PslG, a self-produced glycosyl hydrolase, triggers biofilm disassembly by disrupting exopolysaccharide matrix.

PubMed

Yu, Shan; Su, Tiantian; Wu, Huijun; Liu, Shiheng; Wang, Di; Zhao, Tianhu; Jin, Zengjun; Du, Wenbin; Zhu, Mei-Jun; Chua, Song Lin; Yang, Liang; Zhu, Deyu; Gu, Lichuan; Ma, Luyan Z

2015-12-01

Biofilms are surface-associated communities of microorganism embedded in extracellular matrix. Exopolysaccharide is a critical component in the extracellular matrix that maintains biofilm architecture and protects resident biofilm bacteria from antimicrobials and host immune attack. However, self-produced factors that target the matrix exopolysaccharides, are still poorly understood. Here, we show that PslG, a protein involved in the synthesis of a key biofilm matrix exopolysaccharide Psl in Pseudomonas aeruginosa, prevents biofilm formation and disassembles existing biofilms within minutes at nanomolar concentrations when supplied exogenously. The crystal structure of PslG indicates the typical features of an endoglycosidase. PslG mainly disrupts the Psl matrix to disperse bacteria from biofilms. PslG treatment markedly enhances biofilm sensitivity to antibiotics and macrophage cells, resulting in improved biofilm clearance in a mouse implant infection model. Furthermore, PslG shows biofilm inhibition and disassembly activity against a wide range of Pseudomonas species, indicating its great potential in combating biofilm-related complications.

USSR and Eastern Europe Scientific Abstracts, Engineering and Equipment. No. 24

DTIC Science & Technology

1976-10-18

of ribbed cylindrical envelopes with rectangular apertures. 2/2 N USSR UDC 629.78.023.015.4 IVCHENKO, YE. V., MAKEYEV , YE. M. THE STRENGTH OF A...cylindrical envelope is a semizero-moment 1/2 . 203 USSR IVCHENKO, YE. V., MAKEYEV , YE. M., VSES KONF AVTOMATIZ ISSLED NESUSHCHEY SPOSOBIOSTI I...USSR UDC 629.78.002.3.015.4 MAKEYEV , A. I., FOMICHEV, P. A., TRISHINA, L. A., KORUNA, G. S. THE PROBLEM OF NONLINEAR ADDITION OF FATIGUE DAMAGE VSES

A de novo designed 11 kDa polypeptide: model for amyloidogenic intrinsically disordered proteins.

PubMed

Topilina, Natalya I; Ermolenkov, Vladimir V; Sikirzhytski, Vitali; Higashiya, Seiichiro; Lednev, Igor K; Welch, John T

2010-07-01

A de novo polypeptide GH(6)[(GA)(3)GY(GA)(3)GE](8)GAH(6) (YE8) has a significant number of identical weakly interacting beta-strands with the turns and termini functionalized by charged amino acids to control polypeptide folding and aggregation. YE8 exists in a soluble, disordered form at neutral pH but is responsive to changes in pH and ionic strength. The evolution of YE8 secondary structure has been successfully quantified during all stages of polypeptide fibrillation by deep UV resonance Raman (DUVRR) spectroscopy combined with other morphological, structural, spectral, and tinctorial characterization. The YE8 folding kinetics at pH 3.5 are strongly dependent on polypeptide concentration with a lag phase that can be eliminated by seeding with a solution of folded fibrillar YE8. The lag phase of polypeptide folding is concentration dependent leading to the conclusion that beta-sheet folding of the 11-kDa amyloidogenic polypeptide is completely aggregation driven.

Histone Acetylation in Microglia Contributes to Exercise-Induced Hypoalgesia in Neuropathic Pain Model Mice.

PubMed

Kami, Katsuya; Taguchi, Satoru; Tajima, Fumihiro; Senba, Emiko

2016-05-01

Physical exercise can attenuate neuropathic pain (NPP), but the exact mechanism underlying exercise-induced hypoalgesia (EIH) remains unclear. Recent studies have shown that histone hyperacetylation via pharmacological inhibition of histone deacetylases in the spinal cord attenuates NPP, and that histone acetylation may lead to the production of analgesic factors including interleukin 10. We intended to clarify whether histone acetylation in microglia in the spinal dorsal horn contributes to EIH in NPP model mice. C57BL/6J mice underwent partial sciatic nerve ligation (PSL) and PSL- and sham-runner mice ran on a treadmill at a speed of 7 m/min for 60 min/d, 5 days per week, from 2 days after the surgery. PSL-sedentary mice developed mechanical allodynia and heat hyperalgesia, but such behaviors were significantly attenuated in PSL-runner mice. In immunofluorescence analysis, PSL surgery markedly increased the number of histone deacetylase 1-positive/CD11b-positive microglia in the ipsilateral superficial dorsal horn, and they were significantly decreased by treadmill-running. Moreover, the number of microglia with nuclear expression of acetylated H3K9 in the ipsilateral superficial dorsal horn was maintained at low levels in PSL-sedentary mice, but running exercise significantly increased them. Therefore, we conclude that the epigenetic modification that causes hyperacetylation of H3K9 in activated microglia may play a role in producing EIH. This article presents the importance of epigenetic modification in microglia in producing EIH. The current research is not only helpful for developing novel nonpharmacological therapy for NPP, but will also enhance our understanding of the mechanisms and availability of exercise in our daily life. Copyright © 2016 American Pain Society. Published by Elsevier Inc. All rights reserved.

Improvement in platelet count after 3rd-line and 4th-line eradication therapy for Helicobacter pylori in patients with immune thrombocytopenia.

PubMed

Jomen, Wataru; Sato, Takashi; Maesawa, Chihaya

2017-01-01

Case 1: A 78-year-old woman was diagnosed with H. pylori positive gastritis at a previous hospital in April 2012 and received 3rd-line H. pylori eradication therapy, which ended in failure. She was referred to our department due to oral hemorrhage, petechiae involving all four extremities, and thrombocytopenia in January 2016. She was hospitalized with a diagnosis of ITP and received inpatient treatment. While receiving outpatient prednisolone (PSL) treatment, we administered 4th-line eradication therapy in March. Her platelet levels have since returned to normal, and PSL treatment has been discontinued. She is currently followed without treatment. Case 2: A 65-year-old woman was diagnosed with ITP at a previous hospital in June 2013 and received 2nd-line eradication therapy, which ended in failure. Thereafter, PSL treatment was continued but she was later referred to our department in March 2016. Since 3rd-line eradication therapy was successful, her platelet count normalized and PSL treatment has been discontinued. She is currently followed without treatment. Based on our observations in these two cases, third-line H. pylori eradication therapy is potentially effective in ITP patients.

Development of Long-Circulating pH-Sensitive Liposomes to Circumvent Gemcitabine Resistance in Pancreatic Cancer Cells.

PubMed

Xu, Hongtao; Paxton, James W; Wu, Zimei

2016-07-01

To develop pH-sensitive liposomes (PSL) containing a high content of gemcitabine; and to investigate whether drug loading (DL) would alter the in vitro and pharmacokinetic properties. PSL with a high DL were obtained using a modified small-volume incubation method. The DL effects on drug release rate and in vitro cytotoxicity of PSL were evaluated using MIA PaCa-2 pancreatic cancer cells and their pharmacokinetics investigated in rats. The highest DL of 4.5 ± 0.1% was achieved for gemcitabine in PSL with 145 ± 5 nm diameter. DL did not alter the in vitro release rate from PSL. The IC50 (48 h) of PSL (DL 0.5 and 4.5%) and non pH-sensitive liposomes (NPSL, DL 4.2%) were 1.1 ± 0.1, 0.7 ± 0.1 and 37.0 ± 7.5 μM, respectively. The PSL resulted in a 4.2-fold increase in its elimination half-life (6.2 h) compared to gemcitabine solution (1.4 h) in rats. No significant difference in pharmacokinetic parameters was observed between the two PSL (DL 0.5 and 4.5%). The PSL offered advantages over NPSL in restoring the sensitivity of pancreatic cancer cells to gemcitabine without requiring a high DL. DL in the PSL did not alter release rate, cytotoxicity or their long-circulating properties. Graphical Abstract ᅟ.

The Pseudomonas aeruginosa exopolysaccharide Psl facilitates surface adherence and NF-kappaB activation in A549 cells.

PubMed

Byrd, Matthew S; Pang, Bing; Mishra, Meenu; Swords, W Edward; Wozniak, Daniel J

2010-06-29

In order for the opportunistic Gram-negative pathogen Pseudomonas aeruginosa to cause an airway infection, the pathogen interacts with epithelial cells and the overlying mucous layer. We examined the contribution of the biofilm polysaccharide Psl to epithelial cell adherence and the impact of Psl on proinflammatory signaling by flagellin. Psl has been implicated in the initial attachment of P. aeruginosa to biotic and abiotic surfaces, but its direct role in pathogenesis has not been evaluated (L. Ma, K. D. Jackson, R. M. Landry, M. R. Parsek, and D. J. Wozniak, J. Bacteriol. 188:8213-8221, 2006). Using an NF-kappaB luciferase reporter system in the human epithelial cell line A549, we show that both Psl and flagellin are necessary for full activation of NF-kappaB and production of the interleukin 8 (IL-8) chemokine. We demonstrate that Psl does not directly stimulate NF-kappaB activity, but indirectly as a result of increasing contact between bacterial cells and epithelial cells, it facilitates flagellin-mediated proinflammatory signaling. We confirm differential adherence of Psl and/or flagellin mutants by scanning electron microscopy and identify Psl-dependent membrane structures that may participate in adherence. Although we hypothesized that Psl would protect P. aeruginosa from recognition by the epithelial cell line A549, we instead observed a positive role for Psl in flagellin-mediated NF-kappaB activation, likely as a result of increasing contact between bacterial cells and epithelial cells.

The Pseudomonas aeruginosa Exopolysaccharide Psl Facilitates Surface Adherence and NF-κB Activation in A549 Cells

PubMed Central

Byrd, Matthew S.; Pang, Bing; Mishra, Meenu; Swords, W. Edward; Wozniak, Daniel J.

2010-01-01

In order for the opportunistic Gram-negative pathogen Pseudomonas aeruginosa to cause an airway infection, the pathogen interacts with epithelial cells and the overlying mucous layer. We examined the contribution of the biofilm polysaccharide Psl to epithelial cell adherence and the impact of Psl on proinflammatory signaling by flagellin. Psl has been implicated in the initial attachment of P. aeruginosa to biotic and abiotic surfaces, but its direct role in pathogenesis has not been evaluated (L. Ma, K. D. Jackson, R. M. Landry, M. R. Parsek, and D. J. Wozniak, J. Bacteriol. 188:8213–8221, 2006). Using an NF-κB luciferase reporter system in the human epithelial cell line A549, we show that both Psl and flagellin are necessary for full activation of NF-κB and production of the interleukin 8 (IL-8) chemokine. We demonstrate that Psl does not directly stimulate NF-κB activity, but indirectly as a result of increasing contact between bacterial cells and epithelial cells, it facilitates flagellin-mediated proinflammatory signaling. We confirm differential adherence of Psl and/or flagellin mutants by scanning electron microscopy and identify Psl-dependent membrane structures that may participate in adherence. Although we hypothesized that Psl would protect P. aeruginosa from recognition by the epithelial cell line A549, we instead observed a positive role for Psl in flagellin-mediated NF-κB activation, likely as a result of increasing contact between bacterial cells and epithelial cells. PMID:20802825

A Survival Strategy for Pseudomonas aeruginosa That Uses Exopolysaccharides To Sequester and Store Iron To Stimulate Psl-Dependent Biofilm Formation

PubMed Central

Yu, Shan; Wei, Qing; Zhao, Tianhu; Guo, Yuan

2016-01-01

ABSTRACT Exopolysaccharide Psl is a critical biofilm matrix component in Pseudomonas aeruginosa, which forms a fiber-like matrix to enmesh bacterial communities. Iron is important for P. aeruginosa biofilm development, yet it is not clearly understood how iron contributes to biofilm development. Here, we showed that iron promoted biofilm formation via elevating Psl production in P. aeruginosa. The high level of iron stimulated the synthesis of Psl by reducing rhamnolipid biosynthesis and inhibiting the expression of AmrZ, a repressor of psl genes. Iron-stimulated Psl biosynthesis and biofilm formation held true in mucoid P. aeruginosa strains. Subsequent experiments indicated that iron bound with Psl in vitro and in biofilms, which suggested that Psl fibers functioned as an iron storage channel in P. aeruginosa biofilms. Moreover, among three matrix exopolysaccharides of P. aeruginosa, Psl is the only exopolysaccharide that can bind with both ferrous and ferric ion, yet with higher affinity for ferrous iron. Our data suggest a survival strategy of P. aeruginosa that uses exopolysaccharide to sequester and store iron to stimulate Psl-dependent biofilm formation. IMPORTANCE Pseudomonas aeruginosa is an environmental microorganism which is also an opportunistic pathogen that can cause severe infections in immunocompromised individuals. It is the predominant airway pathogen causing morbidity and mortality in individuals affected by the genetic disease cystic fibrosis (CF). Increased airway iron and biofilm formation have been proposed to be the potential factors involved in the persistence of P. aeruginosa in CF patients. Here, we showed that a high level of iron enhanced the production of the key biofilm matrix exopolysaccharide Psl to stimulate Psl-dependent biofilm formation. Our results not only make the link between biofilm formation and iron concentration in CF, but also could guide the administration or use of iron chelators to interfere with biofilm formation in P. aeruginosa in CF patients. Furthermore, our data also imply a survival strategy of P. aeruginosa under high-iron environmental conditions. PMID:27565622

A Lectin Purified from Blood Red Bracket Mushroom, Pycnoporus sanguineus (Agaricomycetidae), Mycelium Displayed Affinity Toward Bovine Transferrin.

PubMed

Albores, Silvana; Moros, Maria; Cerdeiras, Maria Pia; de la Fuente, Jesus Martinez; Grazu, Valeria; Fraguas, Laura Franco

2016-01-01

Fungal lectins constitute excellent ligands for development of affinity adsorbents useful in affinity chromatography. In this work, a lectin was purified from Pycnoporus sanguineus (PSL) mycelium using 3 procedures: by affinity chromatography, using magnetic galactosyl-nanoparticles or galactose coupled to Sepharose, and by ionic exchange chromatography (IEC). The highest lectin yield was achieved by IEC (55%); SDS-PAGE of PSL showed 2 bands with molecular mass of 68.7 and 55.2 kDa and IEC displayed 2 bands at pi 5.5 and 5.2. The lectin agglutinates rat erythrocytes, exhibiting broad specificity toward several monosaccharides, including galactose. The agglutination was also inhibited by the glycoproteins fetal calf fetuin, bovine lactoferrin, bovine transferrin, and horseradish peroxidase. The lectin was then used to synthesize an affinity adsorbent (PSL-Sepharose) and the interaction with glycoproteins was evaluated by analyzing their chromatographic behaviors. The strongest interaction with the PSL-derivative was observed with transferrin, although lower interactions were also displayed toward fetuin and lactoferrin. These results indicate that the purified PSL constitutes an interesting ligand for the design of affinity adsorbents to be used (i.e., in glycoprotein purification).

Energy absorption of impacts during running at various stride lengths.

PubMed

Derrick, T R; Hamill, J; Caldwell, G E

1998-01-01

The foot-ground impact experienced during running produces a shock wave that is transmitted through the human skeletal system. This shock wave is attenuated by deformation of the ground/shoe as well as deformation of biological tissues in the body. The goal of this study was to investigate the locus of energy absorption during the impact phase of the running cycle. Running speed (3.83 m x s[-1]) was kept constant across five stride length conditions: preferred stride length (PSL), +10% of PSL, -10% of PSL, +20% of PSL, and -20% of PSL. Transfer functions were generated from accelerometers attached to the leg and head of ten male runners. A rigid body model was used to estimate the net energy absorbed at the hip, knee, and ankle joints. There was an increasing degree of shock attenuation as stride length increased. The energy absorbed during the impact portion of the running cycle also increased with stride length. Muscles that cross the knee joint showed the greatest adjustment in response to increased shock. It was postulated that the increased perpendicular distance from the line of action of the resultant ground reaction force to the knee joint center played a role in this increased energy absorption.

The roles of biofilm matrix polysaccharide Psl in mucoid Pseudomonas aeruginosa biofilms.

PubMed

Ma, Luyan; Wang, Shiwei; Wang, Di; Parsek, Matthew R; Wozniak, Daniel J

2012-07-01

The opportunistic pathogen Pseudomonas aeruginosa causes life-threatening, persistent infections in patients with cystic fibrosis (CF). Persistence is attributed to the ability of these bacteria to form structured communities (biofilms). Biofilms rely on an extracellular polymeric substances matrix to maintain structure. Psl exopolysaccharide is a key matrix component of nonmucoid biofilms, yet the role of Psl in mucoid biofilms is unknown. In this report, using a variety of mutants in a mucoid P. aeruginosa background, we found that deletion of Psl-encoding genes dramatically decreased their biofilm formation ability, indicating that Psl is also a critical matrix component of mucoid biofilms. Our data also suggest that the overproduction of alginate leads to mucoid biofilms, which occupy more space, whereas Psl-dependent biofilms are densely packed. These data suggest that Psl polysaccharide may have significant contributions in biofilm persistence in patients with CF and may be helpful for designing therapies for P. aeruginosa CF infection. © 2012 Federation of European Microbiological Societies. Published by Blackwell Publishing Ltd. All rights reserved.

Surface modification of silicon wafer by grafting zwitterionic polymers to improve its antifouling property

NASA Astrophysics Data System (ADS)

Sun, Yunlong; Chen, Changlin; Xu, Heng; Lei, Kun; Xu, Guanzhe; Zhao, Li; Lang, Meidong

2017-10-01

Silicon (111) wafer was modified by triethoxyvinylsilane containing double bond as an intermedium, and then P4VP (polymer 4-vinyl pyridine) brush was "grafted" onto the surface of silicon wafer containing reactive double bonds by adopting the "grafting from" way and Si-P4VP substrate (silicon wafer grafted by P4VP) was obtained. Finally, P4VP brush of Si-P4VP substrate was modified by 1,3-propanesulfonate fully to obtain P4VP-psl brush (zwitterionic polypyridinium salt) and the functional Si-P4VP-psl substrate (silicon wafer grafted by zwitterionic polypyridinium salt based on polymer 4-vinyl pyridine) was obtained successfully. The antifouling property of the silicon wafer, the Si-P4VP substrate and the Si-P4VP-psl substrate was investigated by using bovine serum albumin, mononuclear macrophages (RAW 264.7) and Escherichia coli (E. coli) ATTC25922 as model bacterium. The results showed that compared with the blank sample-silicon wafer, the Si-P4VP-psl substrate had excellent anti-adhesion ability against bovine serum albumin, cells and bacterium, due to zwitterionic P4VP-psl brush (polymer 4-vinyl pyridine salt) having special functionality like antifouling ability on biomaterial field.

Fate of Yersinia enterocolitica during manufacture, ripening and storage of Lighvan cheese.

PubMed

Hanifian, Shahram; Khani, Sajjad

2012-05-15

This study aimed to evaluate the behavior of virulent Yersinia enterocolitica (YE) during the manufacture, ripening and storage of Lighvan cheese with particular reference to strains of YE, initial inoculation level, and storage time. Three strains of YE with low (1 log cfu/ml) and high (3 log cfu/ml) inoculation levels were inoculated to raw whole ewe's milk which was then used for manufacturing of Lighvan cheese. Throughout the manufacturing, ripening and storage periods the number of YE was counted on selective media. Enumerated colonies were then confirmed by duplex PCR using ail and virF genes. Moreover, some microbial and physiochemical characteristics of the cheese samples were examined. According to the results, initial inoculation level and storage time had statistically significant (P<0.01) effects on persistency of YE, while strain type exhibited no statistically significant (P>0.01) impact on survival of the pathogen. Results showed a rapid increase in the number of YE during manufacturing, however, in the ripening and storage periods the number of YE was decreased and eventually it was eliminated in all cheese batches after 4 months of storage. Copyright © 2012 Elsevier B.V. All rights reserved.

Physical Sciences Laboratory 1 Rooftop Stack Mixing Study

DOE Office of Scientific and Technical Information (OSTI.GOV)

Flaherty, Julia E.; Antonio, Ernest J.

To address concerns about worker exposures on the Physical Science Laboratory (PSL) rooftop, a tracer study was conducted to measure gaseous tracer concentrations downwind of six stacks on the southern half of the PSL building (PSL-1). These concerns were raised, in part, due to the non-standard configuration of the stacks on this building. Five of the six stacks were only about 8 feet tall, with one shorter stack that was essentially level with the roof deck. These stacks were reconfigured in August 2016, and these exhaust points on PSL-1 are now 18 feet tall. This report describes the objectives ofmore » the tracer tests performed on PSL-1, provides an overview of how the tests were executed, and presents results of the tests. The tests on the PSL rooftop were a follow-on project from a similar study performed on the LSL-II ventilation exhaust (Flaherty and Antonio, 2016).« less

Potential Economic Benefits of Paid Sick Leave in Reducing Absenteeism Related to the Spread of Influenza-Like Illness.

PubMed

Asfaw, Abay; Rosa, Roger; Pana-Cryan, Regina

2017-09-01

Most U.S. employers are not required to provide paid sick leave (PSL), and there is limited information on the economic return of providing PSL. We estimated potential benefits to employers of PSL in reducing absenteeism related to the spread of influenza-like illness (ILI). We used nationally representative data and a negative binomial random effects model to estimate the impact of PSL in reducing overall absence due to illness or injury. We used published data to compute the share of ILI from the total days of absence, ILI transmission rates at workplaces, wages, and other parameters. Providing PSL could have saved employers $0.63 to $1.88 billion in reduced ILI-related absenteeism costs per year during 2007 to 2014 in 2016 dollars. These findings might help employers consider PSL as an investment rather than as a cost without any return.

[SNACK HIGH WHEY PROTEIN IMPROVES THE LEVEL OF SATIETY AND REDUCES APPETITE HEALTHY WOMEN].

PubMed

Reyna, Nadia; Moreno-Rojas, Rafael; Mendoza, Laura; Urdaneta, Andrés; Artigas, Carlos; Reyna, Eduardo; Cámara Martos, Fernando

2015-10-01

the nutritional content and energy density of foods is related to greater control of appetite, satiety and reducing food intake. the randomized crossover study included 20 healthy women, aged 20 and 30 years with a BMI of 20 to 24.9 kg/m2 and who completed that included 3 day trial comparing 8 hours 130 kcal snacks consumed afternoon: yoghurt with added whey protein (PSL), biscuits and chocolate. Participants consumed a standardized menu; snack was consumed 3 hours after lunch. Perceived hunger and fullness were evaluated during the afternoon until dinner voluntary intake ad libitum. They repeat the same snack 3 times. consumption of yogurt with PSL led to a further reduction of appetite in the afternoon in front of the snack of chocolate and biscuits (p < 0.001). No differences of appetite in the afternoon between chocolate vs cookies but significant difference between yogurt with PSL and other treatments (p < 0.001) were detected. At snack, yogurt there was a significant reduction in caloric intake compared to other snacks (p < 0.001) and a later request for dinner with about 45 minutes apart. snacks with less energy density and rich in protein (yogurt with PSL) improve the control of appetite, satiety and reduces food intake in healthy women later. Copyright AULA MEDICA EDICIONES 2014. Published by AULA MEDICA. All rights reserved.

Biofilm Formation and β-Lactamase Production in Burn Isolates of Pseudomonas aeruginosa.

PubMed

Heydari, Samira; Eftekhar, Fereshteh

2015-03-01

Pseudomonas aeruginosa is an important nosocomial pathogen characterized by its innate resistance to multiple antimicrobial agents. Plasmid-mediated drug resistance also occurs by the production of extended-spectrum β-lactamases (ESBL), metallo β-lactamases (MBL), and AmpC β-lactamases. Another important factor for establishment of chronic infections by P. aeruginosa is biofilm formation mediated by the psl gene cluster. The aim of this study was to evaluate biofilm formation and presence of the pslA gene in burn isolates of P. aeruginosa as well as the association of antibiotic resistance, MBL, ESBL and AmpC β-lactamase production with biofilm formation among the isolates. Sixty-two burn isolates of P. aeruginosa were obtained from Shahid Motahari Hospital in Tehran from August to October 2011. Antibiotic susceptibility was determined by the disc diffusion assay. MBL, AmpC and ESBL production were screened using the double disc synergy test, AmpC disc test and combined disc diffusion assay, respectively. The potential to form biofilm was measured using the microtiter plate assay and pslA gene was detected using specific primers and PCR. Biofilm formation was observed in 43.5% of the isolates, of which 66.7% produced strong and 33.3% formed weak biofilms. All biofilm-positive and 14.2% of biofilm-negative isolates harbored the pslA gene. MBL, AmpC and ESBL production were significantly higher in the biofilm-positive isolates (70.3%, 62.9% and 33.3%, respectively) compared to the biofilm-negative strains (31.4%, 34.2% and 20%, respectively). Overall, 19 isolates (30.6%) co-produced MBL and AmpC, among which the majority were biofilm-positive (63.1%). Finally, four isolates (6.4%) had all three enzymes, of which 3 (75%) produced biofilm. Biofilm formation (both strong and weak) strongly correlated with pslA gene carriage. Biofilm formation also correlated with MBL and AmpC β-lactamase production. More importantly, multiple-β-lactamase phenotype was associated with formation of strong biofilms.

Teaching procedural skills to medical students: A pilot procedural skills lab.

PubMed

Katz, Laurence M; Finch, Alexander; McKinnish, Tyler; Gilliland, Kurt; Tolleson-Rinehart, Sue; Marks, Bonita L

2017-01-01

Medical students have limited confidence in performing procedural skills. A pilot study was conducted to evaluate the effect of a multifaceted Procedural Skills Lab (PSL) on the confidence of medical students to perform procedural skills. Twelve 2nd year medical students were randomly selected to participate in a pilot PSL. The PSL students met with an instructor for 2 h once a week for 4 weeks. Students participated in a flipped classroom and spaced education program before laboratory sessions that included a cadaver laboratory. Procedural skills included a focused assessment with sonography in trauma (FAST) scan, cardiac echocardiogram, lumbar puncture, arthrocentesis, and insertion of intraosseous and intravenous catheters. Students in the PSL were asked to rank their confidence in performing procedural skills before and after completion of the laboratory sessions (Wilcoxon ranked-sum test). A web-based questionnaire was also emailed to all 2nd year medical students to establish a baseline frequency for observing, performing, and confidence performing procedural skills (Mann-Whitney U-test). Fifty-nine percent (n = 106) of 180 2nd year medical students (n = 12 PSL students [treatment group], n = 94 [control group]) completed the survey. Frequency of observation, performance, and confidence in performing procedural skills was similar between the control and treatment groups at baseline. There was an increased confidence level (p < 0.001) for performing all procedural skills for the treatment group after completion of the PSL. An innovative PSL may increase students' confidence to perform procedural skills. Future studies will examine competency after a PSL.

Hydration mechanisms of two polymorphs of synthetic ye'elimite

DOE Office of Scientific and Technical Information (OSTI.GOV)

Cuesta, A.; Álvarez-Pinazo, G.; Sanfélix, S.G.

2014-09-15

Ye'elimite is the main phase in calcium sulfoaluminate cements and also a key phase in sulfobelite cements. However, its hydration mechanism is not well understood. Here we reported new data on the hydration behavior of ye'elimite using synchrotron and laboratory powder diffraction coupled to the Rietveld methodology. Both internal and external standard methodologies have been used to determine the overall amorphous contents. We have addressed the standard variables: water-to-ye'elimite ratio and additional sulfate sources of different solubilities. Moreover, we report a deep study of the role of the polymorphism of pure ye'elimites. The hydration behavior of orthorhombic stoichiometric and pseudo-cubicmore » solid-solution ye'elimites is discussed. In the absence of additional sulfate sources, stoichiometric-ye'elimite reacts slower than solid-solution-ye'elimite, and AFm-type phases are the main hydrated crystalline phases, as expected. Moreover, solid-solution-ye'elimite produces higher amounts of ettringite than stoichiometric-ye'elimite. However, in the presence of additional sulfates, stoichiometric-ye'elimite reacts faster than solid-solution-ye'elimite.« less

The role of oxygen in the photostimulation luminescence process of europium doped potassium chloride

PubMed Central

Xiao, Zhiyan; Mazur, Thomas R.; Driewer, Joseph P.; Li, H. Harold

2015-01-01

A recent suggestion that europium doped potassium chloride (KCl:Eu2+) has the potential to significantly advance the state-of-the-art in radiation therapy dosimetry has generated a renewed interest in a classic storage phosphor material. The purposes of this work are to investigate the role of oxygen in the photostimulation luminescence (PSL) process and to determine if both increased PSL yield and improved temporal stability could be realized in KCl:Eu2+ by incorporating oxygen in the material fabrication process. Regardless of synthesis atmosphere, air or pure nitrogen, PSL amplitude shows a maximum at 1.0 mol % Eu. Depending on europium concentration, dosimeters fabricated in air exhibit stronger PSL by a factor of 2 to 4 compared to those made in N2. There is no change in PSL stimulation spectrum while noticeable shifts in both photoluminescence and PSL emission spectra are observed for air versus nitrogen. Almost all charge-storage centers are spatially correlated, suggesting oxygen’s stabilization role in the PSL process. However, oxygen alone does not improve material’s temporal stability in the first few hours post irradiation at room temperature, probably because a significant portion of radiation-induced holes are stored in the Vk centers which are mobile. PMID:25897274

National Program for Inspection of Non-Federal Dams. Union Meadows Dam, (N.H. 00222), State Number 241.05, Piscataqua River Basin, Wakefield, New Hampshire. Phase I Inspection Report.

DTIC Science & Technology

1979-11-01

inspection, Union Meadows Dam is in good 3-1 condition. Trees growing on thc - e-ast bar-,k of tne discharge channel between the damn and State Route 16T...Vernon A. Know ttOn On the mornin, 01 Novem-,ber 14, 1 9t8, 1 - isitedl L:nion eaw to check a leak oni the lef-t abutmentL ol: thc spillw;oy Thke...8217t 1 .Ce ev-:-r: f ive ye -rs. c)ai.,i3tanft ri1th -. ,m pt~qnt ijlt&vi.-i~ 1-s-’ctor is na ex-oert an ’-i-t~~i~~r~.iK"., cbd sinflt you wiII be

Early diagnosis and treatment of steroid-induced diabetes mellitus in patients with rheumatoid arthritis and other connective tissue diseases.

PubMed

Ito, Satoshi; Ogishima, Hiroshi; Kondo, Yuya; Sugihara, Makoto; Hayashi, Taichi; Chino, Yusuke; Goto, Daisuke; Matsumoto, Isao; Sumida, Takayuki

2014-01-01

To reveal how often patients with rheumatoid arthritis (RA) or any of other connective tissue diseases (CTDs) who take prednisolone (PSL) manifest postprandial hyperglycemia, and to evaluate the effects of divided daily dose administration of PSL, and of acarbose and nateglinide, on RA patients. The blood sugar (BS) levels of the patients were measured after meals. For in-patients who showed postprandial hyperglycemia, the daily dose of PSL was divided and nateglinide and/or acarbose were/was added if their BS levels did not improve sufficiently. The patients with BS levels that were well controlled for three months were compared with the patients with poorly controlled BS levels. The BS levels of 78 patients, including 16 patients with diabetes mellitus (DM), were measured after meals, and 27 of them were newly diagnosed with DM. Five of 14 patients who took a steady dose of PSL showed high BS levels after lunch (over 200 mg/dl) without elevated HbA1c. The combination therapy of divided-dose PSL and nateglinide and/or acarbose improved postprandial hyperglycemia significantly. The period from the start of PSL administration to intervention was significantly longer in patients with good control at three months than the corresponding period in those with poor control. The prevalence of postprandial hyperglycemia was high in patients with RA/CTD taking PSL; accordingly, measurement of the BS level after each meal was valuable. Combination therapy of divided-dose PSL and nateglinide and/or acarbose improved postprandial hyperglycemia.

Zoledronic acid increases the circulating soluble RANKL level in mice, with a further increase in lymphocyte-derived soluble RANKL in zoledronic acid- and glucocorticoid-treated mice stimulated with bacterial lipopolysaccharide.

PubMed

Abe, Takahiro; Sato, Tsuyoshi; Kokabu, Shoichiro; Hori, Naoko; Shimamura, Yumiko; Sato, Tomoya; Yoda, Tetsuya

2016-07-01

The nitrogen-containing bisphosphonate (BP) zoledronic acid (ZA) is a potent antiresorptive drug used in conjunction with standard cancer therapy to treat osteolysis or hypercalcemia due to malignancy. However, it is unclear how ZA influences the circulating levels of bone remodeling factors. The aim of this study was to evaluate the effects of ZA on the serum levels of soluble receptor activator of NF-kB ligand (sRANKL) and osteoprotegerin (OPG). The following four groups of C57BL/6 mice were used (five mice per group): (1) the placebo+phosphate-buffered saline (PBS) group, in which placebo-treated mice were injected once weekly with PBS for 4weeks; (2) the placebo+ZA group, in which placebo-treated mice were injected once weekly with ZA for 4weeks; (3) the prednisolone (PSL)+PBS group, in which PSL-treated mice were injected once weekly with PBS for 4weeks; and (4) the PSL+ZA group, in which PSL-treated mice were injected once weekly with ZA for 4weeks. At the 3-week time point, all mice were subjected to oral inflammatory stimulation with bacterial lipopolysaccharide (LPS). The sera of these mice were obtained every week and the levels of sRANKL and OPG were measured using enzyme-linked immunosorbent assay. At the time of sacrifice, femurs were prepared for micro-computed tomography (micro-CT), histological, and histomorphometric analyses. Our data indicated that ZA administration remarkably reduced bone turnover and significantly increased the basal level of sRANKL. Interestingly, the PSL+ZA group showed a dramatically elevated sRANKL level after LPS stimulation. In contrast, the PSL+ZA group in nonobese diabetic mice with severe combined immunodeficiency disease (NOD-SCID mice), which are characterized by the absence of functional T- and B-lymphocytes, showed no increase in the sRANKL level. Our data suggest that, particularly with combination treatment of ZA and glucocorticoids, surviving lymphocytes might be the source of inflammation-induced sRANKL. Thus, circulating sRANKL levels might be modulated by ZA. Copyright © 2016 Elsevier Ltd. All rights reserved.

Refined Synthesis and Characterization of Controlled Diameter, Narrow Size Distribution Microparticles for Aerospace Research Applications

NASA Technical Reports Server (NTRS)

Tiemsin, Pacita I.; Wohl, Christopher J.

2012-01-01

Flow visualization using polystyrene microspheres (PSL)s has enabled researchers to learn a tremendous amount of information via particle based diagnostic techniques. To better accommodate wind tunnel researchers needs, PSL synthesis via dispersion polymerization has been carried out at NASA Langley Research Center since the late 1980s. When utilizing seed material for flow visualization, size and size distribution are of paramount importance. Therefore, the work described here focused on further refinement of PSL synthesis and characterization. Through controlled variation of synthetic conditions (chemical concentrations, solution stirring speed, temperature, etc.) a robust, controllable procedure was developed. The relationship between particle size and salt concentration, MgSO4, was identified enabling the determination of PSL diameters a priori. Suggestions of future topics related to PSL synthesis, stability, and size variation are also described.

Loop models, modular invariance, and three-dimensional bosonization

NASA Astrophysics Data System (ADS)

Goldman, Hart; Fradkin, Eduardo

2018-05-01

We consider a family of quantum loop models in 2+1 spacetime dimensions with marginally long-ranged and statistical interactions mediated by a U (1 ) gauge field, both purely in 2+1 dimensions and on a surface in a (3+1)-dimensional bulk system. In the absence of fractional spin, these theories have been shown to be self-dual under particle-vortex duality and shifts of the statistical angle of the loops by 2 π , which form a subgroup of the modular group, PSL (2 ,Z ) . We show that careful consideration of fractional spin in these theories completely breaks their statistical periodicity and describe how this occurs, resolving a disagreement with the conformal field theories they appear to approach at criticality. We show explicitly that incorporation of fractional spin leads to loop model dualities which parallel the recent web of (2+1)-dimensional field theory dualities, providing a nontrivial check on its validity.

THE SMALLEST FIELD OF DEFINITION OF A SUBGROUP OF THE GROUP \\mathrm{PSL}_2

NASA Astrophysics Data System (ADS)

Vinberg, È. B.

1995-02-01

As previously proved by the author, for each semisimple algebraic group of adjoint type that is dense in the Zariski topology there exists a smallest field of definition which is an invariant of the class of commensurable subgroups. In the present paper an algorithm is given for finding the smallest field of definition of a dense finitely generated subgroup of the group \\mathrm{PSL}_2(\\mathbb{C}). A criterion for arithmeticity of a lattice in \\mathrm{PSL}_2(\\mathbb{R}) or \\mathrm{PSL}_2(\\mathbb{C}) in terms of this field is presented.Bibliography: 7 titles.

Influence of hydration and annealing on structure, PSL yield and spatial resolution of pressed powder imaging plates of the X-ray storage phosphor CsBr:Eu2+

NASA Astrophysics Data System (ADS)

Kersting, E.; von Seggern, H.

2017-08-01

A new production route for europium doped cesium bromide (CsBr:Eu2+) imaging plates has been developed, synthesizing CsBr:Eu2+ powder from a precipitation reaction of aqueous CsBr solution with ethanol. This new route allows the control of features like homogeneous grain size and grain shape of the obtained powder. After drying and subsequent compacting the powder, disk-like samples were fabricated, and their resulting photostimulated luminescence (PSL) properties like yield and spatial resolution were determined. It will be shown that hydration of such disks causes the CsBr:Eu2+ powder to recrystallize starting from the humidity exposed surfaces to the sample interior up to a completely polycrystalline sample resulting in a decreasing PSL yield and an increasing resolution. Subsequent annealing leads to grain refinement combined with a large PSL yield increment and a minor effect on the spatial resolution. By first annealing the "as made" disk, one observes a strong increment of the PSL yield and almost no effect on the spatial resolution. During subsequent hydration, the recrystallization is hindered by minor structural changes of the grains. The related PSL yield drops slightly with increasing hydration time, and the spatial resolution drops considerably. The obtained PSL properties with respect to structure will be discussed with a simple model.

Production of morphology-controllable porous hyaluronic acid particles using a spray-drying method.

PubMed

Iskandar, Ferry; Nandiyanto, Asep Bayu Dani; Widiyastuti, W; Young, Lee Sin; Okuyama, Kikuo; Gradon, Leon

2009-05-01

Hyaluronic acid (HA) porous particles with controllable porosity and pore size, ranging from 100 to 300 nm, were successfully prepared using a colloidal templating and spray-drying method. HA powder and polystyrene latex (PSL) particles, which were used as the precursor and templating agent, respectively, were mixed in aqueous solution and spray-dried using a two-fluid nozzle system to produce HA and PSL composite particles. Water was evaporated during spray-drying using heated air with a temperature of 120 degrees C. This simple process was completed within several seconds. The prepared particles were collected and washed with an organic solvent to dissolve the PSL templating agent. The porosity and pore size of the resulting particles were easily controlled by changing the initial mass ratio of precursor to templating agent, i.e., HA to PSL, and by altering the size of the PSL template particles.

A scattering methodology for droplet sizing of e-cigarette aerosols.

PubMed

Pratte, Pascal; Cosandey, Stéphane; Goujon-Ginglinger, Catherine

2016-10-01

Knowledge of the droplet size distribution of inhalable aerosols is important to predict aerosol deposition yield at various respiratory tract locations in human. Optical methodologies are usually preferred over the multi-stage cascade impactor for high-throughput measurements of aerosol particle/droplet size distributions. Evaluate the Laser Aerosol Spectrometer technology based on Polystyrene Sphere Latex (PSL) calibration curve applied for the experimental determination of droplet size distributions in the diameter range typical of commercial e-cigarette aerosols (147-1361 nm). This calibration procedure was tested for a TSI Laser Aerosol Spectrometer (LAS) operating at a wavelength of 633 nm and assessed against model di-ethyl-hexyl-sebacat (DEHS) droplets and e-cigarette aerosols. The PSL size response was measured, and intra- and between-day standard deviations calculated. DEHS droplet sizes were underestimated by 15-20% by the LAS when the PSL calibration curve was used; however, the intra- and between-day relative standard deviations were < 3%. This bias is attributed to the fact that the index of refraction of PSL calibrated particles is different in comparison to test aerosols. This 15-20% does not include the droplet evaporation component, which may reduce droplet size prior a measurement is performed. Aerosol concentration was measured accurately with a maximum uncertainty of 20%. Count median diameters and mass median aerodynamic diameters of selected e-cigarette aerosols ranged from 130-191 nm to 225-293 nm, respectively, similar to published values. The LAS instrument can be used to measure e-cigarette aerosol droplet size distributions with a bias underestimating the expected value by 15-20% when using a precise PSL calibration curve. Controlled variability of DEHS size measurements can be achieved with the LAS system; however, this method can only be applied to test aerosols having a refractive index close to that of PSL particles used for calibration.

Building an information model (with the help of PSL/PSA). [Problem Statement Language/Problem Statement Analyzer

NASA Technical Reports Server (NTRS)

Callender, E. D.; Farny, A. M.

1983-01-01

Problem Statement Language/Problem Statement Analyzer (PSL/PSA) applications, which were once a one-step process in which product system information was immediately translated into PSL statements, have in light of experience been shown to result in inconsistent representations. These shortcomings have prompted the development of an intermediate step, designated the Product System Information Model (PSIM), which provides a basis for the mutual understanding of customer terminology and the formal, conceptual representation of that product system in a PSA data base. The PSIM is initially captured as a paper diagram, followed by formal capture in the PSL/PSA data base.

The extracellular matrix Component Psl provides fast-acting antibiotic defense in Pseudomonas aeruginosa biofilms.

PubMed

Billings, Nicole; Millan, MariaRamirez; Caldara, Marina; Rusconi, Roberto; Tarasova, Yekaterina; Stocker, Roman; Ribbeck, Katharina

2013-01-01

Bacteria within biofilms secrete and surround themselves with an extracellular matrix, which serves as a first line of defense against antibiotic attack. Polysaccharides constitute major elements of the biofilm matrix and are implied in surface adhesion and biofilm organization, but their contributions to the resistance properties of biofilms remain largely elusive. Using a combination of static and continuous-flow biofilm experiments we show that Psl, one major polysaccharide in the Pseudomonas aeruginosa biofilm matrix, provides a generic first line of defense toward antibiotics with diverse biochemical properties during the initial stages of biofilm development. Furthermore, we show with mixed-strain experiments that antibiotic-sensitive "non-producing" cells lacking Psl can gain tolerance by integrating into Psl-containing biofilms. However, non-producers dilute the protective capacity of the matrix and hence, excessive incorporation can result in the collapse of resistance of the entire community. Our data also reveal that Psl mediated protection is extendible to E. coli and S. aureus in co-culture biofilms. Together, our study shows that Psl represents a critical first bottleneck to the antibiotic attack of a biofilm community early in biofilm development.

5'-Phosphorothiolate Dinucleotide Cap Analogues: Reagents for Messenger RNA Modification and Potent Small-Molecular Inhibitors of Decapping Enzymes.

PubMed

Wojtczak, Blazej A; Sikorski, Pawel J; Fac-Dabrowska, Kaja; Nowicka, Anna; Warminski, Marcin; Kubacka, Dorota; Nowak, Elzbieta; Nowotny, Marcin; Kowalska, Joanna; Jemielity, Jacek

2018-05-09

The 5' cap consists of 7-methylguanosine (m 7 G) linked by a 5'-5'-triphosphate bridge to messenger RNA (mRNA) and acts as the master regulator of mRNA turnover and translation initiation in eukaryotes. Cap analogues that influence mRNA translation and turnover (either as small molecules or as part of an RNA transcript) are valuable tools for studying gene expression, which is often also of therapeutic relevance. Here, we synthesized a series of 15 dinucleotide cap (m 7 GpppG) analogues containing a 5'-phosphorothiolate (5'-PSL) moiety (i.e., an O-to-S substitution within the 5'-phosphoester) and studied their biological properties in the context of three major cap-binding proteins: translation initiation factor 4E (eIF4E) and two decapping enzymes, DcpS and Dcp2. While the 5'-PSL moiety was neutral or slightly stabilizing for cap interactions with eIF4E, it significantly influenced susceptibility to decapping. Replacing the γ-phosphoester with the 5'-PSL moiety (γ-PSL) prevented β-γ-pyrophosphate bond cleavage by DcpS and conferred strong inhibitory properties. Combining the γ-PSL moiety with α-PSL and β-phosphorothioate (PS) moiety afforded first cap-derived hDcpS inhibitor with low nanomolar potency. Susceptibility to Dcp2 and translational properties were studied after incorporation of the new analogues into mRNA transcripts by RNA polymerase. Transcripts containing the γ-PSL moiety were resistant to cleavage by Dcp2. Surprisingly, superior translational properties were observed for mRNAs containing the α-PSL moiety, which were Dcp2-susceptible. The overall protein expression measured in HeLa cells for this mRNA was comparable to mRNA capped with the translation augmenting β-PS analogue reported previously. Overall, our study highlights 5'-PSL as a synthetically accessible cap modification, which, depending on the substitution site, can either reduce susceptibility to decapping or confer superior translational properties on the mRNA. The 5'-PSL-analogues may find application as reagents for the preparation of efficiently expressed mRNA or for investigation of the role of decapping enzymes in mRNA processing or neuromuscular disorders associated with decapping.

Biofilm Formation and β-Lactamase Production in Burn Isolates of Pseudomonas aeruginosa

PubMed Central

Heydari, Samira; Eftekhar, Fereshteh

2015-01-01

Background: Pseudomonas aeruginosa is an important nosocomial pathogen characterized by its innate resistance to multiple antimicrobial agents. Plasmid-mediated drug resistance also occurs by the production of extended-spectrum β-lactamases (ESBL), metallo β-lactamases (MBL), and AmpC β-lactamases. Another important factor for establishment of chronic infections by P. aeruginosa is biofilm formation mediated by the psl gene cluster. Objectives: The aim of this study was to evaluate biofilm formation and presence of the pslA gene in burn isolates of P. aeruginosa as well as the association of antibiotic resistance, MBL, ESBL and AmpC β-lactamase production with biofilm formation among the isolates. Materials and Methods: Sixty-two burn isolates of P. aeruginosa were obtained from Shahid Motahari Hospital in Tehran from August to October 2011. Antibiotic susceptibility was determined by the disc diffusion assay. MBL, AmpC and ESBL production were screened using the double disc synergy test, AmpC disc test and combined disc diffusion assay, respectively. The potential to form biofilm was measured using the microtiter plate assay and pslA gene was detected using specific primers and PCR. Results: Biofilm formation was observed in 43.5% of the isolates, of which 66.7% produced strong and 33.3% formed weak biofilms. All biofilm-positive and 14.2% of biofilm-negative isolates harbored the pslA gene. MBL, AmpC and ESBL production were significantly higher in the biofilm-positive isolates (70.3%, 62.9% and 33.3%, respectively) compared to the biofilm-negative strains (31.4%, 34.2% and 20%, respectively). Overall, 19 isolates (30.6%) co-produced MBL and AmpC, among which the majority were biofilm-positive (63.1%). Finally, four isolates (6.4%) had all three enzymes, of which 3 (75%) produced biofilm. Conclusions: Biofilm formation (both strong and weak) strongly correlated with pslA gene carriage. Biofilm formation also correlated with MBL and AmpC β-lactamase production. More importantly, multiple-β-lactamase phenotype was associated with formation of strong biofilms. PMID:25964848

Flow cytometric chemosensitivity assay using JC‑1, a sensor of mitochondrial transmembrane potential, in acute leukemia.

PubMed

Yokosuka, Tomoko; Goto, Hiroaki; Fujii, Hisaki; Naruto, Takuya; Takeuchi, Masanobu; Tanoshima, Reo; Kato, Hiromi; Yanagimachi, Masakatsu; Kajiwara, Ryosuke; Yokota, Shumpei

2013-12-01

The purpose of the study is to establish a simple and relatively inexpensive flow cytometric chemosensitivity assay (FCCA) for leukemia to distinguish leukemic blasts from normal leukocytes in clinical samples. We first examined whether the FCCA with the mitochondrial membrane depolarization sensor, 5, 50, 6, 60-tetrachloro-1, 10, 3, 30 tetraethyl benzimidazolo carbocyanine iodide (JC-1), could detect drug-induced apoptosis as the conventional FCCA by annexin V/7-AAD detection did and whether it was applicable in the clinical samples. Second, we compared the results of the FCCA for prednisolone (PSL) with clinical PSL response in 18 acute lymphoblastic leukemia (ALL) patients to evaluate the reliability of the JC-1 FCCA. Finally, we performed the JC-1 FCCA for bortezomib (Bor) in 25 ALL or 11 acute myeloid leukemia (AML) samples as the example of the clinical application of the FCCA. In ALL cells, the results of the JC-1 FCCA for nine anticancer drugs were well correlated with those of the conventional FCCA using anti-annexin V antibody (P < 0.001). In the clinical samples from 18 children with ALL, the results of the JC-1 FCCA for PSL were significantly correlated with the clinical PSL response (P = 0.005). In ALL samples, the sensitivity for Bor was found to be significantly correlated with the sensitivity for PSL (P = 0.005). In AML samples, the Bor sensitivity was strongly correlated with the cytarabine sensitivity (P = 0.0003). This study showed the reliability of a relatively simple and the FCCA using JC-1, and the possibility for the further clinical application.

Ethanol and Acetic Acid Production from Carbon Monoxide in a Clostridium Strain in Batch and Continuous Gas-Fed Bioreactors

PubMed Central

Nalakath Abubackar, Haris; Veiga, María C.; Kennes, Christian

2015-01-01

The effect of different sources of nitrogen as well as their concentrations on the bioconversion of carbon monoxide to metabolic products such as acetic acid and ethanol by Clostridium autoethanogenum was studied. In a first set of assays, under batch conditions, either NH4Cl, trypticase soy broth or yeast extract (YE) were used as sources of nitrogen. The use of YE was found statistically significant (p < 0.05) on the product spectrum in such batch assays. In another set of experiments, three bioreactors were operated with continuous CO supply, in order to estimate the effect of running conditions on products and biomass formation. The bioreactors were operated under different conditions, i.e., EXP1 (pH = 5.75, YE 1g/L), EXP2 (pH = 4.75, YE 1 g/L) and EXP3 (pH = 5.75, YE 0.2 g/L). When compared to EXP2 and EXP3, it was found that EXP1 yielded the maximum biomass accumulation (302.4 mg/L) and products concentrations, i.e., acetic acid (2147.1 mg/L) and ethanol (352.6 mg/L). This can be attributed to the fact that the higher pH and higher YE concentration used in EXP1 stimulated cell growth and did, consequently, also enhance metabolite production. However, when ethanol is the desired end-product, as a biofuel, the lower pH used in EXP2 was more favourable for solventogenesis and yielded the highest ethanol/acetic acid ratio, reaching a value of 0.54. PMID:25608591

Ethanol and acetic acid production from carbon monoxide in a Clostridium strain in batch and continuous gas-fed bioreactors.

PubMed

Abubackar, Haris Nalakath; Veiga, María C; Kennes, Christian

2015-01-20

The effect of different sources of nitrogen as well as their concentrations on the bioconversion of carbon monoxide to metabolic products such as acetic acid and ethanol by Clostridium autoethanogenum was studied. In a first set of assays, under batch conditions, either NH4Cl, trypticase soy broth or yeast extract (YE) were used as sources of nitrogen. The use of YE was found statistically significant (p < 0.05) on the product spectrum in such batch assays. In another set of experiments, three bioreactors were operated with continuous CO supply, in order to estimate the effect of running conditions on products and biomass formation. The bioreactors were operated under different conditions, i.e., EXP1 (pH = 5.75, YE 1g/L), EXP2 (pH = 4.75, YE 1 g/L) and EXP3 (pH = 5.75, YE 0.2 g/L). When compared to EXP2 and EXP3, it was found that EXP1 yielded the maximum biomass accumulation (302.4 mg/L) and products concentrations, i.e., acetic acid (2147.1 mg/L) and ethanol (352.6 mg/L). This can be attributed to the fact that the higher pH and higher YE concentration used in EXP1 stimulated cell growth and did, consequently, also enhance metabolite production. However, when ethanol is the desired end-product, as a biofuel, the lower pH used in EXP2 was more favourable for solventogenesis and yielded the highest ethanol/acetic acid ratio, reaching a value of 0.54.

Vertical pillar-superlattice array and graphene hybrid light emitting diodes.

PubMed

Lee, Jung Min; Choung, Jae Woong; Yi, Jaeseok; Lee, Dong Hyun; Samal, Monica; Yi, Dong Kee; Lee, Chul-Ho; Yi, Gyu-Chul; Paik, Ungyu; Rogers, John A; Park, Won Il

2010-08-11

We report a type of device that combines vertical arrays of one-dimensional (1D) pillar-superlattice (PSL) structures with 2D graphene sheets to yield a class of light emitting diode (LED) with interesting mechanical, optical, and electrical characteristics. In this application, graphene sheets coated with very thin metal layers exhibit good mechanical and electrical properties and an ability to mount, in a freely suspended configuration, on the PSL arrays as a top window electrode. Optical characterization demonstrates that graphene exhibits excellent optical transparency even after deposition of the thin metal films. Thermal annealing of the graphene/metal (Gr/M) contact to the GaAs decreases the contact resistance, to provide enhanced carrier injection. The resulting PSL-Gr/M LEDs exhibit bright light emission over large areas. The result suggests the utility of graphene-based materials as electrodes in devices with unusual, nonplanar 3D architectures.

Bibliography of Soviet Laser Developments, Number 55. September-October 1981.

DTIC Science & Technology

1983-01-01

Boldeskul , I.Ye., and A.Ye. Boldeskul (0). Fluorescence and resonant R-amanspctra1 probes in studies on the dynamics of biological and micellar...AKAYEV A 45 BOLDESKUL I YE 72 AKHMANOV S A 87 PAPADZHAN YE 1 79 BOLGAROV L N 11 AKHMEDZHANOV I M 24 BABARSKOV YE V 84 BOL’SHOV L A 84 AKHSAKHALYAN A D

From climate to global change: Following the footprint of Prof. Duzheng YE's research

NASA Astrophysics Data System (ADS)

Fu, Congbin

2017-10-01

To commemorate 100 years since the birth of Professor Duzheng YE, this paper reviews the contribution of Ye and his research team to the development from climate to global change science in the past 30 or so years, including: (1) the role of climate change in global change; (2) the critical time scales and predictability of global change; (3) the sensitive regions of global change—transitional zones of climate and ecosystems; and (4) orderly human activities and adaptation to global change, with a focus on the development of a proactive strategy for adaptation to such change.

Hyperserotonemia in adults with autistic disorder.

PubMed

Hranilovic, Dubravka; Bujas-Petkovic, Zorana; Vragovic, Renata; Vuk, Tomislav; Hock, Karlo; Jernej, Branimir

2007-11-01

Hyperserotonemia is the most consistent serotonin-related finding in autism. The basis of this phenomenon, and its relationship to the central serotonergic dysfunction remains unclear. Platelet serotonin level (PSL) in 53 autistic adults and 45 healthy controls was measured. Mean PSL in autistic group (75.7 +/- 37.4 ng/microL) was significantly higher than the control sample (59.2 +/- 16.2 ng/microL) due to a presence of hyperserotonemic subjects which comprised 32% of the patients. PSL of autistic subjects did not correlate with the severity of symptoms, as measured by total CARS score, or the degree of mental retardation. However, significant negative relationship was observed between PSL and speech development, indicating the relationship between the peripheral 5HT concentrations and verbal abilities in autistic subjects.

Building blocks for the solution phase synthesis of oligonucleotides: regioselective hydrolysis of 3',5'-Di-O-levulinylnucleosides using an enzymatic approach.

PubMed

García, Javier; Fernández, Susana; Ferrero, Miguel; Sanghvi, Yogesh S; Gotor, Vicente

2002-06-28

A short and convenient synthesis of 3'- and 5'-O-levulinyl-2'-deoxynucleosides has been developed from the corresponding 3',5'-di-O-levulinyl derivatives by regioselective enzymatic hydrolysis, avoiding several tedious chemical protection/deprotection steps. Thus, Candida antartica lipase B (CAL-B) was found to selectively hydrolyze the 5'-levulinate esters, furnishing 3'-O-levulinyl-2'-deoxynucleosides 3 in >80% isolated yields. On the other hand, immobilized Pseudomonas cepacia lipase (PSL-C) and Candida antarctica lipase A (CAL-A) exhibit the opposite selectivity toward the hydrolysis at the 3'-position, affording 5'-O-levulinyl derivatives 4 in >70% yields. A similar hydrolysis procedure was successfully extended to the synthesis of 3'- and 5'-O-levulinyl-protected 2'-O-alkylribonucleosides 7 and 8. This work demonstrates for the first time application of commercial CAL-B and PSL-C toward regioselective hydrolysis of levulinyl esters with excellent selectivity and yields. It is noteworthy that protected cytidine and adenosine base derivatives were not adequate substrates for the enzymatic hydrolysis with CAL-B, whereas PSL-C was able to accommodate protected bases during selective hydrolysis. In addition, we report an improved synthesis of dilevulinyl esters using a polymer-bound carbodiimide as a replacement for dicyclohexylcarbodiimide (DCC), thus considerably simplifying the workup for esterification reactions.

Identification and classification of genes regulated by phosphatidylinositol 3-kinase- and TRKB-mediated signalling pathways during neuronal differentiation in two subtypes of the human neuroblastoma cell line SH-SY5Y.

PubMed

Nishida, Yuichiro; Adati, Naoki; Ozawa, Ritsuko; Maeda, Aasami; Sakaki, Yoshiyuki; Takeda, Tadayuki

2008-10-28

SH-SY5Y cells exhibit a neuronal phenotype when treated with all-trans retinoic acid (RA), but the molecular mechanism of activation in the signalling pathway mediated by phosphatidylinositol 3-kinase (PI3K) is unclear. To investigate this mechanism, we compared the gene expression profiles in SK-N-SH cells and two subtypes of SH-SY5Y cells (SH-SY5Y-A and SH-SY5Y-E), each of which show a different phenotype during RA-mediated differentiation. SH-SY5Y-A cells differentiated in the presence of RA, whereas RA-treated SH-SY5Y-E cells required additional treatment with brain-derived neurotrophic factor (BDNF) for full differentiation. After exposing cells to a PI3K inhibitor, LY294002, we identified 386 genes and categorised these genes into two clusters dependent on the PI3K signalling pathway during RA-mediated differentiation in SH-SY5Y-A cells. Transcriptional regulation of the gene cluster, including 158 neural genes, was greatly reduced in SK-N-SH cells and partially impaired in SH-SY5Y-E cells, which is consistent with a defect in the neuronal phenotype of these cells. Additional stimulation with BDNF induced a set of neural genes that were down-regulated in RA-treated SH-SY5Y-E cells but were abundant in differentiated SH-SY5Y-A cells. We identified gene clusters controlled by PI3K- and TRKB-mediated signalling pathways during the differentiation of two subtypes of SH-SY5Y cells. The TRKB-mediated bypass pathway compensates for impaired neural function generated by defects in several signalling pathways, including PI3K in SH-SY5Y-E cells. Our expression profiling data will be useful for further elucidation of the signal transduction-transcriptional network involving PI3K or TRKB.

Y&E Lessons in Learning: Youth and Education Program News, Summer 2003

ERIC Educational Resources Information Center

Cournoyer, David, Ed.

2003-01-01

This Summer 2003 issue of "Y&E Lessons in Learning" contains the following articles: (1) Playgrounds Where All Kids Are Able to Play; (2) Kellogg Foundation Promotes Youth Voices in Special Comic Book; (3) Families for Kids: A Powerful Approach to System Reform; (4) New Program Focuses Community Leaders on Educational Change; (5)…

FGM (Functionally Graded Material) Thermal Barrier Coatings for Hypersonic Structures - Design and Thermal Structural Analysis

DTIC Science & Technology

2007-06-29

than others. It was found that TZ-3Y-E, which is a partially stabilised zirconia powder , was particularly suitable. The percentage of ceramic powder...layered coatings The current ceramic powder that was being used was a fully stabilised zirconia powder TZ-0Y. However a readily available powder...TZ-3Y-E, partially stabilised zirconia powder , was available and utilised. These tests consisted of a combination of 3, 4 and 5 layers. In the

The challenges encountered in the integration of an early test wafer surface scanning inspection system into a 450mm manufacturing line

NASA Astrophysics Data System (ADS)

Lee, Jeffrey; McGarvey, Steve

2013-04-01

The introduction of early test wafer (ETW) 450mm Surface Scanning Inspection Systems (SSIS) into Si manufacturing has brought with it numerous technical, commercial, and logistical challenges on the path to rapid recipe development and subsequent qualification of other 450mm wafer processing equipment. This paper will explore the feasibility of eliminating the Polystyrene Latex Sphere deposition process step and the subsequent creation of SSIS recipes based upon the theoretical optical properties of both the SSIS and the process film stack(s). The process of Polystyrene Latex Sphere deposition for SSIS recipe generation and development is generally accepted on the previous technology nodes for 150/200/300mm wafers. PSL is deposited with a commercially available deposition system onto a non-patterned bare Si or non-patterned filmed Si wafer. After deposition of multiple PSL spots, located in different positions on a wafer, the wafer is inspected on a SSIS and a response curve is generated. The response curve is based on the the light scattering intensity of the NIST certified PSL that was deposited on the wafer. As the initial 450mm Si wafer manufacturing began, there were no inspection systems with sub-90nm sensitivities available for defect and haze level verification. The introduction of a 450mm sub-30nm inspection system into the manufacturing line generated instant challenges. Whereas the 450mm wafers were relatively defect free at 90nm, at 40nm the wafers contained several hundred thousand defects. When PSL was deposited onto wafers with these kinds of defect levels, PSL with signals less than the sub-90nm defects were difficult to extract. As the defectivity level of the wafers from the Si suppliers rapidly improves the challenges of SSIS recipe creation with high defectivity decreases while at the same time the cost of PSL deposition increases. The current cost per wafer is fifteen thousand dollars for a 450mm PSL deposition service. When viewed from the standpoint of the generations of hundreds of SSIS recipes for the global member companies of ISMI, it is simply not economically viable to create all recipes based on PSL based light scattering response curves. This paper will explore the challenges/end results encountered with the PSL based SSIS recipe generation and compare those against the challenges/end results of SSIS recipes generated based strictly upon theoretical Bidirectional reflectance distribution function (BRDF) light scattering modeling. The BRDF modeling will allow for the creation of SSIS recipes without PSL deposition, which is greatly appealing for a multitude of both technical and commercial considerations. This paper will also explore the technical challenges of SSIS recipe generation based strictly upon BRDF modeling.

Bispecific antibody targets multiple Pseudomonas aeruginosa evasion mechanisms in the lung vasculature.

PubMed

Thanabalasuriar, Ajitha; Surewaard, Bas Gj; Willson, Michelle E; Neupane, Arpan S; Stover, Charles K; Warrener, Paul; Wilson, George; Keller, Ashley E; Sellman, Bret R; DiGiandomenico, Antonio; Kubes, Paul

2017-06-01

Pseudomonas aeruginosa is a major cause of severe infections that lead to bacteremia and high patient mortality. P. aeruginosa has evolved numerous evasion and subversion mechanisms that work in concert to overcome immune recognition and effector functions in hospitalized and immunosuppressed individuals. Here, we have used multilaser spinning-disk intravital microscopy to monitor the blood-borne stage in a murine bacteremic model of P. aeruginosa infection. P. aeruginosa adhered avidly to lung vasculature, where patrolling neutrophils and other immune cells were virtually blind to the pathogen's presence. This cloaking phenomenon was attributed to expression of Psl exopolysaccharide. Although an anti-Psl mAb activated complement and enhanced neutrophil recognition of P. aeruginosa, neutrophil-mediated clearance of the pathogen was suboptimal owing to a second subversion mechanism, namely the type 3 secretion (T3S) injectisome. Indeed, T3S prevented phagosome acidification and resisted killing inside these compartments. Antibody-mediated inhibition of the T3S protein PcrV did not enhance bacterial phagocytosis but did enhance killing of the few bacteria ingested by neutrophils. A bispecific mAb targeting both Psl and PcrV enhanced neutrophil uptake of P. aeruginosa and also greatly increased inhibition of T3S function, allowing for phagosome acidification and bacterial killing. These data highlight the need to block multiple evasion and subversion mechanisms in tandem to kill P. aeruginosa.

Bone characteristics of 16 wk-old turkeys subjected to different dietary regimens and simulated stress

USDA-ARS?s Scientific Manuscript database

The effects of a yeast extract (YE) feed supplement and/or vitamin D3 (VD) on the bone properties of 16 wk-old turkeys, transiently subjected to a simulated stress using dexamethasone (Dex), were determined. The turkeys were fed diets with or without YE and/or VD during 6, 11, and 15 wk post hatch, ...

Bibliography of Soviet Laser Developments, Number 79, September - October 1985.

DTIC Science & Technology

1987-01-01

Prakticheskiye primeneniya. NSPGAN. Leningrad, Nauka, 1985, 107-116. " 470. Ashcheulov, Yu.V.; Petnikov, A.Ye.; Sukhanov , V.I. (). Stability of...YU V 64 SHTANCHAYEV M 1 21 SNEGIREV YE P 75 SUKHANOV V 1 52 SHTERN F K 77 SNITKO 0 V 4 SUKHAREV S A 35 SHTERNI3ERG A R 92 SNOPKO V N 57 SUKHAREVA L K

Phosphatidylserine-targeted liposome for enhanced glioma-selective imaging.

PubMed

Zhang, Liang; Habib, Amyn A; Zhao, Dawen

2016-06-21

Phosphatidylserine (PS), which is normally intracellular, becomes exposed on the outer surface of viable endothelial cells (ECs) of tumor vasculature. Utilizing a PS-targeting antibody, we have recently established a PS-targeted liposomal (PS-L) nanoplatform that has demonstrated to be highly tumor-selective. Because of the vascular lumen-exposed PS that is immediately accessible without a need to penetrate the intact blood brain barrier (BBB), we hypothesize that the systemically administered PS-L binds specifically to tumor vascular ECs, becomes subsequently internalized into the cells and then enables its cargos to be efficiently delivered to glioma parenchyma. To test this, we exploited the dual MRI/optical imaging contrast agents-loaded PS-L and injected it intravenously into mice bearing intracranial U87 glioma. At 24 h, both in vivo optical imaging and MRI depicted enhanced tumor contrast, distinct from the surrounding normal brain. Intriguingly, longitudinal MRI revealed temporal and spatial intratumoral distribution of the PS-L by following MRI contrast changes, which appeared punctate in tumor periphery at an earlier time point (4 h), but became clustering and disseminated throughout the tumor at 24 h post injection. Importantly, glioma-targeting specificity of the PS-L was antigen specific, since a control probe of irrelevant specificity showed minimal accumulation in the glioma. Together, these results indicate that the PS-L nanoplatform enables the enhanced, glioma-targeted delivery of imaging contrast agents by crossing the tumor BBB efficiently, which may also serve as a useful nanoplatform for anti-glioma drugs.

Effect of a six month yoga exercise intervention on fitness outcomes for breast cancer survivors

PubMed Central

Hughes, Daniel C.; Darby, Nydia; Gonzalez, Krystle; Boggess, Terri; Morris, Ruth M.; Ramirez, Amelie G.

2016-01-01

Yoga-based exercise has proven to be beneficial for practitioners, including cancer survivors. This study reports on the improvements in physical fitness for 20 breast cancer survivors who participated in a six-month yoga-based (YE) exercise program. Results are compared to a comprehensive exercise (CE) program group and a comparison (C) exercise group who chose their own exercises. “Pre” and “post” fitness assessments included measures of anthropometrics, cardiorespiratory capacity, strength and flexibility. Descriptive statistics, effect size (d), dependent sample ‘t’ tests for all outcome measures were calculated for the YE group. Significant improvements included: decreased % body fat (−3.00%, d = −0.44, p < 0.001); increased sit to stand leg strength repetitions (2.05, d = 0.48, p = 0.003); forward reach (3.59 cm, d = 0.61, p = 0.01); and right arm sagittal range of motion (6.50°, d = 0.92, p= 0.05). To compare YE outcomes with the other two groups, a one-way analysis of variance (ANOVA) was used. YE participants significantly outperformed C participants on “forward reach” (3.59 cm gained versus −2.44 cm lost), (p = 0.009) and outperformed CE participants (3.59 cm gained versus 1.35 cm gained), but not statistically significant. Our results support yoga-based exercise modified for breast cancer survivors as safe and effective. PMID:26395825

Projection Stereolithographic Fabrication of Human Adipose Stem Cell-Incorporated Biodegradable Scaffolds for Cartilage Tissue Engineering.

PubMed

Sun, Aaron X; Lin, Hang; Beck, Angela M; Kilroy, Evan J; Tuan, Rocky S

2015-01-01

The poor self-healing ability of cartilage necessitates the development of methods for cartilage regeneration. Scaffold construction with live stem cell incorporation and subsequent differentiation presents a promising route. Projection stereolithography (PSL) offers high resolution and processing speed as well as the ability to fabricate scaffolds that precisely fit the anatomy of cartilage defects using medical imaging as the design template. We report here the use of a visible-light-based PSL (VL-PSL) system to encapsulate human adipose-derived stem cells (hASCs) into a biodegradable polymer [poly-d,l-lactic acid/polyethylene glycol/poly-d,l-lactic acid (PDLLA-PEG)]/hyaluronic acid (HA) matrix to produce live cell constructs with customized architectures. After fabrication, hASCs showed high viability (84%) and were uniformly distributed throughout the constructs, which possessed high mechanical properties with a compressive modulus of 780 kPa. The hASC-seeded constructs were then cultured in control or TGF-β3-containing chondrogenic medium for up to 28 days. In chondrogenic medium-treated group (TGF-β3 group), hASCs maintained 77% viability and expressed chondrogenic genes Sox9, collagen type II, and aggrecan at 11, 232, and 2.29 × 10(5) fold increases, respectively compared to levels at day 0 in non-chondrogenic medium. The TGF-β3 group also produced a collagen type II and glycosaminoglycan-rich extracellular matrix, detected by immunohistochemistry, Alcian blue staining, and Safranin O staining suggesting robust chondrogenesis within the scaffold. Without chondroinductive addition (Control group), cell viability decreased with time (65% at 28 days) and showed poor cartilage matrix deposition. After 28 days, mechanical strength of the TGF-β3 group remained high at 240 kPa. Thus, the PSL and PDLLA-PEG/HA-based fabrication method using adult stem cells is a promising approach in producing mechanically competent engineered cartilage for joint cartilage resurfacing.

Yeast peroxisomal multifunctional enzyme: (3R)-hydroxyacyl-CoA dehydrogenase domains A and B are required for optimal growth on oleic acid.

PubMed

Qin, Y M; Marttila, M S; Haapalainen, A M; Siivari, K M; Glumoff, T; Hiltunen, J K

1999-10-01

The yeast peroxisomal (3R)-hydroxyacyl-CoA dehydrogenase/2-enoyl-CoA hydratase 2 (multifunctional enzyme type 2; MFE-2) has two N-terminal domains belonging to the short chain alcohol dehydrogenase/reductase superfamily. To investigate the physiological roles of these domains, here called A and B, Saccharomyces cerevisiae fox-2 cells (devoid of Sc MFE-2) were taken as a model system. Gly(16) and Gly(329) of the S. cerevisiae A and B domains, corresponding to Gly(16), which is mutated in the human MFE-2 deficiency, were mutated to serine and cloned into the yeast expression plasmid pYE352. In oleic acid medium, fox-2 cells transformed with pYE352:: ScMFE-2(aDelta) and pYE352::ScMFE-2(bDelta) grew slower than cells transformed with pYE352::ScMFE-2, whereas cells transformed with pYE352::ScMFE-2(aDeltabDelta) failed to grow. Candida tropicalis MFE-2 with a deleted hydratase 2 domain (Ct MFE- 2(h2Delta)) and mutational variants of the A and B domains (Ct MFE- 2(h2DeltaaDelta), Ct MFE- 2(h2DeltabDelta), and Ct MFE- 2(h2DeltaaDeltabDelta)) were overexpressed and characterized. All proteins were dimers with similar secondary structure elements. Both wild type domains were enzymatically active, with the B domain showing the highest activity with short chain and the A domain with medium and long chain (3R)-hydroxyacyl-CoA substrates. The data show that the dehydrogenase domains of yeast MFE-2 have different substrate specificities required to allow the yeast to propagate optimally on fatty acids as the carbon source.

Ice Crystal Icing Engine Testing in the NASA Glenn Research Center's Propulsion Systems Laboratory (PSL): Altitude Investigation

NASA Technical Reports Server (NTRS)

Oliver, Michael J.

2015-01-01

The National Aeronautics and Space Administration conducted a full scale ice crystal icing turbofan engine test in the NASA Glenn Research Centers Propulsion Systems Laboratory (PSL) Facility in February 2013. Honeywell Engines supplied the test article, an obsolete, unmodified Lycoming ALF502-R5 turbofan engine serial number LF01 that experienced an un-commanded loss of thrust event while operating at certain high altitude ice crystal icing conditions. These known conditions were duplicated in the PSL for this testing.

PSL Icing Facility Upgrade Overview

NASA Technical Reports Server (NTRS)

Griffin, Thomas A.; Dicki, Dennis J.; Lizanich, Paul J.

2014-01-01

The NASA Glenn Research Center Propulsion Systems Lab (PSL) was recently upgraded to perform engine inlet ice crystal testing in an altitude environment. The system installed 10 spray bars in the inlet plenum for ice crystal generation using 222 spray nozzles. As an altitude test chamber, the PSL is capable of simulating icing events at altitude in a groundtest facility. The system was designed to operate at altitudes from 4,000 to 40,000 ft at Mach numbers up to 0.8M and inlet total temperatures from -60 to +15 degF. This paper and presentation will be part of a series of presentations on PSL Icing and will cover the development of the icing capability through design, developmental testing, installation, initial calibration, and validation engine testing. Information will be presented on the design criteria and process, spray bar developmental testing at Cox and Co., system capabilities, and initial calibration and engine validation test. The PSL icing system was designed to provide NASA and the icing community with a facility that could be used for research studies of engine icing by duplicating in-flight events in a controlled ground-test facility. With the system and the altitude chamber we can produce flight conditions and cloud environments to simulate those encountered in flight. The icing system can be controlled to set various cloud uniformities, droplet median volumetric diameter (MVD), and icing water content (IWC) through a wide variety of conditions. The PSL chamber can set altitudes, Mach numbers, and temperatures of interest to the icing community and also has the instrumentation capability of measuring engine performance during icing testing. PSL last year completed the calibration and initial engine validation of the facility utilizing a Honeywell ALF502-R5 engine and has duplicated in-flight roll back conditions experienced during flight testing. This paper will summarize the modifications and buildup of the facility to accomplish these tests.

Bibliography of Soviet Laser Developments, Number 64, March - April 1983.

DTIC Science & Technology

1984-03-06

140. Mirza, S.Yu. * A.N. Soldatov, and V.B. Sukhanov (0). Efficient conversion of radiation in metal vapor to tunable lasing in dyes. Sb 8, 81-107...Device for reconstructing images. Otkr izobr, no. 16, 1983, 1015508. 521. Sander, Ye.A., V.I. Sukhanov , and S.A. Shoydin (0). Study on holographic...Deposit at VINITI, no. 6231-82, 17 Dec 1982, 27 p. (RZhF, 3/83, 3D975) 556. Sukhanov , V.I., A.Ye. Petnikov, and Yu.V. Ashcheulov (0). Hologram

Effects of yeast extract and vitamin D on turkey mortality and cellulitis incidence in a transport stress model.

USDA-ARS?s Scientific Manuscript database

We evaluated yeast extract (YE) and vitamin D (VD) in turkeys treated with dexamethasone (Dex) at intervals designed to simulate transport stress during a 3 stage growout. YE but not VD decreased early mortality (P = 0.001) and mortality at wk 7 (P= 0.02) and wk 12 (P = 0.002) but not wk 16. Celluli...

JPRS Report Science & Technology USSR: Life Sciences.

DTIC Science & Technology

1988-07-18

SOTSIALISTICHESKAYA INDUSTRIYA, 31 Jan 87, 1 Feb 87) 79 PSYCHOLOGY Psychoprevention and Psychotherapy of Alcoholism (V.Ye. Rozhnov, M.Ye. Burno...IMMOBILIZOVANNYYE FERMENTY V MEDITSINE INOVOYE V ZHIZNI, NAUKE, TEKHNIKE: SERIYA "KRTMIYA"] , No 9, Sep 86) 3 Isolation of Cholesterol Oxidase ...No 5, Sep-Oct 86) 17 Alkylation of Benzo- and Dibenzocrown Esters With Various Alcohols (A. K. Tashmukhamedova, I. A. Stempnevskaya, et al

Methyl jasmonate and yeast elicitor induce differential transcriptional and metabolic re-programming in cell suspension cultures of the model legume Medicago truncatula.

PubMed

Suzuki, Hideyuki; Reddy, M S Srinivasa; Naoumkina, Marina; Aziz, Naveed; May, Gregory D; Huhman, David V; Sumner, Lloyd W; Blount, Jack W; Mendes, Pedro; Dixon, Richard A

2005-03-01

Exposure of cell suspension cultures of Medicago truncatula Gaerth. to methyl jasmonate (MeJA) resulted in up to 50-fold induction of transcripts encoding the key triterpene biosynthetic enzyme beta-amyrin synthase (betaAS; EC 5.4.99.-). Transcripts reached maximum levels at 24 h post-elicitation with 0.5 mM MeJA. The entry point enzymes into the phenylpropanoid and flavonoid pathways, L: -phenylalanine ammonia-lyase (PAL; EC 4.3.1.5) and chalcone synthase (CHS; EC 2.3.1.74), respectively, were not induced by MeJA. In contrast, exposure of cells to yeast elicitor (YE) resulted in up to 45- and 14-fold induction of PAL and CHS transcripts, respectively, at only 2 h post-elicitation. betaAS transcripts were weakly induced at 12 h after exposure to YE. Over 30 different triterpene saponins were identified in the cultures, many of which were strongly induced by MeJA, but not by YE. In contrast, cinnamic acids, benzoic acids and isoflavone-derived compounds accumulated following exposure of cultures to YE, but few changes in phenylpropanoid levels were observed in response to MeJA. DNA microarray analysis confirmed the strong differential transcriptional re-programming of the cell cultures for multiple genes in the phenylpropanoid and triterpene pathways in response to MeJA and YE, and indicated different responses of individual members of gene families. This work establishes Medicago cell cultures as an excellent model for future genomics approaches to understand the regulation of legume secondary metabolism.

[Design and verification of Luo-Ye pump-based stress formation for cultivation of tissue-engineered blood vessel].

PubMed

Liao, Wen-Jun; Chen, Wan-Wen; Wen, Zhang; Wu, Yue-Heng; Li, Dong-Feng; Zhou, Jia-Hui; Zheng, Jian-Yi; Lin, Zhan-Yi

2016-06-20

To improve Luo-Ye pump-based stress-forming system and optimize the stimulating effect on smooth muscle cells during cultivation of tissue-engineered blood vessels (TEBV). A new Luo-Ye pump-based TEBV 3D culture system was developed by adding an air pump to the output of the bioreactor. A pressure guide wire was used to measure the stress at different points of the silicone tube inside the TEBV bio-reactor, and fitting curves of the stress changes over time was created using Origin 8.0 software. The TEBVs were constructed by seeding vascular smooth muscle cells (VSMCs) isolated from human umbilical artery on polyglycolic acid (PGA) and cultured under dynamic conditions with 40 mmHg resistance (improved group), dynamic conditions without resistance (control group) or static condition (static group) for 4 weeks. The harvested TEBVs were then examined with HE staining, masson staining, α-SMA immunohistochemical staining, and scanning and transmission electron microscopy with semi-quantitative analysis of collagen content and α-SMA expression. The measured stress values and the fitting curves showed that the stress stimuli from the Luo-Ye pump were enhanced by adding an air pump to the output of the bioreactor. Histological analysis revealed improved VSMC density, collagen content and α-SMA expression in the TEBVs constructed with the improved method as compared with those in the control and static groups. Adding an air pump to the Luo-Ye pump significantly enhances the stress stimulation in the TEBV 3-D culture system to promote the secretion function of VSMCs.

Catheter-Associated Urinary Tract Infection by Pseudomonas aeruginosa Is Mediated by Exopolysaccharide-Independent Biofilms

PubMed Central

Cole, Stephanie J.; Records, Angela R.; Orr, Mona W.; Linden, Sara B.

2014-01-01

Pseudomonas aeruginosa is an opportunistic human pathogen that is especially adept at forming surface-associated biofilms. P. aeruginosa causes catheter-associated urinary tract infections (CAUTIs) through biofilm formation on the surface of indwelling catheters. P. aeruginosa encodes three extracellular polysaccharides, PEL, PSL, and alginate, and utilizes the PEL and PSL polysaccharides to form biofilms in vitro; however, the requirement of these polysaccharides during in vivo infections is not well understood. Here we show in a murine model of CAUTI that PAO1, a strain harboring pel, psl, and alg genes, and PA14, a strain harboring pel and alg genes, form biofilms on the implanted catheters. To determine the requirement of exopolysaccharide during in vivo biofilm infections, we tested isogenic mutants lacking the pel, psl, and alg operons and showed that PA14 mutants lacking these operons can successfully form biofilms on catheters in the CAUTI model. To determine the host factor(s) that induces the ΔpelD mutant to form biofilm, we tested mouse, human, and artificial urine and show that urine can induce biofilm formation by the PA14 ΔpelD mutant. By testing the major constituents of urine, we show that urea can induce a pel-, psl-, and alg-independent biofilm. These pel-, psl-, and alg-independent biofilms are mediated by the release of extracellular DNA. Treatment of biofilms formed in urea with DNase I reduced the biofilm, indicating that extracellular DNA supports biofilm formation. Our results indicate that the opportunistic pathogen P. aeruginosa utilizes a distinct program to form biofilms that are independent of exopolysaccharides during CAUTI. PMID:24595142

Age differences in the associations between sick leave and aspects of health, psychosocial workload and family life: a cross-sectional study

PubMed Central

Bos, Judith T; van der Velden, Koos; van der Gulden, Joost W J

2012-01-01

Objectives To investigate differences in associations between sick leave and aspects of health, psychosocial workload, family life and work–family interference between four age groups (<36, 36–45, 46–55 and 55+ years). Design A cross-sectional study; a questionnaire was sent to the home addresses of all employees of a university. Setting A Dutch university. Participants 1843 employees returned the questionnaire (net response: 49.1%). The age distribution was as follows: <36: 32%; 36–45: 26%; 46–55: 27% and 55+: 12%. Primary outcomes Frequent sick leave (FSL, ≥3 times in the past 12 months) and prolonged sick leave (PSL, >2 weeks in total in the past 12 months). Differences between the age groups in independent variables and outcomes were investigated. Logistic regression analysis was used to calculate associations between various variables and the sick leave outcomes. Interaction terms were included to detect differences between the age groups. Results Age differences were found for many work- and family-related characteristics but not in the mean scores for health-related aspects. Presence of chronic disease was reported more frequently with increasing age. The 55+ age group had almost two times less chance of FSL, but 1.6 times more chance of PSL than the <36 age group. Age moderates the associations between career opportunities, partner's contribution in domestic tasks and sex, and FSL. Job security and pay, support from supervisor, challenging work and being breadwinner have different associations with PSL. However, life events in private lives and perceived health complaints are important in all age groups. FSL and PSL have some determinants in common, but there are differences between the outcomes as well. Conclusions Age should be treated as a variable of interest instead of a control variable. Employers and occupational physicians need to be aware that each phase in life has specific difficulties that can lead to FSL and PSL. PMID:22855622

Interferon-free treatment for patients with chronic hepatitis C and autoimmune liver disease: higher SVR rates with special precautions for deterioration of autoimmune hepatitis.

PubMed

Kanda, Tatsuo; Yasui, Shin; Nakamura, Masato; Nakamoto, Shingo; Takahashi, Koji; Wu, Shuang; Sasaki, Reina; Haga, Yuki; Ogasawara, Sadahisa; Saito, Tomoko; Kobayashi, Kazufumi; Kiyono, Soichiro; Ooka, Yoshihiko; Suzuki, Eiichiro; Chiba, Tetsuhiro; Maruyama, Hitoshi; Imazeki, Fumio; Moriyama, Mitsuhiko; Kato, Naoya

2018-02-20

Interferon-free treatment can achieve higher sustained virological response (SVR) rates, even in patients in whom hepatitis C virus (HCV) could not be eradicated in the interferon treatment era. Immune restoration in the liver is occasionally associated with HCV infection. We examined the safety and effects of interferon-free regimens on HCV patients with autoimmune liver diseases. All 7 HCV patients with autoimmune hepatitis (AIH) completed treatment and achieved SVR. Three patients took prednisolone (PSL) at baseline, and 3 did not take PSL during interferon-free treatment. In one HCV patient with AIH and cirrhosis, PSL were not administered at baseline, but she needed to take 40 mg/day PSL at week 8 for liver dysfunction. She also complained back pain and was diagnosed with vasospastic angina by coronary angiography at week 11. However, she completed interferon-free treatment. All 5 HCV patients with primary biliary cholangitis (PBC) completed treatment and achieved SVR. Three of these HCV patients with PBC were treated with UDCA during interferon-free treatment. Interferon-free regimens could result in higher SVR rates in HCV patients with autoimmune liver diseases. As interferon-free treatment for HCV may have an effect on hepatic immunity and activity of the autoimmune liver diseases, careful attention should be paid to unexpected adverse events in their treatments. Total 12 patients with HCV and autoimmune liver diseases [7 AIH and PBC], who were treated with interferon-free regimens, were retrospectively analyzed.

Atmospheric Boundary Layer Modeling for Combined Meteorology and Air Quality Systems

EPA Science Inventory

Atmospheric Eulerian grid models for mesoscale and larger applications require sub-grid models for turbulent vertical exchange processes, particularly within the Planetary Boundary Layer (PSL). In combined meteorology and air quality modeling systems consistent PSL modeling of wi...

NASA Glenn Propulsion Systems Lab (PSL) Icing Facility Update

NASA Technical Reports Server (NTRS)

Thomas, Queito P.

2015-01-01

The NASA Glenn Research Center Propulsion Systems Lab (PSL) was recently upgraded to perform engine inlet ice crystal testing in an altitude environment. The system installed 10 spray bars in the inlet plenum for ice crystal generation using 222 spray nozzles. As an altitude test chamber, PSL is capable of simulation of in-flight icing events in a ground test facility. The system was designed to operate at altitudes from 4,000 ft. to 40,000 ft. at Mach numbers up to 0.8M and inlet total temperatures from -60F to +15F.

Clinical analysis of 50 children with juvenile dermatomyositis.

PubMed

Kishi, Takayuki; Miyamae, Takako; Hara, Ryoki; Nakajima, Shoko; Imagawa, Tomoyuki; Mori, Masaaki; Yokota, Shumpei

2013-03-01

We performed a retrospective review of medical records to assess the clinical characteristics of 50 Japanese children with juvenile dermatomyositis (JDM). Fourteen boys and 36 girls who visited Yokohama City University Hospital between 1983 and 2008 were enrolled. Gender, age at disease onset and diagnosis, presenting clinical features, laboratory data at onset, complications, treatment, and outcome were reviewed. Mean age at disease onset was 6.9 years. Clinical manifestations at the first visit were muscle pain and/or weakness (90 %), malar rash (90 %), Gottron's papules (86 %), and heliotrope rash (80.0 %). Elevated serum levels of creatine kinase were found in 57.0 % of patients and aldolase in 95 %. T2-weighted magnetic resonance (MR) images with fat suppression demonstrated positive findings in 89.5 % of patients. Initial treatment was prednisolone (PSL) orally or pulsed methylprednisolone (mPSL) i.v. Pulsed mPSL therapy showed efficacy superior to PSL [flare in 8 of 19 (42 %) vs. 18 of 25 (72 %)]. Children refractory to initial treatment were given additional pulsed mPSL and/or cyclophosphamide (IVCY; n = 19) i.v.. Four patients with interstitial pneumonia responded well to IVCY. Our findings support the notion that JDM might be considered as both a systemic inflammatory and noninflammatory vasculopathy best treated by IVCY, as shown in previous literature.

Surface scanning inspection system particle detection dependence on aluminum film morphology

NASA Astrophysics Data System (ADS)

Prater, Walter; Tran, Natalie; McGarvey, Steve

2012-03-01

Physical vapor deposition (PVD) aluminum films present unique challenges when detecting particulate defects with a Surface Scanning Inspection System (SSIS). Aluminum (Al) films 4500Å thick were deposited on 300mm particle grade bare Si wafers at two temperatures using a Novellus Systems INOVA® NExT,.. Film surface roughness and morphology measurements were performed using a Veeco Vx310® atomic force microscope (AFM). AFM characterization found the high deposition temperature (TD) Al roughness (Root Mean Square 16.5 nm) to be five-times rougher than the low-TD Al roughness (rms 3.7 nm). High-TD Al had grooves at the grain boundaries that were measured to be 20 to 80 nm deep. Scanning electron microscopy (SEM) examination, with a Hitachi RS6000 defect review SEM, confirmed the presence of pronounced grain grooves. SEM images established that the low-TD filmed wafers have fine grains (0.1 to 0.3 um diameter) and the high-TD film wafers have fifty-times larger equiaxed plateletshape grains (5 to 15 um diameter). Calibrated Poly-Styrene Latex (PSL) spheres ranging in size from 90 nm to 1 μm were deposited in circular patterns on the wafers using an aerosol deposition chamber. PSL sphere depositions at each spot were controlled to yield 2000 to 5000 counts. A Hitachi LS9100® dark field full wafer SSIS was used to experimentally determine the relationship of the PSL sphere scattered light intensity with S-polarized light, a measure of scattering cross-section, with respect to the calibrated PSL sphere diameter. Comparison of the SSIS scattered light versus PSL spot size calibration curves shows two distinct differences. Scattering cross-section (intensity) of the PSL spheres increased on the low-TD Al film with smooth surface roughness and the low-TD Al film defect detection sensitivity was 126 nm compared to 200 nm for the rougher high- TD Al film. This can be explained by the higher signal to noise attributed to the smooth low-TD Al. Dark field defect detection on surface scanning inspection systems is used to rapidly measure defectivity data. The user generates a calibration curve on the SSIS to plot the intensity of the light scattering derived at each National Institute of Standards and Technology (NIST) certified PSL deposition spot that was deposited. It is not uncommon for the end user to embark upon the time consuming process of attempting to "push" the maximal SSIS film specific sensitivity curve beyond the optical performance capability of the SSIS. Bidirectional reflectance distribution function (BRDF) light scattering modeling was utilized as a means of determining the most appropriate polarity prior to the SSIS recipe creation process. The modeling utilized the Al refractive index (n) and extinction coefficient (k) and the SSIS detector angles and laser wavelength. The modeling results allowed predetermination of the maximal sensitivity for each different Al thickness and eliminate unnecessary recipe modification trial-and-error in search of the SSIS maximal sensitivity. The modeling accurately forecasted the optimal polarization and maximal sensitivity of the SSIS recipe, which, by avoiding a trial and error approach, can result in a substantial savings in time and resources.

Aflatoxin formation and gene expression in response to carbon source media shift in Aspergillus parasiticus.

PubMed

Wilkinson, J R; Yu, J; Abbas, H K; Scheffler, B E; Kim, H S; Nierman, W C; Bhatnagar, D; Cleveland, T E

2007-10-01

Aflatoxins are toxic and carcinogenic polyketide metabolites produced by fungal species, including Aspergillus flavus and A. parasiticus. The biosynthesis of aflatoxins is modulated by many environmental factors, including the availability of a carbon source. The gene expression profile of A. parasiticus was evaluated during a shift from a medium with low concentration of simple sugars, yeast extract (YE), to a similar medium with sucrose, yeast extract sucrose (YES). Gene expression and aflatoxins (B1, B2, G1, and G2) were quantified from fungal mycelia harvested pre- and post-shifting. When compared with YE media, YES caused temporary reduction of the aflatoxin levels detected at 3-h post-shifting and they remained low well past 12 h post-shift. Aflatoxin levels did not exceed the levels in YE until 24 h post-shift, at which time point a tenfold increase was observed over YE. Microarray analysis comparing the RNA samples from the 48-h YE culture to the YES samples identified a total of 2120 genes that were expressed across all experiments, including most of the aflatoxin biosynthesis genes. One-way analysis of variance (ANOVA) identified 56 genes that were expressed with significant variation across all time points. Three genes responsible for converting norsolorinic acid to averantin were identified among these significantly expressed genes. The potential involvement of these genes in the regulation of aflatoxin biosynthesis is discussed.

Initiator system in holographic photopolymer materials

NASA Astrophysics Data System (ADS)

Ortuño, M.; Fernández, E.; Fuentes, R.; Gallego, S.; Márquez, A.

2010-05-01

The photopolymers with a hydrophilic matrix as poly(vinyl alcohol), PVA, are versatile holographic recording materials in hologram recording experiments. They use water as solvent and they can be made in layers with several thickness. One of the photopolymers more used is composed of acrylamide as polymerizable monomer, PVA and water as binder. The pair: triethanolamine, TEA, and the dye yellowish eosin, YE, is widely used as initiator system due to its high sensitivity and efficiency. TEA is the radical initiator more used with dyes derived from fluorescein as YE because they can generate a radical by redox reaction under dye excitation by light. The dye is bleached in this process because is decomposed in the photoinitiation reaction. The ethylenediaminetetraacetic acid EDTA has a molecular structure very similar to TEA and therefore could replace it in this kind of photopolymers. The 4,4' azo-bis-(4-cyanopentanoic acid), ACPA, is a radical initiator that is soluble in water and usually used in polymerizations in solution with thermal initiation. In this work, we use EDTA and ACPA in order to check their properties as radical initiator in the photochemical reaction that takes place inside the photopolymer while a hologram is being recorded. We will compare the results obtained with those derived from TEA and will evaluate the possibilities for these substances.

VizieR Online Data Catalog: Supernova matter EOS (Buyukcizmeci+, 2014)

NASA Astrophysics Data System (ADS)

Buyukcizmeci, N.; Botvina, A. S.; Mishustin, I. N.

2017-03-01

The Statistical Model for Supernova Matter (SMSM) was developed in Botvina & Mishustin (2004, PhLB, 584, 233 ; 2010, NuPhA, 843, 98) as a direct generalization of the Statistical Multifragmentation Model (SMM; Bondorf et al. 1995, PhR, 257, 133). We treat supernova matter as a mixture of nuclear species, electrons, and photons in statistical equilibrium. The SMSM EOS tables cover the following ranges of control parameters: 1. Temperature: T = 0.2-25 MeV; for 35 T values. 2. Electron fraction Ye: 0.02-0.56; linear mesh of Ye = 0.02, giving 28 Ye values. It is equal to the total proton fraction Xp, due to charge neutrality. 3. Baryon number density fraction {rho}/{rho}0 = (10-8-0.32), giving 31 {rho}/{rho}0 values. (2 data files).

Biodegradation of Polychlorinated Methanes in Methanogenic Systems

DTIC Science & Technology

1991-01-01

occurring toxicant and C-1 growth substrate. J. General Microbiol. 132:1139-1142. 18. Hoover, S. R. and N. Porges. 1952. Assimilation of dairy wastes by...carbon and electron donor source; (3) to examine the level of micronutrients - provided as yeast extract (YE) - needed in the system feed; (4) to...provided the electron donor needed to consume oxygen and lower the redox potential in the precolumn; YE provided micronutrients . No reductant (Na2S

Pseudomonas aeruginosa uses a cyclic-di-GMP-regulated adhesin to reinforce the biofilm extracellular matrix

PubMed Central

Borlee, Bradley R; Goldman, Aaron D; Murakami, Keiji; Samudrala, Ram; Wozniak, Daniel J; Parsek, Matthew R

2010-01-01

Pseudomonas aeruginosa, the principal pathogen of cystic fibrosis patients, forms antibiotic-resistant biofilms promoting chronic colonization of the airways. The extracellular (EPS) matrix is a crucial component of biofilms that provides the community multiple benefits. Recent work suggests that the secondary messenger, cyclic-di-GMP, promotes biofilm formation. An analysis of factors specifically expressed in P. aeruginosa under conditions of elevated c-di-GMP, revealed functions involved in the production and maintenance of the biofilm extracellular matrix. We have characterized one of these components, encoded by the PA4625 gene, as a putative adhesin and designated it cdrA. CdrA shares structural similarities to extracellular adhesins that belong to two-partner secretion systems. The cdrA gene is in a two gene operon that also encodes a putative outer membrane transporter, CdrB. The cdrA gene encodes a 220 KDa protein that is predicted to be rod-shaped protein harbouring a β-helix structural motif. Western analysis indicates that the CdrA is produced as a 220 kDa proprotein and processed to 150 kDa before secretion into the extracellular medium. We demonstrated that cdrAB expression is minimal in liquid culture, but is elevated in biofilm cultures. CdrAB expression was found to promote biofilm formation and auto-aggregation in liquid culture. Aggregation mediated by CdrA is dependent on the Psl polysaccharide and can be disrupted by adding mannose, a key structural component of Psl. Immunoprecipitation of Psl present in culture supernatants resulted in co-immunoprecipitation of CdrA, providing additional evidence that CdrA directly binds to Psl. A mutation in cdrA caused a decrease in biofilm biomass and resulted in the formation of biofilms exhibiting decreased structural integrity. Psl-specific lectin staining suggests that CdrA either cross-links Psl polysaccharide polymers and/or tethers Psl to the cells, resulting in increased biofilm structural stability. Thus, this study identifies a key protein structural component of the P. aeruginosa EPS matrix. PMID:20088866

Update on the NASA Glenn PSL Ice Crystal Cloud Characterization (2016)

NASA Technical Reports Server (NTRS)

Van Zante, J.; Bencic, T.; Ratvasky, Thomas P.; Struk, Peter M.

2016-01-01

NASA Glenn's Propulsion Systems Laboratory (PSL) is an altitude engine research test facility capable of producing ice-crystal and supercooled liquid clouds. The cloud characterization parameter space is fairly large and complex, but the phase of the cloud seems primarily governed by wet bulb temperature. The presentation will discuss some of the issues uncovered through four cloud characterization efforts to date, as well as some of instrumentation that has been used to characterize cloud parameters including cloud uniformity, bulk total water content, median volumetric diameter and max-diameter, percent freeze-out, relative humidity, and an update on the NASA Glenn PSL Ice Crystal Cloud Characterization (2016).

OpenIPSL: Open-Instance Power System Library - Update 1.5 to "iTesla Power Systems Library (iPSL): A Modelica library for phasor time-domain simulations"

NASA Astrophysics Data System (ADS)

Baudette, Maxime; Castro, Marcelo; Rabuzin, Tin; Lavenius, Jan; Bogodorova, Tetiana; Vanfretti, Luigi

2018-01-01

This paper presents the latest improvements implemented in the Open-Instance Power System Library (OpenIPSL). The OpenIPSL is a fork from the original iTesla Power Systems Library (iPSL) by some of the original developers of the iPSL. This fork's motivation comes from the will of the authors to further develop the library with additional features tailored to research and teaching purposes. The enhancements include improvements to existing models, the addition of a new package of three phase models, and the implementation of automated tests through continuous integration.

The Influence of Added Mass on Optimal Step Length in Running.

PubMed

Reenalda, Jasper; Maas, Maurice T F; de Koning, Jos J

2016-10-01

To examine the influence of induced changes in the morphology of the leg by adding mass on the optimal step length (OSL) in experienced runners to get more insight into parameters that influence preferred step length (PSL) and OSL. Thirteen experienced male runners (mean age 26.9 ± 6.1 y, height 183.7 ± 7.1 cm, mass 71.8 ± 5.9 kg) ran on a treadmill in 3 different conditions: unloaded (UL), loaded with 2 kg mass at the ankles (MA), and loaded with 2 kg mass at the hips (MH) at 7 different step lengths (SLs). SL deviations were expressed as deviations in relative leg length (%LL) from the individual PSL: 0%LL, ±5%LL, ±10%LL, and ±15%LL. Trials lasted 8 min, and 8 min of rest was given between trials. Oxygen uptake (V̇O 2 ) was expressed as a fraction of V̇O 2 at PSL + 0%LL in the unloaded condition (%V̇O 2 ). The %SL with the lowest value of %V̇O 2 was considered the OSL for this group of participants. OSL at the UL condition was 6% shorter than PSL. The MA condition resulted in a 7%LL larger OSL than at UL and MH (P < .05). The mass distribution of the leg is a determinant of the OSL. As a consequence of the added mass to the ankles, OSL was 7%LL longer. Morphological characteristics of the leg might therefore play an important role in determining the runner's individual optimal SL.

Interferon-free treatment for patients with chronic hepatitis C and autoimmune liver disease: higher SVR rates with special precautions for deterioration of autoimmune hepatitis

PubMed Central

Kanda, Tatsuo; Yasui, Shin; Nakamura, Masato; Nakamoto, Shingo; Takahashi, Koji; Wu, Shuang; Sasaki, Reina; Haga, Yuki; Ogasawara, Sadahisa; Saito, Tomoko; Kobayashi, Kazufumi; Kiyono, Soichiro; Ooka, Yoshihiko; Suzuki, Eiichiro; Chiba, Tetsuhiro; Maruyama, Hitoshi; Imazeki, Fumio; Moriyama, Mitsuhiko; Kato, Naoya

2018-01-01

Background Interferon-free treatment can achieve higher sustained virological response (SVR) rates, even in patients in whom hepatitis C virus (HCV) could not be eradicated in the interferon treatment era. Immune restoration in the liver is occasionally associated with HCV infection. We examined the safety and effects of interferon-free regimens on HCV patients with autoimmune liver diseases. Results All 7 HCV patients with autoimmune hepatitis (AIH) completed treatment and achieved SVR. Three patients took prednisolone (PSL) at baseline, and 3 did not take PSL during interferon-free treatment. In one HCV patient with AIH and cirrhosis, PSL were not administered at baseline, but she needed to take 40 mg/day PSL at week 8 for liver dysfunction. She also complained back pain and was diagnosed with vasospastic angina by coronary angiography at week 11. However, she completed interferon-free treatment. All 5 HCV patients with primary biliary cholangitis (PBC) completed treatment and achieved SVR. Three of these HCV patients with PBC were treated with UDCA during interferon-free treatment. Conclusions Interferon-free regimens could result in higher SVR rates in HCV patients with autoimmune liver diseases. As interferon-free treatment for HCV may have an effect on hepatic immunity and activity of the autoimmune liver diseases, careful attention should be paid to unexpected adverse events in their treatments. Methods Total 12 patients with HCV and autoimmune liver diseases [7 AIH and PBC], who were treated with interferon-free regimens, were retrospectively analyzed. PMID:29545925

Enhanced coal-dependent methanogenesis coupled with algal biofuels: Potential water recycle and carbon capture

USGS Publications Warehouse

Barnhart, Elliott P.; Davis, Katherine J.; Varonka, Matthew; Orem, William H.; Cunningham, Alfred B.; Ramsay, Bradley D.; Fields, Matthew W.

2017-01-01

Many coal beds contain microbial communities that can convert coal to natural gas (coalbed methane). Native microorganisms were obtained from Powder River Basin (PRB) coal seams with a diffusive microbial sampler placed downhole and used as an inoculum for enrichments with different nutrients to investigate microbially-enhanced coalbed methane production (MECoM). Coal-dependent methanogenesis more than doubled when yeast extract (YE) and several less complex components (proteins and amino acids) were added to the laboratory microcosms. Stimulated coal-dependent methanogenesis with peptone was 86% of that with YE while glutamate-stimulated activity was 65% of that with YE, and a vitamin mix had only 33% of the YE stimulated activity. For field application of MECoM, there is interest in identifying cost-effective alternatives to YE and other expensive nutrients. In laboratory studies, adding algal extract (AE) with lipids removed stimulated coal-dependent methanogenesis and the activity was 60% of that with YE at 27 d and almost 90% of YE activity at 1406 d. Analysis of British Thermal Unit (BTU) content of coal (a measure of potential energy yield) from long-term incubations indicated > 99.5% of BTU content remained after coalbed methane (CBM) stimulation with either AE or YE. Thus, the coal resource remains largely unchanged following stimulated microbial methane production. Algal CBM stimulation could lead to technologies that utilize coupled biological systems (photosynthesis and methane production) that sustainably enhance CBM production and generate algal biofuels while also sequestering carbon dioxide (CO2).

Global Particle Size Distributions: Measurements during the Atmospheric Tomography (ATom) Project

NASA Astrophysics Data System (ADS)

Brock, C. A.; Williamson, C.; Kupc, A.; Froyd, K. D.; Richardson, M.; Weinzierl, B.; Dollner, M.; Schuh, H.; Erdesz, F.

2016-12-01

The Atmospheric Tomography (ATom) project is a three-year NASA-sponsored program to map the spatial and temporal distribution of greenhouse gases, reactive species, and aerosol particles from the Arctic to the Antarctic. In situ measurements are being made on the NASA DC-8 research aircraft, which will make four global circumnavigations of the Earth over the mid-Pacific and mid-Atlantic Oceans while continuously profiling between 0.2 and 13 km altitude. In situ microphysical measurements will provide an unique and unprecedented dataset of aerosol particle size distributions between 0.004 and 50 µm diameter. This unbiased, representative dataset allows investigation of new particle formation in the remote troposphere, placing strong observational constraints on the chemical and physical mechanisms that govern particle formation and growth to cloud-active sizes. Particles from 0.004 to 0.055 µm are measured with 10 condensation particle counters. Particles with diameters from 0.06 to 1.0 µm are measured with one-second resolution using two ultra-high sensitivity aerosol size spectrometers (UHSASes). A laser aerosol spectrometer (LAS) measures particle size distributions between 0.12 and 10 µm in diameter. Finally, a cloud, aerosol and precipitation spectrometer (CAPS) underwing optical spectrometer probe sizes ambient particles with diameters from 0.5 to 50 µm and images and sizes precipitation-sized particles. Additional particle instruments on the payload include a high-resolution time-of-flight aerosol mass spectrometer and a single particle laser-ablation aerosol mass spectrometer. The instruments are calibrated in the laboratory and on the aircraft. Calibrations are checked in flight by introducing four sizes of polystyrene latex (PSL) microspheres into the sampling inlet. The CAPS probe is calibrated using PSL and glass microspheres that are aspirated into the sample volume. Comparisons between the instruments and checks with the calibration aerosol indicate flight performance within uncertainties expected from laboratory calibrations. Analysis of data from the first ATom circuit in August 2016 shows high concentrations of newly formed particles in the tropical middle and upper troposphere and Arctic lower troposphere.

Fractionation of yeast extract by nanofiltration process to assess key compounds involved in CHO cell culture improvement.

PubMed

Mosser, Mathilde; Kapel, Romain; Chevalot, Isabelle; Olmos, Eric; Marc, Ivan; Marc, Annie; Oriol, Eric

2015-01-01

Yeast extract (YE) is known to greatly enhance mammalian cell culture performances, but its undefined composition decreases process reliability. Accordingly, in the present study, the nature of YE compounds involved in the improvement of recombinant CHO cell growth and IgG production was investigated. First, the benefits of YE were verified, revealing that it increased maximal concentrations of viable cells and IgG up to 73 and 60%, respectively compared to a reference culture. Then, the analyses of YE composition highlighted the presence of molecules such as amino acids, vitamins, salts, nucleobase, and glucose that were contained in reference medium, while others including peptides, trehalose, polysaccharides, and nucleic acids were not. Consequently, YE was fractionated by a nanofiltration process to deeper evaluate its effects on CHO cell cultures. The YE molecules already contained in reference medium were mainly isolated in the permeate fraction together with trehalose and short peptides, while other molecules were concentrated in the retentate. Permeate, which was free of macromolecules, exhibited a similar positive effect than raw YE on maximal concentrations. Additional studies on cell energetic metabolism underlined that dipeptides and tripeptides in permeate were used as an efficient source of nitrogenous substrates. © 2015 American Institute of Chemical Engineers.

Enhanced coal-dependent methanogenesis coupled with algal biofuels: Potential water recycle and carbon capture

DOE Office of Scientific and Technical Information (OSTI.GOV)

Barnhart, Elliott P.; Davis, Katherine J.; Varonka, Matthew

Many coal beds contain microbial communities that can convert coal to natural gas (coalbed methane). Native microorganisms were obtained from Powder River Basin (PRB) coal seams with a diffusive microbial sampler placed downhole and used as an inoculum for enrichments with different nutrients to investigate microbially-enhanced coalbed methane production (MECoM). Coal-dependent methanogenesis more than doubled when yeast extract (YE) and several less complex components (proteins and amino acids) were added to the laboratory microcosms. Stimulated coal-dependent methanogenesis with peptone was 86% of that with YE while glutamate-stimulated activity was 65% of that with YE, and a vitamin mix had onlymore » 33% of the YE stimulated activity. For field application of MECoM, there is interest in identifying cost-effective alternatives to YE and other expensive nutrients. In laboratory studies, adding algal extract (AE) with lipids removed stimulated coal-dependent methanogenesis and the activity was 60% of that with YE at 27 d and almost 90% of YE activity at 1406 d. Analysis of British Thermal Unit (BTU) content of coal (a measure of potential energy yield) from long-term incubations indicated > 99.5% of BTU content remained after coalbed methane (CBM) stimulation with either AE or YE. Thus, the coal resource remains largely unchanged following stimulated microbial methane production. Algal CBM stimulation could lead to technologies that utilize coupled biological systems (photosynthesis and methane production) that sustainably enhance CBM production and generate algal biofuels while also sequestering carbon dioxide (CO 2).« less

Enhanced coal-dependent methanogenesis coupled with algal biofuels: Potential water recycle and carbon capture

DOE PAGES

Barnhart, Elliott P.; Davis, Katherine J.; Varonka, Matthew; ...

2017-01-05

Many coal beds contain microbial communities that can convert coal to natural gas (coalbed methane). Native microorganisms were obtained from Powder River Basin (PRB) coal seams with a diffusive microbial sampler placed downhole and used as an inoculum for enrichments with different nutrients to investigate microbially-enhanced coalbed methane production (MECoM). Coal-dependent methanogenesis more than doubled when yeast extract (YE) and several less complex components (proteins and amino acids) were added to the laboratory microcosms. Stimulated coal-dependent methanogenesis with peptone was 86% of that with YE while glutamate-stimulated activity was 65% of that with YE, and a vitamin mix had onlymore » 33% of the YE stimulated activity. For field application of MECoM, there is interest in identifying cost-effective alternatives to YE and other expensive nutrients. In laboratory studies, adding algal extract (AE) with lipids removed stimulated coal-dependent methanogenesis and the activity was 60% of that with YE at 27 d and almost 90% of YE activity at 1406 d. Analysis of British Thermal Unit (BTU) content of coal (a measure of potential energy yield) from long-term incubations indicated > 99.5% of BTU content remained after coalbed methane (CBM) stimulation with either AE or YE. Thus, the coal resource remains largely unchanged following stimulated microbial methane production. Algal CBM stimulation could lead to technologies that utilize coupled biological systems (photosynthesis and methane production) that sustainably enhance CBM production and generate algal biofuels while also sequestering carbon dioxide (CO 2).« less

Hyperserotonemia in Adults with Autistic Disorder

ERIC Educational Resources Information Center

Hranilovic, Dubravka; Bujas-Petkovic, Zorana; Vragovic, Renata; Vuk, Tomislav; Hock, Karlo; Jernej, Branimir

2007-01-01

Hyperserotonemia is the most consistent serotonin-related finding in autism. The basis of this phenomenon, and its relationship to the central serotonergic dysfunction remains unclear. Platelet serotonin level (PSL) in 53 autistic adults and 45 healthy controls was measured. Mean PSL in autistic group (75.7 [plus or minus] 37.4 ng/[microliters])…

Bioresponsive release of insulin-like growth factor-I from its PEGylated conjugate.

PubMed

Braun, Alexandra C; Gutmann, Marcus; Mueller, Thomas D; Lühmann, Tessa; Meinel, Lorenz

2018-06-10

PEGylation of protein ligands, the attachment of polyethylene glycol (PEG) polymers to a therapeutic protein, increases therapeutics' half-life but frequently comes at the cost of reduced bioactivity. We are now presenting a bioinspired strategy leading out of this dilemma. To this end, we selected a position within insulin-like growth factor I (IGF-I) for decoration with a PEG 30kDa -modified protease-sensitive peptide linker (PSL) using a combination of enzymatic and chemical bioorthogonal coupling strategies. The PSL sequence responded to matrix metalloproteinases (MMP) to provide a targeted release in diseased tissue. The IGF-PSL-PEG conjugate had different binding protein affinity, cell proliferation, and endocytosis patterns as compared to the wild type. Exposure of the conjugate to elevated levels of activated MMPs, as present in inflamed tissues, fully reestablished the wild type properties through effective PSL cleavage. In conclusion, this bioinspired approach provided a blueprint for PEGylated therapeutics combining the pharmacokinetic advantages of PEGylation, while locally restoring the full suite of biological potential of therapeutics. Copyright © 2018 Elsevier B.V. All rights reserved.

Biogenic mineral production by a novel arsenic-metabolizing thermophilic bacterium from the Alvord Basin, Oregon.

PubMed

Ledbetter, Rhesa N; Connon, Stephanie A; Neal, Andrew L; Dohnalkova, Alice; Magnuson, Timothy S

2007-09-01

The Alvord Basin in southeast Oregon contains a variety of hydrothermal features which have never been microbiologically characterized. A sampling of Murky Pot (61 degrees C; pH 7.1) led to the isolation of a novel arsenic-metabolizing organism (YeAs) which produces an arsenic sulfide mineral known as beta-realgar, a mineral that has not previously been observed as a product of bacterial arsenic metabolism. YeAs was grown on a freshwater medium and utilized a variety of organic substrates, particularly carbohydrates and organic acids. The temperature range for growth was 37 to 75 degrees C (optimum, 55 degrees C), and the pH range for growth was 6.0 to 8.0 (optimum, pH 7.0 to 7.5). No growth was observed when YeAs was grown under aerobic conditions. The doubling time when the organism was grown with yeast extract and As(V) was 0.71 h. Microscopic examination revealed Gram stain-indeterminate, non-spore-forming, nonmotile, rod-shaped cells, with dimensions ranging from 0.1 to 0.2 microm wide by 3 to 10 microm long. Arsenic sulfide mineralization of cell walls and extracellular arsenic sulfide particulate deposition were observed with electron microscopy and elemental analysis. 16S rRNA gene analysis placed YeAs in the family Clostridiaceae and indicated that the organism is most closely related to the Caloramator and Thermobrachium species. The G+C content was 35%. YeAs showed no detectable respiratory arsenate reductase but did display significant detoxification arsenate reductase activity. The phylogenetic, physiological, and morphological characteristics of YeAs demonstrate that it is an anaerobic, moderately thermophilic, arsenic-reducing bacterium. This organism and its associated metabolism could have major implications in the search for innovative methods for arsenic waste management and in the search for novel biogenic mineral signatures.

An Online Respiratory Quotient-Feedback Strategy of Feeding Yeast Extract for Efficient Arachidonic Acid Production by Mortierella alpina

PubMed Central

Li, Xiangyu; Yu, Chao; Yao, Jianming; Wang, Zhiming; Lu, Shuhuan

2018-01-01

Mortierella alpina (M. alpina) is well known for arachidonic acid (ARA) production. However, low efficiency and unstableness are long existed problems for industrial production of ARA by M. alpina due to the lack of online regulations. The aim of the present work is to develop an online-regulation strategy for efficient and stable ARA production in industry. The strategy was developed in 50 L fermenters and then applied in a 200 m3 fermenter. Results indicated that yeast extract (YE) highly increased cell growth in shake flask, it was then used in bioreactor fermentation by various feeding strategies. Feeding YE to control respiratory quotient (RQ) at 1.1 during 0–48 h and at 1.5 during 48–160 h, dry cell weight, and ARA titer reached 53.1 and 11.49 g/L in 50 L fermenter, which were increased by 79.4 and 36.9% as compared to that without YE feeding, respectively. Then, the online RQ-feedback strategy was applied in 200 m3 bioreactor fermentation and an average ARA titer of 16.82 g/L was obtained from 12 batches, which was 41.0% higher than the control batches. This is the first report on successful application of online RQ-feedback control of YE in ARA production, especially in an industrial scale of 200 m3 fermentation. It could be applied to other industrial production of microbial oil by oleaginous microorganisms. PMID:29404320

Exopolysaccharide biosynthetic glycoside hydrolases can be utilized to disrupt and prevent Pseudomonas aeruginosa biofilms.

PubMed

Baker, Perrin; Hill, Preston J; Snarr, Brendan D; Alnabelseya, Noor; Pestrak, Matthew J; Lee, Mark J; Jennings, Laura K; Tam, John; Melnyk, Roman A; Parsek, Matthew R; Sheppard, Donald C; Wozniak, Daniel J; Howell, P Lynne

2016-05-01

Bacterial biofilms present a significant medical challenge because they are recalcitrant to current therapeutic regimes. A key component of biofilm formation in the opportunistic human pathogen Pseudomonas aeruginosa is the biosynthesis of the exopolysaccharides Pel and Psl, which are involved in the formation and maintenance of the structural biofilm scaffold and protection against antimicrobials and host defenses. Given that the glycoside hydrolases PelAh and PslGh encoded in the pel and psl biosynthetic operons, respectively, are utilized for in vivo exopolysaccharide processing, we reasoned that these would provide specificity to target P. aeruginosa biofilms. Evaluating these enzymes as potential therapeutics, we demonstrate that these glycoside hydrolases selectively target and degrade the exopolysaccharide component of the biofilm matrix. PelAh and PslGh inhibit biofilm formation over a 24-hour period with a half maximal effective concentration (EC50) of 69.3 ± 1.2 and 4.1 ± 1.1 nM, respectively, and are capable of disrupting preexisting biofilms in 1 hour with EC50 of 35.7 ± 1.1 and 12.9 ± 1.1 nM, respectively. This treatment was effective against clinical and environmental P. aeruginosa isolates and reduced biofilm biomass by 58 to 94%. These noncytotoxic enzymes potentiated antibiotics because the addition of either enzyme to a sublethal concentration of colistin reduced viable bacterial counts by 2.5 orders of magnitude when used either prophylactically or on established 24-hour biofilms. In addition, PelAh was able to increase neutrophil killing by ~50%. This work illustrates the feasibility and benefits of using bacterial exopolysaccharide biosynthetic glycoside hydrolases to develop novel antibiofilm therapeutics.

Exopolysaccharide biosynthetic glycoside hydrolases can be utilized to disrupt and prevent Pseudomonas aeruginosa biofilms

PubMed Central

Baker, Perrin; Hill, Preston J.; Snarr, Brendan D.; Alnabelseya, Noor; Pestrak, Matthew J.; Lee, Mark J.; Jennings, Laura K.; Tam, John; Melnyk, Roman A.; Parsek, Matthew R.; Sheppard, Donald C.; Wozniak, Daniel J.; Howell, P. Lynne

2016-01-01

Bacterial biofilms present a significant medical challenge because they are recalcitrant to current therapeutic regimes. A key component of biofilm formation in the opportunistic human pathogen Pseudomonas aeruginosa is the biosynthesis of the exopolysaccharides Pel and Psl, which are involved in the formation and maintenance of the structural biofilm scaffold and protection against antimicrobials and host defenses. Given that the glycoside hydrolases PelAh and PslGh encoded in the pel and psl biosynthetic operons, respectively, are utilized for in vivo exopolysaccharide processing, we reasoned that these would provide specificity to target P. aeruginosa biofilms. Evaluating these enzymes as potential therapeutics, we demonstrate that these glycoside hydrolases selectively target and degrade the exopolysaccharide component of the biofilm matrix. PelAh and PslGh inhibit biofilm formation over a 24-hour period with a half maximal effective concentration (EC50) of 69.3 ± 1.2 and 4.1 ± 1.1 nM, respectively, and are capable of disrupting preexisting biofilms in 1 hour with EC50 of 35.7 ± 1.1 and 12.9 ± 1.1 nM, respectively. This treatment was effective against clinical and environmental P. aeruginosa isolates and reduced biofilm biomass by 58 to 94%. These noncytotoxic enzymes potentiated antibiotics because the addition of either enzyme to a sublethal concentration of colistin reduced viable bacterial counts by 2.5 orders of magnitude when used either prophylactically or on established 24-hour biofilms. In addition, PelAh was able to increase neutrophil killing by ~50%. This work illustrates the feasibility and benefits of using bacterial exopolysaccharide biosynthetic glycoside hydrolases to develop novel antibiofilm therapeutics. PMID:27386527

Liberia's Experiment with Privatising Education: A Critical Analysis of the RCT Study

ERIC Educational Resources Information Center

Klees, Steven J.

2018-01-01

To experiment with the possible privatisation of its primary education system, Liberia initiated the Partnership Schools of Liberia (PSL), which turned over the management of 93 public schools to eight private contractors. A randomised controlled trial (RCT) study was initiated comparing the PSL schools with matched public schools and the results…

An application of computer aided requirements analysis to a real time deep space system

NASA Technical Reports Server (NTRS)

Farny, A. M.; Morris, R. V.; Hartsough, C.; Callender, E. D.; Teichroew, D.; Chikofsky, E.

1981-01-01

The entire procedure of incorporating the requirements and goals of a space flight project into integrated, time ordered sequences of spacecraft commands, is called the uplink process. The Uplink Process Control Task (UPCT) was created to examine the uplink process and determine ways to improve it. The Problem Statement Language/Problem Statement Analyzer (PSL/PSA) designed to assist the designer/analyst/engineer in the preparation of specifications of an information system is used as a supporting tool to aid in the analysis. Attention is given to a definition of the uplink process, the definition of PSL/PSA, the construction of a PSA database, the value of analysis to the study of the uplink process, and the PSL/PSA lessons learned.

Dynamic Remodeling of Microbial Biofilms by Functionally Distinct Exopolysaccharides

PubMed Central

Chew, Su Chuen; Kundukad, Binu; Seviour, Thomas; van der Maarel, Johan R. C.; Yang, Liang; Rice, Scott A.; Doyle, Patrick

2014-01-01

ABSTRACT Biofilms are densely populated communities of microbial cells protected and held together by a matrix of extracellular polymeric substances. The structure and rheological properties of the matrix at the microscale influence the retention and transport of molecules and cells in the biofilm, thereby dictating population and community behavior. Despite its importance, quantitative descriptions of the matrix microstructure and microrheology are limited. Here, particle-tracking microrheology in combination with genetic approaches was used to spatially and temporally study the rheological contributions of the major exopolysaccharides Pel and Psl in Pseudomonas aeruginosa biofilms. Psl increased the elasticity and effective cross-linking within the matrix, which strengthened its scaffold and appeared to facilitate the formation of microcolonies. Conversely, Pel reduced effective cross-linking within the matrix. Without Psl, the matrix becomes more viscous, which facilitates biofilm spreading. The wild-type biofilm decreased in effective cross-linking over time, which would be advantageous for the spreading and colonization of new surfaces. This suggests that there are regulatory mechanisms to control production of the exopolysaccharides that serve to remodel the matrix of developing biofilms. The exopolysaccharides were also found to have profound effects on the spatial organization and integration of P. aeruginosa in a mixed-species biofilm model of P. aeruginosa-Staphylococcus aureus. Pel was required for close association of the two species in mixed-species microcolonies. In contrast, Psl was important for P. aeruginosa to form single-species biofilms on top of S. aureus biofilms. Our results demonstrate that Pel and Psl have distinct physical properties and functional roles during biofilm formation. PMID:25096883

Pulmonary Delivery of Anti-Tubercular Drugs Using Ligand Anchored pH Sensitive Liposomes for the Treatment of Pulmonary Tuberculosis.

PubMed

Bhardwaj, Ankur; Grobler, Anne; Rath, Goutam; Goyal, Amit Kumar; Jain, Amit Kumar; Mehta, Abhinav

2016-01-01

Mycobacterium tuberculosis (M. TB) remains the prime cause of bacterial mortality and morbidity world-wide. Therefore, effective delivery and targeting of drug to the cellular tropics is essentially required to generate significant results for tuberculosis treatment. The aim of the present study was to develop and characterize ligand anchored pH sensitive liposomes (TPSL) as dry powder inhaler for the targeted delivery of drugs in the target site i.e. lungs. Ligand anchored PSL (TPSL) was prepared by thin film hydration for the combined delivery of Isoniazid (INH) and Ciprofloxacin HCl (CIP HCl) using 4-aminophenyl-α-D mannopyranoside (Man) as surface functionalized ligand and characterized using different parameters. It was observed that size of the ligand anchored liposomes (TPSL) was slightly more than the non-ligand anchored liposomes (PSL). Drug release was studied at different pH for 24 hrs and it was observed that liposomes exhibited slow release at alkaline pH (58-64%) as compared to macrophage pH (81-87%) where it increased dramatically due to the destabilization of pH sensitive liposome (PSL). In vitro cellular uptake study showed that much higher concentration was achieved in the alveolar macrophage using ligand anchored liposomes as compared to its counterpart. In vivo study showed that maximum drug accumulation was achieved in the lung by delivering drug using ligand anchored PSL as compared to conventional PSL. It was concluded that ligand anchored pH sensitive liposome is one of the promising systems for the targeted drug therapy in pulmonary tuberculosis.

Benefits of High-dose Steroid + Hespander + Mannitol Administration in the Treatment of Bell's Palsy.

PubMed

Furukawa, Takatoshi; Abe, Yasuhiro; Ito, Tsukasa; Kubota, Toshinori; Kakehata, Seiji

2017-02-01

Large-scale investigations have not been recently conducted on the efficacy of high-dose steroid administration of prednisolone (PSL) for Bell's palsy. We compared treatment results between normal-dose steroid (PSL 60 mg/d) and high-dose steroid (PSL 200 mg/d) + Hespander + Mannitol administration. We also investigated the recovery rate for antiviral agents. Retrospective case review. Tertiary referral center. A total of 675 patients with Bell's palsy who had grade V and grade VI on the House-Brackmann (HB) scale were treated in our department between 1995 and 2014. These patients could be divided into a normal-dose group and high-dose group. We separately assessed treatment outcomes for HB grade V patients and HB grade VI patients. Logistic regression analysis was also performed to investigate factors that can impact treatment outcomes, i.e., sex, age, days to start of treatment, PSL dosage, and antiviral drug administration. Recovery rates were significantly better in the high-dose steroid + Hespander + Mannitol group in comparison with the normal-dose steroid group for HB grade V (100% versus 77.7%) and HB grade VI (92.5% versus 68.2%). Additional effects of antiviral agents were only shown in the normal-dose group. Significant factors for treatment outcomes were PSL 200 mg/d administration and early initiation of treatment. Insignificant factors were sex, age, and the antiviral agent. We showed the high-dose steroid + Hespander + Mannitol administration produced significantly better outcomes than normal-dose steroid administration in the treatment of patients with Bell's palsy.

Unimodular sequence design under frequency hopping communication compatibility requirements

NASA Astrophysics Data System (ADS)

Ge, Peng; Cui, Guolong; Kong, Lingjiang; Yang, Jianyu

2016-12-01

The integrated design for both radar and anonymous communication has drawn more attention recently since wireless communication system appeals to enhance security and reliability. Given the frequency hopping (FH) communication system, an effective way to realize integrated design is to meet the spectrum compatibility between these two systems. The paper deals with a unimodular sequence design technique which considers optimizing both the spectrum compatibility and peak sidelobes levels (PSL) of auto-correlation function (ACF). The spectrum compatibility requirement realizes anonymous communication for the FH system and provides this system lower probability of intercept (LPI) since the spectrum of the FH system is hidden in that of the radar system. The proposed algorithm, named generalized fitting template (GFT) technique, converts the sequence optimization design problem to a iterative fitting process. In this process, the power spectrum density (PSD) and PSL behaviors of the generated sequences fit both PSD and PSL templates progressively. Two templates are established based on the spectrum compatibility requirement and the expected PSL. As noted, in order to ensure the communication security and reliability, spectrum compatibility requirement is given a higher priority to achieve in the GFT algorithm. This algorithm realizes this point by adjusting the weight adaptively between these two terms during the iteration process. The simulation results are analyzed in terms of bit error rate (BER), PSD, PSL, and signal-interference rate (SIR) for both the radar and FH systems. The performance of GFT is compared with SCAN, CAN, FRE, CYC, and MAT algorithms in the above aspects, which shows its good effectiveness.

RGD(Arg-Gly-Asp) internalized docetaxel-loaded pH sensitive liposomes: Preparation, characterization and antitumor efficacy in vivo and in vitro.

PubMed

Zuo, Tiantian; Guan, Yuanyuan; Chang, Minglu; Zhang, Fang; Lu, Shanshan; Wei, Ting; Shao, Wei; Lin, Guimei

2016-11-01

The goal of this research was to formulate dual-targeting liposomes (RGD/DTX-PSL) that can selectively release loaded contents in a low pH level environment and to actively target to the tumor using liposomes that had surface arginine-glycine-aspartic (RGD) tripeptides. We investigated whether RGD/DTX-PSL could serve as an effective tumor-targeted nanoparticle that is capable of suppressing tumor growth. The results suggest that DTX is released from liposomes faster at pH 5.0 than pH 7.4, demonstrating their pH sensitivity. RGD/DTX-PSL has a longer blood circulation than Duopafei(®) in rats. The RGD/DTX-PSL formulation displayed stronger antiproliferative effects than DTX alone and the strongest inhibition of tumor growth of the formulations tested, thus expanding therapeutic window of DTX. In conclusion, we established a novel, promising and easy-to-handle liposome formulation that has a considerable antitumor activity in vitro and in vivo. This study provides important prerequisite for the clinical application of dual-targeting liposomes in delivering therapies. Copyright © 2016 Elsevier B.V. All rights reserved.

Mixed-Integer Nonconvex Quadratic Optimization Relaxations and Performance Analysis

DTIC Science & Technology

2016-10-11

Analysis of Interior Point Algorithms for Non-Lipschitz and Nonconvex Minimization,” (W. Bian, X. Chen, and Ye), Math Programming, 149 (2015) 301-327...Chen, Ge, Wang, Ye), Math Programming, 143 (1-2) (2014) 371-383. This paper resolved an important open question in cardinality constrained...Statistical Performance, and Algorithmic Theory for Local Solutions,” (H. Liu, T. Yao, R. Li, Y. Ye) manuscript, 2nd revision in Math Programming

FAME, a microprocessor based front-end analysis and modeling environment

NASA Technical Reports Server (NTRS)

Rosenbaum, J. D.; Kutin, E. B.

1980-01-01

Higher order software (HOS) is a methodology for the specification and verification of large scale, complex, real time systems. The HOS methodology was implemented as FAME (front end analysis and modeling environment), a microprocessor based system for interactively developing, analyzing, and displaying system models in a low cost user-friendly environment. The nature of the model is such that when completed it can be the basis for projection to a variety of forms such as structured design diagrams, Petri-nets, data flow diagrams, and PSL/PSA source code. The user's interface with the analyzer is easily recognized by any current user of a structured modeling approach; therefore extensive training is unnecessary. Furthermore, when all the system capabilities are used one can check on proper usage of data types, functions, and control structures thereby adding a new dimension to the design process that will lead to better and more easily verified software designs.

Effect of corticosteroids on phlebitis induced by intravenous infusion of antineoplastic agents in rabbits

PubMed Central

Kohno, Emiko; Murase, Saori; Matsuyama, Kenji; Okamura, Noboru

2009-01-01

Purpose: Phlebitis caused by intravenous infusion of antineoplastic agents is one of the critical problems when anticancer therapy is prolonged. We have already reported that both rapid infusion and dilution of the injection solution were effective methods for reducing phlebitis caused by vinorelbine (VNR) in rabbits. The aim of this study was to explore other practical methods for preventing phlebitis caused by VNR and doxorubicin (DXR) in a rabbit model. VNR is often used with cisplatin, and dexamethasone (DEX) has been co-administered for prevention of cisplatin-induced nausea. DXR is used with prednisolone (PSL) in the CHOP regimen for the treatment of non-Hodgkin's lymphoma. Therefore, the present study investigated the prevention of phlebitis due to VNR with DEX and that due to DXR with PSL. Methods: VNR and DXR were diluted with normal saline to prepare test solutions at concentrations of 0.6 mg/mL and 1.4 mg/mL, respectively. Each test solution was infused into the auricular veins of rabbits. Two days after VNR infusion and three days after DXR infusion, the veins were evaluated histopathologically. The effect of DEX on VNR-induced phlebitis was evaluated by infusion of DEX before or after VNR. The effect of PSL on DXR-induced phlebitis was similarly evaluated by co-infusion of PSL. Results: The histopathological features of phlebitis caused by the antineoplastic agents differed between VNR and DXR: VNR did not cause the loss of venous endothelial cells, but caused inflammatory cell infiltration, edema, and epidermal degeneration. In contrast, DXR caused the loss of venous endothelial cells and chrondrocyte necrosis. Pre-treatment and post-treatment with DEX significantly decreased VNR-induced phlebitis compared with the control group and pre-treatment was particularly effective. Co-infusion of PSL also significantly decreased phlebitis caused by DXR, but its effect was less marked. Conclusion: The present findings suggested that pre-treatment with DEX may be a useful method for preventing phlebitis due to VNR, and that co-infusion of PSL has the potential to prevent phlebitis caused by DXR. PMID:19680474

Effect of corticosteroids on phlebitis induced by intravenous infusion of antineoplastic agents in rabbits.

PubMed

Kohno, Emiko; Murase, Saori; Matsuyama, Kenji; Okamura, Noboru

2009-08-06

Phlebitis caused by intravenous infusion of antineoplastic agents is one of the critical problems when anticancer therapy is prolonged. We have already reported that both rapid infusion and dilution of the injection solution were effective methods for reducing phlebitis caused by vinorelbine (VNR) in rabbits. The aim of this study was to explore other practical methods for preventing phlebitis caused by VNR and doxorubicin (DXR) in a rabbit model. VNR is often used with cisplatin, and dexamethasone (DEX) has been co-administered for prevention of cisplatin-induced nausea. DXR is used with prednisolone (PSL) in the CHOP regimen for the treatment of non-Hodgkin's lymphoma. Therefore, the present study investigated the prevention of phlebitis due to VNR with DEX and that due to DXR with PSL. VNR and DXR were diluted with normal saline to prepare test solutions at concentrations of 0.6 mg/mL and 1.4 mg/mL, respectively. Each test solution was infused into the auricular veins of rabbits. Two days after VNR infusion and three days after DXR infusion, the veins were evaluated histopathologically. The effect of DEX on VNR-induced phlebitis was evaluated by infusion of DEX before or after VNR. The effect of PSL on DXR-induced phlebitis was similarly evaluated by co-infusion of PSL. The histopathological features of phlebitis caused by the antineoplastic agents differed between VNR and DXR: VNR did not cause the loss of venous endothelial cells, but caused inflammatory cell infiltration, edema, and epidermal degeneration. In contrast, DXR caused the loss of venous endothelial cells and chrondrocyte necrosis. Pre-treatment and post-treatment with DEX significantly decreased VNR-induced phlebitis compared with the control group and pre-treatment was particularly effective. Co-infusion of PSL also significantly decreased phlebitis caused by DXR, but its effect was less marked. The present findings suggested that pre-treatment with DEX may be a useful method for preventing phlebitis due to VNR, and that co-infusion of PSL has the potential to prevent phlebitis caused by DXR.

Effectiveness of antimicrobial photodynamic therapy using a 660 nm laser and methyline blue dye for inactivating Staphylococcus aureus biofilms in compact and cancellous bones: An in vitro study.

PubMed

Rosa, Luciano Pereira; Silva, Francine Cristina da; Nader, Sumaia Alves; Meira, Giselle Andrade; Viana, Magda Souza

2015-06-01

New therapeutic modalities such as antimicrobial photodynamic therapy (APDT) has been investigated in order to be a valid alternative to the treatment of infections caused by different microorganisms. This work evaluated the in vitro effectiveness of Antimicrobial Photodynamic Therapy (APDT) using 660 nm laser combined with methylene blue dye to inactivate Staphylococcus aureus (ATCC 25923) biofilms in compact and cancellous bones specimens. Eighty specimens of compact bone and 80 specimens of cancellous bone were contaminated with a standard suspension of S. aureus and incubated for 14 days at 37°C to induce the formation of biofilms. The specimens were then divided into groups (n = 10) according to the established treatment: PS-L- (control--no treatment), PS+L- (only AM for 5 min in the dark), PS-L+90 (only laser irradiation for 90 s), PS-L+180 (only laser irradiation for 180 s), PS-L+300 (only laser irradiation for 300 s), APDT90 (APDT for 90 s), APDT180 (APDT for 180 s), and APDT300 (APDT for 300 s). The findings were statistically analyzed by ANOVA 5%. All of the experimental treatments showed a significant reduction (log 10 CFU/mL) of S. aureus biofilms in compact and cancellous bones specimens compared with the control group, and the APDT group was the most effective. Compact specimens treated with APDT showed the greatest reduction in biofilms compared with cancellous specimens, regardless of length of treatment. APDT with methylene blue dye and a 660 nm laser proved to be effective in inactivating S. aureus biofilms formed in compact and cancellous bone. Copyright © 2015 Elsevier B.V. All rights reserved.

Overview on platelet preservation: better controls over storage lesion.

PubMed

Ohto, Hitoshi; Nollet, Kenneth E

2011-06-01

Platelet storage lesion (PSL), correlating with reduced in vivo recovery/survival and hemostatic capacity after transfusion, is characterized essentially by morphological and molecular evidence of platelet activation and energy consumption in the medium. Processes that limit shelf-life are multifactorial, and include both necrosis and apoptosis. PSL is greatly influenced by factors including duration of storage, temperature, ratio of platelet number to media volume, solution composition with respect to energy content and buffering capacity, and gas permeability of the container. Recent progress for slowing PSL has been made with storage media that more effectively fuel ATP production and buffer the inevitable effects of metabolism. Improved oxygen-permeability of containers also helps to maintain aerobic-dominant glycolysis. Patients stand to benefit from platelet products of higher intrinsic quality that store well until the moment of transfusion. Copyright © 2011. Published by Elsevier Ltd.

Electromagnetic Modeling of the Passive Stabilization Loop at EAST

NASA Astrophysics Data System (ADS)

Ji, Xiang; Song, Yuntao; Wu, Songtao; Wang, Zhibin; Shen, Guang; Liu, Xufeng; Cao, Lei; Zhou, Zibo; Peng, Xuebing; Wang, Chenghao

2012-09-01

A passive stabilization loop (PSL) has been designed and manufactured in order to enhance the control of vertical instability and accommodate the new stage for high-performance plasma at EAST. Eddy currents are induced by vertical displacement events (VDEs) and disruption, which can produce a magnetic field to control the vertical instability of the plasma in a short timescale. A finite element model is created and meshed using ANSYS software. Based on the simulation of plasma VDEs and disruption, the distribution and decay curve of the eddy currents on the PSL are obtained. The largest eddy current is 200 kA and the stress is 68 MPa at the outer current bridge, which is the weakest point of the PSL because of the eddy currents and the magnetic fields. The analysis results provide the supporting data for the structural design.

Parameter study of r-process lanthanide production and heating rates in kilonovae

NASA Astrophysics Data System (ADS)

Lippuner, Jonas; Roberts, Luke F.

2015-04-01

Explosive r-process nucleosynthesis in material ejected during compact object mergers may lead to radioactively powered transients called kilonovae. The timescale and peak luminosity of these transients are sensitive to the composition of the material after nuclear burning ceases, as the composition determines the local heating rate from nuclear decays and the opacity. The presence of lanthanides in the ejecta can drastically increase the opacity. We use the new general-purpose nuclear reaction network SkyNet to run a parameter study of r-process nucleosynthesis for a range of initial electron fractions Ye, initial entropies s, and density decay timescales τ. We find that the ejecta is lanthanide-free for Ye >~ 0 . 22 - 0 . 3 , depending on s and τ. The heating rate is insensitive to s and τ, but certain, larger values of Ye lead to reduced heating rates, because single nuclides dominate the heating. With a simple model we estimate the luminosity, time, and effective temperature at the peak of the light curve. Since the opacity is much lower in the lanthanide-free case, we find the luminosity peaks much earlier at ~ 1 day vs. ~ 15 days in the lanthanide-rich cases. Although there is significant variation in the heating rate with Ye, changes in the heating rate do not mitigate the effect of the lanthanides. This research is partially supported by NSF under Award Numbers AST-1333520 and AST-1205732.

Photostimulated near-infrared persistent luminescence as a new optical read-out from Cr3+-doped LiGa5O8

PubMed Central

Liu, Feng; Yan, Wuzhao; Chuang, Yen-Jun; Zhen, Zipeng; Xie, Jin; Pan, Zhengwei

2013-01-01

In conventional photostimulable storage phosphors, the optical information written by x-ray or ultraviolet irradiation is usually read out as a visible photostimulated luminescence (PSL) signal under the stimulation of a low-energy light with appropriate wavelength. Unlike the transient PSL, here we report a new optical read-out form, photostimulated persistent luminescence (PSPL) in the near-infrared (NIR), from a Cr3+-doped LiGa5O8 NIR persistent phosphor exhibiting a super-long NIR persistent luminescence of more than 1,000 h. An intense PSPL signal peaking at 716 nm can be repeatedly obtained in a period of more than 1,000 h when an ultraviolet-light (250–360 nm) pre-irradiated LiGa5O8:Cr3+ phosphor is repeatedly stimulated with a visible light or a NIR light. The LiGa5O8:Cr3+ phosphor has promising applications in optical information storage, night-vision surveillance, and in vivo bio-imaging. PMID:23532003

A case-control study of Yersinia enterocolitica infections in Auckland.

PubMed

Satterthwaite, P; Pritchard, K; Floyd, D; Law, B

1999-10-01

To identify major risk factors for Yersinia enterocolitica (YE) and identify measures to reduce YE infections. A prospective case control study, group age matched, using 186 cases of YE identified by community pathology laboratories and 379 randomly selected controls. Conducted between April 1995 and June 1996 in Auckland, New Zealand. Face-to-face interviews used a standardised questionnaire examining exposures to factors potentially associated with YE infections including untreated water, unreticulated sewerage, consumption of selected foods, selected food handling practices and socio-demographic factors. Multivariate logistic regression was used to calculate adjusted odds ratios for the potential risk factors. Population attributable risk (PAR) was calculated for significant exposures. Having more than two people living in the home was more common among cases than controls (OR = 2.2). Town supply water (OR = 0.2), reticulated sewerage (OR = 0.34) and looking after a young child (OR = 0.51) were significantly less common. Of the meats, only pork (OR = 1.34) had a higher consumption rate, while bacon (OR = 0.75) and smallgoods (OR = 0.73) were consumed less frequently by cases than controls. Eating food from a sandwich bar was more frequent among cases (OR = 1.18). Fruit and vegetable consumption was marginally less (OR = 0.98). The population attributable risk of these factors was 0.89, implying that 89% of YE would be eliminated if adverse exposures were removed. The risk of YE illness is increased by contact with untreated water, unreticulated sewerage and consumption of pork. Investigation of non-town water supply, informal sewerage systems and methods of preparation and consumption of pork are recommended to determine how YE enters the human food chain.

Sidelobe reduction and capacity improvement of open-loop collaborative beamforming in wireless sensor networks

PubMed Central

2017-01-01

Collaborative beamforming (CBF) with a finite number of collaborating nodes (CNs) produces sidelobes that are highly dependent on the collaborating nodes’ locations. The sidelobes cause interference and affect the communication rate of unintended receivers located within the transmission range. Nulling is not possible in an open-loop CBF since the collaborating nodes are unable to receive feedback from the receivers. Hence, the overall sidelobe reduction is required to avoid interference in the directions of the unintended receivers. However, the impact of sidelobe reduction on the capacity improvement at the unintended receiver has never been reported in previous works. In this paper, the effect of peak sidelobe (PSL) reduction in CBF on the capacity of an unintended receiver is analyzed. Three meta-heuristic optimization methods are applied to perform PSL minimization, namely genetic algorithm (GA), particle swarm algorithm (PSO) and a simplified version of the PSO called the weightless swarm algorithm (WSA). An average reduction of 20 dB in PSL alongside 162% capacity improvement is achieved in the worst case scenario with the WSA optimization. It is discovered that the PSL minimization in the CBF provides capacity improvement at an unintended receiver only if the CBF cluster is small and dense. PMID:28464000

Viscoelastic Properties of Extracellular Polymeric Substances Can Strongly Affect Their Washing Efficiency from Reverse Osmosis Membranes.

PubMed

Ferrando Chavez, Diana Lila; Nejidat, Ali; Herzberg, Moshe

2016-09-06

The role of the viscoelastic properties of biofouling layers in their removal from the membrane was studied. Model fouling layers of extracellular polymeric substances (EPS) originated from microbial biofilms of Pseudomonas aeruginosa PAO1 differentially expressing the Psl polysaccharide were used for controlled washing experiments of fouled RO membranes. In parallel, adsorption experiments and viscoelastic modeling of the EPS layers were conducted in a quartz crystal microbalance with dissipation (QCM-D). During the washing stage, as shear rate was elevated, significant differences in permeate flux recovery between the three different EPS layers were observed. According to the amount of organic carbon remained on the membrane after washing, the magnitude of Psl production provides elevated resistance of the EPS layer to shear stress. The highest flux recovery during the washing stage was observed for the EPS with no Psl. Psl was shown to elevate the layer's shear modulus and shear viscosity but had no effect on the EPS adhesion to the polyamide surface. We conclude that EPS retain on the membrane as a result of the layer viscoelastic properties. These results highlight an important relation between washing efficiency of fouling layers from membranes and their viscoelastic properties, in addition to their adhesion properties.

Frequency Comb Spectroscopy - From IR to XUV

DTIC Science & Technology

2015-06-09

time resolution of 25 s. Publications: [1] A. Cingöz, Yost, D. C. , Allison, T. K. , Ruehl, A. , Fermann, M. E. , Hartl , I. , and Ye, J...J. , Eikema, K. S. E. , Fermann, M. E. , Hartl , I. , and Ye, J. , “Full phase stabilization of a Yb:fiber femtosecond frequency comb via high...D. C. , Allison, T. K. , Ruehl, A. , Fermann, M. E. , Hartl , I. , and Ye, J. , “Direct frequency comb spectroscopy in the extreme ultraviolet”, Nature

Inhibitory effects of yuzu and its components on human platelet aggregation.

PubMed

Kim, Tae-Ho; Kim, Hye-Min; Park, Se Won; Jung, Yi-Sook

2015-03-01

Our previous study demonstrated that yuzu has an anti-platelet effect in rat blood. In the present study, we examined whether the anti-platelet effect of yuzu can be extended to human blood by investigating its ability to inhibit aggregations induced by various agonists in human platelet rich plasma (PRP). This study also investigated the underlying mechanism of yuzu focusing on ADP granule secretion, TXB2 formations, and PLCγ/Akt signaling. The results from this study showed that ethanolic yuzu extract (YE), and its components, hesperidin and naringin, inhibited human platelet aggregation in a concentration-dependent manner. YE, hesperidin and naringin also inhibited TXB2 formation and ADP release. The phosphorylation of PLCγ and Akt was significantly inhibited by YE, heperidin and naringin. Furthermore, we demonstrated that YE, heperidin and naringin has anti-platelet effects in rat ex vivo studies, and lower side effects in mice tail bleeding time studies. The results from this study suggest that YE, hesperidin and naringin can inhibit human platelet aggregation, at least partly through the inhibition of PLCγ and Akt, leading to a decrease in TXB2 formation and granule secretion.

Slip Correction Measurements of Certified PSL Nanoparticles Using a Nanometer Differential Mobility Analyzer (Nano-DMA) for Knudsen Number From 0.5 to 83

PubMed Central

Kim, Jung Hyeun; Mulholland, George W.; Kukuck, Scott R.; Pui, David Y. H.

2005-01-01

The slip correction factor has been investigated at reduced pressures and high Knudsen number using polystyrene latex (PSL) particles. Nano-differential mobility analyzers (NDMA) were used in determining the slip correction factor by measuring the electrical mobility of 100.7 nm, 269 nm, and 19.90 nm particles as a function of pressure. The aerosol was generated via electrospray to avoid multiplets for the 19.90 nm particles and to reduce the contaminant residue on the particle surface. System pressure was varied down to 8.27 kPa, enabling slip correction measurements for Knudsen numbers as large as 83. A condensation particle counter was modified for low pressure application. The slip correction factor obtained for the three particle sizes is fitted well by the equation: C = 1 + Kn (α + β exp(−γ/Kn)), with α = 1.165, β = 0.483, and γ = 0.997. The first quantitative uncertainty analysis for slip correction measurements was carried out. The expanded relative uncertainty (95 % confidence interval) in measuring slip correction factor was about 2 % for the 100.7 nm SRM particles, about 3 % for the 19.90 nm PSL particles, and about 2.5 % for the 269 nm SRM particles. The major sources of uncertainty are the diameter of particles, the geometric constant associated with NDMA, and the voltage. PMID:27308102

The Impact of Modernization on the Military Capabilities of the People’s Republic of China.

DTIC Science & Technology

1982-04-19

pair of allies on the Standing Committee were Ye Jianying and Li Xiannian, who represented both the veteran cadres who had survived the Cultural...in October with the arrest of the four leading radical figures ("Gang of Four") in a coup lead by the Defense Minister, Marshall Ye Jianying who...Dengkui, and Wu De, from the Politburo. A new Standing Committee was constituted on which Hua Guofeng now sat in lonely isolation; Marshal Ye Jianying and

Investigation of radiation-induced free radicals and luminescence properties in fresh pomegranate fruits.

PubMed

Shahbaz, Hafiz M; Akram, Kashif; Ahn, Jae-Jun; Kwon, Joong-Ho

2013-05-01

Radiation-induced free radicals and luminescence properties were investigated in γ-irradiated (0-3 kGy) pomegranate ( Punica granatum L.) fruits. Photostimulated luminescence (PSL) analysis showed limited applicability, and only 3 kGy-irradiated pomegranates showed positive PSL values (>5000 PCs). Thermoluminescence (TL) glow curve features, such as intensity and the presence of maximum glow peak in radiation-specific temperature range (150-250 °C), provided definite proof of irradiation, and the TL ratios (TL1/TL2) also confirmed the reliability of TL results. Scanning electron microscopy energy dispersive X-ray (SEM-EDX) analysis of the separated minerals showed that feldspar and quartz minerals were responsible for the luminescence properties. Radiation-induced cellulose radicals were detected in the seeds and rinds by ESR analysis. The ESR results were better in freeze-dried samples than in alcohol-extracted ones. A positive correlation was found between the ESR and TL signal intensities and irradiation doses; however, the most promising detection of the irradiation status was possible through TL analysis.

Numerical Analysis of Mixed-Phase Icing Cloud Simulations in the NASA Propulsion Systems Laboratory

NASA Technical Reports Server (NTRS)

Bartkus, Tadas; Tsao, Jen-Ching; Struk, Peter; Van Zante, Judith

2017-01-01

This presentation describes the development of a numerical model that couples the thermal interaction between ice particles, water droplets, and the flowing gas of an icing wind tunnel for simulation of NASA Glenn Research Centers Propulsion Systems Laboratory (PSL). The ultimate goal of the model is to better understand the complex interactions between the test parameters and have greater confidence in the conditions at the test section of the PSL tunnel. The model attempts to explain the observed changes in test conditions by coupling the conservation of mass and energy equations for both the cloud particles and flowing gas mass. Model predictions were compared to measurements taken during May 2015 testing at PSL, where test conditions varied gas temperature, pressure, velocity and humidity levels, as well as the cloud total water content, particle initial temperature, and particle size distribution.

Numerical Analysis of Mixed-Phase Icing Cloud Simulations in the NASA Propulsion Systems Laboratory

NASA Technical Reports Server (NTRS)

Bartkus, Tadas P.; Tsao, Jen-Ching; Struk, Peter M.; Van Zante, Judith F.

2017-01-01

This paper describes the development of a numerical model that couples the thermal interaction between ice particles, water droplets, and the flowing gas of an icing wind tunnel for simulation of NASA Glenn Research Centers Propulsion Systems Laboratory (PSL). The ultimate goal of the model is to better understand the complex interactions between the test parameters and have greater confidence in the conditions at the test section of the PSL tunnel. The model attempts to explain the observed changes in test conditions by coupling the conservation of mass and energy equations for both the cloud particles and flowing gas mass. Model predictions were compared to measurements taken during May 2015 testing at PSL, where test conditions varied gas temperature, pressure, velocity and humidity levels, as well as the cloud total water content, particle initial temperature, and particle size distribution.

Development of the Seeding System Used for Laser Velocimeter Surveys of the NASA Low-Speed Centrifugal Compressor Flow Field

NASA Technical Reports Server (NTRS)

Wasserbauer, C. A.; Hathaway, M. D.

1994-01-01

Consideration is given to an atomizer-based system for distributing high-volume rates of polystyrene latex (PSL) seed material developed to support laser velocimeter investigations of the NASA Low-Speed Compressor flow field. Complete evaporation of the liquid carrier before the flow entering the compressor was of primary concern for the seeder system design. It is argued that the seed nozzle should incorporate a needle valve that can mechanically dislodge accumulated PSL seed material when the nozzle is turned off. Water is less expensive as the liquid carrier and should be used whenever adequate residence times are available to ensure complete evaporation. PSL agglomerates over time and needs to be mixed or blended before use. Arrangement of the spray nozzles needs to be adjustable to provide maximum seeding at the laser probe volume.

Calibration and evaluation of a real-time cascade impactor

DOE Office of Scientific and Technical Information (OSTI.GOV)

Fairchild, C.I.; Wheat, L.D.

1984-04-01

A 10-stage cascade impactor made by California Measurement Inc., can determine aerodynamic size distributions of dilute aerosols in a few minutes. Collection of impacted particles on greased, vibrating piezoelectric crystals produces changes in vibrational frequency proportional to the collected mass. Based on frequency changes and sampling time, a data reduction module calculates the mass collected on each stage. Calibration of the assembled impactor was performed with monodisperse polystyrene latex (PSL) and Eosin-Y (E-Y) aerosols for the lower stages (4-10), and PSL and pollen particles (ragweed and mulberry) for the upper stages (1-3). The stage experimental effective cutoff aerodynamic diameters (ECAD)more » were up to 22 percent different from theoretical ECADs with the exception of Stages 1 and 2 which were respectively 30 and 35 percent different from theoretical ECADs. The overall loss of particles > 3- and < 0.3-..mu..m was severe. Also, considerable scatter of particles was observed on the collection crystals of Stages 1 and 2. Although a majority of particles were in the impaction area, a large fraction was scattered over the outer portions of these crystals.« less

'Micro-hole' optical dating of quartz from HOTRAX-05 Arctic Ocean cores

NASA Astrophysics Data System (ADS)

Berger, G. W.; Polyak, L. V.

2011-12-01

For Quaternary Arctic Ocean cores, numeric dating methods are needed spanning and exceeding the age range of the widely used radiocarbon (C-14) method. Previously, luminescence sediment dating of 4-11 μm diameter quartz and feldspar grains from core tops has often produced large burial-age overestimates (e.g., by >7 kyr) due to failure to resolve mixed-age histories. However, application of micro-focused-laser ('micro-hole') photon-stimulated-luminescence (PSL) applied to quartz grains of 11-90 μm diameters from the tops (upper 2 cm) of high-sedimentation- rate HOTRAX-05 multi-cores at the Alaska margin provides expected near zero ages (0-200 a), thus overcoming the earlier problem of large PSL age over-estimation. This micro-hole PSL dating approach has also been applied to >11 μm quartz grains from multi-cores at two sites on the central Lomonosov Ridge. For a core top within a perched basin, a burial-age estimate of ~2 ka for 11-62 μm quartz was obtained, in accord with published C-14 age estimates from foraminifera, demonstrating the efficacy of the micro-hole approach to this ridge area. At a nearby 'erosive' ridge-top site, the micro-hole PSL approach paradoxically produces two different burial-age estimates from the same core-top horizon. The >90 μm quartz grains yield a burial age of ~25 ka, in accord with a C-14 age estimate of ~26 ka from >250 μm foraminifers from the same horizon. However, the 11-90 μm quartz produces a burial-age estimate of ~9 ka, indicating a differently preserved burial history for the medium silt grains than for the sand grains within a single horizon. This unexpected result provides a unique insight into past, complicated, depositional processes on this ridge top over a time range spanning the LGM. These results from the micro-hole PSL approach thus indicate a clear potential for dating times of detrital quartz deposition at other ridge tops in the Arctic Ocean, and for providing perhaps new insights into local preservation of burial ages. These PSL procedures are being applied also to sediment above and below a diamicton in a HOTRAX-05 core from the Northwind Ridge, with the aim of dating indirectly the diamicton. Preliminary results from this core will be presented.

Inhibitory Effects of Yuzu and Its Components on Human Platelet Aggregation

PubMed Central

Kim, Tae-Ho; Kim, Hye-Min; Park, Se Won; Jung, Yi-Sook

2015-01-01

Our previous study demonstrated that yuzu has an anti-platelet effect in rat blood. In the present study, we examined whether the anti-platelet effect of yuzu can be extended to human blood by investigating its ability to inhibit aggregations induced by various agonists in human platelet rich plasma (PRP). This study also investigated the underlying mechanism of yuzu focusing on ADP granule secretion, TXB2 formations, and PLCγ/Akt signaling. The results from this study showed that ethanolic yuzu extract (YE), and its components, hesperidin and naringin, inhibited human platelet aggregation in a concentration-dependent manner. YE, hesperidin and naringin also inhibited TXB2 formation and ADP release. The phosphorylation of PLCγ and Akt was significantly inhibited by YE, heperidin and naringin. Furthermore, we demonstrated that YE, heperidin and naringin has anti-platelet effects in rat ex vivo studies, and lower side effects in mice tail bleeding time studies. The results from this study suggest that YE, hesperidin and naringin can inhibit human platelet aggregation, at least partly through the inhibition of PLCγ and Akt, leading to a decrease in TXB2 formation and granule secretion. PMID:25767683

Radio-Astronomical Instruments Observations (Selected Articles),

DTIC Science & Technology

1982-08-02

NL SIIDAUG 82 L I MATVEYENKO, G S MISEZHNIKOV UNCLASSIFIED FTO_ ID(RS) -0564-82 N FTD-ID(RS) T -0564-82 FOREIGN TECHNOLOGY DIVISION RADIO-ASTRONOMICAL...INSTR1ThMNTS OBSERVATIONS (Selected Articles) 3 71982 Approved for public release; LAJ distribuion~ urJA’nited. • I . FTD- ID(RS) T -0564-82 UNEDITED... T , t * r a yy y y 7, u F, f E # Ye, ye; E, e* X x X x Kh, kh X C Zh, zn .4 u L q Ts, ts - -. Z ,. 4 f 14 Ch ,ch U 7 H u I , i w Sh, sh 2 R ia Y, y

Identification and Characterization of Functionally Critical, Conserved Motifs in the Internal Repeats and N-terminal Domain of Yeast Translation Initiation Factor 4B (yeIF4B)*

PubMed Central

Zhou, Fujun; Walker, Sarah E.; Mitchell, Sarah F.; Lorsch, Jon R.; Hinnebusch, Alan G.

2014-01-01

eIF4B has been implicated in attachment of the 43 S preinitiation complex (PIC) to mRNAs and scanning to the start codon. We recently determined that the internal seven repeats (of ∼26 amino acids each) of Saccharomyces cerevisiae eIF4B (yeIF4B) compose the region most critically required to enhance mRNA recruitment by 43 S PICs in vitro and stimulate general translation initiation in yeast. Moreover, although the N-terminal domain (NTD) of yeIF4B contributes to these activities, the RNA recognition motif is dispensable. We have now determined that only two of the seven internal repeats are sufficient for wild-type (WT) yeIF4B function in vivo when all other domains are intact. However, three or more repeats are needed in the absence of the NTD or when the functions of eIF4F components are compromised. We corroborated these observations in the reconstituted system by demonstrating that yeIF4B variants with only one or two repeats display substantial activity in promoting mRNA recruitment by the PIC, whereas additional repeats are required at lower levels of eIF4A or when the NTD is missing. These findings indicate functional overlap among the 7-repeats and NTD domains of yeIF4B and eIF4A in mRNA recruitment. Interestingly, only three highly conserved positions in the 26-amino acid repeat are essential for function in vitro and in vivo. Finally, we identified conserved motifs in the NTD and demonstrate functional overlap of two such motifs. These results provide a comprehensive description of the critical sequence elements in yeIF4B that support eIF4F function in mRNA recruitment by the PIC. PMID:24285537

Production of succinic acid from sugarcane molasses supplemented with a mixture of corn steep liquor powder and peanut meal as nitrogen sources by Actinobacillus succinogenes.

PubMed

Shen, N; Qin, Y; Wang, Q; Liao, S; Zhu, J; Zhu, Q; Mi, H; Adhikari, B; Wei, Y; Huang, R

2015-06-01

The potential of using corn steep liquor powder (CSLP), peanut meal (PM), soybean meal (SM), cotton meal (CM) and urea as the substitute of yeast extract (YE) as the nitrogen source was investigated for producing succinic acid (SA). Actinobacillus succinogenes GXAS137 was used as the fermenting bacterium and sugarcane molasses was used as the main substrate. None of these materials were able to produce SA as high as YE did. The CSLP could still be considered as a feasible and inexpensive alternate for YE as the yield of SA produced using CSLP was second only to the yield of SA obtained by YE. The use of CSLP-PM mixed formulation (CSLP to PM ratio = 2·6) as nitrogen source produced SA up to 59·2 g l(-1) with a productivity of 1·2 g l(-1) h(-1). A batch fermentation using a stirred bioreactor produced up to 60·7 g l(-1) of SA at the same formulation. Fed-batch fermentation that minimized the substrate inhibition produced 64·7 g l(-1) SA. These results suggest that sugarcane molasses supplemented with a mixture of CSLP and PM as the nitrogen source could be used to produce SA more economically using A. succinogenes. Significance and impact of the study: Succinic acid (SA) is commonly used as a platform chemical to produce a number of high value derivatives. Yeast extract (YE) is used as a nitrogen source to produce SA. The high cost of YE is currently the limiting factor for industrial production of SA. This study reports the use of a mixture of corn steep liquor powder (CSLP) and peanut meal (PM) as an inexpensive nitrogen source to substitute YE. The results showed that this CSLP-PM mixed formulation can be used as an effective and economic nitrogen source for the production of SA. © 2015 The Society for Applied Microbiology.

Customized Fabrication of Osteochondral Tissue for Articular Joint Surface Repair

DTIC Science & Technology

2016-09-01

differentiation cues for chondrogenesis and osteogenesis, by the 3D printing method of projection stereolithography (PSL). We further test the...military medical care costs. Post Traumatic Osteoarthritis, Injury, Articular Cartilage, tissue-engineered, 3D printing , Osteochondral constructs. Major...tissue with the stem cells used. He will also be assisting with the 3D printing of the material. Funding Support: Supported by internal University

Overexpression of plum auxin receptor PslTIR1 in tomato alters plant growth, fruit development and fruit shelf-life characteristics.

PubMed

El-Sharkawy, I; Sherif, S; El Kayal, W; Jones, B; Li, Z; Sullivan, A J; Jayasankar, Subramanian

2016-02-29

TIR1-like proteins are F-box auxin receptors. Auxin binding to the F-box receptor proteins promotes the formation of SCF(TIR1) ubiquitin ligase complex that targets the auxin repressors, Aux/IAAs, for degradation via the ubiquitin/26S proteasome pathway. The release of auxin response factors (ARFs) from their Aux/IAA partners allows ARFs to mediate auxin-responsive changes in downstream gene transcription. In an attempt to understand the potential role of auxin during fruit development, a plum auxin receptor, PslTIR1, has previously been characterized at the cellular, biochemical and molecular levels, but the biological significance of this protein is still lacking. In the present study, tomato (Solanum lycopersicum) was used as a model to investigate the phenotypic and molecular changes associated with the overexpression of PslTIR1. The findings of the present study highlighted the critical role of PslTIR1 as positive regulator of auxin-signalling in coordinating the development of leaves and fruits. This was manifested by the entire leaf morphology of transgenic tomato plants compared to the wild-type compound leaf patterning. Moreover, transgenic plants produced parthenocarpic fruits, a characteristic property of auxin hypersensitivity. The autocatalytic ethylene production associated with the ripening of climacteric fruits was not significantly altered in transgenic tomato fruits. Nevertheless, the fruit shelf-life characteristics were affected by transgene presence, mainly through enhancing fruit softening rate. The short shelf-life of transgenic tomatoes was associated with dramatic upregulation of several genes encoding proteins involved in cell-wall degradation, which determine fruit softening and subsequent fruit shelf-life. The present study sheds light into the involvement of PslTIR1 in regulating leaf morphology, fruit development and fruit softening-associated ripening, but not autocatalytic ethylene production. The results demonstrate that auxin accelerates fruit softening independently of ethylene action and this is probably mediated through the upregulation of many cell-wall metabolism genes.

Sedative-hypnotic and anxiolytic effects and the mechanism of action of aqueous extracts of peanut stems and leaves in mice.

PubMed

Deng, Lei; Shi, Ai-Min; Wang, Qiang

2018-03-24

Peanut stems and leaves (PSL) have traditionally been used as both a special food and a herbal medicine in Asia. The sedative-hypnotic and anxiolytic effects of PSL have been recorded in classical traditional Chinese literature, and more recently by many other researchers. In a previous study, four sleep-related ingredients (linalool, 5-hydroxy-4',7-dimethoxyflavanone, 2'-O-methylisoliquiritigenin and ferulic acid), among which 5-hydroxy-4',7-dimethoxyflavanone and 2'-O-methylisoliquiritigenin were newly found in Arachis species, were screened by ultrahigh-performance liquid chromatography coupled with quadrupole time-of-flight mass spectrometry (UHPLC/QTOF-MS). In the current study, quantitative examination of the above four ingredients was conducted. Serious fundamental functional studies were done in mice, including locomotor activity, direct sleep tests, pentobarbital-induced sleeping time tests, subthreshold dose of pentobarbital tests and barbital sodium sleep incubation period tests, to determine the material base for the sedative-hypnotic and anxiolytic effects of aqueous extracts of PSL. Furthermore, neurotransmitter levels in three brain regions (cerebrum, cerebellum and brain stem) were determined using UHPLC coupled with triple-quadrupole mass spectrometry (UHPLC/QQQ-MS) in order to elucidate the exact mechanism of action. Aqueous extract of PSL at a dose of 500 mg kg -1 (based on previous experience), along with different concentrations of the above four functional ingredients (189.86 µg kg -1 linalool, 114.75 mg kg -1 5-hydroxy-4',7-dimethoxyflavanone, 32.4mg kg -1 2'-O-methylisoliquiritigenin and 44.44 mg kg -1 ferulic acid), had a sedative-hypnotic effect by affecting neurotransmitter levels in mice. The data demonstrate that these four ingredients are the key functional factors for the sedative-hypnotic and anxiolytic effects of PSL aqueous extracts and that these effects occur via changes in neurotransmitter levels and pathways. © 2018 Society of Chemical Industry. © 2018 Society of Chemical Industry.

R-THP-COP versus R-CHOP in patients younger than 70 years with untreated diffuse large B cell lymphoma: A randomized, open-label, noninferiority phase 3 trial.

PubMed

Hara, Takeshi; Yoshikawa, Takeshi; Goto, Hideko; Sawada, Michio; Yamada, Toshiki; Fukuno, Kenji; Kasahara, Senji; Shibata, Yuhei; Matsumoto, Takuro; Mabuchi, Ryoko; Nakamura, Nobuhiko; Nakamura, Hiroshi; Ninomiya, Soranobu; Kitagawa, Junichi; Kanemura, Nobuhiro; Nannya, Yasuhito; Katsumura, Naoki; Takahashi, Takeshi; Kito, Yusuke; Takami, Tsuyoshi; Miyazaki, Tatsuhiko; Takeuchi, Tamotsu; Shimizu, Masahito; Tsurumi, Hisashi

2018-06-08

Pirarubicin (tetrahydropyranyl adriamycin [THP]) is an anthracyclin with less cardiotoxicity than doxorubicin (DOX). We previously reported the efficacy and safety of R-THP-COP consisting of rituximab (R), THP, cyclophosphamide (CPA), vincristine (VCR), and prednisolone (PSL) for diffuse large B cell lymphoma (DLBCL) in phase 2 studies. Here, we prospectively compared the efficacy and safety of the R-THP-COP and standard R-CHOP regimen (consisting of R, CPA, DOX, VCR, and PSL) in a noninferiority phase 3 trial. This prospective, randomized phase 3 study included patients younger than 70 years of age with previously untreated DLBCL. The regimen consisted of R (day 1), DOX, or THP (day 3), CPA (day 3), VCR (day 3), and PSL for 5 days every 3 weeks for 6 to 8 cycles. Between July 5, 2006 and June 11, 2013, 81 patients were randomly assigned to the treatment groups (R-CHOP group, 40 patients; R-THP-COP group, 41 patients). R-THP-COP was noninferior to R-CHOP, as assessed by the primary endpoint of complete response rate (85% vs 85% respectively). With a median follow-up of 75.2 months, the 5-year overall survival was 87% in the R-CHOP group and 82% in the R-THP-COP group (hazard ratio [HR]: 0.89, 95% confidence interval [CI]: 0.31-2.49; P = .82). The 5-year progression-free survival was 74% in the R-CHOP group and 79% in the R-THP-COP group (HR: 1.37, 95% CI: 0.56-3.55; P = .49). No grade 3 cardiac side effects were observed in either group. No serious late adverse reactions were observed in either group, with the exception of therapy-related acute myeloid leukemia in the R-THP-COP group. These data indicate that R-THP-COP is noninferior to R-CHOP with regard to clinical response, and has an acceptable safety profile. Thus, this regimen may be an alternative therapy to R-CHOP. Copyright © 2018 John Wiley & Sons, Ltd.

Maternal predictive factors for fetal congenital heart block in pregnant mothers positive for anti-SS-A antibodies.

PubMed

Tsuboi, Hiroto; Sumida, Takayuki; Noma, Hisashi; Yamagishi, Kazumasa; Anami, Ai; Fukushima, Kotaro; Horigome, Hitoshi; Maeno, Yasuki; Kishimoto, Mitsumasa; Takasaki, Yoshinari; Nakayama, Masahiro; Waguri, Masako; Sago, Haruhiko; Murashima, Atsuko

2016-07-01

To determine the maternal predictive factors for fetal congenital heart block (CHB) in pregnancy in mothers positive for anti-SS-A antibodies. The Research Team for Surveillance of Autoantibody-Exposed Fetuses and Treatment of Neonatal Lupus Erythematosus, the Research Program of the Japan Ministry of Health, Labor and Welfare, performed a national survey on pregnancy of mothers positive for anti-SS-A antibodies. We analyzed 635 pregnant mothers who tested positive for anti-SS-A antibodies before conception but had no previous history of fetal CHB. We performed univariate and multivariate analysis (models 1, 2, and 3 using different set of independent variables) investigated the relation between risk of fetal CHB and maternal clinical features. Of the 635 pregnant mothers, fetal CHB was detected in 16. Univariate analysis showed that fetal CHB associated with use of corticosteroids before conception (OR 3.72, p = 0.04), and negatively with use of corticosteroids (equivalent doses of prednisolone (PSL), at ≥10 mg/day) after conception before 16-week gestation (OR 0.17, p = 0.03). In multivariate analysis, model 1 identified the use of corticosteroids before conception (OR 4.28, p = 0.04) and high titer of anti-SS-A antibodies (OR 3.58, p = 0.02) as independent and significant risk factors, and model 3 identified use of corticosteroids (equivalent doses of PSL, at ≥10 mg/day) after conception before 16-week gestation as independent protective factor against the development of fetal CHB (OR 0.16, p = 0.03). Other maternal clinical features did not influence the development of fetal CHB. The results identified high titers of anti-SS-A antibodies and use of corticosteroids before conception as independent risk factors, and use of corticosteroids (equivalent doses of PSL, at ≥10 mg/day) after conception before 16-week gestation as an independent protective factor for fetal CHB.

JILA BEC/Ultracold Atoms Homepage

Science.gov Websites

JILA BEC & Ultracold Atoms Bose Einstein Condensate Eric Cornell Cornell Group Debbie Jin Jin Group Jun Ye Ye Group Dana Anderson Anderson Group What is BEC? Easy BEC Machine Nobel BEC BibTek Papers

Comparison of the platelet-rich plasma and buffy coat protocols for preparation of canine platelet concentrates.

PubMed

Hoareau, Guillaume L; Jandrey, Karl E; Burges, Julie; Bremer, Daphne; Tablin, Fern

2014-12-01

Platelet (PLT) concentrates (PC) can be produced via the buffy coat (BC) or platelet-rich plasma (PRP) protocols. The 2 methods have not been compared with canine blood. The aims of the study were to compare the PLT, WBC, and RBC concentrations, in vitro PLT function, and markers of platelet storage lesion (PSL) in canine PC generated by 2 different protocols, and determine microbial growth throughout storage. PC from 8 healthy donor dogs were produced using 2 standard protocols, PRP and BC. PLT, WBC, and RBC counts, optical aggregometry assays, and PSL markers (pH, pCO2 , HCO3 , lactate and glucose concentrations, and LDH activity) were determined on storage days 0, 1, 3, 5, and 7. Aerobic and anaerobic bacterial cultures were also performed. Mean PLT counts were comparable between protocols and remained stable throughout storage up to day 7, while median WBC and RBC counts on day 0 were significantly higher in the BC-PC group (17,800 WBCs/μL; 195,000 RBCs/μL) than in the PRP-PC group (200 WBCs/μL; 10,000 RBCs/μL) (P = .012). In PRP-PC aggregometry, the median slope and amplitude in response to γ-thrombin and convulxin (+ ADP) were significantly decreased, and virtually absent in BC-PC during storage. PSL markers (lactate, LDH activity) were higher in BC-PC. Aerobic bacterial growth was observed in 2 PRP-PC and 1 BC-PC. This in vitro study suggests that PRP-PC had lesser WBC and RBC contamination and superior PLT function compared with BC-PC. In vivo studies are required to address safety and efficacy of PRP-PC. © 2014 American Society for Veterinary Clinical Pathology.

Fabrication of wafer-scale nanopatterned sapphire substrate through phase separation lithography

NASA Astrophysics Data System (ADS)

Guo, Xu; Ni, Mengyang; Zhuang, Zhe; Dai, Jiangping; Wu, Feixiang; Cui, Yushuang; Yuan, Changsheng; Ge, Haixiong; Chen, Yanfeng

2016-04-01

A phase separation lithography (PSL) based on polymer blend provides an extremely simple, low-cost, and high-throughput way to fabricate wafer-scale disordered nanopatterns. This method was introduced to fabricate nanopatterned sapphire substrates (NPSSs) for GaN-based light-emitting diodes (LEDs). The PSL process only involved in spin-coating of polystyrene (PS)/polyethylene glycol (PEG) polymer blend on sapphire substrate and followed by a development with deionized water to remove PEG moiety. The PS nanoporous network was facilely obtained, and the structural parameters could be effectively tuned by controlling the PS/PEG weight ratio of the spin-coating solution. 2-in. wafer-scale NPSSs were conveniently achieved through the PS nanoporous network in combination with traditional nanofabrication methods, such as O2 reactive ion etching (RIE), e-beam evaporation deposition, liftoff, and chlorine-based RIE. In order to investigate the performance of such NPSSs, typical blue LEDs with emission wavelengths of ~450 nm were grown on the NPSS and a flat sapphire substrate (FSS) by metal-organic chemical vapor deposition, respectively. The integral photoluminescence (PL) intensity of the NPSS LED was enhanced by 32.3 % compared to that of the FSS-LED. The low relative standard deviation of 4.7 % for PL mappings of NPSS LED indicated the high uniformity of PL data across the whole 2-in. wafer. Extremely simple, low cost, and high throughput of the process and the ability to fabricate at the wafer scale make PSL a potential method for production of nanopatterned sapphire substrates.

Correlation of intact sensibility and neuropathic pain-related behaviors in eight inbred and outbred rat strains and selection lines.

PubMed

Shir, Y; Zeltser, R; Vatine, J J; Carmi, G; Belfer, I; Zangen, A; Overstreet, D; Raber, P; Seltzer, Z

2001-02-01

In some rat strains, total hindpaw denervation triggers autotomy, a behavior of self mutilation presumably related to neuropathic pain. Partial sciatic ligation (PSL) in rats produces tactile allodynia and heat hyperalgesia but not autotomy. Our aims in this study were to examine: (1) whether sensibility of intact rats to noxious and non-noxious stimuli is strain-dependent; (2) whether sensibility of intact rats could predict levels of autotomy, or of allodynia and hyperalgesia in the PSL model; and (3) whether autotomy levels are correlated with levels of allodynia or hyperalgesia. Here we report that in two inbred rat strains (Lewis and Fisher 344), two outbred rat strains (Sabra and Sprague-Dawley) and four selection lines of rats (Genetically Epilepsy-Prone Rats, High Autotomy, Low Autotomy and Flinders Sensitive Line), tactile sensitivity and response duration to noxious heat of intact animals were strain-dependent. Levels of autotomy following hindpaw denervation and of allodynia and hyperalgesia in the PSL model were also strain-dependent. Thus, these traits are determined in part by genetic factors. Sensory sensibility of intact rats was not correlated with levels of autotomy following total denervation, or allodynia and hyperalgesia following partial denervation. We suggest that preoperative sensibility of intact rats is not a predictor of levels of neuropathic disorders following nerve injury. Likewise, no correlation was found between autotomy, allodynia and hyperalgesia, suggesting that neuropathic pain behaviors triggered by nerve injury of different etiologies are mediated by differing mechanisms.

Matrix polymer species have distinct effects on the mechanics of bacterial biofilms

NASA Astrophysics Data System (ADS)

Kovach, Kristin; Davis-Fields, Megan; Gordon, Vernita

2015-03-01

Biofilms are aggregates of microorganisms embedded in a self-produced extracellular polymer matrix. The matrix confers protection to these microorganisms against mechanical and chemical stresses that they may experience in their environment. The bacterium Pseudomonas aeruginosa is widely used as a model biofilm-forming organism because it is an opportunistic human pathogen common in hospital-acquired infections, in chronic wounds, and in cystic fibrosis lung disease. P. aeruginosa strain PA01 forms biofilms that are primarily structured by the extracellular polysaccharides Pel and Psl. Using bulk rheological measurements, we show that these polysaccharides each play a unique role in the mechanical robustness of the biofilm. Psl increases the elastic storage modulus while Pel increases the ductility of the biofilm. Increased expression of either Psl or Pel increases the yield stress by about the same amount. Identifying the mechanism(s) by which these polymers contribute to the mechanical toughness of the biofilm could allow new approaches to effective biofilm clearance, by revealing targets for disruption that would weaken the biofilm.

A Case of Refractory Heart Failure in Becker Muscular Dystrophy Improved With Corticosteroid Therapy.

PubMed

Nakamura, Makiko; Sunagawa, Osahiko; Hokama, Ryo; Tsuchiya, Hiroyuki; Miyara, Takafumi; Taba, Yoji; Touma, Takashi

2016-09-28

The patient was a 26 year-old man who was referred to our hospital in June 2011 because of severe heart failure. At age 24 years, he was found to have Becker muscular dystrophy. He received enalapril for cardiac dysfunction; however, he had worsening heart failure and was thus referred to our hospital. Echocardiography showed enlargement of the left ventricle, with a diastolic dimension of 77 mm and ejection fraction of 19%. His condition improved temporarily after an infusion of dobutamine and milrinone. He was then administered amiodarone for ventricular tachycardia; however, he subsequently developed hemoptysis. Amiodarone was discontinued and corticosteroid pulse therapy was administered followed by oral prednisolone (PSL). His creatinine phosphokinase (CPK) level and cardiomegaly improved after the corticosteroid therapy. The PSL dose was reduced gradually, bisoprolol was introduced, and the catecholamine infusion was tapered. A cardiac resynchronization device was implanted; however, the patient's condition gradually worsened, which necessitated dobutamine infusion for heart failure. We readministered 30 mg PSL, which decreased the CPK level and improved the cardiomegaly. The dobutamine infusion was discontinued, and the patient was discharged. He was given 7.5 mg PSL as an outpatient, and he returned to normal life without exacerbation of the heart failure. There are similar reports showing that corticosteroids are effective for skeletal muscle improvement in Duchenne muscular dystrophy; however, their effectiveness for heart failure has been rarely reported. We experienced a case of Becker muscular dystrophy in which corticosteroid therapy was effective for refractory heart failure.

Operation Allied Force: The View from Beijing

DTIC Science & Technology

2000-01-01

should “learn and  master”  anti-air-raid,  anti-electronic-war- fare, and anti-information-control operations.19 Information Warfare Reporter Ye  Lu ...also wanted to see whether a strong stimu­ lus   could  provoke  internal  chaos  within China that would cause a change in China’s orientation.31...Ye  Lu ,  “Strategic  Thought  on  Weapons  Development,” Keji Ribao (Beijing), 20 May 1999, in FBIS-CHI-1999-0621; on-line, Internet, 3 July 1999

Modeling Commercial Turbofan Engine Icing Risk With Ice Crystal Ingestion

NASA Technical Reports Server (NTRS)

Jorgenson, Philip C. E.; Veres, Joseph P.

2013-01-01

The occurrence of ice accretion within commercial high bypass aircraft turbine engines has been reported under certain atmospheric conditions. Engine anomalies have taken place at high altitudes that have been attributed to ice crystal ingestion, partially melting, and ice accretion on the compression system components. The result was degraded engine performance, and one or more of the following: loss of thrust control (roll back), compressor surge or stall, and flameout of the combustor. As ice crystals are ingested into the fan and low pressure compression system, the increase in air temperature causes a portion of the ice crystals to melt. It is hypothesized that this allows the ice-water mixture to cover the metal surfaces of the compressor stationary components which leads to ice accretion through evaporative cooling. Ice accretion causes a blockage which subsequently results in the deterioration in performance of the compressor and engine. The focus of this research is to apply an engine icing computational tool to simulate the flow through a turbofan engine and assess the risk of ice accretion. The tool is comprised of an engine system thermodynamic cycle code, a compressor flow analysis code, and an ice particle melt code that has the capability of determining the rate of sublimation, melting, and evaporation through the compressor flow path, without modeling the actual ice accretion. A commercial turbofan engine which has previously experienced icing events during operation in a high altitude ice crystal environment has been tested in the Propulsion Systems Laboratory (PSL) altitude test facility at NASA Glenn Research Center. The PSL has the capability to produce a continuous ice cloud which are ingested by the engine during operation over a range of altitude conditions. The PSL test results confirmed that there was ice accretion in the engine due to ice crystal ingestion, at the same simulated altitude operating conditions as experienced previously in flight. The computational tool was utilized to help guide a portion of the PSL testing, and was used to predict ice accretion could also occur at significantly lower altitudes. The predictions were qualitatively verified by subsequent testing of the engine in the PSL. The PSL test has helped to calibrate the engine icing computational tool to assess the risk of ice accretion. The results from the computer simulation identified prevalent trends in wet bulb temperature, ice particle melt ratio, and engine inlet temperature as a function of altitude for predicting engine icing risk due to ice crystal ingestion.

Applications of Cavity-Enhanced Direct Frequency Comb Spectroscopy

NASA Astrophysics Data System (ADS)

Cossel, Kevin C.; Adler, Florian; Maslowski, Piotr; Ye, Jun

2010-06-01

Cavity-enhanced direct frequency comb spectroscopy (CE-DFCS) is a unique technique that provides broad bandwidth, high resolution, and ultra-high detection sensitivities. This is accomplished by combining a femtosecond laser based optical frequency comb with an enhancement cavity and a broadband, multichannel imaging system. These systems are capable of simultaneously recording many terahertz of spectral bandwidth with sub-gigahertz resolution and absorption sensitivities of 1×10-7 cm-1 Hz-1/2. In addition, the ultrashort pulses enable efficient nonlinear processes, which makes it possible to reach spectral regions that are difficult to access with conventional laser sources. We will present an application of CE-DFCS for trace impurity detection in the semiconductor processing gas arsine near 1.8 μm and the development of a high-power, mid-infrared frequency comb for breath analysis in the 2.8-4.8 μm region. M. J. Thorpe, K. D. Moll, R. J. Jones, B. Safdi, and J. Ye. Science 311, 1595-1599 (2006) F. Adler, M. J. Thorpe, K. C. Cossel, and J. Ye. Annu. Rev. Anal. Chem. 3, 175-205 (2010) F. Adler, K. C. Cossel, M. J. Thorpe, I. Hartl, M. E. Fermann, and J. Ye. Opt. Lett. 34, 1330-1332 (2009)

Optimization of critical medium components using response surface methodology for biomass and extracellular polysaccharide production by Agaricus blazei.

PubMed

Liu, Gao-Qiang; Wang, Xiao-Ling

2007-02-01

Response surface methodology (RSM) was applied to optimize the critical medium ingredients of Agaricus blazei. A three-level Box-Behnken factorial design was employed to determine the maximum biomass and extracellular polysaccharide (EPS) yields at optimum levels for glucose, yeast extract (YE), and peptone. A mathematical model was then developed to show the effect of each medium composition and its interactions on the production of mycelial biomass and EPS. The model predicted the maximum biomass yield of 10.86 g/l that appeared at glucose, YE, peptone of 26.3, 6.84, and 6.62 g/l, respectively, while a maximum EPS yield of 348.4 mg/l appeared at glucose, YE, peptone of 28.4, 4.96, 5.60 g/l, respectively. These predicted values were also verified by validation experiments. The excellent correlation between predicted and measured values of each model justifies the validity of both the response models. The results of bioreactor fermentation also show that the optimized culture medium enhanced both biomass (13.91 +/- 0.71 g/l) and EPS (363 +/- 4.1 mg/l) production by Agaricus blazei in a large-scale fermentation process.

Yeast eIF4B binds to the head of the 40S ribosomal subunit and promotes mRNA recruitment through its N-terminal and internal repeat domains.

PubMed

Walker, Sarah E; Zhou, Fujun; Mitchell, Sarah F; Larson, Victoria S; Valasek, Leos; Hinnebusch, Alan G; Lorsch, Jon R

2013-02-01

Eukaryotic translation initiation factor (eIF)4B stimulates recruitment of mRNA to the 43S ribosomal pre-initiation complex (PIC). Yeast eIF4B (yeIF4B), shown previously to bind single-stranded (ss) RNA, consists of an N-terminal domain (NTD), predicted to be unstructured in solution; an RNA-recognition motif (RRM); an unusual domain comprised of seven imperfect repeats of 26 amino acids; and a C-terminal domain. Although the mechanism of yeIF4B action has remained obscure, most models have suggested central roles for its RRM and ssRNA-binding activity. We have dissected the functions of yeIF4B's domains and show that the RRM and its ssRNA-binding activity are dispensable in vitro and in vivo. Instead, our data indicate that the 7-repeats and NTD are the most critical domains, which mediate binding of yeIF4B to the head of the 40S ribosomal subunit via interaction with Rps20. This interaction induces structural changes in the ribosome's mRNA entry channel that could facilitate mRNA loading. We also show that yeIF4B strongly promotes productive interaction of eIF4A with the 43S•mRNA PIC in a manner required for efficient mRNA recruitment.

Clinical usefulness of ursodeoxycholic acid for Japanese patients with autoimmune hepatitis

PubMed Central

Torisu, Yuichi; Nakano, Masanori; Takano, Keiko; Nakagawa, Ryo; Saeki, Chisato; Hokari, Atsushi; Ishikawa, Tomohisa; Saruta, Masayuki; Zeniya, Mikio

2017-01-01

AIM To evaluate the therapeutic effects of ursodeoxycholic acid (UDCA) on autoimmune hepatitis (AIH). METHODS A total 136 patients who were diagnosed with AIH were included in our study. All of the patients underwent a liver biopsy, and had at least a probable diagnosis on the basis of either the revised scoring system or the simplified scores. Initial treatment included UDCA monotherapy (Group U, n = 48) and prednisolone (PSL) monotherapy (Group P, n = 88). Group U was further classified into two subgroups according to the effect of UDCA: Patients who had achieved remission induction with UDCA monotherapy and showed no sign of relapse (Subgroup U1, n = 34) and patients who additionally received PSL during follow-up (Subgroup U2, n = 14). We compared the clinical and histological findings between each groups, and investigated factors contributing to the response to UDCA monotherapy. RESULTS In Group U, 34 patients (71%) achieved and maintained remission over 49 (range: 8-90) mo (Subgroup U1) and 14 patients (29%) additionally received PSL (Subgroup U2) during follow-up. Two patients in Subgroup U2 achieved remission induction once but additionally required PSL administration because of relapse (15 and 35 mo after the start of treatment). The remaining 12 patients in Subgroup U2 failed to achieve remission induction during follow-up, and PSL was added during 7 (range: 2-18) mo. Compared with Subgroup U2, Subgroup U1 had significantly lower alanine aminotransferase (ALT) levels at onset (124 IU/L vs 262 IU/L, P = 0.023) and a significantly higher proportion of patients with mild inflammation (A1) on histological examination (70.6% vs 35.7%, P = 0.025). When multivariate analysis was performed to identify factors contributing to the response to UDCA monotherapy, only a serum ALT level of 200 IU/L or lower was found to be associated with a significant difference (P = 0.013). CONCLUSION To prevent adverse events related to corticosteroids, UDCA monotherapy for AIH needs to be considered in patients with a serum ALT level of 200 IU/L or lower. PMID:28105259

Development of CMV retinitis in an antigenemia-negative infant after cord blood transplantation.

PubMed

Matsumoto, Akane; Umeda, Katsutsugu; Kawaguchi, Koji; Kawada, Koji; Maeda, Sayaka; Kinehara, Takako; Saida, Satoshi; Kato, Itaru; Hiramatsu, Hidefumi; Watanabe, Ken-Ichiro; Yasumi, Takahiro; Heike, Toshio; Tsujikawa, Akitaka; Uji, Akito; Usami, Ikuya; Ito, Kiminari; Adachi, Souichi

2015-05-01

A five-month-old male infant with familial hemophagocytic lymphohistiocytosis underwent cord blood transplantation using reduced-intensity conditioning. Methylprednisolone (mPSL) pulse administration was performed for marked pulmonary edema during the early phase of transplantation, followed by GVHD treatment with mPSL until day 100. CMV antigenemia was detected on days 27 and 55, but serum became negative with 2- to 3-week ganciclovir (GCV) treatment on both occasions. On day 120, ophthalmological findings included multiple bilateral white spots and a positive PCR study using anterior chamber fluid confirmed the diagnosis of CMV retinitis affecting both eyes, although CMV antigenemia was negative. Re-treatment with GCV had a minimal effect on the ophthalmological findings, while foscarnet administration markedly improved the retinitis and decreased the CMV-DNA level. Considering that a substantial proportion of patients develop CMV retinitis even when CMV antigenemia is not present, routine monitoring involving ophthalmological examinations should be conducted for hematopoietic transplant patients, especially infants, who cannot complain of ocular symptoms.

Reading sentences of uniform word length - II: Very rapid adaptation of the preferred saccade length.

PubMed

Cutter, Michael G; Drieghe, Denis; Liversedge, Simon P

2018-04-25

In the current study we investigated whether readers adjust their preferred saccade length (PSL) during reading on a trial-by-trial basis. The PSL refers to the distance between a saccade launch site and saccade target (i.e., the word center during reading) when participants neither undershoot nor overshoot this target (McConkie, Kerr, Reddix, & Zola in Vision Research, 28, 1107-1118, 1988). The tendency for saccades longer or shorter than the PSL to under or overshoot their target is referred to as the range error. Recent research by Cutter, Drieghe, and Liversedge (Journal of Experimental Psychology: Human Perception and Performance, 2017) has shown that the PSL changes to be shorter when readers are presented with 30 consecutive sentences exclusively made of three-letter words, and longer when presented with 30 consecutive sentences exclusively made of five-letter words. We replicated and extended this work by this time presenting participants with these uniform sentences in an unblocked design. We found that adaptation still occurred across different sentence types despite participants only having one trial to adapt. Our analyses suggested that this effect was driven by the length of the words readers were making saccades away from, rather than the length of the words in the rest of the sentence. We propose an account of the range error in which readers use parafoveal word length information to estimate the length of a saccade between the center of two parafoveal words (termed the Centre-Based Saccade Length) prior to landing on the first of these words.

The analgesic effect of tramadol in animal models of neuropathic pain and fibromyalgia.

PubMed

Kaneko, Kumi; Umehara, Masato; Homan, Takashi; Okamoto, Ken; Oka, Michiko; Oyama, Tatsuya

2014-03-06

(±)-Tramadol hydrochloride (tramadol) is a widely used analgesic for the treatment of cancer pain and chronic pain. Although many animal studies have shown antinociceptive effects of tramadol in both acute and chronic pain, little is known about the effect of tramadol in putative animal models of fibromyalgia. In this study, we compared the antiallodynic effects of oral administration of tramadol in two kinds of rat chronic pain models, neuropathic pain induced by partial sciatic nerve ligation (PSL) and reserpine-induced myalgia (RIM). In PSL rats, the threshold for responses induced by tactile stimulation with von Frey filaments was significantly decreased seven days after the operation, suggesting that the operation induced tactile allodynia. Orally administered tramadol showed a potent and dose-dependent antiallodynic effect on PSL-induced allodynia. In RIM rats, the threshold was significantly decreased five days after reserpine treatment. Orally administered tramadol also attenuated reserpine-induced tactile allodynia. To explore the mechanism of the antiallodynic effect of tramadol in RIM rats, we investigated the effect of the opioid antagonist naloxone on the tramadol-induced analgesic effect in these rats. The effect of tramadol was partially antagonized by naloxone, suggesting that the opioid receptor is involved at least in part in the antiallodynic effect of tramadol in RIM rats. These data indicate that orally administered tramadol produced improvement in both PSL rats and RIM rats at similar doses and provide evidence that the opioid system is partly involved in the analgesic effect of tramadol in RIM rats. Copyright © 2014 Elsevier Ireland Ltd. All rights reserved.

[How the patients on sick leave assess the Medical Inspector: The Institut Català d'Avaluacions Mèdiques (ICAM) experience in Catalonia].

PubMed

Gálvez Hernando, G; Mira Solves, J J; Jardí Lliberia, J; Guilabert Mora, M; Manzanera López, R

2012-01-01

To analyse the patient perception of the medical inspector, and to examine whether this perception is related with the outcome of the medical report. A cross-sectional study based on telephone interviews with a random sample of patients visited in Catalonia in 2010 for temporary (TSL) or permanent (PSL) sick leave. The study was conducted in November 2011. A stratified sample considering the time from the consultation and province where patients were visited was used. The scale was assessed by Intraclass Correlation coefficient (0.93, 95% CI; 0.92-0.94) and testing with the Spearman-Brown split-half coefficient (0.93). A total of 609 patients were surveyed. A majority of them (400; 65.7%) had a positive opinion of the medical inspector. When PSL was denied, the assessment was worse (P=.002), this was different when TSL was cancelled. Patients who did not continue in PSL stated that doctor's decisions were determined by non-medical interests, and not oriented to the defence of the patient's rights (odds ratio 2.8, 95% CI; 1.7 to 4.8). When the perceptions were negative, patients focus their criticism on the role of medical inspector (P<.001), and not about the organisational aspects. When inspectors cancel PSL, patient's perception is strongly associated with a negative assessment of their performance, capacity and independence of the physician. This is not so in the case of TSL. Copyright © 2011 SECA. Published by Elsevier Espana. All rights reserved.

Laboratory study of the effect of oxalic acid on the cloud condensation nuclei activity of mineral dust aerosol

NASA Astrophysics Data System (ADS)

Gierlus, Kelly M.; Laskina, Olga; Abernathy, Tricia L.; Grassian, Vicki H.

2012-01-01

Dicarboxylic acids, which make up a significant portion of the atmospheric organic aerosol, are emitted directly through biomass burning as well as produced through the oxidation of volatile organic compounds. Oxalic acid, the most abundant of the dicarboxylic acids, has been shown by recent field studies to be present in mineral dust aerosol particles. The presence of these internally mixed organic compounds can alter the water absorption and cloud condensation nuclei (CCN) abilities of mineral particles in the Earth's atmosphere. The University of Iowa's Multi-Analysis Aerosol Reactor System ( MAARS) was used to measure the CCN activity of internally mixed particles that were generated from a mixture of either calcite or polystyrene latex spheres (PSLs) in an aqueous solution of oxalic acid. Although PSL is not a mineral dust component, it is used here as a non-reactive, insoluble particle. CCN measurements indicate that the internally mixed oxalate/calcite particles showed nearly identical CCN activity compared to the original calcite particles whereas oxalic acid/PSL internally mixed particles showed much greater CCN activity compared to PSL particles alone. This difference is due to the reaction of calcite with oxalic acid, which produces a relatively insoluble calcium oxalate coating on the particle surface and not a soluble coating as it does on the PSL particle. Our results suggest that atmospheric processing of mineral dust aerosol through heterogeneous processes will likely depend on the mineralogy and the specific chemistry involved. Increase in the CCN activity by incorporation of oxalic acid are only expected for unreactive insoluble dust particles that form a soluble coating.

Comparison of the cytotoxic effect of polystyrene latex nanoparticles on planktonic cells and bacterial biofilms

NASA Astrophysics Data System (ADS)

Nomura, Toshiyuki; Fujisawa, Eri; Itoh, Shikibu; Konishi, Yasuhiro

2016-06-01

The cytotoxic effect of positively charged polystyrene latex nanoparticles (PSL NPs) was compared between planktonic bacterial cells and bacterial biofilms using confocal laser scanning microscopy, atomic force microscopy, and a colony counting method. Pseudomonas fluorescens, which is commonly used in biofilm studies, was employed as the model bacteria. We found that the negatively charged bacterial surface of the planktonic cells was almost completely covered with positively charged PSL NPs, leading to cell death, as indicated by the NP concentration being greater than that required to achieve single layer coverage. In addition, the relationship between surface coverage and cell viability of P. fluorescens cells correlated well with the findings in other bacterial cells ( Escherichia coli and Lactococcus lactis). However, most of the bacterial cells that formed the biofilm were viable despite the positively charged PSL NPs being highly toxic to planktonic bacterial cells. This indicated that bacterial cells embedded in the biofilm were protected by self-produced extracellular polymeric substances (EPS) that provide resistance to antibacterial agents. In conclusion, mature biofilms covered with EPS exhibit resistance to NP toxicity as well as antibacterial agents.

Photo- and thermally stimulated luminescence of polyminerals extracted from herbs and spices

NASA Astrophysics Data System (ADS)

Cruz-Zaragoza, E.; Marcazzó, J.; Chernov, V.

2012-08-01

Ionizing radiation processing is a widely employed method for preservative treatment of foodstuffs. Usually it is possible to detect irradiated herbs and spices by resorting to luminescence techniques, in particular photo- and thermostimulated luminescence. For these techniques to be useful, it is necessary to characterize the response to radiation of each particular herb or spice. In this work, the thermoluminescence (TL) and photostimulated luminescence (PSL) properties of inorganic polymineral fractions extracted from commercial herbs and spices previously irradiated for disinfestation purposes have been analyzed. Samples of mint, cinnamon, chamomile, paprika, black pepper, coriander and Jamaica flower were irradiated from 50 to 400 Gy by using a beta source. The X-ray diffraction (XRD) analysis has shown that the mineral fractions consist mainly of quartz and feldspars. The PSL and TL response as a function of the absorbed dose, and their fading at room temperature have been determined. The TL glow curves have been deconvolved in order to obtain characteristic kinetics parameters in each case. The results of this work show that PSL and TL are reliable techniques for detection and analysis of irradiated foodstuffs.

Students’ Perception of Self-Efficacy Following Medicinal Chemistry Skills Laboratory Exercises

PubMed Central

Roche, Victoria F.; Qi, Yongyue

2016-01-01

Objective. To analyze student perceptions of self-efficacy in meeting medicinal chemistry course related educational outcomes and skills following a medicinal chemistry skills laboratory. Methods. Four activities were implemented in a pharmacy skills laboratory (PSL) for second-year pharmacy students. Students (n=121) worked individually on exercises for three of the four activities. Pre/post-laboratory surveys on self-efficacy were administered. The McNemar test was performed to evaluate students’ self-efficacy above 70% related to course outcomes before and after the exercises in each activity. An independent t test was conducted to compare the mean of students’ responses on meeting course outcomes based on the 70% anchor for the perspective confidence on meeting course outcomes. Results. The post-PSL scores on all self-efficacy questions improved. The majority of students reported skill development in all exercises. Students and clinical faculty qualitative responses indicated they felt exercises were effective. Conclusion. A PSL can serve as a valuable opportunity to address course related educational outcomes and specific skill development and can help students assess their self-efficacy in meeting them. PMID:27402979

Students' Perception of Self-Efficacy Following Medicinal Chemistry Skills Laboratory Exercises.

PubMed

Alsharif, Naser Z; Roche, Victoria F; Qi, Yongyue

2016-06-25

Objective. To analyze student perceptions of self-efficacy in meeting medicinal chemistry course related educational outcomes and skills following a medicinal chemistry skills laboratory. Methods. Four activities were implemented in a pharmacy skills laboratory (PSL) for second-year pharmacy students. Students (n=121) worked individually on exercises for three of the four activities. Pre/post-laboratory surveys on self-efficacy were administered. The McNemar test was performed to evaluate students' self-efficacy above 70% related to course outcomes before and after the exercises in each activity. An independent t test was conducted to compare the mean of students' responses on meeting course outcomes based on the 70% anchor for the perspective confidence on meeting course outcomes. Results. The post-PSL scores on all self-efficacy questions improved. The majority of students reported skill development in all exercises. Students and clinical faculty qualitative responses indicated they felt exercises were effective. Conclusion. A PSL can serve as a valuable opportunity to address course related educational outcomes and specific skill development and can help students assess their self-efficacy in meeting them.

JPRS Report: Proliferation Issues

DTIC Science & Technology

1993-03-08

Mo’allem Khani -ye, approximately 150 km north of Rafsanjani’s brother-in-law and among the leaders of the Tehran. This is a base-most of it underground...the manner national Atomic Energy Agency visited Iran, its mem- in which Saddam Husayn was defeated. bers asked to visit the site at Mo’allem Khani -ye

BUPT_PRIS at TREC 2014 Knowledge Base Acceleration Track

DTIC Science & Technology

2014-11-01

BUPT_PRIS at TREC 2014 Knowledge Base Acceleration Track Yuanyuan Qi, Ye Xu, Dongxu Zhang, Weiran Xu qiyuanyuan@bupt.edu.cn,bob.ye.xu@gmail.com...Filtering for Entity Profile Updates for TREC 2013 [2]Yan Li, Zhaozhao Wang , Baojin Yu, Yong Zhang, Ruiyang Luo,Weiran Xu, Guang Chen, Jun Guo. PRIS

Detection of Yersinia enterocolitica serotype O:9 in the faeces of cattle with false positive reactions in serological tests for brucellosis in Ireland.

PubMed

O'Grady, Don; Kenny, Kevin; Power, Seamus; Egan, John; Ryan, Fergus

2016-10-01

Intestinal infection by Yersinia enterocolitica serotype O:9 (YeO9) in cattle has been linked to false positive serological reactivity (FPSR) in diagnostic tests for brucellosis. Although eradicated in Ireland, brucellosis monitoring still identifies seropositive animals, usually one or two (termed singletons) per herd, which are classed as FPSR. To investigate a link between FPSR and YeO9, faeces and blood were collected from singleton FPSR cattle, and from companion animals, in eight selected herds with more than one FPSR animal, for YeO9 culture and Brucella serology. YeO9 was isolated from 76/474 (16%) FPSR singletons in 309 herds, but not from any of 621 animals in 122 control non-FPSR herds. In the FPSR herds 52/187 (27.8%) animals were culture positive, and 17% of the isolates were from seronegative animals. Seropositive animals were more likely to have a rising antibody titre when culture positive. Copyright © 2016 Elsevier Ltd. All rights reserved.

Comparisons of Mixed-Phase Icing Cloud Simulations with Experiments Conducted at the NASA Propulsion Systems Laboratory

NASA Technical Reports Server (NTRS)

Bartkus, Tadas; Tsao, Jen-Ching; Struk, Peter

2017-01-01

This paper builds on previous work that compares numerical simulations of mixed-phase icing clouds with experimental data. The model couples the thermal interaction between ice particles and water droplets of the icing cloud with the flowing air of an icing wind tunnel for simulation of NASA Glenn Research Centers (GRC) Propulsion Systems Laboratory (PSL). Measurements were taken during the Fundamentals of Ice Crystal Icing Physics Tests at the PSL tunnel in March 2016. The tests simulated ice-crystal and mixed-phase icing that relate to ice accretions within turbofan engines.

Modeling of Commercial Turbofan Engine With Ice Crystal Ingestion: Follow-On

NASA Technical Reports Server (NTRS)

Jorgenson, Philip C. E.; Veres, Joseph P.; Coennen, Ryan

2014-01-01

The occurrence of ice accretion within commercial high bypass aircraft turbine engines has been reported under certain atmospheric conditions. Engine anomalies have taken place at high altitudes that have been attributed to ice crystal ingestion, partially melting, and ice accretion on the compression system components. The result was degraded engine performance, and one or more of the following: loss of thrust control (roll back), compressor surge or stall, and flameout of the combustor. As ice crystals are ingested into the fan and low pressure compression system, the increase in air temperature causes a portion of the ice crystals to melt. It is hypothesized that this allows the ice-water mixture to cover the metal surfaces of the compressor stationary components which leads to ice accretion through evaporative cooling. Ice accretion causes a blockage which subsequently results in the deterioration in performance of the compressor and engine. The focus of this research is to apply an engine icing computational tool to simulate the flow through a turbofan engine and assess the risk of ice accretion. The tool is comprised of an engine system thermodynamic cycle code, a compressor flow analysis code, and an ice particle melt code that has the capability of determining the rate of sublimation, melting, and evaporation through the compressor flow path, without modeling the actual ice accretion. A commercial turbofan engine which has previously experienced icing events during operation in a high altitude ice crystal environment has been tested in the Propulsion Systems Laboratory (PSL) altitude test facility at NASA Glenn Research Center. The PSL has the capability to produce a continuous ice cloud which is ingested by the engine during operation over a range of altitude conditions. The PSL test results confirmed that there was ice accretion in the engine due to ice crystal ingestion, at the same simulated altitude operating conditions as experienced previously in flight. The computational tool was utilized to help guide a portion of the PSL testing, and was used to predict ice accretion could also occur at significantly lower altitudes. The predictions were qualitatively verified by subsequent testing of the engine in the PSL. In a previous study, analysis of select PSL test data points helped to calibrate the engine icing computational tool to assess the risk of ice accretion. This current study is a continuation of that data analysis effort. The study focused on tracking the variations in wet bulb temperature and ice particle melt ratio through the engine core flow path. The results from this study have identified trends, while also identifying gaps in understanding as to how the local wet bulb temperature and melt ratio affects the risk of ice accretion and subsequent engine behavior.

Modeling of Commercial Turbofan Engine with Ice Crystal Ingestion; Follow-On

NASA Technical Reports Server (NTRS)

Jorgenson, Philip C. E.; Veres, Joseph P.; Coennen, Ryan

2014-01-01

The occurrence of ice accretion within commercial high bypass aircraft turbine engines has been reported under certain atmospheric conditions. Engine anomalies have taken place at high altitudes that have been attributed to ice crystal ingestion, partially melting, and ice accretion on the compression system components. The result was degraded engine performance, and one or more of the following: loss of thrust control (roll back), compressor surge or stall, and flameout of the combustor. As ice crystals are ingested into the fan and low pressure compression system, the increase in air temperature causes a portion of the ice crystals to melt. It is hypothesized that this allows the ice-water mixture to cover the metal surfaces of the compressor stationary components which leads to ice accretion through evaporative cooling. Ice accretion causes a blockage which subsequently results in the deterioration in performance of the compressor and engine. The focus of this research is to apply an engine icing computational tool to simulate the flow through a turbofan engine and assess the risk of ice accretion. The tool is comprised of an engine system thermodynamic cycle code, a compressor flow analysis code, and an ice particle melt code that has the capability of determining the rate of sublimation, melting, and evaporation through the compressor flow path, without modeling the actual ice accretion. A commercial turbofan engine which has previously experienced icing events during operation in a high altitude ice crystal environment has been tested in the Propulsion Systems Laboratory (PSL) altitude test facility at NASA Glenn Research Center. The PSL has the capability to produce a continuous ice cloud which is ingested by the engine during operation over a range of altitude conditions. The PSL test results confirmed that there was ice accretion in the engine due to ice crystal ingestion, at the same simulated altitude operating conditions as experienced previously in flight. The computational tool was utilized to help guide a portion of the PSL testing, and was used to predict ice accretion could also occur at significantly lower altitudes. The predictions were qualitatively verified by subsequent testing of the engine in the PSL. In a previous study, analysis of select PSL test data points helped to calibrate the engine icing computational tool to assess the risk of ice accretion. This current study is a continuation of that data analysis effort. The study focused on tracking the variations in wet bulb temperature and ice particle melt ratio through the engine core flow path. The results from this study have identified trends, while also identifying gaps in understanding as to how the local wet bulb temperature and melt ratio affects the risk of ice accretion and subsequent engine behavior.

Yeast eIF4B binds to the head of the 40S ribosomal subunit and promotes mRNA recruitment through its N-terminal and internal repeat domains

PubMed Central

Walker, Sarah E.; Zhou, Fujun; Mitchell, Sarah F.; Larson, Victoria S.; Valasek, Leos; Hinnebusch, Alan G.; Lorsch, Jon R.

2013-01-01

Eukaryotic translation initiation factor (eIF)4B stimulates recruitment of mRNA to the 43S ribosomal pre-initiation complex (PIC). Yeast eIF4B (yeIF4B), shown previously to bind single-stranded (ss) RNA, consists of an N-terminal domain (NTD), predicted to be unstructured in solution; an RNA-recognition motif (RRM); an unusual domain comprised of seven imperfect repeats of 26 amino acids; and a C-terminal domain. Although the mechanism of yeIF4B action has remained obscure, most models have suggested central roles for its RRM and ssRNA-binding activity. We have dissected the functions of yeIF4B’s domains and show that the RRM and its ssRNA-binding activity are dispensable in vitro and in vivo. Instead, our data indicate that the 7-repeats and NTD are the most critical domains, which mediate binding of yeIF4B to the head of the 40S ribosomal subunit via interaction with Rps20. This interaction induces structural changes in the ribosome’s mRNA entry channel that could facilitate mRNA loading. We also show that yeIF4B strongly promotes productive interaction of eIF4A with the 43S•mRNA PIC in a manner required for efficient mRNA recruitment. PMID:23236192

The potential application of a transcriptionally regulated oncolytic herpes simplex virus for human cancer therapy

PubMed Central

Miao, L; Fraefel, C; Sia, K C; Newman, J P; Mohamed-Bashir, S A; Ng, W H; Lam, P Y P

2014-01-01

Background: Emerging studies have shown the potential benefit of arming oncolytic viruses with therapeutic genes. However, most of these therapeutic genes are placed under the regulation of ubiquitous viral promoters. Our goal is to generate a safer yet potent oncolytic herpes simplex virus type-1 (HSV-1) for cancer therapy. Methods: Using bacterial artificial chromosome (BAC) recombineering, a cell cycle-regulatable luciferase transgene cassette was replaced with the infected cell protein 6 (ICP6) coding region (encoded for UL39 or large subunit of ribonucleotide reductase) of the HSV-1 genome. These recombinant viruses, YE-PC8, were further tested for its proliferation-dependent luciferase gene expression. Results: The ability of YE-PC8 to confer proliferation-dependent transgene expression was demonstrated by injecting similar amount of viruses into the tumour-bearing region of the brain and the contralateral normal brain parenchyma of the same mouse. The results showed enhanced levels of luciferase activities in the tumour region but not in the normal brain parenchyma. Similar findings were observed in YE-PC8-infected short-term human brain patient-derived glioma cells compared with normal human astrocytes. intratumoural injection of YE-PC8 viruses resulted in 77% and 80% of tumour regression in human glioma and human hepatocellular carcinoma xenografts, respectively. Conclusion: YE-PC8 viruses confer tumour selectivity in proliferating cells and may be developed further as a feasible approach to treat human cancers. PMID:24196790

Complexes of yeast adenylate kinase and nucleotides investigated by sup 1 H NMR

DOE Office of Scientific and Technical Information (OSTI.GOV)

Vetter, I.R.; Konrad, M.; Rosch, P.

1991-04-30

The role of one of the histidine residues present in many adenylate kinases (H36 in the porcine cytosolic enzyme) is highly disputed. The authors studied the yeast enzyme (AK{sub ye}) containing this His residue. AK{sub ye} is highly homologous to the Escherichia coli enzyme (AK{sub ec}), a protein that is already well characterized by NMR and does not contain the His residue in question. In addition, discrepancies between solution structural and X-ray crystallographic studies on the location of the nucleotide binding sites of adenylate kinases are clarified. One- and two-dimensional nuclear magnetic resonance (NMR) spectroscopy was used to investigate AK{submore » ye} and its complex with the bisubstrate analogue P{sup 1},P{sup 5}-bis(5{prime}-adenosyl)pentaphosphate (AP{sub 5}A). From these studies, all aromatic residues of AK{sub ec} involved in the binding of ATP{center dot}Mg{sup 2+} have functional analogues in AK{sub ye}. The AMP site seems to make no contacts to aromatic side chains, neither in the AK{sub ye}{center dot}AP{sub 5}A{center dot}Mg{sup 2+} nor in the AK{sub ec}{center dot}AP{sub 5}A{center dot}Mg{sup 2+} complexes, so that it is presently not possible to localize this binding site by NMR. In combination with the recent X-ray results on the AP{sub 5}A complexes AK{sub ye} and AK{sub ec} and the GMP complex of guanylate kinase the latter one leading to the definition of the monophosphate site, the problem of the location of the nucleotide sites can be considered to be solved in a way contradicting earlier work and denying the His residue homologous to H36 in porcine adenylate kinase a direct role in substrate binding.« less

Light element production in the big bang and the synthesis of heavy elements in 3D MHD jets from core-collapse supernovae

NASA Astrophysics Data System (ADS)

Winteler, Christian

2014-02-01

In this dissertation we present the main features of a new nuclear reaction network evolution code. This new code allows nucleosynthesis calculations for large numbers of nuclides. The main results in this dissertation are all obtained using this new code. The strength of standard big bang nucleosynthesis is, that all primordial abundances are determined by only one free parameter, the baryon-to-photon ratio η. We perform self consistent nucleosynthesis calculations for the latest WMAP value η = (6.16±0.15)×10^-10 . We predict primordial light element abundances: D/H = (2.84 ± 0.23)×10^-5, 3He/H = (1.07 ± 0.09)×10^-5, Yp = 0.2490±0.0005 and 7Li/H = (4.57 ± 0.55)×10^-10, in agreement with current observations and other predictions. We investigate the influence of the main production rate on the 6 Li abundance, but find no significant increase of the predicted value, which is known to be orders of magnitude lower than the observed. The r-process is responsible for the formation of about half of the elements heavier than iron in our solar system. This neutron capture process requires explosive environments with large neutron densities. The exact astrophysical site where the r-process occurs has not yet been identified. We explore jets from magnetorotational core collapse supernovae (MHD jets) as possible r-process site. In a parametric study, assuming adiabatic expansion, we find good agreement with solar system abundances for a superposition of components with different electron fraction (Ye ), ranging from Ye = 0.1 to Ye = 0.3. Fission is found to be important only for Ye ≤ 0.17. The first postprocessing calculations with data from 3D MHD core collapse supernova simulations are performed for two different simulations. Calculations are based on two different methods to extract data from the simulation: tracer particles and a two dimensional, mass weighted histogram. Both results yield almost identical results. We find that both simulations can reproduce the global solar r-process abundance pattern. The ejected mass is found to be in agreement with galactic chemical evolution for a rare event rate of one MHD jet every hundredth to thousandth supernova.

Identification of the Propionicin F Bacteriocin Immunity Gene (pcfI) and Development of a Food-Grade Cloning System for Propionibacterium freudenreichii▿ †

PubMed Central

Brede, Dag Anders; Lothe, Sheba; Salehian, Zhian; Faye, Therese; Nes, Ingolf F.

2007-01-01

This report describes the first functional analysis of a bacteriocin immunity gene from Propionibacterium freudenreichii and its use as a selection marker for food-grade cloning. Cloning of the pcfI gene (previously orf5 [located as part of the pcfABC propionicin F operon]) rendered the sensitive host 1,000-fold more tolerant to the propionicin F bacteriocin. The physiochemical properties of the 127-residue large PcfI protein resemble those of membrane-bound immunity proteins from bacteriocin systems found in lactic acid bacteria. The high level of immunity conferred by pcfI allowed its use as a selection marker for plasmid transformation in P. freudenreichii. Electroporation of P. freudenreichii IFO12426 by use of the pcfI expression plasmid pSL102 and propionicin F selection (200 bacteriocin units/ml) yielded 107 transformants/μg DNA. The 2.7-kb P. freudenreichii food-grade cloning vector pSL104 consists of the pLME108 replicon, a multiple cloning site, and pcfI expressed from the constitutive PpampS promoter for selection. The pSL104 vector efficiently facilitated cloning of the propionicin T1 bacteriocin in P. freudenreichii. High-level propionicin T1 production (640 BU/ml) was obtained with the IFO12426 strain, and the food-grade propionicin T1 expression plasmid pSL106 was maintained by ∼91% of the cells over 25 generations in the absence of selection. To the best of our knowledge this is the first report of an efficient cloning system that facilitates the generation of food-grade recombinant P. freudenreichii strains. PMID:17933941

Identification of the propionicin F bacteriocin immunity gene (pcfI) and development of a food-grade cloning system for Propionibacterium freudenreichii.

PubMed

Brede, Dag Anders; Lothe, Sheba; Salehian, Zhian; Faye, Therese; Nes, Ingolf F

2007-12-01

This report describes the first functional analysis of a bacteriocin immunity gene from Propionibacterium freudenreichii and its use as a selection marker for food-grade cloning. Cloning of the pcfI gene (previously orf5 [located as part of the pcfABC propionicin F operon]) rendered the sensitive host 1,000-fold more tolerant to the propionicin F bacteriocin. The physiochemical properties of the 127-residue large PcfI protein resemble those of membrane-bound immunity proteins from bacteriocin systems found in lactic acid bacteria. The high level of immunity conferred by pcfI allowed its use as a selection marker for plasmid transformation in P. freudenreichii. Electroporation of P. freudenreichii IFO12426 by use of the pcfI expression plasmid pSL102 and propionicin F selection (200 bacteriocin units/ml) yielded 10(7) transformants/microg DNA. The 2.7-kb P. freudenreichii food-grade cloning vector pSL104 consists of the pLME108 replicon, a multiple cloning site, and pcfI expressed from the constitutive P(pampS) promoter for selection. The pSL104 vector efficiently facilitated cloning of the propionicin T1 bacteriocin in P. freudenreichii. High-level propionicin T1 production (640 BU/ml) was obtained with the IFO12426 strain, and the food-grade propionicin T1 expression plasmid pSL106 was maintained by approximately 91% of the cells over 25 generations in the absence of selection. To the best of our knowledge this is the first report of an efficient cloning system that facilitates the generation of food-grade recombinant P. freudenreichii strains.

The Incidence of Atypical Femoral Fractures in Patients with Rheumatic Disease: Yamagata Prefectural Committee of Atypical Femoral Fractures (YamaCAFe) Study.

PubMed

Takakubo, Yuya; Ohta, Daichi; Ishi, Masaji; Ito, Juji; Oki, Hiroharu; Naganuma, Yasushi; Uno, Tomohiro; Sasaki, Akiko; Akabane, Takeru; Dairaku, Katsuyuki; Goto, Shinichi; Goto, Yasuo; Kanauchi, Yumiko; Kobayashi, Shinji; Nakajima, Taku; Masuda, Keiji; Matsuda, Michiharu; Mura, Nariyuki; Takenouchi, Kenji; Tsuchida, Hiroyuki; Onuma, Yasushi; Shibuya, Junichirou; Seino, Mitsuyoshi; Yamaguchi, Osamu; Hiragami, Ken; Urayama, Yasuhiro; Furukawa, Takashi; Okuda, Shouta; Ogura, Ken; Nakamura, Takeshi; Sasaki, Kan; Konta, Tsuneo; Takagi, Michiaki

2017-08-01

Atypical femoral fractures (AFFs) have been reported to occur with minimal or spontaneous subtrochanteric and femoral shaft fractures with a characteristic transverse pattern, compared with typical femoral fractures in young patients with high-energy trauma. AFFs are related to long-term use of bisphosphonates (BPs), glucocorticoids and rheumatic diseases. We have estimated a blind analysis of AFFs in rheumatic patients receiving BPs and glucocorticoids ordinary over a long time in all Yamagata prefectural area through radiographic examination. The 123 AFFs including suspected cases over six years were collected and reviewed by two independent orthopedic surgeons. We found 86 patients with a total of 99 AFFs between 2009 and 2014 (1.43 cases/100,000 person/year). Of these 99 AFFs, 11 were in 8 rheumatic patients including three patients with bilateral AFFs. The incidence of AFFs in rheumatic patients had trend to increase from 2012. The mean age of all 8 patients was 54.9 years. All 8 patients received BPs and 7/8 received prednisolone (PSL). The mean dose of PSL was 14 mg/day. Compared to patients with unilateral AFFs, those with bilateral AFFs in rheumatic patients were on a higher dose of PSL (20 mg/day vs. 7 mg/day) and had less femoral neck-shaft angle (129° vs. 136°, p < 0.05). In conclusion, the incidence of AFFs in rheumatic patients showed a trend to increase from 2012 to 2014 in Yamagata prefecture. Careful management of AFFs is of particular importance in rheumatic patients who have taken high doses of PSL and have small femoral neck-shaft angle.

Structure of a pectin methylesterase from Yersinia enterocolitica.

PubMed

Boraston, Alisdair B; Abbott, D Wade

2012-02-01

Pectin methylesterases (PMEs) are family 8 carbohydrate esterases (CE8s) which remove the methyl group from methylesterified galacturonic acid (GalA) residues within pectin. Although the role of pectinases such as PMEs within dedicated phytopathogens has been well established, the significance of homologous enzymes found within the genomes of human enteropathogens remains to be determined. Presented here is the low-resolution (3.5 Å) structure of the CE8 from Yersinia enterocolitica (YeCE8). The high degree of structural conservation in the topology of the active-site cleft and catalytic apparatus that is shared with a characterized PME from a bacterial phytopathogen (i) indicates that YeCE8 is active on methylated pectin and (ii) highlights a more prominent role for pectin utilization in Yersinia than in other enteropathogenic species.

An Initial Study of the Fundamentals of Ice Crystal Icing Physics in the NASA Propulsion Systems Laboratory

NASA Technical Reports Server (NTRS)

Struk, Peter; Bartkus, Tadas; Tsao, Jen-Ching; Bencic, Timothy; King, Michael; Ratvasky, Thomas; Van Zante, Judith

2017-01-01

This presentation shows results from an initial study of the fundamental physics of ice-crystal ice accretion using the NASA Propulsion Systems Lab (PSL). Ice accretion due to the ingestion of ice-crystals is being attributed to numerous jet-engine power-loss events. The NASA PSL is an altitude jet-engine test facility which has recently added a capability to inject ice particles into the flow. NASA is evaluating whether this facility, in addition to full-engine and motor-driven-rig tests, can be used for more fundamental ice-accretion studies that simulate the different mixed-phase icing conditions along the core flow passage of a turbo-fan engine compressor. The data from such fundamental accretion tests will be used to help develop and validate models of the accretion process. The present study utilized a NACA0012 airfoil. The mixed-phase conditions were generated by partially freezing the liquid-water droplets ejected from the spray bars. This presentation shows data regarding (1) the freeze out characteristics of the cloud, (2) changes in aerothermal conditions due to the presence of the cloud, and (3) the ice accretion characteristics observed on the airfoil model. The primary variable in this test was the PSL plenum humidity which was systematically varied for two duct-exit-plane velocities (85 and 135 ms) as well as two particle size clouds (15 and 50 m MVDi). The observed clouds ranged from fully glaciated to fully liquid, where the liquid clouds were at least partially supercooled. The air total temperature decreased at the test section when the cloud was activated due to evaporation. The ice accretions observed ranged from sharp arrow-like accretions, characteristic of ice-crystal erosion, to cases with double-horn shapes, characteristic of supercooled water accretions.

An Initial Study of the Fundamentals of Ice Crystal Icing Physics in the NASA Propulsion Systems Laboratory

NASA Technical Reports Server (NTRS)

Struk, Peter M.; Ratvasky, Thomas P.; Bencic, Timothy J.; Van Zante, Judith F.; King, Michael C.; Tsao, Jen-Ching; Bartkus, Tadas P.

2017-01-01

This paper presents results from an initial study of the fundamental physics of ice-crystal ice accretion using the NASA Propulsion Systems Lab (PSL). Ice accretion due to the ingestion of ice-crystals is being attributed to numerous jet-engine power-loss events. The NASA PSL is an altitude jet-engine test facility which has recently added a capability to inject ice particles into the flow. NASA is evaluating whether this facility, in addition to full-engine and motor-driven-rig tests, can be used for more fundamental ice-accretion studies that simulate the different mixed-phase icing conditions along the core flow passage of a turbo-fan engine compressor. The data from such fundamental accretion tests will be used to help develop and validate models of the accretion process. The present study utilized a NACA0012 airfoil. The mixed-phase conditions were generated by partially freezing the liquid-water droplets ejected from the spray bars. This paper presents data regarding (1) the freeze out characteristics of the cloud, (2) changes in aerothermal conditions due to the presence of the cloud, and (3) the ice accretion characteristics observed on the airfoil model. The primary variable in this test was the PSL plenum humidity which was systematically varied for two duct-exit-plane velocities (85 and 135 ms) as well as two particle size clouds (15 and 50 m MVDi). The observed clouds ranged from fully glaciated to fully liquid, where the liquid clouds were at least partially supercooled. The air total temperature decreased at the test section when the cloud was activated due to evaporation. The ice accretions observed ranged from sharp arrow-like accretions, characteristic of ice-crystal erosion, to cases with double-horn shapes, characteristic of supercooled water accretions.

Atomic layer deposition on phase-shift lithography generated photoresist patterns for 1D nanochannel fabrication.

PubMed

Güder, Firat; Yang, Yang; Krüger, Michael; Stevens, Gregory B; Zacharias, Margit

2010-12-01

A versatile, low-cost, and flexible approach is presented for the fabrication of millimeter-long, sub-100 nm wide 1D nanochannels with tunable wall properties (wall thickness and material) over wafer-scale areas on glass, alumina, and silicon surfaces. This approach includes three fabrication steps. First, sub-100 nm photoresist line patterns were generated by near-field contact phase-shift lithography (NFC-PSL) using an inexpensive homemade borosilicate mask (NFC-PSM). Second, various metal oxides were directly coated on the resist patterns with low-temperature atomic layer deposition (ALD). Finally, the remaining photoresist was removed via an acetone dip, and then planar nanochannel arrays were formed on the substrate. In contrast to all the previous fabrication routes, the sub-100 nm photoresist line patterns produced by NFC-PSL are directly employed as a sacrificial layer for the creation of nanochannels. Because both the NFC-PSL and the ALD deposition are highly reproducible processes, the strategy proposed here can be regarded as a general route for nanochannel fabrication in a simplified and reliable manner. In addition, the fabricated nanochannels were used as templates to synthesize various organic and inorganic 1D nanostructures on the substrate surface.

Two Genetic Loci Produce Distinct Carbohydrate-Rich Structural Components of the Pseudomonas aeruginosa Biofilm Matrix

PubMed Central

Friedman, Lisa; Kolter, Roberto

2004-01-01

Pseudomonas aeruginosa forms biofilms, which are cellular aggregates encased in an extracellular matrix. Molecular genetics studies of three common autoaggregative phenotypes, namely wrinkled colonies, pellicles, and solid-surface-associated biofilms, led to the identification of two loci, pel and psl, that are involved in the production of carbohydrate-rich components of the biofilm matrix. The pel gene cluster is involved in the production of a glucose-rich matrix material in P. aeruginosa strain PA14 (L. Friedman and R. Kolter, Mol. Microbiol. 51:675-690, 2004). Here we investigate the role of the pel gene cluster in P. aeruginosa strain ZK2870 and identify a second genetic locus, termed psl, involved in the production of a mannose-rich matrix material. The 11 predicted protein products of the psl genes are homologous to proteins involved in carbohydrate processing. P. aeruginosa is thus able to produce two distinct carbohydrate-rich matrix materials. Either carbohydrate-rich matrix component appears to be sufficient for mature biofilm formation, and at least one of them is required for mature biofilm formation in P. aeruginosa strains PA14 and ZK2870. PMID:15231777

Two genetic loci produce distinct carbohydrate-rich structural components of the Pseudomonas aeruginosa biofilm matrix.

PubMed

Friedman, Lisa; Kolter, Roberto

2004-07-01

Pseudomonas aeruginosa forms biofilms, which are cellular aggregates encased in an extracellular matrix. Molecular genetics studies of three common autoaggregative phenotypes, namely wrinkled colonies, pellicles, and solid-surface-associated biofilms, led to the identification of two loci, pel and psl, that are involved in the production of carbohydrate-rich components of the biofilm matrix. The pel gene cluster is involved in the production of a glucose-rich matrix material in P. aeruginosa strain PA14 (L. Friedman and R. Kolter, Mol. Microbiol. 51:675-690, 2004). Here we investigate the role of the pel gene cluster in P. aeruginosa strain ZK2870 and identify a second genetic locus, termed psl, involved in the production of a mannose-rich matrix material. The 11 predicted protein products of the psl genes are homologous to proteins involved in carbohydrate processing. P. aeruginosa is thus able to produce two distinct carbohydrate-rich matrix materials. Either carbohydrate-rich matrix component appears to be sufficient for mature biofilm formation, and at least one of them is required for mature biofilm formation in P. aeruginosa strains PA14 and ZK2870. Copyright 2004 American Society for Microbiology

Hear Ye, Hear Ye: A Dozen Messages from the New York Common Core Crier

ERIC Educational Resources Information Center

Jaeger, Paige

2014-01-01

In 2010, Jean Stevens from the New York State Education Department addressed a group of NY state administrators and shared, "It is no mistake that inquiry-based learning is throughout the Common Core." That was a cornerstone cry for which only school librarians knew the significance. After years of fighting for turf as a poor fief, it…

Effects on grape amino acid concentration through foliar application of three different elicitors.

PubMed

Gutiérrez-Gamboa, G; Portu, J; Santamaría, P; López, R; Garde-Cerdán, T

2017-09-01

Elicitors play an important role in the defense against pathogens as an alternative to chemical pesticides by increasing secondary metabolites. Their effect on grape amino acid has been little investigated. Thus, the aim of this research was to study the influence of methyl jasmonate (MeJ), chitosan (CHT), and a yeast extract (YE) on grape amino acid composition, through foliar applications to grapevines. The must amino acid concentration was analyzed by HPLC. The results showed that CHT and YE treatments decreased the must concentration of several amino acids, affecting total amino acid content (from 2364 to 1961, and 1818mg/L, respectively). However, MeJ treatment had a slight effect on grape amino acid content, increasing the concentration of Met (from 8.95 to 12.13mg/L) and Phe (from 7.96 to 9.29mg/L). It seems to be that, the resistance induction through CHT and YE treatments results in physiological costs to grapevines associated with a decrease on grape amino acid concentration. Consequently, MeJ applications, as a viticultural practice, could be a better tool than CHT and YE treatments, because did not affect grape amino acid concentration. Copyright © 2017 Elsevier Ltd. All rights reserved.

High-dose nebulized budesonide is effective for mild asthma exacerbations in children under 3 years of age.

PubMed

Saito, M; Kikuchi, Y; Kawarai Lefor, A; Hoshina, M

2017-01-01

Background. High-dose inhaled steroid therapy has been shown to be effective in children and adults with asthma exacerbations. However, few reports are available regarding its efficacy for asthma exacerbations in younger children. Objective. In this study, we administered high-dose nebulized budesonide therapy for mild asthma exacerbations in children < 3 years of age and compared its efficacy and safety with systemic steroid therapy. Methods. This study included children < 3 years old with mild asthma exacerbations. Patients were randomly assigned to two groups: the BIS group was given 1 mg of nebulized budesonide twice daily, and the PSL group received prednisolone 0.5 mg/kg iv three times daily. Days to disappearance of wheezing, days of steroid use, days of oxygen use, serum cortisol level, and incidence of adverse events during treatment were compared between the groups. Result. Wheezing disappeared after an average of five days, and steroids were administered for an average of five days in both groups, with no significant difference in days of oxygen use. Serum cortisol levels at initiation and during the course of treatment remained unchanged in the BIS group, and were decreased in the PSL group; however, the decrease in the latter group was not pathologic. Conclusion. For children < 3 years old with mild asthma exacerbations, high-dose nebulized budesonide therapy is equally as effective as systemic steroid therapy.

Acceleration of yoghurt fermentation time by yeast extract and partial characterisation of the active components.

PubMed

Smith, Esti-Andrine; Myburgh, Jacobus; Osthoff, Gernot; de Wit, Maryna

2014-11-01

Water soluble autolysate of yeast, usually utilised for microbial growth support, was used as additive in yoghurt fermentation. The yeast extract (YE) resulted in a decrease of fermentation time by 21% to reach a pH of 4·6. However, the YE resulted in unacceptable flavour and taste. By size exclusion chromatography, a fraction of the YE was obtained that could account for the observed 21% decrease in fermentation time. The fraction contained molecules of low molecular weight, consisting of minerals, free amino acids and peptides. The acceleration of the yoghurt fermentation was ascribed to the short peptides in the fraction. It is proposed that the application of this extract in industrial yoghurt manufacture would result in savings for both the industry and the consumer.

Validation Ice Crystal Icing Engine Test in the Propulsion Systems Laboratory at NASA Glenn Research Center

NASA Technical Reports Server (NTRS)

Oliver, Michael J.

2014-01-01

The Propulsion Systems Laboratory (PSL) is an existing altitude simulation jet engine test facility located at NASA Glenn Research Center in Cleveland, OH. It was modified in 2012 with the integration of an ice crystal cloud generation system. This paper documents the inaugural ice crystal cloud test in PSL--the first ever full scale, high altitude ice crystal cloud turbofan engine test to be conducted in a ground based facility. The test article was a Lycoming ALF502-R5 high bypass turbofan engine, serial number LF01. The objectives of the test were to validate the PSL ice crystal cloud calibration and engine testing methodologies by demonstrating the capability to calibrate and duplicate known flight test events that occurred on the same LF01 engine and to generate engine data to support fundamental and computational research to investigate and better understand the physics of ice crystal icing in a turbofan engine environment while duplicating known revenue service events and conducting test points while varying facility and engine parameters. During PSL calibration testing it was discovered than heated probes installed through tunnel sidewalls experienced ice buildup aft of their location due to ice crystals impinging upon them, melting and running back. Filtered city water was used in the cloud generation nozzle system to provide ice crystal nucleation sites. This resulted in mineralization forming on flow path hardware that led to a chronic degradation of performance during the month long test. Lacking internal flow path cameras, the response of thermocouples along the flow path was interpreted as ice building up. Using this interpretation, a strong correlation between total water content (TWC) and a weaker correlation between median volumetric diameter (MVD) of the ice crystal cloud and the rate of ice buildup along the instrumented flow path was identified. For this test article the engine anti-ice system was required to be turned on before ice crystal icing would occur. The ice crystal icing event, an uncommanded reduction in thrust, was able to be turned on and off by manipulating cloud TWC. A flight test point where no ice crystal icing event occurred was also duplicated in PSL. Physics based computational tools were successfully used to predict tunnel settings to induce ice buildup along the low pressure compression system flow path for several test points at incrementally lower altitudes, demonstrating that development of ice crystal icing scaling laws is potentially feasible. Analysis of PSL test data showed that uncommanded reduction in thrust occurs during ice crystal cloud on operation prior to fan speed reduction. This supports previous findings that the reduction of thrust for this test article is due to ice buildup leading to a restricted airflow from either physical or aerodynamic blockage in the engine core flow path.

Contribution of corresponding member of the USSR Academy of Sciences Ye. A. Korovin to the science of international space law. Anniversary of corresponding member of the USSR Academy of Sciences, Professor Ye. A. Korovin

NASA Technical Reports Server (NTRS)

Zhukov, G. P.

1980-01-01

The Soviet Union's participation in the solution of international legal problems as space flights became possible is reviewed with emphasis on the efforts of the most prominent Soviet international lawyer. Some of the professor's 230 writings are highlighted.

USSR Report, Life Sciences, Biomedical and Behavioral Sciences

DTIC Science & Technology

1985-02-05

of the toxicity and anticholinesterase activity , of a number of organophosphorus compounds and carbamates, for females of the genus hybomitra and...house flies. Anticholinesterase activity and toxicity did not vary identically. 1842-6508] UDC: 619*616.981.42:612.017.1 ANTIGENTREACTIVE CELLS IN...Rukhlyada, M. Ye. Pillpenko; VETERINARIYA, No 8, Aug 84) 2 Toxicity and Anticholinesterase Action of Insecticides (Ye. K. Balashova, V. I

Structure of a pectin methylesterase from Yersinia enterocolitica

PubMed Central

Boraston, Alisdair B.; Abbott, D. Wade

2012-01-01

Pectin methylesterases (PMEs) are family 8 carbohydrate esterases (CE8s) which remove the methyl group from methylesterified galacturonic acid (GalA) residues within pectin. Although the role of pectinases such as PMEs within dedicated phytopathogens has been well established, the significance of homologous enzymes found within the genomes of human enteropathogens remains to be determined. Presented here is the low-resolution (3.5 Å) structure of the CE8 from Yersinia enterocolitica (YeCE8). The high degree of structural conservation in the topology of the active-site cleft and catalytic apparatus that is shared with a characterized PME from a bacterial phytopathogen (i) indicates that YeCE8 is active on methylated pectin and (ii) highlights a more prominent role for pectin utilization in Yersinia than in other enteropathogenic species. PMID:22297983

Validation of the YuWell YE690A upper-arm blood pressure monitor, for clinic use and self-measurement, according to the European Society of Hypertension International Protocol revision 2010.

PubMed

Chen, Qi; Lei, Lei; Li, Yan; Wang, Ji-Guang

2017-10-01

The present study aimed to evaluate the accuracy of the automated oscillometric upper-arm blood pressure monitor YuWell YE690A for blood pressure measurement according to the International Protocol of the European Society of Hypertension revision 2010. Systolic and diastolic blood pressures were measured sequentially in 33 adult Chinese (12 women, 44.2 years of mean age) using a mercury sphygmomanometer (two observers) and the YE690A device (one supervisor). A total of 99 pairs of comparisons were obtained from 33 participants for judgments in two parts with three grading phases. All the blood pressure requirements were fulfilled. The YuWell YE690A device achieved the targets in part 1 of the validation study. The number of absolute differences between device and observers within 5, 10, and 15 mmHg was 79/99, 96/99, and 97/99, respectively, for systolic blood pressure and 72/99, 95/99, and 98/99, respectively, for diastolic blood pressure. The device also fulfilled the criteria in part 2 of the validation study. Thirty-one and 25 participants for systolic and diastolic blood pressure, respectively, had at least two of the three device-observer differences within 5 mmHg (required ≥24). No participant for systolic and two participants for diastolic blood pressure had all the three device-observer comparisons greater than 5 mmHg. The YuWell blood pressure monitor YE690A has passed the requirements of the International Protocol revision 2010 and hence can be recommended for blood pressure measurement in adults.

Impact of Neutrino Flavor Oscillations on the Neutrino-driven Wind Nucleosynthesis of an Electron-capture Supernova

NASA Astrophysics Data System (ADS)

Pllumbi, Else; Tamborra, Irene; Wanajo, Shinya; Janka, Hans-Thomas; Hüdepohl, Lorenz

2015-08-01

Neutrino oscillations, especially to light sterile states, can affect nucleosynthesis yields because of their possible feedback effect on the electron fraction (Ye). For the first time, we perform nucleosynthesis calculations for neutrino-driven wind trajectories from the neutrino-cooling phase of an 8.8 {M}⊙ electron-capture supernova (SN), whose hydrodynamic evolution was computed in spherical symmetry with sophisticated neutrino transport and whose Ye evolution was post-processed by including neutrino oscillations between both active and active-sterile flavors. We also take into account the α-effect as well as weak magnetism and recoil corrections in the neutrino absorption and emission processes. We observe effects on the Ye evolution that depend in a subtle way on the relative radial positions of the sterile Mikheyev-Smirnov-Wolfenstein resonances, on collective flavor transformations, and on the formation of α particles. For the adopted SN progenitor, we find that neutrino oscillations, also to a sterile state with eV mass, do not significantly affect the element formation and in particular cannot make the post-explosion wind outflow neutron-rich enough to activate a strong r-process. Our conclusions become even more robust when, in order to mimic equation-of-state-dependent corrections due to nucleon potential effects in the dense-medium neutrino opacities, six cases with reduced Ye in the wind are considered. In these cases, despite the conversion of active neutrinos to sterile neutrinos, Ye increases or is not significantly lowered compared to the values obtained without oscillations and active flavor transformations. This is a consequence of a complicated interplay between sterile-neutrino production, neutrino-neutrino interactions, and α-effect.

Rheological profile of diets produced using agro-industrial wastes for rearing codling moth larvae for baculovirus biopesticides.

PubMed

Gnepe, J R; Tyagi, R D; Brar, S K; Valero, J R

2011-01-01

A rheological study of diets using the agro-industrial wastes (brewery wastewater and pomace waste) was carried out in order to obtain a diet most adapted to supply nutrients for growth of codling moth (CM) larvae. Nutritive capacity (g/L) of brewery wastewater (BWW) (25.5 ± 5.5 carbohydrates; 16.9 ± 2.1 proteins; 6 ± 1.6 lipids) and pomace waste (POM) (22.0 ± 0.03 carbohydrates; 11.3 ± 1.3 proteins; 2 ± 0.2 lipids) were essential and important as replacement or in association with other ingredients [soya flour (SF), wheat germ (WG), yeast extract (YE)] of the standard diet for the breeding of codling moth larvae. These diet additives also contributed to the preservation of texture and nutritive content of larvae diet. The eggs and CM larvae were grown on alternate diets under industrial conditions (16:8 h photoperiod; 25 ± 1 °C and 50 ± 0.5 % of humidity). The higher assimilation of nutrients of the diets in BWW and control diet was observed by calculating the rate of hatching of eggs (0.48 to 0.71); larvae growth (0.23 to 0.4) and fertility (1.33 to 3 for control diet). The excellent growth and fertility rates of codling moth larvae were attributed to variations in viscosity (varying from 50 to 266 mPa.s⁻¹), particle size (varying 24.3 μm in 88.05 μm with regard to 110 μm the control diet) and total solids (145.88 g/L POM + YE; 162.08 g/L BWW + YE; 162.2 g/L POM + WG; 173 g/L control; 174.3 g/L BWW + WG) diets. Lower viscosity favored improved diet due to ease of assimilation of nutrients. Thus, rheology is an important parameter during preparation of diets for growth of codling moth larvae as it will dictate the nutrient assimilation which is an important parameter of larvae growth.

Dynamical mass ejection from the merger of asymmetric binary neutron stars: Radiation-hydrodynamics study in general relativity

NASA Astrophysics Data System (ADS)

Sekiguchi, Yuichiro; Kiuchi, Kenta; Kyutoku, Koutarou; Shibata, Masaru; Taniguchi, Keisuke

2016-06-01

We perform neutrino radiation-hydrodynamics simulations for the merger of asymmetric binary neutron stars in numerical relativity. Neutron stars are modeled by soft and moderately stiff finite-temperature equations of state (EOS). We find that the properties of the dynamical ejecta such as the total mass, neutron richness profile, and specific entropy profile depend on the mass ratio of the binary systems for a given EOS in a unique manner. For a soft EOS (SFHo), the total ejecta mass depends weakly on the mass ratio, but the average of electron number per baryon (Ye ) and specific entropy (s ) of the ejecta decreases significantly with the increase of the degree of mass asymmetry. For a stiff EOS (DD2), with the increase of the mass asymmetry degree, the total ejecta mass significantly increases while the average of Ye and s moderately decreases. We find again that only for the SFHo, the total ejecta mass exceeds 0.01 M⊙ irrespective of the mass ratio chosen in this paper. The ejecta have a variety of electron number per baryon with an average approximately between Ye˜0.2 and ˜0.3 irrespective of the EOS employed, which is well suited for the production of the rapid neutron capture process heavy elements (second and third peaks), although its averaged value decreases with the increase of the degree of mass asymmetry.

Responses of eastern Chinese coastal salt marshes to sea-level rise combined with vegetative and sedimentary processes.

PubMed

Ge, Zhen-Ming; Wang, Heng; Cao, Hao-Bin; Zhao, Bin; Zhou, Xiao; Peltola, Heli; Cui, Li-Fang; Li, Xiu-Zhen; Zhang, Li-Quan

2016-06-23

The impacts of sea-level rise (SLR) on coastal ecosystems have attracted worldwide attention in relation to global change. In this study, the salt marsh model for the Yangtze Estuary (SMM-YE, developed in China) and the Sea Level Affecting Marshes Model (SLAMM, developed in the U.S.) were used to simulate the effects of SLR on the coastal salt marshes in eastern China. The changes in the dominant species in the plant community were also considered. Predictions based on the SLAMM indicated a trend of habitat degradation up to 2100; total salt marsh habitat area continued to decline (4-16%) based on the low-level scenario, with greater losses (6-25%) predicted under the high-level scenario. The SMM-YE showed that the salt marshes could be resilient to threats of SLR through the processes of accretion of mudflats, vegetation expansion and sediment trapping by plants. This model predicted that salt marsh areas increased (3-6%) under the low-level scenario. The decrease in the total habitat area with the SMM-YE under the high-level scenario was much lower than the SLAMM prediction. Nevertheless, SLR might negatively affect the salt marsh species that are not adapted to prolonged inundation. An adaptive strategy for responding to changes in sediment resources is necessary in the Yangtze Estuary.

Responses of eastern Chinese coastal salt marshes to sea-level rise combined with vegetative and sedimentary processes

NASA Astrophysics Data System (ADS)

Ge, Zhen-Ming; Wang, Heng; Cao, Hao-Bin; Zhao, Bin; Zhou, Xiao; Peltola, Heli; Cui, Li-Fang; Li, Xiu-Zhen; Zhang, Li-Quan

2016-06-01

The impacts of sea-level rise (SLR) on coastal ecosystems have attracted worldwide attention in relation to global change. In this study, the salt marsh model for the Yangtze Estuary (SMM-YE, developed in China) and the Sea Level Affecting Marshes Model (SLAMM, developed in the U.S.) were used to simulate the effects of SLR on the coastal salt marshes in eastern China. The changes in the dominant species in the plant community were also considered. Predictions based on the SLAMM indicated a trend of habitat degradation up to 2100; total salt marsh habitat area continued to decline (4-16%) based on the low-level scenario, with greater losses (6-25%) predicted under the high-level scenario. The SMM-YE showed that the salt marshes could be resilient to threats of SLR through the processes of accretion of mudflats, vegetation expansion and sediment trapping by plants. This model predicted that salt marsh areas increased (3-6%) under the low-level scenario. The decrease in the total habitat area with the SMM-YE under the high-level scenario was much lower than the SLAMM prediction. Nevertheless, SLR might negatively affect the salt marsh species that are not adapted to prolonged inundation. An adaptive strategy for responding to changes in sediment resources is necessary in the Yangtze Estuary.

Propulsion Systems Lab

NASA Image and Video Library

2015-04-14

NASA Glenn’s Propulsion Systems Lab (PSL) is conducting research to characterize ice crystal clouds that can create a hazard to aircraft engines in certain conditions. With specialized equipment, scientists can create a simulated ice crystal cloud with the set of bars in the back spraying out a mist. The red area includes lasers, which measure the intensity of the cloud and a series of probes to measure everything from humidity to air pressure. The isokinetic probe (in gold) samples particles and the robotic arm (in orange) has a test tube on the end that catches ice particles for further measuring. NASA Glenn’s PSL is the only place in the world which can create these kind of ice crystal cloud conditions.

Recurrent Kikuchi-Fujimoto Disease Successfully Treated by the Concomitant Use of Hydroxychloroquine and Corticosteroids

PubMed Central

Honda, Fumika; Tsuboi, Hiroto; Toko, Hirofumi; Ohyama, Ayako; Takahashi, Hidenori; Abe, Saori; Yokosawa, Masahiro; Asashima, Hiromitsu; Hagiwara, Shinya; Hirota, Tomoya; Kondo, Yuya; Matsumoto, Isao; Sumida, Takayuki

2017-01-01

Kikuchi-Fujimoto disease (KFD) is a benign disease of unknown etiology characterized by lymphadenopathy and a fever. For the majority of patients with KFD, the course is self-limited; however, the optimum method of managing recurrent cases has not yet been established. We herein report a case of a 42-year-old Japanese woman with KFD (confirmed by a lymph node biopsy). Although high-dose prednisolone (PSL) rapidly induced remission, she experienced four recurrences on treatment tapering. Concomitant use of hydroxychloroquine (HCQ) with low-dose PSL induced continuous remission. This is the first case to suggest the effectiveness of HCQ for recurrent KFD in a Japanese patient. PMID:29021444

Recurrent Kikuchi-Fujimoto Disease Successfully Treated by the Concomitant Use of Hydroxychloroquine and Corticosteroids.

PubMed

Honda, Fumika; Tsuboi, Hiroto; Toko, Hirofumi; Ohyama, Ayako; Takahashi, Hidenori; Abe, Saori; Yokosawa, Masahiro; Asashima, Hiromitsu; Hagiwara, Shinya; Hirota, Tomoya; Kondo, Yuya; Matsumoto, Isao; Sumida, Takayuki

2017-12-15

Kikuchi-Fujimoto disease (KFD) is a benign disease of unknown etiology characterized by lymphadenopathy and a fever. For the majority of patients with KFD, the course is self-limited; however, the optimum method of managing recurrent cases has not yet been established. We herein report a case of a 42-year-old Japanese woman with KFD (confirmed by a lymph node biopsy). Although high-dose prednisolone (PSL) rapidly induced remission, she experienced four recurrences on treatment tapering. Concomitant use of hydroxychloroquine (HCQ) with low-dose PSL induced continuous remission. This is the first case to suggest the effectiveness of HCQ for recurrent KFD in a Japanese patient.

Metallic-nanoparticles-enhanced fluorescence from individual micron-sized aerosol particles on-the-fly.

PubMed

Sivaprakasam, Vasanthi; Hart, Matthew B; Jain, Vaibhav; Eversole, Jay D

2014-08-11

Fluorescence spectra from individual aerosol particles that were either coated or embedded with metallic nanoparticles (MNPs) was acquired on-the-fly using 266 nm and 355 nm excitation. Using aqueous suspensions of MNPs with either polystyrene latex (PSL) spheres or dissolved proteins (tryptophan or ovalbumin), we generated PSL spheres coated with MNPs, or protein clusters embedded with MNPs as aerosols. Both enhanced and quenched fluorescence intensities were observed as a function of MNP concentration. Optimizing MNP material, size and spacing should yield enhanced sensitivity for specific aerosol materials that could be exploited to improve detection limits of single-particle, on-the-fly fluorescence or Raman based spectroscopic sensors.

As Ye Sow, So Shall Ye Reap: From Consultant to Collaborator in the Development of a Teacher Preparation Program in Lesotho.

ERIC Educational Resources Information Center

Rothenberg, Julia Johnson

This paper reports on the author's 4-week consultation with faculty of the Lesotho National Teachers College as part of the Primary Education Project which provided technical assistance with issues of primary age schooling in the Kingdom of Lesotho. The consultant worked with 12 faculty members of the National Teachers College in a process that…

User Requirements Analyzer (URA) User’s Manual H6180/Multics/Version 3.3.

DTIC Science & Technology

1978-07-01

4.3 Enterinq Data Into An Input File 11 4.4 Using NAME- GEN 11 4.5 Using PUNCH Files 12 5. Receiving Output From URA Commands 12 5.1 The...CONSISTENCY RBPOPT 2fc^ KWIC INDEX 27? LIST-CHANGES Report 276 NAME- GEN 28C NAME LIST 29? PICTURE 313 PROCESS CHAIN...428 FREQUENCY U32 HELP U33 INPUT-PSL 434 INTERVAL-CONSISTENCY 435 KWIC 436 LIST-CtlANGES 437 N Af.E- GEN 4 38 NAf’B-LIST

iTesla Power Systems Library (iPSL): A Modelica library for phasor time-domain simulations

NASA Astrophysics Data System (ADS)

Vanfretti, L.; Rabuzin, T.; Baudette, M.; Murad, M.

The iTesla Power Systems Library (iPSL) is a Modelica package providing a set of power system components for phasor time-domain modeling and simulation. The Modelica language provides a systematic approach to develop models using a formal mathematical description, that uniquely specifies the physical behavior of a component or the entire system. Furthermore, the standardized specification of the Modelica language (Modelica Association [1]) enables unambiguous model exchange by allowing any Modelica-compliant tool to utilize the models for simulation and their analyses without the need of a specific model transformation tool. As the Modelica language is being developed with open specifications, any tool that implements these requirements can be utilized. This gives users the freedom of choosing an Integrated Development Environment (IDE) of their choice. Furthermore, any integration solver can be implemented within a Modelica tool to simulate Modelica models. Additionally, Modelica is an object-oriented language, enabling code factorization and model re-use to improve the readability of a library by structuring it with object-oriented hierarchy. The developed library is released under an open source license to enable a wider distribution and let the user customize it to their specific needs. This paper describes the iPSL and provides illustrative application examples.

Similar Hydrodynamic and Morphological Changes in the Aqueous Humor Outflow Pathway after Washout and Y27632 Treatment in Monkey Eyes

PubMed Central

Lu, Zhaozeng; Zhang, Yuyan; Freddo, Thomas F.; Gong, Haiyan

2011-01-01

Our previous studies in bovine eyes demonstrated that the structural correlate to the increase in outflow facility after either Rho-kinase inhibitor Y-27632 (Y27) treatment or washout appeared to be separation between the juxtacanalicular tissue (JCT) and inner wall (IW) of the aqueous plexus, the bovine equivalent of Schlemm's canal (SC). While these findings suggest that Y27 and washout may increase outflow facility through a similar mechanism, the anatomy of bovine outflow pathway differs considerably from both the human and monkey outflow pathway; however, only the human eye does not exhibit washout. In light of this, we compared the effects of Y27 and washout on outflow facility, hydrodynamic patterns of outflow, and the morphology of the IW and JCT in monkey eyes, given that their anatomy is closer to human eyes. Twelve freshly enucleated monkey eyes were used in this study. Eyes were perfused with Dulbecco's PBS containing 5.5 mM glucose (GPBS) to establish a baseline facility at 15 mmHg. Four eyes were perfused for a short-duration (30 min) as a control, 4 eyes for a long-duration (180 min) to induce washout, and 4 eyes with GPBS+50 μM Y27 for 30 min. All eyes were then perfused with fluorescent microspheres (0.5μm; 0.002%) to label the hydrodynamic patterns of outflow and then perfusion-fixed. Confocal images of frontal sections were taken along the IW of SC. The total length (TL) and the tracer decorated length (FL) of the IW were measured to calculate the average percent effective filtration length (PEFL=FL/TL). Sections with SC were examined by light and electron microscopy. The TL of the IW and the length exhibiting separation (SL) in the JCT were measured to calculate the average percent separation length (PSL= SL/TL). Outflow facility increased 149.2% (p<0.01) from baseline after washout during long-duration perfusion, and 114.9% (p=0.004) after Y27 treatment, but did not change significantly after short-duration perfusion in control eyes (p=0.46). Distribution of the tracer labeling appeared punctate along the IW of control eyes, while a more uniform pattern was observed after washout and Y27 treatment. PEFL in washout (83.4±2.1%) and Y27 treated eyes (82.5±1.6%) was 3.4-fold larger compared to controls (24.2±4.2%, P<0.001). The JCT appeared distended with loss of connections between JCT cells and between JCT cells and their extracelluar matrix in eyes with washout or after Y-27 treatment. PSL in the JCT was 2.3-fold larger in washout eyes (77.4±3.3%) and 2.2-fold larger in Y27 treated eyes (75.2±5.3%) versus controls (33.5±5.3%, p=0.001). Significant positive correlations were found between outflow facility and PEFL, facility and PSL and between PEFL and PSL. Our data demonstrated that similar hydrodynamic and morphological changes occurred in the aqueous humor outflow pathway of monkey eyes after induction of washout and Y27 treatment. Both Y27 and washout increase outflow facility by redistributing aqueous outflow through a larger area in the JCT. These hydrodynamic changes are likely driven by morphologic changes associated with a decrease in cell-cell and cell-matrix connections in the JCT. PMID:21669200

Tumor-specific pH-responsive peptide-modified pH-sensitive liposomes containing doxorubicin for enhancing glioma targeting and anti-tumor activity.

PubMed

Zhao, Yang; Ren, Wei; Zhong, Ting; Zhang, Shuang; Huang, Dan; Guo, Yang; Yao, Xin; Wang, Chao; Zhang, Wei-Qiang; Zhang, Xuan; Zhang, Qiang

2016-01-28

The pH environment in gliomas is acidic. Therefore, in the present research, we selected our previously reported tumor-specific pH-responsive peptide H7K(R2)2 as a targeting ligand, which could respond to the acidic pH environment in gliomas, possessing CPP characteristics. The pH-sensitive liposomes were selected as carriers which could also respond to the acidic pH environment in gliomas triggering encapsulated drug release from these pH-sensitive liposomes. The H7K(R2)2-modified pH-sensitive liposomes containing doxorubicin (DOX-PSL-H7K(R2)2) were designed and prepared in order to evaluate their potential targeting of glioma tumor cells and their anti-tumor activity in mice with glioma tumor cells. DOX-PSL-H7K(R2)2 was prepared by the thin-film hydration method followed by remote loading using an ammonium sulfate gradient method. The in vitro release of DOX from pH-sensitive liposomes was tested and the in vitro targeting characteristics of H7K(R2)2-modified liposomes regarding C6 (rat C6 glioma cells) and U87-MG (human glioblastoma cells) were evaluated. The in vivo anti-tumor activity of DOX-PSL-H7K(R2)2 was also investigated in C6 tumor-bearing mice and in U87-MG orthotopic tumor-bearing nude mice. A specific targeting effect triggered by an acidic pH was observed in our in vitro experiments in C6 and U87-MG glioma cells. The pH-triggered DOX release from the pH-sensitive liposomes under acidic conditions was also confirmed in our in vitro experiment. Anti-tumor activity of DOX-PSL-H7K(R2)2 was found in C6 tumor-bearing mice and U87-MG orthotopic tumor-bearing nude mice in in vivo experiments. The antiangiogenic activity of DOX-PSL-H7K(R2)2 was confirmed in C6 tumor-bearing mice in the in vivo experiment. These H7K(R2)2-modified pH-sensitive liposomes containing anti-tumor drugs developed in this study are a promising delivery system involving the response stimuli at the acidic pH in the glioma tumor microenvironment and are suitable for anti-tumor therapy. Copyright © 2015 Elsevier B.V. All rights reserved.

Dynamic remodeling of microbial biofilms by functionally distinct exopolysaccharides.

PubMed

Chew, Su Chuen; Kundukad, Binu; Seviour, Thomas; van der Maarel, Johan R C; Yang, Liang; Rice, Scott A; Doyle, Patrick; Kjelleberg, Staffan

2014-08-05

Biofilms are densely populated communities of microbial cells protected and held together by a matrix of extracellular polymeric substances. The structure and rheological properties of the matrix at the microscale influence the retention and transport of molecules and cells in the biofilm, thereby dictating population and community behavior. Despite its importance, quantitative descriptions of the matrix microstructure and microrheology are limited. Here, particle-tracking microrheology in combination with genetic approaches was used to spatially and temporally study the rheological contributions of the major exopolysaccharides Pel and Psl in Pseudomonas aeruginosa biofilms. Psl increased the elasticity and effective cross-linking within the matrix, which strengthened its scaffold and appeared to facilitate the formation of microcolonies. Conversely, Pel reduced effective cross-linking within the matrix. Without Psl, the matrix becomes more viscous, which facilitates biofilm spreading. The wild-type biofilm decreased in effective cross-linking over time, which would be advantageous for the spreading and colonization of new surfaces. This suggests that there are regulatory mechanisms to control production of the exopolysaccharides that serve to remodel the matrix of developing biofilms. The exopolysaccharides were also found to have profound effects on the spatial organization and integration of P. aeruginosa in a mixed-species biofilm model of P. aeruginosa-Staphylococcus aureus. Pel was required for close association of the two species in mixed-species microcolonies. In contrast, Psl was important for P. aeruginosa to form single-species biofilms on top of S. aureus biofilms. Our results demonstrate that Pel and Psl have distinct physical properties and functional roles during biofilm formation. Importance: Most bacteria grow as biofilms in the environment or in association with eukaryotic hosts. Removal of biofilms that form on surfaces is a challenge in clinical and industrial settings. One of the defining features of a biofilm is its extracellular matrix. The matrix has a heterogeneous structure and is formed from a secretion of various biopolymers, including proteins, extracellular DNA, and polysaccharides. It is generally known to interact with biofilm cells, thus affecting cell physiology and cell-cell communication. Despite the fact that the matrix may comprise up to 90% of the biofilm dry weight, how the matrix properties affect biofilm structure, maturation, and interspecies interactions remain largely unexplored. This study reveals that bacteria can use specific extracellular polymers to modulate the physical properties of their microenvironment. This in turn impacts biofilm structure, differentiation, and interspecies interactions. Copyright © 2014 Chew et al.

USSR and Eastern Europe Scientific Abstracts, Cybernetics, Computers, and Automation Technology, Number 26

DTIC Science & Technology

1977-01-26

Sisteme Matematicheskogo Obespecheniya YeS EVM [ Applied Programs in the Software System for the Unified System of Computers], by A. Ye. Fateyev, A. I...computerized systems are most effective in large production complexes , in which the level of utilization of computers can be as high as 500,000...performance of these tasks could be furthered by the complex introduction of electronic computers in automated control systems. The creation of ASU

Detecting and Jamming Dynamic Communication Networks in Anti-Access Environments

DTIC Science & Technology

2011-03-01

P.M. Pardalos, Y. Ye. and C.W. Commander (eds) V. Boginski. Sensors: Theory , Algorithms, and Applications. Springer, to appear in 2009. [21] Joseph C...Sumeetpal S. Singh. Nikolaos Kantas , Ba-Ngu Vo, Arnaud Doucet, and Robin J. Evans. Simulation-based optimal sensor scheduling with application to...observer trajectory planning. Aotomatica, 43(5):817-830, 2007. [27] Anthony Man-Cho So and Yinyu Ye. Theory of semidefinite programming for sensor network

On multi-level thinking and scientific understanding

NASA Astrophysics Data System (ADS)

McIntyre, Michael Edgeworth

2017-10-01

Professor Duzheng YE's name has been familiar to me ever since my postdoctoral years at MIT with Professors Jule CHARNEY and Norman PHILLIPS, back in the late 1960s. I had the enormous pleasure of meeting Professor YE personally in 1992 in Beijing. His concern to promote the very best science and to use it well, and his thinking on multi-level orderly human activities, reminds me not only of the communication skills we need as scientists but also of the multi-level nature of science itself. Here I want to say something (a) about what science is; (b) about why multi-level thinking—and taking more than one viewpoint—is so important for scientific as well as for other forms of understanding; and (c) about what is meant, at a deep level, by "scientific understanding" and trying to communicate it, not only with lay persons but also across professional disciplines. I hope that Professor YE would approve.

Effects of gamma irradiation on the survival of Listeria monocytogenes and on its growth at refrigeration temperature in poultry and red meat.

PubMed

Gürsel, B; Gürakan, G C

1997-12-01

Gamma irradiation sensitivity of a strain of Listeria monocytogenes was determined in trypticase soy broth supplemented with yeast extract (TSB-YE), in a slurry of chicken breast meat and in raw ground beef. D10 values in these different media were 0.364, 0.599, and 0.699 kGy, respectively. This organism appeared most sensitive in TSB-YE, more resistant in minced fresh chicken breast meat, and most resistant in fresh minced beef. It was found that irradiation at 2.5 kGy prior to refrigeration is an efficient way for the preservation of meat products contaminated at 10(3) to 10(4) per gram initial load of L. monocytogenes for about 7 d. However, with this initial load, the injured cells might repair themselves and cause a health hazard during storage at 4 C in the presence of air after 7 d.

USSR Report, Chemistry

DTIC Science & Technology

1985-07-24

ZAVEDENIY: KHBIIYA I KHIMICHESKAYA TEKHNOLOGIYA, No 3, Mar 85) ................ 2 ANALYTICAL CHEMISTRY Spectroscopic Method of Studying...Ye. Gutman, I. A. Myasnikov, et al.; ZHURNAL FIZICHESKOY KHE-1II, No 3, Mar 85) 4 -a - [III - USSR - 21B S&T] Detailed Method for...Containing Rare Earth and Transitional Elements (S. E. Mamedov, B. A. Dadashev: KINETIKA I KATALIZ, No 1, Jan-Feb 85) 11 Isotope Exchange Method in

Characterization of Engine Mount Elastomers

DTIC Science & Technology

2005-02-01

blend of carbon black filled nitrile rubber ( NBR ), polyvinylchloride (PVC), and diisooctyl phthalate (DIOP) that was formulated at PSL (as AMRL 2046...a suitable replacement for natural rubber and neoprene rubber in engine mounts where exposure to hydrocarbon fluids is a concern. The data for NBR ...range 3-7 MPa. The loss factors of the elastomers at 1 Hz, 20oC varied considerably, from 0.02 for natural rubber to 0.27 for ethylene acrylic

Characteristics and Sampling Efficiencies of Two Personal Aerosol Samplers

DTIC Science & Technology

2007-07-01

stainless steel and plastic; therefore, it can be decontaminated easily by immersing in decontamination solution. 9 PAS-2 PAS-1 Figure 3. Picture of PAS...portable, and easy to use for decontamination . The sampling efficiency tests were conducted with monodisperse 0.5-, 1-, and 2.1-gtm fluorescent...Scientific, Corp., Palo Alto, CA). The PSL aerosols were generated using a 24 jet Collison nebulizer and then passed through a radioactive isotope (Kr-85

The Role of the Chinese Military in National Security of Policymaking.

DTIC Science & Technology

1996-01-01

California Press, 1992, pp. 95-124; Wei Li , The Chinese Staff System: A Mechanism for Bureaucratic Control and Integration, Berkeley: Institute of East...representatives, etc. They reportedly continue to perform these roles today. For details, see Wei Li and Lucian W. Pye, "The Ubiquitous Role of the Mishu in...strategic objectives. These included Ye Jianying , Xu Xiangqian, Nie Rongzhen, Yang Shangkun, Zhang Aiping, Yang Dezhi, Yu Qiuli, and Hong Xuezhi. Ye, Xu

Use of DNA probes to study tetracycline resistance determinants in gram-negative bacteria from swine

DOE Office of Scientific and Technical Information (OSTI.GOV)

Lee, C.Y.

1989-01-01

Specific {sup 32}P-labeled DNA probes were prepared and used to evaluate the distribution of tetracycline resistance determinants carried by gram-negative enteric bacteria isolated from pigs in 3 swine herds with different histories of antibiotic exposure. Plasmid DNA, ranging in size from 2.1 to 186 Kb, was observed in over 84% of 114 isolates studied. Two of 78 tetracycline resistant strains did not harbor plasmids. The DNA probes were isolated from plasmids pSL18, pRT29/Tn10, pBR322 and pSL106, respectively, and they represented class A, B, C and D tetracycline resistance determinants. Hybridization conditions using 0.5X SSPE at 65{degrees}C minimize cross-hybridization between themore » different class of tetracycline resistance genes. Cross-hybridization between class A and class C determinants could be distinguished by simultaneous comparison of the intensity of their hybridization signals. Plasmids from over 44% of the tetracycline resistant isolates did not hybridize to DNA probes for the determinants tested. Class B determinant occurred more frequently than class A or C. None of the isolates hybridized with the class D probe.« less

Magnetic resonance imaging findings of the proximal metacarpus in Quarter Horses used for cutting: Retrospective analysis of 32 horses 2009-2012.

PubMed

Barrett, M F; Manchon, P T; Hersman, J; Kawcak, C E

2018-03-01

Injury to the proximal suspensory ligament is a common cause of lameness in cutting horses. Radiographic and ultrasonographic imaging of lesions responsible for lameness can provide ambiguous results. MRI provides the most comprehensive diagnostic imaging evaluation of lesions specifically affecting cutting horses. To describe the distribution and severity of bone and soft tissue lesions present in the proximal metacarpus of Quarter Horse cutting horses and to assess the impact of these lesions on return to competition. Retrospective case series. Retrospective analysis of 32 cutting horses referred for MRI of the proximal metacarpus between 2009 and 2012 with a 2-year follow-up period. MRI studies were evaluated by a board-certified veterinary radiologist; the severity of lesions was graded from 0 (absent) to 3 (severe). A total of 20 right and 24 left forelimbs (12 bilateral studies) of 32 horses were evaluated. The most common findings were: third metacarpal (McIII) sclerosis at the proximal suspensory ligament (PSL) origin (42/44), McIII resorption at the PSL origin (32/44), PSL dorsal margin fibre irregularity (30/44) and McIII bone contusion (22/39). Of the 30 horses, 22 horses successfully returned to competition, irrespective of severity of injury. Strong correlation exists between the degree of resorption in the palmar cortex of proximal McIII, degree of McIII sclerosis and severity of dorsal margin fibre irregularity. Statistical significance was limited by small study population. Further analysis of prognosis was limited by availability of comprehensive medical records. Cutting horses with proximal metacarpal pain have significant pathological change within the proximal suspensory ligament and its enthesis on the palmar cortex of McIII. Severity of lesions and degree of lameness at the time of diagnosis does not influence return to performance. Accurate diagnosis of proximal metacarpal lesions based on MRI offers clinicians the capacity to select treatment protocols targeted to each disease process. © 2017 EVJ Ltd.

Identification of odor volatile compounds and deodorization of Paphia undulata enzymatic hydrolysate

NASA Astrophysics Data System (ADS)

Chen, Deke; Chen, Xin; Chen, Hua; Cai, Bingna; Wan, Peng; Zhu, Xiaolian; Sun, Han; Sun, Huili; Pan, Jianyu

2016-12-01

Unfavorable fishy odour is an inevitable problem in aquatic products. In the present study, headspace solid-phase microextraction gas chromatography mass spectrometry (HS-SPME-GC-MS) analysis of volatiles from untreated samples and three deodorized samples (under the optimal conditions) of Paphia undulata enzymatic hydrolysate revealed that the compounds contributing to the distinctive odor were 1-octen-3-ol, n-hexanal, n-heptanal, 2,4-heptadienal, and 2,4-decadienal, whereas n-pentanal, n-octanal, n-octanol, benzaldehyde, 2-ethylfuran and 2-pentylfuran were the main contributors to the aromatic flavor. The deodorizing effects of activated carbon (AC) adsorption, yeast extract (YE) masking and tea polyphenol (TP) treatment on a P. undulata enzymatic hydrolysate were investigated using orthogonal experiments with sensory evaluation as the index. The following optimized deodorization conditions were obtained: AC adsorption (35 mg mL-1, 80°C, 40 min), YE masking (7 mg mL-1, 45°C, 30 min) and TP treatment (0.4 mg mL-1, 40°C, 50 min). AC adsorption effectively removed off-flavor volatile aldehydes and ketones. YE masking modified the odor profile by increasing the relative contents of aromatic compounds and decreasing the relative contents of aldehydes and ketones. The TP treatment was not effective in reducing the odor score, but it significantly reduced the relative content of aldehydes while increasing that of alkanes. It is also notable that TP effectively suppressed trimethylamine (TMA) formation in a P. undulate hydrolysate solution for a period of 72 h.

Intensifying drought eliminates the expected benefits of elevated [CO2] for soybean

USDA-ARS?s Scientific Manuscript database

Stimulation of C3 crop yield by rising [CO2] is widely expected to counteract crop losses to greater drought this century. But these expectations come from sparse field trials that have been biased towards mesic growth conditions. This eight-year study used precipitation manipulations and year-to-ye...

Bibliography of Soviet Laser Developments, Number 41, May - June 1979.

DTIC Science & Technology

1980-01-10

Andreyeva, O.V., and V.I. Sukhanov (0). Method for calculating the diffraction efficiency of holograms, allowing for the granularity of the photolayer. Sb...thick-layer holograms. Sb 14, 128-133. 315. Sukhanov , V.I., G.I. Lashkov, A.Ye. Petnikov, Yu.V. Ashcheulov, I.I. Reznikova, and A.S. Cherkasov (0... Sukhanov , V.I., Yu.V. Ashcheulov, and A.Ye. Petnikov (0). Recording and readout of holograms in LiNbO :Fe crystals. Sb 14, 64-72. 317. Tanin, L.V. (0

Bibliography of Soviet Laser Developments Number 53, May-June 1981.

DTIC Science & Technology

1982-07-20

Mukhametniyazova, V.M. Sarkisova, and S. Sukhanov (55). Recrystallization of indium antimonide films. IAN Turk, no. 1, 1981, 121-124. 309. Portnova, E.G., K.K...radioholograms. Sb 15, 104-114. (RZhRadiot, 6/81, 6Ye4l0) 506. Andreyeva, O.V., and V.I. Sukhanov (0). Effect of amplitude modulation on the...5Ye356) 714. Sukhanov , I.I., and Yu.V. Troitskiy (0). Phase characteristics of multibeam interferometers. OiS, v. 50, no. 5, 1981, 952-959. 715

Age and gender patterns of thyroid cancer incidence in Ukraine depending on thyroid radiation doses from radioactive iodine exposure after the Chornobyl NPP accident.

PubMed

Fuzik, M M; Prysyazhnyuk, A Y; Shibata, Y; Romanenko, A Y; Fedorenko, Z P; Gudzenko, N A; Gulak, L O; Trotsyuk, N K; Goroh, Y L; Khukhrianska, O M; Sumkina, O V; Saenko, V A; Yamashita, S

2013-01-01

The objective of this study was to investigate the thyroid cancer incidence in a whole territory of Ukraine and to clear up its age and gender patterns depending on average regional (oblast) thyroid doses from radioactive iodine due to the Chornobyl accident. MATERIALS AND METHODS. On the basis of average accumulated thyroid doses from radioactive iodine the geographical regions of Ukraine with low and high average thyroid doses were identified for a comparative analysis performance. Methods of descriptive epidemiology were used. The level and dynamics of thyroid cancer incidence were analyzed in different gender and age groups (both for attained age and age at the moment of the Chornobyl accident). Results of this study confirmed the radiation excess of thyroid cancer in individuals who were children and adolescents in 1986. Some excess was observed in elder age groups too. Especial situation was observed in female age group 40-49 at the moment of the Chornobyl accident i.e. the age-specific thyroid cancer incidence rates were significantly higher in "high exposure" regions comparing with "low exposure" ones during all years of observation within 1989-2009. A probable radiation excess of thyroid cancer was suggested not only in children and adolescents but also in adult age groups. In elder age groups this excess was less expressed and manifested after a longer period of time. The origin of the phenomenon in female age group of 40-49 is unclear now. Hypothesis of combined effect of radiation and natural changing of hormonal status in this age should be checked in the future studies. Fuzik M. M, Prysyazhnyuk A. Ye, Shibata Y., Romanenko A. Yu., Fedorenko Z. P., Gudzenko N. A., Gulak L. O., Trotsyuk N. K., Goroh Ye. L., Khukhrianska O. M., Sumkina O. V., Saenko V. A., Yamashita Sh., 2013.

Immune-mediated neuropathy with Epstein-Barr virus-positive T-cell lymphoproliferative disease.

PubMed

Hattori, Takaaki; Arai, Ayako; Yokota, Takanori; Imadome, Ken-Ichi; Tomimitsu, Hiroyuki; Miura, Osamu; Mizusawa, Hidehiro

2015-01-01

A 47-year-old man with Epstein-Barr virus (EBV)-positive T/NK- cell lymphoproliferative disease (EBV-T/NK-LPD) developed acute-onset weakness. A nerve conduction study showed a conduction block in both the proximal and most distal segments. Although the patient's neuropathy transiently responded to intravenous immunoglobulin, it was progressive for at least 25 days until the start of prednisolone (PSL) administration, after which it remarkably improved. The neuropathy further improved after allogeneic bone marrow transplantation (BMT). The present patient's clinical course is not consistent with that of typical Guillain-Barré syndrome. This case suggests that EBV-T/NK-LPD can cause progressive immune-mediated neuropathy as a result of chronic EBV antigen presentation and can be treated with PSL and BMT.

Update on the NASA Glenn Propulsion Systems Lab Ice Crystal Cloud Characterization (2015)

NASA Technical Reports Server (NTRS)

Van Zante, Judith F.; Bencic, Timothy J.; Ratvasky, Thomas P.

2016-01-01

NASA Glenn's Propulsion Systems Lab (PSL), an altitude engine test facility, was outfitted with a spray system to generate ice crystals. The first ice crystal characterization test occurred in 2012. At PSL, turbine engines and driven rigs can experience ice crystal icing at flight altitudes, temperatures and Mach numbers. To support these tests, four ice crystal characterizations have been conducted in two different facility configurations. In addition, super-cooled liquid and mixed phase clouds have also been generated. This paper will discuss the recent learning from the previous two calibrations. It will describe some of the 12-parameter calibration space, and how those parameters interact with each other, the instrumentation used to characterize the cloud and present a sample of the cloud characterization results.

Plans and Preliminary Results of Fundamental Studies of Ice Crystal Icing Physics in the NASA Propulsion Systems Laboratory

NASA Technical Reports Server (NTRS)

Struk, Peter; Tsao, Jen-Ching; Bartkus, Tadas

2017-01-01

This paper describes plans and preliminary results for using the NASA Propulsion Systems Lab (PSL) to experimentally study the fundamental physics of ice-crystal ice accretion. NASA is evaluating whether this facility, in addition to full-engine and motor-driven-rig tests, can be used for more fundamental ice-accretion studies that simulate the different mixed-phase icing conditions along the core flow passage of a turbo-fan engine compressor. The data from such fundamental accretion tests will be used to help develop and validate models of the accretion process. This paper presents data from some preliminary testing performed in May 2015 which examined how a mixed-phase cloud could be generated at PSL using evaporative cooling in a warmer-than-freezing environment.

Plans and Preliminary Results of Fundamental Studies of Ice Crystal Icing Physics in the NASA Propulsion Systems Laboratory

NASA Technical Reports Server (NTRS)

Struk, Peter; Tsao, Jen-Ching; Bartkus, Tadas

2016-01-01

This presentation accompanies the paper titled Plans and Preliminary Results of Fundamental Studies of Ice Crystal Icing Physics in the NASA Propulsion Systems Laboratory. NASA is evaluating whether PSL, in addition to full-engine and motor-driven-rig tests, can be used for more fundamental ice-accretion studies that simulate the different mixed-phase icing conditions along the core flow passage of a turbo-fan engine compressor. The data from such fundamental accretion tests will be used to help develop and validate models of the accretion process. This presentation (and accompanying paper) presents data from some preliminary testing performed in May 2015 which examined how a mixed-phase cloud could be generated at PSL using evaporative cooling in a warmer-than-freezing environment.

Carbon dioxide emissions from agricultural soils amended with livestock-derived organic materials

NASA Astrophysics Data System (ADS)

Pezzolla, D.; Said-Pullicino, D.; Gigliotti, G.

2009-04-01

Carbon dioxide gas xchange between terrestrial ecosystems and the atmosphere, as well as the carbon sink strength of various arable land ecosystems, is of primary interest for global change research. Measures for increasing soil C inputs include the preferential use of livestock-derived organic materials (e.g. animal manure and slurries, digestate from biogas production plants and compost). The application of such materials to agricultural soils returns essential nutrients for plant growth and organic matter to maintain long-term fertility. Whether or not such practices ultimately result in sustained C sequestration at the ecosystem level will depend on their mineralization rates. This work presents preliminary results from a laboratory incubation trial to evaluate carbon dioxide fluxes from two agricultural soils (a calcareous silt loam and a silty clay loam) amended with agricultural doses of (i) pig slurry (PSL), (ii) the digestate from the anaerobic fermentation of pig slurries (AAS) and (ii) a compost from the aerobic stabilisation of the digestate (LDC). These subsequent steps of slurry stabilisation resulted in a decrease in the content of labile organic matter which was reflected in a reduction in maximum carbon dioxide emission rates from amended soils. Measurements have shown that peak emissions from soils occur immediately after application of these organic materials (within 5 days) and decrease in the order PSL > AAS > LDC. Moreover, mean cumulative emissions over the first 40 days showed that a higher percentage (about 44%) of the C added with PSL was mineralised respect to C added with AAS (39%) and LDC (25%). Although it was hypothesised that apart from the quantity and stability of the added organic materials, even soil characteristics could influence C mineralisation rates, no significant differences were observed between emission fluxes for similarly treated soils. Mean cumulative emission fluxes after 40 days from treatment were of 114, 103 and 84 g C m-2 for PSL, AAS and LDC respectively. Carbon dioxide emission rates were corroborated with results obtained from the quantification of water-extractable organic C (WEOC) and soil microbial biomass-C (Cmic). The former represents the more labile fraction of soil organic matter and its concentration in the freshly amended soils followed the order LDC > AAS ≈ PSL. However, whereas WEOC concentrations decrease rapidly for PSL and LDC amended soils, AAS treated soils showed a steady increase during the first 20 days of incubation followed by a decrease thereafter. This was attributed to the release of soluble organic matter from the anaerobically stabilised digestate in the presence of an aerobic soil microbial community. Irrespective of the type of amendment, Cmic values increased with time with respect to the unamended controls, reaching highest values after 20 days from amendment and decreasing thereafter. Even after 40 days of incubation, Cmic values in all amended soils did not return to the background values obtained with unamended controls. These results suggest that the application of stabilised livestock-derived organic materials to soils may play an important role in reducing C emissions associated with agricultural practices and increase soil C stocks, apart from other indirect beneficial effects such as the recovery of energy from combustion of biogas from anaerobic fermentation of these waste materials.

Elicitation of Jerusalem artichoke (Helianthus tuberosus L.) cell suspension culture for enhancement of inulin production and altered degree of polymerisation.

PubMed

Ma, Chunquan; Zhou, Dong; Wang, Haitao; Han, Dongming; Wang, Yang; Yan, Xiufeng

2017-01-01

Plant cell suspension cultures have emerged as a potential source of secondary metabolites for food additives and pharmaceuticals. In this study inulin accumulation and its degree of polymerisation (DP) in the treated cells in the same medium were investigated after treatment with six types of elicitors. An in vitro cell suspension culture of Jerusalem artichoke (Helianthus tuberosus L.) was optimised by adding an extra nitrogen source. According to the growth kinetics, a maximum biomass of 5.48 g L -1 was obtained from the optimal cell suspension medium consisted of Murashige and Skoog basic medium (MS) + 1.0 mg L -1 α-naphthalene acetic acid (NAA) + 1.0 mg L -1 6-benzylaminopurine (6-BA) + 0.5 mg L -1 proline + 1.0 mg L -1 glutamine. Methyl jasmonate (MeJA, 250 µmol L -1 ) treatment for 15 days led to the highest levels of inulin (2955.27 ± 9.81 mg L -1 compared to control of 1217.46 ± 0.26 mg L -1 ). The elicited effect of five elicitors to the suspension cells of Jerusalem artichoke is as follows: AgNO 3 (Ag, 10 µmol L -1 ), salicylic acid (SA, 75 µmol L -1 ), chitosan (KJT, 40 mg L -1 ), Trichoderma viride (Tv, 90 mg L -1 ), yeast extract (YE, 0.25 mg L -1 ), and the corresponding content of inulin is increased by 2.05-, 1.93-, 1.76-, 1.44- and 1.18-fold compared to control, respectively. The obvious effect on the percentage of lower DP in inulin was observed in cells treated with 40 mg L -1 KJT, 0.25 mg L -1 YE and 10 µmol L -1 Ag. Among the six types of elicitors, the descending order of inulin content is MeJA > Ag > SA > KJT > Tv > YE. For the purpose inulin with lower DP and its application to prebiotic food, three elicitors, including KJT, YE and Ag, can be used for the elicitation. © 2016 Society of Chemical Industry. © 2016 Society of Chemical Industry.

Quantum Quench of the Sachdev-Ye-Kitaev Model

NASA Astrophysics Data System (ADS)

Steinberg, Julia; Eberlein, Andreas; Sachdev, Subir

The Sachdev-Ye-Kitaev model is a single site model containing N flavors of fermions with random infinite range interactions. It is exactly solvable in the large N limit and has an emergent reparameterization symmetry in time at low temperatures and strong coupling. This leads to many interesting properties such as locally critical behavior in correlation functions and the saturation of the chaos bound proposed .We start with the generalized Sachdev-Ye-Kitaev with quadratic and quartic interactions. This Hamiltonian has the form of a 0+1d Fermi liquid and contains long-lived quasiparticles at all values of the quadratic coupling. We quench the system into a locally critical state without quasiparticles by turning off the quadratic coupling at some initial time. We numerically study the spectral function at intermediate and long times and determine the timescale in which the system loses memory of the quasiparticles. J.S. is supported by the National Science Foundation Graduate Research Fellowship under Grant No. DGE1144152.

[Preliminary study on the time of first appearance of "lanhousha" (scarlet fever)].

PubMed

Yu, X

2001-04-01

There are controversies about the problem of the source of "lanhousha" (scarlet fever) in the field of modern medical history, whether it is an epidemic appeared from the ancient time in our country or imported from other countries. Now, almost all researches were carried out around the classic medical books, especially "Medical Records of Ye Tianshi", and hardly dealing it in a historical context at that time. Through contrastive analysis between the records in medical books and historical facts, it is concluded that Ye Tianshi's records of scarlet fever have nothing to do with Ye Tianshi himself, and is by author of allonym. It perhaps was exogenous cold diseases spread when a severe epidemic diseases happened at Southern Jiangsu in the 11th year of Yongzheng reign. Even though there was some scarlet fever, it was not the first spread of scarlet fever in fact. Actually, in late Kangxi reign, scarlet fever was regarded as an epidemic disease seldom seen at Southern Jiangsu.

Innovative /ye/ and /we/ sequences in recent loans in Japanese

NASA Astrophysics Data System (ADS)

Vance, Timothy; Matsugu, Yuka

2005-04-01

The GV sequences /ye/ and /we/ do not occur in Japanese except perhaps in recent loans. Katakana spellings of the relevant loans in authoritative dictionaries are inconsistent, and it is not clear whether native speakers treat them as containing the GV sequences /ye/ and /we/ or as containing the VV sequences /ie/ and /ue/. Native speakers of Japanese with minimal exposure to spoken English were recorded producing some relevant loans in response to picture prompts. The same speakers were also recorded producing some native words containing uncontroversial /ie/ and /ue/ sequences. All the productions are being analyzed acoustically to determine whether they show the expected contrast between GV and VV sequences. A VV sequence is disyllabic (and bimoraic) and should therefore have greater duration and more gradual formant movements than a monosyllabic (and monomoraic) GV sequence. Utterance-initially, a VV sequence should have a LH pitch pattern and should be preceded by a nondistinctive glottal stop, whereas a GV sequence should have a H pitch pattern and should have smooth onset.

Fibrillation mechanism of a model intrinsically disordered protein revealed by 2D correlation deep UV resonance Raman spectroscopy.

PubMed

Sikirzhytski, Vitali; Topilina, Natalya I; Takor, Gaius A; Higashiya, Seiichiro; Welch, John T; Uversky, Vladimir N; Lednev, Igor K

2012-05-14

Understanding of numerous biological functions of intrinsically disordered proteins (IDPs) is of significant interest to modern life science research. A large variety of serious debilitating diseases are associated with the malfunction of IDPs including neurodegenerative disorders and systemic amyloidosis. Here we report on the molecular mechanism of amyloid fibrillation of a model IDP (YE8) using 2D correlation deep UV resonance Raman spectroscopy. YE8 is a genetically engineered polypeptide, which is completely unordered at neutral pH yet exhibits all properties of a fibrillogenic protein at low pH. The very first step of the fibrillation process involves structural rearrangements of YE8 at the global structure level without the detectable appearance of secondary structural elements. The formation of β-sheet species follows the global structural changes and proceeds via the simultaneous formation of turns and β-strands. The kinetic mechanism revealed is an important new contribution to understanding of the general fibrillation mechanism proposed for IDP.

Plasma etched surface scanning inspection recipe creation based on bidirectional reflectance distribution function and polystyrene latex spheres

NASA Astrophysics Data System (ADS)

Saldana, Tiffany; McGarvey, Steve; Ayres, Steve

2014-04-01

The continual increasing demands upon Plasma Etching systems to self-clean and continue Plasma Etching with minimal downtime allows for the examination of SiCN, SiO2 and SiN defectivity based upon Surface Scanning Inspection Systems (SSIS) wafer scan results. Historically all Surface Scanning Inspection System wafer scanning recipes have been based upon Polystyrene Spheres wafer deposition for each film stack and the subsequent creation of light scattering sizing response curves. This paper explores the feasibility of the elimination of Polystyrene Latex Sphere (PSL) and/or process particle deposition on both filmed and bare Silicon wafers prior to Surface Scanning Inspection System recipe creation. The study will explore the theoretical maximal Surface Scanning Inspection System sensitivity based on PSL recipe creation in conjunction with the maximal sensitivity derived from Bidirectional Reflectance Distribution Function (BRDF) maximal sensitivity modeling recipe creation. The surface roughness (Root Mean Square) of plasma etched wafers varies dependent upon the process film stack. Decrease of the root mean square value of the wafer sample surface equates to higher surface scanning inspection system sensitivity. Maximal sensitivity SSIS scan results from bare and filmed wafers inspected with recipes created based upon Polystyrene/Particle Deposition and recipes created based upon BRDF modeling will be overlaid against each other to determine maximal sensitivity and capture rate for each type of recipe that was created with differing recipe creation modes. A statistically valid sample of defects from each Surface Scanning Inspection system recipe creation mode and each bare wafer/filmed substrate will be reviewed post SSIS System processing on a Defect Review Scanning Electron Microscope (DRSEM). Native defects, Polystyrene Latex Spheres will be collected from each statistically valid defect bin category/size. The data collected from the DRSEM will be utilized to determine the maximum sensitivity capture rate for each recipe creation mode. Emphasis will be placed upon the sizing accuracy of PSL versus BRDF modeling results based upon automated DRSEM defect sizing. An examination the scattering response for both Mie and Rayleigh will be explored in relationship to the reported sizing variance of the SSIS to make a determination of the absolute sizing accuracy of the recipes there were generated based upon BRDF modeling. This paper explores both the commercial and technical considerations of the elimination of PSL deposition as a precursor to SSIS recipe creation. Successful integration of BRDF modeling into the technical aspect of SSIS recipe creation process has the potential to dramatically reduce the recipe creation timeline and vetting period. Integration of BRDF modeling has the potential to greatly reduce the overhead operation costs for High Volume Manufacturing sites by eliminating the associated costs of third party PSL deposition.

Group-Based Yogic Weight Loss with Ayurveda-Inspired Components: A Pilot Investigation of Female Yoga Practitioners and Novices.

PubMed

Braun, Tosca D; Park, Crystal L; Gorin, Amy A; Garivaltis, Hilary; Noggle, Jessica J; Conboy, Lisa A

2016-01-01

Overweight/obesity is a pressing international health concern and conventional treatments demonstrate poor long-term efficacy. Preliminary evidence suggests yoga and Ayurveda may be promising approaches, although recent NHIS estimates indicate rare utilization of Ayurveda in the US. Group-based curricula that integrate yoga and Ayurveda-inspired principles to attenuate overweight and obesity across individuals may prove a feasible, disseminable clinical adjunct to facilitate psychosocial health and weight loss and/or maintenance. Determine feasibility and preliminary effectiveness of a ten-week yoga - based, Ayurveda-inspired weight management curriculum (YWL) piloted in female yoga practitioners (Study 1) then refined and tailored for yoga naïves (Study 2), on self-reported psychosocial process variables and % of self-reported total body weight loss (%TBWL). Study 1 enrolled 22 yoga-experienced women (48.2 ± 14.3 years, BMI 30.8 ± 4.2 kg/m2) in a 10-week yoga-based program (YWL-YE). Study 2 enrolled 21 yoga- naïve women (49.4 ± 10.7 years, BMI 35.5 ± 6.8 kg/m2) in a revised 10-week program (YWL-YN). Self-reported weight and self-ratings of mindful eating behavior, body image disturbance, weight loss self-efficacy, body awareness, and self-compassion were collected at baseline, post-treatment (T2), and 3-month follow- up (T3). YWL curricula was feasible in both studies. While attrition rates for both studies favorably compared to other weight management studies, attrition was higher for YWL-YN (28.6%) than YWL-YE (18.2%). In both studies, self-reported process variables and self-reported % TBWL changed in hypothesized directions at T2 and evidenced greater improvement at T3; effect sizes across all process variables were medium (-0.4) to large (-1.8). % TBWL reached clinical significance (>5%) only at T3 for the YWL-YE group. The YWL curricula employed here appear to improve psychosocial health among both overweight/obese yoga-experienced and yoga- naïve women. Results must be interpreted with caution due to study design, self-report assessments, and other limitations. Nonetheless, hypotheses are generated for future investigation.

Group-Based Yogic Weight Loss with Ayurveda-Inspired Components: A Pilot Investigation of Female Yoga Practitioners and Novices.

PubMed

Braun, Tosca D; Park, Crystal L; Gorin, Amy A; Garivaltis, Hilary; Noggle, Jessica J; Conboy, Lisa A

2016-09-01

Overweight/obesity is a pressing international health concern and conventional treatments demonstrate poor long-term efficacy. Preliminary evidence suggests yoga and Ayurveda may be promising approaches, although recent NHIS estimates indicate rare utilization of Ayurveda in the US. Group-based curricula that integrate yoga and Ayurveda-inspired principles to attenuate overweight and obesity across individuals may prove a feasible, disseminable clinical adjunct to facilitate psychosocial health and weight loss and/or maintenance. Determine feasibility and preliminary effectiveness of a ten-week yoga-based, Ayurveda-inspired weight management curriculum (YWL) piloted in female yoga practitioners (Study 1) then refined and tailored for yoga naïves (Study 2), on self-reported psychosocial process variables and % of self-reported total body weight loss (%TBWL). Study 1 enrolled 22 yoga-experienced women (48.2 ± 14.3 years, BMI 30.8 ± 4.2 kg/m2) in a 10-week yoga-based program (YWL-YE). Study 2 enrolled 21 yoga- naïve women (49.4 ± 10.7 years, BMI 35.5 ± 6.8 kg/m2) in a revised 10-week program (YWL-YN). Self-reported weight and self-ratings of mindful eating behavior, body image disturbance, weight loss self-efficacy, body awareness, and self-compassion were collected at baseline, post-treatment (T2), and 3-month follow- up (T3). YWL curricula was feasible in both studies. While attrition rates for both studies favorably compared to other weight management studies, attrition was higher for YWL-YN (28.6%) than YWL-YE (18.2%). In both studies, self-reported process variables and self-reported % TBWL changed in hypothesized directions at T2 and evidenced greater improvement at T3; effect sizes across all process variables were medium (-0.4) to large (-1.8). % TBWL reached clinical significance (>5%) only at T3 for the YWL-YE group. The YWL curricula employed here appear to improve psychosocial health among both overweight/obese yoga-experienced and yoga-naïve women. Results must be interpreted with caution due to study design, self-report assessments, and other limitations. Nonetheless, hypotheses are generated for future investigation.

JPRS Report, Science & Technology, USSR: Physics & Mathematics

DTIC Science & Technology

1987-06-17

Manishin, G. A. Pasmanik; KVANTOVAYA ELEKTRONIKA, No 12, Dec 86) Determination of Weak Optical Absorption of Optoacoustic Method ( S . A. Vinokurov...Gorbunov, A. S . Kaminskiy; ZHURNAL EKSPERIMENTALNOY I TEORETICHESKOY FIZIKI, No 3(9),- -’"’ Sep 86) , ’.. 󈧐 ■ ■ \\ - b - Dependence of...Kokurin, N. Ye. Kuzmenko, et al.; KVANTOVAYA ELEKTRONIKA, No 12, Dec 86) 17 Kinematic Mode Locking in Continuous-Wave YAG:Nd3 Ring Laser (L. S

JPRS Report, Soviet Union, Political Affairs.

DTIC Science & Technology

1989-10-03

18000602 Moscow PRA VDA in Russian 2 Aug 88 p 3 [Article by I . Zarakhovich and T . Trukhacheva, journal- ists, and Ye. Sokolova, member, Central Council...QTJAUn INSP1CH3B t Soviet Union Political Affairs JPRS-UPA-88-044 CONTENTS 03 OCTOBER 1989 PARTY, STATE AFFAIRS History of Formation of Nagorno...Advocated //. Zarakhovich, T . Trukhacheva; PRAVDA, 2 Aug 88] 86 REGIONAL ISSUES Biologist on Costs of Pollution Control Measures [A. Valentey

Ceramics for High Power Lasers

DTIC Science & Technology

2011-12-01

Y3Al5O12”, Applied Physics Letters, 93, 191902 (2008) [2] I. Sakaguchi et al., J . Am. Ceram. Soc. 79 (1996), 1627 [3] http://www.vloc.com/PDFs...of growth defects in synthetic quartz crystals by light-scattering tomography “ J . Crystal Growth, Volume 44, Issue 1, August 1978, Pages 53-60...Investigator Romain Gaume - Research Scientist Roger Route - Senior Research Associate Ye He - Graduate Student Research Assistant V. Publications

Efficacy of a biomechanically-based yoga exercise program in knee osteoarthritis: A randomized controlled trial.

PubMed

Kuntz, Alexander B; Chopp-Hurley, Jaclyn N; Brenneman, Elora C; Karampatos, Sarah; Wiebenga, Emily G; Adachi, Jonathan D; Noseworthy, Michael D; Maly, Monica R

2018-01-01

Certain exercises could overload the osteoarthritic knee. We developed an exercise program from yoga postures with a minimal knee adduction moment for knee osteoarthritis. The purpose was to compare the effectiveness of this biomechanically-based yoga exercise (YE), with traditional exercise (TE), and a no-exercise attention-equivalent control (NE) for improving pain, self-reported physical function and mobility performance in women with knee osteoarthritis. Single-blind, three-arm randomized controlled trial. Community in Southwestern Ontario, Canada. A convenience sample of 31 women with symptomatic knee osteoarthritis was recruited through rheumatology, orthopaedic and physiotherapy clinics, newspapers and word-of-mouth. Participants were stratified by disease severity and randomly allocated to one of three 12-week, supervised interventions. YE included biomechanically-based yoga exercises; TE included traditional leg strengthening on machines; and NE included meditation with no exercise. Participants were asked to attend three 1-hour group classes/sessions each week. Primary outcomes were pain, self-reported physical function and mobility performance. Secondary outcomes were knee strength, depression, and health-related quality of life. All were assessed by a blinded assessor at baseline and immediately following the intervention. The YE group demonstrated greater improvements in KOOS pain (mean difference of 22.9 [95% CI, 6.9 to 38.8; p = 0.003]), intermittent pain (mean difference of -19.6 [95% CI, -34.8 to -4.4; p = 0.009]) and self-reported physical function (mean difference of 17.2 [95% CI, 5.2 to 29.2; p = 0.003]) compared to NE. Improvements in these outcomes were similar between YE and TE. However, TE demonstrated a greater improvement in knee flexor strength compared to YE (mean difference of 0.1 [95% CI, 0.1 to 0.2]. Improvements from baseline to follow-up were present in quality of life score for YE and knee flexor strength for TE, while both also demonstrated improvements in mobility. No improvement in any outcome was present in NE. The biomechanically-based yoga exercise program produced clinically meaningful improvements in pain, self-reported physical function and mobility in women with clinical knee OA compared to no exercise. While not statistically significant, improvements in these outcomes were larger than those elicited from the traditional exercise-based program. Though this may suggest that the yoga program may be more efficacious for knee OA, future research studying a larger sample is required. ClinicalTrials.gov (NCT02370667).

Efficacy of a biomechanically-based yoga exercise program in knee osteoarthritis: A randomized controlled trial

PubMed Central

Kuntz, Alexander B.; Chopp-Hurley, Jaclyn N.; Brenneman, Elora C.; Karampatos, Sarah; Wiebenga, Emily G.; Adachi, Jonathan D.; Noseworthy, Michael D.

2018-01-01

Objective Certain exercises could overload the osteoarthritic knee. We developed an exercise program from yoga postures with a minimal knee adduction moment for knee osteoarthritis. The purpose was to compare the effectiveness of this biomechanically-based yoga exercise (YE), with traditional exercise (TE), and a no-exercise attention-equivalent control (NE) for improving pain, self-reported physical function and mobility performance in women with knee osteoarthritis. Design Single-blind, three-arm randomized controlled trial. Setting Community in Southwestern Ontario, Canada. Participants A convenience sample of 31 women with symptomatic knee osteoarthritis was recruited through rheumatology, orthopaedic and physiotherapy clinics, newspapers and word-of-mouth. Interventions Participants were stratified by disease severity and randomly allocated to one of three 12-week, supervised interventions. YE included biomechanically-based yoga exercises; TE included traditional leg strengthening on machines; and NE included meditation with no exercise. Participants were asked to attend three 1-hour group classes/sessions each week. Measurements Primary outcomes were pain, self-reported physical function and mobility performance. Secondary outcomes were knee strength, depression, and health-related quality of life. All were assessed by a blinded assessor at baseline and immediately following the intervention. Results The YE group demonstrated greater improvements in KOOS pain (mean difference of 22.9 [95% CI, 6.9 to 38.8; p = 0.003]), intermittent pain (mean difference of -19.6 [95% CI, -34.8 to -4.4; p = 0.009]) and self-reported physical function (mean difference of 17.2 [95% CI, 5.2 to 29.2; p = 0.003]) compared to NE. Improvements in these outcomes were similar between YE and TE. However, TE demonstrated a greater improvement in knee flexor strength compared to YE (mean difference of 0.1 [95% CI, 0.1 to 0.2]. Improvements from baseline to follow-up were present in quality of life score for YE and knee flexor strength for TE, while both also demonstrated improvements in mobility. No improvement in any outcome was present in NE. Conclusions The biomechanically-based yoga exercise program produced clinically meaningful improvements in pain, self-reported physical function and mobility in women with clinical knee OA compared to no exercise. While not statistically significant, improvements in these outcomes were larger than those elicited from the traditional exercise-based program. Though this may suggest that the yoga program may be more efficacious for knee OA, future research studying a larger sample is required. Trial registration ClinicalTrials.gov (NCT02370667) PMID:29664955

Potential Partners in the Pacific? Soft Power and the SINO-NATO Relationship

DTIC Science & Technology

2011-01-01

non-threatening manner. While both NATO and China have interests in Afghanistan, the most fertile ground for a future relationship lies in mutual...Soviet Card’ in the U.S. Opening to China, 1971-1974” Diplomatic History, Vol. 29, No. 3 (June 2005): 487. 22 Zhou-Ye Jianying -Kissinger memcon, 20/6

14 CFR 399.34 - Intra-Hawaii and Intra-Puerto Rico/Virgin Islands fare flexibility.

Code of Federal Regulations, 2010 CFR

2010-01-01

... Kodiak ($24.40). 10 July 1977 fare increased by cumulative adjustment factor of 1.5558% per Order 80-4... at 12.35 Percent Return Regulatory actual Y.E. March 1977 Aloha Hawaiian Total Cost inflation... fourth quarter of 1976. 2 Passenger revenue divided by RPM's. 3 Passenger yield at 12.35 percent return...

Modeling of Highly Instrumented Honeywell Turbofan Engine Tested with Ice Crystal Ingestion in the NASA Propulsion System Laboratory

NASA Technical Reports Server (NTRS)

Veres, Joseph P.; Jorgenson, Philip C. E.; Jones, Scott M.

2016-01-01

The Propulsion Systems Laboratory (PSL), an altitude test facility at NASA Glenn Research Center, has been used to test a highly instrumented turbine engine at simulated altitude operating conditions. This is a continuation of the PSL testing that successfully duplicated the icing events that were experienced in a previous engine (serial LF01) during flight through ice crystal clouds, which was the first turbofan engine tested in PSL. This second model of the ALF502R-5A serial number LF11 is a highly instrumented version of the previous engine. The PSL facility provides a continuous cloud of ice crystals with controlled characteristics of size and concentration, which are ingested by the engine during operation at simulated altitudes. Several of the previous operating points tested in the LF01 engine were duplicated to confirm repeatability in LF11. The instrumentation included video cameras to visually illustrate the accretion of ice in the low pressure compressor (LPC) exit guide vane region in order to confirm the ice accretion, which was suspected during the testing of the LF01. Traditional instrumentation included static pressure taps in the low pressure compressor inner and outer flow path walls, as well as total pressure and temperature rakes in the low pressure compressor region. The test data was utilized to determine the losses and blockages due to accretion in the exit guide vane region of the LPC. Multiple data points were analyzed with the Honeywell Customer Deck. A full engine roll back point was modeled with the Numerical Propulsion System Simulation (NPSS) code. The mean line compressor flow analysis code with ice crystal modeling was utilized to estimate the parameters that indicate the risk of accretion, as well as to estimate the degree of blockage and losses caused by accretion during a full engine roll back point. The analysis provided additional validation of the icing risk parameters within the LPC, as well as the creation of models for estimating the rates of blockage growth and losses.

Design and syntheses of MMP inhibitors and photosensitive lipid nanoparticle formulations for drug delivery

NASA Astrophysics Data System (ADS)

Subramaniam, Rajesh

Drug administration without any compromise to the quality of life and lifespan is the ideal goal for disease management. The molecular mechanisms of several pathologies have shown that site-specific delivery of target-specific drugs seems to be a promising avenue to achieve this goal. This thesis describes the initial steps that we have taken toward that goal. Matrix metalloproteinases (MMPs) are a family of about 23 isozymes in humans that were actively targeted for treating a multitude of pathologies. Clinical studies carried out on cancer patients have revealed the complexity of the working of this enzyme family and necessitated the development of isozyme-specific MMP inhibitors. Our studies toward the development of isozyme-specific inhibitors have resulted in the development of several inhibitors that seem to be selective toward some MMP isozymes. Our understanding on the molecular mechanism that confers this selectivity is documented in this thesis. Another aspect of discussion in the thesis is the development of photosensitive liposomes for drug delivery that could be triggered to release the drug by irradiation with light of appropriate wavelength. Development of such delivery vehicles, in principle, would confer external spatiotemporal control on drug delivery. This could potentially lead to better disease management by minimizing side effects and enhancing patient compatibility. The thesis discusses our attempts toward the development of photosensitive liposomes. These liposomes incorporated a photosensitive lipid (PSL) that would be cleaved upon irradiation with UV light, causing liposomal destabilization and release of the enclosed drug. The discussion includes: (i) the syntheses of the PSLs, (ii) formulation of the photosensitive liposomes that contained a model drug, (iii) light-mediated release of the drug and (iv) the mechanism of photocleavage of the PSL that leads to content release from liposomes. The thesis concludes with suggestions toward the development of isozyme-specific inhibitors for MMPs and a PSL that could be potentially cleaved with near infrared light by two-photon absorption. Liposomes incorporating such a PSL could, in principle, confer precise spatiotemporally controlled drug delivery at greater tissue depths if the technology could find ways to mitigate light intensity loss due to scattering by tissues.

Differentiation of Yersinia enterocolitica biotype 1A from pathogenic Yersinia enterocolitica biotypes by detection of β-glucosidase activity: comparison of two chromogenic culture media and Vitek2.

PubMed

Karhukorpi, Jari; Päivänurmi, Marjut

2014-01-01

Aesculin hydrolysis (ESC) is one of the key reactions in differentiating pathogenic Yersinia enterocolitica biotypes 1B, 2, 3, 4 and 5 from the less-pathogenic biotype 1A. Because the ESC reaction is caused by β-glucosidase (βGLU) activity of the bacteria, we studied whether two commonly used methods (BBL CHROMagar Orientation and Vitek2 Gram-negative identification card) could be used in assessing βGLU activity of 74 Yersinia strains. Both methods were sensitive (100 % and 97 %) and specific (100 % and 100 %) in differentiating βGLU-positive YE BT1A from βGLU-negative Y. enterocolitica biotypes. For a subset of strains (n = 69), a new selective CHROMagar Yersinia showed excellent agreement with the strains' βGLU activity. Thus all the methods evaluated in this study may be used to differentiate between YE BT1A and other Y. enterocolitica biotypes.

Polyoxygenated Cyclohexenoids with Promising α-Glycosidase Inhibitory Activity Produced by Phomopsis sp. YE3250, an Endophytic Fungus Derived from Paeonia delavayi.

PubMed

Huang, Rong; Jiang, Bo-Guang; Li, Xiao-Nian; Wang, Ya-Ting; Liu, Si-Si; Zheng, Kai-Xuan; He, Jian; Wu, Shao-Hua

2018-02-07

Seven new polyoxygenated cyclohexenoids, namely, phomopoxides A-G (1-7), were isolated from the fermentation broth extract of an endophytic fungal strain Phomopsis sp. YE3250 from the medicinal plant Paeonia delavayi Franch. The structures of these compounds were established by spectroscopic interpretation. The absolute configurations of compounds 1 and 4 were confirmed by X-ray crystallographic analysis and chemical derivative approach. All isolated compounds showed weak cytotoxic activities toward three human tumor cell lines (Hela, MCF-7, and NCI-H460) and weak antifungal activities against five pathogenic fungi (Candida albicans, Aspergillus niger, Pyricularia oryzae, Fusarium avenaceum, and Hormodendrum compactum). In addition, compounds 1-7 showed a promising α-glycosidase inhibitory activity with IC 50 values of 1.47, 1.55, 1.83, 2.76, 2.88, 3.16, and 2.94 mM, respectively, as compared with a positive control of acarbose (IC 50 = 1.22 mM).

Genetic diversity and paternal origin of domestic donkeys.

PubMed

Han, H; Chen, N; Jordana, J; Li, C; Sun, T; Xia, X; Zhao, X; Ji, C; Shen, S; Yu, J; Ainhoa, F; Chen, H; Lei, C; Dang, R

2017-12-01

Numerous studies have been conducted to investigate genetic diversity, origins and domestication of donkey using autosomal microsatellites and the mitochondrial genome, whereas the male-specific region of the Y chromosome of modern donkeys is largely uncharacterized. In the current study, 14 published equine Y chromosome-specific microsatellites (Y-STR) were investigated in 395 male donkey samples from China, Egypt, Spain and Peru using fluorescent labeled microsatellite markers. The results showed that seven Y-STRs-EcaYP9, EcaYM2, EcaYE2, EcaYE3, EcaYNO1, EcaYNO2 and EcaYNO4-were male specific and polymorphic, showing two to eight alleles in the donkeys studied. A total of 21 haplotypes corresponding to three haplogroups were identified, indicating three independent patrilines in domestic donkey. These markers are useful for the study the Y-chromosome diversity and population genetics of donkeys in Africa, Europe, South America and China. © 2017 Stichting International Foundation for Animal Genetics.

[Textual research on Chen Ye and his Jia cang jing yan fang (Family-preserved Empirical Recipes) of the Song Dynasty].

PubMed

Zhang, Xuedan; Zhang, Ruqing; Chen, Dexing

2014-01-01

Chen Ye, an official of the Southern Song Dynasty, also known as Chen Rihua as his styled name, was born in Changle, Fuzhou in the reign of Shaoxing, and died during the reign of Duanping. He had been consecutively in the positions of Jiang shi lang (Court Gentleman for Ceremonial Service), Zhi zhou (Prefect) of Lingding, the Ti xing (Judicial Commissioner) of Guangdong, the Zong ling (Overseer-general) of Sichuan, Shan ding (Reviser), Shu lin and other positions in Tongzhou, Yuanzhou. His works included 1 volume of Gu ling xian sheng nian pu (Mr. Guling's Chronological Biography), 1 volume of Tan xie (On Humor), 1 volume of Shi hua (Poetry), 8 volumes of Jin yuan li shu (Jin Yuan's Smart Technique), 3 volumes of Yi jian zhi lei bian (Classified Compilation of Yijian's Annals), (Zeng guang) Suo sui lu (Augmented Records of Trivial Matters), 5 volumes of Jia cang jing yan fang (Family-preserved Empirical Recipes). He also compiled the 8-volume Yin jiang zhi (Yinjiang's Annals), published the 2-volume Jia cang ji yao fang (Collected Essential Recipes from Family Preservation), and other proses and poetry. Jia cang jing yan fang was a formulary compiled by Chen Ye, which was lost. Altogether 74 of its recipes were cited in Fu ren da quan liang fang (Complete Effective Prescriptions for Women's Diseases), Shou qin yang lao shu (A Book for Pursuing Seniors' Longevity and Healthcare), Pu ji fang (Prescriptions for Universal Relief) and Yong le da dian (Yongle Encyclopedia).

Barriers to Breast Cancer Screening among Latinas in the U.S.-Mexico Border Region

DTIC Science & Technology

2011-05-01

la Salud : A breast and cervical... en in g E ve r ha d a m am m og ra m H ad a M am m og ra m w ith in th e la st 2 ye ar s H ad a m am m og ra m w ith in th e la st ye ar U na dj us...Cancer Society, Atlanta, GA 22. Fernandez ME, Gonzales A, Tortolero-Luna G et al (2009) Effectiveness of Cultivando la Salud : a breast and cervical

Towards defect free EUVL reticles: carbon and particle removal by single dry cleaning process and pattern repair by HIM

NASA Astrophysics Data System (ADS)

Koster, N. B.; Molkenboer, F. T.; van Veldhoven, E.; Oostrom, S.

2011-04-01

We report on our findings on EUVL reticle contamination removal, inspection and repair. We show that carbon contamination can be removed without damage to the reticle by our plasma process. Also organic particles, simulated by PSL spheres, can be removed from both the surface of the absorber as well as from the bottom of the trenches. The particles shrink in size during the plasma treatment until they are vanished. The determination of the necessary cleaning time for PSL spheres was conducted on Ru coated samples and the final experiment was performed on our dummy reticle. Finally we show that the Helium Ion Microscope in combination with a Gas Injection System is capable of depositing additional lines and squares on the reticle with sufficient resolution for pattern repair.

An automated methodology development. [software design for combat simulation

NASA Technical Reports Server (NTRS)

Hawley, L. R.

1985-01-01

The design methodology employed in testing the applicability of Ada in large-scale combat simulations is described. Ada was considered as a substitute for FORTRAN to lower life cycle costs and ease the program development efforts. An object-oriented approach was taken, which featured definitions of military targets, the capability of manipulating their condition in real-time, and one-to-one correlation between the object states and real world states. The simulation design process was automated by the problem statement language (PSL)/problem statement analyzer (PSA). The PSL/PSA system accessed the problem data base directly to enhance the code efficiency by, e.g., eliminating non-used subroutines, and provided for automated report generation, besides allowing for functional and interface descriptions. The ways in which the methodology satisfied the responsiveness, reliability, transportability, modifiability, timeliness and efficiency goals are discussed.

Risedronate therapy for the prevention of steroid-induced osteoporosis in patients with minimal-change nephrotic syndrome.

PubMed

Takei, Takashi; Itabashi, Mitsuyo; Tsukada, Misao; Sugiura, Hidekazu; Moriyama, Takahito; Kojima, Chiari; Shiohira, Shunji; Shimizu, Ari; Karasawa, Kazunori; Amemiya, Nobuyuki; Kawanishi, Kunio; Ogawa, Tetsuya; Uchida, Keiko; Tsuchiya, Ken; Nitta, Kosaku

2010-01-01

Minimal-change nephrotic syndrome (MCNS) is treated by the administration of prednisolone (PSL) at high doses. Steroid-induced osteoporosis is a serious adverse effect of this drug. Patients with MCNS were randomly assigned to two groups, the risedronate (2.5 mg/day) + alfacalcidol (0.25 µg/day) group (n=20) and the alfacalcidol (0.25 µg/day)-alone group (n=20). All the patients had received PSL and the clinical characteristics were compared between the two groups at baseline and at 12 months. A significant decrease of the mean bone mineral density (BMD) of the lumbar spine from 0.710±0.162 (g/cm(2)) to 0.588±0.125 was observed in the alfacalcidol-alone group (p=0.02), while no such decrease of the bone mineral density was found in the risedronate + alfacalcidol group (0.663±0.169 at baseline and 0.626±0.129 at 12 months). No significant differences in the results of other biochemical tests performed at the baseline and at 12 months were observed between the two groups. The likelihood of development of steroid-induced osteoporosis was influenced by the cumulative dose of PSL, the mean BMD at the baseline, occurrence of disease relapse, and risedronate therapy. Risedronate appears to be effective in preventing steroid-induced osteoporosis. It is necessary to use bisphosphonates to maintain the BMD in patients with MCNS receiving prolonged steroid therapy.

Structure and binding analysis of Polyporus squamosus lectin in complex with the Neu5Acα2-6Galβ1-4GlcNAc human-type influenza receptor

PubMed Central

Kadirvelraj, Renuka; Grant, Oliver C; Goldstein, Irwin J; Winter, Harry C; Tateno, Hiroaki; Fadda, Elisa; Woods, Robert J

2011-01-01

Glycan chains that terminate in sialic acid (Neu5Ac) are frequently the receptors targeted by pathogens for initial adhesion. Carbohydrate-binding proteins (lectins) with specificity for Neu5Ac are particularly useful in the detection and isolation of sialylated glycoconjugates, such as those associated with pathogen adhesion as well as those characteristic of several diseases including cancer. Structural studies of lectins are essential in order to understand the origin of their specificity, which is particularly important when employing such reagents as diagnostic tools. Here, we report a crystallographic and molecular dynamics (MD) analysis of a lectin from Polyporus squamosus (PSL) that is specific for glycans terminating with the sequence Neu5Acα2-6Galβ. Because of its importance as a histological reagent, the PSL structure was solved (to 1.7 Å) in complex with a trisaccharide, whose sequence (Neu5Acα2-6Galβ1-4GlcNAc) is exploited by influenza A hemagglutinin for viral adhesion to human tissue. The structural data illuminate the origin of the high specificity of PSL for the Neu5Acα2-6Gal sequence. Theoretical binding free energies derived from the MD data confirm the key interactions identified crystallographically and provide additional insight into the relative contributions from each amino acid, as well as estimates of the importance of entropic and enthalpic contributions to binding. PMID:21436237

Biofilm formation by Staphylococcus epidermidis on peritoneal dialysis catheters and the effects of extracellular products from Pseudomonas aeruginosa.

PubMed

Pihl, Maria; Arvidsson, Anna; Skepö, Marie; Nilsson, Martin; Givskov, Michael; Tolker-Nielsen, Tim; Svensäter, Gunnel; Davies, Julia R

2013-04-01

Biofilm formation by Staphylococcus epidermidis is a cause of infections related to peritoneal dialysis (PD). We have used a PD catheter flow-cell model in combination with confocal scanning laser microscopy and atomic force microscopy to study biofilm formation by S. epidermidis. Adherence to serum-coated catheters was four times greater than to uncoated ones, suggesting that S. epidermidis binds to serum proteins on the catheter surface. Pseudomonas aeruginosa biofilm supernatant interfered with the formation of a serum protein coat thereby reducing the capacity for biofilm formation in S. epidermidis. Supernatants from ΔpelA, ΔpslBCD and ΔrhlAB strains of P. aeruginosa showed no differences from the wild-type supernatant indicating that the effect on serum coat formation was not due to rhamnolipids or the PelA and PslBCD polysaccharides. Supernatant from P. aeruginosa also dispersed established S. epidermidis biofilms. Supernatants lacking PelA or PslBCD showed no differences from the wild type but that from a ΔrhlAB strain, showed reduced, but not abolished, capacity for dispersal. This suggests that rhamnolipids are involved but not wholly responsible for the effect. Thus, supernatants from P. aeruginosa contain promising substances for the prevention and treatment of biofilm infections, although further work is required to identity more active components. © 2013 Federation of European Microbiological Societies. Published by Blackwell Publishing Ltd. All rights reserved.

A signaling pathway contributing to platelet storage lesion development: targeting PI3-kinase–dependent Rap1 activation slows storage-induced platelet deterioration

PubMed Central

Schubert, Peter; Thon, Jonathan N.; Walsh, Geraldine M.; Chen, Cindy H.I.; Moore, Edwin D.; Devine, Dana V.; Kast, Juergen

2015-01-01

BACKGROUND The term platelet storage lesion (PSL) describes the structural and biochemical changes in platelets (PLTs) during storage. These are typified by alterations of morphologic features and PLT metabolism leading to reduced functionality and hence reduced viability for transfusion. While the manifestations of the storage lesion are well characterized, the biochemical pathways involved in the initiation of this process are unknown. STUDY DESIGN AND METHODS A complementary proteomic approach has recently been applied to analyze changes in the PLT proteome during storage. By employing stringent proteomic criteria, 12 proteins were identified as significantly and consistently changing in relative concentration over a 7-day storage period. Microscopy, Western blot analysis, flow cytometry, and PLT functionality analyses were used to unravel the involvement of a subset of these 12 proteins, which are connected through integrin signaling in one potential signaling pathway underlying storage lesion development. RESULTS Microscopic analysis revealed changes in localization of glycoprotein IIIa, Rap1, and talin during storage. Rap1 activation was observed to correlate with expression of the PLT activation marker CD62P. PLTs incubated for 7 days with the PI3-kinase inhibitor LY294002 showed diminished Rap1 activation as well as a moderate reduction in integrin αIIbβ3 activation and release of α-granules. Furthermore, this inhibitor seemed to improve PLT integrity and quality during storage as several in vitro probes showed a deceleration of PLT activation. CONCLUSION These results provide the first evidence for a signaling pathway mediating PSL in which PI3-kinase–dependent Rap1 activation leads to integrin αIIbβ3 activation and PLT degranulation. PMID:19497060

Low sidelobe level and high time resolution for metallic ultrasonic testing with linear-chirp-Golay coded excitation

NASA Astrophysics Data System (ADS)

Zhang, Jiaying; Gang, Tie; Ye, Chaofeng; Cong, Sen

2018-04-01

Linear-chirp-Golay (LCG)-coded excitation combined with pulse compression is proposed in this paper to improve the time resolution and suppress sidelobe in ultrasonic testing. The LCG-coded excitation is binary complementary pair Golay signal with linear-chirp signal applied on every sub pulse. Compared with conventional excitation which is a common ultrasonic testing method using a brief narrow pulse as exciting signal, the performances of LCG-coded excitation, in terms of time resolution improvement and sidelobe suppression, are studied via numerical and experimental investigations. The numerical simulations are implemented using Matlab K-wave toolbox. It is seen from the simulation results that time resolution of LCG excitation is 35.5% higher and peak sidelobe level (PSL) is 57.6 dB lower than linear-chirp excitation with 2.4 MHz chirp bandwidth and 3 μs time duration. In the B-scan experiment, time resolution of LCG excitation is higher and PSL is lower than conventional brief pulse excitation and chirp excitation. In terms of time resolution, LCG-coded signal has better performance than chirp signal. Moreover, the impact of chirp bandwidth on LCG-coded signal is less than that on chirp signal. In addition, the sidelobe of LCG-coded signal is lower than that of chirp signal with pulse compression.

Post-merger evolution of a neutron star-black hole binary with neutrino transport

NASA Astrophysics Data System (ADS)

Foucart, Francois; O'Connor, Evan; Roberts, Luke; Duez, Matthew D.; Haas, Roland; Kidder, Lawrence E.; Ott, Christian D.; Pfeiffer, Harald P.; Scheel, Mark A.; Szilagyi, Bela

2015-06-01

We present a first simulation of the post-merger evolution of a black hole-neutron star binary in full general relativity using an energy-integrated general-relativistic truncated moment formalism for neutrino transport. We describe our implementation of the moment formalism and important tests of our code, before studying the formation phase of an accretion disk after a black hole-neutron star merger. We use as initial data an existing general-relativistic simulation of the merger of a neutron star of mass 1.4 M⊙ with a black hole of mass 7 M⊙ and dimensionless spin χBH=0.8 . Comparing with a simpler leakage scheme for the treatment of the neutrinos, we find noticeable differences in the neutron-to-proton ratio in and around the disk, and in the neutrino luminosity. We find that the electron neutrino luminosity is much lower in the transport simulations, and that both the disk and the disk outflows are less neutron rich. The spatial distribution of the neutrinos is significantly affected by relativistic effects, due to large velocities and curvature in the regions of strongest emission. Over the short time scale evolved, we do not observe purely neutrino-driven outflows. However, a small amount of material (3 ×10-4M⊙ ) is ejected in the polar region during the circularization of the disk. Most of that material is ejected early in the formation of the disk, and is fairly neutron rich (electron fraction Ye˜0.15 - 0.25 ). Through r-process nucleosynthesis, that material should produce high-opacity lanthanides in the polar region, and could thus affect the light curve of radioactively powered electromagnetic transients. We also show that by the end of the simulation, while the bulk of the disk remains neutron rich (Ye˜0.15 - 0.2 and decreasing), its outer layers have a higher electron fraction: 10% of the remaining mass has Ye>0.3 . As that material would be the first to be unbound by disk outflows on longer time scales, and as composition evolution is slower at later times, the changes in Ye experienced during the formation phase of the disk could have an impact on nucleosynthesis outputs from neutrino-driven and viscously driven outflows. Finally, we find that the effective viscosity due to momentum transport by neutrinos is unlikely to have a strong effect on the growth of the magnetorotational instability in the post-merger accretion disk.

[Concepts of "urinary bladder" and "vesicles (bao)" , "jin ye" (fluid and humor) and "urine" and other associated issues].

PubMed

Son, J R; Liu, Y; Ma, Q N; Ju, B Z; Sun, K F; Wu, J D; Zhang, L D; Yang, G L

2017-09-28

In the Huang di nei jing ( Huangdi ' s Internal Classic ), jin ye (fluid and humor) is described in two senses, broad and narrow, though not so strictly.Sometimes, jin ye is explained ambiguously as "sweat" and "urine" , as in the phrase "the bladder, being a house of jin ye " , here " jin ye " refers to the urine. In the Qi jue lun pian of Su wen ( Chapter on Qi - Syncope of Plain Questions ) , the " bao " in the sentence "heat of bao moved to bladder" refersto the uterus. In the Shi cong rong lun pian ( Chapter of Readily Inspecting ) of Plain Questions , the "bladder" in the phrase "gallbladder, stomach, large intestine, small intestine, spleen, bao and bladder" , which, being an annotation of " bao " originally, is mistakenly incorporated into the text of the Classic . In the Wu wei lun of Ling shu ( On Five Tastes in Miraculous Pivot ) , the " bao " in " bao of bladder" refers to the external hou (external manifestation) of the bladder, that is the scrotum. In the Bei ji qian jin yao fang ( Essential Prescriptions Worth a Thousand Gold for Emergencies ) , the short sentence " pang guang zou bao " is an error in itself. In the sentence of "settled in the bao and zhi causing to dream of defecation and urination" in the Yin xie fa meng (Dreams due to Evils) of Miraculous Pivot , " bao " refers to uterus, and " zhi " to anus. In Bi lun pian ( Chapter on Impediment ) of Plain Questions , "the man suffered bao bimight feel internal pain when the lesser abdomen and bladder are pressed" , here, " bao " refers to the bladder. In the Wu yin wu wei ( Chapter on Five Sound and Five Tastes ) of Miraculous Pivot , the " bao " in the sentence "thoroughfare vessel and conception vessel all starts from bao " , again, " bao " here refers to the bladder, rather than to the uterus. From the above descriptions of "bladder" and " bao " in the Huangdi ' s Internal Classic , the "bladder" in ancient medical books refers to the substantial bladder, an anatomical organ, and " bao " refers to cystiform organs, including the bladder, uterus, scrotum etc.

Biophysical Characterization of Copolymer-Protected Gene Vectors (COPROGs)

PubMed Central

Hönig, Daniel; DeRouchey, Jason; Jungmann, Ralf; Koch, Christian; Plank, Christian; Rädler, Joachim O.

2010-01-01

A copolymer-protected gene vector (COPROG) is a three component gene delivery system consisting of a preformed DNA and branched polyethylenimine (bPEI) complex subsequently modified by the addition of a copolymer (P6YE5C) incorporating both poly(ethylene glycol) (PEG) and anionic peptides. Using fluorescence correlation spectroscopy (FCS) and atomic force microscopy (AFM), we characterized and compared the self-assembly of bPEI/DNA particles and COPROG complexes. In low salt buffer, both bPEI/DNA and COPROG formulations form stable nanoparticles with hydrodynamic radii between 60–120 nm. COPROG particles, as compared to bPEI/DNA, show greatly improved particle stability to both physiological salt as well as low pH conditions. Binding stoichiometry of the three-component COPROG system was investigated by dual-color fluorescence cross-correlation spectroscopy (FCCS). It was found that a significant fraction of P6YE5C copolymer aggregates with excess bPEI forming bPEI/P6YE5C “ghost complexes” with no DNA inside. The ratio of ghost particles to COPROG complexes is about 4:1. In addition we find a large fraction of excess P6YE5C copolymer, which remains unbound in solution. We observe a 2–4 fold enhanced reporter gene expression with COPROG formulations at various equivalents as compared to bPEI-DNA alone. We believe that both complex stabilization as well as the capture of excess bPEI into ghost particles induced by the copolymer is responsible for the improvement in gene expression. PMID:20672861

JPRS Report, Science & Technology, USSR: Computers

DTIC Science & Technology

1987-07-15

Algebras and Multilevel Program Planning (G. Ye.. Tseytlin; PROGRAMMIROVANIYE, No 3, May-Jun 86) 36 Linguistic Facilities for Programming...scientific production associations which, jointly with the USSR Academy of Sciences, will solve basic and applied problems in the informatics industry...especially the establishment of complex , interdisciplinary problems and directions), the change in the style of the scientific thought of the epoch, and

Early age hydration of calcium sulfoaluminate (synthetic ye'elimite, C{sub 4}A{sub 3}S{sup ¯}) in the presence of gypsum and varying amounts of calcium hydroxide

DOE Office of Scientific and Technical Information (OSTI.GOV)

Hargis, Craig W.; Kirchheim, Ana Paula; Monteiro, Paulo J.M., E-mail: monteiro@ce.berkeley.edu

Suspensions of synthetic ye'elimite (C{sub 4}A{sub 3}S{sup ¯}) in a saturated gypsum (CS{sup ¯}H{sub 2}) and calcium hydroxide (CH) solution were examined in-situ in a wet cell by soft X-ray transmission microscopy and ex-situ by scanning electron microscopy. The most voluminous hydration product observed was ettringite. Ettringite commonly displayed acicular, filiform, reticulated, and stellate crystal habits. Additionally, pastes with C{sub 4}A{sub 3}S{sup ¯}, 15% CS{sup ¯}H{sub 2}, and varying amounts of CH were prepared and examined with X-ray diffraction (XRD) and isothermal calorimetry. The XRD experiments showed that increasing CH content caused more solid solution (SO{sub 4}{sup 2−}/OH{sup −}) AFmmore » phases to form at early ages (< 1 d) and more monosulfate to form at later ages (> 1 d). Calorimetry indicated that the increased production of solid solution AFm was accompanied with an increase in the initial (< 30 min) rate of heat evolution, and increasing CH generally reduced the time till the second maximum rate of heat evolution due to the formation of ettringite and monosulfate.« less

Open fermentative production of L-lactic acid with high optical purity by thermophilic Bacillus coagulans using excess sludge as nutrient.

PubMed

Ma, Kedong; Maeda, Toshinari; You, Huiyan; Shirai, Yoshihito

2014-01-01

The development of a low-cost polymer-grade L-lactic acid production process was achieved in this study. Excess sludge hydrolyzate (ESH) was chosen as nutrient source for the objective of reducing nutrient cost in lactic acid production. 1% of ESH had high performance in lactic acid production relative to 2g/l yeast extract (YE) while the production cost of ESH was much lower than that of YE, indicating ESH was a promising substitute of YE. By employing a thermophilic strain of Bacillus coagulans (NBRC 12583), non-sterilized batch and repeated batch L-lactic acid fermentation was successfully performed, and the optical purity of L-lactic acid accumulated was more than 99%. Moreover, the factors associated with cell growth and lactic acid fermentation was investigated through a two-stage lactic acid production strategy. Oxygen played an important role in cell growth, and the optimal condition for cell growth and fermentation was pH 7.0 and 50°C. Copyright © 2013 Elsevier Ltd. All rights reserved.

Validation Ice Crystal Icing Engine Test in the Propulsion Systems Laboratory at NASA Glenn Research Center

NASA Technical Reports Server (NTRS)

Oliver, Michael J.

2014-01-01

The Propulsion Systems Laboratory (PSL) is an existing altitude simulation jet engine test facility located at NASA Glenn Research Center in Clevleand, OH. It was modified in 2012 with the integration of an ice crystal cloud generation system. This paper documents the inaugural ice crystal cloud test in PSLthe first ever full scale, high altitude ice crystal cloud turbofan engine test to be conducted in a ground based facility. The test article was a Lycoming ALF502-R5 high bypass turbofan engine, serial number LF01. The objectives of the test were to validate the PSL ice crystal cloud calibration and engine testing methodologies by demonstrating the capability to calibrate and duplicate known flight test events that occurred on the same LF01 engine and to generate engine data to support fundamental and computational research to investigate and better understand the physics of ice crystal icing in a turbofan engine environment while duplicating known revenue service events and conducting test points while varying facility and engine parameters. During PSL calibration testing it was discovered than heated probes installed through tunnel sidewalls experienced ice buildup aft of their location due to ice crystals impinging upon them, melting and running back. Filtered city water was used in the cloud generation nozzle system to provide ice crystal nucleation sites. This resulted in mineralization forming on flow path hardware that led to a chronic degradation of performance during the month long test. Lacking internal flow path cameras, the response of thermocouples along the flow path was interpreted as ice building up. Using this interpretation, a strong correlation between total water content (TWC) and a weaker correlation between median volumetric diameter (MVD) of the ice crystal cloud and the rate of ice buildup along the instrumented flow path was identified. For this test article the engine anti-ice system was required to be turned on before ice crystal icing would occur. The ice crystal icing event, an uncommanded reduction in thrust, was able to be turned on and off by manipulating cloud TWC. A flight test point where no ice crystal icing event occurred was also duplicated in PSL. Physics based computational tools were successfully used to predict tunnel settings to induce ice buildup along the low pressure compression system flow path for several test points at incrementally lower altitudes, demonstrating that development of ice crystal icing scaling laws is potentially feasible. Analysis of PSL test data showed that uncommanded reduction in thrust occurs during ice crystal cloud on operation prior to fan speed reduction. This supports previous findings that the reduction of thrust for this test article is due to ice buildup leading to a restricted airflow from either physical or aerodynamic blockage in the engine core flow path.

AUV (Autonomous Underwater Vehicle) Dive Control System Development Including Sensor Bias Compensation and Parameter Estimation

DTIC Science & Technology

1988-12-01

equations, x(k+l) = A*x(k) + B*u(k) + Ko *[y(k)-C*x(k)] in which y(k) is the previous time sensor output signals. In this case, two outputs were...available to the observer, the pitch rate, and the water depth. The observer gains, Ko , may be selected by using the dual of the controller pole placement...becomes, 15 y(k) = [l;l]*ye(k) so that the gains for the two-input system become Ko = [l;l]*ke where Ke are found via pole placement using ye(k). The

WE-AB-BRB-05: Toward a 2D Water-Equivalent Dosimetry Panel Using KCl:Eu2+

DOE Office of Scientific and Technical Information (OSTI.GOV)

Mazur, T; Wang, Y; Li, H

Purpose: KCl:Eu2+ storage phosphor shows promise for radiation therapy dosimetry. The purpose of this work is to investigate several important aspects of this material for potential commercial use. Methods: KCl:Eu2+ chips were fabricated and a conformal coating using Parylene was applied. Material’s dose response in a 6 MV beam was investigated using Monte-Carlo simulations. We attempted to micronize the materials using a spiral jet mill. As we did not have a water-free glovebox, we used commercially available non-hygroscopic BaFBr0.85I0.15:Eu2+ computed radiography material to test if a homogeneous panel can be made using micron-sized phosphors. Results: Dosimeters remained intact and showedmore » no change in PSL intensity after eight hrs of submersion in water. We then optically bleached the samples for reuse, irradiated and immersed for another 24 hrs. We observed marginal worsening of the PSL signal for both the soaked and un-soaked chips. By contrast, we were unable to measure PSL intensity of the un-coated pellets due to these pellets dissolving within minutes of being immersed in water. MC data indicate that the micron-sized KCl:Eu2+ is predicted to have a nearly water-equivalent response. KCl:Eu2+ particles with a median size of 3 microns can be produced using a jet mill, which could be reduced further if necessary. While the particles tend to agglomerate over time when stored in a desiccator, they still possess favorable d50’s and d99’s even after 100 minutes, providing an adequate time window for making a panel via tape casting. A panel cast using optimized methods exhibits nearly perfect particle arrangement. Conclusions: Data shown here support ongoing efforts in fabricating a reusable, high resolution dosimetry panel in a water-free glovebox using micron-sized KCl:Eu2+ particles separated by water-equivalent polymers. The conformal coating thereafter will provide good humidity resistance. HL is the founder of DoseImaging, LLC that is exclusively dedicated to commercializing this technology.« less

Initial application of stereoscopic particle image velocimetry to transport and boundary phenomena in dusty plasmas

NASA Astrophysics Data System (ADS)

Thomas, Edward; Williams, Jeremiah; Silver, Jennifer

2004-11-01

Over the past five years, the Auburn Plasma Sciences Laboratory (PSL) has applied two-dimensional particle image velocimetry (2D-PIV) techniques [E. Thomas, Phys. Plasmas, 6, 2672 (1999)] to make measurements of particle transport in dusty plasmas. Although important information was obtained from these earlier studies, the complex behavior of the charged microparticles clearly indicated that three-dimensional velocity information is needed. The PSL has recently acquired and installed a stereoscopic PIV (stereo-PIV) diagnostic tool for dusty plasma investigations [E. Thomas. et al, Phys. Plasmas, L37 (2004)]. It employs a synchronized dual-laser, dual-camera system for measuring particle transport in three dimensions. Results will be presented on the initial application of stereo-PIV to dusty plasma studies. Additional results will be presented on the use of stereo-PIV for measuring the controlled interaction of two dust clouds.

Bibliography of Soviet Laser Developments, Number 76, March - April 1985.

DTIC Science & Technology

1986-06-01

515. Andreyeva, O.V.; Sukhanov , V.I.; Khazova, M.V. 0 * Experimental study on the optical characteristics of * developed layers for three-dimensional...holograms. ZNPFA, no. 6, 1985, 435-438. (RZFZA, 85/3L814). 516. Andreyeva, O.V.; Sukhanov , V.I.; Rhazova, M.V. 0 Relationship of the refractive index... Sukhanov , V.I.; Ashcheulov, Yu.V.; Petnikov, A.Ye. (GOI). Method of measuring values of the diffraction * efficiency of 3D phase holograms. OPMPA, no. 4

A study of in-situ sediment flocculation in the turbidity maxima of the Yangtze Estuary

NASA Astrophysics Data System (ADS)

Guo, Chao; He, Qing; Guo, Leicheng; Winterwerp, Johan C.

2017-05-01

In order to improve our understandings of temporal and vertical variations of sediment flocculation dynamics within the turbidity maxima (TM) of the highly turbid Yangtze Estuary (YE), we deployed LISST-100C, a laser instrument for in-situ monitor of the sizes and concentrations of flocculated particles in a wet season. Field data in terms of vertical profiles of flow velocity, suspended sediment concentration (SSC), salinity, flocculated particle size distribution and volume concentration were obtained, based on field works conducted at consecutive spring, moderate, and neap tides. Data analyses show that the mean floc diameters (DM) were in the range of 14-95 μm, and flocculation exhibited strong temporal and vertical variations within a tidal cycle and between spring-neap cycles. Larger DM were observed during high and low slack waters, and the averaged floc size at neap tide was found 57% larger than at spring tide. Effective density of flocs decreased with the increase of floc size, and fractal dimension of flocs in the YE was mainly between 1.5 and 2.1. We also estimated the settling velocity of flocs by 0.04-0.6 mm s-1 and the largest settling velocity occurred also at slack waters. Moreover, it is found that turbulence plays a dominant role in the flocculation process. Floc size decreases significantly when the shear rate parameter G is > 2-3 s-1, suggesting the turbulence breaking force. Combined effects of fine sediment flocculation, enhanced settling process, and high sediment concentration resulted in a large settling flux around high water, which can in part explain the severe siltation in the TM of the YE, thus shedding lights on the navigation channel management.

U.S. EPA, Pesticide Product Label, , 11/13/1987

EPA Pesticide Factsheets

2011-04-14

... r'r~-::)pir'ati()ll by !J'o(.rll.th-·-I:o···mrouth (H" othl~r mC'·)frS:· \\1t \\·r ... 'f·qhqI.3ti~ nr::~1n r::au~ji:.~ tl.l.ng et:ir:.'rna

Studies in the Phonology of Asian Languages VI: Complex Syllable Nuclei in Vietnamese.

ERIC Educational Resources Information Center

Han, Mieko S.

This study is the sixth in the series "Studies in the Phonology of Asian Languages." A phonetic and phonemic analysis of the three complex nuclei of Vietnames (Hanoi dialect), spelled (1) ye-, -ie-, -ia, (2) -u'o'-, -u'a, and (3) -uo-, -ua, was carried out using the sound spectrograph. The relative domains of the target qualities of the…

Novel Method of Quantifying Radioactive Cesium-Rich Microparticles (CsMPs) in the Environment from the Fukushima Daiichi Nuclear Power Plant.

PubMed

Ikehara, Ryohei; Suetake, Mizuki; Komiya, Tatsuki; Furuki, Genki; Ochiai, Asumi; Yamasaki, Shinya; Bower, William R; Law, Gareth T W; Ohnuki, Toshihiko; Grambow, Bernd; Ewing, Rodney C; Utsunomiya, Satoshi

2018-06-05

Highly radioactive cesium-rich microparticles (CsMPs) were released from the Fukushima Daiichi nuclear power plant (FDNPP) to the surrounding environment at an early stage of the nuclear disaster in March of 2011; however, the quantity of released CsMPs remains undetermined. Here, we report a novel method to quantify the number of CsMPs in surface soils at or around Fukushima and the fraction of radioactivity they contribute, which we call "quantification of CsMPs" (QCP) and is based on autoradiography. Here, photostimulated luminescence (PSL) is linearly correlated to the radioactivity of various microparticles, with a regression coefficient of 0.0523 becquerel/PSL/h (Bq/PSL/h). In soil collected from Nagadoro, Fukushima, Japan, CsMPs were detected in soil sieved with a 114 μm mesh. There was no overlap between the radioactivities of CsMPs and clay particles adsorbing Cs. Based on the distribution of radioactivity of CsMPs, the threshold radioactivity of CsMPs in the size fraction of <114 μm was determined to be 0.06 Bq. Based on this method, the number and radioactivity fraction of CsMPs in four surface soils collected from the vicinity of the FDNPP were determined to be 48-318 particles per gram and 8.53-31.8%, respectively. The QCP method is applicable to soils with a total radioactivity as high as ∼10 6 Bq/kg. This novel method is critically important and can be used to quantitatively understand the distribution and migration of the highly radioactive CsMPs in near-surface environments surrounding Fukushima.

Progressive Stereo Locking (PSL): A Residual Dipolar Coupling Based Force Field Method for Determining the Relative Configuration of Natural Products and Other Small Molecules.

PubMed

Cornilescu, Gabriel; Ramos Alvarenga, René F; Wyche, Thomas P; Bugni, Tim S; Gil, Roberto R; Cornilescu, Claudia C; Westler, William M; Markley, John L; Schwieters, Charles D

2017-08-18

Establishing the relative configuration of a bioactive natural product represents the most challenging part in determining its structure. Residual dipolar couplings (RDCs) are sensitive probes of the relative spatial orientation of internuclear vectors. We adapted a force field structure calculation methodology to allow free sampling of both R and S configurations of the stereocenters of interest. The algorithm uses a floating alignment tensor in a simulated annealing protocol to identify the conformations and configurations that best fit experimental RDC and distance restraints (from NOE and J-coupling data). A unique configuration (for rigid molecules) or a very small number of configurations (for less rigid molecules) of the structural models having the lowest chiral angle energies and reasonable magnitudes of the alignment tensor are provided as the best predictions of the unknown configuration. For highly flexible molecules, the progressive locking of their stereocenters into their statistically dominant R or S state dramatically reduces the number of possible relative configurations. The result is verified by checking that the same configuration is obtained by initiating the locking from different regions of the molecule. For all molecules tested having known configurations (with conformations ranging from mostly rigid to highly flexible), the method accurately determined the correct configuration.

Property-Based Monitoring of Analog and Mixed-Signal Systems

NASA Astrophysics Data System (ADS)

Havlicek, John; Little, Scott; Maler, Oded; Nickovic, Dejan

In the recent past, there has been a steady growth of the market for consumer embedded devices such as cell phones, GPS and portable multimedia systems. In embedded systems, digital, analog and software components are combined on a single chip, resulting in increasingly complex designs that introduce richer functionality on smaller devices. As a consequence, the potential insertion of errors into a design becomes higher, yielding an increasing need for automated analog and mixed-signal validation tools. In the purely digital setting, formal verification based on properties expressed in industrial specification languages such as PSL and SVA is nowadays successfully integrated in the design flow. On the other hand, the validation of analog and mixed-signal systems still largely depends on simulation-based, ad-hoc methods. In this tutorial, we consider some ingredients of the standard verification methodology that can be successfully exported from digital to analog and mixed-signal setting, in particular property-based monitoring techniques. Property-based monitoring is a lighter approach to the formal verification, where the system is seen as a "black-box" that generates sets of traces, whose correctness is checked against a property, that is its high-level specification. Although incomplete, monitoring is effectively used to catch faults in systems, without guaranteeing their full correctness.

Live Load Response of Short Span Bridges with Parallam(R) Decks

DOT National Transportation Integrated Search

2007-01-01

Structural Composite Lumber (SCL) is reconstituted with high grade presorted veneers to enhance properties including higher and more uniform strength and stiffness than conventional lumber. Parallel Strand Lumber (PSL) is mainly constituted of wood s...

Mechanics governs single-cell signaling and multi-cell robustness in biofilm infections

NASA Astrophysics Data System (ADS)

Gordon, Vernita

In biofilms, bacteria and other microbes are embedded in extracellular polymers (EPS). Multiple types of EPS can be produced by a single bacterial strain - the reasons for this redundancy are not well-understood. Our work suggests that different polymers may confer distinct mechanical benefits. Our model organism is Pseudomonas aeruginosa, an opportunistic human pathogen that forms chronic biofilm infections associated with increased antibiotic resistance and evasion of the immune defense. Biofilms initiate when bacteria attach to a surface, sense the surface, and change their gene expression. Changes in gene expression are regulated by a chemical signal, cyclic-di-GMP. We find that one EPS material, called ``PEL,'' enhances surface sensing by increasing mechanical coupling of single bacteria to the surface. Measurements of bacterial motility suggest that PEL may increase frictional interactions between the surface and the bacteria. Consistent with this, we show that bacteria increase cyclic-di-GMP signaling in response to mechanical shear stress. Mechanosensing has long been known to be important to the function of cells in higher eukaryotes, but this is one of only a handful of studies showing that bacteria can sense and respond to mechanical forces. For the mature biofilm, the embedding polymer matrix can protect bacteria both chemically and mechanically. P. aeruginosa infections in the cystic fibrosis (CF) lung often last for decades, ample time for the infecting strain(s) to evolve. Production of another EPS material, alginate, is well-known to tend to increase over time in CF infections. Alginate chemically protects biofilms, but also makes them softer and weaker. Recently, it is being increasingly recognized that bacteria in chronic CF infections also evolve to increase PSL production. We use oscillatory bulk rheology to determine the unique contributions of EPS materials to biofilm mechanics. Unlike alginate, increased PSL stiffens biofilms. Increasing both PSL and alginate expression increases the energy cost to break the biofilm. We compare the elastic moduli of biofilms to estimated stresses exerted by phagocytotic immune cells, and infer that increased PSL could confer a mechanical fitness benefit. This work was supported by start-up funds from The University of Texas at Austin and a gift from ExxonMobile to VDG, and by Grants from the Human Frontiers Science Program (HFSP RGY0081/2012-GORDON) and the National Science Foundation (NSF 1337670).

Analysis of Helicopter Mishaps at Heliports, Airports and Unimproved Sites

DTIC Science & Technology

1991-01-01

Distance ___________ NM A Bearno a_________ ,.~ 400’n 4 Airport Category 5 Airport Certificatton (FAR M39 6 Emergency Plan Tested 7 Months Since...Emergency Plan Tested 1 0 Commerciai service ,0C Ful certrt,catio, 0 ye- 2 0 Reliever 2 [C Limireo certificatior I C 3 0 Ge’e-rai aviation None, Go to block...Aeriai application 8 1Public use 3, instructional (Incluaing air carrer training) 6 -IAerial observation 9 1Ferry A Soecit First PMot Information 87

Phase Diagram of Planar Matrix Quantum Mechanics, Tensor, and Sachdev-Ye-Kitaev Models.

PubMed

Azeyanagi, Tatsuo; Ferrari, Frank; Massolo, Fidel I Schaposnik

2018-02-09

We study the Schwinger-Dyson equations of a fermionic planar matrix quantum mechanics [or tensor and Sachdev-Ye-Kitaev (SYK) models] at leading melonic order. We find two solutions describing a high entropy, SYK black-hole-like phase and a low entropy one with trivial IR behavior. There is a line of first order phase transitions that terminates at a new critical point. Critical exponents are nonmean field and differ on the two sides of the transition. Interesting phenomena are also found in unstable and stable bosonic models, including Kazakov critical points and inconsistency of SYK-like solutions of the IR limit.

A description of a system of programs for mathematically processing on unified series (YeS) computers photographic images of the Earth taken from spacecraft

NASA Technical Reports Server (NTRS)

Zolotukhin, V. G.; Kolosov, B. I.; Usikov, D. A.; Borisenko, V. I.; Mosin, S. T.; Gorokhov, V. N.

1980-01-01

A description of a batch of programs for the YeS-1040 computer combined into an automated system for processing photo (and video) images of the Earth's surface, taken from spacecraft, is presented. Individual programs with the detailed discussion of the algorithmic and programmatic facilities needed by the user are presented. The basic principles for assembling the system, and the control programs are included. The exchange format within whose framework the cataloging of any programs recommended for the system of processing will be activated in the future is displayed.

Identifying asteroid families >2 Gyrs-old

NASA Astrophysics Data System (ADS)

Bolin, Bryce T.; Morbidelli, Alessandro; Delbo, Marco; Walsh, Kevin J.

2017-10-01

There are only a few known Main Belt (MB) asteroid families with ages >2 Gyr. The lack of ancient families may be due to a bias in current techniques used to identify families. Ancient asteroid family fragments disperse in their orbital elements (a,e,i), due to secular resonances and the Yarkovsky effect (YE) making them difficult to identify. We have developed a new technique that is insensitive to the resonant spreading of fragments in e and i by searching for V-shaped correlations between family members in a vs 1/Diameter space. Our V-shape technique is demonstrated on known families and used to discover a 4 Gyr-old family linking most dark asteroids in the inner MB previously not included in any known family. In addition, the 4 Gyr-old family reveals asteroids with D >35 km that are do not belong to any asteroid family implying that they originally accreted from the protoplanetary disk.The V-shape detection tool is also a powerful analysis tool by finding the boundary of an asteroid family and fitting for its shape. Following the proposed relationship between thermal inertia (TI) with D, we find that asteroids YE drift rate might have a more complex size dependence than previous thought, leading to a curved family boundary in a vs 1/D space. The V-shape tool is capable of detecting this on synthetic families and was deployed on >30 families located throughout the MB to find this effect and quantify the YE size-dependent drift rate. We find that there is no correlation between family age and V-shape curvature. In addition, the V-shape curvature decreases for asteroid families with larger a suggesting that the relationship between TI and D is weaker in the outer MB.By examining families <20 Myrs-old, we can use this tool to separate family shape that is due to the initial ejection velocity and that which is due to the YE drift rate. V-shapes which do not contain any spreading due to YE preserve their initial ejection velocity. We constrain the initial initial velocity of young families by measuring the curvature of their fragments' V-shape in a vs 1/D space. We find that the majority of <20 Myr-old asteroid families have initial velocity fields scaling with 1/D supporting impact experiments.

Serial Testing of Postural Control After Acute Lateral Ankle Sprain

PubMed Central

Buckley, W. E.; Denegar, Craig R.

2001-01-01

Objective: To identify subjects' changes in postural control during single-leg stance in the 4 weeks after acute lateral ankle sprain. Design and Setting: We used a 2 × 2 × 3 (side-by-plane-by-session) within-subjects design with repeated measures on all 3 factors. All tests were performed in a university laboratory. Subjects: Seventeen young adults (9 men, 8 women; age, 21.8 ± 5.9 years; mass, 74.9 ± 10.5 kg; height, 176.9 ± 7.1 cm) who had sustained unilateral acute mild or moderate lateral ankle sprains. Measurements: Measures of center-of-pressure excursion length, root mean square velocity of center-of-pressure excursions (VEL), and range of center-of-pressure excursions (RANGE) were calculated separately in the frontal and sagittal planes during 5-second trials of static single-leg stance. Results: We noted significant side-by-plane-by-session interactions for magnitude of center-of-pressure excursions in a given trial (PSL) (P = .004), VEL (P = .011), and RANGE (P = .009). Both PSL and VEL in the frontal plane were greater in the injured limbs compared with the uninjured limbs on day 1 and during week 2 but not during week 4, whereas sagittal-plane differences existed during all 3 testing sessions. Injured-limb, frontal-plane RANGE scores were greater than uninjured values at day 1 but not during weeks 2 or 4. No significant differences in sagittal-plane RANGE scores were seen. Conclusions: Postural control was significantly impaired in the injured limbs at day 1 and during week 2 after lateral ankle sprain but not during week 4. Consistent improvement in postural control measures on both injured and uninjured limbs was seen throughout the 4 weeks after ankle sprain. PMID:12937477

Atomic Layer Deposition of Al2O3 on GaSb Using In Situ Hydrogen Plasma Exposure

DTIC Science & Technology

2012-12-03

Krishna, and A. Javey, Nano Lett. 12, 3592 (2012). 7A. Ali, H. Madan , A. Agrawal, I. Ramirez, R. Misra, J. B. Boos, B. R. Bennett, J. Lindemuth, and S...Trans. Electron Devices 58, 3407 (2011). 9M. Xu, R. S. Wang, and P. D. Ye, IEEE Electron Device Lett. 32, 883 (2011). 10A. Ali, H. S. Madan , A. P. Kirk

JPRS Report, Soviet Union, Political Affairs

DTIC Science & Technology

1989-05-18

crops and grapes which go from production plan was less than half fulfilled, said Viktor here to the city market . This brings the farm a good deal...hurriedly describing the advan- that go back to the days of communal existence- tages of the market from the point of view of effective - traditions of...Ye. Dodolev; MOSKOVSKA YA PRA VDA, 31 Dec 88; 3, 4 Jan 89] ......................................................... 59 Evaluating Effectiveness of

JPRS Report, Science & Technology USSR: Lift Sciences

DTIC Science & Technology

1987-07-17

Viral Diseases and Productivity (A.D. Bobyr, A.A. Barkalova; MIKROBIOLOGICHESKIY ZHURNAL, No 5, Sep-Oct 86) 3 Culture Age as Factor in...Proteinase Production by Bacillus Subtilis (V.V. Artemov, Ye.L. Barskiy, et al.; BIOKHIMIYA, No 5, May 86).. 14 Inhibition of Glutamate Synthetase...I KLETKA, No 4, Jul-Aug 86) 27 Production of Recipient Yeasts for Stable Reproduction of Vectors Involving 2 Micron DNA (O.V. Nevzglyadova, A.G

Self-Consistent Frequency Sweeping of TAE mode

NASA Astrophysics Data System (ADS)

Wang, Ge

2012-03-01

We have extended our intuitive Toroidal Alfven Wave (TAE) model [1] for describing spontaneous frequency sweeping by a destabilizing component of energetic particles. Now a fully developed self-consistent description for frequency sweeping of an isolated TAE mode has been developed. As in [1], we use the Rosenbluth, Berk,Van Dam tip theory [2], valid for low beta, large aspect ratio, circular tokamaks, to describe the evolution of the TAE wave equation. The wave is coupled to the particle dynamics that uses the Berk, Breizman, Ye map model [3] to construct the particle/wave Lagrangian associated with a phase space dependent mode structure. Then together with the appropriate Vlasov equation for describing the particle dynamics, a set of equations determining the dynamics of the system has been formulated. Adiabatic solutions have been obtained and work is underway in simulating the exact nonlinear dynamics. A status report of our results will be given at the meeting. [4pt] [1] G. Wang and H. L. Berk, Communication in Nonlinear Science and Numerical Simulation 17, 2179 (2012) [0pt] [2] M. N. Rosenbluth,; H. L. Berk, J. Van Dam and D. M. Lingberg, Phys. Rev. Lett. 68, 596 (1992). [0pt] [3] Berk, H.L.; Breizman, B.N.; Ye, H. In: Physics of Fluids B 51993, 1506 (1993)

Does perioperative high-dose prednisolone have clinical benefits for generalized myasthenia gravis?

PubMed

Sekine, Yasuo; Kawaguchi, Naoki; Hamada, Chikuma; Sekiguchi, Hiromi; Yasufuku, Kazuhiro; Iyoda, Akira; Shibuya, Kiyoshi; Fujisawa, Takehiko

2006-06-01

The purpose of this study was to clarify the clinical benefits of perioperative administration of high-dose prednisolone (PSL) combined with extended thymectomy on the long-term outcomes of 116 consecutive patients with generalized myasthenia gravis (MG). A retrospective review was conducted on 116 patients diagnosed with generalized MG who received alternate-day oral administration of high-dose PSL (100 mg/alternate days) and had undergone transsternal extended thymectomy. Incidences of postoperative myasthenic crisis, adverse effects of steroid, long-term outcomes, such as complete stable remission (CSR), pharmacologic remission (PR) or improvement (Imp), and disease recurrence after CSR were evaluated. Six patients (5.2%) experienced post-thymectomy myasthenic crisis. Crude cumulative CSR and PR + CSR rates were 44.8 and 62.7%, respectively. Life table analysis showed that 41.8, 52.8 and 63.4% of the patients were in CSR at 3, 5 and 10 years, respectively. Multivariate analysis revealed that age and pretreatment classification according to the Myasthenia Gravis Foundation of America (MGFA) criteria tended to be independent predictors of CSR. There were 6.9% with compressive vertebral fracture, 13.8% with cataract, and 5.2% with steroid-induced diabetes. Life table analysis revealed that recurrence rates after CSR were 36.8 and 46.0% at 3 and 5 years, respectively. Patients with thymoma had a significantly higher rate of recurrence than those without thymoma (p = 0.001). Alternate-day administration of high-dose prednisolone reduced the risk of post-thymectomy myasthenic crisis. Presence of thymoma was a risk factor for MG recurrence after CSR.

Ice Crystal Cloud Research

NASA Image and Video Library

2016-07-11

NASA Glenn’s Propulsion Systems Lab (PSL) is conducting research to characterize ice crystal clouds that can create a hazard to aircraft engines under certain conditions. The isokinetic probe (in gold) samples particles and another series of probes can measure everything from humidity to air pressure.

Inflow-weighted pulmonary perfusion: comparison between dynamic contrast-enhanced MRI versus perfusion scintigraphy in complex pulmonary circulation

PubMed Central

2013-01-01

Background Due to the different properties of the contrast agents, the lung perfusion maps as measured by 99mTc-labeled macroaggregated albumin perfusion scintigraphy (PS) are not uncommonly discrepant from those measured by dynamic contrast-enhanced MRI (DCE-MRI) using indicator-dilution analysis in complex pulmonary circulation. Since PS offers the pre-capillary perfusion of the first-pass transit, we hypothesized that an inflow-weighted perfusion model of DCE-MRI could simulate the result by PS. Methods 22 patients underwent DCE-MRI at 1.5T and also PS. Relative perfusion contributed by the left lung was calculated by PS (PSL%), by DCE-MRI using conventional indicator dilution theory for pulmonary blood volume (PBVL%) and pulmonary blood flow (PBFL%) and using our proposed inflow-weighted pulmonary blood volume (PBViwL%). For PBViwL%, the optimal upper bound of the inflow-weighted integration range was determined by correlation coefficient analysis. Results The time-to-peak of the normal lung parenchyma was the optimal upper bound in the inflow-weighted perfusion model. Using PSL% as a reference, PBVL% showed error of 49.24% to −40.37% (intraclass correlation coefficient RI = 0.55) and PBFL% had error of 34.87% to −27.76% (RI = 0.80). With the inflow-weighted model, PBViwL% had much less error of 12.28% to −11.20% (RI = 0.98) from PSL%. Conclusions The inflow-weighted DCE-MRI provides relative perfusion maps similar to that by PS. The discrepancy between conventional indicator-dilution and inflow-weighted analysis represents a mixed-flow component in which pathological flow such as shunting or collaterals might have participated. PMID:23448679

Inflow-weighted pulmonary perfusion: comparison between dynamic contrast-enhanced MRI versus perfusion scintigraphy in complex pulmonary circulation.

PubMed

Lin, Yi-Ru; Tsai, Shang-Yueh; Huang, Teng-Yi; Chung, Hsiao-Wen; Huang, Yi-Luan; Wu, Fu-Zong; Lin, Chu-Chuan; Peng, Nan-Jing; Wu, Ming-Ting

2013-02-28

Due to the different properties of the contrast agents, the lung perfusion maps as measured by 99mTc-labeled macroaggregated albumin perfusion scintigraphy (PS) are not uncommonly discrepant from those measured by dynamic contrast-enhanced MRI (DCE-MRI) using indicator-dilution analysis in complex pulmonary circulation. Since PS offers the pre-capillary perfusion of the first-pass transit, we hypothesized that an inflow-weighted perfusion model of DCE-MRI could simulate the result by PS. 22 patients underwent DCE-MRI at 1.5T and also PS. Relative perfusion contributed by the left lung was calculated by PS (PS(L%)), by DCE-MRI using conventional indicator dilution theory for pulmonary blood volume (PBV(L%)) and pulmonary blood flow (PBFL%) and using our proposed inflow-weighted pulmonary blood volume (PBV(iw)(L%)). For PBViw(L%), the optimal upper bound of the inflow-weighted integration range was determined by correlation coefficient analysis. The time-to-peak of the normal lung parenchyma was the optimal upper bound in the inflow-weighted perfusion model. Using PSL% as a reference, PBV(L%) showed error of 49.24% to -40.37% (intraclass correlation coefficient R(I) = 0.55) and PBF(L%) had error of 34.87% to -27.76% (R(I) = 0.80). With the inflow-weighted model, PBV(iw)(L%) had much less error of 12.28% to -11.20% (R(I) = 0.98) from PS(L%). The inflow-weighted DCE-MRI provides relative perfusion maps similar to that by PS. The discrepancy between conventional indicator-dilution and inflow-weighted analysis represents a mixed-flow component in which pathological flow such as shunting or collaterals might have participated.

Advanced Optical Diagnostics for Ice Crystal Cloud Measurements in the NASA Glenn Propulsion Systems Laboratory

NASA Technical Reports Server (NTRS)

Bencic, Timothy J.; Fagan, Amy; Van Zante, Judith F.; Kirkegaard, Jonathan P.; Rohler, David P.; Maniyedath, Arjun; Izen, Steven H.

2013-01-01

A light extinction tomography technique has been developed to monitor ice water clouds upstream of a direct connected engine in the Propulsion Systems Laboratory (PSL) at NASA Glenn Research Center (GRC). The system consists of 60 laser diodes with sheet generating optics and 120 detectors mounted around a 36-inch diameter ring. The sources are pulsed sequentially while the detectors acquire line-of-sight extinction data for each laser pulse. Using computed tomography algorithms, the extinction data are analyzed to produce a plot of the relative water content in the measurement plane. To target the low-spatial-frequency nature of ice water clouds, unique tomography algorithms were developed using filtered back-projection methods and direct inversion methods that use Gaussian basis functions. With the availability of a priori knowledge of the mean droplet size and the total water content at some point in the measurement plane, the tomography system can provide near real-time in-situ quantitative full-field total water content data at a measurement plane approximately 5 feet upstream of the engine inlet. Results from ice crystal clouds in the PSL are presented. In addition to the optical tomography technique, laser sheet imaging has also been applied in the PSL to provide planar ice cloud uniformity and relative water content data during facility calibration before the tomography system was available and also as validation data for the tomography system. A comparison between the laser sheet system and light extinction tomography resulting data are also presented. Very good agreement of imaged intensity and water content is demonstrated for both techniques. Also, comparative studies between the two techniques show excellent agreement in calculation of bulk total water content averaged over the center of the pipe.

[Directions for use of corticosteroids and calcineurin inhibitors against generalized myasthenia gravis: therapeutic strategies that can lead to early improvements and veer away from high-dose oral corticosteroids].

PubMed

Utsugisawa, Kimiaki; Nagane, Yuriko; Suzuki, Shigeaki; Suzuki, Norihiro

2012-01-01

The advent of effective immune treatment has meant that myasthenia gravis (MG) is most often not lethal. However, many MG patients still find it difficult to maintain daily activities due to chronic residual fatigability and long-term side effects of medication, since full remission without immune treatment is not common. Our analysis demonstrated that disease severity, dose of oral corticosteroids, and depressive state are the major independent factors negatively associated with self-reported QOL (MG-QOL15-J score). It is noteworthy that oral corticosteroid, the first-line agent for MG, is negatively associated with patients' QOL. When the analysis took into account MGFA postintervention status and dose of oral prednisolne (PSL), the MG-QOL15-J score of MM status patients taking ≤ 5 mg PSL per day is identically low (i.e., just as good QOL) as that seen in CSR and is a target of treatment. In order to veer away from high-dose oral corticosteroids and to achieve early MM or better status with PSL ≤ 5 mg/day, we advocate the early aggressive treatment strategy that can achieve early improvement by performing an aggressive therapy using combined treatment with plasmapheresis and high-dose intravenous methylprednisolone and then maintain an improved clinical status using low-dose oral corticosteroids and calcineurin inhibitors (cyclosporine microemulsion and tacrolimus). The early stages of MG are susceptible to treatment with calcineurin inhibitors. When using cyclosporine microemulsion for MG, blood concentrations 2 h after administration (C2) correlate with clinical improvement and immediately before administration (C0) with side effects (increased serum creatinine and/or hypertension). Monitoring of C2 and C0 levels is useful to estimate efficacy and safety of the drug.

Studies on the quantitative autoradiography. III. Quantitative comparison of a novel tissue-mold measurement technique "paste-mold method," to the semiquantitative whole body autoradiography (WBA), using the same animals.

PubMed

Motoji, N; Hamai, Y; Niikura, Y; Shigematsu, A

1995-01-01

A novel preparation technique, so called "Paste Mold," was devised for organ and tissue distribution studies. This is the most powerful by joining with autoradioluminography (ARLG), which was established and validated recently in the working group of Forum '93 of Japanese Society for study of xenobiotics. A small piece (10-50 mg) of each organ or tissue was available for measuring its radioactive concentration and it was sampled from the remains of frozen carcass used for macroautoradiography (MARG). The solubilization of the frozen pieces was performed with mixing a suitable volume of gelatine and strong alkaline solution prior to mild heating kept at 40 degrees C for a few hours. After that, the tissue paste was molded in template pattern to form the small plates. The molded plates were contacted with Imaging plate (IP) for recording their radioactive concentration. The recorded IP was processed by BAS2000. The molded plate was formed in thickness of 200 microns, so called infinit thickness against soft beta rays, and therefore the resulting relative intensities, represented by (PSL-BG)/S values, indicated practically responsible ratio of the radioactive concentration in organs and tissues, without any calibulation for beta-self absorption coefficiency. On the other hand, the left half body of the frozen carcass was used for making whole body autoradiography (WBA) before the Paste-Mold preparation. Comparison was performed for difference in (PSL-BG)/S values of organs and tissues between frozen and dried sections. A good concordance in relative intensities, (PSL-BG)/S by the Paste-Mold preparation was given with those by the frozen sections rather than dried sections.(ABSTRACT TRUNCATED AT 250 WORDS)

Neutrino Astrophysics in Slowly Rotating Spacetimes Permeated by Nonlinear Electrodynamics Fields

NASA Astrophysics Data System (ADS)

Mosquera Cuesta, Herman J.

2017-02-01

Many theoretical and astrophysical arguments involve consideration of the effects of super strong electromagnetic fields and the rotation during the late stages of core-collapse supernovae. In what follows, we solve Einstein field equations that are minimally coupled to an arbitrary (current-free) Born-Infeld nonlinear Lagrangian L(F,G) of electrodynamics (NLED) in the slow rotation regime a ≪ r+ (outer horizon size), up to first order in a/r. We cross-check the physical properties of such NLED spacetime w.r.t. against the Maxwell one. A study case on both neutrino flavor ({ν }e\\to {ν }μ ,{ν }τ ) oscillations and flavor+helicity (spin) flip ({ν }e\\to {\\overline{ν }}μ ,τ ) gyroscopic precession proves that in the spacetime of a slowly rotating nonlinear charged black hole (RNCBH), the neutrino dynamics translates into a positive enhancement of the r-process (reduction of the electron fraction Ye < 0.5). Consequently, it guarantees successful hyperluminous core-collapse supernova explosions due to the enlargement of the number and amount of decaying nuclide species. This posits that, as far as the whole luminosity is concerned, hypernovae will be a proof of the formation of astrophysical RNCBH.

Reliable screening of various foodstuffs with respect to their irradiation status: A comparative study of different analytical techniques

NASA Astrophysics Data System (ADS)

Ahn, Jae-Jun; Akram, Kashif; Kwak, Ji-Young; Jeong, Mi-Seon; Kwon, Joong-Ho

2013-10-01

Cost-effective and time-efficient analytical techniques are required to screen large food lots in accordance to their irradiation status. Gamma-irradiated (0-10 kGy) cinnamon, red pepper, black pepper, and fresh paprika were investigated using photostimulated luminescence (PSL), direct epifluorescent filter technique/the aerobic plate count (DEFT/APC), and electronic-nose (e-nose) analyses. The screening results were also confirmed with thermoluminescence analysis. PSL analysis discriminated between irradiated (positive, >5000 PCs) and non-irradiated (negative, <700 PCs) cinnamon and red peppers. Black pepper had intermediate results (700-5000 PCs), while paprika had low sensitivity (negative results) upon irradiation. The DEFT/APC technique also showed clear screening results through the changes in microbial profiles, where the best results were found in paprika, followed by red pepper and cinnamon. E-nose analysis showed a dose-dependent discrimination in volatile profiles upon irradiation through principal component analysis. These methods can be used considering their potential applications for the screening analysis of irradiated foods.

Influence of Tl+ activator ions on the luminescence characteristics of KCl0.5Br0.5:Eu2+ powder phosphors.

PubMed

Nagarajan, S; Sudarkodi, R

2009-01-01

Photoluminescence (PL) of thallium co-doped with KCl0.5Br0.5:Eu2+ powder phosphors display emission bands at 320 and 370 nm attributable to centres involving Tl+ ions in addition to characteristic Eu2+ emission around 420 nm. Additional PL excitation and emission bandS observed around 260 and 380 nm, respectively, were observed in the double-doped KCl0.5Br0.5:Eu2+, Tl+ powder phosphors and are attributed to complex centres involving Tl+ and Eu2+ ions. The enhancement observed in the intensity of Eu2+ emission around 420 nm with the addition of TlBr in KCl0.5Br0.5:Eu2+ powder phosphors is attributed to the energy transfer from Tl+ --> Eu2+ ions. Photostimulated luminescence (PSL) studies of gamma-irradiated KCl0.5Br0.5:Eu2+, Tl+ mixed phosphors are reported and a tentative PSL mechanism in the phosphors has been suggested.

Identification of low amount of irradiated spices (red pepper, garlic, ginger powder) with luminescence analysis

NASA Astrophysics Data System (ADS)

Kim, Byeong-Keun; Akram, Kashif; Kim, Cheong-Tae; Kang, Na-Roo; Lee, Jin-Won; Ryang, Jun-Hwan; Kwon, Joong-Ho

2012-08-01

For the identification of irradiated food, current analysis methods have limitations regarding presence and stability of radiation-induced markers. In this study, different spice blends with small quantity of different irradiated (0, 1 and 10 kGy) spice powders, such as red pepper, garlic or ginger, were investigated using PSL and TL techniques. In PSL-based screening analysis, the spice blends containing 10% of irradiated materials (1 or 10 kGy) were determined as intermediate or positive. In TL results, the blends containing 1% of 1 or 10 kGy-irradiated spices showed the typical TL glow curves that could be interpreted as positive. The blends with irradiated garlic powder provided more good results where identification was possible at 0.5% mixing of irradiated sample. However, the TL ratios of all spice blends were <0.1 and only TL glow curve shape and intensity may be used to discriminate the samples having irradiated component.

Hear ye? Hear ye! Successful auditory aging.

PubMed Central

Gates, G A; Rees, T S

1997-01-01

Age-related hearing loss (presbycusis) is a multifactorial process that affects nearly all people in their senior years. Most cases are due to a loss of cochlear hair cell function and are well mediated by communication courtesy and modern amplification technology. Severe hearing loss is generally due to cochlear problems or age-related diseases and may require speech reading, assistive listening devices, and cochlear implants, depending on the degree of loss. Presbycusis may seriously impair communication and contribute to isolation, depression, and possibly dementia. Accurate diagnosis and prompt remediation are widely available but are frequently underused. Geriatric health care and well-being is enhanced by the detection and remediation of communication disorders. PMID:9348755

Thermal Design of Boiler Unit (Standard Method).

DTIC Science & Technology

1980-04-29

T-0411-80" h EhlllllEI mhEhhhhh m~lEElhElllllE Elhllllllhllll llllllllmllllu llllllllhllllu "’FTD-ID(RS)T-0411-80 FOREIGN TECHNOLOGY DIVISION THERMAL...Block italic Transliter. - - A a A, a P p p p R, r S B, b C C S B V, v T m , t r g Y y SD, d SE a Ye, ye; E, e* x X x Kh, , W Zc h , z h L 4 Ti , L...sh sn arc_4n 6 ch cosh arc or -. tar. th tanh arc t- Scot zth cct arc c’- h sec Sch sech arc sc- . - o-ec csc cscn cs ch aronc sc Russian Er.I n h rot

Design of Steel Structures to Resist the Effects of HE Explosions

DTIC Science & Technology

1975-08-01

n-;)L]- )AbFdcosY SCOMSINIED MECHANISMm C , , (2n- w Mp t4 CM5 , ngM w Number )ff oAh~d M boys -- ,2, 3.. /,,’ b~dy ---1~ bF~ w zUniform bbd T/d SL L_...mink’ccli Hs F d 1)Vnamlc yield, ,v: sili-dr s~zcss (psL) F d Dynanic v t’ I’! rr (psi) F’ J Kuler buckling: %tr.’srns t2. td ’ v s.iS&’tv Iacto’r I(p>-’, F1

Multifunctional Poly(2,5-benzimidazole)/Carbon Nanotube Composite Films

DTIC Science & Technology

2010-01-01

Multifunctional Poly(2,5- benzimidazole )/Carbon Nanotube Composite Films JI-YE KANG,1 SOO-MI EO,1 IN-YUP JEON,1 YEONG SUK CHOI,2 LOON-SENG TAN,3 JONG...molecular-weight poly(2,5- benzimidazole ) (ABPBI). ABPBI/carbon nanotube (CNT) compo- sites were prepared via in situ polymerization of the AB-monomer in the...polymerization; multiwalled carbon nanotube (MWCNT); nano- composites; poly(2,5- benzimidazole ); (ABPBI); polycondensa- tion; poly(phosphoric acid); single-walled

Bibliography of Soviet Laser Developments, Number 62, November-December 1982.

DTIC Science & Technology

1983-10-30

A V ill UBOV V S 26 VODOVATOV I A 76 TITOV YE A 34,96 USOVA N A 1 VOZOT B 16 TRAL’ V A 113 USTINOY N D 12,59 VOLCHENOK V 1 17 TODUA...of single pulse lasing. ZhPS, v . 37, no. 5, 1982, 741-748. 3. Zaskal’ko, O.P., and l.G. Rudoy (1). Giant pulse lasing without a resonator. ZhETF P, v ...2534. b. Er 3+ 8. Kaminskiy, A.A. (13).- Staged lasing from Er3 ions in YAlO 3crytal a4 4 1 IV 4 4a 3/2--:--3/2 ’~ A +111/2-1-

Comparative pharmacokinetics of swertiamarin in rats after oral administration of swertiamarin alone, Qing Ye Dan tablets and co-administration of swertiamarin and oleanolic acid.

PubMed

Xu, Gui-li; Li, Hong-liang; He, Jian-chang; Feng, En-fu; Shi, Pan-pan; Liu, Yue-qiong; Liu, Chang-xiao

2013-08-26

Qing Ye Dan is a well-known herbal drug that is widely used to treat viral hepatitis in the Yi and Hani minority regions in the Yunnan province of China. An LC-MS/MS method was developed to determine the levels of swertiamarin in rat plasma. Swertiamarin and naringin (internal standard, IS) were extracted from rat plasma using solid-phase extraction (SPE) to purify the samples. The pharmacokinetics of the following different administration methods of swertiamarin in rats were studied: oral administration of swertiamarin alone, a Qing Ye Dan tablet (QYDT) and co-administration of swertiamarin and oleanolic acid, with each method delivering approximately 20mg/kg of swertiamarin. Non-compartmental pharmacokinetic profiles were constructed by using the software DAS (version 2.1.1), and the pharmacokinetic parameters were compared using an unpaired Student's t-test. The results showed that the pharmacokinetic parameters Cmax, AUC0-∞, Vz/F and CLz/F were significantly different (P<0.05) among the three types of swertiamarin administration. The data indicate that oleanolic acid and the other ingredients present in QYDT could affect the pharmacokinetic behaviour of swertiamarin in rats. Copyright © 2013 Elsevier Ireland Ltd. All rights reserved.

The Manu-Facturing of a Language.

ERIC Educational Resources Information Center

Washabaugh, William

1980-01-01

Discusses Providence Island Sign Language (PSL), an autochthonous and relatively immature language of about 20 speakers. It is a nascent and evolving language whose description can produce rich results for linguistic theory. Such a description will also be an explanation of the phylogeny of a linguistic system. (Author/PJM)

Molecular Approach to Hypothalamic Rhythms

DTIC Science & Technology

1998-06-24

PAGE • PuDiic reoorttnc DUTCH p gather.r.q ar.c n-untai ; COHeCtJO-■ -:r ;-v-rrr.^! ; Davis hiopwa.-, ioiie 1 ■ 1. AGENCY USE AFRL-SR-BL-TR...the same neurons? eharacter"ed „™ „eer ye3f1V 6d ,y the sl" P -^ueing lipid oleamide. He have precursor exeinslvelv H = ’", "^ "W"«1...mapped the anatomical distribution of the degradative enzyme for oleamide within the brain. To identify neuronal populations activated in vivo by 3

Advanced Imaging Tracker

DTIC Science & Technology

1982-06-01

3oijsteii 14.) v ilson f3 1vj Ar inj~on, VA Ž222JY L. or p AtLnZ: -,iii~iarn Ouriey I d.LU ýu ndoldt i~d txlJlýjLuqucqe, 14,, f. /A i’ Atun : ý...34ivision iY) LiOX d /M ye I v - iv i S i 01-1 I ,/L i r ic u .L Lbr~ J o-r y At~rlt -lex earker 1.i nj .on, A½iI r -I efnLi.) DL-4 NAS’A Aines Atun

Elicitor-induced transcription factors for metabolic reprogramming of secondary metabolism in Medicago truncatula

PubMed Central

Naoumkina, Marina A; He, XianZhi; Dixon, Richard A

2008-01-01

Background Exposure of Medicago truncatula cell suspension cultures to pathogen or wound signals leads to accumulation of various classes of flavonoid and/or triterpene defense molecules, orchestrated via a complex signalling network in which transcription factors (TFs) are essential components. Results In this study, we analyzed TFs responding to yeast elicitor (YE) or methyl jasmonate (MJ). From 502 differentially expressed TFs, WRKY and AP2/EREBP gene families were over-represented among YE-induced genes whereas Basic Helix-Loop-Helix (bHLH) family members were more over-represented among the MJ-induced genes. Jasmonate ZIM-domain (JAZ) transcriptional regulators were highly induced by MJ treatment. To investigate potential involvement of WRKY TFs in signalling, we expressed four Medicago WRKY genes in tobacco. Levels of soluble and wall bound phenolic compounds and lignin were increased in all cases. WRKY W109669 also induced tobacco endo-1,3-β-glucanase (NtPR2) and enhanced the systemic defense response to tobacco mosaic virus in transgenic tobacco plants. Conclusion These results confirm that Medicago WRKY TFs have broad roles in orchestrating metabolic responses to biotic stress, and that they also represent potentially valuable reagents for engineering metabolic changes that impact pathogen resistance. PMID:19102779

Extremely high sulfate reduction, sediment oxygen demand and benthic nutrient flux associated with a large-scale artificial dyke and its implication to benthic-pelagic coupling in the Yeongsan River estuary, Yellow Sea.

PubMed

Kim, Sung-Han; Lee, Jae Seong; Hyun, Jung-Ho

2017-07-15

We investigated environmental impact of large-scale dyke on the sediment geochemistry, sulfate reduction rates (SRRs), sediment oxygen demand (SOD) and potential contribution of benthic nutrient flux (BNF) to primary production in the Yeongsan River estuary, Yellow Sea. The sediment near the dyke (YE1) with high organic carbon (C org ) content (>4%, dry wt.) was characterized by extremely high SOD (327mmolm -2 d -1 ) and SRRs (91-140mmolm -2 d -1 ). The sulfate reduction accounted for 73% of C org oxidation, and was responsible for strikingly high concentrations of NH 4 + (7.7mM), PO 4 3- (67μM) and HS - (487μM) in pore water. The BNF at YE1 accounted for approximately 200% of N and P required for primary production in the water column. The results present one of the most extreme cases that the construction of an artificial dyke may have profound impacts on the biogeochemical and ecological processes in coastal ecosystems. Copyright © 2017 Elsevier Ltd. All rights reserved.

Composite Service Life Prediction via Fiber Bundle Testing. Evaluation of Testing Equipment and Data Acquisition System

DTIC Science & Technology

1986-12-01

PREDICTION VIA FIBER BUNDLE TESTING-EVALUATION OF TESTING EQUIPMENT JD DATA ACQUISITION SYSTEM PERSONAL AUTHOR(S) Petridis Dimitrios M. i *y?e o j report...experiencing a known number of filament failures per bundle. The results of this investigation are relevant to man-safe applications as in composite pressure...single filament r’iber testing and can become more 29 3> C o - Pwo PwS ?w4 Pw3 Pw2 Pwl PSD Ps5 PS4 Ps3 Ps2 PS! homoiogous correspondence t ~ to Life ( Laqt

Timber rivets in structural composite lumber

Treesearch

Ronald W. Wolfe; Marshall Begel; Bruce Craig

2004-01-01

Timber rivet connections, originally developed for use with glulam construction, may be a viable option for use with structural composite lumber (SCL) products. Tests were conducted on small samples to assess the performance and predictability of timber rivet connections in parallel strand lumber (PSL) and laminated strand lumber (LSL). The test joint configurations...

A Spectral Library of Emissivity Spectra for MERTIS on BepiColombo

NASA Astrophysics Data System (ADS)

Maturilli, A.; Helbert, J.; Varatharajan, I.; D'Amore, M.; Hiesinger, H.

2018-05-01

At PSL we measured emissivity spectra in vacuum for a suite of Mercury surface analogues for temperatures from 100°C to >400°C. The spectral library is completed by reflectance on samples fresh and post-heating (0.2 to 200 µm spectral range).

Propionic acid production from corn stover hydrolysate by Propionibacterium acidipropionici

DOE PAGES

Wang, Xiaoqing; Salvachua, Davinia; Sanchez i Nogue, Violeta; ...

2017-08-17

The production of value-added chemicals alongside biofuels from lignocellulosic hydrolysates is critical for developing economically viable biorefineries. Here, the production of propionic acid (PA), a potential building block for C3-based chemicals, from corn stover hydrolysate is investigated using the native PA-producing bacterium Propionibacterium acidipropionici. A wide range of culture conditions and process parameters were examined and experimentally optimized to maximize titer, rate, and yield of PA. The effect of gas sparging during fermentation was first examined, and N 2 was found to exhibit improved performance over CO 2. Subsequently, the effects of different hydrolysate concentrations, nitrogen sources, and neutralization agentsmore » were investigated. One of the best combinations found during batch experiments used yeast extract (YE) as the primary nitrogen source and NH 4OH for pH control. This combination enabled PA titers of 30.8 g/L with a productivity of 0.40 g/L h from 76.8 g/L biomass sugars, while successfully minimizing lactic acid production. Due to the economic significance of downstream separations, increasing titers using fed-batch fermentation was examined by changing both feeding media and strategy. Continuous feeding of hydrolysate was found to be superior to pulsed feeding and combined with high YE concentrations increased PA titers to 62.7 g/L and improved the simultaneous utilization of different biomass sugars. Additionally, applying high YE supplementation maintains the lactic acid concentration below 4 g/L for the duration of the fermentation. Finally, with the aim of increasing productivity, high cell density fed-batch fermentations were conducted. PA titers increased to 64.7 g/L with a productivity of 2.35 g/L h for the batch stage and 0.77 g/L h for the overall process. These results highlight the importance of media and fermentation strategy to improve PA production. Altogether, this work demonstrates the feasibility of producing PA from corn stover hydrolysate.« less

Propionic acid production from corn stover hydrolysate by Propionibacterium acidipropionici

DOE Office of Scientific and Technical Information (OSTI.GOV)

Wang, Xiaoqing; Salvachua, Davinia; Sanchez i Nogue, Violeta

The production of value-added chemicals alongside biofuels from lignocellulosic hydrolysates is critical for developing economically viable biorefineries. Here, the production of propionic acid (PA), a potential building block for C3-based chemicals, from corn stover hydrolysate is investigated using the native PA-producing bacterium Propionibacterium acidipropionici. A wide range of culture conditions and process parameters were examined and experimentally optimized to maximize titer, rate, and yield of PA. The effect of gas sparging during fermentation was first examined, and N 2 was found to exhibit improved performance over CO 2. Subsequently, the effects of different hydrolysate concentrations, nitrogen sources, and neutralization agentsmore » were investigated. One of the best combinations found during batch experiments used yeast extract (YE) as the primary nitrogen source and NH 4OH for pH control. This combination enabled PA titers of 30.8 g/L with a productivity of 0.40 g/L h from 76.8 g/L biomass sugars, while successfully minimizing lactic acid production. Due to the economic significance of downstream separations, increasing titers using fed-batch fermentation was examined by changing both feeding media and strategy. Continuous feeding of hydrolysate was found to be superior to pulsed feeding and combined with high YE concentrations increased PA titers to 62.7 g/L and improved the simultaneous utilization of different biomass sugars. Additionally, applying high YE supplementation maintains the lactic acid concentration below 4 g/L for the duration of the fermentation. Finally, with the aim of increasing productivity, high cell density fed-batch fermentations were conducted. PA titers increased to 64.7 g/L with a productivity of 2.35 g/L h for the batch stage and 0.77 g/L h for the overall process. These results highlight the importance of media and fermentation strategy to improve PA production. Altogether, this work demonstrates the feasibility of producing PA from corn stover hydrolysate.« less

A hybrid phase-space and histogram source model for GPU-based Monte Carlo radiotherapy dose calculation

NASA Astrophysics Data System (ADS)

Townson, Reid W.; Zavgorodni, Sergei

2014-12-01

In GPU-based Monte Carlo simulations for radiotherapy dose calculation, source modelling from a phase-space source can be an efficiency bottleneck. Previously, this has been addressed using phase-space-let (PSL) sources, which provided significant efficiency enhancement. We propose that additional speed-up can be achieved through the use of a hybrid primary photon point source model combined with a secondary PSL source. A novel phase-space derived and histogram-based implementation of this model has been integrated into gDPM v3.0. Additionally, a simple method for approximately deriving target photon source characteristics from a phase-space that does not contain inheritable particle history variables (LATCH) has been demonstrated to succeed in selecting over 99% of the true target photons with only ~0.3% contamination (for a Varian 21EX 18 MV machine). The hybrid source model was tested using an array of open fields for various Varian 21EX and TrueBeam energies, and all cases achieved greater than 97% chi-test agreement (the mean was 99%) above the 2% isodose with 1% / 1 mm criteria. The root mean square deviations (RMSDs) were less than 1%, with a mean of 0.5%, and the source generation time was 4-5 times faster. A seven-field intensity modulated radiation therapy patient treatment achieved 95% chi-test agreement above the 10% isodose with 1% / 1 mm criteria, 99.8% for 2% / 2 mm, a RMSD of 0.8%, and source generation speed-up factor of 2.5. Presented as part of the International Workshop on Monte Carlo Techniques in Medical Physics

Unsolved Problems in Evolutionary Theory

DTIC Science & Technology

1967-01-01

finding the probability of survival of a single new mutant). Most natural populations probably satisfy these conditions , as is illustrated by the...Ykl) of small quantities adding to zero. Then under suitable conditions on the function f(x), (3) xi + Yi,t+i = fi(x) + YE yjfi(tf) + O(y yt...It is clear that a sufficient condition for the point x to be locally stable is that all the roots of the matrix, (4) (a j) = ____ should have moduli

Excitatory Amino Acids as Transmitters in the Brain

DTIC Science & Technology

1989-04-30

Amino Acids as Transmitters in the Brain 12 PERSONAL AUTHOR(S) Cotman, C.W. 13a TYPE OF REPORT 1i3b TIME OYERED 14. DATE OF REPORT (Ye, Month, Day) 5s...necenearia i dentf by block number) FIEL.D GROUP SBGOP Excitatory receptors, excitatory amino acids , excitotoxicit N-methyl-D-aspartate, kainate...mediated by excitatory amino acids and their receptors. These receptors participate in both standard synaptic transmission as well as higher order

Bibliography of Soviet Laser Developments, Number 52, March - April 1981.

DTIC Science & Technology

1982-05-17

KNbOj crystal and pumped by the second harmonic of a YAG laser. KE, no. 4, 1981, 715-721. 187. Soldatov, A.N., V.B. Sukhanov , Yu.P. Polunin, and A.I...27.63SLOBODYANYUC A V 36 SUENDER D 96 TOLSTOY M N 7SNIRNOY A N 88 SUKHANOV V B 30 TOMCHUK YE YA 59SMIRNOY D F 37 SUI(HANOVA G3 B 15 TOHILINA V 1 60S?4IRNOV S

Description and texts for the auxiliary programs for processing video information on the YeS computer. Part 3: Test program 2

NASA Technical Reports Server (NTRS)

Borisenko, V. I., G.g.; Stetsenko, Z. A.

1980-01-01

The functions were discribed and the operating instructions, the block diagram and the proposed versions are given for modifying the program in order to obtain the statistical characteristics of multi-channel video information. The program implements certain man-machine methods for investigating video information. It permits representation of the material and its statistical characteristics in a form which is convenient for the user.

Identification of lactobacilli with inhibitory effect on biofilm formation by pathogenic bacteria on stainless steel surfaces.

PubMed

Ait Ouali, Fatma; Al Kassaa, Imad; Cudennec, Benoit; Abdallah, Marwan; Bendali, Farida; Sadoun, Djamila; Chihib, Nour-Eddine; Drider, Djamel

2014-11-17

Two hundred and thirty individual clones of microorganisms were recovered from milk tanks and milking machine surfaces at two distinct farms (Bejaja City, Algeria). Of these clones, 130 were identified as lactic acid bacteria (LAB). In addition Escherichia coli, Salmonella, Staphylococcus aureus and Pseudomonas aeruginosa species were identified in the remaining 100 isolates-spoilage isolate. These isolates were assayed for ability to form biofilms. S. aureus, Lactobacillus brevis strains LB1F2, LB14F1 and LB15F1, and Lactobacillus pentosus strains LB2F2 and LB3F2 were identified as the best biofilm formers. Besides, these LAB isolates were able to produce proteinaceous substances with antagonism against the aforementioned spoilage isolates, when grown in MRS or TSB-YE media. During the screening, L. pentosus LB3F2 exhibited the highest antibacterial activity when grown in TSB-YE medium at 30 °C. Additionally, L. pentosus LB3F2 was able to strongly hamper the adhesion of S. aureus SA3 on abiotic surfaces as polystyrene and stainless steel slides. LAB isolates did not show any hemolytic activity and all of them were sensitive to different families of antibiotic tested. It should be pointed out that LB3F2 isolate was not cytotoxic on the intestinal cells but could stimulate their metabolic activity. This report unveiled the potential of LB1F2, LB14F1, LB15F1, LB2F2, and LB3F2 isolates to be used as natural barrier or competitive exclusion organism in the food processing sector as well as a positive biofilm forming bacteria. Copyright © 2014 Elsevier B.V. All rights reserved.

Corrosion Control at Graphite/Epoxy-Aluminum and Titanium Interfaces

DTIC Science & Technology

1974-07-01

Exfoliation Salt Spray Showing Corrosion on Back Side of Bond Interface (2x) 18 19 20 23 24 27 31 31 32 32 33 33 34 35 ; vll...25 29 Vlll ’-■"■’"-’—’—’"■ •■■’■■: UtaMMUitaittikHMalMiiakii T= zsm ~ ■ - ■- • ’■ ■ -■■■ ■: ---"• SUMMARY Graphlte/epoxy...joint specimen. Cure M 35 psl and 3a0*F for GO minutes. Apply 0,2-0.4 ml ol BH127 adhesive primer to the bond intiiface areas. Bond 4 mil 1100

A Lesson in Vectors "Plain" and Simple

ERIC Educational Resources Information Center

Bradshaw, David M.

2004-01-01

The United States Military Academy (USMA) has a four course core mathematics curriculum that is studied by all students. The third course is MA205, Calculus II; a multivariate calculus course filled with practical applications. During a Problem Solving Lab (PSL), students participated in a hands-on exercise with multiple vector operations,…

A Biofilm Matrix-Associated Protease Inhibitor Protects Pseudomonas aeruginosa from Proteolytic Attack

PubMed Central

2018-01-01

ABSTRACT Pseudomonas aeruginosa produces an extracellular biofilm matrix that consists of nucleic acids, exopolysaccharides, lipid vesicles, and proteins. In general, the protein component of the biofilm matrix is poorly defined and understudied relative to the other major matrix constituents. While matrix proteins have been suggested to provide many functions to the biofilm, only proteins that play a structural role have been characterized thus far. Here we identify proteins enriched in the matrix of P. aeruginosa biofilms. We then focused on a candidate matrix protein, the serine protease inhibitor ecotin (PA2755). This protein is able to inhibit neutrophil elastase, a bactericidal enzyme produced by the host immune system during P. aeruginosa biofilm infections. We show that ecotin binds to the key biofilm matrix exopolysaccharide Psl and that it can inhibit neutrophil elastase when associated with Psl. Finally, we show that ecotin protects both planktonic and biofilm P. aeruginosa cells from neutrophil elastase-mediated killing. This may represent a novel mechanism of protection for biofilms to increase their tolerance against the innate immune response. PMID:29636440

Ionospheric Irregularities: Source, Structure, Plasma Processes and Effects on Sensor Systems

DTIC Science & Technology

1989-10-31

modified by using y - ye + w sin 0 sin 0 (20h) some of M orf et al.’s ideas. Fougere [1981] added a set of subroutines which find for each channel, the...correlation analysis has employed the modified Fedor algo- rithm (Fedor. 1967. CFB, this issue]. 3. ALGORITHM FOR THE SPECTRAL ANALYSIS The elements of the...knowledge, this paper presents with the every 240 m along the orbital track [Ifeelis et al., 1981]. Thus above data set the most detailed analysis of

Instructional Videos for Unsupervised Harvesting and Learning of Action Examples

DTIC Science & Technology

2014-11-03

collection of image or video anno - tations has been tackled in different ways, but most existing methods still require a human in the loop. The...the views of ARO and NSF. 7. REFERENCES [1] C.-C. Chang and C.- J . Lin. LIBSVM: A library for support vector machines. In ACM Transactions on...feature encoding methods. In BMVC, 2011. [3] J . Chen, Y. Cui, G. Ye, D. Liu, and S.-F. Chang. Event-driven semantic concept discovery by exploiting

Chemical Reactions at the Au/InP Interface.

DTIC Science & Technology

1986-10-15

Chye , et al., 6 using various forms of photoemission spectroscopy and ion-depth profiling techniques, found that extremely thin Au films 3 interacted...Appl. Phys. 50, 1445 (1979). 6) P.W. ChYe , I. Lindau, P. Pianetta, Ci’!. Garner, C.Y. Su and W.E. Spicer, Physical Review B, 19, 5545 (1978). 7) R.F.C...Brilison, C.F. Brucker, A.D. Katnani, N.G. Stoffel, and G. Margaritondo, J.Vac.Soi Technol., 19, 661 (1981). 13) 1. Caznlibel, A.K. Chin , F. Eruanis

ONRASIA Scientific Information Bulletin. Volume 17, Number 4, October - December 1992

DTIC Science & Technology

1992-12-01

department tero-technology, and technology location is less congested and much Optical devices chair assessment), and eight endowed greener than that of the...chemi- Tel: +81 3-3481-4411 had been a very good advertisement cal compound design. Some details for Al, and in fact had moved stu- and references are...Point ment for online system. Automatesvolume, of Sale data. setting of parameters when new ter- Daa ye m c t o f Facg (ra ne minal is introduced

USSR and Eastern Europe Scientific Abstracts, Engineering and Equipment, Number 39

DTIC Science & Technology

1978-01-30

34 ’\\ v i \\ • . .1 DISTRIBUTION STATEMENT A Approved for Public Release Distribution Unlimited •’••*^.:- v ;;;.-’.i^ 20000405 198 U. S...1034 manuscript received 22 Feb 77 GOLUBINSKIY, A . I., and GOLYBKIN, V . N., Central Aerohydrodynamic Institute imeni N. Ye. Zhukovskiy [Abstract] A ...Russian Vol 232 No 3, 1977 pp 538-541 manuscript received 23 Apr 76 ZHEVNIN, A . A ., and T0L0KN0V, V . I., Moscow Higher Technical School imeni N. E

Hurricane Impact on Gulf Coast Barriers.

DTIC Science & Technology

1982-01-01

advaince and huge late-ral extent, Frederic de- ye Ii ped a large ,.toriin so rge. After en is~.in g Dauphin [,land, Alabama, Fredi’ric made landfill near...stratification Each set is some 10 to 20 cr0 These fans are characterized byv wide con tinhi-its upper-flow thick . Tahular cross-stratif aioofviblthcnsisa...Note lth ndward mingration swash bars along the fan crest . (See fig 1:3 P’,intFtlicati)n of thi, oblique aerial photo). Photo taken March 12. 19N

RDM Lifetime measurements in ^191Hg using the Gammasphere Plunger

NASA Astrophysics Data System (ADS)

Jin, H.; Kharraja, B.; Garg, U.; Ghugre, S. S.; Carpenter, M. P.; Fischer, S.; Janssens, R. V. F.; Khoo, T. L.; Lauritsen, T.; Nisius, D.; Kaczarowski, R.; Govil, I. M.; Kruecken, R.; Machiavelli, A.; MacLeod, R.

1998-10-01

Recoil Distance Lifetime Measurements have been performed for the nucleus ^191Hg at Gammasphere with a view to further investigate the prolate non-collective structure (ɛ2 = 0.1 - 0.15, γ ~= - 120^circ) reported several years ago by D. Ye et al. (D. Ye et al.,) Phys. Lett. B236, 7 (1990) The ^174Yb(^22Ne, 5n) reaction was employed at a beam energy of 120 MeV. In this experiment the new Gammasphere Plunger was used for the first time. Data were collected at 7 distances ranging from 50 μm to 1070 μm. The extracted lifetimes for the level sequence of interest are in the range of ~ 7 ps to 120 ps, leading to transition probabilities that indeed correspond to a non-collective nature.

A Vectorized ’Nearest-Neighbors’ Algorithm of Order N Using a Monotonic Logical Grid

DTIC Science & Technology

1985-05-29

Computational Phy’sics 0 4 May 29 , 1985 This work was supported by the Office of Naval Research. . ~ Q~JUN 1719851- * NAVAL RESEARCH LABORATORY * lit...YE ’.ARK:NGS UNCLASSIFIED_______________ _____ K -. A R, ~ CA7,ON 4, 71CO1, 3 :)-S7R,9U-ON AdA,.A3:L ’Y OF REPOR7Io - EC..ASi.’ CA27 ON., DOWNGAZING...Year. Month. Day) 5 PAGE COUNT Interim FROM -____ Toi__ 1985 May 29 50 𔄀 SuPPILSMENTARY NOTATION This work was supported by the Office of Naval

Chinese-English Rocketry Dictionary. Volume 3

DTIC Science & Technology

1979-03-01

xiezhen diania 14] Q i. plate tank 1’? yangil yanghuara $, anodic oxidation process 18 yangji yinji dianya I3 A.j - I t anode -cathode voltage...talo Gu Yin yin aao ou Ylng Yin ta’u Ou YU You taluan cuan Yuing Yawg talui cul 341 tau tm yuan ruan toa ’Wg Cown Yft ye. tfu tu Yfln t’tian tuant...tanhuang Jiahe mopian 94f X laE f(4 ’m’. #j spring-loaded membrane 14 tanhuang Jiaju A1 A -)t spring clawp 15 tanhuang Jianshendian A1 &c A V -’P spring

A Systems Evaluation of the Environmental Impact of the Aubrey Reservoir Project on Elm Fork of the Trinity River in North Texas.

DTIC Science & Technology

1972-06-01

JUN 72 L C FITZPATRICK , R L ABSHI RE. L G KNOX D AC W 3-72-C-X052 4 mhhho hhEEE I lffllffllfNOlf NElf mohEEEEEshhhEE EhmhhEEEmhEEEE mhEmhEEEEEmhhI...C-0052, on 30 June 1972. I f’v IabnC Wer’Ye td so; itsj 81 3 3 063 - I _rj_,CLASSIFICATION OF THIS PAGE (When Dole Kntored) REPORT DOCUMENTATION PAGE...Engineers June 1972 Engineering Division, Plng Br, SWFED-P I . NUMBER OFPAGES P. 0. Box 17300, Fort Worth, Texas 76102 339 14. MONITORING AGENCY NAME

A comprehensive proteomics study on platelet concentrates: Platelet proteome, storage time and Mirasol pathogen reduction technology.

PubMed

Salunkhe, Vishal; De Cuyper, Iris M; Papadopoulos, Petros; van der Meer, Pieter F; Daal, Brunette B; Villa-Fajardo, María; de Korte, Dirk; van den Berg, Timo K; Gutiérrez, Laura

2018-03-19

Platelet concentrates (PCs) represent a blood transfusion product with a major concern for safety as their storage temperature (20-24°C) allows bacterial growth, and their maximum storage time period (less than a week) precludes complete microbiological testing. Pathogen inactivation technologies (PITs) provide an additional layer of safety to the blood transfusion products from known and unknown pathogens such as bacteria, viruses, and parasites. In this context, PITs, such as Mirasol Pathogen Reduction Technology (PRT), have been developed and are implemented in many countries. However, several studies have shown in vitro that Mirasol PRT induces a certain level of platelet shape change, hyperactivation, basal degranulation, and increased oxidative damage during storage. It has been suggested that Mirasol PRT might accelerate what has been described as the platelet storage lesion (PSL), but supportive molecular signatures have not been obtained. We aimed at dissecting the influence of both variables, that is, Mirasol PRT and storage time, at the proteome level. We present comprehensive proteomics data analysis of Control PCs and PCs treated with Mirasol PRT at storage days 1, 2, 6, and 8. Our workflow was set to perform proteomics analysis using a gel-free and label-free quantification (LFQ) approach. Semi-quantification was based on LFQ signal intensities of identified proteins using MaxQuant/Perseus software platform. Data are available via ProteomeXchange with identifier PXD008119. We identified marginal differences between Mirasol PRT and Control PCs during storage. However, those significant changes at the proteome level were specifically related to the functional aspects previously described to affect platelets upon Mirasol PRT. In addition, the effect of Mirasol PRT on the platelet proteome appeared not to be exclusively due to an accelerated or enhanced PSL. In summary, semi-quantitative proteomics allows to discern between proteome changes due to Mirasol PRT or PSL, and proves to be a methodology suitable to phenotype platelets in an unbiased manner, in various physiological contexts.

Effects of an 8-Month Ashtanga-Based Yoga Intervention on Bone Metabolism in Middle-Aged Premenopausal Women: A Randomized Controlled Study

PubMed Central

Kim, SoJung; Bemben, Michael G.; Knehans, Allen W.; Bemben, Debra A.

2015-01-01

Although Yoga has the potential to be an alternative physical activity to enhance bone health, there is a lack of high quality evidence for this type of intervention. The purpose of this randomized controlled trial was to examine the effects of a progressive 8-month Ashtanga-based Yoga program on bone turnover markers (BTM), areal bone mineral density (aBMD) and volumetric bone characteristics in premenopausal women. Thirty-four premenopausal women (35-50 years) were randomly assigned either to a Yoga group (YE, n = 16) or a control group (CON, n = 18). Participants in YE group performed 60 minutes of an Ashtanga-based Yoga series 2 times/week with one day between sessions for 8 months, and the session intensity was progressively increased by adding the number of sun salutations (SS). Participants in CON were encouraged to maintain their normal daily lifestyles monitored by the bone specific physical activity questionnaire (BPAQ) at 2 month intervals for 8 months. Body composition was measured by dual energy x-ray absorptiometry (DXA). Bone formation (bone alkaline phosphatase, Bone ALP) and bone resorption (Tartrate-Resistant Acid Phosphatase-5b, TRAP5b) markers were assessed at baseline and after 8 months. aBMD of total body, lumbar spine and dual proximal femur and tibia bone characteristics were measured using DXA and peripheral Quantitative Computed Tomography (pQCT), respectively. We found that the serum Bone ALP concentrations were maintained in YE, but significantly (p = 0.005) decreased in CON after the 8 month intervention, and there were significant (p = 0.002) group differences in Bone ALP percent changes (YE 9.1 ± 4.0% vs. CON -7.1 ± 2.3%). No changes in TRAP5b were found in either group. The 8-month Yoga program did not increase aBMD or tibia bone strength variables. Body composition results showed no changes in weight, fat mass, or % fat, but small significant increases in bone free lean body mass occurred in both groups. The findings of this study suggest that regular long-term Ashtanga Yoga had a small positive effect on bone formation but did not alter aBMD or tibia bone characteristics in premenopausal women. Key points Regular long-term Ashtanga-based Yoga program had a small positive effect on bone formation, but no effects were found on bone resorption. None of the bone density or geometry variables were changed by the 8-month Ashtanga-based Yoga intervention. Future Yoga interventions should focus on longer duration and greater frequency to elicit improvements in bone mineral density. PMID:26664272

Natural hazards at the southern margin of the Central Anatolian Plateau (CAP) (southern Turkey): Tsunami evidence

NASA Astrophysics Data System (ADS)

Ogretmen, Nazik; Cosentino, Domenico; Gliozzi, Elsa; Cipollari, Paola; Radeff, Giuditta; Yıldırım, Cengiz

2016-04-01

In regions that are located in steep, orogenic plateau margins, such as the coastal area of the Central Anatolian Plateau (CAP) southern margin, natural hazard studies related to active tectonics and events that are triggered by active tectonics (e.g., earthquakes, landslides, tsunamis) are very essential in the context of preventing possible damages. This work herein, represents some evidence of the tsunami hazard along the coast between Aydıncık and Narlıkuyu, in southern Turkey. The work is based on a study on out-of-place beachrock-slab boulder acummulation in Aydıncık district, which were transported onshore by sliding process, and on out-of-place more rounded boulders that were transported by saltation process in Narlıkuyu and Yeşilovacık districts. The presence of intertidal organisms (e.g., lithophaga boring, balanids, oysters, etc.) encrusting the boulders of both localities shows that those boulders were carried onland from a marine environment. According to their dimensions and weight, in agreement with out-of-place boulders from areas surely affected by tsunamis, those out-of-place boulders here are interpreted as due to tsunami waves. The tsunamites in the Aydıncık area are located on beachrock slabs. They are platty and some of those blocks are embricated and oriented perpendicular to the shoreline (NE-SW direction). Those boulders have been interpreted as transported by sliding process, in relation with the coastal morphology and the boulder geometry, which means that to move those boulders the energy of the tsunami not necessarily should have been as high as in saltation or rolling transport processes. On the contrary, in Narlıkuyu and Yeşilovacık localities, the boulders are well-rounded and ellipsoidal shaped, suggesting that they were transported by rolling and/or saltation mode rather than by sliding. To carry onland the tsunami boulders observed in the Narlıkuyu and Yeşilovacık districts, which in the Yeşilovacık area they are located at 2.6 m above sea level, it requires a minimum run-up of 3.0 m. Given the steep southern margin of the CAP and its seismic activity, it is highly possible that submarine landslides and/or middle-small magnitude offshore earthquakes, possibly triggered by active normal fault at the CAP southern margin (i.e., the offshore Ecemiş fault zone), may be responsible for the tsunami waves that transported onshore those out-of-place boulders. It is important to record such data considering the proximity of the out-of-place boulders locations to strategic infrastructures planned to be built on the southern Anatolia coastal area (e.g., Akkuyu Nuclear Power Plant).

Genetics Home Reference: microphthalmia

MedlinePlus

... CR, Ye M, Garcha K, Bigot K, Perera AG, Staehling-Hampton K, Mema SC, Chanda B, Mushegian ... qualified healthcare professional . About Selection Criteria for Links Data Files & API Site Map Subscribe Customer Support USA. ...

Programming Support Library (PSL). Users Manual.

DTIC Science & Technology

1978-05-01

which provides the tools to organize, implement, and control computer program develop- ment. This involves the support of the actual programming process...provides the tools toorganize, implement, and control computer program development. The system is designed specifically to support top-down development...Structured Programming are finding increasing application in the computing community. Structured programs are, however, difficult to write in

Topological Sachdev-Ye-Kitaev model

NASA Astrophysics Data System (ADS)

Zhang, Pengfei; Zhai, Hui

2018-05-01

In this Rapid Communication, we construct a large-N exactly solvable model to study the interplay between interaction and topology, by connecting the Sachdev-Ye-Kitaev (SYK) model with constant hopping. The hopping forms a band structure that can exhibit both topologically trivial and nontrivial phases. Starting from a topologically trivial insulator with zero Hall conductance, we show that the interaction can drive a phase transition to a topologically nontrivial insulator with quantized nonzero Hall conductance, and a single gapless Dirac fermion emerges when the interaction is fine tuned to the critical point. The finite temperature effect is also considered, and we show that the topological phase with a stronger interaction is less stable against temperature. Our model provides a concrete example to illustrate the interacting topological phases and phase transitions, and can shed light on similar problems in physical systems.

In-situ early-age hydration study of sulfobelite cements by synchrotron powder diffraction

DOE Office of Scientific and Technical Information (OSTI.GOV)

Álvarez-Pinazo, G.; Cuesta, A.; García-Maté, M.

Eco-friendly belite calcium sulfoaluminate (BCSA) cement hydration behavior is not yet well understood. Here, we report an in-situ synchrotron X-ray powder diffraction study for the first hours of hydration of BCSA cements. Rietveld quantitative phase analysis has been used to establish the degree of reaction (α). The hydration of a mixture of ye'elimite and gypsum revealed that ettringite formation (α ∼ 70% at 50 h) is limited by ye'elimite dissolution. Two laboratory-prepared BCSA cements were also studied: non-active-BCSA and active-BCSA cements, with β- and α′{sub H}-belite as main phases, respectively. Ye'elimite, in the non-active-BCSA system, dissolves at higher pace (αmore » ∼ 25% at 1 h) than in the active-BCSA one (α ∼ 10% at 1 h), with differences in the crystallization of ettringite (α ∼ 30% and α ∼ 5%, respectively). This behavior has strongly affected subsequent belite and ferrite reactivities, yielding stratlingite and other layered phases in non-active-BCSA. The dissolution and crystallization processes are reported and discussed in detail. -- Highlights: •Belite calcium sulfoaluminate cements early hydration mechanism has been determined. •Belite hydration strongly depends on availability of aluminum hydroxide. •Orthorhombic ye’elimite dissolved at a higher pace than cubic one. •Ye’elimite larger reaction degree yields stratlingite formation by belite reaction. •Rietveld method quantified gypsum, anhydrite and bassanite dissolution rates.« less

The Aluminum Ship Evaluation Model (ASEM) Static Test Results

DTIC Science & Technology

1983-12-01

8217- -- fC1 (-10,o 1 3 7-1 -69 6 12 960.00 9869 30 0 t SAME 22 R2A:CM7 9-E1 2 23 9 11 -69 822 - 41 fta 𔃼 2S87 98- 3 35 19 I 30 SOME 12 244𔄂 9 ES0 0 0 1 SAME...YE 0D . 0 0 -40 -:0 0 246 344412; FMD 4-A-AS YES 0 1 0. 01 00 _ 0 A 0 204 848117I8 047 YSI .- 0 0 1 -60-A7 1 24 ;41:0 4-A44 YES 0 I 0. 0100 ’-0 -FC 249

The Renewal Equation for Markov Renewal Processes with Applications to Storage Models.

DTIC Science & Technology

1986-05-01

2.21) = pt(Bf(jO,A))v(EO, tD )+I(6=O)[:P(YnkB,T nkTnkk~t’Ynk-kiY) -2pO(Bn(j0 ,A))v([O,tJ3 if ye (j09A), with p, v as in corollary 2.2, and y and 6 are...S.) max ( max (S n-S )+(S n-S n 0~. l 5j:n no 0 14_XM nk -n: j!nk 0kI n n Thus, for all w 4EA, Z (wlmax( max (S -S.),x +S 1=0. (3.4) l,n 0 1j n 0

An NQR Study of TNT Characteristics.

DTIC Science & Technology

1977-09-01

RDX , HMX , a r d some of t he heavy me t al 3~~: id~.s h~~’n for rn.nn ye.~rs been use d as rn~~lit~~ry nii p lns i n’t-~~~~, Thr p h y s i c a l...ambient temperatures of more than one coexisting crystal phase. This polymorphism is known to occur in TNT , HMX and PbN3, and is responsible for a...specific problems of TNT polymorphism and phase transitions were researched . This is one of the problems which is relevant to present day concerns . The

JPRS Report, Science & Technology, USSR: Computers

DTIC Science & Technology

1987-09-10

O H V 01 Ü C Q) ö H n) in u At A2 Af A2 SC-S5SI A3 A4...At A2 20 Af A2 At 42 -55" A4 ) A3 A4 -555e i Ü .■•; sj <, .^ ^ u o ca to <u u o u CM cfl u u C dJ u u to O i-l 4J tii... O C Q) ß l-l tfl !Z> O Key: A. Multiplex channel. The input of subchannel A of the YeS-5568 disk controller is connected to the first

PSL Chemical Biology Symposia First 2016 Edition: When Chemistry and Biology Share the Language of Discovery.

PubMed

Gautier, Arnaud; Rodriguez, Raphaël

2017-05-18

Chemical biology, the science of understanding biological processes at the molecular level, has grown exponentially with the development of chemical strategies to manipulate and quantify biology with unprecedented precision. Recent advances presented at the Université Paris Sciences et Lettres symposium are discussed. © 2017 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.

Modular amplitudes and flux-superpotentials on elliptic Calabi-Yau fourfolds

NASA Astrophysics Data System (ADS)

Cota, Cesar Fierro; Klemm, Albrecht; Schimannek, Thorsten

2018-01-01

We discuss the period geometry and the topological string amplitudes on elliptically fibered Calabi-Yau fourfolds in toric ambient spaces. In particular, we describe a general procedure to fix integral periods. Using some elementary facts from homological mirror symmetry we then obtain Bridgelands involution and its monodromy action on the integral basis for non-singular elliptically fibered fourfolds. The full monodromy group contains a subgroup that acts as PSL(2,Z) on the Kähler modulus of the fiber and we analyze the consequences of this modularity for the genus zero and genus one amplitudes as well as the associated geometric invariants. We find holomorphic anomaly equations for the amplitudes, reflecting precisely the failure of exact PSL(2,Z) invariance that relates them to quasi-modular forms. Finally we use the integral basis of periods to study the horizontal flux superpotential and the leading order Kähler potential for the moduli fields in F-theory compactifications globally on the complex structure moduli space. For a particular example we verify attractor behaviour at the generic conifold given an aligned choice of flux which we expect to be universal. Furthermore we analyze the superpotential at the orbifold points but find no stable vacua.

Reactive oxygen species drive evolution of pro-biofilm variants in pathogens by modulating cyclic-di-GMP levels.

PubMed

Chua, Song Lin; Ding, Yichen; Liu, Yang; Cai, Zhao; Zhou, Jianuan; Swarup, Sanjay; Drautz-Moses, Daniela I; Schuster, Stephan Christoph; Kjelleberg, Staffan; Givskov, Michael; Yang, Liang

2016-11-01

The host immune system offers a hostile environment with antimicrobials and reactive oxygen species (ROS) that are detrimental to bacterial pathogens, forcing them to adapt and evolve for survival. However, the contribution of oxidative stress to pathogen evolution remains elusive. Using an experimental evolution strategy, we show that exposure of the opportunistic pathogen Pseudomonas aeruginosa to sub-lethal hydrogen peroxide (H 2 O 2 ) levels over 120 generations led to the emergence of pro-biofilm rough small colony variants (RSCVs), which could be abrogated by l-glutathione antioxidants. Comparative genomic analysis of the RSCVs revealed that mutations in the wspF gene, which encodes for a repressor of WspR diguanylate cyclase (DGC), were responsible for increased intracellular cyclic-di-GMP content and production of Psl exopolysaccharide. Psl provides the first line of defence against ROS and macrophages, ensuring the survival fitness of RSCVs over wild-type P. aeruginosa Our study demonstrated that ROS is an essential driving force for the selection of pro-biofilm forming pathogenic variants. Understanding the fundamental mechanism of these genotypic and phenotypic adaptations will improve treatment strategies for combating chronic infections. © 2016 The Authors.

Direct observation on the Brownian coagulation of PSL particles through optical microscope in the regime near critical coagulation concentration (CCC).

PubMed

Fukasawa, Tomonori; Adachi, Yasuhisa

2010-04-15

Microscopic monitoring of floc structure, floc size distribution and the rate of coagulation was carried out for Brownian coagulation of PSL particles. Experiments were designed for the condition of salt concentration that is slightly below critical coagulation concentration (CCC). The density of the solvent was controlled by using deuterium oxide (D(2)O) to avoid sedimentation. Results are summarized as follows: (i) Near CCC, floc restructuring from the beginning stage of coagulation was evidenced, i.e., the ratio of linear triplet is found to be remarkably reduced as compared with the result obtained for the case of rapid coagulation which was implemented under sufficiently high salt concentration. (ii) The increase of fractal dimension from 1.8 in the case of rapid coagulation to 2.2 was confirmed by the analysis of mass balance using size distribution of flocs. This increment resulted in the decrease of effective excluded volume of flocs. (iii) The rate of coagulation was constant until later stage. This result contrasts to the result of rapid coagulation [T. Fukasawa, Y. Adachi, J. Colloid Interface Sci. 304 (2006) 115]. 2010 Elsevier Inc. All rights reserved.

Mars Target Encyclopedia: Information Extraction for Planetary Science

NASA Astrophysics Data System (ADS)

Wagstaff, K. L.; Francis, R.; Gowda, T.; Lu, Y.; Riloff, E.; Singh, K.

2017-06-01

Mars surface targets / and published compositions / Seek and ye will find. We used text mining methods to extract information from LPSC abstracts about the composition of Mars surface targets. Users can search by element, mineral, or target.

Unified planning work program federal fiscal year 2008

DOT National Transportation Integrated Search

2008-01-01

This Unified Planning Work Program (UPWP) contains information about surface-transportation planning projects that will be conducted in the Boston metropolitan region during the period of October 1, 2007, through September 30, 2008 (federal fiscal ye...

Fibre fortification of wheat bread: impact on mineral composition and bioaccessibility.

PubMed

Martins, Zita E; Pinto, Edgar; Almeida, Agostinho A; Pinho, Olívia; Ferreira, Isabel M P L V O

2017-05-24

In this work, wheat bread was fortified with fibre enriched extracts recovered from agroindustry by-products, namely, elderberry skin, pulp and seeds (EE); orange peel (OE); pomegranate peel and interior membranes (PE); and spent yeast (YE). The impact of this fortification on the total and bioaccessible mineral composition of wheat breads, estimated mineral daily intake, and the relationship between bioaccessibility and dietary fibre was evaluated. Fortification with OE, EE, and PE improved the content of essential minerals in bread when compared to control bread. The exception was bread fortified with YE, which presented a mineral content similar to control bread, but its mineral bioaccessibility was significantly higher than in all the other bread formulations. The opposite was observed for PE bread, which presented a significant reduction of bioaccessible minerals. We concluded that the origin of the fibre rich extract must be carefully selected, to avoid potential negative impact on mineral bioaccessibility.

Effect of Sediment Gas Voids and Ebullition on Benthic Solute Exchange.

PubMed

Flury, Sabine; Glud, Ronnie N; Premke, Katrin; McGinnis, Daniel F

2015-09-01

The presence of free gas in sediments and ebullition events can enhance the pore water transport and solute exchange across the sediment-water interface. However, we experimentally and theoretically document that the presence of free gas in sediments can counteract this enhancement effect. The apparent diffusivities (Da) of Rhodamine WT and bromide in sediments containing 8-18% gas (Da,YE) were suppressed by 7-39% compared to the control (no gas) sediments (Da,C). The measured ratios of Da,YE:Da,C were well within the range of ratios predicted by a theoretical soil model for gas-bearing soils. Whereas gas voids in sediments reduce the Da for soluble species, they represent a shortcut for low-soluble species such as methane and oxygen. Therefore, the presence of even minor amounts of gas can increase the fluxes of low-soluble species (i.e., gases) by several factors, while simultaneously suppressing fluxes of dissolved species.

31 CFR 240.3 - Electronic checks and substitute checks.

Code of Federal Regulations, 2010 CFR

2010-07-01

... 31 Money and Finance: Treasury 2 2010-07-01 2010-07-01 false Electronic checks and substitute... OF CHECKS DRAWN ON THE UNITED STATES TREASURY General Provisions § 240.3 Electronic checks and substitute checks. (a) Legal equivalence of electronic checks. An electronic check for which a presenting...

31 CFR 240.3 - Electronic checks and substitute checks.

Code of Federal Regulations, 2011 CFR

2011-07-01

... 31 Money and Finance:Treasury 2 2011-07-01 2011-07-01 false Electronic checks and substitute... OF CHECKS DRAWN ON THE UNITED STATES TREASURY General Provisions § 240.3 Electronic checks and substitute checks. (a) Legal equivalence of electronic checks. An electronic check for which a presenting...

31 CFR 240.3 - Electronic checks and substitute checks.

Code of Federal Regulations, 2012 CFR

2012-07-01

... 31 Money and Finance:Treasury 2 2012-07-01 2012-07-01 false Electronic checks and substitute... OF CHECKS DRAWN ON THE UNITED STATES TREASURY General Provisions § 240.3 Electronic checks and substitute checks. (a) Legal equivalence of electronic checks. An electronic check for which a presenting...

Current smoking is an independent risk factor for new-onset diabetes mellitus during highdose glucocorticoid treatment.

PubMed

Sugiyama, Takao; Sugimoto, Toyohiko; Suzuki, Sawako; Sato, Yuta; Tanaka, Tomoaki; Tatsuno, Ichiro

2015-08-01

Although high-dose glucocorticoids have been reported to cause new-onset diabetes mellitus (glucocorticoid-induced diabetes mellitus), its risk factors have remained to be determined. We investigated the risk factors related to glucocorticoid-induced diabetes mellitus diagnosed within 2 months after the high-dose treatment (newly treated with an initial high dose of > 20 mg prednisolone (PSL) equivalent per day for at least more than 6 months) in collagen vascular diseases. A total of 2,631 patients with collagen vascular diseases was registered between 1986 and 2006 in the Chiba-Shimoshizu Rheumatic Cohort. We analyzed 681 patients newly treated with high-dose glucocorticoid who did not have diabetes mellitus and/or its previous diagnosis (age: 46.3 ± 16.7 years, PSL dose: 40.0 ± 14.1 mg/day). Glucocorticoid-induced diabetes mellitus was diagnosed by two or more glucose measurements in patients with fasting glycaemia ≥ 7 mmol/L and 120 minutes post-load glycaemia ≥ 11.1 mmol/L. Glucocorticoid-induced diabetes mellitus was observed in 26.3% of patients, and the glucocorticoid-induced diabetes mellitus group had higher age, higher BMI, lower rates of females and systemic lupus erythematosus, higher rates of smoking, alcohol use, and microscopic polyangiitis. Multivariate logistic regression analysis demonstrated that the risk of glucocorticoid-induced diabetes mellitus was independently higher in every 10-year increment of initial age with adjusted odds ratio (OR) 1.556 (95% confidence interval: 1.359 - 1.783), in every 1 kg/m2 increment of BMI with OR 1.062 (1.002 - 1.124), in current smoking with OR 1.664 (1.057 - 2.622), and in every 10 mg increment of initial dose of prednisolone with OR 1.250 (1.074 - 1.454). High-dose glucocorticoids caused diabetes mellitus with high prevalence within a short period, and current smokers should be considered at higher risk of glucocorticoidinduced diabetes mellitus in addition to age, BMI, and initial dose.

Corrective Action Management Unit Report of Post-Closure Care Activities Calendar Year 2017.

DOE Office of Scientific and Technical Information (OSTI.GOV)

Ziock, Robert; Little, Bonnie Colleen

The Corrective Action Management Unit (CAMU) at Sandia National Laboratories, New Mexico (SNL/NM) consists of a containment cell and ancillary systems that underwent regulatory closure in 2003 in accordance with the Closure Plan in Appendix D of the Class 3 Permit Modification (SNL/NM September 1997). The containment cell was closed with wastes in place. On January 27, 2015, the New Mexico Environment Department (NMED) issued the Hazardous Waste Facility Operating Permit (Permit) for Sandia National Laboratories (NMED January 2015). The Permit became effective February 26, 2015. The CAMU is undergoing post-closure care in accordance with the Permit, as revised andmore » updated. This CAMU Report of Post-Closure Care Activities documents all activities and results for Calendar Year (CY) 2017 as required by the Permit. The CAMU containment cell consists of engineered barriers including a cover system, a bottom liner with a leachate collection and removal system (LCRS), and a vadose zone monitoring system (VZMS). The VZMS provides information on soil conditions under the cell for early leak detection. The VZMS consists of three monitoring subsystems, which include the primary subliner (PSL), a vertical sensor array (VSA), and the Chemical Waste Landfill (CWL) sanitary sewer (CSS) line. The PSL, VSA, and CSS monitoring subsystems are monitored quarterly for soil moisture concentration, the VSA is monitored quarterly for soil temperature, and the VSA and CSS monitoring subsystems are monitored annually for volatile organic compound (VOC) concentrations in the soil vapor at various depths. Baseline data for the soil moisture, soil temperature, and soil vapor were established between October 2003 and September 2004.« less

Antimicrobial photodynamic inactivation of Staphylococcus aureus biofilms in bone specimens using methylene blue, toluidine blue ortho and malachite green: An in vitro study.

PubMed

Rosa, Luciano Pereira; da Silva, Francine Cristina; Nader, Sumaia Alves; Meira, Giselle Andrade; Viana, Magda Souza

2015-05-01

To evaluate the in vitro effectiveness of APDI with a 660 nm laser combined with methylene blue (MB), toluidine blue ortho (TBO) and malachite green (MG) dyes to inactivate Staphylococcus aureus (ATCC 25923) biofilms in compact and cancellous bone specimens. Eighty specimens of compact and 80 of cancellous bone were contaminated with a standard suspension of the microorganism and incubated for 14 days at 37°C to form biofilms. After this period, the specimens were divided into groups (n=10) according to established treatment: PS-L- (control - no treatment); PSmb+L-, PStbo+L-, PSmg+L- (only MB, TBO or MG for 5 min in the dark); PS-L+ (only laser irradiation for 180 s); and APDImb, APDItbo and APDImg (APDI with MB, TBO or MG for 180 s). The findings were statistically analyzed by ANOVA at 5% significance levels. All experimental treatments showed significant reduction of log CFU/mL S. aureus biofilms when compared with the control group for compact and cancellous bones specimens; the APDI group's treatment was more effective. The APDI carried out for the compact specimens showed better results when compared with cancellous specimens at all times of application. For the group of compact bone, APDImg showed greater reductions in CFU/mL (4.46 log 10). In the group of cancellous bone, the greatest reductions were found in the APDImb group (3.06 log 10). APDI with methylene blue, toluidine blue ortho and malachite green dyes and a 660 nm laser proved to be effective in the inactivation of S. aureus biofilms formed in compact and cancellous bone. Copyright © 2015 Elsevier Ltd. All rights reserved.

Effect of sampling and short isolation methodologies on the recovery of human pathogenic Yersinia enterocolitica from pig tonsils.

PubMed

Van Damme, Inge; Berkvens, Dirk; De Zutter, Lieven

2012-07-01

The objective of this study was to determine the effect of sampling (swab samples compared to destructive samples) on isolation rates of human pathogenic Yersinia enterocolitica from pig tonsils. Moreover, the relative efficiency of different rapid, routinely applicable isolation methods was evaluated. Therefore, swab and destructive samples from tonsils of 120 pigs at slaughter were analyzed in parallel using direct plating and different enrichment methods. Salmonella-Shigella-desoxycholate-calcium chloride (SSDC) agar, cefsulodin-irgasan-novobiocin (CIN) agar, and Yersinia enterocolitica chromogenic medium (YeCM) were used as selective agar media. For enrichment, irgasan-ticarcillin-potassium chlorate (ITC) broth and peptone-sorbitol-bile (PSB) broth were incubated at 25°C for 48 h. Overall, 55 tonsils (45.8%) were positive for Y. enterocolitica bioserotype 4/O:3. Recovery was significantly higher using the destructive method compared to the swabbing method. Direct plating resulted in 47 and 28 Y. enterocolitica-positive destructive and swab samples, respectively. Alkali treatment of PSB and ITC enrichment broths significantly increased recovery of pathogenic Y. enterocolitica from destructive tonsil samples. The performance of YeCM for qualitative and quantitative isolation of pathogenic Y. enterocolitica from pig tonsils was equal to SSDC and CIN. In conclusion, direct plating and ISO 10273: 2003 with minor modifications are suitable and rapid methods for isolation of pathogenic Y. enterocolitica from destructive tonsil samples.

Using runoff slope-break to determine dominate factors of runoff decline in Hutuo River Basin, North China.

PubMed

Tian, Fei; Yang, Yonghui; Han, Shumin

2009-01-01

Water resources in North China have declined sharply in recent years. Low runoff (especially in the mountain areas) has been identified as the main factor. Hutuo River Basin (HRB), a typical up-stream basin in North China with two subcatchments (Ye and Hutuo River Catchments), was investigated in this study. Mann-Kendall test was used to determine the general trend of precipitation and runoff for 1960-1999. Then Sequential Mann-Kendall test was used to establish runoff slope-break from which the beginning point of sharp decline in runoff was determined. Finally, regression analysis was done to illustrate runoff decline via comparison of precipitation-runoff correlation for the period prior to and after sharp runoff decline. This was further verified by analysis of rainy season peak runoff flows. The results are as follows: (1) annual runoff decline in the basin is significant while that of precipitation is insignificant at alpha=0.05 confidence level; (2) sharp decline in runoff in Ye River Catchment (YRC) occurred in 1968 while that in Hutuo River Catchment (HRC) occurred in 1978; (3) based on the regression analysis, human activity has the highest impact on runoff decline in the basin. As runoff slope-breaks in both Catchments strongly coincided with increase in agricultural activity, agricultural water use is considered the dominate factor of runoff decline in the study area.

Iso-migrastatin Titer Improvement in the Engineered Streptomyces lividans SB11002 Strain by Optimization of Fermentation Conditions

PubMed Central

Wu, Xueyun; Yang, Dong; Zhu, Xiangcheng; Feng, Zhiyang; Lv, Zhengbin; Zhang, Yaozhou; Shen, Ben; Xu, Zhinan

2011-01-01

The heterologous production of iso-migrastatin (iso-MGS) was successfully demonstrated in an engineered S. lividans SB11002 strain, which was derived from S. lividans K4–114, following introduction of pBS11001, which harbored the entire mgs biosynthetic gene cluster. However, under similar fermentation conditions, the iso-MGS titer in the engineered strain was significantly lower than that in the native producer - Streptomyces platensis NRRL 18993. To circumvent the problem of low iso-MGS titers and to expand the utility of this heterologous system for iso-MGS biosynthesis and engineering, systematic optimization of the fermentation medium was carried out. The effects of major components in the cultivation medium, including carbon, organic and inorganic nitrogen sources, were investigated using a single factor optimization method. As a result, sucrose and yeast extract were determined to be the best carbon and organic nitrogen sources, resulting in optimized iso-MGS production. Conversely, all other inorganic nitrogen sources evaluated produced various levels of inhibition of iso-MGS production. The final optimized R2YE production medium produced iso-MGS with a titer of 86.5 mg/L, about 3.6-fold higher than that in the original R2YE medium, and 1.5 fold higher than that found within the native S. platensis NRRL 18993 producer. PMID:21625393

"Thou" and "Ye" in Chaucer's "Clerk's Tale."

ERIC Educational Resources Information Center

Wilcockson, Colin

1980-01-01

Examines the use of the second person pronoun in Chaucer's "Clerk's Tale" to demonstrate that students of medieval texts may well miss important areas of meaning if they fail to give adequate attention to the historical study of language. (GT)

Financial management : Federal Aviation Administration lacked accountability for major assets

DOT National Transportation Integrated Search

1998-02-18

This short report is in response to a request by the Congress that the General : Accounting Office (GAO) analyze the Department of Transportation (DOT) Inspector : General's (IG) audit report on the Federal Aviation Administration's (FAA) : fiscal ye...

75 FR 78339 - Buy America Waiver Notification

Federal Register 2010, 2011, 2012, 2013, 2014

2010-12-15

... of steel pipe API 5L, Grade B, PSL 2 as an alternate equivalent product to steel pipe A53 Grade B, 26... Buy America waiver for the use of non-domestic steel pipe; A53 Grade B, 26'' OD, 0.375'' wall for the... Register on October 19, 2010, at 75 FR 64394, for the use of non-domestic steel pipe; A53 Grade B, 26'' OD...

Customized Fabrication of Osteochondral Tissue for Articular Joint Surface Repair

DTIC Science & Technology

2015-09-01

Kilroy EJ, Tuan RS. (2015) Projection Stereolithographic Fabrication of Human Adipose Stem Cell-incorporated Biodegradable Scaffolds for Cartilage...necessary to include the publications already specified above in this section. Nothing to Report (1) Live Cell-scaffold Printing using Biodegradable ...and PCL scaffolds using PSL (Figure 1,2). Solid PDLLA-PEG scaffold (30%) possesses a compressive modulus up to 800kPa and is biodegradable in

Hot mix asphalt tender zone

DOT National Transportation Integrated Search

2000-04-01

Approximately 500 million tons of hot mix asphalt (HMA) are placed in the United States each year. With this large quantity of HMA, it is expected that some construction problems will occur from time to time. One problem that has been observed for ye...

FY 72 Computer Utilization at the Transportation Systems Center

DOT National Transportation Integrated Search

1972-08-01

The Transportation Systems Center currently employs a medley of on-site and off-site computer systems to obtain the computational support it requires. Examination of the monthly User Accountability Reports for FY72 indicated that during the fiscal ye...

Summary of nighttime belt use studies

DOT National Transportation Integrated Search

2007-05-01

Despite gains in the daytime national seat belt rate over the past few years, reaching 81 percent in 2006 (Glassbrenner and Ye, 2007), the number of fatalities has remained basically unchanged. One reason for this may be that many fatalities occur at...

Deconvolution of Thermal Emissivity Spectra of Mercury to their Endmember Counterparts measured in Simulated Mercury Surface Conditions

NASA Astrophysics Data System (ADS)

Varatharajan, I.; D'Amore, M.; Maturilli, A.; Helbert, J.; Hiesinger, H.

2017-12-01

The Mercury Radiometer and Thermal Imaging Spectrometer (MERTIS) payload of ESA/JAXA Bepicolombo mission to Mercury will map the thermal emissivity at wavelength range of 7-14 μm and spatial resolution of 500 m/pixel [1]. Mercury was also imaged at the same wavelength range using the Boston University's Mid-Infrared Spectrometer and Imager (MIRSI) mounted on the NASA Infrared Telescope Facility (IRTF) on Mauna Kea, Hawaii with the minimum spatial coverage of 400-600km/spectra which blends all rocks, minerals, and soil types [2]. Therefore, the study [2] used quantitative deconvolution algorithm developed by [3] for spectral unmixing of this composite thermal emissivity spectrum from telescope to their respective areal fractions of endmember spectra; however, the thermal emissivity of endmembers used in [2] is the inverted reflectance measurements (Kirchhoff's law) of various samples measured at room temperature and pressure. Over a decade, the Planetary Spectroscopy Laboratory (PSL) at the Institute of Planetary Research (PF) at the German Aerospace Center (DLR) facilitates the thermal emissivity measurements under controlled and simulated surface conditions of Mercury by taking emissivity measurements at varying temperatures from 100-500°C under vacuum conditions supporting MERTIS payload. The measured thermal emissivity endmember spectral library therefore includes major silicates such as bytownite, anorthoclase, synthetic glass, olivine, enstatite, nepheline basanite, rocks like komatiite, tektite, Johnson Space Center lunar simulant (1A), and synthetic powdered sulfides which includes MgS, FeS, CaS, CrS, TiS, NaS, and MnS. Using such specialized endmember spectral library created under Mercury's conditions significantly increases the accuracy of the deconvolution model results. In this study, we revisited the available telescope spectra and redeveloped the algorithm by [3] by only choosing the endmember spectral library created at PSL for unbiased model accuracy with the RMS value of 0.03-0.04. Currently, the telescope spectra are investigated for its calibrations and the results will be presented at AGU. References: [1] Hiesinger, H. and J. Helbert (2010) PSS, 58(1-2): 144-165. [2] Sprague, A.L. et al (2009) PSS, 57, 364-383. [3] Ramsey and Christiansen (1998) JGR, 103, 577-596

The Sale of FX Aircraft to Taiwan,

DTIC Science & Technology

1982-02-01

A« ii 4J -r-i cr. u CO U O H oi 4-1 4-1 JS k4 cr. CO 3 1 E C li iH u -H CM CO 01 UH 1...31, 1981, pp. U1-U2 (Xinhua, "Ye Jianying Explains Policy Concerning Return of Taiwan to Mother- land and Peaceful Reunification"). FBIS, People’s...Industrial Potential" (Fei-ohan knai-t’ing tzu- li she-ohi ahien-tsu hsien-shih wo kuo ahun-shih kung-yeh ch’ien- li ), October 9, 1980. , "The U.S. Defense

National Program for Inspection of Non-Federal Dams. Forest Park Upper Dam (MA 00568), Connecticut River Basin, Springfield, Massachusetts. Phase I Inspection Report.

DTIC Science & Technology

1979-09-01

Suburban Rural,Farm___ ’.iod & and 20% Slope: s;teep 20 tied. 2Q% Slight 60%... ______ Fa.rks Nitial P-onlirg xea. 30 Acres; Ave. Depth 6’ lt priuzqt...dam failure? Yes I No .. Character Downstream Valley: Narrow x Wide _ Developed _ _ Rural 70Z Urban 30 , ’ Park Highway WW Railroad .3 k to life and...Location and Type:. Controls___, ’ype;_________________________ Aut~~c *.~n..l . Gperative Yes-___, No___ : W presen~t ’Ye X ,No . Operative Yes-, No___

Non-Line of Sight-Combined Arms (NLOS-CA) Manpower, Personnel and Logistics Impact Analysis (LIA)

DTIC Science & Technology

1993-11-15

total weight and volume to explosive weight have been used. These measure the size of the round relative to the killing power in the round. On this basis...the weapon system is powered up. (3) Alert Time is that time during which radios are operating, but the system is not powered up. For this analysis...TELEPHONE MANUA: SB-22/PT 1S U99185 UTILITY RECEPTACLE I V31211 TELEPHONE SET TA312 26 V•1788 POWER SUPPLY YE8 HYP-571TSEC 2I N32593 SHOP EQUIP AUTO

The Influence of Ballistic Damage on the Aeroelastic Characteristics of Lifting Surfaces.

DTIC Science & Technology

1979-07-01

the pressure distribution. The finite-element method, often referred to as a vortex- lattice or doublet- lattice method, divides the lifting surface into...finite-element modeling, such as doublet- lattice , would provide a better understanding of the near-field effects of a damage hole and allow a data base...0.17 0.33 0.50 6.67 0.833 1.00 Figure 42 125 CASE 5 and CASE 5D 0 Ye=.57 = UNDAMAGED M = DAMAGED 0 C3/ C22 CD QCD 6.330,4 0/ Fiue4 02 CASE 5 and CASE

Transaction Design Specification Medical Exam Databases System (MED) update Transaction

DTIC Science & Technology

1986-12-01

8217RECOFD IN 51) 73. CORONARY SFAS1 SITE ;CHAR X(6) IN 7:) 74* CORONARY FLAQUES (RECO D IN 51) 75. CCFONARY PLAOUE 3ITE ,CHAR K(60 IN 74) 76* FCT DIAMETER...KETOSTEROIDS YE HYDROXYCARTICOSTEROIDS YO 24 HR URINE TOTAL VOLUME MA URINE OSMOLALITY MB SERUM OSMOLALITY MC 24HR URINE TOTAL VOLUME ZE SERUM COPPER FBS TO...RHEUMATOID FACTOR PA N P -2 2 ANTINUCLEAR ANTIBODY PB N P -2 2 0 FREE FATTY ACIDS QA 5 9 57 200 MG% SERUM COPPER RA 30 70 130 300 JG% URINE COPPER RBM 10 30 90

2003 traffic crash facts annual report

DOT National Transportation Integrated Search

2003-01-01

In 2003, the death rate on Nebraska roadways was 1.6 persons killed per : 100 million vehicle miles traveled. The death rate in Nebraska, from 1961 : to 2003 is represented in Figure 1 (Page 2). Even though the death rate : fluctuates from year to ye...

2001 traffic crash facts annual report

DOT National Transportation Integrated Search

2001-01-01

In 2001, the death rate on Nebraska roadways was 1.6 persons killed per : 100 million vehicle miles traveled. The death rate in Nebraska, from 1961 to : 2001 is represented in Figure 1 (Page 2). Even though the death rate fluctuates : from year to ye...

Poly (ethylenimine)-grafted-poly [(aspartic acid)-co-lysine], a potential non-viral vector for DNA delivery.

PubMed

Tang, Gu Ping; Yang, Zhi; Zhou, Jun

2006-01-01

A potential non-viral gene-transfer vector, poly(ethylenimine)-grafted-poly[(aspartic acid)-co-lysine] (PSL), has been developed by thermal polycondensation of aspartic acid and lysine under reduced pressure. Low-molecular-mass branch poly(ethylenimine) (PEI600) was conjugated to the backbone. The chemical structure of the resulting co-polymer was identified by 1H-NMR, FT-IR, TGA and X-ray diffraction. The results of the MTT assay showed that at concentration up to 4000 nmol/l of the vector cell viability was over 80% and showed low toxicity. Electrophoretic retardation and ethidum bromide assay showed that at N/P ratios 12-15 (w/w) the DNA could be condensed and neutralized. Using the zeta potential assay we discovered that it had a high positive charge on its surface of the particle (over 30 mV). The particle sizes of the co-polymer/DNA complexes were 150-170 nm, as measured by DLS and AFM. Compared with PEI600, co-polymer/DNA complexes showed a significant enhancement of transfection activity in the absence and presence of serum in NT2 and COS7 cell lines. This means that the PEI600-PSL co-polymer is a promising candidate for gene delivery.

Comparative calibration of IP scanning equipment

NASA Astrophysics Data System (ADS)

Ingenito, F.; Andreoli, P.; Batani, D.; Boutoux, G.; Cipriani, M.; Consoli, F.; Cristofari, G.; Curcio, A.; De Angelis, R.; Di Giorgio, G.; Ducret, J.; Forestier-Colleoni, P.; Hulin, S.; Jakubowska, K.; Rabhi, N.

2016-05-01

Imaging Plates (IP) are diagnostic devices which contain a photostimulable phosphor layer that stores the incident radiation dose as a latent image. The image is read with a scanner which stimulates the decay of electrons, previously excited by the incident radiation, by exposition to a laser beam. This results in emitted light, which is detected by photomultiplier tubes; so the latent image is reconstructed. IPs have the interesting feature that can be reused many times, after erasing stored information. Algorithms to convert signals stored in the detector to Photostimulated luminescence (PSL) counts depend on the scanner and are not available on every model. A comparative cross-calibration of the IP scanner Dürr CR35 BIO, used in ABC laboratory, was performed, using the Fujifilm FLA 7000 scanner as a reference, to find the equivalence between grey-scale values given by the Dürr scanner to PSL counts. Using an IP and a 55Fe β-source, we produced pairs of samples with the same exposition times, which were analysed by both scanners, placing particular attention to fading times of the image stored on IPs. Data analysis led us to the determine a conversion formula which can be used to compare data of experiments obtained in different laboratories and to use IP calibrations available, till now, only for Fujifilm scanners.

National outbreak of Yersinia enterocolitica infections in military and civilian populations associated with consumption of mixed salad, Norway, 2014

PubMed Central

MacDonald, Emily; Einöder-Moreno, Margot; Borgen, Katrine; Thorstensen Brandal, Lin; Diab, Lore; Fossli, Øivind; Guzman Herrador, Bernardo; Hassan, Ammar Ali; Johannessen, Gro S; Johansen, Eva Jeanette; Jørgensen Kimo, Roger; Lier, Tore; Paulsen, Bjørn Leif; Popescu, Rodica; Tokle Schytte, Charlotte; Sæbø Pettersen, Kristin; Vold, Line; Ørmen, Øyvind; Wester, Astrid Louise; Wiklund, Marit; Nygård, Karin

2016-01-01

In May 2014, a cluster of Yersinia enterocolitica (YE) O9 infections was reported from a military base in northern Norway. Concurrently, an increase in YE infections in civilians was observed in the Norwegian Surveillance System for Communicable Diseases. We investigated to ascertain the extent of the outbreak and identify the source in order to implement control measures. A case was defined as a person with laboratory-confirmed YE O9 infection with the outbreak multilocus variable-number tandem repeat analysis (MLVA)-profile (5-6-9-8-9-9). We conducted a case–control study in the military setting and calculated odds ratios (OR) using logistic regression. Traceback investigations were conducted to identify common suppliers and products in commercial kitchens frequented by cases. By 28 May, we identified 133 cases, of which 117 were linked to four military bases and 16 were civilians from geographically dispersed counties. Among foods consumed by cases, multivariable analysis pointed to mixed salad as a potential source of illness (OR 10.26; 95% confidence interval (CI): 0.85–123.57). The four military bases and cafeterias visited by 14/16 civilian cases received iceberg lettuce or radicchio rosso from the same supplier. Secondary transmission cannot be eliminated as a source of infection in the military camps. The most likely source of the outbreak was salad mix containing imported radicchio rosso, due to its long shelf life. This outbreak is a reminder that fresh produce should not be discounted as a vehicle in prolonged outbreaks and that improvements are still required in the production and processing of fresh salad products. PMID:27588690

National outbreak of Yersinia enterocolitica infections in military and civilian populations associated with consumption of mixed salad, Norway, 2014.

PubMed

MacDonald, Emily; Einöder-Moreno, Margot; Borgen, Katrine; Thorstensen Brandal, Lin; Diab, Lore; Fossli, Øivind; Guzman Herrador, Bernardo; Hassan, Ammar Ali; Johannessen, Gro S; Johansen, Eva Jeanette; Jørgensen Kimo, Roger; Lier, Tore; Paulsen, Bjørn Leif; Popescu, Rodica; Tokle Schytte, Charlotte; Sæbø Pettersen, Kristin; Vold, Line; Ørmen, Øyvind; Wester, Astrid Louise; Wiklund, Marit; Nygård, Karin

2016-08-25

In May 2014, a cluster of Yersinia enterocolitica (YE) O9 infections was reported from a military base in northern Norway. Concurrently, an increase in YE infections in civilians was observed in the Norwegian Surveillance System for Communicable Diseases. We investigated to ascertain the extent of the outbreak and identify the source in order to implement control measures. A case was defined as a person with laboratory-confirmed YE O9 infection with the outbreak multilocus variable-number tandem repeat analysis (MLVA)-profile (5-6-9-8-9-9). We conducted a case-control study in the military setting and calculated odds ratios (OR) using logistic regression. Traceback investigations were conducted to identify common suppliers and products in commercial kitchens frequented by cases. By 28 May, we identified 133 cases, of which 117 were linked to four military bases and 16 were civilians from geographically dispersed counties. Among foods consumed by cases, multivariable analysis pointed to mixed salad as a potential source of illness (OR 10.26; 95% confidence interval (CI): 0.85-123.57). The four military bases and cafeterias visited by 14/16 civilian cases received iceberg lettuce or radicchio rosso from the same supplier. Secondary transmission cannot be eliminated as a source of infection in the military camps. The most likely source of the outbreak was salad mix containing imported radicchio rosso, due to its long shelf life. This outbreak is a reminder that fresh produce should not be discounted as a vehicle in prolonged outbreaks and that improvements are still required in the production and processing of fresh salad products. This article is copyright of The Authors, 2016.

Equation-free modeling unravels the behavior of complex ecological systems

USGS Publications Warehouse

DeAngelis, Donald L.; Yurek, Simeon

2015-01-01

Ye et al. (1) address a critical problem confronting the management of natural ecosystems: How can we make forecasts of possible future changes in populations to help guide management actions? This problem is especially acute for marine and anadromous fisheries, where the large interannual fluctuations of populations, arising from complex nonlinear interactions among species and with varying environmental factors, have defied prediction over even short time scales. The empirical dynamic modeling (EDM) described in Ye et al.’s report, the latest in a series of papers by Sugihara and his colleagues, offers a promising quantitative approach to building models using time series to successfully project dynamics into the future. With the term “equation-free” in the article title, Ye et al. (1) are suggesting broader implications of their approach, considering the centrality of equations in modern science. From the 1700s on, nature has been increasingly described by mathematical equations, with differential or difference equations forming the basic framework for describing dynamics. The use of mathematical equations for ecological systems came much later, pioneered by Lotka and Volterra, who showed that population cycles might be described in terms of simple coupled nonlinear differential equations. It took decades for Lotka–Volterra-type models to become established, but the development of appropriate differential equations is now routine in modeling ecological dynamics. There is no question that the injection of mathematical equations, by forcing “clarity and precision into conjecture” (2), has led to increased understanding of population and community dynamics. As in science in general, in ecology equations are a key method of communication and of framing hypotheses. These equations serve as compact representations of an enormous amount of empirical data and can be analyzed by the powerful methods of mathematics.

T-Check in System-of-Systems Technologies: Cloud Computing

DTIC Science & Technology

2010-09-01

T-Check in System-of-Systems Technologies: Cloud Computing Harrison D. Strowd Grace A. Lewis September 2010 TECHNICAL NOTE CMU/SEI-2010... Cloud Computing 1 1.2 Types of Cloud Computing 2 1.3 Drivers and Barriers to Cloud Computing Adoption 5 2 Using the T-Check Method 7 2.1 T-Check...Hypothesis 3 25 3.4.2 Deployment View of the Solution for Testing Hypothesis 3 27 3.5 Selecting Cloud Computing Providers 30 3.6 Implementing the T-Check

Topological gapped edge states in fractional quantum Hall-superconductor heterostructures

NASA Astrophysics Data System (ADS)

Cook, Ashley; Repellin, Cécile; Regnault, Nicolas; Neupert, Titus

We propose and implement a numerical setup for studying edge states of fractional quantum Hall droplets with a superconducting instability. We focus on a time-reversal symmetric bilayer fractional quantum Hall system of Laughlin ν = 1 / 3 states. The fully gapped edges carry a topological parafermionic degree of freedom that can encode quantum information protected against local perturbations. We numerically simulate such a system using exact diagonalization by restricting the calculation to the Laughlin quasihole subspace. We study the quantization of the total charge on each edge and show that the ground states are permuted by spin flux insertion and the parafermionic Josephson effect, evidencing their topological nature and the Cooper pairing of fractionalized quasiparticles. The full affiliation for Author 3 is: Laboratoire Pierre Aigrain, Ecole Normale Supérieure-PSL Research University, CNRS, Université Pierre et Marie Curie-Sorbonne Universités, Université Paris Diderot-Sorbonne Paris Cité, 24 rue Lhomond, 75231 Paris.

Evaluation of the Separability of Monodisperse Polystyrene Latex Microspheres in a Continuous Flow Electrophoresis System

NASA Technical Reports Server (NTRS)

Williams, G., Jr.

1983-01-01

The continuous flow electrophoresis system makes electrophoresis possible in a free flowing film of aqueous electrolyte medium. The sample is introduced at one end of the chamber and is subjected to a lateral dc field. This process separates the sample into fractions since each component has a distinctive electrophoric mobility. Evaluations were made of sample conductivity and buffer conductivity as they affect sample band spread and separation using the Continuous Particle Electrophoresis (CPE) system. Samples were prepared from mixtures of 5 percent and 1 percent polystyrene latex (PSL) microspheres which were .4, .56 and .7 microns in diameter. These were prepared in electrolyte media 1x and 3x the conductivity of the curtain buffer, approximately 150 and 450 micro mhos/cm. Samples with matched conductivities produced greater resolution and less band spread than those with 3x the conductivity of the curtain buffer.

Pedestrian accidents : a state-of-the-art 1970-1980

DOT National Transportation Integrated Search

1981-09-01

In 1979 in the United States, 8,090 pedestrians were killed in motor vehicle accidents out of a total of 51,093 total traffic fatalities. An estimated total of 150,000 police reported pedestrian accidents of all severities occurred during the same ye...

National Hydroclimatic Change and Infrastructure Adaptation Assessment: Region-Specific Adaptation Factors

EPA Science Inventory

Climate change, land use and socioeconomic developments are principal variables that define the need and scope of adaptive engineering and management to sustain water resource and infrastructure development. As described in IPCC (2007), hydroclimatic changes in the next 30-50 ye...

Yeasts as distinct life forms of fungi

USDA-ARS?s Scientific Manuscript database

This review describes all presently recognized genera of the Ascomycete yeasts (Saccharomycotina, budding yeasts, and the Taphrinomycotina, fission yeasts and related) as well as all currently recognized genera of the Basidiomycete yeasts. This update will be the lead chapter for a book entitled “Ye...

Cool Andromeda

NASA Image and Video Library

2013-01-28

In this new view of the Andromeda, also known as M31, galaxy from the Herschel space observatory, cool lanes of forming stars are revealed in the finest detail yet. M31 is the nearest major galaxy to our own Milky Way at a distance of 2.5 million light-ye

Targeting Environmental Quality to Improve Population Health and Lower Healthcare Costs

EPA Science Inventory

Key goals of health care reform are to stimulate innovative approaches to improve healthcare quality and clinical outcomes while holding down costs. To achieve these goals value-based payment places the needs of the patient first and encourages multi-stakeholder cooperation. Ye...

Dispersive Sachdev-Ye-Kitaev model: Band structure and quantum chaos

NASA Astrophysics Data System (ADS)

Zhang, Pengfei

2017-11-01

The Sachdev-Ye-Kitaev (SYK) model is a concrete model for a non-Fermi liquid with maximally chaotic behavior in (0 +1 ) dimensions. In order to gain some insights into real materials in higher dimensions where fermions could hop between different sites, here we consider coupling a SYK lattice by constant hopping. We call this the dispersive SYK model. Focusing on (1 +1 ) -dimensional homogeneous hopping, by either tuning the temperature or the relative strength of the random interaction (hopping) and constant hopping, we find a crossover between a dispersive metal to an incoherent metal, where the dynamic exponent z changes from 1 to ∞ . We study the crossover by calculating the spectral function, charge density correlator, and the Lyapunov exponent. We further find the Lyapunov exponent becomes larger when the chemical potential is tuned to approach a van Hove singularity because of the large density of states near the Fermi surface. The effect of the topological nontrivial bands is also discussed.

Competition between Chaotic and Nonchaotic Phases in a Quadratically Coupled Sachdev-Ye-Kitaev Model.

PubMed

Chen, Xin; Fan, Ruihua; Chen, Yiming; Zhai, Hui; Zhang, Pengfei

2017-11-17

The Sachdev-Ye-Kitaev (SYK) model is a concrete solvable model to study non-Fermi liquid properties, holographic duality, and maximally chaotic behavior. In this work, we consider a generalization of the SYK model that contains two SYK models with a different number of Majorana modes coupled by quadratic terms. This model is also solvable, and the solution shows a zero-temperature quantum phase transition between two non-Fermi liquid chaotic phases. This phase transition is driven by tuning the ratio of two mode numbers, and a nonchaotic Fermi liquid sits at the critical point with an equal number of modes. At a finite temperature, the Fermi liquid phase expands to a finite regime. More intriguingly, a different non-Fermi liquid phase emerges at a finite temperature. We characterize the phase diagram in terms of the spectral function, the Lyapunov exponent, and the entropy. Our results illustrate a concrete example of the quantum phase transition and critical behavior between two non-Fermi liquid phases.

Strongly Correlated Metal Built from Sachdev-Ye-Kitaev Models

NASA Astrophysics Data System (ADS)

Song, Xue-Yang; Jian, Chao-Ming; Balents, Leon

2017-11-01

Prominent systems like the high-Tc cuprates and heavy fermions display intriguing features going beyond the quasiparticle description. The Sachdev-Ye-Kitaev (SYK) model describes a (0 +1 )D quantum cluster with random all-to-all four-fermion interactions among N fermion modes which becomes exactly solvable as N →∞ , exhibiting a zero-dimensional non-Fermi-liquid with emergent conformal symmetry and complete absence of quasiparticles. Here we study a lattice of complex-fermion SYK dots with random intersite quadratic hopping. Combining the imaginary time path integral with real time path integral formulation, we obtain a heavy Fermi liquid to incoherent metal crossover in full detail, including thermodynamics, low temperature Landau quasiparticle interactions, and both electrical and thermal conductivity at all scales. We find linear in temperature resistivity in the incoherent regime, and a Lorentz ratio L ≡(κ ρ /T ) varies between two universal values as a function of temperature. Our work exemplifies an analytically controlled study of a strongly correlated metal.

Potential therapeutic agents for circulatory diseases from Bauhinia glauca Benth.subsp. pernervosa. (Da Ye Guan Men).

PubMed

Tang, Yingzhan; Ling, Junhong; Zhang, Peng; Zhang, Xiangrong; Zhang, Na; Wang, Wenli; Li, Jiayuan; Li, Ning

2015-08-15

Because of platelets as critical factor in the formation of pathogenic thrombi, anti-platelet activities have been selected as therapeutic target for various circulatory diseases. In order to find potential therapeutic agents, bioassay-directed separation of Bauhinia glauca Benth.subsp. pernervosa. (called Da Ye Guan Men as a traditional Chinese medicine) was performed to get 29 main components (compounds 1-29) from the bioactive part of this herbal. It was the first time to focus on the composition with anti-platelet aggregation activities for this traditional Chinese medicine. The constituents, characterized from the effective extract, were established on the basis of extensive spectral data analysis. Then their anti-platelet aggregation effects were evaluated systematically. On the basis of the chemical profile and biological assay, it was suggested that the flavonoid composition (5 and 18) should be responsible for the anti-platelet aggregation of the herbal because of their significant activities. The primary structure and activity relationship was also discussed briefly. Copyright © 2015. Published by Elsevier Ltd.

Sequence stratigraphy and environmental background of the late Pleistocene and Holocene occupation in the Southeast Primor'ye (the Russian Far East)

NASA Astrophysics Data System (ADS)

Chlachula, Jiri; Krupyanko, Alexander A.

2016-06-01

The paper presents the results of Quaternary palaeoecology and geoarchaeology studies in the Zerkal'naya Basin, with new insights about sequenced natural shifts during the prehistoric occupation of this marginally explored NE Asian maritime territory. The Basin is part of the continental drainage system and the main physiographic and biotic corridor for peopling of the transitive coastal interior SE Primor'ye Region. The Final Pleistocene and Holocene environmental (biotic and abiotic) proxy records from the Upper/Final Palaeolithic to early historical sites document a dynamic climate change with vegetation cover transformations within riverine and mountain valley ecosystems of the Russian Far East. Most of the archaeological sites located on the low terraces and bedrock promontories along the main river channel and its tributary streams suggest traditional hunter gathered lifestyles based on seasonal salmon-fishing supplemented by pastoral economy. Tundra-forests with larch trees, dwarf birch thickets and polypod ferns from the basal stratigraphic units of the late Last Glacial occupation sites associated with the Upper Palaeolithic micro-blade and bifacial stone tool traditions (14C-dated to 19,000-12,000 cal yrs BP) indicate rather pronounced conditions and much lower MAT comparing today. Following a final Pleistocene cooling event, a major climate warming marked the onset of Holocene accompanied by a regional humidity increase promoting the formation of a mixed broadleaved-coniferous oak-dominant taiga, and culminating in the mid-Holocene Climatic Optimum. The appearance of mosaic parklands ca. 5,000-4,000 cal yrs BP. may be partly attributed to the expansion of the Far Eastern Neolithic cultures practicing forest clearance for pastures and dwellings. A progressing landscape opening indicated by the spread of light-demanding thickets and birch-dominated riverine biotopes with Artemisia suggests a further vegetation cover transformation during the late Neolithic and the early Palaeo-Metal (Bronze Age) periods. This trend corroborates the documented climate deterioration between 3,400 and 2,600 cal yrs BP, causing a regional aridification with a parkland-steppe broadening in the main SE Primor'ye river valleys. The late Holocene climate development persisted until the Little Ice Age which led to formation of the present settlement ecosystems with mixed (oak/cedar/fir-dominated) temperate maritime woodlands.

Potential Ameliorative Effects of Qing Ye Dan Against Cadmium Induced Prostatic Deficits via Regulating Nrf-2/HO-1 and TGF-β1/Smad Pathways.

PubMed

Du, Lifen; Lei, Yongfang; Chen, Jinglou; Song, Hongping; Wu, Xinying

2017-01-01

Cadmium (Cd) is an environmental pollutant with reproductive toxicity. Swertia mileensis is used in Chinese medicine for the treatment of prostatic deficits and named as Qing Ye Dan (QYD). This study was undertaken to investigate the potential protective effects of QYD against Cd-induced prostatic deficits. Rat model of prostatic deficits was induced by 0.2 mg/kg/d CdCl2 subcutaneous injection for 15 days. The prostatic oxidative stress was evaluated by detecting the levels of malondialdehyde, nitric oxide, reduced/ oxidized glutathione, total sulfhydryl groups and enzymatic antioxidant status. The prostatic inflammation was estimated by testing the levels of pro-inflammatory cytokines. The levels of epithelial-mesenchymal transition (EMT) markers E-cadherin, fibronectin, vimentin and α-smooth muscle actin were measured by qPCR analysis. Additionally, the prostatic expressions of transforming growth factor-β1 (TGF-β1), type I TGF-β receptor (TGF-βRI), Smad2, phosphorylation-Smad2 (p-Smad2), Smad3, p-Smad3, Smad7, nuclear related factor-2 (Nrf-2), heme oxygenase-1 (HO-1), B-cell CLL/lymphoma (Bcl)-2 and Bcl-2-associated X protein (Bax) were measured by western blot assay. It was found that QYD ameliorated the Cd-induced prostatic oxidative stress and inflammation, attenuated prostatic EMT, inhibited the TGF-β1/Smad pathway, increased Bcl-2/Bax ratio and enhanced the activity of Nrf-2/HO-1 pathway. These results showed that QYD could ameliorate Cd-induced prostatic deficits via modulating Nrf-2/HO-1 and TGF-β1/Smad pathways. © 2017 The Author(s). Published by S. Karger AG, Basel.

Structure of the metal-dependent deacetylase LpxC from Yersinia enterocolitica complexed with the potent inhibitor CHIR-090 .

PubMed

Cole, Kathryn E; Gattis, Samuel G; Angell, Heather D; Fierke, Carol A; Christianson, David W

2011-01-18

The first committed step of lipid A biosynthesis is catalyzed by UDP-(3-O-((R)-3-hydroxymyristoyl))-N-acetylglucosamine deacetylase, a metal-dependent deacetylase also known as LpxC. Because lipid A is essential for bacterial viability, the inhibition of LpxC is an appealing therapeutic strategy for the treatment of Gram-negative bacterial infections. Here we report the 1.79 Å resolution X-ray crystal structure of LpxC from Yersinia enterocolitica (YeLpxC) complexed with the potent hydroxamate inhibitor CHIR-090. This enzyme is a nearly identical orthologue of LpxC from Yersinia pestis (99.7% sequence identity), the pathogen that causes bubonic plague. Similar to the inhibition of LpxC from Escherichia coli, CHIR-090 inhibits YeLpxC via a two-step slow, tight-binding mechanism with an apparent K(i) of 0.54 ± 0.14 nM followed by conversion of the E·I to E·I* species with a rate constant of 0.11 ± 0.01 min(-1). The structure of the LpxC complex with CHIR-090 shows that the inhibitor hydroxamate group chelates the active site zinc ion, and the "tail" of the inhibitor binds in the hydrophobic tunnel in the active site. This hydrophobic tunnel is framed by a βαβ subdomain that exhibits significant conformational flexibility as it accommodates inhibitor binding. CHIR-090 displays a 27 mm zone of inhibition against Y. enterocolitica in a Kirby-Bauer antibiotic assay, which is comparable to its reported activity against other Gram-negative species including E. coli and Pseudomonas aeruginosa. This study demonstrates that the inhibition of LpxC should be explored as a potential therapeutic and/or prophylatic response to infection by weaponized Yersinia species.

Development of cost-effective media to increase the economic potential for larger-scale bioproduction of natural food additives by Lactobacillus rhamnosus , Debaryomyces hansenii , and Aspergillus niger.

PubMed

Salgado, José Manuel; Rodríguez, Noelia; Cortés, Sandra; Domínguez, José Manuel

2009-11-11

Yeast extract (YE) is the most common nitrogen source in a variety of bioprocesses in spite of the high cost. Therefore, the use of YE in culture media is one of the major technical hurdles to be overcome for the development of low-cost fermentation routes, making the search for alternative-cheaper nitrogen sources particularly desired. The aim of the current study is to develop cost-effective media based on corn steep liquor (CSL) and locally available vinasses in order to increase the economic potential for larger-scale bioproduction. Three microorganisms were evaluated: Lactobacillus rhamnosus , Debaryomyces hansenii , and Aspergillus niger . The amino acid profile and protein concentration was relevant for the xylitol and citric acid production by D. hansenii and A. niger , respectively. Metals also played an important role for citric acid production, meanwhile, D. hansenii showed a strong dependence with the initial amount of Mg(2+). Under the best conditions, 28.8 g lactic acid/L (Q(LA) = 0.800 g/L.h, Y(LA/S) = 0.95 g/g), 35.3 g xylitol/L (Q(xylitol) = 0.380 g/L.h, Y(xylitol/S) = 0.69 g/g), and 13.9 g citric acid/L (Q(CA) = 0.146 g/L.h, Y(CA/S) = 0.63 g/g) were obtained. The economic efficiency (E(p/euro)) parameter identify vinasses as a lower cost and more effective nutrient source in comparison to CSL.

Preliminary Evaluation of Altitude Scaling for Turbofan Engine Ice Crystal Icing

NASA Technical Reports Server (NTRS)

Tsao, Jen-Ching

2017-01-01

Preliminary evaluation of altitude scaling for turbofan engine ice crystal icing simulation was conducted during the 2015 LF11 engine icing test campaign in PSL.The results showed that a simplified approach for altitude scaling to simulate the key reference engine ice growth feature and associated icing effects to the engine is possible. But special considerations are needed to address the facility operation limitation for lower altitude engine icing simulation.

USSR Report Engineering and Equipment.

DTIC Science & Technology

1987-05-04

Korenev , et al. ; ENERGETICHESKOYE STROITELSTVO, No 7, Jul 86) 33 Improving Fire Protection of Cables in Electric Power Plants (S.Ye. Korshunov...Russian No 7, Jul 86 pp 32-33 {Article by V.D. Likhachev, candidate of technical sciences, K.I. Korenev , candidate of technical sciences, K.I. Chikvaidze

Conformal and Nearly Conformal Theories at Large N

NASA Astrophysics Data System (ADS)

Tarnoplskiy, Grigory M.

In this thesis we present new results in conformal and nearly conformal field theories in various dimensions. In chapter two, we study different properties of the conformal Quantum Electrodynamics (QED) in continuous dimension d. At first we study conformal QED using large Nf methods, where Nf is the number of massless fermions. We compute its sphere free energy as a function of d, ignoring the terms of order 1/Nf and higher. For finite Nf we use the epsilon-expansion. Next we use a large Nf diagrammatic approach to calculate the leading corrections to CT, the coefficient of the two-point function of the stress-energy tensor, and CJ, the coefficient of the two-point function of the global symmetry current. We present explicit formulae as a function of d and check them versus the expectations in 2 and 4 - epsilon dimensions. In chapter three, we discuss vacuum stability in 1 + 1 dimensional conformal field theories with external background fields. We show that the vacuum decay rate is given by a non-local two-form. This two-form is a boundary term that must be added to the effective in/out Lagrangian. The two-form is expressed in terms of a Riemann-Hilbert decomposition for background gauge fields, and is given by its novel "functional'' version in the gravitational case. In chapter four, we explore Tensor models. Such models possess the large N limit dominated by the melon diagrams. The quantum mechanics of a real anti-commuting rank-3 tensor has a large N limit similar to the Sachdev-Ye-Kitaev (SYK) model. We also discuss the quantum mechanics of a complex 3-index anti-commuting tensor and argue that it is equivalent in the large N limit to a version of SYK model with complex fermions. Finally, we discuss models of a commuting tensor in dimension d. We study the spectrum of the large N quantum field theory of bosonic rank-3 tensors using the Schwinger-Dyson equations. We compare some of these results with the 4 - epsilon expansion, finding perfect agreement. We also study the spectra of bosonic theories of rank q - 1 tensors with φq interactions.

Wood Joist Floors: Probabilistic Analysis of Joist Stiffness Measured at Retail Lumberyards.

DTIC Science & Technology

1982-10-01

me.er maltsmctiued. Rad then a o minrama onotboo, Other species.) A 2 by 8 stamped S-ORN denotes that It was we choe to thsude m xcept for de variabls tha...t4- * 70 2.00 6o 0." 0,t50 -nO.16" 50 ~60 la -. 03 A .0.6 40 .: s 3.62 30040 2.70 20 - 30 10 20 0 . I * I Ip I * p . a10 .50 .60 .70 .80 .90 1.00...34kthstavrageft ye protely ere t. A discussion of the procedures for "idealizing," which considers variability in the histograms on thickness, width

Proceedings of the International Conference on The Performance of Off-Road Vehicles and Machines (8th). Volume 2. Held at Cambridge England, on August 5-11, 1984.

DTIC Science & Technology

1984-08-01

various wheel loads and gecoetries an an aid to vehicle design PO04 299 Flotation tires anc subsurface compaction POMl 300 Tractor power selection...soil copatiml steering computer modelling, vehicle -component design , measuremnt of soil and anow properties and soil bin facilitiesi and vehicle... design . 74 ~ Al i~~s W3 *1oe 9e e1 SALilsasifiLed seCUffiY cLataric*Ye ATWop ’ VA .-I rumo. .. nemraa~sociy m v smuAN vnaaz Yswros 1BR.NM 72 Lym AmI

STUDIES ON ADSORPTION OF 2-CHLORO BIPHENYL ON SEDIMENTS AND SEDIMENT COMPONENTS

EPA Science Inventory

Polychlorinated biphenyls, or PCBs, are a family of 209 structurally related chemical compounds (congeners), consisting of two benzene rings and 1 to 10 chlorine atoms. They range from light, oily fluids to heavier, greasy or waxy substances. PCBs were discovered more than 100 ye...

Q'epethet ye Mestiyexw, A Gathering of the People.

ERIC Educational Resources Information Center

Kenny, Carolyn; Archibald, Jo-ann

2000-01-01

A 4-week program in Vancouver (British Columbia) used traditional and academic formats to connect Aboriginal communities throughout British Columbia with each other and with Maori participants from New Zealand. A conference, a symposium and graduate courses covered the role of Aboriginal art, politics of transforming education, revitalization of…

Comfort Ye My People: Chaplains, Spiritual Care, and Operational Stress Injury

DTIC Science & Technology

2011-04-30

differently, offering "both ·a degree of predictability and an element of surprise.ඉ In the Hebrew Scriptures we read of Jacob who wrestles through...by the use of spiritual practices such as: prayer, meditation, Yoga, Bible reading, reading of other sacred Scripture, a twelve-step program

Dynamic flashing yellow arrow (FYA) : a study on variable left turn mode operational and safety impacts.

DOT National Transportation Integrated Search

2013-12-01

Accommodating left turns at signalized intersections has been a challenge for traffic engineers as they : seek balance between two conflicting goals; capacity and safety. The use of a four-section head for the left-turn : lane only with a flashing ye...

DOE Office of Scientific and Technical Information (OSTI.GOV)

Jevicki, Antal; Suzuki, Kenta

We continue the study of the Sachdev-Ye-Kitaev model in the Large N limit. Following our formulation in terms of bi-local collective fields with dynamical reparametrization symmetry, we perform perturbative calculations around the conformal IR point. As a result, these are based on an ε expansion which allows for analytical evaluation of correlators and finite temperature quantities.

Carbon dynamics and sequestration in urban turfgrass ecosystems

USDA-ARS?s Scientific Manuscript database

Urbanization is a global trend. Turfgrass covers 1.9% of land in the continental US. Here we review existing literature associated with carbon (C) pools, sequestration, and nitrous oxide emission of urban turfgrass ecosystems. Turfgrasses exhibit significant carbon sequestration (0.34–1.4 Mg ha-1 ye...

Modeling the Deterioration of Engine and Low Pressure Compressor Performance During a Roll Back Event Due to Ice Accretion

NASA Technical Reports Server (NTRS)

Veres, Joseph P.; Jorgenson, Philip, C. E.; Jones, Scott M.

2014-01-01

The main focus of this study is to apply a computational tool for the flow analysis of the engine that has been tested with ice crystal ingestion in the Propulsion Systems Laboratory (PSL) of NASA Glenn Research Center. A data point was selected for analysis during which the engine experienced a full roll back event due to the ice accretion on the blades and flow path of the low pressure compressor. The computational tool consists of the Numerical Propulsion System Simulation (NPSS) engine system thermodynamic cycle code, and an Euler-based compressor flow analysis code, that has an ice particle melt estimation code with the capability of determining the rate of sublimation, melting, and evaporation through the compressor blade rows. Decreasing the performance characteristics of the low pressure compressor (LPC) within the NPSS cycle analysis resulted in matching the overall engine performance parameters measured during testing at data points in short time intervals through the progression of the roll back event. Detailed analysis of the fan-core and LPC with the compressor flow analysis code simulated the effects of ice accretion by increasing the aerodynamic blockage and pressure losses through the low pressure compressor until achieving a match with the NPSS cycle analysis results, at each scan. With the additional blockages and losses in the LPC, the compressor flow analysis code results were able to numerically reproduce the performance that was determined by the NPSS cycle analysis, which was in agreement with the PSL engine test data. The compressor flow analysis indicated that the blockage due to ice accretion in the LPC exit guide vane stators caused the exit guide vane (EGV) to be nearly choked, significantly reducing the air flow rate into the core. This caused the LPC to eventually be in stall due to increasing levels of diffusion in the rotors and high incidence angles in the inlet guide vane (IGV) and EGV stators. The flow analysis indicating compressor stall is substantiated by the video images of the IGV taken during the PSL test, which showed water on the surface of the IGV flowing upstream out of the engine, indicating flow reversal, which is characteristic of a stalled compressor.

A comparison between temporal and subband minimum variance adaptive beamforming

NASA Astrophysics Data System (ADS)

Diamantis, Konstantinos; Voxen, Iben H.; Greenaway, Alan H.; Anderson, Tom; Jensen, Jørgen A.; Sboros, Vassilis

2014-03-01

This paper compares the performance between temporal and subband Minimum Variance (MV) beamformers for medical ultrasound imaging. Both adaptive methods provide an optimized set of apodization weights but are implemented in the time and frequency domains respectively. Their performance is evaluated with simulated synthetic aperture data obtained from Field II and is quantified by the Full-Width-Half-Maximum (FWHM), the Peak-Side-Lobe level (PSL) and the contrast level. From a point phantom, a full sequence of 128 emissions with one transducer element transmitting and all 128 elements receiving each time, provides a FWHM of 0.03 mm (0.14λ) for both implementations at a depth of 40 mm. This value is more than 20 times lower than the one achieved by conventional beamforming. The corresponding values of PSL are -58 dB and -63 dB for time and frequency domain MV beamformers, while a value no lower than -50 dB can be obtained from either Boxcar or Hanning weights. Interestingly, a single emission with central element #64 as the transmitting aperture provides results comparable to the full sequence. The values of FWHM are 0.04 mm and 0.03 mm and those of PSL are -42 dB and -46 dB for temporal and subband approaches. From a cyst phantom and for 128 emissions, the contrast level is calculated at -54 dB and -63 dB respectively at the same depth, with the initial shape of the cyst being preserved in contrast to conventional beamforming. The difference between the two adaptive beamformers is less significant in the case of a single emission, with the contrast level being estimated at -42 dB for the time domain and -43 dB for the frequency domain implementation. For the estimation of a single MV weight of a low resolution image formed by a single emission, 0.44 * 109 calculations per second are required for the temporal approach. The same numbers for the subband approach are 0.62 * 109 for the point and 1.33 * 109 for the cyst phantom. The comparison demonstrates similar resolution but slightly lower side-lobes and higher contrast for the subband approach at the expense of increased computation time.

Role of polysaccharides in Pseudomonas aeruginosa biofilm development

PubMed Central

Ryder, Cynthia; Byrd, Matthew; Wozniak, Daniel J.

2008-01-01

During the past decade, there has been a renewed interest in using P. aeruginosa as a model system for biofilm development and pathogenesis. Since the biofilm matrix represents a critical interface between the bacterium and the host or its environment, considerable effort has been expended to acquire a more complete understanding of the matrix composition. Here, we focus on recent developments regarding the roles of alginate, Psl, and Pel polysaccharides in the biofilm matrix. PMID:17981495

Supermultiplet of β-deformations from twistors

NASA Astrophysics Data System (ADS)

Milián, Segundo P.

2017-09-01

We consider the supermultiplet of linearized beta-deformation of 𝒩 = 4 super-Yang-Mills (SYM). It was previously studied on the gravitational side. We study the supermultiplet of beta-deformations on the field theory side and we compare two finite-dimensional representations of psl(4|4,R) algebra. We show that they are related by an intertwining operator. We develop a twistor-based approach which could be useful for studying other finite-dimensional and nonunitary representations in AdS/CFT correspondence.

Evaluation of the Performance of Iodine-Treated Biocidal Filters Under the Influence of Environmental Parameters

DTIC Science & Technology

2013-02-01

analysis for total virus count . To examine the effects of bioaerosol on the release of iodine from the triiodide resin medium, MS2 aerosol was treated with...airborne pathogens. 2.2.2. Viral Aerosols Bioaerosols are airborne particles with biological origins, such as nonviable pollen , and viable fungi...performed: collection efficiency of BioSampler, virus PSD by SMPS, plaque assay for virus infectivity, and PCR analysis for total virus count . PSL

Comparisons of Mixed-Phase Icing Cloud Simulations with Experiments Conducted at the NASA Propulsion Systems Laboratory

NASA Technical Reports Server (NTRS)

Bartkus, Tadas P.; Struk, Peter M.; Tsao, Jen-Ching

2017-01-01

This paper builds on previous work that compares numerical simulations of mixed-phase icing clouds with experimental data. The model couples the thermal interaction between ice particles and water droplets of the icing cloud with the flowing air of an icing wind tunnel for simulation of NASA Glenn Research Centers (GRC) Propulsion Systems Laboratory (PSL). Measurements were taken during the Fundamentals of Ice Crystal Icing Physics Tests at the PSL tunnel in March 2016. The tests simulated ice-crystal and mixed-phase icing that relate to ice accretions within turbofan engines. Experimentally measured air temperature, humidity, total water content, liquid and ice water content, as well as cloud particle size, are compared with model predictions. The model showed good trend agreement with experimentally measured values, but often over-predicted aero-thermodynamic changes. This discrepancy is likely attributed to radial variations that this one-dimensional model does not address. One of the key findings of this work is that greater aero-thermodynamic changes occur when humidity conditions are low. In addition a range of mixed-phase clouds can be achieved by varying only the tunnel humidity conditions, but the range of humidities to generate a mixed-phase cloud becomes smaller when clouds are composed of smaller particles. In general, the model predicted melt fraction well, in particular with clouds composed of larger particle sizes.

Understanding visual search patterns of dermatologists assessing pigmented skin lesions before and after online training.

PubMed

Krupinski, Elizabeth A; Chao, Joseph; Hofmann-Wellenhof, Rainer; Morrison, Lynne; Curiel-Lewandrowski, Clara

2014-12-01

The goal of this investigation was to explore the feasibility of characterizing the visual search characteristics of dermatologists evaluating images corresponding to single pigmented skin lesions (PSLs) (close-ups and dermoscopy) as a venue to improve training programs for dermoscopy. Two Board-certified dermatologists and two dermatology residents participated in a phased study. In phase I, they viewed a series of 20 PSL cases ranging from benign nevi to melanoma. The close-up and dermoscopy images of the PSL were evaluated sequentially and rated individually as benign or malignant, while eye position was recorded. Subsequently, the participating subjects completed an online dermoscopy training module that included a pre- and post-test assessing their dermoscopy skills (phase 2). Three months later, the subjects repeated their assessment on the 20 PSLs presented during phase I of the study. Significant differences in viewing time and eye-position parameters were observed as a function of level of expertise. Dermatologists overall have more efficient search than residents generating fewer fixations with shorter dwells. Fixations and dwells associated with decisions changing from benign to malignant or vice versa from photo to dermatoscopic viewing were longer than any other decision, indicating increased visual processing for those decisions. These differences in visual search may have implications for developing tools to teach dermatologists and residents about how to better utilize dermoscopy in clinical practice.

Phenomenological extraction of two-photon exchange amplitudes from elastic electron-proton scattering cross section data

NASA Astrophysics Data System (ADS)

Qattan, I. A.

2017-05-01

Background: The inconsistency in the results obtained from the Rosenbluth separation method and the high-Q2 recoil polarization results on the ratio μpGEp/GMp implies a systematic difference between the two techniques. Several studies suggest that missing higher-order radiative corrections to elastic electron-proton scattering cross section σR(ɛ ,Q2) and in particular hard two-photon-exchange (TPE) contributions could account for the discrepancy. Purpose: In this work, I improve on and extend to low and high Q2 values the extractions of the ɛ dependence of the real parts of the TPE amplitudes relative to the magnetic form factor, as well as the ratio Pl/PlBorn(ɛ ,Q2) by using world data on σR(ɛ ,Q2) with an emphasis on precise new data covering the low-momentum region which is sensitive to the large-scale structure of the nucleon. Method: I combine cross section and polarization measurements of elastic electron-proton scattering to extract the TPE amplitudes. Because the recoil polarization data were confirmed "experimentally" to be essentially independent of ɛ , I constrain the ratio Pt/Pl(ɛ ,Q2) to its ɛ -independent term (Born value) by setting the TPE contributions to zero. This allows for the amplitude YM(ɛ ,Q2) and σR(ɛ ,Q2) to be expressed in terms of the remaining two amplitudes YE(ɛ ,Q2) and Y3(ɛ ,Q2) which in turn are parametrized as second-order polynomials in ɛ and Q2 to reserve as possible the linearity of σR(ɛ ,Q2) as well as to account for possible nonlinearities in the TPE amplitudes. Furthermore, I impose the Regge limit which ensures the vanishing of the TPE contributions to σR(ɛ ,Q2) and the TPE amplitudes in the limit ɛ →1 . Results: I provide simple parametrizations of the TPE amplitudes, along with an estimate of the fit uncertainties. The extracted TPE amplitudes are compared with previous phenomenological extractions and TPE calculations. The Pl/PlBorn ratio is extracted by using the new parametrizations of the TPE amplitudes and compared to previous extractions, TPE calculations, and direct measurements at Q2=2.50(GeV /c ) 2 . Conclusions: The extracted TPE amplitudes are on the few-percentage-points level and behave roughly linearly with increasing Q2 where they become nonlinear at high Q2. Contrary to YM, which is influenced mainly by elastic contributions, I find YE to be influenced by inelastic contributions at large Q2 values. While YE and Y3 differ in magnitude, they have opposite sign and tend to partially cancel each other. This suggests that the TPE correction to σR(ɛ ,Q2) is driven mainly by YM and to a lesser extent by Y3 in agreement with previous phenomenological extractions and hadronic TPE calculations.

Teichmüller TQFT vs. Chern-Simons theory

NASA Astrophysics Data System (ADS)

Mikhaylov, Victor

2018-04-01

Teichmüller TQFT is a unitary 3d topological theory whose Hilbert spaces are spanned by Liouville conformal blocks. It is related but not identical to PSL(2, ℝ) Chern-Simons theory. To physicists, it is known in particular in the context of 3d-3d correspondence and also in the holographic description of Virasoro conformal blocks. We propose that this theory can be defined by an analytically-continued Chern-Simons path-integral with an unusual integration cycle. On hyperbolic three-manifolds, this cycle is singled out by the requirement of invertible vielbein. Mathematically, our proposal translates a known conjecture by Andersen and Kashaev into a conjecture about the Kapustin-Witten equations. We further explain that Teichmüller TQFT is dual to complex SL(2, ℂ) Chern-Simons theory at integer level k = 1, clarifying some puzzles previously encountered in the 3d-3d correspondence literature. We also present a new simple derivation of complex Chern-Simons theories from the 6d (2,0) theory on a lens space with a transversely-holomorphic foliation.

A proteomic approach reveals the variation in human platelet protein composition after storage at different temperatures.

PubMed

Wang, Shichun; Jiang, Tianlun; Fan, Yahan; Zhao, Shuming

2018-03-29

Cryopreservation can slow down the metabolism and decrease the risk of bacterial contamination. But, chilled platelets (PLTs) show a reduced period in circulation due to the rapid clearance by hepatic cells or spleen macrophages after transfusion. The deleterious changes that PLTs undergo are mainly considered the result of PLT protein variation. However, the basis for proteomic variation of stored PLTs remains poorly understood. Besides count, activation markers (CD62P and Annexin V), and aggregation, we used quantitative mass spectrometry to create the first comprehensive and quantitative human PLT proteome of samples stored at different temperatures (22°C, 10°C and -80°C). We found different conditions caused different platelet storage lesion (PSL). PLT count was decreased no matter at what temperature stored. PLTs viability at low temperature dropped by 21.78% and 11.21%, respectively, as compared 10.26% at room temperature, there were no significant differences between the storage methods. Membrane expression of CD62P gradually increased in all groups especially stored at 22°C up to 40% and 10°C up to 30%. However, exposure of PS on the PLT membrane was below 1% in every group. The PLT proteome showed there were 575 and 454 potential proteins identified by general iTRAQ analysis and phosphorylation iTRAQ a nalysis, respectively, among them, 33 common differentially expressed proteins caused by storage time and 44 caused by storage temperature Especially, membrane-bound proteins (such as FERMT3, STX4, MYL9 and TAGLN2) played key roles in PLT storage lesion. The pathways "Endocytosis", "Fc gamma R-mediated phagocytosis" and "Regulation of actin cytoskeleton" were affected predominantly by storage time. And the pathways "SNARE interactions in vesicular transport" and "Vasopressin-regulated water reabsorption" were affected by cold storage in our study. Proteomic results can help us to understand PLT biochemistry and physiology and thus unravel the mechanisms of PSL in time and space for more successful PLT transfusion therapy.

SU-F-T-558: ArcCheck for Patient Specific QA in Stereotactic Ablative Radiotherapy

DOE Office of Scientific and Technical Information (OSTI.GOV)

Ramachandran, P; RMIT University, Bundoora; Tajaldeen, A

2016-06-15

Purpose: Stereotactic Ablative Radiotherapy (SABR) is one of the most preferred treatment techniques for early stage lung cancer. This technique has been extended to other treatment sites like Spine, Liver, Scapula, Sternum etc., This has resulted in increased physics QA time on machine. In this study, we’ve tested the feasibility of using ArcCheck as an alternative method to replace film dosimetry. Methods: Twelve patients with varied diagnosis of Lung, Liver, scapula, sternum and Spine undergoing SABR were selected for this study. Pre-treatment QA was performed for all the patients which include ionization chamber and film dosimetry. The required gamma criteriamore » for each SABR plan to pass QA and proceed to treatment is 95% (3%,1mm). In addition to this routine process, the treatment plans were exported on to an ArcCheck phantom. The planned and measured dose from the ArcCheck device were compared using four different gamma criteria: 2%,2 mm, 3%,2 mm, 3%,1 mm and 3%, 3 mm. In addition to this, we’ve also introduced errors to gantry, collimator and couch angle to assess sensitivity of the ArcCheck with potential delivery errors. Results: The ArcCheck mean passing rates for all twelve cases were 76.1%±9.7% for gamma criteria 3%,1 mm, 89.5%±5.3% for 2%,2 mm, 92.6%±4.2% for 3%,2 mm, and 97.6%±2.4% for 3%,3 mm gamma criteria. When SABR spine cases are excluded, we observe ArcCheck passing rates higher than 95% for all the studied cases with 3%, 3mm, and ArcCheck results in acceptable agreement with the film gamma results. Conclusion: Our ArcCheck results at 3%, 3 mm were found to correlate well with our non-SABR spine routine patient specific QA results (3%,1 mm). We observed significant reduction in QA time on using ArcCheck for SABR QA. This study shows that ArcCheck could replace film dosimetry for all sites except SABR spine.« less

Development of biocontrol agents from food microbial isolates for controlling post-harvest peach brown rot caused by Monilinia fructicola.

PubMed

Zhou, Ting; Schneider, Karin E; Li, Xiu-Zhen

2008-08-15

An unconventional strategy of screening food microbes for biocontrol activity was used to develop biocontrol agents for controlling post-harvest peach brown rot caused by Monilinia fructicola. Forty-four microbial isolates were first screened for their biocontrol activity on apple fruit. Compared with the pathogen-only check, seven of the 44 isolates reduced brown rot incidence by >50%, including four bacteria: Bacillus sp. C06, Lactobacillus sp. C03-b and Bacillus sp. T03-c, Lactobacillus sp. P02 and three yeasts: Saccharomyces delbrueckii A50, S. cerevisiae YE-5 and S. cerevisiae A41. Eight microbial isolates were selected for testing on peaches by wound co-inoculation with mixtures of individual microbial cultures and conidial suspension of M. fructicola. Only two of them showed significant biocontrol activity after five days of incubation at 22 degrees C. Bacillus sp. C06 suppressed brown rot incidence by 92% and reduced lesion diameter by 88% compared to the pathogen-only check. Bacillus sp.T03-c reduced incidence and lesion diameter by 40% and 62%, respectively. The two isolates were compared with Pseudomonas syringae MA-4, a biocontrol agent for post-harvest peach diseases, by immersing peaches in an aliquot containing individual microbial isolates and the pathogen conidia. Treatments with isolates MA-4, C06 and T03-c significantly controlled brown rot by 91, 100, and 100% respectively. However, only isolates MA-4 and C06 significantly reduced brown rot by 80% and 15%, respectively when bacterial cells alone were applied. On naturally infected peaches, both the bacterial culture and its cell-free filtrate of the isolate C06 significantly controlled peach decay resulting in 77 and 90% reduction, respectively, whereas the treatment using only the bacterial cells generally had no effect. Isolate C06 is a single colony isolate obtained from a mesophilic cheese starter, and has been identified belonging to Bacillus amyloliquefaciens. The results have clearly demonstrated that isolate C06 has a great potential for being developed into a biocontrol agent.

Yeast probiotic supplementation mitigates some of the negative effects of heat stress in feedlot heifers

USDA-ARS?s Scientific Manuscript database

Heat stress (HS) in feedlot cattle can be detrimental to performance, health and profitability; however, utilization of feed additives has the potential to mitigate some of these negative effects. Therefore, this study was designed to determine if supplementation of a combination live yeast and ye...

Mustard seed meal for management of root-knot nematode and weeds in tomato production

USDA-ARS?s Scientific Manuscript database

Mustard seed meals of indian mustard [InM (Brassica juncea)] and yellow mustard [YeM (Sinapis alba)], alone and combined, were tested for effects on tomato (Solanum lycopersicum) plants and for suppression of southern root-knot nematode [RKN (Meloidogyne incognita)] and weed populations. In the gree...

How Can Service-Learning Prepare Students for the Workforce? Exploring the Potential of Positive Psychological Capital

ERIC Educational Resources Information Center

McElravy, L. J.; Matkin, Gina; Hastings, Lindsay J.

2018-01-01

Although service-learning increases several important development and learning outcomes in college students (Yorio & Ye, 2012), it is not clear whether service-learning is better preparing these students for their future careers (Gray, Ondaatje, Fricker, & Geschwind, 2000). To better understand the influence of service-learning on student…

Area-Wide Management of the Formosan subterranean termite, Coptotermes formosanus, Shiraki (Isoptera: Rhinotermitidae) in the New Orleans French Quarter

USDA-ARS?s Scientific Manuscript database

The Formosan subterranean termite, Coptotermes formosanus Shiraki (FST) was first introduced to the continental US after WWII. New Orleans’ French Quarter (FQ) in particular has been severely impacted experiencing reoccurring cycles of damages and repairs since FST was introduced to the region 65 ye...

Say YeSSSSS to Collaboration: Transforming Collaborative Mentoring Relationships

ERIC Educational Resources Information Center

Lamb, Dennis; Ludy, Robbie

2008-01-01

School administrators frequently find themselves working with personnel unprepared for the dynamics of the schools today. Thus, approaches to meeting the needs of newly hired (in-service or novice) teachers have manifested itself since the 1980s. As many researchers have indicated, formal evaluation of performance is essential to one's growth…

Supersymmetric Sachdev-Ye-Kitaev models

DOE PAGES

Fu, Wenbo; Gaiotto, Davide; Maldacena, Juan; ...

2017-01-13

We discuss a supersymmetric generalization of the Sachdev-Ye-Kitaev (SYK) model. These are quantum mechanical models involving N Majorana fermions. The supercharge is given by a polynomial expression in terms of the Majorana fermions with random coefficients. The Hamiltonian is the square of the supercharge. The N = 1 model with a single supercharge has unbroken supersymmetry at large N , but nonperturbatively spontaneously broken supersymmetry in the exact theory. We analyze the model by looking at the large N equation, and also by performing numerical computations for small values of N . We also compute the large N spectrum ofmore » “singlet” operators, where we find a structure qualitatively similar to the ordinary SYK model. We also discuss an N = 2 version. In this case, the model preserves supersymmetry in the exact theory and we can compute a suitably weighted Witten index to count the number of ground states, which agrees with the large N computation of the entropy. In both cases, we discuss the supersymmetric generalizations of the Schwarzian action which give the dominant effects at low energies.« less

Approximating the Sachdev-Ye-Kitaev model with Majorana wires

NASA Astrophysics Data System (ADS)

Chew, Aaron; Essin, Andrew; Alicea, Jason

The Sachdev-Ye-Kitaev (SYK) model describes a large collection of Majorana fermions coupled via random, `all-to-all' four-fermion interactions. This model enjoys broad interdisciplinary interest because it provides a solvable realization of holography in 0+1 dimensions, exhibits unusual spectral and thermodynamic properties, and shares deep connections to chaos and black holes. We propose a solid-state implementation of the SYK Hamiltonian that employs quantum dots coupled to arrays of topological superconductors hosting Majorana end-states. All-to-all four-Majorana couplings are mediated by interactions in the dot, while the randomness originates from disorder in the hoppings between the Majorana modes and dot levels. Using perturbation theory and explicit numerics, we study the properties of the dot-wire array system under various experimental conditions. Interestingly, our setup not only allows exploration of SYK physics, but also provides a controlled testbed for interaction effects on the topological classification of fermionic phases. Supported by the National Science Foundation (DMR-1341822), Institute for Quantum Information and Matter, and Walter Burke Institute at Caltech. AC gratefully acknowledges support from the Dominic Orr Fellowship.

Tools reference manual for a Requirements Specification Language (RSL), version 2.0

NASA Technical Reports Server (NTRS)

Fisher, Gene L.; Cohen, Gerald C.

1993-01-01

This report describes a general-purpose Requirements Specification Language, RSL. The purpose of RSL is to specify precisely the external structure of a mechanized system and to define requirements that the system must meet. A system can be comprised of a mixture of hardware, software, and human processing elements. RSL is a hybrid of features found in several popular requirements specification languages, such as SADT (Structured Analysis and Design Technique), PSL (Problem Statement Language), and RMF (Requirements Modeling Framework). While languages such as these have useful features for structuring a specification, they generally lack formality. To overcome the deficiencies of informal requirements languages, RSL has constructs for formal mathematical specification. These constructs are similar to those found in formal specification languages such as EHDM (Enhanced Hierarchical Development Methodology), Larch, and OBJ3.

Astronaut Alan B. Shepard has his blood pressure and temperature checked

NASA Technical Reports Server (NTRS)

1961-01-01

Astronaut Alan B. Shepard has a thermometer in his mouth to check his temperature checked prior to his Mercury-Redstone 3 (MR-3) mission, the first American manned suborbital space flight (02739); Shepard has his heart rate checked. The attending physician is Dr. William K. Douglas (02740).

Private Student Loans. Report to the Senate Committee on Banking, Housing, and Urban Affairs, the Senate Committee on Health, Education, Labor, and Pensions, the House of Representatives Committee on Financial Services, and the House of Representatives Committee on Education and the Workforce

ERIC Educational Resources Information Center

Consumer Financial Protection Bureau, 2012

2012-01-01

American consumers owe more than $150 billion in outstanding private student loan debt. While this amount is significantly less than the amount outstanding on student loans guaranteed by the federal government, the private student loan ("PSL") product is an important component of higher education finance and does not appear to be well…

Planetary exploration with nanosatellites: a space campus for future technology development

NASA Astrophysics Data System (ADS)

Drossart, P.; Mosser, B.; Segret, B.

2017-09-01

Planetary exploration is at the eve of a revolution through nanosatellites accompanying larger missions, or freely cruising in the solar system, providing a man-made cosmic web for in situ or remote sensing exploration of the Solar System. A first step is to build a specific place dedicated to nanosatellite development. The context of the CCERES PSL space campus presents an environment for nanosatellite testing and integration, a concurrent engineering facility room for project analysis and science environment dedicated to this task.

Risk assessment of debris flow in Yushu seismic area in China: a perspective for the reconstruction

NASA Astrophysics Data System (ADS)

Lan, H. X.; Li, L. P.; Zhang, Y. S.; Gao, X.; Liu, H. J.

2013-11-01

The 14 April 2010 Ms = 7.1 Yushu Earthquake (YE) had caused severe damage in the Jiegu township, the residential centre of Yushu Tibetan Autonomous Prefecture, Qinghai Province, China. In view of the fragile geological conditions after YE, risk assessment of secondary geohazards becomes an important concern for the reconstruction. A quantitative methodology was developed to assess the risk of debris flow by taking into account important intensity information. Debris flow scenarios were simulated with respect to rainfall events with 10, 50 and 100 yr returning period, respectively. The possible economic loss and fatalities caused by damage to buildings were assessed both in the settlement area and in the low hazard settlement area regarding the simulated debris flow events. Three modelled building types were adopted, i.e. hollow brick wood (HBW), hollow brick concrete (HBC) and reinforced concrete (RC) buildings. The results suggest that HBC structure achieves a good balance for the cost-benefit relationship compared with HBW and RC structures and thus could be an optimal choice for most of the new residential buildings in the Jiegu township. The low hazard boundary presents significant risk reduction efficiency in the 100 yr returning debris flow event. In addition, the societal risk for the settlement area is unacceptable when the 100 yr returning event occurs but reduces to ALARP (as low as reasonably practicable) level as the low hazard area is considered. Therefore, the low hazard area was highly recommended to be taken into account in the reconstruction. Yet, the societal risk might indeed approach an unacceptable level if one considers that YE has inevitably increased the occurrence frequency of debris flow. The quantitative results should be treated as a perspective for the reconstruction rather than precise numbers of future losses, owing to the complexity of the problem and the deficiency of data.

Application of a combined approach involving classical random mutagenesis and metabolic engineering to enhance FK506 production in Streptomyces sp. RM7011.

PubMed

Mo, SangJoon; Lee, Sung-Kwon; Jin, Ying-Yu; Oh, Chung-Hun; Suh, Joo-Won

2013-04-01

FK506 production by a mutant strain (Streptomyces sp. RM7011) induced by N-methyl-N'-nitro-N-nitrosoguanidine and ultraviolet mutagenesis was improved by 11.63-fold (94.24 mg/l) compared to that of the wild-type strain. Among three different metabolic pathways involved in the biosynthesis of methylmalonyl-CoA, only expression of propionyl-CoA carboxylase (PCC) pathway led to a 1.75-fold and 2.5-fold increase in FK506 production and the methylmalonyl-CoA pool, respectively, compared to those of the RM7011 strain. Lipase activity of the high FK506 producer mutant increased in direct proportion to the increase in FK506 yield, from low detection level up to 43.1 U/ml (12.6-fold). The level of specific FK506 production and lipase activity was improved by enhancing the supply of lipase inducers. This improvement was approximately 1.88-fold (71.5 mg/g) with the supplementation of 5 mM Tween 80, which is the probable effective stimulator in lipase production, to the R2YE medium. When 5 mM vinyl propionate was added as a precursor for PCC pathway to R2YE medium, the specific production of FK506 increased approximately 1.9-fold (71.61 mg/g) compared to that under the non-supplemented condition. Moreover, in the presence of 5 mM Tween 80, the specific FK506 production was approximately 2.2-fold (157.44 mg/g) higher than that when only vinyl propionate was added to the R2YE medium. In particular, PCC expression in Streptomyces sp. RM7011 (RM7011/pSJ1003) together with vinyl propionate feeding resulted in an increase in the FK506 titer to as much as 1.6-fold (251.9 mg/g) compared with that in RM7011/pSE34 in R2YE medium with 5 mM Tween 80 supplementation, indicating that the vinyl propionate is more catabolized to propionate by stimulated lipase activity on Tween 80, that propionyl-CoA yielded from propionate generates methylmalonyl-CoA, and that the PCC pathway plays a key role in increasing the methylmalonyl-CoA pool for FK506 biosynthesis in RM7011 strain. Overall, these results show that a combined approach involving classical random mutation and metabolic engineering can be applied to supply the limiting factor for FK506 biosynthesis, and vinyl propionate could be successfully used as a precursor of important methylmalonyl-CoA building blocks.

DOE Office of Scientific and Technical Information (OSTI.GOV)

Nakaguchi, Yuji, E-mail: nkgc2003@yahoo.co.jp; Ono, Takeshi; Onitsuka, Ryota

COMPASS system (IBA Dosimetry, Schwarzenbruck, Germany) and ArcCHECK with 3DVH software (Sun Nuclear Corp., Melbourne, FL) are commercial quasi-3-dimensional (3D) dosimetry arrays. Cross-validation to compare them under the same conditions, such as a treatment plan, allows for clear evaluation of such measurement devices. In this study, we evaluated the accuracy of reconstructed dose distributions from the COMPASS system and ArcCHECK with 3DVH software using Monte Carlo simulation (MC) for multi-leaf collimator (MLC) test patterns and clinical VMAT plans. In a phantom study, ArcCHECK 3DVH showed clear differences from COMPASS, measurement and MC due to the detector resolution and the dosemore » reconstruction method. Especially, ArcCHECK 3DVH showed 7% difference from MC for the heterogeneous phantom. ArcCHECK 3DVH only corrects the 3D dose distribution of treatment planning system (TPS) using ArcCHECK measurement, and therefore the accuracy of ArcCHECK 3DVH depends on TPS. In contrast, COMPASS showed good agreement with MC for all cases. However, the COMPASS system requires many complicated installation procedures such as beam modeling, and appropriate commissioning is needed. In terms of clinical cases, there were no large differences for each QA device. The accuracy of the compass and ArcCHECK 3DVH systems for phantoms and clinical cases was compared. Both systems have advantages and disadvantages for clinical use, and consideration of the operating environment is important. The QA system selection is depending on the purpose and workflow in each hospital.« less

Corrosion Modeling and Testing of Riveted Aluminum Alloy Panel

DTIC Science & Technology

2012-08-28

Curve Measurement • V-I measurement using rotating disk electrode ( RDE ) captures mass transport contribution • Mass transport can be important for...curve measurement needed Rotating Disk Electrode ( RDE ) y = 0.0353x + 0.1796 0 10 20 30 40 50 60 70 0.0 0.1 0.2 0.3 0.4 0.5 0.6 0.7 0 5 10 15 B ou nd...ar y la ye r t hi ck ne ss , um D iff us io n Li m ite d C ur re nt ( m A /c m 2 ) Rotation Rate, w1/2 (radian s-1)1/2 Cu RDE Tests IL, mA

Water Quality Management Studies, Lake Seminole, February-December 1979. Phase II.

DTIC Science & Technology

1982-12-01

Carbon, Dissolved Organtc X X X X X X X Carbon. Total Organic I I X I X X" X Carbon Dioxide I X X X X X X I trogen. Total Amonia I X I X X X I Nitrogen...were less than 1 mg S04/1. During Phase I and Phase II there were no distinctive trends in measured carbon dioxide levels. However, there was a tendency...6. so 0 To CARSON DIOXIDE (MG C02.01. 0 1.3 Re 1. Re 0. 2* 0 NITROGEN. TOTAL AMMONIA IMG N/’LI 0.02 < 0.02 < 0.02 CO (002 ’ NITROG01. NITPATE.NITT2lYE

38 CFR 3.1003 - Returned and canceled checks.

Code of Federal Regulations, 2010 CFR

2010-07-01

... 38 Pensions, Bonuses, and Veterans' Relief 1 2010-07-01 2010-07-01 false Returned and canceled... canceled checks. Where the payee of a check for benefits has died prior to negotiating the check, the check shall be returned to the issuing office and canceled. (a) The amount represented by the returned check...

14 CFR 121.411 - Qualifications: Check airmen (airplane) and check airmen (simulator).

Code of Federal Regulations, 2014 CFR

2014-01-01

... 14 Aeronautics and Space 3 2014-01-01 2014-01-01 false Qualifications: Check airmen (airplane) and... § 121.411 Qualifications: Check airmen (airplane) and check airmen (simulator). Link to an amendment... airman (airplane) is a person who is qualified, and permitted, to conduct flight checks or instruction in...

Study of Electromagnetic Wave Absorption Properties of Carbon Nanotubes-Based Composites

DTIC Science & Technology

2012-11-29

Publications: [1]. G. L. Zhao, Z. Ye, Z. Li, J. A. Roberts, "New carbon nanotube-epoxy composite for dampening microwave cavity resonance", IEEE Xplore ...Nanotechnology ( IEEE - NANO), 2012 12th IEEE Conference on 20-23 Aug. 2012. [2]. Z. Li, G. L. Zhao, P. Zhang, S. Guo, J. Tang, " Thermoelectric

Integrated Surveillance for the Next Generation Air Transportation System. Final Report of the Integrated Surveillance Study Team

DTIC Science & Technology

2008-10-31

Navigation Services Working Group Jan de Regt FAA Tony Richardson JPDO Technical Support James Roberts DoD AFFSA Eric Rolfe JPDO Air Navigation...Kirsch DHS Drew Kuepper DoD eragency Architecture and Engineering Division Jay Merkle JPDO Int Paul Polski DHS ing GroupElizabeth Lynn ye JPDO Air

"This Is London, How D'ye Like It?": Teaching the Streets in Eighteenth-Century London

ERIC Educational Resources Information Center

McGraw, Ken

2017-01-01

As a professor of eighteenth-century British Literature I am often tasked (like my colleagues in other areas) with constructing a period based syllabus that "represents" this portion of literary history. Every semester, without fail, I am befuddled by the word "represents." How, exactly, do I want to "represent" the…

Bi-local holography in the SYK model: Perturbations

DOE PAGES

Jevicki, Antal; Suzuki, Kenta

2016-11-08

We continue the study of the Sachdev-Ye-Kitaev model in the Large N limit. Following our formulation in terms of bi-local collective fields with dynamical reparametrization symmetry, we perform perturbative calculations around the conformal IR point. As a result, these are based on an ε expansion which allows for analytical evaluation of correlators and finite temperature quantities.

Pigmentation restored in mutant laboratory strain of the lady beetle Coleomegilla maculata through dietary supplementation

USDA-ARS?s Scientific Manuscript database

A laboratory colony of Coleomegilla maculata (DeGeer), ye, selected for a pigmentation deficiency, was restored to near wild type cuticle coloration by adding crushed heads and wings of the red colored parental strain to the diet. While the wings and other colored portions of the cuticle regained th...

Bibliography of Soviet Laser Developments, Number 90, July-August 1987

DTIC Science & Technology

1988-06-27

8, 1987, 1250-1255. 51. Cernai, K.; Novakov , M. 0. Concentration dependence of stimulated emission in 4-methylumbelliferone-fluorescein laser dye...118 PANCHENKO I P 129 NADENENKO A V 29 NOVAK A 9 PANCHENKO V YA 18 NADEZHDINSKIY A 1 115 NOVAKOV 14 7 PANKOV F N 88 NAGORNYKH S N 121 NOVICHENKOV V YE

An Investigation Into the Feasibility of Establishing Manpower Standards for Major Air Command Engineering and Services Organizations.

DTIC Science & Technology

1984-09-01

time ;oent ikontcorvng, enforcing. and rs,) lving *Lfitculties ind discrepancies inouLd ilso ye Lncluded. time 131 5. 9required to houdjet or:74rias...OH: Grid Publishers, 1979. 21. McNichols, Charles W. An Introduction to Applied Mltivariate Data Analysis, Unpublished Notes. Air Force Institute of

Frank, We Hardly Knew Ye: The Very Personal Side of Frank Parsons

ERIC Educational Resources Information Center

Pope, Mark; Sveinsdottir, Maria

2005-01-01

This article is a detailing of the limited information available regarding the personal life of Frank Parsons, who is credited with founding the career counseling specialization of modern day professional counseling as well as all professional counseling and the related fields of vocational psychology and counseling psychology in the early 1900s.…

Study of Chlamydia trachomatis in Military Women; Prevalence, Risk Factors, and a Cost Benefit Analysis of Early Diagnosis and Treatment

DTIC Science & Technology

1998-09-01

lymphogranuloma venereum (LGV). .?.■ Methods: One hundred and ninety seven consecutive men with a clinical presentation coasUtent with IJGV were...REACTION FOR THE DIAGNOSIS OF \\J 1 / Z> LYMPIIOGRANULOMA VENEREUM IN SOUTHERN AFRICA. Radebc F. Fehler HG, Ye Hrun. Tshabalala V, Ballard RC j V

USSR Report, Earth Sciences.

DTIC Science & Technology

1985-04-19

Specifics of Geology of Saryshagan Molybdenum- Copper - Porphyry Deposit (Northwestern Balkash Area) (Yu. K. Kudryavtsev, V. V. Izotov, et al...SPECIFICS’OF GEOLOGY OF SARYSHAGAN MOLYBDENUM- COPPER - PORPHYRY DEPOSIT (NORTHWESTERN BALKASH AREA) Moscow IZVESTIYA VYSSHIKH UCHEBNYKH ZAVEDENIY... Copper , Lead and Cadmium in Ooze Water of Central Pacific (A. Ye. Kosov, T. P. Demidova; GEOKHIMIYA, No 10, Oct 84) 37 Nickel Minerals in

Modeling the interannual variability of microbial quality metrics of irrigation water in a Pennsylvanian stream

USDA-ARS?s Scientific Manuscript database

Knowledge of the microbial quality of irrigation waters is extremely limited. For this reason, the US FDA has promulgated the Produce Rule, mandating the testing of irrigation water sources for many farms. The rule requires the collection and analysis of at least 20 water samples over two to four ye...

Assessment of check-dam groundwater recharge with water-balance calculations

NASA Astrophysics Data System (ADS)

Djuma, Hakan; Bruggeman, Adriana; Camera, Corrado; Eliades, Marinos

2017-04-01

Studies on the enhancement of groundwater recharge by check-dams in arid and semi-arid environments mainly focus on deriving water infiltration rates from the check-dam ponding areas. This is usually achieved by applying simple water balance models, more advanced models (e.g., two dimensional groundwater models) and field tests (e.g., infiltrometer test or soil pit tests). Recharge behind the check-dam can be affected by the built-up of sediment as a result of erosion in the upstream watershed area. This natural process can increase the uncertainty in the estimates of the recharged water volume, especially for water balance calculations. Few water balance field studies of individual check-dams have been presented in the literature and none of them presented associated uncertainties of their estimates. The objectives of this study are i) to assess the effect of a check-dam on groundwater recharge from an ephemeral river; and ii) to assess annual sedimentation at the check-dam during a 4-year period. The study was conducted on a check-dam in the semi-arid island of Cyprus. Field campaigns were carried out to measure water flow, water depth and check-dam topography in order to establish check-dam water height, volume, evaporation, outflow and recharge relations. Topographic surveys were repeated at the end of consecutive hydrological years to estimate the sediment built up in the reservoir area of the check dam. Also, sediment samples were collected from the check-dam reservoir area for bulk-density analyses. To quantify the groundwater recharge, a water balance model was applied at two locations: at the check-dam and corresponding reservoir area, and at a 4-km stretch of the river bed without check-dam. Results showed that a check-dam with a storage capacity of 25,000 m3 was able to recharge to the aquifer, in four years, a total of 12 million m3 out of the 42 million m3 of measured (or modelled) streamflow. Recharge from the analyzed 4-km long river section without check-dam was estimated to be 1 million m3. Upper and lower limits of prediction intervals were computed to assess the uncertainties of the results. The model was rerun with these values and resulted in recharge values of 0.4 m3 as lower and 38 million m3 as upper limit. The sediment survey in the check-dam reservoir area showed that the reservoir area was filled with 2,000 to 3,000 tons of sediment after one rainfall season. This amount of sediment corresponds to 0.2 to 2 t h-1 y-1 sediment yield at the watershed level and reduces the check-dam storage capacity by approximately 10%. Results indicate that check-dams are valuable structures for increasing groundwater resources, but special attention should be given to soil erosion occurring in the upstream area and the resulting sediment built-up in the check-dam reservoir area. This study has received funding from the EU FP7 RECARE Project (GA 603498)

Current Use of Underage Alcohol Compliance Checks by Enforcement Agencies in the U.S.

PubMed Central

Erickson, Darin J.; Lenk, Kathleen M.; Sanem, Julia R.; Nelson, Toben F.; Jones-Webb, Rhonda; Toomey, Traci L.

2014-01-01

Background Compliance checks conducted by law enforcement agents can significantly reduce the likelihood of illegal alcohol sales to underage individuals, but these checks need to be conducted using optimal methods to maintain effectiveness. Materials and Methods We conducted a national survey of local and state enforcement agencies in 2010–2011 to assess: (1) how many agencies are currently conducting underage alcohol compliance checks, (2) how many agencies that conduct compliance checks use optimal methods—including checking all establishments in the jurisdiction, conducting checks at least 3–4 times per year, conducting follow-up checks within 3 months, and penalizing the licensee (not only the server/clerk) for failing a compliance check, and (3) characteristics of the agencies that conduct compliance checks. Results Just over one third of local law enforcement agencies and over two thirds of state agencies reported conducting compliance checks. However, only a small percentage of the agencies (4–6%) reported using all of the optimal methods to maximize effectiveness of these compliance checks. Local law enforcement agencies with an alcohol-related division, those with at least one full-time officer assigned to work on alcohol, and those in larger communities were significantly more likely to conduct compliance checks. State agencies with more full-time agents and those located in states where the state agency or both state and local enforcement agencies have primary responsibility (vs. only the local law agency) for enforcing alcohol retail laws were also more likely to conduct compliance checks; however, these agency characteristics did not remain statistically significant in the multivariate analyses. Conclusions Continued effort is needed to increase the number of local and state agencies conducting compliance checks using optimal methods to reduce youth access to alcohol. PMID:24716443

T-cell-replete haploidentical stem cell transplantation is highly efficacious for relapsed and refractory childhood acute leukaemia.

PubMed

Kobayashi, S; Ito, M; Sano, H; Mochizuki, K; Akaihata, M; Waragai, T; Ohara, Y; Hosoya, M; Ohto, H; Kikuta, A

2014-10-01

Despite improvements in first-line therapies, the outcomes of relapsed or refractory childhood acute leukaemia that has not achieved complete remission after relapse, has relapsed after stem cell transplantation (SCT), has primary induction failure and has relapsed with a very unfavourable cytogenetic risk profile, are dismal. We evaluated the feasibility and efficacy of T-cell-replete haploidentical peripheral blood stem cell transplantation (haplo-SCT) with low-dose anti-human thymocyte immunoglobulin (ATG), tacrolimus, methotrexate and prednisolone (PSL) in 14 paediatric patients with high-risk childhood acute leukaemia. All patients achieved complete engraftment. The median time to reaching an absolute neutrophil count of more than 0.5 × 10(9) L(-1) was 14 days. Acute graft-vs-host disease (aGVHD) of grades II-IV and III-IV developed in 10 (71%) and 2 (14%) patients, respectively. Treatment-related mortality and relapse occurred in one (7%) patient and six (43%) patients, respectively. Eleven patients were alive and seven of them were disease-free with a median follow-up of 36 months (range: 30-159 months). The probability of event-free survival after 2 years was 50%. These findings indicate that T-cell-replete haplo-SCT, with low-dose ATG and PSL, provides sustained remission with an acceptable risk of GVHD in paediatric patients with advanced haematologic malignancies. © 2014 The Authors. Transfusion Medicine published by John Wiley & Sons Ltd on behalf of British Blood Transfusion Society.

[An autopsy case of amyotrophic lateral sclerosis with prominent muscle cramps, fasciculation, and high titer of anti-voltage gated potassium channel (VGKC) complex antibody].

PubMed

Sato, Aki; Sakai, Naoko; Shinbo, Junsuke; Hashidate, Hideki; Igarashi, Shuichi; Kakita, Akiyoshi; Yamazaki, Motoyoshi

2014-01-01

The patient was a 55-year-old male who had prominent fasciculation and muscle cramps. Muscle weakness and atrophy of the trunk, respiratory system, and extremities gradually progressed. On the basis of these features, we diagnosed this patient as having amyotrophic lateral sclerosis (ALS), however, the upper motor neuron signs were not significant. Following the detection of the anti-voltage gated potassium channel (VGKC) complex antibody at 907.5 pM (normal < 100 pM) and repetitive discharge in a nerve conduction study, immunotherapy with intravenous immunoglobulin, methylprednisolone (mPSL), double filtration plasmapheresis (DFPP), ciclosporin, and rituximab was introduced. mPSL and DFPP showed only tentative effectiveness for fasciculation and muscle cramps, respectively. Thereafter, muscle weakness progressed. The patient died of type II respiratory failure at the age of 57 years, about 2 years after the onset of the disease. At autopsy, a histopathological diagnosis of ALS with lower-motor-predominant degeneration was made. Characteristic cellular features, including Bunina bodies in the remaining lower motor neurons and phosphorylated TAR DNA-binding protein 43-kDa (pTDP-43)-immunopositive inclusions in both upper and lower motor neuron systems, were evident. At present, an immunological role of the anti-VGKC complex antibody in the development of cramp-fasciculation syndrome has been speculated. In this ALS patient, the antibodies might be associated with pathomechanisms underlying the characteristic symptoms.

14 CFR 121.411 - Qualifications: Check airmen (airplane) and check airmen (simulator).

Code of Federal Regulations, 2012 CFR

2012-01-01

... 14 Aeronautics and Space 3 2012-01-01 2012-01-01 false Qualifications: Check airmen (airplane) and... § 121.411 Qualifications: Check airmen (airplane) and check airmen (simulator). (a) For the purposes of this section and § 121.413: (1) A check airman (airplane) is a person who is qualified, and permitted...

14 CFR 121.411 - Qualifications: Check airmen (airplane) and check airmen (simulator).

Code of Federal Regulations, 2011 CFR

2011-01-01

... 14 Aeronautics and Space 3 2011-01-01 2011-01-01 false Qualifications: Check airmen (airplane) and... § 121.411 Qualifications: Check airmen (airplane) and check airmen (simulator). (a) For the purposes of this section and § 121.413: (1) A check airman (airplane) is a person who is qualified, and permitted...

14 CFR 121.411 - Qualifications: Check airmen (airplane) and check airmen (simulator).

Code of Federal Regulations, 2013 CFR

2013-01-01

... 14 Aeronautics and Space 3 2013-01-01 2013-01-01 false Qualifications: Check airmen (airplane) and... § 121.411 Qualifications: Check airmen (airplane) and check airmen (simulator). (a) For the purposes of this section and § 121.413: (1) A check airman (airplane) is a person who is qualified, and permitted...

14 CFR 121.411 - Qualifications: Check airmen (airplane) and check airmen (simulator).

Code of Federal Regulations, 2010 CFR

2010-01-01

... 14 Aeronautics and Space 3 2010-01-01 2010-01-01 false Qualifications: Check airmen (airplane) and... § 121.411 Qualifications: Check airmen (airplane) and check airmen (simulator). (a) For the purposes of this section and § 121.413: (1) A check airman (airplane) is a person who is qualified, and permitted...

The dopamine D2/D3 receptor agonist quinpirole increases checking-like behaviour in an operant observing response task with uncertain reinforcement: A novel possible model of OCD?

PubMed Central

Eagle, Dawn M.; Noschang, Cristie; d’Angelo, Laure-Sophie Camilla; Noble, Christie A.; Day, Jacob O.; Dongelmans, Marie Louise; Theobald, David E.; Mar, Adam C.; Urcelay, Gonzalo P.; Morein-Zamir, Sharon; Robbins, Trevor W.

2014-01-01

Excessive checking is a common, debilitating symptom of obsessive-compulsive disorder (OCD). In an established rodent model of OCD checking behaviour, quinpirole (dopamine D2/3-receptor agonist) increased checking in open-field tests, indicating dopaminergic modulation of checking-like behaviours. We designed a novel operant paradigm for rats (observing response task (ORT)) to further examine cognitive processes underpinning checking behaviour and clarify how and why checking develops. We investigated i) how quinpirole increases checking, ii) dependence of these effects on D2/3 receptor function (following treatment with D2/3 receptor antagonist sulpiride) and iii) effects of reward uncertainty. In the ORT, rats pressed an ‘observing’ lever for information about the location of an ‘active’ lever that provided food reinforcement. High- and low-checkers (defined from baseline observing) received quinpirole (0.5 mg/kg, 10 treatments) or vehicle. Parametric task manipulations assessed observing/checking under increasing task demands relating to reinforcement uncertainty (variable response requirement and active-lever location switching). Treatment with sulpiride further probed the pharmacological basis of long-term behavioural changes. Quinpirole selectively increased checking, both functional observing lever presses (OLPs) and non-functional extra OLPs (EOLPs). The increase in OLPs and EOLPs was long-lasting, without further quinpirole administration. Quinpirole did not affect the immediate ability to use information from checking. Vehicle and quinpirole-treated rats (VEH and QNP respectively) were selectively sensitive to different forms of uncertainty. Sulpiride reduced non-functional EOLPs in QNP rats but had no effect on functional OLPs. These data have implications for treatment of compulsive checking in OCD, particularly for serotonin-reuptake-inhibitor treatment-refractory cases, where supplementation with dopamine receptor antagonists may be beneficial. PMID:24406720

40 CFR Appendix M to Part 51 - Recommended Test Methods for State Implementation Plans

Code of Federal Regulations, 2014 CFR

2014-07-01

..., and after the run with the cyclone removed. The cyclone is removed before the post-test leak-check to.... 4.1.4.3 Post-Test Leak-Check. A leak-check is required at the conclusion of each sampling run... disturbing the collected sample and use the following procedure to conduct a post-test leak-check. 4.1.4.3.1...

40 CFR Appendix M to Part 51 - Recommended Test Methods for State Implementation Plans

Code of Federal Regulations, 2013 CFR

2013-07-01

..., and after the run with the cyclone removed. The cyclone is removed before the post-test leak-check to.... 4.1.4.3 Post-Test Leak-Check. A leak-check is required at the conclusion of each sampling run... disturbing the collected sample and use the following procedure to conduct a post-test leak-check. 4.1.4.3.1...

40 CFR Appendix M to Part 51 - Recommended Test Methods for State Implementation Plans

Code of Federal Regulations, 2011 CFR

2011-07-01

..., and after the run with the cyclone removed. The cyclone is removed before the post-test leak-check to.... 4.1.4.3 Post-Test Leak-Check. A leak-check is required at the conclusion of each sampling run... disturbing the collected sample and use the following procedure to conduct a post-test leak-check. 4.1.4.3.1...

40 CFR Appendix M to Part 51 - Recommended Test Methods for State Implementation Plans

Code of Federal Regulations, 2012 CFR

2012-07-01

..., and after the run with the cyclone removed. The cyclone is removed before the post-test leak-check to.... 4.1.4.3 Post-Test Leak-Check. A leak-check is required at the conclusion of each sampling run... disturbing the collected sample and use the following procedure to conduct a post-test leak-check. 4.1.4.3.1...

30 CFR 77.902-3 - Attachment of ground conductors and ground check wires to equipment frames; use of separate...

Code of Federal Regulations, 2010 CFR

2010-07-01

... 30 Mineral Resources 1 2010-07-01 2010-07-01 false Attachment of ground conductors and ground check wires to equipment frames; use of separate connections. 77.902-3 Section 77.902-3 Mineral...-Voltage Alternating Current Circuits § 77.902-3 Attachment of ground conductors and ground check wires to...

30 CFR 77.902-3 - Attachment of ground conductors and ground check wires to equipment frames; use of separate...

Code of Federal Regulations, 2011 CFR

2011-07-01

... 30 Mineral Resources 1 2011-07-01 2011-07-01 false Attachment of ground conductors and ground check wires to equipment frames; use of separate connections. 77.902-3 Section 77.902-3 Mineral...-Voltage Alternating Current Circuits § 77.902-3 Attachment of ground conductors and ground check wires to...

A Focus into the Charity "Young Enterprise Northern Ireland" and How Effective Their "Company Programme" Is at Increasing "Life Skills" in Young People

ERIC Educational Resources Information Center

McVeigh, Francis

2014-01-01

Purpose - This research project has investigated the "Company Programme" of the charity YE and how effective it is at increasing Life Skills in young people. Data has been obtained using student questionnaires and teacher interviews. Previous studies have been completed on "Life Skills" and "Enterprise Programmes",…

Tomicus piniperda (Scolytidae): a serious pest of yunnan pine in southwestern China

Treesearch

Hui Ye; Robert A. Haack; Jun Lu

2003-01-01

The pine shoot beetle, Tomicus piniperda (L.), is native to the pine growing regions of Europe, Asia, and northern Africa (Bakke 1968; L?ngstrom 1983; Ye 1991). Established populations of T. piniperda were first found in North America in 1992 (Haack and Kucera 1993), and as of January 2002, it now occurs in 318 counties in the...

The Impact of Enterprise Education on Attitudes to Enterprise in Young People: An Evaluation Study

ERIC Educational Resources Information Center

Athayde, Rosemary

2012-01-01

Purpose: The purpose of the paper is to present evidence on the impact of enterprise education on young people still at school in London, UK. The study was designed to measure the effect of participation in a Young Enterprise (YE) Company Program on young people's attitudes toward starting a business, and on their enterprise potential.…

USSR Report, Military Affairs

DTIC Science & Technology

1984-12-12

extracted - Unfamiliar names rendered phonetically or transliterated are enclosed in parentheses. Words or names preceded by a question mark and...warrant officers, and six NCO’s and soldiers raised their scores. Moreover, St Lieutenants Ye. Shavrov, S. Boldin , and V. Radionov became specialists...absence—a scientific essay on the selected specialty; notarized copies of the VUZ graduation diploma and an extract from the academic record; service

2016 Quantum Science Gordon Research Conference

DTIC Science & Technology

2018-01-10

PERSON 19b. TELEPHONE NUMBER Jun Ye 611102 c. THIS PAGE The public reporting burden for this collection of information is estimated to average 1 hour...completing and reviewing the collection of information . Send comments regarding this burden estimate or any other aspect of this collection of information ...including suggesstions for reducing this burden, to Washington Headquarters Services, Directorate for Information Operations and Reports, 1215

Fiscal Year 2013 Comprehensive Oversight Plan for Southwest Asia

DTIC Science & Technology

2012-09-26

Republic JO Jordan TJ Tajikistan KZ Kazakhstan TM Turkmenistan KW Kuwait AE United Arab Emirates KG Kyrgyzstan UZ Uzbekistan LB Lebanon YE Yemen...effective, responsive, democratic, transparent, accountable, and gender sensitive municipal governance in select municipalities in Afghanistan? (Project...CAII-Creative Associates International, Inc., Ambassador’s Small Grants Program to Support Gender Equality in Afghanistan – ASGP Objective: 306-A-00

Effects of Parental Expectations and Cultural-Values Orientation on Career Decision-Making Difficulties of Chinese University Students

ERIC Educational Resources Information Center

Leung, S. Alvin; Hou, Zhi-Jin; Gati, Itamar; Li, Xixi

2011-01-01

This study examined the effects of cultural-values conflict and parental expectations on the career decision-making difficulties of university students in three cities in China (Beijing, Wuhan, and Hong Kong, N = 1342). The Multidimensional Scales of Individual Traditionality and Modernity (Yang, Yu, & Ye, 1989) were used as a measure of…

Effects of whole-stream nutrient enrichment on the concentration and abundance of aquatic hyphomycete conidia in transport

Treesearch

Vol. 96(1): 57-65 Mycologia

2004-01-01

The concentrations and relative abundances of aquatic hyphomycete conidia in water were followed during a three-year study in two headwater streams at Coweeta Hydrologic Laboratory, North Carolina, using the membrane-filtration technique. After a one-ye& pretreatment period, one of the streams was enriched continuously with inorganic nutrients (N+P) for two years...

Bibliography of Soviet Laser Developments, Number 37, September - October 1978

DTIC Science & Technology

1979-07-01

RZhF, 10/78, lbD1210) 333. Sukhanov , V.I., Yu.V. Ashcheulov, and A.Ye. Petnikov (0). Hologram recording in lithium niobate crystals. Sb 15, 86-88...SUCIU P SUKHANOV V I SUKHOVERKHOVA L G SUKOV A I SUSHENKO A N SUSHKEVICH T N SUSHKIN V N SUSLENNIKOV L A SUSLIKOV L M SUSLOV A M SVERDLOV B N

USSR Report, Chemistry

DTIC Science & Technology

1985-08-16

of the thermal interaction of polonium - 210 with palladium and iridium. The vacuum-thermal method of direct synthesis was used, a study of the...ZHURNAL -PRIKLADNOY KHIMII, No k, Apr 85) Ik CATALYSIS Effect of Intermetallic Compounds Zr-Co Composition on Their Catalytic Properties in...KHIMICHESKAYA, No U, Apr 85) IT Effect of Stabilization on Adsorption and Catalytic Properties of Electrodeposited Platinum Catalysts (T. M. Grishina, Ye. V

YeATS- a tool suite for analyzing RNA-seq derived transcriptome identifies a highly transcribed putative extensin in heartwood/sapwood transition zone in black walnut

USDA-ARS?s Scientific Manuscript database

The transcriptome provides a functional footprint of the genome by enumerating the molecular components of cells and tissues. The field of transcript discovery has been revolutionized through high-throughput mRNA sequencing (RNA-seq). Here, we present a methodology that replicates and improves exist...

Imperial Parallels: Analyzing the U.S. Army Regionally Aligned Force Strategy in the Context of Historical Imperialism

DTIC Science & Technology

2014-06-13

bicycle. If it slows down, it could fall off, and the earth might quake ” (Behar 2008c). In order to maintain this momentum, China aggressively...ANALYSIS Rise like Lions after slumber In unvanquishable number — Shake your chains to earth like dew Which in your sleep had fallen on you— Ye are

Directory of Soviet Officials: Science and Education: A Reference Aid

DTIC Science & Technology

1989-05-01

Sergey Yevstratovich id 1971 Organic Semifinished Products and Dyes SRI imeni K. Ye. Voroshllov, Moscow (Nil organicheskikh poluproduktov i... products and also produces dyes for use in the textile industry.) Director Physical Chemistry SRI imeni L Ya, Karppv, Moscow (Nauchno...103 Organic Semifinished Products and Dyes SRI imeni K.Yc. Voroshilov. Moscow 197 Organic Synthesis Institute. Riga 157 Oriental Studies Institute

Kilonova from post-merger ejecta as an optical and near-Infrared counterpart of GW170817

NASA Astrophysics Data System (ADS)

Tanaka, Masaomi; Utsumi, Yousuke; Mazzali, Paolo A.; Tominaga, Nozomu; Yoshida, Michitoshi; Sekiguchi, Yuichiro; Morokuma, Tomoki; Motohara, Kentaro; Ohta, Kouji; Kawabata, Koji S.; Abe, Fumio; Aoki, Kentaro; Asakura, Yuichiro; Baar, Stefan; Barway, Sudhanshu; Bond, Ian A.; Doi, Mamoru; Fujiyoshi, Takuya; Furusawa, Hisanori; Honda, Satoshi; Itoh, Yoichi; Kawabata, Miho; Kawai, Nobuyuki; Kim, Ji Hoon; Lee, Chien-Hsiu; Miyazaki, Shota; Morihana, Kumiko; Nagashima, Hiroki; Nagayama, Takahiro; Nakaoka, Tatsuya; Nakata, Fumiaki; Ohsawa, Ryou; Ohshima, Tomohito; Okita, Hirofumi; Saito, Tomoki; Sumi, Takahiro; Tajitsu, Akito; Takahashi, Jun; Takayama, Masaki; Tamura, Yoichi; Tanaka, Ichi; Terai, Tsuyoshi; Tristram, Paul J.; Yasuda, Naoki; Zenko, Tetsuya

2017-12-01

Recent detection of gravitational waves from a neutron star (NS) merger event GW170817 and identification of an electromagnetic counterpart provide a unique opportunity to study the physical processes in NS mergers. To derive properties of ejected material from the NS merger, we perform radiative transfer simulations of kilonova, optical and near-infrared emissions powered by radioactive decays of r-process nuclei synthesized in the merger. We find that the observed near-infrared emission lasting for >10 d is explained by 0.03 M⊙ of ejecta containing lanthanide elements. However, the blue optical component observed at the initial phases requires an ejecta component with a relatively high electron fraction (Ye). We show that both optical and near-infrared emissions are simultaneously reproduced by the ejecta with a medium Ye of ˜0.25. We suggest that a dominant component powering the emission is post-merger ejecta, which exhibits that the mass ejection after the first dynamical ejection is quite efficient. Our results indicate that NS mergers synthesize a wide range of r-process elements and strengthen the hypothesis that NS mergers are the origin of r-process elements in the Universe.

The advertisement calls of Quasipaa shini (Ahl, 1930) (Anura: Dicroglossidae).

PubMed

Kong, Shen Shen; Zheng, Rong Quan; Zhang, Qi Peng

2016-12-04

The genus Quasipaa (Family Dicroglossidae) is currently composed of 11 species distributed in China and Southeast Asia: Quasipaa acanthophora (Dubois & Ohler 2009), Q. boulengeri (Günther 1889), Q. courtoisi (Angel 1922), Q. delacouri (Angel 1928), Q. exilispinosa (Liu & Hu, 1975), Q. fasciculispina (Inger 1970), Q. jiulongensis (Huang & Liu, 1985), Q. shini (Ahl 1930), Q. spinosa (David 1875), Q. verrucospinosa (Bourret 1937), Q. yei (Chen, Qu & Jiang 2002) (Frost 2016). These species are morphologically similar, and their taxonomy is subject to controversy (Che et al. 2009). Analyses of nuclear and mitochondrial genes suggest the genus likely encompass additional cryptic species (Ye et al. 2013). Bioacoustics has contributed to studies on the taxonomy of the genus (Ye et al. 2013; Shen et al. 2015), however, to date, only the advertisement calls of Q. spinosa are known (Yu & Zheng 2009; Chen et al. 2012; Shen et al. 2015). Here, we describe the advertisement calls of Q. shini, which inhabits streams in the southern part of central China(Guizhou, Hunan, Guangxi and Jiangxi) and is characterized by the presence of keratinized skin spines on the lateral surfaces of the body.

Performance of a Condensing Heat Exchanger in Recovering Waste Heat from a Natural Gas-Fired Boiler

DTIC Science & Technology

1990-05-01

conductea by Richard Caron, Sharon Jones DeVelle, and Kevin Fitzgerald of Arthur D. Little, Inc., under the direction of the U.S. Army Construction...Wienke, USACERL Information Management Office. The cooperation of Mr. Kevin Kinmon of Morton Thiokol, operating contractor for the Louisiana Army...at 00 Palo Steam(4441 k~ha/ht Makep Waer Fsilwter Steamn to Osorator 3733 lbA at 60FedwFe 441lblh atl15psl 3733o OFd (513 (lOGtut/l’ 2 6 0h ( 8 2 5B

Determination of MLC model parameters for Monaco using commercial diode arrays.

PubMed

Kinsella, Paul; Shields, Laura; McCavana, Patrick; McClean, Brendan; Langan, Brian

2016-07-08

Multileaf collimators (MLCs) need to be characterized accurately in treatment planning systems to facilitate accurate intensity-modulated radiation therapy (IMRT) and volumetric-modulated arc therapy (VMAT). The aim of this study was to examine the use of MapCHECK 2 and ArcCHECK diode arrays for optimizing MLC parameters in Monaco X-ray voxel Monte Carlo (XVMC) dose calculation algorithm. A series of radiation test beams designed to evaluate MLC model parameters were delivered to MapCHECK 2, ArcCHECK, and EBT3 Gafchromic film for comparison. Initial comparison of the calculated and ArcCHECK-measured dose distributions revealed it was unclear how to change the MLC parameters to gain agreement. This ambiguity arose due to an insufficient sampling of the test field dose distributions and unexpected discrepancies in the open parts of some test fields. Consequently, the XVMC MLC parameters were optimized based on MapCHECK 2 measurements. Gafchromic EBT3 film was used to verify the accuracy of MapCHECK 2 measured dose distributions. It was found that adjustment of the MLC parameters from their default values resulted in improved global gamma analysis pass rates for MapCHECK 2 measurements versus calculated dose. The lowest pass rate of any MLC-modulated test beam improved from 68.5% to 93.5% with 3% and 2 mm gamma criteria. Given the close agreement of the optimized model to both MapCHECK 2 and film, the optimized model was used as a benchmark to highlight the relatively large discrepancies in some of the test field dose distributions found with ArcCHECK. Comparison between the optimized model-calculated dose and ArcCHECK-measured dose resulted in global gamma pass rates which ranged from 70.0%-97.9% for gamma criteria of 3% and 2 mm. The simple square fields yielded high pass rates. The lower gamma pass rates were attributed to the ArcCHECK overestimating the dose in-field for the rectangular test fields whose long axis was parallel to the long axis of the ArcCHECK. Considering ArcCHECK measurement issues and the lower gamma pass rates for the MLC-modulated test beams, it was concluded that MapCHECK 2 was a more suitable detector than ArcCHECK for the optimization process. © 2016 The Authors

The Schwarzian theory — origins

NASA Astrophysics Data System (ADS)

Mertens, Thomas G.

2018-05-01

In this paper we further study the 1d Schwarzian theory, the universal low-energy limit of Sachdev-Ye-Kitaev models, using the link with 2d Liouville theory. We provide a path-integral derivation of the structural link between both theories, and study the relation between 3d gravity, 2d Jackiw-Teitelboim gravity, 2d Liouville and the 1d Schwarzian. We then generalize the Schwarzian double-scaling limit to rational models, relevant for SYK-type models with internal symmetries. We identify the holographic gauge theory as a 2d BF theory and compute correlators of the holographically dual 1d particle-on-a-group action, decomposing these into diagrammatic building blocks, in a manner very similar to the Schwarzian theory.

Quantitative megavoltage radiation therapy dosimetry using the storage phosphor KCl:Eu2+

PubMed Central

Han, Zhaohui; Driewer, Joseph P.; Zheng, Yuanshui; Low, Daniel A.; Li, H. Harold

2009-01-01

This work, for the first time, reports the use of europium doped potassium chloride (KCl:Eu2+) storage phosphor for quantitative megavoltage radiation therapy dosimetry. In principle, KCl:Eu2+ functions using the same photostimulatated luminescence (PSL) mechanism as commercially available BaFBr0.85I0.15:Eu2+ material that is used for computed radiography (CR) but features a significantly smaller effective atomic number—18 versus 49—making it a potentially useful material for nearly tissue-equivalent radiation dosimetry. Cylindrical KCl:Eu2+ dosimeters, 7 mm in diameter and 1 mm thick, were fabricated in-house. Dosimetric properties, including radiation hardness, response linearity, signal fading, dose rate sensitivity, and energy dependence, were studied with a laboratory optical reader after irradiation by a linear accelerator. The overall experimental uncertainty was estimated to be within ±2.5%. The findings were (1) KCl:Eu2+ showed satisfactory radiation hardness. There was no significant change in the stimulation spectra after irradiation up to 200 Gy when compared to a fresh dosimeter, indicating that this material could be reused at least 100 times if 2 Gy per use was assumed, e.g., for patient-specific IMRT QA. (2) KCl:Eu2+ exhibited supralinear response to dose after irradiation from 0 to 800 cGy. (3) After x ray irradiation, the PSL signal faded with time and eventually reached a fading rate of about 0.1%∕h after 12 h. (4) The sensitivity of the dosimeter was independent of the dose rate ranging from 15 to 1000 cGy∕min. (5) The sensitivity showed no beam energy dependence for either open x ray or megavoltage electron fields. (6) Over-response to low-energy scattered photons was comparable to radiographic film, e.g., Kodak EDR2 film. By sandwiching dosimeters between low-energy photon filters (0.3 mm thick lead foils) during irradiation, the over-response was reduced. The authors have demonstrated that KCl:Eu2+ dosimeters have many desirable dosimetric characteristics that make the material conducive to radiation therapy dosimetry. In the future, a large-area KCl:Eu2+-based CR plate with a thickness of the order of a few microns, created using modern thin film techniques, could provide a reusable, quantitative, high-resolution two-dimensional dosimeter with minimal energy dependence. PMID:19746808

The dopamine D2/D3 receptor agonist quinpirole increases checking-like behaviour in an operant observing response task with uncertain reinforcement: a novel possible model of OCD.

PubMed

Eagle, Dawn M; Noschang, Cristie; d'Angelo, Laure-Sophie Camilla; Noble, Christie A; Day, Jacob O; Dongelmans, Marie Louise; Theobald, David E; Mar, Adam C; Urcelay, Gonzalo P; Morein-Zamir, Sharon; Robbins, Trevor W

2014-05-01

Excessive checking is a common, debilitating symptom of obsessive-compulsive disorder (OCD). In an established rodent model of OCD checking behaviour, quinpirole (dopamine D2/3-receptor agonist) increased checking in open-field tests, indicating dopaminergic modulation of checking-like behaviours. We designed a novel operant paradigm for rats (observing response task (ORT)) to further examine cognitive processes underpinning checking behaviour and clarify how and why checking develops. We investigated i) how quinpirole increases checking, ii) dependence of these effects on D2/3 receptor function (following treatment with D2/3 receptor antagonist sulpiride) and iii) effects of reward uncertainty. In the ORT, rats pressed an 'observing' lever for information about the location of an 'active' lever that provided food reinforcement. High- and low-checkers (defined from baseline observing) received quinpirole (0.5mg/kg, 10 treatments) or vehicle. Parametric task manipulations assessed observing/checking under increasing task demands relating to reinforcement uncertainty (variable response requirement and active-lever location switching). Treatment with sulpiride further probed the pharmacological basis of long-term behavioural changes. Quinpirole selectively increased checking, both functional observing lever presses (OLPs) and non-functional extra OLPs (EOLPs). The increase in OLPs and EOLPs was long-lasting, without further quinpirole administration. Quinpirole did not affect the immediate ability to use information from checking. Vehicle and quinpirole-treated rats (VEH and QNP respectively) were selectively sensitive to different forms of uncertainty. Sulpiride reduced non-functional EOLPs in QNP rats but had no effect on functional OLPs. These data have implications for treatment of compulsive checking in OCD, particularly for serotonin-reuptake-inhibitor treatment-refractory cases, where supplementation with dopamine receptor antagonists may be beneficial. Copyright © 2014 The Authors. Published by Elsevier B.V. All rights reserved.

12 CFR Appendix A to Part 229 - Routing Number Guide to Next-Day Availability Checks and Local Checks

Code of Federal Regulations, 2010 CFR

2010-01-01

... 12 Banks and Banking 3 2010-01-01 2010-01-01 false Routing Number Guide to Next-Day Availability Checks and Local Checks A Appendix A to Part 229 Banks and Banking FEDERAL RESERVE SYSTEM (CONTINUED) BOARD OF GOVERNORS OF THE FEDERAL RESERVE SYSTEM AVAILABILITY OF FUNDS AND COLLECTION OF CHECKS...

Molecular Studies of Alphavirus Immunogenicity

DTIC Science & Technology

1992-12-03

RNAs. These include Ockelbo virus, a virus causing epidemic polyarthritis .n northern Europe , strains of Sindbis virus from Africa, India, Australia...TD TL A VA VAT R YE VDNI T 3421 GGUGUGGUGGIJGGCAUUGAGAACUUUUGCGGAGAGCAAAJAGAGCAUUUGAAGCGAUCAGA 3480 P VL LA L RT F A QS KRA F QA I R 3481...alphaviruses. The Sindbis-like viruses, which are found throughout the Old World from Northern Europe to Africa, India, the Philippines and the Australasian

China/Taiwan: Evolution of the One China Policy - Key Statements from Washington, Beijing, and Taipei

DTIC Science & Technology

2006-09-07

Statements During Clinton Administration . . . . . . . . . . . . . . . . . . . . . . . . . 48 PRC Premier Li Peng Warns Taiwan...Soviet Union/Russia and built up its theater missile force.48 In December 1992 and March 1993, PRC President Jiang Zemin and Premier Li Peng began to...Ye Jianying Explains Policy Concerning Return of Taiwan to Motherland and Peaceful Unification,” Xinhua [New China News Agency], September 30, 1981

An Ada/SQL (Structured Query Language) Application Scanner.

DTIC Science & Technology

1988-03-01

Digital ...8217 (" DIGITS "), 46 new STRING’ ("DO"), new STRING’ ("ELSE"), new STRING’ ("ELSIF"), new STRING’ ("END"), new STRING’ ("ENTRY"), new STRING’ ("EXCEPTION...INTEGERPRINT; generic type NUM is digits <>; package FLOATPRINT is package txtprts.ada 18 prcdr PR (FL inFL %YE LINE n LINTYPE UNCLASSIFIED procedure

Avast Ye Salty Dogs: Salt damage in the context of coastal residential construction and historical maritime timbers

Treesearch

Grant T. Kirker; Samuel L. Zelinka; Leandro Passarini

2016-01-01

Salt damage is a frequent problem in wood exposed to seawater and other saline environments. Symptoms of salt damage are often referred to as fuzzy wood and have been historically considered non-structural damage, but a growing number of customer inquiries have prompted a re-evaluation of this phenomenon. This paper details several case studies involving salt damage,...

JPRS Report, Science & Technology USSR: Chemistry

DTIC Science & Technology

1991-05-02

91] 11 Using Ftorlon Fabric for the Diaphragms of Hydrochloric Acid Electrolyzers [Ye.M. Levinskiy, V.l. Barmashenko, et ai; KHIMICHESKAYA...that boron trifluoride was used in an adsorbed state over a neutral carrier and not complexed with strong inorganic acids . Because of this carrier...the Diaphragms of Hydrochloric Acid Electrolyzers 917M0069I Kiev KHIMICHESKAYA TEKHNOLOGIYA in Russian No 1, Jan-Fcb 91 (manuscript received 13 Nov

Clinical Investigation Program.

DTIC Science & Technology

1981-10-01

Tomographic (CT) Appearance of the ryc- cardium After Neversible and Irreversible Ischemic Injury . 29th Annual Meeting of the Association of University...Orthopedic Surgeons, San Antonio, TX, Nov 1980. (C) Greenfield, G. Q., Jr.: Injuries Related to Rollerskating. Annual Mleeting, Society of Military...volume reduction odiumw balance A c-umuatie-.EDLASE I E st Ac cumul a ti ye Perio -di-c ............ Lost: LOA Cost: $1LO0. Review Results: Continue

Laser Instrumentation for Attosecond Experimentation

DTIC Science & Technology

2009-06-15

Spectroscopy Principal Investigator: Jun Ye, JILA, NIST and University of Colorado, Boulder With revolutionary impact on precision metrology and...geometry, one of the focusing cavity mirrors had a 100-mm hole drilled in the middle. The coupling efficiency and cavity loss associated with such...carried out by the Leone and Neumark groups. These studies provided a gauge of the plasmon-field ponderomotive forces. Attosecond experiments were prepared

JPRS Report, Science & Technology, USSR: Science & Technology Policy

DTIC Science & Technology

1990-05-31

SERVICE SPRINGFIELD, VA. 22161 DTTC QUALITY INSPECTED t Science & Technology USSR: Science & Technology Policy JPRS-UST-90-006 CONTENTS 31 May...64 Uzbek Central Committee Examines S& T Cadre Problem [PRAVDA VOSTOKA, 27Feb 90] 65 Miscellaneous Scientists Comment on Compensation, Contract...Expositions POISK Commentary on February S& T Conference [V. Oshchenko, Ye. Ponarina; POISK, 22-28 Feb 90] 77 Conference Sets Policy for Future S& T

FEASIL Implementation under VAX VMS with Design Information.

DTIC Science & Technology

1986-11-01

desirable to eventually port FEASIL to the HP 9000, the IBM PC, and several other com- puters. However, the flowcharting and VAX conversion efforts have...v W l EU l l~rl EDIIkEL (pg 12) DEL El’F TJ-’LE C rr~PACE 13 HPvrwrH IIUpdate the I Itpe DescrL c ðere tau,1es remaining nthe relatioil ? ye

USSR Report, Life Sciences Biomedical and Behavioral Sciences

DTIC Science & Technology

1984-02-02

Plant Protection 1 Predicting Effectiveness of Mineral Fertilizers on Rice Plantings (Ye. P. Aleshin. et al.; DOKLADY VASKhNIL, No 5, May 83... Protection Cited (Yu. Zaytsev; PRAVDA UKRAINY, 5 Oct 83) 88 - f - AGROTECHNOLOGY BRIEFS BIOLOGICAL PLANT PROTECTION —The criticism contained in the...the biological means of plant protection manufactured by Glavmikrobioprom enterprises are still inferior in quality to better samples. Measures

Radio Engineering System of Short-Range Navigation. RSBN-2. Part I. (Radioteknicheskaya Sistema Blizhney Navigatsii RSBN-2)

DTIC Science & Technology

1977-02-09

RANGE NAVIGATION. RSBN-2 By: Ye. M. Yakovlev, A. N. Kleplkov, et al. English pages: 706 source: Radlotekhnlcheskaya Sistema Bllzhney Navigatsli...L4 and the grid of tube L5 (6N8S) limits grid m^^mammm^m^^^f.^^ rn .„ | -.,, ..S^JTv i tOC = 77050017 PAGE ^ I current©. |: *■ «a—m

The Poor Ye Need Not Have with You; Lessons from the War on Poverty.

ERIC Educational Resources Information Center

Levine, Robert A.

The book provides a dichotomy of the general technique of problem handling in the United States; i.e., getting even or punishing the adversary, and the reverse of this, problem solving; and discusses the two aspects in the context of the war on poverty. The second and third chapters discuss various definitions of the Poor, and provide objectives…

Thermo-Mechanical and Thermal Behavior of High-Temperature Structural Materials.

DTIC Science & Technology

1981-12-31

8217 wtich should r’o = - :a . mere ilret ap. l I it;on to , ision reactor mat.er als. The "roaa ot)l c i: ye oi tie work has 5,!iere : iS tte .:k i,.’nt...Center Materials Department Office of Naval Research Annapolis, Maryland 21402 (1) San Francisco Area Office One Hallidie Plaza, Suite 601 Naval Undersea

"Freely Ye Have Received, Freely Give" (Matthew 10: 8)--How Giving Away Religious Digital Books Influences the Print Sales of Those Books

ERIC Educational Resources Information Center

Hilton, John, III.

2010-01-01

Lack of access prevents many from benefiting from educational resources. Digital technologies now enable educational resources, such as books, to be openly available to those with access to the Internet. This study examined the financial viability of a religious publisher's putting free digital versions of eight of its books on the Internet. The…

Ute Unit: Study Guide and Follow Up Activities.

ERIC Educational Resources Information Center

North Conejos School District, Capulin, CO.

The study guide and follow-up activities were designed primarily to give students a feeling of Ute life in the San Luis Valley in Colorado. The unit begins with six Southern Ute stories about the wolf and coyote, the race between the skunk and the coyote, the frog and the eagle, why the frog croaks, the bear (Que Ye Qat), and the two Indian…

Plasma cleaning of nanoparticles from EUV mask materials by electrostatics

NASA Astrophysics Data System (ADS)

Lytle, W. M.; Raju, R.; Shin, H.; Das, C.; Neumann, M. J.; Ruzic, D. N.

2008-03-01

Particle contamination on surfaces used in extreme ultraviolet (EUV) mask blank deposition, mask fabrication, and patterned mask handling must be avoided since the contamination can create significant distortions and loss of reflectivity. Particles on the order of 10nm are problematic during MLM mirror fabrication, since the introduced defects disrupt the local Bragg planes. The most serious problem is the accumulation of particles on surfaces of patterned blanks during EUV light exposure, since > 25nm particles will be printed without an out-of-focus pellicle. Particle contaminants are also a problem with direct imprint processes since defects are printed every time. Plasma Assisted Cleaning by Electrostatics (PACE) works by utilizing a helicon plasma as well as a pulsed DC substrate bias to charge particle and repel them electrostatically from the surface. Removal of this nature is a dry cleaning method and removes contamination perpendicular from the surface instead of rolling or sweeping the particles off the surface, a benefit when cleaning patterned surfaces where contamination can be rolled or trapped between features. Also, an entire mask can be cleaned at once since the plasma can cover the entire surface, thus there is no need to focus in on an area to clean. Sophisticated particle contamination detection system utilizing high power laser called DEFCON is developed to analyze the particle removal after PACE cleaning process. PACE has shown greater than 90 % particle removal efficiencies for 30 to 220 nm PSL particles on ruthenium capped quartz. Removal results for silicon surfaces and quartz surfaces show similar removal efficiencies. Results of cleaning 80 nm PSL spheres from silicon substrates will be shown.