with average Pb-O distances of 2.3 Å, a Mn second shell with a Pb-Mn distance of 3.7 Å, and a detectable third shell with a Pb-Mn distance of 5.6 Å. Incorporation of Pb(II) at interlayer positions explains the extremely high sorption capacity of the biogenic oxide and its synthetic analogs. The efficiency of Pb(II) sequestration and the ubiquity of bacterial Mn(II)-oxidation suggest that this mode of sequestration could be a major sink/source for Pb(II) in soil solutions.

  13. Salvage of long-term central venous catheters during an outbreak of Pseudomonas putida and Stenotrophomonas maltophilia infections associated with contaminated heparin catheter-lock solution.

    PubMed

    Souza Dias, M Beatriz; Habert, Alina Bernardes; Borrasca, Vera; Stempliuk, Valeska; Ciolli, Aina; Araújo, M Rita E; Costa, Silvia F; Levin, Anna S

    2008-02-01

    To describe the management of patients with long-term central venous catheters (CVCs) during an outbreak of infection due to Pseudomonas putida and Stenotrophomonas maltophilia associated with contaminated heparin catheter-lock solution. Descriptive study. Private, 250-bed tertiary-care hospital. In March 2003, we identified 2 febrile cancer patients with P. putida bacteremia. Over 2 days, 7 cases of bacteremia were identified; lots of syringes prefilled with heparin catheter-lock solution, supplied by a compounding pharmacy, were recalled and samples were cultured. More cases of bacteremia appeared during the following days, and any patient who had had a catheter lock infused with the suspect solution was asked to provide blood samples for culture, even if the patient was asymptomatic. Isolates that were recovered from culture were typed by pulsed-field gel electrophoresis. Antimicrobial salvage treatment of long-term CVCs was attempted. A total of 154 patients had had their catheter lock infused with solution from the lots that were suspected of being contaminated. Only 48 of these patients had CVCs. By day 7 of the outbreak, 18 of these patients had become symptomatic. Twenty-six of the remaining 30 asymptomatic patients then also provided blood samples for culture, 10 of whom developed fever shortly after samples were collected. Thirty-two patients were identified who had P. putida bacteremia; 9 also had infection due to S. maltophilia. Samples from 1 of the 3 lots of prefilled syringes in use at the time of the outbreak also grew P. putida on culture. Molecular typing identified 3 different clones of P. putida from patients and heparin catheter-lock solution, and 1 clone of S. maltophilia. A total of 27 patients received antimicrobial therapy regimens, some of which included decontamination of the catheter lock with anti-infective lock solution. Of 27 patients, 19 (70%) retained their long-term CVC during the 6-month follow-up period. To our knowledge, this is

  14. Alginate production by Pseudomonas putida creates a hydrated microenvironment and contributes to biofilm architecture and stress tolerance under water-limiting conditions.

    PubMed

    Chang, Woo-Suk; van de Mortel, Martijn; Nielsen, Lindsey; Nino de Guzman, Gabriela; Li, Xiaohong; Halverson, Larry J

    2007-11-01

    Biofilms exist in a variety of habitats that are routinely or periodically not saturated with water, and residents must integrate cues on water abundance (matric stress) or osmolarity (solute stress) into lifestyle strategies. Here we examine this hypothesis by assessing the extent to which alginate production by Pseudomonas putida strain mt-2 and by other fluorescent pseudomonads occurs in response to water limitations and how the presence of alginate in turn influences biofilm development and stress tolerance. Total exopolysaccharide (EPS) and alginate production increased with increasing matric, but not solute, stress severity, and alginate was a significant component, but not the major component, of EPS. Alginate influenced biofilm architecture, resulting in biofilms that were taller, covered less surface area, and had a thicker EPS layer at the air interface than those formed by an mt-2 algD mutant under water-limiting conditions, properties that could contribute to less evaporative water loss. We examined this possibility and show that alginate reduces the extent of water loss from biofilm residents by using a biosensor to quantify the water potential of individual cells and by measuring the extent of dehydration-mediated changes in fatty acid composition following a matric or solute stress shock. Alginate deficiency decreased survival of desiccation not only by P. putida but also by Pseudomonas aeruginosa PAO1 and Pseudomonas syringae pv. syringae B728a. Our findings suggest that in response to water-limiting conditions, pseudomonads produce alginate, which influences biofilm development and EPS physiochemical properties. Collectively these responses may facilitate the maintenance of a hydrated microenvironment, protecting residents from desiccation stress and increasing survival.

  15. Effect of complexing ligands on the surface adsorption, internalization, and bioresponse of copper and cadmium in a soil bacterium, Pseudomonas putida.

    PubMed

    McLean, Joan E; Pabst, Mindy W; Miller, Charles D; Dimkpa, Christian O; Anderson, Anne J

    2013-04-01

    Environmental quality criteria for metals toxic to soil and water organisms, using the free ion activity model or the biotic ligand model, are based on the concept that the major form of the metal available to the organism is the free metal ion, yet various metal complexes are bioavailable to a variety of soil and water organisms. We test here whether neutral copper or cadmium sulfates, negatively-charged copper or cadmium citrates and positively-charged copper acetate and cadmium chloride are bioavailable to a soil bacterium, Pseudomonas putida. Adsorption onto the cell surface and uptake into the periplasm and cytoplasm of this Gram-negative root colonizing bacterium was studied by adding a single concentration of Cu or Cd and varying the concentration of the ligands to complex 10-100% of the metal. Metal association from the complexes on and within the cell was defined using selective extraction procedures and compared with free ion controls using the Langmuir isotherm. Cellular responses also were assessed using a P. putida biosensor. Both uptake and bioresponse methodologies showed that P. putida was sensitive to the metal complexes. In particular, the bioresponse to Cu and Cd supplied as a citrate complex occurred with activities of free metal ions two orders of magnitude lower than for the control. We concluded that the tested metal complexes for Cu and Cd are taken up into the cell, where they trigger a bioresponse. We also discuss the implications of these findings on interactions between soil and water organisms and nanoparticles that release metal ions. Copyright © 2012 Elsevier Ltd. All rights reserved.

  16. Pseudomonas putida NCTC 10936 balances membrane fluidity in response to physical and chemical stress by changing the saturation degree and the trans/cis ratio of fatty acids.

    PubMed

    Loffhagen, Norbert; Härtig, Claus; Babel, Wolfgang

    2004-02-01

    This study explored the capability of Pseudomonas putida NCTC 10936 to maintain homeoviscosity after changing the growth temperature, incubating resting cells at differ