A novel genome signature based on inter-nucleotide distances profiles for visualization of metagenomic data

NASA Astrophysics Data System (ADS)

Xie, Xian-Hua; Yu, Zu-Guo; Ma, Yuan-Lin; Han, Guo-Sheng; Anh, Vo

2017-09-01

There has been a growing interest in visualization of metagenomic data. The present study focuses on the visualization of metagenomic data using inter-nucleotide distances profile. We first convert the fragment sequences into inter-nucleotide distances profiles. Then we analyze these profiles by principal component analysis. Finally the principal components are used to obtain the 2-D scattered plot according to their source of species. We name our method as inter-nucleotide distances profiles (INP) method. Our method is evaluated on three benchmark data sets used in previous published papers. Our results demonstrate that the INP method is good, alternative and efficient for visualization of metagenomic data.

Combined hairpin-antisense compositions and methods for modulating expression

DOEpatents

Shanklin, John; Nguyen, Tam

2014-08-05

A nucleotide construct comprising a nucleotide sequence that forms a stem and a loop, wherein the loop comprises a nucleotide sequence that modulates expression of a target, wherein the stem comprises a nucleotide sequence that modulates expression of a target, and wherein the target modulated by the nucleotide sequence in the loop and the target modulated by the nucleotide sequence in the stem may be the same or different. Vectors, methods of regulating target expression, methods of providing a cell, and methods of treating conditions comprising the nucleotide sequence are also disclosed.

Combined hairpin-antisense compositions and methods for modulating expression

DOEpatents

Shanklin, John; Nguyen, Tam Huu

2015-11-24

A nucleotide construct comprising a nucleotide sequence that forms a stem and a loop, wherein the loop comprises a nucleotide sequence that modulates expression of a target, wherein the stem comprises a nucleotide sequence that modulates expression of a target, and wherein the target modulated by the nucleotide sequence in the loop and the target modulated by the nucleotide sequence in the stem may be the same or different. Vectors, methods of regulating target expression, methods of providing a cell, and methods of treating conditions comprising the nucleotide sequence are also disclosed.

IBS: an illustrator for the presentation and visualization of biological sequences.

PubMed

Liu, Wenzhong; Xie, Yubin; Ma, Jiyong; Luo, Xiaotong; Nie, Peng; Zuo, Zhixiang; Lahrmann, Urs; Zhao, Qi; Zheng, Yueyuan; Zhao, Yong; Xue, Yu; Ren, Jian

2015-10-15

Biological sequence diagrams are fundamental for visualizing various functional elements in protein or nucleotide sequences that enable a summarization and presentation of existing information as well as means of intuitive new discoveries. Here, we present a software package called illustrator of biological sequences (IBS) that can be used for representing the organization of either protein or nucleotide sequences in a convenient, efficient and precise manner. Multiple options are provided in IBS, and biological sequences can be manipulated, recolored or rescaled in a user-defined mode. Also, the final representational artwork can be directly exported into a publication-quality figure. The standalone package of IBS was implemented in JAVA, while the online service was implemented in HTML5 and JavaScript. Both the standalone package and online service are freely available at http://ibs.biocuckoo.org. renjian.sysu@gmail.com or xueyu@hust.edu.cn Supplementary data are available at Bioinformatics online. © The Author 2015. Published by Oxford University Press.

An extended sequence specificity for UV-induced DNA damage.

PubMed

Chung, Long H; Murray, Vincent

2018-01-01

The sequence specificity of UV-induced DNA damage was determined with a higher precision and accuracy than previously reported. UV light induces two major damage adducts: cyclobutane pyrimidine dimers (CPDs) and pyrimidine(6-4)pyrimidone photoproducts (6-4PPs). Employing capillary electrophoresis with laser-induced fluorescence and taking advantages of the distinct properties of the CPDs and 6-4PPs, we studied the sequence specificity of UV-induced DNA damage in a purified DNA sequence using two approaches: end-labelling and a polymerase stop/linear amplification assay. A mitochondrial DNA sequence that contained a random nucleotide composition was employed as the target DNA sequence. With previous methodology, the UV sequence specificity was determined at a dinucleotide or trinucleotide level; however, in this paper, we have extended the UV sequence specificity to a hexanucleotide level. With the end-labelling technique (for 6-4PPs), the consensus sequence was found to be 5'-GCTC*AC (where C* is the breakage site); while with the linear amplification procedure, it was 5'-TCTT*AC. With end-labelling, the dinucleotide frequency of occurrence was highest for 5'-TC*, 5'-TT* and 5'-CC*; whereas it was 5'-TT* for linear amplification. The influence of neighbouring nucleotides on the degree of UV-induced DNA damage was also examined. The core sequences consisted of pyrimidine nucleotides 5'-CTC* and 5'-CTT* while an A at position "1" and C at position "2" enhanced UV-induced DNA damage. Crown Copyright © 2017. Published by Elsevier B.V. All rights reserved.

A population study of the minicircles in Trypanosoma cruzi: predicting guide RNAs in the absence of empirical RNA editing.

PubMed

Thomas, Sean; Martinez, L L Isadora Trejo; Westenberger, Scott J; Sturm, Nancy R

2007-05-24

The structurally complex network of minicircles and maxicircles comprising the mitochondrial DNA of kinetoplastids mirrors the complexity of the RNA editing process that is required for faithful expression of encrypted maxicircle genes. Although a few of the guide RNAs that direct this editing process have been discovered on maxicircles, guide RNAs are mostly found on the minicircles. The nuclear and maxicircle genomes have been sequenced and assembled for Trypanosoma cruzi, the causative agent of Chagas disease, however the complement of 1.4-kb minicircles, carrying four guide RNA genes per molecule in this parasite, has been less thoroughly characterised. Fifty-four CL Brener and 53 Esmeraldo strain minicircle sequence reads were extracted from T. cruzi whole genome shotgun sequencing data. With these sequences and all published T. cruzi minicircle sequences, 108 unique guide RNAs from all known T. cruzi minicircle sequences and two guide RNAs from the CL Brener maxicircle were predicted using a local alignment algorithm and mapped onto predicted or experimentally determined sequences of edited maxicircle open reading frames. For half of the sequences no statistically significant guide RNA could be assigned. Likely positions of these unidentified gRNAs in T. cruzi minicircle sequences are estimated using a simple Hidden Markov Model. With the local alignment predictions as a standard, the HMM had an ~85% chance of correctly identifying at least 20 nucleotides of guide RNA from a given minicircle sequence. Inter-minicircle recombination was documented. Variable regions contain species-specific areas of distinct nucleotide preference. Two maxicircle guide RNA genes were found. The identification of new minicircle sequences and the further characterization of all published minicircles are presented, including the first observation of recombination between minicircles. Extrapolation suggests a level of 4% recombinants in the population, supporting a relatively high recombination rate that may serve to minimize the persistence of gRNA pseudogenes. Characteristic nucleotide preferences observed within variable regions provide potential clues regarding the transcription and maturation of T. cruzi guide RNAs. Based on these preferences, a method of predicting T. cruzi guide RNAs using only primary minicircle sequence data was created.

Uncovering drug-responsive regulatory elements

PubMed Central

Luizon, Marcelo R; Ahituv, Nadav

2015-01-01

Nucleotide changes in gene regulatory elements can have a major effect on interindividual differences in drug response. For example, by reviewing all published pharmacogenomic genome-wide association studies, we show here that 96.4% of the associated single nucleotide polymorphisms reside in noncoding regions. We discuss how sequencing technologies are improving our ability to identify drug response-associated regulatory elements genome-wide and to annotate nucleotide variants within them. We highlight specific examples of how nucleotide changes in these elements can affect drug response and illustrate the techniques used to find them and functionally characterize them. Finally, we also discuss challenges in the field of drug-responsive regulatory elements that need to be considered in order to translate these findings into the clinic. PMID:26555224

Discovery of a novel HLA-B*51 variant, B*51:112, in a Taiwanese bone marrow donor and identification of the plausible HLA haplotype in association with B*51:112.

PubMed

Yang, K L; Lee, S K; Lin, P Y

2012-10-01

The sequence of B*51:112 is identical to the sequence of B*51:01:01 in exons 2, 3 and 4, except the nucleotides at positions 206 (C→A) and 213 (C→G). The nucleotide replacement caused one amino acid substitution at residue 45 (T→K). The plausible HLA-A, -B and -DRB1 haplotype in association with B*51:112 may be deduced as HLA-A*02-B*51:112-DRB1*12. The generation of B*51:112 was probably as the result of a DNA recombination event where B*40:01:01 acted as a sequence donor donating a segment of the DNA sequence to the recipient sequence B*51:01:01. The donor carrying B*51:112 was a Minna Taiwanese whose ancestor came to Taiwan from the southern region of China. © 2012 Blackwell Publishing Ltd.

Crimean-Congo Hemorrhagic Fever

DTIC Science & Technology

2004-01-01

aminocaproic acid were also indicated. Much emphasis was also placed on preventing reinfection, including the necessity of remov- ing blood crusts from...The se- quence is approximately 60% identical both at the nucleotide and amino acid levels to the L segment of Dugbe virus, the only other Nairovirus...However, more recent data based on nucleic acid sequence analysis have revealed extensive genetic diversity. The first published CCHFV sequence

Learning a weighted sequence model of the nucleosome core and linker yields more accurate predictions in Saccharomyces cerevisiae and Homo sapiens.

PubMed

Reynolds, Sheila M; Bilmes, Jeff A; Noble, William Stafford

2010-07-08

DNA in eukaryotes is packaged into a chromatin complex, the most basic element of which is the nucleosome. The precise positioning of the nucleosome cores allows for selective access to the DNA, and the mechanisms that control this positioning are important pieces of the gene expression puzzle. We describe a large-scale nucleosome pattern that jointly characterizes the nucleosome core and the adjacent linkers and is predominantly characterized by long-range oscillations in the mono, di- and tri-nucleotide content of the DNA sequence, and we show that this pattern can be used to predict nucleosome positions in both Homo sapiens and Saccharomyces cerevisiae more accurately than previously published methods. Surprisingly, in both H. sapiens and S. cerevisiae, the most informative individual features are the mono-nucleotide patterns, although the inclusion of di- and tri-nucleotide features results in improved performance. Our approach combines a much longer pattern than has been previously used to predict nucleosome positioning from sequence-301 base pairs, centered at the position to be scored-with a novel discriminative classification approach that selectively weights the contributions from each of the input features. The resulting scores are relatively insensitive to local AT-content and can be used to accurately discriminate putative dyad positions from adjacent linker regions without requiring an additional dynamic programming step and without the attendant edge effects and assumptions about linker length modeling and overall nucleosome density. Our approach produces the best dyad-linker classification results published to date in H. sapiens, and outperforms two recently published models on a large set of S. cerevisiae nucleosome positions. Our results suggest that in both genomes, a comparable and relatively small fraction of nucleosomes are well-positioned and that these positions are predictable based on sequence alone. We believe that the bulk of the remaining nucleosomes follow a statistical positioning model.

37 CFR 1.822 - Symbols and format to be used for nucleotide and/or amino acid sequence data.

Code of Federal Regulations, 2011 CFR

2011-07-01

... for nucleotide and/or amino acid sequence data. 1.822 Section 1.822 Patents, Trademarks, and... Amino Acid Sequences § 1.822 Symbols and format to be used for nucleotide and/or amino acid sequence data. (a) The symbols and format to be used for nucleotide and/or amino acid sequence data shall...

The maize stripe virus major noncapsid protein messenger RNA transcripts contain heterogeneous leader sequences at their 5' termini.

PubMed

Huiet, L; Feldstein, P A; Tsai, J H; Falk, B W

1993-12-01

Primer extension analyses and a PCR-based cloning strategy were used to identify and characterize 5' nucleotide sequences on the maize stripe virus (MStV) RNA4 mRNA transcripts encoding the major noncapsid protein (NCP). Direct RNA sequence analysis by primer extension showed that the NCP mRNA transcripts had 10-15 nucleotides beyond the 5' terminus of the MStV RNA4 nucleotide sequence. MStV genomic RNAs isolated from ribonucleoprotein particles (RNPs) lacked the additional 5' nucleotides. cDNA clones representing the 5' region of the mRNA transcripts were constructed, and the nucleotide sequences of the 5' regions were determined for 16 clones. Each was found to have a distinct 10-15 nucleotide sequence immediately 5' of the MStV RNA4 sequence. Eleven of 16 clones had the correct MStV RNA4 5' nucleotide sequence, while five showed minor variations at or near the 5' most MStV RNA4 nucleotide. These characteristics show strong similarities to other viral mRNA transcripts which are synthesized by cap snatching.

37 CFR 1.821 - Nucleotide and/or amino acid sequence disclosures in patent applications.

Code of Federal Regulations, 2010 CFR

2010-07-01

... 37 Patents, Trademarks, and Copyrights 1 2010-07-01 2010-07-01 false Nucleotide and/or amino acid... Biotechnology Invention Disclosures Application Disclosures Containing Nucleotide And/or Amino Acid Sequences § 1.821 Nucleotide and/or amino acid sequence disclosures in patent applications. (a) Nucleotide and...

37 CFR 1.821 - Nucleotide and/or amino acid sequence disclosures in patent applications.

Code of Federal Regulations, 2011 CFR

2011-07-01

... 37 Patents, Trademarks, and Copyrights 1 2011-07-01 2011-07-01 false Nucleotide and/or amino acid... Biotechnology Invention Disclosures Application Disclosures Containing Nucleotide And/or Amino Acid Sequences § 1.821 Nucleotide and/or amino acid sequence disclosures in patent applications. (a) Nucleotide and...

Molecular cloning and sequencing analysis of the interferon receptor (IFNAR-1) from Columba livia.

PubMed

Li, Chao; Chang, Wei Shan

2014-01-01

Partial sequence cloning of interferon receptor (IFNAR-1) of Columba livia. In order to obtain a certain length (630 bp) of gene, a pair of primers was designed according to the conserved nucleotide sequence of Gallus (EU477527.1) and Taeniopygia guttata (XM_002189232.1) IFNAR-1 gene fragment that was published by GenBank. Special primers were designed by the Race method to amplify the 3'terminal cDNA. The Columba livia IFNAR-1 displayed 88.5%, 80.5% and 73.8% nucleotide identity to Falco peregrinus, Gallus and Taeniopygia guttata, respectively. Phylogenetic analysis of the IFNAR1 gene showed that the relationship of Columba livia, Falco peregrinus and chicken had high homology. We successfully obtained a Columba livia IFNAR-1 gene partial sequence. Analysis of the genetic tree showed that the relationship of Columba livia and Falco peregrinus IFNAR-1 had high homology. This result can be used as reference for further research and practical application.

Molecular cloning and sequencing analysis of the interferon receptor (IFNAR-1) from Columba livia

PubMed Central

Chang, Wei Shan

2014-01-01

Objective Partial sequence cloning of interferon receptor (IFNAR-1) of Columba livia. Material and methods In order to obtain a certain length (630 bp) of gene, a pair of primers was designed according to the conserved nucleotide sequence of Gallus (EU477527.1) and Taeniopygia guttata (XM_002189232.1) IFNAR-1 gene fragment that was published by GenBank. Special primers were designed by the Race method to amplify the 3'terminal cDNA. Results The Columba livia IFNAR-1 displayed 88.5%, 80.5% and 73.8% nucleotide identity to Falco peregrinus, Gallus and Taeniopygia guttata, respectively. Phylogenetic analysis of the IFNAR1 gene showed that the relationship of Columba livia, Falco peregrinus and chicken had high homology. Conclusions We successfully obtained a Columba livia IFNAR-1 gene partial sequence. Analysis of the genetic tree showed that the relationship of Columba livia and Falco peregrinus IFNAR-1 had high homology. This result can be used as reference for further research and practical application. PMID:26155117

repDNA: a Python package to generate various modes of feature vectors for DNA sequences by incorporating user-defined physicochemical properties and sequence-order effects.

PubMed

Liu, Bin; Liu, Fule; Fang, Longyun; Wang, Xiaolong; Chou, Kuo-Chen

2015-04-15

In order to develop powerful computational predictors for identifying the biological features or attributes of DNAs, one of the most challenging problems is to find a suitable approach to effectively represent the DNA sequences. To facilitate the studies of DNAs and nucleotides, we developed a Python package called representations of DNAs (repDNA) for generating the widely used features reflecting the physicochemical properties and sequence-order effects of DNAs and nucleotides. There are three feature groups composed of 15 features. The first group calculates three nucleic acid composition features describing the local sequence information by means of kmers; the second group calculates six autocorrelation features describing the level of correlation between two oligonucleotides along a DNA sequence in terms of their specific physicochemical properties; the third group calculates six pseudo nucleotide composition features, which can be used to represent a DNA sequence with a discrete model or vector yet still keep considerable sequence-order information via the physicochemical properties of its constituent oligonucleotides. In addition, these features can be easily calculated based on both the built-in and user-defined properties via using repDNA. The repDNA Python package is freely accessible to the public at http://bioinformatics.hitsz.edu.cn/repDNA/. bliu@insun.hit.edu.cn or kcchou@gordonlifescience.org Supplementary data are available at Bioinformatics online. © The Author 2014. Published by Oxford University Press. All rights reserved. For Permissions, please e-mail: journals.permissions@oup.com.

dbWGFP: a database and web server of human whole-genome single nucleotide variants and their functional predictions.

PubMed

Wu, Jiaxin; Wu, Mengmeng; Li, Lianshuo; Liu, Zhuo; Zeng, Wanwen; Jiang, Rui

2016-01-01

The recent advancement of the next generation sequencing technology has enabled the fast and low-cost detection of all genetic variants spreading across the entire human genome, making the application of whole-genome sequencing a tendency in the study of disease-causing genetic variants. Nevertheless, there still lacks a repository that collects predictions of functionally damaging effects of human genetic variants, though it has been well recognized that such predictions play a central role in the analysis of whole-genome sequencing data. To fill this gap, we developed a database named dbWGFP (a database and web server of human whole-genome single nucleotide variants and their functional predictions) that contains functional predictions and annotations of nearly 8.58 billion possible human whole-genome single nucleotide variants. Specifically, this database integrates 48 functional predictions calculated by 17 popular computational methods and 44 valuable annotations obtained from various data sources. Standalone software, user-friendly query services and free downloads of this database are available at http://bioinfo.au.tsinghua.edu.cn/dbwgfp. dbWGFP provides a valuable resource for the analysis of whole-genome sequencing, exome sequencing and SNP array data, thereby complementing existing data sources and computational resources in deciphering genetic bases of human inherited diseases. © The Author(s) 2016. Published by Oxford University Press.

Phylogenetic Characterizations of Highly Mutated EV-B106 Recombinants Showing Extensive Genetic Exchanges with Other EV-B in Xinjiang, China.

PubMed

Song, Yang; Zhang, Yong; Fan, Qin; Cui, Hui; Yan, Dongmei; Zhu, Shuangli; Tang, Haishu; Sun, Qiang; Wang, Dongyan; Xu, Wenbo

2017-02-23

Human enterovirus B106 (EV-B106) is a new member of the enterovirus B species. To date, only three nucleotide sequences of EV-B106 have been published, and only one full-length genome sequence (the Yunnan strain 148/YN/CHN/12) is available in the GenBank database. In this study, we conducted phylogenetic characterisation of four EV-B106 strains isolated in Xinjiang, China. Pairwise comparisons of the nucleotide sequences and the deduced amino acid sequences revealed that the four Xinjiang EV-B106 strains had only 80.5-80.8% nucleotide identity and 95.4-97.3% amino acid identity with the Yunnan EV-B106 strain, indicating high mutagenicity. Similarity plots and bootscanning analyses revealed that frequent intertypic recombination occurred in all four Xinjiang EV-B106 strains in the non-structural region. These four strains may share a donor sequence with the EV-B85 strain, which circulated in Xinjiang in 2011, indicating extensive genetic exchanges between these strains. All Xinjiang EV-B106 strains were temperature-sensitive. An antibody seroprevalence study against EV-B106 in two Xinjiang prefectures also showed low titres of neutralizing antibodies, suggesting limited exposure and transmission in the population. This study contributes the whole genome sequences of EV-B106 to the GenBank database and provides valuable information regarding the molecular epidemiology of EV-B106 in China.

Phylogenetic Characterizations of Highly Mutated EV-B106 Recombinants Showing Extensive Genetic Exchanges with Other EV-B in Xinjiang, China

PubMed Central

Song, Yang; Zhang, Yong; Fan, Qin; Cui, Hui; Yan, Dongmei; Zhu, Shuangli; Tang, Haishu; Sun, Qiang; Wang, Dongyan; Xu, Wenbo

2017-01-01

Human enterovirus B106 (EV-B106) is a new member of the enterovirus B species. To date, only three nucleotide sequences of EV-B106 have been published, and only one full-length genome sequence (the Yunnan strain 148/YN/CHN/12) is available in the GenBank database. In this study, we conducted phylogenetic characterisation of four EV-B106 strains isolated in Xinjiang, China. Pairwise comparisons of the nucleotide sequences and the deduced amino acid sequences revealed that the four Xinjiang EV-B106 strains had only 80.5–80.8% nucleotide identity and 95.4–97.3% amino acid identity with the Yunnan EV-B106 strain, indicating high mutagenicity. Similarity plots and bootscanning analyses revealed that frequent intertypic recombination occurred in all four Xinjiang EV-B106 strains in the non-structural region. These four strains may share a donor sequence with the EV-B85 strain, which circulated in Xinjiang in 2011, indicating extensive genetic exchanges between these strains. All Xinjiang EV-B106 strains were temperature-sensitive. An antibody seroprevalence study against EV-B106 in two Xinjiang prefectures also showed low titres of neutralizing antibodies, suggesting limited exposure and transmission in the population. This study contributes the whole genome sequences of EV-B106 to the GenBank database and provides valuable information regarding the molecular epidemiology of EV-B106 in China. PMID:28230168

Sequence diversity of wheat mosaic virus isolates.

PubMed

Stewart, Lucy R

2016-02-02

Wheat mosaic virus (WMoV), transmitted by eriophyid wheat curl mites (Aceria tosichella) is the causal agent of High Plains disease in wheat and maize. WMoV and other members of the genus Emaravirus evaded thorough molecular characterization for many years due to the experimental challenges of mite transmission and manipulating multisegmented negative sense RNA genomes. Recently, the complete genome sequence of a Nebraska isolate of WMoV revealed eight segments, plus a variant sequence of the nucleocapsid protein-encoding segment. Here, near-complete and partial consensus sequences of five more WMoV isolates are reported and compared to the Nebraska isolate: an Ohio maize isolate (GG1), a Kansas barley isolate (KS7), and three Ohio wheat isolates (H1, K1, W1). Results show two distinct groups of WMoV isolates: Ohio wheat isolate RNA segments had 84% or lower nucleotide sequence identity to the NE isolate, whereas GG1 and KS7 had 98% or higher nucleotide sequence identity to the NE isolate. Knowledge of the sequence variability of WMoV isolates is a step toward understanding virus biology, and potentially explaining observed biological variation. Published by Elsevier B.V.

Human Retroviruses and AIDS. A compilation and analysis of nucleic acid and amino acid sequences: I--II; III--V

DOE Office of Scientific and Technical Information (OSTI.GOV)

Myers, G.; Korber, B.; Wain-Hobson, S.

1993-12-31

This compendium and the accompanying floppy diskettes are the result of an effort to compile and rapidly publish all relevant molecular data concerning the human immunodeficiency viruses (HIV) and related retroviruses. The scope of the compendium and database is best summarized by the five parts that it comprises: (I) HIV and SIV Nucleotide Sequences; (II) Amino Acid Sequences; (III) Analyses; (IV) Related Sequences; and (V) Database Communications. Information within all the parts is updated at least twice in each year, which accounts for the modes of binding and pagination in the compendium.

Studies of Xenopus laevis mitochondrial DNA: D-loop mapping and characterization of DNA-binding proteins

DOE Office of Scientific and Technical Information (OSTI.GOV)

Cairns, S.S.

1987-01-01

In X. laevis oocytes, mitochondrial DNA accumulates to 10/sup 5/ times the somatic cell complement, and is characterized by a high frequency of a triple-stranded displacement hoop structure at the origin of replication. To map the termini of the single strands, it was necessary to correct the nucleotide sequence of the D-loop region. The revised sequence of 2458 nucleotides contains 54 discrepancies in comparison to a previously published sequence. Radiolabeling of the nascent strands of the D-loop structure either at the 5' end or at the 3' end identifies a major species with a length of 1670 nucleotides. Cleavage ofmore » the 5' labeled strands reveals two families of ends located near several matches to an element, designated CSB-1, that is conserved in this location in several vertebrate genomes. Cleavage of 3' labeled strands produced one fragment. The unique 3' end maps to about 15 nucleotides preceding the tRNA/sup Pro/ gene. A search for proteins which may bind to mtDNA in this region to regulate nucleic acid synthesis has identified three activities in lysates of X. laevis mitochondria. The DNA-binding proteins were assayed by monitoring their ability to retard the migration of labeled double- or single-stranded DNA fragments in polyacrylamide gels. The DNA binding preference was determined by competition with an excess of either ds- or ssDNA.« less

77 FR 65537 - Requirements for Patent Applications Containing Nucleotide Sequence and/or Amino Acid Sequence...

Federal Register 2010, 2011, 2012, 2013, 2014

2012-10-29

... DEPARTMENT OF COMMERCE Patent and Trademark Office Requirements for Patent Applications Containing Nucleotide Sequence and/or Amino Acid Sequence Disclosures ACTION: Proposed collection; comment request... Patent applications that contain nucleotide and/or amino acid sequence disclosures must include a copy of...

Human retroviruses and AIDS, 1991. [CONTAINS GLOSSARY

DOE Office of Scientific and Technical Information (OSTI.GOV)

Myers, G.; Korber, B.; Berzofsky, J.A.

1991-05-01

This compendium and the accompanying floppy diskettes are the result of an effort to compile and rapidly publish all relevant molecular data concerning the human immunodeficiency viruses (HIV) and related retroviruses.The scope of the compendium and database is best summarized by the five parts that it comprises: (1) HIV and SIV Nucleotide Sequences; (2) Amino Acid Sequences; (3) Analyses; (4) Related Sequences; and (5) Database Communications. Information within all the parts is updated at least twice in each year, which accounts for the modes of binding and pagination in the compendium.

Ancient diversity and geographical sub-structuring in African buffalo Theileria parva populations revealed through metagenetic analysis of antigen-encoding loci.

PubMed

Hemmink, Johanneke D; Sitt, Tatjana; Pelle, Roger; de Klerk-Lorist, Lin-Mari; Shiels, Brian; Toye, Philip G; Morrison, W Ivan; Weir, William

2018-03-01

An infection and treatment protocol involving infection with a mixture of three parasite isolates and simultaneous treatment with oxytetracycline is currently used to vaccinate cattle against Theileria parva. While vaccination results in high levels of protection in some regions, little or no protection is observed in areas where animals are challenged predominantly by parasites of buffalo origin. A previous study involving sequencing of two antigen-encoding genes from a series of parasite isolates indicated that this is associated with greater antigenic diversity in buffalo-derived T. parva. The current study set out to extend these analyses by applying high-throughput sequencing to ex vivo samples from naturally infected buffalo to determine the extent of diversity in a set of antigen-encoding genes. Samples from two populations of buffalo, one in Kenya and the other in South Africa, were examined to investigate the effect of geographical distance on the nature of sequence diversity. The results revealed a number of significant findings. First, there was a variable degree of nucleotide sequence diversity in all gene segments examined, with the percentage of polymorphic nucleotides ranging from 10% to 69%. Second, large numbers of allelic variants of each gene were found in individual animals, indicating multiple infection events. Third, despite the observed diversity in nucleotide sequences, several of the gene products had highly conserved amino acid sequences, and thus represent potential candidates for vaccine development. Fourth, although compelling evidence for population differentiation between the Kenyan and South African T. parva parasites was identified, analysis of molecular variance for each gene revealed that the majority of the underlying nucleotide sequence polymorphism was common to both areas, indicating that much of this aspect of genetic variation in the parasite population arose prior to geographic separation. Copyright © 2018 The Authors. Published by Elsevier Ltd.. All rights reserved.

Deep sequencing revealed genome-wide single-nucleotide polymorphism and plasmid content of Erwinia amylovora strains isolated in Middle Atlas, Morocco.

PubMed

Hannou, Najat; Mondy, Samuel; Planamente, Sara; Moumni, Mohieddine; Llop, Pablo; López, María; Manceau, Charles; Barny, Marie-Anne; Faure, Denis

2013-10-01

Erwinia amylovora causes economic losses that affect pear and apple production in Morocco. Here, we report comparative genomics of four Moroccan E. amylovora strains with the European strain CFBP1430 and North-American strain ATCC49946. Analysis of single nucleotide polymorphisms (SNPs) revealed genetic homogeneity of Moroccan's strains and their proximity to the European strain CFBP1430. Moreover, the collected sequences allowed the assembly of a 65 kpb plasmid, which is highly similar to the plasmid pEI70 harbored by several European E. amylovora isolates. This plasmid was found in 33% of the 40 E. amylovora strains collected from several host plants in 2009 and 2010 in Morocco. Copyright © 2013 Institut Pasteur. Published by Elsevier Masson SAS. All rights reserved.

Analysis for complete genomic sequence of HLA-B and HLA-C alleles in the Chinese Han population.

PubMed

Zhu, F; He, Y; Zhang, W; He, J; He, J; Xu, X; Lv, H; Yan, L

2011-08-01

In the present study, we have determined the complete genomic sequence and analysed the intron polymorphism of partial HLA-B and HLA-C alleles in the Chinese Han population. Over 3.0 kb DNA fragments of HLA-B and HLA-C loci were amplified by polymerase chain reaction from partial 5' untranslated region to 3' noncoding region respectively, and then the amplified products were sequenced. Full-length nucleotide sequences of 14 HLA-B alleles and 10 HLA-C alleles were obtained and have been submitted to GenBank and IMGT/HLA database. Two novel alleles of HLA-B*52:01:01:02 and HLA-B*59:01:01:02 were identified, and the complete genomic sequence of HLA-B*52:01:01:01 was firstly reported. Totally 157 and 167 polymorphism positions were found in the full-length genomic sequence of HLA-B and HLA-C loci respectively. Our results suggested that many single nucleotide polymorphisms existed in the exon and intron regions, and the data can provide useful information for understanding the evolution of HLA-B and HLA-C alleles. © 2011 Blackwell Publishing Ltd.

Molecular evaluation of five cardiac genes in Doberman Pinschers with dilated cardiomyopathy.

PubMed

Meurs, Kathryn M; Hendrix, Kristina P; Norgard, Michelle M

2008-08-01

To sequence the exonic and splice site regions of 5 cardiac genes associated with the human form of familial dilated cardiomyopathy (DCM) in Doberman Pinschers with DCM and to identify a causative mutation. 5 unrelated Doberman Pinschers with DCM and 2 unaffected Labrador Retrievers (control dogs). Exonic and splice site regions of the 5 genes encoding the cardiac proteins troponin C, lamin A/C, cysteine- and glycine-rich protein 3, cardiac troponin T, and the beta-myosin heavy chain were sequenced. Sequences were compared for nucleotide changes between affected dogs and the published canine sequences and 2 control dogs. Base pair changes were considered to be causative for DCM if they were present in an affected dog but not in the control dogs or published sequences and if they involved a conserved amino acid and changed that amino acid to a different polarity, acid-base status, or structure. A causative mutation for DCM in Doberman Pinschers was not identified, although single nucleotide polymorphisms were detected in some dogs in the cysteine- and glycine-rich protein 3, beta-myosin heavy chain, and troponin T genes. Mutations in 5 of the cardiac genes associated with the development of DCM in humans did not appear to be causative for DCM in Doberman Pinschers. Continued evaluation of additional candidate genes or a focused approach with an association analysis is warranted to elucidate the molecular cause of this important cardiac disease in Doberman Pinschers.

Nucleotide sequences specific to Yersinia pestis and methods for the detection of Yersinia pestis

DOEpatents

McCready, Paula M [Tracy, CA; Radnedge, Lyndsay [San Mateo, CA; Andersen, Gary L [Berkeley, CA; Ott, Linda L [Livermore, CA; Slezak, Thomas R [Livermore, CA; Kuczmarski, Thomas A [Livermore, CA; Motin, Vladinir L [League City, TX

2009-02-24

Nucleotide sequences specific to Yersinia pestis that serve as markers or signatures for identification of this bacterium were identified. In addition, forward and reverse primers and hybridization probes derived from these nucleotide sequences that are used in nucleotide detection methods to detect the presence of the bacterium are disclosed.

Nucleotide sequences specific to Brucella and methods for the detection of Brucella

DOE Office of Scientific and Technical Information (OSTI.GOV)

McCready, Paula M; Radnedge, Lyndsay; Andersen, Gary L

Nucleotide sequences specific to Brucella that serves as a marker or signature for identification of this bacterium were identified. In addition, forward and reverse primers and hybridization probes derived from these nucleotide sequences that are used in nucleotide detection methods to detect the presence of the bacterium are disclosed.

The World Health Organization Global Programme on AIDS proposal for standardization of HIV sequence nomenclature. WHO Network for HIV Isolation and Characterization.

PubMed

Korber, B T; Osmanov, S; Esparza, J; Myers, G

1994-11-01

The World Health Organization Global Programme on AIDS (WHO/GPA) is conducting a large-scale collaborative study of human immunodeficiency virus type 1 (HIV-1) variation, based in four potential vaccine-trial site countries: Brazil, Rwanda, Thailand, and Uganda. Through the course of this study, it was crucial to keep track of certain attributes of the samples from which the viral nucleotide sequences were derived (e.g., country of origin and viral culture characterization), so that meaningful sequence comparisons could be made. Here we describe a system developed in the context of the WHO/GPA study that summarizes such critical attributes by representing them as standardized characters directly incorporated into sequence names. This nomenclature allows linkage of clinical, phenotypic, and geographic information with molecular data. We propose that other investigators involved in human immunodeficiency virus (HIV) nucleotide sequencing efforts adopt a similar standardized sequence nomenclature to facilitate cross-study sequence comparison. HIV sequence data are being generated at an ever-increasing rate; directly coupled to this increase is our deepening understanding of biological parameters that influence or result from sequence variability. A standardized sequence nomenclature that includes relevant biological information would enable researchers to better utilize the growing body of sequence data, and enhance their ability to interpret the biological implications of their own data through facilitating comparisons with previously published work.

On the phylogenetic placement of human T cell leukemia virus type 1 sequences associated with an Andean mummy.

PubMed

Coulthart, Michael B; Posada, David; Crandall, Keith A; Dekaban, Gregory A

2006-03-01

Recently, the putative finding of ancient human T cell leukemia virus type 1 (HTLV-1) long terminal repeat (LTR) DNA sequences in association with a 1500-year-old Chilean mummy has stirred vigorous debate. The debate is based partly on the inherent uncertainties associated with phylogenetic reconstruction when only short sequences of closely related genotypes are available. However, a full analysis of what phylogenetic information is present in the mummy data has not previously been published, leaving open the question of what precisely is the range of admissible interpretation. To fulfill this need, we re-analyzed the mummy data in a new way. We first performed phylogenetic analysis of 188 published LTR DNA sequences from extant strains belonging to the HTLV-1 Cosmopolitan clade, using the method of statistical parsimony which is designed both to optimize phylogenetic resolution among sequences with little evolutionary divergence, and to permit precise mapping of individual sequence mutations onto branches of a divergence network. We then deduced possible phylogenetic positions for the two main categories of published Chilean mummy sequences, based on their published 157-nucleotide LTR sequences. The possible phylogenetic placements for one of the mummy sequence categories are consistent with a modern origin. However, one of these placements for the other mummy sequence category falls very close to the root of the Cosmopolitan clade, consistent with an ancient origin for both this mummy sequence and the Cosmopolitan clade.

Complete nucleotide sequence of a monopartite Begomovirus and associated satellites infecting Carica papaya in Nepal.

PubMed

Shahid, M S; Yoshida, S; Khatri-Chhetri, G B; Briddon, R W; Natsuaki, K T

2013-06-01

Carica papaya (papaya) is a fruit crop that is cultivated mostly in kitchen gardens throughout Nepal. Leaf samples of C. papaya plants with leaf curling, vein darkening, vein thickening, and a reduction in leaf size were collected from a garden in Darai village, Rampur, Nepal in 2010. Full-length clones of a monopartite Begomovirus, a betasatellite and an alphasatellite were isolated. The complete nucleotide sequence of the Begomovirus showed the arrangement of genes typical of Old World begomoviruses with the highest nucleotide sequence identity (>99 %) to an isolate of Ageratum yellow vein virus (AYVV), confirming it as an isolate of AYVV. The complete nucleotide sequence of betasatellite showed greater than 89 % nucleotide sequence identity to an isolate of Tomato leaf curl Java betasatellite originating from Indonesian. The sequence of the alphasatellite displayed 92 % nucleotide sequence identity to Sida yellow vein China alphasatellite. This is the first identification of these components in Nepal and the first time they have been identified in papaya.

R3D-2-MSA: the RNA 3D structure-to-multiple sequence alignment server.

PubMed

Cannone, Jamie J; Sweeney, Blake A; Petrov, Anton I; Gutell, Robin R; Zirbel, Craig L; Leontis, Neocles

2015-07-01

The RNA 3D Structure-to-Multiple Sequence Alignment Server (R3D-2-MSA) is a new web service that seamlessly links RNA three-dimensional (3D) structures to high-quality RNA multiple sequence alignments (MSAs) from diverse biological sources. In this first release, R3D-2-MSA provides manual and programmatic access to curated, representative ribosomal RNA sequence alignments from bacterial, archaeal, eukaryal and organellar ribosomes, using nucleotide numbers from representative atomic-resolution 3D structures. A web-based front end is available for manual entry and an Application Program Interface for programmatic access. Users can specify up to five ranges of nucleotides and 50 nucleotide positions per range. The R3D-2-MSA server maps these ranges to the appropriate columns of the corresponding MSA and returns the contents of the columns, either for display in a web browser or in JSON format for subsequent programmatic use. The browser output page provides a 3D interactive display of the query, a full list of sequence variants with taxonomic information and a statistical summary of distinct sequence variants found. The output can be filtered and sorted in the browser. Previous user queries can be viewed at any time by resubmitting the output URL, which encodes the search and re-generates the results. The service is freely available with no login requirement at http://rna.bgsu.edu/r3d-2-msa. © The Author(s) 2015. Published by Oxford University Press on behalf of Nucleic Acids Research.

Mitochondrial control-region sequence variation in aboriginal Australians.

PubMed Central

van Holst Pellekaan, S; Frommer, M; Sved, J; Boettcher, B

1998-01-01

The mitochondrial D-loop hypervariable segment 1 (mt HVS1) between nucleotides 15997 and 16377 has been examined in aboriginal Australian people from the Darling River region of New South Wales (riverine) and from Yuendumu in central Australia (desert). Forty-seven unique HVS1 types were identified, varying at 49 nucleotide positions. Pairwise analysis by calculation of BEPPI (between population proportion index) reveals statistically significant structure in the populations, although some identical HVS1 types are seen in the two contrasting regions. mt HVS1 types may reflect more-ancient distributions than do linguistic diversity and other culturally distinguishing attributes. Comparison with sequences from five published global studies reveals that these Australians demonstrate greatest divergence from some Africans, least from Papua New Guinea highlanders, and only slightly more from some Pacific groups (Indonesian, Asian, Samoan, and coastal Papua New Guinea), although the HVS1 types vary at different nucleotide sites. Construction of a median network, displaying three main groups, suggests that several hypervariable nucleotide sites within the HVS1 are likely to have undergone mutation independently, making phylogenetic comparison with global samples by conventional methods difficult. Specific nucleotide-site variants are major separators in median networks constructed from Australian HVS1 types alone and for one global selection. The distribution of these, requiring extended study, suggests that they may be signatures of different groups of prehistoric colonizers into Australia, for which the time of colonization remains elusive. PMID:9463317

Random Amplification and Pyrosequencing for Identification of Novel Viral Genome Sequences

PubMed Central

Hang, Jun; Forshey, Brett M.; Kochel, Tadeusz J.; Li, Tao; Solórzano, Víctor Fiestas; Halsey, Eric S.; Kuschner, Robert A.

2012-01-01

ssRNA viruses have high levels of genomic divergence, which can lead to difficulty in genomic characterization of new viruses using traditional PCR amplification and sequencing methods. In this study, random reverse transcription, anchored random PCR amplification, and high-throughput pyrosequencing were used to identify orthobunyavirus sequences from total RNA extracted from viral cultures of acute febrile illness specimens. Draft genome sequence for the orthobunyavirus L segment was assembled and sequentially extended using de novo assembly contigs from pyrosequencing reads and orthobunyavirus sequences in GenBank as guidance. Accuracy and continuous coverage were achieved by mapping all reads to the L segment draft sequence. Subsequently, RT-PCR and Sanger sequencing were used to complete the genome sequence. The complete L segment was found to be 6936 bases in length, encoding a 2248-aa putative RNA polymerase. The identified L segment was distinct from previously published South American orthobunyaviruses, sharing 63% and 54% identity at the nucleotide and amino acid level, respectively, with the complete Oropouche virus L segment and 73% and 81% identity at the nucleotide and amino acid level, respectively, with a partial Caraparu virus L segment. The result demonstrated the effectiveness of a sequence-independent amplification and next-generation sequencing approach for obtaining complete viral genomes from total nucleic acid extracts and its use in pathogen discovery. PMID:22468136

Nucleotide sequences encoding a thermostable alkaline protease

DOEpatents

Wilson, David B.; Lao, Guifang

1998-01-01

Nucleotide sequences, derived from a thermophilic actinomycete microorganism, which encode a thermostable alkaline protease are disclosed. Also disclosed are variants of the nucleotide sequences which encode a polypeptide having thermostable alkaline proteolytic activity. Recombinant thermostable alkaline protease or recombinant polypeptide may be obtained by culturing in a medium a host cell genetically engineered to contain and express a nucleotide sequence according to the present invention, and recovering the recombinant thermostable alkaline protease or recombinant polypeptide from the culture medium.

Learning a Weighted Sequence Model of the Nucleosome Core and Linker Yields More Accurate Predictions in Saccharomyces cerevisiae and Homo sapiens

PubMed Central

Reynolds, Sheila M.; Bilmes, Jeff A.; Noble, William Stafford

2010-01-01

DNA in eukaryotes is packaged into a chromatin complex, the most basic element of which is the nucleosome. The precise positioning of the nucleosome cores allows for selective access to the DNA, and the mechanisms that control this positioning are important pieces of the gene expression puzzle. We describe a large-scale nucleosome pattern that jointly characterizes the nucleosome core and the adjacent linkers and is predominantly characterized by long-range oscillations in the mono, di- and tri-nucleotide content of the DNA sequence, and we show that this pattern can be used to predict nucleosome positions in both Homo sapiens and Saccharomyces cerevisiae more accurately than previously published methods. Surprisingly, in both H. sapiens and S. cerevisiae, the most informative individual features are the mono-nucleotide patterns, although the inclusion of di- and tri-nucleotide features results in improved performance. Our approach combines a much longer pattern than has been previously used to predict nucleosome positioning from sequence—301 base pairs, centered at the position to be scored—with a novel discriminative classification approach that selectively weights the contributions from each of the input features. The resulting scores are relatively insensitive to local AT-content and can be used to accurately discriminate putative dyad positions from adjacent linker regions without requiring an additional dynamic programming step and without the attendant edge effects and assumptions about linker length modeling and overall nucleosome density. Our approach produces the best dyad-linker classification results published to date in H. sapiens, and outperforms two recently published models on a large set of S. cerevisiae nucleosome positions. Our results suggest that in both genomes, a comparable and relatively small fraction of nucleosomes are well-positioned and that these positions are predictable based on sequence alone. We believe that the bulk of the remaining nucleosomes follow a statistical positioning model. PMID:20628623

Improved nucleic acid descriptors for siRNA efficacy prediction.

PubMed

Sciabola, Simone; Cao, Qing; Orozco, Modesto; Faustino, Ignacio; Stanton, Robert V

2013-02-01

Although considerable progress has been made recently in understanding how gene silencing is mediated by the RNAi pathway, the rational design of effective sequences is still a challenging task. In this article, we demonstrate that including three-dimensional descriptors improved the discrimination between active and inactive small interfering RNAs (siRNAs) in a statistical model. Five descriptor types were used: (i) nucleotide position along the siRNA sequence, (ii) nucleotide composition in terms of presence/absence of specific combinations of di- and trinucleotides, (iii) nucleotide interactions by means of a modified auto- and cross-covariance function, (iv) nucleotide thermodynamic stability derived by the nearest neighbor model representation and (v) nucleic acid structure flexibility. The duplex flexibility descriptors are derived from extended molecular dynamics simulations, which are able to describe the sequence-dependent elastic properties of RNA duplexes, even for non-standard oligonucleotides. The matrix of descriptors was analysed using three statistical packages in R (partial least squares, random forest, and support vector machine), and the most predictive model was implemented in a modeling tool we have made publicly available through SourceForge. Our implementation of new RNA descriptors coupled with appropriate statistical algorithms resulted in improved model performance for the selection of siRNA candidates when compared with publicly available siRNA prediction tools and previously published test sets. Additional validation studies based on in-house RNA interference projects confirmed the robustness of the scoring procedure in prospective studies.

Ab initio DNA synthesis by Bst polymerase in the presence of nicking endonucleases Nt.AlwI, Nb.BbvCI, and Nb.BsmI.

PubMed

Antipova, Valeriya N; Zheleznaya, Lyudmila A; Zyrina, Nadezhda V

2014-08-01

In the absence of added DNA, thermophilic DNA polymerases synthesize double-stranded DNA from free dNTPs, which consist of numerous repetitive units (ab initio DNA synthesis). The addition of thermophilic restriction endonuclease (REase), or nicking endonuclease (NEase), effectively stimulates ab initio DNA synthesis and determines the nucleotide sequence of reaction products. We have found that NEases Nt.AlwI, Nb.BbvCI, and Nb.BsmI with non-palindromic recognition sites stimulate the synthesis of sequences organized mainly as palindromes. Moreover, the nucleotide sequence of the palindromes appeared to be dependent on NEase recognition/cleavage modes. Thus, the heterodimeric Nb.BbvCI stimulated the synthesis of palindromes composed of two recognition sites of this NEase, which were separated by AT-reach sequences or (A)n (T)m spacers. Palindromic DNA sequences obtained in the ab initio DNA synthesis with the monomeric NEases Nb.BsmI and Nt.AlwI contained, along with the sites of these NEases, randomly synthesized sequences consisted of blocks of short repeats. These findings could help investigation of the potential abilities of highly productive ab initio DNA synthesis for the creation of DNA molecules with desirable sequence. © 2014 Federation of European Microbiological Societies. Published by John Wiley & Sons Ltd. All rights reserved.

Nucleotide sequences specific to Francisella tularensis and methods for the detection of Francisella tularensis

DOEpatents

McCready, Paula M [Tracy, CA; Radnedge, Lyndsay [San Mateo, CA; Andersen, Gary L [Berkeley, CA; Ott, Linda L [Livermore, CA; Slezak, Thomas R [Livermore, CA; Kuczmarski, Thomas A [Livermore, CA; Vitalis, Elizabeth A [Livermore, CA

2007-02-06

Described herein is the identification of nucleotide sequences specific to Francisella tularensis that serves as a marker or signature for identification of this bacterium. In addition, forward and reverse primers and hybridization probes derived from these nucleotide sequences that are used in nucleotide detection methods to detect the presence of the bacterium are disclosed.

Nucleotide sequences specific to Francisella tularensis and methods for the detection of Francisella tularensis

DOEpatents

McCready, Paula M [Tracy, CA; Radnedge, Lyndsay [San Mateo, CA; Andersen, Gary L [Berkeley, CA; Ott, Linda L [Livermore, CA; Slezak, Thomas R [Livermore, CA; Kuczmarski, Thomas A [Livermore, CA; Vitalis, Elizabeth A [Livermore, CA

2009-02-24

Described herein is the identification of nucleotide sequences specific to Francisella tularensis that serves as a marker or signature for identification of this bacterium. In addition, forward and reverse primers and hybridization probes derived from these nucleotide sequences that are used in nucleotide detection methods to detect the presence of the bacterium are disclosed.

Computed Energetics of Nucleotides in Spatial Ribozyme Structures: An Accurate Identification of Functional Regions from Structure

PubMed Central

Torshin, Ivan Y.

2004-01-01

Ribozymes are functionally diverse RNA molecules with intrinsic catalytic activity. Multiple structural and biochemical studies are required to establish which nucleotide bases are involved in the catalysis. The relative energetic properties of the nucleotide bases have been analyzed in a set of the known ribozyme structures. It was found that many of the known catalytic nucleotides can be identified using only the structure without any additional biochemical data. The results of the calculations compare well with the available biochemical data on RNA stability. Extensive in silico mutagenesis suggests that most of the nucleotides in ribozymes stabilize the RNA. The calculations show that relative contribution of the catalytic bases to RNA stability observably differs from contributions of the noncatalytic bases. Distinction between the concepts of “relative stability” and “mutational stability” is suggested. As results of prediction for several models of ribozymes appear to be in agreement with the published data on the potential active site regions, the method can potentially be used for prediction of functional nucleotides from nucleic sequence. PMID:15105962

Complete Sequence of the mitochondrial genome of the tapeworm Hymenolepis diminuta: Gene arrangements indicate that platyhelminths are eutrochozoans

DOE Office of Scientific and Technical Information (OSTI.GOV)

von Nickisch-Rosenegk, Markus; Brown, Wesley M.; Boore, Jeffrey L.

2001-01-01

Using ''long-PCR'' we have amplified in overlapping fragments the complete mitochondrial genome of the tapeworm Hymenolepis diminuta (Platyhelminthes: Cestoda) and determined its 13,900 nucleotide sequence. The gene content is the same as that typically found for animal mitochondrial DNA (mtDNA) except that atp8 appears to be lacking, a condition found previously for several other animals. Despite the small size of this mtDNA, there are two large non-coding regions, one of which contains 13 repeats of a 31 nucleotide sequence and a potential stem-loop structure of 25 base pairs with an 11-member loop. Large potential secondary structures are identified also formore » the non-coding regions of two other cestode mtDNAs. Comparison of the mitochondrial gene arrangement of H. diminuta with those previously published supports a phylogenetic position of flatworms as members of the Eutrochozoa, rather than being basal to either a clade of protostomes or a clade of coelomates.« less

Identification of IBV QX vaccine markers : Should vaccine acceptance by authorities require similar identifications for all live IBV vaccines?

PubMed

Listorti, Valeria; Laconi, Andrea; Catelli, Elena; Cecchinato, Mattia; Lupini, Caterina; Naylor, Clive J

2017-10-09

IBV genotype QX causes sufficient disease in Europe for several commercial companies to have started developing live attenuated vaccines. Here, one of those vaccines (L1148) was fully consensus sequenced alongside its progenitor field strain (1148-A) to determine vaccine markers, thereby enabling detection on farms. Twenty-eight single nucleotide substitutions were associated with the 1148-A attenuation, of which any combination can identify vaccine L1148 in the field. Sixteen substitutions resulted in amino acid coding changes of which half were in spike. One change in the 1b gene altered the normally highly conserved final 5 nucleotides of the transcription regulatory sequence of the S gene, common to all IBV QX genes. No mutations can currently be associated with the attenuation process. Field vaccination strategies would greatly benefit by such comparative sequence data being mandatorily submitted to regulators prior to vaccine release following a successful registration process. Copyright © 2017. Published by Elsevier Ltd.

Multilocus amplicon sequencing of Pseudomonas aeruginosa cystic fibrosis airways isolates collected prior to and after early antipseudomonal chemotherapy.

PubMed

Fischer, Sebastian; Greipel, Leonie; Klockgether, Jens; Dorda, Marie; Wiehlmann, Lutz; Cramer, Nina; Tümmler, Burkhard

2017-05-01

Early antimicrobial chemotherapy can prevent or at least delay chronic cystic fibrosis (CF) airways infections with Pseudomonas aeruginosa. During a 10-year study period P. aeruginosa was detected for the first time in 54 CF patients regularly seen at the CF centre Hannover. Amplicon sequencing of 34 loci of the P. aeruginosa core genome was performed in baseline and post-treatment isolates of the 15 CF patients who had remained P. aeruginosa - positive after the first round of antipseudomonal chemotherapy. Deep sequencing uncovered coexisting alternative nucleotides at in total 33 of 55,284 examined genome positions including six non-synonymous polymorphisms in the lasR gene, a key regulator of quorum sensing. After early treatment 42 of 50 novel nucleotide substitutions had emerged in exopolysaccharide biosynthesis, efflux pump and porin genes. Early treatment selects pathoadaptive mutations in P. aeruginosa that are typical for chronic infections of CF lungs. Copyright © 2016 European Cystic Fibrosis Society. Published by Elsevier B.V. All rights reserved.

Genomic stability of adipogenic human adenovirus 36.

PubMed

Nam, J-H; Na, H-N; Atkinson, R L; Dhurandhar, N V

2014-02-01

Human adenovirus Ad36 increases adiposity in several animal models, including rodents and non-human primates. Importantly, Ad36 is associated with human obesity, which has prompted research to understand its epidemiology and to develop a vaccine to prevent a subgroup of obesity. For this purpose, understanding the genomic stability of Ad36 in vivo and in vitro infections is critical. Here, we examined whether in vitro cell passaging over a 14-year period introduced any genetic variation in Ad36. We sequenced the whole genome of Ad36-which was plaque purified in 1998 from the original strain obtained from American Type Culture Collection, and passaged approximately 12 times over the past 14 years (Ad36-2012). This DNA sequence was compared with a previously published sequence of Ad36 likely obtained from the same source (Ad36-1988). Compared with Ad36-1988, only two nucleotides were altered in Ad36-2012: a T insertion at nucleotide 1862, which may induce early termination of the E1B viral protein, and a T➝C transition at nucleotide 26 136. Virus with the T insertion (designated Ad36-2012-T6) was mixed with wild-type virus lacking the T insertion (designated Ad36-2012-T5) in the viral stock. The transition at nucleotide 26 136 does not change the encoded amino acid (aspartic acid) in the pVIII viral protein. The rate of genetic variation in Ad36 is ∼2.37 × 10(-6) mutations/nucleotide/passage. Of particular importance, there were no mutations in the E4orf1 gene, the critical gene for producing obesity. This very-low-variation rate should reduce concerns about genetic variability when developing Ad36 vaccines or developing assays for detecting Ad36 infection in populations.

Nucleotide sequences encoding a thermostable alkaline protease

DOEpatents

Wilson, D.B.; Lao, G.

1998-01-06

Nucleotide sequences, derived from a thermophilic actinomycete microorganism, which encode a thermostable alkaline protease are disclosed. Also disclosed are variants of the nucleotide sequences which encode a polypeptide having thermostable alkaline proteolytic activity. Recombinant thermostable alkaline protease or recombinant polypeptide may be obtained by culturing in a medium a host cell genetically engineered to contain and express a nucleotide sequence according to the present invention, and recovering the recombinant thermostable alkaline protease or recombinant polypeptide from the culture medium. 3 figs.

Bean common mosaic virus isolates causing different symptoms in asparagus bean in China differ greatly in the 5'-parts of their genomes.

PubMed

Zheng, Hongying; Chen, Jiong; Chen, Jianping; Adams, Michael J; Hou, Mingsheng

2002-06-01

Potyvirus isolates from asparagus bean ( Vigna sesquipedalis) plants in Zhejiang province, China, caused either rugose and vein banding mosaic symptoms (isolate R) or severe yellowing (isolate Y) in this host, but were otherwise similar in host range. Both isolates were completely sequenced and shown to be isolates of Bean common mosaic virus (BCMV). The complete sequences were 9992 (R) or 10062 (Y) nucleotides long and shared 91.7% identical nucleotides (93.2% identical amino acids) in their genomes and were more distantly related to the BCMV-Peanut stripe virus sequence (PStV). The isolates were much less similar to one another in the 5'-UTR and the N-terminal region of the P1 protein. In the P1, isolate Y was closer to PStV (76.1% identical amino acids) than to isolate R (64.8%). Phylogenetic analyses of the coat protein region showed that the new isolates grouped with other isolates from Vigna spp., forming the blackeye cowpea mosaic strain subgroup of BCMV with 94-98% nucleotides (96-99% amino acids) identical to one another and about 90% identity to other BCMV isolates. Other significant subgroupings amongst published BCMV isolates were detected.

Cy3 and Cy5 dyes attached to oligonucleotide terminus stabilize DNA duplexes: predictive thermodynamic model.

PubMed

Moreira, Bernardo G; You, Yong; Owczarzy, Richard

2015-03-01

Cyanine dyes are important chemical modifications of oligonucleotides exhibiting intensive and stable fluorescence at visible light wavelengths. When Cy3 or Cy5 dye is attached to 5' end of a DNA duplex, the dye stacks on the terminal base pair and stabilizes the duplex. Using optical melting experiments, we have determined thermodynamic parameters that can predict the effects of the dyes on duplex stability quantitatively (ΔG°, Tm). Both Cy dyes enhance duplex formation by 1.2 kcal/mol on average, however, this Gibbs energy contribution is sequence-dependent. If the Cy5 is attached to a pyrimidine nucleotide of pyrimidine-purine base pair, the stabilization is larger compared to the attachment to a purine nucleotide. This is likely due to increased stacking interactions of the dye to the purine of the complementary strand. Dangling (unpaired) nucleotides at duplex terminus are also known to enhance duplex stability. Stabilization originated from the Cy dyes is significantly larger than the stabilization due to the presence of dangling nucleotides. If both the dangling base and Cy3 are present, their thermodynamic contributions are approximately additive. New thermodynamic parameters improve predictions of duplex folding, which will help design oligonucleotide sequences for biophysical, biological, engineering, and nanotechnology applications. Copyright © 2015. Published by Elsevier B.V.

Molecular Characterization of two Potato Virus S Isolates from Late Blight Resistant Genotypes of Potato (Solanum tuberosum)

USDA-ARS?s Scientific Manuscript database

Potato virus S (PVS) has a widespread distribution in the U.S. However, only two complete nucleotide sequences have been published. A recent survey of potato fields in the state of Washington confirms that PVS is widely prevalent. Late blight resistant (LBR) potato cultivars and genotypes were sho...

Characterization of Austrian koi herpesvirus samples based on the ORF40 region.

PubMed

Marek, A; Schachner, O; Bilic, I; Hess, M

2010-02-17

Using a PCR that amplifies a region of the thymidine kinase (TK) gene, an epidemic spread of koi herpesvirus (KHV) was determined in koi carps in Austria in 2007. A total of 15 virus samples from different locations in Austria were analyzed to determine their genetic relatedness following PCR and nucleic acid sequencing of the open reading frame 40 (ORF40) region of the KHV genome. ORF40-specific PCR amplification products that were obtained from tissue samples shared 100% nucleotide sequence identity with the published sequence of the Japanese strain of KHV. The ORF40 sequence of one isolate from the UK that was included in the present study was 100% identical with the published sequence of an Israeli strain of KHV. This is the first study that used a larger number of samples and a PCR method, which allowed distinguishing all 3 strains of KHV. The present investigation provides information on the epidemiology of KHV infections in Europe and describes a useful molecular tool for epidemiological studies.

[Completed sequences analysis on the Chinese attenuated yellow fever 17D vaccine strain and the WHO standard yellow fever 17D vaccine strain].

PubMed

Li, Jing; Yu, Yong-Xin; Dong, Guan-Mu

2009-04-01

To compare the molecular characteristics of the Chinese attenuated yellow fever 17D vaccine strain and the WHO reference yellow fever 17D vaccine strain. The primers were designed according to the published nucleotide sequences of YFV 17D strains in GenBank. Total RNA of was extracted by the Trizol and reverse transcripted. The each fragments of the YFV genome were amplified by PCR and sequenced subsequently. The fragments of the 5' and 3' end of the two strains were cloned into the pGEM T-easy vector and then sequenced. The nucleotide acid and amino acid sequences of the homology to both strains were 99% with each other. No obvious nulceotide changes were found in the sequences of the entire genome of each 17D strains. Moreover, there was no obvious changes in the E protein genes. But the E173 of YF17D Tiantan, associted with the virulence, had mutantions. And the two live attenuated yellow fever 17D vaccine strains fell to the same lineage by the phylogenetic analysis. The results indicated that the two attenuated yellow fever 17D vaccine viruses accumulates mutations at a very low frequency and the genomes were relative stable.

Application of a time-dependent coalescence process for inferring the history of population size changes from DNA sequence data.

PubMed

Polanski, A; Kimmel, M; Chakraborty, R

1998-05-12

Distribution of pairwise differences of nucleotides from data on a sample of DNA sequences from a given segment of the genome has been used in the past to draw inferences about the past history of population size changes. However, all earlier methods assume a given model of population size changes (such as sudden expansion), parameters of which (e.g., time and amplitude of expansion) are fitted to the observed distributions of nucleotide differences among pairwise comparisons of all DNA sequences in the sample. Our theory indicates that for any time-dependent population size, N(tau) (in which time tau is counted backward from present), a time-dependent coalescence process yields the distribution, p(tau), of the time of coalescence between two DNA sequences randomly drawn from the population. Prediction of p(tau) and N(tau) requires the use of a reverse Laplace transform known to be unstable. Nevertheless, simulated data obtained from three models of monotone population change (stepwise, exponential, and logistic) indicate that the pattern of a past population size change leaves its signature on the pattern of DNA polymorphism. Application of the theory to the published mtDNA sequences indicates that the current mtDNA sequence variation is not inconsistent with a logistic growth of the human population.

Detection of microRNAs in color space.

PubMed

Marco, Antonio; Griffiths-Jones, Sam

2012-02-01

Deep sequencing provides inexpensive opportunities to characterize the transcriptional diversity of known genomes. The AB SOLiD technology generates millions of short sequencing reads in color-space; that is, the raw data is a sequence of colors, where each color represents 2 nt and each nucleotide is represented by two consecutive colors. This strategy is purported to have several advantages, including increased ability to distinguish sequencing errors from polymorphisms. Several programs have been developed to map short reads to genomes in color space. However, a number of previously unexplored technical issues arise when using SOLiD technology to characterize microRNAs. Here we explore these technical difficulties. First, since the sequenced reads are longer than the biological sequences, every read is expected to contain linker fragments. The color-calling error rate increases toward the 3(') end of the read such that recognizing the linker sequence for removal becomes problematic. Second, mapping in color space may lead to the loss of the first nucleotide of each read. We propose a sequential trimming and mapping approach to map small RNAs. Using our strategy, we reanalyze three published insect small RNA deep sequencing datasets and characterize 22 new microRNAs. A bash shell script to perform the sequential trimming and mapping procedure, called SeqTrimMap, is available at: http://www.mirbase.org/tools/seqtrimmap/ antonio.marco@manchester.ac.uk Supplementary data are available at Bioinformatics online.

Molecular diagnosis of lyssaviruses and sequence comparison of Australian bat lyssavirus samples.

PubMed

Foord, A J; Heine, H G; Pritchard, L I; Lunt, R A; Newberry, K M; Rootes, C L; Boyle, D B

2006-07-01

To evaluate and implement molecular diagnostic tests for the detection of lyssaviruses in Australia. A published hemi-nested reverse transcriptase polymerase chain reaction (RT-PCR) for the detection of all lyssavirus genotypes was modified to a fully nested RT-PCR format and compared with the original assay. TaqMan assays for the detection of Australian bat lyssavirus (ABLV) were compared with both the nested and hemi-nested RT-PCR assays. The sequences of RT-PCR products were determined to assess sequence variations of the target region (nucleocapsid gene) in samples of ABLV originating from different regions. The nested RT-PCR assay was highly analytically specific, and at least as analytically sensitive as the hemi-nested assay. The TaqMan assays were highly analytically specific and more analytically sensitive than either RT-PCR assay, with a detection level of approximately 10 genome equivalents per microl. Sequence of the first 544 nucleotides of the nucleocapsid protein coding sequence was obtained from all samples of ABLV received at Australian Animal Health Laboratory during the study period. The nested RT-PCR provided a means for molecular diagnosis of all tested genotypes of lyssavirus including classical rabies virus and Australian bat lyssavirus. The published TaqMan assay proved to be superior to the RT-PCR assays for the detection of ABLV in terms of analytical sensitivity. The TaqMan assay would also be faster and cross contamination is less likely. Nucleotide sequence analyses of samples of ABLV from a wide geographical range in Australia demonstrated the conserved nature of this region of the genome and therefore the suitability of this region for molecular diagnosis.

Characterization of apple stem grooving virus and apple chlorotic leaf spot virus identified in a crab apple tree.

PubMed

Li, Yongqiang; Deng, Congliang; Bian, Yong; Zhao, Xiaoli; Zhou, Qi

2017-04-01

Apple stem grooving virus (ASGV), apple chlorotic leaf spot virus (ACLSV), and prunus necrotic ringspot virus (PNRSV) were identified in a crab apple tree by small RNA deep sequencing. The complete genome sequence of ACLSV isolate BJ (ACLSV-BJ) was 7554 nucleotides and shared 67.0%-83.0% nucleotide sequence identity with other ACLSV isolates. A phylogenetic tree based on the complete genome sequence of all available ACLSV isolates showed that ACLSV-BJ clustered with the isolates SY01 from hawthorn, MO5 from apple, and JB, KMS and YH from pear. The complete nucleotide sequence of ASGV-BJ was 6509 nucleotides (nt) long and shared 78.2%-80.7% nucleotide sequence identity with other isolates. ASGV-BJ and the isolate ASGV_kfp clustered together in the phylogenetic tree as an independent clade. Recombination analysis showed that isolate ASGV-BJ was a naturally occurring recombinant.

Composition for nucleic acid sequencing

DOEpatents

Korlach, Jonas [Ithaca, NY; Webb, Watt W [Ithaca, NY; Levene, Michael [Ithaca, NY; Turner, Stephen [Ithaca, NY; Craighead, Harold G [Ithaca, NY; Foquet, Mathieu [Ithaca, NY

2008-08-26

The present invention is directed to a method of sequencing a target nucleic acid molecule having a plurality of bases. In its principle, the temporal order of base additions during the polymerization reaction is measured on a molecule of nucleic acid, i.e. the activity of a nucleic acid polymerizing enzyme on the template nucleic acid molecule to be sequenced is followed in real time. The sequence is deduced by identifying which base is being incorporated into the growing complementary strand of the target nucleic acid by the catalytic activity of the nucleic acid polymerizing enzyme at each step in the sequence of base additions. A polymerase on the target nucleic acid molecule complex is provided in a position suitable to move along the target nucleic acid molecule and extend the oligonucleotide primer at an active site. A plurality of labelled types of nucleotide analogs are provided proximate to the active site, with each distinguishable type of nucleotide analog being complementary to a different nucleotide in the target nucleic acid sequence. The growing nucleic acid strand is extended by using the polymerase to add a nucleotide analog to the nucleic acid strand at the active site, where the nucleotide analog being added is complementary to the nucleotide of the target nucleic acid at the active site. The nucleotide analog added to the oligonucleotide primer as a result of the polymerizing step is identified. The steps of providing labelled nucleotide analogs, polymerizing the growing nucleic acid strand, and identifying the added nucleotide analog are repeated so that the nucleic acid strand is further extended and the sequence of the target nucleic acid is determined.

Method for sequencing nucleic acid molecules

DOEpatents

Korlach, Jonas; Webb, Watt W.; Levene, Michael; Turner, Stephen; Craighead, Harold G.; Foquet, Mathieu

2006-06-06

The present invention is directed to a method of sequencing a target nucleic acid molecule having a plurality of bases. In its principle, the temporal order of base additions during the polymerization reaction is measured on a molecule of nucleic acid, i.e. the activity of a nucleic acid polymerizing enzyme on the template nucleic acid molecule to be sequenced is followed in real time. The sequence is deduced by identifying which base is being incorporated into the growing complementary strand of the target nucleic acid by the catalytic activity of the nucleic acid polymerizing enzyme at each step in the sequence of base additions. A polymerase on the target nucleic acid molecule complex is provided in a position suitable to move along the target nucleic acid molecule and extend the oligonucleotide primer at an active site. A plurality of labelled types of nucleotide analogs are provided proximate to the active site, with each distinguishable type of nucleotide analog being complementary to a different nucleotide in the target nucleic acid sequence. The growing nucleic acid strand is extended by using the polymerase to add a nucleotide analog to the nucleic acid strand at the active site, where the nucleotide analog being added is complementary to the nucleotide of the target nucleic acid at the active site. The nucleotide analog added to the oligonucleotide primer as a result of the polymerizing step is identified. The steps of providing labelled nucleotide analogs, polymerizing the growing nucleic acid strand, and identifying the added nucleotide analog are repeated so that the nucleic acid strand is further extended and the sequence of the target nucleic acid is determined.

Method for sequencing nucleic acid molecules

DOEpatents

Korlach, Jonas; Webb, Watt W.; Levene, Michael; Turner, Stephen; Craighead, Harold G.; Foquet, Mathieu

2006-05-30

The present invention is directed to a method of sequencing a target nucleic acid molecule having a plurality of bases. In its principle, the temporal order of base additions during the polymerization reaction is measured on a molecule of nucleic acid, i.e. the activity of a nucleic acid polymerizing enzyme on the template nucleic acid molecule to be sequenced is followed in real time. The sequence is deduced by identifying which base is being incorporated into the growing complementary strand of the target nucleic acid by the catalytic activity of the nucleic acid polymerizing enzyme at each step in the sequence of base additions. A polymerase on the target nucleic acid molecule complex is provided in a position suitable to move along the target nucleic acid molecule and extend the oligonucleotide primer at an active site. A plurality of labelled types of nucleotide analogs are provided proximate to the active site, with each distinguishable type of nucleotide analog being complementary to a different nucleotide in the target nucleic acid sequence. The growing nucleic acid strand is extended by using the polymerase to add a nucleotide analog to the nucleic acid strand at the active site, where the nucleotide analog being added is complementary to the nucleotide of the target nucleic acid at the active site. The nucleotide analog added to the oligonucleotide primer as a result of the polymerizing step is identified. The steps of providing labelled nucleotide analogs, polymerizing the growing nucleic acid strand, and identifying the added nucleotide analog are repeated so that the nucleic acid strand is further extended and the sequence of the target nucleic acid is determined.

Poliovirus serotype-specific VP1 sequencing primers.

PubMed

Kilpatrick, David R; Iber, Jane C; Chen, Qi; Ching, Karen; Yang, Su-Ju; De, Lina; Mandelbaum, Mark D; Emery, Brian; Campagnoli, Ray; Burns, Cara C; Kew, Olen

2011-06-01

The Global Polio Laboratory Network routinely uses poliovirus-specific PCR primers and probes to determine the serotype and genotype of poliovirus isolates obtained as part of global poliovirus surveillance. To provide detailed molecular epidemiologic information, poliovirus isolates are further characterized by sequencing the ~900-nucleotide region encoding the major capsid protein, VP1. It is difficult to obtain quality sequence information when clinical or environmental samples contain poliovirus mixtures. As an alternative to conventional methods for resolving poliovirus mixtures, sets of serotype-specific primers were developed for amplifying and sequencing the VP1 regions of individual components of mixed populations of vaccine-vaccine, vaccine-wild, and wild-wild polioviruses. Published by Elsevier B.V.

DNA Barcodes of Asian Houbara Bustard (Chlamydotis undulata macqueenii)

PubMed Central

Arif, Ibrahim A.; Khan, Haseeb A.; Williams, Joseph B.; Shobrak, Mohammad; Arif, Waad I.

2012-01-01

Populations of Houbara Bustards have dramatically declined in recent years. Captive breeding and reintroduction programs have had limited success in reviving population numbers and thus new technological solutions involving molecular methods are essential for the long term survival of this species. In this study, we sequenced the 694 bp segment of COI gene of the four specimens of Asian Houbara Bustard (Chlamydotis undulata macqueenii). We also compared these sequences with earlier published barcodes of 11 individuals comprising different families of the orders Gruiformes, Ciconiiformes, Podicipediformes and Crocodylia (out group). The pair-wise sequence comparison showed a total of 254 variable sites across all the 15 sequences from different taxa. Three of the four specimens of Houbara Bustard had an identical sequence of COI gene and one individual showed a single nucleotide difference (G > A transition at position 83). Within the bustard family (Otididae), comparison among the three species (Asian Houbara Bustard, Great Bustard (Otis tarda) and the Little Bustard (Tetrax tetrax)), representing three different genera, showed 116 variable sites. For another family (Rallidae), the intra-family variable sites among the individuals of four different genera were found to be 146. The COI genetic distances among the 15 individuals varied from 0.000 to 0.431. Phylogenetic analysis using 619 bp nucleotide segment of COI clearly discriminated all the species representing different genera, families and orders. All the four specimens of Houbara Bustard formed a single clade and are clearly separated from other two individuals of the same family (Otis tarda and Tetrax tetrax). The nucleotide sequence of partial segment of COI gene effectively discriminated the closely related species. This is the first study reporting the barcodes of Houbara Bustard and would be helpful in future molecular studies, particularly for the conservation of this threatened bird in Saudi Arabia. PMID:22408462

Organellar phylogenomics of an emerging model system: Sphagnum (peatmoss).

PubMed

Jonathan Shaw, A; Devos, Nicolas; Liu, Yang; Cox, Cymon J; Goffinet, Bernard; Flatberg, Kjell Ivar; Shaw, Blanka

2016-08-01

Sphagnum-dominated peatlands contain approx. 30 % of the terrestrial carbon pool in the form of partially decomposed plant material (peat), and, as a consequence, Sphagnum is currently a focus of studies on biogeochemistry and control of global climate. Sphagnum species differ in ecologically important traits that scale up to impact ecosystem function, and sequencing of the genome from selected Sphagnum species is currently underway. As an emerging model system, these resources for Sphagnum will facilitate linking nucleotide variation to plant functional traits, and through those traits to ecosystem processes. A solid phylogenetic framework for Sphagnum is crucial to comparative analyses of species-specific traits, but relationships among major clades within Sphagnum have been recalcitrant to resolution because the genus underwent a rapid radiation. Herein a well-supported hypothesis for phylogenetic relationships among major clades within Sphagnum based on organellar genome sequences (plastid, mitochondrial) is provided. We obtained nucleotide sequences (273 753 nucleotides in total) from the two organellar genomes from 38 species (including three outgroups). Phylogenetic analyses were conducted using a variety of methods applied to nucleotide and amino acid sequences. The Sphagnum phylogeny was rooted with sequences from the related Sphagnopsida genera, Eosphagnum and Flatbergium Phylogenetic analyses of the data converge on the following subgeneric relationships: (Rigida (((Subsecunda) (Cuspidata)) ((Sphagnum) (Acutifolia))). All relationships were strongly supported. Species in the two major clades (i.e. Subsecunda + Cuspidata and Sphagnum + Acutifolia), which include >90 % of all Sphagnum species, differ in ecological niches and these differences correlate with other functional traits that impact biogeochemical cycling. Mitochondrial intron presence/absence are variable among species and genera of the Sphagnopsida. Two new nomenclatural combinations are made, in the genera Eosphagnum and Flatbergium Newly resolved relationships now permit phylogenetic analyses of morphological, biochemical and ecological traits among Sphagnum species. The results clarify long-standing disagreements about subgeneric relationships and intrageneric classification. © The Author 2016. Published by Oxford University Press on behalf of the Annals of Botany Company. All rights reserved. For Permissions, please email: journals.permissions@oup.com.

Nucleotide sequence of the beta-lactamase gene from Enterococcus faecalis HH22 and its similarity to staphylococcal beta-lactamase genes.

PubMed Central

Zscheck, K K; Murray, B E

1991-01-01

The nucleotide sequence of the constitutively produced beta-lactamase (Bla) gene from Enterococcus faecalis HH22 was shown to be identical to the published sequences of three of four staphylococcal type A beta-lactamase genes; more differences were seen with the genes for staphylococcal type C and D enzymes. One hundred forty nucleotides upstream of the beta-lactamase start codon were determined for an inducible staphylococcal beta-lactamase and were identical to those of the constitutively expressed enterococcal gene, indicating that the changes resulting in constitutive expression are not due to changes in the promoter or operator region. Moreover, complementation studies indicated that production of the enterococcal enzyme could be repressed. The genes for the enterococcal Bla and an inducible staphylococcal Bla were each cloned into a shuttle vector and transformed into enterococcal and staphylococcal recipients. The major difference between the backgrounds of the two hosts was that more enzyme was produced by the staphylococcal host, regardless of the source of the gene. The location of the enzyme was found to be host dependent, since each cloned gene generated extracellular (free) enzyme in the staphylococcus and cell-bound enzyme in the enterococcus. On the basis of the identities of the enterococcal Bla and several staphylococcal Bla sequences, these data suggest the recent spread of beta-lactamase to enterococci and also suggest the loss of a functional repressor. PMID:1952840

Labeled nucleotide phosphate (NP) probes

DOEpatents

Korlach, Jonas [Ithaca, NY; Webb, Watt W [Ithaca, NY; Levene, Michael [Ithaca, NY; Turner, Stephen [Ithaca, NY; Craighead, Harold G [Ithaca, NY; Foquet, Mathieu [Ithaca, NY

2009-02-03

The present invention is directed to a method of sequencing a target nucleic acid molecule having a plurality of bases. In its principle, the temporal order of base additions during the polymerization reaction is measured on a molecule of nucleic acid, i.e. the activity of a nucleic acid polymerizing enzyme on the template nucleic acid molecule to be sequenced is followed in real time. The sequence is deduced by identifying which base is being incorporated into the growing complementary strand of the target nucleic acid by the catalytic activity of the nucleic acid polymerizing enzyme at each step in the sequence of base additions. A polymerase on the target nucleic acid molecule complex is provided in a position suitable to move along the target nucleic acid molecule and extend the oligonucleotide primer at an active site. A plurality of labelled types of nucleotide analogs are provided proximate to the active site, with each distinguishable type of nucleotide analog being complementary to a different nucleotide in the target nucleic acid sequence. The growing nucleic acid strand is extended by using the polymerase to add a nucleotide analog to the nucleic acid strand at the active site, where the nucleotide analog being added is complementary to the nucleotide of the target nucleic acid at the active site. The nucleotide analog added to the oligonucleotide primer as a result of the polymerizing step is identified. The steps of providing labelled nucleotide analogs, polymerizing the growing nucleic acid strand, and identifying the added nucleotide analog are repeated so that the nucleic acid strand is further extended and the sequence of the target nucleic acid is determined.

Sequencing artifacts in the type A influenza databases and attempts to correct them.

PubMed

Suarez, David L; Chester, Nikki; Hatfield, Jason

2014-07-01

There are over 276 000 influenza gene sequences in public databases, with the quality of the sequences determined by the contributor. As part of a high school class project, influenza sequences with possible errors were identified in the public databases based on the size of the gene being longer than expected, with the hypothesis that these sequences would have an error. Students contacted sequence submitters alerting them of the possible sequence issue(s) and requested they the suspect sequence(s) be correct as appropriate. Type A influenza viruses were screened, and gene segments longer than the accepted size were identified for further analysis. Attention was placed on sequences with additional nucleotides upstream or downstream of the highly conserved non-coding ends of the viral segments. A total of 1081 sequences were identified that met this criterion. Three types of errors were commonly observed: non-influenza primer sequence wasn't removed from the sequence; PCR product was cloned and plasmid sequence was included in the sequence; and Taq polymerase added an adenine at the end of the PCR product. Internal insertions of nucleotide sequence were also commonly observed, but in many cases it was unclear if the sequence was correct or actually contained an error. A total of 215 sequences, or 22.8% of the suspect sequences, were corrected in the public databases in the first year of the student project. Unfortunately 138 additional sequences with possible errors were added to the databases in the second year. Additional awareness of the need for data integrity of sequences submitted to public databases is needed to fully reap the benefits of these large data sets. © 2014 The Authors. Influenza and Other Respiratory Viruses Published by John Wiley & Sons Ltd.

37 CFR 5.31-5.33 - [Reserved

Code of Federal Regulations, 2011 CFR

2011-07-01

... from abandonment 1.135 Amino Acid Sequences. (See Nucleotide and/or Amino Acid Sequences) Appeal to... Appeals and Interference 41.47 Of rejection of an application 1.104(a) Nucleotide and/or Amino Acid...) Symbols for nucleotide and/or amino acid sequence data 1.822 T Tables in patent applications 1.58 Terminal...

WEB-server for search of a periodicity in amino acid and nucleotide sequences

NASA Astrophysics Data System (ADS)

E Frenkel, F.; Skryabin, K. G.; Korotkov, E. V.

2017-12-01

A new web server (http://victoria.biengi.ac.ru/splinter/login.php) was designed and developed to search for periodicity in nucleotide and amino acid sequences. The web server operation is based upon a new mathematical method of searching for multiple alignments, which is founded on the position weight matrices optimization, as well as on implementation of the two-dimensional dynamic programming. This approach allows the construction of multiple alignments of the indistinctly similar amino acid and nucleotide sequences that accumulated more than 1.5 substitutions per a single amino acid or a nucleotide without performing the sequences paired comparisons. The article examines the principles of the web server operation and two examples of studying amino acid and nucleotide sequences, as well as information that could be obtained using the web server.

Nucleotide sequence and genetic organization of barley stripe mosaic virus RNA gamma.

PubMed

Gustafson, G; Hunter, B; Hanau, R; Armour, S L; Jackson, A O

1987-06-01

The complete nucleotide sequences of RNA gamma from the Type and ND18 strains of barley stripe mosaic virus (BSMV) have been determined. The sequences are 3164 (Type) and 2791 (ND18) nucleotides in length. Both sequences contain a 5'-noncoding region (87 or 88 nucleotides) which is followed by a long open reading frame (ORF1). A 42-nucleotide intercistronic region separates ORF1 from a second, shorter open reading frame (ORF2) located near the 3'-end of the RNA. There is a high degree of homology between the Type and ND18 strains in the nucleotide sequence of ORF1. However, the Type strain contains a 366 nucleotide direct tandem repeat within ORF1 which is absent in the ND18 strain. Consequently, the predicted translation product of Type RNA gamma ORF1 (mol wt 87,312) is significantly larger than that of ND18 RNA gamma ORF1 (mol wt 74,011). The amino acid sequence of the ORF1 polypeptide contains homologies with putative RNA polymerases from other RNA viruses, suggesting that this protein may function in replication of the BSMV genome. The nucleotide sequence of RNA gamma ORF2 is nearly identical in the Type and ND18 strains. ORF2 codes for a polypeptide with a predicted molecular weight of 17,209 (Type) or 17,074 (ND18) which is known to be translated from a subgenomic (sg) RNA. The initiation point of this sgRNA has been mapped to a location 27 nucleotides upstream of the ORF2 initiation codon in the intercistronic region between ORF1 and ORF2. The sgRNA is not coterminal with the 3'-end of the genomic RNA, but instead contains heterogeneous poly(A) termini up to 150 nucleotides long (J. Stanley, R. Hanau, and A. O. Jackson, 1984, Virology 139, 375-383). In the genomic RNA gamma, ORF2 is followed by a short poly(A) tract and a 238-nucleotide tRNA-like structure.

Nucleotide cleaving agents and method

DOEpatents

Que, Jr., Lawrence; Hanson, Richard S.; Schnaith, Leah M. T.

2000-01-01

The present invention provides a unique series of nucleotide cleaving agents and a method for cleaving a nucleotide sequence, whether single-stranded or double-stranded DNA or RNA, using and a cationic metal complex having at least one polydentate ligand to cleave the nucleotide sequence phosphate backbone to yield a hydroxyl end and a phosphate end.

Nucleotide sequence analysis of the recA gene and discrimination of the three isolates of urease-positive thermophilic Campylobacter (UPTC) isolated from seagulls (Larus spp.) in Northern Ireland.

PubMed

Matsuda, M; Tai, K; Moore, J E; Millar, B C; Murayama, O

2004-01-01

Nucleotide sequencing after TA cloning of the amplicon of the almost-full length recA gene from three strains of UPTC (A1, A2, and A3) isolated from seagulls in Northern Ireland, the phenotypical and genotypical characteristics of which have been demonstrated to be indistinguishable, clarified nucleotide differences at three nucleotide positions among the three strains. In conclusion, the nucleotide sequences of the recA gene were found to discriminate among the three strains of UPTC, A1, A2, and A3, which are indistinguishable phenotypically and genotypically. Thus, the present study strongly suggests that nucleotide sequence data of the amplicon of a suitable gene or region could aid in discriminating among isolates of the UPTC group, which are indistinguishable phenotypically and genotypically. Copyright 2004 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim

Nucleic acid analysis using terminal-phosphate-labeled nucleotides

DOEpatents

Korlach, Jonas [Ithaca, NY; Webb, Watt W [Ithaca, NY; Levene, Michael [Ithaca, NY; Turner, Stephen [Ithaca, NY; Craighead, Harold G [Ithaca, NY; Foquet, Mathieu [Ithaca, NY

2008-04-22

The present invention is directed to a method of sequencing a target nucleic acid molecule having a plurality of bases. In its principle, the temporal order of base additions during the polymerization reaction is measured on a molecule of nucleic acid, i.e. the activity of a nucleic acid polymerizing enzyme on the template nucleic acid molecule to be sequenced is followed in real time. The sequence is deduced by identifying which base is being incorporated into the growing complementary strand of the target nucleic acid by the catalytic activity of the nucleic acid polymerizing enzyme at each step in the sequence of base additions. A polymerase on the target nucleic acid molecule complex is provided in a position suitable to move along the target nucleic acid molecule and extend the oligonucleotide primer at an active site. A plurality of labelled types of nucleotide analogs are provided proximate to the active site, with each distinguishable type of nucleotide analog being complementary to a different nucleotide in the target nucleic acid sequence. The growing nucleic acid strand is extended by using the polymerase to add a nucleotide analog to the nucleic acid strand at the active site, where the nucleotide analog being added is complementary to the nucleotide of the target nucleic acid at the active site. The nucleotide analog added to the oligonucleotide primer as a result of the polymerizing step is identified. The steps of providing labelled nucleotide analogs, polymerizing the growing nucleic acid strand, and identifying the added nucleotide analog are repeated so that the nucleic acid strand is further extended and the sequence of the target nucleic acid is determined.

Nucleotide sequence analysis of the L gene of Newcastle disease virus: homologies with Sendai and vesicular stomatitis viruses.

PubMed Central

Yusoff, K; Millar, N S; Chambers, P; Emmerson, P T

1987-01-01

The nucleotide sequence of the L gene of the Beaudette C strain of Newcastle disease virus (NDV) has been determined. The L gene is 6704 nucleotides long and encodes a protein of 2204 amino acids with a calculated molecular weight of 248822. Mung bean nuclease mapping of the 5' terminus of the L gene mRNA indicates that the transcription of the L gene is initiated 11 nucleotides upstream of the translational start site. Comparison with the amino acid sequences of the L genes of Sendai virus and vesicular stomatitis virus (VSV) suggests that there are several regions of homology between the sequences. These data provide further evidence for an evolutionary relationship between the Paramyxoviridae and the Rhabdoviridae. A non-coding sequence of 46 nucleotides downstream of the presumed polyadenylation site of the L gene may be part of a negative strand leader RNA. Images PMID:3035486

Whole genome sequencing options for bacterial strain typing and epidemiologic analysis based on single nucleotide polymorphism versus gene-by-gene-based approaches.

PubMed

Schürch, A C; Arredondo-Alonso, S; Willems, R J L; Goering, R V

2018-04-01

Whole genome sequence (WGS)-based strain typing finds increasing use in the epidemiologic analysis of bacterial pathogens in both public health as well as more localized infection control settings. This minireview describes methodologic approaches that have been explored for WGS-based epidemiologic analysis and considers the challenges and pitfalls of data interpretation. Personal collection of relevant publications. When applying WGS to study the molecular epidemiology of bacterial pathogens, genomic variability between strains is translated into measures of distance by determining single nucleotide polymorphisms in core genome alignments or by indexing allelic variation in hundreds to thousands of core genes, assigning types to unique allelic profiles. Interpreting isolate relatedness from these distances is highly organism specific, and attempts to establish species-specific cutoffs are unlikely to be generally applicable. In cases where single nucleotide polymorphism or core gene typing do not provide the resolution necessary for accurate assessment of the epidemiology of bacterial pathogens, inclusion of accessory gene or plasmid sequences may provide the additional required discrimination. As with all epidemiologic analysis, realizing the full potential of the revolutionary advances in WGS-based approaches requires understanding and dealing with issues related to the fundamental steps of data generation and interpretation. Copyright © 2018 The Authors. Published by Elsevier Ltd.. All rights reserved.

Detection of de novo single nucleotide variants in offspring of atomic-bomb survivors close to the hypocenter by whole-genome sequencing.

PubMed

Horai, Makiko; Mishima, Hiroyuki; Hayashida, Chisa; Kinoshita, Akira; Nakane, Yoshibumi; Matsuo, Tatsuki; Tsuruda, Kazuto; Yanagihara, Katsunori; Sato, Shinya; Imanishi, Daisuke; Imaizumi, Yoshitaka; Hata, Tomoko; Miyazaki, Yasushi; Yoshiura, Koh-Ichiro

2018-03-01

Ionizing radiation released by the atomic bombs at Hiroshima and Nagasaki, Japan, in 1945 caused many long-term illnesses, including increased risks of malignancies such as leukemia and solid tumours. Radiation has demonstrated genetic effects in animal models, leading to concerns over the potential hereditary effects of atomic bomb-related radiation. However, no direct analyses of whole DNA have yet been reported. We therefore investigated de novo variants in offspring of atomic-bomb survivors by whole-genome sequencing (WGS). We collected peripheral blood from three trios, each comprising a father (atomic-bomb survivor with acute radiation symptoms), a non-exposed mother, and their child, none of whom had any past history of haematological disorders. One trio of non-exposed individuals was included as a control. DNA was extracted and the numbers of de novo single nucleotide variants in the children were counted by WGS with sequencing confirmation. Gross structural variants were also analysed. Written informed consent was obtained from all participants prior to the study. There were 62, 81, and 42 de novo single nucleotide variants in the children of atomic-bomb survivors, compared with 48 in the control trio. There were no gross structural variants in any trio. These findings are in accord with previously published results that also showed no significant genetic effects of atomic-bomb radiation on second-generation survivors.

DOE Office of Scientific and Technical Information (OSTI.GOV)

Kerr, J.M.; Fisher, L.W.; Termine, J.D.

The authors have isolated and partially sequenced the human bone sialoprotein gene (IBSP). IBSP has been sublocalized by in situ hybridization to chromosome 4q38-q31 and is composed of six small exons (51 to 159 bp) and 1 large exon ([approximately]2.6 kb). The intron/exon junctions defined by sequence analysis are of class O, retaining an intact coding triplet. Sequence analysis of the 5[prime] upstream region revealed a TATAA (nucleotides -30 to-25 from the transcriptional start point) and a CCAAT (nucleotides -56 to-52) box, both in the reverse orientation. Intron 1 contains interesting structural elements composed of polypyrimidine repeats followed by amore » poly(AC)[sub n] tract. Both types of structural elements have been detected in promoter regions of other genes and have been implicated in transcriptional regulation. Several differences between the previously published cDNA sequence and the authors' sequence have been identified, most of which are contained within the untranslated exon 1. Three base revisions in the coding region include a G to T (Gly to Val, amino acid 195), T to C (Val to Ala, amino acid 268), and T to A (Glu to Asp, amino acid 270). In conclusion, the genomic organization and potential regulatory elements of human IBSP have been elucidated. 42 refs., 4 figs., 1 tab.« less

Isolation of a gammaherpesvirus similar to asinine herpesvirus-2 (AHV-2) from a mule and a survey of mules and donkeys for AHV-2 infection by real-time PCR.

PubMed

Bell, Stephanie A; Pusterla, Nicola; Balasuriya, Udeni B R; Mapes, Samantha M; Nyberg, Nicole L; MacLachlan, N James

2008-07-27

Equids are commonly infected by herpesviruses, but isolation of herpesviruses from mules has apparently not been previously reported. Furthermore, the genomic relationships among the various equid herpesviruses are poorly characterized. We describe the isolation and preliminary characterization of a mule gammaherpesvirus tentatively identified as asinine herpesvirus-2 (AHV-2; also designated equid herpesvirus-7 (EHV-7)) from the nasal secretions (NS) of a healthy mule in northern California. The virus was initially identified by transmission electron microscopic examination of lysates of cell culture inoculated with NS collected from the mule. A 913 nucleotide sequence of the DNA polymerase gene was amplified using degenerate primers, and comparison of this sequence with those of various other herpesviruses showed that the mule herpesvirus was most closely related to EHV-2 (AHV-2 sequences were not available for comparison). The sequence of a shorter portion (166 nucleotides) of the mule herpesvirus DNA polymerase gene was identical to that of the published sequence of an asinine gammaherpesvirus, previously designated as AHV-4-3 (AY054992). AHV-2 was detected by real-time polymerase chain reaction assay in the NS of approximately 8% of a cohort of 114 healthy mules and 13 donkeys.

37 CFR 1.821 - Nucleotide and/or amino acid sequence disclosures in patent applications.

Code of Federal Regulations, 2014 CFR

2014-07-01

...” means those amino acids other than “Xaa” and those nucleotide bases other than “n”defined in accordance... 37 Patents, Trademarks, and Copyrights 1 2014-07-01 2014-07-01 false Nucleotide and/or amino acid... Biotechnology Invention Disclosures Application Disclosures Containing Nucleotide And/or Amino Acid Sequences...

37 CFR 1.821 - Nucleotide and/or amino acid sequence disclosures in patent applications.

Code of Federal Regulations, 2013 CFR

2013-07-01

...” means those amino acids other than “Xaa” and those nucleotide bases other than “n”defined in accordance... 37 Patents, Trademarks, and Copyrights 1 2013-07-01 2013-07-01 false Nucleotide and/or amino acid... Biotechnology Invention Disclosures Application Disclosures Containing Nucleotide And/or Amino Acid Sequences...

37 CFR 1.821 - Nucleotide and/or amino acid sequence disclosures in patent applications.

Code of Federal Regulations, 2012 CFR

2012-07-01

...” means those amino acids other than “Xaa” and those nucleotide bases other than “n”defined in accordance... 37 Patents, Trademarks, and Copyrights 1 2012-07-01 2012-07-01 false Nucleotide and/or amino acid... Biotechnology Invention Disclosures Application Disclosures Containing Nucleotide And/or Amino Acid Sequences...

Multi-locus genotyping of bottom fermenting yeasts by single nucleotide polymorphisms indicative of brewing characteristics.

PubMed

Ikushima, Shigehito; Tateishi, Yoshiyuki; Kanai, Keiko; Shimada, Emiko; Tanaka, Misa; Ishiguro, Tatsuji; Mizutani, Satoru; Kobayashi, Osamu

2012-04-01

Yeast plays a capital role in brewing fermentation and has a direct impact on flavor and aroma. For the evaluation of competent brewing strains during quality control or development of novel strains it is standard practice to perform fermentation tests, which are costly and time-consuming. Here, we have categorized DNA markers which enable to distinguish and to screen brewing strains more efficiently than ever before. Sequence analysis at 289 loci in the genomes of six bottom fermenting Saccharomyces pastorianus strains revealed that 30 loci contained single nucleotide polymorphisms (SNPs). By determining the nucleotide sequences at the SNP-loci in 26 other S. pastorianus strains and 20 strains of the top fermenting yeast Saccharomyces cerevisiae, almost all these strains could be discriminated solely on the basis of the SNPs. By comparing the fermentative phenotypes of these strains we found that some DNA markers showed a strong association with brewing characteristics, such as the production of ethyl acetate and hydrogen sulphide (H2S). Therefore, the DNA markers we identified will facilitate quality control and the efficient development of brewing yeast strains. Copyright © 2011 The Society for Biotechnology, Japan. Published by Elsevier B.V. All rights reserved.

[Complete nucleotide sequences and genome structure of two Chinese tobacco mosaic virus isolates deduced from full-length infectious cDNA clones].

PubMed

Yang, G; Liu, X G; Qiu, B S

2000-07-01

The complete nucleotides of two Chinese tobacco mosaic virus (TMV) isolates, TMV-Cv (vulgare strain) and TMV-N14 (an attenuated virus originated from a tomato strain), were determined from their respective full-length infectious cDNA clones and compared with published TMV sequences. The genome structure of TMV-Cv contained 6395 nucleotides, in which four functional open reading frames (ORF), coding for replicase (126 kD/183 kD), movement protein (MP, 30 kD) and coat protein (CP, 17.6 kD) respectively, could be recognized. TMV-N14 contained 6384 nucleotides in its genome. In contrast to TMV-Cv, five functional ORFs encoding the replicase 98.5 kD/126 kD/183 kD, MP(27 kD) and CP(17.6 kD), respectively, were detected in the TMV-N14 genome. TMV-Cv is 99% homologous to a Korean TMV isolate belonging to the vulgare strain at the nucleotide level. TMV-N14 is 99% homologous to a highly virulent Japanese isolate TMV-L (tomato strain) at the nucleotide level. In TMV-N14, one opal nulation (UGA) occurred in the replicase gene and one ochre nutation (UAA) in the MP gene. The former mutation created a potential, additional ORF within the replicase gene, the latter reduced the size of the MP to 27 kD. In addition, there were also 13 amino acid substitutions in the replicase gene of TMV-N14 when compared to that of TMV-L. Collectively, these changes may have significant implications in the attenuation of the virulence of TMV-N14.

Nucleotide sequence determination of guinea-pig casein B mRNA reveals homology with bovine and rat alpha s1 caseins and conservation of the non-coding regions of the mRNA.

PubMed Central

Hall, L; Laird, J E; Craig, R K

1984-01-01

Nucleotide sequence analysis of cloned guinea-pig casein B cDNA sequences has identified two casein B variants related to the bovine and rat alpha s1 caseins. Amino acid homology was largely confined to the known bovine or predicted rat phosphorylation sites and within the 'signal' precursor sequence. Comparison of the deduced nucleotide sequence of the guinea-pig and rat alpha s1 casein mRNA species showed greater sequence conservation in the non-coding than in the coding regions, suggesting a functional and possibly regulatory role for the non-coding regions of casein mRNA. The results provide insight into the evolution of the casein genes, and raise questions as to the role of conserved nucleotide sequences within the non-coding regions of mRNA species. Images Fig. 1. PMID:6548375

NCBI-compliant genome submissions: tips and tricks to save time and money.

PubMed

Pirovano, Walter; Boetzer, Marten; Derks, Martijn F L; Smit, Sandra

2017-03-01

Genome sequences nowadays play a central role in molecular biology and bioinformatics. These sequences are shared with the scientific community through sequence databases. The sequence repositories of the International Nucleotide Sequence Database Collaboration (INSDC, comprising GenBank, ENA and DDBJ) are the largest in the world. Preparing an annotated sequence in such a way that it will be accepted by the database is challenging because many validation criteria apply. In our opinion, it is an undesirable situation that researchers who want to submit their sequence need either a lot of experience or help from partners to get the job done. To save valuable time and money, we list a number of recommendations for people who want to submit an annotated genome to a sequence database, as well as for tool developers, who could help to ease the process. © The Author 2015. Published by Oxford University Press. For Permissions, please email: journals.permissions@oup.com.

Complete genome sequence of the first human parechovirus type 3 isolated in Taiwan.

PubMed

Chang, Jenn-Tzong; Yang, Chih-Shiang; Chen, Bao-Chen; Chen, Yao-Shen; Chang, Tsung-Hsien

2017-11-01

The first human parechovirus 3 (HPeV3 VGHKS-2007) in Taiwan was identified from a clinical specimen from a male infant. The entire genome of the HPeV3 isolate was sequenced and compared to known HPeV3 sequences. Genome alignment data showed that HPeV3 VGHKS-2007 shares the highest nucleotide identity, 99%, with the Japanese strain of HPeV3 1361K-162589-Yamagata-2008. All HPeV3 isolates possess at least 97% amino acid identity. The analysis of the genome sequence of HPeV3 VGHKS-2007 will facilitate future investigations of the epidemiology and pathogenicity of HPeV3 infection. Copyright © 2017. Published by Elsevier Taiwan LLC.

Fast and accurate phylogeny reconstruction using filtered spaced-word matches.

PubMed

Leimeister, Chris-André; Sohrabi-Jahromi, Salma; Morgenstern, Burkhard

2017-04-01

Word-based or 'alignment-free' algorithms are increasingly used for phylogeny reconstruction and genome comparison, since they are much faster than traditional approaches that are based on full sequence alignments. Existing alignment-free programs, however, are less accurate than alignment-based methods. We propose Filtered Spaced Word Matches (FSWM) , a fast alignment-free approach to estimate phylogenetic distances between large genomic sequences. For a pre-defined binary pattern of match and don't-care positions, FSWM rapidly identifies spaced word-matches between input sequences, i.e. gap-free local alignments with matching nucleotides at the match positions and with mismatches allowed at the don't-care positions. We then estimate the number of nucleotide substitutions per site by considering the nucleotides aligned at the don't-care positions of the identified spaced-word matches. To reduce the noise from spurious random matches, we use a filtering procedure where we discard all spaced-word matches for which the overall similarity between the aligned segments is below a threshold. We show that our approach can accurately estimate substitution frequencies even for distantly related sequences that cannot be analyzed with existing alignment-free methods; phylogenetic trees constructed with FSWM distances are of high quality. A program run on a pair of eukaryotic genomes of a few hundred Mb each takes a few minutes. The program source code for FSWM including a documentation, as well as the software that we used to generate artificial genome sequences are freely available at http://fswm.gobics.de/. chris.leimeister@stud.uni-goettingen.de. Supplementary data are available at Bioinformatics online. © The Author 2017. Published by Oxford University Press.

Pan-genome multilocus sequence typing and outbreak-specific reference-based single nucleotide polymorphism analysis to resolve two concurrent Staphylococcus aureus outbreaks in neonatal services.

PubMed

Roisin, S; Gaudin, C; De Mendonça, R; Bellon, J; Van Vaerenbergh, K; De Bruyne, K; Byl, B; Pouseele, H; Denis, O; Supply, P

2016-06-01

We used a two-step whole genome sequencing analysis for resolving two concurrent outbreaks in two neonatal services in Belgium, caused by exfoliative toxin A-encoding-gene-positive (eta+) methicillin-susceptible Staphylococcus aureus with an otherwise sporadic spa-type t209 (ST-109). Outbreak A involved 19 neonates and one healthcare worker in a Brussels hospital from May 2011 to October 2013. After a first episode interrupted by decolonization procedures applied over 7 months, the outbreak resumed concomitantly with the onset of outbreak B in a hospital in Asse, comprising 11 neonates and one healthcare worker from mid-2012 to January 2013. Pan-genome multilocus sequence typing, defined on the basis of 42 core and accessory reference genomes, and single-nucleotide polymorphisms mapped on an outbreak-specific de novo assembly were used to compare 28 available outbreak isolates and 19 eta+/spa-type t209 isolates identified by routine or nationwide surveillance. Pan-genome multilocus sequence typing showed that the outbreaks were caused by independent clones not closely related to any of the surveillance isolates. Isolates from only ten cases with overlapping stays in outbreak A, including four pairs of twins, showed no or only a single nucleotide polymorphism variation, indicating limited sequential transmission. Detection of larger genomic variation, even from the start of the outbreak, pointed to sporadic seeding from a pre-existing exogenous source, which persisted throughout the whole course of outbreak A. Whole genome sequencing analysis can provide unique fine-tuned insights into transmission pathways of complex outbreaks even at their inception, which, with timely use, could valuably guide efforts for early source identification. Copyright © 2016 European Society of Clinical Microbiology and Infectious Diseases. Published by Elsevier Ltd. All rights reserved.

Complete nucleotide sequence of Alfalfa mosaic virus isolated from alfalfa (Medicago sativa L.) in Argentina.

PubMed

Trucco, Verónica; de Breuil, Soledad; Bejerman, Nicolás; Lenardon, Sergio; Giolitti, Fabián

2014-06-01

The complete nucleotide sequence of an Alfalfa mosaic virus (AMV) isolate infecting alfalfa (Medicago sativa L.) in Argentina, AMV-Arg, was determined. The virus genome has the typical organization described for AMV, and comprises 3,643, 2,593, and 2,038 nucleotides for RNA1, 2 and 3, respectively. The whole genome sequence and each encoding region were compared with those of other four isolates that have been completely sequenced from China, Italy, Spain and USA. The nucleotide identity percentages ranged from 95.9 to 99.1 % for the three RNAs and from 93.7 to 99 % for the protein 1 (P1), protein 2 (P2), movement protein and coat protein (CP) encoding regions, whereas the amino acid identity percentages of these proteins ranged from 93.4 to 99.5 %, the lowest value corresponding to P2. CP sequences of AMV-Arg were compared with those of other 25 available isolates, and the phylogenetic analysis based on the CP gene was carried out. The highest percentage of nucleotide sequence identity of the CP gene was 98.3 % with a Chinese isolate and 98.6 % at the amino acid level with four isolates, two from Italy, one from Brazil and the remaining one from China. The phylogenetic analysis showed that AMV-Arg is closely related to subgroup I of AMV isolates. To our knowledge, this is the first report of a complete nucleotide sequence of AMV from South America and the first worldwide report of complete nucleotide sequence of AMV isolated from alfalfa as natural host.

Human ribosomal RNA gene: nucleotide sequence of the transcription initiation region and comparison of three mammalian genes.

PubMed Central

Financsek, I; Mizumoto, K; Mishima, Y; Muramatsu, M

1982-01-01

The transcription initiation site of the human ribosomal RNA gene (rDNA) was located by using the single-strand specific nuclease protection method and by determining the first nucleotide of the in vitro capped 45S preribosomal RNA. The sequence of 1,211 nucleotides surrounding the initiation site was determined. The sequenced region was found to consist of 75% G and C and to contain a number of short direct and inverted repeats and palindromes. By comparison of the corresponding initiation regions of three mammalian species, several conserved sequences were found upstream and downstream from the transcription starting point. Two short A + T-rich sequences are present on human, mouse, and rat ribosomal RNA genes between the initiation site and 40 nucleotides upstream, and a C + T cluster is located at a position around -60. At and downstream from the initiation site, a common sequence, T-AG-C-T-G-A-C-A-C-G-C-T-G-T-C-C-T-CT-T, was found in the three genes from position -1 through +18. The strong conservation of these sequences suggests their functional significance in rDNA. The S1 nuclease protection experiments with cloned rDNA fragments indicated the presence in human 45S RNA of molecules several hundred nucleotides shorter than the supposed primary transcript. The first 19 nucleotides of these molecules appear identical--except for one mismatch--to the nucleotide sequence of the 5' end of a supposed early processing product of the mouse 45S RNA. Images PMID:6954460

Quantum Point Contact Single-Nucleotide Conductance for DNA and RNA Sequence Identification.

PubMed

Afsari, Sepideh; Korshoj, Lee E; Abel, Gary R; Khan, Sajida; Chatterjee, Anushree; Nagpal, Prashant

2017-11-28

Several nanoscale electronic methods have been proposed for high-throughput single-molecule nucleic acid sequence identification. While many studies display a large ensemble of measurements as "electronic fingerprints" with some promise for distinguishing the DNA and RNA nucleobases (adenine, guanine, cytosine, thymine, and uracil), important metrics such as accuracy and confidence of base calling fall well below the current genomic methods. Issues such as unreliable metal-molecule junction formation, variation of nucleotide conformations, insufficient differences between the molecular orbitals responsible for single-nucleotide conduction, and lack of rigorous base calling algorithms lead to overlapping nanoelectronic measurements and poor nucleotide discrimination, especially at low coverage on single molecules. Here, we demonstrate a technique for reproducible conductance measurements on conformation-constrained single nucleotides and an advanced algorithmic approach for distinguishing the nucleobases. Our quantum point contact single-nucleotide conductance sequencing (QPICS) method uses combed and electrostatically bound single DNA and RNA nucleotides on a self-assembled monolayer of cysteamine molecules. We demonstrate that by varying the applied bias and pH conditions, molecular conductance can be switched ON and OFF, leading to reversible nucleotide perturbation for electronic recognition (NPER). We utilize NPER as a method to achieve >99.7% accuracy for DNA and RNA base calling at low molecular coverage (∼12×) using unbiased single measurements on DNA/RNA nucleotides, which represents a significant advance compared to existing sequencing methods. These results demonstrate the potential for utilizing simple surface modifications and existing biochemical moieties in individual nucleobases for a reliable, direct, single-molecule, nanoelectronic DNA and RNA nucleotide identification method for sequencing.

Sequence-based prediction of protein-binding sites in DNA: comparative study of two SVM models.

PubMed

Park, Byungkyu; Im, Jinyong; Tuvshinjargal, Narankhuu; Lee, Wook; Han, Kyungsook

2014-11-01

As many structures of protein-DNA complexes have been known in the past years, several computational methods have been developed to predict DNA-binding sites in proteins. However, its inverse problem (i.e., predicting protein-binding sites in DNA) has received much less attention. One of the reasons is that the differences between the interaction propensities of nucleotides are much smaller than those between amino acids. Another reason is that DNA exhibits less diverse sequence patterns than protein. Therefore, predicting protein-binding DNA nucleotides is much harder than predicting DNA-binding amino acids. We computed the interaction propensity (IP) of nucleotide triplets with amino acids using an extensive dataset of protein-DNA complexes, and developed two support vector machine (SVM) models that predict protein-binding nucleotides from sequence data alone. One SVM model predicts protein-binding nucleotides using DNA sequence data alone, and the other SVM model predicts protein-binding nucleotides using both DNA and protein sequences. In a 10-fold cross-validation with 1519 DNA sequences, the SVM model that uses DNA sequence data only predicted protein-binding nucleotides with an accuracy of 67.0%, an F-measure of 67.1%, and a Matthews correlation coefficient (MCC) of 0.340. With an independent dataset of 181 DNAs that were not used in training, it achieved an accuracy of 66.2%, an F-measure 66.3% and a MCC of 0.324. Another SVM model that uses both DNA and protein sequences achieved an accuracy of 69.6%, an F-measure of 69.6%, and a MCC of 0.383 in a 10-fold cross-validation with 1519 DNA sequences and 859 protein sequences. With an independent dataset of 181 DNAs and 143 proteins, it showed an accuracy of 67.3%, an F-measure of 66.5% and a MCC of 0.329. Both in cross-validation and independent testing, the second SVM model that used both DNA and protein sequence data showed better performance than the first model that used DNA sequence data. To the best of our knowledge, this is the first attempt to predict protein-binding nucleotides in a given DNA sequence from the sequence data alone. Copyright © 2014 Elsevier Ireland Ltd. All rights reserved.

Array of nucleic acid probes on biological chips for diagnosis of HIV and methods of using the same

DOEpatents

Chee, Mark; Gingeras, Thomas R.; Fodor, Stephen P. A.; Hubble, Earl A.; Morris, MacDonald S.

1999-01-19

The invention provides an array of oligonucleotide probes immobilized on a solid support for analysis of a target sequence from a human immunodeficiency virus. The array comprises at least four sets of oligonucleotide probes 9 to 21 nucleotides in length. A first probe set has a probe corresponding to each nucleotide in a reference sequence from a human immunodeficiency virus. A probe is related to its corresponding nucleotide by being exactly complementary to a subsequence of the reference sequence that includes the corresponding nucleotide. Thus, each probe has a position, designated an interrogation position, that is occupied by a complementary nucleotide to the corresponding nucleotide. The three additional probe sets each have a corresponding probe for each probe in the first probe set. Thus, for each nucleotide in the reference sequence, there are four corresponding probes, one from each of the probe sets. The three corresponding probes in the three additional probe sets are identical to the corresponding probe from the first probe or a subsequence thereof that includes the interrogation position, except that the interrogation position is occupied by a different nucleotide in each of the four corresponding probes.

The use of sequence-based SSR mining for the development of a vast collection of microsatellites in Aquilegia Formosa

Treesearch

Brandon Schlautman; Vera Pfeiffer; Juan Zalapa; Johanne Brunet

2014-01-01

Numerous microsatellite markers were developed for Aquilegia formosafrom sequences deposited within the Expressed Sequence Tag (EST), Genomic Survey Sequence (GSS), and Nucleotide databases in NCBI. Microsatellites (SSRs) were identified and primers were designed for 9 SSR containing sequences in the Nucleotide database, 3803 sequences in the EST...

Switchgrass ubiquitin promoter (PVUBI2) and uses thereof

DOEpatents

Stewart, C. Neal; Mann, David George James

2013-12-10

The subject application provides polynucleotides, compositions thereof and methods for regulating gene expression in a plant. Polynucleotides disclosed herein comprise novel sequences for a promoter isolated from Panicum virgatum (switchgrass) that initiates transcription of an operably linked nucleotide sequence. Thus, various embodiments of the invention comprise the nucleotide sequence of SEQ ID NO: 2 or fragments thereof comprising nucleotides 1 to 692 of SEQ ID NO: 2 that are capable of driving the expression of an operably linked nucleic acid sequence.

Evaluation of anonymous and expressed sequence tag derived polymorphic microsatellite markers in the tobacco budworm Heliothis virescens (Lepidoptera: noctuidae)

USDA-ARS?s Scientific Manuscript database

Polymorphic genetic markers were identified and characterized using a partial genomic library of Heliothis virescens enriched for simple sequence repeats (SSR) and nucleotide sequences of expressed sequence tags (EST). Nucleotide sequences of 192 clones from the partial genomic library yielded 147 u...

Extension of the COG and arCOG databases by amino acid and nucleotide sequences

PubMed Central

Meereis, Florian; Kaufmann, Michael

2008-01-01

Background The current versions of the COG and arCOG databases, both excellent frameworks for studies in comparative and functional genomics, do not contain the nucleotide sequences corresponding to their protein or protein domain entries. Results Using sequence information obtained from GenBank flat files covering the completely sequenced genomes of the COG and arCOG databases, we constructed NUCOCOG (nucleotide sequences containing COG databases) as an extended version including all nucleotide sequences and in addition the amino acid sequences originally utilized to construct the current COG and arCOG databases. We make available three comprehensive single XML files containing the complete databases including all sequence information. In addition, we provide a web interface as a utility suitable to browse the NUCOCOG database for sequence retrieval. The database is accessible at . Conclusion NUCOCOG offers the possibility to analyze any sequence related property in the context of the COG and arCOG framework simply by using script languages such as PERL applied to a large but single XML document. PMID:19014535

DNA Nucleotide Sequence Restricted by the RI Endonuclease

PubMed Central

Hedgpeth, Joe; Goodman, Howard M.; Boyer, Herbert W.

1972-01-01

The sequence of DNA base pairs adjacent to the phosphodiester bonds cleaved by the RI restriction endonuclease in unmodified DNA from coliphage λ has been determined. The 5′-terminal nucleotide labeled with 32P and oligonucleotides up to the heptamer were analyzed from a pancreatic DNase digest. The following sequence of nucleotides adjacent to the RI break made in λ DNA was deduced from these data and from the 3′-dinucleotide sequence and nearest-neighbor analysis obtained from repair synthesis with the DNA polymerase of Rous sarcoma virus [Formula: see text] The RI endonuclease cleavage of the phosphodiester bonds (indicated by arrows) generates 5′-phosphoryls and short cohesive termini of four nucleotides, pApApTpT. The most striking feature of the sequence is its symmetry. PMID:4343974

Fox parasites in Pre-columbian times: Evidence from the past to understand the current helminth assemblages.

PubMed

Fugassa, M H; Petrigh, R S; Fernández, P M; Carballido Catalayud, M; Belleli, C

2018-06-11

This work aims to increase the information on the entero-parasitism in Holocene carnivores, by examining coprolites found in Patagonia. Molecular analysis was conducted following the Authenticity Criteria to Determine Ancient DNA sequences. The nucleotide sequences showed 99% of identity with the Control Region sequences of Lycalopex culpaeus (culpeo fox). Coprolites were positive for gastrointestinal parasites. The presence of Alaria sp. and Clonorchis sp. represents the first record for pre-Columbian America. The parasitological findings suggest the importance of these carnivores for the dissemination of their own parasites and those to their prey in rockshelters, areas with high re-use of space. Copyright © 2018. Published by Elsevier B.V.

Sequence of a cDNA encoding pancreatic preprosomatostatin-22.

PubMed Central

Magazin, M; Minth, C D; Funckes, C L; Deschenes, R; Tavianini, M A; Dixon, J E

1982-01-01

We report the nucleotide sequence of a precursor to somatostatin that upon proteolytic processing may give rise to a hormone of 22 amino acids. The nucleotide sequence of a cDNA from the channel catfish (Ictalurus punctatus) encodes a precursor to somatostatin that is 105 amino acids (Mr, 11,500). The cDNA coding for somatostatin-22 consists of 36 nucleotides in the 5' untranslated region, 315 nucleotides that code for the precursor to somatostatin-22, 269 nucleotides at the 3' untranslated region, and a variable length of poly(A). The putative preprohormone contains a sequence of hydrophobic amino acids at the amino terminus that has the properties of a "signal" peptide. A connecting sequence of approximately 57 amino acids is followed by a single Arg-Arg sequence, which immediately precedes the hormone. Somatostatin-22 is homologous to somatostatin-14 in 7 of the 14 amino acids, including the Phe-Trp-Lys sequence. Hybridization selection of mRNA, followed by its translation in a wheat germ cell-free system, resulted in the synthesis of a single polypeptide having a molecular weight of approximately 10,000 as estimated on Na-DodSO4/polyacrylamide gels. Images PMID:6127673

Plant nitrogen regulatory P-PII genes

DOEpatents

Coruzzi, Gloria M.; Lam, Hon-Ming; Hsieh, Ming-Hsiun

2001-01-01

The present invention generally relates to plant nitrogen regulatory PII gene (hereinafter P-PII gene), a gene involved in regulating plant nitrogen metabolism. The invention provides P-PII nucleotide sequences, expression constructs comprising said nucleotide sequences, and host cells and plants having said constructs and, optionally expressing the P-PII gene from said constructs. The invention also provides substantially pure P-PII proteins. The P-PII nucleotide sequences and constructs of the

Synthesis and evaluations of an acid-cleavable, fluorescently labeled nucleotide as a reversible terminator for DNA sequencing.

PubMed

Tan, Lianjiang; Liu, Yazhi; Li, Xiaowei; Wu, Xin-Yan; Gong, Bing; Shen, Yu-Mei; Shao, Zhifeng

2016-02-11

An acid-cleavable linker based on a dimethylketal moiety was synthesized and used to connect a nucleotide with a fluorophore to produce a 3'-OH unblocked nucleotide analogue as an excellent reversible terminator for DNA sequencing by synthesis.

Real-time single-molecule electronic DNA sequencing by synthesis using polymer-tagged nucleotides on a nanopore array

PubMed Central

Fuller, Carl W.; Kumar, Shiv; Porel, Mintu; Chien, Minchen; Bibillo, Arek; Stranges, P. Benjamin; Dorwart, Michael; Tao, Chuanjuan; Li, Zengmin; Guo, Wenjing; Shi, Shundi; Korenblum, Daniel; Trans, Andrew; Aguirre, Anne; Liu, Edward; Harada, Eric T.; Pollard, James; Bhat, Ashwini; Cech, Cynthia; Yang, Alexander; Arnold, Cleoma; Palla, Mirkó; Hovis, Jennifer; Chen, Roger; Morozova, Irina; Kalachikov, Sergey; Russo, James J.; Kasianowicz, John J.; Davis, Randy; Roever, Stefan; Church, George M.; Ju, Jingyue

2016-01-01

DNA sequencing by synthesis (SBS) offers a robust platform to decipher nucleic acid sequences. Recently, we reported a single-molecule nanopore-based SBS strategy that accurately distinguishes four bases by electronically detecting and differentiating four different polymer tags attached to the 5′-phosphate of the nucleotides during their incorporation into a growing DNA strand catalyzed by DNA polymerase. Further developing this approach, we report here the use of nucleotides tagged at the terminal phosphate with oligonucleotide-based polymers to perform nanopore SBS on an α-hemolysin nanopore array platform. We designed and synthesized several polymer-tagged nucleotides using tags that produce different electrical current blockade levels and verified they are active substrates for DNA polymerase. A highly processive DNA polymerase was conjugated to the nanopore, and the conjugates were complexed with primer/template DNA and inserted into lipid bilayers over individually addressable electrodes of the nanopore chip. When an incoming complementary-tagged nucleotide forms a tight ternary complex with the primer/template and polymerase, the tag enters the pore, and the current blockade level is measured. The levels displayed by the four nucleotides tagged with four different polymers captured in the nanopore in such ternary complexes were clearly distinguishable and sequence-specific, enabling continuous sequence determination during the polymerase reaction. Thus, real-time single-molecule electronic DNA sequencing data with single-base resolution were obtained. The use of these polymer-tagged nucleotides, combined with polymerase tethering to nanopores and multiplexed nanopore sensors, should lead to new high-throughput sequencing methods. PMID:27091962

Molecular Cloning and Sequencing of Hemoglobin-Beta Gene of Channel Catfish, Ictalurus Punctatus Rafinesque

USDA-ARS?s Scientific Manuscript database

: Hemoglobin-y gene of channel catfish , lctalurus punctatus, was cloned and sequenced . Total RNA from head kidneys was isolated, reverse transcribed and amplified . The sequence of the channel catfish hemoglobin-y gene consists of 600 nucleotides . Analysis of the nucleotide sequence reveals one o...

Novel methodologies for spectral classification of exon and intron sequences

NASA Astrophysics Data System (ADS)

Kwan, Hon Keung; Kwan, Benjamin Y. M.; Kwan, Jennifer Y. Y.

2012-12-01

Digital processing of a nucleotide sequence requires it to be mapped to a numerical sequence in which the choice of nucleotide to numeric mapping affects how well its biological properties can be preserved and reflected from nucleotide domain to numerical domain. Digital spectral analysis of nucleotide sequences unfolds a period-3 power spectral value which is more prominent in an exon sequence as compared to that of an intron sequence. The success of a period-3 based exon and intron classification depends on the choice of a threshold value. The main purposes of this article are to introduce novel codes for 1-sequence numerical representations for spectral analysis and compare them to existing codes to determine appropriate representation, and to introduce novel thresholding methods for more accurate period-3 based exon and intron classification of an unknown sequence. The main findings of this study are summarized as follows: Among sixteen 1-sequence numerical representations, the K-Quaternary Code I offers an attractive performance. A windowed 1-sequence numerical representation (with window length of 9, 15, and 24 bases) offers a possible speed gain over non-windowed 4-sequence Voss representation which increases as sequence length increases. A winner threshold value (chosen from the best among two defined threshold values and one other threshold value) offers a top precision for classifying an unknown sequence of specified fixed lengths. An interpolated winner threshold value applicable to an unknown and arbitrary length sequence can be estimated from the winner threshold values of fixed length sequences with a comparable performance. In general, precision increases as sequence length increases. The study contributes an effective spectral analysis of nucleotide sequences to better reveal embedded properties, and has potential applications in improved genome annotation.

Complete nucleotide sequence of a novel Hibiscus-infecting Cilevirus from Florida and its relationship with closely associated Cileviruses

USDA-ARS?s Scientific Manuscript database

The complete nucleotide sequence of a recently discovered Florida (FL) isolate of Hibiscus infecting Cilevirus (HiCV) was determined by Sanger sequencing. The movement- and coat- protein gene sequences of the HiCV-FL isolate are more divergent than other genes of the previously sequenced HiCV-HA (Ha...

Statistical analysis of nucleotide sequences of the hemagglutinin gene of human influenza A viruses.

PubMed Central

Ina, Y; Gojobori, T

1994-01-01

To examine whether positive selection operates on the hemagglutinin 1 (HA1) gene of human influenza A viruses (H1 subtype), 21 nucleotide sequences of the HA1 gene were statistically analyzed. The nucleotide sequences were divided into antigenic and nonantigenic sites. The nucleotide diversities for antigenic and nonantigenic sites of the HA1 gene were computed at synonymous and nonsynonymous sites separately. For nonantigenic sites, the nucleotide diversities were larger at synonymous sites than at nonsynonymous sites. This is consistent with the neutral theory of molecular evolution. For antigenic sites, however, the nucleotide diversities at nonsynonymous sites were larger than those at synonymous sites. These results suggest that positive selection operates on antigenic sites of the HA1 gene of human influenza A viruses (H1 subtype). PMID:8078892

40 CFR 174.3 - Definitions.

Code of Federal Regulations, 2010 CFR

2010-07-01

..., flowers, and pollen. Noncoding, nonexpressed nucleotide sequences means the nucleotide sequences are not... surgical alteration of the plant pistil, bud pollination, mentor pollen, immunosuppressants, in vitro...

40 CFR 174.3 - Definitions.

Code of Federal Regulations, 2012 CFR

2012-07-01

..., flowers, and pollen. Noncoding, nonexpressed nucleotide sequences means the nucleotide sequences are not... surgical alteration of the plant pistil, bud pollination, mentor pollen, immunosuppressants, in vitro...

40 CFR 174.3 - Definitions.

Code of Federal Regulations, 2013 CFR

2013-07-01

..., flowers, and pollen. Noncoding, nonexpressed nucleotide sequences means the nucleotide sequences are not... surgical alteration of the plant pistil, bud pollination, mentor pollen, immunosuppressants, in vitro...

40 CFR 174.3 - Definitions.

Code of Federal Regulations, 2011 CFR

2011-07-01

..., flowers, and pollen. Noncoding, nonexpressed nucleotide sequences means the nucleotide sequences are not... surgical alteration of the plant pistil, bud pollination, mentor pollen, immunosuppressants, in vitro...

40 CFR 174.3 - Definitions.

Code of Federal Regulations, 2014 CFR

2014-07-01

..., flowers, and pollen. Noncoding, nonexpressed nucleotide sequences means the nucleotide sequences are not... surgical alteration of the plant pistil, bud pollination, mentor pollen, immunosuppressants, in vitro...

Genome sequences of a mouse-avirulent and a mouse-virulent strain of Ross River virus.

PubMed

Faragher, S G; Meek, A D; Rice, C M; Dalgarno, L

1988-04-01

The nucleotide sequence of the genomic RNA of a mouse-avirulent strain of Ross River virus, RRV NB5092 (isolated in 1969), has been determined and the corresponding sequence for the prototype mouse-virulent strain, RRV T48 (isolated in 1959), has been completed. The RRV NB5092 genome is approximately 11,674 nucleotides in length, compared with 11,853 nucleotides for RRV T48. RRV NB5092 and RRV T48 have the same genome organization. For both viruses an untranslated region of 80 nucleotides at the 5' end of the genome is followed by a 7440-nucleotide open reading frame which is interrupted after 5586 nucleotides by a single opal termination codon. By homology with other alphaviruses, the 5586-nucleotide open reading frame encodes the nonstructural proteins nsP1, nsP2, and nsP3; a fourth nonstructural protein, nsP4, is produced by read-through of the opal codon. The RRV nonstructural proteins show strong homology with the corresponding proteins of Sindbis virus and Semliki Forest virus in terms of size, net charge, and hydropathy characteristics. However, homology is not uniform between or within the proteins; nsP1, nsP2, and nsP4 contain extended domains which are highly conserved between alphaviruses, while the C-terminal region of nsP3 shows little conservation in sequence or length between alphaviruses. An untranslated "junction" region of 44 nucleotides (for RRV NB5092) or 47 nucleotides (for RRV T48) separates the nonstructural and structural protein coding regions. The structural proteins (capsid-E3-E2-6K-E1) are translated from an open reading frame of 3762 nucleotides which is followed by a 3'-untranslated region of approximately 348 nucleotides (for RRV NB5092) or 524 nucleotides (for RRV T48). Excluding deletions and insertions, the genomes of RRV NB5092 and RRV T48 differ at 284 nucleotides, representing a sequence divergence of 2.38%. Sequence deletions or insertions were found only in the noncoding regions and include a 173-nucleotide deletion in the 3'-untranslated region of RRV NB5092, compared with RRV T48. In the coding regions, most of the nucleotide differences are silent; there are 36 amino acid differences in the nonstructural proteins and 12 in the structural proteins. The distribution of amino acid differences between the two RRV strains correlates with the location of domains which are poorly conserved in sequence between alphaviruses. The possible role of amino acid differences in envelope glycoproteins E1 and E2 in determining the different antigenic and biological properties of RRV NB5092 and RRV T48 is discussed.

Molecular characterization of two prunus necrotic ringspot virus isolates from Canada.

PubMed

Cui, Hongguang; Hong, Ni; Wang, Guoping; Wang, Aiming

2012-05-01

We determined the entire RNA1, 2 and 3 sequences of two prunus necrotic ringspot virus (PNRSV) isolates, Chr3 from cherry and Pch12 from peach, obtained from an orchard in the Niagara Fruit Belt, Canada. The RNA1, 2 and 3 of the two isolates share nucleotide sequence identities of 98.6%, 98.4% and 94.5%, respectively. Their RNA1- and 2-encoded amino acid sequences are about 98% identical to the corresponding sequences of a cherry isolate, CH57, the only other PNRSV isolate with complete RNA1 and 2 sequences available. Phylogenetic analysis of the coat protein and movement protein encoded by RNA3 of Pch12 and Chr3 and published PNRSV isolates indicated that Chr3 belongs to the PV96 group and Pch12 belongs to the PV32 group.

A high-throughput approach to profile RNA structure.

PubMed

Delli Ponti, Riccardo; Marti, Stefanie; Armaos, Alexandros; Tartaglia, Gian Gaetano

2017-03-17

Here we introduce the Computational Recognition of Secondary Structure (CROSS) method to calculate the structural profile of an RNA sequence (single- or double-stranded state) at single-nucleotide resolution and without sequence length restrictions. We trained CROSS using data from high-throughput experiments such as Selective 2΄-Hydroxyl Acylation analyzed by Primer Extension (SHAPE; Mouse and HIV transcriptomes) and Parallel Analysis of RNA Structure (PARS; Human and Yeast transcriptomes) as well as high-quality NMR/X-ray structures (PDB database). The algorithm uses primary structure information alone to predict experimental structural profiles with >80% accuracy, showing high performances on large RNAs such as Xist (17 900 nucleotides; Area Under the ROC Curve AUC of 0.75 on dimethyl sulfate (DMS) experiments). We integrated CROSS in thermodynamics-based methods to predict secondary structure and observed an increase in their predictive power by up to 30%. © The Author(s) 2016. Published by Oxford University Press on behalf of Nucleic Acids Research.

DNA Data Bank of Japan: 30th anniversary.

PubMed

Kodama, Yuichi; Mashima, Jun; Kosuge, Takehide; Kaminuma, Eli; Ogasawara, Osamu; Okubo, Kousaku; Nakamura, Yasukazu; Takagi, Toshihisa

2018-01-04

The DNA Data Bank of Japan (DDBJ) Center (http://www.ddbj.nig.ac.jp) has been providing public data services for 30 years since 1987. We are collecting nucleotide sequence data and associated biological information from researchers as a member of the International Nucleotide Sequence Database Collaboration (INSDC), in collaboration with the US National Center for Biotechnology Information and the European Bioinformatics Institute. The DDBJ Center also services the Japanese Genotype-phenotype Archive (JGA) with the National Bioscience Database Center to collect genotype and phenotype data of human individuals. Here, we outline our database activities for INSDC and JGA over the past year, and introduce submission, retrieval and analysis services running on our supercomputer system and their recent developments. Furthermore, we highlight our responses to the amended Japanese rules for the protection of personal information and the launch of the DDBJ Group Cloud service for sharing pre-publication data among research groups. © The Author(s) 2017. Published by Oxford University Press on behalf of Nucleic Acids Research.

The complete nucleotide sequence of the glnALG operon of Escherichia coli K12.

PubMed Central

Miranda-Ríos, J; Sánchez-Pescador, R; Urdea, M; Covarrubias, A A

1987-01-01

The nucleotide sequence of the E. coli glnALG operon has been determined. The glnL (ntrB) and glnG (ntrC) genes present a high homology, at the nucleotide and aminoacid levels, with the corresponding genes of Klebsiella pneumoniae. The predicted aminoacid sequence for glutamine synthetase allowed us to locate some of the enzyme domains. The structure of this operon is discussed. PMID:2882477

The nucleotide sequences of 5S rRNAs from a rotifer, Brachionus plicatilis, and two nematodes, Rhabditis tokai and Caenorhabditis elegans.

PubMed

Kumazaki, T; Hori, H; Osawa, S; Ishii, N; Suzuki, K

1982-11-11

The nucleotide sequences of 5S rRNAs from a rotifer, Brachionus plicatilis, and two nematodes, Rhabditis tokai and Caenorhabditis elegans have been determined. The rotifer has two 5S rRNA species that are composed of 120 and 121 nucleotides, respectively. The sequences of these two 5S rRNAs are the same except that the latter has an additional base at its 3'-terminus. The 5S rRNAs from the two nematode species are both 119 nucleotides long. The sequence similarity percents are 79% (Brachionus/Rhabditis), 80% (Brachionus/Caenorhabditis), and 95% (Rhabditis/Caenorhabditis) among these three species. Brachionus revealed the highest similarity to Lingula (89%), but not to the nematodes (79%).

Determination of Trichuris skrjabini by sequencing of the ITS1-5.8S-ITS2 segment of the ribosomal DNA: comparative molecular study of different species of trichurids.

PubMed

Cutillas, C; Oliveros, R; de Rojas, M; Guevara, D C

2004-06-01

Adults of Trichuris skrjahini have been isolated from the cecum of caprine hosts (Capra hircus), Trichuris ovis and Trichuris globulosa from Ovis aries (sheep) and C. hircus (goats), and Trichuris leporis from Lepus europaeus (rabbits) in Spain. Genomic DNA was isolated and the ITS1-5.8S-ITS2 segment from the ribosomal DNA (rDNA) was amplified and sequenced by polymerase chain reaction (PCR) techniques. The ITS1 of T. skrjabini, T. ovis, T. globulosa, and T. leporis was 495, 757, 757, and 536 nucleotides in length, respectively, and had G + C contents of 59.6, 58.7, 58.7, and 60.8%, respectively. Intraindividual variation was detected in the ITSI sequences of the 4 species. Furthermore, the 5.8S sequences of T. skrjabini, T. ovis, T. globulosa, and T. leporis were compared. A total of 157, 152, 153, and 157 nucleotides in length was observed in the 5.8S sequences of these 4 species, respectively. There were no sequence differences of ITS1 and 5.8S products between T. ovis and T. globulosa. Nevertheless, clear differences were detected between the ITS1 sequences of T. skrjabini, T. ovis, T. leporis, Trichuris muris, and T. arvicolae. The ITS2 fragment from the rDNA of T. skrjabini was sequenced. A comparative study of the ITS2 sequence of T. skrjabini with the previously published ITS2 sequence data of T. ovis, T. leporis, T. muris, and T. arvicolae suggested that the combined use of sequence data from both spacers would be useful in the molecular characterization of trichurid parasites.

Re-Assembly and Analysis of an Ancient Variola Virus Genome.

PubMed

Smithson, Chad; Imbery, Jacob; Upton, Chris

2017-09-08

We report a major improvement to the assembly of published short read sequencing data from an ancient variola virus (VARV) genome by the removal of contig-capping sequencing tags and manual searches for gap-spanning reads. The new assembly, together with camelpox and taterapox genomes, permitted new dates to be calculated for the last common ancestor of all VARV genomes. The analysis of recently sequenced VARV-like cowpox virus genomes showed that single nucleotide polymorphisms (SNPs) and amino acid changes in the vaccinia virus (VACV)-Cop-O1L ortholog, predicted to be associated with VARV host specificity and virulence, were introduced into the lineage before the divergence of these viruses. A comparison of the ancient and modern VARV genome sequences also revealed a measurable drift towards adenine + thymine (A + T) richness.

MPRAnator: a web-based tool for the design of massively parallel reporter assay experiments.

PubMed

Georgakopoulos-Soares, Ilias; Jain, Naman; Gray, Jesse M; Hemberg, Martin

2017-01-01

With the rapid advances in DNA synthesis and sequencing technologies and the continuing decline in the associated costs, high-throughput experiments can be performed to investigate the regulatory role of thousands of oligonucleotide sequences simultaneously. Nevertheless, designing high-throughput reporter assay experiments such as massively parallel reporter assays (MPRAs) and similar methods remains challenging. We introduce MPRAnator, a set of tools that facilitate rapid design of MPRA experiments. With MPRA Motif design, a set of variables provides fine control of how motifs are placed into sequences, thereby allowing the investigation of the rules that govern transcription factor (TF) occupancy. MPRA single-nucleotide polymorphism design can be used to systematically examine the functional effects of single or combinations of single-nucleotide polymorphisms at regulatory sequences. Finally, the Transmutation tool allows for the design of negative controls by permitting scrambling, reversing, complementing or introducing multiple random mutations in the input sequences or motifs. MPRAnator tool set is implemented in Python, Perl and Javascript and is freely available at www.genomegeek.com and www.sanger.ac.uk/science/tools/mpranator The source code is available on www.github.com/hemberg-lab/MPRAnator/ under the MIT license. The REST API allows programmatic access to MPRAnator using simple URLs. igs@sanger.ac.uk or mh26@sanger.ac.ukSupplementary information: Supplementary data are available at Bioinformatics online. © The Author 2016. Published by Oxford University Press.

The EMBL nucleotide sequence database

PubMed Central

Stoesser, Guenter; Baker, Wendy; van den Broek, Alexandra; Camon, Evelyn; Garcia-Pastor, Maria; Kanz, Carola; Kulikova, Tamara; Lombard, Vincent; Lopez, Rodrigo; Parkinson, Helen; Redaschi, Nicole; Sterk, Peter; Stoehr, Peter; Tuli, Mary Ann

2001-01-01

The EMBL Nucleotide Sequence Database (http://www.ebi.ac.uk/embl/) is maintained at the European Bioinformatics Institute (EBI) in an international collaboration with the DNA Data Bank of Japan (DDBJ) and GenBank at the NCBI (USA). Data is exchanged amongst the collaborating databases on a daily basis. The major contributors to the EMBL database are individual authors and genome project groups. Webin is the preferred web-based submission system for individual submitters, whilst automatic procedures allow incorporation of sequence data from large-scale genome sequencing centres and from the European Patent Office (EPO). Database releases are produced quarterly. Network services allow free access to the most up-to-date data collection via ftp, email and World Wide Web interfaces. EBI’s Sequence Retrieval System (SRS), a network browser for databanks in molecular biology, integrates and links the main nucleotide and protein databases plus many specialized databases. For sequence similarity searching a variety of tools (e.g. Blitz, Fasta, BLAST) are available which allow external users to compare their own sequences against the latest data in the EMBL Nucleotide Sequence Database and SWISS-PROT. PMID:11125039

Interactive computer programs for the graphic analysis of nucleotide sequence data.

PubMed Central

Luckow, V A; Littlewood, R K; Rownd, R H

1984-01-01

A group of interactive computer programs have been developed which aid in the collection and graphical analysis of nucleotide and protein sequence data. The programs perform the following basic functions: a) enter, edit, list, and rearrange sequence data; b) permit automatic entry of nucleotide sequence data directly from an autoradiograph into the computer; c) search for restriction sites or other specified patterns and plot a linear or circular restriction map, or print their locations; d) plot base composition; e) analyze homology between sequences by plotting a two-dimensional graphic matrix; and f) aid in plotting predicted secondary structures of RNA molecules. PMID:6546437

Nucleotide sequence analysis establishes the role of endogenous murine leukemia virus DNA segments in formation of recombinant mink cell focus-forming murine leukemia viruses.

PubMed Central

Khan, A S

1984-01-01

The sequence of 363 nucleotides near the 3' end of the pol gene and 564 nucleotides from the 5' terminus of the env gene in an endogenous murine leukemia viral (MuLV) DNA segment, cloned from AKR/J mouse DNA and designated as A-12, was obtained. For comparison, the nucleotide sequence in an analogous portion of AKR mink cell focus-forming (MCF) 247 MuLV provirus was also determined. Sequence features unique to MCF247 MuLV DNA in the 3' pol and 5' env regions were identified by comparison with nucleotide sequences in analogous regions of NFS -Th-1 xenotropic and AKR ecotropic MuLV proviruses. These included (i) an insertion of 12 base pairs encoding four amino acids located 60 base pairs from the 3' terminus of the pol gene and immediately preceding the env gene, (ii) the deletion of 12 base pairs (encoding four amino acids) and the insertion of 3 base pairs (encoding one amino acid) in the 5' portion of the env gene, and (iii) single base substitutions resulting in 2 MCF247 -specific amino acids in the 3' pol and 23 in the 5' env regions. Nucleotide sequence comparison involving the 3' pol and 5' env regions of AKR MCF247 , NFS xenotropic, and AKR ecotropic MuLV proviruses with the cloned endogenous MuLV DNA indicated that MCF247 proviral DNA sequences were conserved in the cloned endogenous MuLV proviral segment. In fact, total nucleotide sequence identity existed between the endogenous MuLV DNA and the MCF247 MuLV provirus in the 3' portion of the pol gene. In the 5' env region, only 4 of 564 nucleotides were different, resulting in three amino acid changes between AKR MCF247 MuLV DNA and the endogenous MuLV DNA present in clone A-12. In addition, nucleotide sequence comparison indicated that Moloney-and Friend-MCF MuLVs were also highly related in the 3' pol and 5' env regions to the cloned endogenous MuLV DNA. These results establish the role of endogenous MuLV DNA segments in generation of recombinant MCF viruses. PMID:6328017

Isolation and molecular characterization of partial FSH and LH receptor genes in Arabian camels (Camelus dromedarius)

PubMed Central

Jelokhani-Niaraki, Saber; Tahmoorespur, Mojtaba; Bitaraf-Sani, Morteza

2015-01-01

Very little is known about LHR and FSHR genes of domestic dromedary camels. The main objective of this study was to determine and analyze partial genomic regions of FSHR and LHR genes in dromedary camels for the first time. To this end, a total of50 DNA samples belonging to dromedary camels raised in Iran were sent for sequencing (25 samples of each gene). We compared the nucleotide sequences of Camelus dromedarius with corresponding sequences of previously published FSHR and LHR genes in bactrian camels and other species. According to the data, the same nucleotide variation was identified in both regions of the two camel species. The alignment of deduced protein sequences of the two different species revealed an amino acid variation at the FSHR region. No evidence of amino acid variation was observed, however, in LHR sequences. Phylogenetic analysis indicated that both camel species had a close relationship and clustered together in a separate branch. This was further confirmed by genetic distance values illustrating significant sequence identity between Camelus dromedarius and Camelus bactrianus. Interestingly, sequence comparisons revealed heterozygote patterns in FSHR sequences isolated from dromedary camels of Iran. In comparison to other species, this camel contains three amino acid substitutions at 5, 67, and 105 positions in the FSHR coding region. These positions are found exclusively in camels and can be considered as species specific. The results of our study can be used for hormone functionality research (FSHR and LHR) as well as reproduction-linked polymorphisms and breeding programs. PMID:27844002

Isolation and molecular characterization of partial FSH and LH receptor genes in Arabian camels (Camelus dromedarius).

PubMed

Jelokhani-Niaraki, Saber; Tahmoorespur, Mojtaba; Bitaraf-Sani, Morteza

2015-06-01

Very little is known about LHR and FSHR genes of domestic dromedary camels. The main objective of this study was to determine and analyze partial genomic regions of FSHR and LHR genes in dromedary camels for the first time. To this end, a total of50 DNA samples belonging to dromedary camels raised in Iran were sent for sequencing (25 samples of each gene). We compared the nucleotide sequences of Camelus dromedarius with corresponding sequences of previously published FSHR and LHR genes in bactrian camels and other species. According to the data, the same nucleotide variation was identified in both regions of the two camel species. The alignment of deduced protein sequences of the two different species revealed an amino acid variation at the FSHR region. No evidence of amino acid variation was observed, however, in LHR sequences. Phylogenetic analysis indicated that both camel species had a close relationship and clustered together in a separate branch. This was further confirmed by genetic distance values illustrating significant sequence identity between Camelus dromedarius and Camelus bactrianus . Interestingly, sequence comparisons revealed heterozygote patterns in FSHR sequences isolated from dromedary camels of Iran. In comparison to other species, this camel contains three amino acid substitutions at 5, 67, and 105 positions in the FSHR coding region. These positions are found exclusively in camels and can be considered as species specific. The results of our study can be used for hormone functionality research ( FSHR and LHR ) as well as reproduction-linked polymorphisms and breeding programs.

O-ribosyl-phosphate purine as a constant modified nucleotide located at position 64 in cytoplasmic initiator tRNAs(Met) of yeasts.

PubMed Central

Glasser, A L; Desgres, J; Heitzler, J; Gehrke, C W; Keith, G

1991-01-01

The unknown modified nucleotide G*, isolated from both Schizosaccharomyces pombe and Torulopsis utilis initiator tRNAs(Met), has been identified as an O-ribosyl-(1"----2')-guanosine-5"-phosphate, called Gr(p), by means of HPLC, UV-absorption, mass spectrometry and periodate oxidation procedures. By comparison with the previously published structure of Ar(p) isolated from Saccharomyces cerevisiae initiator tRNA(Met), the (1"----2')-glycosidic bond in Gr(p) has been postulated to have a beta-spatial conformation. The modified nucleotide Gr(p) is located at position 64 in the tRNA(Met) molecules, i.e. at the same position as Ar(p). Since we have also characterized Gr(p) in Candida albicans initiator tRNA(Met), the phosphoribosylation of purine 64 can be considered as a constant nucleotide modification in the cytoplasmic initiator tRNAs(Met) of all yeast species so far sequenced. Precise evidence for the presence of Gr(p) in initiator tRNAs(Met) of several plants is also reported. PMID:1656390

Complete nucleotide sequence and genome organization of a novel allexivirus from alfalfa (Medicago sativa)

USDA-ARS?s Scientific Manuscript database

A new species of the family Alphaflexiviridae provisionally named Alfalfa virus S (AVS) was diagnosed in alfalfa samples originating from Sudan. A complete nucleotide sequence of the viral genome consisting of 8,349 nucleotides excluding the 3’ poly(A) tail was determined by Illumina NGS technology ...

The primary structure of the thymidine kinase gene of fish lymphocystis disease virus.

PubMed

Schnitzler, P; Handermann, M; Szépe, O; Darai, G

1991-06-01

The DNA nucleotide sequence of the thymidine kinase (TK) gene of fish lymphocystis disease virus (FLDV) which has been localized between the coordinates 0.678 to 0.688 of the viral genome was determined. The analysis of the DNA nucleotide sequence located between the recognition sites of HindIII (0.669 map unit; nucleotide position 1) and AccI (nucleotide position 2032) revealed the presence of an open reading frame of 954 bp on the lower strand of this region between nucleotide positions 1868 (ATG) and 915 (TAA). It encodes for a protein of 318 amino acid residues. The evolutionary relationships of the TK gene of FLDV to the other known TK genes was investigated using the method of progressive sequence alignment. These analyses revealed a high degree of diversity between the protein sequence of FLDV TK gene and the amino acid composition of other TKs tested. However, significant conservations were detected at several regions of amino acid residues of the FLDV TK protein when compared to the amino acid sequence of TKs of African swine fever virus, fowlpox virus, shope fibroma virus, and vaccinia virus and to the amino acid sequences of the cellular cytoplasmic TK of chicken, mouse, and man.

Sequence diversity within the reovirus S2 gene: reovirus genes reassort in nature, and their termini are predicted to form a panhandle motif.

PubMed Central

Chapell, J D; Goral, M I; Rodgers, S E; dePamphilis, C W; Dermody, T S

1994-01-01

To better understand genetic diversity within mammalian reoviruses, we determined S2 nucleotide and deduced sigma 2 amino acid sequences of nine reovirus strains and compared these sequences with those of prototype strains of the three reovirus serotypes. The S2 gene and sigma 2 protein are highly conserved among the four type 1, one type 2, and seven type 3 strains studied. Phylogenetic analyses based on S2 nucleotide sequences of the 12 reovirus strains indicate that diversity within the S2 gene is independent of viral serotype. Additionally, we found marked topological differences between phylogenetic trees generated from S1 and S2 gene nucleotide sequences of the seven type 3 strains. These results demonstrate that reovirus S1 and S2 genes have distinct evolutionary histories, thus providing phylogenetic evidence for lateral transfer of reovirus genes in nature. When variability among the 12 sigma 2-encoding S2 nucleotide sequences was analyzed at synonymous positions, we found that approximately 60 nucleotides at the 5' terminus and 30 nucleotides at the 3' terminus were markedly conserved in comparison with other sigma 2-encoding regions of S2. Predictions of RNA secondary structures indicate that the more conserved S2 sequences participate in the formation of an extended region of duplex RNA interrupted by a pair of stem-loops. Among the 12 deduced sigma 2 amino acid sequences examined, substitutions were observed at only 11% of amino acid positions. This finding suggests that constraints on the structure or function of sigma 2, perhaps in part because of its location in the virion core, have limited sequence diversity within this protein. PMID:8289378

DNA sequence analysis of simian virus 40 mutants with deletions mapping in the leader region of the late viral mRNA's: mutants with deletions similar in size and position exhibit varied phenotypes.

PubMed

Barkan, A; Mertz, J E

1981-02-01

The nucleotide sequences of 10 viable yet partially defective deletion mutants of simian virus 40 were determined. The deletions mapped within, and, in many cases, 5' to, the predominant leader sequence of the late viral mRNA's. They ranged from 74 to 187 nucleotide pairs in length. Six of the mutants had lost the sequence that corresponds to the "cap" site (5' terminus) of the most abundant class of 16S mRNA's. One of these mutants had a deletion that extended 103 nucleotide pairs into the region preceding this primary cap site and, therefore, was missing many secondary cap sites as well. A seventh mutant lacked the entire major 16S leader sequence except for the first six nucleotides at its 5' end and the last nine at its 3' end. Although these mutants differed in the size and position of their deletions, we were unable to discover any simple correlations between their growth characteristics and their DNA sequences. This finding indicates that the secondary structures of the RNA transcripts may play a more important role than the exact nucleotide sequence of the RNAs in determining how they function within the cell.

Antifungal polypeptides

DOEpatents

Altier, Daniel J.; Dahlbacka, Glen; Ellanskaya, legal representative, Natalia; Herrmann, Rafael; Hunter-Cevera, Jennie; McCutchen, Billy F.; Presnail, James K.; Rice, Janet A.; Schepers, Eric; Simmons, Carl R.; Torok, Tamas; Yalpani, Nasser; Ellanskaya, deceased, Irina

2007-12-11

Compositions and methods for protecting a plant from a pathogen, particularly a fungal pathogen, are provided. Compositions include novel amino acid sequences, and variants and fragments thereof, for antipathogenic polypeptides that were isolated from microbial fermentation broths. Nucleic acid molecules comprising nucleotide sequences that encode the antipathogenic polypeptides of the invention are also provided. A method for inducing pathogen resistance in a plant using the nucleotide sequences disclosed herein is further provided. The method comprises introducing into a plant an expression cassette comprising a promoter operably linked to a nucleotide sequence that encodes an antipathogenic polypeptide of the invention. Compositions comprising an antipathogenic polypeptide or a transformed microorganism comprising a nucleic acid of the invention in combination with a carrier and methods of using these compositions to protect a plant from a pathogen are further provided. Transformed plants, plant cells, seeds, and microorganisms comprising a nucleotide sequence that encodes an antipathogenic polypeptide of the invention, or variant or fragment thereof, are also disclosed.

Antifungal polypeptides

DOEpatents

Altier, Daniel J.; Dahlbacka, Glen; Elleskaya, Irina; Ellanskaya, legal representative; Natalia; Herrmann, Rafael; Hunter-Cevera, Jennie; McCutchen, Billy F.; Presnail, James K.; Rice, Janet A.; Schepers, Eric; Simmons, Carl R.; Torok, Tamas; Yalpani, Nasser

2010-08-10

Compositions and methods for protecting a plant from a pathogen, particularly a fungal pathogen, are provided. Compositions include novel amino acid sequences, and variants and fragments thereof, for antipathogenic polypeptides that were isolated from microbial fermentation broths. Nucleic acid molecules comprising nucleotide sequences that encode the antipathogenic polypeptides of the invention are also provided. A method for inducing pathogen resistance in a plant using the nucleotide sequences disclosed herein is further provided. The method comprises introducing into a plant an expression cassette comprising a promoter operably linked to a nucleotide sequence that encodes an antipathogenic polypeptide of the invention. Compositions comprising an antipathogenic polypeptide or a transformed microorganism comprising a nucleic acid of the invention in combination with a carrier and methods of using these compositions to protect a plant from a pathogen are further provided. Transformed plants, plant cells, seeds, and microorganisms comprising a nucleotide sequence that encodes an antipathogenic polypeptide of the invention, or variant or fragment thereof, are also disclosed.

Antifungal polypeptides

DOEpatents

Altier, Daniel J [Waukee, IA; Dahlbacka, Glen [Oakland, CA; Elleskaya, Irina [Kyiv, UA; Ellanskaya, legal representative, Natalia; Herrmann, Rafael [Wilmington, DE; Hunter-Cevera, Jennie [Elliott City, MD; McCutchen, Billy F [College Station, IA; Presnail, James K [Avondale, PA; Rice, Janet A [Wilmington, DE; Schepers, Eric [Port Deposit, MD; Simmons, Carl R [Des Moines, IA; Torok, Tamas [Richmond, CA; Yalpani, Nasser [Johnston, IA

2011-04-12

Compositions and methods for protecting a plant from a pathogen, particularly a fungal pathogen, are provided. Compositions include novel amino acid sequences, and variants and fragments thereof, for antipathogenic polypeptides that were isolated from microbial fermentation broths. Nucleic acid molecules comprising nucleotide sequences that encode the antipathogenic polypeptides of the invention are also provided. A method for inducing pathogen resistance in a plant using the nucleotide sequences disclosed herein is further provided. The method comprises introducing into a plant an expression cassette comprising a promoter operably linked to a nucleotide sequence that encodes an antipathogenic polypeptide of the invention. Compositions comprising an antipathogenic polypeptide or a transformed microorganism comprising a nucleic acid of the invention in combination with a carrier and methods of using these compositions to protect a plant from a pathogen are further provided. Transformed plants, plant cells, seeds, and microorganisms comprising a nucleotide sequence that encodes an antipathogenic polypeptide of the invention, or variant or fragment thereof, are also disclosed.

Antifungal polypeptides

DOEpatents

Altier, Daniel J [Granger, IA; Dahlbacka, Glen [Oakland, CA; Ellanskaya, Irina [Kyiv, UA; Ellanskaya, legal representative, Natalia; Herrmann, Rafael [Wilmington, DE; Hunter-Cevera, Jennie [Elliott City, MD; McCutchen, Billy F [College Station, TX; Presnail, James K [Avondale, PA; Rice, Janet A [Wilmington, DE; Schepers, Eric [Port Deposit, MD; Simmons, Carl R [Des Moines, IA; Torok, Tamas [Richmond, CA; Yalpani, Nasser [Johnston, IA

2012-04-03

Compositions and methods for protecting a plant from a pathogen, particularly a fungal pathogen, are provided. Compositions include novel amino acid sequences, and variants and fragments thereof, for antipathogenic polypeptides that were isolated from microbial fermentation broths. Nucleic acid molecules comprising nucleotide sequences that encode the antipathogenic polypeptides of the invention are also provided. A method for inducing pathogen resistance in a plant using the nucleotide sequences disclosed herein is further provided. The method comprises introducing into a plant an expression cassette comprising a promoter operably linked to a nucleotide sequence that encodes an antipathogenic polypeptide of the invention. Compositions comprising an antipathogenic polypeptide or a transformed microorganism comprising a nucleic acid of the invention in combination with a carrier and methods of using these compositions to protect a plant from a pathogen are further provided. Transformed plants, plant cells, seeds, and microorganisms comprising a nucleotide sequence that encodes an antipathogenic polypeptide of the invention, or variant or fragment thereof, are also disclosed.

Intercalation of XR5944 with the estrogen response element is modulated by the tri-nucleotide spacer sequence between half-sites

PubMed Central

Sidell, Neil; Mathad, Raveendra I.; Shu, Feng-jue; Zhang, Zhenjiang; Kallen, Caleb B.; Yang, Danzhou

2011-01-01

DNA-intercalating molecules can impair DNA replication, DNA repair, and gene transcription. We previously demonstrated that XR5944, a DNA bis-intercalator, specifically blocks binding of estrogen receptor-α (ERα) to the consensus estrogen response element (ERE). The consensus ERE sequence is AGGTCAnnnTGACCT, where nnn is known as the tri-nucleotide spacer. Recent work has shown that the tri-nucleotide spacer can modulate ERα-ERE binding affinity and ligand-mediated transcriptional responses. To further understand the mechanism by which XR5944 inhibits ERα-ERE binding, we tested its ability to interact with consensus EREs with variable tri-nucleotide spacer sequences and with natural but non-consensus ERE sequences using one dimensional nuclear magnetic resonance (1D 1H NMR) titration studies. We found that the tri-nucleotide spacer sequence significantly modulates the binding of XR5944 to EREs. Of the sequences that were tested, EREs with CGG and AGG spacers showed the best binding specificity with XR5944, while those spaced with TTT demonstrated the least specific binding. The binding stoichiometry of XR5944 with EREs was 2:1, which can explain why the spacer influences the drug-DNA interaction; each XR5944 spans four nucleotides (including portions of the spacer) when intercalating with DNA. To validate our NMR results, we conducted functional studies using reporter constructs containing consensus EREs with tri-nucleotide spacers CGG, CTG, and TTT. Results of reporter assays in MCF-7 cells indicated that XR5944 was significantly more potent in inhibiting the activity of CGG- than TTT-spaced EREs, consistent with our NMR results. Taken together, these findings predict that the anti-estrogenic effects of XR5944 will depend not only on ERE half-site composition but also on the tri-nucleotide spacer sequence of EREs located in the promoters of estrogen-responsive genes. PMID:21333738

Typing of canine parvovirus isolates using mini-sequencing based single nucleotide polymorphism analysis.

PubMed

Naidu, Hariprasad; Subramanian, B Mohana; Chinchkar, Shankar Ramchandra; Sriraman, Rajan; Rana, Samir Kumar; Srinivasan, V A

2012-05-01

The antigenic types of canine parvovirus (CPV) are defined based on differences in the amino acids of the major capsid protein VP2. Type specificity is conferred by a limited number of amino acid changes and in particular by few nucleotide substitutions. PCR based methods are not particularly suitable for typing circulating variants which differ in a few specific nucleotide substitutions. Assays for determining SNPs can detect efficiently nucleotide substitutions and can thus be adapted to identify CPV types. In the present study, CPV typing was performed by single nucleotide extension using the mini-sequencing technique. A mini-sequencing signature was established for all the four CPV types (CPV2, 2a, 2b and 2c) and feline panleukopenia virus. The CPV typing using the mini-sequencing reaction was performed for 13 CPV field isolates and the two vaccine strains available in our repository. All the isolates had been typed earlier by full-length sequencing of the VP2 gene. The typing results obtained from mini-sequencing matched completely with that of sequencing. Typing could be achieved with less than 100 copies of standard plasmid DNA constructs or ≤10¹ FAID₅₀ of virus by mini-sequencing technique. The technique was also efficient for detecting multiple types in mixed infections. Copyright © 2012 Elsevier B.V. All rights reserved.

The nucleotide sequences of 5S rRNAs from a rotifer, Brachionus plicatilis, and two nematodes, Rhabditis tokai and Caenorhabditis elegans.

PubMed Central

Kumazaki, T; Hori, H; Osawa, S; Ishii, N; Suzuki, K

1982-01-01

The nucleotide sequences of 5S rRNAs from a rotifer, Brachionus plicatilis, and two nematodes, Rhabditis tokai and Caenorhabditis elegans have been determined. The rotifer has two 5S rRNA species that are composed of 120 and 121 nucleotides, respectively. The sequences of these two 5S rRNAs are the same except that the latter has an additional base at its 3'-terminus. The 5S rRNAs from the two nematode species are both 119 nucleotides long. The sequence similarity percents are 79% (Brachionus/Rhabditis), 80% (Brachionus/Caenorhabditis), and 95% (Rhabditis/Caenorhabditis) among these three species. Brachionus revealed the highest similarity to Lingula (89%), but not to the nematodes (79%). PMID:6891053

Detection and quantitation of single nucleotide polymorphisms, DNA sequence variations, DNA mutations, DNA damage and DNA mismatches

DOEpatents

McCutchen-Maloney, Sandra L.

2002-01-01

DNA mutation binding proteins alone and as chimeric proteins with nucleases are used with solid supports to detect DNA sequence variations, DNA mutations and single nucleotide polymorphisms. The solid supports may be flow cytometry beads, DNA chips, glass slides or DNA dips sticks. DNA molecules are coupled to solid supports to form DNA-support complexes. Labeled DNA is used with unlabeled DNA mutation binding proteins such at TthMutS to detect DNA sequence variations, DNA mutations and single nucleotide length polymorphisms by binding which gives an increase in signal. Unlabeled DNA is utilized with labeled chimeras to detect DNA sequence variations, DNA mutations and single nucleotide length polymorphisms by nuclease activity of the chimera which gives a decrease in signal.

37 CFR 1.823 - Requirements for nucleotide and/or amino acid sequences as part of the application.

Code of Federal Regulations, 2011 CFR

2011-07-01

... and/or amino acid sequences as part of the application. 1.823 Section 1.823 Patents, Trademarks, and... Amino Acid Sequences § 1.823 Requirements for nucleotide and/or amino acid sequences as part of the... incorporation-by-reference of the Sequence Listing as required by § 1.52(e)(5). The presentation of the...

37 CFR 1.823 - Requirements for nucleotide and/or amino acid sequences as part of the application.

Code of Federal Regulations, 2013 CFR

2013-07-01

... and/or amino acid sequences as part of the application. 1.823 Section 1.823 Patents, Trademarks, and... Amino Acid Sequences § 1.823 Requirements for nucleotide and/or amino acid sequences as part of the... incorporation-by-reference of the Sequence Listing as required by § 1.52(e)(5). The presentation of the...

37 CFR 1.823 - Requirements for nucleotide and/or amino acid sequences as part of the application.

Code of Federal Regulations, 2012 CFR

2012-07-01

... and/or amino acid sequences as part of the application. 1.823 Section 1.823 Patents, Trademarks, and... Amino Acid Sequences § 1.823 Requirements for nucleotide and/or amino acid sequences as part of the... incorporation-by-reference of the Sequence Listing as required by § 1.52(e)(5). The presentation of the...

37 CFR 1.823 - Requirements for nucleotide and/or amino acid sequences as part of the application.

Code of Federal Regulations, 2010 CFR

2010-07-01

... and/or amino acid sequences as part of the application. 1.823 Section 1.823 Patents, Trademarks, and... Amino Acid Sequences § 1.823 Requirements for nucleotide and/or amino acid sequences as part of the... incorporation-by-reference of the Sequence Listing as required by § 1.52(e)(5). The presentation of the...

37 CFR 1.823 - Requirements for nucleotide and/or amino acid sequences as part of the application.

Code of Federal Regulations, 2014 CFR

2014-07-01

... and/or amino acid sequences as part of the application. 1.823 Section 1.823 Patents, Trademarks, and... Amino Acid Sequences § 1.823 Requirements for nucleotide and/or amino acid sequences as part of the... incorporation-by-reference of the Sequence Listing as required by § 1.52(e)(5). The presentation of the...

Cry-Bt identifier: a biological database for PCR detection of Cry genes present in transgenic plants.

PubMed

Singh, Vinay Kumar; Ambwani, Sonu; Marla, Soma; Kumar, Anil

2009-10-23

We describe the development of a user friendly tool that would assist in the retrieval of information relating to Cry genes in transgenic crops. The tool also helps in detection of transformed Cry genes from Bacillus thuringiensis present in transgenic plants by providing suitable designed primers for PCR identification of these genes. The tool designed based on relational database model enables easy retrieval of information from the database with simple user queries. The tool also enables users to access related information about Cry genes present in various databases by interacting with different sources (nucleotide sequences, protein sequence, sequence comparison tools, published literature, conserved domains, evolutionary and structural data). http://insilicogenomics.in/Cry-btIdentifier/welcome.html.

Biological nanopore MspA for DNA sequencing

NASA Astrophysics Data System (ADS)

Manrao, Elizabeth A.

Unlocking the information hidden in the human genome provides insight into the inner workings of complex biological systems and can be used to greatly improve health-care. In order to allow for widespread sequencing, new technologies are required that provide fast and inexpensive readings of DNA. Nanopore sequencing is a third generation DNA sequencing technology that is currently being developed to fulfill this need. In nanopore sequencing, a voltage is applied across a small pore in an electrolyte solution and the resulting ionic current is recorded. When DNA passes through the channel, the ionic current is partially blocked. If the DNA bases uniquely modulate the ionic current flowing through the channel, the time trace of the current can be related to the sequence of DNA passing through the pore. There are two main challenges to realizing nanopore sequencing: identifying a pore with sensitivity to single nucleotides and controlling the translocation of DNA through the pore so that the small single nucleotide current signatures are distinguishable from background noise. In this dissertation, I explore the use of Mycobacterium smegmatis porin A (MspA) for nanopore sequencing. In order to determine MspA's sensitivity to single nucleotides, DNA strands of various compositions are held in the pore as the resulting ionic current is measured. DNA is immobilized in MspA by attaching it to a large molecule which acts as an anchor. This technique confirms the single nucleotide resolution of the pore and additionally shows that MspA is sensitive to epigenetic modifications and single nucleotide polymorphisms. The forces from the electric field within MspA, the effective charge of nucleotides, and elasticity of DNA are estimated using a Freely Jointed Chain model of single stranded DNA. These results offer insight into the interactions of DNA within the pore. With the nucleotide sensitivity of MspA confirmed, a method is introduced to controllably pass DNA through the pore. Using a DNA polymerase, DNA strands are stepped through MspA one nucleotide at a time. The steps are observable as distinct levels on the ionic-current time-trace and are related to the DNA sequence. These experiments overcome the two fundamental challenges to realizing MspA nanopore sequencing and pave the way to the development of a commercial technology.

First report of Beet western yellows virus infecting Epiphyllum spp

USDA-ARS?s Scientific Manuscript database

Beet western yellow virus (BWYV) was identified from an orchid cactus (Epiphyllum spp.) hybrid without obvious symptoms by high-throughput sequencing. The nearly complete genomic sequence of 5,458 nucleotides of the virus was determined. The isolate has the highest nucleotide sequence identity (93%)...

A new single-nucleotide polymorphism database for rainbow trout generated through whole genome re-sequencing

USDA-ARS?s Scientific Manuscript database

Single-nucleotide polymorphisms (SNPs) are highly abundant markers, which are broadly distributed in animal genomes. For rainbow trout, SNP discovery has been done through sequencing of restriction-site associated DNA (RAD) libraries, reduced representation libraries (RRL), RNA sequencing, and whole...

Sequence analysis of the internal transcribed spacer (ITS) region reveals a novel clade of Ichthyophonus sp. from rainbow trout

USGS Publications Warehouse

Rasmussen, C.; Purcell, M.K.; Gregg, J.L.; LaPatra, S.E.; Winton, J.R.; Hershberger, P.K.

2010-01-01

The mesomycetozoean parasite Ichthyophonus hoferi is most commonly associated with marine fish hosts but also occurs in some components of the freshwater rainbow trout Oncorhynchus mykiss aquaculture industry in Idaho, USA. It is not certain how the parasite was introduced into rainbow trout culture, but it might have been associated with the historical practice of feeding raw, ground common carp Cyprinus carpio that were caught by commercial fisherman. Here, we report a major genetic division between west coast freshwater and marine isolates of Ichthyophonus hoferi. Sequence differences were not detected in 2 regions of the highly conserved small subunit (18S) rDNA gene; however, nucleotide variation was seen in internal transcribed spacer loci (ITS1 and ITS2), both within and among the isolates. Intra-isolate variation ranged from 2.4 to 7.6 nucleotides over a region consisting of ~740 bp. Majority consensus sequences from marine/anadromous hosts differed in only 0 to 3 nucleotides (99.6 to 100% nucleotide identity), while those derived from freshwater rainbow trout had no nucleotide substitutions relative to each other. However, the consensus sequences between isolates from freshwater rainbow trout and those from marine/anadromous hosts differed in 13 to 16 nucleotides (97.8 to 98.2% nucleotide identity).

[Study on the genetic difference of SEO type Hantaviruses].

PubMed

Zhang, X; Zhou, S; Wang, H; Hu, J; Guan, Z; Liu, H

2000-10-01

To understand the genetic type of Hantaviruses and the difference between them caused by rodents in Beijing and to furhter explore the source of the infectious factors. Hantavirus RNA, isolated from lungs of rodents captured in Beijing and positive with Hantavirus antigens with frozen sectioning and Immunofluorescent assay, were reverse-transcribed and amplified with PCR with Hantavirus-specific primers. Five of the PCR amplifications were discovered and sequenced with 300 bp sequence data of M segments (from 2003 - 2302nt according cDNA of seoul 8039 strain). Nucleotide sequence homology showed that they were sequences of SEO-type Hantavirus. Compared with SEO type Hantavirus, the nucleotide sequence homology of these samples was more than 94% while the homology of amonia acid sequence was more than 98%. When compared with HNT type Hantavirus, the homology of nucleotide sequence became less than 72% with the homology of amonia acid sequence less than 81%. Similar to other Hantavirus of SEO type, their nucleotide sequences and deduced amino acid sequences were highly preserved. Phylogenetic tree analysis showed that the five viruses could be divided into at least 4 branches. It was quite likely that there were at least two sub-type SEO viruses with 4 branches that were circulating in Beijing.

Comparison of base composition analysis and Sanger sequencing of mitochondrial DNA for four U.S. population groups.

PubMed

Kiesler, Kevin M; Coble, Michael D; Hall, Thomas A; Vallone, Peter M

2014-01-01

A set of 711 samples from four U.S. population groups was analyzed using a novel mass spectrometry based method for mitochondrial DNA (mtDNA) base composition profiling. Comparison of the mass spectrometry results with Sanger sequencing derived data yielded a concordance rate of 99.97%. Length heteroplasmy was identified in 46% of samples and point heteroplasmy was observed in 6.6% of samples in the combined mass spectral and Sanger data set. Using discrimination capacity as a metric, Sanger sequencing of the full control region had the highest discriminatory power, followed by the mass spectrometry base composition method, which was more discriminating than Sanger sequencing of just the hypervariable regions. This trend is in agreement with the number of nucleotides covered by each of the three assays. Published by Elsevier Ireland Ltd.

BS-virus-finder: virus integration calling using bisulfite sequencing data.

PubMed

Gao, Shengjie; Hu, Xuesong; Xu, Fengping; Gao, Changduo; Xiong, Kai; Zhao, Xiao; Chen, Haixiao; Zhao, Shancen; Wang, Mengyao; Fu, Dongke; Zhao, Xiaohui; Bai, Jie; Mao, Likai; Li, Bo; Wu, Song; Wang, Jian; Li, Shengbin; Yang, Huangming; Bolund, Lars; Pedersen, Christian N S

2018-01-01

DNA methylation plays a key role in the regulation of gene expression and carcinogenesis. Bisulfite sequencing studies mainly focus on calling single nucleotide polymorphism, different methylation region, and find allele-specific DNA methylation. Until now, only a few software tools have focused on virus integration using bisulfite sequencing data. We have developed a new and easy-to-use software tool, named BS-virus-finder (BSVF, RRID:SCR_015727), to detect viral integration breakpoints in whole human genomes. The tool is hosted at https://github.com/BGI-SZ/BSVF. BS-virus-finder demonstrates high sensitivity and specificity. It is useful in epigenetic studies and to reveal the relationship between viral integration and DNA methylation. BS-virus-finder is the first software tool to detect virus integration loci by using bisulfite sequencing data. © The Authors 2017. Published by Oxford University Press.

Sequencing and phylogenetic analysis of tobacco virus 2, a polerovirus from Nicotiana tabacum.

PubMed

Zhou, Benguo; Wang, Fang; Zhang, Xuesong; Zhang, Lina; Lin, Huafeng

2017-07-01

The complete genome sequence of a new virus, provisionally named tobacco virus 2 (TV2), was determined and identified from leaves of tobacco (Nicotiana tabacum) exhibiting leaf mosaic, yellowing, and deformity, in Anhui Province, China. The genome sequence of TV2 comprises 5,979 nucleotides, with 87% nucleotide sequence identity to potato leafroll virus (PLRV). Its genome organization is similar to that of PLRV, containing six open reading frames (ORFs) that potentially encode proteins with putative functions in cell-to-cell movement and suppression of RNA silencing. Phylogenetic analysis of the nucleotide sequence placed TV2 alongside members of the genus Polerovirus in the family Luteoviridae. To the best our knowledge, this study is the first report of a complete genome sequence of a new polerovirus identified in tobacco.

Complete nucleotide sequences of the coat protein messenger RNAs of brome mosaic virus and cowpea chlorotic mottle virus.

PubMed Central

Dasgupta, R; Kaesberg, P

1982-01-01

The nucleotide sequences of the subgenomic coat protein messengers (RNA4's) of two related bromoviruses, brome mosaic virus (BMV) and cowpea chlorotic mottle virus (CCMV), have been determined by direct RNA and CDNA sequencing without cloning. BMV RNA4 is 876 b long including a 5' noncoding region of nine nucleotides and a 3' noncoding region of 300 nucleotides. CCMV RNA 4 is 824 b long, including a 5' noncoding region of 10 nucleotides and a 3' noncoding region of 244 nucleotides. The encoded coat proteins are similar in length (188 amino acids for BMV and 189 amino acids for CCMV) and display about 70% homology in their amino acid sequences. Length difference between the two RNAs is due mostly to a single deletion, in CCMV with respect to BMV, of about 57 b immediately following the coding region. Allowing for this deletion the RNAs are indicate that mutations leading to divergence were constrained in the coding region primarily by the requirement of maintaining a favorable coat protein structure and in the 3' noncoding region primarily by the requirement of maintaining a favorable RNA spatial configuration. PMID:6895941

Nucleotide sequence analysis of the 3' terminal region of a wasabi strain of crucifer tobamovirus genomic RNA: subgrouping of crucifer tobamoviruses.

PubMed

Shimamoto, I; Sonoda, S; Vazquez, P; Minaka, N; Nishiguchi, M

1998-01-01

The 3' terminal 2378 nucleotides of a wasabi strain of crucifer tobamovirus (CTMV-W) infectious to crucifer plants was determined. This includes the 3' non-coding region of 235 nucleotides, coat protein (CP) gene (468 nucleotides), movement protein (MP) gene (798 nucleotides) and C-terminal partial readthrough portion of 180 K protein gene (940 nucleotides). Comparison of the sequence with homologous regions of thirteen other tobamovirus genomes showed that it had much higher identity to those of four other crucifer tobamoviruses, 85.2% to cr-TMV and turnip vein-clearing virus (TVCV), 87.4% to oilseed rape mosaic virus (ORMV) and 87.1% to TMV-Cg, than to those of other tobamoviruses. Thus CTMV-W was most similar to ORMV and TMV-Cg in sequence, but only marginally so, whereas the location and size of its MP gene was the same as cr-TMV amd TVCV. These results, together with other analyses, show that CTMV-W is a new crucifer tobamovirus, that the five crucifer tobamoviruses can be classified into two subgroups based on MP gene organization, and that the rate of sequence change is not the same in all lineages.

Comparative genomic sequence analysis of novel Helicoverpa armigera nucleopolyhedrovirus (NPV) isolated from Kenya and three other previously sequenced Helicoverpa spp. NPVs.

PubMed

Ogembo, Javier Gordon; Caoili, Barbara L; Shikata, Masamitsu; Chaeychomsri, Sudawan; Kobayashi, Michihiro; Ikeda, Motoko

2009-10-01

A newly cloned Helicoverpa armigera nucleopolyhedrovirus (HearNPV) from Kenya, HearNPV-NNg1, has a higher insecticidal activity than HearNPV-G4, which also exhibits lower insecticidal activity than HearNPV-C1. In the search for genes and/or nucleotide sequences that might be involved in the observed virulence differences among Helicoverpa spp. NPVs, the entire genome of NNg1 was sequenced and compared with previously sequenced genomes of G4, C1 and Helicoverpa zea single-nucleocapsid NPV (Hz). The NNg1 genome was 132,425 bp in length, with a total of 143 putative open reading frames (ORFs), and shared high levels of overall amino acid and nucleotide sequence identities with G4, C1 and Hz. Three NNg1 ORFs, ORF5, ORF100 and ORF124, which were shared with C1, were absent in G4 and Hz, while NNg1 and C1 were missing a homologue of G4/Hz ORF5. Another three ORFs, ORF60 (bro-b), ORF119 and ORF120, and one direct repeat sequence (dr) were unique to NNg1. Relative to the overall nucleotide sequence identity, lower sequence identities were observed between NNg1 hrs and the homologous hrs in the other three Helicoverpa spp. NPVs, despite containing the same number of hrs located at essentially the same positions on the genomes. Differences were also observed between NNg1 and each of the other three Helicoverpa spp. NPVs in the diversity of bro genes encoded on the genomes. These results indicate several putative genes and nucleotide sequences that may be responsible for the virulence differences observed among Helicoverpa spp., yet the specific genes and/or nucleotide sequences responsible have not been identified.

Genome characterization of Turkey Rotavirus G strains from the United States identifies potential recombination events with human Rotavirus B strains.

PubMed

Chen, Fangzhou; Knutson, Todd P; Porter, Robert E; Ciarlet, Max; Mor, Sunil Kumar; Marthaler, Douglas G

2017-12-01

Rotavirus G (RVG) strains have been detected in a variety of avian species, but RVG genomes have been published from only a single pigeon and two chicken strains. Two turkey RVG strains were identified and characterized, one in a hatchery with no reported health issues and the other in a hatchery with high embryo/poult mortality. The two turkey RVG strains shared only an 85.3 % nucleotide sequence identity in the VP7 gene while the other genes possessed high nucleotide identity among them (96.3-99.9 %). Low nucleotide percentage identities (31.6-87.3 %) occurred among the pigeon and chicken RVG strains. Interestingly, potential recombination events were detected between our RVG strains and a human RVB strain, in the VP6 and NSP3 segments. The epidemiology of RVG in avian flocks and the pathogenicity of the two different RVG strains should be further investigated to understand the ecology and impact of RVG in commercial poultry flocks.

Predicted stem-loop structures and variation in nucleotide sequence of 3' noncoding regions among animal calicivirus genomes.

PubMed

Seal, B S; Neill, J D; Ridpath, J F

1994-07-01

Caliciviruses are nonenveloped with a polyadenylated genome of approximately 7.6 kb and a single capsid protein. The "RNA Fold" computer program was used to analyze 3'-terminal noncoding sequences of five feline calicivirus (FCV), rabbit hemorrhagic disease virus (RHDV), and two San Miguel sea lion virus (SMSV) isolates. The FCV 3'-terminal sequences are 40-46 nucleotides in length and 72-91% similar. The FCV sequences were predicted to contain two possible duplex structures and one stem-loop structure with free energies of -2.1 to -18.2 kcal/mole. The RHDV genomic 3'-terminal RNA sequences are 54 nucleotides in length and share 49% sequence similarity to homologous regions of the FCV genome. The RHDV sequence was predicted to form two duplex structures in the 3'-terminal noncoding region with a single stem-loop structure, resembling that of FCV. In contrast, the SMSV 1 and 4 genomic 3'-terminal noncoding sequences were 185 and 182 nucleotides in length, respectively. Ten possible duplex structures were predicted with an average structural free energy of -35 kcal/mole. Sequence similarity between the two SMSV isolates was 75%. Furthermore, extensive cloverleaflike structures are predicted in the 3' noncoding region of the SMSV genome, in contrast to the predicted single stem-loop structures of FCV or RHDV.

Terminal Duplex Stability and Nucleotide Identity Differentially Control siRNA Loading and Activity in RNA Interference

PubMed Central

Angart, Phillip A.; Carlson, Rebecca J.; Adu-Berchie, Kwasi

2016-01-01

Efficient short interfering RNA (siRNA)-mediated gene silencing requires selection of a sequence that is complementary to the intended target and possesses sequence and structural features that encourage favorable functional interactions with the RNA interference (RNAi) pathway proteins. In this study, we investigated how terminal sequence and structural characteristics of siRNAs contribute to siRNA strand loading and silencing activity and how these characteristics ultimately result in a functionally asymmetric duplex in cultured HeLa cells. Our results reiterate that the most important characteristic in determining siRNA activity is the 5′ terminal nucleotide identity. Our findings further suggest that siRNA loading is controlled principally by the hybridization stability of the 5′ terminus (Nucleotides: 1–2) of each siRNA strand, independent of the opposing terminus. Postloading, RNA-induced silencing complex (RISC)–specific activity was found to be improved by lower hybridization stability in the 5′ terminus (Nucleotides: 3–4) of the loaded siRNA strand and greater hybridization stability toward the 3′ terminus (Nucleotides: 17–18). Concomitantly, specific recognition of the 5′ terminal nucleotide sequence by human Argonaute 2 (Ago2) improves RISC half-life. These findings indicate that careful selection of siRNA sequences can maximize both the loading and the specific activity of the intended guide strand. PMID:27399870

Correlation approach to identify coding regions in DNA sequences

NASA Technical Reports Server (NTRS)

Ossadnik, S. M.; Buldyrev, S. V.; Goldberger, A. L.; Havlin, S.; Mantegna, R. N.; Peng, C. K.; Simons, M.; Stanley, H. E.

1994-01-01

Recently, it was observed that noncoding regions of DNA sequences possess long-range power-law correlations, whereas coding regions typically display only short-range correlations. We develop an algorithm based on this finding that enables investigators to perform a statistical analysis on long DNA sequences to locate possible coding regions. The algorithm is particularly successful in predicting the location of lengthy coding regions. For example, for the complete genome of yeast chromosome III (315,344 nucleotides), at least 82% of the predictions correspond to putative coding regions; the algorithm correctly identified all coding regions larger than 3000 nucleotides, 92% of coding regions between 2000 and 3000 nucleotides long, and 79% of coding regions between 1000 and 2000 nucleotides. The predictive ability of this new algorithm supports the claim that there is a fundamental difference in the correlation property between coding and noncoding sequences. This algorithm, which is not species-dependent, can be implemented with other techniques for rapidly and accurately locating relatively long coding regions in genomic sequences.

Precise detection of de novo single nucleotide variants in human genomes.

PubMed

Gómez-Romero, Laura; Palacios-Flores, Kim; Reyes, José; García, Delfino; Boege, Margareta; Dávila, Guillermo; Flores, Margarita; Schatz, Michael C; Palacios, Rafael

2018-05-22

The precise determination of de novo genetic variants has enormous implications across different fields of biology and medicine, particularly personalized medicine. Currently, de novo variations are identified by mapping sample reads from a parent-offspring trio to a reference genome, allowing for a certain degree of differences. While widely used, this approach often introduces false-positive (FP) results due to misaligned reads and mischaracterized sequencing errors. In a previous study, we developed an alternative approach to accurately identify single nucleotide variants (SNVs) using only perfect matches. However, this approach could be applied only to haploid regions of the genome and was computationally intensive. In this study, we present a unique approach, coverage-based single nucleotide variant identification (COBASI), which allows the exploration of the entire genome using second-generation short sequence reads without extensive computing requirements. COBASI identifies SNVs using changes in coverage of exactly matching unique substrings, and is particularly suited for pinpointing de novo SNVs. Unlike other approaches that require population frequencies across hundreds of samples to filter out any methodological biases, COBASI can be applied to detect de novo SNVs within isolated families. We demonstrate this capability through extensive simulation studies and by studying a parent-offspring trio we sequenced using short reads. Experimental validation of all 58 candidate de novo SNVs and a selection of non-de novo SNVs found in the trio confirmed zero FP calls. COBASI is available as open source at https://github.com/Laura-Gomez/COBASI for any researcher to use. Copyright © 2018 the Author(s). Published by PNAS.

HIV Sequence Compendium 2015

DOE Office of Scientific and Technical Information (OSTI.GOV)

Foley, Brian Thomas; Leitner, Thomas Kenneth; Apetrei, Cristian

This compendium is an annual printed summary of the data contained in the HIV sequence database. We try to present a judicious selection of the data in such a way that it is of maximum utility to HIV researchers. Each of the alignments attempts to display the genetic variability within the different species, groups and subtypes of the virus. This compendium contains sequences published before January 1, 2015. Hence, though it is published in 2015 and called the 2015 Compendium, its contents correspond to the 2014 curated alignments on our website. The number of sequences in the HIV database ismore » still increasing. In total, at the end of 2014, there were 624,121 sequences in the HIV Sequence Database, an increase of 7% since the previous year. This is the first year that the number of new sequences added to the database has decreased compared to the previous year. The number of near complete genomes (>7000 nucleotides) increased to 5834 by end of 2014. However, as in previous years, the compendium alignments contain only a fraction of these. A more complete version of all alignments is available on our website, http://www.hiv.lanl.gov/ content/sequence/NEWALIGN/align.html As always, we are open to complaints and suggestions for improvement. Inquiries and comments regarding the compendium should be addressed to seq-info@lanl.gov.« less

Porcine insulin receptor substrate 4 (IRS4) gene: cloning, polymorphism and association study

USDA-ARS?s Scientific Manuscript database

Using PCR and IPCR techniques we obtained a 4498 bp nucleotide sequence FN424076 encompassing the complete coding sequence of the porcine IRS4 gene and its proximal promoter. The 1269-amino acid porcine protein deduced from the nucleotide sequence shares 92% identity with the human IRS4 and possesse...

The nucleotide sequence of 5S ribosomal RNA from Micrococcus lysodeikticus.

PubMed Central

Hori, H; Osawa, S; Murao, K; Ishikura, H

1980-01-01

The nucleotide sequence of ribosomal 5S RNA from Micrococcus lysodeikticus is pGUUACGGCGGCUAUAGCGUGGGGGAAACGCCCGGCCGUAUAUCGAACCCGGAAGCUAAGCCCCAUAGCGCCGAUGGUUACUGUAACCGGGAGGUUGUGGGAGAGUAGGUCGCCGCCGUGAOH. When compared to other 5S RNAs, the sequence homology is greatest with Thermus aquaticus, and these two 5S RNAs reveal several features intermediate between those of typical gram-positive bacteria and gram-negative bacteria. PMID:6780979

Evaluation of the reliability of maize reference assays for GMO quantification.

PubMed

Papazova, Nina; Zhang, David; Gruden, Kristina; Vojvoda, Jana; Yang, Litao; Buh Gasparic, Meti; Blejec, Andrej; Fouilloux, Stephane; De Loose, Marc; Taverniers, Isabel

2010-03-01

A reliable PCR reference assay for relative genetically modified organism (GMO) quantification must be specific for the target taxon and amplify uniformly along the commercialised varieties within the considered taxon. Different reference assays for maize (Zea mays L.) are used in official methods for GMO quantification. In this study, we evaluated the reliability of eight existing maize reference assays, four of which are used in combination with an event-specific polymerase chain reaction (PCR) assay validated and published by the Community Reference Laboratory (CRL). We analysed the nucleotide sequence variation in the target genomic regions in a broad range of transgenic and conventional varieties and lines: MON 810 varieties cultivated in Spain and conventional varieties from various geographical origins and breeding history. In addition, the reliability of the assays was evaluated based on their PCR amplification performance. A single base pair substitution, corresponding to a single nucleotide polymorphism (SNP) reported in an earlier study, was observed in the forward primer of one of the studied alcohol dehydrogenase 1 (Adh1) (70) assays in a large number of varieties. The SNP presence is consistent with a poor PCR performance observed for this assay along the tested varieties. The obtained data show that the Adh1 (70) assay used in the official CRL NK603 assay is unreliable. Based on our results from both the nucleotide stability study and the PCR performance test, we can conclude that the Adh1 (136) reference assay (T25 and Bt11 assays) as well as the tested high mobility group protein gene assay, which also form parts of CRL methods for quantification, are highly reliable. Despite the observed uniformity in the nucleotide sequence of the invertase gene assay, the PCR performance test reveals that this target sequence might occur in more than one copy. Finally, although currently not forming a part of official quantification methods, zein and SSIIb assays are found to be highly reliable in terms of nucleotide stability and PCR performance and are proposed as good alternative targets for a reference assay for maize.

Draft genome sequence of Cicer reticulatum L., the wild progenitor of chickpea provides a resource for agronomic trait improvement.

PubMed

Gupta, Sonal; Nawaz, Kashif; Parween, Sabiha; Roy, Riti; Sahu, Kamlesh; Kumar Pole, Anil; Khandal, Hitaishi; Srivastava, Rishi; Kumar Parida, Swarup; Chattopadhyay, Debasis

2017-02-01

Cicer reticulatum L. is the wild progenitor of the fourth most important legume crop chickpea (C. arietinum L.). We assembled short-read sequences into 416 Mb draft genome of C. reticulatum and anchored 78% (327 Mb) of this assembly to eight linkage groups. Genome annotation predicted 25,680 protein-coding genes covering more than 90% of predicted gene space. The genome assembly shared a substantial synteny and conservation of gene orders with the genome of the model legume Medicago truncatula. Resistance gene homologs of wild and domesticated chickpeas showed high sequence homology and conserved synteny. Comparison of gene sequences and nucleotide diversity using 66 wild and domesticated chickpea accessions suggested that the desi type chickpea was genetically closer to the wild species than the kabuli type. Comparative analyses predicted gene flow between the wild and the cultivated species during domestication. Molecular diversity and population genetic structure determination using 15,096 genome-wide single nucleotide polymorphisms revealed an admixed domestication pattern among cultivated (desi and kabuli) and wild chickpea accessions belonging to three population groups reflecting significant influence of parentage or geographical origin for their cultivar-specific population classification. The assembly and the polymorphic sequence resources presented here would facilitate the study of chickpea domestication and targeted use of wild Cicer germplasms for agronomic trait improvement in chickpea. © The Author 2016. Published by Oxford University Press on behalf of Kazusa DNA Research Institute.

Optimization of subculture and DNA extraction steps within the whole genome sequencing workflow for source tracking of Salmonella enterica and Listeria monocytogenes.

PubMed

Gimonet, Johan; Portmann, Anne-Catherine; Fournier, Coralie; Baert, Leen

2018-06-16

This work shows that an incubation time reduced to 4-5 h to prepare a culture for DNA extraction followed by an automated DNA extraction can shorten the hands-on time, the turnaround time by 30% and increase the throughput while maintaining the WGS quality assessed by high quality Single Nucleotide Polymorphism analysis. Copyright © 2018. Published by Elsevier B.V.

Regions of conservation and divergence in the 3' untranslated sequences of genomic RNA from Ross River virus isolates.

PubMed

Faragher, S G; Dalgarno, L

1986-07-20

The 3' untranslated (UT) sequences of the genomic RNAs of five geographic variants of the alphavirus Ross River virus (RRV) were determined and compared with the 3' UT sequence of RRV T48, the prototype strain. Part of the 3' UT region of Getah virus, a close serological relative of RRV, was also sequenced. The RRV 3' UT region varies markedly in length between variants. Large deletions or insertions, sequence rearrangements and single nucleotide substitutions are observed. A sequence tract of 49 to 58 nucleotides, which is repeated as four blocks in the RRV T48 3' UT region, occurs only once in the 3' UT region of one RRV strain (NB5092), indicating that the existence of repeat sequence blocks is not essential for RRV replication. However, the precise sequence of the 3' proximal copy of the repeat block and its position relative to the poly(A) tail were identical in all RRV isolates examined, suggesting that it has an important role in RRV replication. Nucleotide substitutions between RRV variants are distributed non-randomly along the length of the 3' UT region. The sequence of 120 to 130 nucleotides adjacent to the poly(A) tail is strongly conserved. Getah virus RNA contains three repeat sequence blocks in the 3' UT region. These are similar in sequence to those in RRV RNA but differ in their arrangement. Homology between the RRV and Getah 3' UT sequences is greatest in the 3' proximal repeat sequence block that shows three differences in 49 nucleotides. The 3' proximal repeat in Getah RNA occurs at the same position, relative to the poly(A) tail, as in all RRV variants. The RRV and Getah virus 3' UT sequences show extensive homology in the region between the 3' proximal repeat and the poly(A) tail but, apart from the repeat blocks themselves, they show no significant homology elsewhere.

Development of a single-tube loop-mediated isothermal amplification assay for detection of four pathogens of bacterial meningitis.

PubMed

Huy, Nguyen Tien; Hang, Le Thi Thuy; Boamah, Daniel; Lan, Nguyen Thi Phuong; Van Thanh, Phan; Watanabe, Kiwao; Huong, Vu Thi Thu; Kikuchi, Mihoko; Ariyoshi, Koya; Morita, Kouichi; Hirayama, Kenji

2012-12-01

Several loop-mediated isothermal amplification (LAMP) assays have been developed to detect common causative pathogens of bacterial meningitis (BM). However, no LAMP assay is reported to detect Streptococcus agalactiae and Streptococcus suis, which are also among common pathogens of BM. Moreover, it is laborious and expensive by performing multiple reactions for each sample to detect bacterial pathogen. Thus, we aimed to design and develop a single-tube LAMP assay capable of detecting multiple bacterial species, based on the nucleotide sequences of the 16S rRNA genes of the bacteria. The nucleotide sequences of the 16S rRNA genes of main pathogens involved in BM were aligned to identify conserved regions, which were further used to design broad range specific LAMP assay primers. We successfully designed a set of broad range specific LAMP assay primers for simultaneous detection of four species including Staphylococcus aureus, Streptococcus pneumoniae, S. suis and S. agalactiae. The broad range LAMP assay was highly specific without cross-reactivity with other bacteria including Haemophilus influenzae, Neisseria meningitidis and Escherichia coli. The sensitivity of our LAMP assay was 100-1000 times higher compared with the conventional PCR assay. The bacterial species could be identified after digestion of the LAMP products with restriction endonuclease DdeI and HaeIII. © 2012 Federation of European Microbiological Societies. Published by Blackwell Publishing Ltd. All rights reserved.

Update on Pneumocystis carinii f. sp. hominis Typing Based on Nucleotide Sequence Variations in Internal Transcribed Spacer Regions of rRNA Genes

PubMed Central

Lee, Chao-Hung; Helweg-Larsen, Jannik; Tang, Xing; Jin, Shaoling; Li, Baozheng; Bartlett, Marilyn S.; Lu, Jang-Jih; Lundgren, Bettina; Lundgren, Jens D.; Olsson, Mats; Lucas, Sebastian B.; Roux, Patricia; Cargnel, Antonietta; Atzori, Chiara; Matos, Olga; Smith, James W.

1998-01-01

Pneumocystis carinii f. sp. hominis isolates from 207 clinical specimens from nine countries were typed based on nucleotide sequence variations in the internal transcribed spacer regions I and II (ITS1 and ITS2, respectively) of rRNA genes. The number of ITS1 nucleotides has been revised from the previously reported 157 bp to 161 bp. Likewise, the number of ITS2 nucleotides has been changed from 177 to 192 bp. The number of ITS1 sequence types has increased from 2 to 15, and that of ITS2 has increased from 3 to 14. The 15 ITS1 sequence types are designated types A through O, and the 14 ITS2 types are named types a through n. A total of 59 types of P. carinii f. sp. hominis were found in this study. PMID:9508304

Nucleotide Sequence Diversity and Linkage Disequilibrium of Four Nuclear Loci in Foxtail Millet (Setaria italica).

PubMed

He, Shui-Lian; Yang, Yang; Morrell, Peter L; Yi, Ting-Shuang

2015-01-01

Foxtail millet (Setaria italica (L.) Beauv) is one of the earliest domesticated grains, which has been cultivated in northern China by 8,700 years before present (YBP) and across Eurasia by 4,000 YBP. Owing to a small genome and diploid nature, foxtail millet is a tractable model crop for studying functional genomics of millets and bioenergy grasses. In this study, we examined nucleotide sequence diversity, geographic structure, and levels of linkage disequilibrium at four nuclear loci (ADH1, G3PDH, IGS1 and TPI1) in representative samples of 311 landrace accessions across its cultivated range. Higher levels of nucleotide sequence and haplotype diversity were observed in samples from China relative to other sampled regions. Genetic assignment analysis classified the accessions into seven clusters based on nucleotide sequence polymorphisms. Intralocus LD decayed rapidly to half the initial value within ~1.2 kb or less.

Complete genomic sequence of Powassan virus: evaluation of genetic elements in tick-borne versus mosquito-borne flaviviruses.

PubMed

Mandl, C W; Holzmann, H; Kunz, C; Heinz, F X

1993-05-01

The complete nucleotide sequence of the positive-stranded RNA genome of the tick-borne flavivirus Powassan (10,839 nucleotides) was elucidated and the amino acid sequence of all viral proteins was derived. Based on this sequence as well as serological data, Powassan virus represents the most divergent member of the tick-borne serocomplex within the genus flaviviruses, family Flaviviridae. The primary nucleotide sequence and potential RNA secondary structures of the Powassan virus genome as well as the protein sequences and the reactivities of the virion with a panel of monoclonal antibodies were compared to other tick-borne and mosquito-borne flaviviruses. These analyses corroborated significant differences between tick-borne and mosquito-borne flaviviruses, but also emphasized structural elements that are conserved among both vector groups. The comparisons among tick-borne flaviviruses revealed conserved sequence elements that might represent important determinants of the tick-borne flavivirus phenotype.

Detection of a divergent variant of grapevine virus F by next-generation sequencing.

PubMed

Molenaar, Nicholas; Burger, Johan T; Maree, Hans J

2015-08-01

The complete genome sequence of a South African isolate of grapevine virus F (GVF) is presented. It was first detected by metagenomic next-generation sequencing of field samples and validated through direct Sanger sequencing. The genome sequence of GVF isolate V5 consists of 7539 nucleotides and contains a poly(A) tail. It has a typical vitivirus genome arrangement that comprises five open reading frames (ORFs), which share only 88.96 % nucleotide sequence identity with the existing complete GVF genome sequence (JX105428).

Characterization of the Campylobacter jejuni cryptic plasmid pTIW94 recovered from wild birds in the southeastern United States.

PubMed

Hiett, Kelli L; Rothrock, Michael J; Seal, Bruce S

2013-09-01

The complete nucleotide sequence was determined for a cryptic plasmid, pTIW94, recovered from several Campylobacter jejuni isolates from wild birds in the southeastern United States. pTIW94 is a circular molecule of 3860 nucleotides, with a G+C content (31.0%) similar to that of many Campylobacter spp. genomes. A typical origin of replication, with iteron sequences, was identified upstream of DNA sequences that demonstrated similarity to replication initiation proteins. A total of five open reading frames (ORFs) were identified; two of the five ORFs demonstrated significant similarity to plasmid pCC2228-2 found within Campylobacter coli. These two ORFs were similar to essential replication proteins RepA (100%; 26/26 aa identity) and RepB (95%; 327/346 aa identity). A third identified ORF demonstrated significant similarity (99%; 421/424 aa identity) to the MOB protein from C. coli 67-8, originally recovered from swine. The other two identified ORFs were either similar to hypothetical proteins from other Campylobacter spp., or exhibited no significant similarity to any DNA or protein sequence in the GenBank database. Promoter regions (-35 and -10 signal sites), ribosomal binding sites upstream of ORFs, and stem-loop structures were also identified within the plasmid. These results demonstrate that pTIW94 represents a previously un-reported small cryptic plasmid with unique sequences as well as highly similar sequences to other small plasmids found within Campylobacter spp., and that this cryptic plasmid is present among Campylobacter spp. recovered from different genera of wild birds. Copyright © 2013. Published by Elsevier Inc.

Duplicates, redundancies and inconsistencies in the primary nucleotide databases: a descriptive study.

PubMed

Chen, Qingyu; Zobel, Justin; Verspoor, Karin

2017-01-01

GenBank, the EMBL European Nucleotide Archive and the DNA DataBank of Japan, known collectively as the International Nucleotide Sequence Database Collaboration or INSDC, are the three most significant nucleotide sequence databases. Their records are derived from laboratory work undertaken by different individuals, by different teams, with a range of technologies and assumptions and over a period of decades. As a consequence, they contain a great many duplicates, redundancies and inconsistencies, but neither the prevalence nor the characteristics of various types of duplicates have been rigorously assessed. Existing duplicate detection methods in bioinformatics only address specific duplicate types, with inconsistent assumptions; and the impact of duplicates in bioinformatics databases has not been carefully assessed, making it difficult to judge the value of such methods. Our goal is to assess the scale, kinds and impact of duplicates in bioinformatics databases, through a retrospective analysis of merged groups in INSDC databases. Our outcomes are threefold: (1) We analyse a benchmark dataset consisting of duplicates manually identified in INSDC-a dataset of 67 888 merged groups with 111 823 duplicate pairs across 21 organisms from INSDC databases - in terms of the prevalence, types and impacts of duplicates. (2) We categorize duplicates at both sequence and annotation level, with supporting quantitative statistics, showing that different organisms have different prevalence of distinct kinds of duplicate. (3) We show that the presence of duplicates has practical impact via a simple case study on duplicates, in terms of GC content and melting temperature. We demonstrate that duplicates not only introduce redundancy, but can lead to inconsistent results for certain tasks. Our findings lead to a better understanding of the problem of duplication in biological databases.Database URL: the merged records are available at https://cloudstor.aarnet.edu.au/plus/index.php/s/Xef2fvsebBEAv9w. © The Author(s) 2017. Published by Oxford University Press.

Equalizer reduces SNP bias in Affymetrix microarrays.

PubMed

Quigley, David

2015-07-30

Gene expression microarrays measure the levels of messenger ribonucleic acid (mRNA) in a sample using probe sequences that hybridize with transcribed regions. These probe sequences are designed using a reference genome for the relevant species. However, most model organisms and all humans have genomes that deviate from their reference. These variations, which include single nucleotide polymorphisms, insertions of additional nucleotides, and nucleotide deletions, can affect the microarray's performance. Genetic experiments comparing individuals bearing different population-associated single nucleotide polymorphisms that intersect microarray probes are therefore subject to systemic bias, as the reduction in binding efficiency due to a technical artifact is confounded with genetic differences between parental strains. This problem has been recognized for some time, and earlier methods of compensation have attempted to identify probes affected by genome variants using statistical models. These methods may require replicate microarray measurement of gene expression in the relevant tissue in inbred parental samples, which are not always available in model organisms and are never available in humans. By using sequence information for the genomes of organisms under investigation, potentially problematic probes can now be identified a priori. However, there is no published software tool that makes it easy to eliminate these probes from an annotation. I present equalizer, a software package that uses genome variant data to modify annotation files for the commonly used Affymetrix IVT and Gene/Exon platforms. These files can be used by any microarray normalization method for subsequent analysis. I demonstrate how use of equalizer on experiments mapping germline influence on gene expression in a genetic cross between two divergent mouse species and in human samples significantly reduces probe hybridization-induced bias, reducing false positive and false negative findings. The equalizer package reduces probe hybridization bias from experiments performed on the Affymetrix microarray platform, allowing accurate assessment of germline influence on gene expression.

Application of Genotyping during an Extensive Outbreak of Waterborne Giardiasis in Bergen, Norway, during Autumn and Winter 2004†

PubMed Central

Robertson, L. J.; Hermansen, L.; Gjerde, B. K.; Strand, E.; Alvsvåg, J. O.; Langeland, N.

2006-01-01

During the autumn and winter of 2004 and 2005, an extensive outbreak of waterborne giardiasis occurred in Bergen, Norway. Over 1,500 patients were diagnosed with giardiasis. Analysis of water from the implicated source revealed low numbers of Giardia cysts, but the initial contamination event probably occurred up to 10 weeks previously. While sewage leakage from a residential area is now considered to be the probable source of contamination, during the episode waste from one particular septic tank was thought to be a possible source. Genotyping of cysts from the septic tank demonstrated that they were assemblage A cysts, although the sequences were not identical to any previously published sequences. For the β-giardin gene, the closest published subgenotype was subgenotype A3; for the gdh gene, the closest published subgenotype was subgenotype A2. Genotyping of cysts from 21 patient samples revealed that they were assemblage B cysts; thus, the septic tank was unlikely to be the contamination source. Sequencing of the β-giardin and gdh genes from patient samples and a comparison of the sequences gave complex results. For the β-giardin gene, three isolates had sequences identical to subgenotype B3 sequences. However, other isolates had between one and four single-nucleotide polymorphisms (SNPs). For the gdh gene, none of the sequences were identical to the sequence published for subgenotype B3, and the sequences had between one and three SNPs. One isolate, which was identical to subgenotype B3 at the β-giardin gene, was more similar to subgenotype B2 at the gdh gene. Grouping the isolates on the basis of SNPs resulted in different groups for the two genes. The results are discussed in relation to giardiasis in Norway and to other Giardia genotyping studies. PMID:16517674

Development of Prevotella intermedia-specific PCR primers based on the nucleotide sequences of a DNA probe Pig27.

PubMed

Kim, Min Jung; Hwang, Kyung Hwan; Lee, Young-Seok; Park, Jae-Yoon; Kook, Joong-Ki

2011-03-01

The aim of this study was to develop Prevotella intermedia-specific PCR primers based on the P. intermedia-specific DNA probe. The P. intermedia-specific DNA probe was screened by inverted dot blot hybridization and confirmed by Southern blot hybridization. The nucleotide sequences of the species-specific DNA probes were determined using a chain termination method. Southern blot analysis showed that the DNA probe, Pig27, detected only the genomic DNA of P. intermedia strains. PCR showed that the PCR primers, Pin-F1/Pin-R1, had species-specificity for P. intermedia. The detection limits of the PCR primer sets were 0.4pg of the purified genomic DNA of P. intermedia ATCC 49046. These results suggest that the PCR primers, Pin-F1/Pin-R1, could be useful in the detection of P. intermedia as well as in the development of a PCR kit in epidemiological studies related to periodontal diseases. Crown Copyright © 2010. Published by Elsevier B.V. All rights reserved.

Novel alpha-galactosidase A mutation in a female with recurrent strokes.

PubMed

Tuttolomondo, Antonino; Duro, Giovanni; Miceli, Salvatore; Di Raimondo, Domenico; Pecoraro, Rosaria; Serio, Antonia; Albeggiani, Giuseppe; Nuzzo, Domenico; Iemolo, Francesco; Pizzo, Federica; Sciarrino, Serafina; Licata, Giuseppe; Pinto, Antonio

2012-11-01

Anderson-Fabry disease (AFD) is an X-linked inborn error of glycosphingolipid catabolism resulting from the deficient activity of the lysosomal exoglycohydrolase, a-galactosidase A. The complete genomic and cDNA sequences of the human alpha-galactosidase A gene have been determined and to date, several disease-causing alpha-galactosidase A mutations have been identified, including missense mutations, small deletions/insertions, splice mutations, and large gene rearrangements We report a case of a 56-year-old woman with recurrent cryptogenic strokes. Ophthalmological examination revealed whorled opacities of the cornea (cornea verticillata) and dilated tortuous conjunctival vessels. She did not show other typical signs of Fabry disease such as acroparesthesias and angiokeratoma. The patient's alpha-galactosidase A activity was 4.13 nmol/mL/h in whole blood. Alpha-galactosidase A gene sequence analysis revealed a heterozygous single nucleotide point mutation at nucleotide c.550T>A in exon 4 in this woman, leading to the p.Tyr184Asn amino acid substitution. Copyright © 2012 The Canadian Society of Clinical Chemists. Published by Elsevier Inc. All rights reserved.

Nucleotide sequence composition and method for detection of neisseria gonorrhoeae

DOE Office of Scientific and Technical Information (OSTI.GOV)

Lo, A.; Yang, H.L.

1990-02-13

This patent describes a composition of matter that is specific for {ital Neisseria gonorrhoeae}. It comprises: at least one nucleotide sequence for which the ratio of the amount of the sequence which hybridizes to chromosomal DNA of {ital Neisseria gonorrhoeae} to the amount of the sequence which hybridizes to chromosomal DNA of {ital Neisseria meningitidis} is greater than about five. The ratio being obtained by a method described.

Mapping allosteric connections from the receptor to the nucleotide-binding pocket of heterotrimeric G proteins

PubMed Central

Oldham, William M.; Van Eps, Ned; Preininger, Anita M.; Hubbell, Wayne L.; Hamm, Heidi E.

2007-01-01

Heterotrimeric G proteins function as molecular relays that mediate signal transduction from heptahelical receptors in the cell membrane to intracellular effector proteins. Crystallographic studies have demonstrated that guanine nucleotide exchange on the Gα subunit causes specific conformational changes in three key “switch” regions of the protein, which regulate binding to Gβγ subunits, receptors, and effector proteins. In the present study, nitroxide side chains were introduced at sites within the switch I region of Gαi to explore the structure and dynamics of this region throughout the G protein cycle. EPR spectra obtained for each of the Gα(GDP), Gα(GDP)βγ heterotrimer and Gα(GTPγS) conformations are consistent with the local environment observed in the corresponding crystal structures. Binding of the heterotrimer to activated rhodopsin to form the nucleotide-free (empty) complex, for which there is no crystal structure, causes prominent changes relative to the heterotrimer in the structure of switch I and contiguous sequences. The data identify a putative pathway of allosteric changes triggered by receptor binding and, together with previously published data, suggest elements of a mechanism for receptor-catalyzed nucleotide exchange. PMID:17463080

Whole exome sequencing to estimate alloreactivity potential between donors and recipients in stem cell transplantation

PubMed Central

Sampson, Juliana K.; Sheth, Nihar U.; Koparde, Vishal N.; Scalora, Allison F.; Serrano, Myrna G.; Lee, Vladimir; Roberts, Catherine H.; Jameson-Lee, Max; Ferreira-Gonzalez, Andrea; Manjili, Masoud H.; Buck, Gregory A.; Neale, Michael C.; Toor, Amir A.

2016-01-01

Summary Whole exome sequencing (WES) was performed on stem cell transplant donor-recipient (D-R) pairs to determine the extent of potential antigenic variation at a molecular level. In a small cohort of D-R pairs, a high frequency of sequence variation was observed between the donor and recipient exomes independent of human leucocyte antigen (HLA) matching. Nonsynonymous, nonconservative single nucleotide polymorphisms were approximately twice as frequent in HLA-matched unrelated, compared with related D-R pairs. When mapped to individual chromosomes, these polymorphic nucleotides were uniformly distributed across the entire exome. In conclusion, WES reveals extensive nucleotide sequence variation in the exomes of HLA-matched donors and recipients. PMID:24749631

The nucleotide sequences of 5S rRNAs from a fern Dryopteris acuminata and a horsetail Equisetum arvense.

PubMed Central

Hori, H; Osawa, S; Takaiwa, F; Sugiura, M

1984-01-01

The nucleotide sequences from two Pteridophyta species, a fern Dryopteris acuminata and a horsetail Equisetum arvense have been determined. These two sequences are more related to those of the Bryophyta species (88% identity on average) than to those of seed plants (84% identity on average). PMID:6538332

Energy efficiency trade-offs drive nucleotide usage in transcribed regions

PubMed Central

Chen, Wei-Hua; Lu, Guanting; Bork, Peer; Hu, Songnian; Lercher, Martin J.

2016-01-01

Efficient nutrient usage is a trait under universal selection. A substantial part of cellular resources is spent on making nucleotides. We thus expect preferential use of cheaper nucleotides especially in transcribed sequences, which are often amplified thousand-fold compared with genomic sequences. To test this hypothesis, we derive a mutation-selection-drift equilibrium model for nucleotide skews (strand-specific usage of ‘A' versus ‘T' and ‘G' versus ‘C'), which explains nucleotide skews across 1,550 prokaryotic genomes as a consequence of selection on efficient resource usage. Transcription-related selection generally favours the cheaper nucleotides ‘U' and ‘C' at synonymous sites. However, the information encoded in mRNA is further amplified through translation. Due to unexpected trade-offs in the codon table, cheaper nucleotides encode on average energetically more expensive amino acids. These trade-offs apply to both strand-specific nucleotide usage and GC content, causing a universal bias towards the more expensive nucleotides ‘A' and ‘G' at non-synonymous coding sites. PMID:27098217

Phylogenetic relations of humans and African apes from DNA sequences in the Psi eta-globin region

DOE Office of Scientific and Technical Information (OSTI.GOV)

Miyamoto, M.M.; Slightom, J.L.; Goodman, M.

Sequences from the upstream and downstream flanking DNA regions of the Psi eta-globin locus in Pan troglodytes (common chimpanzee), Gorilla gorilla (gorilla), and Pongo pygmaeus (orangutan, the closest living relative to Homo, Pan, and Gorilla) provided further data for evaluating the phylogenetic relations of humans and African apes. These newly sequenced orthologs (an additional 4.9 kilobase pairs (kbp) for each species) were combined with published Psi eta-gene sequences and then compared to the same orthologous stretch (a continuous 7.1-kbp region) available for humans. Phylogenetic analysis of these nucleotide sequences by the parsimony method indicated (i) that human and chimpanzee aremore » more closely related to each other than either is to gorilla and (ii) that the slowdown in the rate of sequence evolution evident in higher primates is especially pronounced in humans. These results indicate that features unique to African apes (but not to humans) are primitive and that even local molecular clocks should be applied with caution.« less

Detection of possible restriction sites for type II restriction enzymes in DNA sequences.

PubMed

Gagniuc, P; Cimponeriu, D; Ionescu-Tîrgovişte, C; Mihai, Andrada; Stavarachi, Monica; Mihai, T; Gavrilă, L

2011-01-01

In order to make a step forward in the knowledge of the mechanism operating in complex polygenic disorders such as diabetes and obesity, this paper proposes a new algorithm (PRSD -possible restriction site detection) and its implementation in Applied Genetics software. This software can be used for in silico detection of potential (hidden) recognition sites for endonucleases and for nucleotide repeats identification. The recognition sites for endonucleases may result from hidden sequences through deletion or insertion of a specific number of nucleotides. Tests were conducted on DNA sequences downloaded from NCBI servers using specific recognition sites for common type II restriction enzymes introduced in the software database (n = 126). Each possible recognition site indicated by the PRSD algorithm implemented in Applied Genetics was checked and confirmed by NEBcutter V2.0 and Webcutter 2.0 software. In the sequence NG_008724.1 (which includes 63632 nucleotides) we found a high number of potential restriction sites for ECO R1 that may be produced by deletion (n = 43 sites) or insertion (n = 591 sites) of one nucleotide. The second module of Applied Genetics has been designed to find simple repeats sizes with a real future in understanding the role of SNPs (Single Nucleotide Polymorphisms) in the pathogenesis of the complex metabolic disorders. We have tested the presence of simple repetitive sequences in five DNA sequence. The software indicated exact position of each repeats detected in the tested sequences. Future development of Applied Genetics can provide an alternative for powerful tools used to search for restriction sites or repetitive sequences or to improve genotyping methods.

Information Entropy of Influenza A Segment 7

NASA Astrophysics Data System (ADS)

Thompson, William A.; Fan, Shaohua; Weltman, Joel K.

2008-12-01

Information entropy (H) is a measure of uncertainty at each position within in a sequence of nucleotides.H was used to characterize a set of influenza A segment 7 nucleotide sequences. Nucleotide locations of high entropy were identified near the 5’ start of all of the sequences and the sequences were assigned to subsets according to synonymous nucleotide variants at those positions: either uracil at position six (U6), cytosine at position six (C6), adenine (A12) at position 12, guanine at position 12 (G12), adenine at position 15 (A15) or cytosine (C15) at position 15. H values were found to be correlated/corresponding (Kendall tau) along the lengths of the nucleotide segments of the subset pairs at each position. However, the H values of each subset of sequences were statistically distinguishable from those of the other member of the pair (Kolmogorov-Smirnov test). The joint probability of uncorrelated distributions of U6 and C6 sequences to viral subtypes and to viral host species was 34 times greater than for the A12:G12 subset pair and 214 times greater than for the A15:C15 pair. This result indicates that the high entropy position six of segment 7 is either a reporter or a sentinel location. The fact that not one of the H5N1 sequences in the dataset was a member of the C6 subset, but all 125 H5N1 sequences are members of the U6 subset suggests a non-random sentinel function.

Occurrence and genetic diversity of the Plasmopara halstedii virus in sunflower downy mildew populations of the world.

PubMed

Grasse, Wolfgang; Spring, Otmar

2015-03-01

Plasmopara halstedii virus (PhV) is a ss(+)RNA virus that exclusively occurs in the sunflower downy mildew pathogen Plasmopara halstedii, a biotrophic oomycete of severe economic impact. The virus origin and its genomic variability are unknown. A PCR-based screening of 128 samples of P. halstedii from five continents and up to 40 y old was conducted. PhV RNA was found in over 90 % of the isolates with no correlation to geographic origin or pathotype of its host. Sequence analyses of the two open reading frames (ORFs) revealed only 18 single nucleotide polymorphisms (SNPs) in 3873 nucleotides. The SNPs had no recognizable effect on the two encoded virus proteins. In 398 nucleotides of the untranslated regions (UTRs) of the RNA 2 strand eight additional SNPs and one short deletion was found. Modelling experiments revealed no effects of these variations on the secondary structure of the RNA. The results showed the presence of PhV in P. halstedii isolates of global origin and the existence of the virus since more than 40 y. The virus genome revealed a surprisingly low variation in both coding and noncoding parts. No sequence differences were correlated with host pathotype or geographic populations of the oomycete. Copyright © 2014 The British Mycological Society. Published by Elsevier Ltd. All rights reserved.

PUTATIVE GENE PROMOTER SEQUENCES IN THE CHLORELLA VIRUSES

PubMed Central

Fitzgerald, Lisa A.; Boucher, Philip T.; Yanai-Balser, Giane; Suhre, Karsten; Graves, Michael V.; Van Etten, James L.

2008-01-01

Three short (7 to 9 nucleotides) highly conserved nucleotide sequences were identified in the putative promoter regions (150 bp upstream and 50 bp downstream of the ATG translation start site) of three members of the genus Chlorovirus, family Phycodnaviridae. Most of these sequences occurred in similar locations within the defined promoter regions. The sequence and location of the motifs were often conserved among homologous ORFs within the Chlorovirus family. One of these conserved sequences (AATGACA) is predominately associated with genes expressed early in virus replication. PMID:18768195

The complete sequence of Cymbidium mosaic virus from Vanilla fragrans in Hainan, China.

PubMed

He, Zhen; Jiang, Dongmei; Liu, Aiqin; Sang, Liwei; Li, Wenfeng; Li, Shifang

2011-06-01

The complete nucleotide sequence of Cymbidium mosaic virus (CymMV) isolated from vanilla in Hainan province, China was determined for the first time. It comprised 6,224 nucleotides; sequence analysis suggested that the isolate we obtained was a member of the genus Potexvirus, and its sequence shared 86.67-96.61% identities with previously reported sequences. Phylogenetic analysis suggested that CymMV from vanilla fragrans was clustered into subgroup A and the isolates in this subgroup displayed little regional difference.

Noninvasive genome sampling in chimpanzees.

PubMed

Kohn, Michael H

2010-12-01

The inevitable has happened: genomic technologies have been added to our noninvasive genetic sampling repertoire. In this issue of Molecular Ecology, Perry et al. (2010) demonstrate how DNA extraction from chimpanzee faeces, followed by a series of steps to enrich for target loci, can be coupled with next-generation sequencing. These authors collected sequence and single-nucleotide polymorphism (SNP) data at more than 600 genomic loci (chromosome 21 and the X) and the complete mitochondrial DNA. By design, each locus was 'deep sequenced' to enable SNP identification. To demonstrate the reliability of their data, the work included samples from six captive chimps, which allowed for a comparison between presumably genuine SNPs obtained from blood and potentially flawed SNPs deduced from faeces. Thus, with this method, anyone with the resources, skills and ambition to do genome sequencing of wild, elusive, or protected mammals can enjoy all of the benefits of noninvasive sampling. © 2010 Blackwell Publishing Ltd.

Molecular Tracing of Hepatitis C Virus Genotype 1 Isolates in Iran: A NS5B Phylogenetic Analysis with Systematic Review.

PubMed

Hesamizadeh, Khashayar; Alavian, Seyed Moayed; Najafi Tireh Shabankareh, Azar; Sharafi, Heidar

2016-12-01

Hepatitis C virus (HCV) is characterized by a high degree of genetic heterogeneity and classified into 7 genotypes and different subtypes. It heterogeneously distributed through various risk groups and geographical regions. A well-established phylogenetic relationship can simplify the tracing of HCV hierarchical strata into geographical regions. The current study aimed to find genetic phylogeny of subtypes 1a and 1b of HCV isolates based on NS5B nucleotide sequences in Iran and other members of Eastern Mediterranean regional office of world health organization, as well as other Middle Eastern countries, with a systematic review of available published and unpublished studies. The phylogenetic analyses were performed based on the nucleotide sequences of NS5B gene of HCV genotype 1 (HCV-1), which were registered in the GenBank database. The literature review was performed in two steps: 1) searching studies evaluating the NS5B sequences of HCV-1, on PubMed, Scopus, and Web of Science, and 2) Searching sequences of unpublished studies registered in the GenBank database. In this study, 442 sequences from HCV-1a and 232 from HCV-1b underwent phylogenetic analysis. Phylogenetic analysis of all sequences revealed different clusters in the phylogenetic trees. The results showed that the proportion of HCV-1a and -1b isolates from Iranian patients probably originated from domestic sources. Moreover, the HCV-1b isolates from Iranian patients may have similarities with the European ones. In this study, phylogenetic reconstruction of HCV-1 sequences clearly indicated for molecular tracing and ancestral relationships of the HCV genotypes in Iran, and showed the likelihood of domestic origin for HCV-1a and various origin for HCV-1b.

Human papillomavirus type 18 variant lineages in United States populations characterized by sequence analysis of LCR-E6, E2, and L1 regions.

PubMed

Arias-Pulido, Hugo; Peyton, Cheri L; Torrez-Martínez, Norah; Anderson, D Nelson; Wheeler, Cosette M

2005-07-20

While HPV 16 variant lineages have been well characterized, the knowledge about HPV 18 variants is limited. In this study, HPV 18 nucleotide variations in the E2 hinge region were characterized by sequence analysis in 47 control and 51 tumor specimens. Fifty of these specimens were randomly selected for sequencing of an LCR-E6 segment and 20 samples representative of LCR-E6 and E2 sequence variants were examined across the L1 region. A total of 2770 nucleotides per HPV 18 variant genome were considered in this study. HPV 18 variant nucleotides were linked among all gene segments analyzed and grouped into three main branches: Asian-American (AA), European (E), and African (Af). These three branches were equally distributed among controls and cases and when stratified by Hispanic and non-Hispanic ethnicities. Among invasive cervical cancer cases, no significant differences in the three HPV variant branches were observed among ethnic groups or when stratified by histopathology (squamous vs. adenocarcinoma). The Af branch showed the greatest nucleotide variability when compared to the HPV 18 reference sequence and was more closely related to HPV 45 than either AA or E branches. Our data also characterize nucleotide and amino acid variations in the L1 capsid gene among HPV 18 variants, which may be relevant to vaccine strategies and subsequent studies of naturally occurring HPV 18 variants. Several novel HPV 18 nucleotide variations were identified in this study.

The repeating nucleotide sequence in the repetitive mitochondrial DNA from a "low-density" petite mutant of yeast.

PubMed Central

Van Kreijl, C F; Bos, J L

1977-01-01

The repeating nucleotide sequence of 68 base pairs in the mtDNA from an ethidium-induced cytoplasmic petite mutant of yeast has been determined. For sequence analysis specifically primed and terminated RNA copies, obtained by in vitro transcription of the separated strands, were use. The sequence consists of 66 consecutive AT base pairs flanked by two GC pairs and comprises nearly all of the mutant mitochondrial genome. The sequence, moreover, also represents the first part of wild-type mtDNA sequence so far. Images PMID:198740

The organization and expression of the mdm2 gene.

PubMed

de Oca Luna, R M; Tabor, A D; Eberspaecher, H; Hulboy, D L; Worth, L L; Colman, M S; Finlay, C A; Lozano, G

1996-05-01

The mdm2 gene encodes a zinc finger protein that negatively regulates p53 function by binding and masking the p53 transcriptional activation domain. Two different promoters control expression of mdm2, one of which is also transactivated by p53. We cloned and characterized the mdm2 gene from a murine 129 library. It contained at least 12 exons and spanned approximately 25 kb of DNA. Sequencing of the mdm2 gene revealed three nucleotide differences that resulted in amino acid substitutions in the previously published mdm2 sequence. Sequencing of normal BalbC/J DNA and the original cosmid clone isolated from the 3T3DM cell line revealed that they are identical, suggesting that the published sequence is in error at these three positions. In addition, we analyzed the expression pattern of mdm2 and found ubiquitous low-level expression throughout embryo development and in adult tissues. Analysis of mRNA from numerous tissues for several mdm2 spliced variants that had been identified in the transformed 3T3DM cell line revealed that these variants could not be detected in the developing embryo or in adult tissues.

Ray Wu as Fifth Business: Deconstructing collective memory in the history of DNA sequencing.

PubMed

Onaga, Lisa A

2014-06-01

The concept of 'Fifth Business' is used to analyze a minority standpoint and bring serious attention to the role of scientists who play a galvanizing role in a science but for multiple reasons appear less prominently in more common recounts of any particular development. Biochemist Ray Wu (1928-2008) published a DNA sequencing experiment in March 1970 using DNA polymerase catalysis and specific nucleotide labeling, both of which are foundational to general sequencing methods today. The scant mention of Wu's work from textbooks, research articles, and other accounts of DNA sequencing calls into question how scientific collective memory forms. This alternative history seeks to understand why a key figure in nucleic acid sequence analysis has remained less visibly connected or peripheral to solidifying narratives about the history of DNA sequencing. The study resists predictable dismissals of Wu's work in order to seriously examine the formation of his nucleic acid sequence analysis research program and how he shared his knowledge of sequencing during a period of rapid advancement in the field. An analysis of Wu's work on sequencing the cohesive ends of lambda bacteriophage in the 1960s and 1970s exemplifies how a variety of individuals and groups attempted to develop protocol for sequencing the order of nucleotide base pairs comprising DNA. This historical examination of the sociality of scientific research suggests a way to understand how Wu and others contributed to the very collective memory of DNA sequencing that Wu eventually tried to repair. The study of Wu, who was a Chinese immigrant to the United States, provides a foundation for further critical scholarship on the heterogeneous histories of Asian American bioscientists, the sociality of their scientific works, and how the resulting knowledge produced is preserved, if not evenly, in a scientific field's collective memory. Copyright © 2014 Elsevier Ltd. All rights reserved.

Recently Patented Viral Nucleotide Sequences and Generation of Virus-Derived Vaccines.

PubMed

Venkataraman, Srividhya; Ahmad, Tauqeer; Haidar, Mounir A; Hefferon, Kathleen L

2017-01-01

With an increase in comprehension of the molecular biology of viruses, there has been a recent surge in the application of virus sequences and viral gene expression strategies towards the diagnosis and treatment of diseases. The scope of the patenting landscape has widened as a result and the current review discusses patents pertaining to live / attenuated viral vaccines. The vaccines addressed here have been developed by both conventional means as well as by the state-of-the-art genetic engineering techniques. This review also addresses the applications of these patents for clinical and biotechnological purposes. Copyright© Bentham Science Publishers; For any queries, please email at epub@benthamscience.org.

NDM-1 encoded by a pNDM-HN380-like plasmid pNDM-BJ03 in clinical Enterobacter cloacae.

PubMed

Lü, Yang; Liu, Wei; Liang, Hui; Zhao, Shulong; Zhang, Wei; Liu, Jia; Jin, Cheng; Hu, Hongyan

2018-02-01

A carbapenemase-producing Enterobacter cloacae hhy03 with a bla NDM-1 and bla SHV-12 -coharboring plasmid was isolated from a sputum specimen of a patient. This is the third nucleotide sequence report of bla NDM-1 -harboring plasmid from Enterobacter cloacae that have caused lethal infections in China, indicating the spread of NDM-1 by IncX3 plasmid between Enterobacteriaceae. Copyright © 2017. Published by Elsevier Inc.

37 CFR 1.824 - Form and format for nucleotide and/or amino acid sequence submissions in computer readable form.

Code of Federal Regulations, 2010 CFR

2010-07-01

... 37 Patents, Trademarks, and Copyrights 1 2010-07-01 2010-07-01 false Form and format for... And/or Amino Acid Sequences § 1.824 Form and format for nucleotide and/or amino acid sequence... Code for Information Interchange (ASCII) text. No other formats shall be allowed. (3) The computer...

The nucleotide sequence of 5S rRNA from a cellular slime mold Dictyostelium discoideum.

PubMed Central

Hori, H; Osawa, S; Iwabuchi, M

1980-01-01

The nucleotide sequence of ribosomal 5S rRNA from a cellular slime mold Dictyostelium discoideum is GUAUACGGCCAUACUAGGUUGGAAACACAUCAUCCCGUUCGAUCUGAUA AGUAAAUCGACCUCAGGCCUUCCAAGUACUCUGGUUGGAGACAACAGGGGAACAUAGGGUGCUGUAUACU. A model for the secondary structure of this 5S rRNA is proposed. The sequence is more similar to those of animals (62% similarity on the average) rather than those of yeasts (56%). Images PMID:7465421

A nucleotide sequence comparison of coxsackievirus B4 isolates from aquatic samples and clinical specimens.

PubMed Central

Hughes, M. S.; Hoey, E. M.; Coyle, P. V.

1993-01-01

Ten coxsackievirus B4 (CVB4) strains isolated from clinical and environmental sources in Northern Ireland in 1985-7, were compared at the nucleotide sequence level. Dideoxynucleotide sequencing of a polymerase chain reaction (PCR) amplified fragment, spanning the VP1/P2A genomic region, classified the isolates into two distinct groups or genotypes as defined by Rico-Hesse and colleagues for poliovirus type 1. Isolates within each group shared approximately 99% sequence identity at the nucleotide level whereas < or = 86% sequence identity was shared between groups. One isolate derived from a clinical specimen in 1987 was grouped with six CVB4 isolates recovered from the aquatic environment in 1986-7. The second group comprised CVB4 isolates from clinical specimens in 1985-6. Both groups were different at the nucleotide level from the prototype strain isolated in 1950. It was concluded that the method could be used to sub-type CVB4 isolates and would be of value in epidemiological studies of CVB4. Predicted amino acid sequences revealed non-conservation of the tyrosine residue at the VP1/P2A cleavage site but were of little value in distinguishing CVB4 variants. PMID:8386098

Control of total GFP expression by alterations to the 3′ region nucleotide sequence

PubMed Central

2013-01-01

Background Previously, we distinguished the Escherichia coli type II cytoplasmic membrane translocation pathways of Tat, Yid, and Sec for unfolded and folded soluble target proteins. The translocation of folded protein to the periplasm for soluble expression via the Tat pathway was controlled by an N-terminal hydrophilic leader sequence. In this study, we investigated the effect of the hydrophilic C-terminal end and its nucleotide sequence on total and soluble protein expression. Results The native hydrophilic C-terminal end of GFP was obtained by deleting the C-terminal peptide LeuGlu-6×His, derived from pET22b(+). The corresponding clones induced total and soluble GFP expression that was either slightly increased or dramatically reduced, apparently through reconstruction of the nucleotide sequence around the stop codon in the 3′ region. In the expression-induced clones, the hydrophilic C-terminus showed increased Tat pathway specificity for soluble expression. However, in the expression-reduced clone, after analyzing the role of the 5′ poly(A) coding sequence with a substituted synonymous codon, we proved that the longer 5′ poly(A) coding sequence interacted with the reconstructed 3′ region nucleotide sequence to create a new mRNA tertiary structure between the 5′ and 3′ regions, which resulted in reduced total GFP expression. Further, to recover the reduced expression by changing the 3′ nucleotide sequence, after replacing selected C-terminal 5′ codons and the stop codon in the ORF with synonymous codons, total GFP expression in most of the clones was recovered to the undeleted control level. The insertion of trinucleotides after the stop codon in the 3′-UTR recovered or reduced total GFP expression. RT-PCR revealed that the level of total protein expression was controlled by changes in translational or transcriptional regulation, which were induced or reduced by the substitution or insertion of 3′ region nucleotides. Conclusions We found that the hydrophilic C-terminal end of GFP increased Tat pathway specificity and that the 3′ nucleotide sequence played an important role in total protein expression through translational and transcriptional regulation. These findings may be useful for efficiently producing recombinant proteins as well as for potentially controlling the expression level of specific genes in the body for therapeutic purposes. PMID:23834827

Molecular characterization of the vitamin D receptor (VDR) gene in Holstein cows.

PubMed

Ali, Mayar O; El-Adl, Mohamed A; Ibrahim, Hussam M M; Elseedy, Youssef Y; Rizk, Mohamed A; El-Khodery, Sabry A

2018-06-01

Vitamin D plays a vital role in calcium homeostasis, growth, and immunoregulation. Because little is known about the vitamin D receptor (VDR) gene in cattle, the aim of the present investigation was to present the molecular characterization of exons 5 and 6 of the VDR gene in Holstein cows. DNA extraction, genomic sequencing, phylogenetic analysis, synteny mapping and single nucleotide gene polymorphism analysis of the VDR gene were performed to assess blood samples collected from 50 clinically healthy Holstein cows. The results revealed the presence of a 450-base pair (bp) nucleotide sequence that resembled exons 5 and 6 with intron 5 enclosed between these exons. Sequence alignment and phylogenetic analysis revealed a close relationship between the sequenced VDR region and that found in Hereford cattle. A close association between this region and the corresponding region in small ruminants was also documented. Moreover, a single nucleotide polymorphism (SNP) that caused the replacement of a glutamate with an arginine in the deduced amino acid sequence was detected at position 7 of exon 5. In conclusion, Holstein and Hereford cattle differ with respect to exon 5 of the VDR gene. Phylogenetic analysis of the VDR gene based on nucleotide sequence produced different results from prior analyses based on amino acid sequence. Copyright © 2018 Elsevier Ltd. All rights reserved.

The CD8α gene in duck (Anatidae): cloning, characterization, and expression during viral infection.

PubMed

Xu, Qi; Chen, Yang; Zhao, Wen Ming; Huang, Zheng Yang; Duan, Xiu Jun; Tong, Yi Yu; Zhang, Yang; Li, Xiu; Chang, Guo Bin; Chen, Guo Hong

2015-02-01

Cluster of differentiation 8 alpha (CD8α) is critical for cell-mediated immune defense and T-cell development. Although CD8α sequences have been reported for several species, very little is known about CD8α in ducks. To elucidate the mechanisms involved in the innate and adaptive immune responses of ducks, we cloned CD8α coding sequences from domestic, Muscovy, Mallard, and Spotbill ducks using reverse transcription polymerase chain reaction (RT-PCR). Each sequence consisted of 714 nucleotides and encoded a signal peptide, an IgV-like domain, a stalk region, a transmembrane region, and a cytoplasmic tail. We identified 58 nucleotide differences and 37 amino acid differences among the four types of duck; of these, 53 nucleotide and 33 amino acid differences were between Muscovy ducks and the other duck species. The CD8α cDNA sequence from domestic duck consisted of a 61-nucleotide 5' untranslated region (UTR), a 714-nucleotide open reading frame, and an 849-nucleotide 3' UTR. Multiple sequence alignments showed that the amino acid sequence of CD8α is conserved in vertebrates. RT-PCR revealed that expression of CD8α mRNA of domestic ducks was highest in the thymus and very low in the kidney, cerebrum, cerebellum, and muscle. Immunohistochemical analyses detected CD8α on the splenic corpuscle and periarterial lymphatic sheath of the spleen. CD8α mRNA in domestic ducklings was initially up-regulated, and then down-regulated, in the thymus, spleen, and liver after treatment with duck hepatitis virus type I (DHV-1) or the immunostimulant polyriboinosinic polyribocytidylic acid (poly I:C).

Whole exome sequencing to estimate alloreactivity potential between donors and recipients in stem cell transplantation.

PubMed

Sampson, Juliana K; Sheth, Nihar U; Koparde, Vishal N; Scalora, Allison F; Serrano, Myrna G; Lee, Vladimir; Roberts, Catherine H; Jameson-Lee, Max; Ferreira-Gonzalez, Andrea; Manjili, Masoud H; Buck, Gregory A; Neale, Michael C; Toor, Amir A

2014-08-01

Whole exome sequencing (WES) was performed on stem cell transplant donor-recipient (D-R) pairs to determine the extent of potential antigenic variation at a molecular level. In a small cohort of D-R pairs, a high frequency of sequence variation was observed between the donor and recipient exomes independent of human leucocyte antigen (HLA) matching. Nonsynonymous, nonconservative single nucleotide polymorphisms were approximately twice as frequent in HLA-matched unrelated, compared with related D-R pairs. When mapped to individual chromosomes, these polymorphic nucleotides were uniformly distributed across the entire exome. In conclusion, WES reveals extensive nucleotide sequence variation in the exomes of HLA-matched donors and recipients. © 2014 John Wiley & Sons Ltd.

Molecular characterization of the virulent infectious hematopoietic necrosis virus (IHNV) strain 220-90

PubMed Central

2010-01-01

Background Infectious hematopoietic necrosis virus (IHNV) is the type species of the genus Novirhabdovirus, within the family Rhabdoviridae, infecting several species of wild and hatchery reared salmonids. Similar to other rhabdoviruses, IHNV has a linear single-stranded, negative-sense RNA genome of approximately 11,000 nucleotides. The IHNV genome encodes six genes; the nucleocapsid, phosphoprotein, matrix protein, glycoprotein, non-virion protein and polymerase protein genes, respectively. This study describes molecular characterization of the virulent IHNV strain 220-90, belonging to the M genogroup, and its phylogenetic relationships with available sequences of IHNV isolates worldwide. Results The complete genomic sequence of IHNV strain 220-90 was determined from the DNA of six overlapping clones obtained by RT-PCR amplification of genomic RNA. The complete genome sequence of 220-90 comprises 11,133 nucleotides (GenBank GQ413939) with the gene order of 3'-N-P-M-G-NV-L-5'. These genes are separated by conserved gene junctions, with di-nucleotide gene spacers. An additional uracil nucleotide was found at the end of the 5'-trailer region, which was not reported before in other IHNV strains. The first 15 of the 16 nucleotides at the 3'- and 5'-termini of the genome are complementary, and the first 4 nucleotides at 3'-ends of the IHNV are identical to other novirhadoviruses. Sequence homology and phylogenetic analysis of the glycoprotein genes show that 220-90 strain is 97% identical to most of the IHNV strains. Comparison of the virulent 220-90 genomic sequences with less virulent WRAC isolate shows more than 300 nucleotides changes in the genome, which doesn't allow one to speculate putative residues involved in the virulence of IHNV. Conclusion We have molecularly characterized one of the well studied IHNV isolates, 220-90 of genogroup M, which is virulent for rainbow trout, and compared phylogenetic relationship with North American and other strains. Determination of the complete nucleotide sequence is essential for future studies on pathogenesis of IHNV using a reverse genetics approach and developing efficient control strategies. PMID:20085652

Hop stunt viroid: molecular cloning and nucleotide sequence of the complete cDNA copy.

PubMed Central

Ohno, T; Takamatsu, N; Meshi, T; Okada, Y

1983-01-01

The complete cDNA of hop stunt viroid (HSV) has been cloned by the method of Okayama and Berg (Mol.Cell.Biol.2,161-170. (1982] and the complete nucleotide sequence has been established. The covalently closed circular single-stranded HSV RNA consists of 297 nucleotides. The secondary structure predicted for HSV contains 67% of its residues base-paired. The native HSV can possess an extended rod-like structure characteristic of viroids previously established. The central region of the native HSV has a similar structure to the conserved region found in all viroids sequenced so far except for avocado sunblotch viroid. The sequence homologous to the 5'-end of U1a RNA is also found in the sequence of HSV but not in the central conserved region. Images PMID:6312412

Nucleotide sequences of Japanese isolates of citrus vein enation virus.

PubMed

Nakazono-Nagaoka, Eiko; Fujikawa, Takashi; Iwanami, Toru

2017-03-01

The genomic sequences of five Japanese isolates of citrus vein enation virus (CVEV) isolates that induce vein enation were determined and compared with that of the Spanish isolate VE-1. The nucleotide sequences of all Japanese isolates were 5,983 nt in length. The genomic RNA of Japanese isolates had five potential open reading frames (ORF 0, ORF 1, ORF 2, ORF 3, and ORF 5) in the positive-sense strand. The nucleotide sequence identity among the Japanese isolates and Spanish isolate VE-1 ranged from 98.0% to 99.8%. Comparison of the partial amino acid sequences of ten Japanese isolates and three Spanish isolates suggested that four amino acid residues, at positions of 83, 104, and 113 in ORF 2 and position 41 in ORF 5, might be unique to some Japanese isolates.

Detecting and Analyzing Genetic Recombination Using RDP4.

PubMed

Martin, Darren P; Murrell, Ben; Khoosal, Arjun; Muhire, Brejnev

2017-01-01

Recombination between nucleotide sequences is a major process influencing the evolution of most species on Earth. The evolutionary value of recombination has been widely debated and so too has its influence on evolutionary analysis methods that assume nucleotide sequences replicate without recombining. When nucleic acids recombine, the evolution of the daughter or recombinant molecule cannot be accurately described by a single phylogeny. This simple fact can seriously undermine the accuracy of any phylogenetics-based analytical approach which assumes that the evolutionary history of a set of recombining sequences can be adequately described by a single phylogenetic tree. There are presently a large number of available methods and associated computer programs for analyzing and characterizing recombination in various classes of nucleotide sequence datasets. Here we examine the use of some of these methods to derive and test recombination hypotheses using multiple sequence alignments.

Dimeric PROP1 binding to diverse palindromic TAAT sequences promotes its transcriptional activity.

PubMed

Nakayama, Michie; Kato, Takako; Susa, Takao; Sano, Akiko; Kitahara, Kousuke; Kato, Yukio

2009-08-13

Mutations in the Prop1 gene are responsible for murine Ames dwarfism and human combined pituitary hormone deficiency with hypogonadism. Recently, we reported that PROP1 is a possible transcription factor for gonadotropin subunit genes through plural cis-acting sites composed of AT-rich sequences containing a TAAT motif which differs from its consensus binding sequence known as PRDQ9 (TAATTGAATTA). This study aimed to verify the binding specificity and sequence of PROP1 by applying the method of SELEX (Systematic Evolution of Ligands by EXponential enrichment), EMSA (electrophoretic mobility shift assay) and transient transfection assay. SELEX, after 5, 7 and 9 generations of selection using a random sequence library, showed that nucleotides containing one or two TAAT motifs were accumulated and accounted for 98.5% at the 9th generation. Aligned sequences and EMSA demonstrated that PROP1 binds preferentially to 11 nucleotides composed of an inverted TAAT motif separated by 3 nucleotides with variation in the half site of palindromic TAAT motifs and with preferential requirement of T at the nucleotide number 5 immediately 3' to a TAAT motif. Transient transfection assay demonstrated first that dimeric binding of PROP1 to an inverted TAAT motif and its cognates resulted in transcriptional activation, whereas monomeric binding of PROP1 to a single TAAT motif and an inverted ATTA motif did not mediate activation. Thus, this study demonstrated that dimeric binding of PROP1 is able to recognize diverse palindromic TAAT sequences separated by 3 nucleotides and to exhibit its transcriptional activity.

Normalization of Complete Genome Characteristics: Application to Evolution from Primitive Organisms to Homo sapiens.

PubMed

Sorimachi, Kenji; Okayasu, Teiji; Ohhira, Shuji

2015-04-01

Normalized nucleotide and amino acid contents of complete genome sequences can be visualized as radar charts. The shapes of these charts depict the characteristics of an organism's genome. The normalized values calculated from the genome sequence theoretically exclude experimental errors. Further, because normalization is independent of both target size and kind, this procedure is applicable not only to single genes but also to whole genomes, which consist of a huge number of different genes. In this review, we discuss the applications of the normalization of the nucleotide and predicted amino acid contents of complete genomes to the investigation of genome structure and to evolutionary research from primitive organisms to Homo sapiens. Some of the results could never have been obtained from the analysis of individual nucleotide or amino acid sequences but were revealed only after the normalization of nucleotide and amino acid contents was applied to genome research. The discovery that genome structure was homogeneous was obtained only after normalization methods were applied to the nucleotide or predicted amino acid contents of genome sequences. Normalization procedures are also applicable to evolutionary research. Thus, normalization of the contents of whole genomes is a useful procedure that can help to characterize organisms.

Detection of a new bat gammaherpesvirus in the Philippines.

PubMed

Watanabe, Shumpei; Ueda, Naoya; Iha, Koichiro; Masangkay, Joseph S; Fujii, Hikaru; Alviola, Phillip; Mizutani, Tetsuya; Maeda, Ken; Yamane, Daisuke; Walid, Azab; Kato, Kentaro; Kyuwa, Shigeru; Tohya, Yukinobu; Yoshikawa, Yasuhiro; Akashi, Hiroomi

2009-08-01

A new bat herpesvirus was detected in the spleen of an insectivorous bat (Hipposideros diadema, family Hipposideridae) collected on Panay Island, the Philippines. PCR analyses were performed using COnsensus-DEgenerate Hybrid Oligonucleotide Primers (CODEHOPs) targeting the herpesvirus DNA polymerase (DPOL) gene. Although we obtained PCR products with CODEHOPs, direct sequencing using the primers was not possible because of high degree of degeneracy. Direct sequencing technology developed in our rapid determination system of viral RNA sequences (RDV) was applied in this study, and a partial DPOL nucleotide sequence was determined. In addition, a partial gB gene nucleotide sequence was also determined using the same strategy. We connected the partial gB and DPOL sequences with long-distance PCR, and a 3741-bp nucleotide fragment, including the 3' part of the gB gene and the 5' part of the DPOL gene, was finally determined. Phylogenetic analysis showed that the sequence was novel and most similar to those of the subfamily Gammaherpesvirinae.

Plant nitrogen regulatory P-PII polypeptides

DOEpatents

Coruzzi, Gloria M.; Lam, Hon-Ming; Hsieh, Ming-Hsiun

2004-11-23

The present invention generally relates to plant nitrogen regulatory PII gene (hereinafter P-PII gene), a gene involved in regulating plant nitrogen metabolism. The invention provides P-PII nucleotide sequences, expression constructs comprising said nucleotide sequences, and host cells and plants having said constructs and, optionally expressing the P-PII gene from said constructs. The invention also provides substantially pure P-PII proteins. The P-PII nucleotide sequences and constructs of the invention may be used to engineer organisms to overexpress wild-type or mutant P-PII regulatory protein. Engineered plants that overexpress or underexpress P-PII regulatory protein may have increased nitrogen assimilation capacity. Engineered organisms may be used to produce P-PII proteins which, in turn, can be used for a variety of purposes including in vitro screening of herbicides. P-PII nucleotide sequences have additional uses as probes for isolating additional genomic clones having the promoters of P-PII gene. P-PII promoters are light- and/or sucrose-inducible and may be advantageously used in genetic engineering of plants.

Greater numbers of nucleotide substitutions are introduced into the genomic RNA of bovine viral diarrhea virus during acute infections of pregnant cattle than of non-pregnant cattle.

PubMed

Neill, John D; Newcomer, Benjamin W; Marley, Shonda D; Ridpath, Julia F; Givens, M Daniel

2012-08-06

Bovine viral diarrhea virus (BVDV) strains circulating in livestock herds show significant sequence variation. Conventional wisdom states that most sequence variation arises during acute infections in response to immune or other environmental pressures. A recent study showed that more nucleotide changes were introduced into the BVDV genomic RNA during the establishment of a single fetal persistent infection than following a series of acute infections of naïve cattle. However, it was not known if nucleotide changes were introduce when the virus crossed the placenta and infected the fetus or during the acute infection of the dam. The sequence of the open reading frame (ORF) from viruses isolated from four acutely infected pregnant heifers following exposure to persistently infected (PI) calves was compared to the sequences of the virus from the progenitor PI calf and the virus from the resulting progeny PI calf to determine when genetic change was introduced. This was compared to genetic change found in viruses isolated from a pregnant PI cow and its PI calf, and in three viruses isolated from acutely infected, non-pregnant cattle exposed to PI calves. Most genetic changes previously identified between the progenitor and progeny PI viruses were in place in the acute phase viruses isolated from the dams six days post-exposure to the progenitor PI calf. Additionally, each progeny PI virus had two to three unique nucleotide substitutions that were introduced in crossing the placenta and infection of the fetus. The nucleotide sequence of two acute phase viruses isolated from steers exposed to PI calves revealed that six and seven nucleotide changes were introduced during the acute infection. The sequence of the BVDV-2 virus isolated from an acute infection of a PI calf (BVDV-1a) co-housed with a BVDV-2 PI calf had ten nucleotides that were different from the progenitor PI virus. Finally, twenty nucleotide changes were identified in the PI virus of a calf born to a PI dam. These results demonstrate that nucleotide changes are introduced into the BVDV infecting pregnant cattle at rates of 2.3 to 8 fold higher then during the acute infection of non-pregnant animals.

Accurate Filtering of Privacy-Sensitive Information in Raw Genomic Data.

PubMed

Decouchant, Jérémie; Fernandes, Maria; Völp, Marcus; Couto, Francisco M; Esteves-Veríssimo, Paulo

2018-04-13

Sequencing thousands of human genomes has enabled breakthroughs in many areas, among them precision medicine, the study of rare diseases, and forensics. However, mass collection of such sensitive data entails enormous risks if not protected to the highest standards. In this article, we follow the position and argue that post-alignment privacy is not enough and that data should be automatically protected as early as possible in the genomics workflow, ideally immediately after the data is produced. We show that a previous approach for filtering short reads cannot extend to long reads and present a novel filtering approach that classifies raw genomic data (i.e., whose location and content is not yet determined) into privacy-sensitive (i.e., more affected by a successful privacy attack) and non-privacy-sensitive information. Such a classification allows the fine-grained and automated adjustment of protective measures to mitigate the possible consequences of exposure, in particular when relying on public clouds. We present the first filter that can be indistinctly applied to reads of any length, i.e., making it usable with any recent or future sequencing technologies. The filter is accurate, in the sense that it detects all known sensitive nucleotides except those located in highly variable regions (less than 10 nucleotides remain undetected per genome instead of 100,000 in previous works). It has far less false positives than previously known methods (10% instead of 60%) and can detect sensitive nucleotides despite sequencing errors (86% detected instead of 56% with 2% of mutations). Finally, practical experiments demonstrate high performance, both in terms of throughput and memory consumption. Copyright © 2018. Published by Elsevier Inc.

An outbreak of respiratory tularemia caused by diverse clones of Francisella tularensis.

PubMed

Johansson, Anders; Lärkeryd, Adrian; Widerström, Micael; Mörtberg, Sara; Myrtännäs, Kerstin; Ohrman, Caroline; Birdsell, Dawn; Keim, Paul; Wagner, David M; Forsman, Mats; Larsson, Pär

2014-12-01

The bacterium Francisella tularensis is recognized for its virulence, infectivity, genetic homogeneity, and potential as a bioterrorism agent. Outbreaks of respiratory tularemia, caused by inhalation of this bacterium, are poorly understood. Such outbreaks are exceedingly rare, and F. tularensis is seldom recovered from clinical specimens. A localized outbreak of tularemia in Sweden was investigated. Sixty-seven humans contracted laboratory-verified respiratory tularemia. F. tularensis subspecies holarctica was isolated from the blood or pleural fluid of 10 individuals from July to September 2010. Using whole-genome sequencing and analysis of single-nucleotide polymorphisms (SNPs), outbreak isolates were compared with 110 archived global isolates. There were 757 SNPs among the genomes of the 10 outbreak isolates and the 25 most closely related archival isolates (all from Sweden/Finland). Whole genomes of outbreak isolates were >99.9% similar at the nucleotide level and clustered into 3 distinct genetic clades. Unexpectedly, high-sequence similarity grouped some outbreak and archival isolates that originated from patients from different geographic regions and up to 10 years apart. Outbreak and archival genomes frequently differed by only 1-3 of 1 585 229 examined nucleotides. The outbreak was caused by diverse clones of F. tularensis that occurred concomitantly, were widespread, and apparently persisted in the environment. Multiple independent acquisitions of F. tularensis from the environment over a short time period suggest that natural outbreaks of respiratory tularemia are triggered by environmental cues. The findings additionally caution against interpreting genome sequence identity for this pathogen as proof of a direct epidemiological link. © The Author 2014. Published by Oxford University Press on behalf of the Infectious Diseases Society of America. All rights reserved. For Permissions, please e-mail: journals.permissions@oup.com.

The vestigial olfactory receptor subgenome of odontocete whales: phylogenetic congruence between gene-tree reconciliation and supermatrix methods.

PubMed

McGowen, Michael R; Clark, Clay; Gatesy, John

2008-08-01

The macroevolutionary transition of whales (cetaceans) from a terrestrial quadruped to an obligate aquatic form involved major changes in sensory abilities. Compared to terrestrial mammals, the olfactory system of baleen whales is dramatically reduced, and in toothed whales is completely absent. We sampled the olfactory receptor (OR) subgenomes of eight cetacean species from four families. A multigene tree of 115 newly characterized OR sequences from these eight species and published data for Bos taurus revealed a diverse array of class II OR paralogues in Cetacea. Evolution of the OR gene superfamily in toothed whales (Odontoceti) featured a multitude of independent pseudogenization events, supporting anatomical evidence that odontocetes have lost their olfactory sense. We explored the phylogenetic utility of OR pseudogenes in Cetacea, concentrating on delphinids (oceanic dolphins), the product of a rapid evolutionary radiation that has been difficult to resolve in previous studies of mitochondrial DNA sequences. Phylogenetic analyses of OR pseudogenes using both gene-tree reconciliation and supermatrix methods yielded fully resolved, consistently supported relationships among members of four delphinid subfamilies. Alternative minimizations of gene duplications, gene duplications plus gene losses, deep coalescence events, and nucleotide substitutions plus indels returned highly congruent phylogenetic hypotheses. Novel DNA sequence data for six single-copy nuclear loci and three mitochondrial genes (> 5000 aligned nucleotides) provided an independent test of the OR trees. Nucleotide substitutions and indels in OR pseudogenes showed a very low degree of homoplasy in comparison to mitochondrial DNA and, on average, provided more variation than single-copy nuclear DNA. Our results suggest that phylogenetic analysis of the large OR superfamily will be effective for resolving relationships within Cetacea whether supermatrix or gene-tree reconciliation procedures are used.

Ancestral sequence reconstruction in primate mitochondrial DNA: compositional bias and effect on functional inference.

PubMed

Krishnan, Neeraja M; Seligmann, Hervé; Stewart, Caro-Beth; De Koning, A P Jason; Pollock, David D

2004-10-01

Reconstruction of ancestral DNA and amino acid sequences is an important means of inferring information about past evolutionary events. Such reconstructions suggest changes in molecular function and evolutionary processes over the course of evolution and are used to infer adaptation and convergence. Maximum likelihood (ML) is generally thought to provide relatively accurate reconstructed sequences compared to parsimony, but both methods lead to the inference of multiple directional changes in nucleotide frequencies in primate mitochondrial DNA (mtDNA). To better understand this surprising result, as well as to better understand how parsimony and ML differ, we constructed a series of computationally simple "conditional pathway" methods that differed in the number of substitutions allowed per site along each branch, and we also evaluated the entire Bayesian posterior frequency distribution of reconstructed ancestral states. We analyzed primate mitochondrial cytochrome b (Cyt-b) and cytochrome oxidase subunit I (COI) genes and found that ML reconstructs ancestral frequencies that are often more different from tip sequences than are parsimony reconstructions. In contrast, frequency reconstructions based on the posterior ensemble more closely resemble extant nucleotide frequencies. Simulations indicate that these differences in ancestral sequence inference are probably due to deterministic bias caused by high uncertainty in the optimization-based ancestral reconstruction methods (parsimony, ML, Bayesian maximum a posteriori). In contrast, ancestral nucleotide frequencies based on an average of the Bayesian set of credible ancestral sequences are much less biased. The methods involving simpler conditional pathway calculations have slightly reduced likelihood values compared to full likelihood calculations, but they can provide fairly unbiased nucleotide reconstructions and may be useful in more complex phylogenetic analyses than considered here due to their speed and flexibility. To determine whether biased reconstructions using optimization methods might affect inferences of functional properties, ancestral primate mitochondrial tRNA sequences were inferred and helix-forming propensities for conserved pairs were evaluated in silico. For ambiguously reconstructed nucleotides at sites with high base composition variability, ancestral tRNA sequences from Bayesian analyses were more compatible with canonical base pairing than were those inferred by other methods. Thus, nucleotide bias in reconstructed sequences apparently can lead to serious bias and inaccuracies in functional predictions.

Museum genomics: low-cost and high-accuracy genetic data from historical specimens.

PubMed

Rowe, Kevin C; Singhal, Sonal; Macmanes, Matthew D; Ayroles, Julien F; Morelli, Toni Lyn; Rubidge, Emily M; Bi, Ke; Moritz, Craig C

2011-11-01

Natural history collections are unparalleled repositories of geographical and temporal variation in faunal conditions. Molecular studies offer an opportunity to uncover much of this variation; however, genetic studies of historical museum specimens typically rely on extracting highly degraded and chemically modified DNA samples from skins, skulls or other dried samples. Despite this limitation, obtaining short fragments of DNA sequences using traditional PCR amplification of DNA has been the primary method for genetic study of historical specimens. Few laboratories have succeeded in obtaining genome-scale sequences from historical specimens and then only with considerable effort and cost. Here, we describe a low-cost approach using high-throughput next-generation sequencing to obtain reliable genome-scale sequence data from a traditionally preserved mammal skin and skull using a simple extraction protocol. We show that single-nucleotide polymorphisms (SNPs) from the genome sequences obtained independently from the skin and from the skull are highly repeatable compared to a reference genome. © 2011 Blackwell Publishing Ltd.

New partial sequences of phosphoenolpyruvate carboxylase as molecular phylogenetic markers.

PubMed

Gehrig, H; Heute, V; Kluge, M

2001-08-01

To better understand the evolution of the enzyme phosphoenolpyruvate carboxylase (PEPC) and to test its versatility as a molecular character in phylogenetic and taxonomic studies, we have characterized and compared 70 new partial PEPC nucleotide and amino acid sequences (about 1100 bp of the 3' side of the gene) from 50 plant species (24 species of Bryophyta, 1 of Pteridophyta, and 25 of Spermatophyta). Together with previously published data, the new set of sequences allowed us to construct the up to now most complete phylogenetic tree of PEPC, where the PEPC sequences cluster according to both the taxonomic positions of the donor plants and the assumed specific function of the PEPC isoforms. Altogether, the study further strengthens the view that PEPC sequences can provide interesting information for the reconstruction of phylogenetic relations between organisms and metabolic pathways. To avoid confusion in future discussion, we propose a new nomenclature for the denotation of PEPC isoforms. Copyright 2001 Academic Press.

Intramolecular interactions in aminoacyl nucleotides: Implications regarding the origin of genetic coding and protein synthesis

NASA Technical Reports Server (NTRS)

Lacey, J. C., Jr.; Mullins, D. W., Jr.; Watkins, C. L.; Hall, L. M.

1986-01-01

Cellular organisms store information as sequences of nucleotides in double stranded DNA. This information is useless unless it can be converted into the active molecular species, protein. This is done in contemporary creatures first by transcription of one strand to give a complementary strand of mRNA. The sequence of nucleotides is then translated into a specific sequence of amino acids in a protein. Translation is made possible by a genetic coding system in which a sequence of three nucleotides codes for a specific amino acid. The origin and evolution of any chemical system can be understood through elucidation of the properties of the chemical entities which make up the system. There is an underlying logic to the coding system revealed by a correlation of the hydrophobicities of amino acids and their anticodonic nucleotides (i.e., the complement of the codon). Its importance lies in the fact that every amino acid going into protein synthesis must first be activated. This is universally accomplished with ATP. Past studies have concentrated on the chemistry of the adenylates, but more recently we have found, through the use of NMR, that we can observe intramolecular interactions even at low concentrations, between amino acid side chains and nucleotide base rings in these adenylates. The use of this type of compound thus affords a novel way of elucidating the manner in which amino acids and nucleotides interact with each other. In aqueous solution, when a hydrophobic amino acid is attached to the most hydrophobic nucleotide, AMP, a hydrophobic interaction takes place between the amino acid side chain and the adenine ring. The studies to be reported concern these hydrophobic interactions.

High speed nucleic acid sequencing

DOEpatents

Korlach, Jonas [Ithaca, NY; Webb, Watt W [Ithaca, NY; Levene, Michael [Ithaca, NY; Turner, Stephen [Ithaca, NY; Craighead, Harold G [Ithaca, NY; Foquet, Mathieu [Ithaca, NY

2011-05-17

The present invention is directed to a method of sequencing a target nucleic acid molecule having a plurality of bases. In its principle, the temporal order of base additions during the polymerization reaction is measured on a molecule of nucleic acid. Each type of labeled nucleotide comprises an acceptor fluorophore attached to a phosphate portion of the nucleotide such that the fluorophore is removed upon incorporation into a growing strand. Fluorescent signal is emitted via fluorescent resonance energy transfer between the donor fluorophore and the acceptor fluorophore as each nucleotide is incorporated into the growing strand. The sequence is deduced by identifying which base is being incorporated into the growing strand.

Information capacity of nucleotide sequences and its applications.

PubMed

Sadovsky, M G

2006-05-01

The information capacity of nucleotide sequences is defined through the specific entropy of frequency dictionary of a sequence determined with respect to another one containing the most probable continuations of shorter strings. This measure distinguishes a sequence both from a random one, and from ordered entity. A comparison of sequences based on their information capacity is studied. An order within the genetic entities is found at the length scale ranged from 3 to 8. Some other applications of the developed methodology to genetics, bioinformatics, and molecular biology are discussed.

Nucleic acid constructs containing orthogonal site selective recombinases (OSSRs)

DOE Office of Scientific and Technical Information (OSTI.GOV)

Gilmore, Joshua M.; Anderson, J. Christopher; Dueber, John E.

The present invention provides for a recombinant nucleic acid comprising a nucleotide sequence comprising a plurality of constructs, wherein each construct independently comprises a nucleotide sequence of interest flanked by a pair of recombinase recognition sequences. Each pair of recombinase recognition sequences is recognized by a distinct recombinase. Optionally, each construct can, independently, further comprise one or more genes encoding a recombinase capable of recognizing the pair of recombinase recognition sequences of the construct. The recombinase can be an orthogonal (non-cross reacting), site-selective recombinase (OSSR).

Unlinking the methylome pattern from nucleotide sequence, revealed by large-scale in vivo genome engineering and methylome editing in medaka fish

PubMed Central

Nakamura, Ryohei; Uno, Ayako; Kumagai, Masahiko; Fukushima, Hiroto S.; Morishita, Shinichi; Takeda, Hiroyuki

2017-01-01

The heavily methylated vertebrate genomes are punctuated by stretches of poorly methylated DNA sequences that usually mark gene regulatory regions. It is known that the methylation state of these regions confers transcriptional control over their associated genes. Given its governance on the transcriptome, cellular functions and identity, genome-wide DNA methylation pattern is tightly regulated and evidently predefined. However, how is the methylation pattern determined in vivo remains enigmatic. Based on in silico and in vitro evidence, recent studies proposed that the regional hypomethylated state is primarily determined by local DNA sequence, e.g., high CpG density and presence of specific transcription factor binding sites. Nonetheless, the dependency of DNA methylation on nucleotide sequence has not been carefully validated in vertebrates in vivo. Herein, with the use of medaka (Oryzias latipes) as a model, the sequence dependency of DNA methylation was intensively tested in vivo. Our statistical modeling confirmed the strong statistical association between nucleotide sequence pattern and methylation state in the medaka genome. However, by manipulating the methylation state of a number of genomic sequences and reintegrating them into medaka embryos, we demonstrated that artificially conferred DNA methylation states were predominantly and robustly maintained in vivo, regardless of their sequences and endogenous states. This feature was also observed in the medaka transgene that had passed across generations. Thus, despite the observed statistical association, nucleotide sequence was unable to autonomously determine its own methylation state in medaka in vivo. Our results apparently argue against the notion of the governance on the DNA methylation by nucleotide sequence, but instead suggest the involvement of other epigenetic factors in defining and maintaining the DNA methylation landscape. Further investigation in other vertebrate models in vivo will be needed for the generalization of our observations made in medaka. PMID:29267279

Using expected sequence features to improve basecalling accuracy of amplicon pyrosequencing data.

PubMed

Rask, Thomas S; Petersen, Bent; Chen, Donald S; Day, Karen P; Pedersen, Anders Gorm

2016-04-22

Amplicon pyrosequencing targets a known genetic region and thus inherently produces reads highly anticipated to have certain features, such as conserved nucleotide sequence, and in the case of protein coding DNA, an open reading frame. Pyrosequencing errors, consisting mainly of nucleotide insertions and deletions, are on the other hand likely to disrupt open reading frames. Such an inverse relationship between errors and expectation based on prior knowledge can be used advantageously to guide the process known as basecalling, i.e. the inference of nucleotide sequence from raw sequencing data. The new basecalling method described here, named Multipass, implements a probabilistic framework for working with the raw flowgrams obtained by pyrosequencing. For each sequence variant Multipass calculates the likelihood and nucleotide sequence of several most likely sequences given the flowgram data. This probabilistic approach enables integration of basecalling into a larger model where other parameters can be incorporated, such as the likelihood for observing a full-length open reading frame at the targeted region. We apply the method to 454 amplicon pyrosequencing data obtained from a malaria virulence gene family, where Multipass generates 20 % more error-free sequences than current state of the art methods, and provides sequence characteristics that allow generation of a set of high confidence error-free sequences. This novel method can be used to increase accuracy of existing and future amplicon sequencing data, particularly where extensive prior knowledge is available about the obtained sequences, for example in analysis of the immunoglobulin VDJ region where Multipass can be combined with a model for the known recombining germline genes. Multipass is available for Roche 454 data at http://www.cbs.dtu.dk/services/MultiPass-1.0 , and the concept can potentially be implemented for other sequencing technologies as well.

The nucleotide sequence and genome organization of Plasmopara halstedii virus.

PubMed

Heller-Dohmen, Marion; Göpfert, Jens C; Pfannstiel, Jens; Spring, Otmar

2011-03-17

Only very few viruses of Oomycetes have been studied in detail. Isometric virions were found in different isolates of the oomycete Plasmopara halstedii, the downy mildew pathogen of sunflower. However, complete nucleotide sequences and data on the genome organization were lacking. Viral RNA of different P. halstedii isolates was subjected to nucleotide sequencing and analysis of the viral genome. The N-terminal sequence of the viral coat protein was determined using Top-Down MALDI-TOF analysis. The complete nucleotide sequences of both single-stranded RNA segments (RNA1 and RNA2) were established. RNA1 consisted of 2793 nucleotides (nt) exclusive its 3' poly(A) tract and a single open-reading frame (ORF1) of 2745 nt. ORF1 was framed by a 5' untranslated region (5' UTR) of 18 nt and a 3' untranslated region (3' UTR) of 30 nt. ORF1 contained motifs of RNA-dependent RNA polymerases (RdRp) and showed similarities to RdRp of Scleropthora macrospora virus A (SmV A) and viruses within the Nodaviridae family. RNA2 consisted of 1526 nt exclusive its 3' poly(A) tract and a second ORF (ORF2) of 1128 nt. ORF2 coded for the single viral coat protein (CP) and was framed by a 5' UTR of 164 nt and a 3' UTR of 234 nt. The deduced amino acid sequence of ORF2 was verified by nano-LC-ESI-MS/MS experiments. Top-Down MALDI-TOF analysis revealed the N-terminal sequence of the CP. The N-terminal sequence represented a region within ORF2 suggesting a proteolytic processing of the CP in vivo. The CP showed similarities to CP of SmV A and viruses within the Tombusviridae family. Fragments of RNA1 (ca. 1.9 kb) and RNA2 (ca. 1.4 kb) were used to analyze the nucleotide sequence variation of virions in different P. halstedii isolates. Viral sequence variation was 0.3% or less regardless of their host's pathotypes, the geographical origin and the sensitivity towards the fungicide metalaxyl. The results showed the presence of a single and new virus type in different P. halstedii isolates. Insignificant viral sequence variation indicated that the virus did not account for differences in pathogenicity of the oomycete P. halstedii.

The immediate upstream region of the 5′-UTR from the AUG start codon has a pronounced effect on the translational efficiency in Arabidopsis thaliana

PubMed Central

Kim, Younghyun; Lee, Goeun; Jeon, Eunhyun; Sohn, Eun ju; Lee, Yongjik; Kang, Hyangju; Lee, Dong wook; Kim, Dae Heon; Hwang, Inhwan

2014-01-01

The nucleotide sequence around the translational initiation site is an important cis-acting element for post-transcriptional regulation. However, it has not been fully understood how the sequence context at the 5′-untranslated region (5′-UTR) affects the translational efficiency of individual mRNAs. In this study, we provide evidence that the 5′-UTRs of Arabidopsis genes showing a great difference in the nucleotide sequence vary greatly in translational efficiency with more than a 200-fold difference. Of the four types of nucleotides, the A residue was the most favourable nucleotide from positions −1 to −21 of the 5′-UTRs in Arabidopsis genes. In particular, the A residue in the 5′-UTR from positions −1 to −5 was required for a high-level translational efficiency. In contrast, the T residue in the 5′-UTR from positions −1 to −5 was the least favourable nucleotide in translational efficiency. Furthermore, the effect of the sequence context in the −1 to −21 region of the 5′-UTR was conserved in different plant species. Based on these observations, we propose that the sequence context immediately upstream of the AUG initiation codon plays a crucial role in determining the translational efficiency of plant genes. PMID:24084084

RNAi-mediated endogene silencing in strawberry fruit: detection of primary and secondary siRNAs by deep sequencing.

PubMed

Härtl, Katja; Kalinowski, Gregor; Hoffmann, Thomas; Preuss, Anja; Schwab, Wilfried

2017-05-01

RNA interference (RNAi) has been exploited as a reverse genetic tool for functional genomics in the nonmodel species strawberry (Fragaria × ananassa) since 2006. Here, we analysed for the first time different but overlapping nucleotide sections (>200 nt) of two endogenous genes, FaCHS (chalcone synthase) and FaOMT (O-methyltransferase), as inducer sequences and a transitive vector system to compare their gene silencing efficiencies. In total, ten vectors were assembled each containing the nucleotide sequence of one fragment in sense and corresponding antisense orientation separated by an intron (inverted hairpin construct, ihp). All sequence fragments along the full lengths of both target genes resulted in a significant down-regulation of the respective gene expression and related metabolite levels. Quantitative PCR data and successful application of a transitive vector system coinciding with a phenotypic change suggested propagation of the silencing signal. The spreading of the signal in strawberry fruit in the 3' direction was shown for the first time by the detection of secondary small interfering RNAs (siRNAs) outside of the primary targets by deep sequencing. Down-regulation of endogenes by the transitive method was less effective than silencing by ihp constructs probably because the numbers of primary siRNAs exceeded the quantity of secondary siRNAs by three orders of magnitude. Besides, we observed consistent hotspots of primary and secondary siRNA formation along the target sequence which fall within a distance of less than 200 nt. Thus, ihp vectors seem to be superior over the transitive vector system for functional genomics in strawberry fruit. © 2016 The Authors. Plant Biotechnology Journal published by Society for Experimental Biology and The Association of Applied Biologists and John Wiley & Sons Ltd.

A genome sequence resource for the aye-aye (Daubentonia madagascariensis), a nocturnal lemur from Madagascar.

PubMed

Perry, George H; Reeves, Darryl; Melsted, Páll; Ratan, Aakrosh; Miller, Webb; Michelini, Katelyn; Louis, Edward E; Pritchard, Jonathan K; Mason, Christopher E; Gilad, Yoav

2012-01-01

We present a high-coverage draft genome assembly of the aye-aye (Daubentonia madagascariensis), a highly unusual nocturnal primate from Madagascar. Our assembly totals ~3.0 billion bp (3.0 Gb), roughly the size of the human genome, comprised of ~2.6 million scaffolds (N50 scaffold size = 13,597 bp) based on short paired-end sequencing reads. We compared the aye-aye genome sequence data with four other published primate genomes (human, chimpanzee, orangutan, and rhesus macaque) as well as with the mouse and dog genomes as nonprimate outgroups. Unexpectedly, we observed strong evidence for a relatively slow substitution rate in the aye-aye lineage compared with these and other primates. In fact, the aye-aye branch length is estimated to be ~10% shorter than that of the human lineage, which is known for its low substitution rate. This finding may be explained, in part, by the protracted aye-aye life-history pattern, including late weaning and age of first reproduction relative to other lemurs. Additionally, the availability of this draft lemur genome sequence allowed us to polarize nucleotide and protein sequence changes to the ancestral primate lineage-a critical period in primate evolution, for which the relevant fossil record is sparse. Finally, we identified 293,800 high-confidence single nucleotide polymorphisms in the donor individual for our aye-aye genome sequence, a captive-born individual from two wild-born parents. The resulting heterozygosity estimate of 0.051% is the lowest of any primate studied to date, which is understandable considering the aye-aye's extensive home-range size and relatively low population densities. Yet this level of genetic diversity also suggests that conservation efforts benefiting this unusual species should be prioritized, especially in the face of the accelerating degradation and fragmentation of Madagascar's forests.

Drosophila Nora virus capsid proteins differ from those of other picorna-like viruses.

PubMed

Ekström, Jens-Ola; Habayeb, Mazen S; Srivastava, Vaibhav; Kieselbach, Thomas; Wingsle, Gunnar; Hultmark, Dan

2011-09-01

The recently discovered Nora virus from Drosophila melanogaster is a single-stranded RNA virus. Its published genomic sequence encodes a typical picorna-like cassette of replicative enzymes, but no capsid proteins similar to those in other picorna-like viruses. We have now done additional sequencing at the termini of the viral genome, extending it by 455 nucleotides at the 5' end, but no more coding sequence was found. The completeness of the final 12,333-nucleotide sequence was verified by the production of infectious virus from the cloned genome. To identify the capsid proteins, we purified Nora virus particles and analyzed their proteins by mass spectrometry. Our results show that the capsid is built from three major proteins, VP4A, B and C, encoded in the fourth open reading frame of the viral genome. The viral particles also contain traces of a protein from the third open reading frame, VP3. VP4A and B are not closely related to other picorna-like virus capsid proteins in sequence, but may form similar jelly roll folds. VP4C differs from the others and is predicted to have an essentially α-helical conformation. In a related virus, identified from EST database sequences from Nasonia parasitoid wasps, VP4C is encoded in a separate open reading frame, separated from VP4A and B by a frame-shift. This opens a possibility that VP4C is produced in non-equimolar quantities. Altogether, our results suggest that the Nora virus capsid has a different protein organization compared to the order Picornavirales. Copyright © 2011 Elsevier B.V. All rights reserved.

Nucleotide Sequence and Genetic Structure of a Novel Carbaryl Hydrolase Gene (cehA) from Rhizobium sp. Strain AC100

PubMed Central

Hashimoto, Masayuki; Fukui, Mitsuru; Hayano, Kouichi; Hayatsu, Masahito

2002-01-01

Rhizobium sp. strain AC100, which is capable of degrading carbaryl (1-naphthyl-N-methylcarbamate), was isolated from soil treated with carbaryl. This bacterium hydrolyzed carbaryl to 1-naphthol and methylamine. Carbaryl hydrolase from the strain was purified to homogeneity, and its N-terminal sequence, molecular mass (82 kDa), and enzymatic properties were determined. The purified enzyme hydrolyzed 1-naphthyl acetate and 4-nitrophenyl acetate indicating that the enzyme is an esterase. We then cloned the carbaryl hydrolase gene (cehA) from the plasmid DNA of the strain and determined the nucleotide sequence of the 10-kb region containing cehA. No homologous sequences were found by a database homology search using the nucleotide and deduced amino acid sequences of the cehA gene. Six open reading frames including the cehA gene were found in the 10-kb region, and sequencing analysis shows that the cehA gene is flanked by two copies of insertion sequence-like sequence, suggesting that it makes part of a composite transposon. PMID:11872471

The complete nucleotide sequence and genome organization of a novel betaflexivirus infecting Citrullus lanatus.

PubMed

Xin, Min; Zhang, Peipei; Liu, Wenwen; Ren, Yingdang; Cao, Mengji; Wang, Xifeng

2017-10-01

The complete nucleotide sequence of a novel positive single-stranded (+ss) RNA virus, tentatively named watermelon virus A (WVA), was determined using a combination of three methods: RNA sequencing, small RNA sequencing, and Sanger sequencing. The full genome of WVA is comprised of 8,372 nucleotides (nt), excluding the poly (A) tail, and contains four open reading frames (ORFs). The largest ORF, ORF1 encodes a putative replication-associated polyprotein (RP) with three conserved domains. ORF2 and ORF4 encode a movement protein (MP) and coat protein (CP), respectively. The putative product encoded by ORF3, of an estimated molecular mass of 25 kDa, has no significant similarity with other proteins. Identity and phylogenetic analysis indicate that WVA is a new virus, closely related to members of the family Betaflexiviridae. However, the final taxonomic allocation of WVA within the family is yet to be determined.

Manipulation of lignin composition in plants using a tissue-specific promoter

DOEpatents

Chapple, Clinton C. S.

2003-08-26

The present invention relates to methods and materials in the field of molecular biology, the manipulation of the phenylpropanoid pathway and the regulation of proteins synthesis through plant genetic engineering. More particularly, the invention relates to the introduction of a foreign nucleotide sequence into a plant genome, wherein the introduction of the nucleotide sequence effects an increase in the syringyl content of the plant's lignin. In one specific aspect, the invention relates to methods for modifying the plant lignin composition in a plant cell by the introduction there into of a foreign nucleotide sequence comprising at issue specific plant promoter sequence and a sequence encoding an active ferulate-5-hydroxylase (F5H) enzyme. Plant transformants harboring an inventive promoter-F5H construct demonstrate increased levels of syringyl monomer residues in their lignin, rendering the polymer more readily delignified and, thereby, rendering the plant more readily pulped or digested.

Dietary nitrogen alters codon bias and genome composition in parasitic microorganisms.

PubMed

Seward, Emily A; Kelly, Steven

2016-11-15

Genomes are composed of long strings of nucleotide monomers (A, C, G and T) that are either scavenged from the organism's environment or built from metabolic precursors. The biosynthesis of each nucleotide differs in atomic requirements with different nucleotides requiring different quantities of nitrogen atoms. However, the impact of the relative availability of dietary nitrogen on genome composition and codon bias is poorly understood. Here we show that differential nitrogen availability, due to differences in environment and dietary inputs, is a major determinant of genome nucleotide composition and synonymous codon use in both bacterial and eukaryotic microorganisms. Specifically, low nitrogen availability species use nucleotides that require fewer nitrogen atoms to encode the same genes compared to high nitrogen availability species. Furthermore, we provide a novel selection-mutation framework for the evaluation of the impact of metabolism on gene sequence evolution and show that it is possible to predict the metabolic inputs of related organisms from an analysis of the raw nucleotide sequence of their genes. Taken together, these results reveal a previously hidden relationship between cellular metabolism and genome evolution and provide new insight into how genome sequence evolution can be influenced by adaptation to different diets and environments.

Alfalfa virus S, a new species in the family Alphaflexiviridae

USDA-ARS?s Scientific Manuscript database

A new species of the family Alphaflexiviridae provisionally named alfalfa virus S (AVS) was discovered in alfalfa samples originating from Sudan. A complete nucleotide sequence of the viral genome consisting of 8,349 nucleotides excluding the 3’ poly(A) tail was determined by high throughput sequenc...

Developing Single Nucleotide Polymorphism (SNP) markers from transcriptome sequences for the identification of longan (Dimocarpus longan) germplasm

USDA-ARS?s Scientific Manuscript database

Longan (Dimocarpus longan Lour.) is an important tropical fruit tree crop. Accurate varietal identification is essential for germplasm management and breeding. Using longan transcriptome sequences from public databases, we developed single nucleotide polymorphism (SNP) markers; validated 60 SNPs in...

Molecular Characterization of an Avian Astrovirus

PubMed Central

Koci, Matthew D.; Seal, Bruce S.; Schultz-Cherry, Stacey

2000-01-01

Astroviruses are known to cause enteric disease in several animal species, including turkeys. However, only human astroviruses have been well characterized at the nucleotide level. Herein we report the nucleotide sequence, genomic organization, and predicted amino acid sequence of a turkey astrovirus isolated from poults with an emerging enteric disease. PMID:10846102

A new single-nucleotide polymorphisms database for rainbow trout generated through whole genome resequencing of selected samples

USDA-ARS?s Scientific Manuscript database

Single-nucleotide polymorphisms (SNPs) are highly abundant markers, which are broadly distributed in animal genomes. For rainbow trout, SNP discovery has been done through sequencing of restriction-site associated DNA (RAD) libraries, reduced representation libraries (RRL), RNA sequencing, and whole...

Nucleotide sequencing and identification of some wild mushrooms.

PubMed

Das, Sudip Kumar; Mandal, Aninda; Datta, Animesh K; Gupta, Sudha; Paul, Rita; Saha, Aditi; Sengupta, Sonali; Dubey, Priyanka Kumari

2013-01-01

The rDNA-ITS (Ribosomal DNA Internal Transcribed Spacers) fragment of the genomic DNA of 8 wild edible mushrooms (collected from Eastern Chota Nagpur Plateau of West Bengal, India) was amplified using ITS1 (Internal Transcribed Spacers 1) and ITS2 primers and subjected to nucleotide sequence determination for identification of mushrooms as mentioned. The sequences were aligned using ClustalW software program. The aligned sequences revealed identity (homology percentage from GenBank data base) of Amanita hemibapha [CN (Chota Nagpur) 1, % identity 99 (JX844716.1)], Amanita sp. [CN 2, % identity 98 (JX844763.1)], Astraeus hygrometricus [CN 3, % identity 87 (FJ536664.1)], Termitomyces sp. [CN 4, % identity 90 (JF746992.1)], Termitomyces sp. [CN 5, % identity 99 (GU001667.1)], T. microcarpus [CN 6, % identity 82 (EF421077.1)], Termitomyces sp. [CN 7, % identity 76 (JF746993.1)], and Volvariella volvacea [CN 8, % identity 100 (JN086680.1)]. Although out of 8 mushrooms 4 could be identified up to species level, the nucleotide sequences of the rest may be relevant to further characterization. A phylogenetic tree is constructed using Neighbor-Joining method showing interrelationship between/among the mushrooms. The determined nucleotide sequences of the mushrooms may provide additional information enriching GenBank database aiding to molecular taxonomy and facilitating its domestication and characterization for human benefits.

Ariadne: a database search engine for identification and chemical analysis of RNA using tandem mass spectrometry data.

PubMed

Nakayama, Hiroshi; Akiyama, Misaki; Taoka, Masato; Yamauchi, Yoshio; Nobe, Yuko; Ishikawa, Hideaki; Takahashi, Nobuhiro; Isobe, Toshiaki

2009-04-01

We present here a method to correlate tandem mass spectra of sample RNA nucleolytic fragments with an RNA nucleotide sequence in a DNA/RNA sequence database, thereby allowing tandem mass spectrometry (MS/MS)-based identification of RNA in biological samples. Ariadne, a unique web-based database search engine, identifies RNA by two probability-based evaluation steps of MS/MS data. In the first step, the software evaluates the matches between the masses of product ions generated by MS/MS of an RNase digest of sample RNA and those calculated from a candidate nucleotide sequence in a DNA/RNA sequence database, which then predicts the nucleotide sequences of these RNase fragments. In the second step, the candidate sequences are mapped for all RNA entries in the database, and each entry is scored for a function of occurrences of the candidate sequences to identify a particular RNA. Ariadne can also predict post-transcriptional modifications of RNA, such as methylation of nucleotide bases and/or ribose, by estimating mass shifts from the theoretical mass values. The method was validated with MS/MS data of RNase T1 digests of in vitro transcripts. It was applied successfully to identify an unknown RNA component in a tRNA mixture and to analyze post-transcriptional modification in yeast tRNA(Phe-1).

PCV: An Alignment Free Method for Finding Homologous Nucleotide Sequences and its Application in Phylogenetic Study.

PubMed

Kumar, Rajnish; Mishra, Bharat Kumar; Lahiri, Tapobrata; Kumar, Gautam; Kumar, Nilesh; Gupta, Rahul; Pal, Manoj Kumar

2017-06-01

Online retrieval of the homologous nucleotide sequences through existing alignment techniques is a common practice against the given database of sequences. The salient point of these techniques is their dependence on local alignment techniques and scoring matrices the reliability of which is limited by computational complexity and accuracy. Toward this direction, this work offers a novel way for numerical representation of genes which can further help in dividing the data space into smaller partitions helping formation of a search tree. In this context, this paper introduces a 36-dimensional Periodicity Count Value (PCV) which is representative of a particular nucleotide sequence and created through adaptation from the concept of stochastic model of Kolekar et al. (American Institute of Physics 1298:307-312, 2010. doi: 10.1063/1.3516320 ). The PCV construct uses information on physicochemical properties of nucleotides and their positional distribution pattern within a gene. It is observed that PCV representation of gene reduces computational cost in the calculation of distances between a pair of genes while being consistent with the existing methods. The validity of PCV-based method was further tested through their use in molecular phylogeny constructs in comparison with that using existing sequence alignment methods.

Sequence of rat alpha- and gamma-casein mRNAs: evolutionary comparison of the calcium-dependent rat casein multigene family.

PubMed Central

Hobbs, A A; Rosen, J M

1982-01-01

The complete sequences of rat alpha- and gamma-casein mRNAs have been determined. The 1402-nucleotide alpha- and 864-nucleotide gamma-casein mRNAs both encode 15 amino acid signal peptides and mature proteins of 269 and 164 residues, respectively. Considerable homology between the 5' non-coding regions, and the regions encoding the signal peptides and the phosphorylation sites, in these mRNAs as compared to several other rodent casein mRNAs, was observed. Significant homology was also detected between rat alpha- and bovine alpha s1-casein. Comparison of the rodent and bovine sequences suggests that the caseins evolved at about the time of the appearance of the primitive mammals. This may have occurred by intragenic duplication of a nucleotide sequence encoding a primitive phosphorylation site, -(Ser)n-Glu-Glu-, and intergenic duplication resulting in the small casein multigene family. A unique feature of the rat alpha-casein sequence is an insertion in the coding region containing 10 repeated elements of 18 nucleotides each. This insertion appears to have occurred 7-12 million years ago, just prior to the divergence of rat and mouse. Images PMID:6298707

EvoDB: a database of evolutionary rate profiles, associated protein domains and phylogenetic trees for PFAM-A

PubMed Central

Ndhlovu, Andrew; Durand, Pierre M.; Hazelhurst, Scott

2015-01-01

The evolutionary rate at codon sites across protein-coding nucleotide sequences represents a valuable tier of information for aligning sequences, inferring homology and constructing phylogenetic profiles. However, a comprehensive resource for cataloguing the evolutionary rate at codon sites and their corresponding nucleotide and protein domain sequence alignments has not been developed. To address this gap in knowledge, EvoDB (an Evolutionary rates DataBase) was compiled. Nucleotide sequences and their corresponding protein domain data including the associated seed alignments from the PFAM-A (protein family) database were used to estimate evolutionary rate (ω = dN/dS) profiles at codon sites for each entry. EvoDB contains 98.83% of the gapped nucleotide sequence alignments and 97.1% of the evolutionary rate profiles for the corresponding information in PFAM-A. As the identification of codon sites under positive selection and their position in a sequence profile is usually the most sought after information for molecular evolutionary biologists, evolutionary rate profiles were determined under the M2a model using the CODEML algorithm in the PAML (Phylogenetic Analysis by Maximum Likelihood) suite of software. Validation of nucleotide sequences against amino acid data was implemented to ensure high data quality. EvoDB is a catalogue of the evolutionary rate profiles and provides the corresponding phylogenetic trees, PFAM-A alignments and annotated accession identifier data. In addition, the database can be explored and queried using known evolutionary rate profiles to identify domains under similar evolutionary constraints and pressures. EvoDB is a resource for evolutionary, phylogenetic studies and presents a tier of information untapped by current databases. Database URL: http://www.bioinf.wits.ac.za/software/fire/evodb PMID:26140928

DNA Sequence-Dependent Ionic Currents in Ultra-Small Solid-State Nanopores†

PubMed Central

Comer, Jeffrey

2016-01-01

Measurements of ionic currents through nanopores partially blocked by DNA have emerged as a powerful method for characterization of the DNA nucleotide sequence. Although the effect of the nucleotide sequence on the nanopore blockade current has been experimentally demonstrated, prediction and interpretation of such measurements remain a formidable challenge. Using atomic resolution computational approaches, here we show how the sequence, molecular conformation, and pore geometry affect the blockade ionic current in model solid-state nanopores. We demonstrate that the blockade current from a DNA molecule is determined by the chemical identities and conformations of at least three consecutive nucleotides. We find the blockade currents produced by the nucleotide triplets to vary considerably with their nucleotide sequence despite having nearly identical molecular conformations. Encouragingly, we find blockade current differences as large as 25% for single-base substitutions in ultra small (1.6 nm × 1.1 nm cross section; 2 nm length) solid-state nanopores. Despite the complex dependence of the blockade current on the sequence and conformation of the DNA triplets, we find that, under many conditions, the number of thymine bases is positively correlated with the current, whereas the number of purine bases and the presence of both purine and pyrimidines in the triplet are negatively correlated with the current. Based on these observations, we construct a simple theoretical model that relates the ion current to the base content of a solid-state nanopore. Furthermore, we show that compact conformations of DNA in narrow pores provide the greatest signal-to-noise ratio for single base detection, whereas reduction of the nanopore length increases the ionic current noise. Thus, the sequence dependence of nanopore blockade current can be theoretically rationalized, although the predictions will likely need to be customized for each nanopore type. PMID:27103233

[Replication of Streptomyces plasmids: the DNA nucleotide sequence of plasmid pSB 24.2].

PubMed

Bolotin, A P; Sorokin, A V; Aleksandrov, N N; Danilenko, V N; Kozlov, Iu I

1985-11-01

The nucleotide sequence of DNA in plasmid pSB 24.2, a natural deletion derivative of plasmid pSB 24.1 isolated from S. cyanogenus was studied. The plasmid amounted by its size to 3706 nucleotide pairs. The G-C composition was equal to 73 per cent. The analysis of the DNA structure in plasmid pSB 24.2 revealed the protein-encoding sequence of DNA, the continuity of which was significant for replication of the plasmid containing more than 1300 nucleotide pairs. The analysis also revealed two A-T-rich areas of DNA, the G-C composition of which was less than 55 per cent and a DNA area with a branched pin structure. The results may be of value in investigation of plasmid replication in actinomycetes and experimental cloning of DNA with this plasmid as a vector.

In-cell RNA structure probing with SHAPE-MaP.

PubMed

Smola, Matthew J; Weeks, Kevin M

2018-06-01

This protocol is an extension to: Nat. Protoc. 10, 1643-1669 (2015); doi:10.1038/nprot.2015.103; published online 01 October 2015RNAs play key roles in many cellular processes. The underlying structure of RNA is an important determinant of how transcripts function, are processed, and interact with RNA-binding proteins and ligands. RNA structure analysis by selective 2'-hydroxyl acylation analyzed by primer extension (SHAPE) takes advantage of the reactivity of small electrophilic chemical probes that react with the 2'-hydroxyl group to assess RNA structure at nucleotide resolution. When coupled with mutational profiling (MaP), in which modified nucleotides are detected as internal miscodings during reverse transcription and then read out by massively parallel sequencing, SHAPE yields quantitative per-nucleotide measurements of RNA structure. Here, we provide an extension to our previous in vitro SHAPE-MaP protocol with detailed guidance for undertaking and analyzing SHAPE-MaP probing experiments in live cells. The MaP strategy works for both abundant-transcriptome experiments and for cellular RNAs of low to moderate abundance, which are not well examined by whole-transcriptome methods. In-cell SHAPE-MaP, performed in roughly 3 d, can be applied in cell types ranging from bacteria to cultured mammalian cells and is compatible with a variety of structure-probing reagents. We detail several strategies by which in-cell SHAPE-MaP can inform new biological hypotheses and emphasize downstream analyses that reveal sequence or structure motifs important for RNA interactions in cells.

Sequence-specific bias correction for RNA-seq data using recurrent neural networks.

PubMed

Zhang, Yao-Zhong; Yamaguchi, Rui; Imoto, Seiya; Miyano, Satoru

2017-01-25

The recent success of deep learning techniques in machine learning and artificial intelligence has stimulated a great deal of interest among bioinformaticians, who now wish to bring the power of deep learning to bare on a host of bioinformatical problems. Deep learning is ideally suited for biological problems that require automatic or hierarchical feature representation for biological data when prior knowledge is limited. In this work, we address the sequence-specific bias correction problem for RNA-seq data redusing Recurrent Neural Networks (RNNs) to model nucleotide sequences without pre-determining sequence structures. The sequence-specific bias of a read is then calculated based on the sequence probabilities estimated by RNNs, and used in the estimation of gene abundance. We explore the application of two popular RNN recurrent units for this task and demonstrate that RNN-based approaches provide a flexible way to model nucleotide sequences without knowledge of predetermined sequence structures. Our experiments show that training a RNN-based nucleotide sequence model is efficient and RNN-based bias correction methods compare well with the-state-of-the-art sequence-specific bias correction method on the commonly used MAQC-III data set. RNNs provides an alternative and flexible way to calculate sequence-specific bias without explicitly pre-determining sequence structures.

Structural outline of the detailed mechanism for elongation factor Ts-mediated guanine nucleotide exchange on elongation factor Tu.

PubMed

Thirup, Søren S; Van, Lan Bich; Nielsen, Tine K; Knudsen, Charlotte R

2015-07-01

Translation elongation factor EF-Tu belongs to the superfamily of guanine-nucleotide binding proteins, which play key cellular roles as regulatory switches. All G-proteins require activation via exchange of GDP for GTP to carry out their respective tasks. Often, guanine-nucleotide exchange factors are essential to this process. During translation, EF-Tu:GTP transports aminoacylated tRNA to the ribosome. GTP is hydrolyzed during this process, and subsequent reactivation of EF-Tu is catalyzed by EF-Ts. The reaction path of guanine-nucleotide exchange is structurally poorly defined for EF-Tu and EF-Ts. We have determined the crystal structures of the following reaction intermediates: two structures of EF-Tu:GDP:EF-Ts (2.2 and 1.8Å resolution), EF-Tu:PO4:EF-Ts (1.9Å resolution), EF-Tu:GDPNP:EF-Ts (2.2Å resolution) and EF-Tu:GDPNP:pulvomycin:Mg(2+):EF-Ts (3.5Å resolution). These structures provide snapshots throughout the entire exchange reaction and suggest a mechanism for the release of EF-Tu in its GTP conformation. An inferred sequence of events during the exchange reaction is presented. Copyright © 2015 The Authors. Published by Elsevier Inc. All rights reserved.

Approach for classification and taxonomy within family Rickettsiaceae based on the Formal Order Analysis.

PubMed

Shpynov, S; Pozdnichenko, N; Gumenuk, A

2015-01-01

Genome sequences of 36 Rickettsia and Orientia were analyzed using Formal Order Analysis (FOA). This approach takes into account arrangement of nucleotides in each sequence. A numerical characteristic, the average distance (remoteness) - "g" was used to compare of genomes. Our results corroborated previous separation of three groups within the genus Rickettsia, including typhus group, classic spotted fever group, and the ancestral group and Orientia as a separate genus. Rickettsia felis URRWXCal2 and R. akari Hartford were not in the same group based on FOA, therefore designation of a so-called transitional Rickettsia group could not be confirmed with this approach. Copyright © 2015 Institut Pasteur. Published by Elsevier Masson SAS. All rights reserved.

Promoter for Sindbis virus RNA-dependent subgenomic RNA transcription.

PubMed

Levis, R; Schlesinger, S; Huang, H V

1990-04-01

Sindbis virus is a positive-strand RNA enveloped virus, a member of the Alphavirus genus of the Togaviridae family. Two species of mRNA are synthesized in cells infected with Sindbis virus; one, the 49S RNA, is the genomic RNA; the other, the 26S RNA, is a subgenomic RNA that is identical in sequence to the 3' one-third of the genomic RNA. Ou et al. (J.-H. Ou, C. M. Rice, L. Dalgarno, E. G. Strauss, and J. H. Strauss, Proc. Natl. Acad. Sci. USA 79:5235-5239, 1982) identified a highly conserved region 19 nucleotides upstream and 2 nucleotides downstream from the start of the 26S RNA and proposed that in the negative-strand template, these nucleotides compose the promoter for directing the synthesis of the subgenomic RNA. Defective interfering (DI) RNAs of Sindbis virus were used to test this proposal. A 227-nucleotide sequence encompassing 98 nucleotides upstream and 117 nucleotides downstream from the start site of the Sindbis virus subgenomic RNA was inserted into a DI genome. The DI RNA containing the insert was replicated and packaged in the presence of helper virus, and cells infected with these DI particles produced a subgenomic RNA of the size and sequence expected if the promoter was functional. The initiating nucleotide was identical to that used for Sindbis virus subgenomic mRNA synthesis. Deletion analysis showed that the minimal region required to detect transcription of a subgenomic RNA from the negative-strand template of a DI RNA was 18 or 19 nucleotides upstream and 5 nucleotides downstream from the start of the subgenomic RNA.

Design and characterization of a nanopore-coupled polymerase for single-molecule DNA sequencing by synthesis on an electrode array

PubMed Central

Stranges, P. Benjamin; Palla, Mirkó; Kalachikov, Sergey; Nivala, Jeff; Dorwart, Michael; Trans, Andrew; Kumar, Shiv; Porel, Mintu; Chien, Minchen; Tao, Chuanjuan; Morozova, Irina; Li, Zengmin; Shi, Shundi; Aberra, Aman; Arnold, Cleoma; Yang, Alexander; Aguirre, Anne; Harada, Eric T.; Korenblum, Daniel; Pollard, James; Bhat, Ashwini; Gremyachinskiy, Dmitriy; Bibillo, Arek; Chen, Roger; Davis, Randy; Russo, James J.; Fuller, Carl W.; Roever, Stefan; Ju, Jingyue; Church, George M.

2016-01-01

Scalable, high-throughput DNA sequencing is a prerequisite for precision medicine and biomedical research. Recently, we presented a nanopore-based sequencing-by-synthesis (Nanopore-SBS) approach, which used a set of nucleotides with polymer tags that allow discrimination of the nucleotides in a biological nanopore. Here, we designed and covalently coupled a DNA polymerase to an α-hemolysin (αHL) heptamer using the SpyCatcher/SpyTag conjugation approach. These porin–polymerase conjugates were inserted into lipid bilayers on a complementary metal oxide semiconductor (CMOS)-based electrode array for high-throughput electrical recording of DNA synthesis. The designed nanopore construct successfully detected the capture of tagged nucleotides complementary to a DNA base on a provided template. We measured over 200 tagged-nucleotide signals for each of the four bases and developed a classification method to uniquely distinguish them from each other and background signals. The probability of falsely identifying a background event as a true capture event was less than 1.2%. In the presence of all four tagged nucleotides, we observed sequential additions in real time during polymerase-catalyzed DNA synthesis. Single-polymerase coupling to a nanopore, in combination with the Nanopore-SBS approach, can provide the foundation for a low-cost, single-molecule, electronic DNA-sequencing platform. PMID:27729524

Molecular detection of viral agents in free-ranging and captive neotropical felids in Brazil.

PubMed

Furtado, Mariana M; Taniwaki, Sueli A; de Barros, Iracema N; Brandão, Paulo E; Catão-Dias, José L; Cavalcanti, Sandra; Cullen, Laury; Filoni, Claudia; Jácomo, Anah T de Almeida; Jorge, Rodrigo S P; Silva, Nairléia Dos Santos; Silveira, Leandro; Ferreira Neto, José S

2017-09-01

We describe molecular testing for felid alphaherpesvirus 1 (FHV-1), carnivore protoparvovirus 1 (CPPV-1), feline calicivirus (FCV), alphacoronavirus 1 (feline coronavirus [FCoV]), feline leukemia virus (FeLV), feline immunodeficiency virus (FIV), and canine distemper virus (CDV) in whole blood samples of 109 free-ranging and 68 captive neotropical felids from Brazil. Samples from 2 jaguars ( Panthera onca) and 1 oncilla ( Leopardus tigrinus) were positive for FHV-1; 2 jaguars, 1 puma ( Puma concolor), and 1 jaguarundi ( Herpairulus yagouaroundi) tested positive for CPPV-1; and 1 puma was positive for FIV. Based on comparison of 103 nucleotides of the UL24-UL25 gene, the FHV-1 sequences were 99-100% similar to the FHV-1 strain of domestic cats. Nucleotide sequences of CPPV-1 were closely related to sequences detected in other wild carnivores, comparing 294 nucleotides of the VP1 gene. The FIV nucleotide sequence detected in the free-ranging puma, based on comparison of 444 nucleotides of the pol gene, grouped with other lentiviruses described in pumas, and had 82.4% identity with a free-ranging puma from Yellowstone Park and 79.5% with a captive puma from Brazil. Our data document the circulation of FHV-1, CPPV-1, and FIV in neotropical felids in Brazil.

T box transcription antitermination riboswitch: Influence of nucleotide sequence and orientation on tRNA binding by the antiterminator element

PubMed Central

Fauzi, Hamid; Agyeman, Akwasi; Hines, Jennifer V.

2008-01-01

Many bacteria utilize riboswitch transcription regulation to monitor and appropriately respond to cellular levels of important metabolites or effector molecules. The T box transcription antitermination riboswitch responds to cognate uncharged tRNA by specifically stabilizing an antiterminator element in the 5′-untranslated mRNA leader region and precluding formation of a thermodynamically more stable terminator element. Stabilization occurs when the tRNA acceptor end base pairs with the first four nucleotides in the seven nucleotide bulge of the highly conserved antiterminator element. The significance of the conservation of the antiterminator bulge nucleotides that do not base pair with the tRNA is unknown, but they are required for optimal function. In vitro selection was used to determine if the isolated antiterminator bulge context alone dictates the mode in which the tRNA acceptor end binds the bulge nucleotides. No sequence conservation beyond complementarity was observed and the location was not constrained to the first four bases of the bulge. The results indicate that formation of a structure that recognizes the tRNA acceptor end in isolation is not the determinant driving force for the high phylogenetic sequence conservation observed within the antiterminator bulge. Additional factors or T box leader features more likely influenced the phylogenetic sequence conservation. PMID:19152843

A space-efficient algorithm for local similarities.

PubMed

Huang, X Q; Hardison, R C; Miller, W

1990-10-01

Existing dynamic-programming algorithms for identifying similar regions of two sequences require time and space proportional to the product of the sequence lengths. Often this space requirement is more limiting than the time requirement. We describe a dynamic-programming local-similarity algorithm that needs only space proportional to the sum of the sequence lengths. The method can also find repeats within a single long sequence. To illustrate the algorithm's potential, we discuss comparison of a 73,360 nucleotide sequence containing the human beta-like globin gene cluster and a corresponding 44,594 nucleotide sequence for rabbit, a problem well beyond the capabilities of other dynamic-programming software.

RoboOligo: software for mass spectrometry data to support manual and de novo sequencing of post-transcriptionally modified ribonucleic acids

PubMed Central

Sample, Paul J.; Gaston, Kirk W.; Alfonzo, Juan D.; Limbach, Patrick A.

2015-01-01

Ribosomal ribonucleic acid (RNA), transfer RNA and other biological or synthetic RNA polymers can contain nucleotides that have been modified by the addition of chemical groups. Traditional Sanger sequencing methods cannot establish the chemical nature and sequence of these modified-nucleotide containing oligomers. Mass spectrometry (MS) has become the conventional approach for determining the nucleotide composition, modification status and sequence of modified RNAs. Modified RNAs are analyzed by MS using collision-induced dissociation tandem mass spectrometry (CID MS/MS), which produces a complex dataset of oligomeric fragments that must be interpreted to identify and place modified nucleosides within the RNA sequence. Here we report the development of RoboOligo, an interactive software program for the robust analysis of data generated by CID MS/MS of RNA oligomers. There are three main functions of RoboOligo: (i) automated de novo sequencing via the local search paradigm. (ii) Manual sequencing with real-time spectrum labeling and cumulative intensity scoring. (iii) A hybrid approach, coined ‘variable sequencing’, which combines the user intuition of manual sequencing with the high-throughput sampling of automated de novo sequencing. PMID:25820423

Molecular characterization of a novel rhabdovirus infecting blackcurrant identified by high-throughput sequencing.

PubMed

Wu, L-P; Yang, T; Liu, H-W; Postman, J; Li, R

2018-05-01

A large contig with sequence similarities to several nucleorhabdoviruses was identified by high-throughput sequencing analysis from a black currant (Ribes nigrum L.) cultivar. The complete genome sequence of this new nucleorhabdovirus is 14,432 nucleotides long. Its genomic organization is very similar to those of unsegmented plant rhabdoviruses, containing six open reading frames in the order 3'-N-P-P3-M-G-L-5. The virus, which is provisionally named "black currant-associated rhabdovirus", is 41-52% identical in its genome nucleotide sequence to other nucleorhabdoviruses and may represent a new species in the genus Nucleorhabdovirus.

PopHuman: the human population genomics browser.

PubMed

Casillas, Sònia; Mulet, Roger; Villegas-Mirón, Pablo; Hervas, Sergi; Sanz, Esteve; Velasco, Daniel; Bertranpetit, Jaume; Laayouni, Hafid; Barbadilla, Antonio

2018-01-04

The 1000 Genomes Project (1000GP) represents the most comprehensive world-wide nucleotide variation data set so far in humans, providing the sequencing and analysis of 2504 genomes from 26 populations and reporting >84 million variants. The availability of this sequence data provides the human lineage with an invaluable resource for population genomics studies, allowing the testing of molecular population genetics hypotheses and eventually the understanding of the evolutionary dynamics of genetic variation in human populations. Here we present PopHuman, a new population genomics-oriented genome browser based on JBrowse that allows the interactive visualization and retrieval of an extensive inventory of population genetics metrics. Efficient and reliable parameter estimates have been computed using a novel pipeline that faces the unique features and limitations of the 1000GP data, and include a battery of nucleotide variation measures, divergence and linkage disequilibrium parameters, as well as different tests of neutrality, estimated in non-overlapping windows along the chromosomes and in annotated genes for all 26 populations of the 1000GP. PopHuman is open and freely available at http://pophuman.uab.cat. © The Author(s) 2017. Published by Oxford University Press on behalf of Nucleic Acids Research.

Structure and possible function of a G-quadruplex in the long terminal repeat of the proviral HIV-1 genome.

PubMed

De Nicola, Beatrice; Lech, Christopher J; Heddi, Brahim; Regmi, Sagar; Frasson, Ilaria; Perrone, Rosalba; Richter, Sara N; Phan, Anh Tuân

2016-07-27

The long terminal repeat (LTR) of the proviral human immunodeficiency virus (HIV)-1 genome is integral to virus transcription and host cell infection. The guanine-rich U3 region within the LTR promoter, previously shown to form G-quadruplex structures, represents an attractive target to inhibit HIV transcription and replication. In this work, we report the structure of a biologically relevant G-quadruplex within the LTR promoter region of HIV-1. The guanine-rich sequence designated LTR-IV forms a well-defined structure in physiological cationic solution. The nuclear magnetic resonance (NMR) structure of this sequence reveals a parallel-stranded G-quadruplex containing a single-nucleotide thymine bulge, which participates in a conserved stacking interaction with a neighboring single-nucleotide adenine loop. Transcription analysis in a HIV-1 replication competent cell indicates that the LTR-IV region may act as a modulator of G-quadruplex formation in the LTR promoter. Consequently, the LTR-IV G-quadruplex structure presented within this work could represent a valuable target for the design of HIV therapeutics. © The Author(s) 2016. Published by Oxford University Press on behalf of Nucleic Acids Research.

Genetic and morphological characterization of Cladobotryum species causing cobweb disease of mushrooms.

PubMed

McKay, G J; Egan, D; Morris, E; Scott, C; Brown, A E

1999-02-01

Cladobotryum dendroides (= Dactylium dendroides) has hitherto been regarded as the major causal agent of cobweb disease of the cultivated mushroom, Agaricus bisporus. Nucleotide sequence data for the internal transcribed spacer (ITS) regions of four Cladobotryum/Hypomyces species reported to be associated with cobweb disease, however, indicate that the most common pathogen is now C. mycophilum. This cobweb pathogen varies somewhat in conidial septation from published descriptions of C. mycophilum and lacks the distinctive colony odor. ITS sequencing revealed minor nucleotide variation which split isolates of the pathogen into three subgroups, two comprising isolates that were sensitive to methylbenzimidazole carbamate (MBC) fungicides and one comprising MBC-resistant isolates. The MBC-resistant isolates, which were only obtained from Ireland and Great Britain, clustered together strongly in randomly amplified polymorphic DNA (RAPD) PCR analysis, suggesting that they may be clonal. The MBC-sensitive isolates were more diverse. A RAPD fragment of 800 to 900 bp, containing a microsatellite and found in the MBC-resistant isolates, also indicated their clonal nature; the microsatellites of these isolates contained the same number of GA repeats. Smaller, polymorphic microsatellites, similarly comprising GA repeats, in the MBC-sensitive isolates in general correlated with their geographic origin.

Genetic and Morphological Characterization of Cladobotryum Species Causing Cobweb Disease of Mushrooms

PubMed Central

McKay, Gareth J.; Egan, Damian; Morris, Elizabeth; Scott, Carol; Brown, Averil E.

1999-01-01

Cladobotryum dendroides (= Dactylium dendroides) has hitherto been regarded as the major causal agent of cobweb disease of the cultivated mushroom, Agaricus bisporus. Nucleotide sequence data for the internal transcribed spacer (ITS) regions of four Cladobotryum/Hypomyces species reported to be associated with cobweb disease, however, indicate that the most common pathogen is now C. mycophilum. This cobweb pathogen varies somewhat in conidial septation from published descriptions of C. mycophilum and lacks the distinctive colony odor. ITS sequencing revealed minor nucleotide variation which split isolates of the pathogen into three subgroups, two comprising isolates that were sensitive to methylbenzimidazole carbamate (MBC) fungicides and one comprising MBC-resistant isolates. The MBC-resistant isolates, which were only obtained from Ireland and Great Britain, clustered together strongly in randomly amplified polymorphic DNA (RAPD) PCR analysis, suggesting that they may be clonal. The MBC-sensitive isolates were more diverse. A RAPD fragment of 800 to 900 bp, containing a microsatellite and found in the MBC-resistant isolates, also indicated their clonal nature; the microsatellites of these isolates contained the same number of GA repeats. Smaller, polymorphic microsatellites, similarly comprising GA repeats, in the MBC-sensitive isolates in general correlated with their geographic origin. PMID:9925589

Investigating intra-host and intra-herd sequence diversity of foot-and-mouth disease virus.

PubMed

King, David J; Freimanis, Graham L; Orton, Richard J; Waters, Ryan A; Haydon, Daniel T; King, Donald P

2016-10-01

Due to the poor-fidelity of the enzymes involved in RNA genome replication, foot-and-mouth disease (FMD) virus samples comprise of unique polymorphic populations. In this study, deep sequencing was utilised to characterise the diversity of FMD virus (FMDV) populations in 6 infected cattle present on a single farm during the series of outbreaks in the UK in 2007. A novel RT-PCR method was developed to amplify a 7.6kb nucleotide fragment encompassing the polyprotein coding region of the FMDV genome. Illumina sequencing of each sample identified the fine polymorphic structures at each nucleotide position, from consensus level changes to variants present at a 0.24% frequency. These data were used to investigate population dynamics of FMDV at both herd and host levels, evaluate the impact of host on the viral swarm structure and to identify transmission links with viruses recovered from other farms in the same series of outbreaks. In 7 samples, from 6 different animals, a total of 5 consensus level variants were identified, in addition to 104 sub-consensus variants of which 22 were shared between 2 or more animals. Further analysis revealed differences in swarm structures from samples derived from the same animal suggesting the presence of distinct viral populations evolving independently at different lesion sites within the same infected animal. Copyright © 2016 The Authors. Published by Elsevier B.V. All rights reserved.

Differential sequence diversity at merozoite surface protein-1 locus of Plasmodium knowlesi from humans and macaques in Thailand.

PubMed

Putaporntip, Chaturong; Thongaree, Siriporn; Jongwutiwes, Somchai

2013-08-01

To determine the genetic diversity and potential transmission routes of Plasmodium knowlesi, we analyzed the complete nucleotide sequence of the gene encoding the merozoite surface protein-1 of this simian malaria (Pkmsp-1), an asexual blood-stage vaccine candidate, from naturally infected humans and macaques in Thailand. Analysis of Pkmsp-1 sequences from humans (n=12) and monkeys (n=12) reveals five conserved and four variable domains. Most nucleotide substitutions in conserved domains were dimorphic whereas three of four variable domains contained complex repeats with extensive sequence and size variation. Besides purifying selection in conserved domains, evidence of intragenic recombination scattering across Pkmsp-1 was detected. The number of haplotypes, haplotype diversity, nucleotide diversity and recombination sites of human-derived sequences exceeded that of monkey-derived sequences. Phylogenetic networks based on concatenated conserved sequences of Pkmsp-1 displayed a character pattern that could have arisen from sampling process or the presence of two independent routes of P. knowlesi transmission, i.e. from macaques to human and from human to humans in Thailand. Copyright © 2013 Elsevier B.V. All rights reserved.

Whole genome sequencing in the prevention and control of Staphylococcus aureus infection.

PubMed

Price, J R; Didelot, X; Crook, D W; Llewelyn, M J; Paul, J

2013-01-01

Staphylococcus aureus remains a leading cause of hospital-acquired infection but weaknesses inherent in currently available typing methods impede effective infection prevention and control. The high resolution offered by whole genome sequencing has the potential to revolutionise our understanding and management of S. aureus infection. To outline the practicalities of whole genome sequencing and discuss how it might shape future infection control practice. We review conventional typing methods and compare these with the potential offered by whole genome sequencing. In contrast with conventional methods, whole genome sequencing discriminates down to single nucleotide differences and allows accurate characterisation of transmission events and outbreaks and additionally provides information about the genetic basis of phenotypic characteristics, including antibiotic susceptibility and virulence. However, translating its potential into routine practice will depend on affordability, acceptable turnaround times and on creating a reliable standardised bioinformatic infrastructure. Whole genome sequencing has the potential to provide a universal test that facilitates outbreak investigation, enables the detection of emerging strains and predicts their clinical importance. Copyright © 2012 The Healthcare Infection Society. Published by Elsevier Ltd. All rights reserved.

Partial bisulfite conversion for unique template sequencing.

PubMed

Kumar, Vijay; Rosenbaum, Julie; Wang, Zihua; Forcier, Talitha; Ronemus, Michael; Wigler, Michael; Levy, Dan

2018-01-25

We introduce a new protocol, mutational sequencing or muSeq, which uses sodium bisulfite to randomly deaminate unmethylated cytosines at a fixed and tunable rate. The muSeq protocol marks each initial template molecule with a unique mutation signature that is present in every copy of the template, and in every fragmented copy of a copy. In the sequenced read data, this signature is observed as a unique pattern of C-to-T or G-to-A nucleotide conversions. Clustering reads with the same conversion pattern enables accurate count and long-range assembly of initial template molecules from short-read sequence data. We explore count and low-error sequencing by profiling 135 000 restriction fragments in a PstI representation, demonstrating that muSeq improves copy number inference and significantly reduces sporadic sequencer error. We explore long-range assembly in the context of cDNA, generating contiguous transcript clusters greater than 3,000 bp in length. The muSeq assemblies reveal transcriptional diversity not observable from short-read data alone. © The Author(s) 2017. Published by Oxford University Press on behalf of Nucleic Acids Research.

First Complete Genome Sequence of an Isolate of Tomato Mottle Mosaic Virus Infecting Plants of Solanum lycopersicum in South America.

PubMed

Nagai, Alice; Duarte, Lígia M L; Chaves, Alexandre L R; Alexandre, Maria A V; Ramos-González, Pedro L; Chabi-Jesus, Camila; Harakava, Ricardo; Dos Santos, Déborah Y A C

2018-05-10

The complete nucleotide sequence of an isolate of tomato mottle mosaic virus (ToMMV) was determined. The virus, originally isolated from symptomatic tomato plants found in a county near the city of São Paulo, Brazil, has a genome with 99% nucleotide sequence identity with ToMMV from Mexico, China, Spain, and the United States. Copyright © 2018 Nagai et al.

A resource of single-nucleotide polymorphisms for rainbow trout generated by restriction-site associated DNA sequencing of doubled haploids

USDA-ARS?s Scientific Manuscript database

Salmonid genomes are considered to be in a pseudo-tetraploid state as a result of an evolutionarily recent genome duplication event. This situation complicates single nucleotide polymorphism (SNP) discovery in rainbow trout as many putative SNPs are actually paralogous sequence variants (PSVs) and ...

Pseudoscorpion mitochondria show rearranged genes and genome-wide reductions of RNA gene sizes and inferred structures, yet typical nucleotide composition bias

PubMed Central

2012-01-01

Background Pseudoscorpions are chelicerates and have historically been viewed as being most closely related to solifuges, harvestmen, and scorpions. No mitochondrial genomes of pseudoscorpions have been published, but the mitochondrial genomes of some lineages of Chelicerata possess unusual features, including short rRNA genes and tRNA genes that lack sequence to encode arms of the canonical cloverleaf-shaped tRNA. Additionally, some chelicerates possess an atypical guanine-thymine nucleotide bias on the major coding strand of their mitochondrial genomes. Results We sequenced the mitochondrial genomes of two divergent taxa from the chelicerate order Pseudoscorpiones. We find that these genomes possess unusually short tRNA genes that do not encode cloverleaf-shaped tRNA structures. Indeed, in one genome, all 22 tRNA genes lack sequence to encode canonical cloverleaf structures. We also find that the large ribosomal RNA genes are substantially shorter than those of most arthropods. We inferred secondary structures of the LSU rRNAs from both pseudoscorpions, and find that they have lost multiple helices. Based on comparisons with the crystal structure of the bacterial ribosome, two of these helices were likely contact points with tRNA T-arms or D-arms as they pass through the ribosome during protein synthesis. The mitochondrial gene arrangements of both pseudoscorpions differ from the ancestral chelicerate gene arrangement. One genome is rearranged with respect to the location of protein-coding genes, the small rRNA gene, and at least 8 tRNA genes. The other genome contains 6 tRNA genes in novel locations. Most chelicerates with rearranged mitochondrial genes show a genome-wide reversal of the CA nucleotide bias typical for arthropods on their major coding strand, and instead possess a GT bias. Yet despite their extensive rearrangement, these pseudoscorpion mitochondrial genomes possess a CA bias on the major coding strand. Phylogenetic analyses of all 13 mitochondrial protein-coding gene sequences consistently yield trees that place pseudoscorpions as sister to acariform mites. Conclusion The well-supported phylogenetic placement of pseudoscorpions as sister to Acariformes differs from some previous analyses based on morphology. However, these two lineages share multiple molecular evolutionary traits, including substantial mitochondrial genome rearrangements, extensive nucleotide substitution, and loss of helices in their inferred tRNA and rRNA structures. PMID:22409411

Nucleotide sequencing and serological evidence that the recently recognized deer tick virus is a genotype of Powassan virus.

PubMed

Beasley, D W; Suderman, M T; Holbrook, M R; Barrett, A D

2001-11-05

Deer tick virus (DTV) is a recently recognized North American virus isolated from Ixodes dammini ticks. Nucleotide sequencing of fragments of structural and non-structural protein genes suggested that this virus was most closely related to the tick-borne flavivirus Powassan (POW), which causes potentially fatal encephalitis in humans. To determine whether DTV represents a new and distinct member of the Flavivirus genus of the family Flaviviridae, we sequenced the structural protein genes and 5' and 3' non-coding regions of this virus. In addition, we compared the reactivity of DTV and POW in hemagglutination inhibition tests with a panel of polyclonal and monoclonal antisera, and performed cross-neutralization experiments using anti-DTV antisera. Nucleotide sequencing revealed a high degree of homology between DTV and POW at both nucleotide (>80% homology) and amino acid (>90% homology) levels, and the two viruses were indistinguishable in serological assays and mouse neuroinvasiveness. On the basis of these results, we suggest that DTV should be classified as a genotype of POW virus.

Tidying Up International Nucleotide Sequence Databases: Ecological, Geographical and Sequence Quality Annotation of ITS Sequences of Mycorrhizal Fungi

PubMed Central

Tedersoo, Leho; Abarenkov, Kessy; Nilsson, R. Henrik; Schüssler, Arthur; Grelet, Gwen-Aëlle; Kohout, Petr; Oja, Jane; Bonito, Gregory M.; Veldre, Vilmar; Jairus, Teele; Ryberg, Martin; Larsson, Karl-Henrik; Kõljalg, Urmas

2011-01-01

Sequence analysis of the ribosomal RNA operon, particularly the internal transcribed spacer (ITS) region, provides a powerful tool for identification of mycorrhizal fungi. The sequence data deposited in the International Nucleotide Sequence Databases (INSD) are, however, unfiltered for quality and are often poorly annotated with metadata. To detect chimeric and low-quality sequences and assign the ectomycorrhizal fungi to phylogenetic lineages, fungal ITS sequences were downloaded from INSD, aligned within family-level groups, and examined through phylogenetic analyses and BLAST searches. By combining the fungal sequence database UNITE and the annotation and search tool PlutoF, we also added metadata from the literature to these accessions. Altogether 35,632 sequences belonged to mycorrhizal fungi or originated from ericoid and orchid mycorrhizal roots. Of these sequences, 677 were considered chimeric and 2,174 of low read quality. Information detailing country of collection, geographical coordinates, interacting taxon and isolation source were supplemented to cover 78.0%, 33.0%, 41.7% and 96.4% of the sequences, respectively. These annotated sequences are publicly available via UNITE (http://unite.ut.ee/) for downstream biogeographic, ecological and taxonomic analyses. In European Nucleotide Archive (ENA; http://www.ebi.ac.uk/ena/), the annotated sequences have a special link-out to UNITE. We intend to expand the data annotation to additional genes and all taxonomic groups and functional guilds of fungi. PMID:21949797

Gause's Principle and the Effect of Resource Partitioning on the Dynamical Coexistence of Replicating Templates

PubMed Central

Szilágyi, András; Zachar, István; Szathmáry, Eörs

2013-01-01

Models of competitive template replication, although basic for replicator dynamics and primordial evolution, have not yet taken different sequences explicitly into account, neither have they analyzed the effect of resource partitioning (feeding on different resources) on coexistence. Here we show by analytical and numerical calculations that Gause's principle of competitive exclusion holds for template replicators if resources (nucleotides) affect growth linearly and coexistence is at fixed point attractors. Cases of complementary or homologous pairing between building blocks with parallel or antiparallel strands show no deviation from the rule that the nucleotide compositions of stably coexisting species must be different and there cannot be more coexisting replicator species than nucleotide types. Besides this overlooked mechanism of template coexistence we show also that interesting sequence effects prevail as parts of sequences that are copied earlier affect coexistence more strongly due to the higher concentration of the corresponding replication intermediates. Template and copy always count as one species due their constraint of strict stoichiometric coupling. Stability of fixed-point coexistence tends to decrease with the length of sequences, although this effect is unlikely to be detrimental for sequences below 100 nucleotides. In sum, resource partitioning (niche differentiation) is the default form of competitive coexistence for replicating templates feeding on a cocktail of different nucleotides, as it may have been the case in the RNA world. Our analysis of different pairing and strand orientation schemes is relevant for artificial and potentially astrobiological genetics. PMID:23990769

Genome Survey Sequencing of Luffa Cylindrica L. and Microsatellite High Resolution Melting (SSR-HRM) Analysis for Genetic Relationship of Luffa Genotypes.

PubMed

An, Jianyu; Yin, Mengqi; Zhang, Qin; Gong, Dongting; Jia, Xiaowen; Guan, Yajing; Hu, Jin

2017-09-11

Luffa cylindrica (L.) Roem. is an economically important vegetable crop in China. However, the genomic information on this species is currently unknown. In this study, for the first time, a genome survey of L. cylindrica was carried out using next-generation sequencing (NGS) technology. In total, 43.40 Gb sequence data of L. cylindrica , about 54.94× coverage of the estimated genome size of 789.97 Mb, were obtained from HiSeq 2500 sequencing, in which the guanine plus cytosine (GC) content was calculated to be 37.90%. The heterozygosity of genome sequences was only 0.24%. In total, 1,913,731 contigs (>200 bp) with 525 bp N 50 length and 1,410,117 scaffolds (>200 bp) with 885.01 Mb total length were obtained. From the initial assembled L. cylindrica genome, 431,234 microsatellites (SSRs) (≥5 repeats) were identified. The motif types of SSR repeats included 62.88% di-nucleotide, 31.03% tri-nucleotide, 4.59% tetra-nucleotide, 0.96% penta-nucleotide and 0.54% hexa-nucleotide. Eighty genomic SSR markers were developed, and 51/80 primers could be used in both "Zheda 23" and "Zheda 83". Nineteen SSRs were used to investigate the genetic diversity among 32 accessions through SSR-HRM analysis. The unweighted pair group method analysis (UPGMA) dendrogram tree was built by calculating the SSR-HRM raw data. SSR-HRM could be effectively used for genotype relationship analysis of Luffa species.

Detection and analysis of hemolysin genes in Aeromonas hydrophila isolated from Gouramy (Osphronemus gouramy) by polymerase chain reaction (PCR)

NASA Astrophysics Data System (ADS)

Rozi; Rahayu, K.; Daruti, D. N.

2018-04-01

The goal of this study was to detect of Aeromonas hydrophila carrying the hlyA gene in guramy by PCR assay. A total of 5 A. hydrophila strains were isolated from gouramy with different location and furthermore genotypic of all A. hydrophila strains havedetected by PCR assay for 16S rRNA gene. The primers used in the PCR targeted a 592-bp fragment of the hlyA gene coding for the hemolysin gene. Particularly hlyA genes are responsible for haemolysin toxins production in this genus. After gel electrophoresis, the amplicons from representative strains of the A. hydrophila were purified using extraction kit and were subjected to the DNA sequencing analysis. The results showed that: (i) the 592bp amplicon of the hlyA gene was detected in 5/6 of the A. hydrophila; (ii) the nucleotide blast results of hemolysin gene sequences of the strains of A. hydrophila revealed a high homology of 90-97 % with published sequences, and;(iii) the protein blast showed 95-98 % homology when compared to the published sequences. The PCR clearly identified the haemolysin-producing strains of A. hydrophila by detection in hlyA genes and may have application as a rapid species-specific virulence test.

DNA sequence-based comparative studies between non-extremophile and extremophile organisms with implications in exobiology

NASA Astrophysics Data System (ADS)

Holden, Todd; Marchese, P.; Tremberger, G., Jr.; Cheung, E.; Subramaniam, R.; Sullivan, R.; Schneider, P.; Flamholz, A.; Lieberman, D.; Cheung, T.

2008-08-01

We have characterized function related DNA sequences of various organisms using informatics techniques, including fractal dimension calculation, nucleotide and multi-nucleotide statistics, and sequence fluctuation analysis. Our analysis shows trends which differentiate extremophile from non-extremophile organisms, which could be reproduced in extraterrestrial life. Among the systems studied are radiation repair genes, genes involved in thermal shocks, and genes involved in drug resistance. We also evaluate sequence level changes that have occurred during short term evolution (several thousand generations) under extreme conditions.

Nucleotide Interdependency in Transcription Factor Binding Sites in the Drosophila Genome.

PubMed

Dresch, Jacqueline M; Zellers, Rowan G; Bork, Daniel K; Drewell, Robert A

2016-01-01

A long-standing objective in modern biology is to characterize the molecular components that drive the development of an organism. At the heart of eukaryotic development lies gene regulation. On the molecular level, much of the research in this field has focused on the binding of transcription factors (TFs) to regulatory regions in the genome known as cis-regulatory modules (CRMs). However, relatively little is known about the sequence-specific binding preferences of many TFs, especially with respect to the possible interdependencies between the nucleotides that make up binding sites. A particular limitation of many existing algorithms that aim to predict binding site sequences is that they do not allow for dependencies between nonadjacent nucleotides. In this study, we use a recently developed computational algorithm, MARZ, to compare binding site sequences using 32 distinct models in a systematic and unbiased approach to explore nucleotide dependencies within binding sites for 15 distinct TFs known to be critical to Drosophila development. Our results indicate that many of these proteins have varying levels of nucleotide interdependencies within their DNA recognition sequences, and that, in some cases, models that account for these dependencies greatly outperform traditional models that are used to predict binding sites. We also directly compare the ability of different models to identify the known KRUPPEL TF binding sites in CRMs and demonstrate that a more complex model that accounts for nucleotide interdependencies performs better when compared with simple models. This ability to identify TFs with critical nucleotide interdependencies in their binding sites will lead to a deeper understanding of how these molecular characteristics contribute to the architecture of CRMs and the precise regulation of transcription during organismal development.

Nucleotide Interdependency in Transcription Factor Binding Sites in the Drosophila Genome

PubMed Central

Dresch, Jacqueline M.; Zellers, Rowan G.; Bork, Daniel K.; Drewell, Robert A.

2016-01-01

A long-standing objective in modern biology is to characterize the molecular components that drive the development of an organism. At the heart of eukaryotic development lies gene regulation. On the molecular level, much of the research in this field has focused on the binding of transcription factors (TFs) to regulatory regions in the genome known as cis-regulatory modules (CRMs). However, relatively little is known about the sequence-specific binding preferences of many TFs, especially with respect to the possible interdependencies between the nucleotides that make up binding sites. A particular limitation of many existing algorithms that aim to predict binding site sequences is that they do not allow for dependencies between nonadjacent nucleotides. In this study, we use a recently developed computational algorithm, MARZ, to compare binding site sequences using 32 distinct models in a systematic and unbiased approach to explore nucleotide dependencies within binding sites for 15 distinct TFs known to be critical to Drosophila development. Our results indicate that many of these proteins have varying levels of nucleotide interdependencies within their DNA recognition sequences, and that, in some cases, models that account for these dependencies greatly outperform traditional models that are used to predict binding sites. We also directly compare the ability of different models to identify the known KRUPPEL TF binding sites in CRMs and demonstrate that a more complex model that accounts for nucleotide interdependencies performs better when compared with simple models. This ability to identify TFs with critical nucleotide interdependencies in their binding sites will lead to a deeper understanding of how these molecular characteristics contribute to the architecture of CRMs and the precise regulation of transcription during organismal development. PMID:27330274

Limited Genetic Diversity Preceded Extinction of the Tasmanian Tiger

PubMed Central

Menzies, Brandon R.; Renfree, Marilyn B.; Heider, Thomas; Mayer, Frieder; Hildebrandt, Thomas B.; Pask, Andrew J.

2012-01-01

The Tasmanian tiger or thylacine was the largest carnivorous marsupial when Europeans first reached Australia. Sadly, the last known thylacine died in captivity in 1936. A recent analysis of the genome of the closely related and extant Tasmanian devil demonstrated limited genetic diversity between individuals. While a similar lack of diversity has been reported for the thylacine, this analysis was based on just two individuals. Here we report the sequencing of an additional 12 museum-archived specimens collected between 102 and 159 years ago. We examined a portion of the mitochondrial DNA hyper-variable control region and determined that all sequences were on average 99.5% identical at the nucleotide level. As a measure of accuracy we also sequenced mitochondrial DNA from a mother and two offspring. As expected, these samples were found to be 100% identical, validating our methods. We also used 454 sequencing to reconstruct 2.1 kilobases of the mitochondrial genome, which shared 99.91% identity with the two complete thylacine mitochondrial genomes published previously. Our thylacine genomic data also contained three highly divergent putative nuclear mitochondrial sequences, which grouped phylogenetically with the published thylacine mitochondrial homologs but contained 100-fold more polymorphisms than the conserved fragments. Together, our data suggest that the thylacine population in Tasmania had limited genetic diversity prior to its extinction, possibly as a result of their geographic isolation from mainland Australia approximately 10,000 years ago. PMID:22530022

Development of single-copy nuclear intron markers for species-level phylogenetics: Case study with Paullinieae (Sapindaceae).

PubMed

Chery, Joyce G; Sass, Chodon; Specht, Chelsea D

2017-09-01

We developed a bioinformatic pipeline that leverages a publicly available genome and published transcriptomes to design primers in conserved coding sequences flanking targeted introns of single-copy nuclear loci. Paullinieae (Sapindaceae) is used to demonstrate the pipeline. Transcriptome reads phylogenetically closer to the lineage of interest are aligned to the closest genome. Single-nucleotide polymorphisms are called, generating a "pseudoreference" closer to the lineage of interest. Several filters are applied to meet the criteria of single-copy nuclear loci with introns of a desired size. Primers are designed in conserved coding sequences flanking introns. Using this pipeline, we developed nine single-copy nuclear intron markers for Paullinieae. This pipeline is highly flexible and can be used for any group with available genomic and transcriptomic resources. This pipeline led to the development of nine variable markers for phylogenetic study without generating sequence data de novo.

Nucleotide Sequence Database Comparison for Routine Dermatophyte Identification by Internal Transcribed Spacer 2 Genetic Region DNA Barcoding.

PubMed

Normand, A C; Packeu, A; Cassagne, C; Hendrickx, M; Ranque, S; Piarroux, R

2018-05-01

Conventional dermatophyte identification is based on morphological features. However, recent studies have proposed to use the nucleotide sequences of the rRNA internal transcribed spacer (ITS) region as an identification barcode of all fungi, including dermatophytes. Several nucleotide databases are available to compare sequences and thus identify isolates; however, these databases often contain mislabeled sequences that impair sequence-based identification. We evaluated five of these databases on a clinical isolate panel. We selected 292 clinical dermatophyte strains that were prospectively subjected to an ITS2 nucleotide sequence analysis. Sequences were analyzed against the databases, and the results were compared to clusters obtained via DNA alignment of sequence segments. The DNA tree served as the identification standard throughout the study. According to the ITS2 sequence identification, the majority of strains (255/292) belonged to the genus Trichophyton , mainly T. rubrum complex ( n = 184), T. interdigitale ( n = 40), T. tonsurans ( n = 26), and T. benhamiae ( n = 5). Other genera included Microsporum (e.g., M. canis [ n = 21], M. audouinii [ n = 10], Nannizzia gypsea [ n = 3], and Epidermophyton [ n = 3]). Species-level identification of T. rubrum complex isolates was an issue. Overall, ITS DNA sequencing is a reliable tool to identify dermatophyte species given that a comprehensive and correctly labeled database is consulted. Since many inaccurate identification results exist in the DNA databases used for this study, reference databases must be verified frequently and amended in line with the current revisions of fungal taxonomy. Before describing a new species or adding a new DNA reference to the available databases, its position in the phylogenetic tree must be verified. Copyright © 2018 American Society for Microbiology.

Complete genome sequence analysis of novel human bocavirus reveals genetic recombination between human bocavirus 2 and human bocavirus 4.

PubMed

Khamrin, Pattara; Okitsu, Shoko; Ushijima, Hiroshi; Maneekarn, Niwat

2013-07-01

Epidemiological surveillance of human bocavirus (HBoV) was conducted on fecal specimens collected from hospitalized children with diarrhea in Chiang Mai, Thailand in 2011. By partial sequence analysis of VP1 gene, an unusual strain of HBoV (CMH-S011-11), was initially identified as HBoV4. The complete genome sequence of CMH-S011-11 was performed and analyzed further to clarify whether it was a recombinant strain or a new HBoV variant. Analysis of complete genome sequence revealed that the coding sequence starting from NS1, NP1 to VP1/VP2 was 4795 nucleotides long. Interestingly, the nucleotide sequence of NS1 gene of CMH-S011-11 was most closely related to the HBoV2 reference strains detected in Pakistan, which contradicted to the initial genotyping result of the partial VP1 region in the previous study. In addition, comparison of NP1 nucleotide sequence of CMH-S011-11 with those of other HBoV1-4 reference strains also revealed a high level of sequence identity with HBoV2. On the other hand, nucleotide sequence of VP1/VP2 gene of CMH-S011-11 was most closely related to those of HBoV4 reference strains detected in Nigeria. The overall full-length sequence analysis revealed that this CMH-S011-11 was grouped within HBoV4 species, but located in a separate branch from other HBoV4 prototype strains. Recombination analysis revealed that CMH-S011-11 was the result of recombination between HBoV2 and HBoV4 strains with the break point located near the start codon of VP2. Copyright © 2013 Elsevier B.V. All rights reserved.

Palindromic Sequence Artifacts Generated during Next Generation Sequencing Library Preparation from Historic and Ancient DNA

PubMed Central

Star, Bastiaan; Nederbragt, Alexander J.; Hansen, Marianne H. S.; Skage, Morten; Gilfillan, Gregor D.; Bradbury, Ian R.; Pampoulie, Christophe; Stenseth, Nils Chr; Jakobsen, Kjetill S.; Jentoft, Sissel

2014-01-01

Degradation-specific processes and variation in laboratory protocols can bias the DNA sequence composition from samples of ancient or historic origin. Here, we identify a novel artifact in sequences from historic samples of Atlantic cod (Gadus morhua), which forms interrupted palindromes consisting of reverse complementary sequence at the 5′ and 3′-ends of sequencing reads. The palindromic sequences themselves have specific properties – the bases at the 5′-end align well to the reference genome, whereas extensive misalignments exists among the bases at the terminal 3′-end. The terminal 3′ bases are artificial extensions likely caused by the occurrence of hairpin loops in single stranded DNA (ssDNA), which can be ligated and amplified in particular library creation protocols. We propose that such hairpin loops allow the inclusion of erroneous nucleotides, specifically at the 3′-end of DNA strands, with the 5′-end of the same strand providing the template. We also find these palindromes in previously published ancient DNA (aDNA) datasets, albeit at varying and substantially lower frequencies. This artifact can negatively affect the yield of endogenous DNA in these types of samples and introduces sequence bias. PMID:24608104

Centrifuge: rapid and sensitive classification of metagenomic sequences.

PubMed

Kim, Daehwan; Song, Li; Breitwieser, Florian P; Salzberg, Steven L

2016-12-01

Centrifuge is a novel microbial classification engine that enables rapid, accurate, and sensitive labeling of reads and quantification of species on desktop computers. The system uses an indexing scheme based on the Burrows-Wheeler transform (BWT) and the Ferragina-Manzini (FM) index, optimized specifically for the metagenomic classification problem. Centrifuge requires a relatively small index (4.2 GB for 4078 bacterial and 200 archaeal genomes) and classifies sequences at very high speed, allowing it to process the millions of reads from a typical high-throughput DNA sequencing run within a few minutes. Together, these advances enable timely and accurate analysis of large metagenomics data sets on conventional desktop computers. Because of its space-optimized indexing schemes, Centrifuge also makes it possible to index the entire NCBI nonredundant nucleotide sequence database (a total of 109 billion bases) with an index size of 69 GB, in contrast to k-mer-based indexing schemes, which require far more extensive space. © 2016 Kim et al.; Published by Cold Spring Harbor Laboratory Press.

Two-phase designs for joint quantitative-trait-dependent and genotype-dependent sampling in post-GWAS regional sequencing.

PubMed

Espin-Garcia, Osvaldo; Craiu, Radu V; Bull, Shelley B

2018-02-01

We evaluate two-phase designs to follow-up findings from genome-wide association study (GWAS) when the cost of regional sequencing in the entire cohort is prohibitive. We develop novel expectation-maximization-based inference under a semiparametric maximum likelihood formulation tailored for post-GWAS inference. A GWAS-SNP (where SNP is single nucleotide polymorphism) serves as a surrogate covariate in inferring association between a sequence variant and a normally distributed quantitative trait (QT). We assess test validity and quantify efficiency and power of joint QT-SNP-dependent sampling and analysis under alternative sample allocations by simulations. Joint allocation balanced on SNP genotype and extreme-QT strata yields significant power improvements compared to marginal QT- or SNP-based allocations. We illustrate the proposed method and evaluate the sensitivity of sample allocation to sampling variation using data from a sequencing study of systolic blood pressure. © 2017 The Authors. Genetic Epidemiology Published by Wiley Periodicals, Inc.

Masking as an effective quality control method for next-generation sequencing data analysis.

PubMed

Yun, Sajung; Yun, Sijung

2014-12-13

Next generation sequencing produces base calls with low quality scores that can affect the accuracy of identifying simple nucleotide variation calls, including single nucleotide polymorphisms and small insertions and deletions. Here we compare the effectiveness of two data preprocessing methods, masking and trimming, and the accuracy of simple nucleotide variation calls on whole-genome sequence data from Caenorhabditis elegans. Masking substitutes low quality base calls with 'N's (undetermined bases), whereas trimming removes low quality bases that results in a shorter read lengths. We demonstrate that masking is more effective than trimming in reducing the false-positive rate in single nucleotide polymorphism (SNP) calling. However, both of the preprocessing methods did not affect the false-negative rate in SNP calling with statistical significance compared to the data analysis without preprocessing. False-positive rate and false-negative rate for small insertions and deletions did not show differences between masking and trimming. We recommend masking over trimming as a more effective preprocessing method for next generation sequencing data analysis since masking reduces the false-positive rate in SNP calling without sacrificing the false-negative rate although trimming is more commonly used currently in the field. The perl script for masking is available at http://code.google.com/p/subn/. The sequencing data used in the study were deposited in the Sequence Read Archive (SRX450968 and SRX451773).

Characterization of the repetitive DNA elements in the genome of fish lymphocystis disease viruses.

PubMed

Schnitzler, P; Darai, G

1989-09-01

The complete DNA nucleotide sequence of the repetitive DNA elements in the genome of fish lymphocystis disease virus (FLDV) isolated from two different species (flounder and dab) was determined. The size of these repetitive DNA elements was found to be 1413 bp which corresponds to the DNA sequences of the 5' terminus of the EcoRI DNA fragment B (0.034 to 0.052 m.u.) and to the EcoRI DNA fragment M (0.718 to 0.736 m.u.) of the FLDV genome causing lymphocystis disease in flounder and plaice. The degree of DNA nucleotide homology between both regions was found to be 99%. The repetitive DNA element in the genome of FLDV isolated from other fish species (dab) was identified and is located within the EcoRI DNA fragment B and J of the viral genome. The DNA nucleotide sequence of one duplicate of this repetition (EcoRI DNA fragment J) was determined (1410 bp) and compared to the DNA nucleotide sequences of the repetitive DNA elements of the genome of FLDV isolated from flounder. It was found that the repetitive DNA elements of the genome of FLDV derived from two different fish species are highly conserved and possess a degree of DNA sequence homology of 94%. The DNA sequences of each strand of the individual repetitive element possess one open reading frame.

ANCAC: amino acid, nucleotide, and codon analysis of COGs--a tool for sequence bias analysis in microbial orthologs.

PubMed

Meiler, Arno; Klinger, Claudia; Kaufmann, Michael

2012-09-08

The COG database is the most popular collection of orthologous proteins from many different completely sequenced microbial genomes. Per definition, a cluster of orthologous groups (COG) within this database exclusively contains proteins that most likely achieve the same cellular function. Recently, the COG database was extended by assigning to every protein both the corresponding amino acid and its encoding nucleotide sequence resulting in the NUCOCOG database. This extended version of the COG database is a valuable resource connecting sequence features with the functionality of the respective proteins. Here we present ANCAC, a web tool and MySQL database for the analysis of amino acid, nucleotide, and codon frequencies in COGs on the basis of freely definable phylogenetic patterns. We demonstrate the usefulness of ANCAC by analyzing amino acid frequencies, codon usage, and GC-content in a species- or function-specific context. With respect to amino acids we, at least in part, confirm the cognate bias hypothesis by using ANCAC's NUCOCOG dataset as the largest one available for that purpose thus far. Using the NUCOCOG datasets, ANCAC connects taxonomic, amino acid, and nucleotide sequence information with the functional classification via COGs and provides a GUI for flexible mining for sequence-bias. Thereby, to our knowledge, it is the only tool for the analysis of sequence composition in the light of physiological roles and phylogenetic context without requirement of substantial programming-skills.

ANCAC: amino acid, nucleotide, and codon analysis of COGs – a tool for sequence bias analysis in microbial orthologs

PubMed Central

2012-01-01

Background The COG database is the most popular collection of orthologous proteins from many different completely sequenced microbial genomes. Per definition, a cluster of orthologous groups (COG) within this database exclusively contains proteins that most likely achieve the same cellular function. Recently, the COG database was extended by assigning to every protein both the corresponding amino acid and its encoding nucleotide sequence resulting in the NUCOCOG database. This extended version of the COG database is a valuable resource connecting sequence features with the functionality of the respective proteins. Results Here we present ANCAC, a web tool and MySQL database for the analysis of amino acid, nucleotide, and codon frequencies in COGs on the basis of freely definable phylogenetic patterns. We demonstrate the usefulness of ANCAC by analyzing amino acid frequencies, codon usage, and GC-content in a species- or function-specific context. With respect to amino acids we, at least in part, confirm the cognate bias hypothesis by using ANCAC’s NUCOCOG dataset as the largest one available for that purpose thus far. Conclusions Using the NUCOCOG datasets, ANCAC connects taxonomic, amino acid, and nucleotide sequence information with the functional classification via COGs and provides a GUI for flexible mining for sequence-bias. Thereby, to our knowledge, it is the only tool for the analysis of sequence composition in the light of physiological roles and phylogenetic context without requirement of substantial programming-skills. PMID:22958836

SeqReporter: automating next-generation sequencing result interpretation and reporting workflow in a clinical laboratory.

PubMed

Roy, Somak; Durso, Mary Beth; Wald, Abigail; Nikiforov, Yuri E; Nikiforova, Marina N

2014-01-01

A wide repertoire of bioinformatics applications exist for next-generation sequencing data analysis; however, certain requirements of the clinical molecular laboratory limit their use: i) comprehensive report generation, ii) compatibility with existing laboratory information systems and computer operating system, iii) knowledgebase development, iv) quality management, and v) data security. SeqReporter is a web-based application developed using ASP.NET framework version 4.0. The client-side was designed using HTML5, CSS3, and Javascript. The server-side processing (VB.NET) relied on interaction with a customized SQL server 2008 R2 database. Overall, 104 cases (1062 variant calls) were analyzed by SeqReporter. Each variant call was classified into one of five report levels: i) known clinical significance, ii) uncertain clinical significance, iii) pending pathologists' review, iv) synonymous and deep intronic, and v) platform and panel-specific sequence errors. SeqReporter correctly annotated and classified 99.9% (859 of 860) of sequence variants, including 68.7% synonymous single-nucleotide variants, 28.3% nonsynonymous single-nucleotide variants, 1.7% insertions, and 1.3% deletions. One variant of potential clinical significance was re-classified after pathologist review. Laboratory information system-compatible clinical reports were generated automatically. SeqReporter also facilitated quality management activities. SeqReporter is an example of a customized and well-designed informatics solution to optimize and automate the downstream analysis of clinical next-generation sequencing data. We propose it as a model that may envisage the development of a comprehensive clinical informatics solution. Copyright © 2014 American Society for Investigative Pathology and the Association for Molecular Pathology. Published by Elsevier Inc. All rights reserved.

Phylogenetic analysis of the complete genome of 11 BKV isolates obtained from allogenic stem cell transplant recipients in Ireland.

PubMed

Drew, Richard John; Walsh, Anne; Laoi, Bairbre Ni; Crowley, Brendan

2012-07-01

BK polyomavirus (family Polyomaviridae) may cause hemorrhagic cystitis (BKV-HC) in hematopoietic stem cell transplant recipients. Eleven complete BKV genomes (GenBank accession numbers: JN192431-JN192441) were sequenced from urine samples of allogenic hematopoietic stem cell transplant recipients and compared to complete BKV genomes in the published literature. Of the 11 isolates, seven (64%) were subgroup Ib-1, three (27%) isolates belonged to subgroup Ib-2 and a single isolate belonged to subtype III. The analysis of single-nucleotide polymorphisms in this study showed that isolates could be subclassified into subtypes I-IV and subgroups Ib-1 and Ib-2 on the basis of VP1 of the first part of the Large T-antigen (LTag). The non-coding control region (NCCR) of the 11 isolates was also sequenced. These sequences showed that there was consistent sequence homology within subgroups Ib-1 and Ib-2. Two new mutations were described in the isolates, G→C at O(84) in isolate SJH-LG-310, and a deletion at R(2-7) in isolate SJH-LG-309. No known transcription factor is thought to be present at the site of either of these mutations. There were no rearrangements seen in isolates and this may be because the patients were not followed up over time. There were five nucleotide positions at which subgroup Ib-1 isolated differed from subgroup Ib-2 isolates in the NCCR sequence, O(41) , P(18) , P(31) , R(4) , and S(18) . The mutation O(41) is present in the promoter granulocyte/macrophage stimulating factor) gene and the P(31) mutation is present in the NF-1 gene. Copyright © 2012 Wiley Periodicals, Inc.

VirVarSeq: a low-frequency virus variant detection pipeline for Illumina sequencing using adaptive base-calling accuracy filtering.

PubMed

Verbist, Bie M P; Thys, Kim; Reumers, Joke; Wetzels, Yves; Van der Borght, Koen; Talloen, Willem; Aerssens, Jeroen; Clement, Lieven; Thas, Olivier

2015-01-01

In virology, massively parallel sequencing (MPS) opens many opportunities for studying viral quasi-species, e.g. in HIV-1- and HCV-infected patients. This is essential for understanding pathways to resistance, which can substantially improve treatment. Although MPS platforms allow in-depth characterization of sequence variation, their measurements still involve substantial technical noise. For Illumina sequencing, single base substitutions are the main error source and impede powerful assessment of low-frequency mutations. Fortunately, base calls are complemented with quality scores (Qs) that are useful for differentiating errors from the real low-frequency mutations. A variant calling tool, Q-cpileup, is proposed, which exploits the Qs of nucleotides in a filtering strategy to increase specificity. The tool is imbedded in an open-source pipeline, VirVarSeq, which allows variant calling starting from fastq files. Using both plasmid mixtures and clinical samples, we show that Q-cpileup is able to reduce the number of false-positive findings. The filtering strategy is adaptive and provides an optimized threshold for individual samples in each sequencing run. Additionally, linkage information is kept between single-nucleotide polymorphisms as variants are called at the codon level. This enables virologists to have an immediate biological interpretation of the reported variants with respect to their antiviral drug responses. A comparison with existing SNP caller tools reveals that calling variants at the codon level with Q-cpileup results in an outstanding sensitivity while maintaining a good specificity for variants with frequencies down to 0.5%. The VirVarSeq is available, together with a user's guide and test data, at sourceforge: http://sourceforge.net/projects/virtools/?source=directory. © The Author 2014. Published by Oxford University Press. All rights reserved. For Permissions, please e-mail: journals.permissions@oup.com.

Whole genome sequencing discriminates hepatocellular carcinoma with intrahepatic metastasis from multi-centric tumors.

PubMed

Furuta, Mayuko; Ueno, Masaki; Fujimoto, Akihiro; Hayami, Shinya; Yasukawa, Satoru; Kojima, Fumiyoshi; Arihiro, Koji; Kawakami, Yoshiiku; Wardell, Christopher P; Shiraishi, Yuichi; Tanaka, Hiroko; Nakano, Kaoru; Maejima, Kazuhiro; Sasaki-Oku, Aya; Tokunaga, Naoki; Boroevich, Keith A; Abe, Tetsuo; Aikata, Hiroshi; Ohdan, Hideki; Gotoh, Kunihito; Kubo, Michiaki; Tsunoda, Tatsuhiko; Miyano, Satoru; Chayama, Kazuaki; Yamaue, Hiroki; Nakagawa, Hidewaki

2017-02-01

Patients with hepatocellular carcinoma (HCC) have a high-risk of multi-centric (MC) tumor occurrence due to a strong carcinogenic background in the liver. In addition, they have a high risk of intrahepatic metastasis (IM). Liver tumors withIM or MC are profoundly different in their development and clinical outcome. However, clinically or pathologically discriminating between IM and MC can be challenging. This study investigated whether IM or MC could be diagnosed at the molecular level. We performed whole genome and RNA sequencing analyses of 49 tumors including two extra-hepatic metastases, and one nodule-in-nodule tumor from 23 HCC patients. Sequencing-based molecular diagnosis using somatic single nucleotide variation information showed higher sensitivity compared to previous techniques due to the inclusion of a larger number of mutation events. This proved useful in cases, which showed inconsistent clinical diagnoses. In addition, whole genome sequencing offered advantages in profiling of other genetic alterations, such as structural variations, copy number alterations, and variant allele frequencies, and helped to confirm the IM/MCdiagnosis. Divergent alterations between IM tumors with sorafenib treatment, long time-intervals, or tumor-in-tumor nodules indicated high intra-tumor heterogeneity, evolution, and clonal switching of liver cancers. It is important to analyze the differences between IM tumors, in addition to IM/MC diagnosis, before selecting a therapeutic strategy for multiple tumors in the liver. Whole genome sequencing of multiple liver tumors enabled the accuratediagnosis ofmulti-centric occurrence and intrahepatic metastasis using somatic single nucleotide variation information. In addition, genetic discrepancies between tumors help us to understand the physical changes during recurrence and cancer spread. Copyright © 2016 European Association for the Study of the Liver. Published by Elsevier B.V. All rights reserved.

Single nucleotide polymorphisms in common bean: their discovery and genotyping using a multiplex detection system

USDA-ARS?s Scientific Manuscript database

Single-nucleotide Polymorphism (SNP) markers are by far the most common form of DNA polymorphism in a genome. The objectives of this study were to discover SNPs in common bean comparing sequences from coding and non-coding regions obtained from Genbank and genomic DNA and to compare sequencing resu...

An integrated genetic linkage map of watermelon and genetic diversity based on single nucleotide polymorphism (SNP) and simple sequence repeat (SSR) markers

USDA-ARS?s Scientific Manuscript database

Watermelon (Citrullus lanatus var. lanatus) is an important vegetable fruit throughout the world. A high number of single nucleotide polymorphism (SNP) and simple sequence repeat (SSR) markers should provide large coverage of the watermelon genome and high phylogenetic resolution of germplasm acces...

A new begomovirus associated with alpha- and betasatellite molecules isolated from Vernonia cinerea in China.

PubMed

Zulfiqar, Awais; Zhang, Jie; Cui, Xiaofeng; Qian, Yajuan; Zhou, Xueping; Xie, Yan

2012-01-01

A begomovirus disease complex associated with Vernonia cinerea showing yellow vein symptoms was studied. The full-length genomic DNA was comprised of 2739 nucleotides (nt) and contained the typical genome structure of begomoviruses. Comparison analysis showed that it shared the highest (78.9%) nucleotide sequence identity with recently characterized Vernonia yellow vein virus (VeYVV) from India. For associated satellites, betasatellite showed the highest nucleotide sequence identity (52.1%) with Vernonia yellow vein virus betasatellite (VeYVVB) and alphasatellite shared the highest sequence identity (70.7%) with Gossypium mustelinium symptomless alphasatellite (GMusSLA). It is a member of a distinct species with cognate alpha- and betasatellites for which the name Vernonia yellow vein Fujian virus (VeYVFjV) is proposed.

The complete nucleotide sequence of the barley yellow dwarf GPV isolate from China shows that it is a new member of the genus Polerovirus.

PubMed

Zhang, Wenwei; Cheng, Zhuomin; Xu, Lei; Wu, Maosen; Waterhouse, Peter; Zhou, Guanghe; Li, Shifang

2009-01-01

The complete nucleotide sequence of the ssRNA genome of a Chinese GPV isolate of barley yellow dwarf virus (BYDV) was determined. It comprised 5673 nucleotides, and the deduced genome organization resembled that of members of the genus Polerovirus. It was most closely related to cereal yellow dwarf virus-RPV (77% nt identity over the entire genome; coat protein amino acid identity 79%). The GPV isolate also differs in vector specificity from other BYDV strains. Biological properties, phylogenetic analyses and detailed sequence comparisons suggest that GPV should be considered a member of a new species within the genus, and the name Wheat yellow dwarf virus-GPV is proposed.

Promoter for Sindbis virus RNA-dependent subgenomic RNA transcription.

PubMed Central

Levis, R; Schlesinger, S; Huang, H V

1990-01-01

Sindbis virus is a positive-strand RNA enveloped virus, a member of the Alphavirus genus of the Togaviridae family. Two species of mRNA are synthesized in cells infected with Sindbis virus; one, the 49S RNA, is the genomic RNA; the other, the 26S RNA, is a subgenomic RNA that is identical in sequence to the 3' one-third of the genomic RNA. Ou et al. (J.-H. Ou, C. M. Rice, L. Dalgarno, E. G. Strauss, and J. H. Strauss, Proc. Natl. Acad. Sci. USA 79:5235-5239, 1982) identified a highly conserved region 19 nucleotides upstream and 2 nucleotides downstream from the start of the 26S RNA and proposed that in the negative-strand template, these nucleotides compose the promoter for directing the synthesis of the subgenomic RNA. Defective interfering (DI) RNAs of Sindbis virus were used to test this proposal. A 227-nucleotide sequence encompassing 98 nucleotides upstream and 117 nucleotides downstream from the start site of the Sindbis virus subgenomic RNA was inserted into a DI genome. The DI RNA containing the insert was replicated and packaged in the presence of helper virus, and cells infected with these DI particles produced a subgenomic RNA of the size and sequence expected if the promoter was functional. The initiating nucleotide was identical to that used for Sindbis virus subgenomic mRNA synthesis. Deletion analysis showed that the minimal region required to detect transcription of a subgenomic RNA from the negative-strand template of a DI RNA was 18 or 19 nucleotides upstream and 5 nucleotides downstream from the start of the subgenomic RNA. Images PMID:2319651

Genome-Wide Search Identifies 1.9 Mb from the Polar Bear Y Chromosome for Evolutionary Analyses.

PubMed

Bidon, Tobias; Schreck, Nancy; Hailer, Frank; Nilsson, Maria A; Janke, Axel

2015-05-27

The male-inherited Y chromosome is the major haploid fraction of the mammalian genome, rendering Y-linked sequences an indispensable resource for evolutionary research. However, despite recent large-scale genome sequencing approaches, only a handful of Y chromosome sequences have been characterized to date, mainly in model organisms. Using polar bear (Ursus maritimus) genomes, we compare two different in silico approaches to identify Y-linked sequences: 1) Similarity to known Y-linked genes and 2) difference in the average read depth of autosomal versus sex chromosomal scaffolds. Specifically, we mapped available genomic sequencing short reads from a male and a female polar bear against the reference genome and identify 112 Y-chromosomal scaffolds with a combined length of 1.9 Mb. We verified the in silico findings for the longer polar bear scaffolds by male-specific in vitro amplification, demonstrating the reliability of the average read depth approach. The obtained Y chromosome sequences contain protein-coding sequences, single nucleotide polymorphisms, microsatellites, and transposable elements that are useful for evolutionary studies. A high-resolution phylogeny of the polar bear patriline shows two highly divergent Y chromosome lineages, obtained from analysis of the identified Y scaffolds in 12 previously published male polar bear genomes. Moreover, we find evidence of gene conversion among ZFX and ZFY sequences in the giant panda lineage and in the ancestor of ursine and tremarctine bears. Thus, the identification of Y-linked scaffold sequences from unordered genome sequences yields valuable data to infer phylogenomic and population-genomic patterns in bears. © The Author(s) 2015. Published by Oxford University Press on behalf of the Society for Molecular Biology and Evolution.

Genetic variation in potential Giardia vaccine candidates cyst wall protein 2 and α1-giardin.

PubMed

Radunovic, Matej; Klotz, Christian; Saghaug, Christina Skår; Brattbakk, Hans-Richard; Aebischer, Toni; Langeland, Nina; Hanevik, Kurt

2017-08-01

Giardia is a prevalent intestinal parasitic infection. The trophozoite structural protein a1-giardin (a1-g) and the cyst protein cyst wall protein 2 (CWP2) have shown promise as Giardia vaccine antigen candidates in murine models. The present study assesses the genetic diversity of a1-g and CWP2 between and within assemblages A and B in human clinical isolates. a1-g and CWP2 sequences were acquired from 15 Norwegian isolates by PCR amplification and 20 sequences from German cultured isolates by whole genome sequencing. Sequences were aligned to reference genomes from assemblage A2 and B to identify genetic variance. Genetic diversity was found between assemblage A and B reference sequences for both a1-g (90.8% nucleotide identity) and CWP2 (82.5% nucleotide identity). However, for a1-g, this translated into only 3 amino acid (aa) substitutions, while for CWP2 there were 41 aa substitutions, and also one aa deletion. Genetic diversity within assemblage B was larger; nucleotide identity 92.0% for a1-g and 94.3% for CWP2, than within assemblage A (nucleotide identity 99.0% for a1-g and 99.7% for CWP2). For CWP2, the diversity on both nucleotide and protein level was higher in the C-terminal end. Predicted antigenic epitopes were not affected for a1-g, but partially for CWP2. Despite genetic diversity in a1-g, we found aa sequence, characteristics, and antigenicity to be well preserved. CWP2 showed more aa variance and potential antigenic differences. Several CWP2 antigens might be necessary in a future Giardia vaccine to provide cross protection against both Giardia assemblages infecting humans.

Complete nucleotide sequence and genome structure of a Japanese isolate of hibiscus latent Fort Pierce virus, a unique tobamovirus that contains an internal poly(A) region in its 3' end.

PubMed

Yoshida, Tetsuya; Kitazawa, Yugo; Komatsu, Ken; Neriya, Yutaro; Ishikawa, Kazuya; Fujita, Naoko; Hashimoto, Masayoshi; Maejima, Kensaku; Yamaji, Yasuyuki; Namba, Shigetou

2014-11-01

In this study, we detected a Japanese isolate of hibiscus latent Fort Pierce virus (HLFPV-J), a member of the genus Tobamovirus, in a hibiscus plant in Japan and determined the complete sequence and organization of its genome. HLFPV-J has four open reading frames (ORFs), each of which shares more than 98 % nucleotide sequence identity with those of other HLFPV isolates. Moreover, HLFPV-J contains a unique internal poly(A) region of variable length, ranging from 44 to 78 nucleotides, in its 3'-untranslated region (UTR), as is the case with hibiscus latent Singapore virus (HLSV), another hibiscus-infecting tobamovirus. The length of the HLFPV-J genome was 6431 nucleotides, including the shortest internal poly(A) region. The sequence identities of ORFs 1, 2, 3 and 4 of HLFPV-J to other tobamoviruses were 46.6-68.7, 49.9-70.8, 31.0-70.8 and 39.4-70.1 %, respectively, at the nucleotide level and 39.8-75.0, 43.6-77.8, 19.2-70.4 and 31.2-74.2 %, respectively, at the amino acid level. The 5'- and 3'-UTRs of HLFPV-J showed 24.3-58.6 and 13.0-79.8 % identity, respectively, to other tobamoviruses. In particular, when compared to other tobamoviruses, each ORF and UTR of HLFPV-J showed the highest sequence identity to those of HLSV. Phylogenetic analysis showed that HLFPV-J, other HLFPV isolates and HLSV constitute a malvaceous-plant-infecting tobamovirus cluster. These results indicate that the genomic structure of HLFPV-J has unique features similar to those of HLSV. To our knowledge, this is the first report of the complete genome sequence of HLFPV.

Detection of a novel herpesvirus from bats in the Philippines.

PubMed

Sano, Kaori; Okazaki, Sachiko; Taniguchi, Satoshi; Masangkay, Joseph S; Puentespina, Roberto; Eres, Eduardo; Cosico, Edison; Quibod, Niña; Kondo, Taisuke; Shimoda, Hiroshi; Hatta, Yuuki; Mitomo, Shumpei; Oba, Mami; Katayama, Yukie; Sassa, Yukiko; Furuya, Tetsuya; Nagai, Makoto; Une, Yumi; Maeda, Ken; Kyuwa, Shigeru; Yoshikawa, Yasuhiro; Akashi, Hiroomi; Omatsu, Tsutomu; Mizutani, Tetsuya

2015-08-01

Bats are natural hosts of many zoonotic viruses. Monitoring bat viruses is important to detect novel bat-borne infectious diseases. In this study, next generation sequencing techniques and conventional PCR were used to analyze intestine, lung, and blood clot samples collected from wild bats captured at three locations in Davao region, in the Philippines in 2012. Different viral genes belonging to the Retroviridae and Herpesviridae families were identified using next generation sequencing. The existence of herpesvirus in the samples was confirmed by PCR using herpesvirus consensus primers. The nucleotide sequences of the resulting PCR amplicons were 166-bp. Further phylogenetic analysis identified that the virus from which this nucleotide sequence was obtained belonged to the Gammaherpesvirinae subfamily. PCR using primers specific to the nucleotide sequence obtained revealed that the infection rate among the captured bats was 30 %. In this study, we present the partial genome of a novel gammaherpesvirus detected from wild bats. Our observations also indicate that this herpesvirus may be widely distributed in bat populations in Davao region.

De-MetaST-BLAST: A Tool for the Validation of Degenerate Primer Sets and Data Mining of Publicly Available Metagenomes

PubMed Central

Gulvik, Christopher A.; Effler, T. Chad; Wilhelm, Steven W.; Buchan, Alison

2012-01-01

Development and use of primer sets to amplify nucleic acid sequences of interest is fundamental to studies spanning many life science disciplines. As such, the validation of primer sets is essential. Several computer programs have been created to aid in the initial selection of primer sequences that may or may not require multiple nucleotide combinations (i.e., degeneracies). Conversely, validation of primer specificity has remained largely unchanged for several decades, and there are currently few available programs that allows for an evaluation of primers containing degenerate nucleotide bases. To alleviate this gap, we developed the program De-MetaST that performs an in silico amplification using user defined nucleotide sequence dataset(s) and primer sequences that may contain degenerate bases. The program returns an output file that contains the in silico amplicons. When De-MetaST is paired with NCBI’s BLAST (De-MetaST-BLAST), the program also returns the top 10 nr NCBI database hits for each recovered in silico amplicon. While the original motivation for development of this search tool was degenerate primer validation using the wealth of nucleotide sequences available in environmental metagenome and metatranscriptome databases, this search tool has potential utility in many data mining applications. PMID:23189198

DNA barcode and identification of the varieties and provenances of Taiwan's domestic and imported made teas using ribosomal internal transcribed spacer 2 sequences.

PubMed

Lee, Shih-Chieh; Wang, Chia-Hsiang; Yen, Cheng-En; Chang, Chieh

2017-04-01

The major aim of made tea identification is to identify the variety and provenance of the tea plant. The present experiment used 113 tea plants [Camellia sinensis (L.) O. Kuntze] housed at the Tea Research and Extension Substation, from which 113 internal transcribed spacer 2 (ITS2) fragments, 104 trnL intron, and 98 trnL-trnF intergenic sequence region DNA sequences were successfully sequenced. The similarity of the ITS2 nucleotide sequences between tea plants housed at the Tea Research and Extension Substation was 0.379-0.994. In this polymerase chain reaction-amplified noncoding region, no varieties possessed identical sequences. Compared with the trnL intron and trnL-trnF intergenic sequence fragments of chloroplast cpDNA, the proportion of ITS2 nucleotide sequence variation was large and is more suitable for establishing a DNA barcode database to identify tea plant varieties. After establishing the database, 30 imported teas and 35 domestic made teas were used in this model system to explore the feasibility of using ITS2 sequences to identify the varieties and provenances of made teas. A phylogenetic tree was constructed using ITS2 sequences with the unweighted pair group method with arithmetic mean, which indicated that the same variety of tea plant is likely to be successfully categorized into one cluster, but contamination from other tea plants was also detected. This result provides molecular evidence that the similarity between important tea varieties in Taiwan remains high. We suggest a direct, wide collection of made tea and original samples of tea plants to establish an ITS2 sequence molecular barcode identification database to identify the varieties and provenances of tea plants. The DNA barcode comparison method can satisfy the need for a rapid, low-cost, frontline differentiation of the large amount of made teas from Taiwan and abroad, and can provide molecular evidence of their varieties and provenances. Copyright © 2016. Published by Elsevier B.V.

Iterative Correction of Reference Nucleotides (iCORN) using second generation sequencing technology.

PubMed

Otto, Thomas D; Sanders, Mandy; Berriman, Matthew; Newbold, Chris

2010-07-15

The accuracy of reference genomes is important for downstream analysis but a low error rate requires expensive manual interrogation of the sequence. Here, we describe a novel algorithm (Iterative Correction of Reference Nucleotides) that iteratively aligns deep coverage of short sequencing reads to correct errors in reference genome sequences and evaluate their accuracy. Using Plasmodium falciparum (81% A + T content) as an extreme example, we show that the algorithm is highly accurate and corrects over 2000 errors in the reference sequence. We give examples of its application to numerous other eukaryotic and prokaryotic genomes and suggest additional applications. The software is available at http://icorn.sourceforge.net

Isolated nucleic acids encoding antipathogenic polypeptides and uses thereof

DOEpatents

Altier, Daniel J.; Crane, Virginia C.; Ellanskaya, Irina; Ellanskaya, Natalia; Gilliam, Jacob T.; Hunter-Cevera, Jennie; Presnail, James K.; Schepers, Eric J.; Simmons, Carl R.; Torok, Tamas; Yalpani, Nasser

2010-04-20

Compositions and methods for protecting a plant from a pathogen, particularly a fungal pathogen, are provided. Compositions include amino acid sequences, and variants and fragments thereof, for antipathogenic polypeptides that were isolated from fungal fermentation broths. Nucleic acids that encode the antipathogenic polypeptides are also provided. A method for inducing pathogen resistance in a plant using the nucleotide sequences disclosed herein is further provided. The method comprises introducing into a plant an expression cassette comprising a promoter operably linked to a nucleotide sequence that encodes an antipathogenic polypeptide of the invention. Compositions comprising an antipathogenic polypeptide or a transformed microorganism comprising a nucleic acid of the invention in combination with a carrier and methods of using these compositions to protect a plant from a pathogen are further provided. Transformed plants, plant cells, seeds, and microorganisms comprising a nucleotide sequence that encodes an antipathogenic polypeptide of the invention are also disclosed.

Nucleotide sequence and proposed secondary structure of Columnea latent viroid: a natural mosaic of viroid sequences.

PubMed Central

Hammond, R; Smith, D R; Diener, T O

1989-01-01

The Columnea latent viroid (CLV) occurs latently in certain Columnea erythrophae plants grown commercially. In potato and tomato, CLV causes potato spindle tuber viroid (PSTV)-like symptoms. Its nucleotide sequence and proposed secondary structure reveal that CLV consists of a single-stranded circular RNA of 370 nucleotides which can assume a rod-like structure with extensive base-pairing characteristic of all known viroids. The electrophoretic mobility of circular CLV under nondenaturing conditions suggests a potential tertiary structure. CLV contains extensive sequence homologies to the PSTV group of viroids but contains a central conserved region identical to that of hop stunt viroid (HSV). CLV also shares some biological properties with each of the two types of viroids. Most probably, CLV is the result of intracellular RNA recombination between an HSV-type and one or more PSTV-type viroids replicating in the same plant. Images PMID:2602114

GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts

PubMed Central

Naito, Yuki; Bono, Hidemasa

2012-01-01

GGRNA (http://GGRNA.dbcls.jp/) is a Google-like, ultrafast search engine for genes and transcripts. The web server accepts arbitrary words and phrases, such as gene names, IDs, gene descriptions, annotations of gene and even nucleotide/amino acid sequences through one simple search box, and quickly returns relevant RefSeq transcripts. A typical search takes just a few seconds, which dramatically enhances the usability of routine searching. In particular, GGRNA can search sequences as short as 10 nt or 4 amino acids, which cannot be handled easily by popular sequence analysis tools. Nucleotide sequences can be searched allowing up to three mismatches, or the query sequences may contain degenerate nucleotide codes (e.g. N, R, Y, S). Furthermore, Gene Ontology annotations, Enzyme Commission numbers and probe sequences of catalog microarrays are also incorporated into GGRNA, which may help users to conduct searches by various types of keywords. GGRNA web server will provide a simple and powerful interface for finding genes and transcripts for a wide range of users. All services at GGRNA are provided free of charge to all users. PMID:22641850

GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.

PubMed

Naito, Yuki; Bono, Hidemasa

2012-07-01

GGRNA (http://GGRNA.dbcls.jp/) is a Google-like, ultrafast search engine for genes and transcripts. The web server accepts arbitrary words and phrases, such as gene names, IDs, gene descriptions, annotations of gene and even nucleotide/amino acid sequences through one simple search box, and quickly returns relevant RefSeq transcripts. A typical search takes just a few seconds, which dramatically enhances the usability of routine searching. In particular, GGRNA can search sequences as short as 10 nt or 4 amino acids, which cannot be handled easily by popular sequence analysis tools. Nucleotide sequences can be searched allowing up to three mismatches, or the query sequences may contain degenerate nucleotide codes (e.g. N, R, Y, S). Furthermore, Gene Ontology annotations, Enzyme Commission numbers and probe sequences of catalog microarrays are also incorporated into GGRNA, which may help users to conduct searches by various types of keywords. GGRNA web server will provide a simple and powerful interface for finding genes and transcripts for a wide range of users. All services at GGRNA are provided free of charge to all users.

Nucleotide sequence of an exceptionally long 5.8S ribosomal RNA from Crithidia fasciculata.

PubMed Central

Schnare, M N; Gray, M W

1982-01-01

In Crithidia fasciculata, a trypanosomatid protozoan, the large ribosomal subunit contains five small RNA species (e, f, g, i, j) in addition to 5S rRNA [Gray, M.W. (1981) Mol. Cell. Biol. 1, 347-357]. The complete primary sequence of species i is shown here to be pAACGUGUmCGCGAUGGAUGACUUGGCUUCCUAUCUCGUUGA ... AGAmACGCAGUAAAGUGCGAUAAGUGGUApsiCAAUUGmCAGAAUCAUUCAAUUACCGAAUCUUUGAACGAAACGG ... CGCAUGGGAGAAGCUCUUUUGAGUCAUCCCCGUGCAUGCCAUAUUCUCCAmGUGUCGAA(C)OH. This sequence establishes that species i is a 5.8S rRNA, despite its exceptional length (171-172 nucleotides). The extra nucleotides in C. fasciculata 5.8S rRNA are located in a region whose primary sequence and length are highly variable among 5.8S rRNAs, but which is capable of forming a stable hairpin loop structure (the "G+C-rich hairpin"). The sequence of C. fasciculata 5.8S rRNA is no more closely related to that of another protozoan, Acanthamoeba castellanii, than it is to representative 5.8S rRNA sequences from the other eukaryotic kingdoms, emphasizing the deep phylogenetic divisions that seem to exist within the Kingdom Protista. Images PMID:7079176

The C-terminal Helix of Pseudomonas aeruginosa Elongation Factor Ts Tunes EF-Tu Dynamics to Modulate Nucleotide Exchange.

PubMed

De Laurentiis, Evelina Ines; Mercier, Evan; Wieden, Hans-Joachim

2016-10-28

Little is known about the conservation of critical kinetic parameters and the mechanistic strategies of elongation factor (EF) Ts-catalyzed nucleotide exchange in EF-Tu in bacteria and particularly in clinically relevant pathogens. EF-Tu from the clinically relevant pathogen Pseudomonas aeruginosa shares over 84% sequence identity with the corresponding elongation factor from Escherichia coli Interestingly, the functionally closely linked EF-Ts only shares 55% sequence identity. To identify any differences in the nucleotide binding properties, as well as in the EF-Ts-mediated nucleotide exchange reaction, we performed a comparative rapid kinetics and mutagenesis analysis of the nucleotide exchange mechanism for both the E. coli and P. aeruginosa systems, identifying helix 13 of EF-Ts as a previously unnoticed regulatory element in the nucleotide exchange mechanism with species-specific elements. Our findings support the base side-first entry of the nucleotide into the binding pocket of the EF-Tu·EF-Ts binary complex, followed by displacement of helix 13 and rapid binding of the phosphate side of the nucleotide, ultimately leading to the release of EF-Ts. © 2016 by The American Society for Biochemistry and Molecular Biology, Inc.

Polymerase chain reaction (PCR) amplification of a nucleoprotein gene sequence of infectious hematopoietic necrosis virus

USGS Publications Warehouse

Arakawa, C.K.; Deering, R.E.; Higman, K.H.; Oshima, K.H.; O'Hara, P.J.; Winton, J.R.

1990-01-01

The polymerase chain reaction [PCR) was used to amplify a portion of the nucleoprotein [NI gene of infectious hematopoietic necrosis virus (IHNV). Using a published sequence for the Round Butte isolate of IHNV, a pair of PCR pnmers was synthesized that spanned a 252 nucleotide region of the N gene from residue 319 to residue 570 of the open reading frame. This region included a 30 nucleotide target sequence for a synthetic oligonucleotide probe developed for detection of IHNV N gene messenger RNA. After 25 cycles of amplification of either messenger or genomic RNA, the PCR product (DNA) of the expected size was easily visible on agarose gels stained with ethidium bromide. The specificity of the amplified DNA was confirmed by Southern and dot-blot analysis using the biotinylated oligonucleotide probe. The PCR was able to amplify the N gene sequence of purified genomic RNA from isolates of IHNV representing 5 different electropherotypes. Using the IHNV primer set, no PCR product was obtained from viral hemorrhagic septicemia virus RNA, but 2 higher molecular weight products were synthesized from hirame rhabdovirus RNA that did not hybridize with the biotinylated probe. The PCR could be efficiently performed with all IHNV genomic RNA template concentrations tested (1 ng to 1 pg). The lowest level of sensitivity was not determined. The PCR was used to amplify RNA extracted from infected cell cultures and selected tissues of Infected rainbow trout. The combination of PCR and nucleic acid probe promises to provide a detection method for IHNV that is rapid, h~ghly specific, and sensitive.

Sequenza: allele-specific copy number and mutation profiles from tumor sequencing data.

PubMed

Favero, F; Joshi, T; Marquard, A M; Birkbak, N J; Krzystanek, M; Li, Q; Szallasi, Z; Eklund, A C

2015-01-01

Exome or whole-genome deep sequencing of tumor DNA along with paired normal DNA can potentially provide a detailed picture of the somatic mutations that characterize the tumor. However, analysis of such sequence data can be complicated by the presence of normal cells in the tumor specimen, by intratumor heterogeneity, and by the sheer size of the raw data. In particular, determination of copy number variations from exome sequencing data alone has proven difficult; thus, single nucleotide polymorphism (SNP) arrays have often been used for this task. Recently, algorithms to estimate absolute, but not allele-specific, copy number profiles from tumor sequencing data have been described. We developed Sequenza, a software package that uses paired tumor-normal DNA sequencing data to estimate tumor cellularity and ploidy, and to calculate allele-specific copy number profiles and mutation profiles. We applied Sequenza, as well as two previously published algorithms, to exome sequence data from 30 tumors from The Cancer Genome Atlas. We assessed the performance of these algorithms by comparing their results with those generated using matched SNP arrays and processed by the allele-specific copy number analysis of tumors (ASCAT) algorithm. Comparison between Sequenza/exome and SNP/ASCAT revealed strong correlation in cellularity (Pearson's r = 0.90) and ploidy estimates (r = 0.42, or r = 0.94 after manual inspecting alternative solutions). This performance was noticeably superior to previously published algorithms. In addition, in artificial data simulating normal-tumor admixtures, Sequenza detected the correct ploidy in samples with tumor content as low as 30%. The agreement between Sequenza and SNP array-based copy number profiles suggests that exome sequencing alone is sufficient not only for identifying small scale mutations but also for estimating cellularity and inferring DNA copy number aberrations. © The Author 2014. Published by Oxford University Press on behalf of the European Society for Medical Oncology.

Simian virus 40 major late promoter: an upstream DNA sequence required for efficient in vitro transcription.

PubMed Central

Brady, J; Radonovich, M; Thoren, M; Das, G; Salzman, N P

1984-01-01

We have previously identified an 11-base DNA sequence, 5'-G-G-T-A-C-C-T-A-A-C-C-3' (simian virus 40 [SV40] map position 294 to 304), which is important in the control of SV40 late RNA expression in vitro and in vivo (Brady et al., Cell 31:625-633, 1982). We report here the identification of another domain of the SV40 late promoter. A series of mutants with deletions extending from SV40 map position 0 to 300 was prepared by nuclease BAL 31 treatment. The cloned templates were then analyzed for efficiency and accuracy of late SV40 RNA expression in the Manley in vitro transcription system. Our studies showed that, in addition to the promoter domain near map position 300, there are essential DNA sequences between nucleotide positions 74 and 95 that are required for efficient expression of late SV40 RNA. Included in this SV40 DNA sequence were two of the six GGGCGG SV40 repeat sequences and an 11-nucleotide segment which showed strong homology with the upstream sequences required for the efficient in vitro and in vivo expression of the histone H2A gene. This upstream promoter sequence supported transcription with the same efficiency even when it was moved 72 nucleotides closer to the major late cap site. In vitro promoter competition analysis demonstrated that the upstream promoter sequence, independent of the 294 to 304 promoter element, is capable of binding polymerase-transcription factors required for SV40 late gene transcription. Finally, we show that DNA sequences which control the specificity of RNA initiation at nucleotide 325 lie downstream of map position 294. Images PMID:6321950

Nucleotide sequence of Hungarian grapevine chrome mosaic nepovirus RNA1.

PubMed Central

Le Gall, O; Candresse, T; Brault, V; Dunez, J

1989-01-01

The nucleotide sequence of the RNA1 of hungarian grapevine chrome mosaic virus, a nepovirus very closely related to tomato black ring virus, has been determined from cDNA clones. It is 7212 nucleotides in length excluding the 3' terminal poly(A) tail and contains a large open reading frame extending from nucleotides 216 to 6971. The presumably encoded polyprotein is 2252 amino acids in length with a molecular weight of 250 kDa. The primary structure of the polyprotein was compared with that of other viral polyproteins, revealing the same general genetic organization as that of other picorna-like viruses (comoviruses, potyviruses and picornaviruses), except that an additional protein is suspected to occupy the N-terminus of the polyprotein. PMID:2798128

A novel representation of the conformational structure of transfer RNAs. Correlation of the folding patterns of the polynucleotide chain with the base sequence and the nucleotide backbone torsions.

PubMed Central

Srinivasan, A R; Yathindra, N

1977-01-01

A novel description of the conformational characteristics of all the individual nucleotides and the phosphodiesters in tRNAs is presented in the form of a circular plot. This representation furnishes information of the base sequence with the folding patterns of the polynucleotide chain as one traverses along the circumference and with the individual nucleotide and phosphodiester linkage torsions along the radii. The circular plot obtained for yeast tRNAPhe strikingly distinguishes the helical and the loop regions. The variation of the different nucleotide torsions along the entire chain length and their effect on the secondary helical and tertiary loop regions become readily apparent. PMID:339206

A Bioluminometric Method of DNA Sequencing

NASA Technical Reports Server (NTRS)

Ronaghi, Mostafa; Pourmand, Nader; Stolc, Viktor; Arnold, Jim (Technical Monitor)

2001-01-01

Pyrosequencing is a bioluminometric single-tube DNA sequencing method that takes advantage of co-operativity between four enzymes to monitor DNA synthesis. In this sequencing-by-synthesis method, a cascade of enzymatic reactions yields detectable light, which is proportional to incorporated nucleotides. Pyrosequencing has the advantages of accuracy, flexibility and parallel processing. It can be easily automated. Furthermore, the technique dispenses with the need for labeled primers, labeled nucleotides and gel-electrophoresis. In this chapter, the use of this technique for different applications is discussed.

Information Entropy Analysis of the H1N1 Genetic Code

NASA Astrophysics Data System (ADS)

Martwick, Andy

2010-03-01

During the current H1N1 pandemic, viral samples are being obtained from large numbers of infected people world-wide and are being sequenced on the NCBI Influenza Virus Resource Database. The information entropy of the sequences was computed from the probability of occurrence of each nucleotide base at every position of each set of sequences using Shannon's definition of information entropy, [ H=∑bpb,2( 1pb ) ] where H is the observed information entropy at each nucleotide position and pb is the probability of the base pair of the nucleotides A, C, G, U. Information entropy of the current H1N1 pandemic is compared to reference human and swine H1N1 entropy. As expected, the current H1N1 entropy is in a low entropy state and has a very large mutation potential. Using the entropy method in mature genes we can identify low entropy regions of nucleotides that generally correlate to critical protein function.

Archaeon and archaeal virus diversity classification via sequence entropy and fractal dimension

NASA Astrophysics Data System (ADS)

Tremberger, George, Jr.; Gallardo, Victor; Espinoza, Carola; Holden, Todd; Gadura, N.; Cheung, E.; Schneider, P.; Lieberman, D.; Cheung, T.

2010-09-01

Archaea are important potential candidates in astrobiology as their metabolism includes solar, inorganic and organic energy sources. Archaeal viruses would also be expected to be present in a sustainable archaeal exobiological community. Genetic sequence Shannon entropy and fractal dimension can be used to establish a two-dimensional measure for classification and phylogenetic study of these organisms. A sequence fractal dimension can be calculated from a numerical series consisting of the atomic numbers of each nucleotide. Archaeal 16S and 23S ribosomal RNA sequences were studied. Outliers in the 16S rRNA fractal dimension and entropy plot were found to be halophilic archaea. Positive correlation (R-square ~ 0.75, N = 18) was observed between fractal dimension and entropy across the studied species. The 16S ribosomal RNA sequence entropy correlates with the 23S ribosomal RNA sequence entropy across species with R-square 0.93, N = 18. Entropy values correspond positively with branch lengths of a published phylogeny. The studied archaeal virus sequences have high fractal dimensions of 2.02 or more. A comparison of selected extremophile sequences with archaeal sequences from the Humboldt Marine Ecosystem database (Wood-Hull Oceanography Institute, MIT) suggests the presence of continuous sequence expression as inferred from distributions of entropy and fractal dimension, consistent with the diversity expected in an exobiological archaeal community.

Single-Cell Sequencing for Drug Discovery and Drug Development.

PubMed

Wu, Hongjin; Wang, Charles; Wu, Shixiu

2017-01-01

Next-generation sequencing (NGS), particularly single-cell sequencing, has revolutionized the scale and scope of genomic and biomedical research. Recent technological advances in NGS and singlecell studies have made the deep whole-genome (DNA-seq), whole epigenome and whole-transcriptome sequencing (RNA-seq) at single-cell level feasible. NGS at the single-cell level expands our view of genome, epigenome and transcriptome and allows the genome, epigenome and transcriptome of any organism to be explored without a priori assumptions and with unprecedented throughput. And it does so with single-nucleotide resolution. NGS is also a very powerful tool for drug discovery and drug development. In this review, we describe the current state of single-cell sequencing techniques, which can provide a new, more powerful and precise approach for analyzing effects of drugs on treated cells and tissues. Our review discusses single-cell whole genome/exome sequencing (scWGS/scWES), single-cell transcriptome sequencing (scRNA-seq), single-cell bisulfite sequencing (scBS), and multiple omics of single-cell sequencing. We also highlight the advantages and challenges of each of these approaches. Finally, we describe, elaborate and speculate the potential applications of single-cell sequencing for drug discovery and drug development. Copyright© Bentham Science Publishers; For any queries, please email at epub@benthamscience.org.

Genome Survey Sequencing of Luffa Cylindrica L. and Microsatellite High Resolution Melting (SSR-HRM) Analysis for Genetic Relationship of Luffa Genotypes

PubMed Central

An, Jianyu; Yin, Mengqi; Zhang, Qin; Gong, Dongting; Jia, Xiaowen; Guan, Yajing; Hu, Jin

2017-01-01

Luffa cylindrica (L.) Roem. is an economically important vegetable crop in China. However, the genomic information on this species is currently unknown. In this study, for the first time, a genome survey of L. cylindrica was carried out using next-generation sequencing (NGS) technology. In total, 43.40 Gb sequence data of L. cylindrica, about 54.94× coverage of the estimated genome size of 789.97 Mb, were obtained from HiSeq 2500 sequencing, in which the guanine plus cytosine (GC) content was calculated to be 37.90%. The heterozygosity of genome sequences was only 0.24%. In total, 1,913,731 contigs (>200 bp) with 525 bp N50 length and 1,410,117 scaffolds (>200 bp) with 885.01 Mb total length were obtained. From the initial assembled L. cylindrica genome, 431,234 microsatellites (SSRs) (≥5 repeats) were identified. The motif types of SSR repeats included 62.88% di-nucleotide, 31.03% tri-nucleotide, 4.59% tetra-nucleotide, 0.96% penta-nucleotide and 0.54% hexa-nucleotide. Eighty genomic SSR markers were developed, and 51/80 primers could be used in both “Zheda 23” and “Zheda 83”. Nineteen SSRs were used to investigate the genetic diversity among 32 accessions through SSR-HRM analysis. The unweighted pair group method analysis (UPGMA) dendrogram tree was built by calculating the SSR-HRM raw data. SSR-HRM could be effectively used for genotype relationship analysis of Luffa species. PMID:28891982

Reduced representation approaches to interrogate genome diversity in large repetitive plant genomes.

PubMed

Hirsch, Cory D; Evans, Joseph; Buell, C Robin; Hirsch, Candice N

2014-07-01

Technology and software improvements in the last decade now provide methodologies to access the genome sequence of not only a single accession, but also multiple accessions of plant species. This provides a means to interrogate species diversity at the genome level. Ample diversity among accessions in a collection of species can be found, including single-nucleotide polymorphisms, insertions and deletions, copy number variation and presence/absence variation. For species with small, non-repetitive rich genomes, re-sequencing of query accessions is robust, highly informative, and economically feasible. However, for species with moderate to large sized repetitive-rich genomes, technical and economic barriers prevent en masse genome re-sequencing of accessions. Multiple approaches to access a focused subset of loci in species with larger genomes have been developed, including reduced representation sequencing, exome capture and transcriptome sequencing. Collectively, these approaches have enabled interrogation of diversity on a genome scale for large plant genomes, including crop species important to worldwide food security. © The Author 2014. Published by Oxford University Press. All rights reserved. For permissions, please email: journals.permissions@oup.com.

Characterization of complete genome sequence of the spring viremia of carp virus isolated from common carp (Cyprinus carpio) in China.

PubMed

Teng, Y; Liu, H; Lv, J Q; Fan, W H; Zhang, Q Y; Qin, Q W

2007-01-01

The complete genome of spring viraemia of carp virus (SVCV) strain A-1 isolated from cultured common carp (Cyprinus carpio) in China was sequenced and characterized. Reverse transcription-polymerase chain reaction (RT-PCR) derived clones were constructed and the DNA was sequenced. It showed that the entire genome of SVCV A-1 consists of 11,100 nucleotide base pairs, the predicted size of the viral RNA of rhabdoviruses. However, the additional insertions in bp 4633-4676 and bp 4684-4724 of SVCV A-1 were different from the other two published SVCV complete genomes. Five open reading frames (ORFs) of SVCV A-1 were identified and further confirmed by RT-PCR and DNA sequencing of their respective RT-PCR products. The 5 structural proteins encoded by the viral RNA were ordered 3'-N-P-M-G-L-5'. This is the first report of a complete genome sequence of SVCV isolated from cultured carp in China. Phylogenetic analysis indicates that SVCV A-1 is closely related to the members of the genus Vesiculovirus, family Rhabdoviridae.

Describing sequencing results of structural chromosome rearrangements with a suggested next-generation cytogenetic nomenclature.

PubMed

Ordulu, Zehra; Wong, Kristen E; Currall, Benjamin B; Ivanov, Andrew R; Pereira, Shahrin; Althari, Sara; Gusella, James F; Talkowski, Michael E; Morton, Cynthia C

2014-05-01

With recent rapid advances in genomic technologies, precise delineation of structural chromosome rearrangements at the nucleotide level is becoming increasingly feasible. In this era of "next-generation cytogenetics" (i.e., an integration of traditional cytogenetic techniques and next-generation sequencing), a consensus nomenclature is essential for accurate communication and data sharing. Currently, nomenclature for describing the sequencing data of these aberrations is lacking. Herein, we present a system called Next-Gen Cytogenetic Nomenclature, which is concordant with the International System for Human Cytogenetic Nomenclature (2013). This system starts with the alignment of rearrangement sequences by BLAT or BLAST (alignment tools) and arrives at a concise and detailed description of chromosomal changes. To facilitate usage and implementation of this nomenclature, we are developing a program designated BLA(S)T Output Sequence Tool of Nomenclature (BOSToN), a demonstrative version of which is accessible online. A standardized characterization of structural chromosomal rearrangements is essential both for research analyses and for application in the clinical setting. Copyright © 2014 The American Society of Human Genetics. Published by Elsevier Inc. All rights reserved.

Pstl repeat: a family of short interspersed nucleotide element (SINE)-like sequences in the genomes of cattle, goat, and buffalo.

PubMed

Sheikh, Faruk G; Mukhopadhyay, Sudit S; Gupta, Prabhakar

2002-02-01

The PstI family of elements are short, highly repetitive DNA sequences interspersed throughout the genome of the Bovidae. We have cloned and sequenced some members of the PstI family from cattle, goat, and buffalo. These elements are approximately 500 bp, have a copy number of 2 x 10(5) - 4 x 10(5), and comprise about 4% of the haploid genome. Studies of nucleotide sequence homology indicate that the buffalo and goat PstI repeats (type II) are similar types of short interspersed nucleotide element (SINE) sequences, but the cattle PstI repeat (type I) is considerably more divergent. Additionally, the goat PstI sequence showed significant sequence homology with bovine serine tRNA, and is therefore likely derived from serine tRNA. Interestingly, Southern hybridization suggests that both types of SINEs (I and II) are present in all the species of Bovidae. Dendrogram analysis indicates that cattle PstI SINE is similar to bovine Alu-like SINEs. Goat and buffalo SINEs formed a separate cluster, suggesting that these two types of SINEs evolved separately in the genome of the Bovidae.

DNA sequencing using polymerase substrate-binding kinetics

PubMed Central

Previte, Michael John Robert; Zhou, Chunhong; Kellinger, Matthew; Pantoja, Rigo; Chen, Cheng-Yao; Shi, Jin; Wang, BeiBei; Kia, Amirali; Etchin, Sergey; Vieceli, John; Nikoomanzar, Ali; Bomati, Erin; Gloeckner, Christian; Ronaghi, Mostafa; He, Molly Min

2015-01-01

Next-generation sequencing (NGS) has transformed genomic research by decreasing the cost of sequencing. However, whole-genome sequencing is still costly and complex for diagnostics purposes. In the clinical space, targeted sequencing has the advantage of allowing researchers to focus on specific genes of interest. Routine clinical use of targeted NGS mandates inexpensive instruments, fast turnaround time and an integrated and robust workflow. Here we demonstrate a version of the Sequencing by Synthesis (SBS) chemistry that potentially can become a preferred targeted sequencing method in the clinical space. This sequencing chemistry uses natural nucleotides and is based on real-time recording of the differential polymerase/DNA-binding kinetics in the presence of correct or mismatch nucleotides. This ensemble SBS chemistry has been implemented on an existing Illumina sequencing platform with integrated cluster amplification. We discuss the advantages of this sequencing chemistry for targeted sequencing as well as its limitations for other applications. PMID:25612848

VarDetect: a nucleotide sequence variation exploratory tool

PubMed Central

Ngamphiw, Chumpol; Kulawonganunchai, Supasak; Assawamakin, Anunchai; Jenwitheesuk, Ekachai; Tongsima, Sissades

2008-01-01

Background Single nucleotide polymorphisms (SNPs) are the most commonly studied units of genetic variation. The discovery of such variation may help to identify causative gene mutations in monogenic diseases and SNPs associated with predisposing genes in complex diseases. Accurate detection of SNPs requires software that can correctly interpret chromatogram signals to nucleotides. Results We present VarDetect, a stand-alone nucleotide variation exploratory tool that automatically detects nucleotide variation from fluorescence based chromatogram traces. Accurate SNP base-calling is achieved using pre-calculated peak content ratios, and is enhanced by rules which account for common sequence reading artifacts. The proposed software tool is benchmarked against four other well-known SNP discovery software tools (PolyPhred, novoSNP, Genalys and Mutation Surveyor) using fluorescence based chromatograms from 15 human genes. These chromatograms were obtained from sequencing 16 two-pooled DNA samples; a total of 32 individual DNA samples. In this comparison of automatic SNP detection tools, VarDetect achieved the highest detection efficiency. Availability VarDetect is compatible with most major operating systems such as Microsoft Windows, Linux, and Mac OSX. The current version of VarDetect is freely available at . PMID:19091032

Description of the mitochondrial genome of the tree coral Dendrophyllia arbuscula (Anthozoa, Scleractinia).

PubMed

Luz, Bruna Louise Pereira; Capel, Kátia Cristina Cruz; Stampar, Sérgio Nascimento; Kitahara, Marcelo Visentini

2016-07-01

Dendrophylliidae is one of the few monophyletic families within the Scleractinia that embraces zooxanthellate and azooxanthellate species represented by both solitary and colonial forms. Among the exclusively azooxanthellate genera, Dendrophyllia is reported worldwide from 1 to 1200 m deep. To date, although three complete mitochondrial (mt) genomes from representatives of the family are available, only that from Turbinaria peltata has been formally published. Here we describe the complete nucleotide sequence of the mt genome from Dendrophyllia arbuscula that is 19 069 bp in length and comprises two rDNAs, two tRNAs, and 13 protein-coding genes arranged in the canonical scleractinian mt gene order. No genes overlap, resulting in the presence of 18 intergenic spacers and one of the longest scleractinian mt genome sequenced to date.

A Laboratory Exercise for Genotyping Two Human Single Nucleotide Polymorphisms

ERIC Educational Resources Information Center

Fernando, James; Carlson, Bradley; LeBard, Timothy; McCarthy, Michael; Umali, Finianne; Ashton, Bryce; Rose, Ferrill F., Jr.

2016-01-01

The dramatic decrease in the cost of sequencing a human genome is leading to an era in which a wide range of students will benefit from having an understanding of human genetic variation. Since over 90% of sequence variation between humans is in the form of single nucleotide polymorphisms (SNPs), a laboratory exercise has been devised in order to…

OrthoANI: An improved algorithm and software for calculating average nucleotide identity.

PubMed

Lee, Imchang; Ouk Kim, Yeong; Park, Sang-Cheol; Chun, Jongsik

2016-02-01

Species demarcation in Bacteria and Archaea is mainly based on overall genome relatedness, which serves a framework for modern microbiology. Current practice for obtaining these measures between two strains is shifting from experimentally determined similarity obtained by DNA-DNA hybridization (DDH) to genome-sequence-based similarity. Average nucleotide identity (ANI) is a simple algorithm that mimics DDH. Like DDH, ANI values between two genome sequences may be different from each other when reciprocal calculations are compared. We compared 63 690 pairs of genome sequences and found that the differences in reciprocal ANI values are significantly high, exceeding 1 % in some cases. To resolve this problem of not being symmetrical, a new algorithm, named OrthoANI, was developed to accommodate the concept of orthology for which both genome sequences were fragmented and only orthologous fragment pairs taken into consideration for calculating nucleotide identities. OrthoANI is highly correlated with ANI (using BLASTn) and the former showed approximately 0.1 % higher values than the latter. In conclusion, OrthoANI provides a more robust and faster means of calculating average nucleotide identity for taxonomic purposes. The standalone software tools are freely available at http://www.ezbiocloud.net/sw/oat.

Deep whole-genome sequencing of 90 Han Chinese genomes.

PubMed

Lan, Tianming; Lin, Haoxiang; Zhu, Wenjuan; Laurent, Tellier Christian Asker Melchior; Yang, Mengcheng; Liu, Xin; Wang, Jun; Wang, Jian; Yang, Huanming; Xu, Xun; Guo, Xiaosen

2017-09-01

Next-generation sequencing provides a high-resolution insight into human genetic information. However, the focus of previous studies has primarily been on low-coverage data due to the high cost of sequencing. Although the 1000 Genomes Project and the Haplotype Reference Consortium have both provided powerful reference panels for imputation, low-frequency and novel variants remain difficult to discover and call with accuracy on the basis of low-coverage data. Deep sequencing provides an optimal solution for the problem of these low-frequency and novel variants. Although whole-exome sequencing is also a viable choice for exome regions, it cannot account for noncoding regions, sometimes resulting in the absence of important, causal variants. For Han Chinese populations, the majority of variants have been discovered based upon low-coverage data from the 1000 Genomes Project. However, high-coverage, whole-genome sequencing data are limited for any population, and a large amount of low-frequency, population-specific variants remain uncharacterized. We have performed whole-genome sequencing at a high depth (∼×80) of 90 unrelated individuals of Chinese ancestry, collected from the 1000 Genomes Project samples, including 45 Northern Han Chinese and 45 Southern Han Chinese samples. Eighty-three of these 90 have been sequenced by the 1000 Genomes Project. We have identified 12 568 804 single nucleotide polymorphisms, 2 074 210 short InDels, and 26 142 structural variations from these 90 samples. Compared to the Han Chinese data from the 1000 Genomes Project, we have found 7 000 629 novel variants with low frequency (defined as minor allele frequency < 5%), including 5 813 503 single nucleotide polymorphisms, 1 169 199 InDels, and 17 927 structural variants. Using deep sequencing data, we have built a greatly expanded spectrum of genetic variation for the Han Chinese genome. Compared to the 1000 Genomes Project, these Han Chinese deep sequencing data enhance the characterization of a large number of low-frequency, novel variants. This will be a valuable resource for promoting Chinese genetics research and medical development. Additionally, it will provide a valuable supplement to the 1000 Genomes Project, as well as to other human genome projects. © The Authors 2017. Published by Oxford University Press.

Skipping of exon 27 in C3 gene compromises TED domain and results in complete human C3 deficiency.

PubMed

da Silva, Karina Ribeiro; Fraga, Tatiana Rodrigues; Lucatelli, Juliana Faggion; Grumach, Anete Sevciovic; Isaac, Lourdes

2016-05-01

Primary deficiency of complement C3 is rare and usually associated with increased susceptibility to bacterial infections. In this work, we investigated the molecular basis of complete C3 deficiency in a Brazilian 9-year old female patient with a family history of consanguinity. Hemolytic assays revealed complete lack of complement-mediated hemolytic activity in the patient's serum. While levels of the complement regulatory proteins Factor I, Factor H and Factor B were normal in the patient's and family members' sera, complement C3 levels were undetectable in the patient's serum and were reduced by at least 50% in the sera of the patient's parents and brother. Additionally, no C3 could be observed in the patient's plasma and cell culture supernatants by Western blot. We also observed that patient's skin fibroblasts stimulated with Escherichia coli LPS were unable to secrete C3, which might be accumulated within the cells before being intracellularly degraded. Sequencing analysis of the patient's C3 cDNA revealed a genetic mutation responsible for the complete skipping of exon 27, resulting in the loss of 99 nucleotides (3450-3549) located in the TED domain. Sequencing of the intronic region between the exons 26 and 27 of the C3 gene (nucleotides 6690313-6690961) showed a nucleotide exchange (T→C) at position 6690626 located in a splicing donor site, resulting in the complete skipping of exon 27 in the C3 mRNA. Copyright © 2016. Published by Elsevier GmbH.

Serotype and genetic diversity of human rhinovirus strains that circulated in Kenya in 2008.

PubMed

Milanoi, Sylvia; Ongus, Juliette R; Gachara, George; Coldren, Rodney; Bulimo, Wallace

2016-05-01

Human rhinoviruses (HRVs) are a well-established cause of the common cold and recent studies indicated that they may be associated with severe acute respiratory illnesses (SARIs) like pneumonia, asthma, and bronchiolitis. Despite global studies on the genetic diversity of the virus, the serotype diversity of these viruses across diverse geographic regions in Kenya has not been characterized. This study sought to characterize the serotype diversity of HRV strains that circulated in Kenya in 2008. A total of 517 archived nasopharyngeal samples collected in a previous respiratory virus surveillance program across Kenya in 2008 were selected. Participants enrolled were outpatients who presented with influenza-like (ILI) symptoms. Real-time RT-PCR was employed for preliminary HRV detection. HRV-positive samples were amplified using RT-PCR and thereafter the nucleotide sequences of the amplicons were determined followed by phylogenetic analysis. Twenty-five percent of the samples tested positive for HRV. Phylogenetic analysis revealed that the Kenyan HRVs clustered into three main species comprising HRV-A (54%), HRV-B (12%), and HRV-C (35%). Overall, 20 different serotypes were identified. Intrastrain sequence homology among the Kenyan strains ranged from 58% to 100% at the nucleotide level and 55% to 100% at the amino acid level. These results show that a wide range of HRV serotypes with different levels of nucleotide variation were present in Kenya. Furthermore, our data show that HRVs contributed substantially to influenza-like illness in Kenya in 2008. © 2016 The Authors. Influenza and Other Respiratory Viruses Published by John Wiley & Sons Ltd.

Solution structure of the catalytic domain of RICH protein from goldfish.

PubMed

Kozlov, Guennadi; Denisov, Alexey Y; Pomerantseva, Ekaterina; Gravel, Michel; Braun, Peter E; Gehring, Kalle

2007-03-01

Regeneration-induced CNPase homolog (RICH) is an axonal growth-associated protein, which is induced in teleost fish upon optical nerve injury. RICH consists of a highly acidic N-terminal domain, a catalytic domain with 2',3'-cyclic nucleotide 3'-phosphodiesterase (CNPase) activity and a C-terminal isoprenylation site. In vitro RICH and mammalian brain CNPase specifically catalyze the hydrolysis of 2',3'-cyclic nucleotides to produce 2'-nucleotides, but the physiologically relevant in vivo substrate remains unknown. Here, we report the NMR structure of the catalytic domain of goldfish RICH and describe its binding to CNPase inhibitors. The structure consists of a twisted nine-stranded antiparallel beta-sheet surrounded by alpha-helices on both sides. Despite significant local differences mostly arising from a seven-residue insert in the RICH sequence, the active site region is highly similar to that of human CNPase. Likewise, refinement of the catalytic domain of rat CNPase using residual dipolar couplings gave improved agreement with the published crystal structure. NMR titrations of RICH with inhibitors point to a similar catalytic mechanism for RICH and CNPase. The results suggest a functional importance for the evolutionarily conserved phosphodiesterase activity and hint of a link with pre-tRNA splicing.

Crystal structure of a DNA/Ba2+ G-quadruplex containing a water-mediated C-tetrad.

PubMed

Zhang, Diana; Huang, Terry; Lukeman, Philip S; Paukstelis, Paul J

2014-12-01

We have determined the 1.50 Å crystal structure of the DNA decamer, d(CCA(CNV)KGCGTGG) ((CNV)K, 3-cyanovinylcarbazole), which forms a G-quadruplex structure in the presence of Ba(2+). The structure contains several unique features including a bulged nucleotide and the first crystal structure observation of a C-tetrad. The structure reveals that water molecules mediate contacts between the divalent cations and the C-tetrad, allowing Ba(2+) ions to occupy adjacent steps in the central ion channel. One ordered Mg(2+) facilitates 3'-3' stacking of two quadruplexes in the asymmetric unit, while the bulged nucleotide mediates crystal contacts. Despite the high diffraction limit, the first four nucleotides including the (CNV)K nucleoside are disordered though they are still involved in crystal packing. This work suggests that the bulky hydrophobic groups may locally influence the formation of non-Watson-Crick structures from otherwise complementary sequences. These observations lead to the intriguing possibility that certain types of DNA damage may act as modulators of G-quadruplex formation. © The Author(s) 2014. Published by Oxford University Press on behalf of Nucleic Acids Research.

Recombination-dependent replication and gene conversion homogenize repeat sequences and diversify plastid genome structure.

PubMed

Ruhlman, Tracey A; Zhang, Jin; Blazier, John C; Sabir, Jamal S M; Jansen, Robert K

2017-04-01

There is a misinterpretation in the literature regarding the variable orientation of the small single copy region of plastid genomes (plastomes). The common phenomenon of small and large single copy inversion, hypothesized to occur through intramolecular recombination between inverted repeats (IR) in a circular, single unit-genome, in fact, more likely occurs through recombination-dependent replication (RDR) of linear plastome templates. If RDR can be primed through both intra- and intermolecular recombination, then this mechanism could not only create inversion isomers of so-called single copy regions, but also an array of alternative sequence arrangements. We used Illumina paired-end and PacBio single-molecule real-time (SMRT) sequences to characterize repeat structure in the plastome of Monsonia emarginata (Geraniaceae). We used OrgConv and inspected nucleotide alignments to infer ancestral nucleotides and identify gene conversion among repeats and mapped long (>1 kb) SMRT reads against the unit-genome assembly to identify alternative sequence arrangements. Although M. emarginata lacks the canonical IR, we found that large repeats (>1 kilobase; kb) represent ∼22% of the plastome nucleotide content. Among the largest repeats (>2 kb), we identified GC-biased gene conversion and mapping filtered, long SMRT reads to the M. emarginata unit-genome assembly revealed alternative, substoichiometric sequence arrangements. We offer a model based on RDR and gene conversion between long repeated sequences in the M. emarginata plastome and provide support that both intra-and intermolecular recombination between large repeats, particularly in repeat-rich plastomes, varies unit-genome structure while homogenizing the nucleotide sequence of repeats. © 2017 Botanical Society of America.

Genetic Characteristics of Coronaviruses from Korean Bats in 2016.

PubMed

Lee, Saemi; Jo, Seong-Deok; Son, Kidong; An, Injung; Jeong, Jipseol; Wang, Seung-Jun; Kim, Yongkwan; Jheong, Weonhwa; Oem, Jae-Ku

2018-01-01

Bats have increasingly been recognized as the natural reservoir of severe acute respiratory syndrome (SARS), coronavirus, and other coronaviruses found in mammals. However, little research has been conducted on bat coronaviruses in South Korea. In this study, bat samples (332 oral swabs, 245 fecal samples, 38 urine samples, and 57 bat carcasses) were collected at 33 natural bat habitat sites in South Korea. RT-PCR and sequencing were performed for specific coronavirus genes to identify the bat coronaviruses in different bat samples. Coronaviruses were detected in 2.7% (18/672) of the samples: 13 oral swabs from one species of the family Rhinolophidae, and four fecal samples and one carcass (intestine) from three species of the family Vespertiliodae. To determine the genetic relationships of the 18 sequences obtained in this study and previously known coronaviruses, the nucleotide sequences of a 392-nt region of the RNA-dependent RNA polymerase (RdRp) gene were analyzed phylogenetically. Thirteen sequences belonging to SARS-like betacoronaviruses showed the highest nucleotide identity (97.1-99.7%) with Bat-CoV-JTMC15 reported in China. The other five sequences were most similar to MERS-like betacoronaviruses. Four nucleotide sequences displayed the highest identity (94.1-95.1%) with Bat-CoV-HKU5 from Hong Kong. The one sequence from a carcass showed the highest nucleotide identity (99%) with Bat-CoV-SC2013 from China. These results suggest that careful surveillance of coronaviruses from bats should be continued, because animal and human infections may result from the genetic variants present in bat coronavirus reservoirs.

Nucleotide sequence of the gag gene and gag-pol junction of feline leukemia virus.

PubMed Central

Laprevotte, I; Hampe, A; Sherr, C J; Galibert, F

1984-01-01

The nucleotide sequence of the gag gene of feline leukemia virus and its flanking sequences were determined and compared with the corresponding sequences of two strains of feline sarcoma virus and with that of the Moloney strain of murine leukemia virus. A high degree of nucleotide sequence homology between the feline leukemia virus and murine leukemia virus gag genes was observed, suggesting that retroviruses of domestic cats and laboratory mice have a common, proximal evolutionary progenitor. The predicted structure of the complete feline leukemia virus gag gene precursor suggests that the translation of nonglycosylated and glycosylated gag gene polypeptides is initiated at two different AUG codons. These initiator codons fall in the same reading frame and are separated by a 222-base-pair segment which encodes an amino terminal signal peptide. The nucleotide sequence predicts the order of amino acids in each of the individual gag-coded proteins (p15, p12, p30, p10), all of which derive from the gag gene precursor. Stable stem-and-loop secondary structures are proposed for two regions of viral RNA. The first falls within sequences at the 5' end of the viral genome, together with adjacent palindromic sequences which may play a role in dimer linkage of RNA subunits. The second includes coding sequences at the gag-pol junction and is proposed to be involved in translation of the pol gene product. Sequence analysis of the latter region shows that the gag and pol genes are translated in different reading frames. Classical consensus splice donor and acceptor sequences could not be localized to regions which would permit synthesis of the expected gag-pol precursor protein. Alternatively, we suggest that the pol gene product (RNA-dependent DNA polymerase) could be translated by a frameshift suppressing mechanism which could involve cleavage modification of stems and loops in a manner similar to that observed in tRNA processing. PMID:6328019

Evaluation of targeted exome sequencing for 28 protein-based blood group systems, including the homologous gene systems, for blood group genotyping.

PubMed

Schoeman, Elizna M; Lopez, Genghis H; McGowan, Eunike C; Millard, Glenda M; O'Brien, Helen; Roulis, Eileen V; Liew, Yew-Wah; Martin, Jacqueline R; McGrath, Kelli A; Powley, Tanya; Flower, Robert L; Hyland, Catherine A

2017-04-01

Blood group single nucleotide polymorphism genotyping probes for a limited range of polymorphisms. This study investigated whether massively parallel sequencing (also known as next-generation sequencing), with a targeted exome strategy, provides an extended blood group genotype and the extent to which massively parallel sequencing correctly genotypes in homologous gene systems, such as RH and MNS. Donor samples (n = 28) that were extensively phenotyped and genotyped using single nucleotide polymorphism typing, were analyzed using the TruSight One Sequencing Panel and MiSeq platform. Genes for 28 protein-based blood group systems, GATA1, and KLF1 were analyzed. Copy number variation analysis was used to characterize complex structural variants in the GYPC and RH systems. The average sequencing depth per target region was 66.2 ± 39.8. Each sample harbored on average 43 ± 9 variants, of which 10 ± 3 were used for genotyping. For the 28 samples, massively parallel sequencing variant sequences correctly matched expected sequences based on single nucleotide polymorphism genotyping data. Copy number variation analysis defined the Rh C/c alleles and complex RHD hybrids. Hybrid RHD*D-CE-D variants were correctly identified, but copy number variation analysis did not confidently distinguish between D and CE exon deletion versus rearrangement. The targeted exome sequencing strategy employed extended the range of blood group genotypes detected compared with single nucleotide polymorphism typing. This single-test format included detection of complex MNS hybrid cases and, with copy number variation analysis, defined RH hybrid genes along with the RHCE*C allele hitherto difficult to resolve by variant detection. The approach is economical compared with whole-genome sequencing and is suitable for a red blood cell reference laboratory setting. © 2017 AABB.

Identification and nucleotide sequence analysis of the repetitive DNA element in the genome of fish lymphocystis disease virus.

PubMed

Schnitzler, P; Delius, H; Scholz, J; Touray, M; Orth, E; Darai, G

1987-12-01

The genome of the fish lymphocystis disease virus (FLDV) was screened for the existence of repetitive DNA sequences using a defined and complete gene library of the viral genome (98 kbp) by DNA-DNA hybridization, heteroduplex analysis, and restriction fine mapping. A repetitive DNA sequence was detected at the coordinates 0.034 to 0.057 and 0.718 to 0.736 map units (m.u.) of the FLDV genome. The first region (0.034 to 0.057 m.u.) corresponds to the 5' terminus of the EcoRI FLDV DNA fragment B (0.034 to 0.165 m.u.) and the second region (0.718 to 0.736 m.u.) is identical to the EcoRI DNA fragment M of the viral genome. The DNA nucleotide sequence of the EcoRI FLDV DNA fragment M was determined. This analysis revealed the presence of many short direct and inverted repetitions, e.g., a 18-mer direct repetition (TTTAAAATTTAATTAA) that started at nucleotide positions 812 and 942 and a 14-mer inverted repeat (TTAAATTTAAATTT) at nucleotide positions 820 and 959. Only short open reading frames were detected within this region. The DNA repetitions are discussed as sequences that play a possible regulatory role for virus replication. Furthermore, hybridization experiments revealed that the repetitive DNA sequences are conserved in the genome of different strains of fish lymphocystis disease virus isolated from two species of Pleuronectidae (flounder and dab).

Formation of cis-diamminedichloroplatinum(II) 1,2-intrastrand cross-links on DNA is flanking-sequence independent.

PubMed

Burstyn, J N; Heiger-Bernays, W J; Cohen, S M; Lippard, S J

2000-11-01

Mapping of cis-diamminedichloroplatinum(II) (cis-DDP, cisplatin) DNA adducts over >3000 nucleotides was carried out using a replication blockage assay. The sites of inhibition of modified T4 DNA polymerase, also referred to as stop sites, were analyzed to determine the effects of local sequence context on the distribution of intrastrand cisplatin cross-links. In a 3120 base fragment from replicative form M13mp18 DNA containing 24.6% guanine, 25.5% thymine, 26.9% adenine and 23.0% cytosine, 166 individual stop sites were observed at a bound platinum/nucleotide ratio of 1-2 per thousand. The majority of stop sites (90%) occurred at G(n>2) sequences and the remainder were located at sites containing an AG dinucleotide. For all of the GG sites present in the mapped sequences, including those with Gn(>)2, 89% blocked replication, whereas for the AG sites only 17% blocked replication. These blockage sites were independent of flanking nucleotides in a sequence of N(1)G*G*N(2) where N(1), N(2) = A, C, G, T and G*G* indicates a 1,2-intrastrand platinum cross-link. The absence of long-range sequence dependence was confirmed by monitoring the reaction of cisplatin with a plasmid containing an 800 bp insert of the human telomere repeat sequence (TTAGGG)(n). Platination reactions monitored at several formal platinum/nucleotide ratios or as a function of time reveal that the telomere insert was not preferentially damaged by cisplatin. Both replication blockage and telomere-insert plasmid platination experiments indicate that cisplatin 1,2-intrastrand adducts do not form preferentially at G-rich sequences in vitro.

Sequence analysis of porcine kobuvirus VP1 region detected in pigs in Japan and Thailand.

PubMed

Okitsu, Shoko; Khamrin, Pattara; Thongprachum, Aksara; Hidaka, Satoshi; Kongkaew, Sompreeya; Kongkaew, Apisek; Maneekarn, Niwat; Mizuguchi, Masashi; Hayakawa, Satoshi; Ushijima, Hiroshi

2012-04-01

Porcine kobuvirus is a new candidate species of the genus Kobuvirus in the family Picornaviridae, and information is still limited. The identification of porcine kobuvirus has been performed by the sequence analyses of the 3D region of the viruses. Therefore, the purpose of this study was to characterize the molecular properties of VP1 nucleotide sequences of the porcine kobuviruses isolated from porcine stool samples in Japan during 2009 and Thailand between 2006 and 2008. In addition, previous identification of a unique porcine kobuvirus; Japanese H023/2009/JP, which is a bovine kobuvirus-like strain based on sequence analysis of the 3D region, was also included in this study. All of the strains were amplified by the VP1-specific primer pair: the amplicons were subjected to direct sequencing and compared with the VP1 nucleotide sequences of reference strains. The VP1 sequences of strains from the GenBank database revealed high nucleotide sequence identity at 84.3-100%. On the other hand, the nucleotide identities among the 15 porcine kobuvirus strains analyzed in this study ranged from 78.8 to 99.8%. The results revealed that diversity of the strains in this study were higher than those of the strains in previous studies. Furthermore, it was found that the VP1 region of the bovine kobuvirus-like strain, H023/2009/JP, clustered with nine porcine kobuvirus strains that were isolated in Thailand and Japan. Since this strain was previously found to be closely related to bovine kobuviruses in the 3D gene region, it may be a natural recombinant.

Terminator oligo blocking efficiently eliminates rRNA from Drosophila small RNA sequencing libraries.

PubMed

Wickersheim, Michelle L; Blumenstiel, Justin P

2013-11-01

A large number of methods are available to deplete ribosomal RNA reads from high-throughput RNA sequencing experiments. Such methods are critical for sequencing Drosophila small RNAs between 20 and 30 nucleotides because size selection is not typically sufficient to exclude the highly abundant class of 30 nucleotide 2S rRNA. Here we demonstrate that pre-annealing terminator oligos complimentary to Drosophila 2S rRNA prior to 5' adapter ligation and reverse transcription efficiently depletes 2S rRNA sequences from the sequencing reaction in a simple and inexpensive way. This depletion is highly specific and is achieved with minimal perturbation of miRNA and piRNA profiles.

The ura5 gene of the ascomycete Sordaria macrospora: molecular cloning, characterization and expression in Escherichia coli.

PubMed

Le Chevanton, L; Leblon, G

1989-04-15

We cloned the ura5 gene coding for the orotate phosphoribosyl transferase from the ascomycete Sordaria macrospora by heterologous probing of a Sordaria genomic DNA library with the corresponding Podospora anserina sequence. The Sordaria gene was expressed in an Escherichia coli pyrE mutant strain defective for the same enzyme, and expression was shown to be promoted by plasmid sequences. The nucleotide sequence of the 1246-bp DNA fragment encompassing the region of homology with the Podospora gene has been determined. This sequence contains an open reading frame of 699 nucleotides. The deduced amino acid sequence shows 72% similarity with the corresponding Podospora protein.

Quantum-Sequencing: Fast electronic single DNA molecule sequencing

NASA Astrophysics Data System (ADS)

Casamada Ribot, Josep; Chatterjee, Anushree; Nagpal, Prashant

2014-03-01

A major goal of third-generation sequencing technologies is to develop a fast, reliable, enzyme-free, high-throughput and cost-effective, single-molecule sequencing method. Here, we present the first demonstration of unique ``electronic fingerprint'' of all nucleotides (A, G, T, C), with single-molecule DNA sequencing, using Quantum-tunneling Sequencing (Q-Seq) at room temperature. We show that the electronic state of the nucleobases shift depending on the pH, with most distinct states identified at acidic pH. We also demonstrate identification of single nucleotide modifications (methylation here). Using these unique electronic fingerprints (or tunneling data), we report a partial sequence of beta lactamase (bla) gene, which encodes resistance to beta-lactam antibiotics, with over 95% success rate. These results highlight the potential of Q-Seq as a robust technique for next-generation sequencing.

LISTA, a comprehensive compilation of nucleotide sequences encoding proteins from the yeast Saccharomyces.

PubMed Central

Linder, P; Dölz, R; Mossé, M O; Lazowska, J; Slonimski, P P

1993-01-01

The amount of nucleotide sequence data is increasing exponentially. We therefore made an effort to make a comprehensive database (LISTA) for the yeast Saccharomyces cerevisiae. Each sequence has been attributed a single genetic name and in the case of allelic duplicated sequences, synonyms are given, if necessary. For the nomenclature we have introduced a standard principle for naming gene sequences based on priority rules. We have also applied a simple method to distinguish duplicated sequences of one and the same gene from non-allelic sequences of duplicated genes. By using these principles we have sorted out a lot of confusion in the literature and databanks. Along with the genetic name, the mnemonic from the EMBL databank, the codon bias, reference of the publication of the sequence and the EMBL accession numbers are included in each entry. PMID:8332521

iPARTS2: an improved tool for pairwise alignment of RNA tertiary structures, version 2.

PubMed

Yang, Chung-Han; Shih, Cheng-Ting; Chen, Kun-Tze; Lee, Po-Han; Tsai, Ping-Han; Lin, Jian-Cheng; Yen, Ching-Yu; Lin, Tiao-Yin; Lu, Chin Lung

2016-07-08

Since its first release in 2010, iPARTS has become a valuable tool for globally or locally aligning two RNA 3D structures. It was implemented by a structural alphabet (SA)-based approach, which uses an SA of 23 letters to reduce RNA 3D structures into 1D sequences of SA letters and applies traditional sequence alignment to these SA-encoded sequences for determining their global or local similarity. In this version, we have re-implemented iPARTS into a new web server iPARTS2 by constructing a totally new SA, which consists of 92 elements with each carrying both information of base and backbone geometry for a representative nucleotide. This SA is significantly different from the one used in iPARTS, because the latter consists of only 23 elements with each carrying only the backbone geometry information of a representative nucleotide. Our experimental results have shown that iPARTS2 outperforms its previous version iPARTS and also achieves better accuracy than other popular tools, such as SARA, SETTER and RASS, in RNA alignment quality and function prediction. iPARTS2 takes as input two RNA 3D structures in the PDB format and outputs their global or local alignments with graphical display. iPARTS2 is now available online at http://genome.cs.nthu.edu.tw/iPARTS2/. © The Author(s) 2016. Published by Oxford University Press on behalf of Nucleic Acids Research.

The human myelin oligodendrocyte glycoprotein (MOG) gene: Complete nucleotide sequence and structural characterization

DOE Office of Scientific and Technical Information (OSTI.GOV)

Paule Roth, M.; Malfroy, L.; Offer, C.

1995-07-20

Human myelin oligodendrocyte glycoprotein (MOG), a myelin component of the central nervous system, is a candidate target antigen for autoimmune-mediated demyelination. We have isolated and sequenced part of a cosmid clone that contains the entire human MOG gene. The primary nuclear transcript, extending from the putative start of transcription to the site of poly(A) addition, is 15,561 nucleotides in length. The human MOG gene contains 8 exons, separated by 7 introns; canonical intron/exon boundary sites are observed at each junction. The introns vary in size from 242 to 6484 bp and contain numerous repetitive DNA elements, including 14 Alu sequencesmore » within 3 introns. Another Alu element is located in the 3{prime}-untranslated region of the gene. Alu sequences were classified with respect to subfamily assignment. Seven hundred sixty-three nucleotides 5{prime} of the transcription start and 1214 nucleotides 3{prime} of the poly(A) addition sites were also sequenced. The 5{prime}-flanking region revealed the presence of several consensus sequences that could be relevant in the transcription of the MOG gene, in particular binding sites in common with other myelin gene promoters. Two polymorphic intragenic dinucleotide (CA){sub n} and tetranucleotide (TAAA){sub n} repeats were identified and may provide genetic marker tools for association and linkage studies. 50 refs., 3 figs., 3 tabs.« less

cDNA cloning of the human peroxisomal enoyl-CoA hydratase: 3-Hydroxyacyl-CoA dehydrogenase bifunctional enzyme and localization to chromosome 3q26. 3-3q28: A free left Alu arm is inserted in the 3[prime] noncoding region

DOE Office of Scientific and Technical Information (OSTI.GOV)

Hoefler, G.; Forstner, M.; Hulla, W.

1994-01-01

Enoyl-CoA hydratase:3-hydroxyacyl-CoA dehydrogenase bifunctional enzyme is one of the four enzymes of the peroxisomal, [beta]-oxidation pathway. Here, the authors report the full-length human cDNA sequence and the localization of the corresponding gene on chromosome 3q26.3-3q28. The cDNA sequence spans 3779 nucleotides with an open reading frame of 2169 nucleotides. The tripeptide SKL at the carboxy terminus, known to serve as a peroxisomal targeting signal, is present. DNA sequence comparison of the coding region showed an 80% homology between human and rat bifunctional enzyme cDNA. The 3[prime] noncoding sequence contains 117 nucleotides homologous to an Alu repeat. Based on sequence comparison,more » they propose that these nucleotides are a free left Alu arm with 86% homology to the Alu-J family. RNA analysis shows one band with highest intensity in liver and kidney. This cDNA will allow in-depth studies of molecular defects in patients with defective peroxisomal bifunctional enzyme. Moreover, it will also provide a means for studying the regulation of peroxisomal [beta]-oxidation in humans. 33 refs., 5 figs.« less

Phylogenetic Analysis of Myobia musculi (Schranck, 1781) by Using the 18S Small Ribosomal Subunit Sequence

PubMed Central

Feldman, Sanford H; Ntenda, Abraham M

2011-01-01

We used high-fidelity PCR to amplify 2 overlapping regions of the ribosomal gene complex from the rodent fur mite Myobia musculi. The amplicons encompassed a large portion of the mite's ribosomal gene complex spanning 3128 nucleotides containing the entire 18S rRNA, internal transcribed spacer (ITS) 1, 5.8S rRNA, ITS2, and a portion of the 5′-end of the 28S rRNA. M. musculi’s 179-nucleotide 5.8S rRNA nucleotide sequence was not conserved, so this region was identified by conservation of rRNA secondary structure. Maximum likelihood and Bayesian inference phylogenetic analyses were performed by using multiple sequence alignment consisting of 1524 nucleotides of M. musculi 18S rRNA and homologous sequences from 42 prostigmatid mites and the tick Dermacentor andersoni. The phylograms produced by both methods were in agreement regarding terminal, secondary, and some tertiary phylogenetic relationships among mites. Bayesian inference discriminated most infraordinal relationships between Eleutherengona and Parasitengona mites in the suborder Anystina. Basal relationships between suborders Anystina and Eupodina historically determined by comparing differences in anatomic characteristics were less well-supported by our molecular analysis. Our results recapitulated similar 18S rRNA sequence analyses recently reported. Our study supports M. musculi as belonging to the suborder Anystina, infraorder Eleutherenona, and superfamily Cheyletoidea. PMID:22330574

New chloroplast microsatellite markers suitable for assessing genetic diversity of Lolium perenne and other related grass species

PubMed Central

Diekmann, Kerstin; Hodkinson, Trevor R.; Barth, Susanne

2012-01-01

Background and Aims Lolium perenne (perennial ryegrass) is the most important forage grass species of temperate regions. We have previously released the chloroplast genome sequence of L. perenne ‘Cashel’. Here nine chloroplast microsatellite markers are published, which were designed based on knowledge about genetically variable regions within the L. perenne chloroplast genome. These markers were successfully used for characterizing the genetic diversity in Lolium and different grass species. Methods Chloroplast genomes of 14 Poaceae taxa were screened for mononucleotide microsatellite repeat regions and primers designed for their amplification from nine loci. The potential of these markers to assess genetic diversity was evaluated on a set of 16 Irish and 15 European L. perenne ecotypes, nine L. perenne cultivars, other Lolium taxa and other grass species. Key Results All analysed Poaceae chloroplast genomes contained more than 200 mononucleotide repeats (chloroplast simple sequence repeats, cpSSRs) of at least 7 bp in length, concentrated mainly in the large single copy region of the genome. Nucleotide composition varied considerably among subfamilies (with Pooideae biased towards poly A repeats). The nine new markers distinguish L. perenne from all non-Lolium taxa. TeaCpSSR28 was able to distinguish between all Lolium species and Lolium multiflorum due to an elongation of an A8 mononucleotide repeat in L. multiflorum. TeaCpSSR31 detected a considerable degree of microsatellite length variation and single nucleotide polymorphism. TeaCpSSR27 revealed variation within some L. perenne accessions due to a 44-bp indel and was hence readily detected by simple agarose gel electrophoresis. Smaller insertion/deletion events or single nucleotide polymorphisms detected by these new markers could be visualized by polyacrylamide gel electrophoresis or DNA sequencing, respectively. Conclusions The new markers are a valuable tool for plant breeding companies, seed testing agencies and the wider scientific community due to their ability to monitor genetic diversity within breeding pools, to trace maternal inheritance and to distinguish closely related species. PMID:22419761

New chloroplast microsatellite markers suitable for assessing genetic diversity of Lolium perenne and other related grass species.

PubMed

Diekmann, Kerstin; Hodkinson, Trevor R; Barth, Susanne

2012-11-01

Lolium perenne (perennial ryegrass) is the most important forage grass species of temperate regions. We have previously released the chloroplast genome sequence of L. perenne 'Cashel'. Here nine chloroplast microsatellite markers are published, which were designed based on knowledge about genetically variable regions within the L. perenne chloroplast genome. These markers were successfully used for characterizing the genetic diversity in Lolium and different grass species. Chloroplast genomes of 14 Poaceae taxa were screened for mononucleotide microsatellite repeat regions and primers designed for their amplification from nine loci. The potential of these markers to assess genetic diversity was evaluated on a set of 16 Irish and 15 European L. perenne ecotypes, nine L. perenne cultivars, other Lolium taxa and other grass species. All analysed Poaceae chloroplast genomes contained more than 200 mononucleotide repeats (chloroplast simple sequence repeats, cpSSRs) of at least 7 bp in length, concentrated mainly in the large single copy region of the genome. Nucleotide composition varied considerably among subfamilies (with Pooideae biased towards poly A repeats). The nine new markers distinguish L. perenne from all non-Lolium taxa. TeaCpSSR28 was able to distinguish between all Lolium species and Lolium multiflorum due to an elongation of an A(8) mononucleotide repeat in L. multiflorum. TeaCpSSR31 detected a considerable degree of microsatellite length variation and single nucleotide polymorphism. TeaCpSSR27 revealed variation within some L. perenne accessions due to a 44-bp indel and was hence readily detected by simple agarose gel electrophoresis. Smaller insertion/deletion events or single nucleotide polymorphisms detected by these new markers could be visualized by polyacrylamide gel electrophoresis or DNA sequencing, respectively. The new markers are a valuable tool for plant breeding companies, seed testing agencies and the wider scientific community due to their ability to monitor genetic diversity within breeding pools, to trace maternal inheritance and to distinguish closely related species.

Mapping RNA Structure In Vitro with SHAPE Chemistry and Next-Generation Sequencing (SHAPE-Seq).

PubMed

Watters, Kyle E; Lucks, Julius B

2016-01-01

Mapping RNA structure with selective 2'-hydroxyl acylation analyzed by primer extension (SHAPE) chemistry has proven to be a versatile method for characterizing RNA structure in a variety of contexts. SHAPE reagents covalently modify RNAs in a structure-dependent manner to create adducts at the 2'-OH group of the ribose backbone at nucleotides that are structurally flexible. The positions of these adducts are detected using reverse transcriptase (RT) primer extension, which stops one nucleotide before the modification, to create a pool of cDNAs whose lengths reflect the location of SHAPE modification. Quantification of the cDNA pools is used to estimate the "reactivity" of each nucleotide in an RNA molecule to the SHAPE reagent. High reactivities indicate nucleotides that are structurally flexible, while low reactivities indicate nucleotides that are inflexible. These SHAPE reactivities can then be used to infer RNA structures by restraining RNA structure prediction algorithms. Here, we provide a state-of-the-art protocol describing how to perform in vitro RNA structure probing with SHAPE chemistry using next-generation sequencing to quantify cDNA pools and estimate reactivities (SHAPE-Seq). The use of next-generation sequencing allows for higher throughput, more consistent data analysis, and multiplexing capabilities. The technique described herein, SHAPE-Seq v2.0, uses a universal reverse transcription priming site that is ligated to the RNA after SHAPE modification. The introduced priming site allows for the structural analysis of an RNA independent of its sequence.

Natural History of Human Respiratory Syncytial Virus Inferred from Phylogenetic Analysis of the Attachment (G) Glycoprotein with a 60-Nucleotide Duplication

PubMed Central

Trento, Alfonsina; Viegas, Mariana; Galiano, Mónica; Videla, Cristina; Carballal, Guadalupe; Mistchenko, Alicia S.; Melero, José A.

2006-01-01

A total of 47 clinical samples were identified during an active surveillance program of respiratory infections in Buenos Aires (BA) (1999 to 2004) that contained sequences of human respiratory syncytial virus (HRSV) with a 60-nucleotide duplication in the attachment (G) protein gene. This duplication was analogous to that previously described for other three viruses also isolated in Buenos Aires in 1999 (A. Trento et al., J. Gen. Virol. 84:3115-3120, 2003). Phylogenetic analysis indicated that BA sequences with that duplication shared a common ancestor (dated about 1998) with other HRSV G sequences reported worldwide after 1999. The duplicated nucleotide sequence was an exact copy of the preceding 60 nucleotides in early viruses, but both copies of the duplicated segment accumulated nucleotide substitutions in more recent viruses at a rate apparently higher than in other regions of the G protein gene. The evolution of the viruses with the duplicated G segment apparently followed the overall evolutionary pattern previously described for HRSV, and this genotype has replaced other prevailing antigenic group B genotypes in Buenos Aires and other places. Thus, the duplicated segment represents a natural tag that can be used to track the dissemination and evolution of HRSV in an unprecedented setting. We have taken advantage of this situation to reexamine the molecular epidemiology of HRSV and to explore the natural history of this important human pathogen. PMID:16378999

Comprehensive Rare Variant Analysis via Whole-Genome Sequencing to Determine the Molecular Pathology of Inherited Retinal Disease.

PubMed

Carss, Keren J; Arno, Gavin; Erwood, Marie; Stephens, Jonathan; Sanchis-Juan, Alba; Hull, Sarah; Megy, Karyn; Grozeva, Detelina; Dewhurst, Eleanor; Malka, Samantha; Plagnol, Vincent; Penkett, Christopher; Stirrups, Kathleen; Rizzo, Roberta; Wright, Genevieve; Josifova, Dragana; Bitner-Glindzicz, Maria; Scott, Richard H; Clement, Emma; Allen, Louise; Armstrong, Ruth; Brady, Angela F; Carmichael, Jenny; Chitre, Manali; Henderson, Robert H H; Hurst, Jane; MacLaren, Robert E; Murphy, Elaine; Paterson, Joan; Rosser, Elisabeth; Thompson, Dorothy A; Wakeling, Emma; Ouwehand, Willem H; Michaelides, Michel; Moore, Anthony T; Webster, Andrew R; Raymond, F Lucy

2017-01-05

Inherited retinal disease is a common cause of visual impairment and represents a highly heterogeneous group of conditions. Here, we present findings from a cohort of 722 individuals with inherited retinal disease, who have had whole-genome sequencing (n = 605), whole-exome sequencing (n = 72), or both (n = 45) performed, as part of the NIHR-BioResource Rare Diseases research study. We identified pathogenic variants (single-nucleotide variants, indels, or structural variants) for 404/722 (56%) individuals. Whole-genome sequencing gives unprecedented power to detect three categories of pathogenic variants in particular: structural variants, variants in GC-rich regions, which have significantly improved coverage compared to whole-exome sequencing, and variants in non-coding regulatory regions. In addition to previously reported pathogenic regulatory variants, we have identified a previously unreported pathogenic intronic variant in CHM in two males with choroideremia. We have also identified 19 genes not previously known to be associated with inherited retinal disease, which harbor biallelic predicted protein-truncating variants in unsolved cases. Whole-genome sequencing is an increasingly important comprehensive method with which to investigate the genetic causes of inherited retinal disease. Copyright © 2017. Published by Elsevier Inc.

UrQt: an efficient software for the Unsupervised Quality trimming of NGS data.

PubMed

Modolo, Laurent; Lerat, Emmanuelle

2015-04-29

Quality control is a necessary step of any Next Generation Sequencing analysis. Although customary, this step still requires manual interventions to empirically choose tuning parameters according to various quality statistics. Moreover, current quality control procedures that provide a "good quality" data set, are not optimal and discard many informative nucleotides. To address these drawbacks, we present a new quality control method, implemented in UrQt software, for Unsupervised Quality trimming of Next Generation Sequencing reads. Our trimming procedure relies on a well-defined probabilistic framework to detect the best segmentation between two segments of unreliable nucleotides, framing a segment of informative nucleotides. Our software only requires one user-friendly parameter to define the minimal quality threshold (phred score) to consider a nucleotide to be informative, which is independent of both the experiment and the quality of the data. This procedure is implemented in C++ in an efficient and parallelized software with a low memory footprint. We tested the performances of UrQt compared to the best-known trimming programs, on seven RNA and DNA sequencing experiments and demonstrated its optimality in the resulting tradeoff between the number of trimmed nucleotides and the quality objective. By finding the best segmentation to delimit a segment of good quality nucleotides, UrQt greatly increases the number of reads and of nucleotides that can be retained for a given quality objective. UrQt source files, binary executables for different operating systems and documentation are freely available (under the GPLv3) at the following address: https://lbbe.univ-lyon1.fr/-UrQt-.html .

Next Generation Semiconductor Based Sequencing of the Donkey (Equus asinus) Genome Provided Comparative Sequence Data against the Horse Genome and a Few Millions of Single Nucleotide Polymorphisms

PubMed Central

Bertolini, Francesca; Scimone, Concetta; Geraci, Claudia; Schiavo, Giuseppina; Utzeri, Valerio Joe; Chiofalo, Vincenzo; Fontanesi, Luca

2015-01-01

Few studies investigated the donkey (Equus asinus) at the whole genome level so far. Here, we sequenced the genome of two male donkeys using a next generation semiconductor based sequencing platform (the Ion Proton sequencer) and compared obtained sequence information with the available donkey draft genome (and its Illumina reads from which it was originated) and with the EquCab2.0 assembly of the horse genome. Moreover, the Ion Torrent Personal Genome Analyzer was used to sequence reduced representation libraries (RRL) obtained from a DNA pool including donkeys of different breeds (Grigio Siciliano, Ragusano and Martina Franca). The number of next generation sequencing reads aligned with the EquCab2.0 horse genome was larger than those aligned with the draft donkey genome. This was due to the larger N50 for contigs and scaffolds of the horse genome. Nucleotide divergence between E. caballus and E. asinus was estimated to be ~ 0.52-0.57%. Regions with low nucleotide divergence were identified in several autosomal chromosomes and in the whole chromosome X. These regions might be evolutionally important in equids. Comparing Y-chromosome regions we identified variants that could be useful to track donkey paternal lineages. Moreover, about 4.8 million of single nucleotide polymorphisms (SNPs) in the donkey genome were identified and annotated combining sequencing data from Ion Proton (whole genome sequencing) and Ion Torrent (RRL) runs with Illumina reads. A higher density of SNPs was present in regions homologous to horse chromosome 12, in which several studies reported a high frequency of copy number variants. The SNPs we identified constitute a first resource useful to describe variability at the population genomic level in E. asinus and to establish monitoring systems for the conservation of donkey genetic resources. PMID:26151450

Next Generation Semiconductor Based Sequencing of the Donkey (Equus asinus) Genome Provided Comparative Sequence Data against the Horse Genome and a Few Millions of Single Nucleotide Polymorphisms.

PubMed

Bertolini, Francesca; Scimone, Concetta; Geraci, Claudia; Schiavo, Giuseppina; Utzeri, Valerio Joe; Chiofalo, Vincenzo; Fontanesi, Luca

2015-01-01

Few studies investigated the donkey (Equus asinus) at the whole genome level so far. Here, we sequenced the genome of two male donkeys using a next generation semiconductor based sequencing platform (the Ion Proton sequencer) and compared obtained sequence information with the available donkey draft genome (and its Illumina reads from which it was originated) and with the EquCab2.0 assembly of the horse genome. Moreover, the Ion Torrent Personal Genome Analyzer was used to sequence reduced representation libraries (RRL) obtained from a DNA pool including donkeys of different breeds (Grigio Siciliano, Ragusano and Martina Franca). The number of next generation sequencing reads aligned with the EquCab2.0 horse genome was larger than those aligned with the draft donkey genome. This was due to the larger N50 for contigs and scaffolds of the horse genome. Nucleotide divergence between E. caballus and E. asinus was estimated to be ~ 0.52-0.57%. Regions with low nucleotide divergence were identified in several autosomal chromosomes and in the whole chromosome X. These regions might be evolutionally important in equids. Comparing Y-chromosome regions we identified variants that could be useful to track donkey paternal lineages. Moreover, about 4.8 million of single nucleotide polymorphisms (SNPs) in the donkey genome were identified and annotated combining sequencing data from Ion Proton (whole genome sequencing) and Ion Torrent (RRL) runs with Illumina reads. A higher density of SNPs was present in regions homologous to horse chromosome 12, in which several studies reported a high frequency of copy number variants. The SNPs we identified constitute a first resource useful to describe variability at the population genomic level in E. asinus and to establish monitoring systems for the conservation of donkey genetic resources.

Molecular cloning and nucleotide sequence of a transforming gene detected by transfection of chicken B-cell lymphoma DNA

NASA Astrophysics Data System (ADS)

Goubin, Gerard; Goldman, Debra S.; Luce, Judith; Neiman, Paul E.; Cooper, Geoffrey M.

1983-03-01

A transforming gene detected by transfection of chicken B-cell lymphoma DNA has been isolated by molecular cloning. It is homologous to a conserved family of sequences present in normal chicken and human DNAs but is not related to transforming genes of acutely transforming retroviruses. The nucleotide sequence of the cloned transforming gene suggests that it encodes a protein that is partially homologous to the amino terminus of transferrin and related proteins although only about one tenth the size of transferrin.

Nucleotide Sequence Analysis of RNA Synthesized from Rabbit Globin Complementary DNA

PubMed Central

Poon, Raymond; Paddock, Gary V.; Heindell, Howard; Whitcome, Philip; Salser, Winston; Kacian, Dan; Bank, Arthur; Gambino, Roberto; Ramirez, Francesco

1974-01-01

Rabbit globin complementary DNA made with RNA-dependent DNA polymerase (reverse transcriptase) was used as template for in vitro synthesis of 32P-labeled RNA. The sequences of the nucleotides in most of the fragments resulting from combined ribonuclease T1 and alkaline phosphatase digestion have been determined. Several fragments were long enough to fit uniquely with the α or β globin amino-acid sequences. These data demonstrate that the cDNA was copied from globin mRNA and contained no detectable contaminants. Images PMID:4139714

Nucleotide Sequence of the blaRTG-2 (CARB-5) Gene and Phylogeny of a New Group of Carbenicillinases

PubMed Central

Choury, Daniele; Szajnert, Marie-France; Joly-Guillou, Marie-Laure; Azibi, Kemal; Delpech, Marc; Paul, Gérard

2000-01-01

We determined the nucleotide sequence of the bla gene for the Acinetobacter calcoaceticus β-lactamase previously described as CARB-5. Alignment of the deduced amino acid sequence with those of known β-lactamases revealed that CARB-5 possesses an RTG triad in box VII, as described for the Proteus mirabilis GN79 enzyme, instead of the RSG consensus characteristic of the other carbenicillinases. Phylogenetic studies showed that these RTG enzymes constitute a new, separate group, possibly ancestors of the carbenicillinase family. PMID:10722515

GBshape: a genome browser database for DNA shape annotations.

PubMed

Chiu, Tsu-Pei; Yang, Lin; Zhou, Tianyin; Main, Bradley J; Parker, Stephen C J; Nuzhdin, Sergey V; Tullius, Thomas D; Rohs, Remo

2015-01-01

Many regulatory mechanisms require a high degree of specificity in protein-DNA binding. Nucleotide sequence does not provide an answer to the question of why a protein binds only to a small subset of the many putative binding sites in the genome that share the same core motif. Whereas higher-order effects, such as chromatin accessibility, cooperativity and cofactors, have been described, DNA shape recently gained attention as another feature that fine-tunes the DNA binding specificities of some transcription factor families. Our Genome Browser for DNA shape annotations (GBshape; freely available at http://rohslab.cmb.usc.edu/GBshape/) provides minor groove width, propeller twist, roll, helix twist and hydroxyl radical cleavage predictions for the entire genomes of 94 organisms. Additional genomes can easily be added using the GBshape framework. GBshape can be used to visualize DNA shape annotations qualitatively in a genome browser track format, and to download quantitative values of DNA shape features as a function of genomic position at nucleotide resolution. As biological applications, we illustrate the periodicity of DNA shape features that are present in nucleosome-occupied sequences from human, fly and worm, and we demonstrate structural similarities between transcription start sites in the genomes of four Drosophila species. © The Author(s) 2014. Published by Oxford University Press on behalf of Nucleic Acids Research.

Exact calculation of loop formation probability identifies folding motifs in RNA secondary structures.

PubMed

Sloma, Michael F; Mathews, David H

2016-12-01

RNA secondary structure prediction is widely used to analyze RNA sequences. In an RNA partition function calculation, free energy nearest neighbor parameters are used in a dynamic programming algorithm to estimate statistical properties of the secondary structure ensemble. Previously, partition functions have largely been used to estimate the probability that a given pair of nucleotides form a base pair, the conditional stacking probability, the accessibility to binding of a continuous stretch of nucleotides, or a representative sample of RNA structures. Here it is demonstrated that an RNA partition function can also be used to calculate the exact probability of formation of hairpin loops, internal loops, bulge loops, or multibranch loops at a given position. This calculation can also be used to estimate the probability of formation of specific helices. Benchmarking on a set of RNA sequences with known secondary structures indicated that loops that were calculated to be more probable were more likely to be present in the known structure than less probable loops. Furthermore, highly probable loops are more likely to be in the known structure than the set of loops predicted in the lowest free energy structures. © 2016 Sloma and Mathews; Published by Cold Spring Harbor Laboratory Press for the RNA Society.

Interstitial telomeric sequences in human chromosomes cluster with common fragile sites, mutagen sensitive sites, viral integration sites, cancer breakpoints, proto-oncogenes and breakpoints involved in primate evolution

DOE Office of Scientific and Technical Information (OSTI.GOV)

Adekunle, S.S.A.; Wyandt, H.; Mark, H.F.L.

1994-09-01

Recently we mapped the telomeric repeat sequences to 111 interstitial sites in the human genome and to sites of gaps and breaks induced by aphidicolin and sister chromatid exchange sites detected by BrdU. Many of these sites correspond to conserved fragile sites in man, gorilla and chimpazee, to sites of conserved sister chromatid exchange in the mammalian X chromosome, to mutagenic sensitive sites, mapped locations of proto-oncogenes, breakpoints implicated in primate evolution and to breakpoints indicated as the sole anomaly in neoplasia. This observation prompted us to investigate if the interstitial telomeric sites cluster with these sites. An extensive literaturemore » search was carried out to find all the available published sites mentioned above. For comparison, we also carried out a statistical analysis of the clustering of the sites of the telomeric repeats with the gene locations where only nucleotide mutations have been observed as the only chromosomal abnormality. Our results indicate that the telomeric repeats cluster most with fragile sites, mutagenic sensitive sites and breakpoints implicated in primate evolution and least with cancer breakpoints, mapped locations of proto-oncogenes and other genes with nucleotide mutations.« less

Mosaic organization of DNA nucleotides

NASA Technical Reports Server (NTRS)

Peng, C. K.; Buldyrev, S. V.; Havlin, S.; Simons, M.; Stanley, H. E.; Goldberger, A. L.

1994-01-01

Long-range power-law correlations have been reported recently for DNA sequences containing noncoding regions. We address the question of whether such correlations may be a trivial consequence of the known mosaic structure ("patchiness") of DNA. We analyze two classes of controls consisting of patchy nucleotide sequences generated by different algorithms--one without and one with long-range power-law correlations. Although both types of sequences are highly heterogenous, they are quantitatively distinguishable by an alternative fluctuation analysis method that differentiates local patchiness from long-range correlations. Application of this analysis to selected DNA sequences demonstrates that patchiness is not sufficient to account for long-range correlation properties.

Asystasia mosaic Madagascar virus: a novel bipartite begomovirus infecting the weed Asystasia gangetica in Madagascar.

PubMed

De Bruyn, Alexandre; Harimalala, Mireille; Hoareau, Murielle; Ranomenjanahary, Sahondramalala; Reynaud, Bernard; Lefeuvre, Pierre; Lett, Jean-Michel

2015-06-01

Here, we describe for the first time the complete genome sequence of a new bipartite begomovirus in Madagascar isolated from the weed Asystasia gangetica (Acanthaceae), for which we propose the tentative name asystasia mosaic Madagascar virus (AMMGV). DNA-A and -B nucleotide sequences of AMMGV were only distantly related to known begomovirus sequence and shared highest nucleotide sequence identity of 72.9 % (DNA-A) and 66.9 % (DNA-B) with a recently described bipartite begomovirus infecting Asystasia sp. in West Africa. Phylogenetic analysis demonstrated that this novel virus from Madagascar belongs to a new lineage of Old World bipartite begomoviruses.

Nucleotide sequence of a chickpea chlorotic stunt virus relative that infects pea and faba bean in China.

PubMed

Zhou, Cui-Ji; Xiang, Hai-Ying; Zhuo, Tao; Li, Da-Wei; Yu, Jia-Lin; Han, Cheng-Gui

2012-07-01

We determined the genome sequence of a new polerovirus that infects field pea and faba bean in China. Its entire nucleotide sequence (6021 nt) was most closely related (83.3% identity) to that of an Ethiopian isolate of chickpea chlorotic stunt virus (CpCSV-Eth). With the exception of the coat protein (encoded by ORF3), amino acid sequence identities of all gene products of this virus to those of CpCSV-Eth and other poleroviruses were <90%. This suggests that it is a new member of the genus Polerovirus, and the name pea mild chlorosis virus is proposed.

MultiGeMS: detection of SNVs from multiple samples using model selection on high-throughput sequencing data.

PubMed

Murillo, Gabriel H; You, Na; Su, Xiaoquan; Cui, Wei; Reilly, Muredach P; Li, Mingyao; Ning, Kang; Cui, Xinping

2016-05-15

Single nucleotide variant (SNV) detection procedures are being utilized as never before to analyze the recent abundance of high-throughput DNA sequencing data, both on single and multiple sample datasets. Building on previously published work with the single sample SNV caller genotype model selection (GeMS), a multiple sample version of GeMS (MultiGeMS) is introduced. Unlike other popular multiple sample SNV callers, the MultiGeMS statistical model accounts for enzymatic substitution sequencing errors. It also addresses the multiple testing problem endemic to multiple sample SNV calling and utilizes high performance computing (HPC) techniques. A simulation study demonstrates that MultiGeMS ranks highest in precision among a selection of popular multiple sample SNV callers, while showing exceptional recall in calling common SNVs. Further, both simulation studies and real data analyses indicate that MultiGeMS is robust to low-quality data. We also demonstrate that accounting for enzymatic substitution sequencing errors not only improves SNV call precision at low mapping quality regions, but also improves recall at reference allele-dominated sites with high mapping quality. The MultiGeMS package can be downloaded from https://github.com/cui-lab/multigems xinping.cui@ucr.edu Supplementary data are available at Bioinformatics online. © The Author 2016. Published by Oxford University Press. All rights reserved. For Permissions, please e-mail: journals.permissions@oup.com.

FALDO: a semantic standard for describing the location of nucleotide and protein feature annotation.

PubMed

Bolleman, Jerven T; Mungall, Christopher J; Strozzi, Francesco; Baran, Joachim; Dumontier, Michel; Bonnal, Raoul J P; Buels, Robert; Hoehndorf, Robert; Fujisawa, Takatomo; Katayama, Toshiaki; Cock, Peter J A

2016-06-13

Nucleotide and protein sequence feature annotations are essential to understand biology on the genomic, transcriptomic, and proteomic level. Using Semantic Web technologies to query biological annotations, there was no standard that described this potentially complex location information as subject-predicate-object triples. We have developed an ontology, the Feature Annotation Location Description Ontology (FALDO), to describe the positions of annotated features on linear and circular sequences. FALDO can be used to describe nucleotide features in sequence records, protein annotations, and glycan binding sites, among other features in coordinate systems of the aforementioned "omics" areas. Using the same data format to represent sequence positions that are independent of file formats allows us to integrate sequence data from multiple sources and data types. The genome browser JBrowse is used to demonstrate accessing multiple SPARQL endpoints to display genomic feature annotations, as well as protein annotations from UniProt mapped to genomic locations. Our ontology allows users to uniformly describe - and potentially merge - sequence annotations from multiple sources. Data sources using FALDO can prospectively be retrieved using federalised SPARQL queries against public SPARQL endpoints and/or local private triple stores.

Nucleotide sequences of immunoglobulin eta genes of chimpanzee and orangutan: DNA molecular clock and hominoid evolution

DOE Office of Scientific and Technical Information (OSTI.GOV)

Sakoyama, Y.; Hong, K.J.; Byun, S.M.

To determine the phylogenetic relationships among hominoids and the dates of their divergence, the complete nucleotide sequences of the constant region of the immunoglobulin eta-chain (C/sub eta1/) genes from chimpanzee and orangutan have been determined. These sequences were compared with the human eta-chain constant-region sequence. A molecular clock (silent molecular clock), measured by the degree of sequence divergence at the synonymous (silent) positions of protein-encoding regions, was introduced for the present study. From the comparison of nucleotide sequences of ..cap alpha../sub 1/-antitrypsin and ..beta..- and delta-globulin genes between humans and Old World monkeys, the silent molecular clock was calibrated: themore » mean evolutionary rate of silent substitution was determined to be 1.56 x 10/sup -9/ substitutions per site per year. Using the silent molecular clock, the mean divergence dates of chimpanzee and orangutan from the human lineage were estimated as 6.4 +/- 2.6 million years and 17.3 +/- 4.5 million years, respectively. It was also shown that the evolutionary rate of primate genes is considerably slower than those of other mammalian genes.« less

FALDO: a semantic standard for describing the location of nucleotide and protein feature annotation

DOE PAGES

Bolleman, Jerven T.; Mungall, Christopher J.; Strozzi, Francesco; ...

2016-06-13

Nucleotide and protein sequence feature annotations are essential to understand biology on the genomic, transcriptomic, and proteomic level. Using Semantic Web technologies to query biological annotations, there was no standard that described this potentially complex location information as subject-predicate-object triples. In this paper, we have developed an ontology, the Feature Annotation Location Description Ontology (FALDO), to describe the positions of annotated features on linear and circular sequences. FALDO can be used to describe nucleotide features in sequence records, protein annotations, and glycan binding sites, among other features in coordinate systems of the aforementioned “omics” areas. Using the same data formatmore » to represent sequence positions that are independent of file formats allows us to integrate sequence data from multiple sources and data types. The genome browser JBrowse is used to demonstrate accessing multiple SPARQL endpoints to display genomic feature annotations, as well as protein annotations from UniProt mapped to genomic locations. Our ontology allows users to uniformly describe – and potentially merge – sequence annotations from multiple sources. Finally, data sources using FALDO can prospectively be retrieved using federalised SPARQL queries against public SPARQL endpoints and/or local private triple stores.« less

Discovery, genotyping and characterization of structural variation and novel sequence at single nucleotide resolution from de novo genome assemblies on a population scale.

PubMed

Liu, Siyang; Huang, Shujia; Rao, Junhua; Ye, Weijian; Krogh, Anders; Wang, Jun

2015-01-01

Comprehensive recognition of genomic variation in one individual is important for understanding disease and developing personalized medication and treatment. Many tools based on DNA re-sequencing exist for identification of single nucleotide polymorphisms, small insertions and deletions (indels) as well as large deletions. However, these approaches consistently display a substantial bias against the recovery of complex structural variants and novel sequence in individual genomes and do not provide interpretation information such as the annotation of ancestral state and formation mechanism. We present a novel approach implemented in a single software package, AsmVar, to discover, genotype and characterize different forms of structural variation and novel sequence from population-scale de novo genome assemblies up to nucleotide resolution. Application of AsmVar to several human de novo genome assemblies captures a wide spectrum of structural variants and novel sequences present in the human population in high sensitivity and specificity. Our method provides a direct solution for investigating structural variants and novel sequences from de novo genome assemblies, facilitating the construction of population-scale pan-genomes. Our study also highlights the usefulness of the de novo assembly strategy for definition of genome structure.

FALDO: a semantic standard for describing the location of nucleotide and protein feature annotation

DOE Office of Scientific and Technical Information (OSTI.GOV)

Bolleman, Jerven T.; Mungall, Christopher J.; Strozzi, Francesco

Nucleotide and protein sequence feature annotations are essential to understand biology on the genomic, transcriptomic, and proteomic level. Using Semantic Web technologies to query biological annotations, there was no standard that described this potentially complex location information as subject-predicate-object triples. In this paper, we have developed an ontology, the Feature Annotation Location Description Ontology (FALDO), to describe the positions of annotated features on linear and circular sequences. FALDO can be used to describe nucleotide features in sequence records, protein annotations, and glycan binding sites, among other features in coordinate systems of the aforementioned “omics” areas. Using the same data formatmore » to represent sequence positions that are independent of file formats allows us to integrate sequence data from multiple sources and data types. The genome browser JBrowse is used to demonstrate accessing multiple SPARQL endpoints to display genomic feature annotations, as well as protein annotations from UniProt mapped to genomic locations. Our ontology allows users to uniformly describe – and potentially merge – sequence annotations from multiple sources. Finally, data sources using FALDO can prospectively be retrieved using federalised SPARQL queries against public SPARQL endpoints and/or local private triple stores.« less

NullSeq: A Tool for Generating Random Coding Sequences with Desired Amino Acid and GC Contents.

PubMed

Liu, Sophia S; Hockenberry, Adam J; Lancichinetti, Andrea; Jewett, Michael C; Amaral, Luís A N

2016-11-01

The existence of over- and under-represented sequence motifs in genomes provides evidence of selective evolutionary pressures on biological mechanisms such as transcription, translation, ligand-substrate binding, and host immunity. In order to accurately identify motifs and other genome-scale patterns of interest, it is essential to be able to generate accurate null models that are appropriate for the sequences under study. While many tools have been developed to create random nucleotide sequences, protein coding sequences are subject to a unique set of constraints that complicates the process of generating appropriate null models. There are currently no tools available that allow users to create random coding sequences with specified amino acid composition and GC content for the purpose of hypothesis testing. Using the principle of maximum entropy, we developed a method that generates unbiased random sequences with pre-specified amino acid and GC content, which we have developed into a python package. Our method is the simplest way to obtain maximally unbiased random sequences that are subject to GC usage and primary amino acid sequence constraints. Furthermore, this approach can easily be expanded to create unbiased random sequences that incorporate more complicated constraints such as individual nucleotide usage or even di-nucleotide frequencies. The ability to generate correctly specified null models will allow researchers to accurately identify sequence motifs which will lead to a better understanding of biological processes as well as more effective engineering of biological systems.

Resolving the tips of the tree of life: How much mitochondrialdata doe we need?

DOE Office of Scientific and Technical Information (OSTI.GOV)

Bonett, Ronald M.; Macey, J. Robert; Boore, Jeffrey L.

2005-04-29

Mitochondrial (mt) DNA sequences are used extensively to reconstruct evolutionary relationships among recently diverged animals,and have constituted the most widely used markers for species- and generic-level relationships for the last decade or more. However, most studies to date have employed relatively small portions of the mt-genome. In contrast, complete mt-genomes primarily have been used to investigate deep divergences, including several studies of the amount of mt sequence necessary to recover ancient relationships. We sequenced and analyzed 24 complete mt-genomes from a group of salamander species exhibiting divergences typical of those in many species-level studies. We present the first comprehensive investigationmore » of the amount of mt sequence data necessary to consistently recover the mt-genome tree at this level, using parsimony and Bayesian methods. Both methods of phylogenetic analysis revealed extremely similar results. A surprising number of well supported, yet conflicting, relationships were found in trees based on fragments less than {approx}2000 nucleotides (nt), typical of the vast majority of the thousands of mt-based studies published to date. Large amounts of data (11,500+ nt) were necessary to consistently recover the whole mt-genome tree. Some relationships consistently were recovered with fragments of all sizes, but many nodes required the majority of the mt-genome to stabilize, particularly those associated with short internal branches. Although moderate amounts of data (2000-3000 nt) were adequate to recover mt-based relationships for which most nodes were congruent with the whole mt-genome tree, many thousands of nucleotides were necessary to resolve rapid bursts of evolution. Recent advances in genomics are making collection of large amounts of sequence data highly feasible, and our results provide the basis for comparative studies of other closely related groups to optimize mt sequence sampling and phylogenetic resolution at the ''tips'' of the Tree of Life.« less

Porcine kobuvirus 1 in healthy and diarrheic pigs: Genetic detection and characterization of virus and co-infection with rotavirus A.

PubMed

Jackova, Anna; Sliz, Ivan; Mandelik, Rene; Salamunova, Slavomira; Novotny, Jaroslav; Kolesarova, Mariana; Vlasakova, Michaela; Vilcek, Stefan

2017-04-01

The porcine kobuvirus 1 (PKV-1) is believed to be an enteric virus. To investigate the prevalence of PKV-1 in pigs, virus was detected by RT-PCR in rectal swabs originating from 414 healthy and diarrheic pigs of different age categories on farms in Slovakia. Among all ages of animals, PKV-1 was detected equally in diarrheic (63.8%) and clinically healthy (62.9%) pigs. PKV-1 was more often detected in diarrheic (74.6%) than in healthy (64.4%) suckling piglets (<28days) but data was not statistically significant. Results in weaned (28-70days) and fattening (>70days) of both healthy and diarrheic pigs were inconsistent ranging in interval 56.2% to 67.9%. This study did not confirm a clear relationship of PKV-1 infection with diarrhea in pigs. Rotavirus A infection was detected among the same animals in 39% diarrheic and 9.2% healthy suckling piglets (p<0.001) confirming rotavirus as a causative agent of diarrhea in this age group. The difference was not significant in older pigs with both diarrheic and healthy pigs being infected within a range of 0% to 12.2%. Co-infection with PKV-1 and rotavirus A was detected overall in 5.6% of healthy and in 13.5% of diarrheic pigs and was highest in suckling piglets (33.9%). The PKV-1sequences from pigs in Slovakia were analyzed at the genetic level in the partial 3D gene region for the first time. The viral sequences were grouped in phylogenetic clusters according to their farm of origin. When compared with 157 nucleotide sequences originating from pig samples of different countries around the world Slovakian PKV-1 sequences were clustered in the phylogenetic tree with Asian sequences but not with nucleotide sequences from the neighbouring countries of Czech Republic or Hungary. Copyright © 2017 The Authors. Published by Elsevier B.V. All rights reserved.

A Genome Sequence Resource for the Aye-Aye (Daubentonia madagascariensis), a Nocturnal Lemur from Madagascar

PubMed Central

Perry, George H.; Reeves, Darryl; Melsted, Páll; Ratan, Aakrosh; Miller, Webb; Michelini, Katelyn; Louis, Edward E.; Pritchard, Jonathan K.; Mason, Christopher E.; Gilad, Yoav

2012-01-01

We present a high-coverage draft genome assembly of the aye-aye (Daubentonia madagascariensis), a highly unusual nocturnal primate from Madagascar. Our assembly totals ∼3.0 billion bp (3.0 Gb), roughly the size of the human genome, comprised of ∼2.6 million scaffolds (N50 scaffold size = 13,597 bp) based on short paired-end sequencing reads. We compared the aye-aye genome sequence data with four other published primate genomes (human, chimpanzee, orangutan, and rhesus macaque) as well as with the mouse and dog genomes as nonprimate outgroups. Unexpectedly, we observed strong evidence for a relatively slow substitution rate in the aye-aye lineage compared with these and other primates. In fact, the aye-aye branch length is estimated to be ∼10% shorter than that of the human lineage, which is known for its low substitution rate. This finding may be explained, in part, by the protracted aye-aye life-history pattern, including late weaning and age of first reproduction relative to other lemurs. Additionally, the availability of this draft lemur genome sequence allowed us to polarize nucleotide and protein sequence changes to the ancestral primate lineage—a critical period in primate evolution, for which the relevant fossil record is sparse. Finally, we identified 293,800 high-confidence single nucleotide polymorphisms in the donor individual for our aye-aye genome sequence, a captive-born individual from two wild-born parents. The resulting heterozygosity estimate of 0.051% is the lowest of any primate studied to date, which is understandable considering the aye-aye's extensive home-range size and relatively low population densities. Yet this level of genetic diversity also suggests that conservation efforts benefiting this unusual species should be prioritized, especially in the face of the accelerating degradation and fragmentation of Madagascar's forests. PMID:22155688

Predicting protein-binding regions in RNA using nucleotide profiles and compositions.

PubMed

Choi, Daesik; Park, Byungkyu; Chae, Hanju; Lee, Wook; Han, Kyungsook

2017-03-14

Motivated by the increased amount of data on protein-RNA interactions and the availability of complete genome sequences of several organisms, many computational methods have been proposed to predict binding sites in protein-RNA interactions. However, most computational methods are limited to finding RNA-binding sites in proteins instead of protein-binding sites in RNAs. Predicting protein-binding sites in RNA is more challenging than predicting RNA-binding sites in proteins. Recent computational methods for finding protein-binding sites in RNAs have several drawbacks for practical use. We developed a new support vector machine (SVM) model for predicting protein-binding regions in mRNA sequences. The model uses sequence profiles constructed from log-odds scores of mono- and di-nucleotides and nucleotide compositions. The model was evaluated by standard 10-fold cross validation, leave-one-protein-out (LOPO) cross validation and independent testing. Since actual mRNA sequences have more non-binding regions than protein-binding regions, we tested the model on several datasets with different ratios of protein-binding regions to non-binding regions. The best performance of the model was obtained in a balanced dataset of positive and negative instances. 10-fold cross validation with a balanced dataset achieved a sensitivity of 91.6%, a specificity of 92.4%, an accuracy of 92.0%, a positive predictive value (PPV) of 91.7%, a negative predictive value (NPV) of 92.3% and a Matthews correlation coefficient (MCC) of 0.840. LOPO cross validation showed a lower performance than the 10-fold cross validation, but the performance remains high (87.6% accuracy and 0.752 MCC). In testing the model on independent datasets, it achieved an accuracy of 82.2% and an MCC of 0.656. Testing of our model and other state-of-the-art methods on a same dataset showed that our model is better than the others. Sequence profiles of log-odds scores of mono- and di-nucleotides were much more powerful features than nucleotide compositions in finding protein-binding regions in RNA sequences. But, a slight performance gain was obtained when using the sequence profiles along with nucleotide compositions. These are preliminary results of ongoing research, but demonstrate the potential of our approach as a powerful predictor of protein-binding regions in RNA. The program and supporting data are available at http://bclab.inha.ac.kr/RBPbinding .

NGSCheckMate: software for validating sample identity in next-generation sequencing studies within and across data types.

PubMed

Lee, Sejoon; Lee, Soohyun; Ouellette, Scott; Park, Woong-Yang; Lee, Eunjung A; Park, Peter J

2017-06-20

In many next-generation sequencing (NGS) studies, multiple samples or data types are profiled for each individual. An important quality control (QC) step in these studies is to ensure that datasets from the same subject are properly paired. Given the heterogeneity of data types, file types and sequencing depths in a multi-dimensional study, a robust program that provides a standardized metric for genotype comparisons would be useful. Here, we describe NGSCheckMate, a user-friendly software package for verifying sample identities from FASTQ, BAM or VCF files. This tool uses a model-based method to compare allele read fractions at known single-nucleotide polymorphisms, considering depth-dependent behavior of similarity metrics for identical and unrelated samples. Our evaluation shows that NGSCheckMate is effective for a variety of data types, including exome sequencing, whole-genome sequencing, RNA-seq, ChIP-seq, targeted sequencing and single-cell whole-genome sequencing, with a minimal requirement for sequencing depth (>0.5X). An alignment-free module can be run directly on FASTQ files for a quick initial check. We recommend using this software as a QC step in NGS studies. https://github.com/parklab/NGSCheckMate. © The Author(s) 2017. Published by Oxford University Press on behalf of Nucleic Acids Research.

Effects of transcriptional start site sequence and position on nucleotide-sensitive selection of alternative start sites at the pyrC promoter in Escherichia coli.

PubMed Central

Liu, J; Turnbough, C L

1994-01-01

In Escherichia coli, expression of the pyrC gene is regulated primarily by a translational control mechanism based on nucleotide-sensitive selection of transcriptional start sites at the pyrC promoter. When intracellular levels of CTP are high, pyrC transcripts are initiated predominantly with CTP at a site 7 bases downstream of the Pribnow box. These transcripts form a stable hairpin at their 5' ends that blocks ribosome binding. When the CTP level is low and the GTP level is high, conditions found in pyrimidine-limited cells, transcripts are initiated primarily with GTP at a site 9 bases downstream of the Pribnow box. These shorter transcripts are unable to form a hairpin at their 5' ends and are readily translated. In this study, we examined the effects of nucleotide sequence and position on the selection of transcriptional start sites at the pyrC promoter. We characterized promoter mutations that systematically alter the sequence at position 7 or 9 downstream of the Pribnow box or vary the spacing between the Pribnow box and wild-type transcriptional initiation region. The results reveal preferences for particular initiating nucleotides (ATP > or = GTP > UTP >> CTP) and for starting positions downstream of the Pribnow box (7 >> 6 and 8 > 9 > 10). The results indicate that optimal nucleotide-sensitive start site switching at the wild-type pyrC promoter is the result of competition between the preferred start site (position 7) that uses the poorest initiating nucleotide (CTP) and a weak start site (position 9) that uses a good initiating nucleotide (GTP). The sequence of the pyrC promoter also minimizes the synthesis of untranslatable transcripts and provides for maximum stability of the regulatory transcript hairpin. In addition, the results show that the effects of the mutations on pyrC expression and regulation are consistent with the current model for translational control. Possible effects of preferences for initiating nucleotides and start sites on the expression and regulation of other genes are discussed. Images PMID:7910603

Nucleic acids encoding antifungal polypeptides and uses thereof

DOEpatents

Altier, Daniel J.; Ellanskaya, I. A.; Gilliam, Jacob T.; Hunter-Cevera, Jennie; Presnail, James K; Schepers, Eric; Simmons, Carl R.; Torok, Tamas; Yalpani, Nasser

2010-11-02

Compositions and methods for protecting a plant from a pathogen, particularly a fungal pathogen, are provided. Compositions include an amino acid sequence, and variants and fragments thereof, for an antipathogenic polypeptide that was isolated from a fungal fermentation broth. Nucleic acid molecules that encode the antipathogenic polypeptides of the invention, and antipathogenic domains thereof, are also provided. A method for inducing pathogen resistance in a plant using the nucleotide sequences disclosed herein is further provided. The method comprises introducing into a plant an expression cassette comprising a promoter operably linked to a nucleotide sequence that encodes an antipathogenic polypeptide of the invention. Compositions comprising an antipathogenic polypeptide or a transformed microorganism comprising a nucleic acid of the invention in combination with a carrier and methods of using these compositions to protect a plant from a pathogen are further provided. Transformed plants, plant cells, seeds, and microorganisms comprising a nucleotide sequence that encodes an antipathogenic polypeptide of the invention are also disclosed.

RNA Editing in Plant Mitochondria

NASA Astrophysics Data System (ADS)

Hiesel, Rudolf; Wissinger, Bernd; Schuster, Wolfgang; Brennicke, Axel

1989-12-01

Comparative sequence analysis of genomic and complementary DNA clones from several mitochondrial genes in the higher plant Oenothera revealed nucleotide sequence divergences between the genomic and the messenger RNA-derived sequences. These sequence alterations could be most easily explained by specific post-transcriptional nucleotide modifications. Most of the nucleotide exchanges in coding regions lead to altered codons in the mRNA that specify amino acids better conserved in evolution than those encoded by the genomic DNA. Several instances show that the genomic arginine codon CGG is edited in the mRNA to the tryptophan codon TGG in amino acid positions that are highly conserved as tryptophan in the homologous proteins of other species. This editing suggests that the standard genetic code is used in plant mitochondria and resolves the frequent coincidence of CGG codons and tryptophan in different plant species. The apparently frequent and non-species-specific equivalency of CGG and TGG codons in particular suggests that RNA editing is a common feature of all higher plant mitochondria.

Simian immunodeficiency viruses from African green monkeys display unusual genetic diversity.

PubMed Central

Johnson, P R; Fomsgaard, A; Allan, J; Gravell, M; London, W T; Olmsted, R A; Hirsch, V M

1990-01-01

African green monkeys are asymptomatic carriers of simian immunodeficiency viruses (SIV), commonly called SIVagm. As many as 50% of African green monkeys in the wild may be SIV seropositive. This high seroprevalence rate and the potential for genetic variation of lentiviruses suggested to us that African green monkeys may harbor widely differing genotypes of SIVagm. To investigate this hypothesis, we determined the entire nucleotide sequence of an infectious proviral molecular clone of SIVagm (155-4) and partial sequences (long terminal repeat and Gag) of three other distinct SIVagm isolates (90, gri-1, and ver-1). Comparisons among the SIVagm isolates revealed extreme diversity at the nucleotide and amino acid levels. Long terminal repeat nucleotide sequences varied up to 35% and Gag protein sequences varied up to 30%. The variability among SIVagm isolates exceeded the variability among any other group of primate lentiviruses. Our data suggest that SIVagm has been in the African green monkey population for a long time and may be the oldest primate lentivirus group in existence. PMID:2304139

Molecular characterization of chikungunya virus from Andhra Pradesh, India & phylogenetic relationship with Central African isolates.

PubMed

M Naresh Kumar, C V; Anthony Johnson, A M; R Sai Gopal, D V

2007-12-01

Chikungunya virus has caused numerous large outbreaks in India. Suspected blood samples from the epidemic were collected and characterized for the identification of the responsible causative from Rayalaseema region of Andhra Pradesh. RT-PCR was used for screening of suspected blood samples. Primers were designed to amplify partial E1 gene and the amplified fragment was cloned and sequenced. The sequence was analyzed and compared with other geographical isolates to find the phylogenetic relationship. The sequence was submitted to the Gen bank DNA database (accession DQ888620). Comparative nucleotide homology analysis of the AP Ra-CTR isolate with the other isolates revealed 94.7+/-3.6 per cent of homology of CHIKAPRa-CTR with other isolates of Chikungunya virus at nucleotide level and 96.8+/-3.2 per cent of homology at amino acid level. The current epidemic was caused by the Central African genotype of CHIKV, grouped in Central Africa cluster in phylogenetic trees generated based on nucleotide and amino acid sequences.

3D RNA and functional interactions from evolutionary couplings

PubMed Central

Weinreb, Caleb; Riesselman, Adam; Ingraham, John B.; Gross, Torsten; Sander, Chris; Marks, Debora S.

2016-01-01

Summary Non-coding RNAs are ubiquitous, but the discovery of new RNA gene sequences far outpaces research on their structure and functional interactions. We mine the evolutionary sequence record to derive precise information about function and structure of RNAs and RNA-protein complexes. As in protein structure prediction, we use maximum entropy global probability models of sequence co-variation to infer evolutionarily constrained nucleotide-nucleotide interactions within RNA molecules, and nucleotide-amino acid interactions in RNA-protein complexes. The predicted contacts allow all-atom blinded 3D structure prediction at good accuracy for several known RNA structures and RNA-protein complexes. For unknown structures, we predict contacts in 160 non-coding RNA families. Beyond 3D structure prediction, evolutionary couplings help identify important functional interactions, e.g., at switch points in riboswitches and at a complex nucleation site in HIV. Aided by accelerating sequence accumulation, evolutionary coupling analysis can accelerate the discovery of functional interactions and 3D structures involving RNA. PMID:27087444

Telling apart Felidae and Ursidae from the distribution of nucleotides in mitochondrial DNA

NASA Astrophysics Data System (ADS)

Rovenchak, Andrij

2018-02-01

Rank-frequency distributions of nucleotide sequences in mitochondrial DNA are defined in a way analogous to the linguistic approach, with the highest-frequent nucleobase serving as a whitespace. For such sequences, entropy and mean length are calculated. These parameters are shown to discriminate the species of the Felidae (cats) and Ursidae (bears) families. From purely numerical values we are able to see in particular that giant pandas are bears while koalas are not. The observed linear relation between the parameters is explained using a simple probabilistic model. The approach based on the non-additive generalization of the Bose distribution is used to analyze the frequency spectra of the nucleotide sequences. In this case, the separation of families is not very sharp. Nevertheless, the distributions for Felidae have on average longer tails comparing to Ursidae.

MSuPDA: A Memory Efficient Algorithm for Sequence Alignment.

PubMed

Khan, Mohammad Ibrahim; Kamal, Md Sarwar; Chowdhury, Linkon

2016-03-01

Space complexity is a million dollar question in DNA sequence alignments. In this regard, memory saving under pushdown automata can help to reduce the occupied spaces in computer memory. Our proposed process is that anchor seed (AS) will be selected from given data set of nucleotide base pairs for local sequence alignment. Quick splitting techniques will separate the AS from all the DNA genome segments. Selected AS will be placed to pushdown automata's (PDA) input unit. Whole DNA genome segments will be placed into PDA's stack. AS from input unit will be matched with the DNA genome segments from stack of PDA. Match, mismatch and indel of nucleotides will be popped from the stack under the control unit of pushdown automata. During the POP operation on stack, it will free the memory cell occupied by the nucleotide base pair.

High Degree of Interlaboratory Reproducibility of Human Immunodeficiency Virus Type 1 Protease and Reverse Transcriptase Sequencing of Plasma Samples from Heavily Treated Patients

PubMed Central

Shafer, Robert W.; Hertogs, Kurt; Zolopa, Andrew R.; Warford, Ann; Bloor, Stuart; Betts, Bradley J.; Merigan, Thomas C.; Harrigan, Richard; Larder, Brendon A.

2001-01-01

We assessed the reproducibility of human immunodeficiency virus type 1 (HIV-1) reverse transcriptase (RT) and protease sequencing using cryopreserved plasma aliquots obtained from 46 heavily treated HIV-1-infected individuals in two laboratories using dideoxynucleotide sequencing. The rates of complete sequence concordance between the two laboratories were 99.1% for the protease sequence and 99.0% for the RT sequence. Approximately 90% of the discordances were partial, defined as one laboratory detecting a mixture and the second laboratory detecting only one of the mixture's components. Only 0.1% of the nucleotides were completely discordant between the two laboratories, and these were significantly more likely to occur in plasma samples with lower plasma HIV-1 RNA levels. Nucleotide mixtures were detected at approximately 1% of the nucleotide positions, and in every case in which one laboratory detected a mixture, the second laboratory either detected the same mixture or detected one of the mixture's components. The high rate of concordance in detecting mixtures and the fact that most discordances between the two laboratories were partial suggest that most discordances were caused by variation in sampling of the HIV-1 quasispecies by PCR rather than by technical errors in the sequencing process itself. PMID:11283081

Complementary DNA cloning and molecular evolution of opine dehydrogenases in some marine invertebrates.

PubMed

Kimura, Tomohiro; Nakano, Toshiki; Yamaguchi, Toshiyasu; Sato, Minoru; Ogawa, Tomohisa; Muramoto, Koji; Yokoyama, Takehiko; Kan-No, Nobuhiro; Nagahisa, Eizou; Janssen, Frank; Grieshaber, Manfred K

2004-01-01

The complete complementary DNA sequences of genes presumably coding for opine dehydrogenases from Arabella iricolor (sandworm), Haliotis discus hannai (abalone), and Patinopecten yessoensis (scallop) were determined, and partial cDNA sequences were derived for Meretrix lusoria (Japanese hard clam) and Spisula sachalinensis (Sakhalin surf clam). The primers ODH-9F and ODH-11R proved useful for amplifying the sequences for opine dehydrogenases from the 4 mollusk species investigated in this study. The sequence of the sandworm was obtained using primers constructed from the amino acid sequence of tauropine dehydrogenase, the main opine dehydrogenase in A. iricolor. The complete cDNA sequence of A. iricolor, H. discus hannai, and P. yessoensis encode 397, 400, and 405 amino acids, respectively. All sequences were aligned and compared with published databank sequences of Loligo opalescens, Loligo vulgaris (squid), Sepia officinalis (cuttlefish), and Pecten maximus (scallop). As expected, a high level of homology was observed for the cDNA from closely related species, such as for cephalopods or scallops, whereas cDNA from the other species showed lower-level homologies. A similar trend was observed when the deduced amino acid sequences were compared. Furthermore, alignment of these sequences revealed some structural motifs that are possibly related to the binding sites of the substrates. The phylogenetic trees derived from the nucleotide and amino acid sequences were consistent with the classification of species resulting from classical taxonomic analyses.

Molecular cloning and nucleotide sequence of the alpha and beta subunits of allophycocyanin from the cyanelle genome of Cyanophora paradoxa.

PubMed Central

Bryant, D A; de Lorimier, R; Lambert, D H; Dubbs, J M; Stirewalt, V L; Stevens, S E; Porter, R D; Tam, J; Jay, E

1985-01-01

The genes for the alpha- and beta-subunit apoproteins of allophycocyanin (AP) were isolated from the cyanelle genome of Cyanophora paradoxa and subjected to nucleotide sequence analysis. The AP beta-subunit apoprotein gene was localized to a 7.8-kilobase-pair Pst I restriction fragment from cyanelle DNA by hybridization with a tetradecameric oligonucleotide probe. Sequence analysis using that oligonucleotide and its complement as primers for the dideoxy chain-termination sequencing method confirmed the presence of both AP alpha- and beta-subunit genes on this restriction fragment. Additional oligonucleotide primers were synthesized as sequencing progressed and were used to determine rapidly the nucleotide sequence of a 1336-base-pair region of this cloned fragment. This strategy allowed the sequencing to be completed without a detailed restriction map and without extensive and time-consuming subcloning. The sequenced region contains two open reading frames whose deduced amino acid sequences are 81-85% homologous to cyanobacterial and red algal AP subunits whose amino acid sequences have been determined. The two open reading frames are in the same orientation and are separated by 39 base pairs. AP alpha is 5' to AP beta and both coding sequences are preceded by a polypurine, Shine-Dalgarno-type sequence. Sequences upstream from AP alpha closely resemble the Escherichia coli consensus promoter sequences and also show considerable homology to promoter sequences for several chloroplast-encoded psbA genes. A 56-base-pair palindromic sequence downstream from the AP beta gene could play a role in the termination of transcription or translation. The allophycocyanin apoprotein subunit genes are located on the large single-copy region of the cyanelle genome. PMID:2987916

Begomoviruses infecting weeds in Cuba: increased host range and a novel virus infecting Sida rhombifolia.

PubMed

Fiallo-Olivé, Elvira; Navas-Castillo, Jesús; Moriones, Enrique; Martínez-Zubiaur, Yamila

2012-01-01

As a result of surveys conducted during the last few years to search for wild reservoirs of begomoviruses in Cuba, we detected a novel bipartite begomovirus, sida yellow mottle virus (SiYMoV), infecting Sida rhombifolia plants. The complete genome sequence was obtained, showing that DNA-A was 2622 nucleotides (nt) in length and that it was most closely related (87.6% nucleotide identity) to DNA-A of an isolate of sida golden mosaic virus (SiGMV) that infects snap beans (Phaseolus vulgaris) in Florida. The DNA-B sequence was 2600 nt in length and shared the highest nucleotide identity (75.1%) with corchorus yellow spot virus (CoYSV). Phylogenetic relationship analysis showed that both DNA components of SiYMoV were grouped in the Abutilon clade, along with begomoviruses from Florida and the Caribbean islands. We also present here the complete nucleotide sequence of a novel strain of sida yellow vein virus found infecting Malvastrum coromandelianum and an isolate of euphorbia mosaic virus that was found for the first time infecting Euphorbia heterophylla in Cuba.

[Determination of genetic bases of auxotrophy in Yersinia pestis ssp. caucasica strains].

PubMed

Odinokov, G N; Eroshenko, G A; Kukleva, L M; Shavina, N Iu; Krasnov, Ia M; Kutyrev, V V

2012-04-01

Based on the results of computer analysis of nucleotide sequences in strains Yersinia pestis and Y. pseudotuberculosis recorded in the files of NCBI GenBank database, differences between genes argA, aroG, aroF, thiH, and thiG of strain Pestoides F (subspecies caucasica) were found, compared to other strains of plaque agent and pseudotuberculosis microbe. Using PCR with calculated primers and the method of sequence analysis, the structure of variable regions of these genes was studied in 96 natural Y. pestis and Y. pseudotuberculosis strains. It was shown that all examined strains of subspecies caucasica, unlike strains of plague-causing agent of other subspecies and pseudotubercolosis microbe, had identical mutations in genes argA (integration of the insertion sequence IS100), aroG (insertion of ten nucleotides), aroF (inserion of IS100), thiH (insertion of nucleotide T), and thiG (deletion of 13 nucleotides). These mutations are the reason for the absence in strains belonging to this subspecies of the ability to synthesize arginine, phenylalanine, tyrosine, and vitamin B1 (thiamine), and cause their auxotrophy for these growth factors.

Comprehensive analysis of the T-cell receptor beta chain gene in rhesus monkey by high throughput sequencing

PubMed Central

Li, Zhoufang; Liu, Guangjie; Tong, Yin; Zhang, Meng; Xu, Ying; Qin, Li; Wang, Zhanhui; Chen, Xiaoping; He, Jiankui

2015-01-01

Profiling immune repertoires by high throughput sequencing enhances our understanding of immune system complexity and immune-related diseases in humans. Previously, cloning and Sanger sequencing identified limited numbers of T cell receptor (TCR) nucleotide sequences in rhesus monkeys, thus their full immune repertoire is unknown. We applied multiplex PCR and Illumina high throughput sequencing to study the TCRβ of rhesus monkeys. We identified 1.26 million TCRβ sequences corresponding to 643,570 unique TCRβ sequences and 270,557 unique complementarity-determining region 3 (CDR3) gene sequences. Precise measurements of CDR3 length distribution, CDR3 amino acid distribution, length distribution of N nucleotide of junctional region, and TCRV and TCRJ gene usage preferences were performed. A comprehensive profile of rhesus monkey immune repertoire might aid human infectious disease studies using rhesus monkeys. PMID:25961410

[The genetical evolution of the full length genes of 5 EV 71 strains from 5 Shenzhen patients with hand-food-mouth disease associated with EV71 infection].

PubMed

Liu, Wei-long; Yang, Gui-lin; Wei, Qing; Zhang, Ming-xia; Chen, Xin-chun; Liu, Ying-xia; Gao, Yang; Zhou, Bo-ping

2011-02-01

To investigate the characteristics of molecular epidemiology and molecular evolution of 5 EV 71 (enterovirus 71, EV71) strains from 5 Shenzhen patients with hand-food-mouth disease associated with EV 71 infection. 5 EV 71 strains were isolated, and sequenced to analyzed the full length gene sequences in order to compare nucleotide and amino acid homology with other EV71 strains from other regions and countries as well as previous strains across the world through bioinformatics software. 5 strains of EV 71 belonged to sub-genotype C4 by analysis of nucleotide sequences of VP1 and VP4 of EV 71. The differences of nucleotide and amino acid sequences were much small with nucleotide homology of 93% and amino acid homology of 98% among these 5 strains. A phylogenetic tree analysis indicated that 2008 Shenzhen epidemic strains were the most close to 2004 Shenzhen circulating strains, and also much close to 1998 Shenzhen epidemic strains and 2008 Fuyang Anhui strains. The dead strain was very close to 2008 Fuyang Anhui epidemic strains. It can be speculated that this epidemic strains of EV 71 probably originate from the same ancient strain in the history, may from 1998 Shenzhen strain.

TFBSshape: a motif database for DNA shape features of transcription factor binding sites.

PubMed

Yang, Lin; Zhou, Tianyin; Dror, Iris; Mathelier, Anthony; Wasserman, Wyeth W; Gordân, Raluca; Rohs, Remo

2014-01-01

Transcription factor binding sites (TFBSs) are most commonly characterized by the nucleotide preferences at each position of the DNA target. Whereas these sequence motifs are quite accurate descriptions of DNA binding specificities of transcription factors (TFs), proteins recognize DNA as a three-dimensional object. DNA structural features refine the description of TF binding specificities and provide mechanistic insights into protein-DNA recognition. Existing motif databases contain extensive nucleotide sequences identified in binding experiments based on their selection by a TF. To utilize DNA shape information when analysing the DNA binding specificities of TFs, we developed a new tool, the TFBSshape database (available at http://rohslab.cmb.usc.edu/TFBSshape/), for calculating DNA structural features from nucleotide sequences provided by motif databases. The TFBSshape database can be used to generate heat maps and quantitative data for DNA structural features (i.e., minor groove width, roll, propeller twist and helix twist) for 739 TF datasets from 23 different species derived from the motif databases JASPAR and UniPROBE. As demonstrated for the basic helix-loop-helix and homeodomain TF families, our TFBSshape database can be used to compare, qualitatively and quantitatively, the DNA binding specificities of closely related TFs and, thus, uncover differential DNA binding specificities that are not apparent from nucleotide sequence alone.

TFBSshape: a motif database for DNA shape features of transcription factor binding sites

PubMed Central

Yang, Lin; Zhou, Tianyin; Dror, Iris; Mathelier, Anthony; Wasserman, Wyeth W.; Gordân, Raluca; Rohs, Remo

2014-01-01

Transcription factor binding sites (TFBSs) are most commonly characterized by the nucleotide preferences at each position of the DNA target. Whereas these sequence motifs are quite accurate descriptions of DNA binding specificities of transcription factors (TFs), proteins recognize DNA as a three-dimensional object. DNA structural features refine the description of TF binding specificities and provide mechanistic insights into protein–DNA recognition. Existing motif databases contain extensive nucleotide sequences identified in binding experiments based on their selection by a TF. To utilize DNA shape information when analysing the DNA binding specificities of TFs, we developed a new tool, the TFBSshape database (available at http://rohslab.cmb.usc.edu/TFBSshape/), for calculating DNA structural features from nucleotide sequences provided by motif databases. The TFBSshape database can be used to generate heat maps and quantitative data for DNA structural features (i.e., minor groove width, roll, propeller twist and helix twist) for 739 TF datasets from 23 different species derived from the motif databases JASPAR and UniPROBE. As demonstrated for the basic helix-loop-helix and homeodomain TF families, our TFBSshape database can be used to compare, qualitatively and quantitatively, the DNA binding specificities of closely related TFs and, thus, uncover differential DNA binding specificities that are not apparent from nucleotide sequence alone. PMID:24214955

Characterization of a tandemly repeated DNA sequence family originally derived by retroposition of tRNA(Glu) in the newt.

PubMed

Nagahashi, S; Endoh, H; Suzuki, Y; Okada, N

1991-11-20

A previous report from this laboratory showed that in vitro transcription of total genomic DNA of the newt Cynopus pyrrhogaster resulted in a discrete sized 8 S RNA, which represented highly repetitive and transcribable sequences with a glutamic acid tRNA-like structure in the newt genome. We isolated four independent clones from a newt genomic library and determined the complete sequences of three 2000 to 2400 base-pair PstI fragments spanning the 8 S RNA gene. The glutamic acid tRNA-related segment in the 8 S RNA gene contains the CCA sequence expected as the 3' terminus of a tRNA molecule. Further, the 11 nucleotides located 13 nucleotides upstream from one of the two transcription initiation sites of the 8 S RNA were found to be repeated in the region upstream from the termination site, suggesting that the original unit, which is shorter than the 8 S RNA, was retrotransposed via cDNA intermediates from the PolIII transcript. In the upstream region of the 8 S RNA gene, a 360 nucleotide unit containing the glutamic acid tRNA-related segment was found to be duplicated (clones NE1 and NE10) or triplicated (clone NE3). Except for the difference in the number of the 360 nucleotide unit, the three sequences of the 2000 to 2400 base-pair PstI fragment were essentially the same with only a few mutations and minor deletions. Inverse polymerase chain reaction and sequence determination of the products, together with a Southern hybridization experiment, demonstrated that the family consists of a tandemly repeated unit of 3300, 3700 or 4100 base-pairs. Thus during evolution, this family in the newt was created by retroposition via cDNA intermediates, followed by duplication or triplication of the 360 nucleotide unit and multiplication of the 3300 to 4100 base-pair region at the DNA level.

The complete nucleotide sequence of RNA 3 of a peach isolate of Prunus necrotic ringspot virus.

PubMed

Hammond, R W; Crosslin, J M

1995-04-01

The complete nucleotide sequence of RNA 3 of the PE-5 peach isolate of Prunus necrotic ringspot ilarvirus (PNRSV) was obtained from cloned cDNA. The RNA sequence is 1941 nucleotides and contains two open reading frames (ORFs). ORF 1 consisted of 284 amino acids with a calculated molecular weight of 31,729 Da and ORF 2 contained 224 amino acids with a calculated molecular weight of 25,018 Da. ORF 2 corresponds to the coat protein gene. Expression of ORF 2 engineered into a pTrcHis vector in Escherichia coli results in a fusion polypeptide of approximately 28 kDa which cross-reacts with PNRSV polyclonal antiserum. Analysis of the coat protein amino acid sequence reveals a putative "zinc-finger" domain at the amino-terminal portion of the protein. Two tetranucleotide AUGC motifs occur in the 3'-UTR of the RNA and may function in coat protein binding and genome activation. ORF 1 homologies to other ilarviruses and alfalfa mosaic virus are confined to limited regions of conserved amino acids. The translated amino acid sequence of the coat protein gene shows 92% similarity to one isolate of apple mosaic virus, a closely related member of the ilarvirus group of plant viruses, but only 66% similarity to the amino acid sequence of the coat protein gene of a second isolate. These relationships are also reflected at the nucleotide sequence level. These results in one instance confirm the close similarities observed at the biophysical and serological levels between these two viruses, but on the other hand call into question the nomenclature used to describe these viruses.

A new family of satellite DNA sequences as a major component of centromeric heterochromatin in owls (Strigiformes).

PubMed

Yamada, Kazuhiko; Nishida-Umehara, Chizuko; Matsuda, Yoichi

2004-03-01

We isolated a new family of satellite DNA sequences from HaeIII- and EcoRI-digested genomic DNA of the Blakiston's fish owl ( Ketupa blakistoni). The repetitive sequences were organized in tandem arrays of the 174 bp element, and localized to the centromeric regions of all macrochromosomes, including the Z and W chromosomes, and microchromosomes. This hybridization pattern was consistent with the distribution of C-band-positive centromeric heterochromatin, and the satellite DNA sequences occupied 10% of the total genome as a major component of centromeric heterochromatin. The sequences were homogenized between macro- and microchromosomes in this species, and therefore intraspecific divergence of the nucleotide sequences was low. The 174 bp element cross-hybridized to the genomic DNA of six other Strigidae species, but not to that of the Tytonidae, suggesting that the satellite DNA sequences are conserved in the same family but fairly divergent between the different families in the Strigiformes. Secondly, the centromeric satellite DNAs were cloned from eight Strigidae species, and the nucleotide sequences of 41 monomer fragments were compared within and between species. Molecular phylogenetic relationships of the nucleotide sequences were highly correlated with both the taxonomy based on morphological traits and the phylogenetic tree constructed by DNA-DNA hybridization. These results suggest that the satellite DNA sequence has evolved by concerted evolution in the Strigidae and that it is a good taxonomic and phylogenetic marker to examine genetic diversity between Strigiformes species.

iRNA-2methyl: Identify RNA 2'-O-methylation Sites by Incorporating Sequence-Coupled Effects into General PseKNC and Ensemble Classifier.

PubMed

Qiu, Wang-Ren; Jiang, Shi-Yu; Sun, Bi-Qian; Xiao, Xuan; Cheng, Xiang; Chou, Kuo-Chen

2017-01-01

Being a kind of post-transcriptional modification (PTCM) in RNA, the 2'-Omethylation modification occurs in the processes of life development and disease formation as well. Accordingly, from the angles of both basic research and drug development, we are facing a challenging problem: given an uncharacterized RNA sequence formed by many nucleotides of A (adenine), C (cytosine), G (guanine), and U (uracil), which one can be of 2-O'-methylation modification, and which one cannot? Unfortunately, so far no computational method whatsoever has been developed to address such a problem. To fill this empty area, we propose a predictor called iRNA-2methyl. It is formed by incorporating a series of sequence-coupled factors into the general PseKNC (pseudo nucleotide composition), followed by fusing 12 basic random forest classifier into four ensemble predictors, with each aimed to identify the cases of A, C, G, and U along the RNA sequence concerned, respectively. Rigorous jackknife cross-validations have indicated that the success rates are very high (>93%). For the convenience of most experimental scientists, a user-friendly web-server for iRNA-2methyl has been established at http://www.jci-bioinfo.cn/iRNA-2methyl, by which users can easily obtain their desired results without the need to go through the complicated mathematical equations involved. The proposed predictor iRNA-2methyl will become a very useful bioinformatics tool for medicinal chemistry, helping to design effective drugs against the diseases related to the 2'-Omethylation modification. Copyright© Bentham Science Publishers; For any queries, please email at epub@benthamscience.org.

Mapping posttranscriptional modifications in 5S ribosomal RNA by MALDI mass spectrometry.

PubMed

Kirpekar, F; Douthwaite, S; Roepstorff, P

2000-02-01

We present a method to screen RNA for posttranscriptional modifications based on Matrix Assisted Laser Desorption/Ionization mass spectrometry (MALDI-MS). After the RNA is digested to completion with a nucleotide-specific RNase, the fragments are analyzed by mass spectrometry. A comparison of the observed mass data with the data predicted from the gene sequence identifies fragments harboring modified nucleotides. Fragments larger than dinucleotides were valuable for the identification of posttranscriptional modifications. A more refined mapping of RNA modifications can be obtained by using two RNases in parallel combined with further fragmentation by Post Source Decay (PSD). This approach allows fast and sensitive screening of a purified RNA for posttranscriptional modification, and has been applied on 5S rRNA from two thermophilic microorganisms, the bacterium Bacillus stearothermophilus and the archaeon Sulfolobus acidocaldarius, as well as the halophile archaea Halobacterium halobium and Haloarcula marismortui. One S. acidocaldarius posttranscriptional modification was identified and was further characterized by PSD as a methylation of cytidine32. The modified C is located in a region that is clearly conserved with respect to both sequence and position in B. stearothermophilus and H. halobium and to some degree also in H. marismortui. However, no analogous modification was identified in the latter three organisms. We further find that the 5' end of H. halobium 5S rRNA is dephosphorylated, in contrast to the other 5S rRNA species investigated. The method additionally gives an immediate indication of whether the expected RNA sequence is in agreement with the observed fragment masses. Discrepancies with two of the published 5S rRNA sequences were identified and are reported here.

Mapping posttranscriptional modifications in 5S ribosomal RNA by MALDI mass spectrometry.

PubMed Central

Kirpekar, F; Douthwaite, S; Roepstorff, P

2000-01-01

We present a method to screen RNA for posttranscriptional modifications based on Matrix Assisted Laser Desorption/Ionization mass spectrometry (MALDI-MS). After the RNA is digested to completion with a nucleotide-specific RNase, the fragments are analyzed by mass spectrometry. A comparison of the observed mass data with the data predicted from the gene sequence identifies fragments harboring modified nucleotides. Fragments larger than dinucleotides were valuable for the identification of posttranscriptional modifications. A more refined mapping of RNA modifications can be obtained by using two RNases in parallel combined with further fragmentation by Post Source Decay (PSD). This approach allows fast and sensitive screening of a purified RNA for posttranscriptional modification, and has been applied on 5S rRNA from two thermophilic microorganisms, the bacterium Bacillus stearothermophilus and the archaeon Sulfolobus acidocaldarius, as well as the halophile archaea Halobacterium halobium and Haloarcula marismortui. One S. acidocaldarius posttranscriptional modification was identified and was further characterized by PSD as a methylation of cytidine32. The modified C is located in a region that is clearly conserved with respect to both sequence and position in B. stearothermophilus and H. halobium and to some degree also in H. marismortui. However, no analogous modification was identified in the latter three organisms. We further find that the 5' end of H. halobium 5S rRNA is dephosphorylated, in contrast to the other 5S rRNA species investigated. The method additionally gives an immediate indication of whether the expected RNA sequence is in agreement with the observed fragment masses. Discrepancies with two of the published 5S rRNA sequences were identified and are reported here. PMID:10688367

Basecalling with LifeTrace

PubMed Central

Walther, Dirk; Bartha, Gábor; Morris, Macdonald

2001-01-01

A pivotal step in electrophoresis sequencing is the conversion of the raw, continuous chromatogram data into the actual sequence of discrete nucleotides, a process referred to as basecalling. We describe a novel algorithm for basecalling implemented in the program LifeTrace. Like Phred, currently the most widely used basecalling software program, LifeTrace takes processed trace data as input. It was designed to be tolerant to variable peak spacing by means of an improved peak-detection algorithm that emphasizes local chromatogram information over global properties. LifeTrace is shown to generate high-quality basecalls and reliable quality scores. It proved particularly effective when applied to MegaBACE capillary sequencing machines. In a benchmark test of 8372 dye-primer MegaBACE chromatograms, LifeTrace generated 17% fewer substitution errors, 16% fewer insertion/deletion errors, and 2.4% more aligned bases to the finished sequence than did Phred. For two sets totaling 6624 dye-terminator chromatograms, the performance improvement was 15% fewer substitution errors, 10% fewer insertion/deletion errors, and 2.1% more aligned bases. The processing time required by LifeTrace is comparable to that of Phred. The predicted quality scores were in line with observed quality scores, permitting direct use for quality clipping and in silico single nucleotide polymorphism (SNP) detection. Furthermore, we introduce a new type of quality score associated with every basecall: the gap-quality. It estimates the probability of a deletion error between the current and the following basecall. This additional quality score improves detection of single basepair deletions when used for locating potential basecalling errors during the alignment. We also describe a new protocol for benchmarking that we believe better discerns basecaller performance differences than methods previously published. PMID:11337481

Pooled Enrichment Sequencing Identifies Diversity and Evolutionary Pressures at NLR Resistance Genes within a Wild Tomato Population.

PubMed

Stam, Remco; Scheikl, Daniela; Tellier, Aurélien

2016-06-02

Nod-like receptors (NLRs) are nucleotide-binding domain and leucine-rich repeats containing proteins that are important in plant resistance signaling. Many of the known pathogen resistance (R) genes in plants are NLRs and they can recognize pathogen molecules directly or indirectly. As such, divergence and copy number variants at these genes are found to be high between species. Within populations, positive and balancing selection are to be expected if plants coevolve with their pathogens. In order to understand the complexity of R-gene coevolution in wild nonmodel species, it is necessary to identify the full range of NLRs and infer their evolutionary history. Here we investigate and reveal polymorphism occurring at 220 NLR genes within one population of the partially selfing wild tomato species Solanum pennellii. We use a combination of enrichment sequencing and pooling ten individuals, to specifically sequence NLR genes in a resource and cost-effective manner. We focus on the effects which different mapping and single nucleotide polymorphism calling software and settings have on calling polymorphisms in customized pooled samples. Our results are accurately verified using Sanger sequencing of polymorphic gene fragments. Our results indicate that some NLRs, namely 13 out of 220, have maintained polymorphism within our S. pennellii population. These genes show a wide range of πN/πS ratios and differing site frequency spectra. We compare our observed rate of heterozygosity with expectations for this selfing and bottlenecked population. We conclude that our method enables us to pinpoint NLR genes which have experienced natural selection in their habitat. © The Author 2016. Published by Oxford University Press on behalf of the Society for Molecular Biology and Evolution.

Single-Nucleotide-Specific Targeting of the Tf1 Retrotransposon Promoted by the DNA-Binding Protein Sap1 of Schizosaccharomyces pombe.

PubMed

Hickey, Anthony; Esnault, Caroline; Majumdar, Anasuya; Chatterjee, Atreyi Ghatak; Iben, James R; McQueen, Philip G; Yang, Andrew X; Mizuguchi, Takeshi; Grewal, Shiv I S; Levin, Henry L

2015-11-01

Transposable elements (TEs) constitute a substantial fraction of the eukaryotic genome and, as a result, have a complex relationship with their host that is both adversarial and dependent. To minimize damage to cellular genes, TEs possess mechanisms that target integration to sequences of low importance. However, the retrotransposon Tf1 of Schizosaccharomyces pombe integrates with a surprising bias for promoter sequences of stress-response genes. The clustering of integration in specific promoters suggests that Tf1 possesses a targeting mechanism that is important for evolutionary adaptation to changes in environment. We report here that Sap1, an essential DNA-binding protein, plays an important role in Tf1 integration. A mutation in Sap1 resulted in a 10-fold drop in Tf1 transposition, and measures of transposon intermediates support the argument that the defect occurred in the process of integration. Published ChIP-Seq data on Sap1 binding combined with high-density maps of Tf1 integration that measure independent insertions at single-nucleotide positions show that 73.4% of all integration occurs at genomic sequences bound by Sap1. This represents high selectivity because Sap1 binds just 6.8% of the genome. A genome-wide analysis of promoter sequences revealed that Sap1 binding and amounts of integration correlate strongly. More important, an alignment of the DNA-binding motif of Sap1 revealed integration clustered on both sides of the motif and showed high levels specifically at positions +19 and -9. These data indicate that Sap1 contributes to the efficiency and position of Tf1 integration. Copyright © 2015 by the Genetics Society of America.

Single-Nucleotide-Specific Targeting of the Tf1 Retrotransposon Promoted by the DNA-Binding Protein Sap1 of Schizosaccharomyces pombe

PubMed Central

Hickey, Anthony; Esnault, Caroline; Majumdar, Anasuya; Chatterjee, Atreyi Ghatak; Iben, James R.; McQueen, Philip G.; Yang, Andrew X.; Mizuguchi, Takeshi; Grewal, Shiv I. S.; Levin, Henry L.

2015-01-01

Transposable elements (TEs) constitute a substantial fraction of the eukaryotic genome and, as a result, have a complex relationship with their host that is both adversarial and dependent. To minimize damage to cellular genes, TEs possess mechanisms that target integration to sequences of low importance. However, the retrotransposon Tf1 of Schizosaccharomyces pombe integrates with a surprising bias for promoter sequences of stress-response genes. The clustering of integration in specific promoters suggests that Tf1 possesses a targeting mechanism that is important for evolutionary adaptation to changes in environment. We report here that Sap1, an essential DNA-binding protein, plays an important role in Tf1 integration. A mutation in Sap1 resulted in a 10-fold drop in Tf1 transposition, and measures of transposon intermediates support the argument that the defect occurred in the process of integration. Published ChIP-Seq data on Sap1 binding combined with high-density maps of Tf1 integration that measure independent insertions at single-nucleotide positions show that 73.4% of all integration occurs at genomic sequences bound by Sap1. This represents high selectivity because Sap1 binds just 6.8% of the genome. A genome-wide analysis of promoter sequences revealed that Sap1 binding and amounts of integration correlate strongly. More important, an alignment of the DNA-binding motif of Sap1 revealed integration clustered on both sides of the motif and showed high levels specifically at positions +19 and −9. These data indicate that Sap1 contributes to the efficiency and position of Tf1 integration. PMID:26358720

Amino acid and nucleotide recurrence in aligned sequences: synonymous substitution patterns in association with global and local base compositions.

PubMed

Nishizawa, M; Nishizawa, K

2000-10-01

The tendency for repetitiveness of nucleotides in DNA sequences has been reported for a variety of organisms. We show that the tendency for repetitive use of amino acids is widespread and is observed even for segments conserved between human and Drosophila melanogaster at the level of >50% amino acid identity. This indicates that repetitiveness influences not only the weakly constrained segments but also those sequence segments conserved among phyla. Not only glutamine (Q) but also many of the 20 amino acids show a comparable level of repetitiveness. Repetitiveness in bases at codon position 3 is stronger for human than for D.melanogaster, whereas local repetitiveness in intron sequences is similar between the two organisms. While genes for immune system-specific proteins, but not ancient human genes (i.e. human homologs of Escherichia coli genes), have repetitiveness at codon bases 1 and 2, repetitiveness at codon base 3 for these groups is similar, suggesting that the human genome has at least two mechanisms generating local repetitiveness. Neither amino acid nor nucleotide repetitiveness is observed beyond the exon boundary, denying the possibility that such repetitiveness could mainly stem from natural selection on mRNA or protein sequences. Analyses of mammalian sequence alignments show that while the 'between gene' GC content heterogeneity, which is linked to 'isochores', is a principal factor associated with the bias in substitution patterns in human, 'within gene' heterogeneity in nucleotide composition is also associated with such bias on a more local scale. The relationship amongst the various types of repetitiveness is discussed.

Amino acid and nucleotide recurrence in aligned sequences: synonymous substitution patterns in association with global and local base compositions

PubMed Central

Nishizawa, Manami; Nishizawa, Kazuhisa

2000-01-01

The tendency for repetitiveness of nucleotides in DNA sequences has been reported for a variety of organisms. We show that the tendency for repetitive use of amino acids is widespread and is observed even for segments conserved between human and Drosophila melanogaster at the level of >50% amino acid identity. This indicates that repetitiveness influences not only the weakly constrained segments but also those sequence segments conserved among phyla. Not only glutamine (Q) but also many of the 20 amino acids show a comparable level of repetitiveness. Repetitiveness in bases at codon position 3 is stronger for human than for D.melanogaster, whereas local repetitiveness in intron sequences is similar between the two organisms. While genes for immune system-specific proteins, but not ancient human genes (i.e. human homologs of Escherichia coli genes), have repetitiveness at codon bases 1 and 2, repetitiveness at codon base 3 for these groups is similar, suggesting that the human genome has at least two mechanisms generating local repetitiveness. Neither amino acid nor nucleotide repetitiveness is observed beyond the exon boundary, denying the possibility that such repetitiveness could mainly stem from natural selection on mRNA or protein sequences. Analyses of mammalian sequence alignments show that while the ‘between gene’ GC content heterogeneity, which is linked to ‘isochores’, is a principal factor associated with the bias in substitution patterns in human, ‘within gene’ heterogeneity in nucleotide composition is also associated with such bias on a more local scale. The relationship amongst the various types of repetitiveness is discussed. PMID:11000273

Novel Mutations in pncA Gene of Pyrazinamide Resistant Clinical Isolates of Mycobacterium tuberculosis.

PubMed

Kahbazi, Manijeh; Sarmadian, Hossein; Ahmadi, Azam; Didgar, Farshideh; Sadrnia, Maryam; Poolad, Toktam; Arjomandzadegan, Mohammad

2018-04-16

In clinical isolates of Mycobacterium tuberculosis (MTB), resistance to pyrazinamide occurs by mutations in any positions of the pncA gene (NC_000962.3) especially in nucleotides 359 and 374. In this study we examined the pncA gene sequence in clinical isolates of MTB. Genomic DNA of 33 clinical isolates of MTB was extracted by the Chelex100 method. The polymerase chain reactions (PCR) were performed using specific primers for amplification of 744 bp amplicon comprising the coding sequences (CDS) of the pncA gene. PCR products were sequenced by an automated sequencing Bioscience system. Additionally, semi Nested-allele specific (sNASP) and polymerase chain reaction-restriction fragment length polymorphism (PCR-RFLP) methods were carried out for verification of probable mutations in nucleotides 359 and 374. Sequencing results showed that from 33 MTB clinical isolates, nine pyrazinamide-resistant isolates have mutations. Furthermore, no mutation was detected in 24 susceptible strains in the entire 561 bp of the pncA gene. Moreover, new mutations of G→A at position 3 of the pncA gene were identified in some of the resistant isolates. Results showed that the sNASP method could detect mutations in nucleotide 359 and 374 of the pncA gene, but the PCR-RFLP method by the SacII enzyme could not detect these mutations. In conclusion, the identification of new mutations in the pncA gene confirmed the probable occurrence of mutations in any nucleotides of the pncA gene sequence in resistant isolates of MTB.

37 CFR 41.37 - Appeal brief.

Code of Federal Regulations, 2011 CFR

2011-07-01

... limitation is described in the specification as filed. If there is a drawing or amino acid or nucleotide material sequence, and at least one limitation is illustrated in a drawing or amino acid or nucleotide...

37 CFR 41.37 - Appeal brief.

Code of Federal Regulations, 2010 CFR

2010-07-01

... limitation is described in the specification as filed. If there is a drawing or amino acid or nucleotide material sequence, and at least one limitation is illustrated in a drawing or amino acid or nucleotide...

Development of the polymerase chain reaction for diagnosis of chancroid.

PubMed Central

Chui, L; Albritton, W; Paster, B; Maclean, I; Marusyk, R

1993-01-01

The published nucleotide sequences of the 16S rRNA gene of Haemophilus ducreyi were used to develop primer sets and probes for the diagnosis of chancroid by polymerase chain reaction (PCR) DNA amplification. One set of broad specificity primers yielded a 303-bp PCR product from all bacteria tested. Two 16-base probes internal to this sequence were species specific for H. ducreyi when tested with 12 species of the families Pasteurellaceae and Enterobacteriaceae. The two probes in combination with the broad specificity primers were 100% sensitive with 51 strains of H. ducreyi isolated from six continents over a 15-year period. The direct detection of H. ducreyi from 100 clinical specimens by PCR showed a sensitivity of 83 to 98% and a specificity of 51 to 67%, depending on the number of amplification cycles. Images PMID:8458959

Genetic characterization of L-Zagreb mumps vaccine strain.

PubMed

Ivancic, Jelena; Gulija, Tanja Kosutic; Forcic, Dubravko; Baricevic, Marijana; Jug, Renata; Mesko-Prejac, Majda; Mazuran, Renata

2005-04-01

Eleven mumps vaccine strains, all containing live attenuated virus, have been used throughout the world. Although L-Zagreb mumps vaccine has been licensed since 1972, only its partial nucleotide sequence was previously determined (accession numbers , and ). Therefore, we sequenced the entire genome of L-Zagreb vaccine strain (Institute of Immunology Inc., Zagreb, Croatia). In order to investigate the genetic stability of the vaccine, sequences of both L-Zagreb master seed and currently produced vaccine batch were determined and no difference between them was observed. A phylogenetic analysis based on SH gene sequence has shown that L-Zagreb strain does not belong to any of established mumps genotypes and that it is most similar to old, laboratory preserved European strains (1950s-1970s). L-Zagreb nucleotide and deduced protein sequences were compared with other mumps virus sequences obtained from the GenBank. Emphasis was put on functionally important protein regions and known antigenic epitopes. The extensive comparisons of nucleotide and deduced protein sequences between L-Zagreb vaccine strain and other previously determined mumps virus sequences have shown that while the functional regions of HN, V, and L proteins are well conserved among various mumps strains, there can be a substantial amino acid difference in antigenic epitopes of all proteins and in functional regions of F protein. No molecular pattern was identified that can be used as a distinction marker between virulent and attenuated strains.

Isolation of laccase gene-specific sequences from white rot and brown rot fungi by PCR.

PubMed Central

D'Souza, T M; Boominathan, K; Reddy, C A

1996-01-01

Degenerate primers corresponding to the consensus sequences of the copper-binding regions in the N-terminal domains of known basidiomycete laccases were used to isolate laccase gene-specific sequences from strains representing nine genera of wood rot fungi. All except three gave the expected PCR product of about 200 bp. Computer searches of the databases identified the sequence of each of the PCR products analyzed as a laccase gene sequence, suggesting the specificity of the primers. PCR products of the white rot fungi Ganoderma lucidum, Phlebia brevispora, and Trametes versicolor showed 65 to 74% nucleotide sequence similarity to each other; the similarity in deduced amino acid sequences was 83 to 91%. The PCR products of Lentinula edodes and Lentinus tigrinus, on the other hand, showed relatively low nucleotide and amino acid similarities (58 to 64 and 62 to 81%, respectively); however, these similarities were still much higher than when compared with the corresponding regions in the laccases of the ascomycete fungi Aspergillus nidulans and Neurospora crassa. A few of the white rot fungi, as well as Gloeophyllum trabeum, a brown rot fungus, gave a 144-bp PCR fragment which had a nucleotide sequence similarity of 60 to 71%. Demonstration of laccase activity in G. trabeum and several other brown rot fungi was of particular interest because these organisms were not previously shown to produce laccases. PMID:8837429

Nucleic and Amino Acid Sequences Support Structure-Based Viral Classification.

PubMed

Sinclair, Robert M; Ravantti, Janne J; Bamford, Dennis H

2017-04-15

Viral capsids ensure viral genome integrity by protecting the enclosed nucleic acids. Interactions between the genome and capsid and between individual capsid proteins (i.e., capsid architecture) are intimate and are expected to be characterized by strong evolutionary conservation. For this reason, a capsid structure-based viral classification has been proposed as a way to bring order to the viral universe. The seeming lack of sufficient sequence similarity to reproduce this classification has made it difficult to reject structural convergence as the basis for the classification. We reinvestigate whether the structure-based classification for viral coat proteins making icosahedral virus capsids is in fact supported by previously undetected sequence similarity. Since codon choices can influence nascent protein folding cotranslationally, we searched for both amino acid and nucleotide sequence similarity. To demonstrate the sensitivity of the approach, we identify a candidate gene for the pandoravirus capsid protein. We show that the structure-based classification is strongly supported by amino acid and also nucleotide sequence similarities, suggesting that the similarities are due to common descent. The correspondence between structure-based and sequence-based analyses of the same proteins shown here allow them to be used in future analyses of the relationship between linear sequence information and macromolecular function, as well as between linear sequence and protein folds. IMPORTANCE Viral capsids protect nucleic acid genomes, which in turn encode capsid proteins. This tight coupling of protein shell and nucleic acids, together with strong functional constraints on capsid protein folding and architecture, leads to the hypothesis that capsid protein-coding nucleotide sequences may retain signatures of ancient viral evolution. We have been able to show that this is indeed the case, using the major capsid proteins of viruses forming icosahedral capsids. Importantly, we detected similarity at the nucleotide level between capsid protein-coding regions from viruses infecting cells belonging to all three domains of life, reproducing a previously established structure-based classification of icosahedral viral capsids. Copyright © 2017 Sinclair et al.

Nucleic and Amino Acid Sequences Support Structure-Based Viral Classification

PubMed Central

Sinclair, Robert M.; Ravantti, Janne J.

2017-01-01

ABSTRACT Viral capsids ensure viral genome integrity by protecting the enclosed nucleic acids. Interactions between the genome and capsid and between individual capsid proteins (i.e., capsid architecture) are intimate and are expected to be characterized by strong evolutionary conservation. For this reason, a capsid structure-based viral classification has been proposed as a way to bring order to the viral universe. The seeming lack of sufficient sequence similarity to reproduce this classification has made it difficult to reject structural convergence as the basis for the classification. We reinvestigate whether the structure-based classification for viral coat proteins making icosahedral virus capsids is in fact supported by previously undetected sequence similarity. Since codon choices can influence nascent protein folding cotranslationally, we searched for both amino acid and nucleotide sequence similarity. To demonstrate the sensitivity of the approach, we identify a candidate gene for the pandoravirus capsid protein. We show that the structure-based classification is strongly supported by amino acid and also nucleotide sequence similarities, suggesting that the similarities are due to common descent. The correspondence between structure-based and sequence-based analyses of the same proteins shown here allow them to be used in future analyses of the relationship between linear sequence information and macromolecular function, as well as between linear sequence and protein folds. IMPORTANCE Viral capsids protect nucleic acid genomes, which in turn encode capsid proteins. This tight coupling of protein shell and nucleic acids, together with strong functional constraints on capsid protein folding and architecture, leads to the hypothesis that capsid protein-coding nucleotide sequences may retain signatures of ancient viral evolution. We have been able to show that this is indeed the case, using the major capsid proteins of viruses forming icosahedral capsids. Importantly, we detected similarity at the nucleotide level between capsid protein-coding regions from viruses infecting cells belonging to all three domains of life, reproducing a previously established structure-based classification of icosahedral viral capsids. PMID:28122979

Dynamics of actin evolution in dinoflagellates.

PubMed

Kim, Sunju; Bachvaroff, Tsvetan R; Handy, Sara M; Delwiche, Charles F

2011-04-01

Dinoflagellates have unique nuclei and intriguing genome characteristics with very high DNA content making complete genome sequencing difficult. In dinoflagellates, many genes are found in multicopy gene families, but the processes involved in the establishment and maintenance of these gene families are poorly understood. Understanding the dynamics of gene family evolution in dinoflagellates requires comparisons at different evolutionary scales. Studies of closely related species provide fine-scale information relative to species divergence, whereas comparisons of more distantly related species provides broad context. We selected the actin gene family as a highly expressed conserved gene previously studied in dinoflagellates. Of the 142 sequences determined in this study, 103 were from the two closely related species, Dinophysis acuminata and D. caudata, including full length and partial cDNA sequences as well as partial genomic amplicons. For these two Dinophysis species, at least three types of sequences could be identified. Most copies (79%) were relatively similar and in nucleotide trees, the sequences formed two bushy clades corresponding to the two species. In comparisons within species, only eight to ten nucleotide differences were found between these copies. The two remaining types formed clades containing sequences from both species. One type included the most similar sequences in between-species comparisons with as few as 12 nucleotide differences between species. The second type included the most divergent sequences in comparisons between and within species with up to 93 nucleotide differences between sequences. In all the sequences, most variation occurred in synonymous sites or the 5' UnTranslated Region (UTR), although there was still limited amino acid variation between most sequences. Several potential pseudogenes were found (approximately 10% of all sequences depending on species) with incomplete open reading frames due to frameshifts or early stop codons. Overall, variation in the actin gene family fits best with the "birth and death" model of evolution based on recent duplications, pseudogenes, and incomplete lineage sorting. Divergence between species was similar to variation within species, so that actin may be too conserved to be useful for phylogenetic estimation of closely related species.

High-throughput sequencing of natively paired antibody chains provides evidence for original antigenic sin shaping the antibody response to influenza vaccination.

PubMed

Tan, Yann-Chong; Blum, Lisa K; Kongpachith, Sarah; Ju, Chia-Hsin; Cai, Xiaoyong; Lindstrom, Tamsin M; Sokolove, Jeremy; Robinson, William H

2014-03-01

We developed a DNA barcoding method to enable high-throughput sequencing of the cognate heavy- and light-chain pairs of the antibodies expressed by individual B cells. We used this approach to elucidate the plasmablast antibody response to influenza vaccination. We show that >75% of the rationally selected plasmablast antibodies bind and neutralize influenza, and that antibodies from clonal families, defined by sharing both heavy-chain VJ and light-chain VJ sequence usage, do so most effectively. Vaccine-induced heavy-chain VJ regions contained on average >20 nucleotide mutations as compared to their predicted germline gene sequences, and some vaccine-induced antibodies exhibited higher binding affinities for hemagglutinins derived from prior years' seasonal influenza as compared to their affinities for the immunization strains. Our results show that influenza vaccination induces the recall of memory B cells that express antibodies that previously underwent affinity maturation against prior years' seasonal influenza, suggesting that 'original antigenic sin' shapes the antibody response to influenza vaccination. Published by Elsevier Inc.

Detection with synthetic oligonucleotide probes of nucleotide sequence variations in the genes encoding enterotoxins of Escherichia coli.

PubMed Central

Nishibuchi, M; Murakami, A; Arita, M; Jikuya, H; Takano, J; Honda, T; Miwatani, T

1989-01-01

We examined variations in the genes encoding heat-stable enterotoxin (ST) and heat-labile enterotoxin (LT) in 88 strains of Escherichia coli isolated from individuals with traveler's diarrhea to find suitable sequences for use as oligonucleotide probes. Four oligonucleotide probes of the gene encoding ST of human origin (STIb or STh), one oligonucleotide probe of the gene encoding ST of porcine origin (STIa or STp), and three oligonucleotide probes of the gene encoding LT of human origin (LTIh) were used in DNA colony hybridization tests. In 15 of 22 strains possessing the STh gene and 28 of 42 strains producing LT, the sequences of all regions tested were identical to the published sequences. One region in the STh gene examined with a 18-mer probe was relatively well conserved and was shown to be closely associated with the enterotoxicity of the E. coli strains in suckling mice. This oligonucleotide, however, hybridized with strains of Vibrio cholerae O1, V. parahaemolyticus, and Yersinia enterocolitica that gave negative results in the suckling mouse assay. PMID:2685027

Using high-throughput barcode sequencing to efficiently map connectomes.

PubMed

Peikon, Ian D; Kebschull, Justus M; Vagin, Vasily V; Ravens, Diana I; Sun, Yu-Chi; Brouzes, Eric; Corrêa, Ivan R; Bressan, Dario; Zador, Anthony M

2017-07-07

The function of a neural circuit is determined by the details of its synaptic connections. At present, the only available method for determining a neural wiring diagram with single synapse precision-a 'connectome'-is based on imaging methods that are slow, labor-intensive and expensive. Here, we present SYNseq, a method for converting the connectome into a form that can exploit the speed and low cost of modern high-throughput DNA sequencing. In SYNseq, each neuron is labeled with a unique random nucleotide sequence-an RNA 'barcode'-which is targeted to the synapse using engineered proteins. Barcodes in pre- and postsynaptic neurons are then associated through protein-protein crosslinking across the synapse, extracted from the tissue, and joined into a form suitable for sequencing. Although our failure to develop an efficient barcode joining scheme precludes the widespread application of this approach, we expect that with further development SYNseq will enable tracing of complex circuits at high speed and low cost. © The Author(s) 2017. Published by Oxford University Press on behalf of Nucleic Acids Research.

Real time application of whole genome sequencing for outbreak investigation - What is an achievable turnaround time?

PubMed

McGann, Patrick; Bunin, Jessica L; Snesrud, Erik; Singh, Seema; Maybank, Rosslyn; Ong, Ana C; Kwak, Yoon I; Seronello, Scott; Clifford, Robert J; Hinkle, Mary; Yamada, Stephen; Barnhill, Jason; Lesho, Emil

2016-07-01

Whole genome sequencing (WGS) is increasingly employed in clinical settings, though few assessments of turnaround times (TAT) have been performed in real-time. In this study, WGS was used to investigate an unfolding outbreak of vancomycin resistant Enterococcus faecium (VRE) among 3 patients in the ICU of a tertiary care hospital. Including overnight culturing, a TAT of just 48.5 h for a comprehensive report was achievable using an Illumina Miseq benchtop sequencer. WGS revealed that isolates from patient 2 and 3 differed from that of patient 1 by a single nucleotide polymorphism (SNP), indicating nosocomial transmission. However, the unparalleled resolution provided by WGS suggested that nosocomial transmission involved two separate events from patient 1 to patient 2 and 3, and not a linear transmission suspected by the time line. Rapid TAT's are achievable using WGS in the clinical setting and can provide an unprecedented level of resolution for outbreak investigations. Published by Elsevier Inc.

Haplotype block structure study of the CFTR gene. Most variants are associated with the M470 allele in several European populations.

PubMed

Pompei, Fiorenza; Ciminelli, Bianca Maria; Bombieri, Cristina; Ciccacci, Cinzia; Koudova, Monika; Giorgi, Silvia; Belpinati, Francesca; Begnini, Angela; Cerny, Milos; Des Georges, Marie; Claustres, Mireille; Ferec, Claude; Macek, Milan; Modiano, Guido; Pignatti, Pier Franco

2006-01-01

An average of about 1700 CFTR (cystic fibrosis transmembrane conductance regulator) alleles from normal individuals from different European populations were extensively screened for DNA sequence variation. A total of 80 variants were observed: 61 coding SNSs (results already published), 13 noncoding SNSs, three STRs, two short deletions, and one nucleotide insertion. Eight DNA variants were classified as non-CF causing due to their high frequency of occurrence. Through this survey the CFTR has become the most exhaustively studied gene for its coding sequence variability and, though to a lesser extent, for its noncoding sequence variability as well. Interestingly, most variation was associated with the M470 allele, while the V470 allele showed an 'extended haplotype homozygosity' (EHH). These findings make us suggest a role for selection acting either on the M470V itself or through an hitchhiking mechanism involving a second site. The possible ancient origin of the V allele in an 'out of Africa' time frame is discussed.

Identification of interleukin genes in Pogona vitticeps using a de novo transcriptome assembly from RNA-seq data.

PubMed

Livernois, Alexandra; Hardy, Kristine; Domaschenz, Renae; Papanicolaou, Alexie; Georges, Arthur; Sarre, Stephen D; Rao, Sudha; Ezaz, Tariq; Deakin, Janine E

2016-10-01

Interleukins are a group of cytokines with complex immunomodulatory functions that are important for regulating immunity in vertebrate species. Reptiles and mammals last shared a common ancestor more than 350 million years ago, so it is not surprising that low sequence identity has prevented divergent interleukin genes from being identified in the central bearded dragon lizard, Pogona vitticeps, in its genome assembly. To determine the complete nucleotide sequences of key interleukin genes, we constructed full-length transcripts, using the Trinity platform, from short paired-end read RNA sequences from stimulated spleen cells. De novo transcript reconstruction and analysis allowed us to identify interleukin genes that are missing from the published P. vitticeps assembly. Identification of key cytokines in P. vitticeps will provide insight into the essential molecular mechanisms and evolution of interleukin gene families and allow for characterization of the immune response in a lizard for comparison with mammals.

UCbase 2.0: ultraconserved sequences database (2014 update).

PubMed

Lomonaco, Vincenzo; Martoglia, Riccardo; Mandreoli, Federica; Anderlucci, Laura; Emmett, Warren; Bicciato, Silvio; Taccioli, Cristian

2014-01-01

UCbase 2.0 (http://ucbase.unimore.it) is an update, extension and evolution of UCbase, a Web tool dedicated to the analysis of ultraconserved sequences (UCRs). UCRs are 481 sequences >200 bases sharing 100% identity among human, mouse and rat genomes. They are frequently located in genomic regions known to be involved in cancer or differentially expressed in human leukemias and carcinomas. UCbase 2.0 is a platform-independent Web resource that includes the updated version of the human genome annotation (hg19), information linking disorders to chromosomal coordinates based on the Systematized Nomenclature of Medicine classification, a query tool to search for Single Nucleotide Polymorphisms (SNPs) and a new text box to directly interrogate the database using a MySQL interface. To facilitate the interactive visual interpretation of UCR chromosomal positioning, UCbase 2.0 now includes a graph visualization interface directly linked to UCSC genome browser. Database URL: http://ucbase.unimore.it. © The Author(s) 2014. Published by Oxford University Press.

The complete mitochondrial genome sequence of the western flower thrips Frankliniella occidentalis (Thysanoptera: Thripidae) contains triplicate putative control regions.

PubMed

Yan, Dankan; Tang, Yunxia; Xue, Xiaofeng; Wang, Minghua; Liu, Fengquan; Fan, Jiaqin

2012-09-10

To investigate the features of the control region (CR) and the gene rearrangement in the mitochondrial (mt) genome of Thysanoptera insects, we sequenced the whole mt genome of the western flower thrips Frankliniella occidentalis (Thysanoptera: Thripidae). The mt genome is a circular molecule with 14,889 nucleotides and an A+T content of 76.6%, and it has triplicate putative CRs. We propose that tandem duplication and deletion account for the evolution of the CR and the gene translocations. Intramitochondrial recombination is a plausible model for the gene inversions. We discuss the excessive duplicate CR sequences and the transcription of the rRNA genes, which are distant from one another and from the CR. Finally, we address the significance of the complicated mt genomes in Thysanoptera for the evolution of the CR and the gene arrangement of the mt genome. Crown Copyright © 2012. Published by Elsevier B.V. All rights reserved.

The mitochondrial genome of Pocillopora (Cnidaria: Scleractinia) contains two variable regions: the putative D-loop and a novel ORF of unknown function.

PubMed

Flot, Jean-François; Tillier, Simon

2007-10-15

The complete mitochondrial genomes of two individuals attributed to different morphospecies of the scleractinian coral genus Pocillopora have been sequenced. Both genomes, respectively 17,415 and 17,422 nt long, share the presence of a previously undescribed ORF encoding a putative protein made up of 302 amino acids and of unknown function. Surprisingly, this ORF turns out to be the second most variable region of the mitochondrial genome (1% nucleotide sequence difference between the two individuals) after the putative control region (1.5% sequence difference). Except for the presence of this ORF and for the location of the putative control region, the mitochondrial genome of Pocillopora is organized in a fashion similar to the other scleractinian coral genomes published to date. For the first time in a cnidarian, a putative second origin of replication is described based on its secondary structure similar to the stem-loop structure of O(L), the origin of L-strand replication in vertebrates.

Sequence, Structure, and Context Preferences of Human RNA Binding Proteins.

PubMed

Dominguez, Daniel; Freese, Peter; Alexis, Maria S; Su, Amanda; Hochman, Myles; Palden, Tsultrim; Bazile, Cassandra; Lambert, Nicole J; Van Nostrand, Eric L; Pratt, Gabriel A; Yeo, Gene W; Graveley, Brenton R; Burge, Christopher B

2018-06-07

RNA binding proteins (RBPs) orchestrate the production, processing, and function of mRNAs. Here, we present the affinity landscapes of 78 human RBPs using an unbiased assay that determines the sequence, structure, and context preferences of these proteins in vitro by deep sequencing of bound RNAs. These data enable construction of "RNA maps" of RBP activity without requiring crosslinking-based assays. We found an unexpectedly low diversity of RNA motifs, implying frequent convergence of binding specificity toward a relatively small set of RNA motifs, many with low compositional complexity. Offsetting this trend, however, we observed extensive preferences for contextual features distinct from short linear RNA motifs, including spaced "bipartite" motifs, biased flanking nucleotide composition, and bias away from or toward RNA structure. Our results emphasize the importance of contextual features in RNA recognition, which likely enable targeting of distinct subsets of transcripts by different RBPs that recognize the same linear motif. Copyright © 2018 The Authors. Published by Elsevier Inc. All rights reserved.

Single-Center Experience with a Targeted Next Generation Sequencing Assay for Assessment of Relevant Somatic Alterations in Solid Tumors.

PubMed

Paasinen-Sohns, Aino; Koelzer, Viktor H; Frank, Angela; Schafroth, Julian; Gisler, Aline; Sachs, Melanie; Graber, Anne; Rothschild, Sacha I; Wicki, Andreas; Cathomas, Gieri; Mertz, Kirsten D

2017-03-01

Companion diagnostics rely on genomic testing of molecular alterations to enable effective cancer treatment. Here we report the clinical application and validation of the Oncomine Focus Assay (OFA), an integrated, commercially available next-generation sequencing (NGS) assay for the rapid and simultaneous detection of single nucleotide variants, short insertions and deletions, copy number variations, and gene rearrangements in 52 cancer genes with therapeutic relevance. Two independent patient cohorts were investigated to define the workflow, turnaround times, feasibility, and reliability of OFA targeted sequencing in clinical application and using archival material. Cohort I consisted of 59 diagnostic clinical samples from the daily routine submitted for molecular testing over a 4-month time period. Cohort II consisted of 39 archival melanoma samples that were up to 15years old. Libraries were prepared from isolated nucleic acids and sequenced on the Ion Torrent PGM sequencer. Sequencing datasets were analyzed using the Ion Reporter software. Genomic alterations were identified and validated by orthogonal conventional assays including pyrosequencing and immunohistochemistry. Sequencing results of both cohorts, including archival formalin-fixed, paraffin-embedded material stored up to 15years, were consistent with published variant frequencies. A concordance of 100% between established assays and OFA targeted NGS was observed. The OFA workflow enabled a turnaround of 3½ days. Taken together, OFA was found to be a convenient tool for fast, reliable, broadly applicable and cost-effective targeted NGS of tumor samples in routine diagnostics. Thus, OFA has strong potential to become an important asset for precision oncology. Copyright © 2017 The Authors. Published by Elsevier Inc. All rights reserved.

Constitutional and functional genetics of human alcohol-related hepatocellular carcinoma.

PubMed

Nahon, Pierre; Nault, Jean-Charles

2017-11-01

Exploration of the constitutional genetics of hepatocellular carcinoma (HCC) has identified numerous variants associated with a higher risk of liver cancer in alcoholic cirrhotic patients. Although Genome-Wide Association studies have not been carried out in the field of alcohol-related HCC, common single nucleotide polymorphisms conferring a small increase in the risk of liver cancer risk have been identified and shown to modulate ethanol metabolism, inflammation, oxidative stress, iron or lipid metabolism. Specific patterns of gene mutations including CTNNB1, TERT, ARID1A and SMARCA2 exist in alcohol-related HCC. Moreover, a specific mutational process observed at the nucleotide level by next generation sequencing has revealed cooperation between alcohol and tobacco in the development of HCC. Combining this genetic information with epidemiological and clinical data that might define specific HCC risk classes and refine surveillance strategies needs to be assessed in large prospective cohorts of patients with alcoholic cirrhosis. © 2017 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.

Molecular events during translocation and proofreading extracted from 200 static structures of DNA polymerase.

PubMed

Ren, Zhong

2016-09-06

DNA polymerases in family B are workhorses of DNA replication that carry out the bulk of the job at a high speed with high accuracy. A polymerase in this family relies on a built-in exonuclease for proofreading. It has not been observed at the atomic resolution how the polymerase advances one nucleotide space on the DNA template strand after a correct nucleotide is incorporated, that is, a process known as translocation. It is even more puzzling how translocation is avoided after the primer strand is excised by the exonuclease and returned back to the polymerase active site once an error occurs. The structural events along the bifurcate pathways of translocation and proofreading have been unwittingly captured by hundreds of structures in Protein Data Bank. This study analyzes all available structures of a representative member in family B and reveals the orchestrated event sequence during translocation and proofreading. © The Author(s) 2016. Published by Oxford University Press on behalf of Nucleic Acids Research.

The first mutation in CNGA2 in two brothers with anosmia.

PubMed

Karstensen, H G; Mang, Y; Fark, T; Hummel, T; Tommerup, N

2015-09-01

Isolated congenital anosmia (ICA) is a rare disorder, where otherwise healthy individuals present with an inability to smell since birth. A list of studies have described the genes involved in syndromic anosmia; however, the genetics of ICA is still in its infancy. Studies in mice show that the cyclic nucleotide-gated channel subunit CNGA2, expressed in the olfactory epithelium has a crucial role in olfactory signal transduction. We have identified a novel X-linked stop mutation in CNGA2 (c.634C>T, p.R212*) in two brothers with ICA using exome sequencing. No additional mutations in CNGA2 were identified in a cohort of 31 non-related ICA individuals. Magnetic resonance brain imaging revealed diminished olfactory bulbs and flattened olfactory sulci. This is the first report of a mutation in the cyclic nucleotide-gated gene CNGA2 and supports the critical role of this gene in human olfaction. © 2014 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.

Detection of 549 new HLA alleles in potential stem cell donors from the United States, Poland and Germany.

PubMed

Hernández-Frederick, C J; Cereb, N; Giani, A S; Ruppel, J; Maraszek, A; Pingel, J; Sauter, J; Schmidt, A H; Yang, S Y

2016-01-01

We characterized 549 new human leukocyte antigen (HLA) class I and class II alleles found in newly registered stem cell donors as a result of high-throughput HLA typing. New alleles include 101 HLA-A, 132 HLA-B, 105 HLA-C, 2 HLA-DRB1, 89 HLA-DQB1 and 120 HLA-DPB1 alleles. Mainly, new alleles comprised single nucleotide variations when compared with homologous sequences. We identified nonsynonymous nucleotide mutations in 70.7% of all new alleles, synonymous variations in 26.4% and nonsense substitutions in 2.9% (null alleles). Some new alleles (55, 10.0%) were found multiple times, HLA-DPB1 alleles being the most frequent among these. Furthermore, as several new alleles were identified in individuals from ethnic minority groups, the relevance of recruiting donors belonging to such groups and the importance of ethnicity data collection in donor centers and registries is highlighted. © 2015 The Authors. HLA published by John Wiley & Sons Ltd.

Complete nucleotide sequence of pig (Sus scrofa) mitochondrial genome and dating evolutionary divergence within Artiodactyla.

PubMed

Lin, C S; Sun, Y L; Liu, C Y; Yang, P C; Chang, L C; Cheng, I C; Mao, S J; Huang, M C

1999-08-05

The complete nucleotide sequence of the pig (Sus scrofa) mitochondrial genome, containing 16613bp, is presented in this report. The genome is not a specific length because of the presence of the variable numbers of tandem repeats, 5'-CGTGCGTACA in the displacement loop (D-loop). Genes responsible for 12S and 16S rRNAs, 22 tRNAs, and 13 protein-coding regions are found. The genome carries very few intergenic nucleotides with several instances of overlap between protein-coding or tRNA genes, except in the D-loop region. For evaluating the possible evolutionary relationships between Artiodactyla and Cetacea, the nucleotide substitutions and amino acid sequences of 13 protein-coding genes were aligned by pairwise comparisons of the pig, cow, and fin whale. By comparing these sequences, we suggest that there is a closer relationship between the pig and cow than that between either of these species and fin whale. In addition, the accumulation of transversions and gaps in pig 12S and 16S rRNA genes was compared with that in other eutherian species, including cow, fin whale, human, horse, and harbor seal. The results also reveal a close phylogenetic relationship between pig and cow, as compared to fin whale and others. Thus, according to the sequence differences of mitochondrial rRNA genes in eutherian species, the evolutionary separation of pig and cow occurred about 53-60 million years ago.

Structural analysis of the human U3 ribonucleoprotein particle reveal a conserved sequence available for base pairing with pre-rRNA.

PubMed Central

Parker, K A; Steitz, J A

1987-01-01

The human U3 ribonucleoprotein (RNP) has been analyzed to determine its protein constituents, sites of protein-RNA interaction, and RNA secondary structure. By using anti-U3 RNP antibodies and extracts prepared from HeLa cells labeled in vivo, the RNP was found to contain four nonphosphorylated proteins of 36, 30, 13, and 12.5 kilodaltons and two phosphorylated proteins of 74 and 59 kilodaltons. U3 nucleotides 72-90, 106-121, 154-166, and 190-217 must contain sites that interact with proteins since these regions are immunoprecipitated after treatment of the RNP with RNase A or T1. The secondary structure was probed with specific nucleases and by chemical modification with single-strand-specific reagents that block subsequent reverse transcription. Regions that are single stranded (and therefore potentially able to interact with a substrate RNA) include an evolutionarily conserved sequence at nucleotides 104-112 and nonconserved sequences at nucleotides 65-74, 80-84, and 88-93. Nucleotides 159-168 do not appear to be highly accessible, thus making it unlikely that this U3 sequence base pairs with sequences near the 5.8S rRNA-internal transcribed spacer II junction, as previously proposed. Alternative functions of the U3 RNP are discussed, including the possibility that U3 may participate in a processing event near the 3' end of 28S rRNA. Images PMID:2959855

Characterization of durum wheat high molecular weight glutenin subunits Bx20 and By20 sequences by a molecular and proteomic approach.

PubMed

Santagati, Vito Davide; Sestili, Francesco; Lafiandra, Domenico; D'Ovidio, Renato; Rogniaux, Helene; Masci, Stefania

2016-07-01

Wheat high molecular weight glutenin subunit variation is important because of its great influence on glutenin polymer structure, that is related to dough technological properties. Among the different subunits, the pair Bx20 and By20 is known to have a negative effect on quality, but the reasons are not clear: Bx20 has two cysteines, which theoretically make this subunit a chain extender of the glutenin polymer, just like the other Bx subunits, showing four cysteines, two of which should be involved in intra-molecular disulfide bonds. By20 has never been characterized so far at molecular level. Here we report the nucleotide sequences of Bx20 and By20 genes isolated from the durum wheat cultivar 'Lira 45' and the validation of the corresponding deduced amino acid sequences by using MALDI-TOF and LC-MS/MS. Four nucleotide differences were identified in the Bx20 gene with respect to the deduced sequence present in NCBI, causing two amino acid substitutions. For the By20 subunit, nucleotide and amino acid sequences revealed a great similarity to By15, both at gene and protein levels, showing five nucleotide changes generating two amino acid differences. No evidence of post-translational modifications has been found. Hypotheses are formulated in regard to relationships with technological quality. Copyright © 2016 John Wiley & Sons, Ltd. Copyright © 2016 John Wiley & Sons, Ltd.

Open reading frames in a 4556 nucleotide sequence within MDV-1 BamHI-D DNA fragment: evidence for splicing of mRNA from a new viral glycoprotein gene.

PubMed

Becker, Y; Asher, Y; Tabor, E; Davidson, I; Malkinson, M

1994-01-01

A DNA segment of the MDV-1 BamHI-D fragment was sequenced, and the open reading frames (ORFs) present in the 4556 nucleotide fragment were analyzed by computer programs. Computer analysis identified 19 putative ORFs in the sequence ranging from a coding capacity of 37 amino acids (aa) (ORF-1a) to 684aa (ORF-1). The special properties of four ORFs (1a, 1, 2, and 3) were investigated. Two adjacent ORFs, ORF-1a and ORF-1, were found by computer analysis to have the properties of two introns encoding a glycoprotein: ORF-1a encodes an aa sequence with the properties of a signal peptide, and ORF-1 encodes a polypeptide with a membrane anchor domain and putative N-glycosylation sites in the aa sequence. ORF-1a and ORF-1 were found to be transcribed in MDV-1-infected cells. Two RNA transcripts were detected: a precursor RNA and its spliced form. Both are transcribed from a promoter located 5' to ORF-1a, and splice donor and acceptor sites are used to splice the mRNA after cleavage of a 71-nucleotide sequence. This finding suggest that ORF-1a and ORF-1 are two introns of a new MDV-1 glycoprotein gene. The DNA sequence containing ORF-1 was transiently expressed in COS-1 cells, and the viral protein produced in these cells was found to react with anti-MDV serotype-1 Antigen B-specific monoclonal antibodies. These studies indicate that the protein encoded by ORF-1 has antigenic properties resembling Antigen B of MDV-1. A gene homologous to ORF-1 was detected in the genome of both MDV-2(SB1) and MDV-3(HVT), which serve as commercial vaccine strains. Two additional ORFs were noted in the 4556 nucleotide sequence: ORF-2, which encodes a 333 aa polypeptide initiating in the UL and terminating in the TRL prior to the putative origin of replication, and ORF-3, which encodes a 155 aa polypeptide that is partly homologous to the phosphoprotein pp38 encoded by the BamHI-H sequence. The 65 N-terminal aa of the two gene products are identical, both being derived from the nucleotide sequences in the TRL and IRL, respectively. Additional homologous aa sequences are the hydrophobic aa domain in the middle of both proteins. The functions of ORF-2, ORF-3, and additional ORFs are under study.

Are commercial providers a viable option for clinical bacterial sequencing?

PubMed

Raven, Kathy; Blane, Beth; Churcher, Carol; Parkhill, Julian; Peacock, Sharon J

2018-04-05

Bacterial whole-genome sequencing in the clinical setting has the potential to bring major improvements to infection control and clinical practice. Sequencing instruments are not currently available in the majority of routine microbiology laboratories worldwide, but an alternative is to use external sequencing providers. To foster discussion around this we investigated whether send-out services were a viable option. Four providers offering MiSeq sequencing were selected based on cost and evaluated based on the service provided and sequence data quality. DNA was prepared from five methicillin-resistant Staphylococcus aureus (MRSA) isolates, four of which were investigated during a previously published outbreak in the UK together with a reference MRSA isolate (ST22 HO 5096 0412). Cost of sequencing per isolate ranged from £155 to £342 and turnaround times from DNA postage to arrival of sequence data ranged from 12 to 63 days. Comparison of commercially generated genomes against the original sequence data demonstrated very high concordance, with no more than one single nucleotide polymorphism (SNP) difference on core genome mapping between the original sequences and the new sequence for all four providers. Multilocus sequence type could not be assigned based on assembly for the two cheapest sequence providers due to fragmented assemblies probably caused by a lower output of sequence data per isolate. Our results indicate that external providers returned highly accurate genome data, but that improvements are required in turnaround time to make this a viable option for use in clinical practice.

Diversity of virus-host systems in hypersaline Lake Retba, Senegal.

PubMed

Sime-Ngando, Télesphore; Lucas, Soizick; Robin, Agnès; Tucker, Kimberly Pause; Colombet, Jonathan; Bettarel, Yvan; Desmond, Elie; Gribaldo, Simonetta; Forterre, Patrick; Breitbart, Mya; Prangishvili, David

2011-08-01

Remarkable morphological diversity of virus-like particles was observed by transmission electron microscopy in a hypersaline water sample from Lake Retba, Senegal. The majority of particles morphologically resembled hyperthermophilic archaeal DNA viruses isolated from extreme geothermal environments. Some hypersaline viral morphotypes have not been previously observed in nature, and less than 1% of observed particles had a head-and-tail morphology, which is typical for bacterial DNA viruses. Culture-independent analysis of the microbial diversity in the sample suggested the dominance of extremely halophilic archaea. Few of the 16S sequences corresponded to known archeal genera (Haloquadratum, Halorubrum and Natronomonas), whereas the majority represented novel archaeal clades. Three sequences corresponded to a new basal lineage of the haloarchaea. Bacteria belonged to four major phyla, consistent with the known diversity in saline environments. Metagenomic sequencing of DNA from the purified virus-like particles revealed very few similarities to the NCBI non-redundant database at either the nucleotide or amino acid level. Some of the identifiable virus sequences were most similar to previously described haloarchaeal viruses, but no sequence similarities were found to archaeal viruses from extreme geothermal environments. A large proportion of the sequences had similarity to previously sequenced viral metagenomes from solar salterns. © 2010 Society for Applied Microbiology and Blackwell Publishing Ltd.

Large scale DNA microsequencing device

DOEpatents

Foote, Robert S.

1997-01-01

A microminiature sequencing apparatus and method provide means for simultaneously obtaining sequences of plural polynucleotide strands. The apparatus comprises a microchip into which plural channels have been etched using standard lithographic procedures and chemical wet etching. The channels include a reaction well and a separating section. Enclosing the channels is accomplished by bonding a transparent cover plate over the apparatus. A first oligonucleotide strand is chemically affixed to the apparatus through an alkyl chain. Subsequent nucleotides are selected by complementary base pair bonding. A target nucleotide strand is used to produce a family of labelled sequencing strands in each channel which are separated in the separating section. During or following separation the sequences are determined using appropriate detection means.

Large scale DNA microsequencing device

DOEpatents

Foote, Robert S.

1999-01-01

A microminiature sequencing apparatus and method provide means for simultaneously obtaining sequences of plural polynucleotide strands. The apparatus comprises a microchip into which plural channels have been etched using standard lithographic procedures and chemical wet etching. The channels include a reaction well and a separating section. Enclosing the channels is accomplished by bonding a transparent cover plate over the apparatus. A first oligonucleotide strand is chemically affixed to the apparatus through an alkyl chain. Subsequent nucleotides are selected by complementary base pair bonding. A target nucleotide strand is used to produce a family of labelled sequencing strands in each channel which are separated in the separating section. During or following separation the sequences are determined using appropriate detection means.

Complete sequence analysis reveals two distinct poleroviruses infecting cucurbits in China.

PubMed

Xiang, Hai-ying; Shang, Qiao-xia; Han, Cheng-gui; Li, Da-wei; Yu, Jia-lin

2008-01-01

The complete RNA genomes of a Chinese isolate of cucurbit aphid-borne yellows virus (CABYV-CHN) and a new polerovirus tentatively referred to as melon aphid-borne yellows virus (MABYV) were determined. The entire genome of CABYV-CHN shared 89.0% nucleotide sequence identity with the French CABYV isolate. In contrast, nucleotide sequence identities between MABYV and CABYV and other poleroviruses were in the range of 50.7-74.2%, with amino acid sequence identities ranging from 24.8 to 82.9% for individual gene products. We propose that CABYV-CHN is a strain of CABYV and that MABYV is a member of a tentative distinct species within the genus Polerovirus.

The complete genomic sequence of a tentative new polerovirus identified in barley in South Korea.

PubMed

Zhao, Fumei; Lim, Seungmo; Yoo, Ran Hee; Igori, Davaajargal; Kim, Sang-Min; Kwak, Do Yeon; Kim, Sun Lim; Lee, Bong Choon; Moon, Jae Sun

2016-07-01

The complete nucleotide sequence of a new barley polerovirus, tentatively named barley virus G (BVG), which was isolated in Gimje, South Korea, has been determined using an RNA sequencing technique combined with polymerase chain reaction methods. The viral genomic RNA of BVG is 5,620 nucleotides long and contains six typical open reading frames commonly observed in other poleroviruses. Sequence comparisons revealed that BVG is most closely related to maize yellow dwarf virus-RMV, with the highest amino acid identities being less than 90 % for all of the corresponding proteins. These results suggested that BVG is a member of a new species in the genus Polerovirus.

Complete nucleotide sequence of spring beauty latent virus, a bromovirus infectious to Arabidopsis thaliana.

PubMed

Fujisaki, K; Hagihara, F; Kaido, M; Mise, K; Okuno, T

2003-01-01

Spring beauty latent virus (SBLV), a bromovirus, systemically and efficiently infected Arabidopsis thaliana, whereas the well-studied bromoviruses brome mosaic virus (BMV) and cowpea chlorotic mottle virus (CCMV) did not infect and poorly infected A. thaliana, respectively. We constructed biologically active cDNA clones of SBLV genomic RNAs and determined their complete nucleotide sequences. Interestingly, SBLV RNA3 contains both the box B motif in the intercistronic region, as does BMV, and the subgenomic promoter-like sequence in the 5' noncoding region, as does CCMV. Sequence comparisons of SBLV, BMV, CCMV, and broad bean mottle virus demonstrated that SBLV is closely related to BMV and CCMV.

Large scale DNA microsequencing device

DOEpatents

Foote, R.S.

1999-08-31

A microminiature sequencing apparatus and method provide means for simultaneously obtaining sequences of plural polynucleotide strands. The apparatus comprises a microchip into which plural channels have been etched using standard lithographic procedures and chemical wet etching. The channels include a reaction well and a separating section. Enclosing the channels is accomplished by bonding a transparent cover plate over the apparatus. A first oligonucleotide strand is chemically affixed to the apparatus through an alkyl chain. Subsequent nucleotides are selected by complementary base pair bonding. A target nucleotide strand is used to produce a family of labelled sequencing strands in each channel which are separated in the separating section. During or following separation the sequences are determined using appropriate detection means. 11 figs.

Nucleotide sequence of a cluster of early and late genes in a conserved segment of the vaccinia virus genome.

PubMed Central

Plucienniczak, A; Schroeder, E; Zettlmeissl, G; Streeck, R E

1985-01-01

The nucleotide sequence of a 7.6 kb vaccinia DNA segment from a genomic region conserved among different orthopox virus has been determined. This segment contains a tight cluster of 12 partly overlapping open reading frames most of which can be correlated with previously identified early and late proteins and mRNAs. Regulatory signals used by vaccinia virus have been studied. Presumptive promoter regions are rich in A, T and carry the consensus sequences TATA and AATAA spaced at 20-24 base pairs. Tandem repeats of a CTATTC consensus sequence are proposed to be involved in the termination of early transcription. PMID:2987815

A three-nucleotide helix I is sufficient for full activity of a hammerhead ribozyme: advantages of an asymmetric design.

PubMed Central

Tabler, M; Homann, M; Tzortzakaki, S; Sczakiel, G

1994-01-01

Trans-cleaving hammerhead ribozymes with long target-specific antisense sequences flanking the catalytic domain share some features with conventional antisense RNA and are therefore termed 'catalytic antisense RNAs'. Sequences 5' to the catalytic domain form helix I and sequences 3' to it form helix III when complexed with the target RNA. A catalytic antisense RNA of more than 400 nucleotides, and specific for the human immunodeficiency virus type 1 (HIV-1), was systematically truncated within the arm that constituted originally a helix I of 128 base pairs. The resulting ribozymes formed helices I of 13, 8, 5, 3, 2, 1 and 0 nucleotides, respectively, and a helix III of about 280 nucleotides. When their in vitro cleavage activity was compared with the original catalytic antisense RNA, it was found that a helix I of as little as three nucleotides was sufficient for full endonucleolytic activity. The catalytically active constructs inhibited HIV-1 replication about four-fold more effectively than the inactive ones when tested in human cells. A conventional hammerhead ribozyme having helices of just 8 nucleotides on either side failed to cleave the target RNA in vitro when tested under the conditions for catalytic antisense RNA. Cleavage activity could only be detected after heat-treatment of the ribozyme substrate mixture which indicates that hammerhead ribozymes with short arms do not associate as efficiently to the target RNA as catalytic antisense RNA. The requirement of just a three-nucleotide helix I allows simple PCR-based generation strategies for asymmetric hammerhead ribozymes. Advantages of an asymmetric design will be discussed. Images PMID:7937118

The Coding of Biological Information: From Nucleotide Sequence to Protein Recognition

NASA Astrophysics Data System (ADS)

Štambuk, Nikola

The paper reviews the classic results of Swanson, Dayhoff, Grantham, Blalock and Root-Bernstein, which link genetic code nucleotide patterns to the protein structure, evolution and molecular recognition. Symbolic representation of the binary addresses defining particular nucleotide and amino acid properties is discussed, with consideration of: structure and metric of the code, direct correspondence between amino acid and nucleotide information, and molecular recognition of the interacting protein motifs coded by the complementary DNA and RNA strands.

Long-term excretion of vaccine-derived poliovirus by a healthy child.

PubMed

Martín, Javier; Odoom, Kofi; Tuite, Gráinne; Dunn, Glynis; Hopewell, Nicola; Cooper, Gill; Fitzharris, Catherine; Butler, Karina; Hall, William W; Minor, Philip D

2004-12-01

A child was found to be excreting type 1 vaccine-derived poliovirus (VDPV) with a 1.1% sequence drift from Sabin type 1 vaccine strain in the VP1 coding region 6 months after he was immunized with oral live polio vaccine. Seventeen type 1 poliovirus isolates were recovered from stools taken from this child during the following 4 months. Contrary to expectation, the child was not deficient in humoral immunity and showed high levels of serum neutralization against poliovirus. Selected virus isolates were characterized in terms of their antigenic properties, virulence in transgenic mice, sensitivity for growth at high temperatures, and differences in nucleotide sequence from the Sabin type 1 strain. The VDPV isolates showed mutations at key nucleotide positions that correlated with the observed reversion to biological properties typical of wild polioviruses. A number of capsid mutations mapped at known antigenic sites leading to changes in the viral antigenic structure. Estimates of sequence evolution based on the accumulation of nucleotide changes in the VP1 coding region detected a "defective" molecular clock running at an apparent faster speed of 2.05% nucleotide changes per year versus 1% shown in previous studies. Remarkably, when compared to several type 1 VDPV strains of different origins, isolates from this child showed a much higher proportion of nonsynonymous versus synonymous nucleotide changes in the capsid coding region. This anomaly could explain the high VP1 sequence drift found and the ability of these virus strains to replicate in the gut for a longer period than expected.

The emergence and evolution of life in a "fatty acid world" based on quantum mechanics.

PubMed

Tamulis, Arvydas; Grigalavicius, Mantas

2011-02-01

Quantum mechanical based electron correlation interactions among molecules are the source of the weak hydrogen and Van der Waals bonds that are critical to the self-assembly of artificial fatty acid micelles. Life on Earth or elsewhere could have emerged in the form of self-reproducing photoactive fatty acid micelles, which gradually evolved into nucleotide-containing micelles due to the enhanced ability of nucleotide-coupled sensitizer molecules to absorb visible light. Comparison of the calculated absorption spectra of micelles with and without nucleotides confirmed this idea and supports the idea of the emergence and evolution of nucleotides in minimal cells of a so-called Fatty Acid World. Furthermore, the nucleotide-caused wavelength shift and broadening of the absorption pattern potentially gives these molecules an additional valuable role, other than a purely genetic one in the early stages of the development of life. From the information theory point of view, the nucleotide sequences in such micelles carry positional information providing better electron transport along the nucleotide-sensitizer chain and, in addition, providing complimentary copies of that information for the next generation. Nucleotide sequences, which in the first period of evolution of fatty acid molecules were useful just for better absorbance of the light in the longer wavelength region, later in the PNA or RNA World, took on the role of genetic information storage.

Isolation of a full-length CC-NBS-LRR resistance gene analog candidate from sugar pine showing low nucleotide diversity.

Treesearch

K.D. Jermstad; L.A. Sheppard; B.B. Kinloch; A. Delfino-Mix; E.S. Ersoz; K.V. Krutovsky; D.B Neale

2006-01-01

The nucleotide-binding-site and leucine-rich-repeat (NBS–LRR) class of R proteins is abundant and widely distributed in plants. By using degenerate primers designed on the NBS domain in lettuce, we amplified sequences in sugar pine that shared sequence identity with many of the NBS–LRR class resistance genes catalogued in GenBank. The polymerase chain reaction products...

Identification of largemouth bass virus in the introduced Northern Snakehead inhabiting the Chesapeake Bay watershed.

PubMed

Iwanowicz, L; Densmore, C; Hahn, C; McAllister, P; Odenkirk, J

2013-09-01

The Northern Snakehead Channa argus is an introduced species that now inhabits the Chesapeake Bay. During a preliminary survey for introduced pathogens possibly harbored by these fish in Virginia waters, a filterable agent was isolated from five specimens that produced cytopathic effects in BF-2 cells. Based on PCR amplification and partial sequencing of the major capsid protein (MCP), DNA polymerase (DNApol), and DNA methyltransferase (Mtase) genes, the isolates were identified as Largemouth Bass virus (LMBV). Nucleotide sequences of the MCP (492 bp) and DNApol (419 pb) genes were 100% identical to those of LMBV. The nucleotide sequence of the Mtase (206 bp) gene was 99.5% identical to that of LMBV, and the single nucleotide substitution did not lead to a predicted amino acid coding change. This is the first report of LMBV from the Northern Snakehead, and provides evidence that noncentrarchid fishes may be susceptible to this virus.

Modular and configurable optimal sequence alignment software: Cola.

PubMed

Zamani, Neda; Sundström, Görel; Höppner, Marc P; Grabherr, Manfred G

2014-01-01

The fundamental challenge in optimally aligning homologous sequences is to define a scoring scheme that best reflects the underlying biological processes. Maximising the overall number of matches in the alignment does not always reflect the patterns by which nucleotides mutate. Efficiently implemented algorithms that can be parameterised to accommodate more complex non-linear scoring schemes are thus desirable. We present Cola, alignment software that implements different optimal alignment algorithms, also allowing for scoring contiguous matches of nucleotides in a nonlinear manner. The latter places more emphasis on short, highly conserved motifs, and less on the surrounding nucleotides, which can be more diverged. To illustrate the differences, we report results from aligning 14,100 sequences from 3' untranslated regions of human genes to 25 of their mammalian counterparts, where we found that a nonlinear scoring scheme is more consistent than a linear scheme in detecting short, conserved motifs. Cola is freely available under LPGL from https://github.com/nedaz/cola.

Nucleotide-Specific Contrast for DNA Sequencing by Electron Spectroscopy.

PubMed

Mankos, Marian; Persson, Henrik H J; N'Diaye, Alpha T; Shadman, Khashayar; Schmid, Andreas K; Davis, Ronald W

2016-01-01

DNA sequencing by imaging in an electron microscope is an approach that holds promise to deliver long reads with low error rates and without the need for amplification. Earlier work using transmission electron microscopes, which use high electron energies on the order of 100 keV, has shown that low contrast and radiation damage necessitates the use of heavy atom labeling of individual nucleotides, which increases the read error rates. Other prior work using scattering electrons with much lower energy has shown to suppress beam damage on DNA. Here we explore possibilities to increase contrast by employing two methods, X-ray photoelectron and Auger electron spectroscopy. Using bulk DNA samples with monomers of each base, both methods are shown to provide contrast mechanisms that can distinguish individual nucleotides without labels. Both spectroscopic techniques can be readily implemented in a low energy electron microscope, which may enable label-free DNA sequencing by direct imaging.

Identification of largemouth bass virus in the introduced Northern snakehead inhabiting the Cheasapeake Bay watershed

USGS Publications Warehouse

Iwanowicz, Luke R.; Densmore, Christine L.; Hahn, Cassidy M.; McAllister, Phillip; Odenkirk, John

2013-01-01

The Northern Snakehead Channa argus is an introduced species that now inhabits the Chesapeake Bay. During a preliminary survey for introduced pathogens possibly harbored by these fish in Virginia waters, a filterable agent was isolated from five specimens that produced cytopathic effects in BF-2 cells. Based on PCR amplification and partial sequencing of the major capsid protein (MCP), DNA polymerase (DNApol), and DNA methyltransferase (Mtase) genes, the isolates were identified as Largemouth Bass virus (LMBV). Nucleotide sequences of the MCP (492 bp) and DNApol (419 pb) genes were 100% identical to those of LMBV. The nucleotide sequence of the Mtase (206 bp) gene was 99.5% identical to that of LMBV, and the single nucleotide substitution did not lead to a predicted amino acid coding change. This is the first report of LMBV from the Northern Snakehead, and provides evidence that noncentrarchid fishes may be susceptible to this virus.

Systematically frameshifting by deletion of every 4th or 4th and 5th nucleotides during mitochondrial transcription: RNA self-hybridization regulates delRNA expression.

PubMed

Seligmann, Hervé

2016-01-01

In mitochondria, secondary structures punctuate post-transcriptional RNA processing. Recently described transcripts match the human mitogenome after systematic deletions of every 4th, respectively every 4th and 5th nucleotides, called delRNAs. Here I explore predicted stem-loop hairpin formation by delRNAs, and their associations with delRNA transcription and detected peptides matching their translation. Despite missing 25, respectively 40% of the nucleotides in the original sequence, del-transformed sequences form significantly more secondary structures than corresponding randomly shuffled sequences, indicating biological function, independently of, and in combination with, previously detected delRNA and thereof translated peptides. Self-hybridization decreases delRNA abundances, indicating downregulation. Systematic deletions of the human mitogenome reveal new, unsuspected coding and structural informations. Copyright © 2016 Elsevier Ireland Ltd. All rights reserved.

MSuPDA: A memory efficient algorithm for sequence alignment.

PubMed

Khan, Mohammad Ibrahim; Kamal, Md Sarwar; Chowdhury, Linkon

2015-01-16

Space complexity is a million dollar question in DNA sequence alignments. In this regards, MSuPDA (Memory Saving under Pushdown Automata) can help to reduce the occupied spaces in computer memory. Our proposed process is that Anchor Seed (AS) will be selected from given data set of Nucleotides base pairs for local sequence alignment. Quick Splitting (QS) techniques will separate the Anchor Seed from all the DNA genome segments. Selected Anchor Seed will be placed to pushdown Automata's (PDA) input unit. Whole DNA genome segments will be placed into PDA's stack. Anchor Seed from input unit will be matched with the DNA genome segments from stack of PDA. Whatever matches, mismatches or Indel, of Nucleotides will be POP from the stack under the control of control unit of Pushdown Automata. During the POP operation on stack it will free the memory cell occupied by the Nucleotide base pair.

Nucleotide sequence of the ribosomal RNA gene of Physarum polycephalum: intron 2 and its flanking regions of the 26S rRNA gene.

PubMed Central

Nomiyama, H; Kuhara, S; Kukita, T; Otsuka, T; Sakaki, Y

1981-01-01

The 26S ribosomal RNA gene of Physarum polycephalum is interrupted by two introns, and we have previously determined the sequence of one of them (intron 1) (Nomiyama et al. Proc.Natl.Acad.Sci.USA 78, 1376-1380, 1981). In this study we sequenced the second intron (intron 2) of about 0.5 kb length and its flanking regions, and found that one nucleotide at each junction is identical in intron 1 and intron 2, though the junction regions share no other sequence homology. Comparison of the flanking exon sequences to E. coli 23S rRNA sequences shows that conserved sequences are interspersed with tracts having little homology. In particular, the region encompassing the intron 2 interruption site is highly conserved. The E. coli ribosomal protein L1 binding region is also conserved. Images PMID:6171776

Nucleotide sequence of a complementary DNA encoding pea cytosolic copper/zinc superoxide dismutase. [Pisum sativum L

DOE Office of Scientific and Technical Information (OSTI.GOV)

White, D.A.; Zilinskas, B.A.

1991-08-01

The authors now report the nucleotide sequence of the cytosolic Cu/Zn SOD cloned from a {lambda}gt11 cDNA library constructed from mRNA extracted from leaves of 7- to 10-d pea seedlings (Pisum sativum L.). The clone was isolated using a 22-base synthetic oligonucleotide complementary to the amino acid sequence CGIIGLQG. This sequence, found at the protein's carboxy terminus, is highly conserved among plant cytosolic Cu/Zn SODs but not chloroplastic Cu/Zn SODs. The 738-base pair sequence contains an open reading frame specifying 152 codons and a predicted M{sub r} of 18,024 D. The deduced amino acid sequence is highly homologous (79-82% identity)more » with the sequences of other known plant cytosolic Cu/Zn SODs but less highly conserved (63-65%) when compared with several chloroplastic Cu/Zn SODs including pea (10).« less

A novel HLA-B allele, B*5214, detected in a Taiwanese volunteer bone marrow donor using a sequence-based typing method.

PubMed

Chen, M J; Chu, C C; Shyr, M H; Lin, C L; Lin, P Y; Yang, K L

2010-02-01

HLA-B*5214, a novel rare allele of HLA-B*52 variant, was found in a Taiwanese volunteer bone marrow donor by sequence-based typing method. The sequence of B*5214 is identical to that of B*520101 in exon 2 but differs from B*520101 in exon 3 at nucleotide positions 419 A-->T and 435 A-->G. Alteration of these two nucleotides resulted an amino acid substitution at amino acid residue 116 Y-->F ( TAC-->TTC) and a silent exchange at residue 121 K-->K (AAA-->AAG).

Nucleotide sequencing and characterization of the genes encoding benzene oxidation enzymes of Pseudomonas putida.

PubMed Central

Irie, S; Doi, S; Yorifuji, T; Takagi, M; Yano, K

1987-01-01

The nucleotide sequence of the genes from Pseudomonas putida encoding oxidation of benzene to catechol was determined. Five open reading frames were found in the sequence. Four corresponding protein molecules were detected by a DNA-directed in vitro translation system. Escherichia coli cells containing the fragment with the four open reading frames transformed benzene to cis-benzene glycol, which is an intermediate of the oxidation of benzene to catechol. The relation between the product of each cistron and the components of the benzene oxidation enzyme system is discussed. Images PMID:3667527

Nucleotide sequence of the gene determining plasmid-mediated citrate utilization.

PubMed Central

Ishiguro, N; Sato, G

1985-01-01

The citrate utilization determinant from transposon Tn3411 has been cloned and sequenced, and its polypeptide products have been characterized in minicell experiments. The nucleotide sequence was determined for a 2,047-base-pair BglII restriction endonuclease fragment that includes the citrate determinant. This region contains an open reading frame that would encode a 431-amino-acid very hydrophobic polypeptide and which is preceded by a reasonable ribosomal binding site. However, the single polypeptide found in minicell experiments had an apparent molecular weight of 35,000 on sodium dodecyl sulfate-polyacrylamide gel electrophoresis. Images PMID:2999087

Trigger loop dynamics can explain stimulation of intrinsic termination by bacterial RNA polymerase without terminator hairpin contact.

PubMed

Ray-Soni, Ananya; Mooney, Rachel A; Landick, Robert

2017-10-31

In bacteria, intrinsic termination signals cause disassembly of the highly stable elongating transcription complex (EC) over windows of two to three nucleotides after kilobases of RNA synthesis. Intrinsic termination is caused by the formation of a nascent RNA hairpin adjacent to a weak RNA-DNA hybrid within RNA polymerase (RNAP). Although the contributions of RNA and DNA sequences to termination are largely understood, the roles of conformational changes in RNAP are less well described. The polymorphous trigger loop (TL), which folds into the trigger helices to promote nucleotide addition, also is proposed to drive termination by folding into the trigger helices and contacting the terminator hairpin after invasion of the hairpin in the RNAP main cleft [Epshtein V, Cardinale CJ, Ruckenstein AE, Borukhov S, Nudler E (2007) Mol Cell 28:991-1001]. To investigate the contribution of the TL to intrinsic termination, we developed a kinetic assay that distinguishes effects of TL alterations on the rate at which ECs terminate from effects of the TL on the nucleotide addition rate that indirectly affect termination efficiency by altering the time window in which termination can occur. We confirmed that the TL stimulates termination rate, but found that stabilizing either the folded or unfolded TL conformation decreased termination rate. We propose that conformational fluctuations of the TL (TL dynamics), not TL-hairpin contact, aid termination by increasing EC conformational diversity and thus access to favorable termination pathways. We also report that the TL and the TL sequence insertion (SI3) increase overall termination efficiency by stimulating pausing, which increases the flux of ECs into the termination pathway. Published under the PNAS license.

Genomic distribution and estimation of nucleotide diversity in natural populations: perspectives from the collared flycatcher (Ficedula albicollis) genome.

PubMed

Dutoit, Ludovic; Burri, Reto; Nater, Alexander; Mugal, Carina F; Ellegren, Hans

2017-07-01

Properly estimating genetic diversity in populations of nonmodel species requires a basic understanding of how diversity is distributed across the genome and among individuals. To this end, we analysed whole-genome resequencing data from 20 collared flycatchers (genome size ≈1.1 Gb; 10.13 million single nucleotide polymorphisms detected). Genomewide nucleotide diversity was almost identical among individuals (mean = 0.00394, range = 0.00384-0.00401), but diversity levels varied extensively across the genome (95% confidence interval for 200-kb windows = 0.0013-0.0053). Diversity was related to selective constraint such that in comparison with intergenic DNA, diversity at fourfold degenerate sites was reduced to 85%, 3' UTRs to 82%, 5' UTRs to 70% and nondegenerate sites to 12%. There was a strong positive correlation between diversity and chromosome size, probably driven by a higher density of targets for selection on smaller chromosomes increasing the diversity-reducing effect of linked selection. Simulations exploring the ability of sequence data from a small number of genetic markers to capture the observed diversity clearly demonstrated that diversity estimation from finite sampling of such data is bound to be associated with large confidence intervals. Nevertheless, we show that precision in diversity estimation in large outbred population benefits from increasing the number of loci rather than the number of individuals. Simulations mimicking RAD sequencing showed that this approach gives accurate estimates of genomewide diversity. Based on the patterns of observed diversity and the performed simulations, we provide broad recommendations for how genetic diversity should be estimated in natural populations. © 2016 The Authors. Molecular Ecology Resources Published by John Wiley & Sons Ltd.

Chromosome specific repetitive DNA sequences

DOEpatents

Moyzis, Robert K.; Meyne, Julianne

1991-01-01

A method is provided for determining specific nucleotide sequences useful in forming a probe which can identify specific chromosomes, preferably through in situ hybridization within the cell itself. In one embodiment, chromosome preferential nucleotide sequences are first determined from a library of recombinant DNA clones having families of repetitive sequences. Library clones are identified with a low homology with a sequence of repetitive DNA families to which the first clones respectively belong and variant sequences are then identified by selecting clones having a pattern of hybridization with genomic DNA dissimilar to the hybridization pattern shown by the respective families. In another embodiment, variant sequences are selected from a sequence of a known repetitive DNA family. The selected variant sequence is classified as chromosome specific, chromosome preferential, or chromosome nonspecific. Sequences which are classified as chromosome preferential are further sequenced and regions are identified having a low homology with other regions of the chromosome preferential sequence or with known sequences of other family me This invention is the result of a contract with the Department of Energy (Contract No. W-7405-ENG-36).

Sequence and pattern of expression of a bovine homologue of a human mitochondrial transport protein associated with Grave's disease.

PubMed

Fiermonte, G; Runswick, M J; Walker, J E; Palmieri, F

1992-01-01

A human cDNA has been isolated previously from a thyroid library with the aid of serum from a patient with Grave's disease. It encodes a protein belonging to the mitochondrial metabolite carrier family, referred to as the Grave's disease carrier protein (GDC). Using primers based on this sequence, overlapping cDNAs encoding the bovine homologue of the GDC have been isolated from total bovine heart poly(A)+ cDNA. The bovine protein is 18 amino acids shorter than the published human sequence, but if a frame shift requiring the removal of one nucleotide is introduced into the human cDNA sequence, the human and bovine proteins become identical in their C-terminal regions, and 308 out of 330 amino acids are conserved over their entire sequences. The bovine cDNA has been used to investigate the expression of the GDC in various bovine tissues. In the tissues that were examined, the GDC is most strongly expressed in the thyroid, but substantial amounts of its mRNA were also detected in liver, lung and kidney, and lesser amounts in heart and skeletal muscle.

Identification of two allelic IgG1 C(H) coding regions (Cgamma1) of cat.

PubMed

Kanai, T H; Ueda, S; Nakamura, T

2000-01-31

Two types of cDNA encoding IgG1 heavy chain (gamma1) were isolated from a single domestic short-hair cat. Sequence analysis indicated a higher level of similarity of these Cgamma1 sequences to human Cgamma1 sequence (76.9 and 77.0%) than to mouse sequence (70.0 and 69.7%) at the nucleotide level. Predicted primary structures of both the feline Cgamma1 genes, designated as Cgamma1a and Cgamma1b, were similar to that of human Cgamma1 gene, for instance, as to the size of constant domains, the presence of six conserved cysteine residues involved in formation of the domain structure, and the location of a conserved N-linked glycosylation site. Sequence comparison between the two alleles showed that 7 out of 10 nucleotide differences were within the C(H)3 domain coding region, all leading to nonsynonymous changes in amino acid residues. Partial sequence analysis of genomic clones showed three nucleotide substitutions between the two Cgamma1 alleles in the intron between the CH2 and C(H)3 domain coding regions. In 12 domestic short-hair cats used in this study, the frequency of Cgamma1a allele (62.5%) was higher than that of the Cgamma1b allele (37.5%).

Human somatostatin I: sequence of the cDNA.

PubMed Central

Shen, L P; Pictet, R L; Rutter, W J

1982-01-01

RNA has been isolated from a human pancreatic somatostatinoma and used to prepare a cDNA library. After prescreening, clones containing somatostatin I sequences were identified by hybridization with an anglerfish somatostatin I-cloned cDNA probe. From the nucleotide sequence of two of these clones, we have deduced an essentially full-length mRNA sequence, including the preprosomatostatin coding region, 105 nucleotides from the 5' untranslated region and the complete 150-nucleotide 3' untranslated region. The coding region predicts a 116-amino acid precursor protein (Mr, 12.727) that contains somatostatin-14 and -28 at its COOH terminus. The predicted amino acid sequence of human somatostatin-28 is identical to that of somatostatin-28 isolated from the porcine and ovine species. A comparison of the amino acid sequences of human and anglerfish preprosomatostatin I indicated that the COOH-terminal region encoding somatostatin-14 and the adjacent 6 amino acids are highly conserved, whereas the remainder of the molecule, including the signal peptide region, is more divergent. However, many of the amino acid differences found in the pro region of the human and anglerfish proteins are conservative changes. This suggests that the propeptides have a similar secondary structure, which in turn may imply a biological function for this region of the molecule. Images PMID:6126875

Scanning the Effects of Ethyl Methanesulfonate on the Whole Genome of Lotus japonicus Using Second-Generation Sequencing Analysis

PubMed Central

Mohd-Yusoff, Nur Fatihah; Ruperao, Pradeep; Tomoyoshi, Nurain Emylia; Edwards, David; Gresshoff, Peter M.; Biswas, Bandana; Batley, Jacqueline

2015-01-01

Genetic structure can be altered by chemical mutagenesis, which is a common method applied in molecular biology and genetics. Second-generation sequencing provides a platform to reveal base alterations occurring in the whole genome due to mutagenesis. A model legume, Lotus japonicus ecotype Miyakojima, was chemically mutated with alkylating ethyl methanesulfonate (EMS) for the scanning of DNA lesions throughout the genome. Using second-generation sequencing, two individually mutated third-generation progeny (M3, named AM and AS) were sequenced and analyzed to identify single nucleotide polymorphisms and reveal the effects of EMS on nucleotide sequences in these mutant genomes. Single-nucleotide polymorphisms were found in every 208 kb (AS) and 202 kb (AM) with a bias mutation of G/C-to-A/T changes at low percentage. Most mutations were intergenic. The mutation spectrum of the genomes was comparable in their individual chromosomes; however, each mutated genome has unique alterations, which are useful to identify causal mutations for their phenotypic changes. The data obtained demonstrate that whole genomic sequencing is applicable as a high-throughput tool to investigate genomic changes due to mutagenesis. The identification of these single-point mutations will facilitate the identification of phenotypically causative mutations in EMS-mutated germplasm. PMID:25660167

SENCA: A Multilayered Codon Model to Study the Origins and Dynamics of Codon Usage

PubMed Central

Pouyet, Fanny; Bailly-Bechet, Marc; Mouchiroud, Dominique; Guéguen, Laurent

2016-01-01

Gene sequences are the target of evolution operating at different levels, including the nucleotide, codon, and amino acid levels. Disentangling the impact of those different levels on gene sequences requires developing a probabilistic model with three layers. Here we present SENCA (site evolution of nucleotides, codons, and amino acids), a codon substitution model that separately describes 1) nucleotide processes which apply on all sites of a sequence such as the mutational bias, 2) preferences between synonymous codons, and 3) preferences among amino acids. We argue that most synonymous substitutions are not neutral and that SENCA provides more accurate estimates of selection compared with more classical codon sequence models. We study the forces that drive the genomic content evolution, intraspecifically in the core genome of 21 prokaryotes and interspecifically for five Enterobacteria. We retrieve the existence of a universal mutational bias toward AT, and that taking into account selection on synonymous codon usage has consequences on the measurement of selection on nonsynonymous substitutions. We also confirm that codon usage bias is mostly driven by selection on preferred codons. We propose new summary statistics to measure the relative importance of the different evolutionary processes acting on sequences. PMID:27401173

Complete genome sequence of a new begomovirus associated with yellow mosaic disease of Hemidesmus indicus in India.

PubMed

Reddy, M Sreekanth; Kanakala, S; Srinivas, K P; Hema, M; Malathi, V G; Sreenivasulu, P

2014-05-01

The complete DNA A genome of a virus isolate associated with yellow mosaic disease of a medicinal plant, Hemidesmus indicus, from India was cloned and sequenced. The length of DNA A was 2825 nucleotides, 35 nucleotides longer than the unit genome of monopartite begomoviruses. Comparison of the nucleotide sequence of DNA A of the virus isolate with those of other begomoviruses showed maximum sequence identity of 69 % to DNA A of ageratum yellow vein China virus (AYVCNV; AJ558120) and 68 % with tomato yellow leaf curl virus- LBa4 (TYLCV; EF185318), and it formed a distinct clade in phylogenetic analysis. The genome organization of the present virus isolate was found to be similar to that of Old World monopartite begomoviruses. The genome was considered to be monopartite, because association of DNA B and β satellite DNA components was not detected. Based on its sequence identity (<70 %) to all other begomoviruses known to date and ICTV (International Committee on Taxonomy of Viruses) species demarcating criteria (<89 % identity), it is considered a member of a novel begomovirus species, and the tentative name "Hemidesmus yellow mosaic virus" (HeYMV) is proposed.

INFO-RNA--a server for fast inverse RNA folding satisfying sequence constraints.

PubMed

Busch, Anke; Backofen, Rolf

2007-07-01

INFO-RNA is a new web server for designing RNA sequences that fold into a user given secondary structure. Furthermore, constraints on the sequence can be specified, e.g. one can restrict sequence positions to a fixed nucleotide or to a set of nucleotides. Moreover, the user can allow violations of the constraints at some positions, which can be advantageous in complicated cases. The INFO-RNA web server allows biologists to design RNA sequences in an automatic manner. It is clearly and intuitively arranged and easy to use. The procedure is fast, as most applications are completed within seconds and it proceeds better and faster than other existing tools. The INFO-RNA web server is freely available at http://www.bioinf.uni-freiburg.de/Software/INFO-RNA/

INFO-RNA—a server for fast inverse RNA folding satisfying sequence constraints

PubMed Central

Busch, Anke; Backofen, Rolf

2007-01-01

INFO-RNA is a new web server for designing RNA sequences that fold into a user given secondary structure. Furthermore, constraints on the sequence can be specified, e.g. one can restrict sequence positions to a fixed nucleotide or to a set of nucleotides. Moreover, the user can allow violations of the constraints at some positions, which can be advantageous in complicated cases. The INFO-RNA web server allows biologists to design RNA sequences in an automatic manner. It is clearly and intuitively arranged and easy to use. The procedure is fast, as most applications are completed within seconds and it proceeds better and faster than other existing tools. The INFO-RNA web server is freely available at http://www.bioinf.uni-freiburg.de/Software/INFO-RNA/ PMID:17452349

alpha-Amylase gene of Streptomyces limosus: nucleotide sequence, expression motifs, and amino acid sequence homology to mammalian and invertebrate alpha-amylases.

PubMed Central

Long, C M; Virolle, M J; Chang, S Y; Chang, S; Bibb, M J

1987-01-01

The nucleotide sequence of the coding and regulatory regions of the alpha-amylase gene (aml) of Streptomyces limosus was determined. High-resolution S1 mapping was used to locate the 5' end of the transcript and demonstrated that the gene is transcribed from a unique promoter. The predicted amino acid sequence has considerable identity to mammalian and invertebrate alpha-amylases, but not to those of plant, fungal, or eubacterial origin. Consistent with this is the susceptibility of the enzyme to an inhibitor of mammalian alpha-amylases. The amino-terminal sequence of the extracellular enzyme was determined, revealing the presence of a typical signal peptide preceding the mature form of the alpha-amylase. Images PMID:3500166

Complete genome analysis of jasmine virus T from Jasminum sambac in China.

PubMed

Tang, Yajun; Gao, Fangluan; Yang, Zhen; Wu, Zujian; Yang, Liang

2016-07-01

The genome of a potyvirus (isolate JaVT_FZ) recovered from jasmine (Jasminum sambac L.) showing yellow ringspot symptoms in Fuzhou, China, was sequenced. JaVT_FZ is closely related to seven other potyviruses with completely sequenced genomes, with which it shares 66-70 % nucleotide and 52-56 % amino acid sequence identity. However, the coat protein (CP) gene shares 82-92 % nucleotide and 90-97 % amino acid sequence identity with those of two partially sequenced potyviruses, named jasmine potyvirus T (JaVT-jasmine) and jasmine yellow mosaic potyvirus (JaYMV-India), respectively. This suggests that JaVT_FZ, JaVT-jasmine and JaYMV-India should be regarded as members of a single potyvirus species, for which the name "Jasmine virus T" has priority.

Nucleotide sequence of the phosphoglycerate kinase gene from the extreme thermophile Thermus thermophilus. Comparison of the deduced amino acid sequence with that of the mesophilic yeast phosphoglycerate kinase.

PubMed Central

Bowen, D; Littlechild, J A; Fothergill, J E; Watson, H C; Hall, L

1988-01-01

Using oligonucleotide probes derived from amino acid sequencing information, the structural gene for phosphoglycerate kinase from the extreme thermophile, Thermus thermophilus, was cloned in Escherichia coli and its complete nucleotide sequence determined. The gene consists of an open reading frame corresponding to a protein of 390 amino acid residues (calculated Mr 41,791) with an extreme bias for G or C (93.1%) in the codon third base position. Comparison of the deduced amino acid sequence with that of the corresponding mesophilic yeast enzyme indicated a number of significant differences. These are discussed in terms of the unusual codon bias and their possible role in enhanced protein thermal stability. Images Fig. 1. PMID:3052437

Parsimony and Model-Based Analyses of Indels in Avian Nuclear Genes Reveal Congruent and Incongruent Phylogenetic Signals

PubMed Central

Yuri, Tamaki; Kimball, Rebecca T.; Harshman, John; Bowie, Rauri C. K.; Braun, Michael J.; Chojnowski, Jena L.; Han, Kin-Lan; Hackett, Shannon J.; Huddleston, Christopher J.; Moore, William S.; Reddy, Sushma; Sheldon, Frederick H.; Steadman, David W.; Witt, Christopher C.; Braun, Edward L.

2013-01-01

Insertion/deletion (indel) mutations, which are represented by gaps in multiple sequence alignments, have been used to examine phylogenetic hypotheses for some time. However, most analyses combine gap data with the nucleotide sequences in which they are embedded, probably because most phylogenetic datasets include few gap characters. Here, we report analyses of 12,030 gap characters from an alignment of avian nuclear genes using maximum parsimony (MP) and a simple maximum likelihood (ML) framework. Both trees were similar, and they exhibited almost all of the strongly supported relationships in the nucleotide tree, although neither gap tree supported many relationships that have proven difficult to recover in previous studies. Moreover, independent lines of evidence typically corroborated the nucleotide topology instead of the gap topology when they disagreed, although the number of conflicting nodes with high bootstrap support was limited. Filtering to remove short indels did not substantially reduce homoplasy or reduce conflict. Combined analyses of nucleotides and gaps resulted in the nucleotide topology, but with increased support, suggesting that gap data may prove most useful when analyzed in combination with nucleotide substitutions. PMID:24832669

Genetic diversity and classification of Tibetan yak populations based on the mtDNA COIII gene.

PubMed

Song, Q Q; Chai, Z X; Xin, J W; Zhao, S J; Ji, Q M; Zhang, C F; Ma, Z J; Zhong, J C

2015-03-13

To determine the level of genetic diversity and phylogenetic relationships among Tibetan yak populations, the mitochondrial DNA cytochrome c oxidase subunit 3 (COIII) genes of 378 yak individuals from 16 populations were analyzed in this study. The results showed that the length of cytochrome c oxidase subunit 3 gene sequences was 781 bp, with nucleotide frequencies of 29.2, 29.4, 26.1, and 15.2% for T, C, A, and G, respectively. A total of 26 haplotypes were identified, with 69 polymorphic sites, including 11 parsimony-informative sites and 58 single-nucleotide polymorphism sites. No deletions/insertions were found in sequence comparison, indicating that nucleotide mutation types were transitions and transversions. Haplotype and nucleotide diversities were 0.562 and 0.00138, respectively, indicating a high level of genetic diversity in Tibetan yak populations. Phylogenetic relationship analysis indicated that Tibetan yak populations are divided into 2 groups.

A weighted sampling algorithm for the design of RNA sequences with targeted secondary structure and nucleotide distribution.

PubMed

Reinharz, Vladimir; Ponty, Yann; Waldispühl, Jérôme

2013-07-01

The design of RNA sequences folding into predefined secondary structures is a milestone for many synthetic biology and gene therapy studies. Most of the current software uses similar local search strategies (i.e. a random seed is progressively adapted to acquire the desired folding properties) and more importantly do not allow the user to control explicitly the nucleotide distribution such as the GC-content in their sequences. However, the latter is an important criterion for large-scale applications as it could presumably be used to design sequences with better transcription rates and/or structural plasticity. In this article, we introduce IncaRNAtion, a novel algorithm to design RNA sequences folding into target secondary structures with a predefined nucleotide distribution. IncaRNAtion uses a global sampling approach and weighted sampling techniques. We show that our approach is fast (i.e. running time comparable or better than local search methods), seedless (we remove the bias of the seed in local search heuristics) and successfully generates high-quality sequences (i.e. thermodynamically stable) for any GC-content. To complete this study, we develop a hybrid method combining our global sampling approach with local search strategies. Remarkably, our glocal methodology overcomes both local and global approaches for sampling sequences with a specific GC-content and target structure. IncaRNAtion is available at csb.cs.mcgill.ca/incarnation/. Supplementary data are available at Bioinformatics online.

Three closely related herpesviruses are associated with fibropapillomatosis in marine turtles

USGS Publications Warehouse

Quackenbush, S.L.; Work, Thierry M.; Balazs, George H.; Casey, Rufina N.; Rovnak, J.; Chaves, A.; duToit, L.; Baines, J.D.; Parrish, C.R.; Bowser, Paul R.; Casey, James W.

1998-01-01

Green turtle fibropapillomatosis is a neoplastic disease of increasingly significant threat to the survivability of this species. Degenerate PCR primers that target highly conserved regions of genes encoding herpesvirus DNA polymerases were used to amplify a DNA sequence from fibropapillomas and fibromas from Hawaiian and Florida green turtles. All of the tumors tested (n= 23) were found to harbor viral DNA, whereas no viral DNA was detected in skin biopsies from tumor-negative turtles. The tissue distribution of the green turtle herpesvirus appears to be generally limited to tumors where viral DNA was found to accumulate at approximately two to five copies per cell and is occasionally detected, only by PCR, in some tissues normally associated with tumor development. In addition, herpesviral DNA was detected in fibropapillomas from two loggerhead and four olive ridley turtles. Nucleotide sequencing of a 483-bp fragment of the turtle herpesvirus DNA polymerase gene determined that the Florida green turtle and loggerhead turtle sequences are identical and differ from the Hawaiian green turtle sequence by five nucleotide changes, which results in two amino acid substitutions. The olive ridley sequence differs from the Florida and Hawaiian green turtle sequences by 15 and 16 nucleotide changes, respectively, resulting in four amino acid substitutions, three of which are unique to the olive ridley sequence. Our data suggest that these closely related turtle herpesviruses are intimately involved in the genesis of fibropapillomatosis.

Detection and characterization of hepatitis A virus circulating in Egypt.

PubMed

Hamza, Hazem; Abd-Elshafy, Dina Nadeem; Fayed, Sayed A; Bahgat, Mahmoud Mohamed; El-Esnawy, Nagwa Abass; Abdel-Mobdy, Emam

2017-07-01

Hepatitis A virus (HAV) still poses a considerable problem worldwide. In the current study, hepatitis A virus was recovered from wastewater samples collected from three wastewater treatment plants over one year. Using RT-PCR, HAV was detected in 43 out of 68 samples (63.2%) representing both inlet and outlet. Eleven positive samples were subjected to sequencing targeting the VP1-2A junction region. Phylogenetic analysis revealed that all samples belonged to subgenotype IB with few substitutions at the amino acid level. The complete sequence of one isolate (HAV/Egy/BI-11/2015) showed that the similarity at the amino acid level was not reflected at the nucleotide level. However, the deduced amino acid sequence derived from the complete nucleotide sequence showed distinct substitutions in the 2B, 2C, and 3A regions. Recombination analysis revealed a recombination event between X75215 (subgenotype IA) and AF268396 (subgenotype IB) involving a portion of the 2B nonstructural protein coding region (nucleotides 3757-3868) assuming the herein characterized sequence an actual recombinant. Despite the role of recombination in picornaviruses evolution, its involvement in HAV evolution has rarely been reported, and this may be due to the limited available complete HAV sequences. To our knowledge, this represents the first characterized complete sequence of an Egyptian isolate and the described recombination event provides an important update on the circulating HAV strains in Egypt.

Sequence dependence of electron-induced DNA strand breakage revealed by DNA nanoarrays

PubMed Central

Keller, Adrian; Rackwitz, Jenny; Cauët, Emilie; Liévin, Jacques; Körzdörfer, Thomas; Rotaru, Alexandru; Gothelf, Kurt V.; Besenbacher, Flemming; Bald, Ilko

2014-01-01

The electronic structure of DNA is determined by its nucleotide sequence, which is for instance exploited in molecular electronics. Here we demonstrate that also the DNA strand breakage induced by low-energy electrons (18 eV) depends on the nucleotide sequence. To determine the absolute cross sections for electron induced single strand breaks in specific 13 mer oligonucleotides we used atomic force microscopy analysis of DNA origami based DNA nanoarrays. We investigated the DNA sequences 5′-TT(XYX)3TT with X = A, G, C and Y = T, BrU 5-bromouracil and found absolute strand break cross sections between 2.66 · 10−14 cm2 and 7.06 · 10−14 cm2. The highest cross section was found for 5′-TT(ATA)3TT and 5′-TT(ABrUA)3TT, respectively. BrU is a radiosensitizer, which was discussed to be used in cancer radiation therapy. The replacement of T by BrU into the investigated DNA sequences leads to a slight increase of the absolute strand break cross sections resulting in sequence-dependent enhancement factors between 1.14 and 1.66. Nevertheless, the variation of strand break cross sections due to the specific nucleotide sequence is considerably higher. Thus, the present results suggest the development of targeted radiosensitizers for cancer radiation therapy. PMID:25487346

Variation in the Nucleotide Sequence of Cottontail Rabbit Papillomavirus a and b Subtypes Affects Wart Regression and Malignant Transformation and Level of Viral Replication in Domestic Rabbits

PubMed Central

Salmon, Jérôme; Nonnenmacher, Mathieu; Cazé, Sandrine; Flamant, Patricia; Croissant, Odile; Orth, Gérard; Breitburd, Françoise

2000-01-01

We previously reported the partial characterization of two cottontail rabbit papillomavirus (CRPV) subtypes with strikingly divergent E6 and E7 oncoproteins. We report now the complete nucleotide sequences of these subtypes, referred to as CRPVa4 (7,868 nucleotides) and CRPVb (7,867 nucleotides). The CRPVa4 and CRPVb genomes differed at 238 (3%) nucleotide positions, whereas CRPVa4 and the prototype CRPV differed by only 5 nucleotides. The most variable region (7% nucleotide divergence) included the long regulatory region (LRR) and the E6 and E7 genes. A mutation in the stop codon resulted in an 8-amino-acid-longer CRPVb E4 protein, and a nucleotide deletion reduced the coding capacity of the E5 gene from 101 to 25 amino acids. In domestic rabbits homozygous for a specific haplotype of the DRA and DQA genes of the major histocompatibility complex, warts induced by CRPVb DNA or a chimeric genome containing the CRPVb LRR/E6/E7 region showed an early regression, whereas warts induced by CRPVa4 or a chimeric genome containing the CRPVa4 LRR/E6/E7 region persisted and evolved into carcinomas. In contrast, most CRPVa, CRPVb, and chimeric CRPV DNA-induced warts showed no early regression in rabbits homozygous for another DRA-DQA haplotype. Little, if any, viral replication is usually observed in domestic rabbit warts. When warts induced by CRPVa and CRPVb virions and DNA were compared, the number of cells positive for viral DNA or capsid antigens was found to be greater by 1 order of magnitude for specimens induced by CRPVb. Thus, both sequence variation in the LRR/E6/E7 region and the genetic constitution of the host influence the expression of the oncogenic potential of CRPV. Furthermore, intratype variation may overcome to some extent the host restriction of CRPV replication in domestic rabbits. PMID:11044121