Experimental Aspects of Polarization Optimized Experiments (POE) for Magic Angle Spinning Solid-State NMR of Microcrystalline and Membrane-Bound Proteins.

PubMed

Gopinath, T; Veglia, Gianluigi

2018-01-01

Conventional NMR pulse sequences record one spectrum per experiment, while spending most of the time waiting for the spin system to return to the equilibrium. As a result, a full set of multidimensional NMR experiments for biological macromolecules may take up to several months to complete. Here, we present a practical guide for setting up a new class of MAS solid-state NMR experiments (POE or polarization optimized experiments) that enable the simultaneous acquisition of multiple spectra of proteins, accelerating data acquisition. POE exploit the long-lived 15 N polarization of isotopically labeled proteins and enable one to obtain up to eight spectra, by concatenating classical NMR pulse sequences. This new strategy propels data throughput of solid-state NMR spectroscopy of fibers, microcrystalline preparations, as well as membrane proteins.

Autoradiography and the Cell Cycle.

ERIC Educational Resources Information Center

Jones, C. Weldon

1992-01-01

Outlines the stages of a cell biology "pulse-chase" experiment in which the students apply autoradiography techniques to learn about the concept of the cell cycle. Includes (1) seed germination and plant growth; (2) radioactive labeling and fixation of root tips; (3) feulgen staining of root tips; (4) preparation of autoradiograms; and…

Ion Channel Conformation and Oligomerization Assessment by Site-Directed Spin Labeling and Pulsed-EPR.

PubMed

Pliotas, Christos

2017-01-01

Mechanosensitive (MS) ion channels are multimeric integral membrane proteins that respond to increased lipid bilayer tension by opening their nonselective pores to release solutes and relieve increased cytoplasmic pressure. These systems undergo major conformational changes during gating and the elucidation of their mechanism requires a deep understanding of the interplay between lipids and proteins. Lipids are responsible for transmitting lateral tension to MS channels and therefore play a key role in obtaining a molecular-detail model for mechanosensation. Site-directed spin labeling combined with electron paramagnetic resonance (EPR) spectroscopy is a powerful spectroscopic tool in the study of proteins. The main bottleneck for its use relates to challenges associated with successful isolation of the protein of interest, introduction of paramagnetic labels on desired sites, and access to specialized instrumentation and expertise. The design of sophisticated experiments, which combine a variety of existing EPR methodologies to address a diversity of specific questions, require knowledge of the limitations and strengths, characteristic of each particular EPR method. This chapter is using the MS ion channels as paradigms and focuses on the application of different EPR techniques to ion channels, in order to investigate oligomerization, conformation, and the effect of lipids on their regulation. The methodology we followed, from the initial strategic selection of mutants and sample preparation, including protein purification, spin labeling, reconstitution into lipid mimics to the complete set-up of the pulsed-EPR experiments, is described in detail. © 2017 Elsevier Inc. All rights reserved.

Evidence for carboxyl-terminal processing and glycolipid-anchoring of human carcinoembryonic antigen.

PubMed

Takami, N; Misumi, Y; Kuroki, M; Matsuoka, Y; Ikehara, Y

1988-09-05

We have investigated the post-translational modification of carcinoembryonic antigen (CEA) for membrane-anchoring in QGP-1 cells derived from a human pancreatic carcinoma. Pulse-chase experiments with [3H]leucine demonstrated that CEA was initially synthesized as a precursor form with Mr 150,000 having N-linked high-mannose-type oligosaccharides, which was then converted to a mature form with Mr 200,000 containing the complex type sugar chains. The mature protein thus labeled was found to be released from the cell surface by treatment with phosphatidylinositol-specific phospholipase C, suggesting that CEA is a phosphatidylinositol-linked membrane protein. This was confirmed by metabolic incorporation into CEA of 3H-labeled compounds such as ethanolamine, myo-inositol, palmitic acid, and stearic acid. The 3H-labeled fatty acids incorporated were specifically removed from the protein by nitrous acid deamination as well as by phosphatidylinositol-specific phospholipase C treatment. Since the available cDNA sequence predicts that CEA contains a single methionine residue only in its carboxyl-terminal hydrophobic domain, processing of the carboxyl terminus was examined by pulse-chase experiments with [35S]methionine. It was found that CEA with Mr 150,000 was initially labeled with [35S]methionine but its radioactivity was immediately lost with chase. Taken together, these results suggest that CEA is anchored to the membrane by simultaneously occurring proteolysis of the carboxyl terminus and replacement by the glycophospholipid immediately after the synthesis.

Identification and subsequent phosphorylation of sequestered partially processed caseins in the lactating guinea-pig mammary gland.

PubMed Central

Boulton, A P; Pascall, J C; Craig, R K

1984-01-01

Golgi and endoplasmic-reticulum fractions were prepared from the lactating guinea-pig mammary gland. The endoplasmic-reticulum fraction was highly active in the processing and sequestration of milk-protein primary translation products. Explants from the lactating gland in organ culture were used to identify milk-protein intermediates present in the secretory pathway, and the timing of the events leading to their post-translational modification. With [35S]methionine, the milk proteins labelled after a short pulse (3 min) were represented by the partially processed (but not phosphorylated) caseins and alpha-lactalbumin sequestered within membrane-bound vesicles. After a 30 min labelling period, higher-Mr caseins with electrophoretic mobilities identical with those of the phosphorylated caseins isolated from milk were identified in the incubation medium, and sequestered within membrane-bound vesicles. Pulse-chase experiments established a precursor-product relationship between these forms. Secretion is apparent approx. 30 min after sequestration. Caseins are highly phosphorylated; removal of the phosphate residues with acid phosphatase results in proteins with increased electrophoretic mobility, similar to those of the partially processed early casein intermediates found sequestered in explants after a 3 min pulse with [35S]methionine, and those sequestered within microsomal membranes after mRNA-directed cell-free protein synthesis. A comparison of the proteins labelled during both short (5 min) and long (30 min) pulses with [35S]methionine and [32P]Pi shows that, in contrast with the 35S-labelled caseins, those labelled with [32P]Pi exhibit only electrophoretic mobilities identical with those of the mature caseins isolated from milk and those identified after long labelling periods with [35S]methionine. No phosphorylated early intermediate forms of caseins were identified. We conclude that the synthesis and post-translational modification of guinea-pig caseins occurs in two stages, (i) an early event involving synthesis and sequestration within the endoplasmic reticulum, an event that involves signal-peptide removal, followed (ii) 10-20 min later by phosphorylation at a different point in the secretory pathway, probably in the Golgi complex. Secretion of the phosphorylated caseins occurs 10-20 min later. Images Fig. 1. Fig. 2. Fig. 3. Fig. 4. Fig. 5. PMID:6477529

C4'/H4' selective, non-uniformly sampled 4D HC(P)CH experiment for sequential assignments of (13)C-labeled RNAs.

PubMed

Saxena, Saurabh; Stanek, Jan; Cevec, Mirko; Plavec, Janez; Koźmiński, Wiktor

2014-11-01

A through bond, C4'/H4' selective, "out and stay" type 4D HC(P)CH experiment is introduced which provides sequential connectivity via H4'(i)-C4'(i)-C4'(i-1)-H4'(i-1) correlations. The (31)P dimension (used in the conventional 3D HCP experiment) is replaced with evolution of better dispersed C4' dimension. The experiment fully utilizes (13)C-labeling of RNA by inclusion of two C4' evolution periods. An additional evolution of H4' is included to further enhance peak resolution. Band selective (13)C inversion pulses are used to achieve selectivity and prevent signal dephasing due to the of C4'-C3' and C4'-C5' homonuclear couplings. For reasonable resolution, non-uniform sampling is employed in all indirect dimensions. To reduce sensitivity losses, multiple quantum coherences are preserved during shared-time evolution and coherence transfer delays. In the experiment the intra-nucleotide peaks are suppressed whereas inter-nucleotide peaks are enhanced to reduce the ambiguities. The performance of the experiment is verified on a fully (13)C, (15)N-labeled 34-nt hairpin RNA comprising typical structure elements.

Resistive-pulse measurements with nanopipettes: detection of Au nanoparticles and nanoparticle-bound anti-peanut IgY.

PubMed

Wang, Yixian; Kececi, Kaan; Mirkin, Michael V; Mani, Vigneshwaran; Sardesai, Naimish; Rusling, James F

2013-02-01

Solid-state nanopores have been widely employed in sensing applications from Coulter counters to DNA sequencing devices. The analytical signal in such experiments is the change in ionic current flowing through the orifice caused by the large molecule or nanoparticle translocation through the pore. Conceptually similar nanopipette-based sensors can offer several advantages including the ease of fabrication and small physical size essential for local measurements and experiments in small spaces. This paper describes the first evaluation of nanopipettes with well characterized geometry for resistive-pulse sensing of Au nanoparticles (AuNP), nanoparticles coated with an allergen epitope peptide layer, and AuNP-peptide particles with bound antipeanut antibodies (IgY) on the peptide layer. The label-free signal produced by IgY-conjugated particles was strikingly different from those obtained with other analytes, thus suggesting the possibility of selective and sensitive resistive-pulse sensing of antibodies.

Resistive-pulse measurements with nanopipettes: detection of Au nanoparticles and nanoparticle-bound anti-peanut IgY†

PubMed Central

Wang, Yixian; Kececi, Kaan; Mani, Vigneshwaran; Sardesai, Naimish

2013-01-01

Solid-state nanopores have been widely employed in sensing applications from Coulter counters to DNA sequencing devices. The analytical signal in such experiments is the change in ionic current flowing through the orifice caused by the large molecule or nanoparticle translocation through the pore. Conceptually similar nanopipette-based sensors can offer several advantages including the ease of fabrication and small physical size essential for local measurements and experiments in small spaces. This paper describes the first evaluation of nanopipettes with well characterized geometry for resistive-pulse sensing of Au nanoparticles (AuNP), nanoparticles coated with an allergen epitope peptide layer, and AuNP–peptide particles with bound antipeanut antibodies (IgY) on the peptide layer. The label-free signal produced by IgY-conjugated particles was strikingly different from those obtained with other analytes, thus suggesting the possibility of selective and sensitive resistive-pulse sensing of antibodies. PMID:23991282

In vivo measurement of the longitudinal relaxation time of arterial blood (T1a) in the mouse using a pulsed arterial spin labeling approach.

PubMed

Thomas, David L; Lythgoe, Mark F; Gadian, David G; Ordidge, Roger J

2006-04-01

A novel method for measuring the longitudinal relaxation time of arterial blood (T1a) is presented. Knowledge of T1a is essential for accurately quantifying cerebral perfusion using arterial spin labeling (ASL) techniques. The method is based on the flow-sensitive alternating inversion recovery (FAIR) pulsed ASL (PASL) approach. We modified the standard FAIR acquisition scheme by incorporating a global saturation pulse at the beginning of the recovery period. With this approach the FAIR tissue signal difference has a simple monoexponential dependence on the recovery time, with T1a as the time constant. Therefore, FAIR measurements performed over a range of recovery times can be fitted to a monoexponential recovery curve and T1a can be calculated directly. This eliminates many of the difficulties associated with the measurement of T1a. Experiments performed in vivo in the mouse at 2.35T produced a mean value of 1.51 s for T1a, consistent with previously published values. (c) 2006 Wiley-Liss, Inc.

Single-pulse enhanced coherent diffraction imaging of bacteria with an X-ray free-electron laser

NASA Astrophysics Data System (ADS)

Fan, Jiadong; Sun, Zhibin; Wang, Yaling; Park, Jaehyun; Kim, Sunam; Gallagher-Jones, Marcus; Kim, Yoonhee; Song, Changyong; Yao, Shengkun; Zhang, Jian; Zhang, Jianhua; Duan, Xiulan; Tono, Kensuke; Yabashi, Makina; Ishikawa, Tetsuya; Fan, Chunhai; Zhao, Yuliang; Chai, Zhifang; Gao, Xueyun; Earnest, Thomas; Jiang, Huaidong

2016-09-01

High-resolution imaging offers one of the most promising approaches for exploring and understanding the structure and function of biomaterials and biological systems. X-ray free-electron lasers (XFELs) combined with coherent diffraction imaging can theoretically provide high-resolution spatial information regarding biological materials using a single XFEL pulse. Currently, the application of this method suffers from the low scattering cross-section of biomaterials and X-ray damage to the sample. However, XFELs can provide pulses of such short duration that the data can be collected using the “diffract and destroy” approach before the effects of radiation damage on the data become significant. These experiments combine the use of enhanced coherent diffraction imaging with single-shot XFEL radiation to investigate the cellular architecture of Staphylococcus aureus with and without labeling by gold (Au) nanoclusters. The resolution of the images reconstructed from these diffraction patterns were twice as high or more for gold-labeled samples, demonstrating that this enhancement method provides a promising approach for the high-resolution imaging of biomaterials and biological systems.

Single-pulse enhanced coherent diffraction imaging of bacteria with an X-ray free-electron laser

PubMed Central

Fan, Jiadong; Sun, Zhibin; Wang, Yaling; Park, Jaehyun; Kim, Sunam; Gallagher-Jones, Marcus; Kim, Yoonhee; Song, Changyong; Yao, Shengkun; Zhang, Jian; Zhang, Jianhua; Duan, Xiulan; Tono, Kensuke; Yabashi, Makina; Ishikawa, Tetsuya; Fan, Chunhai; Zhao, Yuliang; Chai, Zhifang; Gao, Xueyun; Earnest, Thomas; Jiang, Huaidong

2016-01-01

High-resolution imaging offers one of the most promising approaches for exploring and understanding the structure and function of biomaterials and biological systems. X-ray free-electron lasers (XFELs) combined with coherent diffraction imaging can theoretically provide high-resolution spatial information regarding biological materials using a single XFEL pulse. Currently, the application of this method suffers from the low scattering cross-section of biomaterials and X-ray damage to the sample. However, XFELs can provide pulses of such short duration that the data can be collected using the “diffract and destroy” approach before the effects of radiation damage on the data become significant. These experiments combine the use of enhanced coherent diffraction imaging with single-shot XFEL radiation to investigate the cellular architecture of Staphylococcus aureus with and without labeling by gold (Au) nanoclusters. The resolution of the images reconstructed from these diffraction patterns were twice as high or more for gold-labeled samples, demonstrating that this enhancement method provides a promising approach for the high-resolution imaging of biomaterials and biological systems. PMID:27659203

Single-pulse enhanced coherent diffraction imaging of bacteria with an X-ray free-electron laser.

PubMed

Fan, Jiadong; Sun, Zhibin; Wang, Yaling; Park, Jaehyun; Kim, Sunam; Gallagher-Jones, Marcus; Kim, Yoonhee; Song, Changyong; Yao, Shengkun; Zhang, Jian; Zhang, Jianhua; Duan, Xiulan; Tono, Kensuke; Yabashi, Makina; Ishikawa, Tetsuya; Fan, Chunhai; Zhao, Yuliang; Chai, Zhifang; Gao, Xueyun; Earnest, Thomas; Jiang, Huaidong

2016-09-23

High-resolution imaging offers one of the most promising approaches for exploring and understanding the structure and function of biomaterials and biological systems. X-ray free-electron lasers (XFELs) combined with coherent diffraction imaging can theoretically provide high-resolution spatial information regarding biological materials using a single XFEL pulse. Currently, the application of this method suffers from the low scattering cross-section of biomaterials and X-ray damage to the sample. However, XFELs can provide pulses of such short duration that the data can be collected using the "diffract and destroy" approach before the effects of radiation damage on the data become significant. These experiments combine the use of enhanced coherent diffraction imaging with single-shot XFEL radiation to investigate the cellular architecture of Staphylococcus aureus with and without labeling by gold (Au) nanoclusters. The resolution of the images reconstructed from these diffraction patterns were twice as high or more for gold-labeled samples, demonstrating that this enhancement method provides a promising approach for the high-resolution imaging of biomaterials and biological systems.

Multi-pulse pumping for far-field super-resolution imaging

NASA Astrophysics Data System (ADS)

Requena, Sebastian; Raut, Sangram; Doan, Hung; Kimball, Joe; Fudala, Rafal; Borejdo, Julian; Gryczynski, Ignacy; Strzhemechny, Yuri; Gryczynski, Zygmunt

2016-02-01

Recently, far-field optical imaging with a resolution significantly beyond diffraction limit has attracted tremendous attention allowing for high resolution imaging in living objects. Various methods have been proposed that are divided in to two basic approaches; deterministic super-resolution like STED or RESOLFT and stochastic super-resolution like PALM or STORM. We propose to achieve super-resolution in far-field fluorescence imaging by the use of controllable (on-demand) bursts of pulses that can change the fluorescence signal of long-lived component over one order of magnitude. We demonstrate that two beads, one labeled with a long-lived dye and another with a short-lived dye, separated by a distance lower than 100 nm can be easily resolved in a single experiment. The proposed method can be used to separate two biological structures in a cell by targeting them with two antibodies labeled with long-lived and short-lived fluorophores.

Origin of tumor-promoter released fibronectin in fibroblasts

DOE Office of Scientific and Technical Information (OSTI.GOV)

Burrous, B.A.; Wolf, G.

1986-05-01

Previous work from the laboratory showed that the chemical tumor promoter 12-O-tetradecanoylphorbol-13-acetate (TPA) stimulated release of the cell surface glycoprotein, fibronectin (FN) from human lung fibroblasts (HLF), leading to depletion of cell surface FN, while FN synthesis is not altered by TPA. To further investigate the mechanism(s) by which TPA stimulates FN release, two types of experiments were performed. In the first, HLF were pulsed with /sup 35/S-methionine-labeled medium with or without TPA. In the second, cell-surface proteins were labeled by iodination (/sup 125/I) and then incubated in unlabeled medium with or without TPA. In both cases, the fate ofmore » labeled FN was followed over 12 hr. The /sup 35/S-meth-labeled HLF showed a rapid loss of labeled FN, first into a small, highly-labeled pool of cell surface FN (1 hr), later into the medium (4 hr or longer). Specific activities showed that this small pool in the cell surface turned over rapidly. TPA treatment resulted in more rapid movement of /sup 35/S-meth pulse-labeled FN to the cell surface and into the medium than in control cells. TPA thus affected the fate of intracellular FN. TPA treatment of HLF also resulted in more rapid removal of /sup 125/I-cell surface-labeled FN into the medium than in control cells. Thus, TPA affects the fate of preexisting cell surface FN in HLF. From these results, they hypothesize that TPA has two separate effects: it stimulates depletion of preexisting intracellular FN during the first hr of treatment, and it stimulates release of preexisting cell surface FN over all treatment times.« less

Selective excitation for spectral editing and assignment in separated local field experiments of oriented membrane proteins

NASA Astrophysics Data System (ADS)

Koroloff, Sophie N.; Nevzorov, Alexander A.

2017-01-01

Spectroscopic assignment of NMR spectra for oriented uniformly labeled membrane proteins embedded in their native-like bilayer environment is essential for their structure determination. However, sequence-specific assignment in oriented-sample (OS) NMR is often complicated by insufficient resolution and spectral crowding. Therefore, the assignment process is usually done by a laborious and expensive "shotgun" method involving multiple selective labeling of amino acid residues. Presented here is a strategy to overcome poor spectral resolution in crowded regions of 2D spectra by selecting resolved "seed" residues via soft Gaussian pulses inserted into spin-exchange separated local-field experiments. The Gaussian pulse places the selected polarization along the z-axis while dephasing the other signals before the evolution of the 1H-15N dipolar couplings. The transfer of magnetization is accomplished via mismatched Hartmann-Hahn conditions to the nearest-neighbor peaks via the proton bath. By optimizing the length and amplitude of the Gaussian pulse, one can also achieve a phase inversion of the closest peaks, thus providing an additional phase contrast. From the superposition of the selective spin-exchanged SAMPI4 onto the fully excited SAMPI4 spectrum, the 15N sites that are directly adjacent to the selectively excited residues can be easily identified, thereby providing a straightforward method for initiating the assignment process in oriented membrane proteins.

Bacillus megaterium sporal peptidoglycan synthesis studied by high-resolution autoradiography.

PubMed

Frehel, C; Ryter, A

1980-11-01

Cells of a Dap- Lys- mutant strain of Bacillus megaterium were pulse labeled with [3H]diaminopimelic acid at different times of growth and sporulation. They were processed for radioactivity measurements and high-resolution autoradiography either just after the pulse or after a chase in a nonradioactive medium until refractile forespores started to appear at time (t)4,5. In the pulse-labeled cells, autoradiographs and radioactivity measurements showed that the radioactivity incorporated during a pulse decreased abruptly after t0 and stayed at a low level until t5, although the forespore wall and cortex were formed between t4 and t5. In the pulse-chased bacteria, the acid-insoluble radioactivity, as well as the number of silver grains on autoradiographs, increased during the chase in cells labeled at t1 to t2, whereas it decreased in those labeled before t0. Furthermore, analysis of silver grain distribution showed that, in stage IV bacteria, grains were distributed at the outside of the forespore, mostly on the sporangium cell wall, when pulse-labeling occurred before or at t0; they were located along the cortex and in the forespore cytoplasm when labeling was made at t1 or t2. These facts show that [3H]diaminopimelic acid necessary for spore envelope synthesis was incorporated before their morphological appearance. Free or small diaminopimelic acid precursors entered the sporangium between t1 and t2. The appearance of silver grains in the forespore cytoplasm suggests that the forespore is implicated in sporal peptidoglycan synthesis.

An optimized design to reduce eddy current sensitivity in velocity-selective arterial spin labeling using symmetric BIR-8 pulses.

PubMed

Guo, Jia; Meakin, James A; Jezzard, Peter; Wong, Eric C

2015-03-01

Velocity-selective arterial spin labeling (VSASL) tags arterial blood on a velocity-selective (VS) basis and eliminates the tagging/imaging gap and associated transit delay sensitivity observed in other ASL tagging methods. However, the flow-weighting gradient pulses in VS tag preparation can generate eddy currents (ECs), which may erroneously tag the static tissue and create artificial perfusion signal, compromising the accuracy of perfusion quantification. A novel VS preparation design is presented using an eight-segment B1 insensitive rotation with symmetric radio frequency and gradient layouts (sym-BIR-8), combined with delays after gradient pulses to optimally reduce ECs of a wide range of time constants while maintaining B0 and B1 insensitivity. Bloch simulation, phantom, and in vivo experiments were carried out to determine robustness of the new and existing pulse designs to ECs, B0 , and B1 inhomogeneity. VSASL with reduced EC sensitivity across a wide range of EC time constants was achieved with the proposed sym-BIR-8 design, and the accuracy of cerebral blood flow measurement was improved. The sym-BIR-8 design performed the most robustly among the existing VS tagging designs, and should benefit studies using VS preparation with improved accuracy and reliability. © 2014 Wiley Periodicals, Inc.

Residue selective 15N CEST and CPMG experiments for studies of millisecond timescale protein dynamics.

PubMed

Niu, Xiaogang; Ding, Jienv; Zhang, Wenbo; Li, Qianwen; Hu, Yunfei; Jin, Changwen

2018-06-01

Proteins are intrinsically dynamic molecules and undergo exchanges among multiple conformations to perform biological functions. The CPMG relaxation dispersion and CEST experiments are two important solution NMR techniques for characterizing the conformational exchange processes on the millisecond timescale. Traditional pseudo 3D 15 N CEST and CPMG experiments have certain limitations in their applications. For example, both experiments have low sensitivity for broadened resonances, and the process of optimizing sample conditions and experimental parameters are often time consuming. To overcome these limitations, we herein present a new set of residue selective 15 N CEST and CPMG pulse sequences by employing the Hartmann-Hahn cross-polarization transfer of magnetization in both 1D and 2D schemes. Combined with frequency labeling in the indirect dimension using only a small number of increments, the pulse sequences in the 2D scheme can be applied on resonances in overlapped regions of the 1 H- 15 N HSQC spectrum. The pulse sequences were further applied on several proteins, demonstrating their advantages over the traditional CEST and CPMG experiments under specific circumstances. Copyright © 2018 Elsevier Inc. All rights reserved.

Pulse labeling of RNA of mammalian cells.

PubMed

Rovera, G; Berman, S; Baserga, R

1970-04-01

When cells from a hypotetraploid strain of Ehrlich ascites tumor are exposed to uridine-(3)H either in vivo or in vitro, the amount of radioactivity incorporated into RNA reaches a maximum within ten minutes, after which any further incorporation stops. (3)H-uridine triphosphate disappears from the acid soluble pool within 30 minutes and the findings indicate that the RNA of these cells can be pulse labeled without the use of any antibiotic or the need of a "chase." The stability of the pulse labeled RNA in the presence of pentobarbital (an inhibitor of RNA synthesis) indicates the virtual absence of RNA breakdown. However, actinomycin D, at a dosage of 250 mug/mouse in vivo and 10 mug/ml in vitro produces breakdown of labeled RNA, thus confirming earlier observations that the drug is not a suitable tool for RNA kinetics determinations. The pulse-labeled RNA leaves the nucleus slowly and some radioactive RNA is still present in the nuclear fraction after 24 hours. Radioactivity begins to appear in cytoplasmic ribosomal RNA after 20 minutes and continues to increase up to six hours.

Elucidation of metabolic pathways in glycogen-accumulating organisms with in vivo 13C nuclear magnetic resonance.

PubMed

Lemos, Paulo C; Dai, Yu; Yuan, Zhiguo; Keller, Jurg; Santos, Helena; Reis, Maria A M

2007-11-01

Glycogen-accumulating organisms (GAOs) are found in enhanced biological phosphorus removal systems where they compete with polyphosphate-accumulating organisms for external carbon substrates. (13)C nuclear magnetic resonance ((13)C-NMR) was used to elucidate the metabolic pathways operating in an enriched GAO culture dominated by two known GAOs (81.2%). The experiments consisted of adding (13)C-acetate (labelled on position 1 or 2) to the culture under anaerobic conditions, and operating the culture through a cycle consisting of an anaerobic, an aerobic and a further anaerobic phase. The carbon transformations over the cycle were monitored using in vivo(13)C-NMR. The two-carbon moieties in hydroxybutyrate and hydroxyvalerate were derived from acetate, while the propionyl precursor of hydroxyvalerate was primarily derived from glycogen, with only a small fraction originating from acetate. Comparison of the labelling patterns in hydroxyvalerate at the end of the first and the second anaerobic periods in pulse experiments with 2-(13)C-acetate showed that the Entner-Doudoroff (ED) pathway was used for the breakdown of glycogen. This conclusion was further supported by the labelling pattern on glycogen observed in the pulse experiments with 1-(13)C-acetate, which can only be explained by the operation of ED with recycling of pyruvate and glyceraldehyde 3-phosphate via gluconeogenesis. The activity of the ED pathway for glycogen degradation by GAOs is demonstrated here for the first time. In addition, the decarboxylating part of the tricarboxylic acid cycle was confirmed to operate also under anaerobic conditions.

A Simple Picaxe Microcontroller Pulse Source for Juxtacellular Neuronal Labelling.

PubMed

Verberne, Anthony J M

2016-10-19

Juxtacellular neuronal labelling is a method which allows neurophysiologists to fill physiologically-identified neurons with small positively-charged marker molecules. Labelled neurons are identified by histochemical processing of brain sections along with immunohistochemical identification of neuropeptides, neurotransmitters, neurotransmitter transporters or biosynthetic enzymes. A microcontroller-based pulser circuit and associated BASIC software script is described for incorporation into the design of a commercially-available intracellular electrometer for use in juxtacellular neuronal labelling. Printed circuit board construction has been used for reliability and reproducibility. The current design obviates the need for a separate digital pulse source and simplifies the juxtacellular neuronal labelling procedure.

Refining cotton-wick method for 15N plant labelling.

NASA Astrophysics Data System (ADS)

Fustec, Joëlle; Mahieu, Stéphanie

2010-05-01

The symbiosis Fabaceae/Rhizobiaceae plays a critical role in the nitrogen cycle. It gives the plant the ability to fix high amounts of atmospheric N. A part of this N can be transferred to the soil via rhizodeposition. The contribution of Fabaceae to the soil N pool is difficult to measure, since it is necessary for assessing N benefits for other crops, for soil biological activity, and for reducing water pollution in sustainable agriculture (Fustec, 2009). The aim of this study was to test and improve the reliability of the 15N cotton-wick method for measuring the soil N derived from plant rhizodeposition (Mahieu et al., 2007). The effects of the concentration of the 15N-urea labelling solution and of the feeding frequency (continuous or pulses) on the assessment of nitrogen rhizodeposition were studied in two greenhouse experiments using the field pea (Pisum sativum L.) and the non-nodulating isoline P2. The plant parts and the soil were prepared for 15N:14N measurements for assessing N rhizodeposition (Mahieu et al., 2009). The fraction of plants' belowground nitrogen allocated to rhizodeposition in both Frisson pea and P2 was 20 to more than 50% higher when plants were labelled continuously than when they were labelled using fortnightly pulses. Our results suggested that when 15N root enrichment was high, nitrogen rhizodeposition was underestimated only for plants that were 15N-fed by fortnightly pulses, and not in plants 15N-fed continuously. This phenomenon was especially observed for plants relying on symbiotic N fixation for N acquisition; it may be linked to the concentration of the labelling solution. In conclusion, N rhizodeposition assessment was strongly influenced by the 15N-feeding frequency and the concentration of the labelling solution. The estimation of N rhizodeposition was more reliable when plants were labelled continuously with a dilute solution of 15N urea. Fustec et al. 2009. Agron. Sustain. Dev., DOI 10.1051/agro/2009003, in press. Mahieu et al. 2007. Plant Soil 295, 193-205. Mahieu et al. 2009. Soil Biol. Biochem. 41, 2236-2243.

Measurement of skeletal muscle perfusion dynamics with pseudo-continuous arterial spin labeling (pCASL): Assessment of relative labeling efficiency at rest and during hyperemia, and comparison to pulsed arterial spin labeling (PASL).

PubMed

Englund, Erin K; Rodgers, Zachary B; Langham, Michael C; Mohler, Emile R; Floyd, Thomas F; Wehrli, Felix W

2016-10-01

To compare calf skeletal muscle perfusion measured with pulsed arterial spin labeling (PASL) and pseudo-continuous arterial spin labeling (pCASL) methods, and to assess the variability of pCASL labeling efficiency in the popliteal artery throughout an ischemia-reperfusion paradigm. At 3T, relative pCASL labeling efficiency was experimentally assessed in five subjects by measuring the signal intensity of blood in the popliteal artery just distal to the labeling plane immediately following pCASL labeling or control preparation pulses, or without any preparation pulses throughout separate ischemia-reperfusion paradigms. The relative label and control efficiencies were determined during baseline, hyperemia, and recovery. In a separate cohort of 10 subjects, pCASL and PASL sequences were used to measure reactive hyperemia perfusion dynamics. Calculated pCASL labeling and control efficiencies did not differ significantly between baseline and hyperemia or between hyperemia and recovery periods. Relative to the average baseline, pCASL label efficiency was 2 ± 9% lower during hyperemia. Perfusion dynamics measured with pCASL and PASL did not differ significantly (P > 0.05). Average leg muscle peak perfusion was 47 ± 20 mL/min/100g or 50 ± 12 mL/min/100g, and time to peak perfusion was 25 ± 3 seconds and 25 ± 7 seconds from pCASL and PASL data, respectively. Differences of further metrics parameterizing the perfusion time course were not significant between pCASL and PASL measurements (P > 0.05). No change in pCASL labeling efficiency was detected despite the almost 10-fold increase in average blood flow velocity in the popliteal artery. pCASL and PASL provide precise and consistent measurement of skeletal muscle reactive hyperemia perfusion dynamics. J. MAGN. RESON. IMAGING 2016;44:929-939. © 2016 International Society for Magnetic Resonance in Medicine.

Alpha-SNAP functions in insulin exocytosis from mature, but not immature secretory granules in pancreatic beta cells.

PubMed

Nakamichi, Y; Nagamatsu, S

1999-06-24

To explore alpha-SNAP function in insulin exocytosis from either immature or mature secretory granules in pancreatic beta cells, we studied the effects of overexpression of adenovirus-mediated wild-type alpha-SNAP and C-terminally deleted alpha-SNAP mutant (1-285) on newly synthesized proinsulin and insulin release by rat islets and MIN6 cells. Rat islets overexpressing alpha-SNAP and mutant alpha-SNAP were pulse-chased. Exocytosis from immature and mature insulin secretory granules was measured as fractional (%) labeled-proinsulin release immediately after the pulse-labeling and percentage labeled-insulin release after a 3-h chase period, respectively. There was no difference in percentage labeled-proinsulin release between the control and alpha-SNAP or mutant alpha-SNAP-overexpressed islets. Although percentage labeled-insulin release after a 3-h chase period was significantly increased in alpha-SNAP-overexpressed islets, it was decreased in mutant alpha-SNAP-overexpressed islets. Thus, the results demonstrated that alpha-SNAP overexpression in rat islets primarily increased exocytosis from mature, but not immature insulin secretory granules. On the other hand, in MIN6 cells, alpha-SNAP overexpression scarcely affected glucose-stimulated insulin release; therefore, we examined the effect of mutant alpha-SNAP overexpression as the dominant-negative inhibitor on the newly synthesized proinsulin/insulin release using the same protocol as in the rat islet experiments. alpha-SNAP mutant (1-285) overexpression in MIN6 cells decreased the percentage labeled insulin release from mature secretory granules, but not percentage labeled proinsulin release from immature secretory granules. Thus, our data demonstrate that alpha-SNAP functions mainly in the mature insulin secretory granules in pancreatic beta cells. Copyright 1999 Academic Press.

Effects of season and nitrogen supply on the partitioning of recently fixed carbon in understory vegetation using a 13CO2 pulse labeling technique

NASA Astrophysics Data System (ADS)

Hasselquist, Niles; Metcalfe, Daniel; Högberg, Peter

2013-04-01

Vegetation research in boreal forests has traditionally been focused on trees, with little attention given to understory vegetation. However, understory vegetation has been identified as a key driver for the functioning of boreal forests and may play an important role in the amount of carbon (C) that is entering and leaving these forested ecosystems. We conducted a large-scale 13C pulse labeling experiment to better understand how recently fixed C is allocated in the understory vegetation characteristic of boreal forests. We used transparent plastic chambers to pulse label the understory vegetation with enriched 13CO2 in the early (June) and late (August) growing seasons. This study was also replicated across a nitrogen (N) fertilization treatment to better understand the effects of N availability on C allocation patterns. We present data on the amount of 13C label found in different components of the understory vegetation (i.e. leaves, stems, lichens, mosses, rhizomes and fine roots) as well as CO2 efflux. Additionally, we provide estimates of C residence time (MRT) among the different components and examine how MRT of C is affected by seasonality and N availability. Seasonality had a large effect on how recently fixed C is allocated in understory vegetation, whereas N fertilization influenced the MRT of C in the different components of ericaceous vegetation. Moreover, there was a general trend that N additions increased the amount of 13C in CO2 efflux compared to the amount of 13C in biomass, suggesting that N fertilization may lead to an increase in the utilization of recently fixed C, whereas N-limitation promotes the storage of recently fixed C.

A Simple Picaxe Microcontroller Pulse Source for Juxtacellular Neuronal Labelling †

PubMed Central

Verberne, Anthony J. M.

2016-01-01

Juxtacellular neuronal labelling is a method which allows neurophysiologists to fill physiologically-identified neurons with small positively-charged marker molecules. Labelled neurons are identified by histochemical processing of brain sections along with immunohistochemical identification of neuropeptides, neurotransmitters, neurotransmitter transporters or biosynthetic enzymes. A microcontroller-based pulser circuit and associated BASIC software script is described for incorporation into the design of a commercially-available intracellular electrometer for use in juxtacellular neuronal labelling. Printed circuit board construction has been used for reliability and reproducibility. The current design obviates the need for a separate digital pulse source and simplifies the juxtacellular neuronal labelling procedure. PMID:28952589

Selective labeling of a single organelle by using two-photon conversion of a photoconvertible fluorescent protein

NASA Astrophysics Data System (ADS)

Watanabe, Wataru; Shimada, Tomoko; Matsunaga, Sachihiro; Kurihara, Daisuke; Arimura, Shin-ichi; Tsutsumi, Nobuhiro; Fukui, Kiichi; Itoh, Kazuyoshi

2008-02-01

We present space-selective labeling of organelles by using two-photon conversion of a photoconvertible fluorescent protein with near-infrared femtosecond laser pulses. Two-photon excitation of photoconvertible fluorescent-protein, Kaede, enables space-selective labeling of organelles. We alter the fluorescence of target mitochondria in a tobacco BY-2 cell from green to red by focusing femtosecond laser pulses with a wavelength of 750 nm.

The effect of physical back-diffusion of 13CO2 tracer on the coupling between photosynthesis and soil CO2 efflux in grassland.

PubMed

Burri, Susanne; Sturm, Patrick; Baur, Thomas; Barthel, Matti; Knohl, Alexander; Buchmann, Nina

2014-01-01

Pulse labelling experiments provide a common tool to study short-term processes in the plant-soil system and investigate below-ground carbon allocation as well as the coupling of soil CO(2) efflux to photosynthesis. During the first hours after pulse labelling, the measured isotopic signal of soil CO(2) efflux is a combination of both physical tracer diffusion into and out of the soil as well as biological tracer release via root and microbial respiration. Neglecting physical back-diffusion can lead to misinterpretation regarding time lags between photosynthesis and soil CO(2) efflux in grassland or any ecosystem type where the above-ground plant parts cannot be labelled in gas-tight chambers separated from the soil. We studied the effects of physical (13)CO(2) tracer back-diffusion in pulse labelling experiments in grassland, focusing on the isotopic signature of soil CO(2) efflux. Having accounted for back-diffusion, the estimated time lag for first tracer appearance in soil CO(2) efflux changed from 0 to 1.81±0.56 h (mean±SD) and the time lag for maximum tracer appearance from 2.67±0.39 to 9.63±3.32 h (mean±SD). Thus, time lags were considerably longer when physical tracer diffusion was considered. Using these time lags after accounting for physical back-diffusion, high nocturnal soil CO(2) efflux rates could be related to daytime rates of gross primary productivity (R(2)=0.84). Moreover, pronounced diurnal patterns in the δ(13)C of soil CO(2) efflux were found during the decline of the tracer over 3 weeks. Possible mechanisms include diurnal changes in the relative contributions of autotrophic and heterotrophic soil respiration as well as their respective δ(13)C values. Thus, after accounting for physical back-diffusion, we were able to quantify biological time lags in the coupling of photosynthesis and soil CO(2) efflux in grassland at the diurnal time scale.

Enhanced picture of protein-folding intermediates using organic solvents in H/D exchange and quench-flow experiments

PubMed Central

Nishimura, Chiaki; Dyson, H. Jane; Wright, Peter E.

2005-01-01

Hydrogen/deuterium exchange followed by trapping of the labeled species in the aprotic solvent DMSO has been used to elucidate structure in both the burst-phase molten globule-folding intermediate of apomyoglobin and in an equilibrium intermediate that models the kinetic intermediate. Precise estimates can be made of exchange times in an interrupted exchange-out experiment at pH 4 followed by analysis in DMSO solution, giving extensive sequence-specific information about the structure of the equilibrium intermediate. In addition, the use of DMSO as a solvent for NMR measurements after quench-flow pH-pulse labeling experiments gives a greatly increased data set for the elucidation of the kinetic folding pathway. Interestingly, differences are observed in some regions of apomyoglobin between the equilibrium and kinetic intermediates. These differences are quantitative rather than qualitative; that is, the overall patterns of labeling and secondary structure formation remain similar between the two species. However, local differences are observed, which probably reflect the difference in the solution conditions for the equilibrium experiment (pH 4) vs. the kinetic experiment (pH 6) and the change in the status of the stabilizing hydrogen bond between the side chains of His-24 and His-119. PMID:15769860

CIDME: Short distances measured with long chirp pulses.

PubMed

Doll, Andrin; Qi, Mian; Godt, Adelheid; Jeschke, Gunnar

2016-12-01

Frequency-swept pulses have recently been introduced as pump pulses into double electron-electron resonance (DEER) experiments. A limitation of this approach is that the pump pulses need to be short in comparison to dipolar evolution periods. The "chirp-induced dipolar modulation enhancement" (CIDME) pulse sequence introduced in this work circumvents this limitation by means of longitudinal storage during the application of one single or two consecutive pump pulses. The resulting six-pulse sequence is closely related to the five-pulse "relaxation-induced dipolar modulation enhancement" (RIDME) pulse sequence: While dipolar modulation in RIDME is due to stochastic spin flips during longitudinal storage, modulation in CIDME is due to the pump pulse during longitudinal storage. Experimentally, CIDME is examined for Gd-Gd and nitroxide-nitroxide distance determination using a high-power Q-band spectrometer. Since longitudinal storage results in a 50% signal loss, comparisons between DEER using short chirp pump pulses of 64ns duration and CIDME using longer pump pulses are in favor of DEER. While the lower sensitivity restrains the applicability of CIDME for routine distance determination on high-power spectrometers, this result is not to be generalized to spectrometers having lower power and to specialized "non-routine" applications or different types of spin labels. In particular, the advantage of prolonged CIDME pump pulses is demonstrated for experiments at large frequency offset between the pumped and observed spins. At a frequency separation of 1GHz, where broadening due to dipolar pseudo-secular contributions becomes largely suppressed, a Gd-Gd modulation depth larger than 10% is achieved. Moreover, a CIDME experiment at deliberately reduced power underlines the potential of the new technique for spectrometers with lower power, as often encountered at higher microwave frequencies. With longitudinal storage times T below 10μs, however, CIDME appears rather susceptible to artifacts. For nitroxide-nitroxide experiments, these currently inhibit a faithful data analysis. To facilitate further developments, the artifacts are characterized experimentally. In addition, effects that are specific to the high spin of S=7/2 Gd-centers are examined. Herein, population transfer within the observer spin's multiplet due to the pump pulse as well as excitation of dipolar harmonics are discussed. Copyright © 2016 Elsevier Inc. All rights reserved.

Measurement of Bremsstrahlung radiation for in vivo monitoring of 14C tracer distribution between fruit and roots of kiwifruit (Actinidia arguta) cuttings.

PubMed

Black, Marykate Z; Minchin, Peter E H; Gould, Nick; Patterson, Kevin J; Clearwater, Michael J

2012-10-01

In vivo measurements of (14)C tracer distribution have usually involved monitoring the β(-) particles produced as (14)C decays. These particles are only detectable over short distances, limiting the use of this technique to thin plant material. In the present experiments, X-ray detectors were used to monitor the Bremsstrahlung radiation emitted since β(-) particles were absorbed in plant tissues. Bremsstrahlung radiation is detectable through larger tissue depths. The aim of these experiments was to demonstrate the Bremsstrahlung method by monitoring in vivo tracer-labelled photosynthate partitioning in small kiwifruit (Actinidia arguta (Siebold & Zucc.) Planch. ex Miq.) plants in response to root pruning. A source shoot, consisting of four leaves, was pulse labelled with (14)CO(2). Detectors monitored import into a fruit and the root system, and export from a source leaf. Repeat pulse labelling enabled the comparison of pre- and post-treatment observations within an individual plant. Diurnal trends were observed in the distribution of tracer, with leaf export reduced at night. Tracer accumulated in the roots declined after approximately 48 h, which may have resulted from export of (14)C from the roots in carbon skeletons. Cutting off half the roots did not affect tracer distribution to the remaining half. Tracer distribution to the fruit was increased after root pruning, demonstrating the higher competitive strength of the fruit than the roots for carbohydrate supply. Increased partitioning to the fruit following root pruning has also been demonstrated in kiwifruit field trials.

Theoretical description of RESPIRATION-CP

NASA Astrophysics Data System (ADS)

Nielsen, Anders B.; Tan, Kong Ooi; Shankar, Ravi; Penzel, Susanne; Cadalbert, Riccardo; Samoson, Ago; Meier, Beat H.; Ernst, Matthias

2016-02-01

We present a quintuple-mode operator-based Floquet approach to describe arbitrary amplitude modulated cross polarization experiments under magic-angle spinning (MAS). The description is used to analyze variants of the RESPIRATION approach (RESPIRATIONCP) where recoupling conditions and the corresponding first-order effective Hamiltonians are calculated, validated numerically and compared to experimental results for 15N-13C coherence transfer in uniformly 13C,15N-labeled alanine and in uniformly 2H,13C,15N-labeled (deuterated and 100% back-exchanged) ubiquitin at spinning frequencies of 16.7 and 90.9 kHz. Similarities and differences between different implementations of the RESPIRATIONCP sequence using either CW irradiation or small flip-angle pulses are discussed.

HNCA-TOCSY-CANH experiments with alternate 13C-12C labeling: a set of 3D experiment with unique supra-sequential information for mainchain resonance assignment

PubMed Central

Takeuchi, Koh; Gal, Maayan; Takahashi, Hideo; Shimada, Ichio

2011-01-01

Described here is a set of three-dimensional (3D) NMR experiments that rely on CACA-TOCSY magnetization transfer via the weak 3JCαCα coupling. These pulse sequences, which resemble recently described 13C detected CACA-TOCSY (Takeuchi et al. 2010) experiments, are recorded in 1H2O, and use 1H excitation and detection. These experiments require alternate 13C-12C labeling together with perdeuteration, which allows utilizing the small 3JCαCα scalar coupling that is otherwise masked by the stronger 1JCC couplings in uniformly 13C labeled samples. These new experiments provide a unique assignment ladder-mark that yields bidirectional supra-sequential information and can readily straddle proline residues. Unlike the conventional HNCA experiment, which contains only sequential information to the 13Cα of the preceding residue, the 3D hnCA-TOCSY-caNH experiment can yield sequential correlations to alpha carbons in positions i−1, i + 1 and i−2. Furthermore, the 3D hNca-TOCSY-caNH and Hnca-TOC-SY-caNH experiments, which share the same magnetization pathway but use a different chemical shift encoding, directly couple the 15N-1H spin pair of residue i to adjacent amide protons and nitrogens at positions i−2, i−1, i + 1 and i + 2, respectively. These new experimental features make protein backbone assignments more robust by reducing the degeneracy problem associated with the conventional 3D NMR experiments. PMID:21110064

Singular Value Decomposition Method to Determine Distance Distributions in Pulsed Dipolar Electron Spin Resonance.

PubMed

Srivastava, Madhur; Freed, Jack H

2017-11-16

Regularization is often utilized to elicit the desired physical results from experimental data. The recent development of a denoising procedure yielding about 2 orders of magnitude in improvement in SNR obviates the need for regularization, which achieves a compromise between canceling effects of noise and obtaining an estimate of the desired physical results. We show how singular value decomposition (SVD) can be employed directly on the denoised data, using pulse dipolar electron spin resonance experiments as an example. Such experiments are useful in measuring distances and their distributions, P(r) between spin labels on proteins. In noise-free model cases exact results are obtained, but even a small amount of noise (e.g., SNR = 850 after denoising) corrupts the solution. We develop criteria that precisely determine an optimum approximate solution, which can readily be automated. This method is applicable to any signal that is currently processed with regularization of its SVD analysis.

Optimization of Pulsed-DEER Measurements for Gd-Based Labels: Choice of Operational Frequencies, Pulse Durations and Positions, and Temperature

DOE Office of Scientific and Technical Information (OSTI.GOV)

Raitsimring, A.; Astashkin, A. V.; Enemark, J. H.

2012-12-29

In this work, the experimental conditions and parameters necessary to optimize the long-distance (≥ 60 Å) Double Electron-Electron Resonance (DEER) measurements of biomacromolecules labeled with Gd(III) tags are analyzed. The specific parameters discussed are the temperature, microwave band, the separation between the pumping and observation frequencies, pulse train repetition rate, pulse durations and pulse positioning in the electron paramagnetic resonance spectrum. It was found that: (i) in optimized DEER measurements, the observation pulses have to be applied at the maximum of the EPR spectrum; (ii) the optimal temperature range for Ka-band measurements is 14-17 K, while in W-band the optimalmore » temperatures are between 6-9 K; (iii) W-band is preferable to Ka-band for DEER measurements. Recent achievements and the conditions necessary for short-distance measurements (<15 Å) are also briefly discussed.« less

Does Litomosoides sigmodontis synthesize dimethylethanolamine from choline?

PubMed

Houston, K M; Babayan, S A; Allen, J E; Harnett, W

2008-01-01

Juvenile female Litomosoides sigmodontis secrete a protein (Juv-p120) highly modified with dimethylethanolamine (DMAE). In an attempt to establish the source of this decoration worms were pulsed with [3H]-choline and [3H]-ethanolamine and the radio-isotope labelled products analysed. Both isotope labels were successfully taken up by the worms, as demonstrated by labelling of phospholipids with [3H]-choline, being predominantly incorporated into phosphatidylcholine and [3H]-ethanolamine into phosphatidylethanolamine. Isotope labelling of phosphatidylethanolamine was particularly striking with the worms taking up approximately 30 times as much labelled ethanolamine as choline. It was possible to detect faint labelling of Juv-p120 with [3H]-ethanolamine after prolonged exposure periods but, unlike the situation with the phospholipids, it was much more readily labelled with [3H]-choline. When pulsing with [3H]-ethanolamine it was also possible to detect isotope-labelled phosphatidylcholine, which may ultimately account for the low levels of labelling of Juv-p120. Overall our results raise the previously unconsidered but intriguing possibility that in L. sigmodontis, choline may be the precursor of DMAE.

Small-amplitude backbone motions of the spin-labeled lipopeptide trichogin GA IV in a lipid membrane as revealed by electron spin echo.

PubMed

Syryamina, Victoria N; Isaev, Nikolay P; Peggion, Cristina; Formaggio, Fernando; Toniolo, Claudio; Raap, Jan; Dzuba, Sergei A

2010-09-30

Trichogin GA IV is a lipopeptide antibiotic of fungal origin, which is known to be able to modify the membrane permeability. TOAC nitroxide spin-labeled analogues of this membrane active peptide were investigated in hydrated bilayers of 1-palmitoyl-2-oleoyl-sn-glycero-3-phosphocholine (POPC) by electron spin echo (ESE) spectroscopy. Because the TOAC nitroxide spin label is rigidly attached to the peptide backbone, it may report on the backbone orientational dynamics. The ESE signal in this system is observed below ∼150 K. Previously, three-pulse stimulated ESE was found to be sensitive to two types of orientational motion of spin-labeled POPC lipid bilayers at these temperatures. The first type is fast stochastic librations, with a correlation time on the nanosecond scale (which also manifests itself in a two-pulse primary ESE experiment). The second type is slow millisecond inertial rotations. In the present work, we find that at low molar peptide to lipid ratio (1:200), where the individual peptide molecules are randomly distributed at the membrane surface, the spin labels show only a fast type of motion. At the high molar peptide to lipid ratio (1:20), a slow motion is also observed. Because at this high concentration trichogin GA IV is known to change its orientation from the in-plane topology to the transmembrane disposition, the observed onset of a slow motion may be safely attributed to the dynamics of peptides, which are elongated along the lipid molecules of the membrane. The possible interrelation between this backbone rotational motion of the peptide antibiotic and the membrane leakage is discussed.

Rapid two-dimensional ALSOFAST-HSQC experiment for metabolomics and fluxomics studies: application to a 13C-enriched cancer cell model treated with gold nanoparticles.

PubMed

Schätzlein, Martina Palomino; Becker, Johanna; Schulze-Sünninghausen, David; Pineda-Lucena, Antonio; Herance, José Raul; Luy, Burkhard

2018-04-01

Isotope labeling enables the use of 13 C-based metabolomics techniques with strongly improved resolution for a better identification of relevant metabolites and tracing of metabolic fluxes in cell and animal models, as required in fluxomics studies. However, even at high NMR-active isotope abundance, the acquisition of one-dimensional 13 C and classical two-dimensional 1 H, 13 C-HSQC experiments remains time consuming. With the aim to provide a shorter, more efficient alternative, herein we explored the ALSOFAST-HSQC experiment with its rapid acquisition scheme for the analysis of 13 C-labeled metabolites in complex biological mixtures. As an initial step, the parameters of the pulse sequence were optimized to take into account the specific characteristics of the complex samples. We then applied the fast two-dimensional experiment to study the effect of different kinds of antioxidant gold nanoparticles on a HeLa cancer cell model grown on 13 C glucose-enriched medium. As a result, 1 H, 13 C-2D correlations could be obtained in a couple of seconds to few minutes, allowing a simple and reliable identification of various 13 C-enriched metabolites and the determination of specific variations between the different sample groups. Thus, it was possible to monitor glucose metabolism in the cell model and study the antioxidant effect of the coated gold nanoparticles in detail. Finally, with an experiment time of only half an hour, highly resolved 1 H, 13 C-HSQC spectra using the ALSOFAST-HSQC pulse sequence were acquired, revealing the isotope-position-patterns of the corresponding 13 C-nuclei from carbon multiplets. Graphical abstract Fast NMR applied to metabolomics and fluxomics studies with gold nanoparticles.

Low-frequency pulsed electromagnetic field pretreated bone marrow-derived mesenchymal stem cells promote the regeneration of crush-injured rat mental nerve.

PubMed

Seo, NaRi; Lee, Sung-Ho; Ju, Kyung Won; Woo, JaeMan; Kim, BongJu; Kim, SoungMin; Jahng, Jeong Won; Lee, Jong-Ho

2018-01-01

Bone marrow-derived mesenchymal stem cells (BMSCs) have been shown to promote the regeneration of injured peripheral nerves. Pulsed electromagnetic field (PEMF) reportedly promotes the proliferation and neuronal differentiation of BMSCs. Low-frequency PEMF can induce the neuronal differentiation of BMSCs in the absence of nerve growth factors. This study was designed to investigate the effects of low-frequency PEMF pretreatment on the proliferation and function of BMSCs and the effects of low-frequency PEMF pre-treated BMSCs on the regeneration of injured peripheral nerve using in vitro and in vivo experiments. In in vitro experiments, quantitative DNA analysis was performed to determine the proliferation of BMSCs, and reverse transcription-polymerase chain reaction was performed to detect S100 (Schwann cell marker), glial fibrillary acidic protein (astrocyte marker), and brain-derived neurotrophic factor and nerve growth factor (neurotrophic factors) mRNA expression. In the in vivo experiments, rat models of crush-injured mental nerve established using clamp method were randomly injected with low-frequency PEMF pretreated BMSCs, unpretreated BMSCs or PBS at the injury site (1 × 10 6 cells). DiI-labeled BMSCs injected at the injury site were counted under the fluorescence microscope to determine cell survival. One or two weeks after cell injection, functional recovery of the injured nerve was assessed using the sensory test with von Frey filaments. Two weeks after cell injection, axonal regeneration was evaluated using histomorphometric analysis and retrograde labeling of trigeminal ganglion neurons. In vitro experiment results revealed that low-frequency PEMF pretreated BMSCs proliferated faster and had greater mRNA expression of growth factors than unpretreated BMSCs. In vivo experiment results revealed that compared with injection of unpretreated BMSCs, injection of low-frequency PEMF pretreated BMSCs led to higher myelinated axon count and axon density and more DiI-labeled neurons in the trigeminal ganglia, contributing to rapider functional recovery of injured mental nerve. These findings suggest that low-frequency PEMF pretreatment is a promising approach to enhance the efficacy of cell therapy for peripheral nerve injury repair.

Biosynthetic processing of the oligosaccharide chains of cellular fibronectin.

PubMed

Olden, K; Hunter, V A; Yamada, K M

1980-10-15

We have examined the maturation or processing of the oligosaccharides of cellular fibronectin in cultured chick embryo fibroblasts. Fibronectin was pulse-labeled with [2-3H]mannose of [35S]methionine, and the turnover rates of carbohydrate and polypeptide portions of immunoprecipitated fibronectin were compared. The oligosaccharides on fibronectin were analyzed by gel electrophoresis for alterations in sensitivity to the enzyme endo-beta-N-acetylgluosaminidase H, which specifically cleaves the 'high-mannose' class of asparagine-linked oligosaccharide. Incorporated mannose was removed only at early time points, suggesting that the structure of fibronectin oligosaccharides was altered due to processing. This possibility was confirmed by the analysis of glycopeptides generated by exhaustive pronase digestion. Two major glycopeptide structures were detected; their properties correspond to a 'high-mannose' oligosaccharide precursor and a 'complex' carbohydrate product. The precursor-product relationship of these two forms of oligosaccharide chains was demonstrated by pulse-chase labeling experiments. The precursor glycopeptide had an apparent size (Mr 2100) comparable to (Man)9GlcNAc (Mr 2080), and was sensitive to endo-beta-N-acetylglucosaminidase H; nearly all of the labeled mannose incorporated in a 10 min pulse was released from fibronectin glycopeptides by this enzyme. During a 90 min chase period, the glycopeptides became larger and increasingly resistant to endo-beta-N-acetylglucosaminidase H cleavage. The final 'complex' or processed oligosaccharide structure contained approximately two-thirds less [3H]mannose, was insensitive to endo-beta-N-acetylglucosaminidase H and had an apparent Mr of 2300 as estimated by gel filtration. We conclude that the carbohydrate portion of fibronectin is synthesized as a 'high-mannose' intermediate and is subsequently processed to give the characteristic 'complex' oligosaccharide chains of fibronectin.

Biosynthesis and Intracellular Transport of 11S Globulin in Developing Pumpkin Cotyledons 1

PubMed Central

Hara-Nishimura, Ikuko; Nishimura, Mikio; Akazawa, Takashi

1985-01-01

In vitro studies to explore the biosynthesis of 11S globulin developing cotyledons of pumpkin (Cucurbita sp.) demonstrated that 11S globulin is synthesized on membrane-bound polysomes. Mr of the translation products (preproglobulin) synthesized by the poly(A)+-RNA isolated from developing cotyledons were determined to be 64,000 and 59,000, which are larger than those of the mature globulin subunit (62,000 and 57,000). Preproglobulin is then cotranslationally processed by cleavage of the signal peptide to produce proglobulin. In vivo pulse-chase experiments showed the sequential transformation of the single-chain proglobulin to mature globulin subunit (disulfide-linked doublet polypeptides) indicating posttranslational modification of the proglobulin. Subcellular fractionation of the pulse-chased intact cotyledons showed that the [35S]methionine label is detectable in proglobulin in rough endoplasmic reticulum shortly after the pulse label. With time, the labeled proteins move into other cellular fractions: proglobulin in the density = 1.24 grams per cubic centimeter fractions after 30 minutes and mature globulin subunit associated with protein bodies after 1 to 2 hours. The distribution of proglobulin in sucrose density gradients did not correspond with those of catalase (microbody marker) or fumarase (mitochondria marker). An accumulation of proglobulin occurred in the density = 1.24 grams per cubic centimeter fractions, whereas the mature globulin was scarcely detectable in this fraction. In contrast, proglobulin was not detected by immunochemical blotting analysis in the protein bodies prepared under the mild conditions from cotyledon protoplasts. The results suggest that the d = 1.24 grams per cubic centimeter fractions are engaged in the translocation of proglobulin into the protein bodies. Images Fig. 1 Fig. 2 Fig. 3 Fig. 4 Fig. 5 PMID:16664128

Label-free resistive-pulse cytometry.

PubMed

Chapman, M R; Sohn, L L

2011-01-01

Numerous methods have recently been developed to characterize cells for size, shape, and specific cell-surface markers. Most of these methods rely upon exogenous labeling of the cells and are better suited for large cell populations (>10,000). Here, we review a label-free method of characterizing and screening cells based on the Coulter-counter technique of particle sizing: an individual cell transiting a microchannel (or "pore") causes a downward pulse in the measured DC current across that "pore". Pulse magnitude corresponds to the cell size, pulse width to the transit time needed for the cell to pass through the pore, and pulse shape to how the cell traverses across the pore (i.e., rolling or tumbling). When the pore is functionalized with an antibody that is specific to a surface-epitope of interest, label-free screening of a specific marker is possible, as transient binding between the two results in longer time duration than when the pore is unfunctionalized or functionalized with a nonspecific antibody. While this method cannot currently compete with traditional technology in terms of throughput, there are a number of applications for which this technology is better suited than current commercial cytometry systems. Applications include the rapid and nondestructive analysis of small cell populations (<100), which is not possible with current technology, and a platform for providing true point-of-care clinical diagnostics, due to the simplicity of the device, low manufacturing costs, and ease of use. Copyright © 2011 Elsevier Inc. All rights reserved.

High temporal resolution tracing of up-and downward carbon transport in oak trees

NASA Astrophysics Data System (ADS)

Bloemen, Jasper; Ingrisch, Johannes; Bahn, Michael

2017-04-01

Carbon (C) allocation defines the flows of C between plant organs and their storage pools and metabolic processes and is therefore considered as an important determinant of forest C budgets and their responses to climate change. In trees, assimilates derived from leaf photosynthesis are transported via the phloem to above- and belowground sink tissues, where partitioning between growth, storage, and respiration occurs. At the same time, root- and aboveground respired CO2 can be dissolved in water and transported in the xylem tissue, thereby representing a secondary C flux of large magnitude. The relative magnitude of both fluxes in a same set of trees and their concurrent role in C allocation remains unclear. In this study, we 13C pulse labeled five year old potted oak (Quercus rubra) trees to investigate both the role of C transport via the phloem and xylem in C allocation. To this end trees were randomly assigned to two 13C labeling experiments: 1) a canopy labeling experiment using transparent canopy chambers and 2) a stem labeling experiment based on the infusion of 13C labeled water in the stem base. We used high-resolution laser-based measurements of the isotopic composition of stem and soil CO2 efflux to monitor both the down-and upward transport of 13C label. Additional tissue samples at stem, canopy and root level were analyzed to validate the assimilation of the label in tree tissues during transport. Overall, after both labeling experiments enrichment was observed in both stem and soil CO2 efflux, showing that the 13C label was removed from both xylem and phloem transport during up- and downward transport, respectively. Higher enrichments of CO2 efflux were observed after stem labeling as compared to canopy labeling, which implies that xylem transport strongly contributes to C lost to the atmosphere. This study is the first to show combined results from tracing of xylem and phloem transport of C for a same set of trees at high temporal resolution using a 13C labeling approach. Moreover, they extend results from previous studies on the tracing of phloem transport in trees to a tracing of both xylem and canopy transport as well as results from studies on the internal CO2 transport in species with high transpiration rates like poplar to species with lower transpiration rates like oak. The results further demonstrate the complex interplay of phloem and xylem transport of carbon and its role for the emission of respired CO2 from trees into the atmosphere.

Differential Protein Composition and Gene Expression in Leaf Mesophyll Cells and Bundle Sheath Cells of the C(4) Plant Digitaria sanguinalis (L.) Scop.

PubMed

Potter, J W; Black, C C

1982-08-01

The distribution and molecular weights of cellular proteins in soluble and membrane-associated locations were analyzed using sodium dodecyl sulfate-polyacrylamide gel electrophoresis and Coomassie blue staining of leaf (Digitaria sanguinalis L. Scop.) extracts and isolated cell extracts. Leaf polypeptides also were pulse-labeled, followed by isolation of the labeled leaf cell types and analysis of the newly synthesized polypeptides in each cell type by electrophoresis and fluorography.Comparison of the electrophoretic patterns of crabgrass whole leaf polypeptides with isolated cell-type polypeptides indicated a difference in protein distribution patterns for the two cell types. The mesophyll cells exhibited a greater allocation of total cellular protein into membrane-associated proteins relative to soluble proteins. In contrast, the bundle sheath cells exhibited a higher percentage of total cellular protein in soluble proteins. Phosphoenolpyruvate carboxylase was the major soluble protein in the mesophyll cell and ribulose bisphosphate carboxylase was the major soluble protein in the bundle sheath cell. The majority of in vivo(35)S-pulse-labeled proteins synthesized by the two crabgrass cell types corresponded in molecular weight to the proteins present in the cell types which were detected by conventional staining techniques. The bundle sheath cell and mesophyll cell fluorograph profiles each had 15 major (35)S-labeled proteins. The major incorporation of (35)S by bundle sheath cells was into products which co-electrophoresed with the large and small subunits of ribulose bisphosphate carboxylase. In contrast, a major (35)S-labeled product in mesophyll cell extracts co-electrophoresed with the subunit of phosphoenolpyruvate carboxylase. Both cell types exhibited equivalent in vivo labeling of a polypeptide with one- and two-dimensional electrophoretic behavior similar to the major apoprotein of the light-harvesting chlorophyll a/b protein. Results from the use of protein synthesis inhibitors during pulse-labeling experiments indicated intercellular differences in both organelle and cytoplasmic protein synthesis. A majority of the (35)S incorporation by crabgrass mesophyll cell 70S ribosomes was associated with a pair of membrane-associated polypeptides of molecular weight 32,000 and 34,500; a comparison of fluorograph and stained gel profiles suggests these products resemble the precursor and mature forms of the maize chloroplast 32,000 dalton protein reported by Grebanier et al. (1978 J. Cell Biol. 28:734-746). In contrast, crabgrass bundle sheath cell organelle translation was directed predominantly into a product which co-electrophoresed with the large subunit of ribulose bisphosphate carboxylase.

Tracking the fate of nitrate through pulse-flow wetlands: A mesocosm scale 15N enrichment tracer study

USGS Publications Warehouse

Messer, Tiffany L.; Burchell, Michael R.; Böhlke, John Karl; Tobias, Craig R.

2017-01-01

Quantitative information about the fate of applied nitrate (NO3-N) in pulse-flow constructed wetlands is essential for designing wetland treatment systems and assessing their nitrogen removal services for agricultural and stormwater applications. Although many studies have documented NO3-N losses in wetlands, controlled experiments indicating the relative importance of different processes and N sinks are scarce. In the current study, 15NO3-N isotope enrichment tracer experiments were conducted in wetland mesocosms of two different wetland soil types at two realistic agricultural NO3-N source loads. The 15N label was traced from the source NO3-N into plant biomass, soil (including organic matter and ammonium), and N-gas constituents over 7–10 day study periods. All sinks responded positively to higher NO3-N loading. Plant uptake exceeded denitrification 2–3 fold in the low NO3-N loading experiments, while both fates were nearly equivalent in the high loading experiments. One to two years later, soils largely retained the assimilated tracer N, whereas plants had lost much of it. Results demonstrated that plant and microbial assimilation in the soil (temporary N sinks) can exceed denitrification (permanent N loss) in pulse-flow environments and must be considered by wetland designers and managers for optimizing nitrogen removal potential.

Analysis of dofA, a fruA-dependent developmental gene, and its homologue, dofB, in Myxococcus xanthus.

PubMed

Horiuchi, Takayuki; Akiyama, Takuya; Inouye, Sumiko; Komano, Teruya

2002-12-01

The developmentally regulated gene dofA, identified from pulse-labeling experiments by two-dimensional gel electrophoresis, and its homologue, dofB, were cloned and characterized in Myxococcus xanthus. Deletion of dofA and dofB did not affect the vegetative growth and development of M. xanthus. dofA was specifically expressed during development, while dofB expression was observed during vegetative growth and development. The dofA-lacZ fusion was introduced into a fruA mutant and A, B, C, D, and E extracellular signal mutants. The pattern of dofA expression in the C signal mutant was similar to that of the wild-type strain, while dofA expression was not detected in the fruA mutant. These results are consistent with those of the pulse-labeling experiments. dofA expression was reduced in A and E signal mutants, whereas dofA expression was delayed in B and D signal mutants. The patterns of expression of the dofA gene in the fruA mutant and the five signal mutants are strikingly similar to that of the tps gene, which encodes protein S, a major component of the outer surface of the myxospore; this result suggests that the dofA and tps genes are similarly regulated. The involvement of a highly GC-rich inverted repeat sequence (underlined), CGGCCCCCGATTCGTCGGGGGCCG, in developmentally regulated dofA expression is suggested.

Rare isotope studies involving catalytic oxidation of CO over platinum-tin oxide

NASA Technical Reports Server (NTRS)

Upchurch, Billy T.; Wood, George M., Jr.; Hess, Robert V.; Hoyt, Ronald F.

1987-01-01

Results of studies utilizing normal and rare oxygen isotopes in the catalytic oxidation of carbon monoxide over a platinum-tin oxide catalyst substrate are presented. Chemisorption of labeled carbon monoxide on the catalyst followed by thermal desorption yielded a carbon dioxide product with an oxygen-18 composition consistent with the formation of a carbonate-like intermediate in the chemisorption process. The efficacy of a method developed for the oxygen-18 labeling of the platinum-tin oxide catalyst surface for use in closed cycle pulsed care isotope carbon dioxide lasers is demonstrated for the equivalent of 10 to the 6th power pulses at 10 pulses per second.

Advanced cardiac chemical exchange saturation transfer (cardioCEST) MRI for in vivo cell tracking and metabolic imaging

PubMed Central

Pumphrey, Ashley; Yang, Zhengshi; Ye, Shaojing; Powell, David K.; Thalman, Scott; Watt, David S.; Abdel-Latif, Ahmed; Unrine, Jason; Thompson, Katherine; Fornwalt, Brandon; Ferrauto, Giuseppe; Vandsburger, Moriel

2016-01-01

An improved pre-clinical cardiac chemical exchange saturation transfer (CEST) pulse sequence (cardioCEST) was used to selectively visualize paramagnetic CEST (paraCEST)-labeled cells following intramyocardial implantation. In addition, cardioCEST was used to examine the effect of diet-induced obesity upon myocardial creatine CEST contrast. CEST pulse sequences were designed from standard turbo-spin-echo and gradient-echo sequences, and a cardiorespiratory-gated steady-state cine gradient-echo sequence. In vitro validation studies performed in phantoms composed of 20mM Eu-HPDO3A, 20mM Yb-HPDO3A, or saline demonstrated similar CEST contrast by spin-echo and gradient-echo pulse sequences. Skeletal myoblast cells (C2C12) were labeled with either Eu-HPDO3A or saline using a hypotonic swelling procedure and implanted into the myocardium of C57B6/J mice. Inductively coupled plasma mass spectrometry confirmed cellular levels of Eu of 2.1 × 10−3 ng/cell in Eu-HPDO3A-labeled cells and 2.3 × 10−5 ng/cell in saline-labeled cells. In vivo cardioCEST imaging of labeled cells at ±15ppm was performed 24 h after implantation and revealed significantly elevated asymmetric magnetization transfer ratio values in regions of Eu-HPDO3A-labeled cells when compared with surrounding myocardium or saline-labeled cells. We further utilized the cardioCEST pulse sequence to examine changes in myocardial creatine in response to diet-induced obesity by acquiring pairs of cardioCEST images at ±1.8 ppm. While ventricular geometry and function were unchanged between mice fed either a high-fat diet or a corresponding control low-fat diet for 14 weeks, myocardial creatine CEST contrast was significantly reduced in mice fed the high-fat diet. The selective visualization of paraCEST-labeled cells using cardioCEST imaging can enable investigation of cell fate processes in cardioregenerative medicine, or multiplex imaging of cell survival with imaging of cardiac structure and function and additional imaging of myocardial creatine. PMID:26684053

Testing the optimal defence hypothesis for two indirect defences: extrafloral nectar and volatile organic compounds

PubMed Central

Radhika, Venkatesan; Kost, Christian; Bartram, Stefan; Heil, Martin

2008-01-01

Many plants respond to herbivory with an increased production of extrafloral nectar (EFN) and/or volatile organic compounds (VOCs) to attract predatory arthropods as an indirect defensive strategy. In this study, we tested whether these two indirect defences fit the optimal defence hypothesis (ODH), which predicts the within-plant allocation of anti-herbivore defences according to trade-offs between growth and defence. Using jasmonic acid-induced plants of Phaseolus lunatus and Ricinus communis, we tested whether the within-plant distribution pattern of these two indirect defences reflects the fitness value of the respective plant parts. Furthermore, we quantified photosynthetic rates and followed the within-plant transport of assimilates with 13C labelling experiments. EFN secretion and VOC emission were highest in younger leaves. Moreover, the photosynthetic rate increased with leaf age, and pulse-labelling experiments suggested transport of carbon to younger leaves. Our results demonstrate that the ODH can explain the within-plant allocation pattern of both indirect defences studied. PMID:18493790

Recording 13C-15N HMQC 2D sparse spectra in solids in 30 s

NASA Astrophysics Data System (ADS)

Kupče, Ēriks; Trébosc, Julien; Perrone, Barbara; Lafon, Olivier; Amoureux, Jean-Paul

2018-03-01

We propose a dipolar HMQC Hadamard-encoded (D-HMQC-Hn) experiment for fast 2D correlations of abundant nuclei in solids. The main limitation of the Hadamard methods resides in the length of the encoding pulses, which results from a compromise between the selectivity and the sensitivity due to losses. For this reason, these methods should mainly be used with sparse spectra, and they profit from the increased separation of the resonances at high magnetic fields. In the case of the D-HMQC-Hn experiments, we give a simple rule that allows directly setting the optimum length of the selective pulses, versus the minimum separation of the resonances in the indirect dimension. The demonstration has been performed on a fully 13C,15N labelled f-MLF sample, and it allowed recording the build-up curves of the 13C-15N cross-peaks within 10 min. However, the method could also be used in the case of less sensitive samples, but with more accumulations.

Short-term carbon dynamics in a temperate heathland upon six years of exposure to elevated CO2 concentration, drought and warming: Evidence from an in-situ 13CO2 pulse-chase experiment

NASA Astrophysics Data System (ADS)

Ambus, P.; Reinsch, S.; Sárossy, Z.; Egsgaard, H.; Jakobsen, I.; Michelsen, A.; Schmidt, I.; Nielsen, P.

2013-12-01

An in-situ 13CO2 pulse-labeling experiment was carried out in a temperate heathland (8 oC MAT, 610 mm MAP) to study the impact on short-term carbon (C) allocation as affected by elevated CO2 concentration (+120 ppm), prolonged summer droughts (ca. -43 mm) and warming (+1 oC). The study was carried out six years after the climate treatments were initiated and took place in the early growing season in May in vegetation dominated by grasses, mainly Deschampsia flexuosa. Newly assimilated C (13C from the pulse-label) was traced into vegetation, soil and soil microorganisms and belowground respiration 1, 2 and 8 days after pulse-labeling. The importance of the microbial community in C utilization was investigated using 13C enrichment patterns in different microbial functional groups on the basis of phospholipid fatty acid (PLFA) profiles. Climate treatments did not affect microorganism abundance in soil or rhizosphere fractions in terms of total PLFA-C concentration. Elevated CO2 significantly reduced the abundance of gram-negative bacteria (17:0cy), but did not affect the abundance of decomposers (fungi and actinomycetes) in rhizosphere fractions. Drought favored the bacterial community in rhizosphere fractions whereas warming reduced the abundance of gram-negative bacteria (19:0cy) and changed the actinomycetes community (10Me16:0, 10Me18:0). Fastest and highest utilization of recently assimilated C was observed in rhizosphere associated gram-negative bacteria followed by gram-positive bacteria. The utilization of recently assimilated C by the microbial community was faster under elevated CO2 conditions compared to ambient. The 13C assimilation by green plant tissue and translocation to roots was significantly reduced by the extended summer drought. Under elevated CO2 conditions we observed an increased amount of 13C in the litter fraction. The assimilation of 13C by vegetation was not changed when the climate factors were applied in combination. The total amount of 13C lost by belowground respiration was not altered by the climatic manipulations. We conclude that six years of changed climatic conditions have affected the temporal and functional pattern of C utilization by the soil microorganisms towards increased C cycling mainly caused by bacterial activity. This change may potentially alter the ecosystem C balance. Meanwhile, the short-term C balance was not affected by six years of environmental changes, which suggests substantial ecosystem resilience.

Temporal Profiling and Pulsed SILAC Labeling Identify Novel Secreted Proteins During Ex Vivo Osteoblast Differentiation of Human Stromal Stem Cells*

PubMed Central

Kristensen, Lars P.; Chen, Li; Nielsen, Maria Overbeck; Qanie, Diyako W.; Kratchmarova, Irina; Kassem, Moustapha; Andersen, Jens S.

2012-01-01

It is well established that bone forming cells (osteoblasts) secrete proteins with autocrine, paracrine, and endocrine function. However, the identity and functional role for the majority of these secreted and differentially expressed proteins during the osteoblast (OB) differentiation process, is not fully established. To address these questions, we quantified the temporal dynamics of the human stromal (mesenchymal, skeletal) stem cell (hMSC) secretome during ex vivo OB differentiation using stable isotope labeling by amino acids in cell culture (SILAC). In addition, we employed pulsed SILAC labeling to distinguish genuine secreted proteins from intracellular contaminants. We identified 466 potentially secreted proteins that were quantified at 5 time-points during 14-days ex vivo OB differentiation including 41 proteins known to be involved in OB functions. Among these, 315 proteins exhibited more than 2-fold up or down-regulation. The pulsed SILAC method revealed a strong correlation between the fraction of isotope labeling and the subset of proteins known to be secreted and involved in OB differentiation. We verified SILAC data using qRT-PCR analysis of 9 identified potential novel regulators of OB differentiation. Furthermore, we studied the biological effects of one of these proteins, the hormone stanniocalcin 2 (STC2) and demonstrated its autocrine effects in enhancing osteoblastic differentiation of hMSC. In conclusion, combining complete and pulsed SILAC labeling facilitated the identification of novel factors produced by hMSC with potential role in OB differentiation. Our study demonstrates that the secretome of osteoblastic cells is more complex than previously reported and supports the emerging evidence that osteoblastic cells secrete proteins with endocrine functions and regulate cellular processes beyond bone formation. PMID:22801418

Analysis of dofA, a fruA-Dependent Developmental Gene, and Its Homologue, dofB, in Myxococcus xanthus

PubMed Central

Horiuchi, Takayuki; Akiyama, Takuya; Inouye, Sumiko; Komano, Teruya

2002-01-01

The developmentally regulated gene dofA, identified from pulse-labeling experiments by two-dimensional gel electrophoresis, and its homologue, dofB, were cloned and characterized in Myxococcus xanthus. Deletion of dofA and dofB did not affect the vegetative growth and development of M. xanthus. dofA was specifically expressed during development, while dofB expression was observed during vegetative growth and development. The dofA-lacZ fusion was introduced into a fruA mutant and A, B, C, D, and E extracellular signal mutants. The pattern of dofA expression in the C signal mutant was similar to that of the wild-type strain, while dofA expression was not detected in the fruA mutant. These results are consistent with those of the pulse-labeling experiments. dofA expression was reduced in A and E signal mutants, whereas dofA expression was delayed in B and D signal mutants. The patterns of expression of the dofA gene in the fruA mutant and the five signal mutants are strikingly similar to that of the tps gene, which encodes protein S, a major component of the outer surface of the myxospore; this result suggests that the dofA and tps genes are similarly regulated. The involvement of a highly GC-rich inverted repeat sequence (underlined), CGGCCCCCGATTCGTCGGGGGCCG, in developmentally regulated dofA expression is suggested. PMID:12446630

Evaluating the Community Land Model in a pine stand with shading manipulations and 13CO2 labeling

NASA Astrophysics Data System (ADS)

Mao, J.; Ricciuto, D. M.; Thornton, P. E.; Warren, J. M.; King, A. W.; Shi, X.; Iversen, C. M.; Norby, R. J.

2016-02-01

Carbon allocation and flow through ecosystems regulates land surface-atmosphere CO2 exchange and thus is a key, albeit uncertain, component of mechanistic models. The Partitioning in Trees and Soil (PiTS) experiment-model project tracked carbon allocation through a young Pinus taeda stand following pulse labeling with 13CO2 and two levels of shading. The field component of this project provided process-oriented data that were used to evaluate terrestrial biosphere model simulations of rapid shifts in carbon allocation and hydrological dynamics under varying environmental conditions. Here we tested the performance of the Community Land Model version 4 (CLM4) in capturing short-term carbon and water dynamics in relation to manipulative shading treatments and the timing and magnitude of carbon fluxes through various compartments of the ecosystem. When calibrated with pretreatment observations, CLM4 was capable of closely simulating stand-level biomass, transpiration, leaf-level photosynthesis, and pre-labeling 13C values. Over the 3-week treatment period, CLM4 generally reproduced the impacts of shading on soil moisture changes, relative change in stem carbon, and soil CO2 efflux rate. Transpiration under moderate shading was also simulated well by the model, but even with optimization we were not able to simulate the high levels of transpiration observed in the heavy shading treatment, suggesting that the Ball-Berry conductance model is inadequate for these conditions. The calibrated version of CLM4 gave reasonable estimates of label concentration in phloem and in soil surface CO2 after 3 weeks of shade treatment, but it lacks the mechanisms needed to track the labeling pulse through plant tissues on shorter timescales. We developed a conceptual model for photosynthate transport based on the experimental observations, and we discussed conditions under which the hypothesized mechanisms could have an important influence on model behavior in larger-scale applications. Implications for future experimental studies are described, some of which are already being implemented in follow-on studies.

Intersubunit distances in full-length, dimeric, bacterial phytochrome Agp1, as measured by pulsed electron-electron double resonance (PELDOR) between different spin label positions, remain unchanged upon photoconversion.

PubMed

Kacprzak, Sylwia; Njimona, Ibrahim; Renz, Anja; Feng, Juan; Reijerse, Edward; Lubitz, Wolfgang; Krauss, Norbert; Scheerer, Patrick; Nagano, Soshichiro; Lamparter, Tilman; Weber, Stefan

2017-05-05

Bacterial phytochromes are dimeric light-regulated histidine kinases that convert red light into signaling events. Light absorption by the N-terminal photosensory core module (PCM) causes the proteins to switch between two spectrally distinct forms, Pr and Pfr, thus resulting in a conformational change that modulates the C-terminal histidine kinase region. To provide further insights into structural details of photoactivation, we investigated the full-length Agp1 bacteriophytochrome from the soil bacterium Agrobacterium fabrum using a combined spectroscopic and modeling approach. We generated seven mutants suitable for spin labeling to enable application of pulsed EPR techniques. The distances between attached spin labels were measured using pulsed electron-electron double resonance spectroscopy to probe the arrangement of the subunits within the dimer. We found very good agreement of experimental and calculated distances for the histidine-kinase region when both subunits are in a parallel orientation. However, experimental distance distributions surprisingly showed only limited agreement with either parallel- or antiparallel-arranged dimer structures when spin labels were placed into the PCM region. This observation indicates that the arrangements of the PCM subunits in the full-length protein dimer in solution differ significantly from that in the PCM crystals. The pulsed electron-electron double resonance data presented here revealed either no or only minor changes of distance distributions upon Pr-to-Pfr photoconversion. © 2017 by The American Society for Biochemistry and Molecular Biology, Inc.

Translocation in Polytrichum commune (Bryophyta) I. Conduction and allocation of photoassimilates

DOE Office of Scientific and Technical Information (OSTI.GOV)

Thomas, R.J.; Schiele, E.M.; Scheirer, D.C.

1988-02-01

Leafy stems and connecting underground rhizomes of Polytrichum commune Hedw. contain leptome tissues similar in structure to phloem. Isolated stems in clonal groupings were pulse labelled with {sup 14}CO{sub 2}. Labelled sugar, mostly sucrose, glucose, and fructose, appeared in the pulse labelled stems 30 min after treatment. A small amount (3.3%) of labelled sugar was transported to neighboring stems. Silver grain deposition in microautoradiographs of interconnecting rhizomes occurred predominantly over leptome tissues. Increased amounts of translocated radioactivity appeared in starch and cell wall polysaccharide pools one week and six weeks after treatment. These results (1) indicate that transport of photoassimilatemore » occurs through the leptome of perennating rhizomes, (2) demonstrate that translocated carbon is subsequently utilized or stored, and (3) raise important questions about the significance of long distance transport in the life strategy of this complex clonal moss.« less

Pulsed arterial spin labeling using TurboFLASH with suppression of intravascular signal.

PubMed

Pell, Gaby S; Lewis, David P; Branch, Craig A

2003-02-01

Accurate quantification of perfusion with the ADC techniques requires the suppression of the majority of the intravascular signal. This is normally achieved with the use of diffusion gradients. The TurboFLASH sequence with its ultrashort repetition times is not readily amenable to this scheme. This report demonstrates the implementation of a modified TurboFLASH sequence for FAIR imaging. Intravascular suppression is achieved with a modified preparation period that includes a driven equilibrium Fourier transform (DEFT) combination of 90 degrees-180 degrees-90 degrees hard RF pulses subsequent to the inversion delay. These pulses rotate the perfusion-prepared magnetization into the transverse plane where it can experience the suitably placed diffusion gradients before being returned to the longitudinal direction by the second 90 degrees pulse. A value of b = 20-30 s/mm(2) was thereby found to suppress the majority of the intravascular signal. For single-slice perfusion imaging, quantification is only slightly modified. The technique can be readily extended to multislice acquisition if the evolving flow signal after the DEFT preparation is considered. An advantage of the modified preparation scheme is evident in the multislice FAIR images by the preservation of the sign of the magnetization difference. Copyright 2003 Wiley-Liss, Inc.

Determinants of [Cl−] in recycling and late endosomes and Golgi complex measured using fluorescent ligands

PubMed Central

Sonawane, N.D.; Verkman, A.S.

2003-01-01

Chloride concentration ([Cl−]) was measured in defined organellar compartments using fluorescently labeled transferrin, α2-macroglobulin, and cholera toxin B-subunit conjugated with Cl−-sensitive and -insensitive dyes. In pulse-chase experiments, [Cl−] in Tf-labeled early/recycling endosomes in J774 cells was 20 mM just after internalization, increasing to 41 mM over ∼10 min in parallel to a drop in pH from 6.91 to 6.05. The low [Cl−] just after internalization (compared with 137 mM solution [Cl−]) was prevented by reducing the interior-negative Donnan potential. [Cl−] in α2-macroglobulin–labeled endosomes, which enter a late compartment, increased from 28 to 58 mM at 1–45 min after internalization, whereas pH decreased from 6.85 to 5.20. Cl− accumulation was prevented by bafilomycin but restored by valinomycin. A Cl− channel inhibitor slowed endosomal acidification and Cl− accumulation by ∼2.5-fold. [Cl−] was 49 mM and pH was 6.42 in cholera toxin B subunit–labeled Golgi complex in Vero cells; Golgi compartment Cl− accumulation and acidification were reversed by bafilomycin. Our experiments provide evidence that Cl− is the principal counter ion accompanying endosomal and Golgi compartment acidification, and that an interior-negative Donnan potential is responsible for low endosomal [Cl−] early after internalization. We propose that reduced [Cl−] and volume in early endosomes permits endosomal acidification and [Cl−] accumulation without lysis. PMID:12668661

Biosynthesis and maturation of cellular membrane glycoproteins.

PubMed

Hunt, L A

1979-01-01

The biosynthesis and the processing of asparagine-linked oligosaccharides of cellular membrane glycoproteins were examined in monolayer cultures of BHK21 cells and human diploid fibroblasts after pulse- and pulse-chase labeling with [2-3H]mannose. After pronase digestion, radiolabeled glycopeptides were characterized by high-resolution gel filtration, with or without additional digestion with various exoglycosidases and endoglycosidases. Pulse-labeled glycoproteins contained a relatively homogenous population of neutral oligosaccharides (major species: Man9GlcNAc2ASN). The vast majority of these asparagine-linked oligosaccharides was smaller than the major fraction of lipid-linked oligosaccharides from the cell and was apparently devoid of terminal glucose. After pulse-chase or long labeling periods, a significant fraction of the large oligomannosyl cores was processed by removal of mannose units and addition of branch sugars (NeuNAc-Gal-GlcNAc), resulting in complex acidic structures containing three and possibly five mannoses. In addition, some of the large oligomannosyl cores were processed by the removal of only several mannoses, resulting in a mixture of neutral structures with 5-9 mannoses. This oligomannosyl core heterogeneity in both neutral and acidic oligosaccharides linked to asparagine in cellular membrane glycoproteins was analogous to the heterogeneity reported for the oligosaccharides of avian RNA tumor virus glycoproteins (Hunt LA, Wright SE, Etchison JR, Summers DF: J Virol 29:336, 1979).

Detection and characterization of serine and threonine hydroxyl protons in Bacillus circulans xylanase by NMR spectroscopy.

PubMed

Brockerman, Jacob A; Okon, Mark; McIntosh, Lawrence P

2014-01-01

Hydroxyl protons on serine and threonine residues are not well characterized in protein structures determined by both NMR spectroscopy and X-ray crystallography. In the case of NMR spectroscopy, this is in large part because hydroxyl proton signals are usually hidden under crowded regions of (1)H-NMR spectra and remain undetected by conventional heteronuclear correlation approaches that rely on strong one-bond (1)H-(15)N or (1)H-(13)C couplings. However, by filtering against protons directly bonded to (13)C or (15)N nuclei, signals from slowly-exchanging hydroxyls can be observed in the (1)H-NMR spectrum of a uniformly (13)C/(15)N-labeled protein. Here we demonstrate the use of a simple selective labeling scheme in combination with long-range heteronuclear scalar correlation experiments as an easy and relatively inexpensive way to detect and assign these hydroxyl proton signals. Using auxtrophic Escherichia coli strains, we produced Bacillus circulans xylanase (BcX) labeled with (13)C/(15)N-serine or (13)C/(15)N-threonine. Signals from two serine and three threonine hydroxyls in these protein samples were readily observed via (3)JC-OH couplings in long-range (13)C-HSQC spectra. These scalar couplings (~5-7 Hz) were measured in a sample of uniformly (13)C/(15)N-labeled BcX using a quantitative (13)C/(15)N-filtered spin-echo difference experiment. In a similar approach, the threonine and serine hydroxyl hydrogen exchange kinetics were measured using a (13)C/(15)N-filtered CLEANEX-PM pulse sequence. Collectively, these experiments provide insights into the structural and dynamic properties of several serine and threonine hydroxyls within this model protein.

Multimodal nonlinear imaging of arabidopsis thaliana root cell

NASA Astrophysics Data System (ADS)

Jang, Bumjoon; Lee, Sung-Ho; Woo, Sooah; Park, Jong-Hyun; Lee, Myeong Min; Park, Seung-Han

2017-07-01

Nonlinear optical microscopy has enabled the possibility to explore inside the living organisms. It utilizes ultrashort laser pulse with long wavelength (greater than 800nm). Ultrashort pulse produces high peak power to induce nonlinear optical phenomenon such as two-photon excitation fluorescence (TPEF) and harmonic generations in the medium while maintaining relatively low average energy pre area. In plant developmental biology, confocal microscopy is widely used in plant cell imaging after the development of biological fluorescence labels in mid-1990s. However, fluorescence labeling itself affects the sample and the sample deviates from intact condition especially when labelling the entire cell. In this work, we report the dynamic images of Arabidopsis thaliana root cells. This demonstrates the multimodal nonlinear optical microscopy is an effective tool for long-term plant cell imaging.

DNA hybridization detection on electrical microarrays using coulostatic pulse technique.

PubMed

Dharuman, V; Nebling, E; Grunwald, T; Albers, J; Blohm, L; Elsholz, B; Wörl, R; Hintsche, R

2006-12-15

We demonstrated a novel application of transient coulostatic pulse technique for the detection of label free DNA hybridization on nm-sized gold interdigitated ultramicroelectrode arrays (Au-IDA) made in silicon technology. The array consists of eight different positions with an Au-IDA pair at each position arranged on the Si-based Biochip. Immobilization of capture probes onto the Au-IDA was accomplished by self-assembling of thiol-modified oligonucleotides. Target hybridization was indicated by a change in the magnitude of the time dependant potential relaxation curve in presence of electroactive Fe(CN)(6)(3-) in the phosphate buffer solution. While complementary DNA hybridization showed 50% increase in the relaxation potential, the non-complementary DNA showed a negligible change. A constant behaviour was noted for all positions. The dsDNA specific intercalating molecule, methylene blue, was found to be enhancing the discrimination effect. The changes in the relaxation potential curves were further corroborated following the ELISA like experiments using ExtraAvidine alkaline phosphatase labelling and redox recycling of para-aminophenol phosphate at IDAs. The coulostatic pulse technique was shown to be useful for identifying DNA sequences from brain tumour gene CK20, human herpes simplex virus, cytomegalovirus, Epstein-Barr virus and M13 phage. Compared to the hybridization of short chain ONTs (27 mers), the hybridization of long chain M13 phage DNA showed three times higher increase in the relaxation curves. The method is fast enough to monitor hybridization interactions in milli or microsecond time scales and is well suitable for miniaturization and integration compared to the common impedance techniques for developing capacitative DNA sensors.

Glyphosate catabolism by Pseudomonas sp

DOE Office of Scientific and Technical Information (OSTI.GOV)

Shinabarger, D.L.

1986-01-01

The pathway for the degradation of glyphosate (N-phosphonomethylglycine) by Pseudomonas sp. PG2982 has been determined using metabolic radiolabeling experiments. Radiorespirometry experiments utilizing (3-/sup 14/C) glyphosate revealed that approximately 50-59% of the C3 carbon was oxidized to CO/sub 2/. Fractionation of stationary phase cells labeled with (3-/sup 14/C)glyphosate revealed that from 45-47% of the assimilated C3 carbon is distributed to proteins and that amino acids methionine and serine are highly labeled. The nucleic acid bases adenine and guanine received 90% of the C3 label that was incorporated into nucleic acids, and the only pyrimidine base labeled was thymine. Pulse labeling ofmore » PG2982 cells with (3-/sup 14/C)glyphosate revealed that (3-/sup 14/C)sarcosine is an intermediate in glyphosate degradation. Examination of crude extracts prepared from PG2982 cells revealed the presence of an enzyme that oxidizes sarcosine to glycine and formaldehyde. These results indicate that the first step in glyphosate degradation by PG2982 is cleavage of the carbon-phosphorus bond, resulting in the release of sarcosine and a phosphate group. The phosphate group is utilized as a source of phosphorus, and the sarcosine is degraded to glycine and formaldehyde. Phosphonate utilization by Pseudomonas sp. PG2982 was investigated. Each of the ten phosphonates tested were utilized as a sole source of phosphorus by PG2982. Representative compounds tested included alkylphosphonates, 1-amino-substituted alkylphosphonates, amino-terminal phosphonates, and an arylphosphonate. PG2982 cultures degraded phenylphosphonate to benzene and produced methane from methylphosphonate. The data indicate that PG2982 is capable of cleaving the carbon-phosphorus bond of several structurally different phosphonates.« less

Laser-induced forward transfer for printed electronics applications

NASA Astrophysics Data System (ADS)

Fernández-Pradas, J. M.; Sopeña, P.; González-Torres, S.; Arrese, J.; Cirera, A.; Serra, P.

2018-02-01

Laser-induced forward transfer (LIFT) is a printing technique based on the action of a laser pulse that is focused on a thin film of a precursor ink for getting the transfer of a droplet onto a receiver substrate. The experiments presented in this article aim to demonstrate the ability of LIFT to produce electronic circuits on paper, a substrate that is flexible, cheap and recyclable. Tests were conducted to study the printing of conductive tracks with an Ag ink. The printing of a suspension of carbon nanofibers was also studied to demonstrate the ability of LIFT for printing inks with particles with some microns in size that provoke inkjet nozzles to clog. As a proof-of-concept of the LIFT possibilities, both inks were used to print entirely by LIFT a functional humidity sensor on a piece of paper. All the LIFT experiments were performed with a Nd:YAG laser that delivers pulses of a few hundreds of ns in an attempt to approach the technique to laser systems that are already introduced in many production lines for marking and labeling.

The Priming of Amylose Synthesis in Arabidopsis Leaves1

PubMed Central

Zeeman, Samuel C.; Smith, Steven M.; Smith, Alison M.

2002-01-01

We investigated the mechanism of amylose synthesis in Arabidopsis leaves using 14C-labeling techniques. First, we tested the hypothesis that short malto-oligosaccharides (MOS) may act as primers for granule-bound starch synthase I. We found increased amylose synthesis in isolated starch granules supplied with ADP[14C]glucose (ADP[14C]Glc) and MOS compared with granules supplied with ADP[14C]Glc but no MOS. Furthermore, using a MOS-accumulating mutant (dpe1), we found that more amylose was synthesized than in the wild type, correlating with the amount of MOS in vivo. When wild-type and mutant plants were tested in conditions where both lines had similar MOS contents, no difference in amylose synthesis was observed. We also tested the hypothesis that branches of amylopectin might serve as the primers for granule-bound starch synthase I. In this model, elongated branches of amylopectin are subsequently cleaved to form amylose. We conducted pulse-chase experiments, supplying a pulse of ADP[14C]Glc to isolated starch granules or 14CO2 to intact plants, followed by a chase period in unlabeled substrate. We detected no transfer of label from the amylopectin fraction to the amylose fraction of starch either in isolated starch granules or in intact leaves, despite varying the time course of the experiments and using a mutant line (sex4) in which high-amylose starch is synthesized. We therefore find no evidence for amylopectin-primed amylose synthesis in Arabidopsis. We propose that MOS are the primers for amylose synthesis in Arabidopsis leaves. PMID:11891261

The spatial effect of protein deuteration on nitroxide spin-label relaxation: Implications for EPR distance measurement

PubMed Central

El Mkami, Hassane; Ward, Richard; Bowman, Andrew; Owen-Hughes, Tom; Norman, David G.

2014-01-01

Pulsed electron–electron double resonance (PELDOR) coupled with site-directed spin labeling is a powerful technique for the elucidation of protein or nucleic acid, macromolecular structure and interactions. The intrinsic high sensitivity of electron paramagnetic resonance enables measurement on small quantities of bio-macromolecules, however short relaxation times impose a limit on the sensitivity and size of distances that can be measured using this technique. The persistence of the electron spin-echo, in the PELDOR experiment, is one of the most crucial limitations to distance measurement. At a temperature of around 50 K one of the predominant factors affecting persistence of an echo, and as such, the sensitivity and measurable distance between spin labels, is the electron spin echo dephasing time (Tm). It has become normal practice to use deuterated solvents to extend Tm and recently it has been demonstrated that deuteration of the underlying protein significantly extends Tm. Here we examine the spatial effect of segmental deuteration of the underlying protein, and also explore the concentration and temperature dependence of highly deuterated systems. PMID:25310878

Capacitive label reader

DOEpatents

Arlowe, H. Duane

1985-01-01

A capacitive label reader includes an outer ring transmitting portion, an inner ring transmitting portion, and a plurality of insulated receiving portions. A label is the mirror-image of the reader except that identifying portions corresponding to the receiving portions are insulated from only one of two coupling elements. Positive and negative pulses applied, respectively, to the two transmitting rings biased a CMOS shift register positively to either a 1 or 0 condition. The output of the CMOS may be read as an indication of the label.

Capacitive label reader

DOEpatents

Arlowe, H.D.

1985-11-12

A capacitive label reader includes an outer ring transmitting portion, an inner ring transmitting portion, and a plurality of insulated receiving portions. A label is the mirror-image of the reader except that identifying portions corresponding to the receiving portions are insulated from only one of two coupling elements. Positive and negative pulses applied, respectively, to the two transmitting rings biased a CMOS shift register positively to either a 1 or 0 condition. The output of the CMOS may be read as an indication of the label. 5 figs.

Capacitive label reader

DOEpatents

Arlowe, H.D.

1983-07-15

A capacitive label reader includes an outer ring transmitting portion, an inner ring transmitting portion, and a plurality of insulated receiving portions. A label is the mirror-image of the reader except that identifying portions corresponding to the receiving portions are insulated from only one of two coupling elements. Positive and negative pulses applied, respectively, to the two transmitting rings biased a CMOS shift register positively to either a 1 or 0 condition. The output of the CMOS may be read as an indication of the label.

Flash lamp-excited time-resolved fluorescence microscope suppresses autofluorescence in water concentrates to deliver an 11-fold increase in signal-to-noise ratio.

PubMed

Connally, Russell; Veal, Duncan; Piper, James

2004-01-01

The ubiquity of naturally fluorescing components (autofluorophores) encountered in most biological samples hinders the detection and identification of labeled targets through fluorescence-based techniques. Time-resolved fluorescence (TRF) is a technique by which the effects of autofluorescence are reduced by using specific fluorescent labels with long fluorescence lifetimes (compared with autofluorophores) in conjunction with time-gated detection. A time-resolved fluorescence microscope (TRFM) is described that is based on a standard epifluorescence microscope modified by the addition of a pulsed excitation source and an image-intensified time-gateable CCD camera. The choice of pulsed excitation source for TRFM has a large impact on the price and performance of the instrument. A flash lamp with rapid discharge characteristics was selected for our instrument because of the high spectral energy in the UV region and short pulse length. However, the flash output decayed with an approximate lifetime of 18 micros and the TRFM required a long-lived lanthanide chelate label to ensure that probe fluorescence was visible after decay of the flash plasma. We synthesized a recently reported fluorescent chelate (BHHCT) and conjugated it to a monoclonal antibody directed against the waterborne parasite Giardia lamblia. For a 600-nm bandpass filter set and a gate delay of 60 micros, the TRFM provided an 11.3-fold improvement in the signal-to-noise ratio (S/N) of labeled Giardia over background. A smaller gain in an SNR of 9.69-fold was achieved with a 420-nm longpass filter set; however, the final contrast ratio between labeled cyst and background was higher (11.3 versus 8.5). Despite the decay characteristics of the light pulse, flash lamps have many practical advantages compared with optical chopper wheels and modulated lasers for applications in TRFM.

Balancing the (carbon) budget: Using linear inverse models to estimate carbon flows and mass-balance 13C:15N labelling experiments in low oxygen sediments.

NASA Astrophysics Data System (ADS)

Hunter, William Ross; Van Oevelen, Dick; Witte, Ursula

2013-04-01

Over 1 million km2 of seafloor experience permanent low-oxygen conditions within oxygen minimum zones (OMZs). OMZs are predicted to grow as a consequence of climate change, potentially affecting oceanic biogeochemical cycles. The Arabian Sea OMZ impinges upon the western Indian continental margin at bathyal depths (150 - 1500m) producing a strong depth dependent oxygen gradient at the sea floor. The influence of the OMZ upon the short term processing of organic matter by sediment ecosystems was investigated using in situ stable isotope pulse chase experiments. These deployed doses of 13C:15N labeled organic matter onto the sediment surface at four stations from across the OMZ (water depth 540 - 1100 m; [O2] = 0.35 - 15 μM). In order to prevent experimentally anoxia, the mesocosms were not sealed. 13C and 15N labels were traced into sediment, bacteria, fauna and 13C into sediment porewater DIC and DOC. However, the DIC and DOC flux to the water column could not be measured, limiting our capacity to obtain mass-balance for C in each experimental mesocosm. Linear Inverse Modeling (LIM) provides a method to obtain a mass-balanced model of carbon flow that integrates stable-isotope tracer data with community biomass and biogeochemical flux data from a range of sources. Here we present an adaptation of the LIM methodology used to investigate how ecosystem structure influenced carbon flow across the Indian margin OMZ. We demonstrate how oxygen conditions affect food-web complexity, affecting the linkages between the bacteria, foraminifera and metazoan fauna, and their contributions to benthic respiration. The food-web models demonstrate how changes in ecosystem complexity are associated with oxygen availability across the OMZ and allow us to obtain a complete carbon budget for the stationa where stable-isotope labelling experiments were conducted.

Morphogenetic aspects in Macrocystis development

DOE Office of Scientific and Technical Information (OSTI.GOV)

Arzee, T.; Polne, M.; Neushul, M.

1985-09-01

Differential growth of the giant kelp Macrocystic pyrifera, was observed in frond meristems and in young sporophytes at their primary-blade stage. Autoradiographs of plants pulse-labeled with /sup 14/C showed both that the carbon was taken up and translocated and that the fixed carbon was diluted in regions of vigorous meristematic growth. Both labeling experiments and studies of changes in size and location of holes punched in the blades illustrated a pattern of basipetal maturation and determine growth. Size and distribution of mucilage ducts, as seen in cleared whole mounts of primary blades, point to a basipetal pattern of differentiation asmore » well. Alginase activity was relatively high in young pneumatocysts and may be involved in growth of the pneumatocyst and development of the medulla. Frond tips collected from various depths were morphologically different and maintained these differences in their growth potential, even under greenhouse conditions.« less

Dynamics of Monoterpene Formation in Spike Lavender Plants.

PubMed

Mendoza-Poudereux, Isabel; Kutzner, Erika; Huber, Claudia; Segura, Juan; Arrillaga, Isabel; Eisenreich, Wolfgang

2017-12-19

The metabolic cross-talk between the mevalonate (MVA) and the methylerythritol phosphate (MEP) pathways was analyzed in spike lavender ( Lavandula latifolia Med) on the basis of 13 CO₂-labelling experiments using wildtype and transgenic plants overexpressing the 3-hydroxy-3-methylglutaryl CoA reductase (HMGR), the first and key enzyme of the MVA pathway. The plants were labelled in the presence of 13 CO₂ in a gas chamber for controlled pulse and chase periods of time. GC/MS and NMR analysis of 1,8-cineole and camphor, the major monoterpenes present in their essential oil, indicated that the C5-precursors, isopentenyl diphosphate (IPP) and dimethylallyl diphosphate (DMAPP) of both monoterpenes are predominantly biosynthesized via the MEP pathway. Surprisingly, overexpression of HMGR did not have significant impact upon the crosstalk between the MVA and MEP pathways indicating that the MEP route is the preferred pathway for the synthesis of C5 monoterpene precursors in spike lavender.

Water diffusion-exchange effect on the paramagnetic relaxation enhancement in off-resonance rotating frame

NASA Astrophysics Data System (ADS)

Zhang, Huiming; Xie, Yang; Ji, Tongyu

2007-06-01

The off-resonance rotating frame technique based on the spin relaxation properties of off-resonance T1 ρ can significantly increase the sensitivity of detecting paramagnetic labeling at high magnetic fields by MRI. However, the in vivo detectable dimension for labeled cell clusters/tissues in T1 ρ-weighted images is limited by the water diffusion-exchange between mesoscopic scale compartments. An experimental investigation of the effect of water diffusion-exchange between compartments on the paramagnetic relaxation enhancement of paramagnetic agent compartment is presented for in vitro/ in vivo models. In these models, the size of paramagnetic agent compartment is comparable to the mean diffusion displacement of water molecules during the long RF pulses that are used to generate the off-resonance rotating frame. The three main objectives of this study were: (1) to qualitatively correlate the effect of water diffusion-exchange with the RF parameters of the long pulse and the rates of water diffusion, (2) to explore the effect of water diffusion-exchange on the paramagnetic relaxation enhancement in vitro, and (3) to demonstrate the paramagnetic relaxation enhancement in vivo. The in vitro models include the water permeable dialysis tubes or water permeable hollow fibers embedded in cross-linked proteins gels. The MWCO of the dialysis tubes was chosen from 0.1 to 15 kDa to control the water diffusion rate. Thin hollow fibers were chosen to provide sub-millimeter scale compartments for the paramagnetic agents. The in vivo model utilized the rat cerebral vasculatures as a paramagnetic agent compartment, and intravascular agents (Gd-DTPA) 30-BSA were administrated into the compartment via bolus injections. Both in vitro and in vivo results demonstrate that the paramagnetic relaxation enhancement is predominant in the T1 ρ-weighted image in the presence of water diffusion-exchange. The T1 ρ contrast has substantially higher sensitivity than the conventional T1 contrast in detecting paramagnetic agents, especially at low paramagnetic agent volumetric fractions, low paramagnetic agent concentrations, and low RF amplitudes. Short pulse duration, short pulse recycle delay and efficient paramagnetic relaxation can reduce the influence of water diffusion-exchange on the paramagnetic enhancement. This study paves the way for the design of off-resonance rotating experiments to detect labeled cell clusters/tissue compartments in vivo at a sub-millimeter scale.

Characterization of KCNE1 inside Lipodisq Nanoparticles for EPR Spectroscopic Studies of Membrane Proteins.

PubMed

Sahu, Indra D; Zhang, Rongfu; Dunagan, Megan M; Craig, Andrew F; Lorigan, Gary A

2017-06-01

EPR spectroscopic studies of membrane proteins in a physiologically relevant native membrane-bound state are extremely challenging due to the complexity observed in inhomogeneity sample preparation and dynamic motion of the spin-label. Traditionally, detergent micelles are the most widely used membrane mimetics for membrane proteins due to their smaller size and homogeneity, providing high-resolution structure analysis by solution NMR spectroscopy. However, it is often difficult to examine whether the protein structure in a micelle environment is the same as that of the respective membrane-bound state. Recently, lipodisq nanoparticles have been introduced as a potentially good membrane mimetic system for structural studies of membrane proteins. However, a detailed characterization of a spin-labeled membrane protein incorporated into lipodisq nanoparticles is still lacking. In this work, lipodisq nanoparticles were used as a membrane mimic system for probing the structural and dynamic properties of the integral membrane protein KCNE1 using site-directed spin labeling EPR spectroscopy. The characterization of spin-labeled KCNE1 incorporated into lipodisq nanoparticles was carried out using CW-EPR titration experiments for the EPR spectral line shape analysis and pulsed EPR titration experiment for the phase memory time (T m ) measurements. The CW-EPR titration experiment indicated an increase in spectral line broadening with the addition of the SMA polymer which approaches close to the rigid limit at a lipid to polymer weight ratio of 1:1, providing a clear solubilization of the protein-lipid complex. Similarly, the T m titration experiment indicated an increase in T m values with the addition of SMA polymer and approaches ∼2 μs at a lipid to polymer weight ratio of 1:2. Additionally, CW-EPR spectral line shape analysis was performed on six inside and six outside the membrane spin-label probes of KCNE1 in lipodisq nanoparticles. The results indicated significant differences in EPR spectral line broadening and a corresponding inverse central line width between spin-labeled KCNE1 residues located inside and outside of the membrane for lipodisq nanoparticle samples when compared to lipid vesicle samples. These results are consistent with the solution NMR structure of KCNE1. This study will be beneficial for researchers working on studying the structural and dynamic properties of membrane proteins.

Early and late seasonal carbon sequestration and allocation in larch trees growing on permafrost in Central Siberia

NASA Astrophysics Data System (ADS)

Masyagina, Oxana; Prokushkin, Anatoly; Kirdyanov, Alexander; Artyukhov, Aleksey; Udalova, Tatiana; Senchenkov, Sergey; Rublev, Aleksey

2014-05-01

Despite large geographic extent of deciduous conifer species Larix gmelinii, its seasonal photosynthetic activity and translocation of photoassimilated carbon within a tree remain poorly studied. To get better insight into productivity of larch trees growing on permafrost soils in Siberian larch biome we aimed to analyze dynamics of foliage parameters (i.e. leaf area, biomass, %N, %P etc.), seasonal dynamics of photosynthetic activity and apply whole tree labeling by 13CO2, which is powerful and effective tool for tracing newly developed assimilates translocation to tissues and organs of a tree (Kagawa et al., 2006; Keel et al., 2012). Experimental plot has been established in mature 105 year-old larch stand located within the continuous permafrost area near Tura settlement (Central Siberia, 64o17'13" N, 100o11'55" E, 148 m a.s.l.). Trees selected for experiments represented mean tree of the stand. Measurements of seasonal photosynthetic activity and foliar biomass sampling were arranged from early growing season (June 8, 2013) until yellowing and senescence of needles on September 17, 2013. Labeling by 13C in whole tree chamber was conducted by three pulses ([CO2]max ≤ 2,500 ppmv, 13CO2 (30% v/v)) at the early (June) and late (August) phase of growing season for different trees in 3 replicates each time. Both early season and late season labeling experiments demonstrated high rate of 13CO2 assimilation and respective enrichment of needle tissues by 13C: δ13C increased from -28.7 up to +670‰ just after labeling. However, there was distinct post-labeling dynamics of needle δ13C among two seasonal experiments. At the early season 13C depletion in labeled needles was slower, and δ13C approached after 40 days ca. +110 ‰ and remained constant till senescence. In the late season (August) needles were losing labeled C with much faster rate and approached only +1.5 ‰ upon senescence (28 days exposition). These findings suggest that in early season ca. 20% of assimilated C was used for needle structures development. In opposite, in late season the 13C label having fewer fixation in needle was translocated to other tissues/organs (i.e. label appearing in twigs, phloem and accumulating in fine roots). Different 13C translocation rate in early and late season shows the importance of needle phenology as well as differences in dominant physiological processes among seasons. The research is supported by RFBR grant 13-04-00659a.

A novel coherent optical en/decoder for optical label processing of OCDM-based optical packets switching networks

NASA Astrophysics Data System (ADS)

Zhang, Chongfu; Qiu, Kun

2007-11-01

A coherent optical en/decoder based on photonic crystal (PhC) for optical code-division-multiple (OCDM)-based optical label (OCDM-OL) optical packets switching (OPS) networks is proposed in this paper. In this scheme, the optical pulse phase and time delay can be flexibly controlled by the photonic crystal phase shifter and delayer using the appropriate design of fabrication. In this design, the combination calculation of the impurity and normal period layers is applied, according to the PhC transmission matrix theorem. The design and theoretical analysis of the PhC-based optical coherent en/decoder is mainly focused. In addition, the performances of the PhC-based optical en/decoders are analyzed in detail. The reflection, the transmission, delay characteristic and the optical spectrum of pulse en/decoded are studied for the waves tuned in the photonic band-gap by the numerical calculation, taking into account 1-Dimension (1D) PhC. Theoretical analysis and numerical results show that optical pulse is achieved to properly phase modulation and time delay by the proposed scheme, optical label based on OCDM is rewrote successfully by new code for OCDM-based OPS (OCDM-OPS), and an over 8.5 dB ration of auto- and cross-correlation is gained, which demonstrates the applicability of true pulse phase modulation in a number of applications.

Plasma Protein Turnover Rates in Rats Using Stable Isotope Labeling, Global Proteomics, and Activity-Based Protein Profiling

DOE Office of Scientific and Technical Information (OSTI.GOV)

Smith, Jordan Ned; Tyrrell, Kimberly J.; Hansen, Joshua R.

Protein turnover is important for general health on cellular and organism scales providing a strategy to replace old, damaged, or dysfunctional proteins. Protein turnover also informs of biomarker kinetics, as a better understanding of synthesis and degradation of proteins increases the clinical utility of biomarkers. Here, turnover rates of plasma proteins in rats were measured in vivo using a pulse-chase stable isotope labeling experiment. During the pulse, rats (n=5) were fed 13C6-labeled lysine (“heavy”) feed for 23 days to label proteins. During the chase, feed was changed to an unlabeled equivalent feed (“light”), and blood was repeatedly sampled from ratsmore » over 10 time points for 28 days. Plasma samples were digested with trypsin, and analyzed with liquid chromatography-tandem mass spectrometry (LC-MS/MS). MaxQuant was used to identify peptides and proteins, and quantify heavy:light lysine ratios. A system of ordinary differential equations was used to calculate protein turnover rates. Using this approach, 273 proteins were identified, and turnover rates were quantified for 157 plasma proteins with half-lives ranging 0.3-103 days. For the ~70 most abundant proteins, variability in turnover rates among rats was low (median coefficient of variation: 0.09). Activity-based protein profiling was applied to pooled plasma samples to enrich serine hydrolases using a fluorophosphonate (FP2) activity-based probe. This enrichment resulted in turnover rates for an additional 17 proteins. This study is the first to measure global plasma protein turnover rates in rats in vivo, measure variability of protein turnover rates in any animal model, and utilize activity-based protein profiling for enhancing measurements of targeted, low-abundant proteins, such as those commonly used as biomarkers. Measured protein turnover rates will be important for understanding of the role of protein turnover in cellular and organism health as well as increasing the utility of protein biomarkers through better understanding of processes governing biomarker kinetics.« less

Lipidomics in research on yeast membrane lipid homeostasis.

PubMed

de Kroon, Anton I P M

2017-08-01

Mass spectrometry is increasingly used in research on membrane lipid homeostasis, both in analyses of the steady state lipidome at the level of molecular lipid species, and in pulse-chase approaches employing stable isotope-labeled lipid precursors addressing the dynamics of lipid metabolism. Here my experience with, and view on mass spectrometry-based lipid analysis is presented, with emphasis on aspects of quantification of membrane lipid composition of the yeast Saccharomyces cerevisiae. This article is part of a Special Issue entitled: BBALIP_Lipidomics Opinion Articles edited by Sepp Kohlwein. Copyright © 2017 Elsevier B.V. All rights reserved.

Fucosylation of xyloglucan: localization of the transferase in dictyosomes of pea stem cells. [Pisum sativum

DOE Office of Scientific and Technical Information (OSTI.GOV)

Camirand, A.; Brummell, D.; MacLachlan, G.

1987-07-01

Microsomal membranes from elongating regions of etiolated Pisum sativum stems were separated by rate-zonal centrifugation on Renografin gradients. The transfer of labeled fucose and xylose from GDP-(/sup 14/C) fucose and UDP-(/sup 14/C)xylose to xyloglucan occurred mainly in dictyosome-enriched fractions. No transferase activity was detected in secretory vesicle fractions. Pulse-chase experiments using pea stem slices incubated with (/sup 3/H)fucose suggest that xyloglucan chains are fucosylated and their structure completed within the dictyosomes, before being transported to the cell wall by secretory vesicles.

Problem-Based Test: Replication of Mitochondrial DNA during the Cell Cycle

ERIC Educational Resources Information Center

Setalo, Gyorgy, Jr.

2013-01-01

Terms to be familiar with before you start to solve the test: cell cycle, generation time, S-phase, cell culture synchronization, isotopic pulse-chase labeling, density labeling, equilibrium density-gradient centrifugation, buoyant density, rate-zonal centrifugation, nucleoside, nucleotide, kinase enzymes, polymerization of nucleic acids,…

Glycosylation and processing of high-mannose oligosaccharides of thyroid-stimulating hormone subunits: comparison to nonsecretory cell glycoproteins.

PubMed

Ronin, C; Stannard, B S; Rosenbloom, I L; Magner, J A; Weintraub, B D

1984-09-25

Thyroid-stimulating hormone (TSH) subunit glycosylation was compared to that of total cell glycoproteins in mouse thyrotropic tumors. Lipid-linked oligosaccharides, total cell glycoproteins, and TSH subunits were labeled with either [3H]mannose, [3H]galactose, or [3H]glucose in pulse and pulse-chase experiments. The various oligosaccharides were isolated respectively by lipid extraction and mild acid hydrolysis, by selective immunoprecipitation, or by acid precipitation followed by trypsin and endoglycosidase H treatment. The nature of the oligosaccharides was assessed by their migration in paper chromatography, their relative incorporation of different precursors, and also their resistance to alpha-mannosidase. At 60 min, lipid-linked oligosaccharides were found to be composed of Glc3-2Man9GlcNAc2, Man9-8GlcNAc2, and Man5GlcNAc2. At 10 or 60 min of labeling, total cell proteins contained Glc3Man9GlcNAc2, Glc1Man9GlcNAc2, Man9GlcNAc2, Glc1Man8GlcNAc2, Man8GlcNAc2, and Man7GlcNAc2. The largest oligosaccharide, Glc3Man9GlcNAc2, had an unusually long half-life of about 2 h. In contrast, no Glc3Man9GlcNAc2 was found either on TSH + alpha subunits or on free beta subunits isolated either by immunoprecipitation or by sodium dodecyl sulfate gel electrophoresis. Instead, primarily Man9GlcNAc2 was found after a 10-min pulse both on TSH + alpha subunits and on beta subunits. When the pulse was followed by a chase up to 2 h, there was a progressive increase in Man8GlcNAc2 in higher amounts on TSH + alpha-subunit carbohydrate chains than on beta subunits.(ABSTRACT TRUNCATED AT 250 WORDS)

Livestock exclosure with consequent vegetation changes alters photo-assimilated carbon cycling in a Kobresia meadow

NASA Astrophysics Data System (ADS)

Zou, J.; Zhao, L.; Xu, S.; Xu, X.; Chen, D.; Li, Q.; Zhao, N.; Luo, C.; Zhao, X.

2013-11-01

Livestock exclosure has been widely used as an approach for grassland restoration. However, the effects of exclosure on grassland are controversial and can depend on many factors, such as the grassland ecosystem types, evolutionary history and so on. In this study, we conduct field experiments to investigate the variations of ecosystem function in response to livestock exclosure in a Kobresia humilis meadow under six years grazing exclosure on the Qinghai-Tibetan plateau. We focused on two ecosystem functions: plant community structure and ecosystem carbon cycling. The plant aboveground productivity, plant diversity and the composition of plant functional groups of the meadow were addressed as the indicators of the plant community structure. The 13C isotope pulse labeling technique was applied to evaluate the alterations of ecosystem carbon cycling during the short-term. The results showed that the plant community structure was changed after being fenced for six years, with significantly decreased aboveground productivity, species loss and varied composition of the four plant functional groups (grasses, sedges, legumes and forbs). Using the pulse labeling technique, we found a lower cycling rate of 13C in the plant-soil system of the fenced plots compared with the grazed sites during the first 4 days after labeling. A higher proportion of 13C amount recovered in the plant-soil system were migrated into soil as root exudates immediately after labeling at both fenced and control grazed sites, with significantly lower proportion in the fenced site, coinciding with the lower loss of 13C in soil respiration. Thirty-two days after labeling, 37% of recovered 13C remained in the soil of the fenced plots, with significant differences compared to the grazed plots (47%). In addition, less 13C (5% vs. 7%) was lost by soil respiration in the fenced plots during the chase period of 32 d. Overall, our study suggested that livestock exclosure had negative effects on the two ecosystem functions investigated, and the effects on 13C cycling and sequestrations in the soil were in response to variations in community structures, especially the suppression of forbs and legumes in the fenced site.

Unraveling carbohydrate transport mechanisms in young beech trees (Fagus sylvatica f. purpurea) by 13CO2 efflux measurements from stem and soil

NASA Astrophysics Data System (ADS)

Thoms, Ronny; Muhr, Jan; Keitel, Claudia; Kayler, Zachary; Gavrichkova, Olga; Köhler, Michael; Gessler, Arthur; Gleixner, Gerd

2016-04-01

Transport mechanisms of soluble carbohydrates and diurnal CO2 efflux from tree stems and surrounding soil are well studied. However, the effect of transport carbohydrates on respiration and their interaction with storage processes is largely unknown. Therefore, we performed a set of 13CO2 pulse labeling experiments on young trees of European beech (Fagus sylvatica f. purpurea). We labeled the whole tree crowns in a closed transparent plastic chamber with 99% 13CO2 for 30 min. In one experiment, only a single branch was labeled and removed 36 hours after labeling. In all experiments, we continuously measured the 13CO2 efflux from stem, branch and soil and sampled leaf and stem material every 3 h for 2 days, followed by a daily sampling of leaves in the successive 5 days. The compound specific δ 13C value of extracted soluble carbohydrates from leaf and stem material was measured by high-performance liquid chromatography linked with an isotope ratio mass spectrometer (HPLC-IRMS). The 13CO2 signal from soil respiration occurred only few hours after labeling indicating a very high transport rate of carbohydrates from leaf to roots and to the rhizosphere. The label was continuously depleted within the next 5 days. In contrast, we observed a remarkable oscillating pattern of 13CO2 efflux from the stem with maximum 13CO2 enrichment at noon and minima at night time. This oscillation suggests that enriched carbohydrates are respired during the day, whereas in the night the enriched sugars are not respired. The observed oscillation in stem 13CO2 enrichment remained unchanged even when only single branches were labelled and cut right afterwards. Thus, storage and conversion of carbohydrates only occurred within the stem. The δ13C patterns of extracted soluble carbohydrates showed, that a transformation of transitory starch to carbohydrates and vice versa was no driver of the oscillating 13CO2 efflux from the stem. Carbohydrates might have been transported in the phloem to the location of biosynthesis further to a storage pool from which they are respired during the day. Keywords: 13CO2 efflux, oscillating pattern, carbohydrates, transitory starch

Rumen passage kinetics of forage- and concentrate-derived fiber in dairy cows.

PubMed

Krämer, M; Lund, P; Weisbjerg, M R

2013-05-01

Rumen passage kinetics of forage and concentrate fiber were analyzed to determine intrinsic feed effects and extrinsic ration effects on the retention time of fiber in the rumen. Sixteen Danish Holstein cows (557 ± 37 kg of body weight, 120 ± 21 d in milk, mean ± SD), 8 fitted with ruminal cannulas, were used in a completely randomized block experiment. Treatments differed in forage type (corn silage vs. grass silage) and forage:concentrate ratio (50:50 vs. 75:25 on organic matter basis). Fiber passage kinetics were studied based on rumen evacuations and on marker excretion profiles in feces fitted to 1 and 2 pool models. Each cow received ytterbium (Yb)-labeled fiber of the forage fed in the ration, samarium (Sm)-labeled fiber of the forage not fed in the ration, and concentrate fiber labeled with lanthanum (La), all as a single pulse dose. Nineteen fecal grab samples were taken per cow. Rumen liquid passage was studied using chromium-EDTA dosed as a single pulse into the rumen, followed by sampling of rumen liquid from both the ventral and medial rumen. Rumen mean retention time did not differ between forages when based on Yb-excretion profiles but was numerically longer for grass silage- than for corn silage-based rations using rumen evacuation data. Liquid rate of passage did not differ when calculated from medial or ventral rumen liquid samples, indicating that estimates for the probability of rumen liquid escape were independent of rumen sampling site. Total mean retention time decreased from forage fiber to concentrate fiber to liquid. The forage type itself (corn silage or grass silage) rather than the ration composition seemed to determine the total-tract retention time of forage fiber. Copyright © 2013 American Dairy Science Association. Published by Elsevier Inc. All rights reserved.

More than a century of Grain for Green Program is expected to restore soil carbon stock on alpine grassland revealed by field (13)C pulse labeling.

PubMed

Li, Qi; Chen, Dongdong; Zhao, Liang; Yang, Xue; Xu, Shixiao; Zhao, Xinquan

2016-04-15

Anthropogenic changes in land use/cover have altered the vegetation, soil, and carbon (C) cycling on the Qinghai-Tibetan Plateau (QTP) over the last ~50years. As a result, the Grain for Green Program (GfGP) has been widely implemented over the last 10years to mitigate the impacts of cultivation. To quantify the effects of the GfGP on C partitioning and turnover rates at the ecosystem scale, an in situ (13)C pulse labeling experiment was conducted on natural and GfGP grasslands in an agro-pastoral ecotone in the Lake Qinghai region on the QTP. We found that there were significant differences in the C stocks of all the considered pools in both the natural and GfGP grasslands, with higher CO2 uptake rates in the GfGP grassland than that in the natural grassland. Partitioning of photoassimilate (% of recovered (13)C) in C pools of both grasslands was similar 25days after labeling, except in the roots of the 0-15 and 5-15cm soil layer. Soil organic C (SOC) sequestration rate in the GfGP grassland was 11.59±1.89gCm(-2)yr(-1) significantly greater than that in the natural grassland. The results confirmed that the GfGP is an efficient approach for grassland restoration and C sequestration. However, it will take more than a century (119.19±20.26yr) to restore the SOC stock from the current cropland baseline level to the approximate level of natural grassland. We suggest that additional measures are needed in the selection of suitable plant species for vegetation restoration, and in reasonable grazing management. Copyright © 2016 Elsevier B.V. All rights reserved.

Absolute cerebral blood flow quantification with pulsed arterial spin labeling during hyperoxia corrected with the simultaneous measurement of the longitudinal relaxation time of arterial blood.

PubMed

Pilkinton, David T; Hiraki, Teruyuki; Detre, John A; Greenberg, Joel H; Reddy, Ravinder

2012-06-01

Quantitative arterial spin labeling (ASL) estimates of cerebral blood flow (CBF) during oxygen inhalation are important in several contexts, including functional experiments calibrated with hyperoxia and studies investigating the effect of hyperoxia on regional CBF. However, ASL measurements of CBF during hyperoxia are confounded by the reduction in the longitudinal relaxation time of arterial blood (T(1a) ) from paramagnetic molecular oxygen dissolved in blood plasma. The aim of this study is to accurately quantify the effect of arbitrary levels of hyperoxia on T(1a) and correct ASL measurements of CBF during hyperoxia on a per-subject basis. To mitigate artifacts, including the inflow of fresh spins, partial voluming, pulsatility, and motion, a pulsed ASL approach was implemented for in vivo measurements of T(1a) in the rat brain at 3 Tesla. After accounting for the effect of deoxyhemoglobin dilution, the relaxivity of oxygen on blood was found to closely match phantom measurements. The results of this study suggest that the measured ASL signal changes are dominated by reductions in T(1a) for brief hyperoxic inhalation epochs, while the physiologic effects of oxygen on the vasculature account for most of the measured reduction in CBF for longer hyperoxic exposures. Copyright © 2011 Wiley-Liss, Inc.

Excitatory innervation of caudal hypoglossal nucleus from nucleus reticularis gigantocellularis in the rat.

PubMed

Yang, C C; Chan, J Y; Chan, S H

1995-03-01

We examined the possible innervation of the caudal hypoglossal nucleus by the nucleus reticularis gigantocellularis of the medulla oblongata, based on single-neuron recording and retrograde tracing experiments in Sprague-Dawley rats. Under pentobarbital sodium (50 mg/kg, i.p.) anesthesia, electrical stimulation of the caudal portion of the nucleus reticularis gigantocellularis with repetitive 0.5-ms rectangular pulses increased (46 of 51 neurons) the basal discharge frequency of spontaneously active cells, or evoked spike activity in silent, hypoglossal neurons located at the level of the obex. This excitatory effect was related to the intensity (25-100 microA) and/or frequency (0.5-20 Hz) of the stimulating pulses to the nucleus reticularis gigantocellularis. Perikaryal activation of neurons by microinjection of L-glutamate (0.5 nmol, 25 nl) into the caudal portion of the nucleus reticularis gigantocellularis similarly produced an excitatory action on eight of 14 hypoglossal neurons. Retrogradely labeled neurons were found bilaterally within the confines of the nucleus reticularis gigantocellularis following unilateral microinjection of wheatgerm agglutinin-conjugated horseradish peroxidase or Fast Blue into the corresponding hypoglossal recording sites. Furthermore, the distribution of labeled neurons in the nucleus reticularis gigantocellularis substantially overlapped with the loci of electrical or chemical stimulation. These complementary electrophysiological and neuroanatomical results support the conclusion that an excitatory link exists between the nucleus reticularis gigantocellularis and at least the caudal portion of the hypoglossal nucleus in the rat.

Post-translational modification of Rauscher leukemia virus precursor polyproteins encoded by the gag gene.

PubMed Central

Schultz, A M; Rabin, E H; Oroszlan, S

1979-01-01

Post-translational modifications of retrovirus gag gene-encoded polyproteins include proteolytic cleavage, phosphorylation, and glycosylation. To study the sequence of these events, we labeled JLS-V9 cells chronically infected with Rauscher murine leukemia virus in pulse-chase experiments with the radioactive precursors [35S]methionine, [14C]mannose, [3H]glucosamine, and [32P]phosphate. Newly synthesized gag polyproteins which incorporated label, and the modified products derived from them, were identified by immunoprecipitation of cell lysates with anti-p30 rabbit serum, followed by sodium dodecyl sulfate-polyacrylamide gel electrophoresis and autoradiography. Pulse-chase experiments were carried out in the presence as well as in the absence of tunicamycin, an inhibitor of glycosylation. Among the three major polyproteins synthesized in the absence of tunicamycin, two were found to be glycosylated but not phosphorylated. These were designated gPr80gag and gP94gag. Both shared identical [35S]methionine peptides with Pr65gag and p30. Of the two nonglycosylated precursors, Pr65gag and Pr75gag, only Pr65gag was found to be detectably phosphorylated, and Pr75gag could be readily identified only when glycosylation was inhibited. On the basis of these results, a scheme for the post-translational modification of gag polyproteins is proposed. According to this scheme the gag gene-encoded polyproteins are processed from a common precursor, Pr75gag, by two divergent pathways: one leading through the intermediate Pr65gag to internal virion components via cleavage and phosphorylation and the other via tunicamycin-sensitive mannosylation to the intermediate gPr80gag, which is further glycosylated to yield cell surface polyprotein gP94gag. Images PMID:480454

Optimization of transversal relaxation of nitroxides for pulsed electron-electron double resonance spectroscopy in phospholipid membranes.

PubMed

Dastvan, Reza; Bode, Bela E; Karuppiah, Muruga Poopathi Raja; Marko, Andriy; Lyubenova, Sevdalina; Schwalbe, Harald; Prisner, Thomas F

2010-10-28

Pulsed electron-electron double resonance (PELDOR) spectroscopy is increasingly applied to spin-labeled membrane proteins. However, after reconstitution into liposomes, spin labels often exhibit a much faster transversal relaxation (T(m)) than in detergent micelles, thus limiting application of the method in lipid bilayers. In this study, the main reasons for enhanced transversal relaxation in phospholipid membranes were investigated systematically by use of spin-labeled derivatives of stearic acid and phosphatidylcholine as well as spin-labeled derivatives of the channel-forming peptide gramicidin A under the conditions typically employed for PELDOR distance measurements. Our results clearly show that dephasing due to instantaneous diffusion that depends on dipolar interaction among electron spins is an important contributor to the fast echo decay in cases of high local concentrations of spin labels in membranes. The main difference between spin labels in detergent micelles and membranes is their local concentration. Consequently, avoiding spin clustering and suppressing instantaneous diffusion is the key step for maximizing PELDOR sensitivity in lipid membranes. Even though proton spin diffusion is an important relaxation mechanism, only in samples of low local concentrations does deuteration of acyl chains and buffer significantly prolong T(m). In these cases, values of up to 7 μs have been achieved. Furthermore, our study revealed that membrane composition and labeling position in the membrane can also affect T(m), either by promoting the segregation of spin-labeled species or by altering their exposure to matrix protons. Effects of other experimental parameters including temperature (<50 K), presence of oxygen, and cryoprotectant type are negligible under our experimental conditions.

Direct visualization of pancreatic juice flow using unenhanced MRI with spin labeling can be aid in diagnosing chronic pancreatitis.

PubMed

Sugita, Reiji; Furuta, Akemi; Yamazaki, Tetsuro; Itoh, Kei; Fujita, Naotaka; Takahashi, Shoki

2014-05-01

The purpose of this study is to prospectively assess whether direct visualization of pancreatic juice flow using an unenhanced MRI technique with spin labeling can aid in the diagnosis of chronic pancreatitis. Ten healthy volunteers and 50 patients who were categorized as having no chronic pancreatitis (n = 11), early chronic pancreatitis (n = 7), or established chronic pancreatitis (n = 32) underwent MRI, including direct pancreatic juice visualization using a flow-out technique with a time-spatial labeling inversion pulse, comprising a nonselective inversion recovery pulse immediately followed by a spatially selective inversion labeling pulse. The mean velocities and volumes of pancreatic juice excretion were also obtained. Variance tests were used to evaluate the clinical groups with respect to the appearance rate and mean velocity; the Kruskal-Wallis test was used for volume. There were no significant differences between healthy volunteers and patients with no chronic pancreatitis. The appearance rate, mean velocity, and volume of pancreatic juice excretion tended to decrease with the degree of chronic pancreatitis. Although the difference in these values was statistically significant between the healthy group and the established chronic pancreatitis group, the values of the early group and other groups were not statistically significant. There was a significant correlation between the appearance rate of pancreatic juice and the clinical groups (τ = -0.4376, p = 0.0015). The measurement of directly visualized pancreatic juice flow may aid in establishing the diagnosis of chronic pancreatitis.

In situ assessment of the velocity of carbon transfer by tracing 13 C in trunk CO2 efflux after pulse labelling: variations among tree species and seasons.

PubMed

Dannoura, Masako; Maillard, Pascale; Fresneau, Chantal; Plain, Caroline; Berveiller, Daniel; Gerant, Dominique; Chipeaux, Christophe; Bosc, Alexandre; Ngao, Jérôme; Damesin, Claire; Loustau, Denis; Epron, Daniel

2011-04-01

Phloem is the main pathway for transferring photosynthates belowground. In situ(13) C pulse labelling of trees 8-10 m tall was conducted in the field on 10 beech (Fagus sylvatica) trees, six sessile oak (Quercus petraea) trees and 10 maritime pine (Pinus pinaster) trees throughout the growing season. Respired (13) CO2 from trunks was tracked at different heights using tunable diode laser absorption spectrometry to determine time lags and the velocity of carbon transfer (V). The isotope composition of phloem extracts was measured on several occasions after labelling and used to estimate the rate constant of phloem sap outflux (kP ). Pulse labelling together with high-frequency measurement of the isotope composition of trunk CO2 efflux is a promising tool for studying phloem transport in the field. Seasonal variability in V was predicted in pine and oak by bivariate linear regressions with air temperature and soil water content. V differed among the three species consistently with known differences in phloem anatomy between broadleaf and coniferous trees. V increased with tree diameter in oak and beech, reflecting a nonlinear increase in volumetric flow with increasing bark cross-sectional area, which suggests changes in allocation pattern with tree diameter in broadleaf species. Discrepancies between V and kP indicate vertical changes in functional phloem properties. © 2011 The Authors. New Phytologist © 2011 New Phytologist Trust.

Phospholipid bilayer relaxation dynamics as revealed by the pulsed electron-electron double resonance of spin labels

NASA Astrophysics Data System (ADS)

Syryamina, V. N.; Dzuba, S. A.

2012-10-01

Electron paramagnetic resonance (EPR) spectroscopy in the form of pulsed electron-electron double resonance (ELDOR) was applied to 1-palmitoyl-2-oleoyl-sn-glycero-3-phosphocholine (POPC) phospholipid bilayers containing lipids that were spin-labeled at different carbon positions along the lipid acyl chain. Pulsed ELDOR detects motionally induced spin flips of nitrogen nuclei in the nitroxide spin labels, which manifests itself as magnetization transfer (MT) in the nitroxide EPR spectrum. The MT effect was observed over a wide temperature range (100-225 K) on a microsecond time scale. In line with a previous study on molecular glasses [N. P. Isaev and S. A. Dzuba, J. Chem. Phys. 135, 094508 (2011), 10.1063/1.3633241], the motions that induce MT effect were suggested to have the same nature as those in dielectric secondary (β) Johari-Goldstein fast relaxation. The results were compared with literature dielectric relaxation data for POPC bilayers, revealing some common features. Molecular motions resulting in MT are faster for deeper spin labels in the membrane interior. The addition of cholesterol to the bilayer suppresses the lipid motions near the steroid nucleus and accelerates the lipid motions beyond the steroid nucleus, in the bilayer interior. This finding was attributed to the lipid acyl chains being more ordered near the steroid nucleus and less ordered in the bilayer interior. The motions are absent in dry lipids, indicating that the motions are determined by intermolecular interactions in the bilayer.

Optimization of flow-sensitive alternating inversion recovery (FAIR) for perfusion functional MRI of rodent brain.

PubMed

Nasrallah, Fatima A; Lee, Eugene L Q; Chuang, Kai-Hsiang

2012-11-01

Arterial spin labeling (ASL) MRI provides a noninvasive method to image perfusion, and has been applied to map neural activation in the brain. Although pulsed labeling methods have been widely used in humans, continuous ASL with a dedicated neck labeling coil is still the preferred method in rodent brain functional MRI (fMRI) to maximize the sensitivity and allow multislice acquisition. However, the additional hardware is not readily available and hence its application is limited. In this study, flow-sensitive alternating inversion recovery (FAIR) pulsed ASL was optimized for fMRI of rat brain. A practical challenge of FAIR is the suboptimal global inversion by the transmit coil of limited dimensions, which results in low effective labeling. By using a large volume transmit coil and proper positioning to optimize the body coverage, the perfusion signal was increased by 38.3% compared with positioning the brain at the isocenter. An additional 53.3% gain in signal was achieved using optimized repetition and inversion times compared with a long TR. Under electrical stimulation to the forepaws, a perfusion activation signal change of 63.7 ± 6.3% can be reliably detected in the primary somatosensory cortices using single slice or multislice echo planar imaging at 9.4 T. This demonstrates the potential of using pulsed ASL for multislice perfusion fMRI in functional and pharmacological applications in rat brain. Copyright © 2012 John Wiley & Sons, Ltd.

High-speed carrier-envelope phase drift detection of amplified laser pulses.

PubMed

Fordell, T; Miranda, M; Arnold, C L; L'Huillier, A

2011-11-21

An instrument for measuring carrier-envelope phase (CEP) drift of amplified femtosecond laser pulses at repetition rates up to the 100-kHz regime is presented. The device can be used for real-time pulse labeling and it could also enable single-loop CEP control of future high-repetition rate laser amplifiers. The scheme is demonstrated by measuring the CEP drift of a 1-kHz source. © 2011 Optical Society of America

The identification of N-linked oligosaccharides on the human CR2/Epstein-Barr virus receptor and their function in receptor metabolism, plasma membrane expression, and ligand binding.

PubMed

Weis, J J; Fearon, D T

1985-11-05

Human complement receptor type 2 (CR2) was biosynthetically labeled by pulsing SB B lymphoblastoid cells for 25 min with [35S]methionine followed by chase in the presence of excess unlabeled methionine. An Mr 134,000 polypeptide represented the major form of the receptor at the end of the pulse period, and within 1 h of chase this disappeared coincident with the appearance of the Mr 145,000 mature form of CR2. Precursor, but not mature, CR2 was sensitive to endoglycosidase H, indicating that maturation of CR2 represented processing of N-linked high mannose oligosaccharides to the complex type. The processing of precursor CR2 was impaired by monensin. In the presence of tunicamycin an Mr 111,000 form of CR2 was synthesized by SB cells, and this did not chase into either precursor or mature CR2. This Mr 111,000 form of CR2 did not incorporate [3H]glucosamine, indicating that it lacked both N- and O-linked oligosaccharide. The half-lives of mature CR2 and nonglycosylated CR2 pulse-labeled in the presence of tunicamycin were 13.8 and 2.8 h, respectively; the turnover rate of B1, a membrane protein normally lacking carbohydrate, was unaffected by the presence of the antibiotic. The percentage of pulse-labeled, nonglycosylated CR2 that was expressed at the cell surface after 1 h of chase in the presence of tunicamycin was 30%, identical to that of mature CR2 in cells chased in the absence of the antibiotic. However, after 6 h of chase there was no additional net accumulation of nonglycosylated CR2 at the plasma membrane, while the proportion of pulse-labeled mature CR2 at this site had risen to 81%. Therefore, N-linked oligosaccharides are essential for the stability of CR2 and have some role in its plasma membrane expression. In contrast, the observation that all three forms of CR2 bound to Sepharose C3 indicates that oligosaccharides are not necessary for the interaction between CR2 and its complement ligand.

DNA replication after mutagenic treatment in Hordeum vulgare.

PubMed

Kwasniewska, Jolanta; Kus, Arita; Swoboda, Monika; Braszewska-Zalewska, Agnieszka

2016-12-01

The temporal and spatial properties of DNA replication in plants related to DNA damage and mutagenesis is poorly understood. Experiments were carried out to explore the relationships between DNA replication, chromatin structure and DNA damage in nuclei from barley root tips. We quantitavely analysed the topological organisation of replication foci using pulse EdU labelling during the S phase and its relationship with the DNA damage induced by mutagenic treatment with maleic hydrazide (MH), nitroso-N-methyl-urea (MNU) and gamma ray. Treatment with mutagens did not change the characteristic S-phase patterns in the nuclei; however, the frequencies of the S-phase-labelled cells after treatment differed from those observed in the control cells. The analyses of DNA replication in barley nuclei were extended to the micronuclei induced by mutagens. Replication in the chromatin of the micronuclei was rare. The results of simultanous TUNEL reaction to identify cells with DNA strand breaks and the labelling of the S-phase cells with EdU revealed the possibility of DNA replication occurring in damaged nuclei. For the first time, the intensity of EdU fluorescence to study the rate of DNA replication was analysed. Copyright © 2016 Elsevier B.V. All rights reserved.

Enhanced Androgen Signaling With Androgen Receptor Overexpression in the Osteoblast Lineage Controls Skeletal Turnover, Matrix Quality and Bone Architecture

DTIC Science & Technology

2006-12-01

tg males after double-label administration. 8-week-old male AR2.3-transgenic mice were pulsed with oxytetracycline followed 7 days later with...out at the femoral diaphysis. Fluorochromes were administered in 2-month old mice by double-label injection, with oxytetracycline followed by

Synthesis and degradation of nitrate reductase during the cell cycle of Chlorella sorokiniana

NASA Technical Reports Server (NTRS)

Velasco, P. J.; Tischner, R.; Huffaker, R. C.; Whitaker, J. R.

1989-01-01

Studies on the diurnal variations of nitrate reductase (NR) activity during the life cycle of synchronized Chlorella sorokiniana cells grown with a 7:5 light-dark cycle showed that the NADH:NR activity, as well as the NR partial activities NADH:cytochrome c reductase and reduced methyl viologen:NR, closely paralleled the appearance and disappearance of NR protein as shown by sodium dodecyl sulfate gel electrophoresis and immunoblots. Results of pulse-labeling experiments with [35S]methionine further confirmed that diurnal variations of the enzyme activities can be entirely accounted for by the concomitant synthesis and degradation of the NR protein.

Pulsed Electron Beam Water Radiolysis for Sub-Microsecond Hydroxyl Radical Protein Footprinting

PubMed Central

Watson, Caroline; Janik, Ireneusz; Zhuang, Tiandi; Charvátová, Olga; Woods, Robert J.; Sharp, Joshua S.

2009-01-01

Hydroxyl radical footprinting is a valuable technique for studying protein structure, but care must be taken to ensure that the protein does not unfold during the labeling process due to oxidative damage. Footprinting methods based on sub-microsecond laser photolysis of peroxide that complete the labeling process faster than the protein can unfold have been recently described; however, the mere presence of large amounts of hydrogen peroxide can also cause uncontrolled oxidation and minor conformational changes. We have developed a novel method for sub-microsecond hydroxyl radical protein footprinting using a pulsed electron beam from a 2 MeV Van de Graaff electron accelerator to generate a high concentration of hydroxyl radicals by radiolysis of water. The amount of oxidation can be controlled by buffer composition, pulsewidth, dose, and dissolved nitrous oxide gas in the sample. Our results with ubiquitin and β-lactoglobulin A demonstrate that one sub-microsecond electron beam pulse produces extensive protein surface modifications. Highly reactive residues that are buried within the protein structure are not oxidized, indicating that the protein retains its folded structure during the labeling process. Time-resolved spectroscopy indicates that the major part of protein oxidation is complete in a timescale shorter than that of large scale protein motions. PMID:19265387

Stringlike Pulse Quantification Study by Pulse Wave in 3D Pulse Mapping

PubMed Central

Chung, Yu-Feng; Yeh, Cheng-Chang; Si, Xiao-Chen; Chang, Chien-Chen; Hu, Chung-Shing; Chu, Yu-Wen

2012-01-01

Abstract Background A stringlike pulse is highly related to hypertension, and many classification approaches have been proposed in which the differentiation pulse wave (dPW) can effectively classify the stringlike pulse indicating hypertension. Unfortunately, the dPW method cannot distinguish the spring stringlike pulse from the stringlike pulse so labeled by physicians in clinics. Design By using a Bi-Sensing Pulse Diagnosis Instrument (BSPDI), this study proposed a novel Plain Pulse Wave (PPW) to classify a stringlike pulse based on an array of pulse signals, mimicking a Traditional Chinese Medicine physician's finger-reading skill. Results In comparison to PPWs at different pulse taking positions, phase delay Δθand correlation coefficient r can be elucidated as the quantification parameters of stringlike pulse. As a result, the recognition rates of a hypertensive stringlike pulse, spring stringlike pulse, and non–stringlike pulse are 100%, 100%, 77% for PPW and 70%, 0%, 59% for dPW, respectively. Conclusions Integrating dPW and PPW can unify the classification of stringlike pulse including hypertensive stringlike pulse and spring stringlike pulse. Hence, the proposed novel method, PPW, enhances quantification of stringlike pulse. PMID:23057481

Pulse Double-Resonance EPR Techniques for the Study of Metallobiomolecules.

PubMed

Cox, Nicholas; Nalepa, Anna; Pandelia, Maria-Eirini; Lubitz, Wolfgang; Savitsky, Anton

2015-01-01

Electron paramagnetic resonance (EPR) spectroscopy exploits an intrinsic property of matter, namely the electron spin and its related magnetic moment. This can be oriented in a magnetic field and thus, in the classical limit, acts like a little bar magnet. Its moment will align either parallel or antiparallel to the field, giving rise to different energies (termed Zeeman splitting). Transitions between these two quantized states can be driven by incident microwave frequency radiation, analogous to NMR experiments, where radiofrequency radiation is used. However, the electron Zeeman interaction alone provides only limited information. Instead, much of the usefulness of EPR is derived from the fact that the electron spin also interacts with its local magnetic environment and thus can be used to probe structure via detection of nearby spins, e.g., NMR-active magnetic nuclei and/or other electron spin(s). The latter is exploited in spin labeling techniques, an exciting new area in the development of noncrystallographic protein structure determination. Although these interactions are often smaller than the linewidth of the EPR experiment, sophisticated pulse EPR methods allow their detection. A number of such techniques are well established today and can be broadly described as double-resonance methods, in which the electron spin is used as a reporter. Below we give a brief description of pulse EPR methods, particularly their implementation at higher magnetic fields, and how to best exploit them for studying metallobiomolecules. © 2015 Elsevier Inc. All rights reserved.

Arterial spin labeling in combination with a look-locker sampling strategy: inflow turbo-sampling EPI-FAIR (ITS-FAIR).

PubMed

Günther, M; Bock, M; Schad, L R

2001-11-01

Arterial spin labeling (ASL) permits quantification of tissue perfusion without the use of MR contrast agents. With standard ASL techniques such as flow-sensitive alternating inversion recovery (FAIR) the signal from arterial blood is measured at a fixed inversion delay after magnetic labeling. As no image information is sampled during this delay, FAIR measurements are inefficient and time-consuming. In this work the FAIR preparation was combined with a Look-Locker acquisition to sample not one but a series of images after each labeling pulse. This new method allows monitoring of the temporal dynamics of blood inflow. To quantify perfusion, a theoretical model for the signal dynamics during the Look-Locker readout was developed and applied. Also, the imaging parameters of the new ITS-FAIR technique were optimized using an expression for the variance of the calculated perfusion. For the given scanner hardware the parameters were: temporal resolution 100 ms, 23 images, flip-angle 25.4 degrees. In a normal volunteer experiment with these parameters an average perfusion value of 48.2 +/- 12.1 ml/100 g/min was measured in the brain. With the ability to obtain ITS-FAIR time series with high temporal resolution arterial transit times in the range of -138 - 1054 ms were measured, where nonphysical negative values were found in voxels containing large vessels. Copyright 2001 Wiley-Liss, Inc.

A multicenter, prospective, single arm, open label, observational study of sTMS for migraine prevention (ESPOUSE Study).

PubMed

Starling, Amaal J; Tepper, Stewart J; Marmura, Michael J; Shamim, Ejaz A; Robbins, Matthew S; Hindiyeh, Nada; Charles, Andrew C; Goadsby, Peter J; Lipton, Richard B; Silberstein, Stephen D; Gelfand, Amy A; Chiacchierini, Richard P; Dodick, David W

2018-05-01

Objective To evaluate the efficacy and tolerability of single pulse transcranial magnetic stimulation (sTMS) for the preventive treatment of migraine. Background sTMS was originally developed for the acute treatment of migraine with aura. Open label experience has suggested a preventive benefit. The objective of this trial was to evaluate the efficacy and tolerability of sTMS for migraine prevention. Methods The eNeura SpringTMS Post-Market Observational U.S. Study of Migraine (ESPOUSE) Study was a multicenter, prospective, open label, observational study. From December 2014 to March 2016, patients with migraine (n = 263) were consented to complete a 1-month baseline headache diary followed by 3 months of treatment. The treatment protocol consisted of preventive (four pulses twice daily) and acute (three pulses repeated up to three times for each attack) treatment. Patients reported daily headache status, medication use, and device use with a monthly headache diary. The primary endpoint, mean reduction of headache days compared to baseline, was measured over the 28-day period during weeks 9 to 12. The primary endpoint was compared to a statistically-derived placebo estimate (performance goal). Secondary endpoints included: 50% responder rate, acute headache medication consumption, HIT-6, and mean reduction in total headache days from baseline of any intensity. Results Of a total of 263 consented subjects, 229 completed a baseline diary, and 220 were found to be eligible based on the number of headache days. The device was assigned to 217 subjects (Safety Data Set) and 132 were included in the intention to treat Full Analysis Set. For the primary endpoint, there was a -2.75 ± 0.40 mean reduction of headache days from baseline (9.06 days) compared to the performance goal (-0.63 days) ( p < 0.0001). The 50% responder rate of 46% (95% CI 37%, 56%) was also significantly higher ( p < 0.0001) than the performance goal (20%). There was a reduction of -2.93 (5.24) days of acute medication use, headache impact measured by HIT-6, -3.1 (6.4) ( p < 0.0001), and total headache days of any intensity -3.16 days (5.21) compared to the performance goal (-0.63 days) ( p < 0.0001). The most common adverse events were lightheadedness (3.7%), tingling (3.2%), and tinnitus (3.2%). There were no serious adverse events. Conclusions This open label study suggests that sTMS may be an effective, well-tolerated treatment option for migraine prevention. Trial registration number NCT02357381.

EPR-based distance measurements at ambient temperature.

PubMed

Krumkacheva, Olesya; Bagryanskaya, Elena

2017-07-01

Pulsed dipolar (PD) EPR spectroscopy is a powerful technique allowing for distance measurements between spin labels in the range of 2.5-10.0nm. It was proposed more than 30years ago, and nowadays is widely used in biophysics and materials science. Until recently, PD EPR experiments were limited to cryogenic temperatures (T<80K). Recently, application of spin labels with long electron spin dephasing time at room temperature such as triarylmethyl radicals and nitroxides with bulky substituents at a position close to radical centers enabled measurements at room temperature and even at physiologically relevant temperatures by PD EPR as well as other approaches based on EPR (e.g., relaxation enhancement; RE). In this paper, we review the features of PD EPR and RE at ambient temperatures, in particular, requirements on electron spin phase memory time, ways of immobilization of biomolecules, the influence of a linker between the spin probe and biomolecule, and future opportunities. Copyright © 2017 Elsevier Inc. All rights reserved.

In vivo label-free photoacoustic flow cytography and on-the-spot laser killing of single circulating melanoma cells

NASA Astrophysics Data System (ADS)

He, Yun; Wang, Lidai; Shi, Junhui; Yao, Junjie; Li, Lei; Zhang, Ruiying; Huang, Chih-Hsien; Zou, Jun; Wang, Lihong V.

2016-12-01

Metastasis causes as many as 90% of cancer-related deaths, especially for the deadliest skin cancer, melanoma. Since hematogenous dissemination of circulating tumor cells is the major route of metastasis, detection and destruction of circulating tumor cells are vital for impeding metastasis and improving patient prognosis. Exploiting the exquisite intrinsic optical absorption contrast of circulating melanoma cells, we developed dual-wavelength photoacoustic flow cytography coupled with a nanosecond-pulsed melanoma-specific laser therapy mechanism. We have successfully achieved in vivo label-free imaging of rare single circulating melanoma cells in both arteries and veins of mice. Further, the photoacoustic signal from a circulating melanoma cell immediately hardware-triggers a lethal pinpoint laser irradiation to kill it on the spot in a thermally confined manner without causing collateral damage. A pseudo-therapy study including both in vivo and in vitro experiments demonstrated the performance and the potential clinical value of our method, which can facilitate early treatment of metastasis by clearing circulating tumor cells from vasculature.

Data from quantitative label free proteomics analysis of rat spleen.

PubMed

Dudekula, Khadar; Le Bihan, Thierry

2016-09-01

The dataset presented in this work has been obtained using a label-free quantitative proteomic analysis of rat spleen. A robust method for extraction of proteins from rat spleen tissue and LC-MS-MS analysis was developed using a urea and SDS-based buffer. Different fractionation methods were compared. A total of 3484 different proteins were identified from the pool of all experiments run in this study (a total of 2460 proteins with at least two peptides). A total of 1822 proteins were identified from nine non-fractionated pulse gels, 2288 proteins and 2864 proteins were identified by SDS-PAGE fractionation into three and five fractions respectively. The proteomics data are deposited in ProteomeXchange Consortium via PRIDE PXD003520, Progenesis and Maxquant output are presented in the supported information. The generated list of proteins under different regimes of fractionation allow assessing the nature of the identified proteins; variability in the quantitative analysis associated with the different sampling strategy and allow defining a proper number of replicates for future quantitative analysis.

Dynamics of Monoterpene Formation in Spike Lavender Plants

PubMed Central

Kutzner, Erika; Huber, Claudia; Segura, Juan; Arrillaga, Isabel

2017-01-01

The metabolic cross-talk between the mevalonate (MVA) and the methylerythritol phosphate (MEP) pathways was analyzed in spike lavender (Lavandula latifolia Med) on the basis of 13CO2-labelling experiments using wildtype and transgenic plants overexpressing the 3-hydroxy-3-methylglutaryl CoA reductase (HMGR), the first and key enzyme of the MVA pathway. The plants were labelled in the presence of 13CO2 in a gas chamber for controlled pulse and chase periods of time. GC/MS and NMR analysis of 1,8-cineole and camphor, the major monoterpenes present in their essential oil, indicated that the C5-precursors, isopentenyl diphosphate (IPP) and dimethylallyl diphosphate (DMAPP) of both monoterpenes are predominantly biosynthesized via the MEP pathway. Surprisingly, overexpression of HMGR did not have significant impact upon the crosstalk between the MVA and MEP pathways indicating that the MEP route is the preferred pathway for the synthesis of C5 monoterpene precursors in spike lavender. PMID:29257083

PolSK Label Over VSB-CSRZ Payload Scheme in AOLS Network

NASA Astrophysics Data System (ADS)

Chen, Hongwei; Chen, Minghua; Xie, Shizhong

2007-06-01

A novel orthogonal modulation scheme of polarization-shift-keying label over vestigial sideband payload is proposed and experimentally demonstrated over a 43-Gb/s all-optical-label-switching transmission. With this scheme, a high extinction ratio of the label is reached, while a spectral efficiency of 0.8 b/s/Hz is achieved by weakening the imperfection of the high-speed pulse sequence in polarization modulation. Furthermore, this modulation scheme is relatively irrelevant with payload bit rate. The payload and label penalties after 80-km NZDSF fiber transmission and label erasure are 1.5 and 1 dB, respectively. The influence of filter center frequency offset is also investigated. Besides, a label rewriting method is introduced to simplify label processing in intermedia nodes. All these results show that this scheme can be a candidate technique for the next-generation optical network.

Pulsed Magnetic Resonance to Signal-Enhance Metabolites within Seconds by utilizing para-Hydrogen.

PubMed

Korchak, Sergey; Yang, Shengjun; Mamone, Salvatore; Glöggler, Stefan

2018-05-01

Diseases such as Alzheimer's and cancer have been linked to metabolic dysfunctions, and further understanding of metabolic pathways raises hope to develop cures for such diseases. To broaden the knowledge of metabolisms in vitro and in vivo, methods are desirable for direct probing of metabolic function. Here, we are introducing a pulsed nuclear magnetic resonance (NMR) approach to generate hyperpolarized metabolites within seconds, which act as metabolism probes. Hyperpolarization represents a magnetic resonance technique to enhance signals by over 10 000-fold. We accomplished an efficient metabolite hyperpolarization by developing an isotopic labeling strategy for generating precursors containing a favorable nuclear spin system to add para -hydrogen and convert its two-spin longitudinal order into enhanced metabolite signals. The transfer is performed by an invented NMR experiment and 20 000-fold signal enhancements are achieved. Our technique provides a fast way of generating hyperpolarized metabolites by using para -hydrogen directly in a high magnetic field without the need for field cycling.

Pump-probe microscopy of respiratory chain pigments: towards non-fluorescent label-free metabolic imaging

NASA Astrophysics Data System (ADS)

Domingue, Scott R.; Chicco, Adam J.; Bartels, Randy A.; Wilson, Jesse W.

2017-02-01

Current label-free metabolic microscopy techniques are limited to obtaining contrast from fluorescent molecules NAD(P)H and FAD+, and are unable to determine redox state along the mitochondrial respiratory chain itself. The respiratory chain electron carriers do not fluoresce, but some are heme proteins that have redox-dependent absorption spectra. The most prominent of these, cytochrome c, has been extensively characterized by transient absorption spectroscopy, which suggests that pump-probe measurements in the vicinity of 450 - 600 nm can provide strong contrast between its redox states. Motivated by the success of pump-probe microscopy targeting another heme protein, hemoglobin, we seek to extend the technique to the cytochromes, with the ultimate goal of dissecting respiratory chain function of individual cells in live tissue. To that end, we have developed a new optical system producing ultrafast, visible, independently-tunable pulse pairs via sum-frequency generation of nonlinearly broadened pulses in periodically-poled lithium niobate. The system is pumped by a homebuilt fiber-based oscillator/amplifier emitting 1060 nm pulses at 1.3 W (63 MHz repetition rate), and produces tunable pulses in the vicinity of 488 and 532 nm. Pump-probe spectroscopy of cytochrome c with this source reveals differences in excited-state absorption relaxation times between redox states. Though redox contrast is weak with this setup, we argue that this can be improved with a resonant galvo-scanning microscope. Moreover, pump-probe images were acquired of brown adipose tissue (which contains dense mitochondria), demonstrating label-free contrast from excited-state absorption in respiratory chain hemes.

Click Chemistry for Analysis of Cell Proliferation in Flow Cytometry.

PubMed

Clarke, Scott T; Calderon, Veronica; Bradford, Jolene A

2017-10-02

The measurement of cellular proliferation is fundamental to the assessment of cellular health, genotoxicity, and the evaluation of drug efficacy. Labeling, detection, and quantification of cells in the synthesis phase of cell cycle progression are not only important for characterizing basic biology, but also in defining cellular responses to drug treatments. Changes in DNA replication during S-phase can provide valuable insights into mechanisms of cell growth, cell cycle kinetics, and cytotoxicity. A common method for detection of cell proliferation is the incorporation of a thymidine analog during DNA synthesis. This chapter presents a pulse labeling method using the thymidine analog, 5-ethynyl-2'-deoxyuridine (EdU), with subsequent detection by click chemistry. EdU detection using click chemistry is bio-orthogonal to most living systems and does not non-specifically label other biomolecules. Live cells are first pulsed with EdU. After antibody labeling cell surface markers, fixation, and permeabilization, the incorporated EdU is covalently labeled using click chemistry thereby identifying proliferating cells. Improvements in click chemistry allow for labeling in the presence of fluorescent proteins and phycobiliproteins without quenching due to copper. Measuring DNA replication during cell cycle progression has cell health applications in flow cytometry, fluorescence microscopy, and high content imaging. This protocol has been developed and optimized for research use only and is not suitable for use in diagnostic procedures. © 2017 by John Wiley & Sons, Inc. Copyright © 2017 John Wiley & Sons, Inc.

In vitro investigations into enhancement of tPA bioavailability in whole blood clots using pulsed-high intensity focused ultrasound exposures.

PubMed

Jones, Guy; Hunter, Finnie; Hancock, Hilary A; Kapoor, Ankur; Stone, Michael J; Wood, Bradford J; Xie, Jianwu; Dreher, Matthew R; Frenkel, Victor

2010-01-01

Investigations were carried out on the manner by which pulsed-high intensity focused ultrasound (HIFU) enhances the effectiveness of tissue plasminogen activator (tPA) in whole blood clots, in vitro. Scanning electronic microscope (SEM) of the surface of the clots showed that the exposures increased exposed fibrin, as well as the number of openings to more interior regions. These findings were supported by fluorescent antibody labeling of tPA in frozen sections of clots treated post-HIFU. Here, improved accumulation at the surface and penetration of the tPA into the clots were observed in those treated with HIFU. Fluorescence recovery after photobleaching was also performed, indicating that the diffusion coefficient increased 6.3-fold for fluorescently labeled dextrans, comparable in size to tPA, in the HIFU-treated clots. Improved understanding of the manner by which pulsed--HIFU exposures can improve the effectiveness of thrombolytics will help optimize the exposures for this application and potentially facilitate translation to the clinic.

Consensus structures of the Mo(v) sites of sulfite-oxidizing enzymes derived from variable frequency pulsed EPR spectroscopy, isotopic labelling and DFT calculations.

PubMed

Enemark, John H

2017-10-10

Sulfite-oxidizing enzymes from eukaryotes and prokaryotes have five-coordinate distorted square-pyramidal coordination about the molybdenum atom. The paramagnetic Mo(v) state is easily generated, and over the years four distinct CW EPR spectra have been identified, depending upon enzyme source and the reaction conditions, namely high and low pH (hpH and lpH), phosphate inhibited (P i ) and sulfite (or blocked). Extensive studies of these paramagnetic forms of sulfite-oxidizing enzymes using variable frequency pulsed electron spin echo (ESE) spectroscopy, isotopic labeling and density functional theory (DFT) calculations have led to the consensus structures that are described here. Errors in some of the previously proposed structures are corrected.

Uptake of algal carbon and the synthesis of an "essential" fatty acid by Uvigerina ex. gr. semiornata (Foraminifera) within the Pakistan margin oxygen minimum zone: evidence from fatty acid biomarker and 13C tracer experiments

NASA Astrophysics Data System (ADS)

Larkin, K. E.; Gooday, A. J.; Woulds, C.; Jeffreys, R.; Schwartz, M.; Cowie, G.; Whitcraft, C.; Levin, L.; Dick, J. R.; Pond, D. W.

2014-01-01

Foraminifera are an important component of benthic communities in oxygen depleted settings, where they potentially play a~significant role in the processing of organic matter. We tracked the uptake of a 13C-labeled algal food source into individual fatty acids in the benthic foraminiferal species, Uvigerina ex. gr. semiornata, from the Arabian Sea oxygen minimum zone (OMZ). The tracer experiments were conducted on the Pakistan Margin during the late/post monsoon period (August-October 2003). A monoculture of the diatom Thalassiosira weisflogii was 13C-labeled and used to simulate a pulse of phytoplankton in two complementary experiments. A lander system was used for in situ incubations at 140 m and for 2.5 days duration, whilst a laboratory incubation used an oxystat system to maintain ambient dissolved oxygen concentrations. These shipboard experiments were terminated after 5 days. Uptake of diatoms was rapid, with high incorporation of diatom fatty acids into foraminifera after ~2 days in both experiments. Ingestion of the diatom food source was indicated by the increase over time in the quantity of diatom biomarker fatty acids in the foraminifera and by the high percentage of 13C in many of the fatty acids present at the endpoint of both in~situ and laboratory-based experiments. These results indicate that U. ex. gr. semiornata rapidly ingested the diatom food source and that this foraminifera will play an important role in the short-term cycling of organic matter within this OMZ environment. The experiments also suggested that U. ex. gr. semiornata consumed non-labeled bacterial food items, particularly bacteria, and synthesised the polyunsaturated fatty acid 20:4(n-6) de novo. 20:4(n-6) is often abundant in benthic fauna yet its origins and function have remained unclear. This study demonstrates that U. ex. gr. semiornata is capable of de novo synthesis of this "essential fatty acid" and is potentially a major source of this dietary nutrient in benthic food webs.

Improved transfer efficiencies in radio-frequency-driven recoupling solid-state NMR by adiabatic sweep through the dipolar recoupling condition

DOE Office of Scientific and Technical Information (OSTI.GOV)

Straasø, Lasse A.; Shankar, Ravi; Nielsen, Niels Chr.

The homonuclear radio-frequency driven recoupling (RFDR) experiment is commonly used in solid-state NMR spectroscopy to gain insight into the structure of biological samples due to its ease of implementation, stability towards fluctuations/missetting of radio-frequency (rf) field strength, and in general low rf requirements. A theoretical operator-based Floquet description is presented to appreciate the effect of having a temporal displacement of the π-pulses in the RFDR experiment. From this description, we demonstrate improved transfer efficiency for the RFDR experiment by generating an adiabatic passage through the zero-quantum recoupling condition. We have compared the performances of RFDR and the improved sequence tomore » mediate efficient {sup 13}CO to {sup 13}C{sub α} polarization transfer for uniformly {sup 13}C,{sup 15}N-labeled glycine and for the fibril forming peptide SNNFGAILSS (one-letter amino acid codes) uniformly {sup 13}C,{sup 15}N-labeled at the FGAIL residues. Using numerically optimized sweeps, we get experimental gains of approximately 20% for glycine where numerical simulations predict an improvement of 25% relative to the standard implementation. For the fibril forming peptide, using the same sweep parameters as found for glycine, we have gains in the order of 10%–20% depending on the spectral regions of interest.« less

Resolution enhancement in 13C and 15N magic-angle turning experiments with TPPM decoupling.

PubMed

McGeorge, G; Alderman, D W; Grant, D M

1999-03-01

Many solid-state spectra have been shown to have problems related to the poor proton decoupling of carbon nuclei in methylene groups under conditions of slow magic-angle turning. Two-pulse phase-modulation (TPPM) decoupling during the 2D PHORMAT chemical shift separation experiment is shown to be more effective in comparison to that obtainable at much higher spin rates using conventional CW decoupling. TPPM decoupling can also alleviate similar inadequacies when observing the 15N nucleus, particularly with NH2 groups. This is demonstrated in the 15N resonances of fully labeled l-arginine hydrochloride, where a line narrowing of about a factor of two was observed at moderate rotation rates. This significant advantage was also obtained at turning frequencies as low as 500 Hz. Copyright 1999 Academic Press.

Detection of intracellular lactate with localized diffusion { 1H- 13C}-spectroscopy in rat glioma in vivo

NASA Astrophysics Data System (ADS)

Pfeuffer, Josef; Lin, Joseph C.; DelaBarre, Lance; Ugurbil, Kamil; Garwood, Michael

2005-11-01

The aim of this study was to compare the diffusion characteristic of lactate and alanine in a brain tumor model to that of normal brain metabolites known to be mainly intracellular such as N-acetylaspartate or creatine. The diffusion of 13C-labeled metabolites was measured in vivo with localized NMR spectroscopy at 9.4 T (400 MHz) using a previously described localization and editing pulse sequence known as ACED-STEAM ('adiabatic carbon editing and decoupling'). 13C-labeled glucose was administered and the apparent diffusion coefficients of the glycolytic products, { 1H- 13C}-lactate and { 1H- 13C}-alanine, were determined in rat intracerebral 9L glioma. To obtain insights into { 1H- 13C}-lactate compartmentation (intra- versus extracellular), the pulse sequence used very large diffusion weighting (50 ms/μm 2). Multi-exponential diffusion attenuation of the lactate metabolite signals was observed. The persistence of a lactate signal at very large diffusion weighting provided direct experimental evidence of significant intracellular lactate concentration. To investigate the spatial distribution of lactate and other metabolites, 1H spectroscopic images were also acquired. Lactate and choline-containing compounds were consistently elevated in tumor tissue, but not in necrotic regions and surrounding normal-appearing brain. Overall, these findings suggest that lactate is mainly associated with tumor tissue and that within the time-frame of these experiments at least some of the glycolytic product ([ 13C] lactate) originates from an intracellular compartment.

The long-term label retaining population of the renal papilla arises through divergent regional growth of the kidney.

PubMed

Adams, Derek C; Oxburgh, Leif

2009-09-01

Long-term pulse chase experiments previously identified a sizable population of BrdU-retaining cells within the renal papilla. The origin of these cells has been unclear, and in this work we test the hypothesis that they become quiescent early during the course of kidney development and organ growth. Indeed, we find that BrdU-retaining cells of the papilla can be labeled only by pulsing with BrdU from embryonic (E) day 11.25 to postnatal (P) day 7, the approximate period of kidney development in the mouse. BrdU signal in the cortex and outer medulla is rapidly diluted by cellular proliferation during embryonic development and juvenile growth, whereas cells within the papilla differentiate and exit the cell cycle during organogenesis. Indeed, by E17.5, little or no active proliferation can be seen in the distal papilla, indicating maturation of this structure in a distal-to-proximal manner during organogenesis. We conclude that BrdU-retaining cells of the papilla represent a population of cells that quiesce during embryonic development and localize within a region of the kidney that matures early. We therefore propose that selective papillary retention of BrdU arises through a combination of regionalized slowing of, and exit from, the cell cycle within the papilla during the period of ongoing kidney development, and extensive proliferative growth of the juvenile kidney resulting in dilution of BrdU below the detection level in extra-papillary regions.

Forest understory plant and soil microbial response to an experimentally induced drought and heat-pulse event: the importance of maintaining the continuum.

PubMed

von Rein, Isabell; Gessler, Arthur; Premke, Katrin; Keitel, Claudia; Ulrich, Andreas; Kayler, Zachary E

2016-08-01

Drought duration and intensity are expected to increase with global climate change. How changes in water availability and temperature affect the combined plant-soil-microorganism response remains uncertain. We excavated soil monoliths from a beech (Fagus sylvatica L.) forest, thus keeping the understory plant-microbe communities intact, imposed an extreme climate event, consisting of drought and/or a single heat-pulse event, and followed microbial community dynamics over a time period of 28 days. During the treatment, we labeled the canopy with (13) CO2 with the goal of (i) determining the strength of plant-microbe carbon linkages under control, drought, heat and heat-drought treatments and (ii) characterizing microbial groups that are tightly linked to the plant-soil carbon continuum based on (13) C-labeled PLFAs. Additionally, we used 16S rRNA sequencing of bacteria from the Ah horizon to determine the short-term changes in the active microbial community. The treatments did not sever within-plant transport over the experiment, and carbon sinks belowground were still active. Based on the relative distribution of labeled carbon to roots and microbial PLFAs, we determined that soil microbes appear to have a stronger carbon sink strength during environmental stress. High-throughput sequencing of the 16S rRNA revealed multiple trajectories in microbial community shifts within the different treatments. Heat in combination with drought had a clear negative effect on microbial diversity and resulted in a distinct shift in the microbial community structure that also corresponded to the lowest level of label found in the PLFAs. Hence, the strongest changes in microbial abundances occurred in the heat-drought treatment where plants were most severely affected. Our study suggests that many of the shifts in the microbial communities that we might expect from extreme environmental stress will result from the plant-soil-microbial dynamics rather than from direct effects of drought and heat on soil microbes alone. © 2016 John Wiley & Sons Ltd.

Imaging of endogenous exchangeable proton signals in the human brain using frequency labeled exchange transfer imaging.

PubMed

Yadav, Nirbhay N; Jones, Craig K; Hua, Jun; Xu, Jiadi; van Zijl, Peter C M

2013-04-01

To image endogenous exchangeable proton signals in the human brain using a recently reported method called frequency labeled exchange transfer (FLEX) MRI. As opposed to labeling exchangeable protons using saturation (i.e., chemical exchange saturation transfer, or CEST), FLEX labels exchangeable protons with their chemical shift evolution. The use of short high-power frequency pulses allows more efficient labeling of rapidly exchanging protons, while time domain acquisition allows removal of contamination from semi-solid magnetization transfer effects. FLEX-based exchangeable proton signals were detected in human brain over the 1-5 ppm frequency range from water. Conventional magnetization transfer contrast and the bulk water signal did not interfere in the FLEX spectrum. The information content of these signals differed from in vivo CEST data in that the average exchange rate of these signals was 350-400 s(-1) , much faster than the amide signal usually detected using direct saturation (∼30 s(-1) ). Similarly, fast exchanging protons could be detected in egg white in the same frequency range where amide and amine protons of mobile proteins and peptides are known to resonate. FLEX MRI in the human brain preferentially detects more rapidly exchanging amide/amine protons compared to traditional CEST experiments, thereby changing the information content of the exchangeable proton spectrum. This has the potential to open up different types of endogenous applications as well as more easy detection of rapidly exchanging protons in diaCEST agents or fast exchanging units such as water molecules in paracest agents without interference of conventional magnetization transfer contrast. Copyright © 2013 Wiley Periodicals, Inc.

Presence of the epidemic North American Pulsed Field type 1 Clostridium difficile strain in hospitalized children.

PubMed

Toltzis, Philip; Kim, Jason; Dul, Michael; Zoltanski, Joan; Smathers, Sarah; Zaoutis, Theoklis

2009-04-01

A hypervirulent strain of Clostridium difficile-labeled North American Pulsed Field type 1 causes severe disease in adults. To determine the prevalence of NAP1 C. difficile in children, organisms from consecutive C. difficile toxin-positive stool samples at 2 children's hospitals microbiology laboratories were characterized. We found that 19.4% of these samples were NAP1.

Physiologically Based Simulations of Deuterated Glucose for Quantifying Cell Turnover in Humans

PubMed Central

Lahoz-Beneytez, Julio; Schaller, Stephan; Macallan, Derek; Eissing, Thomas; Niederalt, Christoph; Asquith, Becca

2017-01-01

In vivo [6,6-2H2]-glucose labeling is a state-of-the-art technique for quantifying cell proliferation and cell disappearance in humans. However, there are discrepancies between estimates of T cell proliferation reported in short (1-day) versus long (7-day) 2H2-glucose studies and very-long (9-week) 2H2O studies. It has been suggested that these discrepancies arise from underestimation of true glucose exposure from intermittent blood sampling in the 1-day study. Label availability in glucose studies is normally approximated by a “square pulse” (Sq pulse). Since the body glucose pool is small and turns over rapidly, the availability of labeled glucose can be subject to large fluctuations and the Sq pulse approximation may be very inaccurate. Here, we model the pharmacokinetics of exogenous labeled glucose using a physiologically based pharmacokinetic (PBPK) model to assess the impact of a more complete description of label availability as a function of time on estimates of CD4+ and CD8+ T cell proliferation and disappearance. The model enabled us to predict the exposure to labeled glucose during the fasting and de-labeling phases, to capture the fluctuations of labeled glucose availability caused by the intake of food or high-glucose beverages, and to recalculate the proliferation and death rates of immune cells. The PBPK model was used to reanalyze experimental data from three previously published studies using different labeling protocols. Although using the PBPK enrichment profile decreased the 1-day proliferation estimates by about 4 and 7% for CD4 and CD8+ T cells, respectively, differences with the 7-day and 9-week studies remained significant. We conclude that the approximations underlying the “square pulse” approach—recently suggested as the most plausible hypothesis—only explain a component of the discrepancy in published T cell proliferation rate estimates. PMID:28487698

Sindbis virus glycoproteins are abnormally glycosylated in Chinese hamster ovary cells deprived of glucose.

PubMed

Davidson, S K; Hunt, L A

1985-07-01

We have previously demonstrated that Sindbis virus infection of Chinese hamster ovary (CHO) cells altered the protein glycosylation machinery of the cell, so that both normal, full-size (nine mannose-containing) oligosaccharides and abnormal, "truncated' (five mannose-containing) oligosaccharides are transferred from lipid-linked precursors to newly synthesized viral membrane glycoproteins. In the present studies, we have examined the precursor oligosaccharides on viral glycoproteins that were pulse-labelled with [3H]mannose in the presence or absence of glucose, since glucose starvation of uninfected CHO cells has been reported to induce synthesis of truncated precursor oligosaccharides. Pulse-labelling in the absence of glucose led to a greater than 10-fold increase in the relative amount of the truncated precursor oligosaccharides being transferred to the newly synthesized viral glycoproteins and to an apparent underglycosylation of some precursor viral polypeptides, with some asparaginyl sites not acquiring covalently linked oligosaccharides. The mature virion glycoproteins from CHO cells which were pulse-labelled in the absence of glucose and then 'chased' in the presence of glucose contained proportionately more unusual Man3GlcNAc2-size oligosaccharides. These small neutral-type oligosaccharides were apparently not as good a substrate for further processing into complex acidic-type oligosaccharides as the normal Man5GlcNAc2 intermediate that results from the full-size precursor oligosaccharides.

Synthesis and Turnover of Embryonic Sea Urchin Ciliary Proteins during Selective Inhibition of Tubulin Synthesis and Assembly

PubMed Central

Stephens, Raymond E.

1997-01-01

When ciliogenesis first occurs in sea urchin embryos, the major building block proteins, tubulin and dynein, exist in substantial pools, but most 9+2 architectural proteins must be synthesized de novo. Pulse-chase labeling with [3H]leucine demonstrates that these proteins are coordinately up-regulated in response to deciliation so that regeneration ensues and the tubulin and dynein pools are replenished. Protein labeling and incorporation into already-assembled cilia is high, indicating constitutive ciliary gene expression and steady-state turnover. To determine whether either the synthesis of tubulin or the size of its available pool is coupled to the synthesis or turnover of the other 9+2 proteins in some feedback manner, fully-ciliated mid- or late-gastrula stage Strongylocentrotus droebachiensis embryos were pulse labeled in the presence of colchicine or taxol at concentrations that block ciliary growth. As a consequence of tubulin autoregulation mediated by increased free tubulin, no labeling of ciliary tubulin occurred in colchicine-treated embryos. However, most other proteins were labeled and incorporated into steady-state cilia at near-control levels in the presence of colchicine or taxol. With taxol, tubulin was labeled as well. An axoneme-associated 78 kDa cognate of the molecular chaperone HSP70 correlated with length during regeneration; neither colchicine nor taxol influenced the association of this protein in steady-state cilia. These data indicate that 1) ciliary protein synthesis and turnover is independent of tubulin synthesis or tubulin pool size; 2) steady-state incorporation of labeled proteins cannot be due to formation or elongation of cilia; 3) substantial tubulin exchange takes place in fully-motile cilia; and 4) chaperone presence and association in steady-state cilia is independent of background ciliogenesis, tubulin synthesis, and tubulin assembly state. PMID:9362062

Focus: Two-dimensional electron-electron double resonance and molecular motions: The challenge of higher frequencies.

PubMed

Franck, John M; Chandrasekaran, Siddarth; Dzikovski, Boris; Dunnam, Curt R; Freed, Jack H

2015-06-07

The development, applications, and current challenges of the pulsed ESR technique of two-dimensional Electron-Electron Double Resonance (2D ELDOR) are described. This is a three-pulse technique akin to 2D Exchange Nuclear Magnetic Resonance, but involving electron spins, usually in the form of spin-probes or spin-labels. As a result, it required the extension to much higher frequencies, i.e., microwaves, and much faster time scales, with π/2 pulses in the 2-3 ns range. It has proven very useful for studying molecular dynamics in complex fluids, and spectral results can be explained by fitting theoretical models (also described) that provide a detailed analysis of the molecular dynamics and structure. We discuss concepts that also appear in other forms of 2D spectroscopy but emphasize the unique advantages and difficulties that are intrinsic to ESR. Advantages include the ability to tune the resonance frequency, in order to probe different motional ranges, while challenges include the high ratio of the detection dead time vs. the relaxation times. We review several important 2D ELDOR studies of molecular dynamics. (1) The results from a spin probe dissolved in a liquid crystal are followed throughout the isotropic → nematic → liquid-like smectic → solid-like smectic → crystalline phases as the temperature is reduced and are interpreted in terms of the slowly relaxing local structure model. Here, the labeled molecule is undergoing overall motion in the macroscopically aligned sample, as well as responding to local site fluctuations. (2) Several examples involving model phospholipid membranes are provided, including the dynamic structural characterization of the boundary lipid that coats a transmembrane peptide dimer. Additionally, subtle differences can be elicited for the phospholipid membrane phases: liquid disordered, liquid ordered, and gel, and the subtle effects upon the membrane, of antigen cross-linking of receptors on the surface of plasma membrane, vesicles can be observed. These 2D ELDOR experiments are performed as a function of mixing time, Tm, i.e., the time between the second and third π/2 pulses, which provides a third dimension. In fact, a fourth dimension may be added by varying the ESR frequency/magnetic field combination. Therefore, (3) it is shown how continuous-wave multifrequency ESR studies enable the decomposition of complex dynamics of, e.g., proteins by virtue of their respective time scales. These studies motivate our current efforts that are directed to extend 2D ELDOR to higher frequencies, 95 GHz in particular (from 9 and 17 GHz), in order to enable multi-frequency 2D ELDOR. This required the development of quasi-optical methods for performing the mm-wave experiments, which are summarized. We demonstrate state-of-the-art 95 GHz 2D ELDOR spectroscopy through its ability to resolve the two signals from a spin probe dissolved in both the lipid phase and the coexisting aqueous phase. As current 95 GHz experiments are restricted by limited spectral coverage of the π/2 pulse, as well as the very short T2 relaxation times of the electron spins, we discuss how these limitations are being addressed.

Focus: Two-dimensional electron-electron double resonance and molecular motions: The challenge of higher frequencies

NASA Astrophysics Data System (ADS)

Franck, John M.; Chandrasekaran, Siddarth; Dzikovski, Boris; Dunnam, Curt R.; Freed, Jack H.

2015-06-01

The development, applications, and current challenges of the pulsed ESR technique of two-dimensional Electron-Electron Double Resonance (2D ELDOR) are described. This is a three-pulse technique akin to 2D Exchange Nuclear Magnetic Resonance, but involving electron spins, usually in the form of spin-probes or spin-labels. As a result, it required the extension to much higher frequencies, i.e., microwaves, and much faster time scales, with π/2 pulses in the 2-3 ns range. It has proven very useful for studying molecular dynamics in complex fluids, and spectral results can be explained by fitting theoretical models (also described) that provide a detailed analysis of the molecular dynamics and structure. We discuss concepts that also appear in other forms of 2D spectroscopy but emphasize the unique advantages and difficulties that are intrinsic to ESR. Advantages include the ability to tune the resonance frequency, in order to probe different motional ranges, while challenges include the high ratio of the detection dead time vs. the relaxation times. We review several important 2D ELDOR studies of molecular dynamics. (1) The results from a spin probe dissolved in a liquid crystal are followed throughout the isotropic → nematic → liquid-like smectic → solid-like smectic → crystalline phases as the temperature is reduced and are interpreted in terms of the slowly relaxing local structure model. Here, the labeled molecule is undergoing overall motion in the macroscopically aligned sample, as well as responding to local site fluctuations. (2) Several examples involving model phospholipid membranes are provided, including the dynamic structural characterization of the boundary lipid that coats a transmembrane peptide dimer. Additionally, subtle differences can be elicited for the phospholipid membrane phases: liquid disordered, liquid ordered, and gel, and the subtle effects upon the membrane, of antigen cross-linking of receptors on the surface of plasma membrane, vesicles can be observed. These 2D ELDOR experiments are performed as a function of mixing time, Tm, i.e., the time between the second and third π/2 pulses, which provides a third dimension. In fact, a fourth dimension may be added by varying the ESR frequency/magnetic field combination. Therefore, (3) it is shown how continuous-wave multifrequency ESR studies enable the decomposition of complex dynamics of, e.g., proteins by virtue of their respective time scales. These studies motivate our current efforts that are directed to extend 2D ELDOR to higher frequencies, 95 GHz in particular (from 9 and 17 GHz), in order to enable multi-frequency 2D ELDOR. This required the development of quasi-optical methods for performing the mm-wave experiments, which are summarized. We demonstrate state-of-the-art 95 GHz 2D ELDOR spectroscopy through its ability to resolve the two signals from a spin probe dissolved in both the lipid phase and the coexisting aqueous phase. As current 95 GHz experiments are restricted by limited spectral coverage of the π/2 pulse, as well as the very short T2 relaxation times of the electron spins, we discuss how these limitations are being addressed.

A cross-polarization based rotating-frame separated-local-field NMR experiment under ultrafast MAS conditions

NASA Astrophysics Data System (ADS)

Zhang, Rongchun; Damron, Joshua; Vosegaard, Thomas; Ramamoorthy, Ayyalusamy

2015-01-01

Rotating-frame separated-local-field solid-state NMR experiments measure highly resolved heteronuclear dipolar couplings which, in turn, provide valuable interatomic distances for structural and dynamic studies of molecules in the solid-state. Though many different rotating-frame SLF sequences have been put forth, recent advances in ultrafast MAS technology have considerably simplified pulse sequence requirements due to the suppression of proton-proton dipolar interactions. In this study we revisit a simple two-dimensional 1H-13C dipolar coupling/chemical shift correlation experiment using 13C detected cross-polarization with a variable contact time (CPVC) and systematically study the conditions for its optimal performance at 60 kHz MAS. In addition, we demonstrate the feasibility of a proton-detected version of the CPVC experiment. The theoretical analysis of the CPVC pulse sequence under different Hartmann-Hahn matching conditions confirms that it performs optimally under the ZQ (w1H - w1C = ±wr) condition for polarization transfer. The limits of the cross polarization process are explored and precisely defined as a function of offset and Hartmann-Hahn mismatch via spin dynamics simulation and experiments on a powder sample of uniformly 13C-labeled L-isoleucine. Our results show that the performance of the CPVC sequence and subsequent determination of 1H-13C dipolar couplings are insensitive to 1H/13C frequency offset frequency when high RF fields are used on both RF channels. Conversely, the CPVC sequence is quite sensitive to the Hartmann-Hahn mismatch, particularly for systems with weak heteronuclear dipolar couplings. We demonstrate the use of the CPVC based SLF experiment as a tool to identify different carbon groups, and hope to motivate the exploration of more sophisticated 1H detected avenues for ultrafast MAS.

Saturation recovery EPR and ELDOR at W-band for spin labels

PubMed Central

Froncisz, Wojciech; Camenisch, Theodore G.; Ratke, Joseph J.; Anderson, James R.; Subczynski, Witold K.; Strangeway, Robert A.; Sidabras, Jason W.; Hyde, James S.

2008-01-01

A reference-arm W-band (94 GHz) microwave bridge with two sample-irradiation arms for saturation recovery (SR) EPR and ELDOR experiments is described. Frequencies in each arm are derived from 2 GHz synthesizers that have a common time-base and are translated to 94 GHz in steps of 33 and 59 GHz. Intended applications are to nitroxide radical spin labels and spin probes in the liquid phase. An enabling technology is the use of a W-band loop-gap resonator (LGR) (J.W. Sidabras et al., Rev. Sci. Instrum. 78 (2007) 034701). The high efficiency parameter (8.2 GW−1/2 with sample) permits the saturating pump pulse level to be just 5 mW or less. Applications of SR EPR and ELDOR to the hydrophilic spin labels 3-carbamoyl-2,2,5,5-tetra-methyl-3-pyrroline-1-yloxyl (CTPO) and 2,2,6,6,-tetramethyl-4-piperidone-1-oxyl (TEMPONE) are described in detail. In the SR ELDOR experiment, nitrogen nuclear relaxation as well as Heisenberg exchange transfer saturation from pumped to observed hyperfine transitions. SR ELDOR was found to be an essential method for measurements of saturation transfer rates for small molecules such as TEMPONE. Free induction decay (FID) signals for small nitroxides at W-band are also reported. Results are compared with multifrequency measurements of T1e previously reported for these molecules in the range of 2 to 35 GHz (J.S. Hyde et al., J. Phys. Chem. B 108 (2004) 9524–9529). The values of T1e decrease at 94 GHz relative to values at 35 GHz. PMID:18547848

Synthesis and release of fatty acids by human trophoblast cells in culture

DOE Office of Scientific and Technical Information (OSTI.GOV)

Coleman, R.A.; Haynes, E.B.

1987-11-01

In order to determine whether placental cells can synthesize and release fatty acids, trophoblast cells from term human placentas were established in monolayer culture. The cells continued to secrete placental lactogen and progesterone and maintained specific activities of critical enzymes of triacylglycerol and phosphatidylcholine biosynthesis for 24 to 72 hr in culture. Fatty acid was rapidly synthesized from (/sup 14/C)acetate and released by the cells. Palmitoleic, palmitic, and oleic acids were the major fatty acids synthesized from (/sup 14/C)acetate and released. Small amounts of lauric, myristic, and stearic acids were also identified. (/sup 14/C)acetate was also incorporated into cellular triacylglycerol,more » phospholipid, and cholesterol, but radiolabeled free fatty acid did not accumulate intracellularly. In a pulse-chase experiment, cellular glycerolipids were labeled with (1-/sup 14/C)oleate; trophoblast cells then released /sup 14/C-labeled fatty acid into the media as the cellular content of labeled phospholipid and triacylglycerol decreased without intracellular accumulation of free fatty acid. Twenty percent of the /sup 14/C-label lost from cellular glycerolipid could not be recovered as a chloroform-extractable product, suggesting that some of the hydrolyzed fatty acid had been oxidized. These data indicate that cultured placenta trophoblast cells can release fatty acids that have either been synthesized de novo or that have been hydrolyzed from cellular glycerolipids. Trophoblast cells in monolayer culture should provide an excellent model for molecular studies of placental fatty acid metabolism and release.« less

Pulsed 86Sr-labeling and NanoSIMS imaging to study coral biomineralization at ultra-structural length scales

NASA Astrophysics Data System (ADS)

Brahmi, C.; Domart-Coulon, I.; Rougée, L.; Pyle, D. G.; Stolarski, J.; Mahoney, J. J.; Richmond, R. H.; Ostrander, G. K.; Meibom, A.

2012-09-01

A method to label marine biocarbonates is developed based on a concentration enrichment of a minor stable isotope of a trace element that is a natural component of seawater, resulting in the formation of biocarbonate with corresponding isotopic enrichments. This biocarbonate is subsequently imaged with a NanoSIMS ion microprobe to visualize the locations of the isotopic marker on sub-micrometric length scales, permitting resolution of all ultra-structural details. In this study, a scleractinian coral, Pocillopora damicornis, was labeled 3 times with 86Sr-enhanced seawater for a period of 48 h with 5 days under normal seawater conditions separating each labeling event. Two non-specific cellular stress biomarkers, glutathione-S-transferase activity and porphyrin concentration plus carbonic anhydrase, an enzymatic marker involved in the physiology of carbonate biomineralization, as well as unchanged levels of zooxanthellae photosynthesis efficiency indicate that coral physiological processes are not affected by the 86Sr-enhancement. NanoSIMS images of the 86Sr/44Ca ratio in skeleton formed during the experiment allow for a determination of the average extension rate of the two major ultra-structural components of the coral skeleton: Rapid Accretion Deposits are found to form on average about 4.5 times faster than Thickening Deposits. The method opens up new horizons in the study of biocarbonate formation because it holds the potential to observe growth of calcareous structures such as skeletons, shells, tests, spines formed by a wide range of organisms under essentially unperturbed physiological conditions.

Warnings on alcohol containers and advertisements: international experience and evidence on effects.

PubMed

Wilkinson, Claire; Room, Robin

2009-07-01

In light of possible introduction of alcohol warning labels in Australia and New Zealand, this paper discusses the international experience with and evidence of effects of alcohol warning labels. The report describes international experience with providing information and warnings concerning the promotion or sale of alcoholic beverages, and considers the evidence on the effects of such information and warnings. The experience with and evaluations of the effects of tobacco warning labels are also considered. The most methodologically sound evaluations of alcohol warning labels are based on the US experience. Although these evaluations find little evidence that the introduction of the warning label in the USA had an impact on drinking behaviour, there is evidence that they led to an increase in awareness of the message they contained. In contrast, evaluations of tobacco warning labels find clear evidence of effects on behaviour. There is a need and opportunity for a rigorous evaluation of the impacts of introducing alcohol warning labels to add to the published work on their effectiveness. The experience with tobacco labels might guide the way for more effective alcohol warning labels. Alcohol warning labels are an increasingly popular alcohol policy initiative. It is clear that warning labels can be ineffective, but the tobacco experience suggests that effective warning labels are possible. Any introduction of alcohol warning labels should be evaluated in terms of effects on attitudes and behaviour.

Protein catabolism in cultures of hepatocytes derived from mice of various ages.

PubMed

Burrows, R B; Davison, P F

1982-05-01

The degradation of pulse-labeled protein was measured in cultures of hepatocytes derived from mice of 3--4, 15--16, and 28 months of age. The rates of protein degradation were determined in culture media with varying amino acid, insulin, and glucagon concentrations. No differences with age were seen. Also no difference with age was detected in the lysosomal degradation of 125I-labeled asialofetuin.

Classifying syndromes in Chinese medicine using multi-label learning algorithm with relevant features for each label.

PubMed

Xu, Jin; Xu, Zhao-Xia; Lu, Ping; Guo, Rui; Yan, Hai-Xia; Xu, Wen-Jie; Wang, Yi-Qin; Xia, Chun-Ming

2016-11-01

To develop an effective Chinese Medicine (CM) diagnostic model of coronary heart disease (CHD) and to confifirm the scientifific validity of CM theoretical basis from an algorithmic viewpoint. Four types of objective diagnostic data were collected from 835 CHD patients by using a self-developed CM inquiry scale for the diagnosis of heart problems, a tongue diagnosis instrument, a ZBOX-I pulse digital collection instrument, and the sound of an attending acquisition system. These diagnostic data was analyzed and a CM diagnostic model was established using a multi-label learning algorithm (REAL). REAL was employed to establish a Xin (Heart) qi defificiency, Xin yang defificiency, Xin yin defificiency, blood stasis, and phlegm fifive-card CM diagnostic model, which had recognition rates of 80.32%, 89.77%, 84.93%, 85.37%, and 69.90%, respectively. The multi-label learning method established using four diagnostic models based on mutual information feature selection yielded good recognition results. The characteristic model parameters were selected by maximizing the mutual information for each card type. The four diagnostic methods used to obtain information in CM, i.e., observation, auscultation and olfaction, inquiry, and pulse diagnosis, can be characterized by these parameters, which is consistent with CM theory.

Pulsed lasers versus continuous light sources in capillary electrophoresis and fluorescence detection studies: Photodegradation pathways and models.

PubMed

Boutonnet, Audrey; Morin, Arnaud; Petit, Pierre; Vicendo, Patricia; Poinsot, Véréna; Couderc, François

2016-03-17

Pulsed lasers are widely used in capillary electrophoresis (CE) studies to provide laser induced fluorescence (LIF) detection. Unfortunately pulsed lasers do not give linear calibration curves over a wide range of concentrations. While this does not prevent their use in CE/LIF studies, the non-linear behavior must be understood. Using 7-hydroxycoumarin (7-HC) (10-5000 nM), Tamra (10-5000 nM) and tryptophan (1-200 μM) as dyes, we observe that continuous lasers and LEDs result in linear calibration curves, while pulsed lasers give polynomial ones. The effect is seen with both visible light (530 nm) and with UV light (355 nm, 266 nm). In this work we point out the formation of byproducts induced by pulsed laser upon irradiation of 7-HC. Their separation by CE using two Zeta LIF detectors clearly shows that this process is related to the first laser detection. All of these photodegradation products can be identified by an ESI-/MS investigation and correspond to at least two 7HC dimers. By using the photodegradation model proposed by Heywood and Farnsworth (2010) and by taking into account the 7-HC results and the fact that in our system we do not have a constant concentration of fluorophore, it is possible to propose a new photochemical model of fluorescence in LIF detection. The model, like the experiment, shows that it is difficult to obtain linear quantitation curves with pulsed lasers while UV-LEDs used in continuous mode have this advantage. They are a good alternative to UV pulsed lasers. An application involving the separation and linear quantification of oligosaccharides labeled with 2-aminobezoic acid is presented using HILIC and LED (365 nm) induced fluorescence. Copyright © 2016 Elsevier B.V. All rights reserved.

High-Yield Spin Labeling of Long RNAs for Electron Paramagnetic Resonance Spectroscopy.

PubMed

Kerzhner, Mark; Matsuoka, Hideto; Wuebben, Christine; Famulok, Michael; Schiemann, Olav

2018-05-10

Site-directed spin labeling is a powerful tool for investigating the conformation and dynamics of biomacromolecules such as RNA. Here we introduce a spin labeling strategy based on click chemistry in solution that, in combination with enzymatic ligation, allows highly efficient labeling of complex and long RNAs with short reaction times and suppressed RNA degradation. With this approach, a 34-nucleotide aptamer domain of the preQ1 riboswitch and an 81-nucleotide TPP riboswitch aptamer could be labeled with two labels in several positions. We then show that conformations of the preQ1 aptamer and its dynamics can be monitored in the absence and presence of Mg 2+ and a preQ1 ligand by continuous wave electron paramagnetic resonance spectroscopy at room temperature and pulsed electron-electron double resonance spectroscopy (PELDOR or DEER) in the frozen state.

Triacylglycerol mobilization is suppressed by brefeldin A in Chlamydomonas reinhardtii

PubMed Central

Kato, Naohiro; Dong, Trung; Bailey, Michael; Lum, Tony; Ingram, Drury

2013-01-01

Brefeldin A suppresses vesicle trafficking by inhibiting exchange of GDP for GTP in ADP-ribosylation factor. We report that brefeldin A suppresses mobilization of triacylglycerols in Chlamydomonas reinhardtii, a model organism of green microalgae. Analyses revealed that brefeldin A causes Chlamydomonas to form lipid droplets in which triacylglycerols accumulate in a dose-dependent manner. Pulse labeling experiment using fluorescent fatty acids suggested that brefeldin A inhibits the cells from degrading fatty acids. The experiment also revealed that the cells transiently form novel compartments that accumulate exogenously added fatty acids in the cytoplasm, designated fatty acid-induced microbodies (FAIMs). Brefeldin A up-regulates the formation of FAIMs, whereas nitrogen deprivation that up-regulates triacylglycerol synthesis in Chlamydomonas does not cause the cells to form FAIMs. These results underscore the role of the vesicle trafficking machinery in triacylglycerol metabolism in green microalgae. PMID:23872273

Radial diffusion, vertical transport, and refixation of labeled bicarbonate in scots pine stems

NASA Astrophysics Data System (ADS)

Marshall, J. D.; Tarvainen, L.; Wallin, G.

2016-12-01

The CO2 produced by a respiring stem provides an index of metabolic activity in the stem and a quantitative estimate of an important component of the forest carbon budget. Production of CO2 by a given stem volume is lost by three competing processes. First, some diffuses radially outward through the bark. Second, some is dissolved and vertically transported upward out of the control volume by the xylem stream. Third, some is refixed by photosynthesis under the bark. The relative balance among these pathways was quantified in 17-m Scots pine trees by 13C-bicarbonate labeling of the xylem stream and monitoring of the 13CO2 in the xylem water, along with continuous monitoring of the radial diffusive flux at four canopy heights and in transpiration from leaves. Most of the label diffused out radially, as 13CO2, immediately above the labeling site, over about a week. The pulse was weakly and briefly detected 4 m above that height. Further up the stem it was not detected at all. We detected significant refixation of CO2 in the stems at all heights above 4 m, where the bark becomes papery and thin, but the label was so weak at this height that refixation had little influence on the pulse chase. We conclude that the vertical flux is negligible in Scots pine, but that the refixation flux must be accounted for in estimates of whole-stem CO2 efflux.

Quantification of dynamic soil - vegetation feedbacks following an isotopically labelled precipitation pulse

NASA Astrophysics Data System (ADS)

Piayda, Arndt; Dubbert, Maren; Siegwolf, Rolf; Cuntz, Matthias; Werner, Christiane

2017-04-01

The presence of vegetation alters hydrological cycles of ecosystems. Complex plant-soil interactions govern the fate of precipitation input and water transitions through ecosystem compartments. Disentangling these interactions is a major challenge in the field of ecohydrology and pivotal foundation for understanding the carbon cycle of semi-arid ecosystems. Stable water isotopes can be used in this context as tracer to quantify water movement through soil-vegetation-atmosphere interfaces. The aim of this study is to disentangle vegetation effects on soil water infiltration and distribution as well as dynamics of soil evaporation and grassland water-use in a Mediterranean cork-oak woodland during dry conditions. An irrigation experiment using δ18O-labeled water was carried out in order to quantify distinct effects of tree and herbaceous vegetation on infiltration and distribution of event water in the soil profile. Dynamic responses of soil and herbaceous vegetation fluxes to precipitation regarding event water-use, water uptake depth plasticity and contribution to ecosystem evapotranspiration were quantified. Total water loss to the atmosphere from bare soil was as high as from vegetated soil, utilizing large amounts of unproductive water loss for biomass production, carbon sequestration and nitrogen fixation. During the experiment no adjustments of main root water uptake depth to changes of water availability could be observed, rendering light to medium precipitation events under dry conditions useless. This forces understory plants to compete with adjacent trees for soil water in deeper soil layers. Thus understory plants are faster subject to chronic drought, leading to premature senescence at the onset of drought. Despite this water competition, the presence of Cork oak trees fosters infiltration to large degrees. That reduces drought stress, caused by evapotranspiration, due to favourable micro climatic conditions under tree crown shading. This study highlights complex soil-plant-atmosphere and inter-species interactions in both space and time controlling the fate of rain pulse transitions through a typical Mediterranean savannah ecosystem, disentangled by the use of stable water isotopes.

Quantification of dynamic soil-vegetation feedbacks following an isotopically labelled precipitation pulse

NASA Astrophysics Data System (ADS)

Piayda, Arndt; Dubbert, Maren; Siegwolf, Rolf; Cuntz, Matthias; Werner, Christiane

2017-05-01

The presence of vegetation alters hydrological cycles of ecosystems. Complex plant-soil interactions govern the fate of precipitation input and water transitions through ecosystem compartments. Disentangling these interactions is a major challenge in the field of ecohydrology and a pivotal foundation for understanding the carbon cycle of semi-arid ecosystems. Stable water isotopes can be used in this context as tracer to quantify water movement through soil-vegetation-atmosphere interfaces. The aim of this study is to disentangle vegetation effects on soil water infiltration and distribution as well as dynamics of soil evaporation and grassland water use in a Mediterranean cork oak woodland during dry conditions. An irrigation experiment using δ18O labelled water was carried out in order to quantify distinct effects of tree and herbaceous vegetation on the infiltration and distribution of event water in the soil profile. Dynamic responses of soil and herbaceous vegetation fluxes to precipitation regarding event water use, water uptake depth plasticity, and contribution to ecosystem soil evaporation and transpiration were quantified. Total water loss to the atmosphere from bare soil was as high as from vegetated soil, utilizing large amounts of unproductive evaporation for transpiration, but infiltration rates decreased. No adjustments of main root water uptake depth to changes in water availability could be observed during the experiment. This forces understorey plants to compete with adjacent trees for water in deeper soil layers at the onset of summer. Thus, understorey plants are subjected to chronic water deficits faster, leading to premature senescence at the onset of drought. Despite this water competition, the presence of cork oak trees fosters infiltration and reduces evapotranspirative water losses from the understorey and the soil, both due to altered microclimatic conditions under crown shading. This study highlights complex soil-plant-atmosphere and inter-species interactions controlling rain pulse transitions through a typical Mediterranean savannah ecosystem, disentangled by the use of stable water isotopes.

13C-13C dipolar recoupling under very fast magic angle spinning in solid-state nuclear magnetic resonance: Applications to distance measurements, spectral assignments, and high-throughput secondary-structure determination

NASA Astrophysics Data System (ADS)

Ishii, Yoshitaka

2001-05-01

A technique is presented to recouple homonuclear dipolar couplings between dilute spin pairs such as 13C-13C systems under very fast magic angle spinning (MAS) in solid-state nuclear magnetic resonance (NMR) spectroscopy. The presented technique, finite pulse rf driven recoupling (fpRFDR), restores homonuclear dipolar interactions based on constructive usage of finite pulse-width effects in a phase- and symmetry-cycled π-pulse train in which a rotor-synchronous π pulse is applied every rotation period. The restored effective dipolar interaction has the form of a zero-quantum dipolar Hamiltonian for static solids, whose symmetry in spin space is different from that obtained by conventional rf driven recoupling (RFDR) techniques. It is demonstrated that the efficiency of recoupling by fpRFDR is not strongly dependent on chemical shift differences or resonance offsets in contrast to previous recoupling methods under very fast MAS. To realize distance measurements without effects of spin relaxation, a constant-time version of fpRFDR (CT-fpRFDR) is introduced, in which the effective evolution period is varied by refocusing dipolar evolution with a rotor-synchronized solid echo while the total recoupling period is kept constant. From CT-fpRFDR experiments at a spinning speed of 30.3 kHz in a field of 17.6 T, the 13C-13C distance of [1-13C]Ala-[1-13C]Gly-Gly was determined to be 3.27 Å, which agrees well with the value of 3.20 Å obtained by x-ray diffraction. Also, two-dimensional (2D) 13C/13C chemical-shift correlation NMR spectrum in a field of 9.4 T was obtained with fpRFDR for fibrils of the segmentally 13C- and 15N-labeled Alzheimer's β-Amyloid fragments, Aβ16-22 (residues 16-22 taken from the 40-residue Aβ peptide) in which Leu-17 through Ala-21 are uniformly 13C- and 15N-labeled. Most 13C resonances for the main chain as well as for the side chains are assigned based on 2D 13C/13C chemical-shift correlation patterns specific to amino-acid types. Examination of the obtained 13C chemical shifts revealed the formation of β-strand across the entire molecule of Aβ16-22. Possibility of high throughput determination of global main-chain structures based on 13C shifts obtained from 2D 13C/13C chemical-shift correlation under very fast MAS is also discussed for uniformly/segmentally 13C-labeled protein/peptide samples.

"Dark matter" worlds of unstable RNA and protein.

PubMed

Baboo, Sabyasachi; Cook, Peter R

2014-01-01

Astrophysicists use the term "dark matter" to describe the majority of the matter and/or energy in the universe that is hidden from view, and biologists now apply it to the new families of RNA they are uncovering. We review evidence for an analogous hidden world containing peptides. The critical experiments involved pulse-labeling human cells with tagged amino acids for periods as short as five seconds. Results are extraordinary in two respects: both nucleus and cytoplasm become labeled, and most signals disappear with a half-life of less than one minute. Just as the synthesis of each mature mRNA is regulated by the abortive production of hundreds of shorter transcripts that are quickly degraded, it seems that the synthesis of each full-length protein in the stable proteome is regulated by an apparently wasteful production and degradation of shorter peptides. Some of the nuclear synthesis is probably a byproduct of nuclear ribosomes proofreading newly-made RNA for inappropriately-placed termination codons (a process that triggers "nonsense-mediated decay"). We speculate that some "dark-matter" peptides will play other important roles in the cell.

“Dark matter” worlds of unstable RNA and protein

PubMed Central

Baboo, Sabyasachi; Cook, Peter R

2014-01-01

Astrophysicists use the term “dark matter” to describe the majority of the matter and/or energy in the universe that is hidden from view, and biologists now apply it to the new families of RNA they are uncovering. We review evidence for an analogous hidden world containing peptides. The critical experiments involved pulse-labeling human cells with tagged amino acids for periods as short as five seconds. Results are extraordinary in two respects: both nucleus and cytoplasm become labeled, and most signals disappear with a half-life of less than one minute. Just as the synthesis of each mature mRNA is regulated by the abortive production of hundreds of shorter transcripts that are quickly degraded, it seems that the synthesis of each full-length protein in the stable proteome is regulated by an apparently wasteful production and degradation of shorter peptides. Some of the nuclear synthesis is probably a byproduct of nuclear ribosomes proofreading newly-made RNA for inappropriately-placed termination codons (a process that triggers “nonsense-mediated decay”). We speculate that some “dark-matter” peptides will play other important roles in the cell. PMID:25482115

Parallel labeling experiments and metabolic flux analysis: Past, present and future methodologies.

PubMed

Crown, Scott B; Antoniewicz, Maciek R

2013-03-01

Radioactive and stable isotopes have been applied for decades to elucidate metabolic pathways and quantify carbon flow in cellular systems using mass and isotope balancing approaches. Isotope-labeling experiments can be conducted as a single tracer experiment, or as parallel labeling experiments. In the latter case, several experiments are performed under identical conditions except for the choice of substrate labeling. In this review, we highlight robust approaches for probing metabolism and addressing metabolically related questions though parallel labeling experiments. In the first part, we provide a brief historical perspective on parallel labeling experiments, from the early metabolic studies when radioisotopes were predominant to present-day applications based on stable-isotopes. We also elaborate on important technical and theoretical advances that have facilitated the transition from radioisotopes to stable-isotopes. In the second part of the review, we focus on parallel labeling experiments for (13)C-metabolic flux analysis ((13)C-MFA). Parallel experiments offer several advantages that include: tailoring experiments to resolve specific fluxes with high precision; reducing the length of labeling experiments by introducing multiple entry-points of isotopes; validating biochemical network models; and improving the performance of (13)C-MFA in systems where the number of measurements is limited. We conclude by discussing some challenges facing the use of parallel labeling experiments for (13)C-MFA and highlight the need to address issues related to biological variability, data integration, and rational tracer selection. Copyright © 2012 Elsevier Inc. All rights reserved.

Label-free optical-resolution photoacoustic microscopy of superficial microvasculature using a compact visible laser diode excitation

PubMed Central

Zeng, Lvming; Piao, Zhonglie; Huang, Shenghai; Jia, Wangcun; Chen, Zhongping

2015-01-01

We have developed laser-diode-based optical-resolution photoacoustic microscopy (LD-OR-PAM) of superficial microvasculature which has the desirable properties of being compact, low-cost, and label-free. A 300-mW visible pulsed laser diode was operated at a 405 ± 5 nm wavelength with a pulse energy as low as 52 nJ. By using a 3.6 MHz ultrasound transducer, the system was tested on carbon fibers with a lateral resolution of 0.95 µm and an SNR of 38 dB. The subcutaneous microvasculature on a mouse back was imaged without an exogenous contrast agent which demonstrates the potential of the proposed prototype for skin chromophores. Our eventual goal is to offer a practical and affordable multi-wavelength functional LD-OR-PAM instrument suitable for clinical applications. PMID:26698732

Feasibility of Quantifying Arterial Cerebral Blood Volume Using Multiphase Alternate Ascending/Descending Directional Navigation (ALADDIN).

PubMed

Kim, Ki Hwan; Choi, Seung Hong; Park, Sung-Hong

2016-01-01

Arterial cerebral blood volume (aCBV) is associated with many physiologic and pathologic conditions. Recently, multiphase balanced steady state free precession (bSSFP) readout was introduced to measure labeled blood signals in the arterial compartment, based on the fact that signal difference between labeled and unlabeled blood decreases with the number of RF pulses that is affected by blood velocity. In this study, we evaluated the feasibility of a new 2D inter-slice bSSFP-based arterial spin labeling (ASL) technique termed, alternate ascending/descending directional navigation (ALADDIN), to quantify aCBV using multiphase acquisition in six healthy subjects. A new kinetic model considering bSSFP RF perturbations was proposed to describe the multiphase data and thus to quantify aCBV. Since the inter-slice time delay (TD) and gap affected the distribution of labeled blood spins in the arterial and tissue compartments, we performed the experiments with two TDs (0 and 500 ms) and two gaps (300% and 450% of slice thickness) to evaluate their roles in quantifying aCBV. Comparison studies using our technique and an existing method termed arterial volume using arterial spin tagging (AVAST) were also separately performed in five subjects. At 300% gap or 500-ms TD, significant tissue perfusion signals were demonstrated, while tissue perfusion signals were minimized and arterial signals were maximized at 450% gap and 0-ms TD. ALADDIN has an advantage of visualizing bi-directional flow effects (ascending/descending) in a single experiment. Labeling efficiency (α) of inter-slice blood flow effects could be measured in the superior sagittal sinus (SSS) (20.8±3.7%.) and was used for aCBV quantification. As a result of fitting to the proposed model, aCBV values in gray matter (1.4-2.3 mL/100 mL) were in good agreement with those from literature. Our technique showed high correlation with AVAST, especially when arterial signals were accentuated (i.e., when TD = 0 ms) (r = 0.53). The bi-directional perfusion imaging with multiphase ALADDIN approach can be an alternative to existing techniques for quantification of aCBV.

Temporal overlap estimation based on interference spectrum in CARS microscopy

NASA Astrophysics Data System (ADS)

Zhang, Yongning; Jiang, Junfeng; Liu, Kun; Huang, Can; Wang, Shuang; Zhang, Xuezhi; Liu, Tiegen

2018-01-01

Coherent Anti-Stokes Raman Scattering (CARS) microscopy has attracted lots of attention because of the advantages, such as noninvasive, label-free, chemical specificity, intrinsic three-dimension spatial resolution and so on. However, the temporal overlap of pump and Stokes has not been solved owing to the ultrafast optical pulse used in CARS microscopy. We combine interference spectrum of residual pump in Stokes path and nonlinear Schrodinger equation (NLSE) to realize the temporal overlap of pump pulse and Stokes pulse. At first, based on the interference spectrum of pump pulse and residual pump in Stokes path, the optical delay is defined when optical path difference between pump path and Stokes path is zero. Then the relative optical delay between Stokes pulse and residual pump in PCF can be calculated by NLSE. According to the spectrum interference and NLSE, temporal overlap of pump pulse and Stokes pulse will be realized easily and the imaging speed will be improved in CARS microscopy.

Different oligosaccharide processing of the membrane-integrated and the secretory form of gp 80 in rat liver.

PubMed

Tauber, R; Schenck, I; Josić, D; Gross, V; Heinrich, P C; Gerok, W; Reutter, W

1986-09-01

Rat liver synthesizes a glycoprotein with Mr of 80.000 (gp 80) which is partly inserted into the plasma membrane and partly secreted into the serum. The membrane-integrated and the secretory form of this glycoprotein have an identical peptide pattern, but different N-linked glycans. Whereas gp 80 from the serum is glycosylated with complex-type oligosaccharides, gp 80 from the plasma membrane has high mannose glycans. Phase separation with Triton X-114 showed that membrane-integrated gp 80 contains hydrophobic portions, whereas secretory gp 80 has hydrophilic properties. Intracellular transport and oligosaccharide processing of gp 80 were studied in vivo in the endoplasmic reticulum, the Golgi apparatus and plasma membranes of rat liver and in serum using pulse-chase labeling with L-[35S]methionine and immunoprecipitation. Peak labeling of gp 80 was reached in the endoplasmic reticulum 10 min after the pulse, in the Golgi apparatus 20 min later, and in the plasma membrane after 2 h; in the serum the specific radioactivity was steadily increasing during the experiment. Gp 80 of the endoplasmic reticulum was completely sensitive to endo-beta-N-glucosaminidase H (endo H), but simultaneously occurred in the Golgi apparatus in an endo H-sensitive and endo H-resistant form. The endo H-sensitive form was transported to the plasma membrane, the endo H-resistant species secreted into the serum. Conversion from the endo H-sensitive to the endo H-resistant form was completed within 10 min after transfer of gp 80 to the Golgi apparatus.(ABSTRACT TRUNCATED AT 250 WORDS)

"Miscommunication" and Undergraduate Women's Conceptualizations of Sexual Assault: A Qualitative Analysis.

PubMed

Dardis, Christina M; Kraft, Kathryn M; Gidycz, Christine A

2017-08-01

Approximately 60% of legally defined rape victims do not label their experiences as "rape," most of whom label the experience as "a serious miscommunication." However, little research has examined why women choose this label. Labeling rape as a miscommunication could be problematic if chosen due to stereotypical conceptions that one's experience is not "real" rape. The present study used a mixed-methodological approach to understand why women might refer to rape as a "miscommunication," and how their reasons for labeling might differ from those who label their experiences and those who are nonlabeled (i.e., unequivocally state that they were "not victimized"). Participants included 123 undergraduate women who experienced rape. Participants responded to how they labeled rape and answered questions regarding assault characteristics, disclosure, reporting, and self- and perpetrator blame. Chi-square analyses assessed labeling group differences. Responses to an open-ended question about factors contributing to their labeling decision were content analyzed. Whereas miscommunication-labeled and nonlabeled victims reported similar assault characteristics in the quantitative analyses, qualitative content analyses revealed varying reasons for labeling rape as miscommunication, not victimization, and rape. Over three quarters of miscommunication-labeled victims reported that one or more of the following factors influenced their labeling: victim and perpetrator substance use, sexual activity prior to the rape, and perceptions that one did not express nonconsent strongly enough and that the perpetrator "did not realize" their lack of desire. Whereas miscommunication-labeled and nonlabeled victims reported similar assault characteristics, the extent to which those assault characteristics affected their labeling differed. Those who labeled their experiences as miscommunication gave reasons for their label that centered on factors which reflect inconsistencies between their experiences and "stereotypical rape." Misperceptions of rape can be addressed via prevention programming and clinical work.

Dissimilation of [(13)C]methanol by continuous cultures of Bacillus methanolicus MGA3 at 50 degrees C studied by (13)C NMR and isotope-ratio mass spectrometry.

PubMed

Pluschkell, Stefanie B; Flickinger, Michael C

2002-10-01

Using a continuous culture of Bacillus methanolicus MGA3 limited by 100 mM methanol in the feed and growing at a dilution rate D=0.25 h(-1), transients in dissolved methanol were studied to determine the effects of methanol toxicity and the pathway of methanol dissimilation to CO(2). Steady-state cultures were disturbed by pulses of methanol resulting in a rapid change in concentration of 6.4-12.8 mM. B. methanolicus MGA3 responded to a sudden increase in available methanol by a transient decline in the biomass concentration in the reactor. In most cases the culture returned to steady state between 4 and 12 h after pulse addition. However, at a methanol pulse of 12.8 mM, complete biomass washout occurred and the culture did not return to steady state. Integrating the response curves of the dry biomass concentration over a 12 h time period showed that a methanol pulse can cause an average transient decline in the biomass yield of up to 22%. (13)C NMR experiments using labelled methanol indicated that the transient partial or complete biomass washout was probably caused by toxic accumulation of formaldehyde in the culture. These experiments also showed accumulation of formate, indicating that B. methanolicus possesses formaldehyde dehydrogenase and formate dehydrogenase activity resulting in a methanol dissimilation pathway via formate to CO(2). Studies using isotope-ratio mass spectrometry provided further evidence of a methanol dissimilation pathway via formate. B. methanolicus MGA3, growing continuously under methanol limitation, consumed added formate at a rate of approximately 0.85 mmol l(-1) h(-1). Furthermore, significant accumulation of (13)CO(2) in the reactor exhaust gas was measured in response to a pulse addition of [(13)C]formic acid to the bioreactor. This indicates that B. methanolicus dissimilates methanol carbon to CO(2) in order to detoxify formaldehyde by both a linear pathway to formate and a cyclic mechanism as part of the RuMP pathway.

Label-free screening of single biomolecules through resistive pulse sensing technology for precision medicine applications

NASA Astrophysics Data System (ADS)

Harrer, S.; Kim, S. C.; Schieber, C.; Kannam, S.; Gunn, N.; Moore, S.; Scott, D.; Bathgate, R.; Skafidas, S.; Wagner, J. M.

2015-05-01

Employing integrated nano- and microfluidic circuits for detecting and characterizing biological compounds through resistive pulse sensing technology is a vibrant area of research at the interface of biotechnology and nanotechnology. Resistive pulse sensing platforms can be customized to study virtually any particle of choice which can be threaded through a fluidic channel and enable label-free single-particle interrogation with the primary read-out signal being an electric current fingerprint. The ability to perform label-free molecular screening with single-molecule and even single binding site resolution makes resistive pulse sensing technology a powerful tool for analyzing the smallest units of biological systems and how they interact with each other on a molecular level. This task is at the core of experimental systems biology and in particular ‘omics research which in combination with next-generation DNA-sequencing and next-generation drug discovery and design forms the foundation of a novel disruptive medical paradigm commonly referred to as personalized medicine or precision medicine. DNA-sequencing has approached the 1000-Dollar-Genome milestone allowing for decoding a complete human genome with unmatched speed and at low cost. Increased sequencing efficiency yields massive amounts of genomic data. Analyzing this data in combination with medical and biometric health data eventually enables understanding the pathways from individual genes to physiological functions. Access to this information triggers fundamental questions for doctors and patients alike: what are the chances of an outbreak for a specific disease? Can individual risks be managed and if so how? Which drugs are available and how should they be applied? Could a new drug be tailored to an individual’s genetic predisposition fast and in an affordable way? In order to provide answers and real-life value to patients, the rapid evolvement of novel computing approaches for analyzing big data in systems genomics has to be accompanied by an equally strong effort to develop next-generation DNA-sequencing and next-generation drug screening and design platforms. In that context lab-on-a-chip devices utilizing nanopore- and nanochannel based resistive pulse-sensing technology for DNA-sequencing and protein screening applications occupy a key role. This paper describes the status quo of resistive pulse sensing technology for these two application areas with a special focus on current technology trends and challenges ahead.

Label-free screening of single biomolecules through resistive pulse sensing technology for precision medicine applications.

PubMed

Harrer, S; Kim, S C; Schieber, C; Kannam, S; Gunn, N; Moore, S; Scott, D; Bathgate, R; Skafidas, S; Wagner, J M

2015-05-08

Employing integrated nano- and microfluidic circuits for detecting and characterizing biological compounds through resistive pulse sensing technology is a vibrant area of research at the interface of biotechnology and nanotechnology. Resistive pulse sensing platforms can be customized to study virtually any particle of choice which can be threaded through a fluidic channel and enable label-free single-particle interrogation with the primary read-out signal being an electric current fingerprint. The ability to perform label-free molecular screening with single-molecule and even single binding site resolution makes resistive pulse sensing technology a powerful tool for analyzing the smallest units of biological systems and how they interact with each other on a molecular level. This task is at the core of experimental systems biology and in particular 'omics research which in combination with next-generation DNA-sequencing and next-generation drug discovery and design forms the foundation of a novel disruptive medical paradigm commonly referred to as personalized medicine or precision medicine. DNA-sequencing has approached the 1000-Dollar-Genome milestone allowing for decoding a complete human genome with unmatched speed and at low cost. Increased sequencing efficiency yields massive amounts of genomic data. Analyzing this data in combination with medical and biometric health data eventually enables understanding the pathways from individual genes to physiological functions. Access to this information triggers fundamental questions for doctors and patients alike: what are the chances of an outbreak for a specific disease? Can individual risks be managed and if so how? Which drugs are available and how should they be applied? Could a new drug be tailored to an individual's genetic predisposition fast and in an affordable way? In order to provide answers and real-life value to patients, the rapid evolvement of novel computing approaches for analyzing big data in systems genomics has to be accompanied by an equally strong effort to develop next-generation DNA-sequencing and next-generation drug screening and design platforms. In that context lab-on-a-chip devices utilizing nanopore- and nanochannel based resistive pulse-sensing technology for DNA-sequencing and protein screening applications occupy a key role. This paper describes the status quo of resistive pulse sensing technology for these two application areas with a special focus on current technology trends and challenges ahead.

Calling It Rape: Differences in Experiences of Women Who Do or Do Not Label Their Sexual Assault as Rape

ERIC Educational Resources Information Center

Kahn, Arnold S.; Jackson, Jennifer; Kully, Christine; Badger, Kelly; Halvorsen, Jessica

2003-01-01

Past research had found that one-half or more of all women who have had an experience that might meet the definition of rape do not label themselves rape victims. The present study examined the actual rape experiences of 33 women who labeled their assault experience as rape and 56 women who did not label their assault experience as rape through…

Focus: Two-dimensional electron-electron double resonance and molecular motions: The challenge of higher frequencies

DOE Office of Scientific and Technical Information (OSTI.GOV)

Franck, John M.; Chandrasekaran, Siddarth; Dzikovski, Boris

2015-06-07

The development, applications, and current challenges of the pulsed ESR technique of two-dimensional Electron-Electron Double Resonance (2D ELDOR) are described. This is a three-pulse technique akin to 2D Exchange Nuclear Magnetic Resonance, but involving electron spins, usually in the form of spin-probes or spin-labels. As a result, it required the extension to much higher frequencies, i.e., microwaves, and much faster time scales, with π/2 pulses in the 2-3 ns range. It has proven very useful for studying molecular dynamics in complex fluids, and spectral results can be explained by fitting theoretical models (also described) that provide a detailed analysis ofmore » the molecular dynamics and structure. We discuss concepts that also appear in other forms of 2D spectroscopy but emphasize the unique advantages and difficulties that are intrinsic to ESR. Advantages include the ability to tune the resonance frequency, in order to probe different motional ranges, while challenges include the high ratio of the detection dead time vs. the relaxation times. We review several important 2D ELDOR studies of molecular dynamics. (1) The results from a spin probe dissolved in a liquid crystal are followed throughout the isotropic → nematic → liquid-like smectic → solid-like smectic → crystalline phases as the temperature is reduced and are interpreted in terms of the slowly relaxing local structure model. Here, the labeled molecule is undergoing overall motion in the macroscopically aligned sample, as well as responding to local site fluctuations. (2) Several examples involving model phospholipid membranes are provided, including the dynamic structural characterization of the boundary lipid that coats a transmembrane peptide dimer. Additionally, subtle differences can be elicited for the phospholipid membrane phases: liquid disordered, liquid ordered, and gel, and the subtle effects upon the membrane, of antigen cross-linking of receptors on the surface of plasma membrane, vesicles can be observed. These 2D ELDOR experiments are performed as a function of mixing time, T{sub m}, i.e., the time between the second and third π/2 pulses, which provides a third dimension. In fact, a fourth dimension may be added by varying the ESR frequency/magnetic field combination. Therefore, (3) it is shown how continuous-wave multifrequency ESR studies enable the decomposition of complex dynamics of, e.g., proteins by virtue of their respective time scales. These studies motivate our current efforts that are directed to extend 2D ELDOR to higher frequencies, 95 GHz in particular (from 9 and 17 GHz), in order to enable multi-frequency 2D ELDOR. This required the development of quasi-optical methods for performing the mm-wave experiments, which are summarized. We demonstrate state-of-the-art 95 GHz 2D ELDOR spectroscopy through its ability to resolve the two signals from a spin probe dissolved in both the lipid phase and the coexisting aqueous phase. As current 95 GHz experiments are restricted by limited spectral coverage of the π/2 pulse, as well as the very short T{sub 2} relaxation times of the electron spins, we discuss how these limitations are being addressed.« less

Problem-based test: replication of mitochondrial DNA during the cell cycle.

PubMed

Sétáló, György

2013-01-01

Terms to be familiar with before you start to solve the test: cell cycle, generation time, S-phase, cell culture synchronization, isotopic pulse-chase labeling, density labeling, equilibrium density-gradient centrifugation, buoyant density, rate-zonal centrifugation, nucleoside, nucleotide, kinase enzymes, polymerization of nucleic acids, re-replication block, cell fractionation, Svedberg (sedimentation constant = [ S]), nuclear DNA, mitochondrial DNA, heavy and light mitochondrial DNA chains, heteroplasmy, mitochondrial diseases Copyright © 2013 Wiley Periodicals, Inc.

Room-temperature electron spin relaxation of nitroxides immobilized in trehalose: Effect of substituents adjacent to NO-group

NASA Astrophysics Data System (ADS)

Kuzhelev, Andrey A.; Strizhakov, Rodion K.; Krumkacheva, Olesya A.; Polienko, Yuliya F.; Morozov, Denis A.; Shevelev, Georgiy Yu.; Pyshnyi, Dmitrii V.; Kirilyuk, Igor A.; Fedin, Matvey V.; Bagryanskaya, Elena G.

2016-05-01

Trehalose has been recently promoted as efficient immobilizer of biomolecules for room-temperature EPR studies, including distance measurements between attached nitroxide spin labels. Generally, the structure of nitroxide influences the electron spin relaxation times, being crucial parameters for room-temperature pulse EPR measurements. Therefore, in this work we investigated a series of nitroxides with different substituents adjacent to NO-moiety including spirocyclohexane, spirocyclopentane, tetraethyl and tetramethyl groups. Electron spin relaxation times (T1, Tm) of these radicals immobilized in trehalose were measured at room temperature at X- and Q-bands (9/34 GHz). In addition, a comparison was made with the corresponding relaxation times in nitroxide-labeled DNA immobilized in trehalose. In all cases phase memory times Tm were close to 700 ns and did not essentially depend on structure of substituents. Comparison of temperature dependences of Tm at T = 80-300 K shows that the benefit of spirocyclohexane substituents well-known at medium temperatures (∼100-180 K) becomes negligible at 300 K. Therefore, unless there are specific interactions between spin labels and biomolecules, the room-temperature value of Tm in trehalose is weakly dependent on the structure of substituents adjacent to NO-moiety of nitroxide. The issues of specific interactions and stability of nitroxide labels in biological media might be more important for room temperature pulsed dipolar EPR than differences in intrinsic spin relaxation of radicals.

Detection and Characterization of Conjugative Degradative Plasmids in Xenobiotic-Degrading Sphingomonas Strains

PubMed Central

Basta, Tamara; Keck, Andreas; Klein, Joachim; Stolz, Andreas

2004-01-01

A systematic survey for the presence of plasmids in 17 different xenobiotic-degrading Sphingomonas strains was performed. In almost all analyzed strains, two to five plasmids with sizes of about 50 to 500 kb were detected by using pulsed-field gel electrophoresis. A comparison of plasmid preparations untreated or treated with S1 nuclease suggested that, in general, Sphingomonas plasmids are circular. Hybridization experiments with labeled gene probes suggested that large plasmids are involved in the degradation of dibenzo-p-dioxin, dibenzofuran, and naphthalenesulfonates in S. wittichii RW1, Sphingomonas sp. HH69, and S. xenophaga BN6, respectively. The plasmids which are responsible for the degradation of naphthalene, biphenyl, and toluene by S. aromaticivorans F199 (pNL1) and of naphthalenesulfonates by S. xenophaga BN6 (pBN6) were site-specifically labeled with a kanamycin resistance cassette. The conjugative transfer of these labeled plasmids was attempted with various bacterial strains as putative recipient strains. Thus, a conjugative transfer of plasmid pBN6 from S. xenophaga BN6 to a cured mutant of strain BN6 and to Sphingomonas sp. SS3 was observed. The conjugation experiments with plasmid pNL1 suggested a broader host range of this plasmid, because it was transferred without any obvious structural changes to S. yanoikuyae B1, Sphingomonas sp. SS3, and S. herbicidovorans. In contrast, major plasmid rearrangements were observed in the transconjugants after the transfer of plasmid pNL1 to Sphingomonas sp. HH69 and of pBN6 to Sphingomonas sp. SS3. No indications for the transfer of a Sphingomonas plasmid to bacteria outside of the Sphingomonadaceae were obtained. PMID:15175300

High incidence of non-random template strand segregation and asymmetric fate determination in dividing stem cells and their progeny.

PubMed

Conboy, Michael J; Karasov, Ariela O; Rando, Thomas A

2007-05-01

Decades ago, the "immortal strand hypothesis" was proposed as a means by which stem cells might limit acquiring mutations that could give rise to cancer, while continuing to proliferate for the life of an organism. Originally based on observations in embryonic cells, and later studied in terms of stem cell self-renewal, this hypothesis has remained largely unaccepted because of few additional reports, the rarity of the cells displaying template strand segregation, and alternative interpretations of experiments involving single labels or different types of labels to follow template strands. Using sequential pulses of halogenated thymidine analogs (bromodeoxyuridine [BrdU], chlorodeoxyuridine [CldU], and iododeoxyuridine [IdU]), and analyzing stem cell progeny during induced regeneration in vivo, we observed extraordinarily high frequencies of segregation of older and younger template strands during a period of proliferative expansion of muscle stem cells. Furthermore, template strand co-segregation was strongly associated with asymmetric cell divisions yielding daughters with divergent fates. Daughter cells inheriting the older templates retained the more immature phenotype, whereas daughters inheriting the newer templates acquired a more differentiated phenotype. These data provide compelling evidence of template strand co-segregation based on template age and associated with cell fate determination, suggest that template strand age is monitored during stem cell lineage progression, and raise important caveats for the interpretation of label-retaining cells.

Valine but not leucine or isoleucine supports neurotransmitter glutamate synthesis during synaptic activity in cultured cerebellar neurons.

PubMed

Bak, Lasse K; Johansen, Maja L; Schousboe, Arne; Waagepetersen, Helle S

2012-09-01

Synthesis of neuronal glutamate from α-ketoglutarate for neurotransmission necessitates an amino group nitrogen donor; however, it is not clear which amino acid(s) serves this role. Thus, the ability of the three branched-chain amino acids (BCAAs), leucine, isoleucine, and valine, to act as amino group nitrogen donors for synthesis of vesicular neurotransmitter glutamate was investigated in cultured mouse cerebellar (primarily glutamatergic) neurons. The cultures were superfused in the presence of (15) N-labeled BCAAs, and synaptic activity was induced by pulses of N-methyl-D-aspartate (300 μM), which results in release of vesicular glutamate. At the end of the superfusion experiment, the vesicular pool of glutamate was released by treatment with α-latrotoxin (3 nM, 5 min). This experimental paradigm allows a separate analysis of the cytoplasmic and vesicular pools of glutamate. Amount and extent of (15) N labeling of intracellular amino acids plus vesicular glutamate were analyzed employing HPLC and LC-MS analysis. Only when [(15) N]valine served as precursor did the labeling of both cytoplasmic and vesicular glutamate increase after synaptic activity. In addition, only [(15) N]valine was able to maintain the amount of vesicular glutamate during synaptic activity. This indicates that, among the BCAAs, only valine supports the increased need for synthesis of vesicular glutamate. Copyright © 2012 Wiley Periodicals, Inc.

Infant sensitivity to speaker and language in learning a second label.

PubMed

Bhagwat, Jui; Casasola, Marianella

2014-02-01

Two experiments examined when monolingual, English-learning 19-month-old infants learn a second object label. Two experimenters sat together. One labeled a novel object with one novel label, whereas the other labeled the same object with a different label in either the same or a different language. Infants were tested on their comprehension of each label immediately following its presentation. Infants mapped the first label at above chance levels, but they did so with the second label only when requested by the speaker who provided it (Experiment 1) or when the second experimenter labeled the object in a different language (Experiment 2). These results show that 19-month-olds learn second object labels but do not readily generalize them across speakers of the same language. The results highlight how speaker and language spoken guide infants' acceptance of second labels, supporting sociopragmatic views of word learning. Copyright © 2013 Elsevier Inc. All rights reserved.

Labeling of Deployment Sexual Harassment Experiences Among Male and Female Veterans.

PubMed

Dardis, Christina M; Vento, Stephanie A; Gradus, Jaimie L; Street, Amy E

2017-11-20

Victims' conceptualizations of traumatic experiences can impact screening responses and decisions to utilize health care. Despite experiencing events constituting sexual harassment, many victims do not label their experiences as such. In the military, specific situational factors (e.g., occurred on-duty, higher ranking harasser) and victim appraisals of experiences (e.g., offensive, threatening) have been associated with increased labeling of sexual harassment. However, no research has examined sexual harassment labeling among those deployed in recent Afghanistan and Iraq conflicts, where the context of harassment may differ from peacetime settings. The purpose of the present study was to examine frequencies of labeling sexual harassment during deployment, factors associated with labeling, and associations between labeling and perceived need for and use of mental health services. 2,348 veterans (51% women, 49% men) drawn from a random sample of veterans deployed in support of the wars in Afghanistan and Iraq completed a mail survey. Women were significantly more likely than men to label experiences as harassment. Whereas appraisals of events were associated with both women's and men's labeling, situational factors were only associated with women's labeling. Among women, labeling was associated with a greater perceived need for and use of mental health services among those who experienced nonassaultive harassment. These results confirm the importance of using behavioral language when screening for experiences of harassment among veterans returning from deployment. We discuss strategies for addressing labeling in the context of mental health treatment. (PsycINFO Database Record (c) 2017 APA, all rights reserved).

Structural studies of the molybdenum center of mitochondrial amidoxime reducing component (mARC) by pulsed EPR spectroscopy and 17O-labeling

PubMed Central

Rajapakshe, Asha; Astashkin, Andrei V.; Klein, Eric L.; Reichmann, Debora; Mendel, Ralf R.; Bittner, Florian; Enemark, John H.

2011-01-01

Mitochondrial amidoxime reducing components (mARC-1 and mARC-2) represent a novel group of Mo containing enzymes in eukaryotes. These proteins form the catalytic part of a three-component enzyme complex known to be responsible for the reductive activation of several N-hydroxylated prodrugs. No X-ray crystal structures are available for these enzymes as yet. Previous biochemical investigation by B. Wahl et al. (J. Biol. Chem. 285 (2010) 37847–37859) has revealed that two of the Mo coordination positions are occupied by sulfur atoms from a pyranopterindithiolate (molybdopterin, MPT) cofactor. In this work, we have used continuous wave and pulsed electron paramagnetic resonance (EPR) and density functional theoretical (DFT) calculations to determine the nature of remaining ligands in the Mo(V) state of the active site of mARC-2. The experiments with samples in D2O have identified the exchangeable equatorial ligand as a hydroxyl group. The experiments on samples in H217O-enriched buffer have shown the presence of a slowly exchangeable axial oxo ligand. The comparison of the experimental 1H and 17O hyperfine interactions with those calculated using DFT has shown that the remaining non-exchangeable equatorial ligand is, most likely, protein-derived, and that the possibility of an equatorial oxo ligand can be excluded. PMID:21916412

Regulation of asparagine-linked oligosaccharide processing. Oligosaccharide processing in Aedes albopictus mosquito cells.

PubMed

Hsieh, P; Robbins, P W

1984-02-25

We have examined the synthesis and processing of asparagine-linked oligosaccharides from Aedes albopictus C6/36 mosquito cells. These cells synthesized a glucose-containing lipid-linked oligosaccharide with properties identical to that of Glc3Man9GlcNAc2-PP-dolichol. Results of brief pulse label experiments with [3H]mannose were consistent with the transfer of Glc3Man9GlcNAc2 to protein followed by the rapid removal of glucose residues. Pulse-chase experiments established that further processing of oligosaccharides in C6/36 cells resulted in the removal of up to six alpha-linked mannose residues yielding Man3GlcNAc2 whose structure is identical to that of the trimannosyl "core" of N-linked oligosaccharides of vertebrate cells and yeast. Complex-type oligosaccharides were not observed in C6/36 cells. When Sindbis virus was grown in mosquito cells, Man3GlcNAc2 glycans were preferentially located at the two glycosylation sites which were previously shown to have complex glycans in virus grown in vertebrate cells. These Man3GlcNAc2 structures are the most extensively processed oligosaccharides in A. albopictus, and as such, are analogous to the complex glycans of vertebrate cells. We suggest that determinants of oligosaccharide processing which reside in the polypeptide are universally recognized despite evolutionary divergence of the oligosaccharide-processing pathway between insects and vertebrates.

A practical optical-resolution photoacoustic microscopy prototype using a 300 mW visible laser diode

NASA Astrophysics Data System (ADS)

Zeng, Lvming; Piao, Zhonglie; Huang, Shenghai; Jia, Wangcun; Chen, Zhongping

2016-03-01

Optical-resolution photoacoustic microscopy (OR-PAM) is an emerging technique for microvasculature imaging at high spatial resolution and contrast. In this work, we present a practical visible laser-diode-based OR-PAM (LD-OR-PAM) prototype for vasculature imaging, which has the desirable properties of being portable, low-cost, and label-free. The prototype employs a 300 mW pulsed laser diode in a 3.8 mm diameter package, emitting 174 ns pulses at 405 +/- 5 nm wavelength and a pulse energy of 52 nJ. An aspheric objective with a numerical aperture of 0.60 is used to achieve microscope optical illumination. The laser diode excitation has a compact size of 4.5 × 1.8 × 1.8 cm3 assembled with a cooling block. The lateral resolution was tested to be 0.95 μm on ~7 μm carbon fibers. The subcutaneous microvasculature on a mouse back was label-free imaged ex vivo, which demonstrates the potential of the LD-OR-PAM prototype for in vivo imaging skin chromosphores such as hemoglobin. Our ultimate aim is to provide a practical and affordable OR-PAM system as a routine instrument for standard clinical applications.

Uptake of algal carbon and the likely synthesis of an "essential" fatty acid by Uvigerina ex. gr. semiornata (Foraminifera) within the Pakistan margin oxygen minimum zone: evidence from fatty acid biomarker and 13C tracer experiments

NASA Astrophysics Data System (ADS)

Larkin, K. E.; Gooday, A. J.; Woulds, C.; Jeffreys, R. M.; Schwartz, M.; Cowie, G.; Whitcraft, C.; Levin, L.; Dick, J. R.; Pond, D. W.

2014-07-01

Foraminifera are an important component of benthic communities in oxygen-depleted settings, where they potentially play a significant role in the processing of organic matter. We tracked the uptake of a 13C-labelled algal food source into individual fatty acids in the benthic foraminiferal species Uvigerina ex. gr. semiornata from the Arabian Sea oxygen minimum zone (OMZ). The tracer experiments were conducted on the Pakistan margin during the late/post monsoon period (August-October 2003). A monoculture of the diatom Thalassiosira weisflogii was 13C-labelled and used to simulate a pulse of phytoplankton in two complementary experiments. A lander system was used for in situ incubations at 140 m water depth and for 2.5 days in duration. Shipboard laboratory incubations of cores collected at 140 m incorporated an oxystat system to maintain ambient dissolved oxygen concentrations and were terminated after 5 days. Uptake of diatoms was rapid, with a high incorporation of diatom fatty acids into foraminifera after ~ 2 days in both experiments. Ingestion of the diatom food source was indicated by the increase over time in the quantity of diatom biomarker fatty acids in the foraminifera and by the high percentage of 13C in many of the fatty acids present at the endpoint of both in situ and laboratory-based experiments. These results indicate that

Correlating nuclear frequencies by two-dimensional ELDOR-detected NMR spectroscopy.

PubMed

Kaminker, Ilia; Wilson, Tiffany D; Savelieff, Masha G; Hovav, Yonatan; Zimmermann, Herbert; Lu, Yi; Goldfarb, Daniella

2014-03-01

ELDOR (Electron Double Resonance)-detected NMR (EDNMR) is a pulse EPR experiment that is used to measure the transition frequencies of nuclear spins coupled to electron spins. These frequencies are further used to determine hyperfine and quadrupolar couplings, which are signatures of the electronic and spatial structures of paramagnetic centers. In recent years, EDNMR has been shown to be particularly useful at high fields/high frequencies, such as W-band (∼95 GHz, ∼3.5 T), for low γ quadrupolar nuclei. Although at high fields the nuclear Larmor frequencies are usually well resolved, the limited resolution of EDNMR still remains a major concern. In this work we introduce a two dimensional, triple resonance, correlation experiment based on the EDNMR pulse sequence, which we term 2D-EDNMR. This experiment allows circumventing the resolution limitation by spreading the signals in two dimensions and the observed correlations help in the assignment of the signals. First we demonstrate the utility of the 2D-EDNMR experiment on a nitroxide spin label, where we observe correlations between (14)N nuclear frequencies. Negative cross-peaks appear between lines belonging to different MS electron spin manifolds. We resolved two independent correlation patterns for nuclear frequencies arising from the EPR transitions corresponding to the (14)N mI=0 and mI=-1 nuclear spin states, which severely overlap in the one dimensional EDNMR spectrum. The observed correlations could be accounted for by considering changes in the populations of energy levels that S=1/2, I=1 spin systems undergo during the pulse sequence. In addition to these negative cross-peaks, positive cross-peaks appear as well. We present a theoretical model based on the Liouville equation and use it to calculate the time evolution of populations of the various energy levels during the 2D-EDNMR experiment and generated simulated 2D-EDMR spectra. These calculations show that the positive cross-peaks appear due to off resonance effects and/or nuclear relaxation effects. These results suggest that the 2D-EDNMR experiment can be also useful for relaxation pathway studies. Finally we present preliminary results demonstrating that 2D-EDNMR can resolve overlapping (33)S and (14)N signals of type 1 Cu(II) center in (33)S enriched Azurin. Copyright © 2014 Elsevier Inc. All rights reserved.

Genetic algorithm optimized triply compensated pulses in NMR spectroscopy

NASA Astrophysics Data System (ADS)

Manu, V. S.; Veglia, Gianluigi

2015-11-01

Sensitivity and resolution in NMR experiments are affected by magnetic field inhomogeneities (of both external and RF), errors in pulse calibration, and offset effects due to finite length of RF pulses. To remedy these problems, built-in compensation mechanisms for these experimental imperfections are often necessary. Here, we propose a new family of phase-modulated constant-amplitude broadband pulses with high compensation for RF inhomogeneity and heteronuclear coupling evolution. These pulses were optimized using a genetic algorithm (GA), which consists in a global optimization method inspired by Nature's evolutionary processes. The newly designed π and π / 2 pulses belong to the 'type A' (or general rotors) symmetric composite pulses. These GA-optimized pulses are relatively short compared to other general rotors and can be used for excitation and inversion, as well as refocusing pulses in spin-echo experiments. The performance of the GA-optimized pulses was assessed in Magic Angle Spinning (MAS) solid-state NMR experiments using a crystalline U-13C, 15N NAVL peptide as well as U-13C, 15N microcrystalline ubiquitin. GA optimization of NMR pulse sequences opens a window for improving current experiments and designing new robust pulse sequences.

Defective transport of the obesity mutant PC1/3 N222D contributes to loss of function.

PubMed

Prabhu, Yogikala; Blanco, Elias H; Liu, Ming; Peinado, Juan R; Wheeler, Matthew C; Gekakis, Nicholas; Arvan, Peter; Lindberg, Iris

2014-07-01

Mutations in the PCSK1 gene encoding prohormone convertase 1/3 (PC1/3) are strongly associated with obesity in humans. The PC1/3(N222D) mutant mouse thus far represents the only mouse model that mimics the PC1/3 obesity phenotype in humans. The present investigation addresses the cell biology of the N222D mutation. Metabolic labeling experiments reveal a clear defect in the kinetics of insulin biosynthesis in islets from PC1/3(N222D) mutant mice, resulting in an increase in both proinsulin and its processing intermediates, predominantly lacking cleavage at the Arg-Arg site. Although the mutant PC1/3 zymogen is correctly processed to the 87-kDa form, pulse-chase immunoprecipitation experiments, labeling, and immunohistochemical experiments using uncleavable variants all demonstrate that the PC1/3-N222D protein is largely mislocalized compared with similar wild-type (WT) constructs, being predominantly retained in the endoplasmic reticulum. The PC1/3-N222D mutant also undergoes more efficient degradation via the ubiquitin-proteasome system than the WT enzyme. Lastly, the mutant PC1/3-N222D protein coimmunoprecipitates with WT PC1/3 and exerts a modest effect on intracellular retention of the WT enzyme. These profound alterations in the cell biology of PC1/3-N222D are likely to contribute to the defective insulin biosynthetic events observed in the mutant mice and may be relevant to the dramatic contributions of polymorphisms in this gene to human obesity.

Defective Transport of the Obesity Mutant PC1/3 N222D Contributes to Loss of Function

PubMed Central

Prabhu, Yogikala; Blanco, Elias H.; Liu, Ming; Peinado, Juan R.; Wheeler, Matthew C.; Gekakis, Nicholas; Arvan, Peter

2014-01-01

Mutations in the PCSK1 gene encoding prohormone convertase 1/3 (PC1/3) are strongly associated with obesity in humans. The PC1/3N222D mutant mouse thus far represents the only mouse model that mimics the PC1/3 obesity phenotype in humans. The present investigation addresses the cell biology of the N222D mutation. Metabolic labeling experiments reveal a clear defect in the kinetics of insulin biosynthesis in islets from PC1/3N222D mutant mice, resulting in an increase in both proinsulin and its processing intermediates, predominantly lacking cleavage at the Arg-Arg site. Although the mutant PC1/3 zymogen is correctly processed to the 87-kDa form, pulse-chase immunoprecipitation experiments, labeling, and immunohistochemical experiments using uncleavable variants all demonstrate that the PC1/3-N222D protein is largely mislocalized compared with similar wild-type (WT) constructs, being predominantly retained in the endoplasmic reticulum. The PC1/3-N222D mutant also undergoes more efficient degradation via the ubiquitin-proteasome system than the WT enzyme. Lastly, the mutant PC1/3-N222D protein coimmunoprecipitates with WT PC1/3 and exerts a modest effect on intracellular retention of the WT enzyme. These profound alterations in the cell biology of PC1/3-N222D are likely to contribute to the defective insulin biosynthetic events observed in the mutant mice and may be relevant to the dramatic contributions of polymorphisms in this gene to human obesity. PMID:24828610

Endoglycosidase and glycoamidase release of N-linked oligosaccharides.

PubMed

Freeze, H H

2001-05-01

Carbohydrate chain modifications are often used to monitor glycoprotein movement through the secretory pathway. This is because stepwise sugar-chain processing is unidirectional and generally corresponds to the forward or anterograde movement of proteins. This unit offers a group of techniques that will help analyze the general structure of carbohydrate chains on a protein and, therefore, oligosaccharide processing mileposts. The sugar chains themselves are not analyzed, but their presence and structure are inferred from gel mobility differences after one or more enzymatic digestions. This approach is most often used in combination with [35S]Met pulse-chase metabolic labeling protocols, but they can be applied to any suitably labeled protein (e.g., biotinylated or 125I-labeled).

Performance evaluations of hybrid modulation with different optical labels over PDQ in high bit-rate OLS network systems.

PubMed

Xu, M; Li, Y; Kang, T Z; Zhang, T S; Ji, J H; Yang, S W

2016-11-14

Two orthogonal modulation optical label switching(OLS) schemes, which are based on payload of polarization multiplexing-differential quadrature phase shift keying(POLMUX-DQPSK or PDQ) modulated with identifications of duobinary (DB) label and pulse position modulation(PPM) label, are researched in high bit-rate OLS network. The BER performance of hybrid modulation with payload and label signals are discussed and evaluated in theory and simulation. The theoretical BER expressions of PDQ, PDQ-DB and PDQ-PPM are given with analysis method of hybrid modulation encoding in different the bit-rate ratios of payload and label. Theoretical derivation results are shown that the payload of hybrid modulation has a certain gain of receiver sensitivity than payload without label. The sizes of payload BER gain obtained from hybrid modulation are related to the different types of label. The simulation results are consistent with that of theoretical conclusions. The extinction ratio (ER) conflicting between hybrid encoding of intensity and phase types can be compromised and optimized in OLS system of hybrid modulation. The BER analysis method of hybrid modulation encoding in OLS system can be applied to other n-ary hybrid modulation or combination modulation systems.

Time domain simulation of Gd3+-Gd3+ distance measurements by EPR

NASA Astrophysics Data System (ADS)

Manukovsky, Nurit; Feintuch, Akiva; Kuprov, Ilya; Goldfarb, Daniella

2017-07-01

Gd3+-based spin labels are useful as an alternative to nitroxides for intramolecular distance measurements at high fields in biological systems. However, double electron-electron resonance (DEER) measurements using model Gd3+ complexes featured a low modulation depth and an unexpected broadening of the distance distribution for short Gd3+-Gd3+ distances, when analysed using the software designed for S = 1/2 pairs. It appears that these effects result from the different spectroscopic characteristics of Gd3+—the high spin, the zero field splitting (ZFS), and the flip-flop terms in the dipolar Hamiltonian that are often ignored for spin-1/2 systems. An understanding of the factors affecting the modulation frequency and amplitude is essential for the correct analysis of Gd3+-Gd3+ DEER data and for the educated choice of experimental settings, such as Gd3+ spin label type and the pulse parameters. This work uses time-domain simulations of Gd3+-Gd3+ DEER by explicit density matrix propagation to elucidate the factors shaping Gd3+ DEER traces. The simulations show that mixing between the |+½, -½> and |-½, +½> states of the two spins, caused by the flip-flop term in the dipolar Hamiltonian, leads to dampening of the dipolar modulation. This effect may be mitigated by a large ZFS or by pulse frequency settings allowing for a decreased contribution of the central transition and the one adjacent to it. The simulations reproduce both the experimental line shapes of the Fourier-transforms of the DEER time domain traces and the trends in the behaviour of the modulation depth, thus enabling a more systematic design and analysis of Gd3+ DEER experiments.

Virus-Specific RNA Synthesis in Cells Infected by Infectious Pancreatic Necrosis Virus

PubMed Central

Somogyi, Paul; Dobos, Peter

1980-01-01

Pulse-labeling experiments with [3H]uridine revealed that the rate of infections pancreatic necrosis virus-specific RNA synthesis was maximal at 8 to 10 h after infection and was completely diminished by 12 to 14 h. Three forms of RNA intermediates were detected: (i) a putative transcription intermediate (TRI) which comigrated in acrylamide gels with virion double-stranded RNA (dsRNA) after RNase treatment; (ii) a 24S genome length mRNA which could be resolved into two bands by polyacrylamide gel electrophoresis; and (iii) a 14S dsRNA component indistinguishable from virion RNA by gradient centrifugation and gel electrophoresis. The TRI (i) was LiCl precipitable; (ii) sedimented slightly faster and broader (14 to 16S) than the 14S virion dsRNA; (iii) had a lower electrophoretic mobility in acrylamide gels than dsRNA, barely entering acrylamide gels as a heterogenous component; (iv) yielded genome-sized pieces of dsRNA after RNase digestion; and (v) was the most abundant RNA form early in the infectious cycle. The 24S single-stranded RNA was thought to be the viral mRNA since it: (i) became labeled during short pulses; (ii) was found in the polysomal fraction of infected cells; and (iii) hybridized to denatured viral RNA, forming two segments of RNase-resistant RNA that comigrated with virion dsRNA in gels. The 24S mRNA component was formed before the synthesis of dsRNA, and radioactivity could be chased from 24S single-stranded RNA to dsRNA, indicating that 24S RNA may serve as template for the synthesis of complementary strands to form dsRNA. Similar to reovirus, infectious pancreatic necrosis viral 24S mRNA contained no polyadenylic acid tracts. Images PMID:16789184

Human CD62Ldim neutrophils identified as a separate subset by proteome profiling and in vivo pulse-chase labeling.

PubMed

Tak, Tamar; Wijten, Patrick; Heeres, Marjolein; Pickkers, Peter; Scholten, Arjen; Heck, Albert J R; Vrisekoop, Nienke; Leenen, Luke P; Borghans, José A M; Tesselaar, Kiki; Koenderman, Leo

2017-06-29

During acute inflammation, 3 neutrophil subsets are found in the blood: neutrophils with a conventional segmented nucleus, neutrophils with a banded nucleus, and T-cell-suppressing CD62L dim neutrophils with a high number of nuclear lobes. In this study, we compared the in vivo kinetics and proteomes of banded, mature, and hypersegmented neutrophils to determine whether these cell types represent truly different neutrophil subsets or reflect changes induced by lipopolysaccharide (LPS) activation. Using in vivo pulse-chase labeling of neutrophil DNA with 6,6- 2 H 2 -glucose, we found that 2 H-labeled banded neutrophils appeared much earlier in blood than labeled CD62L dim and segmented neutrophils, which shared similar label kinetics. Comparison of the proteomes by cluster analysis revealed that CD62L dim neutrophils were clearly separate from conventional segmented neutrophils despite having similar kinetics in peripheral blood. Interestingly, the conventional segmented cells were more related at a proteome level to banded cells despite a 2-day difference in maturation time. The differences between CD62L dim and mature neutrophils are unlikely to have been a direct result of LPS-induced activation, because of the extremely low transcriptional capacity of CD62L dim neutrophils and the fact that neutrophils do not directly respond to the low dose of LPS used in the study (2 ng/kg body weight). Therefore, we propose CD62L dim neutrophils are a truly separate neutrophil subset that is recruited to the bloodstream in response to acute inflammation. This trial was registered at www.clinicaltrials.gov as #NCT01766414. © 2017 by The American Society of Hematology.

A hormone pulse induces transient changes in the subcellular distribution and leads to a lysosomal accumulation of the estradiol receptor alpha in target tissues.

PubMed

Qualmann, B; Kessels, M M; Thole, H H; Sierralta, W D

2000-06-01

An intrauterine pulse-stimulation with estradiol induced changes in the subcellular localization of estrogen receptor alpha in porcine endometrium, as detected with F(ab') fragments of various anti-receptor antibodies covalently linked to nanogold. The low-sterically hindered immunoreagents--recognizing different epitopes within the hormone binding domain--allowed for an efficient immunolabeling of estradiol receptor alpha, detecting it both in the cytoplasm and the nucleus of nonstimulated epithelium cells. In the cytoplasm, the receptor often seemed to be associated with actin filaments and the endoplasmatic reticulum. After the stimulation with estradiol, a predominantly nuclear localization and a labeling of nucleoli was observed. Our immunoelectron microscopy study demonstrates a localization of the receptor in cytoplasmic organelles that increased after the hormone pulse. These organelles exhibited the morphological properties of lysosomes and relocated to the perinuclear area. In analogous cytoplasmic organelles, the presence of cathepsin D was detected via indirect immunogold labeling, justifying their classification as lysosomes. Quantitative examinations revealed that not only the number of lysosomes in the proximity of the nucleus but also their immunostaining for estradiol receptor alpha increased significantly after the hormone pulse. Thus, estradiol induces both the rapid shift of receptor into the nucleus, a slower perinuclear accumulation of lysosomes and an increase of lysosomal ERalpha-immunoreactivity. These results suggest a role for lysosomes in the degradation of receptor shuttling out of the nucleus. This could serve as termination of the estradiol receptor alpha-dependent activation of target cells. This hypothesis is strengthened by the fact that the receptor content in uterine tissue declined drastically few hours after the hormone pulse.

Novel flashlamp-based time-resolved fluorescence microscope reduces autofluorescence for 30-fold contrast enhancement in environmental samples

NASA Astrophysics Data System (ADS)

Connally, Russell; Veal, Duncan; Piper, James A.

2003-07-01

The abundance of naturally fluorescing components (autofluorophors) encountered in environmentally sourced samples can greatly hinder the detection and identification of fluorescently labeled target using fluorescence microscopy. Time-resolved fluorescence microscopy (TRFM) is a technique that reduces the effects of autofluorescence through precisely controlled time delays. Lanthanide chelates have fluorescence lifetimes many orders of magnitude greater than typical autofluorophors, and persist in their luminescence long after autofluorescence has ceased. An intense short pulse of (UV) light is used to excite fluorescence in the sample and after a short delay period the longer persisting fluorescence from the chelate is captured with an image-intensified CCD camera. The choice of pulsed excitation source for TRFM has a large impact on the price and performance of the instrument. A flashlamp with a short pulse duration was selected for our instrument because of the high spectral energy in the UV region and short pulse length. However, flash output decays with an approximate lifetime of 18μs and the TRFM requires a long-lived chelate to ensure probe fluorescence is still visible after decay of the flash plasma. We synthesized a recently reported fluorescent chelate (BHHCT) and conjugated it to a monoclonal antibody directed against the water-borne parasite Giardia lamblia. Fluorescence lifetime of the construct was determined to be 339μs +/- 14μs and provided a 45-fold enhancement of labeled Giardia over background using a gate delay of 100μs. Despite the sub-optimal decay characteristics of the light pulse, flashlamps have many advantages compared to optical chopper wheels and modulated lasers. Their low cost, lack of vibration, ease of interface and small footprint are important factors to consider in TRFM design.

Laser pulse shape design for laser-indirect-driven quasi-isentropic compression experiments

NASA Astrophysics Data System (ADS)

Xue, Quanxi; Jiang, Shaoen; Wang, Zhebin; Wang, Feng; Zhao, Xueqing; Ding, Yongkun

2018-02-01

Laser pulse shape design is a key work in the design of indirect-laser-driven experiments, especially for long pulse laser driven quasi-isentropic compression experiments. A method for designing such a laser pulse shape is given here. What's more, application experiments were performed, and the results of a typical shot are presented. At last of this article, the details of the application of the method are discussed, such as the equation parameter choice, radiation ablation pressure expression, and approximations in the method. The application shows that the method can provide reliable descriptions of the energy distribution in a hohlraum target; thus, it can be used in the design of long-pulse laser driven quasi-isentropic compression experiments and even other indirect-laser-driven experiments.

Short-term dynamics and partitioning of newly assimilated carbon in the foliage of adult beech and pine are driven by seasonal variations

NASA Astrophysics Data System (ADS)

Desalme, Dorine; Priault, Pierrick; Gérant, Dominique; Dannoura, Masako; Maillard, Pascale; Plain, Caroline; Epron, Daniel

2017-04-01

Carbon (C) allocation is a key process determining C cycling in forest ecosystems. However, the mechanisms underlying the annual patterns of C partitioning in trees, influenced by tree phenology and environmental conditions, are not well identified yet. This study aimed to characterize the short-term dynamics and partitioning of newly assimilated carbon in the foliage of adult European beeches (Fagus sylvatica) and maritime pines (Pinus pinaster) across the seasons. We hypothesized that residence times of recently assimilated C in C compounds should change according to the seasons and that seasonal pattern should differ between deciduous and evergreen tree species, since they have different phenology. 13CO2 pulse-labelling experiments were performed in situ at different dates corresponding to different phenological stages. In beech leaves and pine needles, C contents, isotopic compositions, and 13C dynamics parameters were determined in total organic matter (bulk foliage), in polar fraction (PF, including soluble sugars, amino acids, organic acids) and in starch. For both species and at each phenological stage, 13C amount in bulk foliage decreased following a two-pool exponential model, highlighting the partitioning of newly assimilated C between 'mobile' and 'stable' pools. The relative proportion of the stable pool was maximal in beech leaves in May, when leaves were still growing and could incorporate newly assimilated C in structural C compounds. Young pine needles were still receiving C from previous-year needles in June (two months after budburst) although they are already photosynthesizing, acting as a strong C sink. In summer, short mean residence times of 13C (MRT) in foliage of both tree species reflected the fast respiration and exportation of recent photosynthates to support the whole tree C demand (e.g., supplying perennial organ growth). At the end of the growing season, pre-senescing beech leaves were supplying 13C to perennial organs, whereas overwintering pine needles accumulated labelled PF, probably to acclimate to colder winter temperatures. Results of this experiment revealed that the dynamics and the in-leaf partitioning of newly assimilated C varied seasonally according to the phenology of the two species. In the future, coupling 13C pulse labelling with compound-specific isotope analysis will be promising for tracing the allocation of newly assimilated C to various physiological functions such as growth, export, osmoregulation and defence in trees submitted to global changes.

Photosynthetic carbon fixation characteristics of fruiting structures of Brassica campestris L

DOE Office of Scientific and Technical Information (OSTI.GOV)

Singal, H.R.; Sheoran, I.S.; Singh, R.

1987-04-01

Activities of key enzymes of the Calvin cycle and C/sub 4/ metabolism, rates of CO/sub 2/ fixation, and the initial products of photosynthetic /sup 14/CO/sub 2/ fixation were determined in the podwall, seed coat (fruiting structures), and the subtending leaf (leaf below a receme) of Brassica campestris L. cv Toria. Compared to activities of ribulose-1,5-bisphosphate carboxylase and other Calvin cycle enzymes, e.g. NADP-glyceraldehyde-3-phosphate-dehydrogenase and ribulose-5-phosphate kinase, the activities of phosphoenol pyruvate carboxylase and other enzymes of C/sub 4/ metabolism, viz. NADP-malate dehydrogenase, NADP-malic enzyme, glutamate pyruvate transaminase, and glutamate oxaloacetate transaminase, were generally much higher in seed than in podwallmore » and leaf. Podwall and leaf were comparable to each other. Pulse-chase experiments showed that in seed the major product of /sup 14/CO/sub 2/ assimilation was malate (in short time), whereas in podwall and leaf, the label initially appeared in 3-PGA. With time, the label moved to sucrose. In contrast to legumes, Brassica pods were able to fix net CO/sub 2/ during light. However, respiratory losses were very high during the dark period.« less

A Match-and-Motivation Model of How Women Label Their Nonconsensual Sexual Experiences

ERIC Educational Resources Information Center

Peterson, Zoe D.; Muehlenhard, Charlene L.

2011-01-01

Many rape victims are unacknowledged rape victims--they report an experience meeting researchers' operational definitions of rape but do not label their experience as rape. The purpose of this study was to investigate women's decisions about whether to label their experiences as rape. Participants were 77 college women (predominantly White; mean…

Tracing photosynthetic carbon in leaves with nanoSIMS after 13CO2 labelling

NASA Astrophysics Data System (ADS)

Dannoura, Masako; Takeuchi, Miyuki; Kominami, Yuji; Takanashi, Satoru; Kenichi, Yoshimura; Ataka, Mioko

2015-04-01

To understand the carbon allocation of the tree and forest ecosystem, it is important to consider the residence time of carbon in different pools at suitable time scales. For example the carbon used for respiration will stay a few minutes to a few days in the tree, the carbon used for storage or structure of leaves will stay months to years, and the carbon used for wood structure, it will stay over the whole lifespan of the tree. The leaves are the entrance of carbon in trees where it can be used for foliage growth and maintenance or exported to the other organs or the other forest ecosystem compartments. Tracing carbon isotope using NanoSIMS technique is one of useful methods to estimate where and how long the carbon stay in the tree organs. In this study, 13CO2 pulse labelling were conducted and 13C was measured by IRMS to see the amount of C remaining in the leaves with time.NanoSIMS was used to localize where the labelled C remained within the leaf tissue. Twice labelling were done on branches of Quercus serrata at FFPRI(Forest and Forest Products research Institute) in Kyoto, Japan. The first labelling was in 30 April 2012 when the leaves start flushing and the second one was in 29 May 2012 when the leaves were completely deployed. For both labelling experiment, one branch was selected and covered with transparent plastic bag. CO2 concentration was recorded with IRGA and air temperature inside the chamber was monitored. Then 13CO2 was injected into the bag, and after 1 hour, the bag was removed and the branch was again exposed to ambient air. Leaves were collected before and 10-12 times after labelling and their isotope compositions were measured by IRMS. The leaf collected just after labelling and 6 days after labelling were used for NanoSIMS observation. Samples for nanoSIMS were preserved in glutaraldehyde and then embed in epoxy resin. The sliced sample were placed on the silicon wafer and observed by NanoSIMS 50L(Cameca, France). The 13C was highest just after labelling and decreased with the time. Half life time of delta 13C was longer in April-labelling than May-labelling that indicates that more carbon was retained in structural growth and less exported non-assimilatory organs in April than in May. The NanoSIMS observation showed 13C in starch grains was shown only in May in leaves sampled 6 days after -labelling. This suggests that the usage of carbon differ depending on the stage of leaf formation.

13C metabolic flux analysis: optimal design of isotopic labeling experiments.

PubMed

Antoniewicz, Maciek R

2013-12-01

Measuring fluxes by 13C metabolic flux analysis (13C-MFA) has become a key activity in chemical and pharmaceutical biotechnology. Optimal design of isotopic labeling experiments is of central importance to 13C-MFA as it determines the precision with which fluxes can be estimated. Traditional methods for selecting isotopic tracers and labeling measurements did not fully utilize the power of 13C-MFA. Recently, new approaches were developed for optimal design of isotopic labeling experiments based on parallel labeling experiments and algorithms for rational selection of tracers. In addition, advanced isotopic labeling measurements were developed based on tandem mass spectrometry. Combined, these approaches can dramatically improve the quality of 13C-MFA results with important applications in metabolic engineering and biotechnology. Copyright © 2013 Elsevier Ltd. All rights reserved.

Pathways of assimilation and transfer of fixed nitrogen in coralloid roots of cycad-Nostoc symbioses.

PubMed

Pate, J S; Lindblad, P; Atkins, C A

1988-12-01

Freshly detached coralloid roots of several cycad species were found to bleed spontaneously from xylem, permitting identification of products of nitrogen transfer from symbiotic organ to host. Structural features relevant to the export of fixed N were described for Macrozamia riedlei (Fisch. ex Gaud.) Gardn. the principal species studied. Citrulline (Cit), glutamine (Gln) and glutamic acid (Glu), the latter usually in a lesser amount, were the principal translocated solutes in Macrozamia (5 spp.), Encephalartos (4 spp.) and Lepidozamia (1 sp.), while Gln and a smaller amount of Glu, but no Cit were present in xylem sap of Bowenia (1 sp.),and Cycas (2 spp.). Time-course studies of (15)N enrichment of the different tissue zones and the xylem sap of (15)N2-pulse-fed coralloid roots of M. riedlei showed earlier (15)N incorporation into Gln than into Cit, and a subsequent net decline in the (15)N of Gln of the coralloid-root tissues, whereas Cit labeling continued to increase in inner cortex and stele and in the xylem sap. Hydrolysis of the (15)N-labeled Cit and Gln consistently demonstrated much more intense labeling of the respective carbamyl and amide groups than of the other N-atoms. Coralloid roots of M. riedlei pulse-fed (14)CO2 in darkness showed (14)C labeling of aspartic acid (Asp) and Cit in all tissue zones and of Cit of xylem bleeding sap. Lateral roots and uninfected apogeotropic roots of M. riedlei and M. moorei also incorporated (14)CO2 into Cit. The (14)C of Cit was restricted to the carbamyl-C. Comparable (15)N2 and CO2-feeding studies on corallid roots of Cycas revoluta showed Gln to be the dominant product of N2 fixation, with Asp and alanine as other major (14)C-labeled amino compounds, but a total absence of Cit in labeled or unlabeled form.

Uptake of phytodetritus by benthic foraminifera under oxygen depletion at the Indian margin (Arabian Sea)

NASA Astrophysics Data System (ADS)

Enge, A. J.; Witte, U.; Kucera, M.; Heinz, P.

2014-04-01

Benthic foraminifera in sediments on the Indian margin of the Arabian Sea, where the oxygen minimum zone (OMZ) impinges on the continental slope, are exposed to particularly severe levels of oxygen depletion. Food supply for the benthic community is high but delivered in distinct pulses during upwelling and water mixing events associated with summer and winter monsoon periods. In order to investigate the response by benthic foraminifera to such pulsed food delivery under oxygen concentrations of less than 0.1 mL L-1 (4.5 μmol L-1), an in situ isotope labeling experiment (13C, 15N) was performed on the western continental slope of India at 540 m water depth (OMZ core region). The assemblage of living foraminifera (>125 μm) in the uppermost centimeter at this depth is characterized by an unexpectedly high population density of 3982 individuals 10 cm-2 and a strong dominance by few calcareous species. For the experiment, we concentrated on the nine most abundant taxa, which constitute 93% of the entire foraminiferal population at 0-1 cm sediment depth. Increased concentrations of 13C and 15N in the cytoplasm indicate that all investigated taxa took up labeled phytodetritus during the 4 day experimental phase. In total, these nine species had assimilated 113.8 mg C m-2 (17.5% of the total added carbon). Uptake of nitrogen by the three most abundant taxa (Bolivina aff. B. dilatata, Cassidulina sp., Bulimina gibba) was 2.7 mg N m-2 (2% of the total added nitrogen). The response to the offered phytodetritus varied largely among foraminiferal species with Uvigerina schwageri being by far the most important species in short-term processing, whereas the most abundant taxa Bolivina aff. B. dilatata and Cassidulina sp. showed comparably low uptake of the offered food. We suggest the observed species-specific differences are related to species biomass and specific feeding preferences. In summary, the experiment in the OMZ core region shows rapid processing of fresh phytodetritus by foraminifera under almost anoxic conditions. The uptake of large amounts of organic matter by few species within four days suggests that foraminifera may play an important role in short-term carbon cycling in the OMZ core region on the Indian margin.

Number of pulses or number of sessions? An open-label study of trajectories of improvement for once-vs. twice-daily dorsomedial prefrontal rTMS in major depression.

PubMed

Schulze, Laura; Feffer, Kfir; Lozano, Christopher; Giacobbe, Peter; Daskalakis, Zafiris J; Blumberger, Daniel M; Downar, Jonathan

Repetitive transcranial magnetic stimulation (rTMS) shows efficacy in the treatment of major depressive episodes (MDEs), but can require ≥4-6 weeks for maximal effect. Recent studies suggest that multiple daily sessions of rTMS can accelerate response without reducing therapeutic efficacy. However, it is unresolved whether therapeutic effects track cumulative number of pulses, or cumulative number of sessions. This open-label study reviewed clinical outcomes over a 20-30 session course of high-frequency bilateral dorsomedial prefrontal cortex (DMPFC)-rTMS among patients receiving 6000 pulses/day delivered either in twice-daily sessions 80 min apart (at 20 Hz) or single, longer, once-daily sessions (at 10 Hz). A retrospective chart review identified 130 MDD patients who underwent 20-30 daily sessions of bilateral DMPFC-rTMS (Once-daily, n = 65; Twice-daily, n = 65) at a single Canadian clinic. Mixed-effects modeling revealed significantly faster improvement (group-by-time interaction) for twice-daily versus once-daily DMPFC-rTMS. Across both groups, the pace of improvement showed a consistent relationship with number of cumulative sessions, but not with cumulative number of pulses. Although the twice-daily group completed treatment in half as many days, final clinical outcomes did not differ significantly between groups on dichotomous measures (response/remission rates: once-daily, 35.4%/33.8%; twice-daily, 41.5%/35.4%), or continuous measures, or on overall response distribution. Twice-daily rTMS appears feasible, tolerable, and capable of achieving comparable results to once-daily rTMS, while also reducing course length approximately twofold. Therapeutic gains tracked the cumulative number of sessions, not pulses. Future randomized studies comparing once-daily to multiple-daily rTMS sessions, while controlling for number of pulses, may be warranted. Copyright © 2017 The Authors. Published by Elsevier Inc. All rights reserved.

Time-resolvable fluorescent conjugates for the detection of pathogens in environmental samples containing autofluorescent material

NASA Astrophysics Data System (ADS)

Connally, Russell; Veal, Duncan; Piper, James A.

2003-07-01

Water is routinely monitored for environmental pathogens such a Cryptosporidium and Giardia using immunofluorescence microscopy (IFM). Autofluorescence can greatly diminish an operators capacity to resolve labeled pathogens from non-specific background. Naturally fluorescing components (autofluorophores) encountered in biological samples typically have fluorescent lifetimes (τ) of less than 100 nanoseconds and their emissions may be excluded through use of time-resolved fluorescence microscopy (TRFM). TRFM relies on the large differences in τ between autofluorescent molecules and long-lived lanthanide chelates. In TRFM, targets labeled with a time-resolvable fluorescent immunoconjugate are excited by an intense (UV) light pulse. A short delay is imposed to permit the decay of autofluorescence before capture of luminescence from the excited chelate using an image intensified CCD camera. In our experience, autofluorescence can be reduced to insignificant levels with a consequent 30-fold increase in target visibility using TRFM techniques. We report conjugation of a novel europium chelate to a monoclonal antibody specific for Giardia lamblia and use of the immunoconjugate for TRFM studies. Initial attempts to conjugate the same chelate to a monoclonal antibody directed against Cryptosporidium parvum led to poorly fluorescent constructs that were prone to denature and precipitate. We successfully conjugated BHHCT to anti-mouse polyvalent immunoglobulin and used this construct to overcome the difficulties in direct labeling of the anti-Cryptosporidium antibody. Both Giardia and Cryptosporidium were labeled using the anti-mouse protocol with a subsequent 20-fold and 6.6-fold suppression of autofluorescence respectively. A rapid protocol for conjugating and purifying the immunoconjugate was found and methods of quantifying the fluorescence to protein ratio determined. Performance of our TRFM was dependent on the quality and brightness of the immunoconjugate and optimization of the conjugation process is necessary to reap the full benefit of time-resolved techniques.

Effect of Ca/sup 2 +/ overload on phosphoinositide (PI) metabolism in cardiac muscle

DOE Office of Scientific and Technical Information (OSTI.GOV)

Otani, H.; Otani, H.; Engelman, R.M.

1986-05-01

The investigated the relationship between Ca/sup 2 +/ load and PI metabolism in isolated rat papillary muscle labeled with (/sup 3/H)inositol. Increase in (Ca/sup 2 +/)/sub o/ from 0-3.6 mM reduced the incorporation of (/sup 3/H) inositol into PI moderately and increased the resting tension slightly. The incorporation of the label into PI was unchanged by 10 ..mu..m A-23187 at 1.8 mM (Ca/sup 2 +/)/sub o/ that increased the contractility by 70% without a significant change in the resting tension. However, either 10.8 mM (Ca/sup 2 +/)/sub o/ or 0.3 mM ouabain at 1.8 mM (Ca/sup 2 +/)/sub o/ markedlymore » decreased the PI labeling with corresponding increase in the resting tension while inclusion of excess EGTA greatly enhanced the radioactivity in PI. Determination of the PI breakdown and the inositol phosphates production by pulse-chase experiments revealed that the reduced PI turnover in the Ca/sup 2 +/-overload muscle was due to both inhibition of the synthesis and stimulation of the breakdown of this lipid that accounted for 30% decrease in the labeled PI from the muscle during 45 min without significant loss of the net PI pool size, suggesting the presence of a relatively smaller compartment of PI pool undergoing a rapid breakdown during Ca/sup 2 +/ overload. The authors propose that alteration of Ca/sup 2 +/ homeostasis may modulate the production of putative second messengers, inositol trisphosphate and diacylglycerol, which feed back to regulate (Ca/sup 2 +/)/sub i/ in cardiac muscle.« less

Epithelial Label-Retaining Cells Are Absent during Tooth Cycling in Salmo salar and Polypterus senegalus.

PubMed

Vandenplas, Sam; Willems, Maxime; Witten, P Eckhard; Hansen, Tom; Fjelldal, Per Gunnar; Huysseune, Ann

2016-01-01

The Atlantic salmon (Salmo salar) and African bichir (Polypterus senegalus) are both actinopterygian fish species that continuously replace their teeth without the involvement of a successional dental lamina. Instead, they share the presence of a middle dental epithelium: an epithelial tier enclosed by inner and outer dental epithelium. It has been hypothesized that this tier could functionally substitute for a successional dental lamina and might be a potential niche to house epithelial stem cells involved in tooth cycling. Therefore, in this study we performed a BrdU pulse chase experiment on both species to (1) determine the localization and extent of proliferating cells in the dental epithelial layers, (2) describe cell dynamics and (3) investigate if label-retaining cells are present, suggestive for the putative presence of stem cells. Cells proliferate in the middle dental epithelium, outer dental epithelium and cervical loop at the lingual side of the dental organ to form a new tooth germ. Using long chase times, both in S. salar (eight weeks) and P. senegalus (eight weeks and twelve weeks), we could not reveal the presence of label-retaining cells in the dental organ. Immunostaining of P. senegalus dental organs for the transcription factor Sox2, often used as a stem cell marker, labelled cells in the zone of outer dental epithelium which grades into the oral epithelium (ODE transition zone) and the inner dental epithelium of a successor only. The location of Sox2 distribution does not provide evidence for epithelial stem cells in the dental organ and, more specifically, in the middle dental epithelium. Comparison of S. salar and P. senegalus reveals shared traits in tooth cycling and thus advances our understanding of the developmental mechanism that ensures lifelong replacement.

Epithelial Label-Retaining Cells Are Absent during Tooth Cycling in Salmo salar and Polypterus senegalus

PubMed Central

Vandenplas, Sam; Willems, Maxime; Witten, P. Eckhard; Hansen, Tom; Fjelldal, Per Gunnar; Huysseune, Ann

2016-01-01

The Atlantic salmon (Salmo salar) and African bichir (Polypterus senegalus) are both actinopterygian fish species that continuously replace their teeth without the involvement of a successional dental lamina. Instead, they share the presence of a middle dental epithelium: an epithelial tier enclosed by inner and outer dental epithelium. It has been hypothesized that this tier could functionally substitute for a successional dental lamina and might be a potential niche to house epithelial stem cells involved in tooth cycling. Therefore, in this study we performed a BrdU pulse chase experiment on both species to (1) determine the localization and extent of proliferating cells in the dental epithelial layers, (2) describe cell dynamics and (3) investigate if label-retaining cells are present, suggestive for the putative presence of stem cells. Cells proliferate in the middle dental epithelium, outer dental epithelium and cervical loop at the lingual side of the dental organ to form a new tooth germ. Using long chase times, both in S. salar (eight weeks) and P. senegalus (eight weeks and twelve weeks), we could not reveal the presence of label-retaining cells in the dental organ. Immunostaining of P. senegalus dental organs for the transcription factor Sox2, often used as a stem cell marker, labelled cells in the zone of outer dental epithelium which grades into the oral epithelium (ODE transition zone) and the inner dental epithelium of a successor only. The location of Sox2 distribution does not provide evidence for epithelial stem cells in the dental organ and, more specifically, in the middle dental epithelium. Comparison of S. salar and P. senegalus reveals shared traits in tooth cycling and thus advances our understanding of the developmental mechanism that ensures lifelong replacement. PMID:27049953

Mechanistic investigation of doxycycline photosensitization by picosecond-pulsed and continuous wave laser irradiation of cells in culture

DOE Office of Scientific and Technical Information (OSTI.GOV)

Shea, C.R.; Hefetz, Y.; Gillies, R.

1990-04-15

In order to elucidate the photophysical mechanisms of cellular phototoxicity sensitized by doxycycline, MGH-U1 human bladder carcinoma cells in vitro were treated with 20.7 microM doxycycline and irradiated with either a pulsed (lambda = 355 nm, pulse duration = 24 ps) or a continuous wave (lambda = 351 nm) laser. Cumulative radiant exposure and irradiance were systematically varied in experiments with both lasers. Phototoxicity was assessed by epifluorescence microscopy of unfixed cells using rhodamine 123 labeling of mitochondria. With the continuous wave source, the cumulative radiant exposure required for induction of phototoxic injury was independent of irradiance. With the 24-ps-pulsedmore » source, a significantly lower cumulative radiant exposure was required to induce the phototoxicity when the peak irradiance was 5.8 x 10(7) or 1.3 x 10(8) watts cm-2 compared with when peak irradiance was either lower (6.0 x 10(6) watts cm-2) or higher (7.6 x 10(8) watts cm-2). The measured fluorescence lifetimes of doxycycline in buffered saline solution were longer than the laser pulse duration of 24 ps. The increased efficiency of photosensitization at the optimal peak irradiance in the ps domain appears to result from sequential multiphoton absorption involving higher excited states of the singlet manifold. At the highest irradiance studied, on the other hand, reduced efficiency of photosensitization is attributed to increased photodegradation of doxycycline from higher excited states by processes such as photoionization. A model consistent with these observations is presented along with calculations, based on simple rate equations, that fit the essentials of the proposed model.« less

Electrophysiological and Morphological Evidence for Synchronized GnRH Pulse Generator Activity Among Kisspeptin/Neurokinin B/Dynorphin A (KNDy) Neurons in Goats

PubMed Central

WAKABAYASHI, Yoshihiro; YAMAMURA, Takashi; SAKAMOTO, Kohei; MORI, Yuji; OKAMURA, Hiroaki

2012-01-01

Abstract Neurons in the arcuate nucleus (ARC) that concomitantly express kisspeptin, neurokinin B (NKB) and dynorphin A are termed KNDy neurons and are likely candidates for the intrinsic gonadotropin-releasing hormone (GnRH) pulse generator. Our hypothesis is that KNDy neurons are functionally and anatomically interconnected to generate discrete neural signals that govern pulsatile GnRH secretion. Our goal was to address this hypothesis using electrophysiological and anatomical experiments in goats. Bilateral electrodes targeting KNDy neurons were implanted into ovariectomized goats, and GnRH pulse generator activity, represented by characteristic increases in multiple-unit activity (MUA volleys), was measured. Spontaneous and pheromone- or senktide (an NKB receptor agonist)-induced MUA volleys were simultaneously recorded from both sides of the ARC. An anterograde tracer, biotinylated dextran amine (BDA), was also injected unilaterally into the ARC of castrated male goats, and the distribution of fibers containing both BDA and NKB was examined using dual-labeling histochemistry. The results showed that MUA volleys, regardless of origin (spontaneous or experimentally induced), occur simultaneously between the right and left sides of the ARC. Tract tracing indicated that axons projecting from NKB neurons in the ARC were directly apposed to other NKB neuronal cells located bilaterally in the ARC. These results demonstrate that GnRH pulse generator activity occurs synchronously between both sides of the ARC in goats and that KNDy neurons are bilaterally interconnected in the ARC via NKB-containing fibers. Taken together, the results suggest that KNDy neurons form a neuronal circuit to synchronize burst activity among KNDy neurons and thereby generate discrete neural signals that govern pulsatile GnRH secretion. PMID:23080371

Perturbative transport modeling and comparison to cold-pulse and heat-pulse propagation experiments in Alcator C-Mod and DIII-D

NASA Astrophysics Data System (ADS)

Rodriguez Fernandez, P.; White, A. E.; Cao, N. M.; Creely, A. J.; Greenwald, M. J.; Howard, N. T.; Hubbard, A. E.; Hughes, J. W.; Irby, J. H.; Petty, C. C.; Rice, J. E.; Alcator C-Mod Team

2016-10-01

Possible ``non-local'' transport phenomena are often observed in tokamak plasmas. Different models have been proposed to explain fast responses during perturbative transport experiments, including non-diffusive effects. Specific tools to characterize the dynamic behavior and power balance analysis using TRANSP and the quasi-linear trapped gyro-landau fluid code TGLF have been developed to analyze Alcator C-Mod experiments. Recent results from cold pulse experiments show that fast core temperature increases following edge cold-pulse injections (peak within 10ms , while τE 25ms) are not correlated with the direction of intrinsic rotation, and instead the amplitude of the core response depends on density, plasma current and RF input power. The propagation of the cold pulse can be compared with propagation of heat pulses from sawteeth, and both may be used to probe changes in temperature profile stiffness. A Laser Blow Off (LBO) system is being developed for DIII-D that will allow further validation and cross-machine comparison of cold pulse experiments. LBO at DIII-D will also allow for direct comparisons with ECH perturbative heat pulse experiments. Work supported by US DOE under Grants DE-FC02-99ER54512 (C-Mod) and DE-FC02-04ER54698 (DIII-D) and La Caixa Fellowship.

Dietary Fiber Analysis of Four Pulses Using AOAC 2011.25: Implications for Human Health.

PubMed

Chen, Yiran; McGee, Rebecca; Vandemark, George; Brick, Mark; Thompson, Henry J

2016-12-21

Chickpeas, common beans, dry peas, and lentils are pulse crops that have been a cornerstone of the human diet since the inception of agriculture. However, the displacement of pulses from the diet by low fiber protein alternatives has resulted in a pervasive deficiency referred to as the dietary fiber gap. Using an analytical method American Association of Analytical Chemists (AOAC) 2011.25 that conforms to the Codex Alimentarius Commission consensus definition for dietary fiber, the fiber content of these pulse crops was evaluated in seed types used for commercial production. These pulse crops have 2 to 3 times more fiber per 100 g edible portion than other dietary staples. Moreover, there is marked variation in fiber content among cultivars of the same crop. We conclude that pulse crop consumption should be emphasized in efforts to close the dietary fiber gap. The substantial differences in fiber content among currently available cultivars within a crop can be used to further improve gains in fiber intake without the need to change dietary habits. This provides a rationale for cultivar-based food labeling.

Dietary Fiber Analysis of Four Pulses Using AOAC 2011.25: Implications for Human Health

PubMed Central

Chen, Yiran; McGee, Rebecca; Vandemark, George; Brick, Mark; Thompson, Henry J.

2016-01-01

Chickpeas, common beans, dry peas, and lentils are pulse crops that have been a cornerstone of the human diet since the inception of agriculture. However, the displacement of pulses from the diet by low fiber protein alternatives has resulted in a pervasive deficiency referred to as the dietary fiber gap. Using an analytical method American Association of Analytical Chemists (AOAC) 2011.25 that conforms to the Codex Alimentarius Commission consensus definition for dietary fiber, the fiber content of these pulse crops was evaluated in seed types used for commercial production. These pulse crops have 2 to 3 times more fiber per 100 g edible portion than other dietary staples. Moreover, there is marked variation in fiber content among cultivars of the same crop. We conclude that pulse crop consumption should be emphasized in efforts to close the dietary fiber gap. The substantial differences in fiber content among currently available cultivars within a crop can be used to further improve gains in fiber intake without the need to change dietary habits. This provides a rationale for cultivar-based food labeling. PMID:28009809

Modeling magnetization transfer effects of Q2TIPS bolus saturation in multi-TI pulsed arterial spin labeling.

PubMed

Petr, Jan; Schramm, Georg; Hofheinz, Frank; Langner, Jens; van den Hoff, Jörg

2014-10-01

To estimate the relaxation time changes during Q2TIPS bolus saturation caused by magnetization transfer effects and to propose and evaluate an extended model for perfusion quantification which takes this into account. Three multi inversion-time pulsed arterial spin labeling sequences with different bolus saturation duration were acquired for five healthy volunteers. Magnetization transfer exchange rates in tissue and blood were obtained from control image saturation recovery. Cerebral blood flow (CBF) obtained using the extended model and the standard model was compared. A decrease of obtained CBF of 6% (10%) was observed in grey matter when the duration of bolus saturation increased from 600 to 900 ms (1200 ms). This decrease was reduced to 1.6% (2.8%) when the extended quantification model was used. Compared with the extended model, the standard model underestimated CBF in grey matter by 9.7, 15.0, and 18.7% for saturation durations 600, 900, and 1200 ms, respectively. Results for simulated single inversion-time data showed 5-16% CBF underestimation depending on blood arrival time and bolus saturation duration. Magnetization transfer effects caused by bolus saturation pulses should not be ignored when performing quantification as they can cause appreciable underestimation of the CBF. Copyright © 2013 Wiley Periodicals, Inc.

Lysosomal Membrane Glycoproteins: Properties of LAMP-1 (Lysosome Associated Membrane Protein) and LAMP-2

DTIC Science & Technology

1985-01-01

Biosnthesis of th - Glvcooro ins Precursor forms of L ,MP-1 anc L.,. 2 ann process i’ :o n ecu w er’ examined by pulse -chase Iabeling ann,, recipcian. c t i...in the oresence of deterqent. 4 -",W Studies of the biosynthesis and process inn of the qL/cnDroteins showed that each contained a polypeptide core of...pDroximatelv 43,000 dal tons as identified by use of tunicarnycin and endolvcosidase H. Nascent glycooroteins pulse -labeled for 5 min with [3S

Detection of BrdU-label Retaining Cells in the Lacrimal Gland: Implications for Tissue Repair

PubMed Central

You, Samantha; Tariq, Ayesha; Kublin, Claire L.; Zoukhri, Driss

2011-01-01

The purpose of the present study was to determine if the lacrimal gland contains 5-bromo-2’-deoxyuridine (BrdU)-label retaining cells and if they are involved in tissue repair. Animals were pulsed daily with BrdU injections for 7 consecutive days. After a chase period of 2, 4, or 12 weeks, the animals were sacrificed and the lacrimal glands were removed and processed for BrdU immunostaining. In another series of experiments, the lacrimal glands of 12-week chased animals were either left untreated or were injected with interleukin 1 (IL-1) to induce injury. Two and half day post-injection, the lacrimal glands were removed and processed for BrdU immunostaining. After 2 and 4 week of chase period, a substantial number of lacrimal gland cells were BrdU+ (11.98 ± 1.84 and 7.95 ± 1.83 BrdU+ cells/mm2, respectively). After 12 weeks of chase, there was a 97% decline in the number of BrdU+ cells (0.38 ± 0.06 BrdU+ cells/mm2), suggesting that these BrdU-label retaining cells may represent slow-cycling adult stem/progenitor cells. In support of this hypothesis, the number of BrdU labeled cells increased over 7-fold during repair of the lacrimal gland (control: 0.41 ± 0.09 BrdU+ cells/mm2, injured: 2.91 ± 0.62 BrdU+ cells/mm2). Furthermore, during repair, among BrdU+ cells 58.2 ± 3.6 % were acinar cells, 26.4 ± 4.1% were myoepithelial cells, 0.4 ± 0.4% were ductal cells, and 15.0 ± 3.0% were stromal cells. We conclude that the murine lacrimal gland contains BrdU-label retaining cells that are mobilized following injury to generate acinar, myoepithelial and ductal cells. PMID:22101331

DNA with Parallel Strand Orientation: A Nanometer Distance Study with Spin Labels in the Watson-Crick and the Reverse Watson-Crick Double Helix.

PubMed

Wunnicke, Dorith; Ding, Ping; Yang, Haozhe; Seela, Frank; Steinhoff, Heinz-Jürgen

2015-10-29

Parallel-stranded (ps) DNA characterized by its sugar-phosphate backbones pointing in the same direction represents an alternative pairing system to antiparallel-stranded (aps) DNA with the potential to inhibit transcription and translation. 25-mer oligonucleotides were selected containing only dA·dT base pairs to compare spin-labeled nucleobase distances over a range of 10 or 15 base pairs in ps DNA with those in aps DNA. By means of the copper(I)-catalyzed Huisgen-Meldal-Sharpless alkyne-azide cycloaddition, the spin label 4-azido-2,2,6,6-tetramethylpiperidine-1-oxyl was clicked to 7-ethynyl-7-deaza-2'-deoxyadenosine or 5-ethynyl-2'-deoxyuridine to yield 25-mer oligonucleotides incorporating two spin labels. The interspin distances between spin labeled residues were determined by pulse EPR spectroscopy. The results reveal that in ps DNA these distances are between 5 and 10% longer than in aps DNA when the labeled DNA segment is located near the center of the double helix. The interspin distance in ps DNA becomes shorter compared with aps DNA when one of the spin labels occupies a position near the end of the double helix.

Carbon allocation belowground in Pinus pinaster using stable carbon isotope pulse labeling technique

NASA Astrophysics Data System (ADS)

Dannoura, M.; Bosc, A.; Chipeaux, C.; Sartore, M.; Lambrot, C.; Trichet, P.; Bakker, M.; Loustau, D.; Epron, D.

2010-12-01

Carbon allocation belowground competes with aboveground growth and biomass production. In the other hand, it contributes to resource acquisition such as nutrient, water and carbon sequestration in soil. Thus, a better characterization of carbon flow from plant to soil and its residence time within each compartment is an important issue for understanding and modeling forest ecosystem carbon budget. 13C pulse labeling of whole crown was conducted at 4 seasons to study the fate of assimilated carbon by photosynthesis into the root on 12 year old Pinus pinaster planted in the INRA domain of Pierroton. Maritime pine is the most widely planted species in South-West Europe. Stem, root and soil CO2 effluxes and their isotope composition were measured continuously by tunable diode laser absorption spectroscopy with a trace gas analyzer (TGA 100A; Campbell Scientific) coupled to flow-through chambers. 13CO2 recovery and peak were observed in respiration of each compartment after labeling. It appeared sequentially from top of stem to bottom, and to coarse root. The maximum velocity of carbon transfer was calculated as the difference in time lag of recovery between two positions on the trunk or on the root. It ranged between 0.08-0.2 m h-1 in stem and between 0.04-0.12 m h-1 in coarse root. This velocity was higher in warmer season, and the difference between time lag of recovery and peak increased after first frost. Photosynthates arrived underground 1.5 to 5 days after labeling, at similar time in soil CO2 effluxes and coarse root respiration. 0.08-1.4 g of carbon was respired per tree during first 20 days following labeling. It presented 0.6 -10% of 13C used for labeling and it is strongly related to seasons. The isotope signal was detected in fine root organs and microbial biomass by periodical core sampling. The peak was observed 6 days after labeling in early summer while it was delayed more than 10 days in autumn and winter with less amount of carbon allocated belowground.

Theoretical investigations of quantum correlations in NMR multiple-pulse spin-locking experiments

NASA Astrophysics Data System (ADS)

Gerasev, S. A.; Fedorova, A. V.; Fel'dman, E. B.; Kuznetsova, E. I.

2018-04-01

Quantum correlations are investigated theoretically in a two-spin system with the dipole-dipole interactions in the NMR multiple-pulse spin-locking experiments. We consider two schemes of the multiple-pulse spin-locking. The first scheme consists of π /2-pulses only and the delays between the pulses can differ. The second scheme contains φ-pulses (0<φ <π ) and has equal delays between them. We calculate entanglement for both schemes for an initial separable state. We show that entanglement is absent for the first scheme at equal delays between π /2-pulses at arbitrary temperatures. Entanglement emerges after several periods of the pulse sequence in the second scheme at φ =π /4 at milliKelvin temperatures. The necessary number of the periods increases with increasing temperature. We demonstrate the dependence of entanglement on the number of the periods of the multiple-pulse sequence. Quantum discord is obtained for the first scheme of the multiple-pulse spin-locking experiment at different temperatures.

Labeling Sexual Victimization Experiences: The Role of Sexism, Rape Myth Acceptance, and Tolerance for Sexual Harassment.

PubMed

LeMaire, Kelly L; Oswald, Debra L; Russell, Brenda L

2016-01-01

This study investigated whether attitudinal variables, such as benevolent and hostile sexism toward men and women, female rape myth acceptance, and tolerance of sexual harassment are related to women labeling their sexual assault experiences as rape. In a sample of 276 female college students, 71 (25.7%) reported at least one experience that met the operational definition of rape, although only 46.5% of those women labeled the experience "rape." Benevolent sexism, tolerance of sexual harassment, and rape myth acceptance, but not hostile sexism, significantly predicted labeling of previous sexual assault experiences by the victims. Specifically, those with more benevolent sexist attitudes toward both men and women, greater rape myth acceptance, and more tolerant attitudes of sexual harassment were less likely to label their past sexual assault experience as rape. The results are discussed for their clinical and theoretical implications.

Classifying RRATs and FRBs

NASA Astrophysics Data System (ADS)

Keane, E. F.

2016-06-01

In this paper, we consider the fact that the simple criterion used to label fast radio transient events as either fast radio bursts (FRBs, thought to be extragalactic with as yet unknown progenitors) or rotating radio transients (RRATs, thought to be Galactic neutron stars) is uncertain. We identify single pulse events reported in the literature which have never been seen to repeat, and which have been labelled as RRATs, but are potentially mislabelled FRBs. We examine the probability that such `grey area' events are within the Milky Way. The uncertainty in the RRAT/FRB labelling criterion, as well as Galactic-latitude dependent reporting bias may be contributing to the observed latitude dependence of the FRB rate, in addition to effects such as Eddington bias due to scintillation.

Iron absorption from intrinsically-labeled lentils

USDA-ARS?s Scientific Manuscript database

Low iron (Fe) absorption from important staple foods may contribute to Fe deficiency in developing countries. To date, there are few studies examining the Fe bioavailability of pulse crops as commonly prepared and consumed by humans. The objectives of this study were to characterize the Fe absorpt...

Demonstration of the Protein Involvement in Cell Electropermeabilization using Confocal Raman Microspectroscopy

PubMed Central

Azan, Antoine; Untereiner, Valérie; Gobinet, Cyril; Sockalingum, Ganesh D.; Breton, Marie; Piot, Olivier; Mir, Lluis M.

2017-01-01

Confocal Raman microspectroscopy was used to study the interaction between pulsed electric fields and live cells from a molecular point of view in a non-invasive and label-free manner. Raman signatures of live human adipose-derived mesenchymal stem cells exposed or not to pulsed electric fields (8 pulses, 1 000 V/cm, 100 μs, 1 Hz) were acquired at two cellular locations (nucleus and cytoplasm) and two spectral bands (600–1 800 cm−1 and 2 800–3 100 cm−1). Vibrational modes of proteins (phenylalanine and amide I) and lipids were found to be modified by the electropermeabilization process with a statistically significant difference. The relative magnitude of four phenylalanine peaks decreased in the spectra of the pulsed group. On the contrary, the relative magnitude of the amide I band at 1658 cm−1 increased by 40% when comparing pulsed and control group. No difference was found between the control and the pulsed group in the high wavenumber spectral band. Our results reveal the modification of proteins in living cells exposed to pulsed electric fields by means of confocal Raman microspectroscopy. PMID:28102326

Structures and reaction pathways of the molybdenum centres of sulfite-oxidizing enzymes by pulsed EPR spectroscopy.

PubMed

Enemark, John H; Astashkin, Andrei V; Raitsimring, Arnold M

2008-12-01

SOEs (sulfite-oxidizing enzymes) are physiologically vital and occur in all forms of life. During the catalytic cycle, the five-co-ordinate square pyramidal oxo-molybdenum active site passes through the Mo(V) state, and intimate details of the structure can be obtained from variable frequency pulsed EPR spectroscopy through the hyperfine and nuclear quadrupole interactions of nearby magnetic nuclei. By employing variable spectrometer operational frequencies, it is possible to optimize the measurement conditions for difficult quadrupolar nuclei of interest (e.g. (17)O, (33)S, (35)Cl and (37)Cl) and to simplify the interpretation of the spectra. Isotopically labelled model Mo(V) compounds provide further insight into the electronic and geometric structures and chemical reactions of the enzymes. Recently, blocked forms of SOEs having co-ordinated sulfate, the reaction product, were detected using (33)S (I=3/2) labelling. This blocking of product release is a possible contributor to fatal human sulfite oxidase deficiency in young children.

Forensic applications of 14C bomb-pulse dating

NASA Astrophysics Data System (ADS)

Zoppi, U.; Skopec, Z.; Skopec, J.; Jones, G.; Fink, D.; Hua, Q.; Jacobsen, G.; Tuniz, C.; Williams, A.

2004-08-01

After a brief review of the basics of 14C bomb-pulse dating, this paper presents two unique forensic applications. Particular attention is dedicated to the use of the 14C bomb-pulse to establish the time of harvest of illicit drugs such as heroin and opium. Preliminary measurements of 14C concentrations in milligram samples taken from seized drugs are presented. 14C bomb-pulse dating can determine whether drug distribution originates from stockpiles or recent manufacture, and support the action of law enforcement authorities against criminal organisations involved in drug trafficking. In addition, we describe the dating of wine vintages for a number of authenticated single label vintage red wines from the Barossa Valley - South Australia. Our results show that radiocarbon dating can be used to accurately determine wine vintages and therefore reveal the addition of unrelated materials of natural and synthetic origin.

Disclaimer labels on fashion magazine advertisements: effects on social comparison and body dissatisfaction.

PubMed

Tiggemann, Marika; Slater, Amy; Bury, Belinda; Hawkins, Kimberley; Firth, Bonny

2013-01-01

Recent proposals across a number of Western countries have suggested that idealised media images should carry some sort of disclaimer informing readers when these images have been digitally enhanced. The present studies aimed to experimentally investigate the impact on women's body dissatisfaction of the addition of such warning labels to fashion magazine advertisements. Participants were 120 and 114 female undergraduate students in Experiment 1 and Experiment 2 respectively. In both experiments, participants viewed fashion magazine advertisements with either no warning label, a generic warning label, or a specific more detailed warning label. In neither experiment was there a significant effect of type of label. However, state appearance comparison was found to predict change in body dissatisfaction irrespective of condition. Unexpectedly, trait appearance comparison moderated the effect of label on body dissatisfaction, such that for women high on trait appearance comparison, exposure to specific warning labels actually resulted in increased body dissatisfaction. In sum, the present results showed no benefit of warning labels in ameliorating the known negative effect of viewing thin-ideal media images, and even suggested that one form of warning (specific) might be harmful for some individuals. Accordingly, it was concluded that more extensive research is required to guide the most effective use of disclaimer labels. Copyright © 2012 Elsevier Ltd. All rights reserved.

Extended-pulsed fidaxomicin versus vancomycin for Clostridium difficile infection in patients 60 years and older (EXTEND): a randomised, controlled, open-label, phase 3b/4 trial.

PubMed

Guery, Benoit; Menichetti, Francesco; Anttila, Veli-Jukka; Adomakoh, Nicholas; Aguado, Jose Maria; Bisnauthsing, Karen; Georgopali, Areti; Goldenberg, Simon D; Karas, Andreas; Kazeem, Gbenga; Longshaw, Chris; Palacios-Fabrega, Jose Alejandro; Cornely, Oliver A; Vehreschild, Maria J G T

2018-03-01

Clostridium difficile infection causes severe complications and frequently recurs. An extended-pulsed fidaxomicin regimen might facilitate sustained clinical cure by prolonging C difficile suppression and supporting gut microbiota recovery. We aimed to compare clinical outcomes of extended-pulsed fidaxomicin with standard vancomycin. In this randomised, controlled, open-label, superiority study, we recruited hospitalised adults aged 60 years and older with confirmed C difficile infection at 86 European hospitals. Patients were randomly assigned (1:1) using an interactive web response system to receive extended-pulsed fidaxomicin (200 mg oral tablets, twice daily on days 1-5, then once daily on alternate days on days 7-25) or vancomycin (125 mg oral capsules, four times daily on days 1-10), stratified by baseline C difficile infection severity, cancer presence, age (≥75 years vs <75 years), and number of previous C difficile infection occurrences. The primary endpoint was sustained clinical cure 30 days after end of treatment (day 55 for extended-pulsed fidaxomicin and day 40 for vancomycin), assessed in all randomised patients who met the inclusion criteria and received at least one dose of study medication (modified full analysis set). Adverse events were assessed in all patients who received at least one dose of study drug. The study is registered with ClinicalTrials.gov, number NCT02254967. Between Nov 6, 2014, and May 5, 2016, 364 patients were enrolled and randomly assigned to receive extended-pulsed fidaxomicin or vancomycin. 362 patients received at least one dose of study medication (181 in each group). 124 (70%) of 177 patients in the modified full analysis set receiving extended-pulsed fidaxomicin achieved sustained clinical cure 30 days after end of treatment, compared with 106 (59%) of 179 patients receiving vancomycin (difference 11% [95% CI 1·0-20·7], p=0·030; odds ratio 1·62 [95% CI 1·04-2·54]). Incidence of treatment-emergent adverse events did not differ between extended-pulsed fidaxomicin (121 [67%] of 181) and vancomycin (128 [71%] of 181) treatment arms. One death in the vancomycin arm was considered by the investigator to be related to study drug. Extended-pulsed fidaxomicin was superior to standard-dose vancomycin for sustained cure of C difficile infection, and, to our knowledge, extended-pulsed fidaxomicin recurrence rates in this study are the lowest observed in a randomised clinical trial of antibiotic treatment for C difficile infection. Astellas Pharma, Inc. Copyright © 2018 Elsevier Ltd. All rights reserved.

What good is labeling what's good? A field experimental investigation of parental labeled praise and child compliance.

PubMed

Leijten, Patty; Thomaes, Sander; Orobio de Castro, Bram; Dishion, Thomas J; Matthys, Walter

2016-12-01

There is a need to identify the "effective ingredients" of evidence-based behavior therapies. We tested the effects of one of the most common ingredients in parenting interventions for preventing disruptive child behavior, referred to as labeled praise (e.g., "well done picking up your toys"), which is typically recommended in preference to unlabeled praise (e.g., "well done"). We compared the effects of labeled praise, unlabeled praise, and no praise on child compliance in two experiments. Experiment 1 included 161 4 to 8 year-old community sample children and tested immediate effects of praise. Experiment 2 included 132 3 to 9 year-old children with varying levels of disruptive behavior and tested immediate and two-week effects of praise. In Experiment 1, teaching parents to use labeled praise did not increase immediate child compliance, whereas teaching them to use unlabeled praise did. In Experiment 2, teaching parents to use labeled praise for two weeks reduced disruptive child behavior, but this effect was of a similar magnitude to that for unlabeled praise. Parents preferred the use of unlabeled over labeled praise. These findings suggest that parental praise promotes child compliance, but the addition of labeling the specific positive behavior may not be of incremental value. Copyright © 2016 Elsevier Ltd. All rights reserved.

Repetitively Pulsed Backward-Wave Oscillator Investigations

DTIC Science & Technology

1994-03-31

Sinus-6 High Power BWO Experiments and Theory .................. 6 A . B W O physics .............................................................. 6...B. Experiments with high power output of BWO .............................. 8 Section III. Long Pulse Vacuum BWO Experiments...UNM) has completed its initial phase of research on repetitively pulsed high power backward-wave oscillators (BWOs). The aggressive program that we had

The Effect of Labeling on Preschool Children's Performance in the Dimensional Change Card Sort Task

ERIC Educational Resources Information Center

Muller, Ulrich; Zelazo, Philip D.; Lurye, Leah E.; Liebermann, Dana P.

2008-01-01

Previous research suggests that experimenter-induced labeling of test cards improves preschoolers' performance on the Dimensional Change Card Sort Task (DCCS), a measure of flexible rule use. Three experiments attempted to further clarify how labeling aids performance on the DCCS. Experiment 1 examined the nature of the labeling effect but failed…

Pulse EPR detection of lipid exchange between protein-rich raft and bulk domains in the membrane: methodology development and its application to studies of influenza viral membrane.

PubMed Central

Kawasaki, K; Yin, J J; Subczynski, W K; Hyde, J S; Kusumi, A

2001-01-01

A pulse saturation-recovery electron paramagnetic resonance (EPR) method has been developed that allows estimation of the exchange rates of a spin-labeled lipid between the bulk domain and the protein-rich membrane domain, in which the rate of collision between the spin label and molecular oxygen is reduced (slow-oxygen transport domain, or SLOT domain). It is based on the measurements of saturation-recovery signals of a lipid spin label as a function of concentrations of both molecular oxygen and the spin label. Influenza viral membrane, one of the simplest paradigms for the study of biomembranes, showed the presence of two membrane domains with slow and fast collision rates with oxygen (a 16-fold difference) at 30 degrees C. The outbound rate from and the inbound rate into the SLOT domain (or possibly the rate of the domain disintegration and formation) were estimated to be 7.7 x 10(4) and 4.6 x 10(4) s(-1), (15 micros residency time), respectively, indicating that the SLOT domain is highly dynamic and that the entire SLOT domain represents about one-third of the membrane area. Because the oxygen transport rate in the SLOT domain is a factor of two smaller than that in purple membrane, where bacteriorhodopsin is aggregated, we propose that the SLOT domain in the viral membrane is the cholesterol-rich raft domain stabilized by the trimers of hemagglutinin and/or the tetramers of neuraminidase. PMID:11159441

Noninvasive Label-Free Detection of Micrometastases in the Lymphatics with Ultrasound-Guided Photoacoustic Imaging

DTIC Science & Technology

2015-10-01

imaging can be used to guide dissection. We have also successfully integrated a programmable ultrasound machine (Verasonics Vantage ) and tunable pulsed...Mobile HE) with the programmable ultrasound machine (Verasonics Vantage ). We have synchronized the signals to enable interleaved acquisition of US

Experiments of a 100 kV-level pulse generator based on metal-oxide varistor

NASA Astrophysics Data System (ADS)

Cui, Yan-cheng; Wu, Qi-lin; Yang, Han-wu; Gao, Jing-ming; Li, Song; Shi, Cheng-yu

2018-03-01

This paper introduces the development and experiments of a 100 kV-level pulse generator based on a metal-oxide varistor (MOV). MOV has a high energy handling capacity and nonlinear voltage-current (V-I) characteristics, which makes it useful for high voltage pulse shaping. Circuit simulations based on the measured voltage-current characteristics of MOV verified the shaping concept and showed that a circuit containing a two-section pulse forming network (PFN) will result in better defined square pulse than a simple L-C discharging circuit. A reduced-scale experiment was carried out and the result agreed well with simulation prediction. Then a 100 kV-level pulse generator with multiple MOVs in a stack and a two-section pulse forming network (PFN) was experimented. A pulse with a voltage amplitude of 90 kV, rise time of about 50 ns, pulse width of 500 ns, and flat top of about 400 ns was obtained with a water dummy load of 50 Ω. The results reveal that the combination of PFN and MOV is a practical way to generate high voltage pulses with better flat top waveforms, and the load voltage is stable even if the load's impedance varies. Such pulse generator can be applied in many fields such as surface treatment, corona plasma generation, industrial dedusting, and medical disinfection.

Urgency is a non-monotonic function of pulse rate.

PubMed

Russo, Frank A; Jones, Jeffery A

2007-11-01

Magnitude estimation was used to assess the experience of urgency in pulse-train stimuli (pulsed white noise) ranging from 3.13 to 200 Hz. At low pulse rates, pulses were easily resolved. At high pulse rates, pulses fused together leading to a tonal sensation with a clear pitch level. Urgency ratings followed a nonmonotonic (polynomial) function with local maxima at 17.68 and 200 Hz. The same stimuli were also used in response time and pitch scaling experiments. Response times were negatively correlated with urgency ratings. Pitch scaling results indicated that urgency of pulse trains is mediated by the perceptual constructs of speed and pitch.

Double-blind optimization of subcallosal cingulate deep brain stimulation for treatment-resistant depression: a pilot study.

PubMed

Ramasubbu, Rajamannar; Anderson, Susan; Haffenden, Angela; Chavda, Swati; Kiss, Zelma H T

2013-09-01

Deep brain stimulation (DBS) of the subcallosal cingulate (SCC) is reported to be a safe and effective new treatment for treatment-resistant depression (TRD). However, the optimal electrical stimulation parameters are unknown and generally selected by trial and error. This pilot study investigated the relationship between stimulus parameters and clinical effects in SCC-DBS treatment for TRD. Four patients with TRD underwent SCC-DBS surgery. In a double-blind stimulus optimization phase, frequency and pulse widths were randomly altered weekly, and corresponding changes in mood and depression were evaluated using a visual analogue scale (VAS) and the 17-item Hamilton Rating Scale for Depression (HAM-D-17). In the open-label postoptimization phase, depressive symptoms were evaluated biweekly for 6 months to determine long-term clinical outcomes. Longer pulse widths (270-450 μs) were associated with reductions in HAM-D-17 scores in 3 patients and maximal happy mood VAS responses in all 4 patients. Only 1 patient showed acute clinical or mood effects from changing the stimulation frequency. After 6 months of open-label therapy, 2 patients responded and 1 patient partially responded. Limitations include small sample size, weekly changes in stimulus parameters, and fixed-order and carry-forward effects. Longer pulse width stimulation may have a role in stimulus optimization for SCC-DBS in TRD. Longer pulse durations produce larger apparent current spread, suggesting that we do not yet know the optimal target or stimulus parameters for this therapy. Investigations using different stimulus parameters are required before embarking on large-scale randomized sham-controlled trials.

Differences in the intracellular processing of the radiolabel following the uptake of iodine-125- and technetium-99m-neogalactosyl albumin by the isolated perfused rat liver

DOE Office of Scientific and Technical Information (OSTI.GOV)

Gore, S.; Morris, A.I.; Gilmore, I.T.

1991-03-01

Neogalactosyl albumin (NGA) is a synthetic ligand to the asialoglycoprotein receptor (hepatic binding protein), which has been proposed as a useful receptor binding radiopharmaceutical for the noninvasive assessment of liver function. We have compared the uptake and intracellular processing of iodine-125- (125I) and technetium-99m- ({sup 99m}Tc) NGA following its administration as a 1-min pulse (147 pmol) to the isolated perfused rat liver. Approximately 40% of a pulse of either {sup 125}I- or {sup 99m}Tc-NGA were taken up first pass by the liver. Of the {sup 125}I taken up by the liver, 82% was released after 15-20 min at the sinusoidalmore » pole of the hepatocyte, predominantly as small molecular weight metabolites. A further 8% of the {sup 125}I-associated radioactivity was secreted as intact NGA into bile by the non-lysosomal (direct) pathway while 6% remained in the liver 1 hr after the pulse. In contrast, of the {sup 99m}Tc taken up by the liver, only 4% reappeared in the perfusate while 40% was secreted into bile by the lysosomal (indirect) pathway and 55% remained in the liver 1 hr after the pulse. Since labeled metabolites of {sup 99m}Tc-NGA do not appear in plasma, this permits kinetic modeling with {sup 99m}Tc-NGA without correction for labeled metabolites. Thus, {sup 99m}Tc-NGA is an excellent candidate as a receptor-binding radiopharmaceutical.« less

Long-Term Effects of Labeling a Rape Experience

ERIC Educational Resources Information Center

McMullin, Darcy; White, Jacquelyn W.

2006-01-01

Research has found that approximately half of women who report an experience that meets the legal definition of rape do not label it rape. It has been assumed that labeling the experience as rape is necessary and beneficial for recovery; however, conflicting findings have been reported. In the present study, a longitudinal design was utilized to…

In vivo real-time monitoring system of electroporation mediated control of transdermal and topical drug delivery.

PubMed

Blagus, Tanja; Markelc, Bostjan; Cemazar, Maja; Kosjek, Tina; Preat, Veronique; Miklavcic, Damijan; Sersa, Gregor

2013-12-28

Electroporation (EP) is a physical method for the delivery of molecules into cells and tissues, including the skin. In this study, in order to control the degree of transdermal and topical drug delivery, EP at different amplitudes of electric pulses was evaluated. A new in vivo real-time monitoring system based on fluorescently labeled molecules was developed, for the quantification of transdermal and topical drug delivery. EP of the mouse skin was performed with new non-invasive multi-array electrodes, delivering different amplitudes of electric pulses ranging from 70 to 570 V, between the electrode pin pairs. Patches, soaked with 4 kDa fluorescein-isothiocyanate labeled dextran (FD), doxorubicin (DOX) or fentanyl (FEN), were applied to the skin before and after EP. The new monitoring system was developed based on the delivery of FD to and through the skin. FD relative quantity was determined with fluorescence microscopy imaging, in the treated region of the skin for topical delivery and in a segment of the mouse tail for transdermal delivery. The application of electric pulses for FD delivery resulted in enhanced transdermal delivery. Depending on the amplitude of electric pulses, it increased up to the amplitude of 360 V, and decreased at higher amplitudes (460 and 570 V). Topical delivery steadily enhanced with increasing the amplitude of the delivered electric pulses, being even higher than after tape stripping used as a positive control. The non-invasive monitoring of the delivery of DOX, a fluorescent chemotherapeutic drug, qualitatively and quantitatively confirmed the effects of EP at 360 and 570 V pulse amplitudes on topical and transdermal drug delivery. Delivery of FEN at 360 and 570 V pulse amplitudes verified the observed effects as obtained with FD and DOX, by the measured physiological responses of the mice as well as FEN plasma concentration. This study demonstrates that with the newly developed non-invasive multi-array electrodes and with the varying electric pulse amplitude, the amount of topical and transdermal drug delivery to the skin can be controlled. Furthermore, the newly developed monitoring system provides a tool for rapid real-time determination of both, transdermal and topical delivery, when the delivered molecule is fluorescent. © 2013 Elsevier B.V. All rights reserved.

Spectral variation of high power microwave pulse propagating in a self-generated plasma

NASA Technical Reports Server (NTRS)

Ren, A.; Kuo, S. P.; Kossey, Paul

1995-01-01

A systematic study to understand the spectral variation of a high power microwave pulse propagating in a self-generated plasma is carried out. It includes the theoretical formulation, experimental demonstration, and computer simulations and computer experiments. The experiment of pulse propagation is conducted in a vacuum chamber filled with dry air (approximately 0.2 torr); the chamber is made of a 2 ft. cube of Plexiglas. A rectangular microwave pulse (1 microsec pulse width and 3.27 GHz carrier frequency) is fed into the cube through an S band microwave horn placed at one side of the chamber. A second S-band horn placed at the opposite side of the chamber is used to receive the transmitted pulse. The spectra of the incident pulse and transmitted pulse are then compared. As the power of the incident pulse is only slightly (less than 15%) above the breakdown threshold power of the background air, the peak of the spectrum of the transmitted pulse is upshifted from the carrier frequency 3.27 GHz of the incident pulse. However, as the power of the incident pulse exceeds the breakdown threshold power of the background air by 30%, a different phenomenon appears. The spectrum of the transmitted pulse begins to have two peaks. One is upshifted and the other one downshifted from the single peak location of the incident pulse. The amount of frequency downshift is comparable to that of the upshifted frequency. A theoretical model describing the experiment of pulse propagation in a self-generated plasma is developed. There are excellent agreements between the experimental results and computer simulations based on this theoretical model, which is also used to further carry out computer experiments identifying the role of plasma introduced wave loss on the result of frequency downshift phenomenon.

Individuality embedded in the isolation calls of captive beluga whales (Delphinapterus leucas).

PubMed

Mishima, Yuka; Morisaka, Tadamichi; Itoh, Miho; Matsuo, Ikuo; Sakaguchi, Aiko; Miyamoto, Yoshinori

2015-01-01

Species with fission-fusion social systems tend to exchange individualized contact calls to maintain group cohesion. Signature whistles by bottlenose dolphins are unique compared to the contact calls of other non-human animals in that they include identity information independent of voice cues. Further, dolphins copy the signatures of conspecifics and use them to label specific individuals. Increasing our knowledge of the contact calls of other cetaceans that have a fluid social structure may thus help us better understand the evolutionary and adaptive significance of all forms of individually distinctive calls. It was recently reported that one type of broadband pulsed sounds (PS1), rather than whistles, may function as individualized contact calls in captive belugas. The objective of this study was to assess the function and individual distinctiveness of PS1 calls in an isolation context. Recordings were made from five captive belugas, including both sexes and various ages. PS1 was the predominant call type (38 % in total) out of five broader sound categories. One sub-adult and three adults had individually distinctive and stereotyped pulse repetition pattern in PS1; one calf showed no clear stereotyped pulse repetition pattern. While visual inspection of the PS1 power spectra uncovered no apparent individual specificity, statistical analyses revealed that both temporal and spectral parameters had inter-individual differences and that there was greater inter-individual than intra-individual variability. Discriminant function analysis based on five temporal and spectral parameters classified PS1 calls into individuals with an overall correct classification rate of 80.5 %, and the most informative parameter was the average Inter-pulse interval, followed by peak frequency. These results suggest that belugas use individually distinctive contact calls in an isolation context. If belugas encode signature information in PS1 calls, as seen in bottlenose dolphins, the pulse repetition pattern may be the carrier, as it is individually stereotyped and appears to require vocal development. This idea is supported by the finding that the average inter-pulse interval is the most powerful discriminator in discriminant analysis. Playback experiments will elucidate which parameters are perceived as individual characteristics, and whether one of the parameters functions as a signature.

Alternating current circuit theory and pulsed NMR (Nuclear Magnetic Resonance)

NASA Astrophysics Data System (ADS)

Gerstein, B. C.

1987-06-01

Pulsed NMR, by definition, deals with time varying excitations. These excitations, supplied by resonant circuits which provide a pulse of radiofrequency (frequencies in the megahertz region) power to a resonant circuit containing, among other things, a coil of wire, or inductor, in which a sample under investigation is placed for purposes of the nuclear magnetic resonance experiment. There are therefore two features of the pulse NMR experiment. First is the fact that we have available a source of continuous wave (CW) alternating current at some angular frequency, omega, measured in radians per second. This source is generally supplied by an ultrastable device called a frequency synthesizer. The second feature of the pulsed NMR experiment is that the sample is not continuously irradiated, but a pulse of radiofrequency oscillation is applied to the sample. This report discusses alternating current theory, resonant circuits and the equipment used in this experiment.

Studies related to the development of the Viking 1975 labeled release experiment

NASA Technical Reports Server (NTRS)

Devincenzi, D. L.; Deal, P. H.

1976-01-01

The labeled release life detection experiment on the Viking 1975 Mars mission is based on the concept that microorganisms will metabolize radioactive organic substrates in a nutrient medium and release radioactive carbon dioxide. Several experiments, using laboratory equipment, were carried out to evaluate various aspects of the concept. Results indicate: (1) label is released by sterilization-treated soil, (2) substantial quantities of label are retained in solution under basic conditions, (3) the substrate used, as well as position of label in the molecule, affect release of label, (4) label release is depressed by radiolytic decomposition of substrates, and (5) About 100,000 organisms are required to produce a detectable response. These results, suggest additional areas for testing, add to the data base for interpretation of flight results, and have significance for broader application of this technique for assessing microbial activity.

Hydraulic lift in a neotropical savanna.

Treesearch

M.Z. Moreira; F.G. Scholz; S.J. Bucci; L.S. Sternberg; G. Goldstein; F.C. Meinzer; A.C. Franco

2003-01-01

We report hydraulic lift in the sawmlia vegetation of central Brazil (Cerrado). Both heat-pulse measurements and isotopic (deuterium) labelling were used to determine whether hydraulic lift occurred in two common species, and whether neighbouring small shrubs and trees were utilizing this water.Both techniques showed water uptake by tap-...

Effect of pulse temporal shape on optical trapping and impulse transfer using ultrashort pulsed lasers.

PubMed

Shane, Janelle C; Mazilu, Michael; Lee, Woei Ming; Dholakia, Kishan

2010-03-29

We investigate the effects of pulse duration on optical trapping with high repetition rate ultrashort pulsed lasers, through Lorentz-Mie theory, numerical simulation, and experiment. Optical trapping experiments use a 12 femtosecond duration infrared pulsed laser, with the trapping microscope's temporal dispersive effects measured and corrected using the Multiphoton Intrapulse Interference Phase Scan method. We apply pulse shaping to reproducibly stretch pulse duration by 1.5 orders of magnitude and find no material-independent effects of pulse temporal profile on optical trapping of 780nm silica particles, in agreement with our theory and simulation. Using pulse shaping, we control two-photon fluorescence in trapped fluorescent particles, opening the door to other coherent control applications with trapped particles.

Seasonal variations of the amount of carbon allocated to respiration after in situ 13CO2 pulse labelling of trees (Invited)

NASA Astrophysics Data System (ADS)

Epron, D.; Dannoura, M.; Ngao, J.; Plain, C.; Berveller, D.; Chipeaux, C.; Gerant, D.; Bosc, A.; Maillard, P.; Loustau, D.; Damesin, C.; Cats Project (Anr-07-Blan-0109)

2010-12-01

Soil and trunk respiration are the major sources of carbon from forest ecosystems to the atmosphere and they account for a large fraction of total ecosystem respiration. The amount of photosynthate allocated to respiration affects the growth of the tree and the potential for carbon sequestration of forest ecosystems. This study, aiming at understanding patterns of carbon allocation to respiration among species and seasons, consisted in pure 13CO2 labelling of the entire crown of three different tree species (beech, oak and pine) at distinct phenological stages between Sept 2008 and Feb 2010. 13C was then tracked for several weeks in soil and trunk CO2 efflux at high temporal resolution using tuneable diode laser absorption spectrometry (Plain et al. 2009). Recovery of 13C in trunk and soil CO2 efflux was observed a few couple of hours after the beginning of the labelling in oak and beech. There is a rapid transfer of 13C belowground with a maximum occurring within 2 to 4 days after labelling. Label was recovered at the same time in the respiration and in the biomass of both fine roots and microbes. Maximum recovery occurred earlier in beech and oak, while it happened later in Pine. Indeed, the velocity of phloem transport, calculated as the difference of time lags in 13C recovery in trunk respiration at different height, was around 0.10-0.2m/h in pine and around 0.2-1.2 m/h in oak and beech, reflecting difference in phloem anatomy between angiosperm and gymnosperm. The cumulated amount of label recovered in soil CO2 efflux 20 days after labelling varied among the seasons in all species, from 1 to 16% in beech, 2 to 11% in oak and 1 to 11% in pine. For all species, allocation to soil respiration was greater in early summer compared to spring, late summer and autumn. A compartmental analysis is further conducted to characterise functional pools of labelled substrates and storage compounds that contribute to both trunk and soil respiration. [Plain C, Gérant D, Maillard P, Dannoura M, Dong Y, Zeller B, Priault P, Parent F, Epron D. 2009. Tracing of recently assimilated carbon in respiration at high temporal resolution in the field with a tuneable diode laser absorption spectrometer after in situ 13CO2 pulse labelling of 20-year-old beech trees. Tree Physiology 29: 1433-1447.

Intense laser pulse propagation in capillary discharge plasma channels

DOE Office of Scientific and Technical Information (OSTI.GOV)

Hubbard, R. F.; Moore, C. I.; Sprangle, P.

Optical guiding of intense laser pulses is required for plasma-based accelerator concepts such as the laser wakefield accelerator. Reported experiments have successfully transported intense laser pulses in the hollow plasma column produced by a capillary discharge. The hollow plasma has an index of refraction which peaks on-axis, thus providing optical guiding which overcomes beam expansion due to diffraction. In more recent experiments at Hebrew University, 800 nm wavelength, 0.1 mJ, 100 fs pulses have been guided in {approx}300 micron radius capillaries over distances as long as 6.6 cm. Simulations of these experiments using a 2-D nonlinear laser propagation model producemore » the expected optical guiding, with the laser pulse radius r{sub L} exhibiting oscillations about the equilibrium value predicted by an analytical envelope equation model. The oscillations are damped at the front of the pulse and grow in amplitude in the back of the pulse. This growth and damping is attributed to finite pulse length effects. Simulations also show that further ionization of the discharge plasma by the laser pulse may hollow the laser pulse and introduce modulations in the spot size. This ionization-defocusing effect is expected to be significant at the high intensities required for accelerator application. Capillary discharge experiments at much higher intensities are in progress on the Naval Research Laboratory T{sup 3} laser, and preliminary results are reported.« less

All-fiber femtosecond laser providing 9 nJ, 50 MHz pulses at 1650 nm for three-photon microscopy

NASA Astrophysics Data System (ADS)

Cadroas, P.; Abdeladim, L.; Kotov, L.; Likhachev, M.; Lipatov, D.; Gaponov, D.; Hideur, A.; Tang, M.; Livet, J.; Supatto, W.; Beaurepaire, E.; Février, S.

2017-06-01

The spectral window lying between 1.6 and 1.7 μm is interesting for in-depth multiphoton microscopy of intact tissues due to reduced scattering and absorption in this wavelength range. However, wide adoption of this excitation range will rely on the availability of robust and cost-effective high peak power pulsed lasers operating at these wavelengths. In this communication, we report on a monolithically integrated high repetition rate (50 MHz) all-fiber femtosecond laser based on a soliton self-frequency shift providing 9 nJ, 75 fs pulses at 1650 nm. We illustrate its potential for biological microscopy by recording three-photon-excited fluorescence and third-harmonic generation images of mouse nervous tissue and developing Drosophila embryos labeled with a red fluorescent protein.

The set of triple-resonance sequences with a multiple quantum coherence evolution period

NASA Astrophysics Data System (ADS)

Koźmiński, Wiktor; Zhukov, Igor

2004-12-01

The new pulse sequence building block that relies on evolution of heteronuclear multiple quantum coherences is proposed. The particular chemical shifts are obtained in multiple quadrature, using linear combinations of frequencies taken from spectra measured at different quantum levels. The pulse sequences designed in this way consist of small number of RF-pulses, are as short as possible, and could be applied for determination of coupling constants. The examples presented involve 2D correlations H NCO, H NCA, H N(CO) CA, and H(N) COCA via heteronuclear zero and double coherences, as well as 2D H NCOCA technique with simultaneous evolution of triple and three distinct single quantum coherences. Applications of the new sequences are presented for 13C, 15N-labeled ubiquitin.

Integrated planar terahertz resonators for femtomolar sensitivity label-free detection of DNA hybridization.

PubMed

Nagel, Michael; Bolivar, Peter Haring; Brucherseifer, Martin; Kurz, Heinrich; Bosserhoff, Anja; Büttner, Reinhard

2002-04-01

A promising label-free approach for the analysis of genetic material by means of detecting the hybridization of polynucleotides with electromagnetic waves at terahertz (THz) frequencies is presented. Using an integrated waveguide approach, incorporating resonant THz structures as sample carriers and transducers for the analysis of the DNA molecules, we achieve a sensitivity down to femtomolar levels. The approach is demonstrated with time-domain ultrafast techniques based on femtosecond laser pulses for generating and electro-optically detecting broadband THz signals, although the principle can certainly be transferred to other THz technologies.

Differentiation of tumor from viable myocardium using cardiac tagging with MR imaging.

PubMed

Bouton, S; Yang, A; McCrindle, B W; Kidd, L; McVeigh, E R; Zerhouni, E A

1991-01-01

We report the application of myocardial tagging by MR to define tissue planes and differentiate contractile from noncontractile tissue in a neonate with congenital cardiac rhabdomyoma. Using custom-written pulse programming software, six 2 mm thick radiofrequency (RF) slice-selective presaturation pulses (tags) were used to label the chest wall and myocardium in a star pattern in diastole, approximately 60 ms before the R-wave gating trigger. This method successfully delineated the myocardium from noncontractile tumor, providing information that influenced clinical management. This RF tagging technique allowed us to confirm the exact intramyocardial location of a congenital cardiac tumor.

Target charging in short-pulse-laser-plasma experiments.

PubMed

Dubois, J-L; Lubrano-Lavaderci, F; Raffestin, D; Ribolzi, J; Gazave, J; Compant La Fontaine, A; d'Humières, E; Hulin, S; Nicolaï, Ph; Poyé, A; Tikhonchuk, V T

2014-01-01

Interaction of high-intensity laser pulses with solid targets results in generation of large quantities of energetic electrons that are the origin of various effects such as intense x-ray emission, ion acceleration, and so on. Some of these electrons are escaping the target, leaving behind a significant positive electric charge and creating a strong electromagnetic pulse long after the end of the laser pulse. We propose here a detailed model of the target electric polarization induced by a short and intense laser pulse and an escaping electron bunch. A specially designed experiment provides direct measurements of the target polarization and the discharge current in the function of the laser energy, pulse duration, and target size. Large-scale numerical simulations describe the energetic electron generation and their emission from the target. The model, experiment, and numerical simulations demonstrate that the hot-electron ejection may continue long after the laser pulse ends, enhancing significantly the polarization charge.

To call a cloud 'cirrus': sound symbolism in names for categories or items.

PubMed

Ković, Vanja; Sučević, Jelena; Styles, Suzy J

2017-01-01

The aim of the present paper is to experimentally test whether sound symbolism has selective effects on labels with different ranges-of-reference within a simple noun-hierarchy. In two experiments, adult participants learned the make up of two categories of unfamiliar objects ('alien life forms'), and were passively exposed to either category-labels or item-labels, in a learning-by-guessing categorization task. Following category training, participants were tested on their visual discrimination of object pairs. For different groups of participants, the labels were either congruent or incongruent with the objects. In Experiment 1, when trained on items with individual labels, participants were worse (made more errors) at detecting visual object mismatches when trained labels were incongruent. In Experiment 2, when participants were trained on items in labelled categories, participants were faster at detecting a match if the trained labels were congruent, and faster at detecting a mismatch if the trained labels were incongruent. This pattern of results suggests that sound symbolism in category labels facilitates later similarity judgments when congruent, and discrimination when incongruent, whereas for item labels incongruence generates error in judgements of visual object differences. These findings reveal that sound symbolic congruence has a different outcome at different levels of labelling within a noun hierarchy. These effects emerged in the absence of the label itself, indicating subtle but pervasive effects on visual object processing.

Replication labeling patterns and chromosome territories typical of mammalian nuclei are conserved in the early metazoan Hydra.

PubMed

Alexandrova, Olga; Solovei, Irina; Cremer, Thomas; David, Charles N

2003-12-01

To investigate the evolutionary conservation of higher order nuclear architecture previously described for mammalian cells we have analyzed the nuclear architecture of the simple polyp Hydra. These diploblastic organisms have large nuclei (8-10 microm) containing about 3x10(9) bp of DNA organized in 15 chromosome pairs. They belong to the earliest metazoan phylum and are separated from mammals by at least 600 million years. Single and double pulse labeling with halogenated nucleotides (bromodeoxyuridine, iododeoxyuridine and chlorodeoxyuridine) revealed striking similarities to the known sequence of replication labeling patterns in mammalian nuclei. These patterns reflect a persistent nuclear arrangement of early, mid-, and late replicating chromatin foci that could be identified during all stages of interphase over at least 5-10 cell generations. Segregation of labeled chromatids led after several cell divisions to nuclei with single or a few labeled chromosome territories. In such nuclei distinct clusters of labeled chromatin foci were separated by extended nuclear areas with non-labeled chromatin, which is typical of a territorial arrangement of interphase chromosomes. Our results indicate the conservation of fundamental features of higher order chromatin arrangements throughout the evolution of metazoan animals and suggest the existence of conserved mechanism(s) controlling this architecture.

Development of a real-time flexible multiphoton microendoscope for label-free imaging in a live animal

PubMed Central

Ducourthial, Guillaume; Leclerc, Pierre; Mansuryan, Tigran; Fabert, Marc; Brevier, Julien; Habert, Rémi; Braud, Flavie; Batrin, Renaud; Vever-Bizet, Christine; Bourg-Heckly, Geneviève; Thiberville, Luc; Druilhe, Anne; Kudlinski, Alexandre; Louradour, Frédéric

2015-01-01

We present a two-photon microendoscope capable of in vivo label-free deep-tissue high-resolution fast imaging through a very long optical fiber. First, an advanced light-pulse spectro-temporal shaping device optimally precompensates for linear and nonlinear distortions occurring during propagation within the endoscopic fiber. This enables the delivery of sub-40-fs duration infrared excitation pulses at the output of 5 meters of fiber. Second, the endoscopic fiber is a custom-made double-clad polarization-maintaining photonic crystal fiber specifically designed to optimize the imaging resolution and the intrinsic luminescence backward collection. Third, a miniaturized fiber-scanner of 2.2 mm outer diameter allows simultaneous second harmonic generation (SHG) and two-photon excited autofluorescence (TPEF) imaging at 8 frames per second. This microendoscope’s transverse and axial resolutions amount respectively to 0.8 μm and 12 μm, with a field-of-view as large as 450 μm. This microendoscope’s unprecedented capabilities are validated during label-free imaging, ex vivo on various fixed human tissue samples, and in vivo on an anesthetized mouse kidney demonstrating an imaging penetration depth greater than 300 μm below the surface of the organ. The results reported in this manuscript confirm that nonlinear microendoscopy can become a valuable clinical tool for real-time in situ assessment of pathological states. PMID:26673905

Fourier Analysis and Structure Determination. Part II: Pulse NMR and NMR Imaging.

ERIC Educational Resources Information Center

Chesick, John P.

1989-01-01

Uses simple pulse NMR experiments to discuss Fourier transforms. Studies the generation of spin echoes used in the imaging procedure. Shows that pulse NMR experiments give signals that are additions of sinusoids of differing amplitudes, frequencies, and phases. (MVL)

Overview of selected seminal optical science and photonics processes in nature

NASA Astrophysics Data System (ADS)

Alfano, Robert R.

2016-03-01

This presentation gives an overview on some of seminal research in optical science, condensed matter physics, biophysics, biology, biomedical, nonlinear optics, and structure light propagation and interactions at CCNY and GTE Labs over past 46 years. The advent of ultrafast laser pulses with picosecond and femtosecond pulses and optical spectroscopy (label free native fluorescence and Raman) has led to unravel some of mysteries in the molecular world leading to breakthroughs in various areas of science and medicine. The following topics are discussed: white light continuum called now Supercontinuum (SC); first direct measurement of Optical Phonon's lifetimes; first observation of creation of daughter vibrations in time from excited mother vibration in liquids; first direct measurement of creation and decay of Spin Angular Momentum of electrons in GaAs where picosecond Circular Polarized Light carrying Optical Spin Angular Momentum is generated; Pulse break up into ballistic, snake and diffusive components in scattering media such as um beads and tissues; and use of optical spectroscopy for first cancer detection in label free tissues. Most recently, advances in Biomedical Optics showed that Tryptophan as a key biomarker for aggressive cancers; there are three new optical windows with the Golden window #3 the best for penetrating tissue from 1600 nm to 1800 nm; Complex light with OAM offers potential deeper tissue penetration and Resonance Raman excited using magic 532 nm wavelength in tissues.

Left Gastric Vein Visualization with Hepatopetal Flow Information in Healthy Subjects Using Non-Contrast-Enhanced Magnetic Resonance Angiography with Balanced Steady-State Free-Precession Sequence and Time-Spatial Labeling Inversion Pulse.

PubMed

Furuta, Akihiro; Isoda, Hiroyoshi; Ohno, Tsuyoshi; Ono, Ayako; Yamashita, Rikiya; Arizono, Shigeki; Kido, Aki; Sakashita, Naotaka; Togashi, Kaori

2018-01-01

To selectively visualize the left gastric vein (LGV) with hepatopetal flow information by non-contrast-enhanced magnetic resonance angiography under a hypothesis that change in the LGV flow direction can predict the development of esophageal varices; and to optimize the acquisition protocol in healthy subjects. Respiratory-gated three-dimensional balanced steady-state free-precession scans were conducted on 31 healthy subjects using two methods (A and B) for visualizing the LGV with hepatopetal flow. In method A, two time-spatial labeling inversion pulses (Time-SLIP) were placed on the whole abdomen and the area from the gastric fornix to the upper body, excluding the LGV area. In method B, nonselective inversion recovery pulse was used and one Time-SLIP was placed on the esophagogastric junction. The detectability and consistency of LGV were evaluated using the two methods and ultrasonography (US). Left gastric veins by method A, B, and US were detected in 30 (97%), 24 (77%), and 23 (74%) subjects, respectively. LGV flow by US was hepatopetal in 22 subjects and stagnant in one subject. All hepatopetal LGVs by US coincided with the visualized vessels in both methods. One subject with non-visualized LGV in method A showed stagnant LGV by US. Hepatopetal LGV could be selectively visualized by method A in healthy subjects.

Invited Review Article: Pump-probe microscopy.

PubMed

Fischer, Martin C; Wilson, Jesse W; Robles, Francisco E; Warren, Warren S

2016-03-01

Multiphoton microscopy has rapidly gained popularity in biomedical imaging and materials science because of its ability to provide three-dimensional images at high spatial and temporal resolution even in optically scattering environments. Currently the majority of commercial and home-built devices are based on two-photon fluorescence and harmonic generation contrast. These two contrast mechanisms are relatively easy to measure but can access only a limited range of endogenous targets. Recent developments in fast laser pulse generation, pulse shaping, and detection technology have made accessible a wide range of optical contrasts that utilize multiple pulses of different colors. Molecular excitation with multiple pulses offers a large number of adjustable parameters. For example, in two-pulse pump-probe microscopy, one can vary the wavelength of each excitation pulse, the detection wavelength, the timing between the excitation pulses, and the detection gating window after excitation. Such a large parameter space can provide much greater molecular specificity than existing single-color techniques and allow for structural and functional imaging without the need for exogenous dyes and labels, which might interfere with the system under study. In this review, we provide a tutorial overview, covering principles of pump-probe microscopy and experimental setup, challenges associated with signal detection and data processing, and an overview of applications.

Invited Review Article: Pump-probe microscopy

PubMed Central

Wilson, Jesse W.; Robles, Francisco E.; Warren, Warren S.

2016-01-01

Multiphoton microscopy has rapidly gained popularity in biomedical imaging and materials science because of its ability to provide three-dimensional images at high spatial and temporal resolution even in optically scattering environments. Currently the majority of commercial and home-built devices are based on two-photon fluorescence and harmonic generation contrast. These two contrast mechanisms are relatively easy to measure but can access only a limited range of endogenous targets. Recent developments in fast laser pulse generation, pulse shaping, and detection technology have made accessible a wide range of optical contrasts that utilize multiple pulses of different colors. Molecular excitation with multiple pulses offers a large number of adjustable parameters. For example, in two-pulse pump-probe microscopy, one can vary the wavelength of each excitation pulse, the detection wavelength, the timing between the excitation pulses, and the detection gating window after excitation. Such a large parameter space can provide much greater molecular specificity than existing single-color techniques and allow for structural and functional imaging without the need for exogenous dyes and labels, which might interfere with the system under study. In this review, we provide a tutorial overview, covering principles of pump-probe microscopy and experimental setup, challenges associated with signal detection and data processing, and an overview of applications. PMID:27036751

Pulse energy dependence of subcellular dissection by femtosecond laser pulses

NASA Technical Reports Server (NTRS)

Heisterkamp, A.; Maxwell, I. Z.; Mazur, E.; Underwood, J. M.; Nickerson, J. A.; Kumar, S.; Ingber, D. E.

2005-01-01

Precise dissection of cells with ultrashort laser pulses requires a clear understanding of how the onset and extent of ablation (i.e., the removal of material) depends on pulse energy. We carried out a systematic study of the energy dependence of the plasma-mediated ablation of fluorescently-labeled subcellular structures in the cytoskeleton and nuclei of fixed endothelial cells using femtosecond, near-infrared laser pulses focused through a high-numerical aperture objective lens (1.4 NA). We find that the energy threshold for photobleaching lies between 0.9 and 1.7 nJ. By comparing the changes in fluorescence with the actual material loss determined by electron microscopy, we find that the threshold for true material ablation is about 20% higher than the photobleaching threshold. This information makes it possible to use the fluorescence to determine the onset of true material ablation without resorting to electron microscopy. We confirm the precision of this technique by severing a single microtubule without disrupting the neighboring microtubules, less than 1 micrometer away. c2005 Optical Society of America.

An auditory analog of the picture superiority effect.

PubMed

Crutcher, Robert J; Beer, Jenay M

2011-01-01

Previous research has found that pictures (e.g., a picture of an elephant) are remembered better than words (e.g., the word "elephant"), an empirical finding called the picture superiority effect (Paivio & Csapo. Cognitive Psychology 5(2):176-206, 1973). However, very little research has investigated such memory differences for other types of sensory stimuli (e.g. sounds or odors) and their verbal labels. Four experiments compared recall of environmental sounds (e.g., ringing) and spoken verbal labels of those sounds (e.g., "ringing"). In contrast to earlier studies that have shown no difference in recall of sounds and spoken verbal labels (Philipchalk & Rowe. Journal of Experimental Psychology 91(2):341-343, 1971; Paivio, Philipchalk, & Rowe. Memory & Cognition 3(6):586-590, 1975), the experiments reported here yielded clear evidence for an auditory analog of the picture superiority effect. Experiments 1 and 2 showed that sounds were recalled better than the verbal labels of those sounds. Experiment 2 also showed that verbal labels are recalled as well as sounds when participants imagine the sound that the word labels. Experiments 3 and 4 extended these findings to incidental-processing task paradigms and showed that the advantage of sounds over words is enhanced when participants are induced to label the sounds.

Defining the "like" in "begetting the like": The development of inductive inference in the domain of biology

NASA Astrophysics Data System (ADS)

Lo, Ya-Fen

There are evidences that very young children consider linguistic labels when making similarity judgment and inductive inferences. However, it remains unclear how labels contribute to young children's similarity judgment and inductive inferences. It has been demonstrated that labels facilitate categorical memberships about objects in young children's similarity judgment and inductive inferences. It is also suggested that young children should rely on several sources of information when making similarity judgment and inductive inferences. Three experiments were conducted to examine these interpretations, in which biological information, labeling information, and perceptual similarity information were varied in a systematic manner. Three- to eleven-year-old children were asked to judge which of two Test animals a baby animals would share biological properties with. In Experiment 1, preschool children demonstrated a basic understanding of the importance of biological information for generalizing biological properties. In Experiment 2, when the labeling information became available, young children relied on linguistic labels rather than on biological information when generalizing biological properties. At the same time, 9- to 11-year-old children relied consistently on biological information. Experiment 3 supported the results of Experiment 2 and suggested that in addition to labels, perceptual similarity also contributed to children's inductive inferences.

Non-contrast-enhanced MR portography and hepatic venography with time-spatial labeling inversion pulses: comparison at 1.5 Tesla and 3 Tesla

PubMed Central

Isoda, Hiroyoshi; Furuta, Akihiro; Togashi, Kaori

2015-01-01

Background A 3 Tesla (3 T) magnetic resonance (MR) scanner is a promising tool for upper abdominal MR angiography. However, there is no report focused on the image quality of non-contrast-enhanced MR portography and hepatic venography at 3 T. Purpose To compare and evaluate images of non-contrast-enhanced MR portography and hepatic venography with time-spatial labeling inversion pulses (Time-SLIP) at 1.5 Tesla (1.5 T) and 3 T. Material and Methods Twenty-five healthy volunteers were examined using respiratory-triggered three-dimensional balanced steady-state free-precession (bSSFP) with Time-SLIP. For portography, we used one tagging pulse (selective inversion recovery) and one non-selective inversion recovery pulse; for venography, two tagging pulses were used. The relative signal-to-noise ratio (SNR) and contrast-to-noise ratio (CNR) were quantified, and the quality of visualization was evaluated. Results The CNRs of the main portal vein, right portal vein, and left portal vein at 3 T were better than at 1.5 T. The image quality scores for the portal branches of segment 4, 5, and 8 were significantly higher at 3 T than at 1.5 T. The CNR of the right hepatic vein (RHV) at 3 T was significantly lower than at 1.5 T. The image quality scores of RHV and the middle hepatic vein were higher at 1.5 T than at 3 T. For RHV visualization, the difference was statistically significant. Conclusion Non-contrast-enhanced MR portography with Time-SLIP at 3 T significantly improved visualization of the peripheral branch in healthy volunteers compared with1.5 T. Non-contrast-enhanced MR hepatic venography at 1.5 T was better than at 3 T. PMID:26019890

The determination of pair-distance distribution by double electron-electron resonance: regularization by the length of distance discretization with Monte Carlo calculations

NASA Astrophysics Data System (ADS)

Dzuba, Sergei A.

2016-08-01

Pulsed double electron-electron resonance technique (DEER, or PELDOR) is applied to study conformations and aggregation of peptides, proteins, nucleic acids, and other macromolecules. For a pair of spin labels, experimental data allows for the determination of their distance distribution function, P(r). P(r) is derived as a solution of a first-kind Fredholm integral equation, which is an ill-posed problem. Here, we suggest regularization by increasing the distance discretization length to its upper limit where numerical integration still provides agreement with experiment. This upper limit is found to be well above the lower limit for which the solution instability appears because of the ill-posed nature of the problem. For solving the integral equation, Monte Carlo trials of P(r) functions are employed; this method has an obvious advantage of the fulfillment of the non-negativity constraint for P(r). The regularization by the increasing of distance discretization length for the case of overlapping broad and narrow distributions may be employed selectively, with this length being different for different distance ranges. The approach is checked for model distance distributions and for experimental data taken from literature for doubly spin-labeled DNA and peptide antibiotics.

Short-term effects of cardiac steroids on intracellular membrane traffic in neuronal NT2 cells.

PubMed

Rosen, H; Glukmann, V; Feldmann, T; Fridman, E; Lichtstein, D

2006-12-30

Cardiac steroids (CS) are specific inhibitors of Na+, K+-ATPase activity. Although the presence of CS-like compounds in animal tissues has been established, their physiological role is not clear. In a previous study we showed that in pulse-chase membrane-labeling experiments, long term (hours) interaction of CS at physiological concentrations (nM) with Na+, K+-ATPase, caused changes in endocytosed membrane traffic in human NT2 cells. This was associated with the accumulation of large vesicles adjacent to the nucleus. For this sequence of events to function in the physiological setting, however, CS would be expected to modify membrane traffic upon short term (min) exposure and membrane labeling. We now demonstrate that CS affects membrane traffic also following a short exposure. This was reflected by the CS-induced accumulation of FM1-43 and transferrin in the cells, as well as by changes in their colocalization with Na+, K+-ATPase. We also show that the CS-induced changes in membrane traffic following up to 2 hrs exposure are reversible, whereas longer treatment induces irreversible effects. Based on these observations, we propose that endogenous CS-like compounds are physiological regulators of the recycling of endocytosed membrane proteins and cargo in neuronal cells, and may affect basic mechanisms such as neurotransmitter release and reuptake.

Millimeter-wave optical double resonance schemes for rapid assignment of perturbed spectra, with applications to the C{sup ~} {sup 1}B{sub 2} state of SO{sub 2}

DOE Office of Scientific and Technical Information (OSTI.GOV)

Park, G. Barratt, E-mail: barratt@mit.edu, E-mail: barratt.park@gmail.com; Womack, Caroline C.; Jiang, Jun

2015-04-14

Millimeter-wave detected, millimeter-wave optical double resonance (mmODR) spectroscopy is a powerful tool for the analysis of dense, complicated regions in the optical spectra of small molecules. The availability of cavity-free microwave and millimeter wave spectrometers with frequency-agile generation and detection of radiation (required for chirped-pulse Fourier-transform spectroscopy) opens up new schemes for double resonance experiments. We demonstrate a multiplexed population labeling scheme for rapid acquisition of double resonance spectra, probing multiple rotational transitions simultaneously. We also demonstrate a millimeter-wave implementation of the coherence-converted population transfer scheme for background-free mmODR, which provides a ∼10-fold sensitivity improvement over the population labeling scheme.more » We analyze perturbations in the C{sup ~} state of SO{sub 2}, and we rotationally assign a b{sub 2} vibrational level at 45 328 cm{sup −1} that borrows intensity via a c-axis Coriolis interaction. We also demonstrate the effectiveness of our multiplexed mmODR scheme for rapid acquisition and assignment of three predissociated vibrational levels of the C{sup ~} state of SO{sub 2} between 46 800 and 47 650 cm{sup −1}.« less

Relationship between carbohydrate partitioning and drought resistance in common bean.

PubMed

Cuellar-Ortiz, Sonia M; De La Paz Arrieta-Montiel, Maria; Acosta-Gallegos, Jorge; Covarrubias, Alejandra A

2008-10-01

Drought is a major yield constraint in common bean (Phaseolus vulgaris L.). Pulse-chase (14)C-labelling experiments were performed using Pinto Villa (drought resistant) and Canario 60 (drought sensitive) cultivars, grown under optimal irrigation and water-deficit conditions. Starch and the radioactive label incorporated into starch were measured in leaves and pods at different time points, between the initiation of pod development and the production of mature pods. The water-stress treatment induced a higher starch accumulation in the drought-resistant cultivar pods than in those of the drought-sensitive cultivar. This effect was more noticeable during the early stages of pod development. Consistently, a reduction of starch content occurred in the leaves of the drought-resistant cultivar during the grain-filling stage. Furthermore, a synchronized accumulation of sucrose was observed in immature pods of this cultivar. These data indicate that carbohydrate partitioning is affected by drought in common bean, and that the modulation of this partitioning towards seed filling has been a successful strategy in the development of drought-resistant cultivars. In addition, our results suggest that, in the drought-resistant cultivar, the efficient carbon mobilization towards the seeds in response to water limitation is favoured by a mechanism that implies a more effective sucrose transport.

Macrofauna regulate heterotrophic bacterial carbon and nitrogen incorporation in low-oxygen sediments

PubMed Central

Hunter, William R; Veuger, Bart; Witte, Ursula

2012-01-01

Oxygen minimum zones (OMZs) currently impinge upon >1 million km2 of sea floor and are predicted to expand with climate change. We investigated how changes in oxygen availability, macrofaunal biomass and retention of labile organic matter (OM) regulate heterotrophic bacterial C and N incorporation in the sediments of the OMZ-impacted Indian continental margin (540–1100 m; [O2]=0.35–15 μmol l−1). In situ pulse-chase experiments traced 13C:15N-labelled phytodetritus into bulk sediment OM and hydrolysable amino acids, including the bacterial biomarker 𝒟-alanine. Where oxygen availability was lowest ([O2]=0.35 μmol l−1), metazoan macrofauna were absent and bacteria assimilated 30–90% of the labelled phytodetritus within the sediment. At higher oxygen levels ([O2]=2–15 μmol l−1) the macrofaunal presence and lower phytodetritus retention with the sediment occur concomitantly, and bacterial phytodetrital incorporation was reduced and retarded. Bacterial C and N incorporation exhibited a significant negative relationship with macrofaunal biomass across the OMZ. We hypothesise that fauna–bacterial interactions significantly influence OM recycling in low-oxygen sediments and need to be considered when assessing the consequences of global change on biogeochemical cycles. PMID:22592818

Application of optimal control theory to the design of broadband excitation pulses for high-resolution NMR.

PubMed

Skinner, Thomas E; Reiss, Timo O; Luy, Burkhard; Khaneja, Navin; Glaser, Steffen J

2003-07-01

Optimal control theory is considered as a methodology for pulse sequence design in NMR. It provides the flexibility for systematically imposing desirable constraints on spin system evolution and therefore has a wealth of applications. We have chosen an elementary example to illustrate the capabilities of the optimal control formalism: broadband, constant phase excitation which tolerates miscalibration of RF power and variations in RF homogeneity relevant for standard high-resolution probes. The chosen design criteria were transformation of I(z)-->I(x) over resonance offsets of +/- 20 kHz and RF variability of +/-5%, with a pulse length of 2 ms. Simulations of the resulting pulse transform I(z)-->0.995I(x) over the target ranges in resonance offset and RF variability. Acceptably uniform excitation is obtained over a much larger range of RF variability (approximately 45%) than the strict design limits. The pulse performs well in simulations that include homonuclear and heteronuclear J-couplings. Experimental spectra obtained from 100% 13C-labeled lysine show only minimal coupling effects, in excellent agreement with the simulations. By increasing pulse power and reducing pulse length, we demonstrate experimental excitation of 1H over +/-32 kHz, with phase variations in the spectra <8 degrees and peak amplitudes >93% of maximum. Further improvements in broadband excitation by optimized pulses (BEBOP) may be possible by applying more sophisticated implementations of the optimal control formalism.

In vitro labelling and detection of mesenchymal stromal cells: a comparison between magnetic resonance imaging of iron-labelled cells and magnetic resonance spectroscopy of fluorine-labelled cells.

PubMed

Rizzo, Stefania; Petrella, Francesco; Zucca, Ileana; Rinaldi, Elena; Barbaglia, Andrea; Padelli, Francesco; Baggi, Fulvio; Spaggiari, Lorenzo; Bellomi, Massimo; Bruzzone, Maria Grazia

2017-01-01

Among the various stem cell populations used for cell therapy, adult mesenchymal stromal cells (MSCs) have emerged as a major new cell technology. These cells must be tracked after transplantation to monitor their migration within the body and quantify their accumulation at the target site. This study assessed whether rat bone marrow MSCs can be labelled with superparamagnetic iron oxide (SPIO) nanoparticles and perfluorocarbon (PFC) nanoemulsion formulations without altering cell viability and compared magnetic resonance imaging (MRI) and magnetic resonance spectroscopy (MRS) results from iron-labelled and fluorine-labelled MSCs, respectively. Of MSCs, 2 × 10 6 were labelled with Molday ION Rhodamine-B (MIRB) and 2 × 10 6 were labelled with Cell Sense. Cell viability was evaluated by trypan blue exclusion method. Labelled MSCs were divided into four samples containing increasing cell numbers (0.125 × 10 6 , 0.25 × 10 6 , 0.5 × 10 6 , 1 × 10 6 ) and scanned on a 7T MRI: for MIRB-labelled cells, phantoms and cells negative control, T1, T2 and T2* maps were acquired; for Cell Sense labelled cells, phantoms and unlabelled cells, a 19 F non-localised single-pulse MRS sequence was acquired. In total, 86.8% and 83.6% of MIRB-labelled cells and Cell Sense-labelled cells were viable, respectively. MIRB-labelled cells were visible in all samples with different cell numbers; pellets containing 0.5 × 10 6 and 1 × 10 6 of Cell Sense-labelled cells showed a detectable 19 F signal. Our data support the use of both types of contrast material (SPIO and PFC) for MSCs labelling, although further efforts should be dedicated to improve the efficiency of PFC labelling.

Inter-Slice Blood Flow and Magnetization Transfer Effects as A New Simultaneous Imaging Strategy.

PubMed

Han, Paul Kyu; Barker, Jeffrey W; Kim, Ki Hwan; Choi, Seung Hong; Bae, Kyongtae Ty; Park, Sung-Hong

2015-01-01

The recent blood flow and magnetization transfer (MT) technique termed alternate ascending/descending directional navigation (ALADDIN) achieves the contrast using interslice blood flow and MT effects with no separate preparation RF pulse, thereby potentially overcoming limitations of conventional methods. In this study, we examined the signal characteristics of ALADDIN as a simultaneous blood flow and MT imaging strategy, by comparing it with pseudo-continuous ASL (pCASL) and conventional MT asymmetry (MTA) methods, all of which had the same bSSFP readout. Bloch-equation simulations and experiments showed ALADDIN perfusion signals increased with flip angle, whereas MTA signals peaked at flip angle around 45°-60°. ALADDIN provided signals comparable to those of pCASL and conventional MTA methods emulating the first, second, and third prior slices of ALADDIN under the same scan conditions, suggesting ALADDIN signals to be superposition of signals from multiple labeling planes. The quantitative cerebral blood flow signals from a modified continuous ASL model overestimated the perfusion signals compared to those measured with a pulsed ASL method. Simultaneous mapping of blood flow, MTA, and MT ratio in the whole brain is feasible with ALADDIN within a clinically reasonable time, which can potentially help diagnosis of various diseases.

Magneto acoustic tomography with short pulsed magnetic field for in-vivo imaging of magnetic iron oxide nanoparticles.

PubMed

Mariappan, Leo; Shao, Qi; Jiang, Chunlan; Yu, Kai; Ashkenazi, Shai; Bischof, John C; He, Bin

2016-04-01

Nanoparticles are widely used as contrast and therapeutic agents. As such, imaging modalities that can accurately estimate their distribution in-vivo are actively sought. We present here our method Magneto Acoustic Tomography (MAT), which uses magnetomotive force due to a short pulsed magnetic field to induce ultrasound in the magnetic nanoparticle labeled tissue and estimates an image of the distribution of the nanoparticles in-vivo with ultrasound imaging resolution. In this study, we image the distribution of superparamagnetic iron oxide nanoparticles (IONP) using MAT method. In-vivo imaging was performed on live, nude mice with IONP injected into LNCaP tumors grown subcutaneously within the hind limb of the mice. Our experimental results indicate that the MAT method is capable of imaging the distribution of IONPs in-vivo. Therefore, MAT could become an imaging modality for high resolution reconstruction of MNP distribution in the body. Many magnetic nanoparticles (MNPs) have been used as contrast agents in magnetic resonance imaging. In this study, the authors investigated the use of ultrasound to detect the presence of MNPs by magneto acoustic tomography. In-vivo experiments confirmed the imaging quality of this new approach, which hopefully would provide an alternative method for accurate tumor detection. Copyright © 2015 Elsevier Inc. All rights reserved.

Probing the Time Scale of FPOP (Fast Photochemical Oxidation of Proteins): Radical Reactions Extend Over Tens of Milliseconds

NASA Astrophysics Data System (ADS)

Vahidi, Siavash; Konermann, Lars

2016-07-01

Hydroxyl radical (ṡOH) labeling with mass spectrometry detection reports on protein conformations and interactions. Fast photochemical oxidation of proteins (FPOP) involves ṡOH production via H2O2 photolysis by UV laser pulses inside a flow tube. The experiments are conducted in the presence of a scavenger (usually glutamine) that shortens the ṡOH lifetime. The literature claims that FPOP takes place within 1 μs. This ultrafast time scale implies that FPOP should be immune to labeling-induced artifacts that may be encountered with other techniques. Surprisingly, the FPOP time scale has never been validated in direct kinetic measurements. Here we employ flash photolysis for probing oxidation processes under typical FPOP conditions. Bleaching of the reporter dye cyanine-5 (Cy5) served as readout of the time-dependent radical milieu. Surprisingly, Cy5 oxidation extends over tens of milliseconds. This time range is four orders of magnitude longer than expected from the FPOP literature. We demonstrate that the glutamine scavenger generates metastable secondary radicals in the FPOP solution, and that these radicals lengthen the time frame of Cy5 oxidation. Cy5 and similar dyes are widely used for monitoring the radical dose experienced by proteins in solution. The measured Cy5 kinetics thus strongly suggest that protein oxidation in FPOP extends over a much longer time window than previously thought (i.e., many milliseconds instead of one microsecond). The optical approach developed here should be suitable for assessing the performance of future FPOP-like techniques with improved temporal labeling characteristics.

Transition-metal chromophore as a new, sensitive spectroscopic tag for proteins. Selective covalent labeling of histidine residues in cytochromes c with chloro(2,2':6',2''-terpyridine)platinum(II) chloride

DOE Office of Scientific and Technical Information (OSTI.GOV)

Ratilla, E.M.A.; Brothers, H.M. II; Kostic, N.M.

1987-07-22

Reactivity and selectivity of Pt(trpy)Cl/sup +/ toward proteins are studied with cytochromes c from horse and tuna as examples. The new transition-metal reagent is specific for histidine residues at pH 5. The reaction, facile one-step displacement of the Cl/sup -/ ligand by imidazole, produces good yield. The binding sites, His 26 and His 33 in the horse protein and His 26 in the tuna protein, are identified by UV-vis spectrophotometry and by peptide-mapping experiments. Model complexes with imidazole, histidine, histidine derivatives, and histidine-containing peptides are prepared and characterized. The covalently attached Pt(trpy)/sup 2 +/ labels allow easy separation of themore » protein derivatives by cation-exchange chromatography. The labels do not perturb the conformation and reduction potential of cytochrome c, as shown by UV-vis spectrophotometry, cyclic voltammetry, differential-pulse voltammetry, EPR spectroscopy, and /sup 1/H NMR spectroscopy. The selectivity of Pt(trpy)Cl/sup +/ is entirely opposite from that of PtCl/sub 4//sup 2 -/ although both of them are platinum(II)-chloro complexes. Owing to an interplay between the steric and electronic effects of the terpyridyl ligand, the new reagent is unreactive toward methionine (a thio ether) and cystine (a disulfide), which are otherwise highly nucleophilic ligands, but very reactive toward imidazole, which is otherwise a relatively weak ligand. Unusual and useful selectivity of preformed transition-metal complexes toward proteins evidently can be achieved by a judicious choice of ancillary ligands.« less

Root-derived carbon and nitrogen from beech and ash trees differentially fuel soil animal food webs of deciduous forests.

PubMed

Zieger, Sarah L; Ammerschubert, Silke; Polle, Andrea; Scheu, Stefan

2017-01-01

Evidence is increasing that soil animal food webs are fueled by root-derived carbon (C) and also by root-derived nitrogen (N). Functioning as link between the above- and belowground system, trees and their species identity are important drivers structuring soil animal communities. A pulse labeling experiment using 15N and 13C was conducted by exposing beech (Fagus sylvatica) and ash (Fraxinus excelsior) seedlings to 13CO2 enriched atmosphere and tree leaves to 15N ammonium chloride solution in a plant growth chamber under controlled conditions for 72 h. C and N fluxes into the soil animal food web of beech, associated with ectomycorrhizal fungi (EMF), and ash, associated with arbuscular mycorrhizal fungi (AMF), were investigated at two sampling dates (5 and 20 days after labeling). All of the soil animal taxa studied incorporated root-derived C, while root-derived N was only incorporated into certain taxa. Tree species identity strongly affected C and N incorporation with the incorporation in the beech rhizosphere generally exceeding that in the ash rhizosphere. Incorporation differed little between 5 and 20 days after labeling indicating that both C and N are incorporated quickly into soil animals and are used for tissue formation. Our results suggest that energy and nutrient fluxes in soil food webs depend on the identity of tree species with the differences being associated with different types of mycorrhiza. Further research is needed to prove the generality of these findings and to quantify the flux of plant C and N into soil food webs of forests and other terrestrial ecosystems.

HF coherent backscatter in the ionosphere: In situ measurements of SuperDARN backscatter with e-POP RRI

NASA Astrophysics Data System (ADS)

Perry, G. W.; James, H. G.; Hussey, G. C.; Howarth, A. D.; Yau, A. W.

2017-12-01

We report in situ polarimetry measurements of HF scattering obtained by the Enhanced Polar Outflow Probe (e-POP) Radio Receiver Instrument (RRI) during a coherent backscatter scattering event detected by the Saskatoon Super Dual Auroral Radar Network (SuperDARN). On April 1, 2015, e-POP conducted a 4 minute coordinated experiment with SuperDARN Saskatoon, starting at 3:38:44 UT (21:38:44 LT). Throughout the experiment, SuperDARN was transmitting at 17.5 MHz and e-POP's ground track moved in a northeastward direction, along SuperDARN's field-of-view, increasing in altitude from 331 to 352 km. RRI was tuned to 17.505 MHz, and recorded nearly 12,000 SuperDARN radar pulses during the experiment. In the first half of the experiment, radar pulses recorded by RRI were "well behaved": they retained their transmitted amplitude envelope, and their pulse-to-pulse polarization characteristics were coherent - Faraday rotation was easily measured. During the second half of the experiment the pulses showed clear signs of scattering: their amplitude envelopes became degraded and dispersed, and their pulse-to-pulse polarization characteristics became incoherent - Faraday rotation was difficult to quantify. While these pulses were being received by RRI, SuperDARN Saskatoon detected a latitudinal band of coherent backscatter at e-POP's location, indicating that the scattered pulses measured by RRI may be a signature of HF backscatter. In this presentation, we will outline the polarimetric details of the scattered pulses, and provide an analytic interpretation of RRI's measurements to give new insight into the nature of HF coherent backscatter mechanism taking place in the terrestrial ionosphere.

Optimal Er:YAG laser irradiation parameters for debridement of microstructured fixture surfaces of titanium dental implants.

PubMed

Taniguchi, Yoichi; Aoki, Akira; Mizutani, Koji; Takeuchi, Yasuo; Ichinose, Shizuko; Takasaki, Aristeo Atsushi; Schwarz, Frank; Izumi, Yuichi

2013-07-01

Er:YAG laser (ErL) irradiation has been reported to be effective for treating peri-implant disease. The present study seeks to evaluate morphological and elemental changes induced on microstructured surfaces of dental endosseous implants by high-pulse-repetition-rate ErL irradiation and to determine the optimal irradiation conditions for debriding contaminated microstructured surfaces. In experiment 1, dual acid-etched microstructured implants were irradiated by ErL (pulse energy, 30-50 mJ/pulse; repetition rate, 30 Hz) with and without water spray and for used and unused contact tips. Experiment 2 compared the ErL treatment with conventional mechanical treatments (metal/plastic curettes and ultrasonic scalers). In experiment 3, five commercially available microstructures were irradiated by ErL light (pulse energy, 30-50 mJ/pulse; pulse repetition rate, 30 Hz) while spraying water. In experiment 4, contaminated microstructured surfaces of three failed implants were debrided by ErL irradiation. After the experiments, all treated surfaces were assessed by stereomicroscopy, scanning electron microscopy (SEM), and/or energy-dispersive X-ray spectroscopy (EDS). The stereomicroscopy, SEM, and EDS results demonstrate that, unlike mechanical treatments, ErL irradiation at 30 mJ/pulse and 30 Hz with water spray induced no color or morphological changes to the microstructures except for the anodized implant surface, which was easily damaged. The optimized irradiation parameters effectively removed calcified deposits from contaminated titanium microstructures without causing substantial thermal damage. ErL irradiation at pulse energies below 30 mJ/pulse (10.6 J/cm(2)/pulse) and 30 Hz with water spray in near-contact mode seems to cause no damage and to be effective for debriding microstructured surfaces (except for anodized microstructures).

Solid-state repetitive generator with a gyromagnetic nonlinear transmission line operating as a peak power amplifier

NASA Astrophysics Data System (ADS)

Gusev, A. I.; Pedos, M. S.; Rukin, S. N.; Timoshenkov, S. P.

2017-07-01

In this work, experiments were made in which gyromagnetic nonlinear transmission line (NLTL) operates as a peak power amplifier of the input pulse. At such an operating regime, the duration of the input pulse is close to the period of generated oscillations, and the main part of the input pulse energy is transmitted only to the first peak of the oscillations. Power amplification is achieved due to the voltage amplitude of the first peak across the NLTL output exceeding the voltage amplitude of the input pulse. In the experiments, the input pulse with an amplitude of 500 kV and a half-height pulse duration of 7 ns is applied to the NLTL with a natural oscillation frequency of ˜300 MHz. At the output of the NLTL in 40 Ω coaxial transmission line, the pulse amplitude is increased to 740 kV and the pulse duration is reduced to ˜2 ns, which correspond to power amplification of the input pulse from ˜6 to ˜13 GW. As a source of input pulses, a solid-state semiconductor opening switch generator was used, which allowed carrying out experiments at pulse repetition frequency up to 1 kHz in the burst mode of operation.

DOE Office of Scientific and Technical Information (OSTI.GOV)

Friedman, A.; Barnard, J.J.; Briggs, R.J.

The Heavy Ion Fusion Science Virtual National Laboratory (HIFS-VNL), a collaborationof LBNL, LLNL, and PPPL, has achieved 60-fold pulse compression of ion beams on the Neutralized Drift Compression eXperiment (NDCX) at LBNL. In NDCX, a ramped voltage pulse from an induction cell imparts a velocity"tilt" to the beam; the beam's tail then catches up with its head in a plasma environment that provides neutralization. The HIFS-VNL's mission is to carry out studies of Warm Dense Matter (WDM) physics using ion beams as the energy source; an emerging thrust is basic target physics for heavy ion-driven Inertial Fusion Energy (IFE). Thesemore » goals require an improved platform, labeled NDCX-II. Development of NDCX-II at modest cost was recently enabled by the availability of induction cells and associated hardware from the decommissioned Advanced Test Accelerator (ATA) facility at LLNL. Our initial physics design concept accelerates a ~;;30 nC pulse of Li+ ions to ~;;3 MeV, then compresses it to ~;;1 ns while focusing it onto a mm-scale spot. It uses the ATA cells themselves (with waveforms shaped by passive circuits) to impart the final velocity tilt; smart pulsers provide small corrections. The ATA accelerated electrons; acceleration of non-relativistic ions involves more complex beam dynamics both transversely and longitudinally. We are using analysis, an interactive one-dimensional kinetic simulation model, and multidimensional Warp-code simulations to develop the NDCX-II accelerator section. Both LSP and Warp codes are being applied to the beam dynamics in the neutralized drift and final focus regions, and the plasma injection process. The status of this effort is described.« less

2H{ 19F} REDOR for distance measurements in biological solids using a double resonance spectrometer

NASA Astrophysics Data System (ADS)

Grage, Stephan L.; Watts, Jude A.; Watts, Anthony

2004-01-01

A new approach for distance measurements in biological solids employing 2H{ 19F} rotational echo double resonance was developed and validated on 2H, 19F- D-alanine and an imidazopyridine based inhibitor of the gastric H +/K +-ATPase. The 2H- 19F double resonance experiments presented here were performed without 1H decoupling using a double resonance NMR spectrometer. In this way, it was possible to benefit from the relatively longer distance range of fluorine without the need of specialized fluorine equipment. A distance of 2.5 ± 0.3 Å was measured in the alanine derivative, indicating a gauche conformation of the two labels. In the case of the imidazopyridine compound a lower distance limit of 5.2 Å was determined and is in agreement with an extended conformation of the inhibitor. Several REDOR variants were compared, and their advantages and limitations discussed. Composite fluorine dephasing pulses were found to enhance the frequency bandwidth significantly, and to reduce the dependence of the performance of the experiment on the exact choice of the transmitter frequency.

Signal enhancement for the sensitivity-limited solid state NMR experiments using a continuous, non-uniform acquisition scheme

NASA Astrophysics Data System (ADS)

Qiang, Wei

2011-12-01

We describe a sampling scheme for the two-dimensional (2D) solid state NMR experiments, which can be readily applied to the sensitivity-limited samples. The sampling scheme utilizes continuous, non-uniform sampling profile for the indirect dimension, i.e. the acquisition number decreases as a function of the evolution time ( t1) in the indirect dimension. For a beta amyloid (Aβ) fibril sample, we observed overall 40-50% signal enhancement by measuring the cross peak volume, while the cross peak linewidths remained comparable to the linewidths obtained by regular sampling and processing strategies. Both the linear and Gaussian decay functions for the acquisition numbers result in similar percentage of increment in signal. In addition, we demonstrated that this sampling approach can be applied with different dipolar recoupling approaches such as radiofrequency assisted diffusion (RAD) and finite-pulse radio-frequency-driven recoupling (fpRFDR). This sampling scheme is especially suitable for the sensitivity-limited samples which require long signal averaging for each t1 point, for instance the biological membrane proteins where only a small fraction of the sample is isotopically labeled.

Intense laser pulse propagation in capillary discharge plasma channels

DOE Office of Scientific and Technical Information (OSTI.GOV)

Hubbard, R.F.; Moore, C.I.; Sprangle, P.

Optical guiding of intense laser pulses is required for plasma-based accelerator concepts such as the laser wakefield accelerator. Reported experiments have successfully transported intense laser pulses in the hollow plasma column produced by a capillary discharge. The hollow plasma has an index of refraction which peaks on-axis, thus providing optical guiding which overcomes beam expansion due to diffraction. In more recent experiments at Hebrew University, 800 nm wavelength, 0.1 mJ, 100 fs pulses have been guided in {approximately}300 micron radius capillaries over distances as long as 6.6 cm. Simulations of these experiments using a 2-D nonlinear laser propagation model producemore » the expected optical guiding, with the laser pulse radius r{sub L} exhibiting oscillations about the equilibrium value predicted by an analytical envelope equation model. The oscillations are damped at the front of the pulse and grow in amplitude in the back of the pulse. This growth and damping is attributed to finite pulse length effects. Simulations also show that further ionization of the discharge plasma by the laser pulse may hollow the laser pulse and introduce modulations in the spot size. This ionization-defocusing effect is expected to be significant at the high intensities required for accelerator application. Capillary discharge experiments at much higher intensities are in progress on the Naval Research Laboratory T{sup 3} laser, and preliminary results are reported. {copyright} {ital 1999 American Institute of Physics.}« less

Off-label prescribing to children: attitudes and experience of general practitioners

PubMed Central

Ekins-Daukes, Suzie; Helms, Peter J; Taylor, Michael W; McLay, James S

2005-01-01

Aim To identify experience with and attitudes towards paediatric off-label prescribing in primary care. Method A prospective questionnaire survey was sent to a sample of Scottish primary care practices (346 doctors in 80 general practices located throughout Scotland). Results Two hundred and two (58%) completed questionnaires were returned. Over 70% of GPs admitted to being familiar with the concept, and 40% to knowingly prescribing off-label. The most important sources of paediatric prescribing information were the British National Formulary (81%), personal experience (71%) and previous prescription notes (45%). The most common reason given by GPs for off-label prescribing was prescribing for a younger age than recommended, although prescribing data confirm that age is the least important and dose the most important reason for such prescribing. When asked to comment upon different causes for off-label prescribing, 80% of respondents expressed appropriate awareness of and concern for the described scenarios. Over 97% of GPs ranked development of paediatric formulations and clearer dosage information more highly than clinical trials as a means to reducing off-label prescribing. Conclusions Despite high levels of off-label prescribing in primary care in the UK, the majority of GPs claimed to be familiar with the concept, although less than half were aware of this common practice. A clear disparity between perceived and actual reasons for off-label prescribing was noted, possibly due to a reliance on personal experience, colleague experience or previous patient prescription notes as a guide to prescribing. PMID:16042667

Revisiting NMR composite pulses for broadband 2H excitation

PubMed Central

Shen, Ming; Roopchand, Rabia; Mananga, Eugene S.; Amoureux, Jean-Paul; Chen, Qun; Boutis, Gregory S.; Hu, Bingwen

2014-01-01

Quadrupolar echo NMR spectroscopy of static solids often requires RF excitation that covers spectral widths exceeding 100 kHz, which is difficult to obtain due to instrumental limitations. In this work we revisit four well-known composite pulses (COM-I, II, III and IV) for broadband excitation in deuterium quadrupolar echo spectroscopy. These composite pulses are combined with several phase cycling schemes that were previously shown to decrease finite pulse width distortions in deuterium solid-echo experiments performed with two single pulses. The simulations and experiments show that COM-II and IV composite pulses combined with an 8-step phase cycling aid in achieving broadband excitation with limited pulse width distortions. PMID:25583576

Intravital imaging by simultaneous label-free autofluorescence-multiharmonic microscopy.

PubMed

You, Sixian; Tu, Haohua; Chaney, Eric J; Sun, Yi; Zhao, Youbo; Bower, Andrew J; Liu, Yuan-Zhi; Marjanovic, Marina; Sinha, Saurabh; Pu, Yang; Boppart, Stephen A

2018-05-29

Intravital microscopy (IVM) emerged and matured as a powerful tool for elucidating pathways in biological processes. Although label-free multiphoton IVM is attractive for its non-perturbative nature, its wide application has been hindered, mostly due to the limited contrast of each imaging modality and the challenge to integrate them. Here we introduce simultaneous label-free autofluorescence-multiharmonic (SLAM) microscopy, a single-excitation source nonlinear imaging platform that uses a custom-designed excitation window at 1110 nm and shaped ultrafast pulses at 10 MHz to enable fast (2-orders-of-magnitude improvement), simultaneous, and efficient acquisition of autofluorescence (FAD and NADH) and second/third harmonic generation from a wide array of cellular and extracellular components (e.g., tumor cells, immune cells, vesicles, and vessels) in living tissue using only 14 mW for extended time-lapse investigations. Our work demonstrates the versatility and efficiency of SLAM microscopy for tracking cellular events in vivo, and is a major enabling advance in label-free IVM.

Selective labelling and eradication of antibiotic-tolerant bacterial populations in Pseudomonas aeruginosa biofilms

PubMed Central

Chua, Song Lin; Yam, Joey Kuok Hoong; Hao, Piliang; Adav, Sunil S.; Salido, May Margarette; Liu, Yang; Givskov, Michael; Sze, Siu Kwan; Tolker-Nielsen, Tim; Yang, Liang

2016-01-01

Drug resistance and tolerance greatly diminish the therapeutic potential of antibiotics against pathogens. Antibiotic tolerance by bacterial biofilms often leads to persistent infections, but its mechanisms are unclear. Here we use a proteomics approach, pulsed stable isotope labelling with amino acids (pulsed-SILAC), to quantify newly expressed proteins in colistin-tolerant subpopulations of Pseudomonas aeruginosa biofilms (colistin is a ‘last-resort' antibiotic against multidrug-resistant Gram-negative pathogens). Migration is essential for the formation of colistin-tolerant biofilm subpopulations, with colistin-tolerant cells using type IV pili to migrate onto the top of the colistin-killed biofilm. The colistin-tolerant cells employ quorum sensing (QS) to initiate the formation of new colistin-tolerant subpopulations, highlighting multicellular behaviour in antibiotic tolerance development. The macrolide erythromycin, which has been previously shown to inhibit the motility and QS of P. aeruginosa, boosts biofilm eradication by colistin. Our work provides insights on the mechanisms underlying the formation of antibiotic-tolerant populations in bacterial biofilms and indicates research avenues for designing more efficient treatments against biofilm-associated infections. PMID:26892159

Identification of peripheral vessels in oral and maxillofacial regions on magnetic resonance angiography obtained using a balanced steady-state free-precession sequence with a time-spatial labeling inversion pulse and using fresh blood imaging.

PubMed

Oda, Masafumi; Tanaka, Tatsurou; Yamashita, Yoshihiro; Kito, Shinji; Wakasugi-Sato, Nao; Matsumoto-Takeda, Shinobu; Nishimura, Shun; Habu, Manabu; Kodama, Masaaki; Uehara, Masataka; Kaneuji, Tsuyoshi; Kokuryo, Shinya; Miyamoto, Ikuya; Yoshiga, Daigo; Seta, Yuji; Tominaga, Kazuhiro; Yoshioka, Izumi; Morimoto, Yasuhiro

2013-12-01

To elucidate the characteristics of visualizing thin main peripheral vessels in oral and maxillofacial regions of 3-dimensional magnetic resonance angiography (MRA) using a balanced steady-state free-precession (SSFP) sequence with a time-spatial labeling inversion pulse (time-SLIP) and using fresh blood imaging (FBI). The conspicuity of blood vessels and the characteristics on MRA using SSFP with a time-SLIP was compared with those on MRA using FBI in 20 healthy participants. The conspicuity of the main peripheral arteries was significantly higher on MRA using SSFP with a time-SLIP than on MRA using FBI. MRA scans using SSFP were obtained in all participants, and scans using FBI were obtained in 16 of 20 participants. An electrocardiogram was unnecessary when using SSFP but was necessary when using FBI. MRA obtained using SSFP with a time-SLIP is a useful technique to visualize thin main peripheral arteries in the oral and maxillofacial regions without contrast medium. Copyright © 2013 Elsevier Inc. All rights reserved.

Protein Folding—How and Why: By Hydrogen Exchange, Fragment Separation, and Mass Spectrometry

PubMed Central

Englander, S. Walter; Mayne, Leland; Kan, Zhong-Yuan; Hu, Wenbing

2017-01-01

Advanced hydrogen exchange (HX) methodology can now determine the structure of protein folding intermediates and their progression in folding pathways. Key developments over time include the HX pulse labeling method with nuclear magnetic resonance analysis, development of the fragment separation method, the addition to it of mass spectrometric (MS) analysis, and recent improvements in the HX MS technique and data analysis. Also, the discovery of protein foldons and their role supplies an essential interpretive link. Recent work using HX pulse labeling with HX MS analysis finds that a number of proteins fold by stepping through a reproducible sequence of native-like intermediates in an ordered pathway. The stepwise nature of the pathway is dictated by the cooperative foldon unit construction of the protein. The pathway order is determined by a sequential stabilization principle; prior native-like structure guides the formation of adjacent native-like structure. This view does not match the funneled energy landscape paradigm of a very large number of folding tracks, which was framed before foldons were known. PMID:27145881

Lesion-induced DNA weak structural changes detected by pulsed EPR spectroscopy combined with site-directed spin labelling.

PubMed

Sicoli, Giuseppe; Mathis, Gérald; Aci-Sèche, Samia; Saint-Pierre, Christine; Boulard, Yves; Gasparutto, Didier; Gambarelli, Serge

2009-06-01

Double electron-electron resonance (DEER) was applied to determine nanometre spin-spin distances on DNA duplexes that contain selected structural alterations. The present approach to evaluate the structural features of DNA damages is thus related to the interspin distance changes, as well as to the flexibility of the overall structure deduced from the distance distribution. A set of site-directed nitroxide-labelled double-stranded DNA fragments containing defined lesions, namely an 8-oxoguanine, an abasic site or abasic site analogues, a nick, a gap and a bulge structure were prepared and then analysed by the DEER spectroscopic technique. New insights into the application of 4-pulse DEER sequence are also provided, in particular with respect to the spin probes' positions and the rigidity of selected systems. The lesion-induced conformational changes observed, which were supported by molecular dynamics studies, confirm the results obtained by other, more conventional, spectroscopic techniques. Thus, the experimental approaches described herein provide an efficient method for probing lesion-induced structural changes of nucleic acids.

Selective labelling and eradication of antibiotic-tolerant bacterial populations in Pseudomonas aeruginosa biofilms.

PubMed

Chua, Song Lin; Yam, Joey Kuok Hoong; Hao, Piliang; Adav, Sunil S; Salido, May Margarette; Liu, Yang; Givskov, Michael; Sze, Siu Kwan; Tolker-Nielsen, Tim; Yang, Liang

2016-02-19

Drug resistance and tolerance greatly diminish the therapeutic potential of antibiotics against pathogens. Antibiotic tolerance by bacterial biofilms often leads to persistent infections, but its mechanisms are unclear. Here we use a proteomics approach, pulsed stable isotope labelling with amino acids (pulsed-SILAC), to quantify newly expressed proteins in colistin-tolerant subpopulations of Pseudomonas aeruginosa biofilms (colistin is a 'last-resort' antibiotic against multidrug-resistant Gram-negative pathogens). Migration is essential for the formation of colistin-tolerant biofilm subpopulations, with colistin-tolerant cells using type IV pili to migrate onto the top of the colistin-killed biofilm. The colistin-tolerant cells employ quorum sensing (QS) to initiate the formation of new colistin-tolerant subpopulations, highlighting multicellular behaviour in antibiotic tolerance development. The macrolide erythromycin, which has been previously shown to inhibit the motility and QS of P. aeruginosa, boosts biofilm eradication by colistin. Our work provides insights on the mechanisms underlying the formation of antibiotic-tolerant populations in bacterial biofilms and indicates research avenues for designing more efficient treatments against biofilm-associated infections.

A fast data acquisition system for the study of transient events by high repetition rate time-of-flight mass spectrometry

NASA Technical Reports Server (NTRS)

Lincoln, K. A.; Bechtel, R. D.

1986-01-01

Recent advances in commercially available data acquisition electronics embodying high speed A/D conversion coupled to increased memory storage have now made practical (at least within time intervals of a third of a millisecond or more) the capturing of all of the data generated by a high repetition rate time-of-flight mass spectrometer producing complete spectra every 25 to 35 microseconds. Such a system was assembled and interfaced with a personal computer for control and management of data. The applications are described for recording time-resolved spectra of individual vapor plumes induced from the pulsed-laser heating of material. Each laser pulse triggers the system to generate automatically a 3-dimensional (3-D) presentation of the time-resolved spectra with m/z labeling of the major mass peaks, plus an intensity versus time display of both the laser pulse and the resulting vapor pulse. The software also permits storing of data and its presentation in various additional forms.

Identification of Gustatory–Olfactory Flavor Mixtures: Effects of Linguistic Labeling

PubMed Central

2013-01-01

Two experiments, using different ranges and numbers of stimuli, examined how linguistic labels affect the identification of flavor mixtures containing different proportions of sucrose (gustatory flavorant) and citral (olfactory flavorant). Both experiments asked subjects to identify each stimulus as having either “mostly sugar” or “mostly citrus.” In one condition, no labels preceded the flavor stimuli. In another condition, each flavor stimulus followed a label, either SUGAR or CITRUS, which, the subjects were informed, usually though not always named the stronger flavor component; that is, the labels were probabilistically valid. The results of both experiments showed that the labels systematically modified the identification responses: Subjects responded “sugar” or “citrus” more often when the flavor stimulus followed the corresponding label, SUGAR or CITRUS. But the labels hardly affected overall accuracy of identification. Accuracy was possibly limited, however, by both the confusability of the flavor stimuli per se and the way that confusability could limit the opportunity to discern the probabilistic associations between labels and individual flavor stimuli. We describe the results in terms of a decision-theoretic model, in which labels induce shifts in response criteria governing the identification responses, or possibly effect changes in the sensory representations of the flavorants themselves. PMID:23329730

Optimal design of isotope labeling experiments.

PubMed

Yang, Hong; Mandy, Dominic E; Libourel, Igor G L

2014-01-01

Stable isotope labeling experiments (ILE) constitute a powerful methodology for estimating metabolic fluxes. An optimal label design for such an experiment is necessary to maximize the precision with which fluxes can be determined. But often, precision gained in the determination of one flux comes at the expense of the precision of other fluxes, and an appropriate label design therefore foremost depends on the question the investigator wants to address. One could liken ILE to shadows that metabolism casts on products. Optimal label design is the placement of the lamp; creating clear shadows for some parts of metabolism and obscuring others.An optimal isotope label design is influenced by: (1) the network structure; (2) the true flux values; (3) the available label measurements; and, (4) commercially available substrates. The first two aspects are dictated by nature and constrain any optimal design. The second two aspects are suitable design parameters. To create an optimal label design, an explicit optimization criterion needs to be formulated. This usually is a property of the flux covariance matrix, which can be augmented by weighting label substrate cost. An optimal design is found by using such a criterion as an objective function for an optimizer. This chapter uses a simple elementary metabolite units (EMU) representation of the TCA cycle to illustrate the process of experimental design of isotope labeled substrates.

Modelling multi-protein complexes using PELDOR distance measurements for rigid body minimisation experiments using XPLOR-NIH

PubMed Central

Hammond, Colin M.; Owen-Hughes, Tom; Norman, David G.

2014-01-01

Crystallographic and NMR approaches have provided a wealth of structural information about protein domains. However, often these domains are found as components of larger multi domain polypeptides or complexes. Orienting domains within such contexts can provide powerful new insight into their function. The combination of site specific spin labelling and Pulsed Electron Double Resonance (PELDOR) provide a means of obtaining structural measurements that can be used to generate models describing how such domains are oriented. Here we describe a pipeline for modelling the location of thio-reactive nitroxyl spin locations to engineered sties on the histone chaperone Vps75. We then use a combination of experimentally determined measurements and symmetry constraints to model the orientation in which homodimers of Vps75 associate to form homotetramers using the XPLOR-NIH platform. This provides a working example of how PELDOR measurements can be used to generate a structural model. PMID:25448300

Study on the amplifier experiment of end-pumped long pulse slab laser

NASA Astrophysics Data System (ADS)

Jin, Quanwei; Chen, Xiaoming; Jiang, JianFeng; Pang, Yu; Tong, Lixin; Li, Mi; Hu, Hao; Lv, Wenqiang; Gao, Qingsong; Tang, Chun

2018-03-01

The amplifier experiment research of end-pumped long pulse slab laser is developed, the results of out-put energy, optical-optical efficiency and pulse waveform are obtained at different experiment conditions, such as peak pumped power, amplifier power and pumped pulse width. The seed laser is CW fundamental transverse-mode operation fiber laser, the laser medium is composited Nd:YAG slab. Under end-pumped and the 2 passes, the laser obtain 7.65J out-put energy and 43.1% optical-optical efficiency with 45kW peak-pumped power and 386μs pump pulse width. The experimental results provide the basic for the optimization design to high frequency, high energy and high beam-quality slab lasers.

Experiment and theoretical study of the propagation of high power microwave pulse in air breakdown environment

NASA Technical Reports Server (NTRS)

Kuo, S. P.; Ren, A.; Zhang, Y. S.

1991-01-01

In the study of the propagation of high power microwave pulse, one of the main concerns is how to minimize the energy loss of the pulse before reaching the destination. In the very high power region, one has to prevent the cutoff reflection caused by the excessive ionization in the background air. A frequency auto-conversion process which can lead to reflectionless propagation of powerful EM pulses in self-generated plasmas is studied. The theory shows that under the proper conditions the carrier frequency, omega, of the pulse will indeed shift upward with the growth of plasma frequency, omega(sub pe). Thus, the plasma during breakdown will always remain transparent to the pulse (i.e., omega greater than omega(sub pe)). A chamber experiment to demonstrate the frequency auto-conversion during the pulse propagation through the self-generated plasma is then conducted in a chamber. The detected frequency shift is compared with the theoretical result calculated y using the measured electron density distribution along the propagation path of the pulse. Good agreement between the theory and the experiment results is obtained.

Towards pump-probe experiments of defect dynamics with short ion beam pulses

NASA Astrophysics Data System (ADS)

Schenkel, T.; Lidia, S. M.; Weis, C. D.; Waldron, W. L.; Schwartz, J.; Minor, A. M.; Hosemann, P.; Kwan, J. W.

2013-11-01

A novel, induction type linear accelerator, the Neutralized Drift Compression eXperiment (NDCX-II), is currently being commissioned at Berkeley Lab. This accelerator is designed to deliver intense (up to 3 × 1011 ions/pulse), 0.6 to ∼600 ns duration pulses of 0.05-1.2 MeV lithium ions at a rate of about 2 pulses per minute onto 1-10 mm scale target areas. When focused to mm-diameter spots, the beam is predicted to volumetrically heat micrometer thick foils to temperatures of ∼30,000 °K. At lower beam power densities, the short excitation pulse with tunable intensity and time profile enables pump-probe type studies of defect dynamics in a broad range of materials. We briefly describe the accelerator concept and design, present results from beam pulse shaping experiments and discuss examples of pump-probe type studies of defect dynamics following irradiation of materials with intense, short ion beam pulses from NDCX-II.

ALE: automated label extraction from GEO metadata.

PubMed

Giles, Cory B; Brown, Chase A; Ripperger, Michael; Dennis, Zane; Roopnarinesingh, Xiavan; Porter, Hunter; Perz, Aleksandra; Wren, Jonathan D

2017-12-28

NCBI's Gene Expression Omnibus (GEO) is a rich community resource containing millions of gene expression experiments from human, mouse, rat, and other model organisms. However, information about each experiment (metadata) is in the format of an open-ended, non-standardized textual description provided by the depositor. Thus, classification of experiments for meta-analysis by factors such as gender, age of the sample donor, and tissue of origin is not feasible without assigning labels to the experiments. Automated approaches are preferable for this, primarily because of the size and volume of the data to be processed, but also because it ensures standardization and consistency. While some of these labels can be extracted directly from the textual metadata, many of the data available do not contain explicit text informing the researcher about the age and gender of the subjects with the study. To bridge this gap, machine-learning methods can be trained to use the gene expression patterns associated with the text-derived labels to refine label-prediction confidence. Our analysis shows only 26% of metadata text contains information about gender and 21% about age. In order to ameliorate the lack of available labels for these data sets, we first extract labels from the textual metadata for each GEO RNA dataset and evaluate the performance against a gold standard of manually curated labels. We then use machine-learning methods to predict labels, based upon gene expression of the samples and compare this to the text-based method. Here we present an automated method to extract labels for age, gender, and tissue from textual metadata and GEO data using both a heuristic approach as well as machine learning. We show the two methods together improve accuracy of label assignment to GEO samples.

Pulse-chase Analysis of N-linked Sugar Chains from Glycoproteins in Mammalian Cells

PubMed Central

Avezov, Edward; Ron, Efrat; Izenshtein, Yana; Adan, Yosef; Lederkremer, Gerardo Z.

2010-01-01

Attachment of the Glc3Man9GlcNAc2 precursor oligosaccharide to nascent polypeptides in the ER is a common modification for secretory proteins. Although this modification was implicated in several biological processes, additional aspects of its function are emerging, with recent evidence of its role in the production of signals for glycoprotein quality control and trafficking. Thus, phenomena related to N-linked glycans and their processing are being intensively investigated. Methods that have been recently developed for proteomic analysis have greatly improved the characterization of glycoprotein N-linked glycans. Nevertheless, they do not provide insight into the dynamics of the sugar chain processing involved. For this, labeling and pulse-chase analysis protocols are used that are usually complex and give very low yields. We describe here a simple method for the isolation and analysis of metabolically labeled N-linked oligosaccharides. The protocol is based on labeling of cells with [2-3H] mannose, denaturing lysis and enzymatic release of the oligosaccharides from either a specifically immunoprecipitated protein of interest or from the general glycoprotein pool by sequential treatments with endo H and N-glycosidase F, followed by molecular filtration (Amicon). In this method the isolated oligosaccharides serve as an input for HPLC analysis, which allows discrimination between various glycan structures according to the number of monosaccharide units comprising them, with a resolution of a single monosaccharide. Using this method we were able to study high mannose N-linked oligosaccharide profiles of total cell glycoproteins after pulse-chase in normal conditions and under proteasome inhibition. These profiles were compared to those obtained from an immunoprecipitated ER-associated degradation (ERAD) substrate. Our results suggest that most NIH 3T3 cellular glycoproteins are relatively stable and that most of their oligosaccharides are trimmed to Man9-8GlcNAc2. In contrast, unstable ERAD substrates are trimmed to Man6-5GlcNAc2 and glycoproteins bearing these species accumulate upon inhibition of proteasomal degradation. PMID:20424595

Pulse-chase analysis of N-linked sugar chains from glycoproteins in mammalian cells.

PubMed

Avezov, Edward; Ron, Efrat; Izenshtein, Yana; Adan, Yosef; Lederkremer, Gerardo Z

2010-04-27

Attachment of the Glc3Man9GlcNAc2 precursor oligosaccharide to nascent polypeptides in the ER is a common modification for secretory proteins. Although this modification was implicated in several biological processes, additional aspects of its function are emerging, with recent evidence of its role in the production of signals for glycoprotein quality control and trafficking. Thus, phenomena related to N-linked glycans and their processing are being intensively investigated. Methods that have been recently developed for proteomic analysis have greatly improved the characterization of glycoprotein N-linked glycans. Nevertheless, they do not provide insight into the dynamics of the sugar chain processing involved. For this, labeling and pulse-chase analysis protocols are used that are usually complex and give very low yields. We describe here a simple method for the isolation and analysis of metabolically labeled N-linked oligosaccharides. The protocol is based on labeling of cells with [2-(3)H] mannose, denaturing lysis and enzymatic release of the oligosaccharides from either a specifically immunoprecipitated protein of interest or from the general glycoprotein pool by sequential treatments with endo H and N-glycosidase F, followed by molecular filtration (Amicon). In this method the isolated oligosaccharides serve as an input for HPLC analysis, which allows discrimination between various glycan structures according to the number of monosaccharide units comprising them, with a resolution of a single monosaccharide. Using this method we were able to study high mannose N-linked oligosaccharide profiles of total cell glycoproteins after pulse-chase in normal conditions and under proteasome inhibition. These profiles were compared to those obtained from an immunoprecipitated ER-associated degradation (ERAD) substrate. Our results suggest that most NIH 3T3 cellular glycoproteins are relatively stable and that most of their oligosaccharides are trimmed to Man9-8GlcNAc2. In contrast, unstable ERAD substrates are trimmed to Man6-5GlcNAc2 and glycoproteins bearing these species accumulate upon inhibition of proteasomal degradation.

21 CFR 101.108 - Temporary exemptions for purposes of conducting authorized food labeling experiments.

Code of Federal Regulations, 2013 CFR

2013-04-01

... 21 Food and Drugs 2 2013-04-01 2013-04-01 false Temporary exemptions for purposes of conducting authorized food labeling experiments. 101.108 Section 101.108 Food and Drugs FOOD AND DRUG ADMINISTRATION, DEPARTMENT OF HEALTH AND HUMAN SERVICES (CONTINUED) FOOD FOR HUMAN CONSUMPTION FOOD LABELING Exemptions From...

21 CFR 101.108 - Temporary exemptions for purposes of conducting authorized food labeling experiments.

Code of Federal Regulations, 2011 CFR

2011-04-01

... 21 Food and Drugs 2 2011-04-01 2011-04-01 false Temporary exemptions for purposes of conducting authorized food labeling experiments. 101.108 Section 101.108 Food and Drugs FOOD AND DRUG ADMINISTRATION, DEPARTMENT OF HEALTH AND HUMAN SERVICES (CONTINUED) FOOD FOR HUMAN CONSUMPTION FOOD LABELING Exemptions From...

21 CFR 101.108 - Temporary exemptions for purposes of conducting authorized food labeling experiments.

Code of Federal Regulations, 2012 CFR

2012-04-01

... 21 Food and Drugs 2 2012-04-01 2012-04-01 false Temporary exemptions for purposes of conducting authorized food labeling experiments. 101.108 Section 101.108 Food and Drugs FOOD AND DRUG ADMINISTRATION, DEPARTMENT OF HEALTH AND HUMAN SERVICES (CONTINUED) FOOD FOR HUMAN CONSUMPTION FOOD LABELING Exemptions From...

21 CFR 101.108 - Temporary exemptions for purposes of conducting authorized food labeling experiments.

Code of Federal Regulations, 2010 CFR

2010-04-01

... 21 Food and Drugs 2 2010-04-01 2010-04-01 false Temporary exemptions for purposes of conducting authorized food labeling experiments. 101.108 Section 101.108 Food and Drugs FOOD AND DRUG ADMINISTRATION, DEPARTMENT OF HEALTH AND HUMAN SERVICES (CONTINUED) FOOD FOR HUMAN CONSUMPTION FOOD LABELING Exemptions From...

Active cancellation - A means to zero dead-time pulse EPR.

PubMed

Franck, John M; Barnes, Ryan P; Keller, Timothy J; Kaufmann, Thomas; Han, Songi

2015-12-01

The necessary resonator employed in pulse electron paramagnetic resonance (EPR) rings after the excitation pulse and creates a finite detector dead-time that ultimately prevents the detection of signal from fast relaxing spin systems, hindering the application of pulse EPR to room temperature measurements of interesting chemical or biological systems. We employ a recently available high bandwidth arbitrary waveform generator (AWG) to produce a cancellation pulse that precisely destructively interferes with the resonant cavity ring-down. We find that we can faithfully detect EPR signal at all times immediately after, as well as during, the excitation pulse. This is a proof of concept study showcasing the capability of AWG pulses to precisely cancel out the resonator ring-down, and allow for the detection of EPR signal during the pulse itself, as well as the dead-time of the resonator. However, the applicability of this approach to conventional EPR experiments is not immediate, as it hinges on either (1) the availability of low-noise microwave sources and amplifiers to produce the necessary power for pulse EPR experiment or (2) the availability of very high conversion factor micro coil resonators that allow for pulse EPR experiments at modest microwave power. Copyright © 2015 Elsevier Inc. All rights reserved.

A multi-functional high voltage experiment apparatus for vacuum surface flashover switch research.

PubMed

Zeng, Bo; Su, Jian-cang; Cheng, Jie; Wu, Xiao-long; Li, Rui; Zhao, Liang; Fang, Jin-peng; Wang, Li-min

2015-04-01

A multifunctional high voltage apparatus for experimental researches on surface flashover switch and high voltage insulation in vacuum has been developed. The apparatus is composed of five parts: pulse generating unit, axial field unit, radial field unit, and two switch units. Microsecond damped ringing pulse with peak-to-peak voltage 800 kV or unipolar pulse with maximum voltage 830 kV is generated, forming transient axial or radial electrical field. Different pulse waveforms and field distributions make up six experimental configurations in all. Based on this apparatus, preliminary experiments on vacuum surface flashover switch with different flashover dielectric materials have been conducted in the axial field unit, and nanosecond pulse is generated in the radial field unit which makes a pulse transmission line in the experiment. Basic work parameters of this kind of switch such as lifetime, breakdown voltage are obtained.

Practical witness for electronic coherences

DOE Office of Scientific and Technical Information (OSTI.GOV)

Johnson, Allan S.; Department of Physics, Imperial College London, London; Yuen-Zhou, Joel

2014-12-28

The origin of the coherences in two-dimensional spectroscopy of photosynthetic complexes remains disputed. Recently, it has been shown that in the ultrashort-pulse limit, oscillations in a frequency-integrated pump-probe signal correspond exclusively to electronic coherences, and thus such experiments can be used to form a test for electronic vs. vibrational oscillations in such systems. Here, we demonstrate a method for practically implementing such a test, whereby pump-probe signals are taken at several different pulse durations and used to extrapolate to the ultrashort-pulse limit. We present analytic and numerical results determining requirements for pulse durations and the optimal choice of pulse centralmore » frequency, which can be determined from an absorption spectrum. Our results suggest that for numerous systems, the required experiment could be implemented by many ultrafast spectroscopy laboratories using pulses of tens of femtoseconds in duration. Such experiments could resolve the standing debate over the nature of coherences in photosynthetic complexes.« less

Practical witness for electronic coherences.

PubMed

Johnson, Allan S; Yuen-Zhou, Joel; Aspuru-Guzik, Alán; Krich, Jacob J

2014-12-28

The origin of the coherences in two-dimensional spectroscopy of photosynthetic complexes remains disputed. Recently, it has been shown that in the ultrashort-pulse limit, oscillations in a frequency-integrated pump-probe signal correspond exclusively to electronic coherences, and thus such experiments can be used to form a test for electronic vs. vibrational oscillations in such systems. Here, we demonstrate a method for practically implementing such a test, whereby pump-probe signals are taken at several different pulse durations and used to extrapolate to the ultrashort-pulse limit. We present analytic and numerical results determining requirements for pulse durations and the optimal choice of pulse central frequency, which can be determined from an absorption spectrum. Our results suggest that for numerous systems, the required experiment could be implemented by many ultrafast spectroscopy laboratories using pulses of tens of femtoseconds in duration. Such experiments could resolve the standing debate over the nature of coherences in photosynthetic complexes.

Designing dipolar recoupling and decoupling experiments for biological solid-state NMR using interleaved continuous wave and RF pulse irradiation.

PubMed

Bjerring, Morten; Jain, Sheetal; Paaske, Berit; Vinther, Joachim M; Nielsen, Niels Chr

2013-09-17

Rapid developments in solid-state NMR methodology have boosted this technique into a highly versatile tool for structural biology. The invention of increasingly advanced rf pulse sequences that take advantage of better hardware and sample preparation have played an important part in these advances. In the development of these new pulse sequences, researchers have taken advantage of analytical tools, such as average Hamiltonian theory or lately numerical methods based on optimal control theory. In this Account, we focus on the interplay between these strategies in the systematic development of simple pulse sequences that combines continuous wave (CW) irradiation with short pulses to obtain improved rf pulse, recoupling, sampling, and decoupling performance. Our initial work on this problem focused on the challenges associated with the increasing use of fully or partly deuterated proteins to obtain high-resolution, liquid-state-like solid-state NMR spectra. Here we exploit the overwhelming presence of (2)H in such samples as a source of polarization and to gain structural information. The (2)H nuclei possess dominant quadrupolar couplings which complicate even the simplest operations, such as rf pulses and polarization transfer to surrounding nuclei. Using optimal control and easy analytical adaptations, we demonstrate that a series of rotor synchronized short pulses may form the basis for essentially ideal rf pulse performance. Using similar approaches, we design (2)H to (13)C polarization transfer experiments that increase the efficiency by one order of magnitude over standard cross polarization experiments. We demonstrate how we can translate advanced optimal control waveforms into simple interleaved CW and rf pulse methods that form a new cross polarization experiment. This experiment significantly improves (1)H-(15)N and (15)N-(13)C transfers, which are key elements in the vast majority of biological solid-state NMR experiments. In addition, we demonstrate how interleaved sampling of spectra exploiting polarization from (1)H and (2)H nuclei can substantially enhance the sensitivity of such experiments. Finally, we present systematic development of (1)H decoupling methods where CW irradiation of moderate amplitude is interleaved with strong rotor-synchronized refocusing pulses. We show that these sequences remove residual cross terms between dipolar coupling and chemical shielding anisotropy more effectively and improve the spectral resolution over that observed in current state-of-the-art methods.

Stem cell therapy: MRI guidance and monitoring.

PubMed

Kraitchman, Dara L; Gilson, Wesley D; Lorenz, Christine H

2008-02-01

With the recent advances in magnetic resonance (MR) labeling of cellular therapeutics, it is natural that interventional MRI techniques for targeting would be developed. This review provides an overview of the current methods of stem cell labeling and the challenges that are created with respect to interventional MRI administration. In particular, stem cell therapies will require specialized, MR-compatible devices as well as integration of graphical user interfaces with pulse sequences designed for interactive, real-time delivery in many organs. Specific applications that are being developed will be reviewed as well as strategies for future translation to the clinical realm. (Copyright) 2008 Wiley-Liss, Inc.

Formation of nonextractable soil residues: A stable isotope approach

DOE Office of Scientific and Technical Information (OSTI.GOV)

Richnow, H.H.; Eschenback, A.; Mahro, B.

1999-11-01

Stable carbon isotopic measurements were employed to characterize the transformation of a {sup 13}C-labeled polycyclic aromatic hydrocarbon (PAH), anthracene, in a closed soil bioreactor system. The {sup 13}C-label was used to calculate a carbon mass balance including mineralization and the formation of nonextractable soil-bound residues. Similar results were obtained from {sup 13}C-labeled carbon and {sup 14}C-labeled carbon mass balance calculations for separate batch experiments with labeled anthracene. In concentration ranges typical for real PAH-contaminated sites, the sensitivity of the {sup 13}C tracer method meets the requirements of classical radiotracer experiments. Therefore, the authors balancing method based on stable isotope-labeled chemicalsmore » may supplement or substitute radiotracer experiments under many circumstances. One major advantage of using stable isotope-labeled tracers is the possible application in transformation studies where the use of radioactive substances is of environmental concern. The transformation of {sup 13}C-labeled PAH into nonextractable residues clearly depends on the metabolic activity of the soil microflora and occurs during an early phase of biodegradation. Successive contamination of the soil by anthracene leads to a progressive adaptation of the microflora to a complete mineralization of anthracene in the soil. The extent of residue formation is controlled by the capability of the microflora to degrade the contaminant. Results of long-term experiments indicate that nonextractable residues are relatively stable over time.« less

Ultrashort laser pulse driven inverse free electron laser accelerator experiment

DOE Office of Scientific and Technical Information (OSTI.GOV)

Moody, J. T.; Anderson, S. G.; Anderson, G.

In this paper we discuss the ultrashort pulse high gradient Inverse Free Electron laser accelerator experiment carried out at the Lawrence Livermore National Laboratory which demonstrated gra- dients exceeding 200 MV/m using a 4 TW 100 fs long 800 nm Ti:Sa laser pulse. Due to the short laser and electron pulse lengths, synchronization was determined to be one of the main challenges in this experiment. This made necessary the implementation of a single-shot, non destructive, electro-optic sampling based diagnostics to enable time-stamping of each laser accelerator shot with < 100 fs accuracy. The results of this experiment are expected tomore » pave the way towards the development of future GeV-class IFEL accelerators.« less

Ultrashort laser pulse driven inverse free electron laser accelerator experiment

DOE PAGES

Moody, J. T.; Anderson, S. G.; Anderson, G.; ...

2016-02-29

In this paper we discuss the ultrashort pulse high gradient Inverse Free Electron laser accelerator experiment carried out at the Lawrence Livermore National Laboratory which demonstrated gra- dients exceeding 200 MV/m using a 4 TW 100 fs long 800 nm Ti:Sa laser pulse. Due to the short laser and electron pulse lengths, synchronization was determined to be one of the main challenges in this experiment. This made necessary the implementation of a single-shot, non destructive, electro-optic sampling based diagnostics to enable time-stamping of each laser accelerator shot with < 100 fs accuracy. The results of this experiment are expected tomore » pave the way towards the development of future GeV-class IFEL accelerators.« less

A flexible and rapid frequency selective scheme for SRS microscopy

NASA Astrophysics Data System (ADS)

Li, Jingting; Yue, Yuankai; Shih, Wei-Chuan

2017-02-01

Stimulated Raman scattering (SRS) is a label-free imaging technique suitable for studying biological systems. Due to stimulated nature by ultrafast laser pulses, SRS microscopy has the advantage of significantly higher sensitivity but often reduced spectroscopic information. In this paper, we present a newly constructed femtosecond SRS microscope with a high-speed dynamic micromirror device based pulse shaper to achieve flexible and rapid frequency selection within the C-H stretch region near 2800 to 3100 cm-1 with spectral width of 30 cm-1. This technique is applicable to lipid profiling such as cell activity mapping, lipid distribution mapping and distinction among subclasses.

Experiments and PIC simulations on liquid crystal plasma mirrors for pulse contrast enhancement

NASA Astrophysics Data System (ADS)

Cochran, G. E.; Poole, P. L.; Krygier, A.; Foster, P. S.; Scott, G. G.; Wilson, L. A.; Bailey, J.; Bourgeois, N.; Hernandez-Gomez, C.; Heery, R.; Purcell, J.; Neely, D.; Rajeev, P. P.; Freeman, R. R.; Schumacher, D. W.

2016-10-01

High pulse contrast is crucial for performing many experiments on high intensity lasers in order to minimize modification of the target surface by pre-pulse. This is often achieved through the use of solid dielectric plasma mirrors which can limit laser shot rates. Liquid crystal films, originally developed as variable thickness ion acceleration targets, have been demonstrated as effective plasma mirrors for pulse cleaning, reaching peak reflectivities over 70%. These films were used as plasma mirrors in an ion acceleration experiment on the Scarlet laser and the resultant increase in peak proton energy and change in acceleration direction will be discussed. Also presented here are novel 2D3V, LSP particle-in-cell simulations of dielectric plasma mirror operation. By including multiphoton ionization and dimensionality corrections, an excellent match to experiment is obtained over 4 decades in intensity. Analysis of pulse shortening and plasma critical surface behavior in these simulations will be discussed. Formation of thin films at 1.5 Hz will also be presented. Performed with support from the DARPA PULSE program through AMRDEC, from NNSA, and from OSC.

Tracking synthesis and turnover of triacylglycerol in leaves.

PubMed

Tjellström, Henrik; Strawsine, Merissa; Ohlrogge, John B

2015-03-01

Triacylglycerol (TAG), typically represents <1% of leaf glycerolipids but can accumulate under stress and other conditions or if leaves are supplied with fatty acids, or in plants transformed with regulators or enzymes of lipid metabolism. To better understand the metabolism of TAG in leaves, pulse-chase radiolabelling experiments were designed to probe its synthesis and turnover. When Arabidopsis leaves were incubated with [(14)C]lauric acid (12:0), a major initial product was [(14)C]TAG. Thus, despite low steady-state levels, leaves possess substantial TAG biosynthetic capacity. The contributions of diacylglycerol acyltransferase1 and phospholipid:diacylglycerol acyltransferase1 to leaf TAG synthesis were examined by labelling of dgat1 and pdat1 mutants. The dgat1 mutant displayed a major (76%) reduction in [(14)C]TAG accumulation whereas pdat1 TAG labelling was only slightly reduced. Thus, DGAT1 has a principal role in TAG biosynthesis in young leaves. During a 4h chase period, radioactivity in TAG declined 70%, whereas the turnover of [(14)C]acyl chains of phosphatidylcholine (PC) and other polar lipids was much lower. Sixty percent of [(14)C]12:0 was directly incorporated into glycerolipids without modification, whereas 40% was elongated and desaturated to 16:0 and 18:1 by plastids. The unmodified [(14)C]12:0 and the plastid products of [(14)C]12:0 metabolism entered different pathways. Although plastid-modified (14)C-labelled products accumulated in monogalactosyldiacylglycerol, PC, phosphatidylethanolamine, and diacylglcerol (DAG), there was almost no accumulation of [(14)C]16:0 and [(14)C]18:1 in TAG. Because DAG and acyl-CoA are direct precursors of TAG, the differential labelling of polar glycerolipids and TAG by [(14)C]12:0 and its plastid-modified products provides evidence for multiple subcellular pools of both acyl-CoA and DAG. © The Author 2015. Published by Oxford University Press on behalf of the Society for Experimental Biology.

Tracking synthesis and turnover of triacylglycerol in leaves

DOE PAGES

Tjellstrom, Henrik; Strawsine, Merissa; Ohlrogge, John B.

2015-01-21

Triacylglycerol (TAG), typically represents <1% of leaf glycerolipids but can accumulate under stress and other conditions or if leaves are supplied with fatty acids, or in plants transformed with regulators or enzymes of lipid metabolism. To better understand the metabolism of TAG in leaves, pulse-chase radiolabelling experiments were designed to probe its synthesis and turnover. When Arabidopsis leaves were incubated with [ 14C]lauric acid (12:0), a major initial product was [ 14C]TAG. Thus, despite low steady-state levels, leaves possess substantial TAG biosynthetic capacity. The contributions of diacylglycerol acyltransferase1 and phospholipid:diacylglycerol acyltransferase1 to leaf TAG synthesis were examined by labelling ofmore » dgat1 and pdat1 mutants. The dgat1 mutant displayed a major (76%) reduction in [ 14C]TAG accumulation whereas pdat1 TAG labelling was only slightly reduced. Thus, DGAT1 has a principal role in TAG biosynthesis in young leaves. During a 4h chase period, radioactivity in TAG declined 70%, whereas the turnover of [ 14C]acyl chains of phosphatidylcholine (PC) and other polar lipids was much lower. Sixty percent of [ 14C]12:0 was directly incorporated into glycerolipids without modification, whereas 40% was elongated and desaturated to 16:0 and 18:1 by plastids. The unmodified [ 14C]12:0 and the plastid products of [ 14C]12:0 metabolism entered different pathways. Although plastid-modified 14C-labelled products accumulated in monogalactosyldiacylglycerol, PC, phosphatidylethanolamine, and diacylglcerol (DAG), there was almost no accumulation of [ 14C]16:0 and [ 14C]18:1 in TAG. Lastly, because DAG and acyl-CoA are direct precursors of TAG, the differential labelling of polar glycerolipids and TAG by [ 14C]12:0 and its plastid-modified products provides evidence for multiple subcellular pools of both acyl-CoA and DAG.« less

DOE Office of Scientific and Technical Information (OSTI.GOV)

Fischer, Martin C., E-mail: Martin.Fischer@duke.edu; Wilson, Jesse W.; Robles, Francisco E.

Multiphoton microscopy has rapidly gained popularity in biomedical imaging and materials science because of its ability to provide three-dimensional images at high spatial and temporal resolution even in optically scattering environments. Currently the majority of commercial and home-built devices are based on two-photon fluorescence and harmonic generation contrast. These two contrast mechanisms are relatively easy to measure but can access only a limited range of endogenous targets. Recent developments in fast laser pulse generation, pulse shaping, and detection technology have made accessible a wide range of optical contrasts that utilize multiple pulses of different colors. Molecular excitation with multiple pulsesmore » offers a large number of adjustable parameters. For example, in two-pulse pump-probe microscopy, one can vary the wavelength of each excitation pulse, the detection wavelength, the timing between the excitation pulses, and the detection gating window after excitation. Such a large parameter space can provide much greater molecular specificity than existing single-color techniques and allow for structural and functional imaging without the need for exogenous dyes and labels, which might interfere with the system under study. In this review, we provide a tutorial overview, covering principles of pump-probe microscopy and experimental setup, challenges associated with signal detection and data processing, and an overview of applications.« less

Avoiding the side effects of electric current pulse application to electroporated cells in disposable small volume cuvettes assures good cell survival.

PubMed

Grys, Maciej; Madeja, Zbigniew; Korohoda, Włodzimierz

2017-01-01

The harmful side effects of electroporation to cells due to local changes in pH, the appearance of toxic electrode products, temperature increase, and the heterogeneity of the electric field acting on cells in the cuvettes used for electroporation were observed and discussed in several laboratories. If cells are subjected to weak electric fields for prolonged periods, for example in experiments on cell electrophoresis or galvanotaxis the same effects are seen. In these experiments investigators managed to reduce or eliminate the harmful side effects of electric current application. For the experiments, disposable 20 μl cuvettes with two walls made of dialysis membranes were constructed and placed in a locally focused electric field at a considerable distance from the electrodes. Cuvettes were mounted into an apparatus for horizontal electrophoresis and the cells were subjected to direct current electric field (dcEF) pulses from a commercial pulse generator of exponentially declining pulses and from a custom-made generator of double and single rectangular pulses. More than 80% of the electroporated cells survived the dcEF pulses in both systems. Side effects related to electrodes were eliminated in both the flow through the dcEF and in the disposable cuvettes placed in the focused dcEFs. With a disposable cuvette system, we also confirmed the sensitization of cells to a dcEF using procaine by observing the loading of AT2 cells with calceine and using a square pulse generator, applying 50 ms single rectangular pulses. We suggest that the same methods of avoiding the side effects of electric current pulse application as in cell electrophoresis and galvanotaxis should also be used for electroporation. This conclusion was confirmed in our electroporation experiments performed in conditions assuring survival of over 80% of the electroporated cells. If the amplitude, duration, and shape of the dcEF pulse are known, then electroporation does not depend on the type of pulse generator. This knowledge of the characteristics of the pulse assures reproducibility of electroporation experiments using different equipment.

The hamster clock phase-response curve from summerlike light:dark cycles and its role in daily and seasonal timekeeping.

PubMed

Alleva, John J; Alleva, Frederic R

2002-11-01

We address the subject of entrainment of the hamster clock by the day:night cycle in summer when the sun sets after 6 PM and rises before 6 AM (nights < 12 h). Summer day:night cycles were simulated by 6 light:dark (LD) cycles with D < 12 h (summerlike, SLD) ranging from SLD 12.5 h:11.5 h (D, 6:15 PM-5:45 AM) to 18 h:6 h (D, 9 PM-3 AM). These are the near limiting SLDs for constant PM timing (entrainment) of behavioral estrus and wheel running in hamsters. The onset of estrus was observed every 4 d in the same hamsters as a phase marker of their 24 h clock. On the day before an experimental estrus, preceded and followed by control onsets, a dark period was imposed to cover a putative 6 PM-6 AM light-sensitive period (LSP). This was scanned with a light pulse (and periodic 5 sec bell alarms) lasting 5-240 min. Shifts in onset of estrus on the next day were plotted vs. the end of the light pulse for PM times ("dusk") and its onset for AM times ("dawn"). The resulting phase shifts from the six SLDs were similar, permitting their combination into a single phase-response curve (PRC) of 1605 shifts. This SLD composite PRC rose at 10:15 PM, peaked at 2 AM (81 min advanced shift), fell linearly to 5:55 AM, and then abruptly to normal at 6 AM (no shift). Peak shift was unaffected by light pulse duration or intensity, or hamster age. The SLD composite PRC lacked the 6 PM-9 PM curve of delayed shifts present in reported PRCs from LD 12 h:12 h and DD. However, a two-pulse experiment showed that all light from 6 PM to L-off was needed to block (balance) the advancing action of a 5 min morning light pulse, thereby maintaining entrainment. A working hypothesis to explain daily entrainment and seasonal fertility in the golden hamster is illustrated. A nomenclature for labeling the phases of the hamster clock (circadian time) is proposed.

Autofluorescence and non-specific immunofluorescent labeling in frozen bovine intestinal tissue sections: Solutions for multi-color immunofluorescence experiments

USDA-ARS?s Scientific Manuscript database

Autofluorescence and non-specific immunofluorescent labeling are common challenges associated with immunofluorescence experiments. Autofluorescence typically demonstrates a broad emission spectrum, increasing the potential for overlap with experiments that utilize multiple fluorophores. During immun...

Quantitative Measurement of GPCR Endocytosis via Pulse-Chase Covalent Labeling

PubMed Central

Fujishiro, Mitsuhiro; Okamura, Tomohisa; Fujio, Keishi; Okazaki, Hiroaki; Nomura, Seitaro; Takeda, Norifumi; Harada, Mutsuo; Toko, Haruhiro; Takimoto, Eiki; Akazawa, Hiroshi; Morita, Hiroyuki; Suzuki, Jun-ichi; Yamazaki, Tsutomu; Yamamoto, Kazuhiko; Komuro, Issei; Yanagisawa, Masashi

2015-01-01

G protein-coupled receptors (GPCRs) play a critical role in many physiological systems and represent one of the largest families of signal-transducing receptors. The number of GPCRs at the cell surface regulates cellular responsiveness to their cognate ligands, and the number of GPCRs, in turn, is dynamically controlled by receptor endocytosis. Recent studies have demonstrated that GPCR endocytosis, in addition to affecting receptor desensitization and resensitization, contributes to acute G protein-mediated signaling. Thus, endocytic GPCR behavior has a significant impact on various aspects of physiology. In this study, we developed a novel GPCR internalization assay to facilitate characterization of endocytic GPCR behavior. We genetically engineered chimeric GPCRs by fusing HaloTag (a catalytically inactive derivative of a bacterial hydrolase) to the N-terminal end of the receptor (HT-GPCR). HaloTag has the ability to form a stable covalent bond with synthetic HaloTag ligands that contain fluorophores or a high-affinity handle (such as biotin) and the HaloTag reactive linker. We selectively labeled HT-GPCRs at the cell surface with a HaloTag PEG ligand, and this pulse-chase covalent labeling allowed us to directly monitor the relative number of internalized GPCRs after agonist stimulation. Because the endocytic activities of GPCR ligands are not necessarily correlated with their agonistic activities, applying this novel methodology to orphan GPCRs, or even to already characterized GPCRs, will increase the likelihood of identifying currently unknown ligands that have been missed by conventional pharmacological assays. PMID:26020647

The virion N protein of infectious bronchitis virus is more phosphorylated than the N protein from infected cell lysates

DOE Office of Scientific and Technical Information (OSTI.GOV)

Jayaram, Jyothi; Department of Biology, Texas A and M University, College Station, TX 77843-3258; Youn, Soonjeon

Because phosphorylation of the infectious bronchitis virus (IBV) nucleocapsid protein (N) may regulate its multiple roles in viral replication, the dynamics of N phosphorylation were examined. {sup 32}P-orthophosphate labeling and Western blot analyses confirmed that N was the only viral protein that was phosphorylated. Pulse labeling with {sup 32}P-orthophosphate indicated that the IBV N protein was phosphorylated in the virion, as well as at all times during infection in either chicken embryo kidney cells or Vero cells. Pulse-chase analyses followed by immunoprecipitation of IBV N proteins using rabbit anti-IBV N polyclonal antibody demonstrated that the phosphate on the N proteinmore » was stable for at least 1 h. Simultaneous labeling with {sup 32}P-orthophosphate and {sup 3}H-leucine identified a 3.5-fold increase in the {sup 32}P:{sup 3}H counts per minute (cpm) ratio of N in the virion as compared to the {sup 32}P:{sup 3}H cpm ratio of N in the cell lysates from chicken embryo kidney cells, whereas in Vero cells the {sup 32}P:{sup 3}H cpm ratio of N from the virion was 10.5-fold greater than the {sup 32}P:{sup 3}H cpm ratio of N from the cell lysates. These studies are consistent with the phosphorylation of the IBV N playing a role in assembly or maturation of the viral particle.« less

In Silico Labeling: Predicting Fluorescent Labels in Unlabeled Images.

PubMed

Christiansen, Eric M; Yang, Samuel J; Ando, D Michael; Javaherian, Ashkan; Skibinski, Gaia; Lipnick, Scott; Mount, Elliot; O'Neil, Alison; Shah, Kevan; Lee, Alicia K; Goyal, Piyush; Fedus, William; Poplin, Ryan; Esteva, Andre; Berndl, Marc; Rubin, Lee L; Nelson, Philip; Finkbeiner, Steven

2018-04-19

Microscopy is a central method in life sciences. Many popular methods, such as antibody labeling, are used to add physical fluorescent labels to specific cellular constituents. However, these approaches have significant drawbacks, including inconsistency; limitations in the number of simultaneous labels because of spectral overlap; and necessary perturbations of the experiment, such as fixing the cells, to generate the measurement. Here, we show that a computational machine-learning approach, which we call "in silico labeling" (ISL), reliably predicts some fluorescent labels from transmitted-light images of unlabeled fixed or live biological samples. ISL predicts a range of labels, such as those for nuclei, cell type (e.g., neural), and cell state (e.g., cell death). Because prediction happens in silico, the method is consistent, is not limited by spectral overlap, and does not disturb the experiment. ISL generates biological measurements that would otherwise be problematic or impossible to acquire. Copyright © 2018 Elsevier Inc. All rights reserved.

DiOlistic Labeling of Neurons in Tissue Slices: A Qualitative and Quantitative Analysis of Methodological Variations.

PubMed

Staffend, Nancy A; Meisel, Robert L

2011-01-01

Fine neuronal morphology, such as dendritic spines, classically has been studied using the Golgi technique; however, Golgi staining is difficult to combine with other histological techniques. With the increasing popularity of fluorescent imaging, a number of fluorescent dyes have been developed that enable the coupling of multiple fluorescent labels in a single preparation. These fluorescent dyes include the lipophilic dialkylcarbocyanine, DiI; traditionally used for anterograde and retrograde neuronal tracing. More recently, DiI labeling has been used in combination with the Gene Gun for "DiOlistic" labeling of neurons in slice preparations. DiI sequesters itself within and diffuses laterally along the neuronal membrane, however once the cell is permeabilized, the DiI begins to leak from the cell membrane. A DiI derivative, Cell Tracker™ CM-DiI, increases dye stability and labeling half-life in permeabilized tissue, however at much greater expense. Here, the DiI and CM-DiI DiOlistic labeling techniques were tested in side-by-side experiments evaluating dye stability within dendritic architecture in medium spiny neurons of the dorsal stratum in both non-permeabilized and permeabilized tissue sections. In tissue sections that were not permeabilized, spine density in DiI labeled sections was higher than in CM-DiI labeling. In contrast, tissue sections that were permeabilized had higher spine densities in CM-DiI labeled neurons. These results suggest that for experiments involving non-permeabilized tissue, traditional DiI will suffice, however for experiments involving permeabilized tissue CM-DiI provides more consistent data. These experiments provide the first quantitative analyses of the impact of methodological permutations on neuronal labeling with DiI.

Hadronic vs. electromagnetic pulse shape discrimination in CsI(Tl) for high energy physics experiments

NASA Astrophysics Data System (ADS)

Longo, S.; Roney, J. M.

2018-03-01

Pulse shape discrimination using CsI(Tl) scintillators to perform neutral hadron particle identification is explored with emphasis towards application at high energy electron-positron collider experiments. Through the analysis of the pulse shape differences between scintillation pulses from photon and hadronic energy deposits using neutron and proton data collected at TRIUMF, it is shown that the pulse shape variations observed for hadrons can be modelled using a third scintillation component for CsI(Tl), in addition to the standard fast and slow components. Techniques for computing the hadronic pulse amplitudes and shape variations are developed and it is shown that the intensity of the additional scintillation component can be computed from the ionization energy loss of the interacting particles. These pulse modelling and simulation methods are integrated with GEANT4 simulation libraries and the predicted pulse shape for CsI(Tl) crystals in a 5 × 5 array of 5 × 5 × 30 cm3 crystals is studied for hadronic showers from 0.5 and 1 GeV/c KL0 and neutron particles. Using a crystal level and cluster level approach for photon vs. hadron cluster separation we demonstrate proof-of-concept for neutral hadron detection using CsI(Tl) pulse shape discrimination in high energy electron-positron collider experiments.

Production of pulsed ultra slow muons and first /μSR experiments on thin metallic and magnetic films

NASA Astrophysics Data System (ADS)

Träger, K.; Breitrück, A.; Trigo, M. Diaz; Grossmann, A.; Jungmann, K.; Merkel, J.; Meyer, V.; Neumayer, P.; Pachl, B.; zu Putlitz, G.; Santra, R.; William, L.; Allodi, G.; Bucci, C.; Renzi, R. De; Galli, F.; Guidi, G.; Shiroka, T.; Eaton, G. H.; King, P. J. C.; Scott, C. A.; Williams, G. W.; Roduner, E.; Scheuermann, R.; Charlton, M. C.; Donnelly, P.; Pareti, L.; Turilli, G.

2000-08-01

At ISIS, RAL (UK) we have produced a pulsed ultra-slow muon beam (E≲20 eV) and performed the first μSR experiments. Thanks to the pulsed feature, the implantation time is automatically determined and, by adjusting the final muon energy between ∼8 keV and 20 eV, depth slicing experiments are possible down to monolayers distances. We report slicing experiments across a 20 nm copper film on quartz substrate with evidence for a 2 nm copper oxide surface layer. A preliminary experiment on a hexagonal cobalt film suggests the existence of muon precession in the local magnetic field.

The effects of humor on memory for non-sensical pictures.

PubMed

Takahashi, Masanobu; Inoue, Tomoyoshi

2009-09-01

Two experiments investigated the effects of humor on memory for non-sensical pictures. Each picture was given three labels that differed in the degree of humor: high, low, and no humor labels. In Experiment 1, the humor of the picture labels was manipulated between participants. Participants were shown 30 pictures for 10s each and were asked to rate the degree of humor of each picture. After the rating task, participants were asked to draw the pictures in an unexpected memory test. Performance in the memory test was best in the high humor label group, followed by the low and the no humor label groups. In Experiment 2, intention to learn (incidental versus intentional encoding tasks) as well as humor label was manipulated between the participants. In the incidental learning condition, the high humor group performed better than the low humor group, but in the intentional learning condition, there was no humor effect. The effects of humor on picture memory were discussed in terms of appraisal processing within a distinctiveness framework.

The effects of nutrition labeling on consumer food choice: a psychological experiment and computational model.

PubMed

Helfer, Peter; Shultz, Thomas R

2014-12-01

The widespread availability of calorie-dense food is believed to be a contributing cause of an epidemic of obesity and associated diseases throughout the world. One possible countermeasure is to empower consumers to make healthier food choices with useful nutrition labeling. An important part of this endeavor is to determine the usability of existing and proposed labeling schemes. Here, we report an experiment on how four different labeling schemes affect the speed and nutritional value of food choices. We then apply decision field theory, a leading computational model of human decision making, to simulate the experimental results. The psychology experiment shows that quantitative, single-attribute labeling schemes have greater usability than multiattribute and binary ones, and that they remain effective under moderate time pressure. The computational model simulates these psychological results and provides explanatory insights into them. This work shows how experimental psychology and computational modeling can contribute to the evaluation and improvement of nutrition-labeling schemes. © 2014 New York Academy of Sciences.

DOE Office of Scientific and Technical Information (OSTI.GOV)

Cammarata, Marco; Eybert, Laurent; Ewald, Friederike

A chopper system for time resolved pump-probe experiments with x-ray beams from a synchrotron is described. The system has three parts: a water-cooled heatload chopper, a high-speed chopper, and a millisecond shutter. The chopper system, which is installed in beamline ID09B at the European Synchrotron Radiation Facility, provides short x-ray pulses for pump-probe experiments with ultrafast lasers. The chopper system can produce x-ray pulses as short as 200 ns in a continuous beam and repeat at frequencies from 0 to 3 kHz. For bunch filling patterns of the synchrotron with pulse separations greater than 100 ns, the high-speed chopper canmore » isolate single 100 ps x-ray pulses that are used for the highest time resolution. A new rotor in the high-speed chopper is presented with a single pulse (100 ps) and long pulse (10 {mu}s) option. In white beam experiments, the heatload of the (noncooled) high-speed chopper is lowered by a heatload chopper, which absorbs 95% of the incoming power without affecting the pulses selected by the high speed chopper.« less

Single-organelle tracking by two-photon conversion

NASA Astrophysics Data System (ADS)

Watanabe, Wataru; Shimada, Tomoko; Matsunaga, Sachihiro; Kurihara, Daisuke; Fukui, Kiichi; Shin-Ichi Arimura, Shin-Ichi; Tsutsumi, Nobuhiro; Isobe, Keisuke; Itoh, Kazuyoshi

2007-03-01

Spatial and temporal information about intracellular objects and their dynamics within a living cell are essential for dynamic analysis of such objects in cell biology. A specific intracellular object can be discriminated by photoactivatable fluorescent proteins that exhibit pronounced light-induced spectral changes. Here, we report on selective labeling and tracking of a single organelle by using two-photon conversion of a photoconvertible fluorescent protein with near-infrared femtosecond laser pulses. We performed selective labeling of a single mitochondrion in a living tobacco BY-2 cell using two-photon photoconversion of Kaede. Using this technique, we demonstrated that, in plants, the directed movement of individual mitochondria along the cytoskeletons was mediated by actin filaments, whereas microtubules were not required for the movement of mitochondria. This single-organelle labeling technique enabled us to track the dynamics of a single organelle, revealing the mechanisms involved in organelle dynamics. The technique has potential application in direct tracking of selective cellular and intracellular structures.

Radiation-induced insulator discharge pulses in the CRRES internal discharge monitor satellite experiment

NASA Technical Reports Server (NTRS)

Frederickson, A. R.; Mullen, E. G.; Brautigam, D. H.; Kerns, K. J.

1992-01-01

The Internal Discharge Monitor (IDM) was designed to observe electrical pulses from common electrical insulators in space service. The sixteen insulator samples included twelve planar printed circuit boards and four cables. The samples were fully enclosed, mutually isolated, and space radiation penetrated 0.02 cm of aluminum before striking the samples. Pulsing began on the seventh orbit, the maximum pulse rate occurred on the seventeenth orbit when 13 pulses occurred, and the pulses slowly diminished to about one per 3 orbits six months later. After 8 months, the radiation belts abruptly increased and the pulse rates attained a new high. These pulse rates were in agreement with laboratory experience on shorter time scales. Several of the samples never pulsed. If the pulses were not confined within IDM, the physical processes could spread to become a full spacecraft anomaly. The IDM results indicate the rate at which small insulator pulses occur. Small pulses are the seeds of larger satellite electrical anomalies. The pulse rates are compared with space radiation intensities, L shell location, and spectral distributions from the radiation spectrometers on the Combined Release and Radiation Effects Satellite.

Use of indigenous cultural idioms by Chinese immigrant relatives for psychosis: impacts on stigma and psychoeducational approaches.

PubMed

Yang, Lawrence H; Singla, Daisy R

2011-11-01

Indigenous interpretations of mental illness might negatively impact treatment adherence. However, psychiatric "labeling" potentially leads to stigma among Chinese groups, thus encouraging the use of indigenous idioms. We examined how relatives' use of indigenous labeling varied with the consumers' experience of illness and whether indigenous labeling protected relatives from internalized and experienced forms of stigma. Forty-nine relatives of Chinese-immigrant consumers with psychosis were sampled. Although consumers had progressed to the middle stages of psychosis, 39% of relatives used indigenous idioms to label psychosis. Indigenous labeling decreased when illness duration increased and when visual hallucinations were present. Indigenous labeling further predicted lower internalized stigma among relatives. Relatives who used indigenous labeling also reported fewer indirect stigma experiences, although not after controlling for illness severity. The frequency of direct discrimination among relatives did not differ by labeling. These forms of felt stigma might be embedded into relatives' psychoeducation programs to mitigate adverse consequences of psychiatric labeling.

Extremely High Peak Power Obtained at 29 GHZ Microwave Pulse Generation

NASA Astrophysics Data System (ADS)

Rostov, V. V.; Gunin, A. V.; Romanchenko, I. V.; Pedos, M. S.; Rukin, S. N.; Sharypov, K. A.; Shunailov, S. A.; Ul'maskulov, M. R.; Yalandin, M. I.

2017-12-01

The paper presents research results on enhancing the peak power of microwave pulses with sub- and nanosecond length using a backward-wave oscillator (BWO) operating at 29 GHz frequency and possessing a reproducible phase structure. Experiments are conducted in two modes on a high-current electron accelerator with the required electron beam power. In the first (superradiation) mode, which utilizes the elongated slow-wave structure, the BWO peak power is 3 GW at 180 ns pulse duration (full width at halfmaximum, FWHM). In the second (quasi-stationary) mode, the BWO peak power reaches 600 MW at 2 ns pulse duration (FWHM). The phase spread from pulse to pulse can vary from units to several tens of percent in a nanosecond pulse mode. The experiments do not show any influence of microwave breakdown on the BWO power generation and radiation pulse duration.

Polarization transfer NMR imaging

DOEpatents

Sillerud, Laurel O.; van Hulsteyn, David B.

1990-01-01

A nuclear magnetic resonance (NMR) image is obtained with spatial information modulated by chemical information. The modulation is obtained through polarization transfer from a first element representing the desired chemical, or functional, information, which is covalently bonded and spin-spin coupled with a second element effective to provide the imaging data. First and second rf pulses are provided at first and second frequencies for exciting the imaging and functional elements, with imaging gradients applied therebetween to spatially separate the nuclei response for imaging. The second rf pulse is applied at a time after the first pulse which is the inverse of the spin coupling constant to select the transfer element nuclei which are spin coupled to the functional element nuclei for imaging. In a particular application, compounds such as glucose, lactate, or lactose, can be labeled with .sup.13 C and metabolic processes involving the compounds can be imaged with the sensitivity of .sup.1 H and the selectivity of .sup.13 C.

Enhancing the Linear Dynamic Range in Multi-Channel Single Photon Detector beyond 7OD

PubMed Central

Gudkov, Dmytro; Gudkov, George; Gorbovitski, Boris; Gorfinkel, Vera

2015-01-01

We present design, implementation, and characterization of a single photon detector based on 32-channel PMT sensor [model H7260-20, Hamamatsu]. The developed high speed electronics enables the photon counting with linear dynamic range (LDR) up to 108count/s per detector's channel. The experimental characterization and Monte-Carlo simulations showed that in the single photon counting mode the LDR of the PMT sensor is limited by (i) “photon” pulse width (current pulse) of 900ps and (ii) substantial decrease of amplitudes of current pulses for count rates exceeding 108 count/s. The multi-channel architecture of the detector and the developed firm/software allow further expansion of the dynamic range of the device by 32-fold by using appropriate beam shaping. The developed single photon counting detector was tested for the detection of fluorescence labeled microbeads in capillary flow. PMID:27087788

Idiopathic scoliosis, growth zones, magnetic therapy.

PubMed

Arsenev, A; Dudin, M; Lednev, V; Belova, N; Mikhailov, V; Sokolov, G

2012-01-01

The study has been performed to investigate the influence of pulsed magnetic field on the bone growth plates to get new grounds of magneto therapy in AIS treatment. Were used methods of "strong" and "weak" pulsed magnetic fields influence. Application of pulsed magnetic field causes an authentic inhibition of chondrocytes' active proliferation processes, decreases the index of labeled nuclei, indicating the suppression of DNA synthesis, takes place an increase in the unit weight of the more "mature" differentiated chondrocytes. The final result of these effects is the accelerated synostosis of bones' growth plates. Regardless of the reasons that cause growth infringements, the operating organ in the chain is the body's growth plate. Therefore, the appliance of magnetic fields in AIS treatment can be considered as a perspective one concerning growth plates' functional activity local management. To our point of view, the potential of magneto therapy methods in child's orthopedic treatment is significantly higher compared with modern practice.

Absorption of subcutaneously infused insulin: influence of the basal rate pulse interval.

PubMed

Hildebrandt, P; Birch, K; Jensen, B M; Kühl, C; Brange, J

1985-01-01

Eight insulin-dependent diabetic patients were given two constant infusions (each 1 IU/h) of 125I-labeled insulin into the abdominal subcutaneous tissue for about 12 h. Insulin was infused in pulses into one side of the abdomen in 6-min intervals (by means of an Auto-Syringe pump) and in the other side of the abdomen, insulin was infused in 1-h intervals (by means of a Medix pump). The size of the subcutaneous depots was continuously measured by counting the radioactivity at the infusion sites. After starting the infusions, the two depots were built up to steady-state levels at the same time and of the same size (approximately 3 IU) and with similar absorption rates. Thus, during basal rate insulin infusion, identical insulin absorption kinetics was achieved, irrespective of a 10-fold difference in the pulse rate.

H(C)P and H(P)C triple-resonance experiments at natural abundance employing long-range couplings.

PubMed

Malon, Michal; Koshino, Hiroyuki

2007-09-01

Modified two-dimensional (2D) triple-resonance H(C)P and H(P)C experiments based on INEPT/HMQC and double-INEPT schemes are applied to the study of organophosphorus compounds at natural abundances. The implementation of effective (1)H--(13)C gradient selection, additional purging pulsed field gradients, spinlock pulses, and improved phase cycling is demonstrated to allow weak correlation signals based on long-range couplings to be readily observed. Through the combination of two heteronuclear long-range coupling constants, (n)J(CH) and (n)J(PC) in H(C)P experiments or (n)J(PH) and (n)J(PC) in H(P)C experiments, protons can be correlated to a second heteronucleus through 4-7 chemical bonds. These experiments thus overcome the inherit limitations of classical (1)H-X HMBC experiments, which require a nonzero value of the heteronuclear coupling constant (n)J(XH). Ultra-broadband inversion composite pulses are successfully employed in the H(P)C INEPT/HMQC and H(P)C double-INEPT pulse sequences to increase the utility of the experiments and the quality of obtained spectra. This work extends and completes a set of 2D phase-sensitive triple-resonance experiments applicable at natural abundances, and also offers insight into the methodology of triple-resonance experiments and the application of pulsed field gradients. A one-dimensional triple-resonance experiment employing carbon detection is suggested for accurate determination of small (n)J(PC).

Recognition memory for hue: Prototypical bias and the role of labeling.

PubMed

Kelly, Laura Jane; Heit, Evan

2017-06-01

How does the concurrent use of language affect perception and memory for exemplars? Labels cue more general category information than a specific exemplar. Applying labels can affect the resulting memory for an exemplar. Here 3 alternative hypotheses are proposed for the role of labeling an exemplar at encoding: (a) labels distort memory toward the label prototype, (b) labels guide the level of specificity needed in the current context, and (c) labels direct attention to the label's referent among all possible features within a visual scene. University students were shown hues on object silhouettes that they either labeled with basic color categories, made preference judgments about, or indicated the animacy of its category. Experiments 1 and 2 established that there are response shifts toward the category prototype regardless of labeling, showing a pervasive influence of category knowledge on response bias. They also established an effect of labeling whereby labeling decreases the magnitude of shifts. Experiments 3 and 4 investigated the uniqueness and necessity of language in causing the decreased shift-neither of which proved to be the case. Overall, category-relative bias was pervasive and labeling appears to direct attention to the feature resulting in less biased memory. The results highlight that the context at encoding affects how memory is formed. (PsycINFO Database Record (c) 2017 APA, all rights reserved).

[The influence of labeling format on use and understanding of nutrition information: results of an experiment in workplace restaurants].

PubMed

Gomez, P; Le Minous, A-E

2012-02-01

Nutrition labeling usually describes food product composition in terms of nutrients. This article aims at investigating the influence of nutrition labeling on use and understanding of nutrition information in workplace restaurants and comparing the difference between a nutrient-based labeling and an alternative labeling based on food groups. In this respect, an experiment was conducted in two workplace restaurants during 4 weeks. Then, a survey was carried out, covering 329 individuals, to assess use and understanding of nutrition information. We found that 42.9% of the sample saw the nutrient labeling and only 5.2% said they used it. Our results show that both labeling formats lead to high understanding. Nutrition labeling format was found to have no significant influence on use and understanding of nutrition information. In spite of these results, food groups labeling were perceived as easier to process than nutrient-based labeling. Understanding is more widespread than use among participants suggesting that the main hurdle to information use comes from a lack of motivation. Food groups labeling are of limited interest compared to nutrient-based labeling. Copyright © 2011 Elsevier Masson SAS. All rights reserved.

Academic Deficiency: Student Experiences of Institutional Labeling

ERIC Educational Resources Information Center

Barouch-Gilbert, Abraham

2015-01-01

Limited existing research examines how undergraduate students in the United States experience the process of being identified as deficient due to their academic performance. The purpose of this phenomenological study was to explore the lived experiences of college students on academic probation who were labeled academically deficient. Students…

The effects of echolalia on acquisition and generalization of receptive labeling in autistic children.

PubMed Central

Charlop, M H

1983-01-01

This investigation, consisting of two experiments, was designed to assess the effects of autistic immediate echolalia on acquisition and generalization of receptive labeling tasks. Experiment 1 addressed whether autistic children could use their echolalia to facilitate acquisition. The results indicated that incorporating echolalia (echo of the requested object's label) into the task before manual response (handing the requested object to the experimenter) facilitated receptive labeling. Experiment 2 was designed to determine the effects of incorporating echolalia into task response on acquisition and subsequent generalization. These results indicated that echolalia facilitated generalization for echolalic autistic children but not for functionally mute autistic children. The results of the experiments are discussed in terms of stimulus control. Additionally, it is proposed that perhaps in certain cases, echolalia should not be eliminated, but used to advantage in receptive responding. PMID:6833164

The effects of echolalia on acquisition and generalization of receptive labeling in autistic children.

PubMed

Charlop, M H

1983-01-01

This investigation, consisting of two experiments, was designed to assess the effects of autistic immediate echolalia on acquisition and generalization of receptive labeling tasks. Experiment 1 addressed whether autistic children could use their echolalia to facilitate acquisition. The results indicated that incorporating echolalia (echo of the requested object's label) into the task before manual response (handing the requested object to the experimenter) facilitated receptive labeling. Experiment 2 was designed to determine the effects of incorporating echolalia into task response on acquisition and subsequent generalization. These results indicated that echolalia facilitated generalization for echolalic autistic children but not for functionally mute autistic children. The results of the experiments are discussed in terms of stimulus control. Additionally, it is proposed that perhaps in certain cases, echolalia should not be eliminated, but used to advantage in receptive responding.

Note: A well-confined pulsed low-energy ion beam: Test experiments of Ar+

NASA Astrophysics Data System (ADS)

Hu, Jie; Wu, Chun-Xiao; Tian, Shan Xi

2018-06-01

Here we report a pulsed low-energy ion beam source for ion-molecule reaction study, in which the ions produced by the pulsed electron impact are confined well in the spatial size of each bunch. In contrast to the ion focusing method to reduce the transverse section of the beam, the longitudinal section in the translational direction is compressed by introducing a second pulse in the ion time-of-flight system. The test experiments for the low-energy argon ions are performed. The present beam source is ready for applications in the ion-molecule reaction dynamics experiments, in particular, in combination with the ion velocity map imaging technique.

Explaining Cold-Pulse Dynamics in Tokamak Plasmas Using Local Turbulent Transport Models

NASA Astrophysics Data System (ADS)

Rodriguez-Fernandez, P.; White, A. E.; Howard, N. T.; Grierson, B. A.; Staebler, G. M.; Rice, J. E.; Yuan, X.; Cao, N. M.; Creely, A. J.; Greenwald, M. J.; Hubbard, A. E.; Hughes, J. W.; Irby, J. H.; Sciortino, F.

2018-02-01

A long-standing enigma in plasma transport has been resolved by modeling of cold-pulse experiments conducted on the Alcator C-Mod tokamak. Controlled edge cooling of fusion plasmas triggers core electron heating on time scales faster than an energy confinement time, which has long been interpreted as strong evidence of nonlocal transport. This Letter shows that the steady-state profiles, the cold-pulse rise time, and disappearance at higher density as measured in these experiments are successfully captured by a recent local quasilinear turbulent transport model, demonstrating that the existence of nonlocal transport phenomena is not necessary for explaining the behavior and time scales of cold-pulse experiments in tokamak plasmas.

Single voxel localization for dynamic hyperpolarized 13C MR spectroscopy

NASA Astrophysics Data System (ADS)

Chen, Albert P.; Cunningham, Charles H.

2015-09-01

The PRESS technique has been widely used to achieve voxel localization for in vivo1H MRS acquisitions. However, for dynamic hyperpolarized 13C MRS experiments, the transition bands of the refocusing pulses may saturate the pre-polarized substrate spins flowing into the voxel. This limitation may be overcome by designing refocusing pulses that do not perturb the resonance of the hyperpolarized substrate, but selectively refocuses the spins of the metabolic products. In this study, a PRESS pulse sequence incorporating spectral-spatial refocusing pulses that have a stop band ('notch') at the substrate resonance is tested in vivo using hyperpolarized [1-13C]pyruvate. Higher metabolite SNR was observed in experiments using the spectral-spatial refocusing pulses as compared to conventional refocusing pulses.

Laser beam delivery at ELI-NP

DOE PAGES

Ursescu, Daniel; Cheriaux, G.; Audebert, P.; ...

2017-01-01

The Laser Beam Delivery (LBD) system technical design report covers the interface between the High Power Laser System (HPLS) and the experiments, together with the pulse quality management. Here, the laser transport part of the LBD has a number of subsystems as follows: the beam transport lines for the six main outputs of HPLS, the additional short and long pulses and the synchronization system including the timing of the laser pulses with the Gamma Beam System (GBS) and the experiments on femtosecond timescale. Pulse quality management, discussed further here, consist in the generation and delivery of multiple HPLS pulses, coherentmore » combining of the HPLS arms, laser pulse diagnostics on target, laser beam dumps, shutters and output energy adaption.« less

Changes in the Microenvironment of Nitroxide Radicals around the Glass Transition Temperature.

PubMed

Bordignon, Enrica; Nalepa, Anna I; Savitsky, Anton; Braun, Lukas; Jeschke, Gunnar

2015-10-29

For structural characterization by pulsed EPR methods, spin-labeled macromolecules are routinely studied at cryogenic temperatures. The equilibration of the conformational ensemble during shock-freezing occurs to a good approximation at the glass transition temperature (Tg). In this work, we used X-band power saturation continuous wave (cw) EPR to obtain information on the glass transition temperatures in the microenvironment of nitroxide radicals in solvents or bound to different sites in proteins. The temperature dependence of the saturation curve of nitroxide probes in pure glycerol or ortho-terphenyl showed detectable transitions at the respective Tg values, with the latter solvent characterized by a sharper change of the saturation properties, according to its higher fragility. In contrast, nitroxide probes in a glycerol/water mixture showed a discontinuity in the saturation properties close to the expected glass transition temperature, which made the determination of Tg complicated. Low-temperature W-band cw EPR and W-band ELDOR-detected NMR experiments demonstrated that the discontinuity is due to local rearrangements of H-bonds between water molecules and the nitroxide reporter group. The change in the network of H-bonds formed between the nitroxide and water molecules that occurs around Tg was found to be site-dependent in spin-labeled proteins. This effect can therefore be modulated by neighboring residues with different steric hindrances and/or charge distributions and possibly by the glycerol enrichment on protein surfaces. In conclusion, if the thermal history of the sample is carefully reproduced, the nitroxide probe is extremely sensitive in reporting site-specific changes in the H-bonding to water molecules close to Tg and local glass transition temperatures in spin-labeled macromolecules.

Root-derived carbon and nitrogen from beech and ash trees differentially fuel soil animal food webs of deciduous forests

PubMed Central

Ammerschubert, Silke; Polle, Andrea; Scheu, Stefan

2017-01-01

Evidence is increasing that soil animal food webs are fueled by root-derived carbon (C) and also by root-derived nitrogen (N). Functioning as link between the above- and belowground system, trees and their species identity are important drivers structuring soil animal communities. A pulse labeling experiment using 15N and 13C was conducted by exposing beech (Fagus sylvatica) and ash (Fraxinus excelsior) seedlings to 13CO2 enriched atmosphere and tree leaves to 15N ammonium chloride solution in a plant growth chamber under controlled conditions for 72 h. C and N fluxes into the soil animal food web of beech, associated with ectomycorrhizal fungi (EMF), and ash, associated with arbuscular mycorrhizal fungi (AMF), were investigated at two sampling dates (5 and 20 days after labeling). All of the soil animal taxa studied incorporated root-derived C, while root-derived N was only incorporated into certain taxa. Tree species identity strongly affected C and N incorporation with the incorporation in the beech rhizosphere generally exceeding that in the ash rhizosphere. Incorporation differed little between 5 and 20 days after labeling indicating that both C and N are incorporated quickly into soil animals and are used for tissue formation. Our results suggest that energy and nutrient fluxes in soil food webs depend on the identity of tree species with the differences being associated with different types of mycorrhiza. Further research is needed to prove the generality of these findings and to quantify the flux of plant C and N into soil food webs of forests and other terrestrial ecosystems. PMID:29236746

Experimental soil warming and cooling alters the partitioning of recent assimilates: evidence from a (14)C-labelling study at the alpine treeline.

PubMed

Ferrari, A; Hagedorn, F; Niklaus, P A

2016-05-01

Despite concerns about climate change effects on ecosystems functioning, little is known on how plant assimilate partitioning changes with temperature. Particularly, large temperature effects might occur in cold ecosystems where critical processes are at their temperature limit. In this study, we tested temperature effects on carbon (C) assimilate partitioning in a field experiment at the alpine treeline. We warmed and cooled soils of microcosms planted with Pinus mugo or Leucanthemopsis alpina, achieving daily mean soil temperatures (3-10 cm depth) around 5.8, 12.7 and 19.2 °C in cooled, control and warmed soils. We pulse-labelled these systems with (14)CO2 for one photoperiod and traced (14)C over the successive 4 days. Plant net (14)C uptake increased steadily with soil temperature. However, (14)C amounts in fungal hyphae, soil microbial biomass, soil organic matter, and soil respiration showed a non-linear response to temperature. This non-linear pattern was particularly pronounced in P. mugo, with five times higher (14)C activities in cooled compared to control soils, but no difference between warmed and control soil. Autoradiographic analysis of the spatial distribution of (14)C in soils indicated that temperature effects on the vertical label distribution within soils depended on plant species. Our results show that plant growth, in particular root metabolism, is limited by low soil temperature. As a consequence, positive temperature effects on net C uptake may not be paralleled by similar changes in rhizodeposition. This has important implications for predictions of soil C storage, because rhizodeposits and plant biomass vary strongly in their residence times.

Warm Dense Matter: Another Application for Pulsed Power Hydrodynamics

DTIC Science & Technology

2009-06-01

Pulsed power hydrodynamic techniques, such as large convergence liner compression of a large volume, modest density, low temperature plasma to...controlled than are similar high explosively powered hydrodynamic experiments. While the precision and controllability of gas- gun experiments is...well established, pulsed power techniques using imploding liner offer access to convergent conditions, difficult to obtain with guns – and essential

An Investigation of Fully Modulated, Turbulent Diffusion Flames in Reduced Gravity

NASA Technical Reports Server (NTRS)

Hermanson, J. C.; Johari, H.; Usowicz, J. E.; Sangras, R.; Stocker, D. P.; Hegde, U. G.; Nagashima, T.; Obata, S.

2001-01-01

Pulsed combustion appears to have the potential to provide for rapid fuel/air mixing, compact and economical combustors, and reduced exhaust emissions. The objective of this Flight-Definition experiment (PuFF, for Pulsed-Fully Flames) is to increase the fundamental understanding of the fuel/air mixing and combustion behavior of pulsed, turbulent diffusion flames by conducting experiments in microgravity. In this research the fuel jet is fully modulated (i.e., completely shut off between pulses) by an externally controlled valve system. This gives rise to drastic modification of the combustion and flow characteristics of flames, leading to enhanced fuel/air mixing mechanisms not operative for the case of acoustically excited or partially-modulated jets. The fully-modulated injection approach also simplifies the combustion process by avoiding the acoustic forcing generally present in pulsed combustors. Relatively little is known about the behavior of turbulent flames in reduced-gravity conditions, even in the absence of pulsing. Fundamental issues addressed in this experiment include the impact of buoyancy on the fuel/air mixing and combustion characteristics of fully-modulated flames. It is also important for the planned space experiments to establish the effects of confinement and oxidizer co-flow on these flames.

Fast Pulses in a Coaxial Cable.

ERIC Educational Resources Information Center

Gray, Levi

1985-01-01

Describes an experiment designed to introduce physics majors to the triggered oscilloscope. The experiment uses an inexpensive, easily constructed generator which sends pulses down a long coaxial cable, thus providing useful waveforms. (DH)

The Cu2+-nitrilotriacetic acid complex improves loading of α-helical double histidine site for precise distance measurements by pulsed ESR

NASA Astrophysics Data System (ADS)

Ghosh, Shreya; Lawless, Matthew J.; Rule, Gordon S.; Saxena, Sunil

2018-01-01

Site-directed spin labeling using two strategically placed natural histidine residues allows for the rigid attachment of paramagnetic Cu2+. This double histidine (dHis) motif enables extremely precise, narrow distance distributions resolved by Cu2+-based pulsed ESR. Furthermore, the distance measurements are easily relatable to the protein backbone-structure. The Cu2+ ion has, till now, been introduced as a complex with the chelating agent iminodiacetic acid (IDA) to prevent unspecific binding. Recently, this method was found to have two limiting concerns that include poor selectivity towards α-helices and incomplete Cu2+-IDA complexation. Herein, we introduce an alternative method of dHis-Cu2+ loading using the nitrilotriacetic acid (NTA)-Cu2+ complex. We find that the Cu2+-NTA complex shows a four-fold increase in selectivity toward α-helical dHis sites. Furthermore, we show that 100% Cu2+-NTA complexation is achievable, enabling precise dHis loading and resulting in no free Cu2+ in solution. We analyze the optimum dHis loading conditions using both continuous wave and pulsed ESR. We implement these findings to show increased sensitivity of the Double Electron-Electron Resonance (DEER) experiment in two different protein systems. The DEER signal is increased within the immunoglobulin binding domain of protein G (called GB1). We measure distances between a dHis site on an α-helix and dHis site either on a mid-strand or a non-hydrogen bonded edge-strand β-sheet. Finally, the DEER signal is increased twofold within two α-helix dHis sites in the enzymatic dimer glutathione S-transferase exemplifying the enhanced α-helical selectivity of Cu2+-NTA.

DOE Office of Scientific and Technical Information (OSTI.GOV)

Friedman, A; Barnard, J J; Briggs, R J

The Heavy Ion Fusion Science Virtual National Laboratory (HIFS-VNL), a collaboration of LBNL, LLNL, and PPPL, has achieved 60-fold pulse compression of ion beams on the Neutralized Drift Compression eXperiment (NDCX) at LBNL. In NDCX, a ramped voltage pulse from an induction cell imparts a velocity 'tilt' to the beam; the beam's tail then catches up with its head in a plasma environment that provides neutralization. The HIFS-VNL's mission is to carry out studies of warm dense matter (WDM) physics using ion beams as the energy source; an emerging thrust is basic target physics for heavy ion-driven inertial fusion energymore » (IFE). These goals require an improved platform, labeled NDCX-II. Development of NDCX-II at modest cost was recently enabled by the availability of induction cells and associated hardware from the decommissioned advanced test accelerator (ATA) facility at LLNL. Our initial physics design concept accelerates an {approx} 30 nC pulse of Li{sup +} ions to {approx} 3 MeV, then compresses it to {approx} 1 ns while focusing it onto a mm-scale spot. It uses the ATA cells themselves (with waveforms shaped by passive circuits) to impart the final velocity tilt; smart pulsers provide small corrections. The ATA accelerated electrons; acceleration of non-relativistic ions involves more complex beam dynamics both transversely and longitudinally. We are using an interactive one-dimensional kinetic simulation model and multidimensional Warp-code simulations to develop the NDCX-II accelerator section. Both LSP and Warp codes are being applied to the beam dynamics in the neutralized drift and final focus regions, and the plasma injection process. The status of this effort is described.« less

Characterization of the LCLS “nanosecond two-bunch” mode for x-ray speckle visibility spectroscopy experiments

DOE PAGES

Sun, Yanwen; Zhu, Diling; Song, Sanghoon; ...

2017-05-23

The generation of two X-ray pulses with tunable nanosecond scale time separations has recently been demonstrated at the Linac Coherent Light Source using an accelerator based technique. This approach offers the opportunity to extend X-ray Photon Correlation Spectroscopy techniques to the yet unexplored regime of nanosecond timescales by means of X-ray Speckle Visibility Spectroscopy. As the two pulses originate from two independent Spontaneous Amplified Stimulated Emission processes, the beam properties fluctuate from pulse pair to pulse pair, but as well between the individual pulses within a pair. However, two-pulse XSVS experiments require the intensity of the individual pulses to bemore » either identical in the ideal case, or with a accurately known intensity ratio. We present the design and performances of a non-destructive intensity diagnostic based on measurement of scattering from a transparent target using a high-speed photo-detector. Individual pulses within a pulse pair with time delays as short as 0.7 ns can be resolved. Moreover, using small angle coherent scattering, we characterize the averaged spatial overlap of the focused pulse pairs. Furthermore, the multi-shot average-speckle contrasts from individual pulses and pulse pairs are compared.« less

Labeling of sexual assault and its relationship with sexual functioning: the mediating role of coping.

PubMed

Kelley, Erika L; Gidycz, Christine A

2015-01-01

Little research has examined the relationship between women's labeling of their sexual assault experiences and sexual functioning, as well as identification of variables that may mediate the labeling-trauma outcome relationship. The purpose of this study was to fill this gap in the literature, by examining the potential mediating role of coping strategies in response to sexual assault in the relationship between labeling and sexual functioning. The sample included 135 college women with a history of adolescent/early adulthood sexual assault. Labeling was not bivariately related to sexual functioning outcomes; however, anxious coping mediated the relationships between labeling and both sexual lubrication and sexual satisfaction. This suggests that correlational analyses between labeling and trauma outcomes may not capture the complexity of this relationship, as it may be more indirect. Furthermore, results suggest that labeling is part of the coping process in response to sexual assault; some women who consider their experience to be sexual assault may engage in anxious coping efforts, contributing to difficulties with sexual lubrication and sexual dissatisfaction. Victims actively working to integrate their sexual assault experience with prior beliefs and self-concept may benefit from treatment focused on decreasing anxious coping, especially as it relates to sexual functioning. © The Author(s) 2014.

Subjective Responses to Emotional Stimuli During Labeling, Reappraisal, and Distraction

PubMed Central

Lieberman, Matthew D.; Inagaki, Tristen K.; Tabibnia, Golnaz; Crockett, Molly J.

2011-01-01

Although multiple neuroimaging studies suggest that affect labeling (i.e., putting feelings into words) can dampen affect-related responses in the amygdala, the consequences of affect labeling have not been examined in other channels of emotional responding. We conducted four studies examining the effect of affect labeling on self-reported emotional experience. In study one, self-reported distress was lower during affect labeling, compared to passive watching, of negative emotional pictures. Studies two and three added reappraisal and distraction conditions, respectively. Affect labeling showed similar effects on self-reported distress as both of these intentional emotion regulation strategies. In each of the first three studies, however, participant predictions about the effects of affect labeling suggest that unlike reappraisal and distraction, people do not believe affect labeling to be an effective emotion regulation strategy. Even after having the experience of affect labels leading to lower distress, participants still predicted that affect labeling would increase distress in the future. Thus, affect labeling is best described as an incidental emotion regulation process. Finally, study four employed positive emotional pictures and here, affect labeling was associated with diminished self-reported pleasure, relative to passive watching. This suggests that affect labeling tends to dampen affective responses in general, rather than specifically alleviating negative affect. PMID:21534661

Linking sounds to meanings: infant statistical learning in a natural language.

PubMed

Hay, Jessica F; Pelucchi, Bruna; Graf Estes, Katharine; Saffran, Jenny R

2011-09-01

The processes of infant word segmentation and infant word learning have largely been studied separately. However, the ease with which potential word forms are segmented from fluent speech seems likely to influence subsequent mappings between words and their referents. To explore this process, we tested the link between the statistical coherence of sequences presented in fluent speech and infants' subsequent use of those sequences as labels for novel objects. Notably, the materials were drawn from a natural language unfamiliar to the infants (Italian). The results of three experiments suggest that there is a close relationship between the statistics of the speech stream and subsequent mapping of labels to referents. Mapping was facilitated when the labels contained high transitional probabilities in the forward and/or backward direction (Experiment 1). When no transitional probability information was available (Experiment 2), or when the internal transitional probabilities of the labels were low in both directions (Experiment 3), infants failed to link the labels to their referents. Word learning appears to be strongly influenced by infants' prior experience with the distribution of sounds that make up words in natural languages. Copyright © 2011 Elsevier Inc. All rights reserved.

Determination of Multiple φ-Torsion Angles in Proteins by Selective and Extensive 13C Labeling and Two-Dimensional Solid-State NMR

NASA Astrophysics Data System (ADS)

Hong, Mei

1999-08-01

We describe an approach to efficiently determine the backbone conformation of solid proteins that utilizes selective and extensive 13C labeling in conjunction with two-dimensional magic-angle-spinning NMR. The selective 13C labeling approach aims to reduce line broadening and other multispin complications encountered in solid-state NMR of uniformly labeled proteins while still enhancing the sensitivity of NMR spectra. It is achieved by using specifically labeled glucose or glycerol as the sole carbon source in the protein expression medium. For amino acids synthesized in the linear part of the biosynthetic pathways, [1-13C]glucose preferentially labels the ends of the side chains, while [2-13C]glycerol labels the Cα of these residues. Amino acids produced from the citric-acid cycle are labeled in a more complex manner. Information on the secondary structure of such a labeled protein was obtained by measuring multiple backbone torsion angles φ simultaneously, using an isotropic-anisotropic 2D correlation technique, the HNCH experiment. Initial experiments for resonance assignment of a selectively 13C labeled protein were performed using 15N-13C 2D correlation spectroscopy. From the time dependence of the 15N-13C dipolar coherence transfer, both intraresidue and interresidue connectivities can be observed, thus yielding partial sequential assignment. We demonstrate the selective 13C labeling and these 2D NMR experiments on a 8.5-kDa model protein, ubiquitin. This isotope-edited NMR approach is expected to facilitate the structure determination of proteins in the solid state.

An all solid-state, rolled strip pulse forming line with low impedance and compact structure

NASA Astrophysics Data System (ADS)

Yang, Shi; Zhong, Hui-Huang; Qian, Bao-Liang; Yang, Han-Wu

2010-04-01

An all solid-state and compact pulsed strip pulse forming line (PFL) is investigated both theoretically and experimentally. The electromagnetic field distribution and the pulse formation in the strip PFL are analyzed numerically. Based on the theoretical analysis and numerical results, a rolled strip PFL with output voltage of 20 kV, pulse duration of 230 ns, and characteristic impedance of 0.5 Ω was designed and manufactured. We use the Mylar film and copper as the dielectric and conductor of the strip PFL. The dimension of the strip line is 23 000×400×1.6 mm3 in the case in which the strip line is unrolled, and the strip line is finally rolled into a cylinder of diameter of 311 mm for the experiment. The dimension and weight are about ten times smaller than those of traditional dielectric (oil or pure water) PFL with the same electrical parameters. Two experiments were performed using the strip line. One was for a transmission line experiment, and the other was for a PFL experiment. In the experiment of transmission line, the transmission time of the voltage signal was 115 ns, and the signal had almost no distortion, which verified the design. In the PFL experiment, results gave a 17.8 kV, 270 ns (full width at half maximum) voltage pulse which was a quasisquare wave on the water load of 0.5 Ω. The current going through the load is about 35.6 kA.

In situ 13CO2 pulse labelling of field-grown eucalypt trees revealed the effects of potassium nutrition and throughfall exclusion on phloem transport of photosynthetic carbon.

PubMed

Epron, Daniel; Cabral, Osvaldo Machado Rodrigues; Laclau, Jean-Paul; Dannoura, Masako; Packer, Ana Paula; Plain, Caroline; Battie-Laclau, Patricia; Moreira, Marcelo Zacharias; Trivelin, Paulo Cesar Ocheuze; Bouillet, Jean-Pierre; Gérant, Dominique; Nouvellon, Yann

2016-01-01

Potassium (K) is an important limiting factor of tree growth, but little is known of the effects of K supply on the long-distance transport of photosynthetic carbon (C) in the phloem and of the interaction between K fertilization and drought. We pulse-labelled 2-year-old Eucalyptus grandis L. trees grown in a field trial combining K fertilization (+K and -K) and throughfall exclusion (+W and -W), and we estimated the velocity of C transfer by comparing time lags between the uptake of (13)CO2 and its recovery in trunk CO2 efflux recorded at different heights. We also analysed the dynamics of the labelled photosynthates recovered in the foliage and in the phloem sap (inner bark extract). The mean residence time of labelled C in the foliage was short (21-31 h). The time series of (13)C in excess in the foliage was affected by the level of fertilization, whereas the effect of throughfall exclusion was not significant. The velocity of C transfer in the trunk (0.20-0.82 m h(-1)) was twice as high in +K trees than in -K trees, with no significant effect of throughfall exclusion except for one +K -W tree labelled in the middle of the drought season that was exposed to a more pronounced water stress (midday leaf water potential of -2.2 MPa). Our results suggest that besides reductions in photosynthetic C supply and in C demand by sink organs, the lower velocity under K deficiency is due to a lower cross-sectional area of the sieve tubes, whereas an increase in phloem sap viscosity is more likely limiting phloem transport under drought. In all treatments, 10 times less (13)C was recovered in inner bark extracts at the bottom of the trunk when compared with the base of the crown, suggesting that a large part of the labelled assimilates has been exported out of the phloem and replaced by unlabelled C. This supports the 'leakage-retrieval mechanism' that may play a role in maintaining the pressure gradient between source and sink organs required to sustain high velocity of phloem transport in tall trees. © The Author 2015. Published by Oxford University Press. All rights reserved. For Permissions, please email: journals.permissions@oup.com.

Measurement of brain perfusion in newborns: Pulsed arterial spin labeling (PASL) versus pseudo-continuous arterial spin labeling (pCASL)

PubMed Central

Boudes, Elodie; Gilbert, Guillaume; Leppert, Ilana Ruth; Tan, Xianming; Pike, G. Bruce; Saint-Martin, Christine; Wintermark, Pia

2014-01-01

Background Arterial spin labeling (ASL) perfusion-weighted imaging (PWI) by magnetic resonance imaging (MRI) has been shown to be useful for identifying asphyxiated newborns at risk of developing brain injury, whether or not therapeutic hypothermia was administered. However, this technique has been only rarely used in newborns until now, because of the challenges to obtain sufficient signal-to-noise ratio (SNR) and spatial resolution in newborns. Objective To compare two methods of ASL-PWI (i.e., single inversion-time pulsed arterial spin labeling [single TI PASL], and pseudo-continuous arterial spin labeling [pCASL]) to assess brain perfusion in asphyxiated newborns treated with therapeutic hypothermia and in healthy newborns. Design/methods We conducted a prospective cohort study of term asphyxiated newborns meeting the criteria for therapeutic hypothermia; four additional healthy term newborns were also included as controls. Each of the enrolled newborns was scanned at least once during the first month of life. Each MRI scan included conventional anatomical imaging, as well as PASL and pCASL PWI-MRI. Control and labeled images were registered separately to reduce the effect of motion artifacts. For each scan, the axial slice at the level of the basal ganglia was used for comparisons. Each scan was scored for its image quality. Quantification of whole-slice cerebral blood flow (CBF) was done afterwards using previously described formulas. Results A total number of 61 concomitant PASL and pCASL scans were obtained in nineteen asphyxiated newborns treated with therapeutic hypothermia and four healthy newborns. After discarding the scans with very poor image quality, 75% (46/61) remained for comparison between the two ASL methods. pCASL images presented a significantly superior image quality score compared to PASL images (p < 0.0001). Strong correlation was found between the CBF measured by PASL and pCASL (r = 0.61, p < 0.0001). Conclusion This study demonstrates that both ASL methods are feasible to assess brain perfusion in healthy and sick newborns. However, pCASL might be a better choice over PASL in newborns, as pCASL perfusion maps had a superior image quality that allowed a more detailed identification of the different brain structures. PMID:25379424

Rapid 3D NMR using the filter diagonalization method: application to oligosaccharides derivatized with 13C-labeled acetyl groups

NASA Astrophysics Data System (ADS)

Armstrong, Geoffrey S.; Cano, Kristin E.; Mandelshtam, Vladimir A.; Shaka, A. J.; Bendiak, Brad

2004-09-01

Rapid 3D NMR spectroscopy of oligosaccharides having isotopically labeled acetyl "isotags" was made possible with high resolution in the indirect dimensions using the filter diagonalization method (FDM). A pulse sequence was designed for the optimal correlation of acetyl methyl protons, methyl carbons, and carbonyl carbons. The multi-dimensional nature of the FDM, coupled with the advantages of constant-time evolution periods, resulted in marked improvements over Fourier transform (FT) and mirror-image linear prediction (MI-LP) processing methods. The three methods were directly compared using identical data sets. A highly resolved 3D spectrum was achieved with the FDM using a very short experimental time (28 min).

Rapid 3D NMR using the filter diagonalization method: application to oligosaccharides derivatized with 13C-labeled acetyl groups.

PubMed

Armstrong, Geoffrey S; Cano, Kristin E; Mandelshtam, Vladimir A; Shaka, A J; Bendiak, Brad

2004-09-01

Rapid 3D NMR spectroscopy of oligosaccharides having isotopically labeled acetyl "isotags" was made possible with high resolution in the indirect dimensions using the filter diagonalization method (FDM). A pulse sequence was designed for the optimal correlation of acetyl methyl protons, methyl carbons, and carbonyl carbons. The multi-dimensional nature of the FDM, coupled with the advantages of constant-time evolution periods, resulted in marked improvements over Fourier transform (FT) and mirror-image linear prediction (MI-LP) processing methods. The three methods were directly compared using identical data sets. A highly resolved 3D spectrum was achieved with the FDM using a very short experimental time (28 min).

Microfluidic and Label-Free Multi-Immunosensors Based on Carbon Nanotube Microelectrodes

NASA Astrophysics Data System (ADS)

Tsujita, Yuichi; Maehashi, Kenzo; Matsumoto, Kazuhiko; Chikae, Miyuki; Takamura, Yuzuru; Tamiya, Eiichi

2009-06-01

We fabricated microfluidic and label-free multi-immunosensors by the integration of carbon nanotube (CNT)-arrayed electrodes and microchannels with pneumatic micropumps made of poly(dimethylsiloxane). In the microfluidic systems, four kinds of sample solutions were transported from each liquid inlet to microchannels using six pneumatic micropumps. As a result, two kinds of antibodies were immobilized onto different CNT electrodes using the microfluidic systems. Next, two kinds of cancer markers, prostate specific antigen and human chorionic gonadotropin in phosphate buffer solution, were simultaneously detected by differential pulse voltammetry. Therefore, microfludic multi-immunosensors based on CNT electrodes and pneumatic micropumps are useful for the development of multiplex hand-held biosensors.

Biosynthesis and processing of cathepsin G and neutrophil elastase in the leukemic myeloid cell line U-937.

PubMed

Lindmark, A; Persson, A M; Olsson, I

1990-12-01

The processing of the neutral proteases cathepsin G and neutrophil elastase, normally synthesized in myeloid precursor cells and stored in azurophil granules, were investigated by biosynthetic labeling with 14C-leucine of the monoblastic cell line U-937. The proteases were precipitated with specific antibodies and the immunoprecipitates were analyzed by sodium dodecyl sulfate polyacrylamide gel electrophoresis (SDS-PAGE) followed by fluorography. The transfer to lysosomes of newly synthesized proteases was demonstrated in pulse-chase labeling experiments followed by centrifugation of cell homogenates in a Percoll gradient. The presence of a closely spaced polypeptide band-doublet at intermediate gradient density suggested cleavage of the specific aminoterminal pro dipeptide extension before storage in lysosomes. The molecular heterogeneity observed for cathepsin G and neutrophil elastase seemed to be due to modifications occurring after sorting into lysosomes, most likely because of C-terminal processing. Modifications of the secreted enzymes were not detectable by SDS-PAGE. In contrast to other lysosomal enzymes, no phosphorylation was demonstrated. Newly synthesized cathepsin G and neutrophil elastase rapidly became resistant to endoglycosidase H, indicating transport through the medial and trans cisternae of the Golgi complex and conversion to "complex" oligosaccharide side chains. This conversion was inhibited by an agent swainsonine, but translocation from the Golgi complex and secretion were unaffected. The processing described may play a role in activation of the proteases.

Calreticulin is expressed on the cell surface of activated human peripheral blood T lymphocytes in association with major histocompatibility complex class I molecules.

PubMed

Arosa, F A; de Jesus, O; Porto, G; Carmo, A M; de Sousa, M

1999-06-11

Calreticulin is an endoplasmic reticulum resident molecule known to be involved in the folding and assembly of major histocompatibility complex (MHC) class I molecules. In the present study, expression of calreticulin was analyzed in human peripheral blood T lymphocytes. Pulse-chase experiments in [35S]methionine-labeled T cell blasts showed that calreticulin was associated with several proteins in the endoplasmic reticulum and suggested that it was expressed at the cell surface. Indeed, the 60-kDa calreticulin was labeled by cell surface biotinylation and precipitated from the surface of activated T cells together with a protein with an apparent molecular mass of 46 kDa. Cell surface expression of calreticulin by activated T lymphocytes was further confirmed by immunofluorescence and flow cytometry, studies that showed that both CD8+ and CD4+ T cells expressed calreticulin in the plasma membrane. Low amounts of cell surface calreticulin were detected in resting T lymphocytes. By sequential immunoprecipitation using the conformation independent monoclonal antibody HC-10, we provided evidence that the cell surface 46-kDa protein co-precipitated with calreticulin is unfolded MHC I. These results show for the first time that after T cell activation, significant amounts of calreticulin are expressed on the T cell surface, where they are found in physical association with a pool of beta2-free MHC class I molecules.

Encoding probabilistic brain atlases using Bayesian inference.

PubMed

Van Leemput, Koen

2009-06-01

This paper addresses the problem of creating probabilistic brain atlases from manually labeled training data. Probabilistic atlases are typically constructed by counting the relative frequency of occurrence of labels in corresponding locations across the training images. However, such an "averaging" approach generalizes poorly to unseen cases when the number of training images is limited, and provides no principled way of aligning the training datasets using deformable registration. In this paper, we generalize the generative image model implicitly underlying standard "average" atlases, using mesh-based representations endowed with an explicit deformation model. Bayesian inference is used to infer the optimal model parameters from the training data, leading to a simultaneous group-wise registration and atlas estimation scheme that encompasses standard averaging as a special case. We also use Bayesian inference to compare alternative atlas models in light of the training data, and show how this leads to a data compression problem that is intuitive to interpret and computationally feasible. Using this technique, we automatically determine the optimal amount of spatial blurring, the best deformation field flexibility, and the most compact mesh representation. We demonstrate, using 2-D training datasets, that the resulting models are better at capturing the structure in the training data than conventional probabilistic atlases. We also present experiments of the proposed atlas construction technique in 3-D, and show the resulting atlases' potential in fully-automated, pulse sequence-adaptive segmentation of 36 neuroanatomical structures in brain MRI scans.

Probing de novo sphingolipid metabolism in mammalian cells utilizing mass spectrometry.

PubMed

Snider, Justin M; Snider, Ashley J; Obeid, Lina M; Luberto, Chiara; Hannun, Yusuf A

2018-06-01

Sphingolipids constitute a dynamic metabolic network that interconnects several bioactive molecules, including ceramide (Cer), sphingosine (Sph), Sph 1-phosphate, and Cer 1-phosphate. The interconversion of these metabolites is controlled by a cohort of at least 40 enzymes, many of which respond to endogenous or exogenous stimuli. Typical probing of the sphingolipid pathway relies on sphingolipid mass levels or determination of the activity of individual enzymes. Either approach is unable to provide a complete analysis of flux through sphingolipid metabolism, which, given the interconnectivity of the sphingolipid pathway, is critical information to identify nodes of regulation. Here, we present a one-step in situ assay that comprehensively probes the flux through de novo sphingolipid synthesis, post serine palmitoyltransferase, by monitoring the incorporation and metabolism of the 17 carbon dihydrosphingosine precursor with LC/MS. Pulse labeling and analysis of precursor metabolism identified sequential well-defined phases of sphingolipid synthesis, corresponding to the activity of different enzymes in the pathway, further confirmed by the use of specific inhibitors and modulators of sphingolipid metabolism. This work establishes precursor pulse labeling as a practical tool for comprehensively studying metabolic flux through de novo sphingolipid synthesis and complex sphingolipid generation.

Loss of Citron Kinase Affects a Subset of Progenitor Cells That Alters Late but Not Early Neurogenesis in the Developing Rat Retina

PubMed Central

Karunakaran, Devi Krishna Priya; Chhaya, Nisarg; Lemoine, Christopher; Congdon, Sean; Black, Amye; Kanadia, Rahul

2015-01-01

Purpose. To understand how loss of citron kinase (CitK) affects retinal progenitor cells (RPCs) in the developing rat retina. Methods. We compared knockout (KO) and wild-type (WT) retinae by immunohistochemistry. The TdT-mediated dUTP terminal nick-end labeling (TUNEL) assay was performed to determine cell death. Pulse-chase experiments using 5-ethynyl-2’-deoxyuridine (EdU) were carried out to interrogate RPC behavior and in turn neurogenesis. Results. Reverse transcription–polymerase chain reaction analysis showed that CitK was expressed at embryonic day (E)12 and was turned off at approximately postnatal day (P)4. Immunohistochemistry showed CitK being localized as puncta at the apical end of the outer neuroblastic layer (ONBL). Analyses during embryonic development showed that the KO retina was of comparable size to that of WT until E13. However, by E14, there was a reduction in the number of S-phase RPCs with a concomitant increase in TUNEL+ cells in the KO retina. Moreover, early neurogenesis, as reflected by retinal ganglion cell production, was not affected. Postnatal analysis of the retina showed that ONBL in the KO retina was reduced to half the size of that in WT and showed further degeneration. Immunohistochemistry revealed absence of Islet1+ bipolar cells at P2, which was further confirmed by EdU pulse-chase experiments. The CitK KO retinae underwent complete degeneration by P14. Conclusions. Our study showed that CitK is not required for a subset of RPCs before E14, but is necessary for RPC survival post E14. This in turn results in normal early embryonic neurogenesis, but severely compromised later embryonic and postnatal neurogenesis. PMID:25593024

Attitudes and experiences of community pharmacists towards paediatric off-label prescribing: a prospective survey

PubMed Central

Stewart, Derek; Rouf, Abdul; Snaith, Ailsa; Elliott, Kathleen; Helms, Peter J; McLay, James S

2007-01-01

What is already known about this subject There are increasing concerns about the safety and efficacy of paediatric off-label medicines. In the UK, each year 26% of children receive an off-label prescription from their general practitioner. The community pharmacist is the final and key professional in the chain, with the responsibility to ensure that medicines are both prescribed and dispensed appropriately. What this study adds The majority of community pharmacists are aware of off-label prescribing, but through work experience rather than undergraduate or postgraduate training or professional development. Community pharmacists, like UK general practitioners, underestimate the levels of paediatric off-label prescribing, and appear unclear as to the most common reasons for a prescription being off label. Most community pharmacists stated that they should inform the prescriber that a medicine was off label; however, when given specific practical examples, less than half would actually appear to do so. The majority of community pharmacists have been asked by the public to sell over-the-counter medicines for paediatric off-label use. Aim To identify community pharmacist experiences of, and attitudes towards paediatric off-label prescribing. Methods A prospective questionnaire-based study, with a 21-item questionnaire issued to 1500 randomly selected community pharmacies throughout the UK during 2005 on three separate occasions. Results Four hundred and eighty-two (32.1%) completed questionnaires were returned. Over 70% of respondents were familiar with the concept of off-label prescribing, primarily through dispensing experience rather than education, although only 40% were aware of having dispensed a paediatric off-label prescription within the previous month. The reasons given for a prescription being off label were younger age than recommended (84.6%, 297/351), primarily for antihistamines, analgesics and β2-agonists, and higher (73.9%, 229/310) or lower than (41%, 103/258) recommended dose, primarily antibiotics and analgesics. Over 60% of respondents had been asked by the public to sell paediatric over-the-counter medicines, such as antihistamines, analgesics and steroid preparations for off-label use. The majority of respondents used the British National Formulary or the Pack Insert rather than specialist formularies or guidelines as a source of specialist paediatric information. Although 78% of respondents believed they had a responsibility to inform the prescriber that a medicine was off label, only 66% believed that they had a similar responsibility to inform parents. Conclusion The community pharmacists who responded to this questionnaire appear to be aware of and concerned by the issues which surround paediatric off-label prescribing. Despite this, most gained relevant knowledge through work experience rather than undergraduate or postgraduate training or professional development. PMID:17324238

Dynamic model of target charging by short laser pulse interactions

NASA Astrophysics Data System (ADS)

Poyé, A.; Dubois, J.-L.; Lubrano-Lavaderci, F.; D'Humières, E.; Bardon, M.; Hulin, S.; Bailly-Grandvaux, M.; Ribolzi, J.; Raffestin, D.; Santos, J. J.; Nicolaï, Ph.; Tikhonchuk, V.

2015-10-01

A model providing an accurate estimate of the charge accumulation on the surface of a metallic target irradiated by a high-intensity laser pulse of fs-ps duration is proposed. The model is confirmed by detailed comparisons with specially designed experiments. Such a model is useful for understanding the electromagnetic pulse emission and the quasistatic magnetic field generation in laser-plasma interaction experiments.

Dynamic model of target charging by short laser pulse interactions.

PubMed

Poyé, A; Dubois, J-L; Lubrano-Lavaderci, F; D'Humières, E; Bardon, M; Hulin, S; Bailly-Grandvaux, M; Ribolzi, J; Raffestin, D; Santos, J J; Nicolaï, Ph; Tikhonchuk, V

2015-10-01

A model providing an accurate estimate of the charge accumulation on the surface of a metallic target irradiated by a high-intensity laser pulse of fs-ps duration is proposed. The model is confirmed by detailed comparisons with specially designed experiments. Such a model is useful for understanding the electromagnetic pulse emission and the quasistatic magnetic field generation in laser-plasma interaction experiments.

From few-cycle femtosecond pulse to single attosecond pulse-controlling and tracking electron dynamics with attosecond precision

NASA Astrophysics Data System (ADS)

Wang, He

The few-cycle femtosecond laser pulse has proved itself to be a powerful tool for controlling the electron dynamics inside atoms and molecules. By applying such few-cycle pulses as a driving field, single isolated attosecond pulses can be produced through the high-order harmonic generation process, which provide a novel tool for capturing the real time electron motion. The first part of the thesis is devoted to the state of the art few-cycle near infrared (NIR) laser pulse development, which includes absolute phase control (carrier-envelope phase stabilization), amplitude control (power stabilization), and relative phase control (pulse compression and shaping). Then the double optical gating (DOG) method for generating single attosecond pulses and the attosecond streaking experiment for characterizing such pulses are presented. Various experimental limitations in the attosecond streaking measurement are illustrated through simulation. Finally by using the single attosecond pulses generated by DOG, an attosecond transient absorption experiment is performed to study the autoionization process of argon. When the delay between a few-cycle NIR pulse and a single attosecond XUV pulse is scanned, the Fano resonance shapes of the argon autoionizing states are modified by the NIR pulse, which shows the direct observation and control of electron-electron correlation in the temporal domain.

Dead-time correction for high-throughput fluorescence lifetime imaging microscopy (Conference Presentation)

NASA Astrophysics Data System (ADS)

Enderlein, Joerg; Ruhlandt, Daja; Chithik, Anna; Ebrecht, René; Wouters, Fred S.; Gregor, Ingo

2016-02-01

Fluorescence lifetime microscopy has become an important method of bioimaging, allowing not only to record intensity and spectral, but also lifetime information across an image. One of the most widely used methods of FLIM is based on Time-Correlated Single Photon Counting (TCSPC). In TCSPC, one determines this curve by exciting molecules with a periodic train of short laser pulses, and then measuring the time delay between the first recorded fluorescence photon after each exciting laser pulse. An important technical detail of TCSPC measurements is the fact that the delay times between excitation laser pulses and resulting fluorescence photons are always measured between a laser pulse and the first fluorescence photon which is detected after that pulse. At high count rates, this leads to so-called pile-up: ``early'' photons eclipse long-delay photons, resulting in heavily skewed TCSPC histograms. To avoid pile-up, a rule of thumb is to perform TCSPC measurements at photon count rates which are at least hundred times smaller than the laser-pulse excitation rate. The downside of this approach is that the fluorescence-photon count-rate is restricted to a value below one hundredth of the laser-pulse excitation-rate, reducing the overall speed with which a fluorescence signal can be measured. We present a new data evaluation method which provides pile-up corrected fluorescence decay estimates from TCSPC measurements at high count rates, and we demonstrate our method on FLIM of fluorescently labeled cells.

Design and development of compact pulsed power driver for electron beam experiments

DOE Office of Scientific and Technical Information (OSTI.GOV)

Deb, Pankaj; Sharma, S.K.; Adhikary, B.

2014-07-01

Pulsed electron beam generation requires high power pulses of fast rise, short duration pulse with flat top. With this objective we have designed a low cost compact pulsed power driver based on water dielectric transmission line. The paper describes the design aspects and construction of the pulse power driver and its experimental results. The pulsed power driver consist of a capacitor bank and its charging power supply, high voltage generator, high voltage switch and pulse compression system. (author)

Label-free high-throughput imaging flow cytometry

NASA Astrophysics Data System (ADS)

Mahjoubfar, A.; Chen, C.; Niazi, K. R.; Rabizadeh, S.; Jalali, B.

2014-03-01

Flow cytometry is an optical method for studying cells based on their individual physical and chemical characteristics. It is widely used in clinical diagnosis, medical research, and biotechnology for analysis of blood cells and other cells in suspension. Conventional flow cytometers aim a laser beam at a stream of cells and measure the elastic scattering of light at forward and side angles. They also perform single-point measurements of fluorescent emissions from labeled cells. However, many reagents used in cell labeling reduce cellular viability or change the behavior of the target cells through the activation of undesired cellular processes or inhibition of normal cellular activity. Therefore, labeled cells are not completely representative of their unaltered form nor are they fully reliable for downstream studies. To remove the requirement of cell labeling in flow cytometry, while still meeting the classification sensitivity and specificity goals, measurement of additional biophysical parameters is essential. Here, we introduce an interferometric imaging flow cytometer based on the world's fastest continuous-time camera. Our system simultaneously measures cellular size, scattering, and protein concentration as supplementary biophysical parameters for label-free cell classification. It exploits the wide bandwidth of ultrafast laser pulses to perform blur-free quantitative phase and intensity imaging at flow speeds as high as 10 meters per second and achieves nanometer-scale optical path length resolution for precise measurements of cellular protein concentration.

Sudan Black B masks Mycobacterium avium subspecies paratuberculosis immunofluorescent antibody labeling

USDA-ARS?s Scientific Manuscript database

Autofluorescence and non-specific immunofluorescent labeling are common challenges associated with immunofluorescence experiments. Autofluorescence typically demonstrates a broad emission spectrum, increasing the potential for overlap with experiments that utilize multiple fluorophores. During immun...

Semantic priming of familiar songs.

PubMed

Johnson, Sarah K; Halpern, Andrea R

2012-05-01

We explored the functional organization of semantic memory for music by comparing priming across familiar songs both within modalities (Experiment 1, tune to tune; Experiment 3, category label to lyrics) and across modalities (Experiment 2, category label to tune; Experiment 4, tune to lyrics). Participants judged whether or not the target tune or lyrics were real (akin to lexical decision tasks). We found significant priming, analogous to linguistic associative-priming effects, in reaction times for related primes as compared to unrelated primes, but primarily for within-modality comparisons. Reaction times to tunes (e.g., "Silent Night") were faster following related tunes ("Deck the Hall") than following unrelated tunes ("God Bless America"). However, a category label (e.g., Christmas) did not prime tunes from within that category. Lyrics were primed by a related category label, but not by a related tune. These results support the conceptual organization of music in semantic memory, but with potentially weaker associations across modalities.

CACA-TOCSY with alternate 13C–12C labeling: a 13Cα direct detection experiment for mainchain resonance assignment, dihedral angle information, and amino acid type identification

PubMed Central

Takeuchi, Koh; Frueh, Dominique P.; Sun, Zhen-Yu J.; Hiller, Sebastian

2010-01-01

We present a 13C direct detection CACA-TOCSY experiment for samples with alternate 13C–12C labeling. It provides inter-residue correlations between 13Cα resonances of residue i and adjacent Cαs at positions i − 1 and i + 1. Furthermore, longer mixing times yield correlations to Cα nuclei separated by more than one residue. The experiment also provides Cα-to-sidechain correlations, some amino acid type identifications and estimates for ψ dihedral angles. The power of the experiment derives from the alternate 13C–12C labeling with [1,3-13C] glycerol or [2-13C] glycerol, which allows utilizing the small scalar 3JCC couplings that are masked by strong 1JCC couplings in uniformly 13C labeled samples. PMID:20383561

CACA-TOCSY with alternate 13C-12C labeling: a 13Calpha direct detection experiment for mainchain resonance assignment, dihedral angle information, and amino acid type identification.

PubMed

Takeuchi, Koh; Frueh, Dominique P; Sun, Zhen-Yu J; Hiller, Sebastian; Wagner, Gerhard

2010-05-01

We present a (13)C direct detection CACA-TOCSY experiment for samples with alternate (13)C-(12)C labeling. It provides inter-residue correlations between (13)C(alpha) resonances of residue i and adjacent C(alpha)s at positions i - 1 and i + 1. Furthermore, longer mixing times yield correlations to C(alpha) nuclei separated by more than one residue. The experiment also provides C(alpha)-to-sidechain correlations, some amino acid type identifications and estimates for psi dihedral angles. The power of the experiment derives from the alternate (13)C-(12)C labeling with [1,3-(13)C] glycerol or [2-(13)C] glycerol, which allows utilizing the small scalar (3)J(CC) couplings that are masked by strong (1)J(CC) couplings in uniformly (13)C labeled samples.

Analysis of Picosecond Pulsed Laser Melted Graphite

DOE R&D Accomplishments Database

Steinbeck, J.; Braunstein, G.; Speck, J.; Dresselhaus, M. S.; Huang, C. Y.; Malvezzi, A. M.; Bloembergen, N.

1986-12-01

A Raman microprobe and high resolution TEM have been used to analyze the resolidified region of liquid carbon generated by picosecond pulse laser radiation. From the relative intensities of the zone center Raman-allowed mode for graphite at 1582 cm{sup -1} and the disorder-induced mode at 1360 cm{sup -1}, the average graphite crystallite size in the resolidified region is determined as a function of position. By comparison with Rutherford backscattering spectra and Raman spectra from nanosecond pulsed laser melting experiments, the disorder depth for picosecond pulsed laser melted graphite is determined as a function of irradiating energy density. Comparisons of TEM micrographs for nanosecond and picosecond pulsed laser melting experiments show that the structure of the laser disordered regions in graphite are similar and exhibit similar behavior with increasing laser pulse fluence.

Femtosecond laser-induced periodic surface structures on silicon upon polarization controlled two-color double-pulse irradiation.

PubMed

Höhm, Sandra; Herzlieb, Marcel; Rosenfeld, Arkadi; Krüger, Jörg; Bonse, Jörn

2015-01-12

Two-color double-fs-pulse experiments were performed on silicon wafers to study the temporally distributed energy deposition in the formation of laser-induced periodic surface structures (LIPSS). A Mach-Zehnder interferometer generated parallel or cross-polarized double-pulse sequences at 400 and 800 nm wavelength, with inter-pulse delays up to a few picoseconds between the sub-ablation 50-fs-pulses. Multiple two-color double-pulse sequences were collinearly focused by a spherical mirror to the sample. The resulting LIPSS characteristics (periods, areas) were analyzed by scanning electron microscopy. A wavelength-dependent plasmonic mechanism is proposed to explain the delay-dependence of the LIPSS. These two-color experiments extend previous single-color studies and prove the importance of the ultrafast energy deposition for LIPSS formation.

Attosecond nonlinear optics using gigawatt-scale isolated attosecond pulses

PubMed Central

Takahashi, Eiji J.; Lan, Pengfei; Mücke, Oliver D.; Nabekawa, Yasuo; Midorikawa, Katsumi

2013-01-01

High-energy isolated attosecond pulses required for the most intriguing nonlinear attosecond experiments as well as for attosecond-pump/attosecond-probe spectroscopy are still lacking at present. Here we propose and demonstrate a robust generation method of intense isolated attosecond pulses, which enable us to perform a nonlinear attosecond optics experiment. By combining a two-colour field synthesis and an energy-scaling method of high-order harmonic generation, the maximum pulse energy of the isolated attosecond pulse reaches as high as 1.3 μJ. The generated pulse with a duration of 500 as, as characterized by a nonlinear autocorrelation measurement, is the shortest and highest-energy pulse ever with the ability to induce nonlinear phenomena. The peak power of our tabletop light source reaches 2.6 GW, which even surpasses that of an extreme-ultraviolet free-electron laser. PMID:24158092

Explaining Cold-Pulse Dynamics in Tokamak Plasmas Using Local Turbulent Transport Models

DOE PAGES

Rodriguez-Fernandez, P.; White, A. E.; Howard, N. T.; ...

2018-02-16

A long-standing enigma in plasma transport has been resolved by modeling of cold-pulse experiments conducted on the Alcator C-Mod tokamak. Controlled edge cooling of fusion plasmas triggers core electron heating on time scales faster than an energy confinement time, which has long been interpreted as strong evidence of nonlocal transport. Here, this Letter shows that the steady-state profiles, the cold-pulse rise time, and disappearance at higher density as measured in these experiments are successfully captured by a recent local quasilinear turbulent transport model, demonstrating that the existence of nonlocal transport phenomena is not necessary for explaining the behavior and timemore » scales of cold-pulse experiments in tokamak plasmas.« less

Explaining Cold-Pulse Dynamics in Tokamak Plasmas Using Local Turbulent Transport Models

DOE Office of Scientific and Technical Information (OSTI.GOV)

Rodriguez-Fernandez, P.; White, A. E.; Howard, N. T.

A long-standing enigma in plasma transport has been resolved by modeling of cold-pulse experiments conducted on the Alcator C-Mod tokamak. Controlled edge cooling of fusion plasmas triggers core electron heating on time scales faster than an energy confinement time, which has long been interpreted as strong evidence of nonlocal transport. Here, this Letter shows that the steady-state profiles, the cold-pulse rise time, and disappearance at higher density as measured in these experiments are successfully captured by a recent local quasilinear turbulent transport model, demonstrating that the existence of nonlocal transport phenomena is not necessary for explaining the behavior and timemore » scales of cold-pulse experiments in tokamak plasmas.« less

Multidimensional oriented solid-state NMR experiments enable the sequential assignment of uniformly 15N labeled integral membrane proteins in magnetically aligned lipid bilayers.

PubMed

Mote, Kaustubh R; Gopinath, T; Traaseth, Nathaniel J; Kitchen, Jason; Gor'kov, Peter L; Brey, William W; Veglia, Gianluigi

2011-11-01

Oriented solid-state NMR is the most direct methodology to obtain the orientation of membrane proteins with respect to the lipid bilayer. The method consists of measuring (1)H-(15)N dipolar couplings (DC) and (15)N anisotropic chemical shifts (CSA) for membrane proteins that are uniformly aligned with respect to the membrane bilayer. A significant advantage of this approach is that tilt and azimuthal (rotational) angles of the protein domains can be directly derived from analytical expression of DC and CSA values, or, alternatively, obtained by refining protein structures using these values as harmonic restraints in simulated annealing calculations. The Achilles' heel of this approach is the lack of suitable experiments for sequential assignment of the amide resonances. In this Article, we present a new pulse sequence that integrates proton driven spin diffusion (PDSD) with sensitivity-enhanced PISEMA in a 3D experiment ([(1)H,(15)N]-SE-PISEMA-PDSD). The incorporation of 2D (15)N/(15)N spin diffusion experiments into this new 3D experiment leads to the complete and unambiguous assignment of the (15)N resonances. The feasibility of this approach is demonstrated for the membrane protein sarcolipin reconstituted in magnetically aligned lipid bicelles. Taken with low electric field probe technology, this approach will propel the determination of sequential assignment as well as structure and topology of larger integral membrane proteins in aligned lipid bilayers. © Springer Science+Business Media B.V. 2011

The efficacy of sugar labeling formats: Implications for labeling policy.

PubMed

Vanderlee, Lana; White, Christine M; Bordes, Isabelle; Hobin, Erin P; Hammond, David

2015-12-01

To examine knowledge of sugar recommendations and test the efficacy of formats for labeling total and added sugar on pre-packaged foods. Online surveys were conducted among 2008 Canadians aged 16-24. Participants were asked to identify recommended limits for total and added sugar consumption. In Experiment 1, participants were randomized to one of six labeling conditions with varying information for total sugar for a high- or low-sugar product and were asked to identify the relative amount of total sugar in the product. In Experiment 2, participants were randomized to one of three labels with different added sugar formats and were asked if the product contained added sugar and the relative amount of added sugar. Few young people correctly identified recommendations for total sugar (5%) or added sugar (7%). In Experiment 1, those who were shown percent daily value information were more likely to correctly identify the relative amount of total sugar (P < 0.05). In Experiment 2, those shown added sugar information were more likely to correctly identify that the product contained added sugar and the relative amount of added sugar in the product (P < 0.05). Improved labeling may improve consumer understanding of the amount of sugars in food products. © 2015 The Obesity Society.

Respiration of the external mycelium in the arbuscular mycorrhizal symbiosis shows strong dependence on recent photosynthates and acclimation to temperature.

PubMed

Heinemeyer, A; Ineson, P; Ostle, N; Fitter, A H

2006-01-01

* Although arbuscular mycorrhizal (AM) fungi are a major pathway in the global carbon cycle, their basic biology and, in particular, their respiratory response to temperature remain obscure. * A pulse label of the stable isotope (13)C was applied to Plantago lanceolata, either uninoculated or inoculated with the AM fungus Glomus mosseae. The extra-radical mycelium (ERM) of the fungus was allowed to grow into a separate hyphal compartment excluding roots. We determined the carbon costs of the ERM and tested for a direct temperature effect on its respiration by measuring total carbon and the (13)C:(12)C ratio of respired CO(2). With a second pulse we tested for acclimation of ERM respiration after 2 wk of soil warming. * Root colonization remained unchanged between the two pulses but warming the hyphal compartment increased ERM length. delta(13)C signals peaked within the first 10 h and were higher in mycorrhizal treatments. The concentration of CO(2) in the gas samples fluctuated diurnally and was highest in the mycorrhizal treatments but was unaffected by temperature. Heating increased ERM respiration only after the first pulse and reduced specific ERM respiration rates after the second pulse; however, both pulses strongly depended on radiation flux. * The results indicate a fast ERM acclimation to temperature, and that light is the key factor controlling carbon allocation to the fungus.

Light-Induced resetting of the circadian pacemaker: quantitative analysis of transient versus steady-state phase shifts.

PubMed

Watanabe, K; Deboer, T; Meijer, J H

2001-12-01

The suprachiasmatic nuclei of the hypothalamus contain the major circadian pacemaker in mammals, driving circadian rhythms in behavioral and physiological functions. This circadian pacemaker's responsiveness to light allows synchronization to the light-dark cycle. Phase shifting by light often involves several transient cycles in which the behavioral activity rhythm gradually shifts to its steady-state position. In this article, the authors investigate in Syrian hamsters whether a phase-advancing light pulse results in immediate shifts of the PRC at the next circadian cycle. In a first series of experiments, the authors aimed a light pulse at CT 19 to induce a phase advance. It appeared that the steady-state phase advances were highly correlated with activity onset in the first and second transient cycle. This enabled them to make a reliable estimate of the steady-state phase shift induced by a phase-advancing light pulse on the basis of activity onset in the first transient cycle. In the next series of experiments, they presented a light pulse at CT 19, which was followed by a second light pulse aimed at the delay zone of the PRC on the next circadian cycle. The immediate and steady-state phase delays induced by the second light pulse were compared with data from a third experiment in which animals received a phase-delaying light pulse only. The authors observed that the waveform of the phase-delay part of the PRC (CT 12-16) obtained in Experiment 2 was virtually identical to the phase-delay part of the PRC for a single light pulse (obtained in Experiment 3). This finding allowed for a quantitative assessment of the data. The analysis indicates that the delay part of the PRC-between CT 12 and CT 16-is rapidly reset following a light pulse at CT 19. These findings complement earlier findings in the hamster showing that after a light pulse at CT 19, the phase-advancing part of the PRC is immediately shifted. Together, the data indicate that the basis for phase advancing involves rapid resetting of both advance and delay components of the PRC.

Experiments with linear compressors for phase shifting in pulse tube crycoolers

NASA Astrophysics Data System (ADS)

Lewis, Michael; Bradley, Peter; Radebaugh, Ray

2012-06-01

For the past year NIST has been investigating the use of mechanical phase shifters as warm expanders for pulse tube cryocoolers. Unlike inertance tubes, which have a limited phase shifting ability at low acoustic powers, mechanical phase shifters have the ability to provide nearly any phase angle between the mass flow and the pressure. We discuss our results with experiments and modeling on a commercially available miniature linear compressor operating as an expander on the warm-end of a 4 K pulse tube, whose temperature is nominally about 35 K. We also present results on experiments with a linear compressor operating at room temperature but coupled to the 4 K stage through secondary regenerators and secondary pulse tubes. Experiments on a small pulse tube test apparatus with both 4He and 3He showed improved efficiency when using the mechanical expander over that of inertance tubes. Phase locking techniques using function generators and power amplifiers for control of phase angle are detailed. The use of expanders demonstrates flexible control in optimizing phase angles for improved cryocooler performance.

Status and Planned Experiments of the Hiradmat Pulsed Beam Material Test Facility at CERN SPS

DOE Office of Scientific and Technical Information (OSTI.GOV)

Charitonidis, Nikolaos; Efthymiopoulos, Ilias; Fabich, Adrian

2015-06-01

HiRadMat (High Irradiation to Materials) is a facility at CERN designed to provide high-intensity pulsed beams to an irradiation area where material samples as well as accelerator component assemblies (e.g. vacuum windows, shock tests on high power targets, collimators) can be tested. The beam parameters (SPS 440 GeV protons with a pulse energy of up to 3.4 MJ, or alternatively lead/argon ions at the proton equivalent energy) can be tuned to match the needs of each experiment. It is a test area designed to perform single pulse experiments to evaluate the effect of high-intensity pulsed beams on materials in amore » dedicated environment, excluding long-time irradiation studies. The facility is designed for a maximum number of 1016 protons per year, in order to limit the activation of the irradiated samples to acceptable levels for human intervention. This paper will demonstrate the possibilities for research using this facility and go through examples of upcoming experiments scheduled in the beam period 2015/2016.« less

Buoyancy Effects in Fully-Modulated, Turbulent Diffusion Flames

NASA Technical Reports Server (NTRS)

Hermanson, J. C.; Johari, H.; Ghaem-Maghami, E.; Stocker, D. P.; Hegde, U. G.; Page, K. L.

2003-01-01

Pulsed combustion appears to have the potential to provide for rapid fuel/air mixing, compact and economical combustors, and reduced exhaust emissions. The objective of this experiment (PuFF, for Pulsed-Fully Flames) is to increase the fundamental understanding of the fuel/air mixing and combustion behavior of pulsed, turbulent diffusion flames by conducting experiments in microgravity. In this research the fuel jet is fully-modulated (i.e., completely shut off between pulses) by an externally controlled valve system. This gives rise to drastic modification of the combustion and flow characteristics of flames, leading to enhanced fuel/air mixing compared to acoustically excited or partially-modulated jets. Normal-gravity experiments suggest that the fully-modulated technique also has the potential for producing turbulent jet flames significantly more compact than steady flames with no increase in exhaust emissions. The technique also simplifies the combustion process by avoiding the acoustic forcing generally present in pulsed combustors. Fundamental issues addressed in this experiment include the impact of buoyancy on the structure and flame length, temperatures, radiation, and emissions of fully-modulated flames.

High-resolution four-dimensional carbon-correlated 1H- 1H ROESY experiments employing isotags and the filter diagonalization method for effective assignment of glycosidic linkages in oligosaccharides

NASA Astrophysics Data System (ADS)

Armstrong, Geoffrey S.; Bendiak, Brad

2006-07-01

Four-dimensional nuclear magnetic resonance spectroscopy of oligosaccharides that correlates 1H-1H ROESY cross peaks to two additional 13C frequency dimensions is reported. The 13C frequencies were introduced by derivatization of all free hydroxyl groups with doubly 13C-labeled acetyl isotags. Pulse sequences were optimized for processing with the filter diagonalization method. The extensive overlap typically observed in 2D ROESY 1H-1H planes was alleviated by resolution of ROESY cross peaks in the two added dimensions associated with the carbon frequencies of the isotags. This enabled the interresidue 1H-1H ROESY cross peaks to be unambiguously assigned hence spatially proximate sugar spin systems across glycosidic bonds could be effectively ascertained. An experiment that selectively amplifies interresidue ROESY 1H-1H cross peaks is also reported. It moves the magnetization of an intraresidue proton normally correlated to a sugar H-1 signal orthogonally along the z axis prior to a Tr-ROESY mixing sequence. This virtually eliminates the incoherent intraresidue ROESY transfer, suppresses coherent TOCSY transfer, and markedly enhances the intensity of interresidue ROESY cross peaks.

High-resolution four-dimensional carbon-correlated 1H-1H ROESY experiments employing isotags and the filter diagonalization method for effective assignment of glycosidic linkages in oligosaccharides.

PubMed

Armstrong, Geoffrey S; Bendiak, Brad

2006-07-01

Four-dimensional nuclear magnetic resonance spectroscopy of oligosaccharides that correlates 1H-1H ROESY cross peaks to two additional 13C frequency dimensions is reported. The 13C frequencies were introduced by derivatization of all free hydroxyl groups with doubly 13C-labeled acetyl isotags. Pulse sequences were optimized for processing with the filter diagonalization method. The extensive overlap typically observed in 2D ROESY 1H-1H planes was alleviated by resolution of ROESY cross peaks in the two added dimensions associated with the carbon frequencies of the isotags. This enabled the interresidue 1H-1H ROESY cross peaks to be unambiguously assigned hence spatially proximate sugar spin systems across glycosidic bonds could be effectively ascertained. An experiment that selectively amplifies interresidue ROESY 1H-1H cross peaks is also reported. It moves the magnetization of an intraresidue proton normally correlated to a sugar H-1 signal orthogonally along the z axis prior to a Tr-ROESY mixing sequence. This virtually eliminates the incoherent intraresidue ROESY transfer, suppresses coherent TOCSY transfer, and markedly enhances the intensity of interresidue ROESY cross peaks.

Does an understanding of ecosystems responses to rainfall pulses improve predictions of responses of drylands to climate change?

USDA-ARS?s Scientific Manuscript database

Drylands will experience more intense and frequent droughts and floods. Ten-year field experiments manipulating the amount and variability of precipitation suggest that we cannot predict responses of drylands to climate change based on pulse experimentation. Long-term drought experiments showed no e...

Are Luxury Brand Labels and “Green” Labels Costly Signals of Social Status? An Extended Replication

PubMed Central

2017-01-01

Costly signaling theory provides an explanation for why humans are willing to a pay a premium for conspicuous products such as luxury brand-labeled clothing or conspicuous environmentally friendly cars. According to the theory, the extra cost of such products is a signal of social status and wealth and leads to advantages in social interactions for the signaler. A previous study found positive evidence for the case of luxury brand labels. However, an issue of this study was that some of the experiments were not conducted in a perfectly double-blind manner. I resolved this by replicating variations of the original design in a double-blind procedure. Additionally, besides the luxury label condition, I introduced a “green” label condition. Thus, the hypothesis that signaling theory is able to explain pro-environmental behavior was tested for the first time in a natural field setting. Further, I conducted experiments in both average and below-average socioeconomic neighborhoods, where, according to signaling theory, the effects of luxury signals should be even stronger. In contrast to the original study, I did not find positive effects of the luxury brand label in any of the five experiments. Nor did I find evidence for a green-signaling effect. Moreover, in poor neighborhoods a negative tendency of the luxury label actually became evident. This suggests that a signaling theory explanation of costly labels must take into account the characteristics of the observers, e.g. their social status. PMID:28170399

Are Luxury Brand Labels and "Green" Labels Costly Signals of Social Status? An Extended Replication.

PubMed

Berger, Joël

2017-01-01

Costly signaling theory provides an explanation for why humans are willing to a pay a premium for conspicuous products such as luxury brand-labeled clothing or conspicuous environmentally friendly cars. According to the theory, the extra cost of such products is a signal of social status and wealth and leads to advantages in social interactions for the signaler. A previous study found positive evidence for the case of luxury brand labels. However, an issue of this study was that some of the experiments were not conducted in a perfectly double-blind manner. I resolved this by replicating variations of the original design in a double-blind procedure. Additionally, besides the luxury label condition, I introduced a "green" label condition. Thus, the hypothesis that signaling theory is able to explain pro-environmental behavior was tested for the first time in a natural field setting. Further, I conducted experiments in both average and below-average socioeconomic neighborhoods, where, according to signaling theory, the effects of luxury signals should be even stronger. In contrast to the original study, I did not find positive effects of the luxury brand label in any of the five experiments. Nor did I find evidence for a green-signaling effect. Moreover, in poor neighborhoods a negative tendency of the luxury label actually became evident. This suggests that a signaling theory explanation of costly labels must take into account the characteristics of the observers, e.g. their social status.

High Frequency, High Gradient Dielectric Wakefield Acceleration Experiments at SLAC and BNL

DOE Office of Scientific and Technical Information (OSTI.GOV)

Rosenzweig, James; /UCLA; Travish, Gil

Given the recent success of >GV/m dielectric wakefield accelerator (DWA) breakdown experiments at SLAC, and follow-on coherent Cerenkov radiation production at the UCLA Neptune, a UCLA-USC-SLAC collaboration is now implementing a new set of experiments that explore various DWA scenarios. These experiments are motivated by the opportunities presented by the approval of FACET facility at SLAC, as well as unique pulse-train wakefield drivers at BNL. The SLAC experiments permit further exploration of the multi-GeV/m envelope in DWAs, and will entail investigations of novel materials (e.g. CVD diamond) and geometries (Bragg cylindrical structures, slab-symmetric DWAs), and have an over-riding goal ofmore » demonstrating >GeV acceleration in {approx}33 cm DWA tubes. In the nearer term before FACET's commissioning, we are planning measurements at the BNL ATF, in which we drive {approx}50-200 MV/m fields with single pulses or pulse trains. These experiments are of high relevance to enhancing linear collider DWA designs, as they will demonstrate potential for efficient operation with pulse trains.« less

Outlook for metal lasers

NASA Technical Reports Server (NTRS)

Russell, G. R.

1976-01-01

Lasers utilizing atomic metallic vapors are considered with emphasis on a double discharge technique and multiply pulsed experiments. Data are presented on the effect of time delay after the first electrical discharge and the effect of lasant temperature along with results of absorption measurements utilizing a 13 mm diameter laser tube. Data obtained from multiply pulsed experiments for discharge diameters varying from 1 to 4 cm indicate that the efficiency increases with the pulsing rate.

Arterial spin-labeling assessment of normalized vascular intratumoral signal intensity as a predictor of histologic grade of astrocytic neoplasms.

PubMed

Furtner, J; Schöpf, V; Schewzow, K; Kasprian, G; Weber, M; Woitek, R; Asenbaum, U; Preusser, M; Marosi, C; Hainfellner, J A; Widhalm, G; Wolfsberger, S; Prayer, D

2014-03-01

Pulsed arterial spin-labeling is a noninvasive MR imaging perfusion method performed with the use of water in the arterial blood as an endogenous contrast agent. The purpose of this study was to determine the inversion time with the largest difference in normalized intratumoral signal intensity between high-grade and low-grade astrocytomas. Thirty-three patients with gliomas, histologically classified as low-grade (n = 7) or high-grade astrocytomas (n = 26) according to the World Health Organization brain tumor classification, were included. A 3T MR scanner was used to perform pulsed arterial spin-labeling measurements at 8 different inversion times (370 ms, 614 ms, 864 ms, 1114 ms, 1364 ms, 1614 ms, 1864 ms, and 2114 ms). Normalized intratumoral signal intensity was calculated, which was defined by the signal intensity ratio of the tumor and the contralateral normal brain tissue for all fixed inversion times. A 3-way mixed ANOVA was used to reveal potential differences in the normalized vascular intratumoral signal intensity between high-grade and low-grade astrocytomas. The difference in normalized vascular intratumoral signal intensity between high-grade and low-grade astrocytomas obtained the most statistically significant results at 370 ms (P = .003, other P values ranged from .012-.955). The inversion time by which to differentiate high-grade and low-grade astrocytomas by use of normalized vascular intratumoral signal intensity was 370 ms in our study. The normalized vascular intratumoral signal intensity values at this inversion time mainly reflect the labeled intra-arterial blood bolus and therefore could be referred to as normalized vascular intratumoral signal intensity. Our data indicate that the use of normalized vascular intratumoral signal intensity values allows differentiation between low-grade and high-grade astrocytomas and thus may serve as a new, noninvasive marker for astrocytoma grading.

Arterial Transit Time-corrected Renal Blood Flow Measurement with Pulsed Continuous Arterial Spin Labeling MR Imaging.

PubMed

Shimizu, Kazuhiro; Kosaka, Nobuyuki; Fujiwara, Yasuhiro; Matsuda, Tsuyoshi; Yamamoto, Tatsuya; Tsuchida, Tatsuro; Tsuchiyama, Katsuki; Oyama, Nobuyuki; Kimura, Hirohiko

2017-01-10

The importance of arterial transit time (ATT) correction for arterial spin labeling MRI has been well debated in neuroimaging, but it has not been well evaluated in renal imaging. The purpose of this study was to evaluate the feasibility of pulsed continuous arterial spin labeling (pcASL) MRI with multiple post-labeling delay (PLD) acquisition for measuring ATT-corrected renal blood flow (ATC-RBF). A total of 14 volunteers were categorized into younger (n = 8; mean age, 27.0 years) and older groups (n = 6; 64.8 years). Images of pcASL were obtained at three different PLDs (0.5, 1.0, and 1.5 s), and ATC-RBF and ATT were calculated using a single-compartment model. To validate ATC-RBF, a comparative study of effective renal plasma flow (ERPF) measured by 99m Tc-MAG3 scintigraphy was performed. ATC-RBF was corrected by kidney volume (ATC-cRBF) for comparison with ERPF. The younger group showed significantly higher ATC-RBF (157.68 ± 38.37 mL/min/100 g) and shorter ATT (961.33 ± 260.87 ms) than the older group (117.42 ± 24.03 mL/min/100 g and 1227.94 ± 226.51 ms, respectively; P < 0.05). A significant correlation was evident between ATC-cRBF and ERPF (P < 0.05, r = 0.47). With suboptimal single PLD (1.5 s) settings, there was no significant correlation between ERPF and kidney volume-corrected RBF calculated from single PLD data. Calculation of ATT and ATC-RBF by pcASL with multiple PLD was feasible in healthy volunteers, and differences in ATT and ATC-RBF were seen between the younger and older groups. Although ATT correction by multiple PLD acquisitions may not always be necessary for RBF quantification in the healthy subjects, the effect of ATT should be taken into account in renal ASL-MRI as debated in brain imaging.

Medial forebrain bundle lesions fail to structurally and functionally disconnect the ventral tegmental area from many ipsilateral forebrain nuclei: implications for the neural substrate of brain stimulation reward.

PubMed

Simmons, J M; Ackermann, R F; Gallistel, C R

1998-10-15

Lesions in the medial forebrain bundle rostral to a stimulating electrode have variable effects on the rewarding efficacy of self-stimulation. We attempted to account for this variability by measuring the anatomical and functional effects of electrolytic lesions at the level of the lateral hypothalamus (LH) and by correlating these effects to postlesion changes in threshold pulse frequency (pps) for self-stimulation in the ventral tegmental area (VTA). We implanted True Blue in the VTA and compared cell labeling patterns in forebrain regions of intact and lesioned animals. We also compared stimulation-induced regional [14C]deoxyglucose (DG) accumulation patterns in the forebrains of intact and lesioned animals. As expected, postlesion threshold shifts varied: threshold pps remained the same or decreased in eight animals, increased by small but significant amounts in three rats, and increased substantially in six subjects. Unexpectedly, LH lesions did not anatomically or functionally disconnect all forebrain nuclei from the VTA. Most septal and preoptic regions contained equivalent levels of True Blue label in intact and lesioned animals. In both intact and lesioned groups, VTA stimulation increased metabolic activity in the fundus of the striatum (FS), the nucleus of the diagonal band, and the medial preoptic area. On the other hand, True Blue labeling demonstrated anatomical disconnection of the accumbens, FS, substantia innominata/magnocellular preoptic nucleus (SI/MA), and bed nucleus of the stria terminalis. [14C]DG autoradiography indicated functional disconnection of the lateral preoptic area and SI/MA. Correlations between patterns of True Blue labeling or [14C]deoxyglucose accumulation and postlesion shifts in threshold pulse frequency were weak and generally negative. These direct measures of connectivity concord with the behavioral measures in suggesting a diffuse net-like connection between forebrain nuclei and the VTA.

A versatile computer-controlled pulsed nuclear quadrupole resonance spectrometer

NASA Astrophysics Data System (ADS)

Fisher, Gregory; MacNamara, Ernesto; Santini, Robert E.; Raftery, Daniel

1999-12-01

A new, pulsed nuclear quadrupole resonance (NQR) spectrometer capable of performing a variety of pulsed and swept experiments is described. The spectrometer features phase locked, superheterodyne detection using a commercial spectrum analyzer and a fully automatic, computer-controlled tuning and matching network. The tuning and matching network employs stepper motors which turn high power air gap capacitors in a "moving grid" optimization strategy to minimize the reflected power from a directional coupler. In the duplexer circuit, digitally controlled relays are used to switch different lengths of coax cable appropriate for the different radio frequencies. A home-built pulse programmer card controls the timing of radio frequency pulses sent to the probe, while data acquisition and control software is written in Microsoft Quick Basic. Spin-echo acquisition experiments are typically used to acquire the data, although a variety of pulse sequences can be employed. Scan times range from one to several hours depending upon the step resolution and the spectral range required for each experiment. Pure NQR spectra of NaNO2 and 3-aminopyridine are discussed.

3D GRASE PROPELLER: improved image acquisition technique for arterial spin labeling perfusion imaging.

PubMed

Tan, Huan; Hoge, W Scott; Hamilton, Craig A; Günther, Matthias; Kraft, Robert A

2011-07-01

Arterial spin labeling is a noninvasive technique that can quantitatively measure cerebral blood flow. While traditionally arterial spin labeling employs 2D echo planar imaging or spiral acquisition trajectories, single-shot 3D gradient echo and spin echo (GRASE) is gaining popularity in arterial spin labeling due to inherent signal-to-noise ratio advantage and spatial coverage. However, a major limitation of 3D GRASE is through-plane blurring caused by T(2) decay. A novel technique combining 3D GRASE and a periodically rotated overlapping parallel lines with enhanced reconstruction trajectory (PROPELLER) is presented to minimize through-plane blurring without sacrificing perfusion sensitivity or increasing total scan time. Full brain perfusion images were acquired at a 3 × 3 × 5 mm(3) nominal voxel size with pulsed arterial spin labeling preparation sequence. Data from five healthy subjects was acquired on a GE 1.5T scanner in less than 4 minutes per subject. While showing good agreement in cerebral blood flow quantification with 3D gradient echo and spin echo, 3D GRASE PROPELLER demonstrated reduced through-plane blurring, improved anatomical details, high repeatability and robustness against motion, making it suitable for routine clinical use. Copyright © 2011 Wiley-Liss, Inc.

Nuclear spin-lattice relaxation in nitroxide spin-label EPR.

PubMed

Marsh, Derek

2016-11-01

Nuclear relaxation is a sensitive monitor of rotational dynamics in spin-label EPR. It also contributes competing saturation transfer pathways in T 1 -exchange spectroscopy, and the determination of paramagnetic relaxation enhancement in site-directed spin labelling. A survey shows that the definition of nitrogen nuclear relaxation rate W n commonly used in the CW-EPR literature for 14 N-nitroxyl spin labels is inconsistent with that currently adopted in time-resolved EPR measurements of saturation recovery. Redefinition of the normalised 14 N spin-lattice relaxation rate, b=W n /(2W e ), preserves the expressions used for CW-EPR, whilst rendering them consistent with expressions for saturation recovery rates in pulsed EPR. Furthermore, values routinely quoted for nuclear relaxation times that are deduced from EPR spectral diffusion rates in 14 N-nitroxyl spin labels do not accord with conventional analysis of spin-lattice relaxation in this three-level system. Expressions for CW-saturation EPR with the revised definitions are summarised. Data on nitrogen nuclear spin-lattice relaxation times are compiled according to the three-level scheme for 14 N-relaxation: T 1 n =1/W n . Results are compared and contrasted with those for the two-level 15 N-nitroxide system. Copyright © 2016 Elsevier Inc. All rights reserved.

Burst-mode optical label processor with ultralow power consumption.

PubMed

Ibrahim, Salah; Nakahara, Tatsushi; Ishikawa, Hiroshi; Takahashi, Ryo

2016-04-04

A novel label processor subsystem for 100-Gbps (25-Gbps × 4λs) burst-mode optical packets is developed, in which a highly energy-efficient method is pursued for extracting and interfacing the ultrafast packet-label to a CMOS-based processor where label recognition takes place. The method involves performing serial-to-parallel conversion for the label bits on a bit-by-bit basis by using an optoelectronic converter that is operated with a set of optical triggers generated in a burst-mode manner upon packet arrival. Here we present three key achievements that enabled a significant reduction in the total power consumption and latency of the whole subsystem; 1) based on a novel operation mechanism for providing amplification with bit-level selectivity, an optical trigger pulse generator, that consumes power for a very short duration upon packet arrival, is proposed and experimentally demonstrated, 2) the energy of optical triggers needed by the optoelectronic serial-to-parallel converter is reduced by utilizing a negative-polarity signal while employing an enhanced conversion scheme entitled the discharge-or-hold scheme, 3) the necessary optical trigger energy is further cut down by half by coupling the triggers through the chip's backside, whereas a novel lens-free packaging method is developed to enable a low-cost alignment process that works with simple visual observation.

Outcomes of self-labeling sexual harassment.

PubMed

Magley, V J; Hulin, C L; Fitzgerald, L F; DeNardo, M

1999-06-01

Research has consistently documented a discrepancy between experiencing offensive sex-related behaviors and labeling these situations as sexual harassment, leading to several attempts to understand this phenomenon. The authors propose that the issue of why it is that women who report such experiences generally do not indicate that they have been sexually harassed is an important psychological question, and may provide a path through the nested meanings of workplace harassment. The authors argue for the value of moving beyond a descriptive approach to this issue by examining the effects of self-labeling on the psychological, health, and work-related outcomes of unwelcome, sex-related experiences. They present data from female employees working in 3 separate organizations, demonstrating that women exposed to such behaviors report very similar consequences, whether they label their experiences as harassment or not.

Sulphur tracer experiments in laboratory animals using 34S-labelled yeast.

PubMed

Martínez-Sierra, J Giner; Moreno Sanz, F; Herrero Espílez, P; Marchante Gayón, J M; Rodríguez Fernández, J; García Alonso, J I

2013-03-01

We have evaluated the use of (34)S-labelled yeast to perform sulphur metabolic tracer experiments in laboratory animals. The proof of principle work included the selection of the culture conditions for the preparation of sulphur labelled yeast, the study of the suitability of this labelled yeast as sulphur source for tracer studies using in vitro gastrointestinal digestion and the administration of the (34)S-labelled yeast to laboratory animals to follow the fate and distribution of (34)S in the organism. For in vitro gastrointestinal digestion, the combination of sodium dodecyl sulphate-polyacrylamide gel electrophoresis and high-performance liquid chromatography and inductively coupled plasma mass spectrometry (HPLC-ICP-MS) showed that labelled methionine, cysteine and other low molecular weight sulphur-containing biomolecules were the major components in the digested extracts of the labelled yeast. Next, in vivo kinetic experiments were performed in healthy Wistar rats after the oral administration of (34)S-labelled yeast. The isotopic composition of total sulphur in tissues, urine and faeces was measured by double-focusing inductively coupled plasma mass spectrometry after microwave digestion. It was observed that measurable isotopic enrichments were detected in all samples. Finally, initial investigations on sulphur isotopic composition of serum and urine samples by HPLC-ICP-MS have been carried out. For serum samples, no conclusive data were obtained. Interestingly, chromatographic analysis of urine samples showed differential isotope enrichment for several sulphur-containing biomolecules.

Do labeled versus unlabeled treatments of alternatives' names influence stated choice outputs? Results from a mode choice study.

PubMed

Jin, Wen; Jiang, Hai; Liu, Yimin; Klampfl, Erica

2017-01-01

Discrete choice experiments have been widely applied to elicit behavioral preferences in the literature. In many of these experiments, the alternatives are named alternatives, meaning that they are naturally associated with specific names. For example, in a mode choice study, the alternatives can be associated with names such as car, taxi, bus, and subway. A fundamental issue that arises in stated choice experiments is whether to treat the alternatives' names as labels (that is, labeled treatment), or as attributes (that is, unlabeled treatment) in the design as well as the presentation phases of the choice sets. In this research, we investigate the impact of labeled versus unlabeled treatments of alternatives' names on the outcome of stated choice experiments, a question that has not been thoroughly investigated in the literature. Using results from a mode choice study, we find that the labeled or the unlabeled treatment of alternatives' names in either the design or the presentation phase of the choice experiment does not statistically affect the estimates of the coefficient parameters. We then proceed to measure the influence toward the willingness-to-pay (WTP) estimates. By using a random-effects model to relate the conditional WTP estimates to the socioeconomic characteristics of the individuals and the labeled versus unlabeled treatments of alternatives' names, we find that: a) Given the treatment of alternatives' names in the presentation phase, the treatment of alternatives' names in the design phase does not statistically affect the estimates of the WTP measures; and b) Given the treatment of alternatives' names in the design phase, the labeled treatment of alternatives' names in the presentation phase causes the corresponding WTP estimates to be slightly higher.

Do labeled versus unlabeled treatments of alternatives’ names influence stated choice outputs? Results from a mode choice study

PubMed Central

Jin, Wen; Jiang, Hai; Liu, Yimin; Klampfl, Erica

2017-01-01

Discrete choice experiments have been widely applied to elicit behavioral preferences in the literature. In many of these experiments, the alternatives are named alternatives, meaning that they are naturally associated with specific names. For example, in a mode choice study, the alternatives can be associated with names such as car, taxi, bus, and subway. A fundamental issue that arises in stated choice experiments is whether to treat the alternatives’ names as labels (that is, labeled treatment), or as attributes (that is, unlabeled treatment) in the design as well as the presentation phases of the choice sets. In this research, we investigate the impact of labeled versus unlabeled treatments of alternatives’ names on the outcome of stated choice experiments, a question that has not been thoroughly investigated in the literature. Using results from a mode choice study, we find that the labeled or the unlabeled treatment of alternatives’ names in either the design or the presentation phase of the choice experiment does not statistically affect the estimates of the coefficient parameters. We then proceed to measure the influence toward the willingness-to-pay (WTP) estimates. By using a random-effects model to relate the conditional WTP estimates to the socioeconomic characteristics of the individuals and the labeled versus unlabeled treatments of alternatives’ names, we find that: a) Given the treatment of alternatives’ names in the presentation phase, the treatment of alternatives’ names in the design phase does not statistically affect the estimates of the WTP measures; and b) Given the treatment of alternatives’ names in the design phase, the labeled treatment of alternatives’ names in the presentation phase causes the corresponding WTP estimates to be slightly higher. PMID:28806764

Words, shape, visual search and visual working memory in 3-year-old children.

PubMed

Vales, Catarina; Smith, Linda B

2015-01-01

Do words cue children's visual attention, and if so, what are the relevant mechanisms? Across four experiments, 3-year-old children (N = 163) were tested in visual search tasks in which targets were cued with only a visual preview versus a visual preview and a spoken name. The experiments were designed to determine whether labels facilitated search times and to examine one route through which labels could have their effect: By influencing the visual working memory representation of the target. The targets and distractors were pictures of instances of basic-level known categories and the labels were the common name for the target category. We predicted that the label would enhance the visual working memory representation of the target object, guiding attention to objects that better matched the target representation. Experiments 1 and 2 used conjunctive search tasks, and Experiment 3 varied shape discriminability between targets and distractors. Experiment 4 compared the effects of labels to repeated presentations of the visual target, which should also influence the working memory representation of the target. The overall pattern fits contemporary theories of how the contents of visual working memory interact with visual search and attention, and shows that even in very young children heard words affect the processing of visual information. © 2014 John Wiley & Sons Ltd.

Albumin transcytosis from the pleural space.

PubMed

Agostoni, Emilio; Bodega, Francesca; Zocchi, Luciano

2002-11-01

Occurrence of transcytosis in pleural mesothelium was verified by measuring removal of labeled macromolecules from pleural liquid in experiments without and with nocodazole. To this end, we injected 0.3 ml of Ringer-albumin with 750 microg of albumin-Texas red or with 600 microg of dextran 70-Texas red in the right pleural space of anesthetized rabbits, and after 3 h we measured pleural liquid volume, labeled macromolecule concentration, and, hence, labeled macromolecule quantity in the liquid of this space. Labeled albumin left was 318 +/- 28 microg in control and 419 +/- 17 microg in nocodazole experiments (means +/- SE); hence, whereas ventilation was similar its removal was greater (P < 0.01) in control experiments. Labeled dextran left was 283 +/- 10 microg in control and 381 +/- 21 microg in nocodazole experiments; hence, whereas ventilation was similar its removal was greater (P < 0.01) in control experiments. These findings indicate occurrence of transcytosis from the pleural space. Liquid removed by transcytosis was 0.05 ml/h. This amount times unlabeled albumin concentration under physiological conditions (10 mg/ml) times lumen-vesicle partition coefficient for albumin (0.78) provides fluid-phase albumin transcytosis: approximately 203 microg. h(-1) kg(-2/3). Transcytosis might contribute a relevant part of protein and liquid removal from the pleural space.

Influence of a falling edge on high power microwave pulse combination

DOE Office of Scientific and Technical Information (OSTI.GOV)

Li, Jiawei; Huang, Wenhua; Science and Technology on High Power Microwave Laboratory, Northwest Institute of Nuclear Technology, Xi'an 710024

This paper presents an explanation of the influence of a microwave falling edge on high-power microwave pulse combination. Through particle-in-cell simulations, we discover that the falling edge is the driving factor that limits the output power of the combined pulses. We demonstrate that the space charge field, which accumulates to become comparable to the E-field at the falling edge of the former pulse, will trap the electrons in the gas layer and decrease its energy to attain a high ionization rate. Hence, avalanche discharge, caused by trapped electrons, makes the plasma density to approach the critical density and cuts offmore » the latter microwave pulse. An X-band combination experiment is conducted with different pulse intervals. This experiment confirms that the high density plasma induced by the falling edge can cut off the latter pulse, and that the time required for plasma recombination in the transmission channel is several microseconds. To ensure a high output power for combined pulses, the latter pulse should be moved ahead of the falling edge of the former one, and consequently, a beat wave with high peak power becomes the output by adding two pulses with normal amplitudes.« less

Influence of a falling edge on high power microwave pulse combination

NASA Astrophysics Data System (ADS)

Li, Jiawei; Huang, Wenhua; Zhu, Qi; Xiao, Renzhen; Shao, Hao

2016-07-01

This paper presents an explanation of the influence of a microwave falling edge on high-power microwave pulse combination. Through particle-in-cell simulations, we discover that the falling edge is the driving factor that limits the output power of the combined pulses. We demonstrate that the space charge field, which accumulates to become comparable to the E-field at the falling edge of the former pulse, will trap the electrons in the gas layer and decrease its energy to attain a high ionization rate. Hence, avalanche discharge, caused by trapped electrons, makes the plasma density to approach the critical density and cuts off the latter microwave pulse. An X-band combination experiment is conducted with different pulse intervals. This experiment confirms that the high density plasma induced by the falling edge can cut off the latter pulse, and that the time required for plasma recombination in the transmission channel is several microseconds. To ensure a high output power for combined pulses, the latter pulse should be moved ahead of the falling edge of the former one, and consequently, a beat wave with high peak power becomes the output by adding two pulses with normal amplitudes.

Fluorescence imaging in the upper gastrointestinal tract for the detection of dysplasic changes

NASA Astrophysics Data System (ADS)

Sukowski, Uwe; Ebert, Bernd; Ortner, Marianne; Mueller, Karsten; Voderholzer, W.; Weber-Eibel, J.; Dietel, M.; Lochs, Herbert; Rinneberg, Herbert H.

2001-10-01

During endoscopy of the esophagus fluorescence images were recorded at a delay of 20 ns after pulsed laser excitation simultaneously with conventional reflected white light images. To label malignant cells (dysplasia, tumor) 5-aminolaevulinic acid was applied prior to fluorescence guided bi-opsy. In this way pre-malignant and malignant lesions were detected not seen previously during routine endoscopy.

A Ku band pulsed electron paramagnetic resonance spectrometer using an arbitrary waveform generator for quantum control experiments at millikelvin temperatures

DOE Office of Scientific and Technical Information (OSTI.GOV)

Yap, Yung Szen, E-mail: yungszen@utm.my; Faculty of Science, Universiti Teknologi Malaysia, 81310 UTM Johor Bahru, Johor; Tabuchi, Yutaka

2015-06-15

We present a 17 GHz (Ku band) arbitrary waveform pulsed electron paramagnetic resonance spectrometer for experiments down to millikelvin temperatures. The spectrometer is located at room temperature, while the resonator is placed either in a room temperature magnet or inside a cryogen-free dilution refrigerator; the operating temperature range of the dilution unit is from ca. 10 mK to 8 K. This combination provides the opportunity to perform quantum control experiments on electron spins in the pure-state regime. At 0.6 T, spin echo experiments were carried out using γ-irradiated quartz glass from 1 K to 12.3 mK. With decreasing temperatures, wemore » observed an increase in spin echo signal intensities due to increasing spin polarizations, in accordance with theoretical predictions. Through experimental data fitting, thermal spin polarization at 100 mK was estimated to be at least 99%, which was almost pure state. Next, to demonstrate the ability to create arbitrary waveform pulses, we generate a shaped pulse by superposing three Gaussian pulses of different frequencies. The resulting pulse was able to selectively and coherently excite three different spin packets simultaneously—a useful ability for analyzing multi-spin system and for controlling a multi-qubit quantum computer. By applying this pulse to the inhomogeneously broadened sample, we obtain three well-resolved excitations at 8 K, 1 K, and 14 mK.« less

Bidirectional reaction steps in metabolic networks: I. Modeling and simulation of carbon isotope labeling experiments.

PubMed

Wiechert, W; de Graaf, A A

1997-07-05

The extension of metabolite balancing with carbon labeling experiments, as described by Marx et al. (Biotechnol. Bioeng. 49: 11-29), results in a much more detailed stationary metabolic flux analysis. As opposed to basic metabolite flux balancing alone, this method enables both flux directions of bidirectional reaction steps to be quantitated. However, the mathematical treatment of carbon labeling systems is much more complicated, because it requires the solution of numerous balance equations that are bilinear with respect to fluxes and fractional labeling. In this study, a universal modeling framework is presented for describing the metabolite and carbon atom flux in a metabolic network. Bidirectional reaction steps are extensively treated and their impact on the system's labeling state is investigated. Various kinds of modeling assumptions, as usually made for metabolic fluxes, are expressed by linear constraint equations. A numerical algorithm for the solution of the resulting linear constrained set of nonlinear equations is developed. The numerical stability problems caused by large bidirectional fluxes are solved by a specially developed transformation method. Finally, the simulation of carbon labeling experiments is facilitated by a flexible software tool for network synthesis. An illustrative simulation study on flux identifiability from available flux and labeling measurements in the cyclic pentose phosphate pathway of a recombinant strain of Zymomonas mobilis concludes this contribution.

Dipolar recoupling in solid state NMR by phase alternating pulse sequences

PubMed Central

Lin, J.; Bayro, M.; Griffin, R. G.; Khaneja, N.

2009-01-01

We describe some new developments in the methodology of making heteronuclear and homonuclear recoupling experiments in solid state NMR insensitive to rf-inhomogeneity by phase alternating the irradiation on the spin system every rotor period. By incorporating delays of half rotor periods in the pulse sequences, these phase alternating experiments can be made γ encoded. The proposed methodology is conceptually different from the standard methods of making recoupling experiments robust by the use of ramps and adiabatic pulses in the recoupling periods. We show how the concept of phase alternation can be incorporated in the design of homonuclear recoupling experiments that are both insensitive to chemical-shift dispersion and rf-inhomogeneity. PMID:19157931

The Role of Linguistic Labels in Inductive Generalization

ERIC Educational Resources Information Center

Deng, W.; Sloutsky, Vladimir M.

2013-01-01

What is the role of linguistic labels in inductive generalization? According to one approach labels denote categories and differ from object features, whereas according to another approach labels start out as features and may become category markers in the course of development. This issue was addressed in four experiments with 4- and 5-year-olds…

Learning Words from Labeling and Directive Speech

ERIC Educational Resources Information Center

Callanan, Maureen A.; Akhtar, Nameera; Sussman, Lisa

2014-01-01

Despite the common intuition that labeling may be the best way to teach a new word to a child, systematic testing is needed of the prediction that children learn words better from labeling utterances than from directive utterances. Two experiments compared toddlers' label learning in the context of hearing words used in directive versus labeling…

An Automatic Segmentation and Classification Framework Based on PCNN Model for Single Tooth in MicroCT Images.

PubMed

Wang, Liansheng; Li, Shusheng; Chen, Rongzhen; Liu, Sze-Yu; Chen, Jyh-Cheng

2016-01-01

Accurate segmentation and classification of different anatomical structures of teeth from medical images plays an essential role in many clinical applications. Usually, the anatomical structures of teeth are manually labelled by experienced clinical doctors, which is time consuming. However, automatic segmentation and classification is a challenging task because the anatomical structures and surroundings of the tooth in medical images are rather complex. Therefore, in this paper, we propose an effective framework which is designed to segment the tooth with a Selective Binary and Gaussian Filtering Regularized Level Set (GFRLS) method improved by fully utilizing three dimensional (3D) information, and classify the tooth by employing unsupervised learning Pulse Coupled Neural Networks (PCNN) model. In order to evaluate the proposed method, the experiments are conducted on the different datasets of mandibular molars and the experimental results show that our method can achieve better accuracy and robustness compared to other four state of the art clustering methods.

Kinetics and Mechanism of Mammalian Mitochondrial Ribosome Assembly.

PubMed

Bogenhagen, Daniel F; Ostermeyer-Fay, Anne G; Haley, John D; Garcia-Diaz, Miguel

2018-02-13

Mammalian mtDNA encodes only 13 proteins, all essential components of respiratory complexes, synthesized by mitochondrial ribosomes. Mitoribosomes contain greatly truncated RNAs transcribed from mtDNA, including a structural tRNA in place of 5S RNA as a scaffold for binding 82 nucleus-encoded proteins, mitoribosomal proteins (MRPs). Cryoelectron microscopy (cryo-EM) studies have determined the structure of the mitoribosome, but its mechanism of assembly is unknown. Our SILAC pulse-labeling experiments determine the rates of mitochondrial import of MRPs and their assembly into intact mitoribosomes, providing a basis for distinguishing MRPs that bind at early and late stages in mitoribosome assembly to generate a working model for mitoribosome assembly. Mitoribosome assembly is a slow process initiated at the mtDNA nucleoid driven by excess synthesis of individual MRPs. MRPs that are tightly associated in the structure frequently join the complex in a coordinated manner. Clinically significant MRP mutations reported to date affect proteins that bind early on during assembly. Copyright © 2018 The Author(s). Published by Elsevier Inc. All rights reserved.

Effects of ginsenosides Rg1 and Rb1 of Panax ginseng on mitosis in root tip cells of Allium cepa.

PubMed

Ng, W Y; Chao, C Y

1981-01-01

The effects of ginsenosides Rg1 and Rb1 of Panax ginseng on mitosis in the onion root tip cells as well as on the rate of DNA synthesis in onion seedlings were studied. Results obtained from the concentration and time course study in bulb and seeding root tip cells indicate that Rg1 promotes and Rb1 inhibits mitosis, both being dose-dependent. The promoting effect of Rg1 on the rate of DNA synthesis was observed at the peak hour which occurs at the same time as that of the control. Rb1 was found to shift the peak hour of DNA synthesis to a later period of the experiment. These results are in agreement with the results obtained from the study of the cell cycle by pulse labeling and autoradiography, which show that Rg1 shortens the mitotic cell cycle and S period while Rb1 lengthens them. They in turn increase and decrease the mitotic indices respectively.

Multiple-rotor-cycle 2D PASS experiments with applications to (207)Pb NMR spectroscopy.

PubMed

Vogt, F G; Gibson, J M; Aurentz, D J; Mueller, K T; Benesi, A J

2000-03-01

Thetwo-dimensional phase-adjusted spinning sidebands (2D PASS) experiment is a useful technique for simplifying magic-angle spinning (MAS) NMR spectra that contain overlapping or complicated spinning sideband manifolds. The pulse sequence separates spinning sidebands by their order in a two-dimensional experiment. The result is an isotropic/anisotropic correlation experiment, in which a sheared projection of the 2D spectrum effectively yields an isotropic spectrum with no sidebands. The original 2D PASS experiment works best at lower MAS speeds (1-5 kHz). At higher spinning speeds (8-12 kHz) the experiment requires higher RF power levels so that the pulses do not overlap. In the case of nuclei such as (207)Pb, a large chemical shift anisotropy often yields too many spinning sidebands to be handled by a reasonable 2D PASS experiment unless higher spinning speeds are used. Performing the experiment at these speeds requires fewer 2D rows and a correspondingly shorter experimental time. Therefore, we have implemented PASS pulse sequences that occupy multiple MAS rotor cycles, thereby avoiding pulse overlap. These multiple-rotor-cycle 2D PASS sequences are intended for use in high-speed MAS situations such as those required by (207)Pb. A version of the multiple-rotor-cycle 2D PASS sequence that uses composite pulses to suppress spectral artifacts is also presented. These sequences are demonstrated on (207)Pb test samples, including lead zirconate, a perovskite-phase compound that is representative of a large class of interesting materials. Copyright 2000 Academic Press.

Simply adding the word "fruit" makes sugar healthier: The misleading effect of symbolic information on the perceived healthiness of food.

PubMed

Sütterlin, Bernadette; Siegrist, Michael

2015-12-01

People may use simple heuristics to assess the healthiness of food products. For instance, the information that a product contains "fruit sugar" (in German, "fruit sugar" is the colloquial term for fructose) could be interpreted as a cue that the product is relatively healthy, since the term "fruit" symbolizes healthiness. This can have a misleading effect on the perceived healthiness of a product. In Experiment 1, participants (N = 164) were asked to evaluate the healthiness of one of two breakfast cereals based on the information provided in a nutrition table. For one group, the label "fruit sugar" was used; for the other, the label "sugar" was used. Results suggest that the phrase "fruit sugar" listed as an ingredient of the breakfast cereal resulted in a more positive perception of the healthiness of the cereal compared with the ingredient labeled "sugar." In Experiment 2 (N = 202), the results of Experiment 1 were replicated with a within-subjects design in which participants evaluated the two products simultaneously. Experiment 3 (N = 251) ruled out the alternative explanation that the effect could be due to differing inferences about the product's ingredients based on the label used, that is, that the product labeled with "fruit sugar" contains fruit. Finally, in Experiment 4 (N = 162), the results show that the healthiness associated with the labeling of the ingredient "sugar" ("fruit sugar" vs. "sugar") mediates the observed effect. Results of the four experiments indicate that symbolic information is an important factor that can influence people's health perceptions of food. These findings have implications for marketing and public health. Copyright © 2015 Elsevier Ltd. All rights reserved.

THz pulse doubler at FLASH: double pulses for pump–probe experiments at X-ray FELs

PubMed Central

Zapolnova, Ekaterina; Golz, Torsten; Pan, Rui; Klose, Karsten; Stojanovic, Nikola

2018-01-01

FLASH, the X-ray free-electron laser in Hamburg, Germany, employs a narrowband high-field accelerator THz source for unique THz pump X-ray probe experiments. However, the large difference in optical paths of the THz and X-ray beamlines prevents utilization of the machine’s full potential (e.g. extreme pulse energies in the soft X-ray range). To solve this issue, lasing of double electron bunches, separated by 28 periods of the driving radiofrequency (at 1.3 GHz), timed for the temporal overlap of THz and X-ray pulses at the experimental station has been employed. In order to optimize conditions for a typical THz pump X-ray probe experiment, X-ray lasing of the first bunch to one-sixth of that of the second has been suppressed. Finally, synchronization of THz radiation pulses was measured to be ∼20 fs (r.m.s.), and a solution for monitoring the arrival time for achieving higher temporal resolution is presented. PMID:29271749

2-D Air-Breathing Lightcraft Engine Experiments in Hypersonic Conditions

NASA Astrophysics Data System (ADS)

Salvador, Israel I.; Myrabo, Leik N.; Minucci, Marco A. S.; de Oliveira, Antonio C.; Toro, Paulo G. P.; Chanes, José B.; Rego, Israel S.

2011-11-01

Experiments were performed with a 2-D, repetitively-pulsed (RP) laser Lightcraft model in hypersonic flow conditions. The main objective was the feasibility analysis for impulse generation with repetitively-pulsed air-breathing laser Lightcraft engines at hypersonic speeds. The future application of interest for this basic research endeavor is the laser launch of pico-, nano-, and micro-satellites (i.e., 0.1-100 kg payloads) into Low-Earth-Orbit, at low-cost and on-demand. The laser propulsion experiments employed a Hypersonic Shock Tunnel integrated with twin gigawatt pulsed Lumonics 620-TEA CO2 lasers (˜ 1 μs pulses), to produce the required test conditions. This hypersonic campaign was carried out at nominal Mach numbers ranging from 6 to 10. Time-dependent surface pressure distributions were recorded together with Schlieren movies of the flow field structure resulting from laser energy deposition. Results indicated laser-induced pressure increases of 0.7-0.9 bar with laser pulse energies of ˜ 170 J, on off-shroud induced breakdown condition, and Mach number of 7.

THz pulse doubler at FLASH: double pulses for pump-probe experiments at X-ray FELs.

PubMed

Zapolnova, Ekaterina; Golz, Torsten; Pan, Rui; Klose, Karsten; Schreiber, Siegfried; Stojanovic, Nikola

2018-01-01

FLASH, the X-ray free-electron laser in Hamburg, Germany, employs a narrowband high-field accelerator THz source for unique THz pump X-ray probe experiments. However, the large difference in optical paths of the THz and X-ray beamlines prevents utilization of the machine's full potential (e.g. extreme pulse energies in the soft X-ray range). To solve this issue, lasing of double electron bunches, separated by 28 periods of the driving radiofrequency (at 1.3 GHz), timed for the temporal overlap of THz and X-ray pulses at the experimental station has been employed. In order to optimize conditions for a typical THz pump X-ray probe experiment, X-ray lasing of the first bunch to one-sixth of that of the second has been suppressed. Finally, synchronization of THz radiation pulses was measured to be ∼20 fs (r.m.s.), and a solution for monitoring the arrival time for achieving higher temporal resolution is presented.

Specific characteristics of negative corona currents generated in short point-plane gap

DOE Office of Scientific and Technical Information (OSTI.GOV)

Li, Zhen; Zhang, Bo; He, Jinliang

The Trichel pulse is a typical kind of negative corona current observed in electronegative gases with a highly regular form. The characteristics of the Trichel pulse, such as the repetition frequency, the amplitude of each pulse, and the mean current, are dependent on different discharge conditions. Quite many scholars have studied the mean current and the current-voltage characteristic of Trichel pulses, yet the specific characteristics of the pulses have barely been investigated. In this paper, a series of experiments were carried out in a short point-to-plane discharge gap to investigate the detailed characteristics of Trichel pulses. After numerical fitting ofmore » the experiment results was performed, a new set of empirical formulas were derived to predict the specific characteristics of the negative corona current under different conditions. Different from existing literature, this paper uses as variables the average electric field intensity and the corona inception field intensity which is independent of the gap spacing in the empirical formulas. In the experiments, an inverse correlation between amplitude and repetition frequency of the pulses was observed. Based on the investigation of the remaining space charge in the discharge gap, this correlation is theoretically proved to be caused by the influence of space charges.« less

Neurophysin biosynthesis in normal rats and in rats with hereditary diabetes insipidus.

PubMed Central

Brownstein, M J; Gainer, H

1977-01-01

When [35S]cysteine was injected adjacent to the supraoptic nucleus (SON) in rats, it was rapidly incorporated into proteins in the SON. The [35S]cysteine-labeled proteins extracted from the SON were separated by isoelectric focusing on polyacrylamide gels. Twenty minutes after the injection of [35S]cysteine, two major labeled peaks (pI = 5.4 and 6.1) were found in the SON of normal rats; Brattleboro rats had only one major labeled peak (pI = 5.4). One hour after the injection, four major radioactive peaks were found in the SON of normal animals (pI = 5.1, 5.4, 5.6, and 6.1). Animals with diabetes insipidus had only two major labeled proteins (pI = 5.1 AND 5.4). Twenty-four hours after normal rats were injected with [35S]cysteine, all of the labeled peaks described above, except for the one with pI = 5.1, had decreased markedly in size and a small amount of labeled protein with pI about 4.8 was present in the SON. After 24 hr the posterior pituitary of normal animals contained two [35S]cysteine-labeled proteins with pI = 4.6 AND 4.8. The pituitaries of Brattleboro rats had only the pI = 4.6 labeled protein. These pulse-chase data, with data we have presented elsewhere, indicate that the vasopressin- and oxytocin-neurophysins are synthesized as parts of separate precursors (pI = 6.1 and 5.4, respectively). These precursors are converted into at least two intermediates (pI = 5.6 and 5.1) which, in turn, yield the vasopressin-neurophysin (pI = 4.8) and the oxytocin-neurophysin (pI = 4.6). PMID:269451

In vivo stationary flux analysis by 13C labeling experiments.

PubMed

Wiechert, W; de Graaf, A A

1996-01-01

Stationary flux analysis is an invaluable tool for metabolic engineering. In the last years the metabolite balancing technique has become well established in the bioengineering community. On the other hand metabolic tracer experiments using 13C isotopes have long been used for intracellular flux determination. Only recently have both techniques been fully combined to form a considerably more powerful flux analysis method. This paper concentrates on modeling and data analysis for the evaluation of such stationary 13C labeling experiments. After reviewing recent experimental developments, the basic equations for modeling carbon labeling in metabolic systems, i.e. metabolite, carbon label and isotopomer balances, are introduced and discussed in some detail. Then the basics of flux estimation from measured extracellular fluxes combined with carbon labeling data are presented and, finally, this method is illustrated by using an example from C. glutamicum. The main emphasis is on the investigation of the extra information that can be obtained with tracer experiments compared with the metabolite balancing technique alone. As a principal result it is shown that the combined flux analysis method can dispense with some rather doubtful assumptions on energy balancing and that the forward and backward flux rates of bidirectional reaction steps can be simultaneously determined in certain situations. Finally, it is demonstrated that the variant of fractional isotopomer measurement is even more powerful than fractional labeling measurement but requires much higher numerical effort to solve the balance equations.

Advances in stable isotope assisted labeling strategies with information science.

PubMed

Kigawa, Takanori

2017-08-15

Stable-isotope (SI) labeling of proteins is an essential technique to investigate their structures, interactions or dynamics by nuclear magnetic resonance (NMR) spectroscopy. The assignment of the main-chain signals, which is the fundamental first step in these analyses, is usually achieved by a sequential assignment method based on triple resonance experiments. Independently of the triple resonance experiment-based sequential assignment, amino acid-selective SI labeling is beneficial for discriminating the amino acid type of each signal; therefore, it is especially useful for the signal assignment of difficult targets. Various combinatorial selective labeling schemes have been developed as more sophisticated labeling strategies. In these strategies, amino acids are represented by combinations of SI labeled samples, rather than simply assigning one amino acid to one SI labeled sample as in the case of conventional amino acid-selective labeling. These strategies have proven to be useful for NMR analyses of difficult proteins, such as those in large complex systems, in living cells, attached or integrated into membranes, or with poor solubility. In this review, recent advances in stable isotope assisted labeling strategies will be discussed. Copyright © 2017 Elsevier Inc. All rights reserved.

DOE Office of Scientific and Technical Information (OSTI.GOV)

Adachi, T.; The Graduate University for Advanced Studies, Hayama, Miura, Kanagawa 240-0193; Arai, T.

A new type of pulse chopper called an Einzel lens chopper is described. An Einzel lens placed immediately after an electron cyclotron resonance ion source is driven by high-voltage pulses generated by a newly developed solid-state Marx generator. A rectangular negative barrier pulse-voltage is controlled in time, and the barrier pulse is turned on only when a beam pulse is required. The results of successful experiments are reported herein.

Kinetic processes determining attainable pulse repetition rate in pulsed metal vapor lasers

NASA Astrophysics Data System (ADS)

Petrash, Gueorgii G.

1998-06-01

A review of the investigations of the main processes determining the attainable pulse repetition rate of elemental metal vapor pulsed gas discharge self-terminating lasers, such as copper vapor laser, gold vapor laser, lead vapor laser, is given. Kinetic processes during an excitation pulse and interpulse period are considered as well as experiments with lasers operating at high repetition rate.

A novel design for a dual stable isotope continuous labeling chamber: results on labeling efficiency and C and N allocation in Andropogon gerardii

NASA Astrophysics Data System (ADS)

Soong, J.; Stewart, C.; Reuss, D.; Pinney, C.; Cotrufo, F. M.

2010-12-01

The use of stable isotope enriched plant material can provide an unobstructed method of studying ecosystem nutrient dynamics between plants, soil, and atmosphere. However, the production of uniformly labeled perennial plant material is challenging due to plant physiological constraints and the mechanics of building and operating an isotope labeling system. In this study we present the design of a novel dual 13C and 15N continuous isotope labeling chamber located at Colorado State University. The chamber is equipped with automatic controls for CO2 concentration, temperature, and humidity, and has successfully been used to grow and label the tallgrass perennial Andropogon gerardii in pots from rhizomes. Three different nitrogen fertilization levels were applied to assess how substrate availability may alter growth and overall performance in the system. The efficiency of the 13C and 15N labeling chamber, its design and overall performance, as well as a full C, N, 13C, and 15N budget of the aboveground biomass, belowground biomass, and soil will be presented. Solid samples were analyzed on an EA-IRMS, while air samples from the chamber were analyzed using a precon-GC-IRMS system. The dual stable isotope labeled A. gerardii produced from this chamber will be used in a decomposition experiment to quantify the relative contribution of aboveground litter derived C to soil respiration, dissolved organic carbon, and various soil organic matter pools. Based on the results of our A. gerardii 13C and 15N labeling experiment we believe that this chamber design can be used to successfully produce dual stable isotope labeled plants for a wide variety of terrestrial nutrient flux experiments.

Feasibility of protein turnover studies in prototroph Saccharomyces cerevisiae strains.

PubMed

Martin-Perez, Miguel; Villén, Judit

2015-04-07

Quantitative proteomics studies of yeast that use metabolic labeling with amino acids rely on auxotrophic mutations of one or more genes on the amino acid biosynthesis pathways. These mutations affect yeast metabolism and preclude the study of some biological processes. Overcoming this limitation, it has recently been described that proteins in a yeast prototrophic strain can also be metabolically labeled with heavy amino acids. However, the temporal profiles of label incorporation under the different phases of the prototroph's growth have not been examined. Labeling trajectories are important in the study of protein turnover and dynamics, in which label incorporation into proteins is monitored across many time points. Here we monitored protein labeling trajectories for 48 h after a pulse with heavy lysine in a yeast prototrophic strain and compared them with those of a lysine auxotrophic yeast. Labeling was successful in prototroph yeast during exponential growth phase but not in stationary phase. Furthermore, we were able to determine the half-lives of more than 1700 proteins during exponential phase of growth with high accuracy and reproducibility. We found a median half-life of 2 h in both strains, which corresponds with the cellular doubling time. Nucleolar and ribosomal proteins showed short half-lives, whereas mitochondrial proteins and other energy production enzymes presented longer half-lives. Except for some proteins involved in lysine biosynthesis, we observed a high correlation in protein half-lives between prototroph and auxotroph strains. Overall, our results demonstrate the feasibility of using prototrophs for proteomic turnover studies and provide a reliable data set of protein half-lives in exponentially growing yeast.

Defining multiple, distinct, and shared spatiotemporal patterns of DNA replication and endoreduplication from 3D image analysis of developing maize (Zea mays L.) root tip nuclei.

PubMed

Bass, Hank W; Hoffman, Gregg G; Lee, Tae-Jin; Wear, Emily E; Joseph, Stacey R; Allen, George C; Hanley-Bowdoin, Linda; Thompson, William F

2015-11-01

Spatiotemporal patterns of DNA replication have been described for yeast and many types of cultured animal cells, frequently after cell cycle arrest to aid in synchronization. However, patterns of DNA replication in nuclei from plants or naturally developing organs remain largely uncharacterized. Here we report findings from 3D quantitative analysis of DNA replication and endoreduplication in nuclei from pulse-labeled developing maize root tips. In both early and middle S phase nuclei, flow-sorted on the basis of DNA content, replicative labeling was widely distributed across euchromatic regions of the nucleoplasm. We did not observe the perinuclear or perinucleolar replicative labeling patterns characteristic of middle S phase in mammals. Instead, the early versus middle S phase patterns in maize could be distinguished cytologically by correlating two quantitative, continuous variables, replicative labeling and DAPI staining. Early S nuclei exhibited widely distributed euchromatic labeling preferentially localized to regions with weak DAPI signals. Middle S nuclei also exhibited widely distributed euchromatic labeling, but the label was preferentially localized to regions with strong DAPI signals. Highly condensed heterochromatin, including knobs, replicated during late S phase as previously reported. Similar spatiotemporal replication patterns were observed for both mitotic and endocycling maize nuclei. These results revealed that maize euchromatin exists as an intermingled mixture of two components distinguished by their condensation state and replication timing. These different patterns might reflect a previously described genome organization pattern, with "gene islands" mostly replicating during early S phase followed by most of the intergenic repetitive regions replicating during middle S phase.

Who needs cream and sugar when there is eco-labeling? Taste and willingness to pay for "eco-friendly" coffee.

PubMed

Sörqvist, Patrik; Hedblom, Daniel; Holmgren, Mattias; Haga, Andreas; Langeborg, Linda; Nöstl, Anatole; Kågström, Jonas

2013-01-01

Participants tasted two cups of coffee, decided which they preferred, and then rated each coffee. They were told (in lure) that one of the cups contained "eco-friendly" coffee while the other did not, although the two cups contained identical coffee. In Experiments 1 and 3, but not in Experiment 2, the participants were also told which cup contained which type of coffee before they tasted. The participants preferred the taste of, and were willing to pay more for, the "eco-friendly" coffee, at least those who scored high on a questionnaire on attitudes toward sustainable consumer behavior (Experiment 1). High sustainability consumers were also willing to pay more for "eco-friendly" coffee, even when they were told, after their decision, that they preferred the non-labeled alternative (Experiment 2). Moreover, the eco-label effect does not appear to be a consequence of social desirability, as participants were just as biased when reporting the taste estimates and willingness to pay anonymously (Experiment 3). Eco labels not only promote a willingness to pay more for the product but also lead to a more favorable perceptual experience of it.

Who Needs Cream and Sugar When There Is Eco-Labeling? Taste and Willingness to Pay for “Eco-Friendly” Coffee

PubMed Central

Sörqvist, Patrik; Hedblom, Daniel; Holmgren, Mattias; Haga, Andreas; Langeborg, Linda; Nöstl, Anatole; Kågström, Jonas

2013-01-01

Participants tasted two cups of coffee, decided which they preferred, and then rated each coffee. They were told (in lure) that one of the cups contained “eco-friendly” coffee while the other did not, although the two cups contained identical coffee. In Experiments 1 and 3, but not in Experiment 2, the participants were also told which cup contained which type of coffee before they tasted. The participants preferred the taste of, and were willing to pay more for, the “eco-friendly” coffee, at least those who scored high on a questionnaire on attitudes toward sustainable consumer behavior (Experiment 1). High sustainability consumers were also willing to pay more for “eco-friendly” coffee, even when they were told, after their decision, that they preferred the non-labeled alternative (Experiment 2). Moreover, the eco-label effect does not appear to be a consequence of social desirability, as participants were just as biased when reporting the taste estimates and willingness to pay anonymously (Experiment 3). Eco labels not only promote a willingness to pay more for the product but also lead to a more favorable perceptual experience of it. PMID:24324623

Poloxamer 188 decreases susceptibility of artificial lipid membranes to electroporation.

PubMed Central

Sharma, V; Stebe, K; Murphy, J C; Tung, L

1996-01-01

The effect of a nontoxic, nonionic block co-polymeric surface active agent, poloxamer 188, on electroporation of artificial lipid membranes made of azolectin, was investigated. Two different experimental protocols were used in our study: charge pulse and voltage clamp. For the charge pulse protocol, membranes were pulsed with a 10-micronsecond rectangular voltage waveform, after which membrane voltage decay was observed through an external 1-M omega resistance. For the voltage clamp protocol the membranes were pulsed with a waveform that consisted of an initial 10-microsecond rectangular phase, followed by a negative sloped ramp that decayed to zero in the subsequent 500 microseconds. Several parameters characterizing the electroporation process were measured and compared for the control membranes and membranes treated with 1.0 mM poloxamer 188. For both the charge pulse and voltage clamp experiments, the threshold voltage (amplitude of initial rectangular phase) and latency time (time elapsed between the end of rectangular phase and the onset of membrane electroporation) were measured. Membrane conductance (measured 200 microseconds after the initial rectangular phase) and rise time (tr; the time required for the porated membrane to reach a certain conductance value) were also determined for the voltage clamp experiments, and postelectroporation time constant (PE tau; the time constant for transmembrane voltage decay after onset of electroporation) for the charge pulse experiments. The charge pulse experiments were performed on 23 membranes with 10 control and 13 poloxamer-treated membranes, and voltage pulse experiments on 49 membranes with 26 control and 23 poloxamer-treated membranes. For both charge pulse and voltage clamp experiments, poloxamer 188-treated membranes exhibited a statistically higher threshold voltage (p = 0.1 and p = 0.06, respectively), and longer latency time (p = 0.04 and p = 0.05, respectively). Also, poloxamer 188-treated membranes were found to have a relatively lower conductance (p = 0.001), longer time required for the porated membrane to reach a certain conductance value (p = 0.05), and longer postelectroporation time constant (p = 0.005). Furthermore, addition of poloxamer 188 was found to reduce the membrane capacitance by approximately 4-8% in 5 min. These findings suggest that poloxamer 188 adsorbs into the lipid bilayers, thereby decreasing their susceptibility to electroporation. Images FIGURE 1 PMID:8968593

Investigation of Readout RF Pulse Impact on the Chemical Exchange Saturation Transfer Spectrum

PubMed Central

Huang, Sheng-Min; Jan, Meei-Ling; Liang, Hsin-Chin; Chang, Chia-Hao; Wu, Yi-Chun; Tsai, Shang-Yueh; Wang, Fu-Nien

2015-01-01

Chemical exchange saturation transfer magnetic resonance imaging (CEST-MRI) is capable of both microenvironment and molecular imaging. The optimization of scanning parameters is important since the CEST effect is sensitive to factors such as saturation power and field homogeneity. The aim of this study was to determine if the CEST effect would be altered by changing the length of readout RF pulses. Both theoretical computer simulation and phantom experiments were performed to examine the influence of readout RF pulses. Our results showed that the length of readout RF pulses has unremarkable impact on the Z-spectrum and CEST effect in both computer simulation and phantom experiment. Moreover, we demonstrated that multiple refocusing RF pulses used in rapid acquisition with relaxation enhancement (RARE) sequence induced no obvious saturation transfer contrast. Therefore, readout RF pulse has negligible effect on CEST Z-spectrum and the optimization of readout RF pulse length can be disregarded in CEST imaging protocol. PMID:26455576

Propagation failures, breathing pulses, and backfiring in an excitable reaction-diffusion system.

PubMed

Manz, Niklas; Steinbock, Oliver

2006-09-01

We report results from experiments with a pseudo-one-dimensional Belousov-Zhabotinsky reaction that employs 1,4-cyclohexanedione as its organic substrate. This excitable system shows traveling oxidation pulses and pulse trains that can undergo complex sequences of propagation failures. Moreover, we present examples for (i) breathing pulses that undergo periodic changes in speed and size and (ii) backfiring pulses that near their back repeatedly generate new pulses propagating in opposite direction.

Label-free photoacoustic nanoscopy

PubMed Central

Danielli, Amos; Maslov, Konstantin; Garcia-Uribe, Alejandro; Winkler, Amy M.; Li, Chiye; Wang, Lidai; Chen, Yun; Dorn, Gerald W.; Wang, Lihong V.

2014-01-01

Abstract. Super-resolution microscopy techniques—capable of overcoming the diffraction limit of light—have opened new opportunities to explore subcellular structures and dynamics not resolvable in conventional far-field microscopy. However, relying on staining with exogenous fluorescent markers, these techniques can sometimes introduce undesired artifacts to the image, mainly due to large tagging agent sizes and insufficient or variable labeling densities. By contrast, the use of endogenous pigments allows imaging of the intrinsic structures of biological samples with unaltered molecular constituents. Here, we report label-free photoacoustic (PA) nanoscopy, which is exquisitely sensitive to optical absorption, with an 88 nm resolution. At each scanning position, multiple PA signals are successively excited with increasing laser pulse energy. Because of optical saturation or nonlinear thermal expansion, the PA amplitude depends on the nonlinear incident optical fluence. The high-order dependence, quantified by polynomial fitting, provides super-resolution imaging with optical sectioning. PA nanoscopy is capable of super-resolution imaging of either fluorescent or nonfluorescent molecules. PMID:25104412

Optimal tracers for parallel labeling experiments and 13C metabolic flux analysis: A new precision and synergy scoring system.

PubMed

Crown, Scott B; Long, Christopher P; Antoniewicz, Maciek R

2016-11-01

13 C-Metabolic flux analysis ( 13 C-MFA) is a widely used approach in metabolic engineering for quantifying intracellular metabolic fluxes. The precision of fluxes determined by 13 C-MFA depends largely on the choice of isotopic tracers and the specific set of labeling measurements. A recent advance in the field is the use of parallel labeling experiments for improved flux precision and accuracy. However, as of today, no systemic methods exist for identifying optimal tracers for parallel labeling experiments. In this contribution, we have addressed this problem by introducing a new scoring system and evaluating thousands of different isotopic tracer schemes. Based on this extensive analysis we have identified optimal tracers for 13 C-MFA. The best single tracers were doubly 13 C-labeled glucose tracers, including [1,6- 13 C]glucose, [5,6- 13 C]glucose and [1,2- 13 C]glucose, which consistently produced the highest flux precision independent of the metabolic flux map (here, 100 random flux maps were evaluated). Moreover, we demonstrate that pure glucose tracers perform better overall than mixtures of glucose tracers. For parallel labeling experiments the optimal isotopic tracers were [1,6- 13 C]glucose and [1,2- 13 C]glucose. Combined analysis of [1,6- 13 C]glucose and [1,2- 13 C]glucose labeling data improved the flux precision score by nearly 20-fold compared to widely use tracer mixture 80% [1- 13 C]glucose +20% [U- 13 C]glucose. Copyright © 2016 International Metabolic Engineering Society. Published by Elsevier Inc. All rights reserved.

Single-shot spectro-temporal characterization of XUV pulses from a seeded free-electron laser

PubMed Central

De Ninno, Giovanni; Gauthier, David; Mahieu, Benoît; Ribič, Primož Rebernik; Allaria, Enrico; Cinquegrana, Paolo; Danailov, Miltcho Bojanov; Demidovich, Alexander; Ferrari, Eugenio; Giannessi, Luca; Penco, Giuseppe; Sigalotti, Paolo; Stupar, Matija

2015-01-01

Intense ultrashort X-ray pulses produced by modern free-electron lasers (FELs) allow one to probe biological systems, inorganic materials and molecular reaction dynamics with nanoscale spatial and femtoscale temporal resolution. These experiments require the knowledge, and possibly the control, of the spectro-temporal content of individual pulses. FELs relying on seeding have the potential to produce spatially and temporally fully coherent pulses. Here we propose and implement an interferometric method, which allows us to carry out the first complete single-shot spectro-temporal characterization of the pulses, generated by an FEL in the extreme ultraviolet spectral range. Moreover, we provide the first direct evidence of the temporal coherence of a seeded FEL working in the extreme ultraviolet spectral range and show the way to control the light generation process to produce Fourier-limited pulses. Experiments are carried out at the FERMI FEL in Trieste. PMID:26290320

Plasma Switch for High-Power Active Pulse Compressor

DOE Office of Scientific and Technical Information (OSTI.GOV)

Hirshfield, Jay L.

2013-11-04

Results are presented from experiments carried out at the Naval Research Laboratory X-band magnicon facility on a two-channel X-band active RF pulse compressor that employed plasma switches. Experimental evidence is shown to validate the basic goals of the project, which include: simultaneous firing of plasma switches in both channels of the RF circuit, operation of quasi-optical 3-dB hybrid directional coupler coherent superposition of RF compressed pulses from both channels, and operation of the X-band magnicon directly in the RF pulse compressor. For incident 1.2 ?s pulses in the range 0.63 ? 1.35 MW, compressed pulses of peak powers 5.7 ?more » 11.3 MW were obtained, corresponding to peak power gain ratios of 8.3 ? 9.3. Insufficient bakeout and conditioning of the high-power RF circuit prevented experiments from being conducted at higher RF input power levels.« less

Strong electromagnetic pulses generated in laser-matter interactions with 10TW-class fs laser

NASA Astrophysics Data System (ADS)

Rączka, Piotr; Rosiński, Marcin; Zaraś-Szydłowska, Agnieszka; Wołowski, Jerzy; Badziak, Jan

2018-01-01

The results of an experiment on the generation of electromagnetic pulses (EMP) in the interaction of 10TW fs pulses with thick (mm scale) and thin foil (μm scale) targets are described. Such pulses, with frequencies in the GHz range, may pose a threat to safe and reliable operation of high-power, high-intensity laser facilities. The main point of the experiment is to investigate the fine temporal structure of such pulses using an oscilloscope capable of measurements at very high sampling rate. It is found that the amazing reproducibility of such pulses is confirmed at this high sampling rate. Furthermore, the differences between the EMP signals generated from thick and thin foil targets are clearly seen, which indicates that besides electric polarization of the target and the target neutralization current there may be other factors essential for the EMP emission.

Biological instrumentation for the Viking 1975 mission to Mars.

PubMed

Klein, H P; Vishniac, W

1972-01-01

A brief introduction is given on why Mars is of interest from a biological point of view, along with an overview of the Viking 1975 mission. Details are given about the four biology instruments aboard the spacecraft and the experiments for which they are to be used. These are: the carbon assimilation experiment to determine whether the soil is biologically active, by incubation in presence of 14C-labelled CO and CO2 (known to be present in the Martian atmosphere); the label release experiment to detect metabolic activity by the release of radioactive CO2, from 14C-labelled simple organic substrates; the gas exchange experiment to detect biological activity by repeated gas chromatography analysis of soil samples; the light scattering experiment, where increase of scattering and decrease of light transmission would indicate the growth of organisms. Examples are given of data obtained with terrestrial soils in these experiments.

Time domain dielectric spectroscopy of nanosecond pulsed electric field induced changes in dielectric properties of pig whole blood.

PubMed

Zhuang, Jie; Kolb, Juergen F

2015-06-01

The dielectric spectra of fresh pig whole blood in the β-dispersion range after exposure to 300-nanosecond pulsed electric fields (nsPEFs) with amplitude higher than the supra-electroporation threshold for erythrocytes were recorded by time domain reflectometry dielectric spectroscopy. The implications of the dielectric parameters on the dynamics of post-pulse pore development were discussed in light of the Cole-Cole relaxation model. The temporal development of the Cole-Cole parameters indicates that nsPEFs induced significant poration and swelling of erythrocytes within the first 5 min. The results also show that the majority of erythrocytes could not fully recover from supra-electroporation up to 30 min. The findings of this study suggest that time domain dielectric spectroscopy is a promising label-free and real-time physiological measuring technique for nsPEF-blood related biomedical applications, capable of following the conformational and morphological changes of cells. Copyright © 2014 Elsevier B.V. All rights reserved.

An Experiment Investigation of Fully-Modulated, Turbulent Diffusion Flames in Reduced Gravity

NASA Technical Reports Server (NTRS)

Hermanson, J. C.; Johari, H.; Usowicz, J. E.; Stocker, D. P.; Nagashima, T.; Obata, S.

1999-01-01

Pulsed combustion appears to have the potential to provide for rapid fuel/air mixing, compact and economical combustors, and reduced exhaust emissions. The ultimate objective of this program is to increase the fundamental understanding of the fuel/air mixing and combustion behavior of pulsed, turbulent diffusion flames by conducting experiments in microgravity. In this research the fuel jet is fully-modulated (i.e., completely shut off between pulses) by an externally controlled valve system. This can give rise to drastic modification of the combustion and flow characteristics of flames, leading to enhanced fuel/air mixing mechanisms not operative for the case of acoustically excited or partially-modulated jets. In addition, the fully-modulated injection approach avoids the strong acoustic forcing present in pulsed combustion devices, significantly simplifying the mixing and combustion processes. Relatively little is known of the behavior of turbulent flames in reduced-gravity conditions, even in the absence of pulsing. The goal of this Flight-Definition experiment (PUFF, for PUlsed-Fully Flames) is to establish the behavior of fully-modulated, turbulent diffusion flames under microgravity conditions. Fundamental issues to be addressed in this experiment include the mechanisms responsible for the flame length decrease for fully-modulated, turbulent diffusion flames compared with steady flames, the impact of buoyancy on the mixing and combustion characteristics of these flames, and the characteristics of turbulent flame puffs under fully momentum-dominated conditions.

Designing optimal universal pulses using second-order, large-scale, non-linear optimization

NASA Astrophysics Data System (ADS)

Anand, Christopher Kumar; Bain, Alex D.; Curtis, Andrew Thomas; Nie, Zhenghua

2012-06-01

Recently, RF pulse design using first-order and quasi-second-order pulses has been actively investigated. We present a full second-order design method capable of incorporating relaxation, inhomogeneity in B0 and B1. Our model is formulated as a generic optimization problem making it easy to incorporate diverse pulse sequence features. To tame the computational cost, we present a method of calculating second derivatives in at most a constant multiple of the first derivative calculation time, this is further accelerated by using symbolic solutions of the Bloch equations. We illustrate the relative merits and performance of quasi-Newton and full second-order optimization with a series of examples, showing that even a pulse already optimized using other methods can be visibly improved. To be useful in CPMG experiments, a universal refocusing pulse should be independent of the delay time and insensitive of the relaxation time and RF inhomogeneity. We design such a pulse and show that, using it, we can obtain reliable R2 measurements for offsets within ±γB1. Finally, we compare our optimal refocusing pulse with other published refocusing pulses by doing CPMG experiments.

Slowing light down by low magnetic fields: pulse delay by transient spectral hole-burning in ruby.

PubMed

Riesen, Hans; Rebane, Aleksander K; Szabo, Alex; Carceller, Ivana

2012-08-13

We report on the observation of slow light induced by transient spectral hole-burning in a solid, that is based on excited-state population storage. Experiments were conducted in the R1-line (2E←4A2 transition) of a 2.3 mm thick pink ruby (Al2O3:Cr(III) 130 ppm). Importantly, the pulse delay can be controlled by the application of a low external magnetic field B||c≤9 mT and delays of up to 11 ns with minimal pulse distortion are observed for ~55 ns Gaussian pulses. The delay corresponds to a group velocity value of ~c/1400. The experiment is very well modelled by linear spectral filter theory and the results indicate the possibility of using transient hole-burning based slow light experiments as a spectroscopic technique.

Investigation of laser pulse length and pre-plasma scale length impact on hot electron generation on OMEGA-EP

DOE Office of Scientific and Technical Information (OSTI.GOV)

Peebles, J.; Wei, M. S.; Arefiev, A. V.

A series of experiments studying pre-plasma’s effect on electron generation and transport due to a high intensity laser were conducted on the OMEGA-EP laser facility. A controlled pre-plasma was produced in front of an aluminum foil target prior to the arrival of the high intensity short pulse beam. Energetic electron spectra were characterized with magnetic and bremsstrahlung spectrometers. Preplasma and pulse length were shown to have a large impact on the temperature of lower energy, ponderomotive scaling electrons. Furthermore, super-ponderomotive electrons, seen in prior pre-plasma experiments with shorter pulses, were observed without any initial pre-plasma in our experiment. 2D particle-in-cellmore » and radiation-hydrodynamic simulations shed light on and validate these experimental results.« less

Investigation of laser pulse length and pre-plasma scale length impact on hot electron generation on OMEGA-EP

DOE PAGES

Peebles, J.; Wei, M. S.; Arefiev, A. V.; ...

2017-02-02

A series of experiments studying pre-plasma’s effect on electron generation and transport due to a high intensity laser were conducted on the OMEGA-EP laser facility. A controlled pre-plasma was produced in front of an aluminum foil target prior to the arrival of the high intensity short pulse beam. Energetic electron spectra were characterized with magnetic and bremsstrahlung spectrometers. Preplasma and pulse length were shown to have a large impact on the temperature of lower energy, ponderomotive scaling electrons. Furthermore, super-ponderomotive electrons, seen in prior pre-plasma experiments with shorter pulses, were observed without any initial pre-plasma in our experiment. 2D particle-in-cellmore » and radiation-hydrodynamic simulations shed light on and validate these experimental results.« less

Impact of initial pulse shape on the nonlinear spectral compression in optical fibre

NASA Astrophysics Data System (ADS)

Boscolo, Sonia; Chaussard, Frederic; Andresen, Esben; Rigneault, Hervé; Finot, Christophe

2018-02-01

We theoretically study the effects of the temporal intensity profile of the initial pulse on the nonlinear propagation spectral compression process arising from nonlinear propagation in an optical fibre. Various linearly chirped input pulse profiles are considered, and their dynamics is explained with the aid of time-frequency representations. While initially parabolic-shaped pulses show enhanced spectral compression compared to Gaussian pulses, no significant spectral narrowing occurs when initially super-Gaussian pulses are used. Triangular pulses lead to a spectral interference phenomenon similar to the Fresnel bi-prism experiment.

Compact field programmable gate array-based pulse-sequencer and radio-frequency generator for experiments with trapped atoms.

PubMed

Pruttivarasin, Thaned; Katori, Hidetoshi

2015-11-01

We present a compact field-programmable gate array (FPGA) based pulse sequencer and radio-frequency (RF) generator suitable for experiments with cold trapped ions and atoms. The unit is capable of outputting a pulse sequence with at least 32 transistor-transistor logic (TTL) channels with a timing resolution of 40 ns and contains a built-in 100 MHz frequency counter for counting electrical pulses from a photo-multiplier tube. There are 16 independent direct-digital-synthesizers RF sources with fast (rise-time of ∼60 ns) amplitude switching and sub-mHz frequency tuning from 0 to 800 MHz.

Compact field programmable gate array-based pulse-sequencer and radio-frequency generator for experiments with trapped atoms

DOE Office of Scientific and Technical Information (OSTI.GOV)

Pruttivarasin, Thaned, E-mail: thaned.pruttivarasin@riken.jp; Katori, Hidetoshi; Innovative Space-Time Project, ERATO, JST, Bunkyo-ku, Tokyo 113-8656

We present a compact field-programmable gate array (FPGA) based pulse sequencer and radio-frequency (RF) generator suitable for experiments with cold trapped ions and atoms. The unit is capable of outputting a pulse sequence with at least 32 transistor-transistor logic (TTL) channels with a timing resolution of 40 ns and contains a built-in 100 MHz frequency counter for counting electrical pulses from a photo-multiplier tube. There are 16 independent direct-digital-synthesizers RF sources with fast (rise-time of ∼60 ns) amplitude switching and sub-mHz frequency tuning from 0 to 800 MHz.

A survey of pulse shape options for a revised plastic ablator ignition design

NASA Astrophysics Data System (ADS)

Clark, Daniel; Eder, David; Haan, Steven; Hinkel, Denise; Jones, Ogden; Marinak, Michael; Milovich, Jose; Peterson, Jayson; Robey, Harold; Salmonson, Jay; Smalyuk, Vladimir; Weber, Christopher

2014-10-01

Recent experimental results using the ``high foot'' pulse shape on the National Ignition Facility (NIF) have shown encouraging progress compared to earlier ``low foot'' experiments. These results strongly suggest that controlling ablation front instability growth can dramatically improve implosion performance, even in the presence of persistent, large, low-mode distortions. In parallel, Hydro. Growth Radiography experiments have so far validated the techniques used for modeling ablation front growth in NIF experiments. It is timely then to combine these two results and ask how current ignition pulse shapes could be modified so as to improve implosion performance, namely fuel compressibility, while maintaining the stability properties demonstrated with the high foot. This talk presents a survey of pulse shapes intermediate between the low and high foot extremes in search of a more optimal design. From the database of pulse shapes surveyed, a higher picket version of the original low foot pulse shape shows the most promise for improved compression without loss of stability. This work performed under the auspices of the U.S. Department of Energy by Lawrence Livermore National Laboratory under Contract DE-AC52-07NA27344.

Carbon Allocation of 13CO2-labeled Photoassimilate in Larix gmelinii Saplings - A Physiological Basis for Isotope Dendroclimatology in Eastern Siberia.

NASA Astrophysics Data System (ADS)

Kagawa, A.; Sugimoto, A.; Maximov, T. C.

2006-12-01

Tree-ring density and widths have been successfully used to reconstruct summer temperatures in high- northern latitudes, although a discrepancy between tree-growth and temperature has been found for recent decades. The so-called "reduced sensitivity" of tree rings to summer temperatures has been observed especially strongly in northern Siberia (Briffa et al., 1998) and drought stress (increased water use efficiency) arose from global warming and/or increasing CO2 are suggested as causes (Barber et al. 2000, Saurer et al. 2004). By using carbon isotope ratio as an indicator of drought stress and ring-width/density as indicators of growth, we can clarify how drought stress caused by recent global warming affects wood formation of Siberian trees. However, isotope dendroclimatology is still in its infancy and our understanding of basic physiological processes of isotope signal transfer from leaves to tree rings is insufficient. In order to understand translocation, storage, and allocation of photoassimilate to different organs of trees, we pulse- labeled ten L. gmelinii growing in a continuous permafrost zone with stable 13CO2. We studied seasonal course of carbon allocation patterns of photoassimilate among needles, branches, stem and roots and also how spring, summer, and autumn photoassimilate is later used for both earlywood and latewood formation. About half of the carbon in new needles was derived from stored material. The starch pool in non- needle parts, which can be used for xylem formation, drew about 43 percent of its carbon from previous year's photoassimilate, suggesting that carbon storage is the key mechanism behind autocorrelation in (isotope) dendroclimatology. Analysis of intra-annual 13C of the tree rings formed after the labeling revealed that earlywood contained photoassimilate from the previous summer and autumn as well as from the current spring. Latewood was mainly composed of photoassimilate from the current year's summer/autumn, although it also relied on stored material in some cases. Carbon isotope chronology of recent 100 years shows that the latewood 13C contains stronger climate signal than the earlywood and is significantly correlated to July temperature and July precipitation, corresponding to the timing of carbon incorporation that constitutes latewood. The results suggest the need for separating earlywood and latewood for isotope dendroclimatological study in Siberia. References: 1) Kagawa A., Sugimoto A., & Maximov, T.C. (2006) 13CO2 pulse-labelling of photoassimilates reveals carbon allocation within and between tree rings. Plant, Cell and Environment 29, 1571-1584. 2) Kagawa A., Sugimoto A., & Maximov, T. C. (2006) Seasonal course of translocation, storage, and remobilization of 13C pulse-labeled photoassimilate in naturally growing Larix gmelinii saplings. New Phytologist 171, 793-804. 3) Kagawa A., Naito D., Sugimoto A. & Maximov T. C. (2003) Effects of spatial and temporal variability in soil moisture on widths and 13C values of eastern Siberian tree rings. Journal of Geophysical Research 108 (D16), 4500, doi:10.1029/2002JD003019.

Monthly oral methylprednisolone pulse treatment in progressive multiple sclerosis.

PubMed

Ratzer, Rikke; Iversen, Pernille; Börnsen, Lars; Dyrby, Tim B; Romme Christensen, Jeppe; Ammitzbøll, Cecilie; Madsen, Camilla Gøbel; Garde, Ellen; Lyksborg, Mark; Andersen, Birgit; Hyldstrup, Lars; Sørensen, Per Soelberg; Siebner, Hartwig R; Sellebjerg, Finn

2016-06-01

There is a large unmet need for treatments for patients with progressive multiple sclerosis (MS). Phase 2 studies with cerebrospinal fluid (CSF) biomarker outcomes may be well suited for the initial evaluation of efficacious treatments. To evaluate the effect of monthly oral methylprednisolone pulse treatment on intrathecal inflammation in progressive MS. In this open-label phase 2A study, 15 primary progressive and 15 secondary progressive MS patients received oral methylprednisolone pulse treatment for 60 weeks. Primary outcome was changes in CSF concentrations of osteopontin. Secondary outcomes were other CSF biomarkers of inflammation, axonal damage and demyelination; clinical scores; magnetic resonance imaging measures of disease activity, magnetization transfer ratio (MTR) and diffusion tensor imaging (DTI); motor evoked potentials; and bone density scans. We found no change in the CSF concentration of osteopontin, but we observed significant improvement in clinical scores, MTR, DTI and some secondary CSF outcome measures. Adverse events were well-known side effects to methylprednisolone. Monthly methylprednisolone pulse treatment was safe, but had no effect on the primary outcome. However, improvements in secondary clinical and MRI outcome measures suggest that this treatment regimen may have a beneficial effect in progressive MS. © The Author(s), 2015.

Permeabilization of the nuclear envelope following nanosecond pulsed electric field exposure.

PubMed

Thompson, Gary L; Roth, Caleb C; Kuipers, Marjorie A; Tolstykh, Gleb P; Beier, Hope T; Ibey, Bennett L

2016-01-29

Permeabilization of cell membranes occurs upon exposure to a threshold absorbed dose (AD) of nanosecond pulsed electric fields (nsPEF). The ultimate, physiological bioeffect of this exposure depends on the type of cultured cell and environment, indicating that cell-specific pathways and structures are stimulated. Here we investigate 10 and 600 ns duration PEF effects on Chinese hamster ovary (CHO) cell nuclei, where our hypothesis is that pulse disruption of the nuclear envelope membrane leads to observed cell death and decreased viability 24 h post-exposure. To observe short-term responses to nsPEF exposure, CHO cells have been stably transfected with two fluorescently-labeled proteins known to be sequestered for cellular chromosomal function within the nucleus - histone-2b (H2B) and proliferating cell nuclear antigen (PCNA). H2B remains associated with chromatin after nsPEF exposure, whereas PCNA leaks out of nuclei permeabilized by a threshold AD of 10 and 600 ns PEF. A downturn in 24 h viability, measured by MTT assay, is observed at the number of pulses required to induce permeabilization of the nucleus. Copyright © 2015 Elsevier Inc. All rights reserved.

Noncontrast-enhanced renal angiography using multiple inversion recovery and alternating TR balanced steady-state free precession.

PubMed

Dong, Hattie Z; Worters, Pauline W; Wu, Holden H; Ingle, R Reeve; Vasanawala, Shreyas S; Nishimura, Dwight G

2013-08-01

Noncontrast-enhanced renal angiography techniques based on balanced steady-state free precession avoid external contrast agents, take advantage of high inherent blood signal from the T 2 / T 1 contrast mechanism, and have short steady-state free precession acquisition times. However, background suppression is limited; inflow times are inflexible; labeling region is difficult to define when tagging arterial flow; and scan times are long. To overcome these limitations, we propose the use of multiple inversion recovery preparatory pulses combined with alternating pulse repetition time balanced steady-state free precession to produce renal angiograms. Multiple inversion recovery uses selective spatial saturation followed by four nonselective inversion recovery pulses to concurrently null a wide range of background T 1 species while allowing for adjustable inflow times; alternating pulse repetition time steady-state free precession maintains vessel contrast and provides added fat suppression. The high level of suppression enables imaging in three-dimensional as well as projective two-dimensional formats, the latter of which has a scan time as short as one heartbeat. In vivo studies at 1.5 T demonstrate the superior vessel contrast of this technique. © 2012 Wiley Periodicals, Inc.

Optically Isolated Control of the MOCHI LabJet High Power Pulsed Plasma Experiment

NASA Astrophysics Data System (ADS)

Carroll, Evan; Quinley, Morgan; von der Linden, Jens; You, Setthivoine

2014-10-01

The MOCHI LabJet experiment designed to investigate the dynamics of astrophysical jets at the University of Washington, requires high energy pulsed power supplies for plasma generation and sustainment. Two 600 μ F, 10 kV DC, pulse forming, power supplies have been specifically developed for this application. For safe and convenient user operation, the power supplies are controlled remotely with optical isolation. Three input voltage signals are required for relay actuation, adjusting bank charging voltage, and to fire the experiment: long duration DC signals, long duration user adjustable DC signals and fast trigger pulses with < μ s rise times. These voltage signals are generated from National Instruments timing cards via LabVIEW and are converted to optical signals by coupling photodiodes with custom electronic circuits. At the experiment, the optical signals are converted back to usable voltage signals using custom circuits. These custom circuits and experimental set-up are presented. This work is supported by US DOE Grant DE-SC0010340.

DOE Office of Scientific and Technical Information (OSTI.GOV)

Clark, D. S.; Milovich, J. L.; Hinkel, D. E.

Recent experimental results using the “high foot” pulse shape for inertial confinement fusion ignition experiments on the National Ignition Facility (NIF) [Moses et al., Phys. Plasmas 16, 041006 (2009)] have shown encouraging progress compared to earlier “low foot” experiments. These results strongly suggest that controlling ablation front instability growth can significantly improve implosion performance even in the presence of persistent, large, low-mode distortions. Simultaneously, hydrodynamic growth radiography experiments have confirmed that ablation front instability growth is being modeled fairly well in NIF experiments. It is timely then to combine these two results and ask how current ignition pulse shapes couldmore » be modified to improve one-dimensional implosion performance while maintaining the stability properties demonstrated with the high foot. This paper presents such a survey of pulse shapes intermediate between the low and high foot extremes in search of an intermediate foot optimum. Of the design space surveyed, it is found that a higher picket version of the low foot pulse shape shows the most promise for improved compression without loss of stability.« less

Molecular Biology of Proteins Acting in Immune Response Mechanisms

DTIC Science & Technology

1988-06-01

Studies of the bigsynthesis and processing of LAMP-i and LAMP-2 by pulse -labeling with [ S]methionine showed that the proteins were synthesized as...about Mr 90,000, and post-translationally processed by the addition of a heterogeneous mixture of complex-type oligosaccharides to form mature...centrifugation, and analysis of oligosaccharide processing (D’Souza et -l., 1986). Synthesis and glycosylation of the core polypeptide in the rough

Posttranslational modifications of Sindbis virus glycoproteins: electrophoretic analysis of pulse-chase-labeled infected cells.

PubMed

Bonatti, S; Cancedda, F D

1982-04-01

Cytoplasmic extracts prepared from Sindbis virus-infected chicken embryo fibroblasts pulse-chase-labeled with [35S]methionine 6 h postinfection were analyzed on a highly resolving sodium dodecyl sulfate-gel either directly or after various treatments. The results we obtained suggest that (i) the proteolytic cleavage which converts PE2 to E2 glycoprotein takes place intracellularly, before or at least during the formation of complex-type oligosaccharide side chains; and (ii) E1 glycoprotein undergoes a complex maturation pattern. Newly synthesized E1 has a molecular weight of 53,000: shortly thereafter, this 53,000 (53K) form was converted to a 50K form. Subsequently, the 50K form decreased its apparent molecular weight progressively and eventually comigrated with E1 glycoprotein present in the extracellular virus, which displays a molecular weight of 51,000 to 52,000. The conversion of the 53K to the 50K form was not the result of a proteolytic processing and did not depend on glycosylation or disulfide bridge formation and exchange. The possible mechanisms of this conversion are discussed. The second conversion step (from the 50K to the 51-52K form) was due to the formation of complex-type oligosaccharide and was reversed by incubating the cellular extracts with neuraminidase before electrophoretic analysis.

Effects of waterlogging on carbon assimilate partitioning in the Zoigê alpine wetlands revealed by 13CO2 pulse labeling

PubMed Central

Gao, Jun-Qin; Gao, Ju-Juan; Zhang, Xue-Wen; Xu, Xing-Liang; Deng, Zhao-Heng; Yu, Fei-Hai

2015-01-01

Waterlogging has been suggested to affect carbon (C) turnover in wetlands, but how it affects C allocation and stocks remains unclear in alpine wetlands. Using in situ 13CO2 pulse labelling, we investigated C allocation in both waterlogged and non-waterlogged sites in the Zoigê wetlands on the Tibetan Plateau in August 2011. More than 50% of total 13C fixed by photosynthesis was lost via shoot respiration. Shoots recovered about 19% of total 13C fixed by photosynthesis at both sites. Only about 26% of total fixed 13C was translocated into the belowground pools. Soil organic C pool accounted for 19% and roots recovered about 5–7% of total fixed 13C at both sites. Waterlogging significantly reduced soil respiration and very little 13C was lost via soil respiration in the alpine wetlands compared to that in grasslands. We conclude that waterlogging did not significantly alter C allocations among the C pools except the 13CO2 efflux derived from soil respiration and that shoots made similar contributions to C sequestration as the belowground parts in the Zoigê alpine wetlands. Therefore, changes in waterlogging due to climate change will not affect C assimilate partitioning but soil C efflux. PMID:25797457

THz pulses from 4th generation X-ray light sources: Perspectives for fully synchronized THz pump X-ray probe experiments

DOE Office of Scientific and Technical Information (OSTI.GOV)

Gensch, M.

2010-02-03

In this paper the prospects of terahertz (THz) pulses generated at 4th generation X-ray light sources are presented on the example of recent results from a prototype set-up at the soft X-ray FEL FLASH. It is shown, that the THz pulses from the relativistic ultra short electron bunches have unique properties, that at FLASH are utilized for novel THz pump X-ray probe experiments with a robust few fs resolution. Based on these experiences it is discussed, how future facilities can benefit from implementation of similar or further improved instrumentation.

Removal of slow-pulsing artifacts in in-phase 15N relaxation dispersion experiments using broadband 1H decoupling.

PubMed

Chatterjee, Soumya Deep; Ubbink, Marcellus; van Ingen, Hugo

2018-06-02

Understanding of the molecular mechanisms of protein function requires detailed insight into the conformational landscape accessible to the protein. Conformational changes can be crucial for biological processes, such as ligand binding, protein folding, and catalysis. NMR spectroscopy is exquisitely sensitive to such dynamic changes in protein conformations. In particular, Carr-Purcell-Meiboom-Gill (CPMG) relaxation dispersion experiments are a powerful tool to investigate protein dynamics on a millisecond time scale. CPMG experiments that probe the chemical shift modulation of 15 N in-phase magnetization are particularly attractive, due to their high sensitivity. These experiments require high power 1 H decoupling during the CPMG period to keep the 15 N magnetization in-phase. Recently, an improved version of the in-phase 15 N-CPMG experiment was introduced, offering greater ease of use by employing a single 1 H decoupling power for all CPMG pulsing rates. In these experiments however, incomplete decoupling of off-resonance amide 1 H spins introduces an artefactual dispersion of relaxation rates, the so-called slow-pulsing artifact. Here, we analyze the slow-pulsing artifact in detail and demonstrate that it can be suppressed through the use of composite pulse decoupling (CPD). We report the performances of various CPD schemes and show that CPD decoupling based on the 90 x -240 y -90 x element results in high-quality dispersion curves free of artifacts, even for amides with high 1 H offset.

Uptake of phytodetritus by benthic foraminifera under oxygen depletion at the Indian Margin (Arabian Sea)

NASA Astrophysics Data System (ADS)

Enge, A. J.; Witte, U.; Kucera, M.; Heinz, P.

2013-09-01

Benthic foraminifera in sediments on the Indian margin of the Arabian Sea where the oxygen minimum zone (OMZ) impinges on the continental slope are exposed to particularly severe levels of oxygen depletion. Food supply for the benthic community is high but delivered in distinct pulses during upwelling and water mixing events associated with summer and winter monsoon periods. In order to investigate the response by benthic foraminifera to such pulsed food delivery under oxygen concentrations of less than 0.1 mL L-1 (4.5 μmol L-1), an in situ isotope labeling experiment (13C, 15N) was performed at the western continental slope of India at 540 m water depth (OMZ core region). The assemblage of living foraminifera (>125 μm) in the uppermost centimeter at this depth is characterized by an unexpectedly high population density of 3982 ind. 10 cm-2 and a strong dominance by few calcareous species. For the experiment, we concentrated on the nine most abundant taxa, which constitute 93% of the entire foraminifera population at 0-1 cm sediment depth. Increased concentrations of 13C and 15N in the cytoplasm indicate that all investigated taxa took up the labeled phytodetritus during the 4 day experimental phase. In total, these nine species had assimilated 113.8 mg C m-2 (17.5% of the total added carbon). The uptake of nitrogen by the three most abundant taxa (Bolivina aff. B. dilatata, Cassidulina sp., Bulimina gibba) was 2.7 mg N m-2 (2% of the total added nitrogen) and showed the successful application of 15N as tracer in foraminiferal studies. The short-term response to the offered phytodetritus varied largely among foraminiferal species with Uvigerina schwageri being by far the most important species in short-term processing whereas the most abundant taxa Bolivina aff. B. dilatata and Cassidulina sp. showed comparably low uptake of the offered food. We suggest that the observed species-specific differences are related to individual biomass of species and to specific feeding preferences. The high numbers of living foraminifera and their rapid response to deposited fresh phytodetritus demonstrate the importance of foraminifera in short-term carbon cycling under oxygen-depleted conditions. We propose that foraminifera at the studied site benefit from unique adaptations in their metabolisms to nearly anoxic conditions as well as from the exclusion of macrofauna and the resulting relaxation of competition for food and low predation pressure.

Experiments on sediment pulses in mountain rivers

Treesearch

Y. Cui; T. E. Lisle; J. E. Pizzuto; G. Parker

1998-01-01

Pulses of sediment can be introduced into mountain rivers from such mechanisms as debris flows, landslides and fans at tributary confluences. These processes can be natural or associated with the activities of humans, as in the case of a pulse created by sediment derived from timber harvest or the removal of a dam. How does the river digest these pulses?

Hohlraum glint and laser pre-pulse detector for NIF experiments using velocity interferometer system for any reflector.

PubMed

Moody, J D; Clancy, T J; Frieders, G; Celliers, P M; Ralph, J; Turnbull, D P

2014-11-01

Laser pre-pulse and early-time laser reflection from the hohlraum wall onto the capsule (termed "glint") can cause capsule imprint and unwanted early-time shocks on indirect drive implosion experiments. In a minor modification to the existing velocity interferometer system for any reflector diagnostic on NIF a fast-response vacuum photodiode was added to detect this light. The measurements show evidence of laser pre-pulse and possible light reflection off the hohlraum wall and onto the capsule.

Contrast Enhancement of the LOASIS CPA Laser and Effects on Electron Beam Performance of LWFA

DOE Office of Scientific and Technical Information (OSTI.GOV)

Toth, Csaba; Gonsalves, Anthony J.; Panasenko, Dmitriy

2009-01-22

A nonlinear optical pulse cleaning technique based on cross-polarized wave (XPW) generation filtering [1] has been implemented to improve laser pulse contrast, and consequently to control pre-ionization in laser-plasma accelerator experiments. Three orders of magnitude improvement in pre-pulse contrast has been achieved, resulting in 4-fold increase in electron charge and improved stability of both the electron beam energy and THz radiation generated as a secondary process in the gas-jet-based LWFA experiments.

Fungal carbon sources in a pine forest: evidence from a 13C-labeled global change experiment

Treesearch

Erik A. Hobbie; Kirsten S. Hofmockel; Linda T.A. Van Diepen; Erik A. Lilleskov; Andrew P. Oiumette; Adrien C. Finzi

2014-01-01

We used natural abundance 13C:12C (δ13C) and 8 yr of labeling with 13C-depleted CO2 in a Pinus taeda Free Air CO2 Enrichment (FACE) experiment to investigate carbon sources of saprotrophic fungi, ectomycorrhizal...

The Narrative Experiences of Hmong American Adolescent Males Labeled "Educationally 'At Risk'"

ERIC Educational Resources Information Center

Endo, R.

2017-01-01

This article analyzes the narrative experiences of Hmong American adolescent males who were labeled "at risk" or "high risk" for academic failure or underperformance by their predominantly White school counselors and teachers. Additional data sources included classroom observations at two racially diverse public high schools…

Less label, more free: approaches in label-free quantitative mass spectrometry.

PubMed

Neilson, Karlie A; Ali, Naveid A; Muralidharan, Sridevi; Mirzaei, Mehdi; Mariani, Michael; Assadourian, Gariné; Lee, Albert; van Sluyter, Steven C; Haynes, Paul A

2011-02-01

In this review we examine techniques, software, and statistical analyses used in label-free quantitative proteomics studies for area under the curve and spectral counting approaches. Recent advances in the field are discussed in an order that reflects a logical workflow design. Examples of studies that follow this design are presented to highlight the requirement for statistical assessment and further experiments to validate results from label-free quantitation. Limitations of label-free approaches are considered, label-free approaches are compared with labelling techniques, and forward-looking applications for label-free quantitative data are presented. We conclude that label-free quantitative proteomics is a reliable, versatile, and cost-effective alternative to labelled quantitation. Copyright © 2011 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

Missing the Party: Political Categorization and Reasoning in the Absence of Party Label Cues.

PubMed

Heit, Evan; Nicholson, Stephen P

2016-07-01

This research addressed theoretical approaches in political science arguing that the American electorate is either poorly informed or dependent on party label cues, by assessing performance on political judgment tasks when party label information is missing. The research materials were created from the results of a national opinion survey held during a national election. The experiments themselves were run on nationally representative samples of adults, identified from another national electoral survey. Participants saw profiles of simulated individuals, including information about demographics and issue positions, but omitting party labels. In Experiment 1, participants successfully judged the likelihood of party membership based on the profiles. In Experiment 2, participants successfully voted based on their party interests. The results were mediated by participants' political knowledge. Conclusions are drawn with respect to theories from political science and issues in cognitive science regarding categorization and reasoning. Copyright © 2016 Cognitive Science Society, Inc.

Short-pulse, compressed ion beams at the Neutralized Drift Compression Experiment

DOE PAGES

Seidl, P. A.; Barnard, J. J.; Davidson, R. C.; ...

2016-05-01

We have commenced experiments with intense short pulses of ion beams on the Neutralized Drift Compression Experiment (NDCX-II) at Lawrence Berkeley National Laboratory, with 1-mm beam spot size within 2.5 ns full-width at half maximum. The ion kinetic energy is 1.2 MeV. To enable the short pulse duration and mm-scale focal spot radius, the beam is neutralized in a 1.5-meter-long drift compression section following the last accelerator cell. A short-focal-length solenoid focuses the beam in the presence of the volumetric plasma that is near the target. In the accelerator, the line-charge density increases due to the velocity ramp imparted onmore » the beam bunch. The scientific topics to be explored are warm dense matter, the dynamics of radiation damage in materials, and intense beam and beam-plasma physics including select topics of relevance to the development of heavy-ion drivers for inertial fusion energy. Below the transition to melting, the short beam pulses offer an opportunity to study the multi-scale dynamics of radiation-induced damage in materials with pump-probe experiments, and to stabilize novel metastable phases of materials when short-pulse heating is followed by rapid quenching. First experiments used a lithium ion source; a new plasma-based helium ion source shows much greater charge delivered to the target.« less

Characterization of lipoprotein lipase activity, secretion, and degradation at different sites of post-translational processing in primary cultures of rat adipocytes.

PubMed

Simsolo, R B; Ong, J M; Kern, P A

1992-12-01

The regulation of adipose tissue lipoprotein lipase (LPL) by feeding and fasting occurs through post-translational changes in the LPL protein. In addition, LPL activity and secretion are decreased when N-linked glycosylation is inhibited. To better understand the role of oligosaccharide processing in the development of LPL activity and in LPL secretion, primary cultures of rat adipocytes were treated with inhibitors of oligosaccharide processing. LPL catalytic activity from the heparin-releasable fraction of adipocytes was inhibited by more than 70%, with similar decreases in LPL mass, when cells were cultured for 24 h in the presence of either tunicamycin or castanospermine. On the other hand, deoxymannojirimycin (DMJ) and swainsonine had no effect on LPL activity. LPL secretion was examined after pulse-labeling cells with [35S]methionine. The appearance of 35S-labeled LPL in the medium was blocked by treatment of cells with tunicamycin and castanospermine, whereas secretion was not affected by DMJ or swainsonine. To examine the effect of oligosaccharide processing on LPL intracellular degradation, adipocytes were treated with tunicamycin, castanospermine, and DMJ and then pulse-labeled with [35S]methionine, followed by a chase with unlabeled methionine for 120 min. The unglycosylated [35S]LPL that was synthesized in the presence of tunicamycin demonstrated essentially no intracellular degradation. In the presence of castanospermine and DMJ, the half-life of newly synthesized LPL was increased to 81 and 113 min, as compared to 65 min in control cells. Thus, castanospermine-treated adipocytes demonstrated a decrease in LPL activity and secretion, suggesting that the glucosidase-mediated cleavage of terminal glucose residues from oligosaccharides is a critical step in LPL maturation.(ABSTRACT TRUNCATED AT 250 WORDS)

Quantifying Protein Synthesis and Degradation in Arabidopsis by Dynamic 13CO2 Labeling and Analysis of Enrichment in Individual Amino Acids in Their Free Pools and in Protein1[OPEN

PubMed Central

Fernie, Alisdair R.; Stitt, Mark

2015-01-01

Protein synthesis and degradation represent substantial costs during plant growth. To obtain a quantitative measure of the rate of protein synthesis and degradation, we supplied 13CO2 to intact Arabidopsis (Arabidopsis thaliana) Columbia-0 plants and analyzed enrichment in free amino acids and in amino acid residues in protein during a 24-h pulse and 4-d chase. While many free amino acids labeled slowly and incompletely, alanine showed a rapid rise in enrichment in the pulse and a decrease in the chase. Enrichment in free alanine was used to correct enrichment in alanine residues in protein and calculate the rate of protein synthesis. The latter was compared with the relative growth rate to estimate the rate of protein degradation. The relative growth rate was estimated from sequential determination of fresh weight, sequential images of rosette area, and labeling of glucose in the cell wall. In an 8-h photoperiod, protein synthesis and cell wall synthesis were 3-fold faster in the day than at night, protein degradation was slow (3%–4% d−1), and flux to growth and degradation resulted in a protein half-life of 3.5 d. In the starchless phosphoglucomutase mutant at night, protein synthesis was further decreased and protein degradation increased, while cell wall synthesis was totally inhibited, quantitatively accounting for the inhibition of growth in this mutant. We also investigated the rates of protein synthesis and degradation during leaf development, during growth at high temperature, and compared synthesis rates of Rubisco large and small subunits of in the light and dark. PMID:25810096

Quantifying protein synthesis and degradation in Arabidopsis by dynamic 13CO2 labeling and analysis of enrichment in individual amino acids in their free pools and in protein.

PubMed

Ishihara, Hirofumi; Obata, Toshihiro; Sulpice, Ronan; Fernie, Alisdair R; Stitt, Mark

2015-05-01

Protein synthesis and degradation represent substantial costs during plant growth. To obtain a quantitative measure of the rate of protein synthesis and degradation, we supplied (13)CO2 to intact Arabidopsis (Arabidopsis thaliana) Columbia-0 plants and analyzed enrichment in free amino acids and in amino acid residues in protein during a 24-h pulse and 4-d chase. While many free amino acids labeled slowly and incompletely, alanine showed a rapid rise in enrichment in the pulse and a decrease in the chase. Enrichment in free alanine was used to correct enrichment in alanine residues in protein and calculate the rate of protein synthesis. The latter was compared with the relative growth rate to estimate the rate of protein degradation. The relative growth rate was estimated from sequential determination of fresh weight, sequential images of rosette area, and labeling of glucose in the cell wall. In an 8-h photoperiod, protein synthesis and cell wall synthesis were 3-fold faster in the day than at night, protein degradation was slow (3%-4% d(-1)), and flux to growth and degradation resulted in a protein half-life of 3.5 d. In the starchless phosphoglucomutase mutant at night, protein synthesis was further decreased and protein degradation increased, while cell wall synthesis was totally inhibited, quantitatively accounting for the inhibition of growth in this mutant. We also investigated the rates of protein synthesis and degradation during leaf development, during growth at high temperature, and compared synthesis rates of Rubisco large and small subunits of in the light and dark. © 2015 American Society of Plant Biologists. All Rights Reserved.

Joint learning of ultrasonic backscattering statistical physics and signal confidence primal for characterizing atherosclerotic plaques using intravascular ultrasound.

PubMed

Sheet, Debdoot; Karamalis, Athanasios; Eslami, Abouzar; Noël, Peter; Chatterjee, Jyotirmoy; Ray, Ajoy K; Laine, Andrew F; Carlier, Stephane G; Navab, Nassir; Katouzian, Amin

2014-01-01

Intravascular Ultrasound (IVUS) is a predominant imaging modality in interventional cardiology. It provides real-time cross-sectional images of arteries and assists clinicians to infer about atherosclerotic plaques composition. These plaques are heterogeneous in nature and constitute fibrous tissue, lipid deposits and calcifications. Each of these tissues backscatter ultrasonic pulses and are associated with a characteristic intensity in B-mode IVUS image. However, clinicians are challenged when colocated heterogeneous tissue backscatter mixed signals appearing as non-unique intensity patterns in B-mode IVUS image. Tissue characterization algorithms have been developed to assist clinicians to identify such heterogeneous tissues and assess plaque vulnerability. In this paper, we propose a novel technique coined as Stochastic Driven Histology (SDH) that is able to provide information about co-located heterogeneous tissues. It employs learning of tissue specific ultrasonic backscattering statistical physics and signal confidence primal from labeled data for predicting heterogeneous tissue composition in plaques. We employ a random forest for the purpose of learning such a primal using sparsely labeled and noisy samples. In clinical deployment, the posterior prediction of different lesions constituting the plaque is estimated. Folded cross-validation experiments have been performed with 53 plaques indicating high concurrence with traditional tissue histology. On the wider horizon, this framework enables learning of tissue-energy interaction statistical physics and can be leveraged for promising clinical applications requiring tissue characterization beyond the application demonstrated in this paper. Copyright © 2013 Elsevier B.V. All rights reserved.

Closely related glycosylation patterns of recombinant human IL-2 expressed in a CHO cell line and natural IL-2

DOE Office of Scientific and Technical Information (OSTI.GOV)

Vita, N.; Magazin, M.; Marchese, E.

We report here the study of the glycosylation pattern of human recombinant (r) IL2 expressed in a Chinese hamster ovary (CHO) cell line. The human rIL2 secreted by this high-producing recombinant CHO cell line was metabolically radiolabelled with (35S)-methionine, or with (3H)-glucosamine and (3H)-galactose, purified to homogeneity, and then characterized. The electrophoretic analysis of the (35S)-methionine-labelled proteins present in the culture medium of the CHO cell line showed that the rIL2 represents approximately 12% of the total secreted proteins. Furthermore, pulse-chase experiments showed that the glycosylated rIL2 is synthesized and secreted within 30 min. The point of attachment and themore » structure of the carbohydrate moiety of the rIL2 was determined by: amino-terminal sequencing and fingerprint analysis of the 3H-labelled rIL2, mass spectroscopy of the amino-terminal tryptic octapeptide, and carbohydrate analysis after enzymatic (Vibrio cholerae neuraminidase and Aspergillus oryzae beta-galactosidase) or sulfuric acid hydrolysis. The results indicate that the recombinant protein possesses a sugar moiety O-linked to the threonine residue at position 3 of the polypeptide chain, and that sialic acid, galactose and N-acetyl galactosamine are components of this carbohydrate moiety. Taken together these results suggest that the recombinant molecule is identical to natural IL2.« less

Early intranuclear replication of African swine fever virus genome modifies the landscape of the host cell nucleus.

PubMed

Simões, Margarida; Martins, Carlos; Ferreira, Fernando

2015-12-02

Although African swine fever virus (ASFV) replicates in viral cytoplasmic factories, the presence of viral DNA within the host cell nucleus has been previously reported to be essential for productive infection. Herein, we described, for the first time, the intranuclear distribution patterns of viral DNA replication events, preceding those that occur in the cytoplasmic compartment. Using BrdU pulse-labelling experiments, newly synthesized ASFV genomes were exclusively detected inside the host cell nucleus at the early phase of infection, both in swine monocyte-derived macrophages (MDMs) and Vero cells. From 8hpi onwards, BrdU labelling was only observed in ASFV cytoplasmic factories. Our results also show that ASFV specifically activates the Ataxia Telangiectasia Mutated Rad-3 related (ATR) pathway in ASFV-infected swine MDMs from the early phase of infection, most probably because ASFV genome is recognized as foreign DNA. Morphological changes of promyelocytic leukaemia nuclear bodies (PML-NBs), nuclear speckles and Cajal bodies were also found in ASFV-infected swine MDMs, strongly suggesting the viral modulation of cellular antiviral responses and cellular transcription, respectively. As described for other viral infections, the nuclear reorganization that takes place during ASFV infection may also provide an environment that favours its intranuclear replication events. Altogether, our results contribute for a better understanding of ASFV replication strategies, starting with an essential intranuclear DNA replication phase which induces host nucleus changes towards a successful viral infection. Copyright © 2015 Elsevier B.V. All rights reserved.

'Own-Label' Versus Branded Commercial Dental Resin Composite Materials: Mechanical And Physical Property Comparisons.

PubMed

Shaw, Kathryn; Martins, Ricardo; Hadis, Mohammed Abdul; Burke, Trevor; Palin, William

2016-09-01

A majority of dental materials are manufactured by companies who have experience in the field. However, a number of "own label" materials have become available, principally marketed by distributors and other companies with little or no experience in the field. These materials are attractive because of their reduced cost, but they may have no research on which clinicians might base their potential performance. It is therefore the purpose of this work to compare the performance of different batches of a number of "own-label" dental materials with a similar number from manufacturers with experience in the field, using a variety of laboratory test regimes which include filler determination, degree of conversion, flexural strength and flexural modulus, in order to evaluate key material properties. The results indicated that own-label dental resin composites produced similar results to materials from established companies in terms of flexural strength characteristics and degree of conversion. However, a greater batch-to-batch variation in several mechanical and physical properties of the own-label materials was noted. Copyright© 2016 Dennis Barber Ltd.

In vitro investigations of propulsion during laser lithotripsy using video tracking.

PubMed

Eisel, Maximilian; Ströbl, Stephan; Pongratz, Thomas; Strittmatter, Frank; Sroka, Ronald

2018-04-01

Ureteroscopic laser lithotripsy is an important and widely used method for destroying ureter stones. It represents an alternative to ultrasonic and pneumatic lithotripsy techniques. Although these techniques have been thoroughly investigated, the influence of some physical parameters that may be relevant to further improve the treatment results is not fully understood. One crucial topic is the propulsive stone movement induced by the applied laser pulses. To simplify and speed up the optimization of laser parameters in this regard, a video tracking method was developed in connection with a vertical column setup that allows recording and subsequently analyzing the propulsive stone movement in dependence of different laser parameters in a particularly convenient and fast manner. Pulsed laser light was applied from below to a cubic BegoStone phantom loosely guided within a vertical column setup. The video tracking method uses an algorithm to determine the vertical stone position in each frame of the recorded scene. The time-dependence of the vertical stone position is characterized by an irregular series of peaks. By analyzing the slopes of the peaks in this signal it was possible to determine the mean upward stone velocity for a whole pulse train and to compare it for different laser settings. For a proof of principle of the video tracking method, a specific pulse energy setting (1 J/pulse) was used in combination with three different pulse durations: short pulse (0.3 ms), medium pulse (0.6 ms), and long pulse (1.0 ms). The three pulse durations were compared in terms of their influence on the propulsive stone movement in terms of upward velocity. Furthermore, the propulsions induced by two different pulse energy settings (0.8 J/pulse and 1.2 J/pulse) for a fixed pulse duration (0.3 ms) were compared. A pulse repetition rate of 10 Hz was chosen for all experiments, and for each laser setting, the experiment was repeated on 15 different freshly prepared stones. The latter set of experiments was compared with the results of previous propulsion measurements performed with a pendulum setup. For a fixed pulse energy (1 J/pulse), the mean upward propulsion velocity increased (from 120.0 to 154.9 mm · s -1 ) with decreasing pulse duration. For fixed pulse duration (0.3 ms), the mean upward propulsion velocity increased (from 91.9 to 123.3 mm · s -1 ) with increasing pulse energy (0.8 J/pulse and 1.2 J/pulse). The latter result corresponds roughly to the one obtained with the pendulum setup (increase from 61 to 105 mm · s -1 ). While the mean propulsion velocities for the two different pulse energies were found to differ significantly (P < 0.001) for the two experimental and analysis methods, the standard deviations of the measured mean propulsion velocities were considerably smaller in case of the vertical column method with video tracking (12% and 15% for n = 15 freshly prepared stones) than in case of the pendulum method (26% and 41% for n = 50 freshly prepared stones), in spite of the considerably smaller number of experiment repetitions ("sample size") in the first case. The proposed vertical column method with video tracking appears advantageous compared to the pendulum method in terms of the statistical significance of the obtained results. This may partly be understood by the fact that the entire motion of the stones contributes to the data analysis, rather than just their maximum distance from the initial position. The key difference is, however, that the pendulum method involves only one single laser pulse in each experiment run, which renders this method rather tedious to perform. Furthermore, the video tracking method appears much better suited to model a clinical lithotripsy intervention that utilizes longer series of laser pulses at higher repetition rates. The proposed video tracking method can conveniently and quickly deliver results for a large number of laser pulses that can easily be averaged. An optimization of laser settings to achieve minimal propulsive stone movement should thus be more easily feasible with the video tracking method in connection with the vertical column setup. Lasers Surg. Med. 50:333-339, 2018. © 2017 Wiley Periodicals, Inc. © 2017 Wiley Periodicals, Inc.

Category labels versus feature labels: category labels polarize inferential predictions.

PubMed

Yamauchi, Takashi; Yu, Na-Yung

2008-04-01

What makes category labels different from feature labels in predictive inference? This study suggests that category labels tend to make inductive reasoning polarized and homogeneous. In two experiments, participants were shown two schematic pictures of insects side by side and predicted the value of a hidden feature of one insect on the basis of the other insect. Arbitrary verbal labels were shown above the two pictures, and the meanings of the labels were manipulated in the instructions. In one condition, the labels represented the category membership of the insects, and in the other conditions, the same labels represented attributes of the insects. When the labels represented category membership, participants' responses became substantially polarized and homogeneous, indicating that the mere reference to category membership can modify reasoning processes.

Collaborative development for setup, execution, sharing and analytics of complex NMR experiments.

PubMed

Irvine, Alistair G; Slynko, Vadim; Nikolaev, Yaroslav; Senthamarai, Russell R P; Pervushin, Konstantin

2014-02-01

Factory settings of NMR pulse sequences are rarely ideal for every scenario in which they are utilised. The optimisation of NMR experiments has for many years been performed locally, with implementations often specific to an individual spectrometer. Furthermore, these optimised experiments are normally retained solely for the use of an individual laboratory, spectrometer or even single user. Here we introduce a web-based service that provides a database for the deposition, annotation and optimisation of NMR experiments. The application uses a Wiki environment to enable the collaborative development of pulse sequences. It also provides a flexible mechanism to automatically generate NMR experiments from deposited sequences. Multidimensional NMR experiments of proteins and other macromolecules consume significant resources, in terms of both spectrometer time and effort required to analyse the results. Systematic analysis of simulated experiments can enable optimal allocation of NMR resources for structural analysis of proteins. Our web-based application (http://nmrplus.org) provides all the necessary information, includes the auxiliaries (waveforms, decoupling sequences etc.), for analysis of experiments by accurate numerical simulation of multidimensional NMR experiments. The online database of the NMR experiments, together with a systematic evaluation of their sensitivity, provides a framework for selection of the most efficient pulse sequences. The development of such a framework provides a basis for the collaborative optimisation of pulse sequences by the NMR community, with the benefits of this collective effort being available to the whole community. Copyright © 2013 Elsevier Inc. All rights reserved.

Influence of simplified nutrition labeling and taxation on laboratory energy intake in adults.

PubMed

Temple, Jennifer L; Johnson, Karena M; Archer, Kelli; Lacarte, Allison; Yi, Christina; Epstein, Leonard H

2011-08-01

The purpose of these studies was to test the hypotheses that simplified nutrition labeling and taxation alter food selection and intake. In Experiment 1, participants consumed lunch in the laboratory three times with no labels, standard nutrition labels, or traffic light diet labels at each visit. In Experiment 2, participants were given $6.00 with which to purchase lunch in the laboratory twice with standard pricing on one visit and a 25% tax on "red" foods on another visit. Participants received a brief education session on the labeling systems being used. Total energy intake and energy intake and number of foods purchased from each traffic light category were measured. Nutrition labeling decreased energy intake in lean females, but had no effect in men or in obese females. Traffic light labels increased consumption of "green" foods and decreased consumption of "red" foods. Taxation decreased the purchasing of "red" foods in obese, but not non-obese participants. There were no interactions between taxation and simplified nutrition labeling. Although generalization to real-world purchasing and consumption is limited by the laboratory study design, our findings suggests that taking multiple, simultaneous approaches to reduce energy intake may have the greatest impact on food purchases and/or nutrient consumption. Copyright © 2011 Elsevier Ltd. All rights reserved.

View the label before you view the movie: A field experiment into the impact of Portion size and Guideline Daily Amounts labelling on soft drinks in cinemas

PubMed Central

2011-01-01

Background Large soft drink sizes increase consumption, and thereby contribute to obesity. Portion size labelling may help consumers to select more appropriate food portions. This study aimed to assess the effectiveness of portion size and caloric Guidelines for Daily Amounts (GDA) labelling on consumers' portion size choices and consumption of regular soft drinks. Methods A field experiment that took place on two subsequent evenings in a Dutch cinema. Participants (n = 101) were asked to select one of five different portion sizes of a soft drink. Consumers were provided with either portion size and caloric GDA labelling (experimental condition) or with millilitre information (control condition). Results Labelling neither stimulated participants to choose small portion sizes (OR = .75, p = .61, CI: .25 - 2.25), nor did labelling dissuade participants to choose large portion sizes (OR = .51, p = .36, CI: .12 - 2.15). Conclusions Portion size and caloric GDA labelling were found to have no effect on soft drink intake. Further research among a larger group of participants combined with pricing strategies is required. The results of this study are relevant for the current public health debate on food labelling. PMID:21645373

Configural displays can improve nutrition-related. decisions: an application of the proximity compatibility principle.

PubMed

Marino, Christopher J; Mahan, Robert R

2005-01-01

The nutrition label format currently used by consumers to make dietary-related decisions presents significant information-processing demands for integration-based decisions; however, those demands were not considered as primary factors when the format was adopted. Labels designed in accordance with known principles of cognitive psychology might enhance the kind of decision making that food labeling was intended to facilitate. Three experiments were designed on the basis of the proximity compatibility principle (PCP) to investigate the relationship between nutrition label format and decision making; the experiments involved two types of integration decisions and one type of filtering decision. Based on the PCP, decision performance was measured to test the overall hypothesis that matched task-display tandems would result in better decision performance than would mismatched tandems. In each experiment, a statistically significant increase in mean decision performance was found when the display design was cognitively matched to the demands of the task. Combined, the results from all three experiments support the general hypothesis that task-display matching is a design principle that may enhance the utility of nutrition labeling in nutrition-related decision making. Actual or potential applications of this research include developing robust display solutions that aid in less effortful assimilation of nutrition-related information for consumers.

A high voltage pulse generator based on silicon-controlled rectifier for field-reversed configuration experiment.

PubMed

Lin, Munan; Liu, Ming; Zhu, Guanghui; Wang, Yanpeng; Shi, Peiyun; Sun, Xuan

2017-08-01

A high voltage pulse generator based on a silicon-controlled rectifier has been designed and implemented for a field reversed configuration experiment. A critical damping circuit is used in the generator to produce the desired pulse waveform. Depending on the load, the rise time of the output trigger signal can be less than 1 μs, and the peak amplitudes of trigger voltage and current are up to 8 kV and 85 A in a single output. The output voltage can be easily adjusted by changing the voltage on a capacitor of the generator. In addition, the generator integrates an electrically floating heater circuit so it is capable of triggering either pseudosparks (TDI-type hydrogen thyratron) or ignitrons. Details of the circuits and their implementation are described in the paper. The trigger generator has successfully controlled the discharging sequence of the pulsed power supply for a field reversed configuration experiment.

A high voltage pulse generator based on silicon-controlled rectifier for field-reversed configuration experiment

NASA Astrophysics Data System (ADS)

Lin, Munan; Liu, Ming; Zhu, Guanghui; Wang, Yanpeng; Shi, Peiyun; Sun, Xuan

2017-08-01

A high voltage pulse generator based on a silicon-controlled rectifier has been designed and implemented for a field reversed configuration experiment. A critical damping circuit is used in the generator to produce the desired pulse waveform. Depending on the load, the rise time of the output trigger signal can be less than 1 μs, and the peak amplitudes of trigger voltage and current are up to 8 kV and 85 A in a single output. The output voltage can be easily adjusted by changing the voltage on a capacitor of the generator. In addition, the generator integrates an electrically floating heater circuit so it is capable of triggering either pseudosparks (TDI-type hydrogen thyratron) or ignitrons. Details of the circuits and their implementation are described in the paper. The trigger generator has successfully controlled the discharging sequence of the pulsed power supply for a field reversed configuration experiment.

Analysis of higher harmonics on bidirectional heat pulse propagation experiment in helical and tokamak plasmas

NASA Astrophysics Data System (ADS)

Kobayashi, T.; Ida, K.; Inagaki, S.; Tsuchiya, H.; Tamura, N.; Choe, G. H.; Yun, G. S.; Park, H. K.; Ko, W. H.; Evans, T. E.; Austin, M. E.; Shafer, M. W.; Ono, M.; López-bruna, D.; Ochando, M. A.; Estrada, T.; Hidalgo, C.; Moon, C.; Igami, H.; Yoshimura, Y.; Tsujimura, T. Ii.; Itoh, S.-I.; Itoh, K.

2017-07-01

In this contribution we analyze modulation electron cyclotron resonance heating (MECH) experiment and discuss higher harmonic frequency dependence of transport coefficients. We use the bidirectional heat pulse propagation method, in which both inward propagating heat pulse and outward propagating heat pulse are analyzed at a radial range, in order to distinguish frequency dependence of transport coefficients due to hysteresis from that due to other reasons, such as radially dependent transport coefficients, a finite damping term, or boundary effects. The method is applied to MECH experiments performed in various helical and tokamak devices, i.e. Large Helical Device (LHD), TJ-II, Korea Superconducting Tokamak Advanced Research (KSTAR), and Doublet III-D (DIII-D) with different plasma conditions. The frequency dependence of transport coefficients are clearly observed, showing a possibility of existence of transport hysteresis in flux-gradient relation.

Software defined photon counting system for time resolved x-ray experiments.

PubMed

Acremann, Y; Chembrolu, V; Strachan, J P; Tyliszczak, T; Stöhr, J

2007-01-01

The time structure of synchrotron radiation allows time resolved experiments with sub-100 ps temporal resolution using a pump-probe approach. However, the relaxation time of the samples may require a lower repetition rate of the pump pulse compared to the full repetition rate of the x-ray pulses from the synchrotron. The use of only the x-ray pulse immediately following the pump pulse is not efficient and often requires special operation modes where only a few buckets of the storage ring are filled. We designed a novel software defined photon counting system that allows to implement a variety of pump-probe schemes at the full repetition rate. The high number of photon counters allows to detect the response of the sample at multiple time delays simultaneously, thus improving the efficiency of the experiment. The system has been successfully applied to time resolved scanning transmission x-ray microscopy. However, this technique is applicable more generally.

Eradication of multidrug-resistant pseudomonas biofilm with pulsed electric fields.

PubMed

Khan, Saiqa I; Blumrosen, Gaddi; Vecchio, Daniela; Golberg, Alexander; McCormack, Michael C; Yarmush, Martin L; Hamblin, Michael R; Austen, William G

2016-03-01

Biofilm formation is a significant problem, accounting for over eighty percent of microbial infections in the body. Biofilm eradication is problematic due to increased resistance to antibiotics and antimicrobials as compared to planktonic cells. The purpose of this study was to investigate the effect of Pulsed Electric Fields (PEF) on biofilm-infected mesh. Prolene mesh was infected with bioluminescent Pseudomonas aeruginosa and treated with PEF using a concentric electrode system to derive, in a single experiment, the critical electric field strength needed to kill bacteria. The effect of the electric field strength and the number of pulses (with a fixed pulse length duration and frequency) on bacterial eradication was investigated. For all experiments, biofilm formation and disruption were confirmed with bioluminescent imaging and Scanning Electron Microscopy (SEM). Computation and statistical methods were used to analyze treatment efficiency and to compare it to existing theoretical models. In all experiments 1500 V are applied through a central electrode, with pulse duration of 50 μs, and pulse delivery frequency of 2 Hz. We found that the critical electric field strength (Ecr) needed to eradicate 100-80% of bacteria in the treated area was 121 ± 14 V/mm when 300 pulses were applied, and 235 ± 6.1 V/mm when 150 pulses were applied. The area at which 100-80% of bacteria were eradicated was 50.5 ± 9.9 mm(2) for 300 pulses, and 13.4 ± 0.65 mm(2) for 150 pulses. 80% threshold eradication was not achieved with 100 pulses. The results indicate that increased efficacy of treatment is due to increased number of pulses delivered. In addition, we that showed the bacterial death rate as a function of the electrical field follows the statistical Weibull model for 150 and 300 pulses. We hypothesize that in the clinical setting, combining systemic antibacterial therapy with PEF will yield a synergistic effect leading to improved eradication of mesh infections. © 2015 Wiley Periodicals, Inc.