Science.gov

Sample records for pulse stretcher amps

  1. Mechanical design philosophy and construction of the Amsterdam Pulse Stretcher ring AmPS

    NASA Astrophysics Data System (ADS)

    Kaan, A. P.; Heemskerk, J. A.; Touw, J.; Bijleveld, J.; Rookhuizen, H. Boer; Verlegh, W.; Langedijk, J.; Bron, G.; Arink, R.; Lassing, P.

    The design philosophy and the construction of the Amsterdam Pulse Stretcher (AmPS) are described with emphasis on the vacuum components as well as on the alignment system and on the supports for the magnets and the monitors. The AmPS ring is a 900 MeV electron pulse stretcher and storage ring with a circumference of 212 m. The ring was planned to start in Spring 1992. The vacuum chambers in the bending sections therefore are fabricated from stainless steel 316 LN with a very low cobalt content. An advanced welding and cleaning technique was developed to avoid the inclusion of impurities. The vacuum pump capacity and the pump distribution along the ring were optimized as function of local conductances and outgassing.

  2. Pulse stretcher

    DOEpatents

    Horton, J.A.

    1994-05-03

    Apparatus for increasing the length of a laser pulse to reduce its peak power without substantial loss in the average power of the pulse is disclosed. The apparatus uses a White cell having a plurality of optical delay paths of successively increasing number of passes between the field mirror and the objective mirrors. A pulse from a laser travels through a multi-leg reflective path between a beam splitter and a totally reflective mirror to the laser output. The laser pulse is also simultaneously injected through the beam splitter to the input mirrors of the optical delay paths. The pulses from the output mirrors of the optical delay paths go simultaneously to the laser output and to the input mirrors of the longer optical delay paths. The beam splitter is 50% reflective and 50% transmissive to provide equal attenuation of all of the pulses at the laser output. 6 figures.

  3. Pulse stretcher

    DOEpatents

    Horton, James A.

    1994-01-01

    Apparatus (20) for increasing the length of a laser pulse to reduce its peak power without substantial loss in the average power of the pulse. The apparatus (20) uses a White cell (10) having a plurality of optical delay paths (18a-18d) of successively increasing number of passes between the field mirror (13) and the objective mirrors (11 and 12). A pulse (26) from a laser (27) travels through a multi-leg reflective path (28) between a beam splitter (21) and a totally reflective mirror (24) to the laser output (37). The laser pulse (26) is also simultaneously injected through the beam splitter (21) to the input mirrors (14a-14d) of the optical delay paths (18a-18d). The pulses from the output mirrors (16a-16d) of the optical delay paths (18a-18d) go simultaneously to the laser output (37) and to the input mirrors ( 14b-14d) of the longer optical delay paths. The beam splitter (21) is 50% reflective and 50% transmissive to provide equal attenuation of all of the pulses at the laser output (37).

  4. Predicted performance of a multi-section VUV FEL with the Amsterdam pulse stretcher and storage ring AmPS

    SciTech Connect

    Bazylev, V.A.; Pitatelev, M.I.; Tulupov, A.V.

    1995-12-31

    A design is proposed to realize a VUV FEL with the Amsterdam Pulse Stretcher and Storage Ring (AmPS). The FEL is based on 4 identical undulator sections and 3 dispersive sections. The total magnetic system has a length of 12 m. 3 D simulations with the actual electron beam parameters of AmPS have been done with a version of TDA code modified for multi-sectional FELs. The spectral range between 50 and 100 nm has been considered. The simulations show that an amplification as large as 1*E5 - 1*E7 can be achieved. The amplification can be enhanced by a further optimisation procedure.

  5. SHORT PULSE STRETCHER

    DOEpatents

    Branum, D.R.; Cummins, W.F.

    1962-12-01

    >A short pulse stretching circuit capable of stretching a short puise to enable it to be displayed on a relatively slow sweeping oscilloscope is described. Moreover, the duration of the pulse is increased by charging a capacitor through a diode and thereafter discharging the capacitor at such time as is desired. In the circuit the trigger pulse alone passes through a delay line, whereas the main signal passes through the diode only, and results in over-all circuit losses which are proportional to the low losses of the diode only. (AEC)

  6. Aberration-free, all-reflective laser pulse stretcher

    DOEpatents

    Perry, Michael D.; Banks, Paul S.; Stuart, Brent C.; Fochs, Scott N.

    1999-09-28

    An all-reflective pulse stretcher for laser systems employing chirped-pulse amplification enables on-axis use of the focusing mirror which results in ease of use, significantly decreased sensitivity to alignment and near aberration-free performance. By using a new type of diffraction grating which contains a mirror incorporated into the grating, the stretcher contains only three elements: 1) the grating, 2) a spherical or parabolic focusing mirror, and 3) a flat mirror. Addition of a fourth component, a retro-reflector, enables multiple passes of the same stretcher resulting in stretching ratios beyond the current state of the art in a simple and compact design. The pulse stretcher has been used to stretch pulses from 20 fsec to over 600 psec (a stretching ratio in excess of 30,000).

  7. Polarization-controlled optical ring cavity (PORC) tunable pulse stretcher

    NASA Astrophysics Data System (ADS)

    Williamson, Andrew P.; Kiefer, Johannes

    2016-08-01

    A new concept and a theoretical approach for modeling a tunable polarization-controlled optical ring cavity pulse stretcher is demonstrated. The technique discussed herein permits highly simplified and flexible tuning of the temporal shape of nanosecond duration pulses. Using half-wave plates positioned extra- and intracavity, transmission to reflection ratios across both input faces of a polarization beam splitter can easily be controlled. The resulting models indicate a further reduction in peak intensity of 30%, with respect to conventional dielectric beam splitting optical ring cavities, when configured under equivalent and optimized cavity settings.

  8. Laser pulse stretcher method and apparatus

    DOEpatents

    Hawkins, Jon K.; Williams, William A.

    1990-01-01

    The output of an oscillator stage of a laser system is monitored by a photocell which is coupled to a feedback section to control a Pockels Cell and change the light output of the oscillator stage. A synchronizing pulse is generated in timed relation to the initiation of operation of the oscillator stage and is applied to a forward feed section which cooperates with the feedback section to maintain the light output constant for an extended time interval.

  9. Short pulse laser stretcher-compressor using a single common reflective grating

    DOEpatents

    Erbert, Gaylen V.; Biswal, Subrat; Bartolick, Joseph M.; Stuart, Brent C.; Telford, Steve

    2004-05-25

    The present invention provides an easily aligned, all-reflective, aberration-free pulse stretcher-compressor in a compact geometry. The stretcher-compressor device is a reflective multi-layer dielectric that can be utilized for high power chirped-pulse amplification material processing applications. A reflective grating element of the device is constructed: 1) to receive a beam for stretching of laser pulses in a beam stretcher beam path and 2) to also receive stretched amplified pulses to be compressed in a compressor beam path through the same (i.e., common) reflective multilayer dielectric diffraction grating. The stretched and compressed pulses are interleaved about the grating element to provide the desired number of passes in each respective beam path in order to achieve the desired results.

  10. A stretcher fiber for use in fs chirped pulse Yb amplifiers.

    PubMed

    Grüner-Nielsen, Lars; Jakobsen, Dan; Jespersen, Kim G; Pálsdóttir, Bera

    2010-02-15

    A newly developed fiber for use in pulse stretchers for chirped pulse amplifiers working in the 1 mum wavelength range of Yb fiber amplifiers is reported. The fiber has a record high numerical third order to second order dispersion beta(3)/beta(2) ratio of -7.7 fs. The fiber has very good dispersion match to a grating compressor for second, third, and fourth order dispersion. By combining the stretcher fiber with an anomalous dispersion fiber working in a higher order mode, even higher beta(3)/beta(2) ratio of -16.8 fs is demonstrated. The combined module shows very good dispersion match to a grating compressor.

  11. Fiber-based pulse stretcher for narrowband terahertz pulse generation with a chirped-pulse beating method

    NASA Astrophysics Data System (ADS)

    Yoshida, Tetsuya; Kamada, Shohei; Murata, Shuhei; Aoki, Takao

    2013-10-01

    We theoretically show that it is possible to generate chirp-free terahertz (THz) pulses with a chirped-pulse beating method by using an optical fiber as a pulse stretcher. Proper choices of the core radius and the dopant fraction of the core material of a step-index single-mode optical fiber eliminate the third-order spectral phase of the fiber, thus giving the pump laser pulse a purely linear chirp. We also show that even a standard commercial single-mode optical fiber can give THz pulses of lower chirp than the lower limit for a grating pair. We perform experiments to verify our theory.

  12. Integrated pulse stretchers for high-energy CPA and OPCPA systems

    NASA Astrophysics Data System (ADS)

    Shah, Lawrence; Bodnar, Nathan; Roumayah, Patrick; Webb, Benjamin; Bradford, Joshua; Richardson, Martin

    2016-03-01

    Pulse stretchers are critical components in chirped pulse amplification (CPA) and optical parametric CPA (OPCPA) laser systems. In CPA systems, pulse stretching and compression is typical accomplished using bulk diffraction gratings; however integrated devices such volume or fiber Bragg gratings can provide similar optical performance with significantly smaller footprint and simplified alignment. In this work, we discuss the use of such integrated devices to stretch a 100 fs pulse to 400 ps with customized third order dispersion for use in a multi-TW Ti:Sapphire system as well as integrated optics to control the pulse duration in pump lasers for OPCPA systems.

  13. Transmission grating stretcher for contrast enhancement of high power lasers.

    PubMed

    Tang, Yunxin; Hooker, Chris; Chekhlov, Oleg; Hawkes, Steve; Collier, John; Rajeev, P P

    2014-12-01

    We propose, for the first time, a transmission grating stretcher for high power lasers and demonstrate its superiority over conventional, reflective gold grating stretchers in terms of pulse temporal quality. We show that, compared to a conventional stretcher with the same stretching factor, the transmission-grating based stretcher yields more than an order of magnitude improvement in the contrast pedestal. We have also quantitatively characterized the roughness of the grating surfaces and estimated its impact on the contrast pedestal.

  14. Grism based stretcher/compressor system for amplified, femtosecond kilohertz lasers

    NASA Astrophysics Data System (ADS)

    Gaudiosi, David M.; Gibson, Emily A.; Kane, Steve; Huff, Rachael; Murnane, Margaret; Kaptyen, Henry C.; Durfee, Charles G.; Squier, Jeff; Jimenez, Ralph

    We demonstrate a simple and efficient grism based stretcher/compression system. 36 fs, ˜300 µJ pulses are generated at 5-15 kHz by using this unique grism stretcher/material compressor in a Ti:sapphire amplifier system based on downchirped pulse amplification.

  15. Monochromators as Light Stretchers.

    ERIC Educational Resources Information Center

    Rubin, B.; Herman, R. M.

    1981-01-01

    A known but often overlooked property of optical monochromators is discussed in view of its current applications. It is shown that grating and prism monochromators hold on to light for time durations proportional to resolving power and that the dispersing ability of monochromators extends to pulses of arbitrarily short duration. (SK)

  16. Stretchers and compressors for ultra-high power laser systems

    SciTech Connect

    Yakovlev, I V

    2014-05-30

    This review is concerned with pulse stretchers and compressors as key components of ultra-high power laser facilities that take advantage of chirped-pulse amplification. The potentialities, characteristics, configurations and methods for the matching and alignment of these devices are examined, with particular attention to the history of the optics of ultra-short, ultra-intense pulses before and after 1985, when the chirped-pulse amplification method was proposed, which drastically changed the view of the feasibility of creating ultra-high power laser sources. The review is intended primarily for young scientists and experts who begin to address the amplification and compression of chirped pulses, experts in laser optics and all who are interested in scientific achievements in the field of ultra-high power laser systems. (review)

  17. Cell behavior in Dictyostelium discoideum: preaggregation response to localized cyclic AMP pulses

    PubMed Central

    1982-01-01

    The motion of cells in the aggregation phase of Dictyostelium discoideum development is complex. To probe its mechanisms we applied precisely timed (+/- 1 s) and positioned (+/-2 micrometers) pulses of cyclic AMP to fields of cells of moderate density using a micropipette. We recorded cell behavior by time lapse microcinematography and extracted cell motion data from the film with our Galatea computer system. Analysis of these data reveals: (a) Chemotaxis lasts only about as long as the cyclic AMP signal; in particular, brief pulses (approximately 5 s) do not induce chemotaxis. (b) Chemotactic competence increases gradually from within an hour after the initiation of development (starvation) to full competence at approximately 15 h when aggregation begins under our conditions. (c) Cell motion reverses rapidly (within 20 s) when the external gradient is reversed. There is no refractory period for motion. We present a new description of the process of aggregation consistent with our result and other recent findings. (d) The behavioral response to cyclic AMP includes a phenomenon we call "cringing." In a prototypical cringe the cell speed drops within 3 s after a brief cyclic AMP stimulus, and the cell stops and rounds and then resumes motion after 25 s. (e) The development of the speed response in cringing as the cells age closely parallels the development of the cyclic AMP-induced light-scattering response of cells in suspension. (f) Cringing occurs in natural populations during weak oriented movement. The computerized analysis of cell behavior proves to be a powerful technique which can reveal significant phenomena that are not apparent to the eye even after repeated examination of the film. PMID:6282894

  18. 21 CFR 880.6900 - Hand-carried stretcher.

    Code of Federal Regulations, 2014 CFR

    2014-04-01

    ... 21 Food and Drugs 8 2014-04-01 2014-04-01 false Hand-carried stretcher. 880.6900 Section 880.6900 Food and Drugs FOOD AND DRUG ADMINISTRATION, DEPARTMENT OF HEALTH AND HUMAN SERVICES (CONTINUED... Devices § 880.6900 Hand-carried stretcher. (a) Identification. A hand-carried stretcher is a...

  19. 21 CFR 880.6900 - Hand-carried stretcher.

    Code of Federal Regulations, 2012 CFR

    2012-04-01

    ... 21 Food and Drugs 8 2012-04-01 2012-04-01 false Hand-carried stretcher. 880.6900 Section 880.6900 Food and Drugs FOOD AND DRUG ADMINISTRATION, DEPARTMENT OF HEALTH AND HUMAN SERVICES (CONTINUED... Devices § 880.6900 Hand-carried stretcher. (a) Identification. A hand-carried stretcher is a...

  20. 21 CFR 880.6900 - Hand-carried stretcher.

    Code of Federal Regulations, 2013 CFR

    2013-04-01

    ... 21 Food and Drugs 8 2013-04-01 2013-04-01 false Hand-carried stretcher. 880.6900 Section 880.6900 Food and Drugs FOOD AND DRUG ADMINISTRATION, DEPARTMENT OF HEALTH AND HUMAN SERVICES (CONTINUED... Devices § 880.6900 Hand-carried stretcher. (a) Identification. A hand-carried stretcher is a...

  1. 21 CFR 880.6900 - Hand-carried stretcher.

    Code of Federal Regulations, 2010 CFR

    2010-04-01

    ... 21 Food and Drugs 8 2010-04-01 2010-04-01 false Hand-carried stretcher. 880.6900 Section 880.6900 Food and Drugs FOOD AND DRUG ADMINISTRATION, DEPARTMENT OF HEALTH AND HUMAN SERVICES (CONTINUED... Devices § 880.6900 Hand-carried stretcher. (a) Identification. A hand-carried stretcher is a...

  2. 21 CFR 880.6900 - Hand-carried stretcher.

    Code of Federal Regulations, 2011 CFR

    2011-04-01

    ... 21 Food and Drugs 8 2011-04-01 2011-04-01 false Hand-carried stretcher. 880.6900 Section 880.6900 Food and Drugs FOOD AND DRUG ADMINISTRATION, DEPARTMENT OF HEALTH AND HUMAN SERVICES (CONTINUED... Devices § 880.6900 Hand-carried stretcher. (a) Identification. A hand-carried stretcher is a...

  3. 21 CFR 880.6910 - Wheeled stretcher.

    Code of Federal Regulations, 2011 CFR

    2011-04-01

    ... 21 Food and Drugs 8 2011-04-01 2011-04-01 false Wheeled stretcher. 880.6910 Section 880.6910 Food and Drugs FOOD AND DRUG ADMINISTRATION, DEPARTMENT OF HEALTH AND HUMAN SERVICES (CONTINUED) MEDICAL... platform mounted on a wheeled frame that is designed to transport patients in a horizontal position....

  4. Chirped-pulse amplification with narrowband pulses.

    PubMed

    Shverdin, M Y; Albert, F; Anderson, S G; Betts, S M; Gibson, D J; Messerly, M J; Hartemann, F V; Siders, C W; Barty, C P J

    2010-07-15

    We demonstrate a compact hyperdispersion stretcher and compressor pair that permit chirped-pulse amplification in Nd:YAG. We generate 750 mJ, 0.2 nm FWHM, 10 Hz pulses recompressed to an 8 ps near-transform-limited duration. The dispersion-matched pulse compressor and stretcher impart a chirp of 7300 ps/nm, in a 3 m x 1 m footprint.

  5. Chirped-pulse amplification with narrowband pulses.

    PubMed

    Shverdin, M Y; Albert, F; Anderson, S G; Betts, S M; Gibson, D J; Messerly, M J; Hartemann, F V; Siders, C W; Barty, C P J

    2010-07-15

    We demonstrate a compact hyperdispersion stretcher and compressor pair that permit chirped-pulse amplification in Nd:YAG. We generate 750 mJ, 0.2 nm FWHM, 10 Hz pulses recompressed to an 8 ps near-transform-limited duration. The dispersion-matched pulse compressor and stretcher impart a chirp of 7300 ps/nm, in a 3 m x 1 m footprint. PMID:20634869

  6. Validation and perspectives of a femtosecond laser fabricated monolithic optical stretcher

    PubMed Central

    Bellini, Nicola; Bragheri, Francesca; Cristiani, Ilaria; Guck, Jochen; Osellame, Roberto; Whyte, Graeme

    2012-01-01

    The combination of high power laser beams with microfluidic delivery of cells is at the heart of high-throughput, single-cell analysis and disease diagnosis with an optical stretcher. So far, the challenges arising from this combination have been addressed by externally aligning optical fibres with microfluidic glass capillaries, which has a limited potential for integration into lab-on-a-chip environments. Here we demonstrate the successful production and use of a monolithic glass chip for optical stretching of white blood cells, featuring microfluidic channels and optical waveguides directly written into bulk glass by femtosecond laser pulses. The performance of this novel chip is compared to the standard capillary configuration. The robustness, durability and potential for intricate flow patterns provided by this monolithic optical stretcher chip suggest its use for future diagnostic and biotechnological applications. PMID:23082304

  7. Ampère-Class Pulsed Field Emission from Carbon-Nanotube Cathodes in a Radiofrequency Resonator

    SciTech Connect

    Mihalcea, D.; Faillace, L.; Hartzell, J.; Panuganti, H.; Boucher, S. M.; Murokh, A.; Piot, P.; Thangaraj, J. C.T.

    2014-12-01

    Pulsed field emission from cold carbon-nanotube cathodes placed in a radiofrequency resonant cavity was observed. The cathodes were located on the backplate of a conventional $1+\\frac{1}{2}$-cell resonant cavity operating at 1.3-GHz and resulted in the production of bunch train with maximum average current close to 0.7 Amp\\`ere. The measured Fowler-Nordheim characteristic, transverse emittance, and pulse duration are presented and, when possible, compared to numerical simulations. The implications of our results to high-average-current electron sources are briefly discussed.

  8. Dispersion compensation in chirped pulse amplification systems

    SciTech Connect

    Bayramian, Andrew James; Molander, William A.

    2014-07-15

    A chirped pulse amplification system includes a laser source providing an input laser pulse along an optical path. The input laser pulse is characterized by a first temporal duration. The system also includes a multi-pass pulse stretcher disposed along the optical path. The multi-pass pulse stretcher includes a first set of mirrors operable to receive input light in a first plane and output light in a second plane parallel to the first plane and a first diffraction grating. The pulse stretcher also includes a second set of mirrors operable to receive light diffracted from the first diffraction grating and a second diffraction grating. The pulse stretcher further includes a reflective element operable to reflect light diffracted from the second diffraction grating. The system further includes an amplifier, a pulse compressor, and a passive dispersion compensator disposed along the optical path.

  9. 21 CFR 890.3690 - Powered wheeled stretcher.

    Code of Federal Regulations, 2014 CFR

    2014-04-01

    ... 21 Food and Drugs 8 2014-04-01 2014-04-01 false Powered wheeled stretcher. 890.3690 Section 890.3690 Food and Drugs FOOD AND DRUG ADMINISTRATION, DEPARTMENT OF HEALTH AND HUMAN SERVICES (CONTINUED) MEDICAL DEVICES PHYSICAL MEDICINE DEVICES Physical Medicine Prosthetic Devices § 890.3690 Powered...

  10. 21 CFR 890.3690 - Powered wheeled stretcher.

    Code of Federal Regulations, 2012 CFR

    2012-04-01

    ... 21 Food and Drugs 8 2012-04-01 2012-04-01 false Powered wheeled stretcher. 890.3690 Section 890.3690 Food and Drugs FOOD AND DRUG ADMINISTRATION, DEPARTMENT OF HEALTH AND HUMAN SERVICES (CONTINUED) MEDICAL DEVICES PHYSICAL MEDICINE DEVICES Physical Medicine Prosthetic Devices § 890.3690 Powered...

  11. 21 CFR 890.3690 - Powered wheeled stretcher.

    Code of Federal Regulations, 2013 CFR

    2013-04-01

    ... 21 Food and Drugs 8 2013-04-01 2013-04-01 false Powered wheeled stretcher. 890.3690 Section 890.3690 Food and Drugs FOOD AND DRUG ADMINISTRATION, DEPARTMENT OF HEALTH AND HUMAN SERVICES (CONTINUED) MEDICAL DEVICES PHYSICAL MEDICINE DEVICES Physical Medicine Prosthetic Devices § 890.3690 Powered...

  12. 21 CFR 890.3690 - Powered wheeled stretcher.

    Code of Federal Regulations, 2010 CFR

    2010-04-01

    ... 21 Food and Drugs 8 2010-04-01 2010-04-01 false Powered wheeled stretcher. 890.3690 Section 890.3690 Food and Drugs FOOD AND DRUG ADMINISTRATION, DEPARTMENT OF HEALTH AND HUMAN SERVICES (CONTINUED) MEDICAL DEVICES PHYSICAL MEDICINE DEVICES Physical Medicine Prosthetic Devices § 890.3690 Powered...

  13. 21 CFR 890.3690 - Powered wheeled stretcher.

    Code of Federal Regulations, 2011 CFR

    2011-04-01

    ... 21 Food and Drugs 8 2011-04-01 2011-04-01 false Powered wheeled stretcher. 890.3690 Section 890.3690 Food and Drugs FOOD AND DRUG ADMINISTRATION, DEPARTMENT OF HEALTH AND HUMAN SERVICES (CONTINUED) MEDICAL DEVICES PHYSICAL MEDICINE DEVICES Physical Medicine Prosthetic Devices § 890.3690 Powered...

  14. Development of an Arbitrary Waveform Membrane Stretcher for Dynamic Cell Culture

    PubMed Central

    Lau, Jason J.; Wang, Raymond M.; Black, Lauren D.

    2014-01-01

    In this paper, a novel cell stretcher design that mimics the real-time stretch of the heart wall is introduced. By culturing cells under stretched conditions that mimics the mechanical aspects of the native cardiac environment, better understanding on the role of biomechanical signaling on cell development can be achieved. The device utilizes a moving magnet linear actuator controlled through pulse-width modulated power combined with an automated closed loop feedback system for accurate generation of a designated mechanical stretch profile. The system’s capability to stretch a cell culture membrane and accuracy of the designated frequency and waveform production for cyclic stretching were evaluated. Temperature and degradation assessments as well as a scalable design demonstrated the system’s cell culture application for long term, in vitro studies. PMID:24473700

  15. Programmable dispersion compensation and pulse shaping in a 26-fs chirped-pulse amplifier.

    PubMed

    Efimov, A; Reitze, D H

    1998-10-15

    We have constructed a 26-fs chirped-pulse amplifier that incorporates a programmable liquid-crystal spatial light modulator in the pulse stretcher. The modulator serves a dual purpose. First, we apply frequency-dependent phase shifts to compensate for cubic, quartic, and nonlinear phase dispersion in the amplifier, which results in a reduction in pulse duration from 32 to 26 fs, in agreement with the transform limit of the amplified pulse spectrum. Second, we are able to produce high-fidelity compressed amplified shaped pulses by applying phase masks directly within the stretcher. Shaped pulse energies of greater than 1 mJ are routinely obtained.

  16. Programmable dispersion compensation and pulse shaping in a 26-fs chirped-pulse amplifier.

    PubMed

    Efimov, A; Reitze, D H

    1998-10-15

    We have constructed a 26-fs chirped-pulse amplifier that incorporates a programmable liquid-crystal spatial light modulator in the pulse stretcher. The modulator serves a dual purpose. First, we apply frequency-dependent phase shifts to compensate for cubic, quartic, and nonlinear phase dispersion in the amplifier, which results in a reduction in pulse duration from 32 to 26 fs, in agreement with the transform limit of the amplified pulse spectrum. Second, we are able to produce high-fidelity compressed amplified shaped pulses by applying phase masks directly within the stretcher. Shaped pulse energies of greater than 1 mJ are routinely obtained. PMID:18091861

  17. On an ambulance stretcher suspension concerned with the reduction of patient's blood pressure variation.

    PubMed

    Sagawa, K; Inooka, H; Ino-oka, E; Takahashi, T

    1997-01-01

    The design process and control of an ambulance stretcher suspension to reduce patient's blood pressure variation (BPV) is discussed. The BPV caused by applying the vehicle brakes may lead to deterioration of a patient's condition. The proposed method can reduce BPV by tilting the stretcher and counterbalancing back-to-front acceleration of the ambulance with gravity. The experimental results obtained when using a manually controlled stretcher confirm that BPV is reduced by tilting the stretcher. A continuous control method that varies the tilting angle is investigated through simulation analysis. The results show that this control method reduces the BPV effectively and achieves safe transport of the patient.

  18. Temporal laser pulse manipulation using multiple optical ring-cavities

    NASA Technical Reports Server (NTRS)

    Nguyen, Quang-Viet (Inventor); Kojima, Jun (Inventor)

    2010-01-01

    An optical pulse stretcher and a mathematical algorithm for the detailed calculation of its design and performance is disclosed. The optical pulse stretcher has a plurality of optical cavities, having multiple optical reflectors such that an optical path length in each of the optical cavities is different. The optical pulse stretcher also has a plurality of beam splitters, each of which intercepts a portion of an input optical beam and diverts the portion into one of the plurality of optical cavities. The input optical beam is stretched and a power of an output beam is reduced after passing through the optical pulse stretcher and the placement of the plurality of optical cavities and beam splitters is optimized through a model that takes into account optical beam divergence and alignment in the pluralities of the optical cavities. The optical pulse stretcher system can also function as a high-repetition-rate (MHz) laser pulse generator, making it suitable for use as a stroboscopic light source for high speed ballistic projectile imaging studies, or it can be used for high speed flow diagnostics using a laser light sheet with digital particle imaging velocimetry. The optical pulse stretcher system can also be implemented using fiber optic components to realize a rugged and compact optical system that is alignment free and easy to use.

  19. Influence of foot-stretcher height on rowing technique and performance.

    PubMed

    Buckeridge, Erica M; Weinert-Aplin, Robert A; Bull, Anthony M J; McGregor, Alison H

    2016-11-01

    Strength, technique, and coordination are crucial to rowing performance, but external interventions such as foot-stretcher set-up can fine-tune technique and optimise power output. For the same resultant force, raising the height of foot-stretchers on a rowing ergometer theoretically alters the orientation of the resultant force vector in favour of the horizontal component. This study modified foot-stretcher heights and examined their instantaneous effect on foot forces and rowing technique. Ten male participants rowed at four foot-stretcher heights on an ergometer that measured handle force, stroke length, and vertical and horizontal foot forces. Rowers were instrumented with motion sensors to measure ankle, knee, hip, and lumbar-pelvic kinematics. Key resultant effects of increased foot-stretcher heights included progressive reductions in horizontal foot force, stroke length, and pelvis range of motion. Raising foot-stretcher height did not increase the horizontal component of foot force as previously speculated. The reduced ability to anteriorly rotate the pelvis at the front of the stroke may be a key obstacle in gaining benefits from raised foot-stretcher heights. This study shows that small changes in athlete set-up can influence ergometer rowing technique, and rowers must individually fine-tune their foot-stretcher height to optimise power transfer through the rowing stroke on an ergometer. PMID:27256844

  20. Orthopedic stretcher with average-sized person can pass through 18-inch opening

    NASA Technical Reports Server (NTRS)

    Lothschuetz, F. X.

    1966-01-01

    Modified Robinson stretcher for vertical lifting and carrying, will pass through an opening 18 inches in diameter, while containing a person of average height and weight. A subject 6 feet tall and weighing 200 pounds was lowered and raised out of an 18 inch diameter opening in a tank to test the stretcher.

  1. Influence of foot-stretcher height on rowing technique and performance.

    PubMed

    Buckeridge, Erica M; Weinert-Aplin, Robert A; Bull, Anthony M J; McGregor, Alison H

    2016-11-01

    Strength, technique, and coordination are crucial to rowing performance, but external interventions such as foot-stretcher set-up can fine-tune technique and optimise power output. For the same resultant force, raising the height of foot-stretchers on a rowing ergometer theoretically alters the orientation of the resultant force vector in favour of the horizontal component. This study modified foot-stretcher heights and examined their instantaneous effect on foot forces and rowing technique. Ten male participants rowed at four foot-stretcher heights on an ergometer that measured handle force, stroke length, and vertical and horizontal foot forces. Rowers were instrumented with motion sensors to measure ankle, knee, hip, and lumbar-pelvic kinematics. Key resultant effects of increased foot-stretcher heights included progressive reductions in horizontal foot force, stroke length, and pelvis range of motion. Raising foot-stretcher height did not increase the horizontal component of foot force as previously speculated. The reduced ability to anteriorly rotate the pelvis at the front of the stroke may be a key obstacle in gaining benefits from raised foot-stretcher heights. This study shows that small changes in athlete set-up can influence ergometer rowing technique, and rowers must individually fine-tune their foot-stretcher height to optimise power transfer through the rowing stroke on an ergometer.

  2. Laser Pulse-Stretching Using Multiple Optical Ring-Cavities

    NASA Technical Reports Server (NTRS)

    Kojima, Jun; Nguyen, Quang-Viet; Lee, Chi-Ming (Technical Monitor)

    2002-01-01

    We describe a simple and passive nanosecond-long (ns-long) laser 'pulse-stretcher' using multiple optical ring-cavities. We present a model of the pulse-stretching process for an arbitrary number of optical ring-cavities. Using the model, we optimize the design of a pulse-stretcher for use in a spontaneous Raman scattering excitation system that avoids laser-induced plasma spark problems. From the optimized design, we then experimentally demonstrate and verify the model with a 3-cavity pulse-stretcher system that converts a 1000 mJ, 8.4 ns-long input laser pulse into an approximately 75 ns-long (FWHM) output laser pulse with a peak power reduction of 0.10X, and an 83% efficiency.

  3. A monolithic time stretcher for precision time recording

    SciTech Connect

    Varner, Gary S.

    2007-04-20

    Identifying light mesons which contain only up/down quarks (pions) from those containing a strange quark (kaons) over the typical meter length scales of a particle physics detector requires instrumentation capable of measuring flight times with a resolution on the order of 20ps. In the last few years a large number of inexpensive, multi-channel Time-to-Digital Converter (TDC) chips have become available. These devices typically have timing resolution performance in the hundreds of ps regime. A technique is presented that is a monolithic version of ``time stretcher'' solution adopted for the Belle Time-Of-Flight system to address this gap between resolution need and intrinsic multi-hit TDC performance.

  4. A Microfluidic Optical Stretcher As A Diagnostic Tool

    NASA Astrophysics Data System (ADS)

    Lincoln, Bryan; Schinkinger, Stefan; Wottawah, Falk; Guck, Jochen

    2003-03-01

    By combining the Optical Stretcher, a two beam laser trap that measures the viscoelastic properties of cells, with current microfabrication techniques, we have developed a device able to differentiate cell types within a heterogeneous population. A micro-peristaltic pump controls the flow of cells through channels constructed by PDMS soft lithography. Cells are individually trapped and deformed by two divergent, counter-propagating laser beams aligned perpendicular to the flow, and are measured using videomicroscopy. Viscoelastic properties of a cell depend strongly on its cytoskeleton, which along with a cell's optical properties determine the amount of stretching, or optical deformability, for a given laser power. This serves as a new, inherent cell marker capable, for example, of detecting less elastic cancer cells among a population of healthy cells. As higher levels of integration become possible the experiment will progress towards the ultimate goal of a lab-on-a-chip. Increasingly more advanced microfluidic systems will incorporate cell sorting, medium swapping, and DNA microarrays, and will help span the gap between genomics, proteomics, and cellomics.

  5. Experimental verification and analysis of wavelength effect on pulse stretching and compressing in mid-IR chirped-pulse amplification

    NASA Astrophysics Data System (ADS)

    Zhong, Haizhe; Yuan, Peng; Zhao, Kun; Zhang, Lifu; Ma, Jingui; Li, Ying; Fan, Dianyuan

    2016-02-01

    As a consequence of the general experimental challenge to detect signals in mid-IR range, taking dispersive chirped near-IR laser pulses as the injected signal source seems to be an artistic route avoiding the daunting mid-IR stretcher and constantly was applied in moderate energy mid-IR optical parametric chirped-pulse amplifications (OPCPA) systems. In this paper we study the wavelength effect on pulse stretching and compressing in detail. Beginning with the theoretical analysis on each dispersion term of grating pairs, we evaluate the residual dispersions when pulse stretcher and compressor work at distinct wavelengths, which shows that this wavelength effect will result in poorly compressed pulses far from transform-limited. Via proof-of-principle experiments based on mid-IR OPCPAs and corresponding numerical simulations, we show that this artful configuration led to un-compressible pulses of ∼2 ps with a time-bandwidth product of ∼ 10 when the chirped-pulse duration is ∼400 ps. To overcome this effect, we demonstrate a simple design of pulse stretcher and compressor. The presented design consisted of a reflection grism-pair compressor can simultaneously cancel the quadric and cubic dispersions of conventional grating based stretcher, showing a potential ability of supporting high-contrast, sub-100-fs pulse-duration and 10,000× of pulse expansion.

  6. Imaging of a linear diode bar for an optical cell stretcher

    PubMed Central

    Roth, K. B.; Neeves, K. B.; Squier, J.; Marr, D. W. M.

    2015-01-01

    We present a simplified approach for imaging a linear diode bar laser for application as an optical stretcher within a microfluidic geometry. We have recently shown that these linear sources can be used to measure cell mechanical properties; however, the source geometry creates imaging challenges. To minimize intensity losses and simplify implementation within microfluidic systems without the use of expensive objectives, we combine aspheric and cylindrical lenses to create a 1:1 image of the source at the stretcher focal plane and demonstrate effectiveness by measuring the deformation of human red blood cells and neutrophils. PMID:25798305

  7. Story Stretchers for the Primary Grades: Activities To Expand Children's Favorite Books.

    ERIC Educational Resources Information Center

    Raines, Shirley C.; Canady, Robert J.

    This book is the third in a series of books for a literature-inspired curriculum for grades 1-3 organized around thematic units. The book's "story stretchers" are a means to extend children's enthusiasm for stories and to better connect children's books and teaching ideas with other areas of the curriculum. The book contains 18 units or themes…

  8. 450 More Story Stretchers for the Primary Grades: Activities To Expand Children's Favorite Books.

    ERIC Educational Resources Information Center

    Raines, Shirley C.

    This book emphasizes the reading process by suggesting effective ways to read with children, to engage children as thinkers, and to model the processes of studying a text. The book's "story stretchers" are a means to extend children's enthusiasm for stories and to better connect children's books and teaching ideas with other areas of the…

  9. High energy femtosecond fiber chirped pulse amplification system with adaptive phase control.

    PubMed

    He, F; Hung, H S S; Price, J H V; Daga, N K; Naz, N; Prawiharjo, J; Hanna, D C; Shepherd, D P; Richardson, D J; Dawson, J W; Siders, C W; Barty, C P

    2008-04-14

    We demonstrate increased peak power from an Yb fiber CPA system operating with strong self-phase modulation by shaping the spectral-phase of the input pulses. An adaptive control loop used feedback from the output autocorrelation. We investigated pre-compensation of both SPM phase distortion at high energies, and residual dispersion from mismatched stretcher/compressor technologies at low energies. Phase shaping resulted in improved pulse quality. When using a bulk grating stretcher, shaping increased the autocorrelation peak by a factor of 2.9, and with a fiber stretcher, shaping increased the autocorrelation peak by a factor of 3.4. High-quality 800 fs, 65 microJ recompressed pulses were produced. This technique could benefit a wide variety of fiber amplifier systems and is self-optimising for operation at both low and high pulse energies.

  10. The cell-stretcher: A novel device for the mechanical stimulation of cell populations.

    PubMed

    Seriani, S; Del Favero, G; Mahaffey, J; Marko, D; Gallina, P; Long, C S; Mestroni, L; Sbaizero, O

    2016-08-01

    Mechanical stimulation appears to be a critical modulator for many aspects of biology, both of living tissue and cells. The cell-stretcher, a novel device for the mechanical uniaxial stimulation of populations of cells, is described. The system is based on a variable stroke cam-lever-tappet mechanism which allows the delivery of cyclic stimuli with frequencies of up to 10 Hz and deformation between 1% and 20%. The kinematics is presented and a simulation of the dynamics of the system is shown, in order to compute the contact forces in the mechanism. The cells, following cultivation and preparation, are plated on an ad hoc polydimethylsiloxane membrane which is then loaded on the clamps of the cell-stretcher via force-adjustable magnetic couplings. In order to show the viability of the experimentation and biocompatibility of the cell-stretcher, a set of two in vitro tests were performed. Human epithelial carcinoma cell line A431 and Adult Mouse Ventricular Fibroblasts (AMVFs) from a dual reporter mouse were subject to 0.5 Hz, 24 h cyclic stretching at 15% strain, and to 48 h stimulation at 0.5 Hz and 15% strain, respectively. Visual analysis was performed on A431, showing definite morphological changes in the form of cellular extroflections in the direction of stimulation compared to an unstimulated control. A cytometric analysis was performed on the AMVF population. Results show a post-stimulation live-dead ratio deviance of less than 6% compared to control, which proves that the environment created by the cell-stretcher is suitable for in vitro experimentation. PMID:27587132

  11. The cell-stretcher: A novel device for the mechanical stimulation of cell populations

    NASA Astrophysics Data System (ADS)

    Seriani, S.; Del Favero, G.; Mahaffey, J.; Marko, D.; Gallina, P.; Long, C. S.; Mestroni, L.; Sbaizero, O.

    2016-08-01

    Mechanical stimulation appears to be a critical modulator for many aspects of biology, both of living tissue and cells. The cell-stretcher, a novel device for the mechanical uniaxial stimulation of populations of cells, is described. The system is based on a variable stroke cam-lever-tappet mechanism which allows the delivery of cyclic stimuli with frequencies of up to 10 Hz and deformation between 1% and 20%. The kinematics is presented and a simulation of the dynamics of the system is shown, in order to compute the contact forces in the mechanism. The cells, following cultivation and preparation, are plated on an ad hoc polydimethylsiloxane membrane which is then loaded on the clamps of the cell-stretcher via force-adjustable magnetic couplings. In order to show the viability of the experimentation and biocompatibility of the cell-stretcher, a set of two in vitro tests were performed. Human epithelial carcinoma cell line A431 and Adult Mouse Ventricular Fibroblasts (AMVFs) from a dual reporter mouse were subject to 0.5 Hz, 24 h cyclic stretching at 15% strain, and to 48 h stimulation at 0.5 Hz and 15% strain, respectively. Visual analysis was performed on A431, showing definite morphological changes in the form of cellular extroflections in the direction of stimulation compared to an unstimulated control. A cytometric analysis was performed on the AMVF population. Results show a post-stimulation live-dead ratio deviance of less than 6% compared to control, which proves that the environment created by the cell-stretcher is suitable for in vitro experimentation.

  12. A Novel First Aid Stretcher for Immobilization and Transportation of Spine Injured Patients

    PubMed Central

    Liu, Yan-Sheng; Feng, Ya-Ping; Xie, Jia-Xin; Luo, Zhuo-Jing; Shen, Cai-Hong; Niu, Fang; Zou, Jian; Tang, Shao-Feng; Hao, Jiang; Xu, Jia-Xiang; Xiao, Li-Ping; Xu, Xiao-Ming; Zhu, Hui

    2012-01-01

    Effective immobilization and transportation are vital to the life-saving acute medical care needed when treating critically injured people. However, the most common types of stretchers used today are wrought with problems that can lead to further medical complications, difficulty in employment and rescue, and ineffective transitions to hospital treatment. Here we report a novel first aid stretcher called the “emergency carpet”, which solves these problems with a unique design for spine injured patients. Polyurethane composite material, obtained by a novel process of manually mixing isocyanate and additives, can be poured into a specially designed fabric bag and allowed to harden to form a rigid human-shaped stretcher. The effectiveness of the emergency carpet was examined in the pre-hospital management of victims with spinal fractures. Additionally, it was tested on flat ground and complex terrain as well as in the sea and air. We demonstrated that the emergency carpet can be assembled and solidified on the scene in 5 minutes, providing effective immobilization to the entire injured body. With the protection of the emergency carpet, none of the 20 patients, who were finally confirmed to have spinal column fracture or dislocation, had any neurological deterioration during transportation. Furthermore, the carpet can be handled and transported by multiple means under differing conditions, without compromising immobilization. Finally, the emergency carpet allows the critically injured patient to receive multiple examinations such as X-ray, CT, and MRI without being removed from the carpet. Our results demonstrate that the emergency carpet has ideal capabilities for immobilization, extrication, and transportation of the spine injured patients. Compared with other stretchers, it allows for better mobility, effective immobilization, remarkable conformity to the body, and various means for transportation. The emergency carpet is promising for its intrinsic advantages

  13. Generation of sub-50 fs pulses from a high-power Yb-doped fiber amplifier.

    PubMed

    Deng, Yujun; Chien, Ching-Yuan; Fidric, Bernard G; Kafka, James D

    2009-11-15

    We demonstrate the generation of 48 fs pulses with 18 W average power and 226 nJ of pulse energy from a Yb-doped fiber amplifier. The system uses a simple stretcher-free single-stage amplifier configuration operating in the parabolic pulse regime. The gain fiber length and pump wavelength are chosen in order to reduce the gain per unit length and generate both shorter pulses and higher pulse energy.

  14. Use of mismatched grating pairs in chirped-pulse amplification systems.

    PubMed

    Squier, J; Barty, C P; Salin, F O; Le Blanc, C; Kane, S

    1998-03-20

    We demonstrate for the first time to our knowledge the use of mismatched grating pairs between the stretching and compression systems in a chirped-pulse amplification laser. Pulses as short as 57 fs are generated with 2000-lines/mm gratings in the compressor and 1200-lines/mm gratings in the stretcher.

  15. Pulse

    MedlinePlus

    ... resting for at least 10 minutes. Take the exercise heart rate while you are exercising. ... pulse rate can help determine if the patient's heart is pumping. ... rate gives information about your fitness level and health.

  16. Broadband stimulated Raman scattering spectroscopy by a photonic time stretcher.

    PubMed

    Saltarelli, Francesco; Kumar, Vikas; Viola, Daniele; Crisafi, Francesco; Preda, Fabrizio; Cerullo, Giulio; Polli, Dario

    2016-09-19

    Stimulated Raman scattering spectroscopy is a powerful technique for label-free molecular identification, but its broadband implementation is technically challenging. We introduce and experimentally demonstrate a novel approach based on photonic time stretch. The broadband femtosecond Stokes pulse, after interacting with the sample, is stretched by a telecom fiber to ≈15ns, mapping its spectrum in time. The signal is sampled through a fast analog-to-digital converter, providing single-shot spectra at 80-kHz rate. We demonstrate ≈10-5 sensitivity over ≈500cm-1 in the C-H region. Our results pave the way to high-speed broadband vibrational imaging for materials science and biophotonics. PMID:27661870

  17. Local scattering stress distribution on surface of a spherical cell in optical stretcher

    NASA Astrophysics Data System (ADS)

    Bareil, Paul B.; Sheng, Yunlong; Chiou, Arthur

    2006-12-01

    We calculate stress distribution on the surface of a spherical cell trapped by two counter propagating beams in the optical stretcher in the ray optics regime. We demonstrate that the local scattering stress is perpendicular to the spherical refractive surface regardless of incident angle, polarization and the reflectance and transmittance at the surface. We explain the apparition of peaks in the stress distribution, which were not revealed in the existing theory. We consider the divergence of the incident beams from the fibers, and express the stress distribution as a function of fiber-to-cell distance. The new theory can predict the cell’s deformation more precisely.

  18. Increasing laser intensity using pulse shaping method in fast ignitor research

    NASA Astrophysics Data System (ADS)

    Habara, H.; Kodama, R.; Mori, M.; Sawai, K.; Suzuki, K.; Kitagawa, Y.; Yamanaka, T.

    2004-03-01

    Pulse shaping in chirped pulse amplification laser system with large glass amplifier is demonstrated through the spectral control of the chirped pulse. Spectral shape is modified by changing the spatial dispersion with a spatially modulated transmission filter in pulse stretcher. Three different pulse shaping controls, prepulse control, pedestal reduction and pulse duration shortening, are performed in both experiments and calculations. A 70 TW/300 fs laser pulse was obtained without an increase of the laser energy in the system, which usually provides 40 TW/500 fs pulse.

  19. Evaluation of occupational injuries in an urban emergency medical services system before and after implementation of electrically powered stretchers.

    PubMed

    Studnek, Jonathan R; Mac Crawford, J; Fernandez, Antonio R

    2012-01-01

    Musculoskeletal injuries are frequently reported among Emergency Medical Services (EMS) professionals. The objective of this study was to evaluate occupational injuries in an urban EMS system before and after implementation of hydraulic stretchers. Data for this analysis were obtained from Austin Travis County EMS (A/TCEMS). In December 2006, A/TCEMS placed into service electrically powered patient stretchers. The pre-intervention period was between 01/01/1999 and 12/31/2006, and the post-intervention period was between 01/01/2007 and 4/30/2008. Incidence rate calculations were performed for four injury sub-groups and rate ratios (RRs) and corresponding 95% confidence interval (CI) were presented. There were 2087 and 706 person-years of observation pre- and post-intervention, respectively. The incidence rates for overall injury pre-intervention and post-intervention were 61.1 and 28.8 per 100 FTE, with a corresponding RR of 0.47 (95% CI 0.41-0.55) indicating a significant decrease in the rate of injury. The subcategory of stretcher-related injuries had the lowest RR (0.30; 95% CI 0.17-0.52) when comparing pre- and post-intervention time periods.

  20. Cyclic AMP in prokaryotes.

    PubMed Central

    Botsford, J L; Harman, J G

    1992-01-01

    Cyclic AMP (cAMP) is found in a variety of prokaryotes including both eubacteria and archaebacteria. cAMP plays a role in regulating gene expression, not only for the classic inducible catabolic operons, but also for other categories. In the enteric coliforms, the effects of cAMP on gene expression are mediated through its interaction with and allosteric modification of a cAMP-binding protein (CRP). The CRP-cAMP complex subsequently binds specific DNA sequences and either activates or inhibits transcription depending upon the positioning of the complex relative to the promoter. Enteric coliforms have provided a model to explore the mechanisms involved in controlling adenylate cyclase activity, in regulating adenylate cyclase synthesis, and in performing detailed examinations of CRP-cAMP complex-regulated gene expression. This review summarizes recent work focused on elucidating the molecular mechanisms of CRP-cAMP complex-mediated processes. For other bacteria, less detail is known. cAMP has been implicated in regulating antibiotic production, phototrophic growth, and pathogenesis. A role for cAMP has been suggested in nitrogen fixation. Often the only data that support cAMP involvement in these processes includes cAMP measurement, detection of the enzymes involved in cAMP metabolism, or observed effects of high concentrations of the nucleotide on cell growth. PMID:1315922

  1. Giant-chirp oscillators for short-pulse fiber amplifiers.

    PubMed

    Renninger, William H; Chong, Andy; Wise, Frank W

    2008-12-15

    A new regime of pulse parameters in a normal-dispersion fiber laser is identified. Dissipative solitons exist with remarkably large pulse duration and chirp, along with large pulse energy. A low-repetition-rate oscillator that generates pulses with large and linear chirp can replace the standard oscillator, stretcher, pulse-picker, and preamplifier in a chirped-pulse fiber amplifier. The theoretical properties of such a giant-chirp oscillator are presented. A fiber laser designed to operate in the new regime generates approximately 150 ps pulses at a 3 MHz repetition rate. Amplification of these pulses to 1 microJ energy with pulse duration as short as 670 fs demonstrates the promise of this new approach.

  2. Compensation of nonlinear phase shifts with third-order dispersion in short-pulse fiber amplifiers.

    PubMed

    Zhou, Shian; Kuznetsova, Lyuba; Chong, Andy; Wise, Frank

    2005-06-27

    We show that nonlinear phase shifts and third-order dispersion can compensate each other in short-pulse fiber amplifiers. This compen-sation can be exploited in any implementation of chirped-pulse amplification, with stretching and compression accomplished with diffraction gratings, single-mode fiber, microstructure fiber, fiber Bragg gratings, etc. In particular, we consider chirped-pulse fiber amplifiers at wavelengths for which the fiber dispersion is normal. The nonlinear phase shift accumulated in the amplifier can be compensated by the third-order dispersion of the combination of a fiber stretcher and grating compressor. A numerical model is used to predict the compensation, and experimental results that exhibit the main features of the calculations are presented. In the presence of third-order dispersion, an optimal nonlinear phase shift reduces the pulse duration, and enhances the peak power and pulse contrast compared to the pulse produced in linear propagation. Contrary to common belief, fiber stretchers can perform as well or better than grating stretchers in fiber amplifiers, while offering the major practical advantages of a waveguide medium.

  3. Cyclic AMP regulation of early gene expression in Dictyostelium discoideum: mediation via the cell surface cyclic AMP receptor.

    PubMed Central

    Mann, S K; Firtel, R A

    1987-01-01

    We examined two sets of genes expressed early in the developmental cycle of Dictyostelium discoideum that appear to be regulated by cyclic AMP (cAMP). The transcripts of both sets of genes were not detectable in vegetative cells. During normal development on filter pads, RNA complementary to these genes could be detected at about 2 h, peaked around 6 to 8 h, and decreased gradually thereafter. Expression of these genes upon starvation in shaking culture was stimulated by pulsing the cells with nanomolar levels of cAMP, a condition that mimics the in vivo pulsing during normal aggregation. Expression was inhibited by caffeine or by continuous levels of cAMP, a condition found later in development when in vivo expression of these genes decreased. The inhibition of caffeine could be overcome by pulsing cells with cAMP. These results suggest that the expression is mediated via the cell surface cAMP receptor, but does not require a rise in intracellular cAMP. mRNA from a gene of the second class was induced upon starvation, peaked by 2.5 h of development, and then declined. In contrast to the other genes, its expression was maintained by continuous levels of cAMP and repressed by cAMP pulses. These and other results on a number of classes of developmentally regulated genes indicates that changing levels of cAMP, acting via the cell surface cAMP receptor, are involved in controlling these groups of genes. We also examined the structure and partial sequence of the cAMP pulse-induced genes. The two tandemly duplicated M3 genes were almost continuously homologous over the sequenced portion of the protein-coding region except for a region near the N-terminal end. The two M3 genes had regions of homology in the 5' flanking sequence and showed slight homology to the same regions in gene D2, another cAMP pulse-induced gene. D2 showed extremely significant homology over its entire sequenced length to an acetylcholinesterase. The results presented here and by others suggest that

  4. Role of the lens capsule on the mechanical accommodative response in a lens stretcher

    PubMed Central

    Ziebarth, Noël M.; Borja, David; Arrieta, Esdras; Aly, Mohamed; Manns, Fabrice; Dortonne, Isabelle; Nankivil, Derek; Jain, Rakhi; Parel, Jean-Marie

    2009-01-01

    Purpose To determine if changes in elastic properties of the lens capsule ex vivo with age contribute to the forces required to accommodate. Methods Post-mortem human (n=22; age average: 41±17years, range: 6–71 years) and cynomolgus monkey (n=19; age average: 7.7±1.8 years, range: 4.2–10 years) tissues including the lens, capsule, zonules, ciliary body, and sclera were mounted in an optomechanical lens stretching system. Starting at zero load, the sclera was symmetrically stretched to 2mm in 0.25 steps at a speed of 0.1mm.s−1. The load and lens diameter were measured at each step. The lens contents were removed through a mini-capsulorhexis. The stretching cycles were repeated on the empty capsular bag. The forces required to stretch the natural lens and empty bag were quantified as a function of age and compared. Results The force required to stretch the empty lens capsule was independent of age (human=2.6–34.9g/mm [25.2–342.7mN/mm], monkey=8.2–21.3g/mm [80.3–208.6mN/mm]). The ratio of the force required to stretch the empty lens capsule to the force required to stretch the natural lens decreases with age in human and monkey lenses (p=0.003, p=0.72, respectively). Conclusions The mechanical properties of the empty lens capsule assessed ex vivo in a lens stretcher remain constant with age, suggesting that the changes in elasticity of the lens capsule do not play a significant role in presbyopia. In young eyes, the lens capsule determines the force required to stretch the whole lens. The age-related increase in force required to stretch the lens is due to changes in the lens contents. PMID:18515568

  5. Dispersion management for a sub-10-fs, 10 TW optical parametric chirped-pulse amplifier

    NASA Astrophysics Data System (ADS)

    Tavella, Franz; Nomura, Yutaka; Veisz, Laszlo; Pervak, Vladimir; Marcinkevičius, Andrius; Krausz, Ferenc

    2007-08-01

    We report the amplification of three-cycle, 8.5 fs optical pulses in a near-infrared noncollinear optical parametric chirped-pulse amplifier (OPCPA) up to energies of 80 mJ. Improved dispersion management in the amplifier by means of a combination of reflection grisms and a chirped-mirror stretcher allowed us to recompress the amplified pulses to within 6% of their Fourier limit. The novel ultrabroad, ultraprecise dispersion control technology presented in this work opens the way to scaling multiterawatt technology to even shorter pulses by optimizing the OPCPA bandwidth.

  6. Dispersion management for a sub-10-fs, 10 TW optical parametric chirped-pulse amplifier.

    PubMed

    Tavella, Franz; Nomura, Yutaka; Veisz, Laszlo; Pervak, Vladimir; Marcinkevicius, Andrius; Krausz, Ferenc

    2007-08-01

    We report the amplification of three-cycle, 8.5 fs optical pulses in a near-infrared noncollinear optical parametric chirped-pulse amplifier (OPCPA) up to energies of 80 mJ. Improved dispersion management in the amplifier by means of a combination of reflection grisms and a chirped-mirror stretcher allowed us to recompress the amplified pulses to within 6% of their Fourier limit. The novel ultrabroad, ultraprecise dispersion control technology presented in this work opens the way to scaling multiterawatt technology to even shorter pulses by optimizing the OPCPA bandwidth.

  7. 200 TW 45 fs laser based on optical parametric chirped pulse amplification.

    PubMed

    Lozhkarev, V V; Freidman, G I; Ginzburg, V N; Katin, E V; Khazanov, E A; Kirsanov, A V; Luchinin, G A; Mal'shakov, A N; Martyanov, M A; Palashov, O V; Poteomkin, A K; Sergeev, A M; Shaykin, A A; Yakovlev, I V; Garanin, S G; Sukharev, S A; Rukavishnikov, N N; Charukhchev, A V; Gerke, R R; Yashin, V E

    2006-01-01

    200 TW peak power has been achieved experimentally using a Cr:forsterite master oscillator at 1250 nm, a stretcher, three optical parametrical amplifiers based on KD*P (DKDP) crystals providing 14.5 J energy in the chirped pulse at 910 nm central wavelength, and a vacuum compressor. The final parametrical amplifier and the compressor are described in detail. Scaling of such architecture to multipetawatt power is discussed.

  8. AMPED Program Overview

    ScienceCinema

    Gur, Ilan

    2016-07-12

    An overview presentation about ARPA-E's AMPED program. AMPED projects seek to develop advanced sensing, control, and power management technologies that redefine the way we think about battery management. Energy storage can significantly improve U.S. energy independence, efficiency, and security by enabling a new generation of electric vehicles. While rapid progress is being made in new battery materials and storage technologies, few innovations have emerged in the management of advanced battery systems. AMPED aims to unlock enormous untapped potential in the performance, safety, and lifetime of today's commercial battery systems exclusively through system-level innovations, and is thus distinct from existing efforts to enhance underlying battery materials and architectures.

  9. AMPED Program Overview

    SciTech Connect

    Gur, Ilan

    2014-03-04

    An overview presentation about ARPA-E's AMPED program. AMPED projects seek to develop advanced sensing, control, and power management technologies that redefine the way we think about battery management. Energy storage can significantly improve U.S. energy independence, efficiency, and security by enabling a new generation of electric vehicles. While rapid progress is being made in new battery materials and storage technologies, few innovations have emerged in the management of advanced battery systems. AMPED aims to unlock enormous untapped potential in the performance, safety, and lifetime of today's commercial battery systems exclusively through system-level innovations, and is thus distinct from existing efforts to enhance underlying battery materials and architectures.

  10. Pulse charging of lead-acid traction cells

    NASA Technical Reports Server (NTRS)

    Smithrick, J. J.

    1980-01-01

    Pulse charging, as a method of rapidly and efficiently charging 300 amp-hour lead-acid traction cells for an electric vehicle application was investigated. A wide range of charge pulse current square waveforms were investigated and the results were compared to constant current charging at the time averaged pulse current values. Representative pulse current waveforms were: (1) positive waveform-peak charge pulse current of 300 amperes (amps), discharge pulse-current of zero amps, and a duty cycle of about 50%; (2) Romanov waveform-peak charge pulse current of 300 amps, peak discharge pulse current of 15 amps, and a duty of 50%; and (3) McCulloch waveform peak charge pulse current of 193 amps, peak discharge pulse current of about 575 amps, and a duty cycle of 94%. Experimental results indicate that on the basis of amp-hour efficiency, pulse charging offered no significant advantage as a method of rapidly charging 300 amp-hour lead-acid traction cells when compared to constant current charging at the time average pulse current value. There were, however, some disadvantages of pulse charging in particular a decrease in charge amp-hour and energy efficiencies and an increase in cell electrolyte temperature. The constant current charge method resulted in the best energy efficiency with no significant sacrifice of charge time or amp-hour output. Whether or not pulse charging offers an advantage over constant current charging with regard to the cell charge/discharge cycle life is unknown at this time.

  11. Applying Mathematical Processes (AMP)

    ERIC Educational Resources Information Center

    Kathotia, Vinay

    2011-01-01

    This article provides insights into the "Applying Mathematical Processes" resources, developed by the Nuffield Foundation. It features Nuffield AMP activities--and related ones from Bowland Maths--that were designed to support the teaching and assessment of key processes in mathematics--representing a situation mathematically, analysing,…

  12. Spatiotemporal noise characterization for chirped-pulse amplification systems.

    PubMed

    Ma, Jingui; Yuan, Peng; Wang, Jing; Wang, Yongzhi; Xie, Guoqiang; Zhu, Heyuan; Qian, Liejia

    2015-02-04

    Optical noise, the core of the pulse-contrast challenge for ultra-high peak power femtosecond lasers, exhibits spatiotemporal (ST) coupling induced by angular dispersion. Full characterization of such ST noise requires two-dimensional measurements in the ST domain. Thus far, all noise measurements have been made only in the temporal domain. Here we report the experimental characterization of the ST noise, which is made feasible by extending cross-correlation from the temporal domain to the ST domain. We experimentally demonstrate that the ST noise originates from the optical surface imperfections in the pulse stretcher/compressor and exhibits a linear ST coupling in the far-field plane. The contrast on the far-field axis, underestimated in the conventional measurements, is further improved by avoiding the far-field optics in the stretcher. These results enhance our understanding of the pulse contrast with respect to its ST-coupling nature and pave the way toward the design of high-contrast ultra-high peak power lasers.

  13. Multiple THz pulse generation with variable energy ratio and delay

    NASA Astrophysics Data System (ADS)

    Ungureanu, R. G.; Grigore, O. V.; Dinca, M. P.; Cojocaru, G. V.; Ursescu, D.; Dascalu, T.

    2015-04-01

    Two methods for multiple high energetic THz pulse generation by two-color filamentation in air with controllable energy ratio and delay ranging from one to hundreds of ps were investigated. In the first method the laser pulse is split into two inside the optical stretcher of a CPA laser system, the resulting consecutive filaments occur in the same region and allows the study of the influence of the first plasma filament on the THz emission of the delayed filament. Based on a polarization sensitive thin film beam splitter placed in front of a 45° mirror, the second method produces multiple parallel consecutive filaments. Above a certain total pump level the THz energy delivered by multiple pulses exceeds the value given by a single filament for the same pump energy, thereby overcoming the THz emission saturation of the single filament.

  14. Effects of dihydroavermectin B1a and analogs on stretcher muscle of the lined shore crab, Pachygrapsus crassipes.

    PubMed

    Bowman, J W; Lee, B L; Whaley, H A; Thompson, D P

    1991-01-01

    1. Dihydroavermectin B1a (DHAVM, Ivermectin) at 1 microM reduces excitatory and inhibitory postsynaptic potentials (EPSPs and IPSPs, respectively) in stretcher muscle fibres of the lined shore crab, Pachygrapsus crassipes. IPSPs decline faster and more extensively than EPSPs and, unlike EPSPs, do not recover upon replacement of DHAVM with picrotoxinin-containing medium. 2. Intracellular recordings show DHAVM reduces membrane resistance (Rin) and hyperpolarizes muscle fibres in a concentration-dependent manner, beginning at 10 nM. The rate and magnitude of DHAVM effects on Rin mirror its effects on EPSPs. 3. The decline in Rin due to DHAVM is sustained over time (i.e. there is no tendency for desensitization); it is also irreversible and not affected by coadministration of 1 mM gamma-aminobutyric acid (GABA), 0.1 mM bicuculline methiodide or addition of 20 mM Co2+ to the recording medium. 4. Replacement of DHAVM-containing medium with medium containing Cl- channel blockers (picrotoxinin or lindane) results in partial recovery of Rin, while channel blockers specific for other ions (TTX, TEA, 4-AP or verapamil) are without effect. The decline of Rin following application of DHAVM is attenuated in Cl(-)-free medium. 5. Results of tests using compounds structurally related to DHAVM reveal that relatively minor changes in the molecule often reduce biological activity significantly. Removal of one sugar, for instance, results in a ten-fold reduction in potency. 6. In general, avermectins that stimulate conductance in shore crab muscle also possess anthelmintic activity at similar concentrations, based on studies using the free-living nematode, Caenorhabditis elegans.(ABSTRACT TRUNCATED AT 250 WORDS) PMID:1685403

  15. Ytterbium fiber-based, 270 fs, 100 W chirped pulse amplification laser system with 1 MHz repetition rate

    NASA Astrophysics Data System (ADS)

    Zhao, Zhigang; Kobayashi, Yohei

    2016-01-01

    A 100 W Yb-doped, fiber-based, femtosecond, chirped pulse amplification laser system was developed with a repetition rate of 1 MHz, corresponding to a pulse energy of 100 µJ. Large-scale, fused-silica transmission gratings were used for both the pulse stretcher and compressor, with a compression throughput efficiency of ∼85%. A pulse duration of 270 fs was measured by second harmonic generation frequency-resolved optical gating (SHG-FROG). To the best of our knowledge, this is the shortest pulse duration ever achieved by a 100-W-level fiber chirped pulse amplification laser system at a repetition rate of few megahertz, without any special post-compression manipulation.

  16. Cyclic AMP modulates electrical signaling in a weakly electric fish.

    PubMed

    McAnelly, L; Silva, A; Zakon, H H

    2003-04-01

    Many species of electric fish show diurnal or socially elicited variation in electric organ discharge amplitude. In Sternopygus macrurus, activation of protein kinase A by 8-bromo-cAMP increases electrocyte sodium current magnitude. To determine whether the behavioral plasticity in electric organ discharge amplitude is controlled by electrocyte biophysical properties, we examined whether the effects of phosphorylation on ion currents in the electric organ translate directly into electric organ discharge changes. We injected the electric organ of restrained fish with 8-bromo-cAMP and monitored the electric organ discharge. The effect of protein kinase A activation on electrocyte action potentials was examined in isolated electric organ using two-electrode current clamp. Electric organ discharge and action potential amplitude and pulse duration increased in response to 8-bromo-cAMP. Pulse and action potential duration both increased by about 25%. However, the increase in electric organ discharge amplitude (approximately 400%) was several-fold greater than the action potential amplitude increase (approximately 40%). Resting membrane resistance decreased in electrocytes exposed to 8-bromo-cAMP. We propose that in the Thevenin equivalent circuit of the electric organ a moderate increase in action potential amplitude combined with a decrease in internal resistance produces a greater voltage drop across the external resistance (the water around the fish), accounting for the large increase in the externally recorded electric organ discharge.

  17. High contrast, 86  fs, 35  mJ pulses from a diode-pumped, Yb:glass, double-chirped-pulse amplification laser system.

    PubMed

    Liebetrau, Hartmut; Hornung, Marco; Keppler, Sebastian; Hellwing, Marco; Kessler, Alexander; Schorcht, Frank; Hein, Joachim; Kaluza, Malte C

    2016-07-01

    We demonstrate the generation of 86 fs, 35 mJ, high-contrast laser pulses at 1030 nm with a repetition rate of 1 Hz from a diode-pumped double chirped-pulse amplification setup. The pulses exhibit a spectral bandwidth exceeding 27 nm full width at half-maximum. This could be achieved by using a laser architecture comprising two stages of chirped pulse amplification with a cross-polarized wave generation filter in between, by applying spectral shaping and by increasing the spectral hard-clip of the second stretcher. These are, to the best of our knowledge, the shortest pulses at the mJ level with ultra-high contrast generated with a diode-pumped front end at 1030 nm.

  18. Brain Stretchers, Book 2.

    ERIC Educational Resources Information Center

    Anderson, Carolyn; Haller, Jackie

    This collection of activities is designed to help students develop critical thinking skills. The activities are non-graded and can be used from upper elementary to high school. The reading levels vary from no reading required to very little reading required and can be used effectively with students who are poor readers, bilingual, or at a special…

  19. Experiment definition studies for AMPS Spacelab

    NASA Technical Reports Server (NTRS)

    Liemohn, H.

    1975-01-01

    The electrical charging of the space shuttle orbiter is discussed in relation to the AMPS Spacelab payload along with an operations research technique for the selection of AMPS Spacelab experiments. Experiments proposed for AMPS include: hydromagnetic wave experiments; bistatic sounder of AMPS wake; and an artificial meteor gun. Experiment objectives and instrument functions are given for all experiments.

  20. [Technological innovation and humanitarianism in the transport of war wounded: Nicasio Landa's report on a new elastic suspension system for stretchers (Pamplona, May 29, 1875)].

    PubMed

    Arrizabalaga, Jon; García-Reyes, Juan Carlos

    2016-01-01

    In May 1875, in the midst of a bloody civil conflict in Spain known as the Third Carlist War, Nicasio Landa, a medical officer with Military Health, wrote a report requesting authorization for the Spanish Red Cross, of which he was Inspector General, to adopt a new elastic suspension system for stretchers that he had designed, developed and tested. Intended above all for use in farm wagons - still the most widely-used method of transporting the wounded at the time - it was an inexpensive, sturdy mechanism that improved patient comfort and could also be installed in ambulance carriages, railway carriages and hospital ships. An annotated version of the report is included, preceded by a presentation of its contents. PMID:27557360

  1. DBcAMP stimulates vesicle transport and HRP excretion in isolated perfused rat liver.

    PubMed

    Hayakawa, T; Bruck, R; Ng, O C; Boyer, J L

    1990-11-01

    To clarify the effect of adenosine 3',5'-cyclic monophosphate (cAMP) on the transcytotic vesicle pathway, we measured the biliary excretion of bile acid, phospholipid, and horseradish peroxidase (HRP) in the isolated perfused rat liver (IPRL) with or without infusion of N6,2'-O-dibutyryl-cAMP (DBcAMP). A linear relationship between bile flow and bile acid excretion was observed in both control and DBcAMP-infused livers. DBcAMP increased the y-axis intercept from 1.10 +/- 0.16 to 1.48 +/- 0.19 microliters.min-1.g liver-1 (P less than 0.01) and the slope from 6.5 +/- 1.99 to 10.77 +/- 1.71 microliters/mumol bile acid (P less than 0.01). DBcAMP also increased the biliary excretion of bile acid and phospholipid during a 1.0 mumol/min infusion of taurocholate. When HRP was pulse loaded for 1 min, HRP appeared in bile in early (4-6 min) and late (20-25 min) peaks. DBcAMP markedly increased the late peak of HRP from 0.33 +/- 0.08 to 1.15 +/- 0.32 ng.min-1.g liver-1 (P less than 0.01), a phenomenon blocked by colchicine. An electron-microscopic morphometric analysis indicated that DBcAMP increased both the density and %area of HRP-containing vesicles in the pericanalicular area, compared with controls, 18 min after a 1-min pulse of HRP. DBcAMP had no effect on the uptake rate of HRP in 4-h primary hepatocyte cultures but stimulated biliary excretion of HRP when preloaded in the IPRL. These findings indicate that cAMP regulates excretory function in part by stimulating the microtubule-dependent transcytotic vesicle transport system.

  2. Frequency conversion of high-intensity, femtosecond laser pulses

    SciTech Connect

    Banks, P S

    1997-06-01

    Almost since the invention of the laser, frequency conversion of optical pulses via non- linear processes has been an area of active interest. However, third harmonic generation using ~(~1 (THG) in solids is an area that has not received much attention because of ma- terial damage limits. Recently, the short, high-intensity pulses possible with chirped-pulse amplification (CPA) laser systems allow the use of intensities on the order of 1 TW/cm2 in thin solids without damage. As a light source to examine single-crystal THG in solids and other high field inter- actions, the design and construction of a Ti:sapphire-based CPA laser system capable of ultimately producing peak powers of 100 TW is presented. Of special interest is a novel, all-reflective pulse stretcher design which can stretch a pulse temporally by a factor of 20,000. The stretcher design can also compensate for the added material dispersion due to propagation through the amplifier chain and produce transform-limited 45 fs pulses upon compression. A series of laser-pumped amplifiers brings the peak power up to the terawatt level at 10 Hz, and the design calls for additional amplifiers to bring the power level to the 100 TW level for single shot operation. The theory for frequency conversion of these short pulses is presented, focusing on conversion to the third harmonic in single crystals of BBO, KD*P, and d-LAP (deuterated I-arginine phosphate). Conversion efficiencies of up to 6% are obtained with 500 fs pulses at 1053 nm in a 3 mm thick BBO crystal at 200 GW/cm 2. Contributions to this process by unphasematched, cascaded second harmonic generation and sum frequency generation are shown to be very significant. The angular relationship between the two orders is used to measure the tensor elements of C = xt3)/4 with Crs = -1.8 x 1O-23 m2/V2 and .15Cri + .54Crs = 4.0 x 1O-23 m2/V2. Conversion efficiency in d-LAP is about 20% that in BBO and conversion efficiency in KD*P is 1% that of BBO. It is calculated

  3. Schwann Cells Metabolize Extracellular 2',3'-cAMP to 2'-AMP.

    PubMed

    Verrier, Jonathan D; Kochanek, Patrick M; Jackson, Edwin K

    2015-08-01

    The 3',5'-cAMP-adenosine pathway (3',5'-cAMP→5'-AMP→adenosine) and the 2',3'-cAMP-adenosine pathway (2',3'-cAMP→2'-AMP/3'-AMP→adenosine) are active in the brain. Oligodendrocytes participate in the brain 2',3'-cAMP-adenosine pathway via their robust expression of 2',3'-cyclic nucleotide 3'-phosphodiesterase (CNPase; converts 2',3'-cAMP to 2'-AMP). Because Schwann cells also express CNPase, it is conceivable that the 2',3'-cAMP-adenosine pathway exists in the peripheral nervous system. To test this and to compare the 2',3'-cAMP-adenosine pathway to the 3',5'-cAMP-adenosine pathway in Schwann cells, we examined the metabolism of 2',3'-cAMP, 2'-AMP, 3'-AMP, 3',5'-cAMP, and 5'-AMP in primary rat Schwann cells in culture. Addition of 2',3'-cAMP (3, 10, and 30 µM) to Schwann cells increased levels of 2'-AMP in the medium from 0.006 ± 0.002 to 21 ± 2, 70 ± 3, and 187 ± 10 nM/µg protein, respectively; in contrast, Schwann cells had little ability to convert 2',3'-cAMP to 3'-AMP or 3',5'-cAMP to either 3'-AMP or 5'-AMP. Although Schwann cells slightly converted 2',3'-cAMP and 2'-AMP to adenosine, they did so at very modest rates (e.g., 5- and 3-fold, respectively, more slowly compared with our previously reported studies in oligodendrocytes). Using transected myelinated rat sciatic nerves in culture medium, we observed a time-related increase in endogenous intracellular 2',3'-cAMP and extracellular 2'-AMP. These findings indicate that Schwann cells do not have a robust 3',5'-cAMP-adenosine pathway but do have a 2',3'-cAMP-adenosine pathway; however, because the pathway mostly involves 2'-AMP formation rather than 3'-AMP, and because the conversion of 2'-AMP to adenosine is slow, metabolism of 2',3'-cAMP mostly results in the accumulation of 2'-AMP. Accumulation of 2'-AMP in peripheral nerves postinjury could have pathophysiological consequences. PMID:25998049

  4. Amps particle accelerator definition study

    NASA Technical Reports Server (NTRS)

    Sellen, J. M., Jr.

    1975-01-01

    The Particle Accelerator System of the AMPS (Atmospheric, Magnetospheric, and Plasmas in Space) payload is a series of charged particle accelerators to be flown with the Space Transportation System Shuttle on Spacelab missions. In the configuration presented, the total particle accelerator system consists of an energetic electron beam, an energetic ion accelerator, and both low voltage and high voltage plasma acceleration devices. The Orbiter is illustrated with such a particle accelerator system.

  5. Agile manufacturing prototyping system (AMPS)

    SciTech Connect

    Garcia, P.

    1998-05-09

    The Agile Manufacturing Prototyping System (AMPS) is being integrated at Sandia National Laboratories. AMPS consists of state of the industry flexible manufacturing hardware and software enhanced with Sandia advancements in sensor and model based control; automated programming, assembly and task planning; flexible fixturing; and automated reconfiguration technology. AMPS is focused on the agile production of complex electromechanical parts. It currently includes 7 robots (4 Adept One, 2 Adept 505, 1 Staubli RX90), conveyance equipment, and a collection of process equipment to form a flexible production line capable of assembling a wide range of electromechanical products. This system became operational in September 1995. Additional smart manufacturing processes will be integrated in the future. An automated spray cleaning workcell capable of handling alcohol and similar solvents was added in 1996 as well as parts cleaning and encapsulation equipment, automated deburring, and automated vision inspection stations. Plans for 1997 and out years include adding manufacturing processes for the rapid prototyping of electronic components such as soldering, paste dispensing and pick-and-place hardware.

  6. Effect of micropulse duration on tissue ablation using a stretched free electron laser pulse train

    NASA Astrophysics Data System (ADS)

    Kozub, John A.; Mackanos, Mark A.; Mendenhall, Marcus H.; Jansen, E. Duco

    2004-06-01

    The pulse train from a Mark III FEL tuned to a wavelength of 6.45 microns has been shown to be efficient at ablating soft tissue with minimal collateral damage. This laser has a unique pulse structure consisting of a train of 1ps micropulses spaced 350ps apart, which is maintained for 4-5 microseconds (the macropulse) and is repeated at 1-30Hz. We are investigating the role of the pulse structure in the ablation mechanism. In order to determine the importance of non-linear effects potentially induced by the high peak power of the micropulses, we are using a grating pulse stretcher optimized for 6.45 microns to vary the micropulse duration while maintaining the macropulse duration and micropulse frequency. The technique allows use of the same pulse energy and average power with widely variable peak power. Ablation thresholds were measured using PROB-IT analysis and crater depths were measured using OCT imaging. In water, gelatin, and mouse dermis, we have found no statistically significant difference in the ablation threshold of pulses having widths of 1, 30, 60, and 100ps. The measured ablation efficiency of mouse dermis also showed no significant difference over the same range of pulse widths. This data suggests that the ablation characteristics obtained with the FEL at 6.45 microns are independent of the micropulse duration and do not rely on the high peak power of the FEL pulse train.

  7. Modeling and simulation of ultra-short pulse amplification

    NASA Astrophysics Data System (ADS)

    Pflaum, Christoph; Hartmann, Rainer; Rahimi, Zhabiz

    2016-03-01

    Ultra-short pulses with high average power are required for a variety of technical and medical applications. Single, multi-pass, and regenerative amplifiers are used, in order to increase the power of ultra-short lasers. Typical laser crystals for such amplifiers include Ti:Sapphire or Yb:YAG laser crystals. Difficulties in the amplification of ultra-short pulses include gain narrowing effects and dispersion effects in the laser crystal. In particular, these complications arise, when a pulse stretcher is needed before amplification of the laser beam. We present a technique to model and simulate the amplification of ultra-short pulses. This technique allows to model both gain narrowing effects and decrease of beam quality caused by amplification of the laser beam. This requires a detailed 3-dimensional simulation of population inversion. Gain narrowing effects are taken into account by analyzing the gain of the spectrum of the laser beam. It is important to distinguish amplifiers with one or only two passes and a regenerative amplifier. These two different kind of amplifiers are modeled by different approaches. A regenerative amplifier is modeled by a set of time dependent rate equations. However, a single pass amplifier is modeled by a set of spatial dependent rate equations. In both cases, a system of rate equations arises from spectral discretization of the laser beam. Detailed simulation results are presented.

  8. Pulse compression of a high-power thin disk laser using rod-type fiber amplifiers.

    PubMed

    Saraceno, C J; Heckl, O H; Baer, C R E; Südmeyer, T; Keller, U

    2011-01-17

    We report on two pulse compressors for a high-power thin disk laser oscillator using rod-type fiber amplifiers. Both systems are seeded by a standard SESAM modelocked thin disk laser that delivers 16 W of average power at a repetition rate of 10.6 MHz with a pulse energy of 1.5 μJ and a pulse duration of 1 ps. We discuss two results with different fiber parameters with different trade-offs in pulse duration, average power, damage and complexity. The first amplifier setup consists of a Yb-doped fiber amplifier with a 2200 μm2 core area and a length of 55 cm, resulting in a compressed average power of 55 W with 98-fs pulses at a repetition rate of 10.6 MHz. The second system uses a shorter 36-cm fiber with a larger core area of 4500 μm2. In a stretcher-free configuration we obtained 34 W of compressed average power and 65-fs pulses. In both cases peak powers of > 30 MW were demonstrated at several μJ pulse energies. The power scaling limitations due to damage and self-focusing are discussed.

  9. Compensation of high-order phase distortions in chirped-pulse amplification system

    NASA Astrophysics Data System (ADS)

    Zhou, Bing; Jiang, Yong-Liang; Leng, Yu-xin; Chen, Xiao-Wei; Li, Ru-Xin; Xu, Zhi-Zhan

    2007-01-01

    Chirped-pulse amplification (CPA) technique has been widely used to generate ultra-intense femto-second pulses. In this scheme the seed pulses from an oscillator are stretched before amplification. The stretched pulses can support more energy extraction and effectively decrease the nonlinear effects in the gain media. The subsequent amplification in a CPA chain will result in a broadening of the output compressed pulses in temporal domain due to the gain narrowing and uncompensated phase distortions. In our experiment, using spectral modulation and phase pre-compensation system (Acoustic-Optics Programmable Dispersive Filter) between the oscillator and the stretcher, the effects of gain narrowing and high-order dispersions on the pulse duration in kHz chirped-pulse amplification system have been pre-compensated, and the spectral FWHM is expanded from 30nm to 50nm. The effects of GDD, TOD and FOD were investigated by scanning the four dispersion parameters respectively. By pre-compensating the high-order phase distortions with the phase measured by SPIDER, we successfully optimize the output duration from 51fs to 30fs, which is 1.07 times Fourier-transform-limitation.

  10. Time-domain aspect of carrier-envelope-phase control: field stabilized optical pulse generation

    NASA Astrophysics Data System (ADS)

    Torizuka, Kenji; Takada, Hideyuki; Kakehata, Masayuki

    2006-06-01

    An ultrashort pulse laser system with precisely controlled output-timing and carrier-envelope phase (CEP) is reported. Recently developed technology Ofl CEP control of a mode-locked laser not only introduced an optical frequency comh in frequency domain hut also gave us a way to generate optical pulses whose oscillating electric field is under a fixed phase relation with the intensity shape. Fortunately, recent advances on optical physics have also showed that sonic types of light-matter interactions become sensitive to the field shape when the pulse approaches a few cycles in duration and has a high peak intensity. Owing to those advances, field-controlled ultrashort pulse generation, based on suh-femtosecond resolution timing-control and sub-radian CEP control of femtosecond lasers, becomes an attractive challenge. Our final goal is to realize a shaped electric field within optical-cycle time scale br researches on light-matter interaction and other future application. CEP control Ofl a mode-locked Ti:sapphire laser is the first step of such a laser system. Trade-off between the accuracy and robustness of the control, and the monitoring technique of CEP br amplilication, will he discussed. Amplification of a CEP-controlled pulse, which is necessary for most of time-domain application, is successfully performed by the CEP monitoring technique. Our chirped-pulse amplifier, that includes a grating-based stretcher/compressor, has a potential to achieve higher-energy amplification of a fixed CEP pulse. Multichannel phase control of spectrally divided ultrashort pulses is applied to dynamic control of pulse-timing and CEP of amplifled pulses. Related results on short-pulse, sub-l3fs, generation by a chirped-pulse Ti:sapphire amplifier, and multicolor phase-coherent pulse sources will be also discussed briefly, showing our on-going efforts to approach the final goal.

  11. Cooperative pulses

    NASA Astrophysics Data System (ADS)

    Braun, Michael; Glaser, Steffen J.

    2010-11-01

    We introduce the concept of cooperative (COOP) pulses which are designed to compensate each other's imperfections. In multi-scan experiments, COOP pulses can cancel undesired signal contributions, complementing and generalizing phase cycles. COOP pulses can be efficiently optimized using an extended version of the optimal-control-based gradient ascent pulse engineering (GRAPE) algorithm. The advantage of the COOP approach is experimentally demonstrated for broadband and band-selective pulses.

  12. PULSE SORTER

    DOEpatents

    Wade, E.J.

    1958-07-29

    An apparatus is described for counting and recording the number of electrical pulses occurring in each of a timed sequence of groups of pulses. The particular feature of the invention resides in a novel timing circuit of the univibrator type which provides very accurately timed pulses for opening each of a series of coincidence channels in sequence. The univibrator is shown incorporated in a pulse analyzing system wherein a series of pulse counting channels are periodically opened in order, one at a time, for a predetermtned open time interval, so that only one channel will be open at the time of occurrence of any of the electrical pulses to be sorted.

  13. The AzTEC Mathematics Project (AMP).

    ERIC Educational Resources Information Center

    Johnson, Gae R.

    The AzTEC Mathematics Project (AMP) is a statewide partnership among Arizona's Regents universities and state community colleges, partner school districts, and economic communities. AzTec is committed to preparing highly qualified K-12 mathematics and science teachers. AMP targeted Native American teachers and teachers of Native American students…

  14. Chirped pulse amplification of a dissipative soliton thulium-doped fiber laser

    NASA Astrophysics Data System (ADS)

    Tan, Fangzhou; Shi, Hongxing; Wang, Peng; Liu, Jiang; Wang, Pu

    2016-03-01

    We demonstrate on chirped pulse amplification of a dissipative soliton thulium-doped fiber laser. The system consists of an all-fiber seed laser, a fiber-based stretcher, two-stage fiber amplifier and a free space grating compressor. The oscillator works in the normal dispersion regime and delivers up-chirped pulses with output power of 3 mW at repetition rate of 29.3 MHz. The spectrum of the seed laser is located at 1938 nm with a 10 dB bandwidth of 50 nm. The output pulses are directly stretched in ~50 m normal dispersion fiber to 72 ps pulse duration. In the pre-amplifier and power amplifier, both forward pumping and backward pumping are tested in the experiment. Output power of 7 W has been achieved in the power amplifier with backward pumping corresponding to a pulse energy of 239 nJ, which has an amplification slope efficiency of 37.8%. The PER at the highest average output power was measured to be 19.5 dB. The amplified up-chirped pulses could be dechirped to a duration time of 121 fs with energy of 161 nJ using a pair of fused silica transmission gratings.

  15. Pulse Oximetry

    MedlinePlus

    ... www.thoracic.org amount of gases (oxygen and carbon dioxide) that are in your blood. To get an ... Also, a pulse oximeter does not measure your carbon dioxide level. How accurate is the pulse oximeter? The ...

  16. PULSE GENERATOR

    DOEpatents

    Roeschke, C.W.

    1957-09-24

    An improvement in pulse generators is described by which there are produced pulses of a duration from about 1 to 10 microseconds with a truly flat top and extremely rapid rise and fall. The pulses are produced by triggering from a separate input or by modifying the current to operate as a free-running pulse generator. In its broad aspect, the disclosed pulse generator comprises a first tube with an anode capacitor and grid circuit which controls the firing; a second tube series connected in the cathode circuit of the first tube such that discharge of the first tube places a voltage across it as the leading edge of the desired pulse; and an integrator circuit from the plate across the grid of the second tube to control the discharge time of the second tube, determining the pulse length.

  17. Three Yersinia enterocolitica AmpD Homologs Participate in the Multi-Step Regulation of Chromosomal Cephalosporinase, AmpC.

    PubMed

    Liu, Chang; Wang, Xin; Chen, Yuhuang; Hao, Huijing; Li, Xu; Liang, Junrong; Duan, Ran; Li, Chuchu; Zhang, Jing; Shao, Shihe; Jing, Huaiqi

    2016-01-01

    In many gram negative bacilli, AmpD plays a key role in both cell well-recycling pathway and β-lactamase regulation, inactivation of the ampD causes the accumulation of 1,6-anhydromuropeptides, and results in the ampC overproduction. In Yersinia enterocolitica, the regulation of ampC expression may also rely on the ampR-ampC system, the role of AmpD in this species is still unknown. In this study, three AmpD homologs (AmpD1, AmpD2, and AmpD3) have been identified in complete sequence of strain Y. enterocolitica subsp. palearctica 105.5R(r). To understand the role of three AmpD homologs, several mutant strains were constructed and analyzed where a rare ampC regulation mechanism was observed: low-effective ampD2 and ampD3 cooperate with the high-effective ampD1 in the three levels regulation of ampC expression. Enterobacteriaceae was used to be supposed to regulate ampC expression by two steps, three steps regulation was only observed in Pseudomonas aeruginosa. In this study, we first reported that Enterobacteriaceae Y. enterocolitica can also possess a three steps stepwise regulation mechanism, regulating the ampC expression precisely. PMID:27588018

  18. Three Yersinia enterocolitica AmpD Homologs Participate in the Multi-Step Regulation of Chromosomal Cephalosporinase, AmpC

    PubMed Central

    Liu, Chang; Wang, Xin; Chen, Yuhuang; Hao, Huijing; Li, Xu; Liang, Junrong; Duan, Ran; Li, Chuchu; Zhang, Jing; Shao, Shihe; Jing, Huaiqi

    2016-01-01

    In many gram negative bacilli, AmpD plays a key role in both cell well-recycling pathway and β-lactamase regulation, inactivation of the ampD causes the accumulation of 1,6-anhydromuropeptides, and results in the ampC overproduction. In Yersinia enterocolitica, the regulation of ampC expression may also rely on the ampR-ampC system, the role of AmpD in this species is still unknown. In this study, three AmpD homologs (AmpD1, AmpD2, and AmpD3) have been identified in complete sequence of strain Y. enterocolitica subsp. palearctica 105.5R(r). To understand the role of three AmpD homologs, several mutant strains were constructed and analyzed where a rare ampC regulation mechanism was observed: low-effective ampD2 and ampD3 cooperate with the high-effective ampD1 in the three levels regulation of ampC expression. Enterobacteriaceae was used to be supposed to regulate ampC expression by two steps, three steps regulation was only observed in Pseudomonas aeruginosa. In this study, we first reported that Enterobacteriaceae Y. enterocolitica can also possess a three steps stepwise regulation mechanism, regulating the ampC expression precisely. PMID:27588018

  19. Electrical Stimulation Decreases Coupling Efficiency Between Beta-Adrenergic Receptors and Cyclic AMP Production in Cultured Muscle Cells

    NASA Technical Reports Server (NTRS)

    Young, R. B.; Bridge, K. Y.

    1999-01-01

    Electrical stimulation of skeletal muscle cells in culture is an effective way to simulate the effects of muscle contraction and its effects on gene expression in muscle cells. Expression of the beta-adrenergic receptor and its coupling to cyclic AMP synthesis are important components of the signaling system that controls muscle atrophy and hypertrophy, and the goal of this project was to determine if electrical stimulation altered the beta-adrenergic response in muscle cells. Chicken skeletal muscle cells that had been grown for seven days in culture were subjected to electrical stimulation for an additional two days at a pulse frequency of 0.5 pulses/sec and a pulse duration of 200 msec. At the end of this two-day stimulation period, beta-adrenergic receptor population was measured by the binding of tritium-labeled CGP-12177 to muscle cells, and coupling to cAMP synthesis was measured by Radioimmunoassay (RIA) after treating the cells for 10 min with the potent (beta)AR agonist, isoproterenol. The number of beta adrenergic receptors and the basal levels of intracellular cyclic AMP were not affected by electrical stimulation. However, the ability of these cells to synthesize cyclic AMP was reduced by approximately 50%. Thus, an enhanced level of contraction reduces the coupling efficiency of beta-adrenergic receptors for cyclic AMP production.

  20. FY07 LDRD Final Report Precision, Split Beam, Chirped-Pulse, Seed Laser Technology

    SciTech Connect

    Dawson, J W; Messerly, M J; Phan, H H; Crane, J K; Beach, R J; Siders, C W; Barty, C J

    2009-11-12

    The goal of this LDRD ER was to develop a robust and reliable technology to seed high-energy laser systems with chirped pulses that can be amplified to kilo-Joule energies and recompressed to sub-picosecond pulse widths creating extremely high peak powers suitable for petawatt class physics experiments. This LDRD project focused on the development of optical fiber laser technologies compatible with the current long pulse National Ignition Facility (NIF) seed laser. New technologies developed under this project include, high stability mode-locked fiber lasers, fiber based techniques for reduction of compressed pulse pedestals and prepulses, new compact stretchers based on chirped fiber Bragg gratings (CFBGs), new techniques for manipulation of chirped pulses prior to amplification and new high-energy fiber amplifiers. This project was highly successful and met virtually all of its goals. The National Ignition Campaign has found the results of this work to be very helpful. The LDRD developed system is being employed in experiments to engineer the Advanced Radiographic Capability (ARC) front end and the fully engineered version of the ARC Front End will employ much of the technology and techniques developed here.

  1. Simultaneous visible and near-infrared emission from a pulse-stretched alexandrite laser source

    NASA Astrophysics Data System (ADS)

    Boczar, Bruce; Thevar, Thanga; Rousseva, Ivelina; Kramer, Norman; Pryor, Brian; Frost, Rick

    2004-07-01

    An efficient method to make multi-spectral laser light having any selected pulsed duration in the range of 100 ns to 1 μs has been demonstrated in the laboratory. This laser system, based on the alexandrite tunable solid-state gain medium, which is tunable in its fundamental between 720 and 800 nm, was constructed near the gain maximum of 755 nm. A novel intracavity pulse-stretcher provides control of the pulse duration up to about 5 μs using the Pockels effect. In the demonstration prototype, however, the pulse duration was restricted to 500 ns to maintain the peak power needed for efficient nonlinear conversion. Following an amplification stage, Raman shifting in hydrogen gas was used to achieve efficient wavelength conversion to 1100 nm. The Raman shifted beam was frequency doubled to 550 nm using two BBO crystals arranged for walk-off compensation. The result was a convenient source of light whose spectral content, pulse duration, as well as other parameters, could be critically controlled.

  2. C++ Coding Standards for the AMP Project

    SciTech Connect

    Evans, Thomas M; Clarno, Kevin T

    2009-09-01

    This document provides an initial starting point to define the C++ coding standards used by the AMP nuclear fuel performance integrated code project and a part of AMP's software development process. This document draws from the experiences, and documentation [1], of the developers of the Marmot Project at Los Alamos National Laboratory. Much of the software in AMP will be written in C++. The power of C++ can be abused easily, resulting in code that is difficult to understand and maintain. This document gives the practices that should be followed on the AMP project for all new code that is written. The intent is not to be onerous but to ensure that the code can be readily understood by the entire code team and serve as a basis for collectively defining a set of coding standards for use in future development efforts. At the end of the AMP development in fiscal year (FY) 2010, all developers will have experience with the benefits, restrictions, and limitations of the standards described and will collectively define a set of standards for future software development. External libraries that AMP uses do not have to meet these requirements, although we encourage external developers to follow these practices. For any code of which AMP takes ownership, the project will decide on any changes on a case-by-case basis. The practices that we are using in the AMP project have been in use in the Denovo project [2] for several years. The practices build on those given in References [3-5]; the practices given in these references should also be followed. Some of the practices given in this document can also be found in [6].

  3. Generation, temporal characterization and applications of femtosecond-/ attosecond extreme ultraviolet pulses

    NASA Astrophysics Data System (ADS)

    Thomann, Isabell

    dependence of molecular photoionization on the molecular orientation. To this end, molecules were impulsively aligned by means of femtosecond pump pulses. The excited molecular rotational wavepacket experiences revivals that continue long after the pump pulse has left. During such revivals, the molecular axes change their orientation from parallel to perpendicular with respect to the polarization of the pump pulse within a few hundred femtoseconds. Therefore photoionization by femtosecond EUV pulses with variable delay during a revival is equivalent to photoionization of molecules with varying orientation. With this novel method the orientational dependence of single-photon photoionization of N2 and CO2 into non-dissociating channels, as well as for a long-lived state of CO+2 was measured for the first time. (C) Carrier-envelope-phase (CEP) stabilization of a femtosecond chirped pulse amplifier. Lastly, CEP stabilization of intense laser pulses from a chirped pulse amplifier was realized. For amplifier systems containing a pulse stretcher and compressor based on diffraction gratings, an increased susceptibility to CEP fluctuations had been expected prior to this work. Therefore the pulse stretcher and compressor system were examined separately in a first step, and the introduced CEP fluctuations were found to be insignificant. The CEP stability of the full amplifier system was then characterized, and excellent long-term stability was shown. With this work a scaling of the energy of CEP-stabilized pulses into the joule range becomes possible. In contrast to absolute frequency measurements with low-energy femtosecond pulses which require stability in the frequency range, the interest in stabilized high-energy pulses is to control the entire electric field of intense laser pulses in the time domain with attosecond precision, to allow full control of the dynamics of electrons in intense light fields.

  4. Pulse Voltammetry

    NASA Astrophysics Data System (ADS)

    Stojek, Zbigniew

    The idea of imposing potential pulses and measuring the currents at the end of each pulse was proposed by Barker in a little-known journal as early as in 1958 [1]. However, the first reliable trouble-free and affordable polarographs offering voltammetric pulse techniques appeared on the market only in the 1970s. This delay was due to some limitations on the electronic side. In the 1990s, again substantial progress in electrochemical pulse instrumentation took place. This was related to the introduction of microprocessors, computers, and advanced software.

  5. Changes in nephrogenous cyclic AMP excretion and plasma cyclic AMP following treatment of hyperthyroidism.

    PubMed

    Naafs, M A; van der Velden, P C; Fischer, H R; Koorevaar, G; van Duin, S; Hackeng, W H; Schopman, W; Silberbusch, J

    1984-08-01

    Plasma cyclic AMP (PcAMP) concentration and the excretion of cyclic AMP/dl GF were estimated in 11 thyrotoxic patients before and after medical treatment. PcAMP concentrations were significantly higher during hyperthyroidism (2.30 +/- 0.69 vs 1.88 +/- 0.71 nmol/dl; P less than 0.05), and total urinary cyclic AMP (TcAMP) excretion showed no significant changes (3.24 +/- 0.64 vs 3.44 +/- 1.77 nmol/dl GF). Nephrogenous (NcAMP) excretion rose significantly (1.00 +/- 0.82 vs 1.68 +/- 1.31 mmol/dl GF; P less than 0.025). The increase in NcAMP excretion correlated significantly with the decrease in serum T3 levels (r = -0.46; P less than 0.05). Serum iPTH levels showed no significant change. Both the serum Ca, corrected for serum total protein and TmPO4/GFR declined after treatment (respectively 2.44 +/- 0.13 vs 2.33 +/- 0.08 mmol/l; P less than 0.05 and 1.18 +/- 0.29 vs 1.05 +/- 0.22 mmol/l; P less than 0.05). It is concluded that the rise in NcAMP excretion corroborates the concept of increasing parathyroid activity following the treatment of hyperthyroidism. PMID:6206676

  6. Highly Efficient Tabletop Optical Parametric Chirped Pulse Amplifier at 1 (micron)m

    SciTech Connect

    Jovanovic, I.; Ebbers, C.A.; Comaskey, B.J.; Bonner, R.A.; Morse, E.C.

    2001-12-04

    Optical parametric chirped pulse amplification (OPCPA) is a scalable technology, for ultrashort pulse amplification. Its major advantages include design simplicity, broad bandwidth, tunability, low B-integral, high contrast, and high beam quality. OPCPA is suitable both for scaling to high peak power as well as high average power. We describe the amplification of stretched 100 fs oscillator pulses in a three-stage OPCPA system pumped by a commercial, single-longitudinal-mode, Q-switched Nd:YAG laser. The stretched pulses were centered around 1054 nm with a FWHM bandwidth of 16.5 nm and had an energy of 0.5 nJ. Using our OPCPA system, we obtained an amplified pulse energy of up to 31 mJ at a 10 Hz repetition rate. The overall conversion efficiency from pump to signal is 6%, which is the highest efficiency obtained With a commercial tabletop pump laser to date. The overall conversion efficiency is limited due to the finite temporal overlap of the seed (3 ns) with respect to the duration of the pump (8.5 ns). Within the temporal window of the seed pulse the pump to signal conversion efficiency exceeds 20%. Recompression of the amplified signal was demonstrated to 310 fs, limited by the aberrations initially present in the low energy seed imparted by the pulse stretcher. The maximum gain in our OPCPA system is 6 x 10{sup 7}, obtained through single passing of 40 mm of beta-barium borate. We present data on the beam quality obtained from our system (M{sup 2}=1.1). This relatively simple system replaces a significantly more complex Ti:sapphire regenerative amplifier based CPA system used in the front end of a high energy short pulse laser. Future improvement will include obtaining shorter amplified pulses and higher average power.

  7. PULSE AMPLIFIER

    DOEpatents

    Johnstone, C.W.

    1958-06-17

    The improvement of pulse amplifiers used with scintillation detectors is described. The pulse amplifier circuit has the advantage of reducing the harmful effects of overloading cause by large signal inputs. In general the pulse amplifier circuit comprises two amplifier tubes with the input pulses applied to one amplifier grid and coupled to the second amplifier tube through a common cathode load. The output of the second amplifier is coupled from the plate circuit to a cathode follower tube grid and a diode tube in connected from grid to cathode of the cathode follower tube. Degenerative feedback is provided in the second amplifier by coupling a signal from the cathode follower cathode to the second amplifier grid. The circuit proqides moderate gain stability, and overload protection for subsequent pulse circuits.

  8. Inflatable stretcher to transport patients

    NASA Technical Reports Server (NTRS)

    Clark, C. C.; Gordon, F. T., Jr.; Schmidt, C. B.

    1970-01-01

    Inflatable plastic bag inside strong, inflexible outer bag facilitates emergency transport of seriously burned or disabled patients. When the bag is inflated the patient is completely immobilized and cushioned from external shock. Air for breathing, temperature controls and communications may be provided by appropriate plug-in connections.

  9. Brain Stretchers Book 4--Advanced.

    ERIC Educational Resources Information Center

    Anderson, Carolyn

    This book provides puzzles, games, and mathematical activities for students in elementary grades. Number concepts and arithmetic are common topics. These classic math, logic, and word-problem activities encourage students to become flexible, creative thinkers while teaching them to draw valid conclusions based on logic and evidence. Each activity…

  10. Atmospheric, Magnetospheric and Plasmas in space (AMPS) spacelab payload definition study. Volume 4. Part 1, AMPS program specification

    NASA Technical Reports Server (NTRS)

    Keeley, J. T.

    1976-01-01

    The AMPS Program Specification delineates the AMPS Program requirements consistent with the resources defined in the AMPS Project Plan. All subsidiary specifications and requirements shall conform to the requirements presented. The requirements hierarchy for the AMPS program is illustrated. A brief description of each of the requirements documents and their intended use is provided.

  11. cAMP signalling meets mitochondrial compartments.

    PubMed

    Lefkimmiatis, Konstantinos

    2014-04-01

    Mitochondria are highly dynamic organelles comprising at least three distinct areas, the OMM (outer mitochondrial membrane), the IMS (intermembrane space) and the mitochondrial matrix. Physical compartmentalization allows these organelles to host different functional domains and therefore participate in a variety of important cellular actions such as ATP synthesis and programmed cell death. In a surprising homology, it is now widely accepted that the ubiquitous second messenger cAMP uses the same stratagem, compartmentalization, in order to achieve the characteristic functional pleiotropy of its pathway. Accumulating evidence suggests that all the main mitochondrial compartments contain segregated cAMP cascades; however, the regulatory properties and functional significance of such domains are not fully understood and often remain controversial issues. The present mini-review discusses our current knowledge of how the marriage between mitochondrial and cAMP compartmentalization is achieved and its effects on the biology of the cell. PMID:24646228

  12. Pulse Data.

    ERIC Educational Resources Information Center

    Hands On!, 1998

    1998-01-01

    Presents an activity using computer software to investigate the role of the heart and blood, how the blood system responds to exercise, and how pulse rate is a good measure of physical condition. (ASK)

  13. Simultaneous second- and third- order spectral phase control of Ti:sapphire laser pulses using achromatic doublet prisms.

    PubMed

    Mueller, Alexander; Fuerbach, Alexander

    2016-03-20

    The standard technique commonly utilized to introduce large amounts of negative group delay dispersion (GDD) into the beam path of ultrashort laser pulses with low insertion losses is the use of a pair of prisms in a double pass configuration. However, one disadvantage of this approach is the unavoidable introduction of additional high-order spectral phase errors, most notably third-order dispersion (TOD) due to the characteristics of the refractive index of available optical materials. In this paper we provide an overview of the dispersive properties of more than 100 common types of optical glasses, used either as a bulk stretcher or in a prism compressor configuration. In addition, we present a novel method that enables independent control of GDD and TOD in a prism-only setup. The performance of different prism combinations is analyzed numerically, and design guidelines are given. PMID:27140563

  14. Simultaneous second- and third- order spectral phase control of Ti:sapphire laser pulses using achromatic doublet prisms.

    PubMed

    Mueller, Alexander; Fuerbach, Alexander

    2016-03-20

    The standard technique commonly utilized to introduce large amounts of negative group delay dispersion (GDD) into the beam path of ultrashort laser pulses with low insertion losses is the use of a pair of prisms in a double pass configuration. However, one disadvantage of this approach is the unavoidable introduction of additional high-order spectral phase errors, most notably third-order dispersion (TOD) due to the characteristics of the refractive index of available optical materials. In this paper we provide an overview of the dispersive properties of more than 100 common types of optical glasses, used either as a bulk stretcher or in a prism compressor configuration. In addition, we present a novel method that enables independent control of GDD and TOD in a prism-only setup. The performance of different prism combinations is analyzed numerically, and design guidelines are given.

  15. AMP decreases the efficiency of skeletal-muscle mitochondria.

    PubMed

    Cadenas, S; Buckingham, J A; St-Pierre, J; Dickinson, K; Jones, R B; Brand, M D

    2000-10-15

    Mitochondrial proton leak in rat muscle is responsible for approx. 15% of the standard metabolic rate, so its modulation could be important in regulating metabolic efficiency. We report in the present paper that physiological concentrations of AMP (K(0.5)=80 microM) increase the resting respiration rate and double the proton conductance of rat skeletal-muscle mitochondria. This effect is specific for AMP. AMP also doubles proton conductance in skeletal-muscle mitochondria from an ectotherm (the frog Rana temporaria), suggesting that AMP activation is not primarily for thermogenesis. AMP activation in rat muscle mitochondria is unchanged when uncoupling protein-3 is doubled by starvation, indicating that this protein is not involved in the AMP effect. AMP activation is, however, abolished by inhibitors and substrates of the adenine nucleotide translocase (ANT), suggesting that this carrier (possibly the ANT1 isoform) mediates AMP activation. AMP activation of ANT could be important for physiological regulation of metabolic rate.

  16. AMP decreases the efficiency of skeletal-muscle mitochondria.

    PubMed Central

    Cadenas, S; Buckingham, J A; St-Pierre, J; Dickinson, K; Jones, R B; Brand, M D

    2000-01-01

    Mitochondrial proton leak in rat muscle is responsible for approx. 15% of the standard metabolic rate, so its modulation could be important in regulating metabolic efficiency. We report in the present paper that physiological concentrations of AMP (K(0.5)=80 microM) increase the resting respiration rate and double the proton conductance of rat skeletal-muscle mitochondria. This effect is specific for AMP. AMP also doubles proton conductance in skeletal-muscle mitochondria from an ectotherm (the frog Rana temporaria), suggesting that AMP activation is not primarily for thermogenesis. AMP activation in rat muscle mitochondria is unchanged when uncoupling protein-3 is doubled by starvation, indicating that this protein is not involved in the AMP effect. AMP activation is, however, abolished by inhibitors and substrates of the adenine nucleotide translocase (ANT), suggesting that this carrier (possibly the ANT1 isoform) mediates AMP activation. AMP activation of ANT could be important for physiological regulation of metabolic rate. PMID:11023814

  17. Cyclic AMP (cAMP) Receptor Protein-cAMP Complex Regulates Heparosan Production in Escherichia coli Strain Nissle 1917.

    PubMed

    Yan, Huihui; Bao, Feifei; Zhao, Liping; Yu, Yanying; Tang, Jiaqin; Zhou, Xianxuan

    2015-11-01

    Heparosan serves as the starting carbon backbone for the chemoenzymatic synthesis of heparin, a widely used clinical anticoagulant drug. The availability of heparosan is a significant concern for the cost-effective synthesis of bioengineered heparin. The carbon source is known as the pivotal factor affecting heparosan production. However, the mechanism by which carbon sources control the biosynthesis of heparosan is unclear. In this study, we found that the biosynthesis of heparosan was influenced by different carbon sources. Glucose inhibits the biosynthesis of heparosan, while the addition of either fructose or mannose increases the yield of heparosan. Further study demonstrated that the cyclic AMP (cAMP)-cAMP receptor protein (CRP) complex binds to the upstream region of the region 3 promoter and stimulates the transcription of the gene cluster for heparosan biosynthesis. Site-directed mutagenesis of the CRP binding site abolished its capability of binding CRP and eliminated the stimulative effect on transcription. (1)H nuclear magnetic resonance (NMR) analysis was further performed to determine the Escherichia coli strain Nissle 1917 (EcN) heparosan structure and quantify extracellular heparosan production. Our results add to the understanding of the regulation of heparosan biosynthesis and may contribute to the study of other exopolysaccharide-producing strains. PMID:26319872

  18. Cyclic AMP (cAMP) Receptor Protein-cAMP Complex Regulates Heparosan Production in Escherichia coli Strain Nissle 1917

    PubMed Central

    Yan, Huihui; Bao, Feifei; Zhao, Liping; Yu, Yanying; Tang, Jiaqin

    2015-01-01

    Heparosan serves as the starting carbon backbone for the chemoenzymatic synthesis of heparin, a widely used clinical anticoagulant drug. The availability of heparosan is a significant concern for the cost-effective synthesis of bioengineered heparin. The carbon source is known as the pivotal factor affecting heparosan production. However, the mechanism by which carbon sources control the biosynthesis of heparosan is unclear. In this study, we found that the biosynthesis of heparosan was influenced by different carbon sources. Glucose inhibits the biosynthesis of heparosan, while the addition of either fructose or mannose increases the yield of heparosan. Further study demonstrated that the cyclic AMP (cAMP)-cAMP receptor protein (CRP) complex binds to the upstream region of the region 3 promoter and stimulates the transcription of the gene cluster for heparosan biosynthesis. Site-directed mutagenesis of the CRP binding site abolished its capability of binding CRP and eliminated the stimulative effect on transcription. 1H nuclear magnetic resonance (NMR) analysis was further performed to determine the Escherichia coli strain Nissle 1917 (EcN) heparosan structure and quantify extracellular heparosan production. Our results add to the understanding of the regulation of heparosan biosynthesis and may contribute to the study of other exopolysaccharide-producing strains. PMID:26319872

  19. 21 CFR 862.1230 - Cyclic AMP test system.

    Code of Federal Regulations, 2010 CFR

    2010-04-01

    ... 21 Food and Drugs 8 2010-04-01 2010-04-01 false Cyclic AMP test system. 862.1230 Section 862.1230...) MEDICAL DEVICES CLINICAL CHEMISTRY AND CLINICAL TOXICOLOGY DEVICES Clinical Chemistry Test Systems § 862.1230 Cyclic AMP test system. (a) Identification. A cyclic AMP test system is a device intended...

  20. PULSE COUNTER

    DOEpatents

    Trumbo, D.E.

    1959-02-10

    A transistorized pulse-counting circuit adapted for use with nuclear radiation detecting detecting devices to provide a small, light weight portable counter is reported. The small size and low power requirements of the transistor are of particular value in this instance. The circuit provides an adjustable count scale with a single transistor which is triggered by the accumulated charge on a storage capacitor.

  1. AMPS Supporting Research and Technology (SR and T) report. Atmospheric, Magnetospheric and Plasmas in Space (AMPS) definition study

    NASA Technical Reports Server (NTRS)

    1976-01-01

    A listing of candidate technology areas that require additional study is presented. These candidate tasks, identified during the AMPS Phase B studies, are requisites to the design, development, and operation of the AMPS concept selected for preliminary design.

  2. Detection of cyclic di-AMP using a competitive ELISA with a unique pneumococcal cyclic di-AMP binding protein

    PubMed Central

    Underwood, Adam J.; Zhang, Yang; Metzger, Dennis W.; Bai, Guangchun

    2014-01-01

    Cyclic di-AMP (c-di-AMP) is a signaling molecule that has been shown to play important roles in bacterial physiology and infections. Currently, c-di-AMP detection and quantification relies mostly on the use of high-performance liquid chromatography (HPLC) or liquid chromatography-mass spectrometry (LC-MS). In this study, a competitive enzyme-linked immunosorbent assay (ELISA) for the quantification of c-di-AMP was developed, which utilizes a novel pneumococcal c-di-AMP binding protein (CabP) and a newly commercialized c-di-AMP derivative. With this new method, c-di-AMP concentrations in biological samples can be quickly and accurately quantified. Furthermore, this assay is much more efficient than current methods as it requires less overall cost and training while processing many samples at once. Therefore, this assay can be extensively used in research into c-di-AMP signaling. PMID:25239824

  3. Effect of electrical stimulation on beta-adrenergic receptor population and cyclic amp production in chicken and rat skeletal muscle cell cultures

    NASA Technical Reports Server (NTRS)

    Young, R. B.; Bridge, K. Y.; Strietzel, C. J.

    2000-01-01

    Expression of the beta-adrenergic receptor (betaAR) and its coupling to cyclic AMP (cAMP) synthesis are important components of the signaling system that controls muscle atrophy and hypertrophy, and the goal of this study was to determine if electrical stimulation in a pattern simulating slow muscle contraction would alter the betaAR response in primary cultures of avian and mammalian skeletal muscle cells. Specifically, chicken skeletal muscle cells and rat skeletal muscle cells that had been grown for 7 d in culture were subjected to electrical stimulation for an additional 2 d at a pulse frequency of 0.5 pulses/sec and a pulse duration of 200 msec. In chicken skeletal muscle cells, the betaAR population was not significantly affected by electrical stimulation; however, the ability of these cells to synthesize cyclic AMP was reduced by approximately one-half. In contrast, the betaAR population in rat muscle cells was increased slightly but not significantly by electrical stimulation, and the ability of these cells to synthesize cyclic AMP was increased by almost twofold. The basal levels of intracellular cyclic AMP in neither rat muscle cells nor chicken muscle cells were affected by electrical stimulation.

  4. Electron emitter pulsed-type cylindrical IEC

    SciTech Connect

    Miley, G.H.; Gu, Y.; Stubbers, R.; Zich, R.; Sved, J.; Anderl, R.; Hartwell, J.

    1997-12-31

    A cylindrical version of the single grid Inertial Electrostatic Confinement (IEC) device (termed the C-device) has been developed for use as a 2.5-MeV D-D fusion neutron source for neutron activation analysis. The C-device employs a hollow-tube type cathode with similar anodes backed up by ``reflector`` dishes. The resulting discharge differs from a conventional hollow cathode discharge, by creating an explicit ion beam which is ``pinched`` in the cathode region. Resulting fusion reactions generate {approximately}10{sup 6} neutron/s. A pulsed version is under development for applications requiring higher fluxes. Several pulsing techniques are under study, including an electron emitter (e-emitter) assisted discharge in a thorated tungsten wire emitter located behind a slotted area in the reflector dishes. Pulsing is initiated after establishing a low power steady-state discharge by pulsing the e-emitter current using a capacitor switch type circuit. The resulting electron jet, coupled with the discharge by the biased slot array, creates a strong pulse in the pinched ion beam. The pulse length/repetition rate are controlled by the e-emitter pulse circuit. Typical parameters in present studies are {approximately}30{micro}s, 10Hz and 1-amp ion current. Corresponding neutron measurements are an In-foil type activation counter for time averaged rates. Results for a wide variety of operating conditions are presented.

  5. Fiscal Year 2011 Infrastructure Refactorizations in AMP

    SciTech Connect

    Berrill, Mark A.; Philip, Bobby; Sampath, Rahul S.; Allu, Srikanth; Barai, Pallab; Cochran, Bill; Clarno, Kevin T.; Dilts, Gary A.

    2011-09-01

    In Fiscal Year 2011 (FY11), the AMP (Advanced MultiPhysics) Nuclear Fuel Performance code [1] went through a thorough review and refactorization based on the lessons-learned from the previous year, in which the version 0.9 of the software was released as a prototype. This report describes the refactorization work that has occurred or is in progress during FY11.

  6. The Applied Mathematics for Power Systems (AMPS)

    SciTech Connect

    Chertkov, Michael

    2012-07-24

    Increased deployment of new technologies, e.g., renewable generation and electric vehicles, is rapidly transforming electrical power networks by crossing previously distinct spatiotemporal scales and invalidating many traditional approaches for designing, analyzing, and operating power grids. This trend is expected to accelerate over the coming years, bringing the disruptive challenge of complexity, but also opportunities to deliver unprecedented efficiency and reliability. Our Applied Mathematics for Power Systems (AMPS) Center will discover, enable, and solve emerging mathematics challenges arising in power systems and, more generally, in complex engineered networks. We will develop foundational applied mathematics resulting in rigorous algorithms and simulation toolboxes for modern and future engineered networks. The AMPS Center deconstruction/reconstruction approach 'deconstructs' complex networks into sub-problems within non-separable spatiotemporal scales, a missing step in 20th century modeling of engineered networks. These sub-problems are addressed within the appropriate AMPS foundational pillar - complex systems, control theory, and optimization theory - and merged or 'reconstructed' at their boundaries into more general mathematical descriptions of complex engineered networks where important new questions are formulated and attacked. These two steps, iterated multiple times, will bridge the growing chasm between the legacy power grid and its future as a complex engineered network.

  7. Cyclic AMP efflux inhibitors as potential therapeutic agents for leukemia

    PubMed Central

    Perez, Dominique R.; Smagley, Yelena; Garcia, Matthew; Carter, Mark B.; Evangelisti, Annette; Matlawska-Wasowska, Ksenia; Winter, Stuart S.; Sklar, Larry A.; Chigaev, Alexandre

    2016-01-01

    Apoptotic evasion is a hallmark of cancer. We propose that some cancers may evade cell death by regulating 3′-5′-cyclic adenosine monophosphate (cAMP), which is associated with pro-apoptotic signaling. We hypothesize that leukemic cells possess mechanisms that efflux cAMP from the cytoplasm, thus protecting them from apoptosis. Accordingly, cAMP efflux inhibition should result in: cAMP accumulation, activation of cAMP-dependent downstream signaling, viability loss, and apoptosis. We developed a novel assay to assess cAMP efflux and performed screens to identify inhibitors. In an acute myeloid leukemia (AML) model, several identified compounds reduced cAMP efflux, appropriately modulated pathways that are responsive to cAMP elevation (cAMP-responsive element-binding protein phosphorylation, and deactivation of Very Late Antigen-4 integrin), and induced mitochondrial depolarization and caspase activation. Blocking adenylyl cyclase activity was sufficient to reduce effects of the most potent compounds. These compounds also decreased cAMP efflux and viability of B-lineage acute lymphoblastic leukemia (B-ALL) cell lines and primary patient samples, but not of normal primary peripheral blood mononuclear cells. Our data suggest that cAMP efflux is a functional feature that could be therapeutically targeted in leukemia. Furthermore, because some of the identified drugs are currently used for treating other illnesses, this work creates an opportunity for repurposing. PMID:27129155

  8. Pulsed hydrojet

    DOEpatents

    Bohachevsky, I.O.; Torrey, M.D.

    1986-06-10

    An underwater pulsed hydrojet propulsion system is provided for accelerating and propelling a projectile or other vessel. A reactant, such as lithium, is fluidized and injected into a water volume. The resulting reaction produces an energy density in a time effective to form a steam pocket. Thrust flaps or baffles direct the pressure from the steam pocket toward an exit nozzle for accelerating a water volume to create thrust. A control system regulates the dispersion of reactant to control thrust characteristics.

  9. Enhanced responsiveness to parathyroid hormone and induction of functional differentiation of cultured rabbit costal chondrocytes by a pulsed electromagnetic field.

    PubMed

    Hiraki, Y; Endo, N; Takigawa, M; Asada, A; Takahashi, H; Suzuki, F

    1987-10-22

    Pulsed electromagnetic fields promote healing of delayed united and ununited fractures by triggering a series of events in fibrocartilage. We examined the effects of a pulsed electromagnetic field (recurrent bursts, 15.4 Hz, of shorter pulses of an average of 2 gauss) on rabbit costal chondrocytes in culture. A pulsed electromagnetic field slightly reduced the intracellular cyclic adenosine 3',5'-monophosphate (cAMP) level in the culture. However, it significantly enhanced cAMP accumulation in response to parathyroid hormone (PTH) to 140% of that induced by PTH in its absence, while it did not affect cAMP accumulation in response to prostaglandin E1 or prostaglandin I2. The effect on cAMP accumulation in response to PTH became evident after exposure of the cultures to the pulsed electromagnetic field for 48 h, and was dependent upon the field strength. cAMP accumulation in response to PTH is followed by induction of ornithine decarboxylase, a good marker of differentiated chondrocytes, after PTH treatment for 4 h. Consistent with the enhanced cAMP accumulation, ornithine decarboxylase activity induced by PTH was also increased by the pulsed electromagnetic field to 170% of that in cells not exposed to a pulsed electromagnetic field. Furthermore, stimulation of glycosaminoglycan synthesis, a differentiated phenotype, in response to PTH was significantly enhanced by a pulsed electromagnetic field. Thus, a pulsed electromagnetic field enhanced a series of events in rabbit costal chondrocytes in response to PTH. These findings show that exposure of chondrocytes to a pulsed electromagnetic field resulted in functional differentiation of the cells.

  10. Directed evolution of the Escherichia coli cAMP receptor protein at the cAMP pocket.

    PubMed

    Gunasekara, Sanjiva M; Hicks, Matt N; Park, Jin; Brooks, Cory L; Serate, Jose; Saunders, Cameron V; Grover, Simranjeet K; Goto, Joy J; Lee, Jin-Won; Youn, Hwan

    2015-10-30

    The Escherichia coli cAMP receptor protein (CRP) requires cAMP binding to undergo a conformational change for DNA binding and transcriptional regulation. Two CRP residues, Thr(127) and Ser(128), are known to play important roles in cAMP binding through hydrogen bonding and in the cAMP-induced conformational change, but the connection between the two is not completely clear. Here, we simultaneously randomized the codons for these two residues and selected CRP mutants displaying high CRP activity in a cAMP-producing E. coli. Many different CRP mutants satisfied the screening condition for high CRP activity, including those that cannot form any hydrogen bonds with the incoming cAMP at the two positions. In vitro DNA-binding analysis confirmed that these selected CRP mutants indeed display high CRP activity in response to cAMP. These results indicate that the hydrogen bonding ability of the Thr(127) and Ser(128) residues is not critical for the cAMP-induced CRP activation. However, the hydrogen bonding ability of Thr(127) and Ser(128) was found to be important in attaining high cAMP affinity. Computational analysis revealed that most natural cAMP-sensing CRP homologs have Thr/Ser, Thr/Thr, or Thr/Asn at positions 127 and 128. All of these pairs are excellent hydrogen bonding partners and they do not elevate CRP activity in the absence of cAMP. Taken together, our analyses suggest that CRP evolved to have hydrogen bonding residues at the cAMP pocket residues 127 and 128 for performing dual functions: preserving high cAMP affinity and keeping CRP inactive in the absence of cAMP.

  11. PULSE COLUMN

    DOEpatents

    Grimmett, E.S.

    1964-01-01

    This patent covers a continuous countercurrent liquidsolids contactor column having a number of contactor states each comprising a perforated plate, a layer of balls, and a downcomer tube; a liquid-pulsing piston; and a solids discharger formed of a conical section at the bottom of the column, and a tubular extension on the lowest downcomer terminating in the conical section. Between the conical section and the downcomer extension is formed a small annular opening, through which solids fall coming through the perforated plate of the lowest contactor stage. This annular opening is small enough that the pressure drop thereacross is greater than the pressure drop upward through the lowest contactor stage. (AEC)

  12. Seizure Suppression by High Temperature via cAMP Modulation in Drosophila

    PubMed Central

    Saras, Arunesh; Tanouye, Mark A.

    2016-01-01

    Bang-sensitive (BS) Drosophila mutants display characteristic seizure-like activity (SLA) and paralysis after mechanical shock . After high-frequency electrical stimulation (HFS) of the brain, they generate robust seizures at very low threshold voltage. Here we report an important phenomenon, which effectively suppresses SLA in BS mutants. High temperature causes seizure suppression in all BS mutants (parabss1, eas, sda) examined in this study. This effect is fully reversible and flies show complete recovery from BS paralysis once the temperature effect is nullified. High temperature induces an increase in seizure threshold after a brief pulse of heat shock (HS). By genetic screening, we identified the involvement of cAMP in the suppression of seizures by high temperature. We propose that HS induces adenylyl cyclase which in turn increases cAMP concentration which eventually suppresses seizures in mutant flies. In summary, we describe an unusual phenomenon, where high temperature can suppress SLA in flies by modulating cAMP concentration. PMID:27558668

  13. Tapered pulse tube for pulse tube refrigerators

    DOEpatents

    Swift, Gregory W.; Olson, Jeffrey R.

    1999-01-01

    Thermal insulation of the pulse tube in a pulse-tube refrigerator is maintained by optimally varying the radius of the pulse tube to suppress convective heat loss from mass flux streaming in the pulse tube. A simple cone with an optimum taper angle will often provide sufficient improvement. Alternatively, the pulse tube radius r as a function of axial position x can be shaped with r(x) such that streaming is optimally suppressed at each x.

  14. The Regulatory Repertoire of Pseudomonas aeruginosa AmpC ß-Lactamase Regulator AmpR Includes Virulence Genes

    PubMed Central

    Balasubramanian, Deepak; Schneper, Lisa; Merighi, Massimo; Smith, Roger; Narasimhan, Giri; Lory, Stephen; Mathee, Kalai

    2012-01-01

    In Enterobacteriaceae, the transcriptional regulator AmpR, a member of the LysR family, regulates the expression of a chromosomal β-lactamase AmpC. The regulatory repertoire of AmpR is broader in Pseudomonas aeruginosa, an opportunistic pathogen responsible for numerous acute and chronic infections including cystic fibrosis. In addition to regulating ampC, P. aeruginosa AmpR regulates the sigma factor AlgT/U and production of some quorum sensing (QS)-regulated virulence factors. In order to better understand the ampR regulon, we compared the transcriptional profile generated using DNA microarrays of the prototypic P. aeruginosa PAO1 strain with its isogenic ampR deletion mutant, PAOΔampR. Transcriptome analysis demonstrates that the AmpR regulon is much more extensive than previously thought, with the deletion of ampR influencing the differential expression of over 500 genes. In addition to regulating resistance to β-lactam antibiotics via AmpC, AmpR also regulates non-β-lactam antibiotic resistance by modulating the MexEF-OprN efflux pump. Other virulence mechanisms including biofilm formation and QS-regulated acute virulence factors are AmpR-regulated. Real-time PCR and phenotypic assays confirmed the microarray data. Further, using a Caenorhabditis elegans model, we demonstrate that a functional AmpR is required for P. aeruginosa pathogenicity. AmpR, a member of the core genome, also regulates genes in the regions of genome plasticity that are acquired by horizontal gene transfer. Further, we show differential regulation of other transcriptional regulators and sigma factors by AmpR, accounting for the extensive AmpR regulon. The data demonstrates that AmpR functions as a global regulator in P. aeruginosa and is a positive regulator of acute virulence while negatively regulating biofilm formation, a chronic infection phenotype. Unraveling this complex regulatory circuit will provide a better understanding of the bacterial response to antibiotics and how the

  15. Parallel Allostery by cAMP and PDE Coordinates Activation and Termination Phases in cAMP Signaling.

    PubMed

    Krishnamurthy, Srinath; Tulsian, Nikhil Kumar; Chandramohan, Arun; Anand, Ganesh S

    2015-09-15

    The second messenger molecule cAMP regulates the activation phase of the cAMP signaling pathway through high-affinity interactions with the cytosolic cAMP receptor, the protein kinase A regulatory subunit (PKAR). Phosphodiesterases (PDEs) are enzymes responsible for catalyzing hydrolysis of cAMP to 5' AMP. It was recently shown that PDEs interact with PKAR to initiate the termination phase of the cAMP signaling pathway. While the steps in the activation phase are well understood, steps in the termination pathway are unknown. Specifically, the binding and allosteric networks that regulate the dynamic interplay between PKAR, PDE, and cAMP are unclear. In this study, PKAR and PDE from Dictyostelium discoideum (RD and RegA, respectively) were used as a model system to monitor complex formation in the presence and absence of cAMP. Amide hydrogen/deuterium exchange mass spectrometry was used to monitor slow conformational transitions in RD, using disordered regions as conformational probes. Our results reveal that RD regulates its interactions with cAMP and RegA at distinct loci by undergoing slow conformational transitions between two metastable states. In the presence of cAMP, RD and RegA form a stable ternary complex, while in the absence of cAMP they maintain transient interactions. RegA and cAMP each bind at orthogonal sites on RD with resultant contrasting effects on its dynamics through parallel allosteric relays at multiple important loci. RD thus serves as an integrative node in cAMP termination by coordinating multiple allosteric relays and governing the output signal response.

  16. Didactical formulation of the Ampère law

    NASA Astrophysics Data System (ADS)

    Barchiesi, Dominique

    2014-05-01

    The Ampère law is useful to calculate the magnetostatic field in the cases of distributions of current with high degree of symmetry. Nevertheless the magnetic field produced by a thin straight wire carrying a current I requires the Biot-Savart law and the use of the Ampère law leads to a mistake. A didactical formulation of the Ampère law is proposed to prevent misinterpretations.

  17. Cardiac cAMP: production, hydrolysis, modulation and detection

    PubMed Central

    Boularan, Cédric; Gales, Céline

    2015-01-01

    Cyclic adenosine 3′,5′-monophosphate (cAMP) modulates a broad range of biological processes including the regulation of cardiac myocyte contractile function where it constitutes the main second messenger for β-adrenergic receptors' signaling to fulfill positive chronotropic, inotropic and lusitropic effects. A growing number of studies pinpoint the role of spatial organization of the cAMP signaling as an essential mechanism to regulate cAMP outcomes in cardiac physiology. Here, we will briefly discuss the complexity of cAMP synthesis and degradation in the cardiac context, describe the way to detect it and review the main pharmacological arsenal to modulate its availability. PMID:26483685

  18. Effect of Electrical Stimulation on Beta-Adrenergic Receptor Population and Cyclic AMP Production in Chicken and Rat Skeletal Muscle Cell Cultures

    NASA Technical Reports Server (NTRS)

    Young, Ronald B.; Bridge, Kristin Y.; Strietzel, Catherine J.

    2000-01-01

    Expression of the beta-adrenergic receptor (PAR) and its coupling to Adenosine 3'5' Cyclic Monophosphate (cAMP) synthesis are important components of the signaling system that controls muscle atrophy and hypertrophy and the goal of this study was to determine if electrical stimulation in a pattern simulating slow muscle contraction would alter the PAR response in primary cultures of avian and mammalian skeletal muscle cells. Specifically chicken skeletal muscle cells and rat skeletal muscle cells that had been grown for 7 d in culture, were subjected to electrical stimulation for an additional 2 d at a pulse frequency of 0.5 pulses/sec and a pulse duration of 200 msec. In chicken skeletal muscle cells, the PAR population was not significantly affected by electrical stimulation; however, the ability, of these cells to synthesize cyclic AMP was reduced by approximately one-half. In contrast, the PAR population in rat muscle cells was increased slightly but not significantly by electrical stimulation, and the ability of these cells to synthesize cyclic AMP was increased by almost twofold. The basal levels of intracellular cyclic AMP in neither rat muscle cells nor chicken muscle cells were affected by electrical stimulation.

  19. Revisiting cAMP signaling in the carotid body

    PubMed Central

    Nunes, Ana R.; Holmes, Andrew P.; Conde, Sílvia V.; Gauda, Estelle B.; Monteiro, Emília C.

    2014-01-01

    Chronic carotid body (CB) activation is now recognized as being essential in the development of hypertension and promoting insulin resistance; thus, it is imperative to characterize the chemotransduction mechanisms of this organ in order to modulate its activity and improve patient outcomes. For several years, and although controversial, cyclic adenosine monophosphate (cAMP) was considered an important player in initiating the activation of the CB. However, its relevance was partially displaced in the 90s by the emerging role of the mitochondria and molecules such as AMP-activated protein kinase and O2-sensitive K+ channels. Neurotransmitters/neuromodulators binding to metabotropic receptors are essential to chemotransmission in the CB, and cAMP is central to this process. cAMP also contributes to raise intracellular Ca2+ levels, and is intimately related to the cellular energetic status (AMP/ATP ratio). Furthermore, cAMP signaling is a target of multiple current pharmacological agents used in clinical practice. This review (1) provides an outline on the classical view of the cAMP-signaling pathway in the CB that originally supported its role in the O2/CO2 sensing mechanism, (2) presents recent evidence on CB cAMP neuromodulation and (3) discusses how CB activity is affected by current clinical therapies that modify cAMP-signaling, namely dopaminergic drugs, caffeine (modulation of A2A/A2B receptors) and roflumilast (PDE4 inhibitors). cAMP is key to any process that involves metabotropic receptors and the intracellular pathways involved in CB disease states are likely to involve this classical second messenger. Research examining the potential modification of cAMP levels and/or interactions with molecules associated with CB hyperactivity is currently in its beginning and this review will open doors for future explorations. PMID:25389406

  20. Pre-Amp Box Platform Analysis

    SciTech Connect

    Kirby, K.; Kurita, C.; /Fermilab

    1989-01-17

    A platform to be used for the installation and repair of the high voltage pre-amp boxes on the CC cryostat has been designed to support a uniform load of 30 Ibs./sq. ft. However, according to the standards set by both the American National Standard and the Uniform Building Code, the minimum uniformly distributed design load for a structure used as an 'elevated platform or walkway' is 60 lbs./sq. ft. The existing platform was tested with a uniform load of 40 lbs./sq. ft. with no major problems occurring during the testing. Considering a 40 lbs./sq. ft. load to be the minimum acceptable value for 'residential' use, and the platform in hand to be better categorized as an 'elevated platform or walkway', the platform is carefully re-analyzed for a 60 lbs./sq. ft. uniformly distributed load.

  1. ADJUSTABLE DOUBLE PULSE GENERATOR

    DOEpatents

    Gratian, J.W.; Gratian, A.C.

    1961-08-01

    >A modulator pulse source having adjustable pulse width and adjustable pulse spacing is described. The generator consists of a cross coupled multivibrator having adjustable time constant circuitry in each leg, an adjustable differentiating circuit in the output of each leg, a mixing and rectifying circuit for combining the differentiated pulses and generating in its output a resultant sequence of negative pulses, and a final amplifying circuit for inverting and square-topping the pulses. (AEC)

  2. Mutants of PC12 cells with altered cyclic AMP responses

    SciTech Connect

    Block, T.; Kon, C.; Breckenridge, B.M.

    1984-10-01

    PCl2 cells, derived from a rat pheochromocytoma, were mutagenized and selected in media containing agents known to elevate intracellular concentrations of cyclic AMP (cAMP). More than 40 clones were isolated by selection with cholera toxin or 2-chloroadenosine or both. The variants that were deficient in accumulating cAMP were obtained by using a protocol in which 1 ..mu..m 8-bromo-cAMP was included in addition to the agonist. Certain of these variants were partially characterized with respect to the site of altered cAMP metabolism. The profiles of adenylate cyclase activity responsiveness of certain variants to guanosine-5'-(BETA,..gamma..-imido) triphosphate and to forskolin resembled those of UNC and cyc phenotypes of S49 lymphoma cells, which are functionally deficient in the GTP-sensitive coupling protein, N/sub s/. Other variants were characterized by increased cyclic nucleotide phosphodiesterase activity at low substrate concentration. Diverse morphological traits were observed among the variants, but it was not possible to assign them to a particular cAMP phenotype. Two revertants of a PCl2 mutant were isolated and observed to have regained a cellular cAMP response to 2-chloroadenosine and to forskolin. It is hoped that these PCl2 mutants will have utility for defining cAMP-mediated functions, including any links to the action of nerve growth factor, in cells derived from the neural crest.

  3. Age-dependence of the optomechanical responses of ex vivo human lenses from India and the USA, and the force required to produce these in a lens stretcher: the similarity to in vivo disaccommodation.

    PubMed

    Augusteyn, Robert C; Mohamed, Ashik; Nankivil, Derek; Veerendranath, Pesala; Arrieta, Esdras; Taneja, Mukesh; Manns, Fabrice; Ho, Arthur; Parel, Jean-Marie

    2011-07-15

    The purpose of this study was to study the age-dependence of the optomechanical properties of human lenses during simulated disaccommodation in a mechanical lens stretcher, designed to determine accommodative forces as a function of stretch distance, to compare the results with in vivo disaccommodation and to examine whether differences exist between eyes harvested in the USA and India. Postmortem human eyes obtained in the USA (n=46, age=6-83 years) and India (n=91, age=1 day-85 years) were mounted in an optomechanical lens stretching system and dissected to expose the lens complete with its accommodating framework, including zonules, ciliary body, anterior vitreous and a segmented rim of sclera. Disaccommodation was simulated through radial stretching of the sectioned globe by 2mm in increments of 0.25 mm. The load, inner ciliary ring diameter, lens equatorial diameter, central thickness and power were measured at each step. Changes in these parameters were examined as a function of age, as were the dimension/load and power/load responses. Unstretched lens diameter and thickness increased over the whole age range examined and were indistinguishable from those of in vivo lenses as well as those of in vitro lenses freed from zonular attachments. Stretching increased the diameter and decreased the thickness in all lenses examined but the amount of change decreased with age. Unstretched lens power decreased with age and the accommodative amplitude decreased to zero by age 45-50. The load required to produce maximum stretch was independent of age (median 80 mN) whereas the change in lens diameter and power per unit load decreased significantly with age. The age related changes in the properties of human lenses, as observed in the lens stretching device, are similar to those observed in vivo and are consistent with the classical Helmholtz theory of accommodation. The response of lens diameter and power to disaccommodative (stretching) forces decreases with age

  4. Rp-cAMPS Prodrugs Reveal the cAMP Dependence of First-Phase Glucose-Stimulated Insulin Secretion

    PubMed Central

    Schwede, Frank; Chepurny, Oleg G.; Kaufholz, Melanie; Bertinetti, Daniela; Leech, Colin A.; Cabrera, Over; Zhu, Yingmin; Mei, Fang; Cheng, Xiaodong; Manning Fox, Jocelyn E.; MacDonald, Patrick E.; Genieser, Hans-G.; Herberg, Friedrich W.

    2015-01-01

    cAMP-elevating agents such as the incretin hormone glucagon-like peptide-1 potentiate glucose-stimulated insulin secretion (GSIS) from pancreatic β-cells. However, a debate has existed since the 1970s concerning whether or not cAMP signaling is essential for glucose alone to stimulate insulin secretion. Here, we report that the first-phase kinetic component of GSIS is cAMP-dependent, as revealed through the use of a novel highly membrane permeable para-acetoxybenzyl (pAB) ester prodrug that is a bioactivatable derivative of the cAMP antagonist adenosine-3′,5′-cyclic monophosphorothioate, Rp-isomer (Rp-cAMPS). In dynamic perifusion assays of human or rat islets, a step-wise increase of glucose concentration leads to biphasic insulin secretion, and under these conditions, 8-bromoadenosine-3′,5′-cyclic monophosphorothioate, Rp-isomer, 4-acetoxybenzyl ester (Rp-8-Br-cAMPS-pAB) inhibits first-phase GSIS by up to 80%. Surprisingly, second-phase GSIS is inhibited to a much smaller extent (≤20%). Using luciferase, fluorescence resonance energy transfer, and bioluminescence resonance energy transfer assays performed in living cells, we validate that Rp-8-Br-cAMPS-pAB does in fact block cAMP-dependent protein kinase activation. Novel effects of Rp-8-Br-cAMPS-pAB to block the activation of cAMP-regulated guanine nucleotide exchange factors (Epac1, Epac2) are also validated using genetically encoded Epac biosensors, and are independently confirmed in an in vitro Rap1 activation assay using Rp-cAMPS and Rp-8-Br-cAMPS. Thus, in addition to revealing the cAMP dependence of first-phase GSIS from human and rat islets, these findings establish a pAB-based chemistry for the synthesis of highly membrane permeable prodrug derivatives of Rp-cAMPS that act with micromolar or even nanomolar potency to inhibit cAMP signaling in living cells. PMID:26061564

  5. Rp-cAMPS Prodrugs Reveal the cAMP Dependence of First-Phase Glucose-Stimulated Insulin Secretion.

    PubMed

    Schwede, Frank; Chepurny, Oleg G; Kaufholz, Melanie; Bertinetti, Daniela; Leech, Colin A; Cabrera, Over; Zhu, Yingmin; Mei, Fang; Cheng, Xiaodong; Manning Fox, Jocelyn E; MacDonald, Patrick E; Genieser, Hans-G; Herberg, Friedrich W; Holz, George G

    2015-07-01

    cAMP-elevating agents such as the incretin hormone glucagon-like peptide-1 potentiate glucose-stimulated insulin secretion (GSIS) from pancreatic β-cells. However, a debate has existed since the 1970s concerning whether or not cAMP signaling is essential for glucose alone to stimulate insulin secretion. Here, we report that the first-phase kinetic component of GSIS is cAMP-dependent, as revealed through the use of a novel highly membrane permeable para-acetoxybenzyl (pAB) ester prodrug that is a bioactivatable derivative of the cAMP antagonist adenosine-3',5'-cyclic monophosphorothioate, Rp-isomer (Rp-cAMPS). In dynamic perifusion assays of human or rat islets, a step-wise increase of glucose concentration leads to biphasic insulin secretion, and under these conditions, 8-bromoadenosine-3',5'-cyclic monophosphorothioate, Rp-isomer, 4-acetoxybenzyl ester (Rp-8-Br-cAMPS-pAB) inhibits first-phase GSIS by up to 80%. Surprisingly, second-phase GSIS is inhibited to a much smaller extent (≤20%). Using luciferase, fluorescence resonance energy transfer, and bioluminescence resonance energy transfer assays performed in living cells, we validate that Rp-8-Br-cAMPS-pAB does in fact block cAMP-dependent protein kinase activation. Novel effects of Rp-8-Br-cAMPS-pAB to block the activation of cAMP-regulated guanine nucleotide exchange factors (Epac1, Epac2) are also validated using genetically encoded Epac biosensors, and are independently confirmed in an in vitro Rap1 activation assay using Rp-cAMPS and Rp-8-Br-cAMPS. Thus, in addition to revealing the cAMP dependence of first-phase GSIS from human and rat islets, these findings establish a pAB-based chemistry for the synthesis of highly membrane permeable prodrug derivatives of Rp-cAMPS that act with micromolar or even nanomolar potency to inhibit cAMP signaling in living cells. PMID:26061564

  6. Enzymatic characterization of AMP phosphorylase and ribose-1,5-bisphosphate isomerase functioning in an archaeal AMP metabolic pathway.

    PubMed

    Aono, Riku; Sato, Takaaki; Yano, Ayumu; Yoshida, Shosuke; Nishitani, Yuichi; Miki, Kunio; Imanaka, Tadayuki; Atomi, Haruyuki

    2012-12-01

    AMP phosphorylase (AMPpase), ribose-1,5-bisphosphate (R15P) isomerase, and type III ribulose-1,5-bisphosphate carboxylase/oxygenase (Rubisco) have been proposed to constitute a novel pathway involved in AMP metabolism in the Archaea. Here we performed a biochemical examination of AMPpase and R15P isomerase from Thermococcus kodakarensis. R15P isomerase was specific for the α-anomer of R15P and did not recognize other sugar compounds. We observed that activity was extremely low with the substrate R15P alone but was dramatically activated in the presence of AMP. Using AMP-activated R15P isomerase, we reevaluated the substrate specificity of AMPpase. AMPpase exhibited phosphorylase activity toward CMP and UMP in addition to AMP. The [S]-v plot (plot of velocity versus substrate concentration) of the enzyme toward AMP was sigmoidal, with an increase in activity observed at concentrations higher than approximately 3 mM. The behavior of the two enzymes toward AMP indicates that the pathway is intrinsically designed to prevent excess degradation of intracellular AMP. We further examined the formation of 3-phosphoglycerate from AMP, CMP, and UMP in T. kodakarensis cell extracts. 3-Phosphoglycerate generation was observed from AMP alone, and from CMP or UMP in the presence of dAMP, which also activates R15P isomerase. 3-Phosphoglycerate was not formed when 2-carboxyarabinitol 1,5-bisphosphate, a Rubisco inhibitor, was added. The results strongly suggest that these enzymes are actually involved in the conversion of nucleoside monophosphates to 3-phosphoglycerate in T. kodakarensis.

  7. Control of bacterial exoelectrogenesis by c-AMP-GMP

    PubMed Central

    Nelson, James W.; Sudarsan, Narasimhan; Phillips, Grace E.; Stav, Shira; Lünse, Christina E.; McCown, Phillip J.; Breaker, Ronald R.

    2015-01-01

    Major changes in bacterial physiology including biofilm and spore formation involve signaling by the cyclic dinucleotides c-di-GMP and c-di-AMP. Recently, another second messenger dinucleotide, c-AMP-GMP, was found to control chemotaxis and colonization by Vibrio cholerae. We have identified a superregulon of genes controlled by c-AMP-GMP in numerous Deltaproteobacteria, including Geobacter species that use extracellular insoluble metal oxides as terminal electron acceptors. This exoelectrogenic process has been studied for its possible utility in energy production and bioremediation. Many genes involved in adhesion, pilin formation, and others that are important for exoelectrogenesis are controlled by members of a variant riboswitch class that selectively bind c-AMP-GMP. These RNAs constitute, to our knowledge, the first known specific receptors for c-AMP-GMP and reveal that this molecule is used by many bacteria to control specialized physiological processes. PMID:25848023

  8. Synergistic Antipseudomonal Effects of Synthetic Peptide AMP38 and Carbapenems.

    PubMed

    Rudilla, Héctor; Fusté, Ester; Cajal, Yolanda; Rabanal, Francesc; Vinuesa, Teresa; Viñas, Miguel

    2016-01-01

    The aim was to explore the antimicrobial activity of a synthetic peptide (AMP38) and its synergy with imipenem against imipenem-resistant Pseudomonas aeruginosa. The main mechanism of imipenem resistance is the loss or alteration of protein OprD. Time-kill and minimal biofilm eradication concentration (MBEC) determinations were carried out by using clinical imipenem-resistant strains. AMP38 was markedly synergistic with imipenem when determined in imipenem-resistant P. aeruginosa. MBEC obtained for the combination of AMP38 and imipenem was of 62.5 μg/mL, whereas the MBEC of each antimicrobial separately was 500 μg/mL. AMP38 should be regarded as a promising antimicrobial to fight MDR P. aeruginosa infections. Moreover, killing effect and antibiofilm activity of AMP38 plus imipenem was much higher than that of colistin plus imipenem. PMID:27626405

  9. 8-Chloro-cAMP-related changes on mice uteri.

    PubMed

    Actis, Andrea; Croci, Máximo; Levin, Emanuel; Bergoc, Rosa

    2002-05-22

    Histopathological effects of cAMP analog (8-Chloro-cAMP), tamoxifen, and medroxyprogesterone, alone or combined, upon BALB/c mice uteri are reported. 8-Chloro-cAMP diminished uterine weight, but did not modify its histopathology or estral cycle significantly. Tamoxifen diminished uterine weight showing cystic hyperplasia and an estral cycle arrested at diestrus. Medroxyprogesterone increased uterine weight, caused a swelling of the endometrium and a pseudopregnancy estrus. When combined with 8-Chloro-cAMP, tamoxifen or medroxyprogesterone always had a predominant effect. We concluded that the effects of 8-Chloro-cAMP on mice uteri did not cause significant changes on its histopathology, but diminished its weight.

  10. Control of bacterial exoelectrogenesis by c-AMP-GMP.

    PubMed

    Nelson, James W; Sudarsan, Narasimhan; Phillips, Grace E; Stav, Shira; Lünse, Christina E; McCown, Phillip J; Breaker, Ronald R

    2015-04-28

    Major changes in bacterial physiology including biofilm and spore formation involve signaling by the cyclic dinucleotides c-di-GMP and c-di-AMP. Recently, another second messenger dinucleotide, c-AMP-GMP, was found to control chemotaxis and colonization by Vibrio cholerae. We have identified a superregulon of genes controlled by c-AMP-GMP in numerous Deltaproteobacteria, including Geobacter species that use extracellular insoluble metal oxides as terminal electron acceptors. This exoelectrogenic process has been studied for its possible utility in energy production and bioremediation. Many genes involved in adhesion, pilin formation, and others that are important for exoelectrogenesis are controlled by members of a variant riboswitch class that selectively bind c-AMP-GMP. These RNAs constitute, to our knowledge, the first known specific receptors for c-AMP-GMP and reveal that this molecule is used by many bacteria to control specialized physiological processes.

  11. Long pulse production from short pulses

    DOEpatents

    Toeppen, John S.

    1994-01-01

    A method of producing a long output pulse (SA) from a short pump pulse (P), using an elongated amplified fiber (11) having a doped core (12) that provides an amplifying medium for light of one color when driven into an excited state by light of a shorter wavelength and a surrounding cladding 13. A seed beam (S) of the longer wavelength is injected into the core (12) at one end of the fiber (11) and a pump pulse (P) of the shorter wavelength is injected into the cladding (13) at the other end of the fiber (11). The counter-propagating seed beam (S) and pump pulse (P) will produce an amplified output pulse (SA) having a time duration equal to twice the transit time of the pump pulse (P) through the fiber (11) plus the length of the pump pulse (P).

  12. Long pulse production from short pulses

    DOEpatents

    Toeppen, J.S.

    1994-08-02

    A method of producing a long output pulse from a short pump pulse is disclosed, using an elongated amplified fiber having a doped core that provides an amplifying medium for light of one color when driven into an excited state by light of a shorter wavelength and a surrounding cladding. A seed beam of the longer wavelength is injected into the core at one end of the fiber and a pump pulse of the shorter wavelength is injected into the cladding at the other end of the fiber. The counter-propagating seed beam and pump pulse will produce an amplified output pulse having a time duration equal to twice the transit time of the pump pulse through the fiber plus the length of the pump pulse. 3 figs.

  13. Design of digital hardware system for pulse signals.

    PubMed

    Lee, J; Kim, J; Lee, M

    2001-12-01

    In this study, we have developed the digital hardware system which performs signal processing necessary for the filtering to eliminate noises by inputting pulse wave signals from the sensor group. With a view to obtain clinically effective information, we analyzed structural elements of pulse waveform and, thus, conducted a systematic classification. What is more, we performed the modeling of the digital filter by using the Steiglitz-McBride iteration method in order to get the same results with output signals coming out of an galvanometer of analog type of existing Pulse diagnosis system with input signals entering into galvanometer and coming out of the amp group of the Pulse diagnosis system. PMID:11708398

  14. Phorbol esters modulate cyclic AMP accumulation in porcine thyroid cells

    SciTech Connect

    Emoto, T.; Kasai, K.; Hiraiwa, M.; Shimoda, S.

    1988-01-01

    In cultured porcine thyroid cells, during 60 min incubation phorbol 12-myristate 13-acetate (PMA) had no effect on basal cyclic AMP accumulation and slightly stimulated cyclic AMP accumulation evoked by thyroid stimulating hormone (TSH) or forskolin. Cholera toxin-induced cyclic AMP accumulation was significantly stimulated by PMA. On the other hand, cyclic AMP accumulation evoked by prostaglandin E/sub 1/ or E/sub 2/ (PGE/sub 1/ and PGE/sub 2/) was markedly depressed by simultaneous addition of PMA. These opposing effects of PMA on cyclic AMP accumulation evoked by PGE and cholera toxin were observed in a dose-related fashion, with half-maximal effect of around 10/sup -9/ M in either case. The almost same effects of PMA on cyclic AMP accumulation in basal and stimulated conditions were also observed in freshly prepared thyroid cells. The present study was performed in the presence of phosphodiesterase inhibitor, 3-iso-butyl-1-methylxanthine (IBMX), indicating that PMA affected adenylate cyclase activity. Therefore, it is suggested that PMA may modulate the production of cyclic AMP in response to different stimuli, possibly by affecting several sites in the adenylate cyclase complex in thyroid cells.

  15. Direct activation of cardiac pacemaker channels by intracellular cyclic AMP.

    PubMed

    DiFrancesco, D; Tortora, P

    1991-05-01

    Cyclic AMP acts as a second messenger in the modulation of several ion channels that are typically controlled by a phosphorylation process. In cardiac pacemaker cells, adrenaline and acetylcholine regulate the hyperpolarization-activated current (if), but in opposite ways; this current is involved in the generation and modulation of pacemaker activity. These actions are mediated by cAMP and underlie control of spontaneous rate by neurotransmitters. Whether the cAMP modulation of if is mediated by channel phosphorylation is, however, still unknown. Here we investigate the action of cAMP on if in excised patches of cardiac pacemaker cells and find that cAMP activates if by a mechanism independent of phosphorylation, involving a direct interaction with the channels at their cytoplasmic side. Cyclic AMP activates if by shifting its activation curve to more positive voltages, in agreement with whole-cell results. This is the first evidence of an ion channel whose gating is dually regulated by voltage and direct cAMP binding.

  16. Cyclic AMP-dependent protein kinase activity in Trypanosoma cruzi.

    PubMed Central

    Ulloa, R M; Mesri, E; Esteva, M; Torres, H N; Téllez-Iñón, M T

    1988-01-01

    A cyclic AMP-dependent protein kinase activity from epimastigote forms of Trypanosoma cruzi was characterized. Cytosolic extracts were chromatographed on DEAE-cellulose columns, giving two peaks of kinase activity, which were eluted at 0.15 M- and 0.32 M-NaCl respectively. The second activity peak was stimulated by nanomolar concentrations of cyclic AMP. In addition, a cyclic AMP-binding protein co-eluted with the second kinase activity peak. Cyclic AMP-dependent protein kinase activity was further purified by gel filtration, affinity chromatography on histone-agarose and cyclic AMP-agarose, as well as by chromatography on CM-Sephadex. The enzyme ('holoenzyme') could be partially dissociated into two different components: 'catalytic' and 'regulatory'. The 'regulatory' component had specific binding for cyclic AMP, and it inhibited phosphotransferase activity of the homologous 'catalytic component' or of the 'catalytic subunit' from bovine heart. Cyclic AMP reversed these inhibitions. A 'holoenzyme preparation' was phosphorylated in the absence of exogenous phosphate acceptor and analysed by polyacrylamide-gel electrophoresis. A 56 kDa band was phosphorylated. The same preparation was analysed by Western blotting, by using polyclonal antibodies to the regulatory subunits of protein kinases type I or II. Both antibodies reacted with the 56 kDa band. Images Fig. 7. Fig. 8. PMID:2848508

  17. [cAMP as a regulator of the phototransduction cascade].

    PubMed

    Astakhova, L A; Kapitskiĭ, S V; Govardovskiĭ, V I; Firsov, M L

    2012-11-01

    Until recently, it has generally been believed that cyclic AMP plays an important role in supporting circadian cycles in the vertebrate retina, but does not directly control the photoreceptors' phototransduction cascade. However, the cAMP levels in photoreceptors oscillate during the day/night cycle, and the cAMP turnover in photoreceptors may be light-dependent. Thus it is natural to suggest that the cAMP-dependent protein phosphorylation may be a mechanism of tuning phototransduction to lighting conditions. In the present review, we summarize available information on the structure and operation of the retinal pacemaker, role(s) of cAMP in its functioning, and identified intracellular targets that could be controlled by cAMP. We discuss our recent results that show that cAMP changes do regulate the phototransduction cascade. This regulation may substantially extend the range of photoreceptor's adaptation by increasing its sensitivity at night, and reducing the sensitivity in bright light. PMID:23431758

  18. The Popeye Domain Containing Genes and cAMP Signaling

    PubMed Central

    Brand, Thomas; Poon, Kar Lai; Simrick, Subreena; Schindler, Roland F.R.

    2016-01-01

    3'-5'-cyclic adenosine monophosphate (cAMP) is a second messenger, which plays an important role in the heart. It is generated in response to activation of G-protein-coupled receptors (GPCRs). Initially, it was thought that protein kinase A (PKA) exclusively mediates cAMP-induced cellular responses such as an increase in cardiac contractility, relaxation, and heart rate. With the identification of the exchange factor directly activated by cAMP (EPAC) and hyperpolarizing cyclic nucleotide-gated (HCN) channels as cAMP effector proteins it became clear that a protein network is involved in cAMP signaling. The Popeye domain containing (Popdc) genes encode yet another family of cAMP-binding proteins, which are prominently expressed in the heart. Loss-of-function mutations in mice are associated with cardiac arrhythmia and impaired skeletal muscle regeneration. Interestingly, the cardiac phenotype, which is present in both, Popdc1 and Popdc2 null mutants, is characterized by a stress-induced sinus bradycardia, suggesting that Popdc proteins participate in cAMP signaling in the sinuatrial node. The identification of the two-pore channel TREK-1 and Caveolin 3 as Popdc-interacting proteins represents a first step into understanding the mechanisms of heart rate modulation triggered by Popdc proteins. PMID:27500161

  19. Cyclic AMP negatively regulates prodigiosin production by Serratia marcescens.

    PubMed

    Kalivoda, Eric J; Stella, Nicholas A; Aston, Marissa A; Fender, James E; Thompson, Paul P; Kowalski, Regis P; Shanks, Robert M Q

    2010-03-01

    Many Serratia marcescens strains produce the red pigment prodigiosin, which has antimicrobial and anti-tumor properties. Previous reports suggest that cyclic AMP (cAMP) is a positive regulator of prodigiosin production. Supporting this model, the addition of glucose to growth medium inhibited pigment production in rich and minimal media. Unexpectedly, we observed highly elevated levels of prodigiosin production in isogenic strains with mutations in genes involved in cAMP production (cyaA and crr) and in cAMP-dependent transcriptional signaling (crp). Multicopy expression of the Escherichia coli cAMP-phosphodiesterase gene, cpdA, also conferred a striking increase in prodigiosin production. Exogenous cAMP decreased both pigment production and pigA-lacZ transcription in the wild-type (WT) strain, and pigA-lacZ transcription was significantly increased in a crp mutant relative to WT. Suppressor and epistasis analysis indicate that the hyperpigment phenotype was dependent upon pigment biosynthetic genes (pigA, pigB, pigC, pigD and pigM). These experiments establish cAMP as a negative regulator of prodigiosin production in S. marcescens.

  20. AMP-18 Targets p21 to Maintain Epithelial Homeostasis.

    PubMed

    Chen, Peili; Li, Yan Chun; Toback, F Gary

    2015-01-01

    Dysregulated homeostasis of epithelial cells resulting in disruption of mucosal barrier function is an important pathogenic mechanism in inflammatory bowel diseases (IBD). We have characterized a novel gastric protein, Antrum Mucosal Protein (AMP)-18, that has pleiotropic properties; it is mitogenic, anti-apoptotic and can stimulate formation of tight junctions. A 21-mer synthetic peptide derived from AMP-18 exhibits the same biological functions as the full-length protein and is an effective therapeutic agent in mouse models of IBD. In this study we set out to characterize therapeutic mechanisms and identify molecular targets by which AMP-18 maintains and restores disrupted epithelial homeostasis in cultured intestinal epithelial cells and a mouse model of IBD. Tumor necrosis factor (TNF)-α, a pro-inflammatory cytokine known to mediate gastrointestinal (GI) mucosal injury in IBD, was used to induce intestinal epithelial cell injury, and study the effects of AMP-18 on apoptosis and the cell cycle. An apoptosis array used to search for targets of AMP-18 in cells exposed to TNF-α identified the cyclin-dependent kinase inhibitor p21 WAF1/CIP1. Treatment with AMP-18 blunted increases in p21 expression and apoptosis, while reversing disturbed cell cycle kinetics induced by TNF-α. AMP-18 appears to act through PI3K/AKT pathways to increase p21 phosphorylation, thereby reducing its nuclear accumulation to overcome the antiproliferative effects of TNF-α. In vitamin D receptor-deficient mice with TNBS-induced IBD, the observed increase in p21 expression in colonic epithelial cells was suppressed by treatment with AMP peptide. The results indicate that AMP-18 can maintain and/or restore the homeostatic balance between proliferation and apoptosis in intestinal epithelial cells to protect and repair mucosal barrier homeostasis and function, suggesting a therapeutic role in IBD.

  1. Cyclic AMP inhibits secretion from electroporated human neutrophils.

    PubMed

    Smolen, J E; Stoehr, S J; Kuczynski, B

    1991-02-01

    It has long been known that intracellular cAMP inhibits and cGMP enhances intact neutrophil function. However, these effects are modest and require relatively high concentrations of the cyclic nucleotides. We decided to re-examine the effects of cyclic nucleotides on Ca2(+)-induced secretion by electroporated cells. This system allowed us to bypass normal cell surface receptor-ligand interactions as well as to directly expose the intracellular space to native cyclic nucleotides. We found that concentrations of cAMP as low as 3 microM inhibited Ca2(+)-induced secretion; 30-300 microM cAMP was maximally inhibitory. cAMP was actually slightly more potent than dibutyryl cAMP, a membrane-permeant derivative. In contrast, cGMP was only slightly stimulatory at 3 microM and modestly inhibitory at 300 microM; dibutyryl cGMP was ineffective. A more detailed investigation of the effects of cAMP showed that inhibition was only obtained in the presence of Mg2+. Half-maximal inhibition by cAMP occurred at 10-30 microM. Inhibition by cAMP was achieved by shifting the Ca2+ dose-response curve for secretion to the right; this was observed for the release of both specific granules (vitamin B12 binding protein) and azurophil granules (B-glucuronidase). We previously showed that ATP could enhance Ca2(+)-induced secretion in the presence of Mg2+, apparently by interacting with a cell surface purine receptor. However, increasing concentrations of ATP could not overcome inhibition by cAMP; this suggested that cAMP acted at some site other than the purine receptor. Inhibition by cAMP was also less apparent in the presence of the protein kinase C agonist phorbol myristate acetate (PMA), suggesting that the cyclic nucleotide did not produce systemic desensitization of the neutrophils. In summary, these results demonstrate that low, physiologically relevant concentrations of cAMP can modulate neutrophil responsiveness. PMID:1846904

  2. Multiple Facets of cAMP Signalling and Physiological Impact: cAMP Compartmentalization in the Lung

    PubMed Central

    Oldenburger, Anouk; Maarsingh, Harm; Schmidt, Martina

    2012-01-01

    Therapies involving elevation of the endogenous suppressor cyclic AMP (cAMP) are currently used in the treatment of several chronic inflammatory disorders, including chronic obstructive pulmonary disease (COPD). Characteristics of COPD are airway obstruction, airway inflammation and airway remodelling, processes encompassed by increased airway smooth muscle mass, epithelial changes, goblet cell and submucosal gland hyperplasia. In addition to inflammatory cells, airway smooth muscle cells and (myo)fibroblasts, epithelial cells underpin a variety of key responses in the airways such as inflammatory cytokine release, airway remodelling, mucus hypersecretion and airway barrier function. Cigarette smoke, being next to environmental pollution the main cause of COPD, is believed to cause epithelial hyperpermeability by disrupting the barrier function. Here we will focus on the most recent progress on compartmentalized signalling by cAMP. In addition to G protein-coupled receptors, adenylyl cyclases, cAMP-specific phospho-diesterases (PDEs) maintain compartmentalized cAMP signalling. Intriguingly, spatially discrete cAMP-sensing signalling complexes seem also to involve distinct members of the A-kinase anchoring (AKAP) superfamily and IQ motif containing GTPase activating protein (IQGAPs). In this review, we will highlight the interaction between cAMP and the epithelial barrier to retain proper lung function and to alleviate COPD symptoms and focus on the possible molecular mechanisms involved in this process. Future studies should include the development of cAMP-sensing multiprotein complex specific disruptors and/or stabilizers to orchestrate cellular functions. Compartmentalized cAMP signalling regulates important cellular processes in the lung and may serve as a therapeutic target. PMID:24281338

  3. cAMP Regulation of the lactose operon.

    PubMed

    Szeberenyi, Jozsef

    2004-05-01

    Terms to be familiar with before you start to solve the test: lactose operon, adenylate cyclase, cAMP, catabolite activator protein (CAP), expression plasmid, lac operator, lac repressor, lactose, glucose, promoter, cis- and trans-acting factors. PMID:21706723

  4. Amped Up! - Volume 1, No. 3, May/June 2015

    SciTech Connect

    2015-05-01

    Welcome to the latest issue of our bimonthly newsletter, Amped Up!, highlighting the initiatives, events and technologies in the Office of Energy Efficiency and Renewable Energy that influence change.

  5. DIFFERENTIAL PULSE HEIGHT DISCRIMINATOR

    DOEpatents

    Test, L.D.

    1958-11-11

    Pulse-height discriminators are described, specifically a differential pulse-height discriminator which is adapted to respond to pulses of a band of amplitudes, but to reject pulses of amplitudes greater or less than tbe preselected band. In general, the discriminator includes a vacuum tube having a plurality of grids adapted to cut off plate current in the tube upon the application of sufficient negative voltage. One grid is held below cutoff, while a positive pulse proportional to the amplltude of each pulse is applled to this grid. Another grid has a negative pulse proportional to the amplitude of each pulse simultaneously applied to it. With this arrangement the tube will only pass pulses which are of sufficlent amplitude to counter the cutoff bias but not of sufficlent amplitude to cutoff the tube.

  6. ^amp;+^amp;-p Electroproduction Cross Sections off Protons in the Second Resonance Region

    NASA Astrophysics Data System (ADS)

    Fedotov, Gleb; Gothe, Ralf; Mokeev, Victor

    2013-04-01

    In this talk we present preliminary ^amp;+^amp;-p electroproduction cross sections off protons in the kinematical area of W from 1.4 to 1.8 GeV and Q^2 from 0.4 to 1.1 GeV^2. Our kinematical coverage in part overlap with previous CLAS measurements, but offers more than a factor six finer binning in Q^2. The physics analysis of these data within the framework of the JM model will allow us to determine the electrocouplings and the partial πδ, ρp decay widths of several high lying nucleon resonances S31(1620), S11(1650), F15(1685), D33(1700), P13(1720) and to further explore the evidence for the 3/2^+(1720) candidate-state. Analysis of the single pion electroproduction data measured with CLAS in the aforementioned kinematic region is in progress. Single and charged double pion exclusive channels are major contributors to the meson electroproduction in the N* excitation region with different non-resonant mechanisms. A successful description of all observables in these exclusive channels with consistent N* electrocouplings will offer evidence for the reliable evaluation of these fundamental quantities.

  7. Airborne Multisensor Pod System (AMPS) data management overview

    SciTech Connect

    Wiberg, J.D.; Blough, D.K.; Daugherty, W.R.; Hucks, J.A.; Gerhardstein, L.H.; Meitzler, W.D.; Melton, R.B.; Shoemaker, S.V.

    1994-09-01

    An overview of the Data Management Plan for the Airborne Multisensor Pod System (AMPS) pro-grain is provided in this document. The Pacific Northwest Laboratory (PNL) has been assigned the responsibility of data management for the program, which includes defining procedures for data management and data quality assessment. Data management is defined as the process of planning, acquiring, organizing, qualifying and disseminating data. The AMPS program was established by the U.S. Department of Energy (DOE), Office of Arms Control and Non-Proliferation (DOE/AN) and is integrated into the overall DOE AN-10.1 technology development program. Sensors used for collecting the data were developed under the on-site inspection, effluence analysis, and standoff sensor program, the AMPS program interacts with other technology programs of DOE/NN-20. This research will be conducted by both government and private industry. AMPS is a research and development program, and it is not intended for operational deployment, although the sensors and techniques developed could be used in follow-on operational systems. For a complete description of the AMPS program, see {open_quotes}Airborne Multisensor Pod System (AMPS) Program Plan{close_quotes}. The primary purpose of the AMPS is to collect high-quality multisensor data to be used in data fusion research to reduce interpretation problems associated with data overload and to derive better information than can be derived from any single sensor. To collect the data for the program, three wing-mounted pods containing instruments with sensors for collecting data will be flight certified on a U.S. Navy RP-3A aircraft. Secondary objectives of the AMPS program are sensor development and technology demonstration. Pod system integrators and instrument developers will be interested in the performance of their deployed sensors and their supporting data acquisition equipment.

  8. Amp Synthesis in Aqueous Solution of Adenosine and Phosphorus Pentoxide

    NASA Astrophysics Data System (ADS)

    Yamagata, Y.; Kojima, H.; Ejiri, K.; Inomata, K.

    1982-12-01

    Possible formation of a P4O10 molecule in magma, the stability of the molecule in hydrous volcanic gas at high temperatures and a possible prebiotic phosphate cycle were discussed in relation to chemical evolution. To demonstrate the utility of phosphorus pentoxide as a phosphorylating agent, aqueous solutions of adenosine (0.02M) and phosphorus pentoxide (0.2M) were incubated at 37°C for 5 months. The pH of the solutions was adjusted every day or every few days to each fixed value (9.0, 10.5, 11.5, 12.5) with 10 N NaOH. The HPLC analysis showed the formation of 2'-AMP, 3'-AMP, 5'-AMP, cyclic (2' 3')-AMP and cyclic (3' 5')-AMP. The main components of the products were 2'- and 3'-AMP, though cyclic (2' 3')-AMP was the main component in the early period of the incubation at pH 9.0. The yields (conversion rate of adenosine to AMPs) were increased almost linearly with the incubation time for 5 months in the case of pH 9.0. The final yields were about 3% (pH 9.0), 6% (pH 9.0, 1 M NaCl), 5% (pH 9.0, 0.01 M CaCl2, 0.01 M MgCl2), 7% (pH 9.0, 0.5 M NaCl, 0.01 M CaCl2, 0.01 M MgCl2), 9% (pH 9.0, 1 M NaCl, 0.01 M CaCl2, 0.01 M MgCl2), 32% (pH 10.5), 43% (pH 11.5), 35% (pH 12.5).

  9. Why Ampère did not discover electromagnetic induction

    NASA Astrophysics Data System (ADS)

    Williams, L. Pearce

    1986-04-01

    In 1832, after Michael Faraday had announced his discovery of electromagnetic induction, Andre-Marie Ampère claimed that he had actually discovered the induction of one current by another in 1822. In fact, he had, but did not really publish the fact at that time. This article explores the reasons for Ampère's failure to lay claim to a discovery that would have guaranteed him scientific immortality.

  10. Bacterial Cyclic AMP-Phosphodiesterase Activity Coordinates Biofilm Formation

    PubMed Central

    Kalivoda, Eric J.; Brothers, Kimberly M.; Stella, Nicholas A.; Schmitt, Matthew J.; Shanks, Robert M. Q.

    2013-01-01

    Biofilm-related infections are a major contributor to human disease, and the capacity for surface attachment and biofilm formation are key attributes for the pathogenesis of microbes. Serratia marcescens type I fimbriae-dependent biofilms are coordinated by the adenylate cyclase, CyaA, and the cyclic 3′,5′-adenosine monophosphate (cAMP)-cAMP receptor protein (CRP) complex. This study uses S. marcescens as a model system to test the role of cAMP-phosphodiesterase activity in controlling biofilm formation. Herein we describe the characterization of a putative S. marcescens cAMP-phosphodiesterase gene (SMA3506), designated as cpdS, and demonstrated to be a functional cAMP-phosphodiesterase both in vitro and in vivo. Deletion of cpdS resulted in defective biofilm formation and reduced type I fimbriae production, whereas multicopy expression of cpdS conferred a type I fimbriae-dependent hyper-biofilm. Together, these results support a model in which bacterial cAMP-phosphodiesterase activity modulates biofilm formation. PMID:23923059

  11. Activation of AMP-kinase by Policosanol Requires Peroxisomal Metabolism

    PubMed Central

    Banerjee, Subhashis; Ghoshal, Sarbani

    2011-01-01

    Policosanol, a well-defined mixture of very long chain primary alcohols that is available as a nutraceutical product, has been reported to lower blood cholesterol levels. The present studies demonstrate that policosanol promotes the phosphorylation of AMP-kinase and HMG-CoA reductase in hepatoma cells and in mouse liver after intragastric administration, providing a possible means by which policosanol might lower blood cholesterol levels. Treatment of hepatoma cells with policosanol produced a 2.5-fold or greater increase in the phosphorylation of AMP-kinase and HMG-CoA reductase, and increased the phosphorylation of Ca++/calmodulin-dependent kinase kinase (CaMKK), an upstream AMP-kinase kinase. Intra-gastric administration of policosanol to mice similarly increased the phosphorylation of hepatic HMG-CoA reductase and AMP-kinase by greater than 2-fold. siRNA-mediated suppression of fatty aldehyde dehydrogenase, fatty acyl-CoA synthetase 4, and acyl-CoA acetyltransferase expression in hepatoma cells prevented the phosphorylation of AMP-kinase and HMG-CoA reductase by policosanol, indicating that metabolism of these very long chain alcohols to activated fatty acids is necessary for the suppression of cholesterol synthesis, presumably by increasing cellular AMP levels. Subsequent peroxisomal β-oxidation probably augments this effect. PMID:21359855

  12. MEK Inhibitors Reverse cAMP-Mediated Anxiety in Zebrafish

    PubMed Central

    Lundegaard, Pia R.; Anastasaki, Corina; Grant, Nicola J.; Sillito, Rowland R.; Zich, Judith; Zeng, Zhiqiang; Paranthaman, Karthika; Larsen, Anders Peter; Armstrong, J. Douglas; Porteous, David J.; Patton, E. Elizabeth

    2015-01-01

    Summary Altered phosphodiesterase (PDE)-cyclic AMP (cAMP) activity is frequently associated with anxiety disorders, but current therapies act by reducing neuronal excitability rather than targeting PDE-cAMP-mediated signaling pathways. Here, we report the novel repositioning of anti-cancer MEK inhibitors as anxiolytics in a zebrafish model of anxiety-like behaviors. PDE inhibitors or activators of adenylate cyclase cause behaviors consistent with anxiety in larvae and adult zebrafish. Small-molecule screening identifies MEK inhibitors as potent suppressors of cAMP anxiety behaviors in both larvae and adult zebrafish, while causing no anxiolytic behavioral effects on their own. The mechanism underlying cAMP-induced anxiety is via crosstalk to activation of the RAS-MAPK signaling pathway. We propose that targeting crosstalk signaling pathways can be an effective strategy for mental health disorders, and advance the repositioning of MEK inhibitors as behavior stabilizers in the context of increased cAMP. PMID:26388333

  13. Laser pulse stacking method

    DOEpatents

    Moses, E.I.

    1992-12-01

    A laser pulse stacking method is disclosed. A problem with the prior art has been the generation of a series of laser beam pulses where the outer and inner regions of the beams are generated so as to form radially non-synchronous pulses. Such pulses thus have a non-uniform cross-sectional area with respect to the outer and inner edges of the pulses. The present invention provides a solution by combining the temporally non-uniform pulses in a stacking effect to thus provide a more uniform temporal synchronism over the beam diameter. 2 figs.

  14. Nerve-pulse interactions

    SciTech Connect

    Scott, A.C.

    1982-01-01

    Some recent experimental and theoretical results on mechanisms through which individual nerve pulses can interact are reviewed. Three modes of interactions are considered: (1) interaction of pulses as they travel along a single fiber which leads to velocity dispersion; (2) propagation of pairs of pulses through a branching region leading to quantum pulse code transformations; and (3) interaction of pulses on parallel fibers through which they may form a pulse assembly. This notion is analogous to Hebb's concept of a cell assembly, but on a lower level of the neural hierarchy.

  15. Prevalence and molecular epidemiology of acquired AmpC β-lactamases and carbapenemases in Enterobacteriaceae isolates from 35 hospitals in Spain.

    PubMed

    Miró, E; Agüero, J; Larrosa, M N; Fernández, A; Conejo, M C; Bou, G; González-López, J J; Lara, N; Martínez-Martínez, L; Oliver, A; Aracil, B; Oteo, J; Pascual, A; Rodríguez-Baño, J; Zamorano, L; Navarro, F

    2013-02-01

    The purpose of this investigation was to determine the prevalence of plasmid-mediated AmpC (pAmpC) and carbapenemases in Enterobacteriaceae collected from 35 hospitals in Spain and to establish their epidemiological relationships. We conducted a prospective multi-centre study on pAmpC- or carbapenemase-producing Enterobacteriaceae isolates from clinical samples collected from February to July 2009. The strains suspected to carry pAmpC were resistant or showed intermediate susceptibility to co-amoxiclav and second- or third-generation cephalosporins. Strains suspected to carry a carbapenemase were selected because they showed a minimum inhibitory concentration (MIC) to imipenem >1 mg/L. Polymerase chain reaction (PCR) and a sequencing strategy were used to characterise the enzymes. The clonal relationships between isolates was analysed by pulsed field gel electrophoresis (PFGE). Among 100,132 Enterobacteriaceae isolates collected, 1,654 were compatible with the production of pAmpC or carbapenemases. We found a prevalence of 0.64 % of pAmpC (n = 635) and 0.04 % of carbapenemases (n = 43). The most prevalent pAmpC enzymes were CMY-type (78.3 %), DHA-type (19.5 %), ACC-type (1.6 %) and FOX-type (0.6 %). The CMY-type was the most frequent in Escherichia coli and Proteus mirabilis species, whereas the DHA-type was mainly found in Klebsiella spp. The enzymes involved in carbapenem resistance were VIM-1, IMP-22 and the new IMP-28. Nine new bla genes were described: bla (CMY-54), bla (CMY-55), bla (CMY-56), bla (CMY-57), bla (CMY-96), bla (DHA-6), bla (DHA-7), bla (FOX-8) and bla (IMP-28). The prevalence of pAmpC or carbapenemases found is not negligible. The CMY-types were the predominant pAmpC, whereas the VIM or IMP enzymes were the predominant carbapenemases. Furthermore, we observed a great genetic diversity among pAmpC-producing strains and a close clonal relationship between carbapenemase-producing strains. PMID:22956023

  16. Pulse to pulse klystron diagnosis system

    SciTech Connect

    Nowak, J.; Davidson, V.; Genova, L.; Johnson, R.; Reagan, D.

    1981-03-01

    This report describes a system used to study the behavior of SLAC high powered klystrons operating with a twice normal pulse width of 5 ..mu..s. At present, up to eight of the klystrons installed along the accelerator can be operated with long pulses and monitored by this system. The report will also discuss some of the recent findings and investigations.

  17. The Search for a π1(1400) Exotic Meson in the γp->^amp;++η^amp;- System

    NASA Astrophysics Data System (ADS)

    Schott, Diane

    2013-04-01

    Over twenty years ago QCD-inspired models of hadronic states suggested the existence of mesons beyond the Naive Quark Model (NQM), which motivated a rigorous search for exotic mesons. The lightest of these states is the π1(1400) decaying to η^amp;- observed by experiment E852 at Brookhaven and the VES collaboration at IHEP. Photoproduction is predicted to favor production of a J^PC=1^-+ gluonic excitation resulting in the increase of the ratio of π1 to a2 mesons. A Partial Wave Analysis was conducted on the reaction γp->^amp;++X->p^amp;+^amp;-(η), using the ^amp;++ to select the pion exchange. The analysis has shown the final spectra of the resonance decaying to η^amp;- to be dominated by the quantum state of J^PC=2^++ corresponding to the presence of the a2(1320). The J^PC=1^-+ state, shows no structure in the intensity distribution. The phase difference between the J^PC=1^-+ and J^PC=2^++ amplitudes show the interference between the two states. This is the first spin-parity analysis of the ηπ final state in photoproduction.

  18. Effect of positive pulse charge waveforms on the energy efficiency of lead-acid traction cells

    NASA Technical Reports Server (NTRS)

    Smithrick, J. J.

    1981-01-01

    The effects of four different charge methods on the energy conversion efficiency of 300 ampere hour lead acid traction cells were investigated. Three of the methods were positive pulse charge waveforms; the fourth, a constant current method, was used as a baseline of comparison. The positive pulse charge waveforms were: 120 Hz full wave rectified sinusoidal; 120 Hz silicon controlled rectified; and 1 kHz square wave. The constant current charger was set at the time average pulse current of each pulse waveform, which was 150 amps. The energy efficiency does not include charger losses. The lead acid traction cells were charged to 70 percent of rated ampere hour capacity in each case. The results of charging the cells using the three different pulse charge waveforms indicate there was no significant difference in energy conversion efficiency when compared to constant current charging at the time average pulse current value.

  19. Few cycle optical pulse studies of the transition state process in myoglobin

    NASA Astrophysics Data System (ADS)

    Armstrong, Michael Robert

    Requisite to the detection of high frequency nuclear motions in biological molecules presented in this work was the development of very stable high power amplified laser systems and a reliable method to accurately manipulate the phase of broadband, ultrashort pulses. These systems include a novel two-head laser design providing up to 25 W of TEM00 output and a unique compressed disk design which produces up to 20 W of TEM00 output. The compressed disk design in particular represents a fundamental advance in the development of high power, high beam quality laser design and has the potential to scale to greater than 50 W output power. Also presented are the details of the development and construction of a versatile, sub-10 fs pulse generation and phase manipulation technique. This technique includes the generation of very broadband (as much as 150 nm) 150 fs duration visible pulses via noncollinear optical parametric amplification. These broadband pulses are then compressed to 7 fs pulse duration in a compact, glassless combination of static negatively chirped mirrors and a zero dispersion stretcher with a deformable mirror at the focal plane for the manipulation of the spectral phase. These ultrashort pulses are then used to investigate with very high resolution the early time dynamics of deoxyand carboxymyoglobin after the photoinitiated dissociation of the carbonmonoxide ligand. Using time domain pump-probe spectroscopy, we observe known oscillations of the heme in the MbCO photoproduct at frequencies corresponding to the deoxyMb species, indicating that these oscillations are driven by the dissociation event, not field driven wavepacket propagation due to Raman prepared ground state vibrational motion of MbCO. Furthermore, we measure the phase of these oscillations and find it to be consistent with a very fast (with 20--30 fs) crossing from the excited state of MbCO to the photoproduct ground state deoxyMb, with strong channeling of the excited state wavepacket

  20. Constant potential pulse polarography

    USGS Publications Warehouse

    Christie, J.H.; Jackson, L.L.; Osteryoung, R.A.

    1976-01-01

    The new technique of constant potential pulse polarography, In which all pulses are to be the same potential, is presented theoretically and evaluated experimentally. The response obtained is in the form of a faradaic current wave superimposed on a constant capacitative component. Results obtained with a computer-controlled system exhibit a capillary response current similar to that observed In normal pulse polarography. Calibration curves for Pb obtained using a modified commercial pulse polarographic instrument are in good accord with theoretical predictions.

  1. Alternate drop pulse polarography

    USGS Publications Warehouse

    Christie, J.H.; Jackson, L.L.; Osteryoung, R.A.

    1976-01-01

    The new technique of alternate drop pulse polarography is presented. An experimental evaluation of alternate drop pulse polarography shows complete compensation of the capacitative background due to drop expansion. The capillary response phenomenon was studied in the absence of faradaic reaction and the capillary response current was found to depend on the pulse width to the -0.72 power. Increased signal-to-noise ratios were obtained using alternate drop pulse polarography at shorter drop times.

  2. Optically pulsed electron accelerator

    DOEpatents

    Fraser, John S.; Sheffield, Richard L.

    1987-01-01

    An optically pulsed electron accelerator can be used as an injector for a free electron laser and comprises a pulsed light source, such as a laser, for providing discrete incident light pulses. A photoemissive electron source emits electron bursts having the same duration as the incident light pulses when impinged upon by same. The photoemissive electron source is located on an inside wall of a radio frequency powered accelerator cell which accelerates the electron burst emitted by the photoemissive electron source.

  3. Optically pulsed electron accelerator

    DOEpatents

    Fraser, J.S.; Sheffield, R.L.

    1985-05-20

    An optically pulsed electron accelerator can be used as an injector for a free electron laser and comprises a pulsed light source, such as a laser, for providing discrete incident light pulses. A photoemissive electron source emits electron bursts having the same duration as the incident light pulses when impinged upon by same. The photoemissive electron source is located on an inside wall of a radiofrequency-powered accelerator cell which accelerates the electron burst emitted by the photoemissive electron source.

  4. Electrical pulse generator

    DOEpatents

    Norris, Neil J.

    1979-01-01

    A technique for generating high-voltage, wide dynamic range, shaped electrical pulses in the nanosecond range. Two transmission lines are coupled together by resistive elements distributed along the length of the lines. The conductance of each coupling resistive element as a function of its position along the line is selected to produce the desired pulse shape in the output line when an easily produced pulse, such as a step function pulse, is applied to the input line.

  5. Cyclic Di-AMP Homeostasis in Bacillus subtilis

    PubMed Central

    Mehne, Felix M. P.; Gunka, Katrin; Eilers, Hinnerk; Herzberg, Christina; Kaever, Volkhard; Stülke, Jörg

    2013-01-01

    The genome of the Gram-positive soil bacterium Bacillus subtilis encodes three potential diadenylate cyclases that may synthesize the signaling nucleotide cyclic di-AMP (c-di-AMP). These enzymes are expressed under different conditions in different cell compartments, and they localize to distinct positions in the cell. Here we demonstrate the diadenylate cyclase activity of the so far uncharacterized enzymes CdaA (previously known as YbbP) and CdaS (YojJ). Our work confirms that c-di-AMP is essential for the growth of B. subtilis and shows that an excess of the molecule is also harmful for the bacteria. Several lines of evidence suggest that the diadenylate cyclase CdaA is part of the conserved essential cda-glm module involved in cell wall metabolism. In contrast, the CdaS enzyme seems to provide c-di-AMP for spores. Accumulation of large amounts of c-di-AMP impairs the growth of B. subtilis and results in the formation of aberrant curly cells. This phenotype can be partially suppressed by elevated concentrations of magnesium. These observations suggest that c-di-AMP interferes with the peptidoglycan synthesis machinery. The activity of the diadenylate cyclases is controlled by distinct molecular mechanisms. CdaA is stimulated by a regulatory interaction with the CdaR (YbbR) protein. In contrast, the activity of CdaS seems to be intrinsically restricted, and a single amino acid substitution is sufficient to drastically increase the activity of the enzyme. Taken together, our results support the idea of an important role for c-di-AMP in B. subtilis and suggest that the levels of the nucleotide have to be tightly controlled. PMID:23192352

  6. Intraoperative urinary cyclic AMP monitoring in primary hyperparathyroidism.

    PubMed Central

    Schenk, W G; Wills, M; MacLeod, M S; Hanks, J B

    1993-01-01

    OBJECTIVE: This study examined the utility of intraoperative urinary cyclic 3'5' adenosine monophosphate (UcAMP), an indicator of parathyroid (PTH) hormone end-organ activity, as a "biochemical frozen section," signaling the real-time resolution of PTH hyperactivity during surgery for primary hyperparathyroidism. SUMMARY BACKGROUND DATA: The unsuccessful initial neck exploration for primary hyperparathyroidism, leaving the patient with persistent hyperfunctioning parathyroid tissue, results in part from the surgeon's inability intraoperatively to correlate a gland's gross appearance and size estimation with physiologic function. Preoperative imaging, intraoperative imaging, and intraoperative histologic/cytologic surveillance have not resolved this dilemma. METHODS: Twenty-seven patients underwent a prospective intraoperative UcAMP monitoring protocol. The patients all had a clinical diagnosis of primary hyperparathyroidism and an average preoperative serum calcium of 12.0 +/- 0.3 mg/dl. UcAMP was assayed intraoperatively using 20-minute nonequilibrium radioimmunoassay providing real-time feedback to the operating team. RESULTS: All patients had an elevated UcAMP confirming PTh hyperactivity at the beginning of the procedure. One patient, subsequently found to have an supernumerary ectopic adenoma, had four normal glands identified intraoperatively, and his intraoperative UcAMP values corroborated persistent hyperparathyroidism, the UcAMP of the remaining 26 patients decreased from 7.0 +/- 1.1 to 2.7 +/- 0.7 nm.dl GF (p < .00005) after complete adenoma excision, and they remain normocalcemic. The protocol provided useful and relevant information to the operating team, and aided in surgical decision-making, in 10 of the 27 cases (37%). CONCLUSION: Intraoperative biochemical surveillance with ucAMP monitoring reliably signals resolution of PTH hyperfunction. It is a useful adjunct to the surgeon's skill, judgment, and experience in parathyroid surgery. PMID:8387765

  7. Design of a 50 TW/20 J chirped-Pulse Amplification Laser for High-Energy-Density Plasma Physics Experiments at the Nevada Terawatt Facility of the University of Nevada

    SciTech Connect

    Erlandson, A C; Astanovitskiy, A; Batie, S; Bauer, B; Bayramian, A; Caird, J A; Cowan, T; Ebbers, C; Fuchs, J; Faretto, H; Glassman, J; Ivanov, V; LeGalloudec, B; LeGalloudec, N; Letzring, S; Payne, S; Stuart, B

    2003-09-07

    We have developed a conceptual design for a 50 TW/20 J short-pulse laser for performing high-energy-density plasma physics experiments at the Nevada Terawatt Facility of the University of Nevada, Reno. The purpose of the laser is to develop proton and x-ray radiography techniques, to use these techniques to study z-pinch plasmas, and to study deposition of intense laser energy into both magnetized and unmagnetized plasmas. Our design uses a commercial diode-pumped Nd:glass oscillator to generate 3-nJ. 200-fs mode-locked pulses at 1059 m. An all-reflective grating stretcher increases pulse duration to 1.1 ns. A two-stage chirped-pulse optical parametric amplifier (OPCPA) using BBO crystals boosts pulse energy to 12 mJ. A chain using mixed silicate-phosphate Nd:glass increases pulse energy to 85 J while narrowing bandwidth to 7.4 nm (FWHM). About 50 J is split off to the laser target chamber to generate plasma while the remaining energy is directed to a roof-mirror pulse compressor, where two 21 cm x 42 cm gold gratings recompress pulses to {approx}350 fs. A 30-cm-focal-length off-axis parabolic reflector (OAP) focuses {approx}20 J onto target, producing an irradiance of 10{sup 19} W/cm{sup 2} in a 10-{micro}m-diameter spot. This paper describes planned plasma experiments, system performance requirements, the laser design, and the target area design.

  8. Hybrid chirped pulse amplification system

    DOEpatents

    Barty, Christopher P.; Jovanovic, Igor

    2005-03-29

    A hybrid chirped pulse amplification system wherein a short-pulse oscillator generates an oscillator pulse. The oscillator pulse is stretched to produce a stretched oscillator seed pulse. A pump laser generates a pump laser pulse. The stretched oscillator seed pulse and the pump laser pulse are directed into an optical parametric amplifier producing an optical parametric amplifier output amplified signal pulse and an optical parametric amplifier output unconverted pump pulse. The optical parametric amplifier output amplified signal pulse and the optical parametric amplifier output laser pulse are directed into a laser amplifier producing a laser amplifier output pulse. The laser amplifier output pulse is compressed to produce a recompressed hybrid chirped pulse amplification pulse.

  9. Stress pulse phenomena

    SciTech Connect

    McGlaun, M.

    1993-08-01

    This paper is an introductory discussion of stress pulse phenomena in simple solids and fluids. Stress pulse phenomena is a very rich and complex field that has been studied by many scientists and engineers. This paper describes the behavior of stress pulses in idealized materials. Inviscid fluids and simple solids are realistic enough to illustrate the basic behavior of stress pulses. Sections 2 through 8 deal with the behavior of pressure pulses. Pressure is best thought of as the average stress at a point. Section 9 deals with shear stresses which are most important in studying solids.

  10. Laser fusion pulse shape controller

    DOEpatents

    Siebert, Larry D.

    1977-01-01

    An apparatus for controlling the pulse shape, i.e., the pulse duration and intensity pattern, of a pulsed laser system, and which is particularly well adapted for controlling the pellet ignition pulse in a laser-driven fusion reaction system. The apparatus comprises a laser generator for providing an optical control pulse of the shape desired, a pulsed laser triggered by the control pulse, and a plurality of optical Kerr-effect gates serially disposed at the output of the pulsed laser and selectively triggered by the control pulse to pass only a portion of the pulsed laser output generally corresponding in shape to the control pulse.

  11. Profound Asymmetry in the Structure of the cAMP-free cAMP Receptor Protein (CRP) from Mycobacterium tuberculosis

    SciTech Connect

    Gallagher, D.; Smith, N; Kim, S; Robinson, H; Reddy, P

    2009-01-01

    The cyclic AMP receptor protein (CRP, also called catabolite gene activator protein or CAP) plays a key role in metabolic regulation in bacteria and has become a widely studied model allosteric transcription factor. On binding its effector cAMP in the N-terminal domain, CRP undergoes a structural transition to a conformation capable of specific DNA binding in the C-terminal domain and transcription initiation. The crystal structures of Escherichia coli CRP (EcCRP) in the cAMP-bound state, both with and without DNA, are known, although its structure in the off state (cAMP-free, apoCRP) remains unknown. We describe the crystal structure at 2.0A resolution of the cAMP-free CRP homodimer from Mycobacterium tuberculosis H37Rv (MtbCRP), whose sequence is 30% identical with EcCRP, as the first reported structure of an off-state CRP. The overall structure is similar to that seen for the cAMP-bound EcCRP, but the apo MtbCRP homodimer displays a unique level of asymmetry, with a root mean square deviation of 3.5A between all C? positions in the two subunits. Unlike structures of on-state EcCRP and other homologs in which the C-domains are asymmetrically positioned but possess the same internal conformation, the two C-domains of apo MtbCRP differ both in hinge structure and in internal arrangement, with numerous residues that have completely different local environments and hydrogen bond interactions, especially in the hinge and DNA-binding regions. Comparison of the structures of apo MtbCRP and DNA-bound EcCRP shows how DNA binding would be inhibited in the absence of cAMP and supports a mechanism involving functional asymmetry in apoCRP.

  12. PULSE DURATION LENGTHENER

    DOEpatents

    Aiken, W.R.

    1958-02-01

    This patent pertains to pulse modifying apparatus and, more particularly, describes a device to provide a rise time and time base expander for signal pulses having a very short duration. The basic element of the device is a vacuum tube comprising a charged particie beam, grid control means, an accelerating electrode, a drift tube, and a collector electrode. As the short duration input pulse modulates the particle beam through the grid control means, the voltage between the drift tube and accelerating electrode is caused to vary, whereby the output signal from the collector is a pulse having longer rise time, expanded duration and proportionate characteristics of the original pulse. The invention is particuiarly useful where subsequent pulse circultry does not have the frequency bandwidth to handle the short duration pulse without distorting it.

  13. ELECTRICAL PULSE COUNTER APPARATUS

    DOEpatents

    Kaufman, W.M.; Jeeves, T.A.

    1962-09-01

    A progressive electrical pulse counter circuit rs designed for the counting of a chain of input pulses. The circuit employs a series of direct connected bistable counting stages simultaneously pulsed by each input pulse and a delay means connected between each of the stages. Each bistable stage has two d-c operative states, which stage, when in its initial state, prevents the next succeeding stage from changing its condition when the latter stage is pulsed. Since the delay circuits between the stages prevents the immediate decay of the d-c state of each stage when the stages are pulsed, only one stage will change its state for each input pulse, thereby providing progressive stage-by-stage counting. (AEC)

  14. Intracellular tortuosity underlies slow cAMP diffusion in adult ventricular myocytes

    PubMed Central

    Richards, Mark; Lomas, Oliver; Jalink, Kees; Ford, Kerrie L.; Vaughan-Jones, Richard D.; Lefkimmiatis, Konstantinos; Swietach, Pawel

    2016-01-01

    Aims 3′,5′-Cyclic adenosine monophosphate (cAMP) signals in the heart are often confined to concentration microdomains shaped by cAMP diffusion and enzymatic degradation. While the importance of phosphodiesterases (degradative enzymes) in sculpting cAMP microdomains is well established in cardiomyocytes, less is known about cAMP diffusivity (DcAMP) and factors affecting it. Many earlier studies have reported fast diffusivity, which argues against sharply defined microdomains. Methods and results [cAMP] dynamics in the cytoplasm of adult rat ventricular myocytes were imaged using a fourth generation genetically encoded FRET-based sensor. The [cAMP]-response to the addition and removal of isoproterenol (β-adrenoceptor agonist) quantified the rates of cAMP synthesis and degradation. To obtain a read out of DcAMP, a stable [cAMP] gradient was generated using a microfluidic device which delivered agonist to one half of the myocyte only. After accounting for phosphodiesterase activity, DcAMP was calculated to be 32 µm2/s; an order of magnitude lower than in water. Diffusivity was independent of the amount of cAMP produced. Saturating cAMP-binding sites with the analogue 6-Bnz-cAMP did not accelerate DcAMP, arguing against a role of buffering in restricting cAMP mobility. cAMP diffused at a comparable rate to chemically unrelated but similar sized molecules, arguing for a common physical cause of restricted diffusivity. Lower mitochondrial density and order in neonatal cardiac myocytes allowed for faster diffusion, demonstrating the importance of mitochondria as physical barriers to cAMP mobility. Conclusion In adult cardiac myocytes, tortuosity due to physical barriers, notably mitochondria, restricts cAMP diffusion to levels that are more compatible with microdomain signalling. PMID:27089919

  15. Toxoplasma gondii Cyclic AMP-Dependent Protein Kinase Subunit 3 Is Involved in the Switch from Tachyzoite to Bradyzoite Development

    PubMed Central

    Sugi, Tatsuki; Ma, Yan Fen; Tomita, Tadakimi; Murakoshi, Fumi; Eaton, Michael S.; Yakubu, Rama; Han, Bing; Tu, Vincent; Kato, Kentaro; Kawazu, Shin-Ichiro; Gupta, Nishith; Suvorova, Elena S.; White, Michael W.; Kim, Kami

    2016-01-01

    ABSTRACT Toxoplasma gondii is an obligate intracellular apicomplexan parasite that infects warm-blooded vertebrates, including humans. Asexual reproduction in T. gondii allows it to switch between the rapidly replicating tachyzoite and quiescent bradyzoite life cycle stages. A transient cyclic AMP (cAMP) pulse promotes bradyzoite differentiation, whereas a prolonged elevation of cAMP inhibits this process. We investigated the mechanism(s) by which differential modulation of cAMP exerts a bidirectional effect on parasite differentiation. There are three protein kinase A (PKA) catalytic subunits (TgPKAc1 to -3) expressed in T. gondii. Unlike TgPKAc1 and TgPKAc2, which are conserved in the phylum Apicomplexa, TgPKAc3 appears evolutionarily divergent and specific to coccidian parasites. TgPKAc1 and TgPKAc2 are distributed in the cytomembranes, whereas TgPKAc3 resides in the cytosol. TgPKAc3 was genetically ablated in a type II cyst-forming strain of T. gondii (PruΔku80Δhxgprt) and in a type I strain (RHΔku80Δhxgprt), which typically does not form cysts. The Δpkac3 mutant exhibited slower growth than the parental and complemented strains, which correlated with a higher basal rate of tachyzoite-to-bradyzoite differentiation. 3-Isobutyl-1-methylxanthine (IBMX) treatment, which elevates cAMP levels, maintained wild-type parasites as tachyzoites under bradyzoite induction culture conditions (pH 8.2/low CO2), whereas the Δpkac3 mutant failed to respond to the treatment. This suggests that TgPKAc3 is the factor responsible for the cAMP-dependent tachyzoite maintenance. In addition, the Δpkac3 mutant had a defect in the production of brain cysts in vivo, suggesting that a substrate of TgPKAc3 is probably involved in the persistence of this parasite in the intermediate host animals. PMID:27247232

  16. Cyclic AMP, a nonessential regulator of the cell cycle.

    PubMed Central

    Coffino, P; Gray, J W; Tomkins, G M

    1975-01-01

    Flow-microfluorimetric analysis has been carried out on populations of exponentially growing S49 mouse lymphoma cells treated with dibutyryl cyclic AMP. The drug produces a specific concentration-dependent block in the G-1 phase of the cell cycle while other phases of the cycle are not perceptibly altered. The cell cycle of a line of mutant cells lacking the cyclic AMP-dependent protein kinase is not affected by the drug. Since these mutant cells have been shown to maintain a normal cell cycle, even in the presence of high levels of cyclic AMP, periodic fluctuations in the levels of the cyclic nucleotide cannot be required for or determine progression through the cell cycle. PMID:165491

  17. cAMP Sensor EPAC Proteins and Energy Homeostasis

    PubMed Central

    Almahariq, Muayad; Mei, Fang C.; Cheng, Xiaodong

    2013-01-01

    The pleotropic second messenger cAMP plays a critical role in mediating the effects of various hormones on metabolism. The major intracellular functions of cAMP are transduced by protein kinase A (PKA) and exchange proteins directly activated by cAMP (EPACs). The latter act as guanine nucleotide exchange factors for the RAS-like small G-proteins Rap1 and Rap2. While the role of PKA in regulating energy balance has been extensively studied, EPACs’ impact remains relatively enigmatic. This review summarizes recent genetic and pharmacological studies concerning EPACs’ involvement in glucose homeostasis and energy balance, through regulation of leptin and insulin signaling pathways. Additionally, the development of small molecule EPAC-specific modulators and their therapeutic potential for the treatment of diabetes and obesity are discussed. PMID:24231725

  18. Cyclic AMP system in muscle tissue during prolonged hypokinesia

    NASA Technical Reports Server (NTRS)

    Antipenko, Y. A.; Bubeyev, Y. A.; Korovkin, B. F.; Mikhaleva, N. P.

    1980-01-01

    Components of the cyclic Adenosine-cyclic-35-monophosphate (AMP) system in the muscle tissue of white rats were studied during 70-75 days of hypokinesia, created by placing the animals in small booths which restricted their movements, and during the readaptation period. In the initial period, cyclic AMP levels and the activities of phosphodiesterase and adenylate cyclase in muscle tissue were increased. The values for these indices were roughly equal for controls and experimental animals during the adaptation period, but on the 70th day of the experiment cAMP levels dropped, phosphodiesterase activity increased, and the stimulative effect of epinephrine on the activity of adenylate cyclase decreased. The indices under study normalized during the readaptation period.

  19. Transcriptomic analysis of cyclic AMP response in bovine cumulus cells.

    PubMed

    Khan, D R; Guillemette, C; Sirard, M A; Richard, F J

    2015-09-01

    Acquisition of oocyte developmental competence needs to be understood to improve clinical outcomes of assisted reproduction. The stimulation of cumulus cell concentration of cyclic adenosine 3'5'-monophosphate (cAMP) by pharmacological agents during in vitro maturation (IVM) participates in improvement of oocyte quality. However, precise coordination and downstream targets of cAMP signaling in cumulus cells are largely unknown. We have previously demonstrated better embryo development after cAMP stimulation for first 6 h during IVM. Using this model, we investigated cAMP signaling in cumulus cells through in vitro culture of cumulus-oocyte complexes (COCs) in the presence of cAMP raising agents: forskolin, IBMX, and dipyridamole (here called FID treatment). Transcriptomic analysis of cumulus cells indicated that FID-induced differentially expressed transcripts were implicated in cumulus expansion, steroidogenesis, cell metabolism, and oocyte competence. Functional genomic analysis revealed that protein kinase-A (PKA), extracellular signal regulated kinases (ERK1/2), and calcium (Ca(2+)) pathways as key regulators of FID signaling. Inhibition of PKA (H89) in FID-supplemented COCs or substitution of FID with calcium ionophore (A23187) demonstrated that FID activated primarily the PKA pathway which inhibited ERK1/2 phosphorylation and was upstream of calcium signaling. Furthermore, inhibition of ERK1/2 phosphorylation by FID supported a regulation by dual specific phosphatase (DUSP1) via PKA. Our findings imply that cAMP (FID) regulates cell metabolism, steroidogenesis, intracellular signaling and cumulus expansion through PKA which modulates these functions through optimization of ERK1/2 phosphorylation and coordination of calcium signaling. These findings have implications for development of new strategies for improving oocyte in vitro maturation leading to better developmental competence.

  20. Transcriptomic analysis of cyclic AMP response in bovine cumulus cells

    PubMed Central

    Khan, D. R.; Guillemette, C.; Sirard, M. A.

    2015-01-01

    Acquisition of oocyte developmental competence needs to be understood to improve clinical outcomes of assisted reproduction. The stimulation of cumulus cell concentration of cyclic adenosine 3′5′-monophosphate (cAMP) by pharmacological agents during in vitro maturation (IVM) participates in improvement of oocyte quality. However, precise coordination and downstream targets of cAMP signaling in cumulus cells are largely unknown. We have previously demonstrated better embryo development after cAMP stimulation for first 6 h during IVM. Using this model, we investigated cAMP signaling in cumulus cells through in vitro culture of cumulus-oocyte complexes (COCs) in the presence of cAMP raising agents: forskolin, IBMX, and dipyridamole (here called FID treatment). Transcriptomic analysis of cumulus cells indicated that FID-induced differentially expressed transcripts were implicated in cumulus expansion, steroidogenesis, cell metabolism, and oocyte competence. Functional genomic analysis revealed that protein kinase-A (PKA), extracellular signal regulated kinases (ERK1/2), and calcium (Ca2+) pathways as key regulators of FID signaling. Inhibition of PKA (H89) in FID-supplemented COCs or substitution of FID with calcium ionophore (A23187) demonstrated that FID activated primarily the PKA pathway which inhibited ERK1/2 phosphorylation and was upstream of calcium signaling. Furthermore, inhibition of ERK1/2 phosphorylation by FID supported a regulation by dual specific phosphatase (DUSP1) via PKA. Our findings imply that cAMP (FID) regulates cell metabolism, steroidogenesis, intracellular signaling and cumulus expansion through PKA which modulates these functions through optimization of ERK1/2 phosphorylation and coordination of calcium signaling. These findings have implications for development of new strategies for improving oocyte in vitro maturation leading to better developmental competence. PMID:26082143

  1. PULSE RATE DIVIDER

    DOEpatents

    McDonald, H.C. Jr.

    1962-12-18

    A compact pulse-rate divider circuit affording low impedance output and high input pulse repetition rates is described. The circuit features a single secondary emission tube having a capacitor interposed between its dynode and its control grid. An output pulse is produced at the anode of the tube each time an incoming pulse at the control grid drives the tube above cutoff and the duration of each output pulse corresponds to the charging time of the capacitor. Pulses incoming during the time the grid bias established by the discharging capacitor is sufficiently negative that the pulses are unable to drive the tube above cutoff do not produce output pulses at the anode; these pulses are lost and a dividing action is thus produced by the circuit. The time constant of the discharge path may be vanied to vary in turn the division ratio of the circuit; the time constant of the charging circuit may be varied to vary the width of the output pulses. (AEC)

  2. PULSE HEIGHT ANALYZER

    DOEpatents

    Goldsworthy, W.W.

    1958-06-01

    A differential pulse-height discriminator circuit is described which is readily adaptable for operation in a single-channel pulse-height analyzer. The novel aspect of the circuit lies in the specific arrangement of differential pulse-height discriminator which includes two pulse-height discriminators having a comnnon input and an anticoincidence circuit having two interconnected vacuum tubes with a common cathode resistor. Pulses from the output of one discriminator circuit are delayed and coupled to the grid of one of the anticoincidence tubes by a resistor. The output pulses from the other discriminator circuit are coupled through a cathode follower circuit, which has a cathode resistor of such value as to provide a long time constant with the interelectrode capacitance of the tube, to lenthen the output pulses. The pulses are then fed to the grid of the other anticoincidence tube. With such connections of the circuits, only when the incoming pulse has a pesk value between the operating levels of the two discriminators does an output pulse occur from the anticoincidence circuit.

  3. AKAPs: The Architectural Underpinnings of Local cAMP signaling

    PubMed Central

    Kritzer, Michael D.; Li, Jinliang; Dodge-Kafka, Kimberly; Kapiloff, Michael S.

    2011-01-01

    The cAMP-dependent protein kinase A (PKA) is targeted to specific compartments in the cardiac myocyte by A-kinase anchoring proteins (AKAPs), a diverse set of scaffold proteins that have been implicated in the regulation of excitation-contraction coupling and cardiac remodeling. AKAPs bind not only PKA, but also a large variety of structural and signaling molecules. In this review, we discuss the basic concepts underlying compartmentation of cAMP and PKA signaling, as well as a few of the individual AKAPs that have been shown to be functionally relevant in the heart. PMID:21600214

  4. The field concept in Ampère's magnetostatics

    NASA Astrophysics Data System (ADS)

    Davis, Artice M.

    2009-08-01

    We update Ampère's theory using vector notation and derive his expression for the force between two current elements. We assume that the two elements are in different current loops and integrate over one to obtain the force on a differential element in the second. This procedure allows us to define the magnetic field in a natural manner and to derive the Lorentz force for a current segment. We equate the magnetic moments of current and permanent magnet dipoles and show that Biot and Savart could have performed their experiment using a small current loop, thus establishing the Biot-Savart law as a consequence of Ampère's theory.

  5. Regulation and organization of adenylyl cyclases and cAMP.

    PubMed Central

    Cooper, Dermot M F

    2003-01-01

    Adenylyl cyclases are a critically important family of multiply regulated signalling molecules. Their susceptibility to many modes of regulation allows them to integrate the activities of a variety of signalling pathways. However, this property brings with it the problem of imparting specificity and discrimination. Recent studies are revealing the range of strategies utilized by the cyclases to solve this problem. Microdomains are a consequence of these solutions, in which cAMP dynamics may differ from the broad cytosol. Currently evolving methodologies are beginning to reveal cAMP fluctuations in these various compartments. PMID:12940771

  6. Luteinizing hormone-releasing hormone (LHRH) attenuates morphine-induced inhibition of cyclic AMP (cAMP) in opioid-responsive SK-N-SH cells.

    PubMed

    Ratka, A; Simpkins, J W

    1997-04-01

    SK-N-SH cells were used to assess the effects of luteinizing hormone-releasing hormone (LHRH) on opioid receptor-mediated changes in cyclic AMP (cAMP). Prostaglandin E1 (PGE1, 1 microM) caused a dramatic increase in cAMP levels. Treatment with 10 microM morphine (MOR) significantly inhibited the stimulatory effect of PGE1, LHRH (0.8 microM) caused an increase in the basal level of intracellular cAMP and potentiated the stimulatory effect of PGE1 on cAMP accumulation. In cells pretreated with LHRH the inhibitory effect of MOR on cAMP accumulation was significantly attenuated. An LHRH antagonist had no effect on cAMP. The involvement of pertussis toxin (PTX)-sensitive G proteins in the actions of LHRH was studied. PTX increased the stimulatory effect of PGE1 on cAMP and attenuated the inhibitory effect of MOR. However, PTX pretreatment prevented the effects of LHRH on the intracellular actions of PGE1 but exerted an additive effect with LHRH in blocking the MOR-induced decrease in cAMP levels. We conclude that LHRH attenuates the inhibitory, opioid receptor-mediated effect of MOR on intracellular cAMP accumulation in SK-N-SH cells, and that the G protein-independent mechanism may be involved in LHRH-induced attenuation of the inhibitory effect of MOR on neuronal cAMP.

  7. PULSE AMPLITUDE ANALYZER

    DOEpatents

    Greenblatt, M.H.

    1958-03-25

    This patent pertains to pulse amplitude analyzers for sorting and counting a serles of pulses, and specifically discloses an analyzer which ls simple in construction and presents the puise height distribution visually on an oscilloscope screen. According to the invention, the pulses are applied to the vertical deflection plates of an oscilloscope and trigger the horizontal sweep. Each pulse starts at the same point on the screen and has a maximum amplitude substantially along the same vertical line. A mask is placed over the screen except for a slot running along the line where the maximum amplitudes of the pulses appear. After the slot has been scanned by a photocell in combination with a slotted rotating disk, the photocell signal is displayed on an auxiliary oscilloscope as vertical deflection along a horizontal time base to portray the pulse amplitude distribution.

  8. PULSE AMPLITUDE ANALYSERS

    DOEpatents

    Lewis, I.A.D.

    1956-05-15

    This patent pentains to an electrical pulse amplitude analyzer, capable of accepting input pulses having a separation between adjacent pulses in the order of one microsecond while providing a large number of channels of classification. In its broad aspect the described pulse amplitude analyzer utilizes a storage cathode ray tube und control circuitry whereby the amplitude of the analyzed pulses controls both the intensity and vertical defiection of the beam to charge particular spots in horizontal sectors of the tube face as the beam is moved horizontally across the tube face. As soon as the beam has swept the length of the tube the information stored therein is read out by scanning individually each horizontal sector corresponding to a certain range of pulse amplitudes and applying the output signal from each scan to separate indicating means.

  9. Field measurements and interpretation of TMI-2 instrumentation: YM-AMP-7023 and YM-AMP-7025

    SciTech Connect

    Jones, J E; Smith, J T; Mathis, M V

    1982-01-01

    This report describes the measurement and results of the Loose Part Monitor Channels YM-AMP-7023 and YM-AMP-7025. These instruments consist of an Endevco Model 2276 accelerometer and a model 2652M4 charge amplifier connected to the Loose Parts Monitorng System terminals by approximately 400 feet (500 feet for 7025) of cable. The instruments were being incorporated into a B and W supplied system when the measurements were taken; therefore, the equipment was not expected to be fully operational.

  10. PulseSoar

    SciTech Connect

    Carter, P.; Peglow, S.

    1992-07-21

    This paper is an introduction to the PulseSoar concept. PulseSoar is a hypervelocity airplane that uses existing airport facilities and current technologies to fly at the very edge of space. It will be shown that PulseSoar can fly between any two points on the globe in less than two hours with fuel efficiency exceeding current state of the art commercial airliners. In addition, it will be shown that PulseSoar avoids environmental issues concerning the ozone layer and sonic booms because of its unique flight profile. All of this can be achieved with current technology. PulseSoar does not require the development of enabling technology. It is a concept which can be demonstrated today. The importance of this idea goes beyond the technical significance`s of PulseSoar in terms of feasibility and performance. PulseSoar could provide a crucial economic advantage to America`s largest export market: commercial aircraft. PulseSoar is a breakthrough concept for addressing the emerging markets of long range and high speed aircraft. Application of PulseSoar to commercial transport could provide the US Aerospace industry a substantial lead in offering high speed/long range aircraft to the world`s airlines. The rapid emergence of a US developed high speed aircraft could also be important to our competitiveness in the Pacific Rim and South American economies. A quick and inexpensive demonstration vehicle is proposed to bang the concept to reality within two years. This discussion will address all the major technical subjects encompassed by PulseSoar and identifies several near-term, and low risk, applications which may be further explored with the initial demonstration vehicle. What is PulseSoar? PulseSoar could enable high speed, high altitude and long range flight without many of the difficulties encountered by traditional hypersonic vehicles.

  11. PULSED INDICATOR CIRCUIT

    DOEpatents

    Linlor, W.I.; Kerns, Q.A.

    1960-11-15

    A system is given for detecting incremental changes in a transducer impedance terminating a transmission line. Principal novelty resides in the transducer impedance terminating the line in a mismatch and a pulse generator being provided to apply discrete pulses to the input end of the line. The amplitudes of the pulses reflected to the input end of the line from the mismatched transducer impedance are then observed as a very accurate measure of the instantaneous value of the latter.

  12. High voltage pulse conditioning

    DOEpatents

    Springfield, Ray M.; Wheat, Jr., Robert M.

    1990-01-01

    Apparatus for conditioning high voltage pulses from particle accelerators in order to shorten the rise times of the pulses. Flashover switches in the cathode stalk of the transmission line hold off conduction for a determinable period of time, reflecting the early portion of the pulses. Diodes upstream of the switches divert energy into the magnetic and electrostatic storage of the capacitance and inductance inherent to the transmission line until the switches close.

  13. Glucose-induced hyperaccumulation of cyclic AMP and defective glucose repression in yeast strains with reduced activity of cyclic AMP-dependent protein kinase.

    PubMed

    Mbonyi, K; van Aelst, L; Argüelles, J C; Jans, A W; Thevelein, J M

    1990-09-01

    Addition of glucose or related fermentable sugars to derepressed cells of the yeast Saccharomyces cerevisiae triggers a RAS-mediated cyclic AMP (cAMP) signal that induces a protein phosphorylation cascade. In yeast mutants (tpk1w1, tpk2w1, and tpk3w1) containing reduced activity of cAMP-dependent protein kinase, fermentable sugars, as opposed to nonfermentable carbon sources, induced a permanent hyperaccumulation of cAMP. This finding confirms previous conclusions that fermentable sugars are specific stimulators of cAMP synthesis in yeast cells. Despite the huge cAMP levels present in these mutants, deletion of the gene (BCY1) coding for the regulatory subunit of cAMP-dependent protein kinase severely reduced hyperaccumulation of cAMP. Glucose-induced hyperaccumulation of cAMP was also observed in exponential-phase glucose-grown cells of the tpklw1 and tpk2w1 strains but not the tpk3w1 strain even though addition of glucose to glucose-repressed wild-type cells did not induce a cAMP signal. Investigation of mitochondrial respiration by in vivo 31P nuclear magnetic resonance spectroscopy showed the tpk1w1 and tpk2w1 strains, to be defective in glucose repression. These results are consistent with the idea that the signal transmission pathway from glucose to adenyl cyclase contains a glucose-repressible protein. They also show that a certain level of cAMP-dependent protein phosphorylation is required for glucose repression. Investigation of the glucose-induced cAMP signal and glucose-induced activation of trehalase in derepressed cells of strains containing only one of the wild-type TPK genes indicates that the transient nature of the cAMP signal is due to feedback inhibition by cAMP-dependent protein kinase.

  14. Electrodeposition of low contraction chromium/molybdenum alloys using pulse-reverse plating. Final report

    SciTech Connect

    Miller, M.D.; Langston, S.

    1994-12-01

    The use of modulated pulse periodic reverse (pulse-reverse) current to electrodeposit a low contraction (LC) chromium/molybdenum alloy has been evaluated. When using one full pulse-reverse plating cycle, the percent molybdenum in the deposit increased almost 400 percent (from 1 to 4 percent) as the current in the reverse cycle was increased from 0 to 10 amps. However, when the pulse reverse current was carried to six full plating cycles, the percent molybdenum in the deposit was not dependent upon the current and remained constant at about 1 percent. This is about the same percent molybdenum that could be expected in direct current-plated LC chromium/molybdenum alloy and about half the percent molybdenum that could be expected in an on/off pulse-plated LC chromium/molybdenum alloy.

  15. Femtosecond polarization pulse shaping.

    PubMed

    Brixner, T; Gerber, G

    2001-04-15

    We report computer-controlled femtosecond polarization pulse shaping where intensity, momentary frequency, and light polarization are varied as functions of time. For the first time to our knowledge, a pulse shaper is used to modulate the degree of ellipticity as well as the orientation of the elliptical principal axes within a single laser pulse by use of a 256-pixel two-layer liquid-crystal display inside a zero-dispersion compressor. Interferometric stability of the setup is not required. Complete pulse characterization is achieved by dual-channel spectral interferometry. This technology has a large range of applications, especially in the field of quantum control.

  16. Femtosecond polarization pulse shaping.

    PubMed

    Brixner, T; Gerber, G

    2001-04-15

    We report computer-controlled femtosecond polarization pulse shaping where intensity, momentary frequency, and light polarization are varied as functions of time. For the first time to our knowledge, a pulse shaper is used to modulate the degree of ellipticity as well as the orientation of the elliptical principal axes within a single laser pulse by use of a 256-pixel two-layer liquid-crystal display inside a zero-dispersion compressor. Interferometric stability of the setup is not required. Complete pulse characterization is achieved by dual-channel spectral interferometry. This technology has a large range of applications, especially in the field of quantum control. PMID:18040384

  17. Mobile genetic elements related to the diffusion of plasmid-mediated AmpC β-lactamases or carbapenemases from Enterobacteriaceae: findings from a multicenter study in Spain.

    PubMed

    Zamorano, L; Miró, E; Juan, C; Gómez, L; Bou, G; González-López, J J; Martínez-Martínez, L; Aracil, B; Conejo, M C; Oliver, A; Navarro, F

    2015-09-01

    We examined the genetic context of 74 acquired ampC genes and 17 carbapenemase genes from 85 of 640 Enterobacteriaceae isolates collected in 2009. Using S1 pulsed-field gel electrophoresis and Southern hybridization, 37 of 74 bla AmpC genes were located on large plasmids of different sizes belonging to six incompatibility groups. We used sequencing and PCR mapping to investigate the regions flanking the acquired ampC genes. The bla CMY-2-like genes were associated with ISEcp1; the surrounding bla DHA genes were similar to Klebsiella pneumoniae plasmid pTN60013 associated with IS26 and the psp and sap operons; and the bla ACC-1 genes were associated with IS26 elements inserted into ISEcp1. All of the carbapenemase genes (bla VIM-1, bla IMP-22, and bla IMP-28) were located in class 1 integrons. Therefore, although plasmids are the main cause of the rapid dissemination of ampC genes among Enterobacteriaceae, we need to be aware that other mobile genetic elements, such as insertion sequences, transposons, or integrons, can be involved in the mobilization of these genes of chromosomal origin. Additionally, three new integrons (In846 to In848) are described in this study. PMID:26077249

  18. Mobile Genetic Elements Related to the Diffusion of Plasmid-Mediated AmpC β-Lactamases or Carbapenemases from Enterobacteriaceae: Findings from a Multicenter Study in Spain

    PubMed Central

    Zamorano, L.; Miró, E.; Juan, C.; Gómez, L.; Bou, G.; González-López, J. J.; Martínez-Martínez, L.; Aracil, B.; Conejo, M. C.; Oliver, A.

    2015-01-01

    We examined the genetic context of 74 acquired ampC genes and 17 carbapenemase genes from 85 of 640 Enterobacteriaceae isolates collected in 2009. Using S1 pulsed-field gel electrophoresis and Southern hybridization, 37 of 74 blaAmpC genes were located on large plasmids of different sizes belonging to six incompatibility groups. We used sequencing and PCR mapping to investigate the regions flanking the acquired ampC genes. The blaCMY-2-like genes were associated with ISEcp1; the surrounding blaDHA genes were similar to Klebsiella pneumoniae plasmid pTN60013 associated with IS26 and the psp and sap operons; and the blaACC-1 genes were associated with IS26 elements inserted into ISEcp1. All of the carbapenemase genes (blaVIM-1, blaIMP-22, and blaIMP-28) were located in class 1 integrons. Therefore, although plasmids are the main cause of the rapid dissemination of ampC genes among Enterobacteriaceae, we need to be aware that other mobile genetic elements, such as insertion sequences, transposons, or integrons, can be involved in the mobilization of these genes of chromosomal origin. Additionally, three new integrons (In846 to In848) are described in this study. PMID:26077249

  19. Cyclic AMP signalling pathways in the regulation of uterine relaxation

    PubMed Central

    Yuan, Wei; López Bernal, Andrés

    2007-01-01

    Studying the mechanism(s) of uterine relaxation is important and will be helpful in the prevention of obstetric difficulties such as preterm labour, which remains a major cause of perinatal mortality and morbidity. Multiple signalling pathways regulate the balance between maintaining relative uterine quiescence during gestation, and the transition to the contractile state at the onset of parturition. Elevation of intracellular cyclic AMP promotes myometrial relaxation, and thus quiescence, via effects on multiple intracellular targets including calcium channels, potassium channels and myosin light chain kinase. A complete understanding of cAMP regulatory pathways (synthesis and hydrolysis) would assist in the development of better tocolytics to delay or inhibit preterm labour. Here we review the enzymes involved in cAMP homoeostasis (adenylyl cyclases and phosphodiesterases) and possible myometrial substrates for the cAMP dependent protein kinase. We must emphasise the need to identify novel pharmacological targets in human pregnant myometrium to achieve safe and selective uterine relaxation when this is indicated in preterm labour or other obstetric complications. PMID:17570154

  20. Fluorescence study of Escherichia coli cyclic AMP receptor protein.

    PubMed

    Wasylewski, M; Małecki, J; Wasylewski, Z

    1995-07-01

    Time-resolved, steady-state fluorescence and fluorescence-detected circular dichroism (FDCD) have been used to resolve the fluorescence contributions of the two tryptophan residues, Trp-13 and Trp-85, in the cyclic AMP receptor protein (CRP). The iodide and acrylamide quenching data show that in CRP one tryptophan residue, Trp-85, is buried within the protein matrix and the other, Trp-13, is moderately exposed on the surface of the protein. Fluorescence-quenching-resolved spectra show that Trp-13 has emission at about 350 nm and contributes 76-83% to the total fluorescence emission. The Trp-85, unquenchable by iodide and acrylamide, has the fluorescence emission at about 337 nm. The time-resolved fluorescence measurements show that Trp-13 has a longer fluorescence decay time. The Trp-85 exhibits a shorter fluorescence decay time. In the CRP-cAMP complex the Trp-85, previously buried in the apoprotein becomes totally exposed to the iodide and acrylamide quenchers. The FDCD spectra indicate that in the CRP-cAMP complex Trp-85 remains in the same environment as in the protein alone. It has been proposed that the binding of cAMP to CRP is accompanied by a hinge reorientation of two protein domains. This allows for penetration of the quencher molecules into the Trp-85 residue previously buried in the protein matrix. PMID:8590598

  1. 21 CFR 862.1230 - Cyclic AMP test system.

    Code of Federal Regulations, 2013 CFR

    2013-04-01

    ... 21 Food and Drugs 8 2013-04-01 2013-04-01 false Cyclic AMP test system. 862.1230 Section 862.1230 Food and Drugs FOOD AND DRUG ADMINISTRATION, DEPARTMENT OF HEALTH AND HUMAN SERVICES (CONTINUED) MEDICAL DEVICES CLINICAL CHEMISTRY AND CLINICAL TOXICOLOGY DEVICES Clinical Chemistry Test Systems §...

  2. 21 CFR 862.1230 - Cyclic AMP test system.

    Code of Federal Regulations, 2012 CFR

    2012-04-01

    ... 21 Food and Drugs 8 2012-04-01 2012-04-01 false Cyclic AMP test system. 862.1230 Section 862.1230 Food and Drugs FOOD AND DRUG ADMINISTRATION, DEPARTMENT OF HEALTH AND HUMAN SERVICES (CONTINUED) MEDICAL DEVICES CLINICAL CHEMISTRY AND CLINICAL TOXICOLOGY DEVICES Clinical Chemistry Test Systems §...

  3. 21 CFR 862.1230 - Cyclic AMP test system.

    Code of Federal Regulations, 2014 CFR

    2014-04-01

    ... 21 Food and Drugs 8 2014-04-01 2014-04-01 false Cyclic AMP test system. 862.1230 Section 862.1230 Food and Drugs FOOD AND DRUG ADMINISTRATION, DEPARTMENT OF HEALTH AND HUMAN SERVICES (CONTINUED) MEDICAL DEVICES CLINICAL CHEMISTRY AND CLINICAL TOXICOLOGY DEVICES Clinical Chemistry Test Systems §...

  4. 21 CFR 862.1230 - Cyclic AMP test system.

    Code of Federal Regulations, 2011 CFR

    2011-04-01

    ... 21 Food and Drugs 8 2011-04-01 2011-04-01 false Cyclic AMP test system. 862.1230 Section 862.1230 Food and Drugs FOOD AND DRUG ADMINISTRATION, DEPARTMENT OF HEALTH AND HUMAN SERVICES (CONTINUED) MEDICAL DEVICES CLINICAL CHEMISTRY AND CLINICAL TOXICOLOGY DEVICES Clinical Chemistry Test Systems §...

  5. Role of CNPase in the oligodendrocytic extracellular 2',3'-cAMP-adenosine pathway.

    PubMed

    Verrier, Jonathan D; Jackson, Travis C; Gillespie, Delbert G; Janesko-Feldman, Keri; Bansal, Rashmi; Goebbels, Sandra; Nave, Klaus-Armin; Kochanek, Patrick M; Jackson, Edwin K

    2013-10-01

    Extracellular adenosine 3',5'-cyclic monophosphate (3',5'-cAMP) is an endogenous source of localized adenosine production in many organs. Recent studies suggest that extracellular 2',3'-cAMP (positional isomer of 3',5'-cAMP) is also a source of adenosine, particularly in the brain in vivo post-injury. Moreover, in vitro studies show that both microglia and astrocytes can convert extracellular 2',3'-cAMP to adenosine. Here, we examined the ability of primary mouse oligodendrocytes and neurons to metabolize extracellular 2',3'-cAMP and their respective adenosine monophosphates (2'-AMP and 3'-AMP). Cells were also isolated from mice deficient in 2',3'-cyclic nucleotide-3'-phosphodiesterase (CNPase). Oligodendrocytes metabolized 2',3'-cAMP to 2'-AMP with 10-fold greater efficiency than did neurons (and also more than previously examined microglia and astrocytes); whereas, the production of 3'-AMP was minimal in both oligodendrocytes and neurons. The production of 2'-AMP from 2',3'-cAMP was reduced by 65% in CNPase -/- versus CNPase +/+ oligodendrocytes. Oligodendrocytes also converted 2'-AMP to adenosine, and this was also attenuated in CNPase -/- oligodendrocytes. Inhibition of classic 3',5'-cAMP-3'-phosphodiesterases with 3-isobutyl-1-methylxanthine did not block metabolism of 2',3'-cAMP to 2'-AMP and inhibition of classic ecto-5'-nucleotidase (CD73) with α,β-methylene-adenosine-5'-diphosphate did not attenuate the conversion of 2'-AMP to adenosine. These studies demonstrate that oligodendrocytes express the extracellular 2',3'-cAMP-adenosine pathway (2',3'-cAMP → 2'-AMP → adenosine). This pathway is more robustly expressed in oligodendrocytes than in all other CNS cell types because CNPase is the predominant enzyme that metabolizes 2',3'-cAMP to 2-AMP in CNS cells. By reducing levels of 2',3'-cAMP (a mitochondrial toxin) and increasing levels of adenosine (a neuroprotectant), oligodendrocytes may protect axons from injury. PMID:23922219

  6. Opportunities in pulse combustion

    SciTech Connect

    Brenchley, D.L.; Bomelburg, H.J.

    1985-10-01

    In most pulse combustors, the combustion occurs near the closed end of a tube where inlet valves operate in phase with the pressure amplitude variations. Thus, within the combustion zone, both the temperature and the pressure oscillate around a mean value. However, the development of practical applications of pulse combustion has been hampered because effective design requires the right combination of the combustor's dimensions, valve characteristics, fuel/oxidizer combination, and flow pattern. Pulse combustion has several additional advantages for energy conversion efficiency, including high combustion and thermal efficiency, high combustion intensity, and high convective heat transfer rates. Also, pulse combustion can be self-aspirating, generating a pressure boost without using a blower. This allows the use of a compact heat exchanger that may include a condensing section and may obviate the need for a chimney. In the last decade, these features have revived interest in pulse combustion research and development, which has resulted in the development of a pulse combustion air heater by Lennox, and a pulse combustion hydronic unit by Hydrotherm, Inc. To appraise this potential for energy savings, a systematic study was conducted of the many past and present attempts to use pulse combustion for practical purposes. The authors recommended areas where pulse combustion technology could possibly be applied in the future and identified areas in which additional R and D would be necessary. Many of the results of the study project derived from a special workshop on pulse combustion. This document highlights the main points of the study report, with particular emphasis on pulse combustion application in chemical engineering.

  7. Chronic fatigue syndrome and impaired peripheral pulse characteristics on orthostasis--a new potential diagnostic biomarker.

    PubMed

    Allen, John; Murray, Alan; Di Maria, Costanzo; Newton, Julia L

    2012-02-01

    Autonomic nervous system dysfunction is frequently reported in chronic fatigue syndrome (CFS) with orthostatic intolerance, a common symptom that can be objectively assessed. The frequent finding of autonomic dysfunction and symptoms on standing has the potential to provide a diagnostic biomarker in chronic fatigue. In this study we explored the clinical value of non-invasive optical multi-site photoplethysmography (PPG) technology to assess cardiovascular responses to standing. Multi-site PPG pulses were collected from tissue pads of the ears, fingers and toes of 14 patients with CFS and 14 age-matched sedentary subjects using a measurement protocol of a 10 min baseline (subject supine) followed by 3 min of tilting on a tilt table (head-up to 70°). Percentage change in pulse timing (pulse transit time, PTTf) and pulse amplitude (AMP) at each site were calculated using beat-to-beat pulse wave analysis. A significant reduction in the overall pulse timing response to controlled standing was found for the CFS group (using summed absolute percentage change in PTTf for ear, finger and toe sites, median change of 26% for CFS and 37% for control with p = 0.002). There were no significant differences between subject groups for the AMP measure at any site. Changes in AMP with tilt were, however, weakly significantly and negatively correlated with fatigue severity (p < 0.05). Receiver operating characteristic (ROC) analysis of timing measures produced an area under the curve of 0.81. Experimental linear discriminant classification analysis comparing both timing and amplitude measures produced an overall diagnostic accuracy of 82%. Pulse wave abnormalities have been observed in CFS and represent a potential objective measure to help differentiate between CFS patients and healthy controls.

  8. Presence of free cyclic AMP receptor protein and regulation of its level by cyclic AMP in neuroblastoma-glioma hybrid cells.

    PubMed Central

    Walter, U; Costa, M R; Breakefield, X O; Greengard, P

    1979-01-01

    Neuroblastoma-glioma hybrid cells of line 108CC-5 were found to contain high levels of soluble adenosine 3',5'-cyclic monophosphate (cAMP)-dependent protein kinase activity and high levels of two specific cAMP receptor proteins, RI and RII. Treatment of the hybrid cells with dibutyryl cAMP increased the level of RI but did not significantly affect the level either of RII or of cAMP-dependent protein kinase activity. The effect of dibutyryl cAMP could be mimicked by prostaglandin E1 and 3-isobutyl-1-methylxanthine, both of which are known to raise cAMP levels in neuroblastoma-glioma hybrid cells. Both in control as well as in dibutyryl cAMP-treated cells, RII but not RI was associated with cAMP-dependent protein kinase. Several lines of evidence suggest that RI represents the free regulatory subunit of type I cAMP-dependent protein kinase. The presence of this regulatory subunit as free cAMP receptor protein in neuroblastoma-glioma hybrid cells may be of significance with respect to the regulation of growth and differentiation in tumor cells. Images PMID:226964

  9. Purification, characterization, and sequencing of novel antimicrobial peptides, Tu-AMP 1 and Tu-AMP 2, from bulbs of tulip (Tulipa gesneriana L.).

    PubMed

    Fujimura, Masatoshi; Ideguchi, Mineo; Minami, Yuji; Watanabe, Keiichi; Tadera, Kenjiro

    2004-03-01

    Novel antimicrobial peptides (AMP), designated Tu-AMP 1 and Tu-AMP 2, were purified from the bulbs of tulip (Tulipa gesneriana L.) by chitin affinity chromatography and reverse-phase high-performance liquid chromatography (HPLC). They bind to chitin in a reversible way. They were basic peptides having isoelectric points of over 12. Tu-AMP 1 and Tu-AMP 2 had molecular masses of 4,988 Da and 5,006 Da on MALDI-TOF MS analysis, and their extinction coefficients of 1% aqueous solutions at 280 nm were 3.3 and 3.4, respectively. Half of all amino acid residues of Tu-AMP 1 and Tu-AMP 2 were occupied by cysteine, arginine, lysine, and proline. The concentrations of peptides required for 50% inhibition (IC(50)) of the growth of plant pathogenic bacteria and fungi were 2 to 20 microg/ml. The structural characteristics of Tu-AMP 1 and Tu-AMP 2 indicated that they were novel thionin-like antimicrobial peptides, though Tu-AMP 2 was a heterodimer composes of two short peptides joined with disulfide bonds.

  10. PULSE HEIGHT ANALYZER

    DOEpatents

    Johnstone, C.W.

    1958-01-21

    An anticoincidence device is described for a pair of adjacent channels of a multi-channel pulse height analyzer for preventing the lower channel from generating a count pulse in response to an input pulse when the input pulse has sufficient magnitude to reach the upper level channel. The anticoincidence circuit comprises a window amplifier, upper and lower level discriminators, and a biased-off amplifier. The output of the window amplifier is coupled to the inputs of the discriminators, the output of the upper level discriminator is connected to the resistance end of a series R-C network, the output of the lower level discriminator is coupled to the capacitance end of the R-C network, and the grid of the biased-off amplifier is coupled to the junction of the R-C network. In operation each discriminator produces a negative pulse output when the input pulse traverses its voltage setting. As a result of the connections to the R-C network, a trigger pulse will be sent to the biased-off amplifier when the incoming pulse level is sufficient to trigger only the lower level discriminator.

  11. Pulsed Fission Propulsion Concept

    NASA Technical Reports Server (NTRS)

    1999-01-01

    In the 1960's U.S. Government laboratories, under Project Orion, investigated a pulsed nuclear fission propulsion system. Small nuclear pulse units would be sequentially discharged from the aft end of the vehicle. A blast shield and shock absorber system would protect the crew and convert the shock loads into a continuous propusive force.

  12. Pulsed Fission Propulsion Concept

    NASA Technical Reports Server (NTRS)

    1999-01-01

    In the 1960's U.S. Government laboratories, under Project Orion, investigated a pulsed nuclear fission propulsion system. Small nuclear pulse units would be sequentially discharged from the aft end of the vehicle. A blast shield and shock absorber system would protect the crew and convert the shock loads into a continuous propulsive force.

  13. PULSE AMPLITUDE DISTRIBUTION RECORDER

    DOEpatents

    Cowper, G.

    1958-08-12

    A device is described for automatica1ly recording pulse annplitude distribution received from a counter. The novelty of the device consists of the over-all arrangement of conventional circuit elements to provide an easy to read permanent record of the pulse amplitude distribution during a certain time period. In the device a pulse analyzer separates the pulses according to annplitude into several channels. A scaler in each channel counts the pulses and operates a pen marker positioned over a drivable recorder sheet. Since the scalers in each channel have the sanne capacity, the control circuitry permits counting of the incoming pulses until one scaler reaches capacity, whereupon the input is removed and an internal oscillator supplies the necessary pulses to fill up the other scalers. Movement of the chart sheet is initiated wben the first scaler reaches capacity to thereby give a series of marks at spacings proportional to the time required to fill the remaining scalers, and accessory equipment marks calibration points on the recorder sheet to facilitate direct reading of the number of external pulses supplied to each scaler.

  14. Sources of pulsed radiation

    SciTech Connect

    Sauer, M.C. Jr.

    1981-01-01

    Characteristics of various sources of pulsed radiation are examined from the viewpoint of their importance to the radiation chemist, and some examples of uses of such sources are mentioned. A summary is given of the application of methods of physical dosimetry to pulsed sources, and the calibration of convenient chemical dosimeters by physical dosimetry is outlined. 7 figures, 1 table.

  15. Pulsed Laser Tissue Interaction

    NASA Astrophysics Data System (ADS)

    Walsh, Joseph T.; van Leeuwen, Ton G.; Jansen, E. Duco; Motamedi, Massoud; Welch, Ashley J.

    Pulsed lasers, by virtue of their ability to deliver energy in a spatially and temporally confined fashion, are able to micromachine biological tissues. The clinical success of pulsed laser treatment, however, is often limited by the extent of damage that is caused to the tissue in the vicinity of the ablation crater. In general, pulsed ablation is a trade off between thermal damage to surrounding tissue, caused by relatively long pulses (>100 ms), and mechanical damage to surrounding tissue, caused by relatively short pulses (<1 ms). To identify the origin of pulsed laser induced damage, the possible laser tissue interactions and ablation are discussed here and in Chapter 14. The purpose of this chapter is to provide the reader with a condensed overview of the parameters that must be considered in the process of pulsed laser ablation of soft tissue. In this chapter, pulsed infrared ablation of biological soft tissue is used as a paradigm to illustrate the concepts and design considerations. Generally speaking, the absorption of laser light may lead to photothermal, photomechanical or photochemical interaction with the irradiated tissue [1-5]. The vast majority of therapeutic laser-tissue interactions is based on photothermal interactions where laser energy is converted into heat. Subsequent to thermalization of the absorbed optical energy, heat transfer mechanisms, in particular conduction allow thermal diffusion from high temperature areas to surrounding regions. When laser penetration depth is less than the laser spot radius, the thermal diffusion time, τ th, can be defined as:

  16. Extrusion cooking: Legume pulses

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Extrusion is used commercially to produce high value breakfast and snack foods based on cereals such as wheat or corn. However, this processing method is not being commercially used for legume pulses seeds due to the perception that they do not expand well in extrusion. Extrusion cooking of pulses (...

  17. Trehalase activity and cyclic AMP content during early development of Mucor rouxii spores.

    PubMed Central

    Dewerchin, M A; Van Laere, A J

    1984-01-01

    Incubation of Mucor rouxii sporangiospores in complex medium under aerobic conditions resulted in a transient 20-fold increase in trehalase activity. Maximum activity was reached after 15 min. Simultaneously, the cyclic AMP (cAMP) content increased approximately eightfold, reaching a maximum within 10 min. Increases in trehalase activity and cAMP content were also observed under anaerobic conditions (CO2). The extent of trehalase activation and the changes in cAMP content, during both aerobic and anaerobic incubation, varied with the medium used. Trehalase was activated in vitro by a cAMP- and ATP-dependent process. An even faster activation was obtained when cAMP was replaced by the catalytic subunit of beef heart protein kinase. The coincidence of, and the correlation between, increased cAMP contents and trehalase activities support the involvement of a cAMP-dependent phosphorylation in the in vivo regulation of trehalase activity. PMID:6327611

  18. Composite Pulse Tube

    NASA Technical Reports Server (NTRS)

    Martin, Jerry L.; Cloyd, Jason H.

    2007-01-01

    A modification of the design of the pulse tube in a pulse-tube cryocooler reduces axial thermal conductance while preserving radial thermal conductance. It is desirable to minimize axial thermal conductance in the pulse-tube wall to minimize leakage of heat between the warm and cold ends of the pulse tube. At the same time, it is desirable to maximize radial thermal conductance at the cold end of the pulse tube to ensure adequate thermal contact between (1) a heat exchanger in the form of a stack of copper screens inside the pulse tube at the cold end and (2) the remainder of the cold tip, which is the object to which the heat load is applied and from which heat must be removed. The modified design yields a low-heat-leak pulse tube that can be easily integrated with a cold tip. A typical pulse tube of prior design is either a thin-walled metal tube or a metal tube with a nonmetallic lining. It is desirable that the outer surface of a pulse tube be cylindrical (in contradistinction to tapered) to simplify the design of a regenerator that is also part of the cryocooler. Under some conditions, it is desirable to taper the inner surface of the pulse tube to reduce acoustic streaming. The combination of a cylindrical outer surface and a tapered inner surface can lead to unacceptably large axial conduction if the pulse tube is made entirely of metal. Making the pulse-tube wall of a nonmetallic, lowthermal- conductivity material would not solve the problem because the wall would not afford the needed thermal contact for the stack of screens in the cold end. The modified design calls for fabricating the pulse tube in two parts: a longer, nonmetallic part that is tapered on the inside and cylindrical on the outside and a shorter, metallic part that is cylindrical on both the inside and the outside. The nonmetallic part can be made from G-10 fiberglass-reinforced epoxy or other low-thermal-conductivity, cryogenically compatible material. The metallic part must have high

  19. Pulsed electron beam precharger

    SciTech Connect

    Finney, W.C.; Shelton, W.N.

    1990-01-01

    Florida State University is investigating the concept of pulsed electron beams for fly ash precipitation. This report describes the results and data on three of the subtasks of this project and preliminary work only on the remaining five subtasks. Described are the modification of precharger for pulsed and DC energization of anode; installation of the Q/A measurement system; and modification and installation of pulsed power supply to provide both pulsed and DC energization of the anode. The other tasks include: measurement of the removal efficiency for monodisperse simulated fly ash particles; measurement of particle charge; optimization of pulse energization schedule for maximum removal efficiency; practical assessment of results; and measurement of the removal efficiency for polydisperse test particles. 15 figs., 1 tab. (CK)

  20. Pulsed hall thruster system

    NASA Technical Reports Server (NTRS)

    Hruby, Vladimir J. (Inventor); Pote, Bruce M. (Inventor); Gamero-Castano, Manuel (Inventor)

    2004-01-01

    A pulsed Hall thruster system includes a Hall thruster having an electron source, a magnetic circuit, and a discharge chamber; a power processing unit for firing the Hall thruster to generate a discharge; a propellant storage and delivery system for providing propellant to the discharge chamber and a control unit for defining a pulse duration .tau.<0.1d.sup.3.rho./m, where d is the characteristic size of the thruster, .rho. is the propellant density at standard conditions, and m is the propellant mass flow rate for operating either the power processing unit to provide to the Hall thruster a power pulse of a pre-selected duration, .tau., or operating the propellant storage and delivery system to provide a propellant flow pulse of duration, .tau., or providing both as pulses, synchronized to arrive coincidentally at the discharge chamber to enable the Hall thruster to produce a discreet output impulse.

  1. Localized wave pulse experiments

    SciTech Connect

    Chambers, D L; Henderson, T L; Krueger, K L; Lewis, D K; Zilkowski, R N

    1999-06-01

    The Localized Wave project of the Strategic System Support Program has recently finished an experiment in cooperation with the Advanced SONAR group of the Applied Research Laboratory of the University of Texas at Austin. The purpose of the experiment was three-fold. They wanted to see if (1) the LW pulse could propagate over significant distances, to see if (2) a new type of array and drive system specifically designed for the pulse would increase efficiency over single frequency tone bursts, and to see if (3) the complexity of our 24 channel drivers resulted in better efficiency than a single equivalent pulse driving a piston. In the experiment, several LW pulses were launched from the Lake Travis facility and propagated over distances of either 100 feet or 600 feet, through a thermocline for the 600 foot measurements. The results show conclusively that the Localized Wave will propagate past the near field distance. The LW pulses resulted in extremely broad frequency band width pulses with narrow spatial beam patterns and unmeasurable side lobes. Their array gain was better than most tone bursts and further, were better than their equivalent piston pulses. This marks the first test of several Low Diffraction beams against their equivalent piston pulses, as well as the first propagation of LW pulses over appreciable distances. The LW pulse is now proven a useful tool in open water, rather than a laboratory curiosity. The experimental system and array were built by ARL, and the experiments were conducted by ARL staff on their standard test range. The 600 feet measurements were made at the farthest extent of that range.

  2. Suppression of Virulence of Toxigenic Vibrio cholerae by Anethole through the Cyclic AMP (cAMP)-cAMP Receptor Protein Signaling System.

    PubMed

    Zahid, M Shamim Hasan; Awasthi, Sharda Prasad; Asakura, Masahiro; Chatterjee, Shruti; Hinenoya, Atsushi; Faruque, Shah M; Yamasaki, Shinji

    2015-01-01

    Use of natural compounds as antivirulence drugs could be an alternative therapeutic approach to modify the outcome of bacterial infections, particularly in view of growing resistance to available antimicrobials. Here, we show that sub-bactericidal concentration of anethole, a component of sweet fennel seed, could suppress virulence potential in O1 El Tor biotype strains of toxigenic Vibrio cholerae, the causative agent of the ongoing 7th cholera pandemic. The expression of cholera toxin (CT) and toxin coregulated pilus (TCP), the major virulence factors of V. cholerae, is controlled through a regulatory cascade involving activation of ToxT with synergistic coupling interaction of ToxR/ToxS with TcpP/TcpH. We present evidence that anethole inhibits in vitro expression of CT and TCP in a toxT-dependent but toxR/toxS-independent manner and through repression of tcpP/tcpH, by using bead-ELISA, western blotting and quantitative real-time RT-PCR assays. The cyclic AMP (cAMP)-cAMP receptor protein (CRP) is a well-studied global signaling system in bacterial pathogens, and this complex is known to suppress expression of tcpP/tcpH in V. cholerae. We find that anethole influences the virulence regulatory cascade by over-expressing cyaA and crp genes. Moreover, suppression of toxigenic V. cholerae-mediated fluid accumulation in ligated ileum of rabbit by anethole demonstrates its potentiality as an antivirulence drug candidate against the diseases caused by toxigenic V. cholerae. Taken altogether, these results revealing a mechanism of virulence inhibition in V. cholerae by the natural compound anethole, may have relevance in designing antivirulence compounds, particularly against multiple antibiotic resistant bacterial pathogens.

  3. Suppression of Virulence of Toxigenic Vibrio cholerae by Anethole through the Cyclic AMP (cAMP)-cAMP Receptor Protein Signaling System.

    PubMed

    Zahid, M Shamim Hasan; Awasthi, Sharda Prasad; Asakura, Masahiro; Chatterjee, Shruti; Hinenoya, Atsushi; Faruque, Shah M; Yamasaki, Shinji

    2015-01-01

    Use of natural compounds as antivirulence drugs could be an alternative therapeutic approach to modify the outcome of bacterial infections, particularly in view of growing resistance to available antimicrobials. Here, we show that sub-bactericidal concentration of anethole, a component of sweet fennel seed, could suppress virulence potential in O1 El Tor biotype strains of toxigenic Vibrio cholerae, the causative agent of the ongoing 7th cholera pandemic. The expression of cholera toxin (CT) and toxin coregulated pilus (TCP), the major virulence factors of V. cholerae, is controlled through a regulatory cascade involving activation of ToxT with synergistic coupling interaction of ToxR/ToxS with TcpP/TcpH. We present evidence that anethole inhibits in vitro expression of CT and TCP in a toxT-dependent but toxR/toxS-independent manner and through repression of tcpP/tcpH, by using bead-ELISA, western blotting and quantitative real-time RT-PCR assays. The cyclic AMP (cAMP)-cAMP receptor protein (CRP) is a well-studied global signaling system in bacterial pathogens, and this complex is known to suppress expression of tcpP/tcpH in V. cholerae. We find that anethole influences the virulence regulatory cascade by over-expressing cyaA and crp genes. Moreover, suppression of toxigenic V. cholerae-mediated fluid accumulation in ligated ileum of rabbit by anethole demonstrates its potentiality as an antivirulence drug candidate against the diseases caused by toxigenic V. cholerae. Taken altogether, these results revealing a mechanism of virulence inhibition in V. cholerae by the natural compound anethole, may have relevance in designing antivirulence compounds, particularly against multiple antibiotic resistant bacterial pathogens. PMID:26361388

  4. A low power pulsed arcjet thruster for spacecraft propulsion

    NASA Astrophysics Data System (ADS)

    Willmes, Gary Francis

    1997-11-01

    An electrothermal thruster that operates in a pulsed mode at low power (<200 W) is investigated. The thruster, called a pulsed arcjet, uses a capacitor and a pulse- forming electrical circuit to transfer stored electrical energy to a helium propellant gas in 3-10 μsec arc discharges at repetition rates of 550 to 2600 pulses-per- second with pulse energies from 24 to 130 mJ. The arc discharges occur in a cylindrical capillary upstream of a converging-diverging nozzle, and all the energy addition occurs in the subsonic region. Peak currents in the arc are 110 to 270 amps. Pulsed arcjet performance at thermal steady state is measured for two 20 degree half angle conical nozzles with area ratios of 20 and 230. Thrust levels from 10 to 30 mN are measured on an inverted pendulum-type thrust stand, and input power levels from 24 to 119 watts are determined from measurements of pulse rate and breakdown voltage. A maximum specific impulse of 305 seconds is achieved with 38% efficiency. A time-dependent, quasi-1D numerical model is developed to evaluate energy losses in the pulsed arcjet. The numerical model uses a time-marching procedure and the MacCormack predictor-corrector algorithm. Viscous and heat transfer effects are incorporated though a friction factor and an average heat transfer coefficient. A numerical study of nozzle parameters, capillary geometry, wall temperature, and pulse energy shows that the performance is insensitive to capillary and nozzle geometry and that thermal characteristics are the dominant factor affecting performance. The specific impulse and efficiency of the pulsed arcjet are found to be sensitive to wall temperature due to heat transfer losses in the subsonic region. A pulse-forming electrical circuit is developed to reduce energy losses in the storage capacitor, and greater than 85% of the initial stored energy is transferred to the arc in a unipolar pulse. A high current diode installed across the capacitor terminals is used to eliminate

  5. Molecular characterisation of acquired and overproduced chromosomal blaAmpC in Escherichia coli clinical isolates.

    PubMed

    Alonso, Noemí; Miró, Elisenda; Pascual, Vanesa; Rivera, Alba; Simó, Maria; Garcia, Maria Consol; Xercavins, Mariona; Morera, Maria Antonia; Espejo, Elena; Gurguí, Mercè; Pérez, Josefa; Rodríguez-Carballeira, Mònica; Garau, Javier; Calbo, Esther; Navarro, Ferran; Mirelis, Beatriz; Coll, Pere

    2016-01-01

    Escherichia coli recovered from three hospitals in Barcelona (Spain) were studied to determine the prevalence of isolates with acquired AmpC (ac-AmpC) and/or overproduced chromosomal AmpC (c-AmpC). Mechanisms involved in blac-AmpC overexpression, blaac-AmpC and the plasmids associated with their distribution as well as the prevalence of plasmid-mediated quinolone resistance (PMQR) in AmpC-producing isolates were also determined. Isolates were selected according to their resistance phenotype. blaac-AmpC, alterations in the blac-AmpC promoter/attenuator, and PMQR genes [qnrA, qnrB, qnrS, aac(6')-Ib-cr and qepA] were characterised by PCR and sequencing. blac-AmpC expression was determined by qRT-PCR. Population structure analysis was performed using PFGE, MLST and phylogenetic group PCR. Plasmids carrying blaac-AmpC were characterised by PCR-based replicon typing and S1-PFGE. IncI1 and IncF plasmids were also analysed by plasmid MLST and replicon sequence typing, respectively. Among 21563 E. coli isolates, 240 (1.1%) overproduced AmpC β-lactamases, including 180 (75.0%) harbouring ac-AmpC (132 CMY-2 variants and 48 DHA-1) and 60 (25.0%) c-AmpC enzymes. Three mutation profiles in the blac-AmpC promoter/attenuator were associated with a 72.5-, 19.9- and 5.8-fold increased expression, respectively. Moreover, 63.3% of ac-AmpC and 43.3% of c-AmpC isolates belonged to B2, D, E or F phylogenetic groups. PMQR was found in 31% of ac-AmpC isolates [38 qnrB4, 8 aac(6')-Ib-cr, 6 qnrS1 and 3 qnrB19] and in 10% of c-AmpC isolates [5 aac(6')-Ib-cr and 1 qnrS1]. IncI1-ST12 and IncF were associated with blaCMY-2 and blaDHA-1, respectively. These results suggest that ac-AmpC β-lactamases were the main mechanism of AmpC production. Isolates and plasmids both showed high genetic diversity.

  6. Preference pulses without reinforcers.

    PubMed

    McLean, Anthony P; Grace, Randolph C; Pitts, Raymond C; Hughes, Christine E

    2014-05-01

    Preference pulses are thought to represent strong, short-term effects of reinforcers on preference in concurrent schedules. However, the general shape of preference pulses is substantially determined by the distributions of responses-per-visit (visit lengths) for the two choice alternatives. In several series of simulations, we varied the means and standard deviations of distributions describing visits to two concurrently available response alternatives, arranged "reinforcers" according to concurrent variable-interval schedules, and found a range of different preference pulses. Because characteristics of these distributions describe global aspects of behavior, and the simulations assumed no local effects of reinforcement, these preference pulses derive from the visit structure alone. This strongly questions whether preference pulses should continue to be interpreted as representing local effects of reinforcement. We suggest an alternative approach whereby local effects are assessed by subtracting the artifactual part, which derives from visit structure, from the observed preference pulses. This yields "residual" preference pulses. We illustrate this method in application to published data from mixed dependent concurrent schedules, revealing evidence that the delivery of reinforcers had modest lengthening effects on the duration of the current visit, a conclusion that is quantitatively consistent with early research on short-term effects of reinforcement.

  7. RF pulsed heating

    NASA Astrophysics Data System (ADS)

    Pritzkau, David Peace

    RF pulsed heating is a process by which a metal is heated from magnetic fields on its surface due to high-power pulsed RF. When the thermal stresses induced are larger than the elastic limit, microcracks and surface roughening will occur due to cyclic fatigue. Pulsed heating limits the maximum magnetic field on the surface and through it the maximum achievable accelerating gradient in a normal conducting accelerator structure. An experiment using circularly cylindrical cavities operating in the TE011 mode at a resonant frequency of 11.424 GHz is designed to study pulsed heating on OFE copper, a material commonly used in normal conducting accelerator structures. The high-power pulsed RF is supplied by an X-band klystron capable of outputting 50 MW, 1.5 μs pulses. The test pieces of the cavity are designed to be removable to allow testing of different materials with different surface preparations. A diagnostic tool is developed to measure the temperature rise in the cavity utilizing the dynamic Q change of the resonant mode due to heating. The diagnostic consists of simultaneously exciting a TE012 mode to steady-state in the cavity at 18 GHz and measuring the change in reflected power as the cavity is heated from high-power pulsed RF. Two experimental runs were completed. One run was executed at a calculated temperature rise of 120 K for 56 × 106 pulses. The second run was executed at a calculated temperature rise of 82 K for 86 × 106 pulses. Scanning electron microscope pictures show extensive damage occurring in the region of maximum temperature rise on the surface of the test pieces.

  8. Dynamic pulse difference circuit

    DOEpatents

    Erickson, Gerald L.

    1978-01-01

    A digital electronic circuit of especial use for subtracting background activity pulses in gamma spectrometry comprises an up-down counter connected to count up with signal-channel pulses and to count down with background-channel pulses. A detector responsive to the count position of the up-down counter provides a signal when the up-down counter has completed one scaling sequence cycle of counts in the up direction. In an alternate embodiment, a detector responsive to the count position of the up-down counter provides a signal upon overflow of the counter.

  9. Four variants of the Citrobacter freundii AmpC-Type cephalosporinases, including novel enzymes CMY-14 and CMY-15, in a Proteus mirabilis clone widespread in Poland.

    PubMed

    Literacka, Elzbieta; Empel, Joanna; Baraniak, Anna; Sadowy, Ewa; Hryniewicz, Waleria; Gniadkowski, Marek

    2004-11-01

    Twenty-nine Proteus mirabilis isolates from 17 Polish hospitals were analyzed. The isolates were resistant to a variety of antimicrobials, and their patterns of resistance to beta-lactams resembled those of the constitutive class C cephalosporinase (AmpC) producers. Indeed, beta-lactamases with a pI of approximately 9.0 were found in all of the isolates, and they were subsequently identified as four AmpC-type cephalosporinases, CMY-4, -12, -14, and -15, of which the two last ones were novel enzyme variants. The enzymes were of Citrobacter freundii origin and were closely related to each other, with CMY-4 likely being the evolutionary precursor of the remaining ones. The bla(CMY) genes were located exclusively in chromosomal DNA, within EcoRI restriction fragments of the same size of approximately 10 kb. In the CMY-12- and -15-producing isolates, an additional fragment of approximately 4.5 kb hybridized with the bla(CMY) probe as well, which could have arisen from a duplication event during the evolution of the genes. In all of the isolates, the ISEcp1 mobile element, which most probably is involved in mobilization of the C. freundii ampC gene, was placed at the same distance from the 5' ends of the bla(CMY) genes, and sequences located between them were identical in isolates carrying each of the four genes. These data suggested that a single chromosome-to-chromosome transfer of the ampC gene from C. freundii to P. mirabilis could have initiated the spread and evolution of the AmpC-producing P. mirabilis in Poland. The hypothesis seems to be confirmed by pulsed-field gel electrophoresis typing, which revealed several cases of close relatedness between the P. mirabilis isolates from distant centers and showed an overall similarity between the majority of the multiresistant isolates.

  10. Regulatory components in Citrobacter freundii ampC beta-lactamase induction.

    PubMed

    Lindberg, F; Westman, L; Normark, S

    1985-07-01

    Citrobacter freundii encodes an inducible chromosomal beta-lactamase similar to the constitutively expressed ampC beta-lactamase of Escherichia coli. In the latter species the ampC gene is located next to the fumarate reductase (frd) operon, whereas in C. freundii the ampC gene is known to be separated from frd by 1100 base pairs. This intervening DNA segment carries a gene, ampR, coding for a 31-kilodalton polypeptide. The cloned C. freundii OS60 ampC gene is inducible by beta-lactam antibiotics in E. coli, but only in the presence of an intact ampR gene. In the absence of inducer the AmpR protein represses C. freundii ampC synthesis 2.5-fold. Addition of beta-lactams induced expression from the cloned ampC beta-lactamase gene 11-fold. Thus, the AmpR protein has a positive effect on ampC expression in the presence of inducing beta-lactams. Two spontaneous mutants of C. freundii were isolated that constitutively overproduce the ampC beta-lactamase. The mutations in both these strains occurred outside the frd-amp region, suggesting that there is at least one additional component in the regulatory system. With the cloned C. freundii ampC gene in E. coli, mutants with the same phenotype could be obtained. These mutations were located on the E. coli chromosome. The constitutive beta-lactamase overproduction in these mutants requires the presence of an intact ampR gene.

  11. Protein Kinase A-Dependent and -Independent Signaling Pathways Contribute to Cyclic AMP-Stimulated Proliferation

    PubMed Central

    Cass, Lisa A.; Summers, Scott A.; Prendergast, Gregory V.; Backer, Jonathan M.; Birnbaum, Morris J.; Meinkoth, Judy L.

    1999-01-01

    The effects of cyclic AMP (cAMP) on cell proliferation are cell type specific. Although the growth-inhibitory effects of cAMP have been well studied, much less is known regarding how cAMP stimulates proliferation. We report that cAMP stimulates proliferation through both protein kinase A (PKA)-dependent and PKA-independent signaling pathways and that phosphatidylinositol 3-kinase (PI3K) is required for cAMP-stimulated mitogenesis. In cells where cAMP is a mitogen, cAMP-elevating agents stimulate membrane ruffling, Akt phosphorylation, and p70 ribosomal S6 protein kinase (p70s6k) activity. cAMP effects on ruffle formation and Akt were PKA independent but sensitive to wortmannin. In contrast, cAMP-stimulated p70s6k activity was repressed by PKA inhibitors but not by wortmannin or microinjection of the N-terminal SH2 domain of the p85 regulatory subunit of PI3K, indicating that p70s6k and Akt can be regulated independently. Microinjection of highly specific inhibitors of PI3K or Rac1, or treatment with the p70s6k inhibitor rapamycin, impaired cAMP-stimulated DNA synthesis, demonstrating that PKA-dependent and -independent pathways contribute to cAMP-mediated mitogenesis. Direct elevation of PI3K activity through microinjection of an antibody that stimulates PI3K activity or stable expression of membrane-localized p110 was sufficient to confer hormone-independent DNA synthesis when accompanied by elevations in p70s6k activity. These findings indicate that multiple pathways contribute to cAMP-stimulated mitogenesis, only some of which are PKA dependent. Furthermore, they demonstrate that the ability of cAMP to stimulate both p70s6k- and PI3K-dependent pathways is an important facet of cAMP-regulated cell cycle progression. PMID:10454535

  12. Interface demarcation in GaAs by current pulsing

    NASA Technical Reports Server (NTRS)

    Matthiesen, D. H.; Kafalas, J. A.; Duchene, G. A.; Bellows, A. H.

    1990-01-01

    GTE Laboratories is currently conducting a program to investigate the effect of convection in the melt on the properties of bulk grown gallium arsenide (GaAs). In addition to extensive ground based experimentation, a Get Away Special growth system has been developed to grow two GaAs crystals aboard the Space Shuttle, each with a one inch diameter. In order to perform a complete segregation analysis of the crystals grown in space, it is necessary to measure the interface shape and growth rate as well as the spatial distribution of the selenium dopant. The techniques for interface demarcation in selenium doped GaAs by current pulsing have been developed at GTE Laboratories and successful interface demarcation has been achieved for current pulses ranging from 20 to 90 amps, in both single crystal and polycrystalline regions.

  13. Epidermal chalone and cyclic AMP: an in vivo study.

    PubMed

    Elgjo, K

    1975-01-01

    Water extracts of skin contain two factors that inhibit epidermal cell proliferation: one substance inhibits epidermal cells in the G2 phase (the epidermal G2 inhibitor), and another inhibits the transit of cells from the G1 phase into the S phase (the epidermal G1 inhibitor). Pretreatment of mice with a beta-receptor antagonist (propranolol) abolished the activity of the G2 inhibitor but not that of the G1 inhibitor. After pretreatment with both propranolol and a phosphodiesterase inhibitor (caffine)the G2 inhibitor had full effect. Cafine alone had a moderately inhibitory effect on epidermal G2 cells and enhanced the depressing effect of the G1 inhibitor on epidermal DNA synthesis. AMP level in epidermis to be active. Cyclic AMP is probably also involved in the regulation of the rate of transit of epidermal G1 cells into the S phase but the epidermal cyclic AMP level seems not to be so critical for the efficacy of the epidermal G2 inhibitor in epidermal cell differentiation. PMID:162919

  14. Software Design Document for the AMP Nuclear Fuel Performance Code

    SciTech Connect

    Philip, Bobby; Clarno, Kevin T; Cochran, Bill

    2010-03-01

    The purpose of this document is to describe the design of the AMP nuclear fuel performance code. It provides an overview of the decomposition into separable components, an overview of what those components will do, and the strategic basis for the design. The primary components of a computational physics code include a user interface, physics packages, material properties, mathematics solvers, and computational infrastructure. Some capability from established off-the-shelf (OTS) packages will be leveraged in the development of AMP, but the primary physics components will be entirely new. The material properties required by these physics operators include many highly non-linear properties, which will be replicated from FRAPCON and LIFE where applicable, as well as some computationally-intensive operations, such as gap conductance, which depends upon the plenum pressure. Because there is extensive capability in off-the-shelf leadership class computational solvers, AMP will leverage the Trilinos, PETSc, and SUNDIALS packages. The computational infrastructure includes a build system, mesh database, and other building blocks of a computational physics package. The user interface will be developed through a collaborative effort with the Nuclear Energy Advanced Modeling and Simulation (NEAMS) Capability Transfer program element as much as possible and will be discussed in detail in a future document.

  15. Cyclic AMP and its functional relationship in Tetrahymena: a comparison between phagocytosis and glucose uptake.

    PubMed

    Csaba, G; Nagy, S U; Lantos, T

    1978-01-01

    In Tetrahymena, an increase in the level of cAMP is accompanied by an increased phagocytotic rate, whereas increased sugar uptake is parallelled by a decreased cAMP level. The increase in cAMP level seems to be decisive with respect to phagocytosis as a basic phenomenon of life. In the action of epinephrine, however, some mechanism other than cAMP mediation may be involved. Depending on concentration, one hormone may provoke either an increase or a decrease in cAMP level, and this in turn triggers the corresponding function.

  16. Pulse Coil Tester

    NASA Technical Reports Server (NTRS)

    Simon, Richard A.

    1988-01-01

    Set of relays tested easily and repeatedly. Pulse coil tester causes coil under test to generate transient voltage; waveform indicates condition of coil. Tester accommodates assembly of up to four coils at a time.

  17. HIGH POWER PULSED OSCILLATOR

    DOEpatents

    Singer, S.; Neher, L.K.

    1957-09-24

    A high powered, radio frequency pulse oscillator is described for generating trains of oscillations at the instant an input direct voltage is impressed, or immediately upon application of a light pulse. In one embodiment, the pulse oscillator comprises a photo-multiplier tube with the cathode connected to the first dynode by means of a resistor, and adjacent dynodes are connected to each other through adjustable resistors. The ohmage of the resistors progressively increases from a very low value for resistors adjacent the cathode to a high value adjacent the plate, the last dynode. Oscillation occurs with this circuit when a high negative voltage pulse is applied to the cathode and the photo cathode is bombarded. Another embodiment adds capacitors at the resistor connection points of the above circuit to increase the duration of the oscillator train.

  18. Pulsed mode cathode

    NASA Technical Reports Server (NTRS)

    Myers, Roger M. (Inventor); Rawlin, Vinvent K. (Inventor)

    1994-01-01

    A cathode in an MPD thruster has an internal heater and utilizes low work function material. The cathode is preheated to operating temperature, and then the thruster is fired by discharging a capacitor bank in a pulse forming network.

  19. Pulsed-neutron monochromator

    DOEpatents

    Mook, H.A. Jr.

    1984-01-01

    In one aspect, the invention is an improved pulsed-neutron monochromator of the vibrated-crystal type. The monochromator is designed to provide neutron pulses which are characterized both by short duration and high density. A row of neutron-reflecting crystals is disposed in a neutron beam to reflect neutrons onto a common target. The crystals in the row define progressively larger neutron-scattering angles and are vibrated sequentially in descending order with respect to the size of their scattering angles, thus generating neutron pulses which arrive simultaneously at the target. Transducers are coupled to one end of the crystals to vibrate them in an essentially non-resonant mode. The transducers propagate transverse waves in the crystal which progress longitudinally therein. The waves are absorbed at the undriven ends of the crystals by damping material mounted thereon. In another aspect, the invention is a method for generating neutron pulses characterized by high intensity and short duration.

  20. Pulsed-neutron monochromator

    DOEpatents

    Mook, Jr., Herbert A.

    1985-01-01

    In one aspect, the invention is an improved pulsed-neutron monochromator of the vibrated-crystal type. The monochromator is designed to provide neutron pulses which are characterized both by short duration and high density. A row of neutron-reflecting crystals is disposed in a neutron beam to reflect neutrons onto a common target. The crystals in the row define progressively larger neutron-scattering angles and are vibrated sequentially in descending order with respect to the size of their scattering angles, thus generating neutron pulses which arrive simultaneously at the target. Transducers are coupled to one end of the crystals to vibrate them in an essentially non-resonant mode. The transducers propagate transverse waves in the crystal which progress longitudinally therein. The wave are absorbed at the undriven ends of the crystals by damping material mounted thereon. In another aspect, the invention is a method for generating neutron pulses characterized by high intensity and short duration.

  1. Multiple pulse laser

    SciTech Connect

    Hughes, R.S.; Jernigan, J.L.

    1981-02-10

    A multiple pulse laser from a single resonant cavity is disclosed. An acousto-optic cell is used to modulate coherent light from a lasing element. Either multiple chirp signals or a masked mirror are used to provide distinct pulses of light. Through proper choice of materials for the acousto-optic cell and use of divergent optics, a higher power level is obtained. Use of a multi-tapped delay line permits a shorter period between pulses due to the linear superposition principle. When the mask embodiment is used, the acousto-optic cell focuses light which scans across the mask. Whenever the focused light passes through the mask, lasing occurs which generates an output pulse.

  2. Pulse measurement apparatus and method

    DOEpatents

    Marciante, John R.; Donaldson, William R.; Roides, Richard G.

    2011-10-25

    An embodiment of the invention is directed to a pulse measuring system that measures a characteristic of an input pulse under test, particularly the pulse shape of a single-shot, nano-second duration, high shape-contrast optical or electrical pulse. An exemplary system includes a multi-stage, passive pulse replicator, wherein each successive stage introduces a fixed time delay to the input pulse under test, a repetitively-gated electronic sampling apparatus that acquires the pulse train including an entire waveform of each replica pulse, a processor that temporally aligns the replicated pulses, and an averager that temporally averages the replicated pulses to generate the pulse shape of the pulse under test. An embodiment of the invention is directed to a method for measuring an optical or an electrical pulse shape. The method includes the steps of passively replicating the pulse under test with a known time delay, temporally stacking the pulses, and temporally averaging the stacked pulses. An embodiment of the invention is directed to a method for increasing the dynamic range of a pulse measurement by a repetitively-gated electronic sampling device having a rated dynamic range capability, beyond the rated dynamic range of the sampling device; e.g., enhancing the dynamic range of an oscilloscope. The embodied technique can improve the SNR from about 300:1 to 1000:1. A dynamic range enhancement of four to seven bits may be achieved.

  3. Pulsed spallation neutron sources

    SciTech Connect

    Carpenter, J.M.

    1996-05-01

    This paper reviews the early history of pulsed spallation neutron source development ar Argonne and provides an overview of existing sources world wide. A number of proposals for machines more powerful than currently exist are under development, which are briefly described. The author reviews the status of the Intense Pulsed Neutron Source, its instrumentation, and its user program, and provide a few examples of applications in fundamental condensed matter physics, materials science and technology.

  4. Pulsed spallation Neutron Sources

    SciTech Connect

    Carpenter, J.M.

    1994-12-31

    This paper reviews the early history of pulsed spallation neutron source development at Argonne and provides an overview of existing sources world wide. A number of proposals for machines more powerful than currently exist are under development, which are briefly described. The author reviews the status of the Intense Pulsed Neutron Source, its instrumentation, and its user program, and provides a few examples of applications in fundamental condensed matter physics, materials science and technology.

  5. RF Pulsed Heating

    NASA Astrophysics Data System (ADS)

    Pritzkau, D. P.

    2002-01-01

    RF pulsed heating is a process by which a metal is heated from magnetic elds on its surface due to high-power pulsed RF. When the thermal stresses induced are larger than the elastic limit, microcracks and surface roughening will occur due to cyclic fatigue. Pulsed heating limits the maximum magnetic eld on the surface and through it the maximum achievable accelerating gradient in a normal conducting accelerator structure. An experiment using circularly cylindrical cavities operating in the TE011 mode at a resonant frequency of 11:424 GHz is designed to study pulsed heating on OFE copper, a material commonly used in normal conducting accelerator structures. The high-power pulsed RF is supplied by an X-band klystron capable of outputting 50 MW, 1:5 s perent surface preparations.he cavity are designed to A diagnostic tool is developed to measure the temperature rise in the cavity utilizing the dynamic Q change of the resonant mode due to heating. The diagnostic consists of simultaneously exciting a TE012 mode to steady-state in the cavity at 18 GHz and measuring the change in re ected power as the cavity is heated from high-power pulsed RF. Two experimental runs were completed. One run was executed at a calculated temperature rise of 120 K for 56 106 pulses. The second run was executed at a calculated temperature rise of 82 K for 86106 pulses. Scanning electron microscope pictures show extensive damage occurring in the region of maximum temperature rise on the surface of the test pieces.

  6. Pulse magnetic welder

    DOEpatents

    Christiansen, D.W.; Brown, W.F.

    1984-01-01

    A welder is described for automated closure of fuel pins by a pulsed magnetic process in which the open end of a length of cladding is positioned within a complementary tube surrounded by a pulsed magnetic welder. Seals are provided at each end of the tube, which can be evacuated or can receive tag gas for direct introduction to the cladding interior. Loading of magnetic rings and end caps is accomplished automatically in conjunction with the welding steps carried out within the tube.

  7. Expression profiles of antimicrobial peptides (AMPs) and their regulation by Relish

    NASA Astrophysics Data System (ADS)

    Wang, Dongdong; Li, Fuhua; Li, Shihao; Wen, Rong; Xiang, Jianhai

    2012-07-01

    Antimicrobial peptides (AMPs), as key immune effectors, play important roles in the innate immune system of invertebrates. Different types of AMPs, including Penaeidin, Crustin, ALF (antilipopolysaccharide factor) have been identified in different penaeid shrimp; however, systematic analyses on the function of different AMPs in shrimp responsive to different types of bacteria are very limited. In this study, we analyzed the expression profiles of AMPs in the Chinese shrimps, Fenneropenaeus chinensis, simultaneously by real-time RT-PCR (reverse transcription-polymerase chain reaction) when shrimp were challenged with Micrococcus lysodeikticus (Gram-positive, G+) or Vibrio anguillarium (Gram-negative, G-). Different AMPs showed different expression profiles when shrimp were injected with one type of bacterium, and one AMP also showed different expression profiles when shrimp were challenged with different bacteria. Furthermore, the expression of these AMPs showed temporal expression profiles, suggesting that different AMPs function coordinately in bacteria-infected shrimp. An RNA interference approach was used to study the function of the Relish transcription factor in regulating the transcription of different AMPs. The current study showed that Relish could regulate the transcription of different AMPs in shrimp. Differential expression profiles of AMPs in shrimp injected with different types of bacteria indicated that a complicated antimicrobial response network existed in shrimp. These data contribute to our understanding of immunity in shrimp and may provide a strategy for the control of disease in shrimp.

  8. 3':5'-cyclic AMP and hormonal control of puparium formation in the fleshfly Sarcophaga bullata.

    PubMed

    Fraenkel, G; Blechl, A; Blechl, J; Herman, P; Seligman, M I

    1977-05-01

    Injection of 3':5'-cyclic AMP (cAMP) into larvae of the fly Sarcophaga bullata 3-4 hr before the beginning of puparium formation (red-spiracle stage) greatly accelerates the onset of tanning without affecting initiation of puparium formation (anterior retraction). Accelerated tanning resembles real tanning in two important respects: the solubility of cuticular proteins becomes reduced and [U-14C]tyrosine is incorporated into the cuticle. Of a number of cAMP analogues tested, 3':5'- cyclic GMP, 2':3'-cyclic AMP, and 5'-AMP were inactive, dibutyryl-3':5'-cAMP had only slight activity, and cyclic IMP and deoxy-3':5'-cAMP showed some activity. Theophylline enhanced the effect of small doses of cAMP or of blood, diluted 1:8, active in the puparium tanning factor. Injection of dopa, dopamine, acetyldopamine, or epinephrine, but not of tyrosine, had an accelerating effect similar to that of cAMP. The tanning-inhibiting effect of DL-alpha-methyl-alpha-hydrazino-beta-(3,4-dihydroxyphenyl)propionic acid monohydrate is reversed by dopamine or epinephrine, but not by tyrosine, dopa, or cAMP. Evidence is presented to indicate that the responses to cAMP are not artifacts but reflect actual biochemical events during tanning.

  9. Orthologous and Paralogous AmpD Peptidoglycan Amidases from Gram-Negative Bacteria

    PubMed Central

    Rivera, Ivanna; Molina, Rafael; Lee, Mijoon; Mobashery, Shahriar

    2016-01-01

    Cell wall recycling and β-lactam antibiotic resistance are linked in Enterobacteriaceae and in Pseudomonas aeruginosa. This process involves a large number of murolytic enzymes, among them a cytoplasmic peptidoglycan amidase AmpD, which plays an essential role by cleaving the peptide stem from key intermediates en route to the β-lactamase production (a resistance mechanism) and cell wall recycling. Uniquely, P. aeruginosa has two additional paralogues of AmpD, designated AmpDh2 and AmpDh3, which are periplasmic enzymes. Despite the fact that AmpDh2 and AmpDh3 share a common motif for their respective catalytic domains, they are each comprised of multidomain architectures and exhibit distinct oligomerization properties. We review herein the structural and biochemical properties of orthologous and paralogous AmpD proteins and discuss their implication in cell wall recycling and antibiotic resistance processes. PMID:27326855

  10. A Fluorescent Transport Assay Enables Studying AmpG Permeases Involved in Peptidoglycan Recycling and Antibiotic Resistance.

    PubMed

    Perley-Robertson, G Evan; Yadav, Anuj K; Winogrodzki, Judith L; Stubbs, Keith A; Mark, Brian L; Vocadlo, David J

    2016-09-16

    Inducible AmpC β-lactamases deactivate a broad-spectrum of β-lactam antibiotics and afford antibiotic resistance in many Gram-negative bacteria. The disturbance of peptidoglycan recycling caused by β-lactam antibiotics leads to accumulation of GlcNAc-1,6-anhydroMurNAc-peptides, which are transported by AmpG to the cytoplasm where they are processed into AmpC inducers. AmpG transporters are poorly understood; however, their loss restores susceptibility toward β-lactam antibiotics, highlighting AmpG as a potential target for resistance-attenuating therapeutics. We prepare a GlcNAc-1,6-anhydroMurNAc-fluorophore conjugate and, using live E. coli spheroplasts, quantitatively analyze its transport by AmpG and inhibition of this process by a competing substrate. Further, we use this transport assay to evaluate the function of two AmpG homologues from Pseudomonas aeruginosa and show that P. aeruginosa AmpG (Pa-AmpG) but not AmpP (Pa-AmpP) transports this probe substrate. We corroborate these results by AmpC induction assays with Pa-AmpG and Pa-AmpP. This fluorescent AmpG probe and spheroplast-based transport assay will enable improved understanding of PG recycling and of permeases from the major facilitator superfamily of transport proteins and may aid in identification of AmpG antagonists that combat AmpC-mediated resistance toward β-lactam antibiotics.

  11. A versatile pulse programmer for pulsed nuclear magnetic resonance spectroscopy.

    NASA Technical Reports Server (NTRS)

    Tarr, C. E.; Nickerson, M. A.

    1972-01-01

    A digital pulse programmer producing the standard pulse sequences required for pulsed nuclear magnetic resonance spectroscopy is described. In addition, a 'saturation burst' sequence, useful in the measurement of long relaxation times in solids, is provided. Both positive and negative 4 V trigger pulses are produced that are fully synchronous with a crystal-controlled time base, and the pulse programmer may be phase-locked with a maximum pulse jitter of 3 ns to the oscillator of a coherent pulse spectrometer. Medium speed TTL integrated circuits are used throughout.

  12. LED flicker pulsing

    NASA Astrophysics Data System (ADS)

    Johnson, Mark A.; Cote, Paul J.

    2001-08-01

    There is need to replace hazardous radioluminescent light sources with a means of illumination that is environmentally friendly. This paper describes an electronic source that was developed as a potential candidate to replace low intensity tritium in a military system. It employs an LED for illumination and a 3-volt coin cell battery as a power source. This new light source is electronically invisible, requires minimal maintenance, and provides the lowest practical illumination to preclude detection by optical means. The low intensity requires that the LED be driven at DC current levels resulting in poor luminous efficiency. Therefore, in an effort to maximize battery life, the LED is pulsed into a more optically efficient mode of operation. However, conventional pulsing techniques are not employed because of concerns the electronics could be identified by conspicuous power spectral density (PSD) components in the electromagnetic spectrum generated by a pulsed LED. Therefore, flicker noise concepts have been employed to efficiently drive the LED while generating a virtually undetectable spectral signature. Although ideally the pulse durations, magnitudes, and spacings should be random, a significant reduction in conspicuous PSD components can be achieved when imposing practical constraints. The dominant components of the power spectrum are significantly reduced using fixed pulse durations and magnitudes while varying only the pulse spacing. The mean duty cycle is set to provide the same effective illumination as DC operation while generating a PSD normally associated with natural phenomena.

  13. Opposing Activity Changes in AMP Deaminase and AMP-Activated Protein Kinase in the Hibernating Ground Squirrel

    PubMed Central

    Cicerchi, Christina; Garcia, Gabriela E.; Roncal-Jimenez, Carlos A.; Trostel, Jessica; Jain, Swati; Mant, Colin T.; Rivard, Christopher J.; Ishimoto, Takuji; Shimada, Michiko; Sanchez-Lozada, Laura Gabriela; Nakagawa, Takahiko; Jani, Alkesh; Stenvinkel, Peter; Martin, Sandra L.; Johnson, Richard J.

    2015-01-01

    Hibernating animals develop fatty liver when active in summertime and undergo a switch to a fat oxidation state in the winter. We hypothesized that this switch might be determined by AMP and the dominance of opposing effects: metabolism through AMP deaminase (AMPD2) (summer) and activation of AMP-activated protein kinase (AMPK) (winter). Liver samples were obtained from 13-lined ground squirrels at different times during the year, including summer and multiples stages of winter hibernation, and fat synthesis and β-fatty acid oxidation were evaluated. Changes in fat metabolism were correlated with changes in AMPD2 activity and intrahepatic uric acid (downstream product of AMPD2), as well as changes in AMPK and intrahepatic β-hydroxybutyrate (a marker of fat oxidation). Hepatic fat accumulation occurred during the summer with relatively increased enzymes associated with fat synthesis (FAS, ACL and ACC) and decreased enoyl CoA hydratase (ECH1) and carnitine palmitoyltransferase 1A (CPT1A), rate limiting enzymes of fat oxidation. In summer, AMPD2 activity and intrahepatic uric acid levels were high and hepatic AMPK activity was low. In contrast, the active phosphorylated form of AMPK and β-hydroxybutyrate both increased during winter hibernation. Therefore, changes in AMPD2 and AMPK activity were paralleled with changes in fat synthesis and fat oxidation rates during the summer-winter cycle. These data illuminate the opposing forces of metabolism of AMP by AMPD2 and its availability to activate AMPK as a switch that governs fat metabolism in the liver of hibernating ground squirrel. PMID:25856396

  14. Opposing activity changes in AMP deaminase and AMP-activated protein kinase in the hibernating ground squirrel.

    PubMed

    Lanaspa, Miguel A; Epperson, L Elaine; Li, Nanxing; Cicerchi, Christina; Garcia, Gabriela E; Roncal-Jimenez, Carlos A; Trostel, Jessica; Jain, Swati; Mant, Colin T; Rivard, Christopher J; Ishimoto, Takuji; Shimada, Michiko; Sanchez-Lozada, Laura Gabriela; Nakagawa, Takahiko; Jani, Alkesh; Stenvinkel, Peter; Martin, Sandra L; Johnson, Richard J

    2015-01-01

    Hibernating animals develop fatty liver when active in summertime and undergo a switch to a fat oxidation state in the winter. We hypothesized that this switch might be determined by AMP and the dominance of opposing effects: metabolism through AMP deaminase (AMPD2) (summer) and activation of AMP-activated protein kinase (AMPK) (winter). Liver samples were obtained from 13-lined ground squirrels at different times during the year, including summer and multiples stages of winter hibernation, and fat synthesis and β-fatty acid oxidation were evaluated. Changes in fat metabolism were correlated with changes in AMPD2 activity and intrahepatic uric acid (downstream product of AMPD2), as well as changes in AMPK and intrahepatic β-hydroxybutyrate (a marker of fat oxidation). Hepatic fat accumulation occurred during the summer with relatively increased enzymes associated with fat synthesis (FAS, ACL and ACC) and decreased enoyl CoA hydratase (ECH1) and carnitine palmitoyltransferase 1A (CPT1A), rate limiting enzymes of fat oxidation. In summer, AMPD2 activity and intrahepatic uric acid levels were high and hepatic AMPK activity was low. In contrast, the active phosphorylated form of AMPK and β-hydroxybutyrate both increased during winter hibernation. Therefore, changes in AMPD2 and AMPK activity were paralleled with changes in fat synthesis and fat oxidation rates during the summer-winter cycle. These data illuminate the opposing forces of metabolism of AMP by AMPD2 and its availability to activate AMPK as a switch that governs fat metabolism in the liver of hibernating ground squirrel.

  15. Expression and organization of BP74, a cyclic AMP-regulated gene expressed during Dictyostelium discoideum development.

    PubMed Central

    Hopkinson, S B; Pollenz, R S; Drummond, I; Chisholm, R L

    1989-01-01

    We have characterized a cDNA and the corresponding gene for a cyclic AMP-inducible gene expressed during Dictyostelium development. This gene, BP74, was found to be first expressed about the time of aggregate formation, approximately 6 h after starvation. Accumulation of BP74 mRNA did not occur in Dictyostelium cells that had been starved in fast-shaken suspension cultures but was induced in similar cultures to which cyclic AMP pulses had been added. The BP74 cDNA and gene were characterized by DNA sequence analysis and transcriptional mapping. When the BP74 promoter region was fused with a chloramphenicol acetyltransferase reporter gene and reintroduced into Dictyostelium cells, the transfected chloramphenicol acetyltransferase gene displayed the same developmentally regulated pattern of expression as did the endogenous BP74 gene, suggesting that all of the cis-acting elements required for regulated expression were carried by a 2-kilobase cloned genomic fragment. On the basis of sequence analysis, the gene appeared to encode a protein containing a 20-residue hydrophobic sequence at the amino-terminal end and 26 copies of a 20-amino-acid repeat. Images PMID:2555685

  16. Three-dimensional measurement of cAMP gradients using hyperspectral confocal microscopy

    NASA Astrophysics Data System (ADS)

    Rich, Thomas C.; Annamdevula, Naga; Britain, Andrea L.; Mayes, Samuel; Favreau, Peter F.; Leavesley, Silas J.

    2016-03-01

    Cyclic AMP (cAMP) is a ubiquitous second messenger known to differentially regulate many cellular functions over a wide range of timescales. Several lines of evidence have suggested that the distribution of cAMP within cells is not uniform, and that cAMP compartmentalization is largely responsible for signaling specificity within the cAMP signaling pathway. However, to date, no studies have experimentally measured three dimensional (3D) cAMP distributions within cells. Here we use both 2D and 3D hyperspectral microscopy to visualize cAMP gradients in endothelial cells from the pulmonary microvasculature (PMVECs). cAMP levels were measured using a FRETbased cAMP sensor comprised of a cAMP binding domain from EPAC sandwiched between FRET donors and acceptors -- Turquoise and Venus fluorescent proteins. Data were acquired using either a Nikon A1R spectral confocal microscope or custom spectral microscopy system. Analysis of hyperspectral image stacks from a single confocal slice or from summed images of all slices (2D analysis) indicated little or no cAMP gradients were formed within PMVECs under basal conditions or following agonist treatment. However, analysis of hyperspectral image stacks from 3D cellular geometries (z stacks) demonstrate marked cAMP gradients from the apical to basolateral membrane of PMVECs. These results strongly suggest that 2D imaging studies of cAMP compartmentalization -- whether epifluorescence or confocal microscopy -- may lead to erroneous conclusions about the existence of cAMP gradients, and that 3D studies are required to assess mechanisms of signaling specificity.

  17. Pulse shaping with transmission lines

    DOEpatents

    Wilcox, R.B.

    1985-08-15

    A method and apparatus for forming shaped voltage pulses uses passive reflection from a transmission line with nonuniform impedance. The impedance of the reflecting line varies with length in accordance with the desired pulse shape. A high voltage input pulse is transmitted to the reflecting line. A reflected pulse is produced having the desired shape and is transmitted by pulse removal means to a load. Light activated photoconductive switches made of silicon can be utilized. The pulse shaper can be used to drive a Pockels cell to produce shaped optical pulses.

  18. Pulse shaping with transmission lines

    DOEpatents

    Wilcox, Russell B.

    1987-01-01

    A method and apparatus for forming shaped voltage pulses uses passive reflection from a transmission line with nonuniform impedance. The impedance of the reflecting line varies with length in accordance with the desired pulse shape. A high voltage input pulse is transmitted to the reflecting line. A reflected pulse is produced having the desired shape and is transmitted by pulse removal means to a load. Light activated photoconductive switches made of silicon can be utilized. The pulse shaper can be used to drive a Pockels cell to produce shaped optical pulses.

  19. CFE-1, a novel plasmid-encoded AmpC beta-lactamase with an ampR gene originating from Citrobacter freundii.

    PubMed

    Nakano, Ryuichi; Okamoto, Ryoichi; Nakano, Yumiko; Kaneko, Kenichi; Okitsu, Naohiro; Hosaka, Yoshio; Inoue, Matsuhisa

    2004-04-01

    A clinical isolate of Escherichia coli from a patient in Japan, isolate KU6400, was found to produce a plasmid-encoded beta-lactamase that conferred resistance to extended-spectrum cephalosporins and cephamycins. Resistance arising from production of a beta-lactamase could be transferred by either conjugation or transformation with plasmid pKU601 into E. coli ML4947. The substrate and inhibition profiles of this enzyme resembled those of the AmpC beta-lactamase. The resistance gene of pKU601, which was cloned and expressed in E. coli, proved to contain an open reading frame showing 99.8% DNA sequence identity with the ampC gene of Citrobacter freundii GC3. DNA sequence analysis also identified a gene upstream of ampC whose sequence was 99.0% identical to the ampR gene from C. freundii GC3. In addition, a fumarate operon (frdABCD) and an outer membrane lipoprotein (blc) surrounding the ampR-ampC genes in C. freundii were identified, and insertion sequence (IS26) elements were observed on both sides of the sequences identified (forming an IS26 composite transposon); these results confirm the evidence of the translocation of a beta-lactamase-associated gene region from the chromosome to a plasmid. Finally, we describe a novel plasmid-encoded AmpC beta-lactamase, CFE-1, with an ampR gene derived from C. freundii.

  20. Efficient optical pulse stacker system

    DOEpatents

    Seppala, Lynn G.; Haas, Roger A.

    1982-01-01

    Method and apparatus for spreading and angle-encoding each pulse of a multiplicity of small area, short pulses into several temporally staggered pulses by use of appropriate beam splitters, with the optical elements being arranged so that each staggered pulse is contiguous with one or two other such pulses, and the entire sequence of stacked pulses comprising a single, continuous long pulse. The single long pulse is expanded in area, and then doubly passed through a nonstorage laser amplifier such as KrF. After amplification, the physically separated, angle-encoded and temporally staggered pulses are recombined into a single pulse of short duration. This high intensity output beam is well collimated and may be propagated over long distance, or used for irradiating inertial confinement fusion targets.

  1. High voltage pulse generator

    DOEpatents

    Fasching, George E.

    1977-03-08

    An improved high-voltage pulse generator has been provided which is especially useful in ultrasonic testing of rock core samples. An N number of capacitors are charged in parallel to V volts and at the proper instance are coupled in series to produce a high-voltage pulse of N times V volts. Rapid switching of the capacitors from the paralleled charging configuration to the series discharging configuration is accomplished by using silicon-controlled rectifiers which are chain self-triggered following the initial triggering of a first one of the rectifiers connected between the first and second of the plurality of charging capacitors. A timing and triggering circuit is provided to properly synchronize triggering pulses to the first SCR at a time when the charging voltage is not being applied to the parallel-connected charging capacitors. Alternate circuits are provided for controlling the application of the charging voltage from a charging circuit to be applied to the parallel capacitors which provides a selection of at least two different intervals in which the charging voltage is turned "off" to allow the SCR's connecting the capacitors in series to turn "off" before recharging begins. The high-voltage pulse-generating circuit including the N capacitors and corresponding SCR's which connect the capacitors in series when triggered "on" further includes diodes and series-connected inductors between the parallel-connected charging capacitors which allow sufficiently fast charging of the capacitors for a high pulse repetition rate and yet allow considerable control of the decay time of the high-voltage pulses from the pulse-generating circuit.

  2. Photoconductive circuit element pulse generator

    DOEpatents

    Rauscher, Christen

    1989-01-01

    A pulse generator for characterizing semiconductor devices at millimeter wavelength frequencies where a photoconductive circuit element (PCE) is biased by a direct current voltage source and produces short electrical pulses when excited into conductance by short laser light pulses. The electrical pulses are electronically conditioned to improve the frequency related amplitude characteristics of the pulses which thereafter propagate along a transmission line to a device under test.

  3. HydroPulse Drilling

    SciTech Connect

    J.J. Kolle

    2004-04-01

    Tempress HydroPulse{trademark} tool increases overbalanced drilling rates by generating intense suction pulses at the drill bit. This report describes the operation of the tool; results of pressure drilling tests, wear tests and downhole drilling tests; and the business case for field applications. The HydroPulse{trademark} tool is designed to operate on weighted drilling mud at conventional flow rates and pressures. Pressure drilling tests confirm that the HydroPulse{trademark} tool provides 33% to 200% increased rate of penetration. Field tests demonstrated conventional rotary and mud motor drilling operations. The tool has been operated continuous for 50 hours on weighted mud in a wear test stand. This level of reliability is the threshold for commercial application. A seismic-while-drilling version of the tool was also developed and tested. This tool was used to demonstrate reverse vertical seismic profiling while drilling an inclined test well with a PDC bit. The primary applications for the HydroPulse{trademark} tool are deep onshore and offshore drilling where rate of penetration drives costs. The application of the seismic tool is vertical seismic profiling-while-drilling and look-ahead seismic imaging while drilling.

  4. Kilovolt Blumlein pulse generator with variable pulse duration and polarity

    NASA Astrophysics Data System (ADS)

    de Angelis, Andrea; Kolb, Juergen F.; Zeni, Luigi; Schoenbach, Karl H.

    2008-04-01

    A Blumlein pulse generator which utilizes the superposition of electrical pulses launched from two individually switched pulse forming lines has been designed and tested. By using a power metal-oxide-semiconductor field-effect transistor as a switch on each end of the Blumlein line, we were able to generate pulses with amplitudes of 1kV across a 100Ω load. Pulse duration and polarity can be controlled by the temporal delay in the triggering of the two switches. Using this technique, we have demonstrated the generation of pulses with durations between 8 and 60ns. The lower limit in pulse duration was determined by the switch closing time and the upper limit by the length of the pulse forming line. A further advantage of the concept is that pulse distortions caused by the non-negligible on-resistance of a line with a single switch can be eliminated by using switches with identical characteristics.

  5. Kilovolt Blumlein pulse generator with variable pulse duration and polarity.

    PubMed

    de Angelis, Andrea; Kolb, Juergen F; Zeni, Luigi; Schoenbach, Karl H

    2008-04-01

    A Blumlein pulse generator which utilizes the superposition of electrical pulses launched from two individually switched pulse forming lines has been designed and tested. By using a power metal-oxide-semiconductor field-effect transistor as a switch on each end of the Blumlein line, we were able to generate pulses with amplitudes of 1 kV across a 100 Omega load. Pulse duration and polarity can be controlled by the temporal delay in the triggering of the two switches. Using this technique, we have demonstrated the generation of pulses with durations between 8 and 60 ns. The lower limit in pulse duration was determined by the switch closing time and the upper limit by the length of the pulse forming line. A further advantage of the concept is that pulse distortions caused by the non-negligible on-resistance of a line with a single switch can be eliminated by using switches with identical characteristics.

  6. A novel cysteine-rich antifungal peptide ToAMP4 from Taraxacum officinale Wigg. flowers.

    PubMed

    Astafieva, A A; Rogozhin, Eugene A; Andreev, Yaroslav A; Odintsova, T I; Kozlov, S A; Grishin, Eugene V; Egorov, Tsezi A

    2013-09-01

    A novel peptide named ToAMP4 was isolated from Taraxacum officinale Wigg. flowers by a combination of acetic acid extraction and different types of chromatography: affinity, size-exclusion, and RP-HPLC. The amino acid sequence of ToAMP4 was determined by automated Edman degradation. The peptide is basic, consists of 41 amino acids, and incorporates three disulphide bonds. Due to the unusual cysteine spacing pattern, ToAMP4 does not belong to any known plant AMP family, but classifies together with two other antimicrobial peptides ToAMP1 and ToAMP2 previously isolated from the dandelion flowers. To study the biological activity of ToAMP4, it was successfully produced in a prokaryotic expression system as a fusion protein with thioredoxin. The recombinant peptide was shown to be identical to the native ToAMP4 by chromatographic behavior, molecular mass, and N-terminal amino acid sequence. The peptide displays broad-spectrum antifungal activity against important phytopathogens. Two ToAMP4-mediated inhibition strategies depending on the fungus were demonstrated. The results obtained add to our knowledge on the structural and functional diversity of AMPs in plants.

  7. Leveraging family-specific signatures for AMP discovery and high-throughput annotation

    PubMed Central

    Waghu, Faiza Hanif; Barai, Ram Shankar; Idicula-Thomas, Susan

    2016-01-01

    Antimicrobial peptides (AMPs) are diverse, biologically active, essential components of the innate immune system. As compared to conventional antibiotics, AMPs exhibit broad spectrum antimicrobial activity, reduced toxicity and reduced microbial resistance. They are widely researched for their therapeutic potential, especially against multi-drug resistant pathogens. AMPs are known to have family-specific sequence composition, which can be mined for their discovery and rational design. Here, we present a detailed family-based study on AMP families. The study involved the use of sequence signatures represented by patterns and hidden Markov models (HMMs) present in experimentally studied AMPs to identify novel AMPs. Along with AMPs, peptides hitherto lacking antimicrobial annotation were also retrieved and wet-lab studies on randomly selected sequences proved their antimicrobial activity against Escherichia coli. CAMPSign, a webserver has been created for researchers to effortlessly exploit the use of AMP family signatures for identification of AMPs. The webserver is available online at www.campsign.bicnirrh.res.in. In this work, we demonstrate an optimised and experimentally validated protocol along with a freely available webserver that uses family-based sequence signatures for accelerated discovery of novel AMPs. PMID:27089856

  8. A novel biosensor to study cAMP dynamics in cilia and flagella

    PubMed Central

    Mukherjee, Shatanik; Jansen, Vera; Jikeli, Jan F; Hamzeh, Hussein; Alvarez, Luis; Dombrowski, Marco; Balbach, Melanie; Strünker, Timo; Seifert, Reinhard; Kaupp, U Benjamin; Wachten, Dagmar

    2016-01-01

    The cellular messenger cAMP regulates multiple cellular functions, including signaling in cilia and flagella. The cAMP dynamics in these subcellular compartments are ill-defined. We introduce a novel FRET-based cAMP biosensor with nanomolar sensitivity that is out of reach for other sensors. To measure cAMP dynamics in the sperm flagellum, we generated transgenic mice and reveal that the hitherto methods determining total cAMP levels do not reflect changes in free cAMP levels. Moreover, cAMP dynamics in the midpiece and principal piece of the flagellum are distinctively different. The sole cAMP source in the flagellum is the soluble adenylate cyclase (SACY). Although bicarbonate-dependent SACY activity requires Ca2+, basal SACY activity is suppressed by Ca2+. Finally, we also applied the sensor to primary cilia. Our new cAMP biosensor features unique characteristics that allow gaining new insights into cAMP signaling and unravel the molecular mechanisms underlying ciliary function in vitro and in vivo. DOI: http://dx.doi.org/10.7554/eLife.14052.001 PMID:27003291

  9. A Computational Modeling and Simulation Approach to Investigate Mechanisms of Subcellular cAMP Compartmentation.

    PubMed

    Yang, Pei-Chi; Boras, Britton W; Jeng, Mao-Tsuen; Docken, Steffen S; Lewis, Timothy J; McCulloch, Andrew D; Harvey, Robert D; Clancy, Colleen E

    2016-07-01

    Subcellular compartmentation of the ubiquitous second messenger cAMP has been widely proposed as a mechanism to explain unique receptor-dependent functional responses. How exactly compartmentation is achieved, however, has remained a mystery for more than 40 years. In this study, we developed computational and mathematical models to represent a subcellular sarcomeric space in a cardiac myocyte with varying detail. We then used these models to predict the contributions of various mechanisms that establish subcellular cAMP microdomains. We used the models to test the hypothesis that phosphodiesterases act as functional barriers to diffusion, creating discrete cAMP signaling domains. We also used the models to predict the effect of a range of experimentally measured diffusion rates on cAMP compartmentation. Finally, we modeled the anatomical structures in a cardiac myocyte diad, to predict the effects of anatomical diffusion barriers on cAMP compartmentation. When we incorporated experimentally informed model parameters to reconstruct an in silico subcellular sarcomeric space with spatially distinct cAMP production sites linked to caveloar domains, the models predict that under realistic conditions phosphodiesterases alone were insufficient to generate significant cAMP gradients. This prediction persisted even when combined with slow cAMP diffusion. When we additionally considered the effects of anatomic barriers to diffusion that are expected in the cardiac myocyte dyadic space, cAMP compartmentation did occur, but only when diffusion was slow. Our model simulations suggest that additional mechanisms likely contribute to cAMP gradients occurring in submicroscopic domains. The difference between the physiological and pathological effects resulting from the production of cAMP may be a function of appropriate compartmentation of cAMP signaling. Therefore, understanding the contribution of factors that are responsible for coordinating the spatial and temporal

  10. A Computational Modeling and Simulation Approach to Investigate Mechanisms of Subcellular cAMP Compartmentation

    PubMed Central

    Yang, Pei-Chi; Boras, Britton W.; Jeng, Mao-Tsuen; Lewis, Timothy J.; McCulloch, Andrew D.; Harvey, Robert D.; Clancy, Colleen E.

    2016-01-01

    Subcellular compartmentation of the ubiquitous second messenger cAMP has been widely proposed as a mechanism to explain unique receptor-dependent functional responses. How exactly compartmentation is achieved, however, has remained a mystery for more than 40 years. In this study, we developed computational and mathematical models to represent a subcellular sarcomeric space in a cardiac myocyte with varying detail. We then used these models to predict the contributions of various mechanisms that establish subcellular cAMP microdomains. We used the models to test the hypothesis that phosphodiesterases act as functional barriers to diffusion, creating discrete cAMP signaling domains. We also used the models to predict the effect of a range of experimentally measured diffusion rates on cAMP compartmentation. Finally, we modeled the anatomical structures in a cardiac myocyte diad, to predict the effects of anatomical diffusion barriers on cAMP compartmentation. When we incorporated experimentally informed model parameters to reconstruct an in silico subcellular sarcomeric space with spatially distinct cAMP production sites linked to caveloar domains, the models predict that under realistic conditions phosphodiesterases alone were insufficient to generate significant cAMP gradients. This prediction persisted even when combined with slow cAMP diffusion. When we additionally considered the effects of anatomic barriers to diffusion that are expected in the cardiac myocyte dyadic space, cAMP compartmentation did occur, but only when diffusion was slow. Our model simulations suggest that additional mechanisms likely contribute to cAMP gradients occurring in submicroscopic domains. The difference between the physiological and pathological effects resulting from the production of cAMP may be a function of appropriate compartmentation of cAMP signaling. Therefore, understanding the contribution of factors that are responsible for coordinating the spatial and temporal

  11. Functional Analysis of a c-di-AMP-specific Phosphodiesterase MsPDE from Mycobacterium smegmatis

    PubMed Central

    Tang, Qing; Luo, Yunchao; Zheng, Cao; Yin, Kang; Ali, Maria Kanwal; Li, Xinfeng; He, Jin

    2015-01-01

    Cyclic di‑AMP (c-di-AMP) is a second signaling molecule involved in the regulation of bacterial physiological processes and interaction between pathogen and host. However, the regulatory network mediated by c-di-AMP in Mycobacterium remains obscure. In M. smegmatis, a diadenylate cyclase (DAC) was reported recently, but there is still no investigation on c-di-AMP phosphodiesterase (PDE). Here, we provide a systematic study on signaling mechanism of c-di-AMP PDE in M. smegmatis. Based on our enzymatic analysis, MsPDE (MSMEG_2630), which contained a DHH-DHHA1 domain, displayed a 200-fold higher hydrolytic efficiency (kcat/Km) to c-di-AMP than to c-di-GMP. MsPDE was capable of converting c-di-AMP to pApA and AMP, and hydrolyzing pApA to AMP. Site-directed mutations in DHH and DHHA1 revealed that DHH domain was critical for the phosphodiesterase activity. To explore the regulatory role of c-di-AMP in vivo, we constructed the mspde mutant (Δmspde) and found that deficiency of MsPDE significantly enhanced intracellular C12-C20 fatty acid accumulation. Deficiency of DAC in many bacteria results in cell death. However, we acquired the M. smegmatis strain with DAC gene disrupted (ΔmsdisA) by homologous recombination approach. Deletion of msdisA reduced bacterial C12-C20 fatty acids production but scarcely affected bacterial survival. We also provided evidences that superfluous c-di-AMP in M. smegmatis could lead to abnormal colonial morphology. Collectively, our results indicate that MsPDE is a functional c-di-AMP-specific phosphodiesterase both in vitro and in vivo. Our study also expands the regulatory network mediated by c-di-AMP in M. smegmatis. PMID:26078723

  12. Regulation of the Dictyostelium glycogen phosphorylase 2 gene by cyclic AMP.

    PubMed

    Sucic, J F; Selmin, O; Rutherford, C L

    1993-01-01

    A crucial developmental event in the cellular slime mold, Dictyostelium discoideum, is glycogen degradation. The enzyme that catalyzes this degradation, glycogen phosphorylase 2 (gp-2), is developmentally regulated and cAMP appears to be involved in this regulation. We have examined several aspects of the cAMP regulation of gp-2. We show that addition of exogenous cAMP to aggregation competent amoebae induced the appearance of gp-2 mRNA. The induction of gp-2 mRNA occurred within 1 and 1.5 h after the initial exposure to cAMP. Exposure to exogenous cAMP concentrations as low as 1.0 microM could induce gp-2 mRNA. We also examined the molecular mechanism through which cAMP induction of gp-2 occurs. Induction of gp-2 appears to result from a mechanism that does not require intracellular cAMP signaling, and may occur directly through a cAMP binding protein without the requirement of any intracellular signalling. We also examined the promoter region of the gp-2 gene for cis-acting elements that are involved in the cAMP regulation of gp-2. A series of deletions of the promoter were fused to a luciferase reporter gene and then analyzed for cAMP responsiveness. The results indicated that a region from -258 nucleotides to the transcriptional start site is sufficient for essentially full activity and appears to carry all necessary cis-acting sites for cAMP induction. Further deletion of 58 nucleotides from the 5' end, results in fivefold less activity in the presence of cAMP. Deletion of the next 104 nucleotides eliminates the cAMP response entirely. PMID:8222346

  13. Nanomolar Inhibitors of AmpC [beta]-Lactamase

    SciTech Connect

    Morandi, Federica; Caselli, Emilia; Morandi, Stefania; Focia, Pamela J.; Blazquez, Jesus; Shoichet, Brian K.; Prati, Fabio

    2010-03-08

    {beta}-lactamases are the most widespread resistance mechanism to {beta}-lactam antibiotics, such as the penicillins and the cephalosporins. In an effort to combat these enzymes, a combination of stereoselective organic synthesis, enzymology, microbiology, and X-ray crystallography was used to design and evaluate new carboxyphenyl-glycylboronic acid transition-state analogue inhibitors of the class C {beta}-lactamase AmpC. The new compounds improve inhibition by over 2 orders of magnitude compared to analogous glycylboronic acids, with K{sub i} values as low as 1 nM. On the basis of the differential binding of different analogues, the introduced carboxylate alone contributes about 2.1 kcal/mol in affinity. This carboxylate corresponds to the ubiquitous C3(4)' carboxylate of {beta}-lactams, and this energy represents the first thermodynamic measurement of the importance of this group in molecular recognition by class C {beta}-lactamases. The structures of AmpC in complex with two of these inhibitors were determined by X-ray crystallography at 1.72 and 1.83 {angstrom} resolution. These structures suggest a structural basis for the high affinity of the new compounds and provide templates for further design. The highest affinity inhibitor was 5 orders of magnitude more selective for AmpC than for characteristic serine proteases, such as chymotrypsin. This inhibitor reversed the resistance of clinical pathogens to the third generation cephalosporin ceftazidime; it may serve as a lead compound for drug discovery to combat bacterial resistance to {beta}-lactam antibiotics.

  14. Amp-hour counting control for PV hybrid power systems

    SciTech Connect

    Hund, T.D.; Thompson, B.

    1997-06-01

    The performance of an amp-hour (Ah) counting battery charge control algorithm has been defined and tested using the Digital Solar Technologies MPR-9400 microprocessor based PV hybrid charge controller. This work included extensive field testing of the charge algorithm on flooded lead-antimony and valve regulated lead-acid (VRLA) batteries. The test results after one-year have demonstrated that PV charge utilization, battery charge control, and battery state of charge (SOC) has been significantly improved by providing maximum charge to the batteries while limiting battery overcharge to manufacturers specifications during variable solar resource and load periods.

  15. Op. amps in power amplification: a laboratory exercise on feedback

    NASA Astrophysics Data System (ADS)

    Borcherds, P. H.

    1984-05-01

    Rapid and continuing developments in electronics make it necessary to revise constantly the teaching of electronics and to replace obsolescent laboratory exercises. The author describes a new exercise which believes helps students' (and lecturers') understanding of negative feedback. A power amplifier is constructed from an operational amplifier (op. amp.) together with a complementary pair of transistors as an output stage. To make the exercise more realistic a low impedance (8 Omega ) loudspeaker is used as the load. The amplifier is developed and tested stage by stage, and at each stage the defects apparent at the previous stage are eliminated.

  16. Laser pulse sampler

    DOEpatents

    Vann, C.

    1998-03-24

    The Laser Pulse Sampler (LPS) measures temporal pulse shape without the problems of a streak camera. Unlike the streak camera, the laser pulse directly illuminates a camera in the LPS, i.e., no additional equipment or energy conversions are required. The LPS has several advantages over streak cameras. The dynamic range of the LPS is limited only by the range of its camera, which for a cooled camera can be as high as 16 bits, i.e., 65,536. The LPS costs less because there are fewer components, and those components can be mass produced. The LPS is easier to calibrate and maintain because there is only one energy conversion, i.e., photons to electrons, in the camera. 5 figs.

  17. Laser pulse sampler

    DOEpatents

    Vann, Charles

    1998-01-01

    The Laser Pulse Sampler (LPS) measures temporal pulse shape without the problems of a streak camera. Unlike the streak camera, the laser pulse directly illuminates a camera in the LPS, i.e., no additional equipment or energy conversions are required. The LPS has several advantages over streak cameras. The dynamic range of the LPS is limited only by the range of its camera, which for a cooled camera can be as high as 16 bits, i.e., 65,536. The LPS costs less because there are fewer components, and those components can be mass produced. The LPS is easier to calibrate and maintain because there is only one energy conversion, i.e., photons to electrons, in the camera.

  18. Pulse shaping system

    DOEpatents

    Skeldon, Mark D.; Letzring, Samuel A.

    1999-03-23

    Temporally shaped electrical waveform generation provides electrical waveforms suitable for driving an electro-optic modulator (EOM) which produces temporally shaped optical laser pulses for inertial confinement fusion (ICF) research. The temporally shaped electrical waveform generation is carried out with aperture coupled transmission lines having an input transmission line and an aperture coupled output transmission line, along which input and output pulses propagate in opposite directions. The output electrical waveforms are shaped principally due to the selection of coupling aperture width, in a direction transverse to the lines, which varies along the length of the line. Specific electrical waveforms, which may be high voltage (up to kilovolt range), are produced and applied to the EOM to produce specifically shaped optical laser pulses.

  19. Pulse shaping system

    DOEpatents

    Skeldon, M.D.; Letzring, S.A.

    1999-03-23

    Temporally shaped electrical waveform generation provides electrical waveforms suitable for driving an electro-optic modulator (EOM) which produces temporally shaped optical laser pulses for inertial confinement fusion (ICF) research. The temporally shaped electrical waveform generation is carried out with aperture coupled transmission lines having an input transmission line and an aperture coupled output transmission line, along which input and output pulses propagate in opposite directions. The output electrical waveforms are shaped principally due to the selection of coupling aperture width, in a direction transverse to the lines, which varies along the length of the line. Specific electrical waveforms, which may be high voltage (up to kilovolt range), are produced and applied to the EOM to produce specifically shaped optical laser pulses. 8 figs.

  20. Micro pulse lidar

    SciTech Connect

    Spinhirne, J.D. )

    1993-01-01

    An eye safe, compact, solid state lidar for profiling atmospheric cloud and aerosol scattering has been demonstrated. The transmitter of the micro pulse lidar is a diode pumped [mu]J pulse energy, high repetition rate Nd:YLF laser. Eye safety is obtained through beam expansion. The receiver employs a photon counting solid state Geiger mode avalanche photodiode detector. Data acquisition is by a single card multichannel scaler. Daytime background induced quantum noise is controlled by a narrow receiver field-of-view (FOV) and a narrow bandwidth temperature controlled interference filter. Dynamic range of the signal is limited by optical geometric signal compression. Signal simulations and initial atmospheric measurements indicate that systems built on the micro pulse lidar concept are capable of detecting and profiling all significant cloud and aerosol scattering through the troposphere and into the stratosphere. The intended applications are scientific studies and environmental monitoring which require full time, unattended measurements of the cloud and aerosol height structure.

  1. Pulsed neutron detector

    DOEpatents

    Robertson, deceased, J. Craig; Rowland, Mark S.

    1989-03-21

    A pulsed neutron detector and system for detecting low intensity fast neutron pulses has a body of beryllium adjacent a body of hydrogenous material the latter of which acts as a beta particle detector, scintillator, and moderator. The fast neutrons (defined as having En>1.5 MeV) react in the beryllium and the hydrogenous material to produce larger numbers of slow neutrons than would be generated in the beryllium itself and which in the beryllium generate hellium-6 which decays and yields beta particles. The beta particles reach the hydrogenous material which scintillates to yield light of intensity related to the number of fast neutrons. A photomultiplier adjacent the hydrogenous material (scintillator) senses the light emission from the scintillator. Utilization means, such as a summing device, sums the pulses from the photo-multiplier for monitoring or other purposes.

  2. Pulsed welding plasma source

    NASA Astrophysics Data System (ADS)

    Knyaz'kov, A.; Pustovykh, O.; Verevkin, A.; Terekhin, V.; Shachek, A.; Tyasto, A.

    2016-04-01

    It is shown that in order to form the current pulse of a near rectangular shape, which provides conversion of the welding arc into a dynamic mode, it is rational to connect a forming element made on the basis of an artificial forming line in series to the welding DC circuit. The paper presents a diagram of a pulsed device for welding with a non-consumable electrode in argon which was developed using the forming element. The conversion of the arc into the dynamic mode is illustrated by the current and voltage oscillograms of the arc gap and the dynamic characteristic of the arc within the interval of one pulse generation time in the arc gap. The background current travels in the interpulse interval.

  3. Pulse power linac

    DOEpatents

    Villa, Francesco

    1990-01-01

    A linear acceleration for charged particles is constructed of a plurality of transmission line sections that extend between a power injection region and an accelerating region. Each line section is constructed of spaced plate-like conductors and is coupled to an accelerating gap located at the accelerating region. Each gap is formed between a pair of apertured electrodes, with all of the electrode apertures being aligned along a particle accelerating path. The accelerating gaps are arranged in series, and at the injection region the line sections are connected in parallel. At the injection region a power pulse is applied simultaneously to all line sections. The line sections are graduated in length so that the pulse reaches the gaps in a coordinated sequence whereby pulse energy is applied to particles as they reach each of the gaps along the accelerating path.

  4. PULSED ION SOURCE

    DOEpatents

    Ford, F.C.; Ruff, J.W.; Zizzo, S.G.; Cook, B.

    1958-11-11

    An ion source is described adapted for pulsed operation and producing copious quantities of ions with a particular ion egress geometry. The particular source construction comprises a conical member having a conducting surface formed of a metal with a gas occladed therein and narrow non-conducting portions hereon dividing the conducting surface. A high voltage pulse is applied across the conducting surface or producing a discharge across the surface. After the gas ions have been produced by the discharge, the ions are drawn from the source in a diverging conical beam by a specially constructed accelerating electrode.

  5. An Essential Poison: Synthesis and Degradation of Cyclic Di-AMP in Bacillus subtilis

    PubMed Central

    Gundlach, Jan; Mehne, Felix M. P.; Herzberg, Christina; Kampf, Jan; Valerius, Oliver; Kaever, Volkhard

    2015-01-01

    ABSTRACT Gram-positive bacteria synthesize the second messenger cyclic di-AMP (c-di-AMP) to control cell wall and potassium homeostasis and to secure the integrity of their DNA. In the firmicutes, c-di-AMP is essential for growth. The model organism Bacillus subtilis encodes three diadenylate cyclases and two potential phosphodiesterases to produce and degrade c-di-AMP, respectively. Among the three cyclases, CdaA is conserved in nearly all firmicutes, and this enzyme seems to be responsible for the c-di-AMP that is required for cell wall homeostasis. Here, we demonstrate that CdaA localizes to the membrane and forms a complex with the regulatory protein CdaR and the glucosamine-6-phosphate mutase GlmM. Interestingly, cdaA, cdaR, and glmM form a gene cluster that is conserved throughout the firmicutes. This conserved arrangement and the observed interaction between the three proteins suggest a functional relationship. Our data suggest that GlmM and GlmS are involved in the control of c-di-AMP synthesis. These enzymes convert glutamine and fructose-6-phosphate to glutamate and glucosamine-1-phosphate. c-di-AMP synthesis is enhanced if the cells are grown in the presence of glutamate compared to that in glutamine-grown cells. Thus, the quality of the nitrogen source is an important signal for c-di-AMP production. In the analysis of c-di-AMP-degrading phosphodiesterases, we observed that both phosphodiesterases, GdpP and PgpH (previously known as YqfF), contribute to the degradation of the second messenger. Accumulation of c-di-AMP in a gdpP pgpH double mutant is toxic for the cells, and the cells respond to this accumulation by inactivation of the diadenylate cyclase CdaA. IMPORTANCE Bacteria use second messengers for signal transduction. Cyclic di-AMP (c-di-AMP) is the only second messenger known so far that is essential for a large group of bacteria. We have studied the regulation of c-di-AMP synthesis and the role of the phosphodiesterases that degrade this second

  6. Temporal and spatial regulation of cAMP signaling in disease: role of cyclic nucleotide phosphodiesterases.

    PubMed

    Otero, Carolina; Peñaloza, Juan P; Rodas, Paula I; Fernández-Ramires, Ricardo; Velasquez, Luis; Jung, Juan E

    2014-12-01

    Since its discovery, cAMP has been proposed as one of the most versatile second messengers. The remarkable feature of cAMP to tightly control highly diverse physiological processes, including metabolism, homeostasis, secretion, muscle contraction, cell proliferation and migration, immune response, and gene transcription, is reflected by millions of different articles worldwide. Compartmentalization of cAMP in space and time, maintained by mainly phosphodiesterases, contributes to the maintenance of equilibrium inside the cell where one signal can trigger many different events. Novel cAMP sensors seem to carry out certain unexpected signaling properties of cAMP and thereby to permit delicate adaptations of biologic responses. Measuring space and time events with biosensors will increase our current knowledge on the pathophysiology of diseases, such as chronic obstructive pulmonary disease, asthma, cognitive impairment, cancer, and renal and heart failure. Further insights into the cAMP dynamics will help to optimize the pharmacological treatment for these diseases.

  7. Enzymatic production of 5'-inosinic acid by AMP deaminase from a newly isolated Aspergillus oryzae.

    PubMed

    Li, Shubo; Chen, Leitao; Hu, Yangjun; Fang, Guohui; Zhao, Mouming; Guo, Yuan; Pang, Zongwen

    2017-02-01

    5'-adenylic acid deaminase (AMP deaminase), an important enzyme for the food industry, can catalyze the irreversible hydrolysis of adenosine monophosphate (AMP) to inosine monophosphate (IMP) and ammonia. In this study, a new strain was screened that efficiently produces 3191.6U/g of AMP deaminase at 32°C. After purification, the optimal temperature and pH of the AMP deaminase were found to be 40°C and 6.0, respectively, but it was partially inhibited by Fe(3+), Cu(2+), Al(3+), and Zn(2+). With amplification of the AMP deaminase production system, 6mL of crude enzyme could produce 2.00mg/g of IMP from 2.04mg/g of dried yeast with an 84.8% molar yield after 40min. These results provide a new insight into AMP deaminase production and offer a potential platform for producing 5'-IMP. PMID:27596420

  8. Enzymatic production of 5'-inosinic acid by AMP deaminase from a newly isolated Aspergillus oryzae.

    PubMed

    Li, Shubo; Chen, Leitao; Hu, Yangjun; Fang, Guohui; Zhao, Mouming; Guo, Yuan; Pang, Zongwen

    2017-02-01

    5'-adenylic acid deaminase (AMP deaminase), an important enzyme for the food industry, can catalyze the irreversible hydrolysis of adenosine monophosphate (AMP) to inosine monophosphate (IMP) and ammonia. In this study, a new strain was screened that efficiently produces 3191.6U/g of AMP deaminase at 32°C. After purification, the optimal temperature and pH of the AMP deaminase were found to be 40°C and 6.0, respectively, but it was partially inhibited by Fe(3+), Cu(2+), Al(3+), and Zn(2+). With amplification of the AMP deaminase production system, 6mL of crude enzyme could produce 2.00mg/g of IMP from 2.04mg/g of dried yeast with an 84.8% molar yield after 40min. These results provide a new insight into AMP deaminase production and offer a potential platform for producing 5'-IMP.

  9. Cyclic AMP Can Decrease Expression of Genes Subject to Catabolite Repression in Saccharomyces cerevisiae

    PubMed Central

    Zaragoza, Oscar; Lindley, Chris; Gancedo, Juana M.

    1999-01-01

    External cyclic AMP (cAMP) hindered the derepression of gluconeogenic enzymes in a pde2 mutant of Saccharomyces cerevisiae, but it did not prevent invertase derepression. cAMP reduced nearly 20-fold the transcription driven by upstream activation sequence (UAS1FBP1) from FBP1, encoding fructose-1,6-bisphosphatase; it decreased 2-fold the activation of transcription by UAS2FBP1. Nuclear extracts from cells derepressed in the presence of cAMP were impaired in the formation of specific UASFBP1-protein complexes in band shift experiments. cAMP does not appear to act through the repressing protein Mig1. Control of FBP1 transcription through cAMP is redundant with other regulatory mechanisms. PMID:10198033

  10. Temporal and spatial regulation of cAMP signaling in disease: role of cyclic nucleotide phosphodiesterases.

    PubMed

    Otero, Carolina; Peñaloza, Juan P; Rodas, Paula I; Fernández-Ramires, Ricardo; Velasquez, Luis; Jung, Juan E

    2014-12-01

    Since its discovery, cAMP has been proposed as one of the most versatile second messengers. The remarkable feature of cAMP to tightly control highly diverse physiological processes, including metabolism, homeostasis, secretion, muscle contraction, cell proliferation and migration, immune response, and gene transcription, is reflected by millions of different articles worldwide. Compartmentalization of cAMP in space and time, maintained by mainly phosphodiesterases, contributes to the maintenance of equilibrium inside the cell where one signal can trigger many different events. Novel cAMP sensors seem to carry out certain unexpected signaling properties of cAMP and thereby to permit delicate adaptations of biologic responses. Measuring space and time events with biosensors will increase our current knowledge on the pathophysiology of diseases, such as chronic obstructive pulmonary disease, asthma, cognitive impairment, cancer, and renal and heart failure. Further insights into the cAMP dynamics will help to optimize the pharmacological treatment for these diseases. PMID:24750474

  11. Expression of Dm-AMP1 in rice confers resistance to Magnaporthe oryzae and Rhizoctonia solani.

    PubMed

    Jha, Sanjay; Tank, Harsukh G; Prasad, Bishun Deo; Chattoo, Bharat B

    2009-02-01

    Magnaporthe oryzae and Rhizoctonia solani, are among the most important pathogens of rice, severely limiting its productivity. Dm-AMP1, an antifungal plant defensin from Dahlia merckii, was expressed in rice (Oryza sativa L. sp. indica cv. Pusa basmati 1) using Agrobacterium tumefaciens-mediated transformation. Expression levels of Dm-AMP1 ranged from 0.43% to 0.57% of total soluble protein in transgenic plants. It was observed that constitutive expression of Dm-AMP1 suppresses the growth of M. oryzae and R. solani by 84% and 72%, respectively. Transgenic expression of Dm-AMP1 was not accompanied by an induction of pathogenesis-related (PR) gene expression, indicating that the expression of DmAMP1 directly inhibits the pathogen. The results of in vitro, in planta and microscopic analyses suggest that Dm-AMP1 expression has the potential to provide broad-spectrum disease resistance in rice. PMID:18618285

  12. Targeting cAMP/PKA pathway for glycemic control and type 2 diabetes therapy.

    PubMed

    Yang, Haihua; Yang, Linghai

    2016-08-01

    In mammals, cyclic adenosine monophosphate (cAMP) is an intracellular second messenger that is usually elicited by binding of hormones and neurotransmitters to G protein-coupled receptors (GPCRs). cAMP exerts many of its physiological effects by activating cAMP-dependent protein kinase (PKA), which in turn phosphorylates and regulates the functions of downstream protein targets including ion channels, enzymes, and transcription factors. cAMP/PKA signaling pathway regulates glucose homeostasis at multiple levels including insulin and glucagon secretion, glucose uptake, glycogen synthesis and breakdown, gluconeogenesis, and neural control of glucose homeostasis. This review summarizes recent genetic and pharmacological studies concerning the regulation of glucose homeostasis by cAMP/PKA in pancreas, liver, skeletal muscle, adipose tissues, and brain. We also discuss the strategies for targeting cAMP/PKA pathway for research and potential therapeutic treatment of type 2 diabetes mellitus (T2D). PMID:27194812

  13. Functions of AMP-activated protein kinase in adipose tissue

    PubMed Central

    Daval, Marie; Foufelle, Fabienne; Ferré, Pascal

    2006-01-01

    AMP-activated protein kinase (AMPK) is involved in cellular energy homeostasis. Its functions have been extensively studied in muscles and liver. AMPK stimulates pathways which increase energy production (glucose transport, fatty acid oxidation) and switches off pathways which consume energy (lipogenesis, protein synthesis, gluconeogenesis). This has led to the concept that AMPK has an interesting pharmaceutical potential in situations of insulin resistance and it is indeed the target of existing drugs and hormones which improve insulin sensitivity. Adipose tissue is a key player in energy metabolism through the release of substrates and hormones involved in metabolism and insulin sensitivity. Activation of AMPK in adipose tissue can be achieved through situations such as fasting and exercise. Leptin and adiponectin as well as hypoglycaemic drugs are activators of adipose tissue AMPK. This activation probably involves changes in the AMP/ATP ratio and the upstream kinase LKB1. When activated, AMPK limits fatty acid efflux from adipocytes and favours local fatty acid oxidation. Since fatty acids have a key role in insulin resistance, especially in muscles, activating AMPK in adipose tissue might be found to be beneficial in insulin-resistant states, particularly as AMPK activation also reduces cytokine secretion in adipocytes. PMID:16709632

  14. Reanalyzing the Ampère-Maxwell Law

    NASA Astrophysics Data System (ADS)

    Hill, S. Eric

    2011-09-01

    In a recent TPT article, I addressed a common miscommunication about Faraday's law, namely, that introductory texts often say the law expresses a causal relationship between the magnetic fields time variation and the electric fields circulation. In that article, I demonstrated that these field behaviors share a common cause in a time-varying current density. From that, many readers may have rightly guessed at a symmetric conclusion: while the Ampère-Maxwell law is commonly said to express a causal relation between the electric fields time variation and the magnetic fields circulation, these field behaviors share a distinct, common cause. Together, Faraday's law and the Ampère-Maxwell law constitute half of Maxwell's laws that form a foundation for almost all of electricity and magnetism. By misrepresenting these two laws, introductory texts not only present students with unnecessary conceptual hurdles early in their physics educations but also leave them with enduring misunderstandings about the very foundation of electricity and magnetism. Fortunately, compared to what is commonly taught, the actual cause of these field variations is conceptually simpler and more consistent with what the students will have already learned in the introductory texts' own earlier chapters.

  15. Cyclic GMP-AMP Displays Mucosal Adjuvant Activity in Mice

    PubMed Central

    Škrnjug, Ivana

    2014-01-01

    The recently discovered mammalian enzyme cyclic GMP-AMP synthase produces cyclic GMP-AMP (cGAMP) after being activated by pathogen-derived cytosolic double stranded DNA. The product can stimulate STING-dependent interferon type I signaling. Here, we explore the efficacy of cGAMP as a mucosal adjuvant in mice. We show that cGAMP can enhance the adaptive immune response to the model antigen ovalbumin. It promotes antigen specific IgG and a balanced Th1/Th2 lymphocyte response in immunized mice. A characteristic of the cGAMP-induced immune response is the slightly reduced induction of interleukin-17 as a hallmark of Th17 activity – a distinct feature that is not observed with other cyclic di-nucleotide adjuvants. We further characterize the innate immune stimulation activity in vitro on murine bone marrow-derived dendritic cells and human dendritic cells. The observed results suggest the consideration of cGAMP as a candidate mucosal adjuvant for human vaccines. PMID:25295996

  16. Regulation of cAMP-dependent Protein Kinases

    PubMed Central

    Diskar, Mandy; Zenn, Hans-Michael; Kaupisch, Alexandra; Kaufholz, Melanie; Brockmeyer, Stefanie; Sohmen, Daniel; Berrera, Marco; Zaccolo, Manuela; Boshart, Michael; Herberg, Friedrich W.; Prinz, Anke

    2010-01-01

    cAMP-dependent protein kinases are reversibly complexed with any of the four isoforms of regulatory (R) subunits, which contain either a substrate or a pseudosubstrate autoinhibitory domain. The human protein kinase X (PrKX) is an exemption as it is inhibited only by pseudosubstrate inhibitors, i.e. RIα or RIβ but not by substrate inhibitors RIIα or RIIβ. Detailed examination of the capacity of five PrKX-like kinases ranging from human to protozoa (Trypanosoma brucei) to form holoenzymes with human R subunits in living cells shows that this preference for pseudosubstrate inhibitors is evolutionarily conserved. To elucidate the molecular basis of this inhibitory pattern, we applied bioluminescence resonance energy transfer and surface plasmon resonance in combination with site-directed mutagenesis. We observed that the conserved αH-αI loop residue Arg-283 in PrKX is crucial for its RI over RII preference, as a R283L mutant was able to form a holoenzyme complex with wild type RII subunits. Changing the corresponding αH-αI loop residue in PKA Cα (L277R), significantly destabilized holoenzyme complexes in vitro, as cAMP-mediated holoenzyme activation was facilitated by a factor of 2–4, and lead to a decreased affinity of the mutant C subunit for R subunits, significantly affecting RII containing holoenzymes. PMID:20819953

  17. Solution structure of the cAMP-dependent protein kinase

    SciTech Connect

    Trewhella, J.; Olah, G.A.; Walsh, D.A.; Mitchell, R.D.

    1998-12-31

    This is the final report of a three-year, Laboratory Directed Research and Development (LDRD) project as Los Alamos National Laboratory (LANL). Protein phosphorylation is well established as one of the most important mechanisms of signal transduction and cellular regulation. Two of the key enzymes that catalyze these phosphorylation reactions are the cAMP- (PKA) and cGMP- (PKG) dependent protein kinases. PKA has served as the prototypic model of this class of enzymes that now comprises in excess of 300 phylogenetically related proteins. A large number of these protein kinases are critical for the regulation of cell function and a full analysis of their similarities and differences is essential to understand their diverse physiological roles. The cAMP-dependent protein kinase has the subunit structure R2C2, in which C and R refer to the catalytic and regulatory subunits, respectively. The cGMP-dependent protein kinase (PKG) is highly homologous to PKA but is distinguished from it by having the regulatory and catalytic domains on a contiguous polypeptide. The studies described here use small-angle scattering and Fourier Transform InfraRed (FTIR) spectroscopy to study domain movements and conformational changes in these enzymes in different functional states in order to elucidate the molecular bases for the regulation of their activities.

  18. SNMR pulse sequence phase cycling

    DOEpatents

    Walsh, David O; Grunewald, Elliot D

    2013-11-12

    Technologies applicable to SNMR pulse sequence phase cycling are disclosed, including SNMR acquisition apparatus and methods, SNMR processing apparatus and methods, and combinations thereof. SNMR acquisition may include transmitting two or more SNMR pulse sequences and applying a phase shift to a pulse in at least one of the pulse sequences, according to any of a variety cycling techniques. SNMR processing may include combining SNMR from a plurality of pulse sequences comprising pulses of different phases, so that desired signals are preserved and indesired signals are canceled.

  19. Is This Op-Amp Any Good?: Lab-Built Checker Removes All Doubt!

    ERIC Educational Resources Information Center

    Harman, Charles

    2007-01-01

    Electronics instructors and students find it very helpful to be able to check an operational amplifier at the proto-board stage. Most students lack the experience or knowledge that it takes to recognize whether an op-amp is operating normally or not. This article discusses a handy op-amp checker that allows one to check and/or test op-amps at the…

  20. Impact of AmpC Derepression on Fitness and Virulence: the Mechanism or the Pathway?

    PubMed Central

    Pérez-Gallego, Marcelo; Torrens, Gabriel; Castillo-Vera, Jane; Moya, Bartolomé; Zamorano, Laura; Hultenby, Kjell; Albertí, Sebastián; Mellroth, Peter; Henriques-Normark, Birgitta; Normark, Staffan

    2016-01-01

    ABSTRACT Understanding the interplay between antibiotic resistance and bacterial fitness and virulence is essential to guide individual treatments and improve global antibiotic policies. A paradigmatic example of a resistance mechanism is the intrinsic inducible chromosomal β-lactamase AmpC from multiple Gram-negative bacteria, including Pseudomonas aeruginosa, a major nosocomial pathogen. The regulation of ampC expression is intimately linked to peptidoglycan recycling, and AmpC-mediated β-lactam resistance is frequently mediated by inactivating mutations in ampD, encoding an N-acetyl-anhydromuramyl-l-alanine amidase, affecting the levels of ampC-activating muropeptides. Here we dissect the impact of the multiple pathways causing AmpC hyperproduction on P. aeruginosa fitness and virulence. Through a detailed analysis, we demonstrate that the lack of all three P. aeruginosa AmpD amidases causes a dramatic effect in fitness and pathogenicity, severely compromising growth rates, motility, and cytotoxicity; the latter effect is likely achieved by repressing key virulence factors, such as protease LasA, phospholipase C, or type III secretion system components. We also show that ampC overexpression is required but not sufficient to confer the growth-motility-cytotoxicity impaired phenotype and that alternative pathways leading to similar levels of ampC hyperexpression and resistance, such as those involving PBP4, had no fitness-virulence cost. Further analysis indicated that fitness-virulence impairment is caused by overexpressing ampC in the absence of cell wall recycling, as reproduced by expressing ampC from a plasmid in an AmpG (muropeptide permease)-deficient background. Thus, our findings represent a major step in the understanding of β-lactam resistance biology and its interplay with fitness and pathogenesis. PMID:27795406

  1. Dynamics of β-adrenergic/cAMP signaling and morphological changes in cultured astrocytes.

    PubMed

    Vardjan, Nina; Kreft, Marko; Zorec, Robert

    2014-04-01

    The morphology of astrocytes, likely regulated by cAMP, determines the structural association between astrocytes and the synapse, consequently modulating synaptic function. β-Adrenergic receptors (β-AR), which increase cytosolic cAMP concentration ([cAMP]i ), may affect cell morphology. However, the real-time dynamics of β-AR-mediated cAMP signaling in single live astrocytes and its effect on cell morphology have not been studied. We used the fluorescence resonance energy transfer (FRET)-based cAMP biosensor Epac1-camps to study time-dependent changes in [cAMP]i ; morphological changes in primary rat astrocytes were monitored by real-time confocal microscopy. Stimulation of β-AR by adrenaline, noradrenaline, and isoprenaline, a specific agonist of β-AR, rapidly increased [cAMP]i (∼15 s). The FRET signal response, mediated via β-AR, was faster than in the presence of forskolin (twofold) and dibutyryl-cAMP (>35-fold), which directly activate adenylyl cyclase and Epac1-camps, respectively, likely due to slow entry of these agents into the cytosol. Oscillations in [cAMP]i have not been recorded, indicating that cAMP-dependent processes operate in a slow time domain. Most Epac1-camps expressing astrocytes revealed a morphological change upon β-AR activation and attained a stellate morphology within 1 h. The morphological changes exhibited a bell-shaped dependency on [cAMP]i . The 5-10% decrease in cell cross-sectional area and the 30-50% increase in cell perimeter are likely due to withdrawal of the cytoplasm to the perinuclear region and the appearance of protrusions on the surface of astrocytes. Because astrocyte processes ensheath neurons, β-AR/cAMP-mediated morphological changes can modify the geometry of the extracellular space, affecting synaptic, neuronal, and astrocyte functions in health and disease. PMID:24464905

  2. Cyclic AMP pathway modifies memory through neural cell adhesion molecule alterations in the rat hippocampus.

    PubMed

    Razmi, Ali; Sahebgharani, Mousa; Khani, Mohammad Hossein; Paylakhi, Seyed Hassan; Faizi, Mehrdad; Zarrindast, Mohammad-Reza

    2014-01-01

    Neural Cell Adhesion Molecules (NCAMs) are known to influence memory by affecting neural cell-cell and cell-extracellular matrix junctions. This study investigated the possible role of cAMP pathway in the expression of hippocampal NCAM and its polysialylated derivative (PSA-NCAM). The following pharmacological tools were employed for manipulation of cAMP pathway: a) forskolin; the activator of adenylyl cyclase (AC), b) 8-Br-cAMP; a protein kinase A (PKA) agonist, c) 8-pCPT-2'-O-Me-cAMP; a selective enhancer of exchange protein activated by cAMP (Epac) and d) Rp-cAMP; a PKA inhibitor. Memory acquisition was tested by passive avoidance paradigm after injecting the above compounds for three consecutive days into the CA1 region of dorsal hippocampus of rats. Forskolin and 8-Br-cAMP enhanced memory retrieval while Rp-cAMP significantly reduced memory and NCAM levels. 8-pCPT-2'-O-Me-cAMP failed to alter memory performance or NCAM levels as compared to vehicle. We observed no significant changes in PSA-NCAM, however the expression of St8sia4 and St8sia2 (the polysialyltransferase isoforms) were altered. The mRNA levels of St8sia4 was down-regulated by 8-Br-cAMP, Rp-cAMP and 8-pCPT while forskolin led to almost 3 and 5 fold increase in mRNAs of St8sia2 and St8sia4, respectively. The current insight might endorse the predominant role of PKA as compared to Epac in cAMP pathway in expression of NCAM and memory function. PMID:24901853

  3. Mathematical model of cAMP-dependent signaling pathway in constitutive and UV-induced melanogenesis

    NASA Astrophysics Data System (ADS)

    Stolnitz, Mikhail M.; Peshkova, Anna Y.

    2002-07-01

    Cascade of reactions of cAMP-dependent signaling pathway in melanocytes is investigated by mathematical modeling. Model takes into account (alpha) -melanocyte stimulating hormone binding to melanocortin-1 receptor, adenylate cyclase activation by G-protein, increase of the intracellular cAMP concentration, PKA activation by cAMP, CREB phosphorylation by PKA, microphthalmia gene expression, microphthalmia binding to tyrosinase gene promoter, increase of tyrosinase synthesis. Positive and negative feedback loops of this system are analyzed.

  4. Pulse distortion in single-mode fibers. 3: Chirped pulses.

    PubMed

    Marcuse, D

    1981-10-15

    The theory of pulse distortion in single-mode fibers is extended to include laser sources that suffer a linear wavelength sweep (chirp) during the duration of the pulse. The transmitted pulse is expressed as a Fourier integral whose spectral function is given by an analytical expression in closed form. The rms width of the transmitted pulse is also expressed in closed form. Numerical examples illustrate the influence of the chirp on the shape and rms width of the pulse. A somewhat paradoxical situation exists. A given input pulse can be made arbitrarily short by a sufficiently large amount of chirping, and, after a given fiber length, this chirped pulse returns to its original width. But at this particular distance an unchirped pulse would be only [equiation] times longer. Thus chirping can improve the rate of data transmission by only 40%.

  5. Passive and active pulse stacking scheme for pulse shaping

    DOEpatents

    Harney, Robert C.; Schipper, John F.

    1977-01-01

    Apparatus and method for producing a sequence of radiation pulses with a pulse envelope of time variation which is controllable by an external electromagnetic signal applied to an active medium or by a sectored reflector, through which the radiation passes.

  6. Butyrate activates the cAMP-protein kinase A-cAMP response element-binding protein signaling pathway in Caco-2 cells.

    PubMed

    Wang, Aihua; Si, Hongwei; Liu, Dongmin; Jiang, Honglin

    2012-01-01

    Butyrate is a major SCFA produced by microbial fermentation of dietary fiber in the gastrointestinal tract. Butyrate is widely thought to mediate the benefits of fiber and resistant starch consumption to colon health in humans. Besides serving as a substrate for energy production, butyrate has many regulatory effects in animals. Little is known about the signaling mechanisms underlying the regulatory effects of butyrate and other SCFA. In this study, we determined whether butyrate can activate cAMP-protein kinase A (PKA)- cAMP response element (CRE)-binding protein (CREB) signaling in Caco-2 cells, a model of intestinal epithelial cells. Butyrate promoted luciferase expression from a CRE-reporter construct, induced phosphorylation of CREB, increased the activity of PKA, and elevated the levels of cAMP in Caco-2 cells. These data suggest that butyrate activates cAMP-PKA-CREB signaling in Caco-2 cells. Butyrate, however, had no effect on the activities of adenylyl cyclase (AC) and phosphodiesterase (PDE), two enzymes that determine the production and degradation of intracellular cAMP, respectively. Because the activities of AC and PDE are primarily regulated by G protein-coupled receptor (GPR)-mediated intracellular signaling, lack of an effect of butyrate on these two enzymes suggests that butyrate does not activate cAMP-PKA-CREB signaling through GPR. Butyrate-treated Caco-2 cells had greater concentrations of ATP than untreated cells. Because ATP is the substrate for cAMP production, this difference suggests that butyrate may activate cAMP-PKA-CREB signaling in Caco-2 cells through increased ATP production. Overall, this study raises the possibility that some of the regulatory effects of butyrate in animals, including those on the colonocytes, may be mediated by the cAMP-PKA-CREB signaling pathway at the cellular level.

  7. Pulsed Plasma Thruster

    NASA Technical Reports Server (NTRS)

    2002-01-01

    Dr. Tom Markusic, a propulsion research engineer at the Marshall Space Flight Center (MSFC), adjusts a diagnostic laser while a pulsed plasma thruster (PPT) fires in a vacuum chamber in the background. NASA/MSFC's Propulsion Research Center (PRC) is presently investigating plasma propulsion for potential use on future nuclear-powered spacecraft missions, such as human exploration of Mars.

  8. Hybrid Chirped Pulse Amplification

    SciTech Connect

    Jovanovic, I; Barty, C P J

    2002-05-07

    We present a novel chirped pulse amplification method which combines optical parametric amplification and laser amplification. We have demonstrated this hybrid CPA concept with a combination of beta-barium borate and Ti:sapphire. High-efficiency, multi-terawatt compatible amplification is achieved without gain narrowing and without electro-optic modulators using a simple commercial pump laser.

  9. Lectures on pulsed NMR

    SciTech Connect

    Pines, A.

    1986-09-01

    These lectures discuss some recent developments in pulsed NMR, emphasizing fundamental principles with selected illustrative applications. Major topics covered include multiple-quantum spectroscopy, spin decoupling, the interaction of spins with a quantized field, adiabatic rapid passage, spin temperature and statistics of cross-polarization, coherent averaging, and zero field NMR. 55 figs.

  10. Downhole pulse tube refrigerators

    SciTech Connect

    Swift, G.; Gardner, D.

    1997-12-01

    This report summarizes a preliminary design study to explore the plausibility of using pulse tube refrigeration to cool instruments in a hot down-hole environment. The original motivation was to maintain Dave Reagor`s high-temperature superconducting electronics at 75 K, but the study has evolved to include three target design criteria: cooling at 30 C in a 300 C environment, cooling at 75 K in a 50 C environment, cooling at both 75 K and 30 C in a 250 C environment. These specific temperatures were chosen arbitrarily, as representative of what is possible. The primary goals are low cost, reliability, and small package diameter. Pulse-tube refrigeration is a rapidly growing sub-field of cryogenic refrigeration. The pulse tube refrigerator has recently become the simplest, cheapest, most rugged and reliable low-power cryocooler. The authors expect this technology will be applicable downhole because of the ratio of hot to cold temperatures (in absolute units, such as Kelvin) of interest in deep drilling is comparable to the ratios routinely achieved with cryogenic pulse-tube refrigerators.

  11. Lectures on pulsed NMR

    SciTech Connect

    Pines, A.

    1988-08-01

    These lectures discuss some recent developments in pulsed NMR, emphasizing fundamental principles with selected illustrative applications. Major topics covered include multiple-quantum spectroscopy, spin decoupling, the interaction of spins with a quantized field, adiabatic rapid passage, spin temperature and statistics of cross-polarization, coherent averaging, and zero field NMR. 32 refs., 56 figs.

  12. Experiments in Pulsed Ultrasonics

    ERIC Educational Resources Information Center

    Palmer, S. B.; Forster, G. A.

    1970-01-01

    Describes and apparatus designed to generate and detect pulsed ultrasonics in solids and liquids over the frequency range 1-20 MHz. Experiments are suggested for velocity of sound, elastic constant and ultrasonic attenuation measurements on various materials over a wide temperature range. The equipment should be useful for demonstration purposes.…

  13. Regenerative pulse shaping and amplification of ultrabroadband optical pulses.

    PubMed

    Barty, C P; Korn, G; Raksi, F; Rose-Petruck, C; Squier, J; Tien, A C; Wilson, K R; Yakovlev, V V; Yamakawa, K

    1996-02-01

    Regenerative pulse shaping is used to alleviate gain narrowing during ultrashort-pulse amplification. Amplification bandwidths of ~ 100 nm, or nearly three times wider than the traditional gain-narrowing limit, are produced with a modified Ti:sapphire regenerative amplifier. This novel regenerative amplifier has been used to amplify pulses to the 5-mJ level with a bandwidth sufficient to support ~ 10-fs pulses.

  14. cAMP diffusion in Dictyostelium discoideum: A Green's function method

    NASA Astrophysics Data System (ADS)

    Calovi, Daniel S.; Brunnet, Leonardo G.; de Almeida, Rita M. C.

    2010-07-01

    A Green’s function method is developed to approach the spatiotemporal equations describing the cAMP production in Dictyostelium discoideum, markedly reducing numerical calculations times: cAMP concentrations and gradients are calculated just at the amoeba locations. A single set of parameters is capable of reproducing the different observed behaviors, from cAMP synchronization, spiral waves and reaction-diffusion patterns to streaming and mound formation. After aggregation, the emergence of a circular motion of amoebas, breaking the radial cAMP field symmetry, is observed.

  15. Photoactivated adenylyl cyclase (PAC) reveals novel mechanisms underlying cAMP-dependent axonal morphogenesis

    PubMed Central

    Zhou, Zhiwen; Tanaka, Kenji F.; Matsunaga, Shigeru; Iseki, Mineo; Watanabe, Masakatsu; Matsuki, Norio; Ikegaya, Yuji; Koyama, Ryuta

    2016-01-01

    Spatiotemporal regulation of axonal branching and elongation is essential in the development of refined neural circuits. cAMP is a key regulator of axonal growth; however, whether and how intracellular cAMP regulates axonal branching and elongation remain unclear, mainly because tools to spatiotemporally manipulate intracellular cAMP levels have been lacking. To overcome this issue, we utilized photoactivated adenylyl cyclase (PAC), which produces cAMP in response to blue-light exposure. In primary cultures of dentate granule cells transfected with PAC, short-term elevation of intracellular cAMP levels induced axonal branching but not elongation, whereas long-term cAMP elevation induced both axonal branching and elongation. The temporal dynamics of intracellular cAMP levels regulated axonal branching and elongation through the activation of protein kinase A (PKA) and exchange protein directly activated by cAMP (Epac), respectively. Thus, using PAC, our study for the first time reveals that temporal cAMP dynamics could regulate axonal branching and elongation via different signaling pathways. PMID:26795422

  16. cAMP enhances BMP2-signaling through PKA and MKP1-dependent mechanisms

    SciTech Connect

    Ghayor, Chafik; Ehrbar, Martin; Miguel, Blanca San; Graetz, Klaus W.; Weber, Franz E.

    2009-04-03

    Recent studies suggest that the elevation of intracellular cyclic adenosine monophosphate (cAMP) and the activation of the protein kinase A regulate BMP-induced osteogenesis. However, the precise mechanisms underlying the enhancing effect of cAMP on BMP2 signaling were not completely revealed. In this study we investigated the effect of elevated cAMP level and PKA activation on the BMP2-induced osteoblastic differentiation in pluripotent C2C12 cells. Alkaline phosphatase activity and its mRNA were consistently induced by BMP2 treatment. The pretreatment of C2C12 cells with Forskolin, a cAMP generating agent, dbcAMP, an analogue of cAMP, or IBMX (3-isobutyl 1-methyl xanthine), and a nonspecific inhibitor of phosphodiesterases elicited further activation of alkaline phosphatase. Furthermore, elevated intracellular cAMP level increased BMP2-induced MKP1. On the other hand, BMP2-induced Erk phosphorylation (p44/p42) and cell proliferation were suppressed in the presence of cAMP. Thus, cAMP might enhance BMP2-induced osteoblastic differentiation by a MKP1-Erk-dependent mechanism.

  17. A-kinase anchoring proteins: cAMP compartmentalization in neurodegenerative and obstructive pulmonary diseases

    PubMed Central

    Poppinga, W J; Muñoz-Llancao, P; González-Billault, C; Schmidt, M

    2014-01-01

    The universal second messenger cAMP is generated upon stimulation of Gs protein-coupled receptors, such as the β2-adreneoceptor, and leads to the activation of PKA, the major cAMP effector protein. PKA oscillates between an on and off state and thereby regulates a plethora of distinct biological responses. The broad activation pattern of PKA and its contribution to several distinct cellular functions lead to the introduction of the concept of compartmentalization of cAMP. A-kinase anchoring proteins (AKAPs) are of central importance due to their unique ability to directly and/or indirectly interact with proteins that either determine the cellular content of cAMP, such as β2-adrenoceptors, ACs and PDEs, or are regulated by cAMP such as the exchange protein directly activated by cAMP. We report on lessons learned from neurons indicating that maintenance of cAMP compartmentalization by AKAP5 is linked to neurotransmission, learning and memory. Disturbance of cAMP compartments seem to be linked to neurodegenerative disease including Alzheimer's disease. We translate this knowledge to compartmentalized cAMP signalling in the lung. Next to AKAP5, we focus here on AKAP12 and Ezrin (AKAP78). These topics will be highlighted in the context of the development of novel pharmacological interventions to tackle AKAP-dependent compartmentalization. PMID:25132049

  18. Identification of a cyclic-AMP-responsive element within the rat somatostatin gene.

    PubMed Central

    Montminy, M R; Sevarino, K A; Wagner, J A; Mandel, G; Goodman, R H

    1986-01-01

    We have examined the regulation of somatostatin gene expression by cAMP in PC12 rat pheochromocytoma cells transfected with the rat somatostatin gene. Forskolin at 10 microM caused a 4-fold increase in somatostatin mRNA levels within 4 hr of treatment in stably transfected cells. Chimeric genes containing the somatostatin gene promoter fused to the bacterial reporter gene encoding chloramphenicol acetyltransferase were also induced by cAMP in PC12 cells. To delineate the sequences required for response to cAMP, we constructed a series of promoter deletion mutants. Our studies defined a region between 60 and 29 base pairs upstream from the transcriptional initiation site that conferred cAMP responsiveness when placed adjacent to the simian virus 40 promoter. Within the cAMP-responsive element of the somatostatin gene, we observed an 8-base palindrome, 5'-TGACGTCA-3', which is highly conserved in many other genes whose expression is regulated by cAMP. cAMP responsiveness was greatly reduced when the somatostatin fusion genes were transfected into the mutant PC12 line A126-1B2, which is deficient in cAMP-dependent protein kinase 2. Our studies indicate that transcriptional regulation of the somatostatin gene by cAMP requires protein kinase 2 activity and may depend upon a highly conserved promoter element. Images PMID:2875459

  19. Photoactivated adenylyl cyclase (PAC) reveals novel mechanisms underlying cAMP-dependent axonal morphogenesis.

    PubMed

    Zhou, Zhiwen; Tanaka, Kenji F; Matsunaga, Shigeru; Iseki, Mineo; Watanabe, Masakatsu; Matsuki, Norio; Ikegaya, Yuji; Koyama, Ryuta

    2016-01-01

    Spatiotemporal regulation of axonal branching and elongation is essential in the development of refined neural circuits. cAMP is a key regulator of axonal growth; however, whether and how intracellular cAMP regulates axonal branching and elongation remain unclear, mainly because tools to spatiotemporally manipulate intracellular cAMP levels have been lacking. To overcome this issue, we utilized photoactivated adenylyl cyclase (PAC), which produces cAMP in response to blue-light exposure. In primary cultures of dentate granule cells transfected with PAC, short-term elevation of intracellular cAMP levels induced axonal branching but not elongation, whereas long-term cAMP elevation induced both axonal branching and elongation. The temporal dynamics of intracellular cAMP levels regulated axonal branching and elongation through the activation of protein kinase A (PKA) and exchange protein directly activated by cAMP (Epac), respectively. Thus, using PAC, our study for the first time reveals that temporal cAMP dynamics could regulate axonal branching and elongation via different signaling pathways. PMID:26795422

  20. TSH-induced cyclic AMP production in an ovine thyroid cell line: OVNIS 5H.

    PubMed

    Fayet, G; Aouani, A; Hovsépian, S

    1986-01-01

    The TSH-induced cyclic AMP response was studied using a 3-year-old ovine thyroid cell line TSH-independent for growth: OVNIS 5H. The kinetics of cyclic AMP production was followed both in cell layers and in cell culture media, with or without phosphodiesterase inhibitor. It is noteworthy that following the first wave in cyclic AMP obtained within minutes, we observed later a sustained exponential increase in cyclic AMP during the 5 days following TSH stimulation. A bioassay of TSH was derived allowing measurement of 1 microU/ml TSH from a crude bTSH preparation. PMID:3000830

  1. Increase in Endogenous and Exogenous Cyclic AMP Levels Inhibits Sclerotial Development in Sclerotinia sclerotiorum

    PubMed Central

    Rollins, Jeffrey A.; Dickman, Martin B.

    1998-01-01

    Growth and development of a wild-type Sclerotinia sclerotiorum isolate were examined in the presence of various pharmacological compounds to investigate signal transduction pathways that influence the development of sclerotia. Compounds known to increase endogenous cyclic AMP (cAMP) levels in other organisms by inhibiting phosphodiesterase activity (caffeine and 3-isobutyl-1-methyl xanthine) or by activating adenylate cyclase (NaF) reduced or eliminated sclerotial development in S. sclerotiorum. Growth in the presence of 5 mM caffeine correlated with increased levels of endogenous cAMP in mycelia. In addition, incorporation of cAMP into the growth medium decreased or eliminated the production of sclerotia in a concentration-dependent manner and increased the accumulation of oxalic acid. Inhibition of sclerotial development was cAMP specific, as exogenous cyclic GMP, AMP, and ATP did not influence sclerotial development. Transfer of developing cultures to cAMP-containing medium at successive time points demonstrated that cAMP inhibits development prior to or during sclerotial initiation. Together, these results indicate that cAMP plays a role in the early transition between mycelial growth and sclerotial development. PMID:9647827

  2. Ethanol-induced loss of brain cyclic AMP binding proteins: correlation with growth suppression

    SciTech Connect

    Pennington, S.; Kalmus, G.

    1987-05-01

    Brain hypoplasia secondary to maternal ethanol consumption is a common fetal defect observed in all models of fetal alcohol syndrome. The molecular mechanism by which ethanol inhibits growth is unknown but has been hypothesized to involve ethanol-induced changes in the activity of cyclic-AMP stimulated protein kinase. Acute and chronic alcohol exposure elevate cyclic AMP level in many tissues, including brain. This increase in cyclic AMP should increase the phosphorylating activity of kinase by increasing the amount of dissociated (active) kinase catalytic subunit. In 7-day embryonic chick brains, ethanol-induced growth suppression was correlated with increased brain cyclic AMP content but neither basal nor cyclic AMP stimulated kinase catalytic activity was increased. However, the levels of cyclic AMP binding protein (kinase regulatory subunit) were significantly lowered by ethanol exposure. Measured as either /sup 3/H cyclic AMP binding or as 8-azido cyclic AM/sup 32/P labeling, ethanol-exposed brains had significantly less cyclic AMP binding activity (51 +/- 14 versus 29 +/- 10 units/..mu..g protein for 8-azido cyclic AMP binding). These findings suggest that ethanol's effect on kinase activity may involve more than ethanol-induced activation of adenylate cyclase.

  3. cAMP signaling microdomains and their observation by optical methods

    PubMed Central

    Calebiro, Davide; Maiellaro, Isabella

    2014-01-01

    The second messenger cyclic AMP (cAMP) is a major intracellular mediator of many hormones and neurotransmitters and regulates a myriad of cell functions, including synaptic plasticity in neurons. Whereas cAMP can freely diffuse in the cytosol, a growing body of evidence suggests the formation of cAMP gradients and microdomains near the sites of cAMP production, where cAMP signals remain apparently confined. The mechanisms responsible for the formation of such microdomains are subject of intensive investigation. The development of optical methods based on fluorescence resonance energy transfer (FRET), which allow a direct observation of cAMP signaling with high temporal and spatial resolution, is playing a fundamental role in elucidating the nature of such microdomains. Here, we will review the optical methods used for monitoring cAMP and protein kinase A (PKA) signaling in living cells, providing some examples of their application in neurons, and will discuss the major hypotheses on the formation of cAMP/PKA microdomains. PMID:25389388

  4. All about Heart Rate (Pulse)

    MedlinePlus

    ... Pressure High Blood Pressure Tools & Resources Stroke More All About Heart Rate (Pulse) Updated:Apr 19,2016 ... Sodium and Salt 3 Low Blood Pressure 4 All About Heart Rate (Pulse) 5 How to Eat ...

  5. A compact nanosecond pulse modulator

    NASA Astrophysics Data System (ADS)

    Sha, Jizhang; Xue, Jianchao; Qiang, Bohan

    Two circuits of nanosecond pulse modulator which generate two different width rectangular pulses respectively are described. The basic configuration of the modulator is the Marx circuit, in which avalanche transistors are used as switching devices. In order to obtain the rectangular pulses a pulse-forming network (PFN) is introduced and fitted into the Marx. A multi-parallel arrangement of the Marx is used to satisfy the broad pulse requirement. Experiments have shown that the two different width rectangular pulses which have 130 V amplitudes and 30 and 200 ns widths respectively can be obtained at a 50 ohms load. The two pulses have steep front edges (3.6 ns and 10 ns respectively) and flat tops with less than + or - 5 percent ripples. Therefore, the modulator can meet the requirements of the nanosecond pulse radar.

  6. Nondegenerate optical parametric chirped pulse amplifier

    DOEpatents

    Jovanovic, Igor; Ebbers, Christopher A.

    2005-03-22

    A system provides an input pump pulse and a signal pulse. A first dichroic beamsplitter is highly reflective for the input signal pulse and highly transmissive for the input pump pulse. A first optical parametric amplifier nonlinear crystal transfers part of the energy from the input pump pulse to the input signal pulse resulting in a first amplified signal pulse and a first depleted pump pulse. A second dichroic beamsplitter is highly reflective for the first amplified signal pulse and highly transmissive for the first depleted pump pulse. A second optical parametric amplifier nonlinear crystal transfers part of the energy from the first depleted pump pulse to the first amplified signal pulse resulting in a second amplified signal pulse and a second depleted pump pulse. A third dichroic beamsplitter receives the second amplified signal pulse and the second depleted pump pulse. The second depleted pump pulse is discarded.

  7. Sequentially pulsed traveling wave accelerator

    DOEpatents

    Caporaso, George J.; Nelson, Scott D.; Poole, Brian R.

    2009-08-18

    A sequentially pulsed traveling wave compact accelerator having two or more pulse forming lines each with a switch for producing a short acceleration pulse along a short length of a beam tube, and a trigger mechanism for sequentially triggering the switches so that a traveling axial electric field is produced along the beam tube in synchronism with an axially traversing pulsed beam of charged particles to serially impart energy to the particle beam.

  8. Isolation and characterization of cAMP-resistant mutants of the H-4 rat hepatoma cells

    SciTech Connect

    Liu, A.Y.; Lin, Z.

    1987-05-01

    H-4 rat hepatoma cells were mutagenized with ethyl methane-sulfonate and the frequency of emergence of cAMP resistant mutant cells were evaluated by cloning the EMS-treated cells in a semi-solid agar medium that contained either 1-3 mM 8-bromo-cAMP plus 1 mM 3-isobutyl-1-methyl xanthine or 5 ..mu..g/ml cholera toxin plus 1 mM IBMX. cAMP resistant mutants emerged at a frequency of 8 x 10/sup -5/. 15 colonies were isolated, recloned, grown in mass culture, and cell extracts were prepared. Analysis of cAMP-dependent protein kinase demonstrated that: (1) the type II enzyme is the only cAMP-dependent protein kinase detected in extracts of the hepatoma cells; (2) of the 15 cAMP resistant clonal cell lines examined, only one (H/sub 4/M/sub 18/) was found to be devoid of cAMP-dependent protein kinase activity. In another cell line (H/sub 4/M/sub 10/) the activity was 30% of that of the parental H-4 cells; (3) there was an increase (130-300%) in cAMP-dependent protein kinase activity in 13/15 of the mutant cell lines over that of the parental H-4 cells. Analysis of cAMP-phosphodiesterase demonstrated significant increases (150-370%) in the enzyme activity in extracts of the mutants over that of the H-4 parental line. Their results suggest that while a deficiency in cAMP-dependent protein kinase may confer resistance to the hepatoma cells against the cytostatic effects of 8-bromo-cAMP and cholera toxin, other events such as overexpression of phosphodiesterase may contribute to this phenotype.

  9. Genetically-encoded tools for cAMP probing and modulation in living systems

    PubMed Central

    Paramonov, Valeriy M.; Mamaeva, Veronika; Sahlgren, Cecilia; Rivero-Müller, Adolfo

    2015-01-01

    Intracellular 3′-5′-cyclic adenosine monophosphate (cAMP) is one of the principal second messengers downstream of a manifold of signal transduction pathways, including the ones triggered by G protein-coupled receptors. Not surprisingly, biochemical assays for cAMP have been instrumental for basic research and drug discovery for decades, providing insights into cellular physiology and guiding pharmaceutical industry. However, despite impressive track record, the majority of conventional biochemical tools for cAMP probing share the same fundamental shortcoming—all the measurements require sample disruption for cAMP liberation. This common bottleneck, together with inherently low spatial resolution of measurements (as cAMP is typically analyzed in lysates of thousands of cells), underpin the ensuing limitations of the conventional cAMP assays: (1) genuine kinetic measurements of cAMP levels over time in a single given sample are unfeasible; (2) inability to obtain precise information on cAMP spatial distribution and transfer at subcellular levels, let alone the attempts to pinpoint dynamic interactions of cAMP and its effectors. At the same time, tremendous progress in synthetic biology over the recent years culminated in drastic refinement of our toolbox, allowing us not only to bypass the limitations of conventional assays, but to put intracellular cAMP life-span under tight control—something, that seemed scarcely attainable before. In this review article we discuss the main classes of modern genetically-encoded tools tailored for cAMP probing and modulation in living systems. We examine the capabilities and weaknesses of these different tools in the context of their operational characteristics and applicability to various experimental set-ups involving living cells, providing the guidance for rational selection of the best tools for particular needs. PMID:26441653

  10. cAMP Signaling Prevents Podocyte Apoptosis via Activation of Protein Kinase A and Mitochondrial Fusion

    PubMed Central

    Xie, Kewei; Ni, Zhaohui; Yan, Yucheng; Wei, Kai; Chuang, Peter Y.; He, John Cijiang; Gu, Leyi

    2014-01-01

    Our previous in vitro studies suggested that cyclic AMP (cAMP) signaling prevents adriamycin (ADR) and puromycin aminonucleoside (PAN)-induced apoptosis in podocytes. As cAMP is an important second messenger and plays a key role in cell proliferation, differentiation and cytoskeleton formation via protein kinase A (PKA) or exchange protein directly activated by cAMP (Epac) pathways, we sought to determine the role of PKA or Epac signaling in cAMP-mediated protection of podocytes. In the ADR nephrosis model, we found that forskolin, a selective activator of adenylate cyclase, attenuated albuminuria and improved the expression of podocyte marker WT-1. When podocytes were treated with pCPT-cAMP (a selective cAMP/PKA activator), PKA activation was increased in a time-dependent manner and prevented PAN-induced podocyte loss and caspase 3 activation, as well as a reduction in mitochondrial membrane potential. We found that PAN and ADR resulted in a decrease in Mfn1 expression and mitochondrial fission in podocytes. pCPT-cAMP restored Mfn1 expression in puromycin or ADR-treated podocytes and induced Drp1 phosphorylation, as well as mitochondrial fusion. Treating podocytes with arachidonic acid resulted in mitochondrial fission, podocyte loss and cleaved caspase 3 production. Arachidonic acid abolished the protective effects of pCPT-cAMP on PAN-treated podocytes. Mdivi, a mitochondrial division inhibitor, prevented PAN-induced cleaved caspase 3 production in podocytes. We conclude that activation of cAMP alleviated murine podocyte caused by ADR. PKA signaling resulted in mitochondrial fusion in podocytes, which at least partially mediated the effects of cAMP. PMID:24642777

  11. Dose and Chemical Modification Considerations for Continuous Cyclic AMP Analog Delivery to the Injured CNS

    PubMed Central

    Fouad, Karim; Ghosh, Mousumi; Vavrek, Romana; Tse, Arthur D.

    2009-01-01

    Abstract In this investigation, two cell-permeable synthetic analogs of cAMP, dibutyryl-cAMP (db-cAMP) and 8-bromo-cAMP, which are widely used to elevate intracellular cAMP levels under experimental conditions, were investigated for their ability to dose-dependently improve histological and functional outcomes following continuous delivery in two models of incomplete spinal cord injury (SCI). The cAMP analogs were delivered via osmotic minipumps at 1–250 mM through an indwelling cortical cannula or by intrathecal infusion for up to 4 weeks after either a T8 unilateral over-hemisection or a C2-3 dorsolateral quadrant lesion, respectively. In both SCI models, continuous db-cAMP delivery was associated with histopathological changes that included sporadic micro-hemorrhage formation and cavitation, enhanced macrophage infiltration and tissue damage at regions beyond the immediate application site; no deleterious or beneficial effect of agent delivery was observed at the spinal injury site. Furthermore, these changes were accompanied by pronounced behavioral deficits that included an absence of progressive locomotor recovery, increased extensor tone, paralysis, and sensory abnormalities. These deleterious effects were not observed in saline-treated animals, in animals in which the db-cAMP dose did not exceed 1 mM, or in those animals that received a high dose (250 mM) of the alternative cAMP analog, 8-bromo-cAMP. These results demonstrate that, for continuous intraparenchymal or intrathecal administration of cAMP analogs for the study of biological or therapeutic effects within the central nervous system (CNS), consideration of the effective concentration applied as well as the potential toxicity of chemical moieties on the parent molecule and/or their activity needs to be taken into account. PMID:19397425

  12. Cyclic AMP Affects Oocyte Maturation and Embryo Development in Prepubertal and Adult Cattle

    PubMed Central

    Bernal-Ulloa, Sandra Milena; Heinzmann, Julia; Herrmann, Doris; Hadeler, Klaus-Gerd; Aldag, Patrick; Winkler, Sylke; Pache, Dorit; Baulain, Ulrich; Lucas-Hahn, Andrea; Niemann, Heiner

    2016-01-01

    High cAMP levels during in vitro maturation (IVM) have been related to improved blastocyst yields. Here, we employed the cAMP/cGMP modulators, forskolin, IBMX, and cilostamide, during IVM to unravel the role of high cAMP in early embryonic development produced from prepubertal and adult bovine oocytes. Oocytes were collected via transvaginal aspiration and randomly assigned to three experimental groups: TCM24 (24h IVM/control), cAMP30 (2h pre-IVM (forskolin-IBMX), 30h IVM-cilostamide), and DMSO30 (Dimethyl Sulfoxide/vehicle control). After IVM, oocytes were fertilized in vitro and zygotes were cultured in vitro to blastocysts. Meiotic progression, cAMP levels, mRNA abundance of selected genes and DNA methylation were evaluated in oocytes. Blastocysts were used for gene expression or DNA methylation analyses. Blastocysts from the cAMP30 groups were transferred to recipients. The cAMP elevation delayed meiotic progression, but developmental rates were not increased. In immature oocytes, mRNA abundance of PRKACA was higher for cAMP30 protocol and no differences were found for PDE3A, SMAD2, ZAR1, PRDX1 and SLC2A8. EGR1 gene was up-regulated in prepubertal cAMP30 immature oocytes and down-regulated in blastocysts from all in vitro treatments. A similar gene expression profile was observed for DNMT3b, BCL2L1, PRDX1 and SLC2A8 in blastocysts. Satellite DNA methylation profiles were different between prepubertal and adult oocytes and blastocysts derived from the TCM24 and DMSO30 groups. Blastocysts obtained from prepubertal and adult oocytes in the cAMP30 treatment displayed normal methylation profiles and produced offspring. These data indicate that cAMP regulates IVM in prepubertal and adult oocytes in a similar manner, with impact on the establishment of epigenetic marks and acquisition of full developmental competency. PMID:26926596

  13. Polynomial solutions of the Monge-Ampère equation

    NASA Astrophysics Data System (ADS)

    Aminov, Yu A.

    2014-11-01

    The question of the existence of polynomial solutions to the Monge-Ampère equation zxxzyy-zxy^2=f(x,y) is considered in the case when f(x,y) is a polynomial. It is proved that if f is a polynomial of the second degree, which is positive for all values of its arguments and has a positive squared part, then no polynomial solution exists. On the other hand, a solution which is not polynomial but is analytic in the whole of the x, y-plane is produced. Necessary and sufficient conditions for the existence of polynomial solutions of degree up to 4 are found and methods for the construction of such solutions are indicated. An approximation theorem is proved. Bibliography: 10 titles.

  14. Polynomial solutions of the Monge-Ampère equation

    SciTech Connect

    Aminov, Yu A

    2014-11-30

    The question of the existence of polynomial solutions to the Monge-Ampère equation z{sub xx}z{sub yy}−z{sub xy}{sup 2}=f(x,y) is considered in the case when f(x,y) is a polynomial. It is proved that if f is a polynomial of the second degree, which is positive for all values of its arguments and has a positive squared part, then no polynomial solution exists. On the other hand, a solution which is not polynomial but is analytic in the whole of the x, y-plane is produced. Necessary and sufficient conditions for the existence of polynomial solutions of degree up to 4 are found and methods for the construction of such solutions are indicated. An approximation theorem is proved. Bibliography: 10 titles.

  15. Amp: A modular approach to machine learning in atomistic simulations

    NASA Astrophysics Data System (ADS)

    Khorshidi, Alireza; Peterson, Andrew A.

    2016-10-01

    Electronic structure calculations, such as those employing Kohn-Sham density functional theory or ab initio wavefunction theories, have allowed for atomistic-level understandings of a wide variety of phenomena and properties of matter at small scales. However, the computational cost of electronic structure methods drastically increases with length and time scales, which makes these methods difficult for long time-scale molecular dynamics simulations or large-sized systems. Machine-learning techniques can provide accurate potentials that can match the quality of electronic structure calculations, provided sufficient training data. These potentials can then be used to rapidly simulate large and long time-scale phenomena at similar quality to the parent electronic structure approach. Machine-learning potentials usually take a bias-free mathematical form and can be readily developed for a wide variety of systems. Electronic structure calculations have favorable properties-namely that they are noiseless and targeted training data can be produced on-demand-that make them particularly well-suited for machine learning. This paper discusses our modular approach to atomistic machine learning through the development of the open-source Atomistic Machine-learning Package (Amp), which allows for representations of both the total and atom-centered potential energy surface, in both periodic and non-periodic systems. Potentials developed through the atom-centered approach are simultaneously applicable for systems with various sizes. Interpolation can be enhanced by introducing custom descriptors of the local environment. We demonstrate this in the current work for Gaussian-type, bispectrum, and Zernike-type descriptors. Amp has an intuitive and modular structure with an interface through the python scripting language yet has parallelizable fortran components for demanding tasks; it is designed to integrate closely with the widely used Atomic Simulation Environment (ASE), which

  16. AMP-deaminase from thymus of patients with myasthenia gravis.

    PubMed

    Rybakowska, I; Szydłowska, M; Szrok, S; Bakuła, S; Kaletha, K

    2015-01-01

    Myasthenia gravis (MG) is characterized clinically by skeletal muscle fatigue following the excessive exercise. Interestingly most of MG patients manifest parallely also some abnormalities of the thymus.AMP-deaminase (AMPD) from human thymus was not a subject of studies up to now. In this paper, mRNA expression and some physico-chemical and immunological properties of AMPD purified from the thymus of MG patients were described. Experiments performed identified the liver isozyme (AMPD2) as the main isoform of AMPD expressed in this organ. The activity of AMPD found in this organ was higher than in other human non-(skeletal) muscle tissues indicating on role the enzyme may play in supplying of guanylates required for the intensive multiplication of thymocytes.

  17. Heterogeneity of Calcium Channel/cAMP-Dependent Transcriptional Activation.

    PubMed

    Kobrinsky, Evgeny

    2015-01-01

    The major function of the voltage-gated calcium channels is to provide the Ca(2+) flux into the cell. L-type voltage-gated calcium channels (Cav1) serve as voltage sensors that couple membrane depolarization to many intracellular processes. Electrical activity in excitable cells affects gene expression through signaling pathways involved in the excitation-transcription (E-T) coupling. E-T coupling starts with activation of the Cav1 channel and results in initiation of the cAMP-response element binding protein (CREB)-dependent transcription. In this review we discuss the new quantitative approaches to measuring E-T signaling events. We describe the use of wavelet transform to detect heterogeneity of transcriptional activation in nuclei. Furthermore, we discuss the properties of discovered microdomains of nuclear signaling associated with the E-T coupling and the basis of the frequency-dependent transcriptional regulation.

  18. AMP-activated protein kinase and metabolic control

    PubMed Central

    Viollet, Benoit; Andreelli, Fabrizio

    2011-01-01

    AMP-activated protein kinase (AMPK), a phylogenetically conserved serine/threonine protein kinase, is a major regulator of cellular and whole-body energy homeostasis that coordinates metabolic pathways in order to balance nutrient supply with energy demand. It is now recognized that pharmacological activation of AMPK improves blood glucose homeostasis, lipid profile and blood pressure in insulin-resistant rodents. Indeed, AMPK activation mimics the beneficial effects of physical activity or those of calorie restriction by acting on multiple cellular targets. In addition it is now demonstrated that AMPK is one of the probable (albeit indirect) targets of major antidiabetic drugs including, the biguanides (metformin) and thiazolidinediones, as well as of insulin sensitizing adipokines (e.g., adiponectin). Taken together, such findings highlight the logic underlying the concept of targeting the AMPK pathway for the treatment of metabolic syndrome and type 2 diabetes. PMID:21484577

  19. Laser pulse detector

    DOEpatents

    Mashburn, Douglas N.; Akerman, M. Alfred

    1981-01-01

    A laser pulse detector is provided which is small and inexpensive and has the capability of detecting laser light of any wavelength with fast response (less than 5 nanoseconds rise time). The laser beam is focused onto the receiving end of a graphite rod coaxially mounted within a close-fitting conductive, open-end cylindrical housing so that ablation and electric field breakdown of the resulting plasma occurs due to a bias potential applied between the graphite rod and housing. The pulse produced by the breakdown is transmitted through a matched impedance coaxial cable to a recording device. The cable is connected with its central lead to the graphite rod and its outer conductor to the housing.

  20. Laser pulse detector

    DOEpatents

    Mashburn, D.N.; Akerman, M.A.

    1979-08-13

    A laser pulse detector is provided which is small and inexpensive and has the capability of detecting laser light of any wavelength with fast response (less than 5 nanoseconds rise time). The laser beam is focused onto the receiving end of a graphite rod coaxially mounted within a close-fitting conductive, open-end cylindrical housing so that ablation and electric field breakdown of the resulting plasma occurs due to a bias potential applied between the graphite rod and housing. The pulse produced by the breakdown is transmitted through a matched impedance coaxial cable to a recording device. The cable is connected with its central lead to the graphite rod and its outer conductor to the housing.

  1. Pulsed Quantum Optomechanics

    NASA Astrophysics Data System (ADS)

    Vanner, Michael R.; Pikovski, Igor; Cole, Garrett D.; Kim, Myungshik; Brukner, Caslav; Hammerer, Klemens; Milburn, Gerard J.; Aspelmeyer, Markus

    2011-03-01

    By combining quantum optics with mechanical resonators an avenue is opened to extend investigations of quantum behavior into unprecendented mass regimes. The field resulting from this combination - ``cavity quantum optomechanics'' -- is receiving a surge of interest for its potential to contribute to quantum measurement and control, studies of decoherence and non-classical state preparation of macroscopic objects. However, quantum state preparation and especially quantum state reconstruction of mechanical oscillators is currently a significant challenge. We are pursuing a scheme that employs short optical pulses to realize quantum state tomography, squeezing via measurement and state purifcation of a mechanical resonator. The pulsed scheme has considerable resilience to initial thermal occupation, provides a promising means to explore the quantum nature of massive oscillators and can be applied to other systems such as trapped ions. Our theoretical proposal and experimental results will be discussed.

  2. Noisy homoclinic pulse dynamics

    NASA Astrophysics Data System (ADS)

    Eaves, T. S.; Balmforth, Neil J.

    2016-04-01

    The effect of stochastic perturbations on nearly homoclinic pulse trains is considered for three model systems: a Duffing oscillator, the Lorenz-like Shimizu-Morioka model, and a co-dimension-three normal form. Using the Duffing model as an example, it is demonstrated that the main effect of noise does not originate from the neighbourhood of the fixed point, as is commonly assumed, but due to the perturbation of the trajectory outside that region. Singular perturbation theory is used to quantify this noise effect and is applied to construct maps of pulse spacing for the Shimizu-Morioka and normal form models. The dynamics of these stochastic maps is then explored to examine how noise influences the sequence of bifurcations that take place adjacent to homoclinic connections in Lorenz-like and Shilnikov-type flows.

  3. Noisy homoclinic pulse dynamics.

    PubMed

    Eaves, T S; Balmforth, Neil J

    2016-04-01

    The effect of stochastic perturbations on nearly homoclinic pulse trains is considered for three model systems: a Duffing oscillator, the Lorenz-like Shimizu-Morioka model, and a co-dimension-three normal form. Using the Duffing model as an example, it is demonstrated that the main effect of noise does not originate from the neighbourhood of the fixed point, as is commonly assumed, but due to the perturbation of the trajectory outside that region. Singular perturbation theory is used to quantify this noise effect and is applied to construct maps of pulse spacing for the Shimizu-Morioka and normal form models. The dynamics of these stochastic maps is then explored to examine how noise influences the sequence of bifurcations that take place adjacent to homoclinic connections in Lorenz-like and Shilnikov-type flows. PMID:27131483

  4. Micro pulse laser radar

    NASA Technical Reports Server (NTRS)

    Spinhirne, James D. (Inventor)

    1993-01-01

    An eye safe, compact, solid state lidar for profiling atmospheric cloud and aerosol scattering is disclosed. The transmitter of the micro pulse lidar is a diode pumped micro-J pulse energy, high repetition rate Nd:YLF laser. Eye safety is obtained through beam expansion. The receiver employs a photon counting solid state Geiger mode avalanche photodiode detector. Data acquisition is by a single card multichannel scaler. Daytime background induced quantum noise is controlled by a narrow receiver field-of-view and a narrow bandwidth temperature controlled interference filter. Dynamic range of the signal is limited to optical geometric signal compression. Signal simulations and initial atmospheric measurements indicate that micropulse lider systems are capable of detecting and profiling all significant cloud and aerosol scattering through the troposphere and into the stratosphere. The intended applications are scientific studies and environmental monitoring which require full time, unattended measurements of the cloud and aerosol height structure.

  5. ELECTRONIC PULSE SCALING CIRCUITS

    DOEpatents

    Cooke-Yarborough, E.H.

    1958-11-18

    Electronic pulse scaling circults of the klnd comprlsing a serles of bi- stable elements connected ln sequence, usually in the form of a rlng so as to be cycllcally repetitive at the highest scallng factor, are described. The scaling circuit comprises a ring system of bi-stable elements each arranged on turn-off to cause, a succeeding element of the ring to be turned-on, and one being arranged on turn-off to cause a further element of the ring to be turned-on. In addition, separate means are provided for applying a turn-off pulse to all the elements simultaneously, and for resetting the elements to a starting condition at the end of each cycle.

  6. Pulse thermal loop

    NASA Technical Reports Server (NTRS)

    Weislogel, Mark M. (Inventor)

    2002-01-01

    A pulse thermal loop heat transfer system includes a means to use pressure rises in a pair of evaporators to circulate a heat transfer fluid. The system includes one or more valves that iteratively, alternately couple the outlets the evaporators to the condenser. While flow proceeds from one of the evaporators to the condenser, heating creates a pressure rise in the other evaporator, which has its outlet blocked to prevent fluid from exiting the other evaporator. When the flow path is reconfigured to allow flow from the other evaporator to the condenser, the pressure in the other evaporator is used to circulate a pulse of fluid through the system. The reconfiguring of the flow path, by actuating or otherwise changing the configuration of the one or more valves, may be triggered when a predetermined pressure difference between the evaporators is reached.

  7. Training Ultrafast Laser Pulses

    NASA Astrophysics Data System (ADS)

    Averin, Ruslan; Wells, N.; Todt, M.; Smolnisky, N.; Jastram, N.; Jochim, B.; Gregerson, N.; Wells, E.; Sayler, A.; McKenna, J.; Carnes, K.; Ben-Itzhak, I.; Kling, M. F.

    2009-11-01

    Closed loop control of molecular processes utilizing shaped ultrafast laser pulses has been around for a number of years, yet this type of control has primarily utilized Time of Flight ion yield data for feedback. We present experiments using Velocity Map Imaging (VMI) as the feedback source for the closed loop control. Using VMI allows for pulse optimization not only with respect to the disassociation species but also angular information of the final state. We demonstrate the feasibility of incorporating this kind of feedback into the control loop. Using this technique, we controlled the dissociation branching ratio of CO^+ into C^+ +O or C ^+O^+ and used the VMI information to recover additional information about the control mechanism.

  8. Short pulse neutron generator

    DOEpatents

    Elizondo-Decanini, Juan M.

    2016-08-02

    Short pulse neutron generators are described herein. In a general embodiment, the short pulse neutron generator includes a Blumlein structure. The Blumlein structure includes a first conductive plate, a second conductive plate, a third conductive plate, at least one of an inductor or a resistor, a switch, and a dielectric material. The first conductive plate is positioned relative to the second conductive plate such that a gap separates these plates. A vacuum chamber is positioned in the gap, and an ion source is positioned to emit ions in the vacuum chamber. The third conductive plate is electrically grounded, and the switch is operable to electrically connect and disconnect the second conductive plate and the third conductive plate. The at least one of the resistor or the inductor is coupled to the first conductive plate and the second conductive plate.

  9. Pressure pulse detection apparatus

    SciTech Connect

    Claycomb, J.R.

    1981-04-14

    A pressure pulse detection apparatus is disclosed which is adapted to receive small signals from downhole measuring while drilling apparatus which signals are propogated as pressure pulses traveling upstream in a column of drilling mud, which signals are obscured by mud pump pressure and velocity variations traveling downstream and which are significantly larger. The preferred embodiment incorporates a transient pressure transducer and an ultrasonic fluid velocity detector, the two forming output signals which are conditioned, amplified and offset against one another. They cancel (When properly calibrated) so that pressure and velocity variations from the mud pump upstream are nulled to zero. They reinforce so that pressure and velocity variations from the downhole signal generator are enhanced, thereby forming an output signal of downhole variations of interest.

  10. Generation of 18-fs, multiterawatt pulses by regenerative pulse shaping and chirped-pulse amplification.

    PubMed

    Barty, C P; Guo, T; Le Blanc, C; Raksi, F; Rose-Petruck, C; Squier, J; Wilson, K R; Yakovlev, V V; Yamakawa, K

    1996-05-01

    Transform-limited, 18-fs pulses of 4.4-TW peak power are produced in a Ti:sapphire-based chirped-pulsed amplification system at a repetition rate of 50 Hz. Regenerative pulse shaping is used to control gain narrowing during amplification, and an optimized, quintic-phase-limited dispersion compensation scheme is used to control higher-order phase distortions over a bandwidth of ~100 nm. Seed pulses are temporally stretched >100,000 times before amplification.

  11. Downhole pulse radar

    DOEpatents

    Chang, Hsi-Tien

    1989-01-01

    A borehole logging tool generates a fast rise-time, short duration, high peak-power radar pulse having broad energy distribution between 30 MHz and 300 MHz through a directional transmitting and receiving antennas having barium titanate in the electromagnetically active region to reduce the wavelength to within an order of magnitude of the diameter of the antenna. Radar returns from geological discontinuities are sampled for transmission uphole.

  12. Downhole pulse radar

    DOEpatents

    Chang, Hsi-Tien

    1987-09-28

    A borehole logging tool generates a fast rise-time, short duration, high peak-power radar pulse having broad energy distribution between 30 MHz and 300 MHz through a directional transmitting and receiving antennas having barium titanate in the electromagnetically active region to reduce the wavelength to within an order of magnitude of the diameter of the antenna. Radar returns from geological discontinuities are sampled for transmission uphole. 7 figs.

  13. Pulse Portraiture: Pulsar timing

    NASA Astrophysics Data System (ADS)

    Pennucci, Timothy T.; Demorest, Paul B.; Ransom, Scott M.

    2016-06-01

    Pulse Portraiture is a wideband pulsar timing code written in python. It uses an extension of the FFTFIT algorithm (Taylor 1992) to simultaneously measure a phase (TOA) and dispersion measure (DM). The code includes a Gaussian-component-based portrait modeling routine. The code uses the python interface to the pulsar data analysis package PSRCHIVE (ascl:1105.014) and also requires the non-linear least-squares minimization package lmfit (ascl:1606.014).

  14. Pulsed gas laser

    DOEpatents

    Anderson, Louis W.; Fitzsimmons, William A.

    1978-01-01

    A pulsed gas laser is constituted by Blumlein circuits wherein space metal plates function both as capacitors and transmission lines coupling high frequency oscillations to a gas filled laser tube. The tube itself is formed by spaced metal side walls which function as connections to the electrodes to provide for a high frequency, high voltage discharge in the tube to cause the gas to lase. Also shown is a spark gap switch having structural features permitting a long life.

  15. International magnetic pulse compression

    SciTech Connect

    Kirbie, H.C.; Newton, M.A.; Siemens, P.D.

    1991-04-01

    Although pulsed-power engineering traditionally has been practiced by a fairly small, close community in the areas of defense and energy research, it is becoming more common in high-power, high-energy commercial pursuits such as material processing and lasers. This paper is a synopsis of the Feb. 12--14, 1990 workshop on magnetic switching as it applies primarily to pulse compression (power transformation). During the course of the Workshop at Granlibakken, a great deal of information was amassed and a keen insight into both the problems and opportunities as to the use of this switching approach was developed. The segmented workshop format proved ideal for identifying key aspects affecting optimum performance in a variety of applications. Individual groups of experts addressed network and system modeling, magnetic materials, power conditioning, core cooling and dielectrics, and finally circuits and application. At the end, they came together to consolidate their input and formulate the workshop's conclusions, identifying roadblocks or suggesting research projects, particularly as they apply to magnetic switching's trump card -- its high-average-power-handling capability (at least on a burst-mode basis). The workshop was especially productive both in the quality and quantity of information transfer in an environment conducive to a free and open exchange of ideas. We will not delve into the organization proper of this meeting, rather we wish to commend to the interested reader this volume, which provides the definitive and most up-to-date compilation on the subject of magnetic pulse compression from underlying principles to current state of the art as well as the prognosis for the future of magnetic pulse compression as a consensus of the workshop's organizers and participants.

  16. International magnetic pulse compression

    NASA Astrophysics Data System (ADS)

    Kirbie, H. C.; Newton, M. A.; Siemens, P. D.

    1991-04-01

    Although pulsed-power engineering traditionally has been practiced by a fairly small, close community in the areas of defense and energy research, it is becoming more common in high-power, high-energy commercial pursuits such as material processing and lasers. This paper is a synopsis of the Feb. 12-14, 1990 workshop on magnetic switching as it applies primarily to pulse compression (power transformation). During the course of the Workshop at Granlibakken, a great deal of information was amassed and a keen insight into both the problems and opportunities as to the use of this switching approach was developed. The segmented workshop format proved ideal for identifying key aspects affecting optimum performance in a variety of applications. Individual groups of experts addressed network and system modeling, magnetic materials, power conditioning, core cooling and dielectrics, and finally circuits and application. At the end, they came together to consolidate their input and formulate the workshop's conclusions, identifying roadblocks or suggesting research projects, particularly as they apply to magnetic switching's trump card - its high-average-power-handling capability (at least on a burst-mode basis). The workshop was especially productive both in the quality and quantity of information transfer in an environment conducive to a free and open exchange of ideas. We will not delve into the organization proper of this meeting, rather we wish to commend to the interested reader this volume, which provides the definitive and most up-to-date compilation on the subject of magnetic pulse compression from underlying principles to current state of the art as well as the prognosis for the future of magnetic pulse compression as a consensus of the workshop's organizers and participants.

  17. Numerically Modeling Pulsed-Current, Kinked Wire Experiments

    NASA Astrophysics Data System (ADS)

    Filbey, Gordon; Kingman, Pat

    1999-06-01

    The U.S. Army Research Laboratory (ARL) has embarked on a program to provide far-term land fighting vehicles with electromagnetic armor protection. Part of this work seeks to establish robust simulations of magneto-solid-mechanics phenomena. Whether describing violent rupture of a fuse link resulting from a large current pulse or the complete disruption of a copper shaped-charge jet subjected to high current densities, the simulations must include effects of intense Lorentz body forces and rapid Ohmic heating. Material models are required that describe plasticity, flow and fracture, conductivity, and equation of state (EOS) parameters for media in solid, liquid, and vapor phases. An extended version of the Eulerian wave code CTH has been used to predict the apex motion of a V-shaped (``kinked'') copper wire 3mm in diameter during a 400 kilo-amp pulse. These predictions, utilizing available material, EOS, and conductivity data for copper and the known characteristics of an existing capacitor-bank pulsed power supply, were then used to configure an experiment. The experiments were in excellent agreement with the prior simulations. Both computational and experimental results (including electrical data and flash X-rays) will be presented.

  18. MULTICHANNEL PULSE-HEIGHT ANALYZER

    DOEpatents

    Russell, J.T.; Lefevre, H.W.

    1958-01-21

    This patent deals with electronic computing circuits and more particularly to pulse-height analyzers used for classifying variable amplitude pulses into groups of different amplitudes. The device accomplishes this pulse allocation by by converting the pulses into frequencies corresponding to the amplitudes of the pulses, which frequencies are filtered in channels individually pretuned to a particular frequency and then detected and recorded in the responsive channel. This circuit substantially overcomes the disadvantages of prior annlyzers incorporating discriminators pre-set to respond to certain voltage levels, since small variation in component values is not as critical to satisfactory circuit operation.

  19. Hybrid chirped-pulse amplification.

    PubMed

    Jovanovic, Igor; Ebbers, Christopher A; Barty, C P J

    2002-09-15

    Conversion efficiency in optical parametric chirped-pulse amplification is limited by spatiotemporal characteristics of the pump pulse. We have demonstrated a novel hybrid chirped-pulse amplification scheme that uses a single pump pulse and combines optical parametric amplification and laser amplification to achieve high gain, high conversion efficiency, and high prepulse contrast without utilization of electro-optic modulators. We achieved an overall conversion efficiency of 37% from the hybrid amplification system at a center wavelength of 820nm. Generation of multiterawatt pulses is possible by use of this simple method and commercial Q -switched pump lasers.

  20. Asymptotic behavior on a kind of parabolic Monge-Ampère equation

    NASA Astrophysics Data System (ADS)

    Wang, Bo; Bao, Jiguang

    2015-07-01

    In this paper, we apply level set and nonlinear perturbation methods to obtain the asymptotic behavior of the solution to a kind of parabolic Monge-Ampère equation at infinity. The Jörgens-Calabi-Pogorelov theorem for parabolic and elliptic Monge-Ampère equation can be regarded as special cases of our result.

  1. Targeting brain tumor cAMP: the case for sex-specific therapeutics

    PubMed Central

    Warrington, Nicole M.; Sun, Tao; Rubin, Joshua B.

    2015-01-01

    A relationship between cyclic adenosine 3′, 5′-monophosphate (cAMP) levels and brain tumor biology has been evident for nearly as long as cAMP and its synthetase, adenylate cyclase (ADCY) have been known. The importance of the pathway in brain tumorigenesis has been demonstrated in vitro and in multiple animal models. Recently, we provided human validation for a cooperating oncogenic role for cAMP in brain tumorigenesis when we found that SNPs in ADCY8 were correlated with glioma (brain tumor) risk in individuals with Neurofibromatosis type 1 (NF1). Together, these studies provide a strong rationale for targeting cAMP in brain tumor therapy. However, the cAMP pathway is well-known to be sexually dimorphic, and SNPs in ADCY8 affected glioma risk in a sex-specific fashion, elevating the risk for females while protecting males. The cAMP pathway can be targeted at multiple levels in the regulation of its synthesis and degradation. Sex differences in response to drugs that target cAMP regulators indicate that successful targeting of the cAMP pathway for brain tumor patients is likely to require matching specific mechanisms of drug action with patient sex. PMID:26283963

  2. A possible signal-coupling role for cyclic AMP during endocytosis in Amoeba proteus.

    PubMed

    Prusch, R D; Roscoe, J C

    1993-01-01

    Cytoplasmic levels of cAMP in Amoeba proteus were measured utilizing radioimmunoassays under control conditions and when stimulated by inducers of either pinocytosis or phagocytosis. In control cells, cytoplasmic cAMP levels were approximately 0.39 pM/mg cells. When exposed to either chemotactic peptide or mannose which stimulate phagocytosis in the amoeba, there is a rapid doubling of the cAMP level within 45 sec of stimulation which then returns to the control level within 3-5 min. Theophylline prolongs the elevation of cytoplasmic cAMP in stimulated cells and is also capable of eliciting food vacuole formation in the amoeba. In addition isoproterenol also causes food vacuole formation in the amoeba as well as a large and prolonged increase in cytoplasmic cAMP levels. Inducers of pinocytosis (BSA and Na Cl) also elicit changes in cytoplasmic cAMP in the amoeba, but the response appears to differ from that elicited by inducers of phagocytosis in that the peak cAMP levels are broader and biphasic. It is concluded that cAMP plays a signal-coupling role during the early phases of both forms of endocytosis in Amoeba proteus.

  3. BaAMPs: the database of biofilm-active antimicrobial peptides.

    PubMed

    Di Luca, Mariagrazia; Maccari, Giuseppe; Maisetta, Giuseppantonio; Batoni, Giovanna

    2015-01-01

    Antimicrobial peptides (AMPs) are increasingly being considered as novel agents against biofilms. The development of AMP-based anti-biofilm strategies strongly relies on the design of sequences optimized to target specific features of sessile bacterial/fungal communities. Although several AMP databases have been created and successfully exploited for AMP design, all of these use data collected on peptides tested against planktonic microorganisms. Here, an open-access, manually curated database of AMPs specifically assayed against microbial biofilms (BaAMPs) is presented for the first time. In collecting relevant data from the literature an effort was made to define a minimal standard set of essential information including, for each AMP, the microbial species and biofilm conditions against which it was tested, and the specific assay and peptide concentration used. The availability of these data in an organized framework will benefit anti-biofilm research and support the design of novel molecules active against biofilm. BaAMPs is accessible at http://www.baamps.it. PMID:25760404

  4. A Temporal-Specific and Transient cAMP Increase Characterizes Odorant Classical Conditioning

    ERIC Educational Resources Information Center

    Cui, Wen; Smith, Andrew; Darby-King, Andrea; Harley, Carolyn W.; McLean, John H.

    2007-01-01

    Increases in cyclic adenosine monophosphate (cAMP) are proposed to initiate learning in a wide variety of species. Here, we measure changes in cAMP in the olfactory bulb prior to, during, and following a classically conditioned odor preference trial in rat pups. Measurements were taken up to the point of maximal CREB phosphorylation in olfactory…

  5. Phosphorylation and inhibition of. gamma. -glutamyl transferase activity by cAMP-dependent protein kinase

    SciTech Connect

    Kolesnichenko, L.S.; Chernov, N.N.

    1986-10-20

    It was shown that preparations of bovine kidney ..gamma..-glutamyl transferase of differing degrees of purity are phosphorylated by cAMP-dependent protein kinase. This is accompanied by a decrease in both the transferase and hydrolase activities of the enzyme. Consequently, ..gamma..-glutamyl transferase may serve as the substrate and target of the regulation of cAMP-dependent protein kinase.

  6. A Cell-Autonomous Molecular Cascade Initiated by AMP-Activated Protein Kinase Represses Steroidogenesis

    PubMed Central

    Abdou, Houssein S.; Bergeron, Francis

    2014-01-01

    Steroid hormones regulate essential physiological processes, and inadequate levels are associated with various pathological conditions. In testosterone-producing Leydig cells, steroidogenesis is strongly stimulated by luteinizing hormone (LH) via its receptor leading to increased cyclic AMP (cAMP) production and expression of the steroidogenic acute regulatory (STAR) protein, which is essential for the initiation of steroidogenesis. Steroidogenesis then passively decreases with the degradation of cAMP into AMP by phosphodiesterases. In this study, we show that AMP-activated protein kinase (AMPK) is activated following cAMP-to-AMP breakdown in MA-10 and MLTC-1 Leydig cells. Activated AMPK then actively inhibits cAMP-induced steroidogenesis by repressing the expression of key regulators of steroidogenesis, including Star and Nr4a1. Similar results were obtained in Y-1 adrenal cells and in the constitutively steroidogenic R2C cells. We have also determined that maximum AMPK activation following stimulation of steroidogenesis in MA-10 Leydig cells occurs when steroid hormone production has reached a plateau. Our data identify AMPK as a molecular rheostat that actively represses steroid hormone biosynthesis to preserve cellular energy homeostasis and prevent excess steroid production. PMID:25225331

  7. Changes in the cyclic AMP content during growth and development of Acetabularia.

    PubMed

    Minder, C; Vanden Driessche, T

    1978-05-26

    The 3',5'-adenosine monophosphate (cyclic-AMP) content of the unicellular alga Acetabularia has been examined at various developmental stages. It has been found that very young algae, less than 10mm in length, have a high cAMP content [more than 7 pmoles per 100 mg wet weight (WW)], but that with the growth of the algae, the cAMP content decreases rapidly, reaching the low level of 0.5--1.0 pmoles per 100mg WW. The cAMP content remains at this level until cap differentiation, after which an increase in cAMP content accompanies cap enlargement. It has been shown that these results are unlikely to be affected by changes in the cAMP content induced by variations in circadian rhythm. Treatment with theophylline (2.10(-3) M), a phosphodieterase inhibitor, results in an increase in the cAMP content and delays growth and cap formation. Experiments on the effects of theophylline upon the circadian rhythm of oxygen evolution have shown that the continuous presence of theophylline in the culture medium does not induce a phase shift in the rhythm. The cAMP content of anucleate Acetabularia shows development stage variations parallel to that of the whole algae.

  8. Cyclic-AMP inhibition of fimbriae and prodigiosin production by Serratia marcescens is strain-dependent.

    PubMed

    Stella, Nicholas A; Shanks, Robert M Q

    2014-05-01

    The cyclic-nucleotide 3',5'-cyclic AMP (cAMP) is an ancient and widespread regulatory molecule. Previous studies have shown that fimbria production and secondary metabolite production are inhibited by cAMP in the prokaryote Serratia marcescens. This study used genetic manipulations to test the strain specificity of cAMP-cyclic-AMP receptor protein regulation of fimbria production and of the red pigment, prodigiosin. A surprising amount of variation was observed, as multicopy expression of the cAMP-phosphodiesterase gene, cpdS, conferred either an increase or decrease in fimbriae-dependent yeast agglutination and prodigiosin production depending upon the strain background. Mutation of crp, the gene coding for the cAMP-receptor protein, similarly conferred strain-dependent phenotypes. This study shows that three distinct biological properties, modulated by a conserved genetic regulatory molecule, can vary significantly among strains. Such variation can complicate the functional analysis of bacterial phenotypic properties which are dependent upon global genetic regulators such as cAMP.

  9. Petawatt pulsed-power accelerator

    DOEpatents

    Stygar, William A.; Cuneo, Michael E.; Headley, Daniel I.; Ives, Harry C.; Ives, legal representative; Berry Cottrell; Leeper, Ramon J.; Mazarakis, Michael G.; Olson, Craig L.; Porter, John L.; Wagoner; Tim C.

    2010-03-16

    A petawatt pulsed-power accelerator can be driven by various types of electrical-pulse generators, including conventional Marx generators and linear-transformer drivers. The pulsed-power accelerator can be configured to drive an electrical load from one- or two-sides. Various types of loads can be driven; for example, the accelerator can be used to drive a high-current z-pinch load. When driven by slow-pulse generators (e.g., conventional Marx generators), the accelerator comprises an oil section comprising at least one pulse-generator level having a plurality of pulse generators; a water section comprising a pulse-forming circuit for each pulse generator and a level of monolithic triplate radial-transmission-line impedance transformers, that have variable impedance profiles, for each pulse-generator level; and a vacuum section comprising triplate magnetically insulated transmission lines that feed an electrical load. When driven by LTD generators or other fast-pulse generators, the need for the pulse-forming circuits in the water section can be eliminated.

  10. Quarter-wave pulse tube

    NASA Astrophysics Data System (ADS)

    Swift, G. W.; Gardner, D. L.; Backhaus, S. N.

    2011-10-01

    In high-power pulse-tube refrigerators, the pulse tube itself can be very long without too much dissipation of acoustic power on its walls. The pressure amplitude, the volume-flow-rate amplitude, and the time phase between them evolve significantly along a pulse tube that is about a quarter-wavelength long. Proper choice of length and area makes the oscillations at the ambient end of the long pulse tube optimal for driving a second, smaller pulse-tube refrigerator, thereby utilizing the acoustic power that would typically have been dissipated in the first pulse-tube refrigerator's orifice. Experiments show that little heat is carried from the ambient heat exchanger to the cold heat exchanger in such a long pulse tube, even though the oscillations are turbulent and even when the tube is compactly coiled.

  11. Laser beam pulse formatting method

    DOEpatents

    Daly, T.P.; Moses, E.I.; Patterson, R.W.; Sawicki, R.H.

    1994-08-09

    A method for formatting a laser beam pulse using one or more delay loops is disclosed. The delay loops have a partially reflective beam splitter and a plurality of highly reflective mirrors arranged such that the laser beam pulse enters into the delay loop through the beam splitter and circulates therein along a delay loop length defined by the mirrors. As the laser beam pulse circulates within the delay loop a portion thereof is emitted upon each completed circuit when the laser beam pulse strikes the beam splitter. The laser beam pulse is thereby formatted into a plurality of sub-pulses. The delay loops are used in combination to produce complex waveforms by combining the sub-pulses using additive waveform synthesis. 8 figs.

  12. Laser beam pulse formatting method

    DOEpatents

    Daly, Thomas P.; Moses, Edward I.; Patterson, Ralph W.; Sawicki, Richard H.

    1994-01-01

    A method for formatting a laser beam pulse (20) using one or more delay loops (10). The delay loops (10) have a partially reflective beam splitter (12) and a plurality of highly reflective mirrors (14) arranged such that the laser beam pulse (20) enters into the delay loop (10) through the beam splitter (12) and circulates therein along a delay loop length (24) defined by the mirrors (14). As the laser beam pulse (20) circulates within the delay loop (10) a portion thereof is emitted upon each completed circuit when the laser beam pulse (20) strikes the beam splitter (12). The laser beam pulse (20) is thereby formatted into a plurality of sub-pulses (50, 52, 54 and 56). The delay loops (10) are used in combination to produce complex waveforms by combining the sub-pulses (50, 52, 54 and 56) using additive waveform synthesis.

  13. cAMP prevents TNF-induced apoptosis through inhibiting DISC complex formation in rat hepatocytes

    SciTech Connect

    Bhattacharjee, Rajesh; Xiang, Wenpei; Wang, Yinna; Zhang, Xiaoying

    2012-06-22

    Highlights: Black-Right-Pointing-Pointer cAMP blocks cell death induced by TNF and actinomycin D in cultured hepatocytes. Black-Right-Pointing-Pointer cAMP blocks NF-{kappa}B activation induced by TNF and actinomycin D. Black-Right-Pointing-Pointer cAMP blocks DISC formation following TNF and actinomycin D exposure. Black-Right-Pointing-Pointer cAMP blocks TNF signaling at a proximal step. -- Abstract: Tumor necrosis factor {alpha} (TNF) is a pleiotropic proinflammatory cytokine that plays a role in immunity and the control of cell proliferation, cell differentiation, and apoptosis. The pleiotropic nature of TNF is due to the formation of different signaling complexes upon the binding of TNF to its receptor, TNF receptor type 1 (TNFR1). TNF induces apoptosis in various mammalian cells when the cells are co-treated with a transcription inhibitor like actinomycin D (ActD). When TNFR1 is activated, it recruits an adaptor protein, TNF receptor-associated protein with death domain (TRADD), through its cytoplasmic death effector domain (DED). TRADD, in turn, recruits other signaling proteins, including TNF receptor-associated protein 2 (TRAF2) and receptor-associated protein kinase (RIPK) 1, to form a complex. Subsequently, this complex combines with FADD and procaspase-8, converts into a death-inducing signaling complex (DISC) to induce apoptosis. Cyclic AMP (cAMP) is a second messenger that regulates various cellular processes such as cell proliferation, gene expression, and apoptosis. cAMP analogues are reported to act as anti-apoptotic agents in various cell types, including hepatocytes. We found that a cAMP analogue, dibutyryl cAMP (db-cAMP), inhibits TNF + ActD-induced apoptosis in rat hepatocytes. The protein kinase A (PKA) inhibitor KT-5720 reverses this inhibitory effect of cAMP on apoptosis. Cytoprotection by cAMP involves down-regulation of various apoptotic signal regulators like TRADD and FADD and inhibition of caspase-8 and caspase-3 cleavage. We also found

  14. cAMP inducibility of transcriptional repressor ICER in developing and mature human T lymphocytes.

    PubMed

    Bodor, J; Spetz, A L; Strominger, J L; Habener, J F

    1996-04-16

    Stimulation of the cAMP-dependent signaling pathway exerts an inhibitory effect on the proliferation and effector functions of T cells. The ability of T cells to form high intracellular levels of cAMP is acquired during development in the human thymus and is retained by the majority of mature peripheral T lymphocytes. Here we show that elevated cAMP levels in T cells correlate with the expression of the potent transcriptional repressor ICER (inducible cAMP early repressor) previously described in the hypothalamic-pituitary-gonadal axis. Further, in transcriptional assays in vivo, ICER inhibits calcineurin-mediated expression of the interleukin 2 promoter as well as Tax-mediated transactivation of the human T-lymphotropic virus type I (HTLV-I) promoter. Thus, the induction of ICER in T cells may play an important role in the cAMP-induced quiescence and the persistent latency of HTLV-I.

  15. AMP-Conjugated Quantum Dots: Low Immunotoxicity Both In Vitro and In Vivo

    NASA Astrophysics Data System (ADS)

    Dai, Tongcheng; Li, Na; Liu, Lu; Liu, Qin; Zhang, Yuanxing

    2015-11-01

    Quantum dots (QDs) are engineered nanoparticles that possess special optical and electronic properties and have shown great promise for future biomedical applications. In this work, adenosine 5'-monophosphate (AMP), a small biocompatible molecular, was conjugated to organic QDs to produce hydrophilic AMP-QDs. Using macrophage J774A.1 as the cell model, AMP-QDs exhibited both prior imaging property and low toxicity, and more importantly, triggered limited innate immune responses in macrophage, indicating low immunotoxicity in vitro. Using BALB/c mice as the animal model, AMP-QDs were found to be detained in immune organs but did not evoke robust inflammation responses or obvious histopathological abnormalities, which reveals low immunotoxicity in vivo. This work suggests that AMP is an excellent surface ligand with low immunotoxicity, and potentially used in surface modification for more extensive nanoparticles.

  16. High-speed pulse-shape generator, pulse multiplexer

    DOEpatents

    Burkhart, Scott C.

    2002-01-01

    The invention combines arbitrary amplitude high-speed pulses for precision pulse shaping for the National Ignition Facility (NIF). The circuitry combines arbitrary height pulses which are generated by replicating scaled versions of a trigger pulse and summing them delayed in time on a pulse line. The combined electrical pulses are connected to an electro-optic modulator which modulates a laser beam. The circuit can also be adapted to combine multiple channels of high speed data into a single train of electrical pulses which generates the optical pulses for very high speed optical communication. The invention has application in laser pulse shaping for inertial confinement fusion, in optical data links for computers, telecommunications, and in laser pulse shaping for atomic excitation studies. The invention can be used to effect at least a 10.times. increase in all fiber communication lines. It allows a greatly increased data transfer rate between high-performance computers. The invention is inexpensive enough to bring high-speed video and data services to homes through a super modem.

  17. The Pseudomonas aeruginosa Chp Chemosensory System Regulates Intracellular cAMP Levels by Modulating Adenylate Cyclase Activity

    PubMed Central

    Fulcher, Nanette B.; Holliday, Phillip M.; Klem, Erich; Cann, Martin J.; Wolfgang, Matthew C.

    2010-01-01

    Summary Multiple virulence systems in the opportunistic pathogen Pseudomonas aeruginosa are regulated by the second messenger signaling molecule adenosine 3’, 5’-cyclic monophosphate (cAMP). Production of cAMP by the putative adenylate cyclase enzyme CyaB represents a critical control point for virulence gene regulation. To identify regulators of CyaB, we screened a transposon insertion library for mutants with reduced intracellular cAMP. The majority of insertions resulting in reduced cAMP mapped to the Chp gene cluster encoding a putative chemotaxis-like chemosensory system. Further genetic analysis of the Chp system revealed that it has both positive and negative effects on intracellular cAMP and that it regulates cAMP levels by modulating CyaB activity. The Chp system was previously implicated in the production and function of type IV pili (TFP). Given that cAMP and the cAMP-dependent transcriptional regulator Vfr control TFP biogenesis gene expression, we explored the relationship between cAMP, the Chp system and TFP regulation. We discovered that the Chp system controls TFP production through modulation of cAMP while control of TFP-dependent twitching motility is cAMP-independent. Overall, our data define a novel function for a chemotaxis-like system in controlling cAMP production and establish a regulatory link between the Chp system, TFP and other cAMP-dependent virulence systems. PMID:20345659

  18. Positive Effect of Carbon Sources on Natural Transformation in Escherichia coli: Role of Low-Level Cyclic AMP (cAMP)-cAMP Receptor Protein in the Derepression of rpoS

    PubMed Central

    Guo, Mengyue; Wang, Huanyu; Xie, Nengbin

    2015-01-01

    ABSTRACT Natural plasmid transformation of Escherichia coli is a complex process that occurs strictly on agar plates and requires the global stress response factor σS. Here, we showed that additional carbon sources could significantly enhance the transformability of E. coli. Inactivation of phosphotransferase system genes (ptsH, ptsG, and crr) caused an increase in the transformation frequency, and the addition of cyclic AMP (cAMP) neutralized the promotional effect of carbon sources. This implies a negative role of cAMP in natural transformation. Further study showed that crp and cyaA mutations conferred a higher transformation frequency, suggesting that the cAMP-cAMP receptor protein (CRP) complex has an inhibitory effect on transformation. Moreover, we observed that rpoS is negatively regulated by cAMP-CRP in early log phase and that both crp and cyaA mutants show no transformation superiority when rpoS is knocked out. Therefore, it can be concluded that both the crp and cyaA mutations derepress rpoS expression in early log phase, whereby they aid in the promotion of natural transformation ability. We also showed that the accumulation of RpoS during early log phase can account for the enhanced transformation aroused by additional carbon sources. Our results thus demonstrated that the presence of additional carbon sources promotes competence development and natural transformation by reducing cAMP-CRP and, thus, derepressing rpoS expression during log phase. This finding could contribute to a better understanding of the relationship between nutrition state and competence, as well as the mechanism of natural plasmid transformation in E. coli. IMPORTANCE Escherichia coli, which is not usually considered to be naturally transformable, was found to spontaneously take up plasmid DNA on agar plates. Researching the mechanism of natural transformation is important for understanding the role of transformation in evolution, as well as in the transfer of pathogenicity and

  19. Complex Regulation Pathways of AmpC-Mediated β-Lactam Resistance in Enterobacter cloacae Complex.

    PubMed

    Guérin, François; Isnard, Christophe; Cattoir, Vincent; Giard, Jean Christophe

    2015-12-01

    Enterobacter cloacae complex (ECC), an opportunistic pathogen causing numerous infections in hospitalized patients worldwide, is able to resist β-lactams mainly by producing the AmpC β-lactamase enzyme. AmpC expression is highly inducible in the presence of some β-lactams, but the underlying genetic regulation, which is intricately linked to peptidoglycan recycling, is still poorly understood. In this study, we constructed different mutant strains that were affected in genes encoding enzymes suspected to be involved in this pathway. As expected, the inactivation of ampC, ampR (which encodes the regulator protein of ampC), and ampG (encoding a permease) abolished β-lactam resistance. Reverse transcription-quantitative PCR (qRT-PCR) experiments combined with phenotypic studies showed that cefotaxime (at high concentrations) and cefoxitin induced the expression of ampC in different ways: one involving NagZ (a N-acetyl-β-D-glucosaminidase) and another independent of NagZ. Unlike the model established for Pseudomonas aeruginosa, inactivation of DacB (also known as PBP4) was not responsible for a constitutive ampC overexpression in ECC, whereas it caused AmpC-mediated high-level β-lactam resistance, suggesting a post-transcriptional regulation mechanism. Global transcriptomic analysis by transcriptome sequencing (RNA-seq) of a dacB deletion mutant confirmed these results. Lastly, analysis of 37 ECC clinical isolates showed that amino acid changes in the AmpD sequence were likely the most crucial event involved in the development of high-level β-lactam resistance in vivo as opposed to P. aeruginosa where dacB mutations have been commonly found. These findings bring new elements for a better understanding of β-lactam resistance in ECC, which is essential for the identification of novel potential drug targets. PMID:26438498

  20. Complex Regulation Pathways of AmpC-Mediated β-Lactam Resistance in Enterobacter cloacae Complex

    PubMed Central

    Guérin, François; Isnard, Christophe; Giard, Jean Christophe

    2015-01-01

    Enterobacter cloacae complex (ECC), an opportunistic pathogen causing numerous infections in hospitalized patients worldwide, is able to resist β-lactams mainly by producing the AmpC β-lactamase enzyme. AmpC expression is highly inducible in the presence of some β-lactams, but the underlying genetic regulation, which is intricately linked to peptidoglycan recycling, is still poorly understood. In this study, we constructed different mutant strains that were affected in genes encoding enzymes suspected to be involved in this pathway. As expected, the inactivation of ampC, ampR (which encodes the regulator protein of ampC), and ampG (encoding a permease) abolished β-lactam resistance. Reverse transcription-quantitative PCR (qRT-PCR) experiments combined with phenotypic studies showed that cefotaxime (at high concentrations) and cefoxitin induced the expression of ampC in different ways: one involving NagZ (a N-acetyl-β-d-glucosaminidase) and another independent of NagZ. Unlike the model established for Pseudomonas aeruginosa, inactivation of DacB (also known as PBP4) was not responsible for a constitutive ampC overexpression in ECC, whereas it caused AmpC-mediated high-level β-lactam resistance, suggesting a post-transcriptional regulation mechanism. Global transcriptomic analysis by transcriptome sequencing (RNA-seq) of a dacB deletion mutant confirmed these results. Lastly, analysis of 37 ECC clinical isolates showed that amino acid changes in the AmpD sequence were likely the most crucial event involved in the development of high-level β-lactam resistance in vivo as opposed to P. aeruginosa where dacB mutations have been commonly found. These findings bring new elements for a better understanding of β-lactam resistance in ECC, which is essential for the identification of novel potential drug targets. PMID:26438498

  1. AMP-18 protects barrier function of colonic epithelial cells: role of tight junction proteins

    PubMed Central

    Walsh-Reitz, Margaret M.; Huang, Erick F.; Musch, Mark W.; Chang, Eugene B.; Martin, Terence E.; Kartha, Sreedharan; Toback, F. Gary

    2005-01-01

    AMP-18, a novel gastric antrum mucosal protein, and a synthetic peptide of amino acids 77-97, have mitogenic and motogenic properties for epithelial cells. The possibility that AMP-18 is also protective was evaluated in the colonic mucosa of mice and monolayer cultures of human colonic epithelial Caco2/bbe (C2) cells. Administration of AMP peptide to mice with dextran sulfate sodium (DSS)-induced colonic injury delayed the onset of bloody diarrhea, and reduced weight loss. Treatment of C2 cells with AMP peptide protected monolayers against decreases in transepithelial electrical resistance (TER) induced by the oxidant monochloramine, indomethacin, or DSS. A molecular mechanism for these barrier-protective effects was sought by asking if AMP peptide acted on specific tight junction (TJ) proteins. Immunoblots of detergent-insoluble fractions of C2 cells treated with AMP peptide exhibited increased accumulation of specific TJ proteins. Occludin immunoreactivity was also increased in detergent-insoluble fractions obtained from colonic mucosal cells of mice injected with AMP peptide. Laser scanning confocal microscopy (CF) supported the capacity of AMP peptide to enhance accumulation of occludin and ZO-1 in TJ domains of C2 cell monolayers, and together with immunoblot analysis showed that the peptide protected against loss of these TJ proteins following oxidant injury. AMP peptide also protected against a fall in TER during disruption of actin filaments by cytochalasin D, and stabilized perijunctional actin during oxidant injury when assessed by CF. These findings suggest that AMP-18 could protect the intestinal mucosal barrier by acting on specific TJ proteins and stabilizing perijunctional actin. PMID:15961882

  2. Dibutyryl cAMP effects on thromboxane and leukotriene production in decompression-induced lung injury

    NASA Technical Reports Server (NTRS)

    Little, T. M.; Butler, B. D.

    1997-01-01

    Decompression-induced venous bubble formation has been linked to increased neutrophil counts, endothelial cell injury, release of vasoactive eicosanoids, and increased vascular membrane permeability. These actions may account for inflammatory responses and edema formation. Increasing the intracellular cAMP has been shown to decrease eicosanoid production and edema formation in various models of lung injury. Reduction of decompression-induced inflammatory responses was evaluated in decompressed rats pretreated with saline (controls) or dibutyryl cAMP (DBcAMP, an analog of cAMP). After pretreatment, rats were exposed to either 616 kPa for 120 min or 683 kPa for 60 min. The observed increases in extravascular lung water ratios (pulmonary edema), bronchoalveolar lavage, and pleural protein in the saline control group (683 kPa) were not evident with DBcAMP treatment. DBcAMP pretreatment effects were also seen with the white blood cell counts and the percent of neutrophils in the bronchoalveolar lavage. Urinary levels of thromboxane B2, 11-dehydrothromboxane B2, and leukotriene E4 were significantly increased with the 683 kPa saline control decompression exposure. DBcAMP reduced the decompression-induced leukotriene E4 production in the urine. Plasma levels of thromboxane B2, 11-dehydrothromboxane B2, and leukotriene E4 were increased with the 683-kPa exposure groups. DBcAMP treatment did not affect these changes. The 11-dehydrothromboxane B2 and leukotriene E4 levels in the bronchoalveolar lavage were increased with the 683 kPa exposure and were reduced with the DBcAMP treatment. Our results indicate that DBcAMP has the capability to reduce eicosanoid production and limit membrane permeability and subsequent edema formation in rats experiencing decompression sickness.

  3. cAMP-binding proteins in medullary tubules from rat kidney: effect of ADH

    SciTech Connect

    Gapstur, S.M.; Homma, S.; Dousa, T.P.

    1988-08-01

    Little is known of the regulatory steps in the cellular action of vasopressin (AVP) on the renal epithelium, subsequent to the cAMP generation. We studied cAMP-binding proteins in the medullary collecting tubule (MCT) and the thick ascending limb of Henle's loop (MTAL) microdissected from the rat kidney by use of photoaffinity labeling. Microdissected tubules were homogenized and photoaffinity labeled by incubation with 1 microM 32P-labeled 8-azido-adenosine 3',5'-cyclic monophosphate (N3-8-(32P)-cAMP); the incorporated 32P was analyzed by sodium dodecyl sulfate-polyacrylamide gel electrophoresis and autoradiography. Both in MCT and MTAL preparations, the analyses showed incorporation of N3-8-(32P)cAMP into two bands (Mr = 49,000 and Mr = 55,000) that comigrated with standards of the cAMP-dependent protein kinase regulatory subunits RI and RII. In MCT, most of the 32P (80%) was incorporated into RI, whereas in MTAL the 32P incorporated into RI and RII was equivalent. When freshly dissected MCT segments were incubated with 10(-12)-10(-6) M AVP, the subsequent photoaffinity labeling of RI with N3-8-(32P)cAMP was markedly diminished in a dose-dependent manner compared with controls. Our results suggest that cAMP binds in MCT and MTAL to regulatory subunits RI and RII of cAMP-dependent protein kinase. However, in MCT the dominant type of cAMP-dependent protein kinase appears to be type I. The outlined procedure is suitable to indirectly measure the occupancy of RI by endogenous cAMP generated in MCT cells in response to physiological levels (10(-12) M) of AVP.

  4. Atrazine Acts as an Endocrine Disrupter by Inhibiting cAMP-specific Phosphodiesterase-4

    PubMed Central

    Kucka, Marek; Pogrmic-Majkic, Kristina; Fa, Svetlana; Stojilkovic, Stanko S.; Kovacevic, Radmila

    2014-01-01

    Atrazine, one of the most commonly used herbicides worldwide, acts as an endocrine disruptor, but the mechanism of its action has not been characterized. In this study, we show that atrazine rapidly increases cAMP levels in cultured rat pituitary and testicular Leydig cells in a concentration-dependent manner, but less effectively than 3-isobutyl-1-methylxanthine, a competitive non-specific inhibitor of phosphodiesterases (PDEs). In forskolin (an activator of adenylyl cyclase)- and probenecid (an inhibitor of cyclic nucleotide transporters)-treated cells, but not in 3-isobutyl-1-methylxanthine-treated cells, atrazine further increased cAMP levels, indicating that inhibition of PDEs accounts for accumulation of cAMP. In contrast to cAMP, atrazine did not alter cGMP levels, further indicating that it inhibits cAMP-specific PDEs. Atrazine-induced changes in cAMP levels were sufficient to stimulate prolactin release in pituitary cells and androgen production in Leydig cells, indicating that it acts as an endocrine disrupter both in cells that secrete by exocytosis of prestored hormones and in cells that secrete by de novo hormone synthesis. Rolipram abolished the stimulatory effect of atrazine on cAMP release in both cell types, suggesting that it acts as an inhibitor of PDE4s, isoforms whose mRNA transcripts dominate in pituitary and Leydig cells together with mRNA for PDE8A. In contrast, immortalized lacto-somatotrophs showed low expression of these mRNA transcripts and several fold higher cAMP levels compared to normal pituitary cells, and atrazine was unable to further increase cAMP levels. These results indicate that atrazine acts as a general endocrine disrupter by inhibiting cAMP-specific PDE4s. PMID:23022511

  5. Intrasteric control of AMPK via the gamma1 subunit AMP allosteric regulatory site.

    PubMed

    Adams, Julian; Chen, Zhi-Ping; Van Denderen, Bryce J W; Morton, Craig J; Parker, Michael W; Witters, Lee A; Stapleton, David; Kemp, Bruce E

    2004-01-01

    AMP-activated protein kinase (AMPK) is a alphabetagamma heterotrimer that is activated in response to both hormones and intracellular metabolic stress signals. AMPK is regulated by phosphorylation on the alpha subunit and by AMP allosteric control previously thought to be mediated by both alpha and gamma subunits. Here we present evidence that adjacent gamma subunit pairs of CBS repeat sequences (after Cystathionine Beta Synthase) form an AMP binding site related to, but distinct from the classical AMP binding site in phosphorylase, that can also bind ATP. The AMP binding site of the gamma(1) CBS1/CBS2 pair, modeled on the structures of the CBS sequences present in the inosine monophosphate dehydrogenase crystal structure, contains three arginine residues 70, 152, and 171 and His151. The yeast gamma homolog, snf4 contains a His151Gly substitution, and when this is introduced into gamma(1), AMP allosteric control is substantially lost and explains why the yeast snf1p/snf4p complex is insensitive to AMP. Arg70 in gamma(1) corresponds to the site of mutation in human gamma(2) and pig gamma(3) genes previously identified to cause an unusual cardiac phenotype and glycogen storage disease, respectively. Mutation of any of AMP binding site Arg residues to Gln substantially abolishes AMP allosteric control in expressed AMPK holoenzyme. The Arg/Gln mutations also suppress the previously described inhibitory properties of ATP and render the enzyme constitutively active. We propose that ATP acts as an intrasteric inhibitor by bridging the alpha and gamma subunits and that AMP functions to derepress AMPK activity.

  6. cAMP mediators of pulsatile insulin secretion from glucose-stimulated single beta-cells.

    PubMed

    Idevall-Hagren, Olof; Barg, Sebastian; Gylfe, Erik; Tengholm, Anders

    2010-07-23

    Pulsatile insulin release from glucose-stimulated beta-cells is driven by oscillations of the Ca(2+) and cAMP concentrations in the subplasma membrane space ([Ca(2+)](pm) and [cAMP](pm)). To clarify mechanisms by which cAMP regulates insulin secretion, we performed parallel evanescent wave fluorescence imaging of [cAMP](pm), [Ca(2+)](pm), and phosphatidylinositol 3,4,5-trisphosphate (PIP(3)) in the plasma membrane. This lipid is formed by autocrine insulin receptor activation and was used to monitor insulin release kinetics from single MIN6 beta-cells. Elevation of the glucose concentration from 3 to 11 mm induced, after a 2.7-min delay, coordinated oscillations of [Ca(2+)](pm), [cAMP](pm), and PIP(3). Inhibitors of protein kinase A (PKA) markedly diminished the PIP(3) response when applied before glucose stimulation, but did not affect already manifested PIP(3) oscillations. The reduced PIP(3) response could be attributed to accelerated depolarization causing early rise of [Ca(2+)](pm) that preceded the elevation of [cAMP](pm). However, the amplitude of the PIP(3) response after PKA inhibition was restored by a specific agonist to the cAMP-dependent guanine nucleotide exchange factor Epac. Suppression of cAMP formation with adenylyl cyclase inhibitors reduced already established PIP(3) oscillations in glucose-stimulated cells, and this effect was almost completely counteracted by the Epac agonist. In cells treated with small interfering RNA targeting Epac2, the amplitudes of the glucose-induced PIP(3) oscillations were reduced, and the Epac agonist was without effect. The data indicate that temporal coordination of the triggering [Ca(2+)](pm) and amplifying [cAMP](pm) signals is important for glucose-induced pulsatile insulin release. Although both PKA and Epac2 partake in initiating insulin secretion, the cAMP dependence of established pulsatility is mediated by Epac2.

  7. Repair of nonunions by electrically pulsed current stimulation.

    PubMed

    Zichner, L

    1981-01-01

    Five congenital and 52 acquired nonunions of bone were stimulated using an invasive device. The unit delivered a constant but pulsed right-angled current of positive polarity measuring 20 to 25 muAmps (voltage of 750 mV) and a frequency of 20 Hz. The power pack encapsulated in epoxy resin was implanted at the time of operative fragment stabilization. THe cathode was inserted at the site of the nonunion gap. After two to 12 months, all but two of the acquired nonunions and one of the congenital pseudarthroses healed. In the unsuccessful cases, the bone ends were often totally necrotic. Four cases required reimplantation because of broken wires or expiration of the battery, and two cases failed owing to purulent infection. Electrostimulation is an adjuvant treatment to fragment stabilization in hyporeactive and hypovascular or congenital pseudarthroses. Electrical stimuli may be assumed to simulate conditions which are essential for bone healing.

  8. Coiled transmission line pulse generators

    DOEpatents

    McDonald, Kenneth Fox

    2010-11-09

    Methods and apparatus are provided for fabricating and constructing solid dielectric "Coiled Transmission Line" pulse generators in radial or axial coiled geometries. The pour and cure fabrication process enables a wide variety of geometries and form factors. The volume between the conductors is filled with liquid blends of monomers, polymers, oligomers, and/or cross-linkers and dielectric powders; and then cured to form high field strength and high dielectric constant solid dielectric transmission lines that intrinsically produce ideal rectangular high voltage pulses when charged and switched into matched impedance loads. Voltage levels may be increased by Marx and/or Blumlein principles incorporating spark gap or, preferentially, solid state switches (such as optically triggered thyristors) which produce reliable, high repetition rate operation. Moreover, these Marxed pulse generators can be DC charged and do not require additional pulse forming circuitry, pulse forming lines, transformers, or an a high voltage spark gap output switch. The apparatus accommodates a wide range of voltages, impedances, pulse durations, pulse repetition rates, and duty cycles. The resulting mobile or flight platform friendly cylindrical geometric configuration is much more compact, light-weight, and robust than conventional linear geometries, or pulse generators constructed from conventional components. Installing additional circuitry may accommodate optional pulse shape improvements. The Coiled Transmission Lines can also be connected in parallel to decrease the impedance, or in series to increase the pulse length.

  9. Prostaglandins and muscarinic agonists induce cyclic AMP attenuation by two distinct mechanisms in the pregnant-rat myometrium. Interaction between cyclic AMP and Ca2+ signals.

    PubMed Central

    Goureau, O; Tanfin, Z; Harbon, S

    1990-01-01

    In pregnant-rat myometrium (day 21 of gestation), isoprenaline-induced cyclic AMP accumulation, resulting from receptor-mediated activation of adenylate cyclase, was negatively regulated by prostaglandins [PGE2, PGF2 alpha; EC50 (concn. giving 50% of maximal response) = 2 nM] and by the muscarinic agonist carbachol (EC50 = 2 microM). PG-induced inhibition was prevented by pertussis-toxin treatment, supporting the idea that it was mediated by the inhibitory G-protein Gi through the inhibitory pathway of the adenylate cyclase. Both isoprenaline-induced stimulation and PG-evoked inhibition of cyclic AMP were insensitive to Ca2+ depletion. By contrast, carbachol-evoked attenuation of cyclic AMP accumulation was dependent on Ca2+ and was insensitive to pertussis toxin. The inhibitory effect of carbachol was mimicked by ionomycin. Indirect evidence was thus provided for the enhancement of cyclic AMP degradation by a Ca2(+)-dependent phosphodiesterase activity in the muscarinic-mediated effect. The attenuation of cyclic AMP elicited by carbachol coincided with carbachol-stimulated inositol phosphate (InsP3, InsP2 and InsP) generation, which displayed an almost identical EC50 (3 microM) and was similarly unaffected by pertussis toxin. Both carbachol effects were reproduced by oxotremorine, whereas pilocarpine (a partial muscarinic agonist) failed to induce any decrease in cyclic AMP accumulation and concurrently was unable to stimulate the generation of inositol phosphates. These data support our proposal for a carbachol-mediated enhancement of a Ca2(+)-dependent phosphodiesterase activity, compatible with the rises in Ca2+ associated with muscarinic-induced increased generation of inositol phosphates. They further illustrate that a cross-talk between the two major transmembrane signalling systems contributed to an ultimate decrease in cyclic AMP in the pregnant-rat myometrium near term. PMID:1700899

  10. Microwave and Pulsed Power

    SciTech Connect

    Freytag, E.K.

    1993-03-01

    The goals of the Microwave and Pulsed Power thrust area are to identify realizable research and development efforts and to conduct high-quality research in those pulse power and microwave technologies that support existing and emerging programmatic requirements at Lawrence Livermore National Laboratory (LLNL). Our main objective is to work on nationally important problems while enhancing our basic understanding of enabling technologies such as component design and testing, compact systems packaging, exploratory physics experiments, and advanced systems integration and performance. During FY-92, we concentrated our research efforts on the six project areas described in this report. (1) We are investigating the superior electronic and thermal properties of diamond that may make it an ideal material for a high-power, solid-state switch. (2) We are studying the feasibility of using advanced Ground Penetrating Imaging Radar technology for reliable non-destructive evaluation of bridges and other high-value concrete structures. These studies include conceptual designs, modeling, experimental verifications, and image reconstruction of simulated radar data. (3) We are exploring the efficiency of pulsed plasma processing techniques used for the removal of NO{sub x} from various effluent sources. (4) We have finished the investigation of the properties of a magnetically delayed low-pressure gas switch, which was designed here at LLNL. (5) We are applying statistical electromagnetic theory techniques to help assess microwave effects on electronic subsystems, by using a mode stirred chamber as our measurement tool. (6) We are investigating the generation of perfluoroisobutylene (PFIB) in proposed CFC replacement fluids when they are subjected to high electrical stresses and breakdown environments.

  11. Atrazine acts as an endocrine disrupter by inhibiting cAMP-specific phosphodiesterase-4

    SciTech Connect

    Kucka, Marek; Pogrmic-Majkic, Kristina; Fa, Svetlana; Stojilkovic, Stanko S.; Kovacevic, Radmila

    2012-11-15

    Atrazine, one of the most commonly used herbicides worldwide, acts as an endocrine disruptor, but the mechanism of its action has not been characterized. In this study, we show that atrazine rapidly increases cAMP levels in cultured rat pituitary and testicular Leydig cells in a concentration-dependent manner, but less effectively than 3-isobutyl-1-methylxanthine, a competitive non-specific inhibitor of phosphodiesterases (PDEs). In forskolin (an activator of adenylyl cyclase)- and probenecid (an inhibitor of cyclic nucleotide transporters)-treated cells, but not in 3-isobutyl-1-methylxanthine-treated cells, atrazine further increased cAMP levels, indicating that inhibition of PDEs accounts for accumulation of cAMP. In contrast to cAMP, atrazine did not alter cGMP levels, further indicating that it inhibits cAMP-specific PDEs. Atrazine-induced changes in cAMP levels were sufficient to stimulate prolactin release in pituitary cells and androgen production in Leydig cells, indicating that it acts as an endocrine disrupter both in cells that secrete by exocytosis of prestored hormones and in cells that secrete by de novo hormone synthesis. Rolipram abolished the stimulatory effect of atrazine on cAMP release in both cell types, suggesting that it acts as an inhibitor of PDE4s, isoforms whose mRNA transcripts dominate in pituitary and Leydig cells together with mRNA for PDE8A. In contrast, immortalized lacto-somatotrophs showed low expression of these mRNA transcripts and several fold higher cAMP levels compared to normal pituitary cells, and atrazine was unable to further increase cAMP levels. These results indicate that atrazine acts as a general endocrine disrupter by inhibiting cAMP-specific PDE4s. -- Highlights: ► Atrazine stimulates cAMP accumulation in pituitary and Leydig cells. ► Atrazine also stimulates PRL and androgens secretion. ► Stimulatory effects of atrazine were abolished in cells with IBMX-inhibited PDEs. ► Atrazine specificity toward cAMP

  12. Pulsed Plasma Thruster Technology

    NASA Technical Reports Server (NTRS)

    1996-01-01

    The continuing emphasis on reducing costs and downsizing spacecraft is forcing increased emphasis on reducing the subsystem mass and integration costs. For many commercial, scientific, and Department of Defense space missions, onboard propulsion is either the predominant spacecraft mass or it limits the spacecraft lifetime. Electromagnetic-pulsed-plasma thrusters (PPT's) offer the combined benefits of extremely low average electric power requirements (1 to 150 W), high specific impulse (approx. 1000 sec), and system simplicity derived from the use of an inert solid propellant. Potential applications range from orbit insertion and maintenance of small satellites to attitude control for large geostationary communications satellites.

  13. PULSE SYNTHESIZING GENERATOR

    DOEpatents

    Kerns, Q.A.

    1963-08-01

    >An electronlc circuit for synthesizing electrical current pulses having very fast rise times includes several sinewave generators tuned to progressively higher harmonic frequencies with signal amplitudes and phases selectable according to the Fourier series of the waveform that is to be synthesized. Phase control is provided by periodically triggering the generators at precisely controlled times. The outputs of the generators are combined in a coaxial transmission line. Any frequency-dependent delays that occur in the transmission line can be readily compensated for so that the desired signal wave shape is obtained at the output of the line. (AEC)

  14. Pulsed Long Arc Welding

    NASA Astrophysics Data System (ADS)

    Krampit, N. Yu

    2016-04-01

    The paper presents a method and an appliance for pulsed arc welding. The method supports dosage of energy required for melting each bead of electrode metal starting from the detachment of a bead. The appliance including a sensor to register bead detachment shows this moment due to the voltage burst in the arc space. Transferred beads of electrode metal are of similar size because of the dosage of energy used for melting each bead, as the consequence, the process is more stable and starting conditions to transfer electrode metal are similar, as the result, a produced weld is improved.

  15. Green Light Pulse Oximeter

    DOEpatents

    Scharf, John Edward

    1998-11-03

    A reflectance pulse oximeter that determines oxygen saturation of hemoglobin using two sources of electromagnetic radiation in the green optical region, which provides the maximum reflectance pulsation spectrum. The use of green light allows placement of an oximetry probe at central body sites (e.g., wrist, thigh, abdomen, forehead, scalp, and back). Preferably, the two green light sources alternately emit light at 560 nm and 577 nm, respectively, which gives the biggest difference in hemoglobin extinction coefficients between deoxyhemoglobin, RHb, and oxyhemoglobin, HbO.sub.2.

  16. Pulse front tilt measurement of femtosecond laser pulses

    NASA Astrophysics Data System (ADS)

    Dimitrov, Nikolay; Stoyanov, Lyubomir; Stefanov, Ivan; Dreischuh, Alexander; Hansinger, Peter; Paulus, Gerhard G.

    2016-07-01

    In this work we report experimental investigations of an intentionally introduced pulse front tilt on femtosecond laser pulses by using an inverted field correlator/interferometer. A reliable criterion for the precision in aligning (in principle) dispersionless systems for manipulating ultrashort pulses is developed, specifically including cases when the pulse front tilt is a result of a desired spatio-temporal coupling. The results obtained using two low-dispersion diffraction gratings are in good qualitative agreement with the data from a previously developed analytical model and from an independent interferometric measurement.

  17. Subcycle Pulsed Focused Vector Beams

    SciTech Connect

    Lin Qiang; Zheng Jian; Becker, Wilhelm

    2006-12-22

    An accurate description of a subcycle pulsed beam (SCPB) is presented based on the complex-source model. The fields are exact solutions of Maxwell's equations and applicable to a focused pulsed beam with a pulse duration down to and below one cycle of the carrier wave and with arbitrary polarization state. Depending on the pulse duration, the pulse is blueshifted, and its wings are chirped. This effect, which we refer to as 'self-induced blueshift' goes beyond the carrier-envelope description. The corresponding phase is a temporal analog of the Gouy phase. The energy gain of a relativistic electron swept over by an SCPB is very sensitive to the proper form chosen to describe the pulse.

  18. Activation of Exchange Protein Activated by Cyclic-AMP Enhances Long-Lasting Synaptic Potentiation in the Hippocampus

    ERIC Educational Resources Information Center

    Gelinas, Jennifer N.; Banko, Jessica L.; Peters, Melinda M.; Klann, Eric; Weeber, Edwin J.; Nguyen, Peter V.

    2008-01-01

    cAMP is a critical second messenger implicated in synaptic plasticity and memory in the mammalian brain. Substantial evidence links increases in intracellular cAMP to activation of cAMP-dependent protein kinase (PKA) and subsequent phosphorylation of downstream effectors (transcription factors, receptors, protein kinases) necessary for long-term…

  19. Cyclic AMP Signaling through Epac Axis Modulates Human Hemogenic Endothelium and Enhances Hematopoietic Cell Generation.

    PubMed

    Saxena, Shobhit; Rönn, Roger E; Guibentif, Carolina; Moraghebi, Roksana; Woods, Niels-Bjarne

    2016-05-10

    Hematopoietic cells emerge from hemogenic endothelium in the developing embryo. Mechanisms behind human hematopoietic stem and progenitor cell development remain unclear. Using a human pluripotent stem cell differentiation model, we report that cyclic AMP (cAMP) induction dramatically increases HSC-like cell frequencies. We show that hematopoietic cell generation requires cAMP signaling through the Exchange proteins activated by cAMP (cAMP-Epac) axis; Epac signaling inhibition decreased both hemogenic and non-hemogenic endothelium, and abrogated hematopoietic cell generation. Furthermore, in hematopoietic progenitor and stem-like cells, cAMP induction mitigated oxidative stress, created a redox-state balance, and enhanced C-X-C chemokine receptor type 4 (CXCR4) expression, benefiting the maintenance of these primitive cells. Collectively, our study provides insights and mechanistic details on the previously unrecognized role of cAMP signaling in regulating human hematopoietic development. These findings advance the mechanistic understanding of hematopoietic development toward the development of transplantable human hematopoietic cells for therapeutic needs. PMID:27117782

  20. The role of the RAS pathway in iAMP21-ALL.

    PubMed

    Ryan, S L; Matheson, E; Grossmann, V; Sinclair, P; Bashton, M; Schwab, C; Towers, W; Partington, M; Elliott, A; Minto, L; Richardson, S; Rahman, T; Keavney, B; Skinner, R; Bown, N; Haferlach, T; Vandenberghe, P; Haferlach, C; Santibanez-Koref, M; Moorman, A V; Kohlmann, A; Irving, J A E; Harrison, C J

    2016-09-01

    Intrachromosomal amplification of chromosome 21 (iAMP21) identifies a high-risk subtype of acute lymphoblastic leukaemia (ALL), requiring intensive treatment to reduce their relapse risk. Improved understanding of the genomic landscape of iAMP21-ALL will ascertain whether these patients may benefit from targeted therapy. We performed whole-exome sequencing of eight iAMP21-ALL samples. The mutation rate was dramatically disparate between cases (average 24.9, range 5-51) and a large number of novel variants were identified, including frequent mutation of the RAS/MEK/ERK pathway. Targeted sequencing of a larger cohort revealed that 60% (25/42) of diagnostic iAMP21-ALL samples harboured 42 distinct RAS pathway mutations. High sequencing coverage demonstrated heterogeneity in the form of multiple RAS pathway mutations within the same sample and diverse variant allele frequencies (VAFs) (2-52%), similar to other subtypes of ALL. Constitutive RAS pathway activation was observed in iAMP21 samples that harboured mutations in the predominant clone (⩾35% VAF). Viable iAMP21 cells from primary xenografts showed reduced viability in response to the MEK1/2 inhibitor, selumetinib, in vitro. As clonal (⩾35% VAF) mutations were detected in 26% (11/42) of iAMP21-ALL, this evidence of response to RAS pathway inhibitors may offer the possibility to introduce targeted therapy to improve therapeutic efficacy in these high-risk patients.

  1. The role of the RAS pathway in iAMP21-ALL

    PubMed Central

    Ryan, Sarra L.; Matheson, Elizabeth; Grossmann, Vera; Sinclair, Paul; Bashton, Matthew; Schwab, Claire; Towers, Will; Partington, Matthew; Elliott, Alannah; Minto, Lynne; Richardson, Stacey; Rahman, Thahira; Keavney, Bernard; Skinner, Roderick; Bown, Nick; Haferlach, Torsten; Vandenberghe, Peter; Haferlach, Claudia; Santibanez-Koref, Mauro; Moorman, Anthony V.; Kohlmann, Alexander; Irving, Julie A. E.; Harrison, Christine J.

    2016-01-01

    Intrachromosomal amplification of chromosome 21 (iAMP21) identifies a high-risk subtype of acute lymphoblastic leukaemia (ALL), requiring intensive treatment to reduce their relapse risk. Improved understanding of the genomic landscape of iAMP21-ALL will ascertain whether these patients may benefit from targeted therapy. We performed whole-exome sequencing of eight iAMP21-ALL samples. The mutation rate was dramatically disparate between cases (average 24.9, range 5-51) and a large number of novel variants were identified, including frequent mutation of the RAS/MEK/ERK pathway. Targeted sequencing of a larger cohort revealed that 60% (25/42) of diagnostic iAMP21-ALL samples harboured 42 distinct RAS pathway mutations. High sequencing coverage demonstrated heterogeneity in the form of multiple RAS pathway mutations within the same sample and diverse variant allele frequencies (VAF) (2-52%), similar to other subtypes of ALL. Constitutive RAS pathway activation was observed in iAMP21 samples that harboured mutations in the predominant clone (≥35% VAF). Viable iAMP21 cells from primary xenografts showed reduced viability in response to the MEK1/2 inhibitor, selumetinib, in vitro. As clonal (≥35% VAF) mutations were detected in 26% (11/42) of iAMP21-ALL, this evidence of response to RAS pathway inhibitors may offer the possibility to introduce targeted therapy to improve therapeutic efficacy in these high-risk patients. PMID:27168466

  2. Crystal structure of a c-di-AMP riboswitch reveals an internally pseudo-dimeric RNA.

    PubMed

    Jones, Christopher P; Ferré-D'Amaré, Adrian R

    2014-11-18

    Cyclic diadenosine monophosphate (c-di-AMP) is a second messenger that is essential for growth and homeostasis in bacteria. A recently discovered c-di-AMP-responsive riboswitch controls the expression of genes in a variety of bacteria, including important pathogens. To elucidate the molecular basis for specific binding of c-di-AMP by a gene-regulatory mRNA domain, we have determined the co-crystal structure of this riboswitch. Unexpectedly, the structure reveals an internally pseudo-symmetric RNA in which two similar three-helix-junction elements associate head-to-tail, creating a trough that cradles two c-di-AMP molecules making quasi-equivalent contacts with the riboswitch. The riboswitch selectively binds c-di-AMP and discriminates exquisitely against other cyclic dinucleotides, such as c-di-GMP and cyclic-AMP-GMP, via interactions with both the backbone and bases of its cognate second messenger. Small-angle X-ray scattering experiments indicate that global folding of the riboswitch is induced by the two bound cyclic dinucleotides, which bridge the two symmetric three-helix domains. This structural reorganization likely couples c-di-AMP binding to gene expression. PMID:25271255

  3. Cyclic AMP Represents a Crucial Component of Treg Cell-Mediated Immune Regulation

    PubMed Central

    Klein, Matthias; Bopp, Tobias

    2016-01-01

    T regulatory (Treg) cells are one of the key players in the immune tolerance network, and a plethora of manuscripts have described their development and function in the course of the last two decades. Nevertheless, it is still a matter of debate as to which mechanisms and agents are employed by Treg cells, providing the basis of their suppressive potency. One of the important candidates is cyclic AMP (cAMP), which is long known as a potent suppressor at least of T cell activation and function. While this suppressive function by itself is widely accepted, the source and the mechanism of action of cAMP are less clear, and a multitude of seemingly contradictory data allow for, in principle, two different scenarios of cAMP-mediated suppression. In one scenario, Treg cells contain high amounts of cAMP and convey this small molecule via gap junction intercellular communication directly to the effector T cells (Teff) leading to their suppression. Alternatively, it was shown that Treg cells represent the origin of considerable amounts of adenosine, which trigger the adenylate cyclases in Teff cells via A2A and A2B receptors, thus strongly increasing intracellular cAMP. This review will present and discuss initial findings and recent developments concerning the function of cAMP for Treg cells and its impact on immune regulation. PMID:27621729

  4. Cyclic AMP Represents a Crucial Component of Treg Cell-Mediated Immune Regulation.

    PubMed

    Klein, Matthias; Bopp, Tobias

    2016-01-01

    T regulatory (Treg) cells are one of the key players in the immune tolerance network, and a plethora of manuscripts have described their development and function in the course of the last two decades. Nevertheless, it is still a matter of debate as to which mechanisms and agents are employed by Treg cells, providing the basis of their suppressive potency. One of the important candidates is cyclic AMP (cAMP), which is long known as a potent suppressor at least of T cell activation and function. While this suppressive function by itself is widely accepted, the source and the mechanism of action of cAMP are less clear, and a multitude of seemingly contradictory data allow for, in principle, two different scenarios of cAMP-mediated suppression. In one scenario, Treg cells contain high amounts of cAMP and convey this small molecule via gap junction intercellular communication directly to the effector T cells (Teff) leading to their suppression. Alternatively, it was shown that Treg cells represent the origin of considerable amounts of adenosine, which trigger the adenylate cyclases in Teff cells via A2A and A2B receptors, thus strongly increasing intracellular cAMP. This review will present and discuss initial findings and recent developments concerning the function of cAMP for Treg cells and its impact on immune regulation.

  5. Cyclic AMP Represents a Crucial Component of Treg Cell-Mediated Immune Regulation

    PubMed Central

    Klein, Matthias; Bopp, Tobias

    2016-01-01

    T regulatory (Treg) cells are one of the key players in the immune tolerance network, and a plethora of manuscripts have described their development and function in the course of the last two decades. Nevertheless, it is still a matter of debate as to which mechanisms and agents are employed by Treg cells, providing the basis of their suppressive potency. One of the important candidates is cyclic AMP (cAMP), which is long known as a potent suppressor at least of T cell activation and function. While this suppressive function by itself is widely accepted, the source and the mechanism of action of cAMP are less clear, and a multitude of seemingly contradictory data allow for, in principle, two different scenarios of cAMP-mediated suppression. In one scenario, Treg cells contain high amounts of cAMP and convey this small molecule via gap junction intercellular communication directly to the effector T cells (Teff) leading to their suppression. Alternatively, it was shown that Treg cells represent the origin of considerable amounts of adenosine, which trigger the adenylate cyclases in Teff cells via A2A and A2B receptors, thus strongly increasing intracellular cAMP. This review will present and discuss initial findings and recent developments concerning the function of cAMP for Treg cells and its impact on immune regulation.

  6. Cyclic AMP Represents a Crucial Component of Treg Cell-Mediated Immune Regulation.

    PubMed

    Klein, Matthias; Bopp, Tobias

    2016-01-01

    T regulatory (Treg) cells are one of the key players in the immune tolerance network, and a plethora of manuscripts have described their development and function in the course of the last two decades. Nevertheless, it is still a matter of debate as to which mechanisms and agents are employed by Treg cells, providing the basis of their suppressive potency. One of the important candidates is cyclic AMP (cAMP), which is long known as a potent suppressor at least of T cell activation and function. While this suppressive function by itself is widely accepted, the source and the mechanism of action of cAMP are less clear, and a multitude of seemingly contradictory data allow for, in principle, two different scenarios of cAMP-mediated suppression. In one scenario, Treg cells contain high amounts of cAMP and convey this small molecule via gap junction intercellular communication directly to the effector T cells (Teff) leading to their suppression. Alternatively, it was shown that Treg cells represent the origin of considerable amounts of adenosine, which trigger the adenylate cyclases in Teff cells via A2A and A2B receptors, thus strongly increasing intracellular cAMP. This review will present and discuss initial findings and recent developments concerning the function of cAMP for Treg cells and its impact on immune regulation. PMID:27621729

  7. Central role of soluble adenylyl cyclase and cAMP in sperm physiology

    PubMed Central

    Buffone, Mariano G.; Wertheimer, Eva V.; Visconti, Pablo E.; Krapf, Dario

    2014-01-01

    Cyclic adenosine 3′,5′-monophosphate (cAMP), the first second messenger to be described, plays a central role in cell signaling in a wide variety of cell types. Over the last decades, a wide body of literature addressed the different roles of cAMP in cell physiology, mainly in response to neurotransmitters and hormones. cAMP is synthesized by a wide variety of adenylyl cylases that can generally be grouped in two types: transmembrane adenylyl cyclase and soluble adenylyl cyclases. In particular, several aspects of sperm physiology are regulated by cAMP produced by a single atypical adenylyl cyclase (Adcy10, aka sAC, SACY). The signature that identifies sAC among other ACs, is their direct stimulation by bicarbonate. The essential nature of cAMP in sperm function has been demonstrated using gain of function as well as loss of function approaches. This review unifies state of the art knowledge of the role of cAMP and those enzymes involved in cAMP signaling pathways required for the acquisition of fertilizing capacity of mammalian sperm. PMID:25066614

  8. From drought sensing to developmental control: evolution of cyclic AMP signaling in social amoebas.

    PubMed

    Ritchie, Allyson V; van Es, Saskia; Fouquet, Celine; Schaap, Pauline

    2008-10-01

    Amoebas and other protists commonly encyst when faced with environmental stress. Although little is known of the signaling pathways that mediate encystation, the analogous process of spore formation in dictyostelid social amoebas is better understood. In Dictyostelium discoideum, secreted cyclic AMP (cAMP) mediates the aggregation of starving amoebas and induces the differentiation of prespore cells. Intracellular cAMP acting on cAMP-dependent protein kinase (PKA) triggers the maturation of spores and prevents their germination under the prevalent conditions of high osmolality in the spore head. The osmolyte-activated adenylate cyclase, ACG, produces cAMP for prespore differentiation and inhibition of spore germination. To retrace the origin of ACG function, we investigated ACG gene conservation and function in species that span the dictyostelid phylogeny. ACG genes, osmolyte-activated ACG activity, and osmoregulation of spore germination were detected in species that represent the 4 major groups of Dictyostelia. Unlike the derived species D. discoideum, many basal Dictyostelia have retained the ancestral mechanism of encystation from solitary amoebas. In these species and in solitary amoebas, encystation is independently triggered by starvation or by high osmolality. Osmolyte-induced encystation was accompanied by an increase in cAMP and prevented by inhibition of PKA, indicating that ACG and PKA activation mediate this response. We propose that high osmolality signals drought in soil amoebas and that developmental cAMP signaling in the Dictyostelia has evolved from this stress response.

  9. The mechanisms of action of cAMP. A quantum chemical study.

    PubMed

    van Ool, P J; Buck, H M

    1982-01-01

    Quantum chemical calculations were performed on the formation of intermediates with trigonal bipyramidal (TBP) configurations in the hydrolysis of adenosine 3',5'-monophosphate (cAMP) with phosphodiesterases and the activation of protein kinases by cAMP. The results show that in the reaction sequence concerning the hydrolysis of cAMP with phosphodiesterase the TBP intermediate must possess an equatorial-apical cyclic phosphate ring with the 3'-oxygen atom in the apical position. This could be an additional reason for the sensitivity of the 3' position in cAMP towards modifications in comparison with the 5' position. According to the calculations, a mechanistic model is presented for the enzymatic hydrolysis of cAMP with the involvement of a covalently bonded enzyme-nucleotide intermediate. Also a model is offered for the activation of protein kinase by cAMP. The activation of protein kinase is assumed to proceed via diequatorial-ring-positioned TBP intermediates resulting in the formation of a covalent bond between cAMP and the protein kinase with retention of the cyclic phosphate ring. It seems likely that the enzyme-nucleotide intermediate enforces a conformational change in the enzyme, which causes the dissociation of the regulatory and catalytic subunit of the protein kinase, necessary for a physiological response.

  10. Cyclic-AMP inhibition of fimbriae and prodigiosin production by Serratia marcescens is strain-dependent

    PubMed Central

    Stella, Nicholas A.; Shanks, Robert M. Q.

    2014-01-01

    The cyclic-nucleotide 3’,5’-cyclic AMP (cAMP) is an ancient and wide spread regulatory molecule. Previous studies have shown that fimbria production and secondary metabolite production are inhibited by cAMP in the prokaryote Serratia marcescens. This study used genetic manipulations to test the strain specificity of cAMP-CRP regulation of fimbria production and of the red pigment, prodigiosin. A surprising amount of variation was observed, as multicopy expression of the cAMP-phosphodiesterase gene, cpdS, conferred either an increase or decrease in fimbriae-dependent yeast agglutination and prodigiosin production depending upon the strain background. Mutation of crp, the gene coding for the cAMP-receptor protein similarly conferred strain-dependent phenotypes. This study shows that three distinct biological properties, modulated by a conserved genetic regulatory molecule, can vary significantly among strains. Such variation can complicate the functional analysis of bacterial phenotypic properties which are dependent upon global genetic regulators such as cAMP. PMID:24619531

  11. Role of coronary endothelium in cyclic AMP formation by the heart

    SciTech Connect

    Kroll, K.; Schrader, J.

    1986-03-01

    In order to quantify the activation of adenylate cyclase of the coronary endothelium in vivo, endothelial adenine nucleotides of isolated guinea pig hearts were selectively pre-labeled by intracoronary infusion of tritiated (H3)-adenosine, and the coronary efflux of H3-cAMP was measured. The adenosine receptor agonist, NECA (12 ..mu..M), increased total cAMP release 4 fold, and raised H3-cAMP release 22 fold. Several classes of coronary vasodilators (adenosine, L-PIA, D-PIA, the beta 2-adrenergic agonist procaterol, and PGE1) caused dose-dependent increases in endothelial-derived H3-cAMP release. These increases were accompanied by decreases in vascular resistance, at agonist doses without positive intropic effects. Hypoxic perfusion also raised H3-cAMP release, and this was antagonized by theophylline. It is concluded: (1) cyclic AMP formation by coronary endothelium can dominate total cAMP production by the heart; (2) coronary endothelial adenylate cyclase-coupled receptors for adenosine (A2), catecholamines (beta2) and prostaglandins are activated in parallel with coronary vasodilation; (3) endothelial adenylate cyclase can be activated by endogenous adenosine.

  12. Switching power pulse system

    DOEpatents

    Aaland, K.

    1983-08-09

    A switching system for delivering pulses of power from a source to a load using a storage capacitor charged through a rectifier, and maintained charged to a reference voltage level by a transistor switch and voltage comparator. A thyristor is triggered to discharge the storage capacitor through a saturable reactor and fractional turn saturable transformer having a secondary to primary turn ratio N of n:l/n = n[sup 2]. The saturable reactor functions as a soaker'' while the thyristor reaches saturation, and then switches to a low impedance state. The saturable transformer functions as a switching transformer with high impedance while a load coupling capacitor charges, and then switches to a low impedance state to dump the charge of the storage capacitor into the load through the coupling capacitor. The transformer is comprised of a multilayer core having two secondary windings tightly wound and connected in parallel to add their output voltage and reduce output inductance, and a number of single turn windings connected in parallel at nodes for the primary winding, each single turn winding linking a different one of the layers of the multilayer core. The load may be comprised of a resistive beampipe for a linear particle accelerator and capacitance of a pulse forming network. To hold off discharge of the capacitance until it is fully charged, a saturable core is provided around the resistive beampipe to isolate the beampipe from the capacitance until it is fully charged. 5 figs.

  13. Heat driven pulse pump

    NASA Technical Reports Server (NTRS)

    Benner, Steve M (Inventor); Martins, Mario S. (Inventor)

    2000-01-01

    A heat driven pulse pump includes a chamber having an inlet port, an outlet port, two check valves, a wick, and a heater. The chamber may include a plurality of grooves inside wall of the chamber. When heated within the chamber, a liquid to be pumped vaporizes and creates pressure head that expels the liquid through the outlet port. As liquid separating means, the wick, disposed within the chamber, is to allow, when saturated with the liquid, the passage of only liquid being forced by the pressure head in the chamber, preventing the vapor from exiting from the chamber through the outlet port. A plurality of grooves along the inside surface wall of the chamber can sustain the liquid, which is amount enough to produce vapor for the pressure head in the chamber. With only two simple moving parts, two check valves, the heat driven pulse pump can effectively function over the long lifetimes without maintenance or replacement. For continuous flow of the liquid to be pumped a plurality of pumps may be connected in parallel.

  14. Pulsed Plasma Thruster Contamination

    NASA Technical Reports Server (NTRS)

    Myers, Roger M.; Arrington, Lynn A.; Pencil, Eric J.; Carter, Justin; Heminger, Jason; Gatsonis, Nicolas

    1996-01-01

    Pulsed Plasma Thrusters (PPT's) are currently baselined for the Air Force Mightysat II.1 flight in 1999 and are under consideration for a number of other missions for primary propulsion, precision positioning, and attitude control functions. In this work, PPT plumes were characterized to assess their contamination characteristics. Diagnostics included planar and cylindrical Langmuir probes and a large number of collimated quartz contamination sensors. Measurements were made using a LES 8/9 flight PPT at 0.24, 0.39, 0.55, and 1.2 m from the thruster, as well as in the backflow region behind the thruster. Plasma measurements revealed a peak centerline ion density and velocity of approx. 6 x 10(exp 12) cm(exp -3) and 42,000 m/s, respectively. Optical transmittance measurements of the quartz sensors after 2 x 10(exp 5) pulses showed a rapid decrease in plume contamination with increasing angle from the plume axis, with a barely measurable transmittance decrease in the ultraviolet at 90 deg. No change in optical properties was detected for sensors in the backflow region.

  15. Compensated pulsed alternator

    DOEpatents

    Weldon, William F.; Driga, Mircea D.; Woodson, Herbert H.

    1980-01-01

    This invention relates to an electromechanical energy converter with inertial energy storage. The device, a single phase, two or multi-pole alternator with stationary field coils, and a rotating armature is provided. The rotor itself may be of laminated steel for slower pulses or for faster pulses should be nonmagnetic and electrically nonconductive in order to allow rapid penetration of the field as the armature coil rotates. The armature coil comprises a plurality of power generating conductors mounted on the rotor. The alternator may also include a stationary or counterrotating compensating coil to increase the output voltage thereof and to reduce the internal impedance of the alternator at the moment of peak outout. As the machine voltage rises sinusoidally, an external trigger switch is adapted to be closed at the appropriate time to create the desired output current from said alternator to an external load circuit, and as the output current passes through zero a self-commutating effect is provided to allow the switch to disconnect the generator from the external circuit.

  16. Bipolar pulse forming line

    DOEpatents

    Rhodes, Mark A.

    2008-10-21

    A bipolar pulse forming transmission line module for linear induction accelerators having first, second, third, fourth, and fifth planar conductors which form an interleaved stack with dielectric layers between the conductors. Each conductor has a first end, and a second end adjacent an acceleration axis. The first and second planar conductors are connected to each other at the second ends, the fourth and fifth planar conductors are connected to each other at the second ends, and the first and fifth planar conductors are connected to each other at the first ends via a shorting plate adjacent the first ends. The third planar conductor is electrically connectable to a high voltage source, and an internal switch functions to short a high voltage from the first end of the third planar conductor to the first end of the fourth planar conductor to produce a bipolar pulse at the acceleration axis with a zero net time integral. Improved access to the switch is enabled by an aperture through the shorting plate and the proximity of the aperture to the switch.

  17. Pulsed atmospheric fluidized bed combustion

    SciTech Connect

    Not Available

    1992-05-01

    During this first quarter, a lab-scale water-cooled pulse combustor was designed, fabricated, and integrated with old pilot-scale PAFBC test systems. Characterization tests on this pulse combustor firing different kinds of fuel -- natural gas, pulverized coal and fine coal -- were conducted (without fluidized bed operation) for the purpose of finalizing PAFBC full-scale design. Steady-state tests were performed. Heat transfer performance and combustion efficiency of a coal-fired pulse combustor were evaluated.

  18. Perivascular fat, AMP-activated protein kinase and vascular diseases

    PubMed Central

    Almabrouk, T A M; Ewart, M A; Salt, I P; Kennedy, S

    2014-01-01

    Perivascular adipose tissue (PVAT) is an active endocrine and paracrine organ that modulates vascular function, with implications for the pathophysiology of cardiovascular disease (CVD). Adipocytes and stromal cells contained within PVAT produce mediators (adipokines, cytokines, reactive oxygen species and gaseous compounds) with a range of paracrine effects modulating vascular smooth muscle cell contraction, proliferation and migration. However, the modulatory effect of PVAT on the vascular system in diseases, such as obesity, hypertension and atherosclerosis, remains poorly characterized. AMP-activated protein kinase (AMPK) regulates adipocyte metabolism, adipose biology and vascular function, and hence may be a potential therapeutic target for metabolic disorders such as type 2 diabetes mellitus (T2DM) and the vascular complications associated with obesity and T2DM. The role of AMPK in PVAT or the actions of PVAT have yet to be established, however. Activation of AMPK by pharmacological agents, such as metformin and thiazolidinediones, may modulate the activity of PVAT surrounding blood vessels and thereby contribute to their beneficial effect in cardiometabolic diseases. This review will provide a current perspective on how PVAT may influence vascular function via AMPK. We will also attempt to demonstrate how modulating AMPK activity using pharmacological agents could be exploited therapeutically to treat cardiometabolic diseases. PMID:24490856

  19. Activating AMP-activated protein kinase (AMPK) slows renal cystogenesis.

    PubMed

    Takiar, Vinita; Nishio, Saori; Seo-Mayer, Patricia; King, J Darwin; Li, Hui; Zhang, Li; Karihaloo, Anil; Hallows, Kenneth R; Somlo, Stefan; Caplan, Michael J

    2011-02-01

    Renal cyst development and expansion in autosomal dominant polycystic kidney disease (ADPKD) involves both fluid secretion and abnormal proliferation of cyst-lining epithelial cells. The chloride channel of the cystic fibrosis transmembrane conductance regulator (CFTR) participates in secretion of cyst fluid, and the mammalian target of rapamycin (mTOR) pathway may drive proliferation of cyst epithelial cells. CFTR and mTOR are both negatively regulated by AMP-activated protein kinase (AMPK). Metformin, a drug in wide clinical use, is a pharmacological activator of AMPK. We find that metformin stimulates AMPK, resulting in inhibition of both CFTR and the mTOR pathways. Metformin induces significant arrest of cystic growth in both in vitro and ex vivo models of renal cystogenesis. In addition, metformin administration produces a significant decrease in the cystic index in two mouse models of ADPKD. Our results suggest a possible role for AMPK activation in slowing renal cystogenesis as well as the potential for therapeutic application of metformin in the context of ADPKD. PMID:21262823

  20. Cyclic AMP levels during induction and repression of cellulase biosynthesis in Thermomonospora curvata

    SciTech Connect

    Wood, W.E.; Neubauer, D.G.; Stutzenberger, F.J.

    1984-12-01

    Specific cellulase production rates (SCPR) were compared with intracellular cyclic AMP (cAMP) levels in the thermophilic actinomycete, Thermomonospora curvata, during growth on several carbon sources in a chemically defined medium. SCPR and cAMP levels were 0.03 U (endoglucanase (EG) units) and 2 pmol per mg of dry cells, respectively, during exponential growth on glucose. These values increased to about 6 and 25, respectively, during growth on cellulose. Detectable EG production ceased when cAMP levels dropped below 10. Cellobiose (usually considered to be a cellulase inducer) caused a sharp decrease in cAMP levels and repressed EG production when added to cellulose-grown cultures. 2-deoxy-D-glucose, although nometabolizable in T. curvata, depressed cAMP to levels observed with glucose, but unlike glucose, the 2DG effect persisted until cells were washed and transferred to fresh medium. SCPR values and cAMP levels in cells grown in continuous culture under conditions of cellobiose limitation were markedly influenced by dilution rate (D). The maxima for both occurred at D = 0.085 (culture generation time of 11.8 h). When D was held constant and cellobiose concentration was increased over a 14-fold range to support higher steady state population levels, SCPR values decreased about fivefold, indicating that extracellular catabolite accumulation may be a factor in EG repression. The role of cAMP in the mechanism of this repression appears to be neither simple nor direct, since large changes (up to 200-fold) in SCPR accompany relatively small changes (10-fold) in cellular cAMP levels.

  1. Modulation of a human lymphoblastoid B cell line by cyclic AMP. Ig secretion and phosphatidylcholine metabolism

    SciTech Connect

    Shearer, W.T.; Patke, C.L.; Gilliam, E.B.; Rosenblatt, H.M.; Barron, K.S.; Orson, F.M.

    1988-09-01

    A transformed human B cell line, LA350, was found to be sensitive to cAMP-elevating agents by responding with rapid (0 to 2 h) severalfold elevations of intracellular cAMP to treatment with cholera toxin, isobutylmethylxanthine (IBMX), forskolin, and dibutyryl cAMP (all p less than 0.001). These cAMP-elevating agents also produced significant inhibitions of subsequent (48 to 72 h) Ig secretion by the same B cells as measured by a reverse hemolytic plaque assay and an enzyme-linked immunoadsorbent assay for IgM (both p less than 0.001). PMA- and IBMX-treated cells were particularly responsive to the effects of cholera toxin, showing a doubling of cAMP content and profound decrease in Ig production (p less than 0.001). Because our previous studies had correlated activation of the metabolic turnover of the phosphatidylcholine (PC) fraction of membrane phospholipids with enhanced Ig secretion, we examined the sensitivity of PC metabolism to cAMP in control and PMA-stimulated cells. Formation of PC was found to be inhibited by forskolin and IBMX (both p less than 0.002) but breakdown of PC was stimulated (p less than 0.001). These findings imply that as the enzymatic products of PC, choline phosphate and diacylglycerol, are depleted due to the combined effects of cAMP upon synthesis and turnover of PC, there is a decrease in Ig secretion. Since diacylglycerol activates protein kinase C, it appears reasonable that Ig secretion is at least partially regulated by cAMP-responsive alterations in PC metabolism produced by protein kinase C-induced phosphorylation. We conclude that the early cAMP-sensitive changes in PC metabolism in this activated B cell line may signal for subsequent alterations in Ig secretion.

  2. cAMP controls rod photoreceptor sensitivity via multiple targets in the phototransduction cascade

    PubMed Central

    Astakhova, Luba A.; Samoiliuk, Evgeniia V.; Govardovskii, Victor I.

    2012-01-01

    In early studies, both cyclic AMP (cAMP) and cGMP were considered as potential secondary messengers regulating the conductivity of the vertebrate photoreceptor plasma membrane. Later discovery of the cGMP specificity of cyclic nucleotide–gated channels has shifted attention to cGMP as the only secondary messenger in the phototransduction cascade, and cAMP is not considered in modern schemes of phototransduction. Here, we report evidence that cAMP may also be involved in regulation of the phototransduction cascade. Using a suction pipette technique, we recorded light responses of isolated solitary rods from the frog retina in normal solution and in the medium containing 2 µM of adenylate cyclase activator forskolin. Under forskolin action, flash sensitivity rose more than twofold because of a retarded photoresponse turn-off. The same concentration of forskolin lead to a 2.5-fold increase in the rod outer segment cAMP, which is close to earlier reported natural day/night cAMP variations. Detailed analysis of cAMP action on the phototransduction cascade suggests that several targets are affected by cAMP increase: (a) basal dark phosphodiesterase (PDE) activity decreases; (b) at the same intensity of light background, steady background-induced PDE activity increases; (c) at light backgrounds, guanylate cyclase activity at a given fraction of open channels is reduced; and (d) the magnitude of the Ca2+ exchanger current rises 1.6-fold, which would correspond to a 1.6-fold elevation of [Ca2+]in. Analysis by a complete model of rod phototransduction suggests that an increase of [Ca2+]in might also explain effects (b) and (c). The mechanism(s) by which cAMP could regulate [Ca2+]in and PDE basal activity is unclear. We suggest that these regulations may have adaptive significance and improve the performance of the visual system when it switches between day and night light conditions. PMID:23008435

  3. Modulation of dihydropyridine-sensitive calcium channels in Drosophila by a cAMP-mediated pathway.

    PubMed

    Bhattacharya, A; Gu, G G; Singh, S

    1999-06-15

    Drosophila has proved to be a valuable system for studying the structure and function of ion channels. However, relatively little is known about the regulation of ion channels, particularly that of Ca2+ channels, in Drosophila. Physiological and pharmacological differences between invertebrate and mammalian L-type Ca2+ channels raise questions on the extent of conservation of Ca2+ channel modulatory pathways. We have examined the role of cyclic adenosine monophosphate (cAMP) cascade in modulating the dihydropyridine (DHP)-sensitive Ca2+ channels in the larval muscles of Drosophila, using mutations and drugs that disrupt specific steps in this pathway. The L-type (DHP-sensitive) Ca2+ channel current was increased in the dunce mutants, which have high cAMP concentration owing to cAMP-specific phosphodiesterase (PDE) disruption. The current was decreased in the rutabaga mutants, where adenylyl cyclase (AC) activity is altered thereby decreasing the cAMP concentration. The dunce effect was mimicked by 8-Br-cAMP, a cAMP analog, and IBMX, a PDE inhibitor. The rutabaga effect was rescued by forskolin, an AC activator. H-89, an inhibitor of protein kinase-A (PKA), reduced the current and inhibited the effect of 8-Br-cAMP. The data suggest modulation of L-type Ca2+ channels of Drosophila via a cAMP-PKA mediated pathway. While there are differences in L-type channels, as well as in components of cAMP cascade, between Drosophila and vertebrates, main features of the modulatory pathway have been conserved. The data also raise questions on the likely role of DHP-sensitive Ca2+ channel modulation in synaptic plasticity, and learning and memory, processes disrupted by the dnc and the rut mutations. PMID:10380071

  4. Influence of cAMP and protein kinase A on neurite length from spiral ganglion neurons

    PubMed Central

    Xu, Ningyong; Engbers, Jonathan; Khaja, Sobia; Xu, Linjing; Clark, J. Jason; Hansen, Marlan R.

    2011-01-01

    Regrowth of peripheral spiral ganglion neuron (SGN) fibers is a primary objective in efforts to improve cochlear implant outcomes and to potentially reinnervate regenerated hair cells. Cyclic adenosine monophosphate (cAMP) regulates neurite growth and guidance via activation of protein kinase A (PKA) and Exchange Protein directly Activated by Cylic AMP (Epac). Here we explored the effects of cAMP signaling on SGN neurite length in vitro. We find that the cAMP analog, cpt-cAMP, exerts a biphasic effect on neurite length; increasing length at lower concentrations and reducing length at higher concentrations. This biphasic response occurs in cultures plated on laminin, fibronectin, or tenascin C suggesting that it is not substrate dependent. cpt-cAMP also reduces SGN neurite branching. The Epac-specific agonist, 8-pCPT-2’-O-Me-cAMP, does not alter SGN neurite length. Constitutively active PKA isoforms strongly inhibit SGN neurite length similar to higher levels of cAMP. Chronic membrane depolarization activates PKA in SGNs and also inhibits SGN neurite length. However, inhibition of PKA fails to rescue neurite length in depolarized cultures implying that activation of PKA is not necessary for the inhibition of SGN neurite length by chronic depolarization. Expression of constitutively active phosphatidylinositol 3-kinase, but not c-Jun N-terminal kinase, isoforms partially rescues SGN neurite length in the presence of activated PKA. Taken together, these results suggest that activation of cAMP/PKA represents a potential strategy to enhance SGN fiber elongation following deafness; however such therapies will likely require careful titration so as to simultaneously promote rather than inhibit nerve fiber regeneration. PMID:22154930

  5. Characteristic analysis of the ampC gene encoding beta-lactamase from Photobacterium phosphoreum.

    PubMed

    Lin, Juey-Wen; Weng, Shu-Fen; Chao, Yuh-Fen; Chung, Yi-Ting

    2005-01-21

    The ampC gene of Photobacterium phosphoreum ATCC 11040 was cloned and identified. Nucleotide sequence of the regulatory region R&R and the ampC gene (GenBank Accession No. AY787792) from P. phosphoreum has been determined, and the encoded beta-lactamase is deduced. The beta-lactamase encoded by the ampC gene has a calculated M(r) 31,198 and comprises 285 amino acid residues (pI 7.35). There is a signal peptide of 20 amino acid residues MKLRFIASTLLLSFSQLASA to lead the beta-lactamase secretion, and the cleavage site is between ASA-Q; thus, the matured protein only has M(r) 29,019 and comprises 265 amino acid residues (pI 6.21). The specific amino acid residues STFK (65th to 68th), SDN (125th to 127th), and D (158th) located 33 residues downstream from the SDN loop of the class A beta-lactamases are highly conserved, but the KTG is not found. The gene order of the ampC is <--ufo-R&R-ampC-->, the genes running in the opposite directions. Functional analysis elicits that R&R([ampC]) does function to lead to the gene expression. Primer extension assay elicits that the ampC gene's transcriptional initiation +1 is -26 C upstream of the start codon; the P([I])-promoter should be the promoter response for the gene expression. Analysis of the R&R([ampC]) elicits that the upstream activator binding sequence Sigma UAS TGTTTAAATACGCTTTGAACA is like the two-component regulator binding sequence TGT-N(8-12)-ACA. It implies that P. phosphoreum ampC gene could be under-regulated by the specific two-component regulator. PMID:15596133

  6. A cardiac mitochondrial cAMP signaling pathway regulates calcium accumulation, permeability transition and cell death

    PubMed Central

    Wang, Z; Liu, D; Varin, A; Nicolas, V; Courilleau, D; Mateo, P; Caubere, C; Rouet, P; Gomez, A-M; Vandecasteele, G; Fischmeister, R; Brenner, C

    2016-01-01

    Although cardiac cytosolic cyclic 3′,5′-adenosine monophosphate (cAMP) regulates multiple processes, such as beating, contractility, metabolism and apoptosis, little is known yet on the role of this second messenger within cardiac mitochondria. Using cellular and subcellular approaches, we demonstrate here the local expression of several actors of cAMP signaling within cardiac mitochondria, namely a truncated form of soluble AC (sACt) and the exchange protein directly activated by cAMP 1 (Epac1), and show a protective role for sACt against cell death, apoptosis as well as necrosis in primary cardiomyocytes. Upon stimulation with bicarbonate (HCO3−) and Ca2+, sACt produces cAMP, which in turn stimulates oxygen consumption, increases the mitochondrial membrane potential (ΔΨm) and ATP production. cAMP is rate limiting for matrix Ca2+ entry via Epac1 and the mitochondrial calcium uniporter and, as a consequence, prevents mitochondrial permeability transition (MPT). The mitochondrial cAMP effects involve neither protein kinase A, Epac2 nor the mitochondrial Na+/Ca2+ exchanger. In addition, in mitochondria isolated from failing rat hearts, stimulation of the mitochondrial cAMP pathway by HCO3− rescued the sensitization of mitochondria to Ca2+-induced MPT. Thus, our study identifies a link between mitochondrial cAMP, mitochondrial metabolism and cell death in the heart, which is independent of cytosolic cAMP signaling. Our results might have implications for therapeutic prevention of cell death in cardiac pathologies. PMID:27100892

  7. cAMP controls rod photoreceptor sensitivity via multiple targets in the phototransduction cascade.

    PubMed

    Astakhova, Luba A; Samoiliuk, Evgeniia V; Govardovskii, Victor I; Firsov, Michael L

    2012-10-01

    In early studies, both cyclic AMP (cAMP) and cGMP were considered as potential secondary messengers regulating the conductivity of the vertebrate photoreceptor plasma membrane. Later discovery of the cGMP specificity of cyclic nucleotide-gated channels has shifted attention to cGMP as the only secondary messenger in the phototransduction cascade, and cAMP is not considered in modern schemes of phototransduction. Here, we report evidence that cAMP may also be involved in regulation of the phototransduction cascade. Using a suction pipette technique, we recorded light responses of isolated solitary rods from the frog retina in normal solution and in the medium containing 2 µM of adenylate cyclase activator forskolin. Under forskolin action, flash sensitivity rose more than twofold because of a retarded photoresponse turn-off. The same concentration of forskolin lead to a 2.5-fold increase in the rod outer segment cAMP, which is close to earlier reported natural day/night cAMP variations. Detailed analysis of cAMP action on the phototransduction cascade suggests that several targets are affected by cAMP increase: (a) basal dark phosphodiesterase (PDE) activity decreases; (b) at the same intensity of light background, steady background-induced PDE activity increases; (c) at light backgrounds, guanylate cyclase activity at a given fraction of open channels is reduced; and (d) the magnitude of the Ca(2+) exchanger current rises 1.6-fold, which would correspond to a 1.6-fold elevation of [Ca(2+)](in). Analysis by a complete model of rod phototransduction suggests that an increase of [Ca(2+)](in) might also explain effects (b) and (c). The mechanism(s) by which cAMP could regulate [Ca(2+)](in) and PDE basal activity is unclear. We suggest that these regulations may have adaptive significance and improve the performance of the visual system when it switches between day and night light conditions. PMID:23008435

  8. Association of the cyclic AMP chemotaxis receptor with the detergent- insoluble cytoskeleton of Dictyostelium discoideum

    PubMed Central

    1984-01-01

    Treatment of 6-h differentiated Dictyostelium discoideum cells with the nonionic detergent Triton X-100 dissolves away membranes and soluble components, as judged by marker enzyme distributions, leaving intact a cytoskeletal residue that contains approximately 10% of the cell protein and 50% of the actin. Nitrobenzooxadiazo-phallacidin staining for F-actin and electron microscopy of detergent-extracted whole-mounts indicate that the cytoskeletons retain the size and shape of intact cells and contain F-actin in cortical meshworks. The cytoskeletons contain little if any remaining membrane material by morphological criteria, and the plasma membrane enzymes cyclic nucleotide phosphodiesterase and alkaline phosphatase are absent from the insoluble residue, which retains only 15% of the membrane concanavalin A-binding glycoproteins. This detergent-insoluble residue retains a specific [3H]cAMP-binding site with the nucleotide specificity, rapid kinetics and approximate affinity of the cAMP receptor on intact cells. Upon detergent extraction of cells, the number of cAMP-binding sites increases 20-70%. The binding site is attached to the insoluble residue whether or not the cAMP receptor is occupied at the time of detergent addition. The pH dependence for recovery of the insoluble cAMP-binding site is much sharper than that on intact cells or membranes with an optimum at pH 6.1. Conditions of pH and ionic composition that lead to disruption of the cytoskeleton upon detergent treatment also result in the loss of cAMP binding. During differentiation, the detergent- insoluble cAMP binding increases in parallel with cell surface cAMP receptors and chemotaxis to cAMP. PMID:6693497

  9. Role of cyclic AMP in pulmonary xenobiotic metabolism with special emphasis on benzo(a)pyrene

    SciTech Connect

    Schaeffer, V.H.

    1986-01-01

    This thesis was intended to investigate the role of the intracellular regulator, cAMP, on pulmonary xenobiotic metabolism using the well-studied carcinogen, benzo(a)pyrene (BP) as a representative xenobiotic. Lung slices from rats administered N/sup 6/, O/sup 2/', dibutyryl cAMP (DcAMP), theophylline or forskolin, all of which elevated biologically reactive cAMP levels in the lung, showed an increased ability to metabolize (/sup 3/H)-BP. This effect occurred beyond 6 hr following treatment and reached a maximum at 12 hr, at a time when cAMP content had already peaked and returned to basal levels. The perfusion of BP through the isolated lungs of animals administered DcAMP in vivo indicated that the BP metabolites primarily responsible for the cyclic nucleotide-induced increase in metabolism were the 3-hydroxy BP, 9-hydroxy BP, BP 9, 10 diol, BP-glucuronides and BP-glutathione conjugates. Kinetic analysis indicated that the Km component of these reactions was altered without a corresponding change in Vmax, suggesting that elevated pulmonary cAMP content may be affecting the detoxication enzymes, UDP-glucuronyltransferase and sulfotransferase. Studies with pulmonary microsomes from DcAMP-treated animals indicated that the cyclic nucleotide not only enhanced the hydroxylation of BP but also the cytochrome P450-dependent hydroxylation of coumarin. This is supported by the fact that DcAMP administration in vivo also enhanced phosphorylation of two classes of nuclear proteins, histones and nuclear acidic proteins, believed to play a role in the transcription of RNA and DNA.

  10. Role of phosphodiesterases in the shaping of sub-plasma-membrane cAMP oscillations and pulsatile insulin secretion.

    PubMed

    Tian, Geng; Sågetorp, Jenny; Xu, Yunjian; Shuai, Hongyan; Degerman, Eva; Tengholm, Anders

    2012-11-01

    Specificity and versatility in cyclic AMP (cAMP) signalling are governed by the spatial localisation and temporal dynamics of the signal. Phosphodiesterases (PDEs) are important for shaping cAMP signals by hydrolyzing the nucleotide. In pancreatic β-cells, glucose triggers sub-plasma-membrane cAMP oscillations, which are important for insulin secretion, but the mechanisms underlying the oscillations are poorly understood. Here, we investigated the role of different PDEs in the generation of cAMP oscillations by monitoring the concentration of cAMP in the sub-plasma-membrane space ([cAMP](pm)) with ratiometric evanescent wave microscopy in MIN6 cells or mouse pancreatic β-cells expressing a fluorescent translocation biosensor. The general PDE inhibitor IBMX increased [cAMP](pm), and whereas oscillations were frequently observed at 50 µM IBMX, 300 µM-1 mM of the inhibitor caused a stable increase in [cAMP](pm). The [cAMP](pm) was nevertheless markedly suppressed by the adenylyl cyclase inhibitor 2',5'-dideoxyadenosine, indicating IBMX-insensitive cAMP degradation. Among IBMX-sensitive PDEs, PDE3 was most important for maintaining a low basal level of [cAMP](pm) in unstimulated cells. After glucose induction of [cAMP](pm) oscillations, inhibitors of PDE1, PDE3 and PDE4 inhibitors the average cAMP level, often without disturbing the [cAMP](pm) rhythmicity. Knockdown of the IBMX-insensitive PDE8B by shRNA in MIN6 cells increased the basal level of [cAMP](pm) and prevented the [cAMP](pm)-lowering effect of 2',5'-dideoxyadenosine after exposure to IBMX. Moreover, PDE8B-knockdown cells showed reduced glucose-induced [cAMP](pm) oscillations and loss of the normal pulsatile pattern of insulin secretion. It is concluded that [cAMP](pm) oscillations in β-cells are caused by periodic variations in cAMP generation, and that several PDEs, including PDE1, PDE3 and the IBMX-insensitive PDE8B, are required for shaping the sub-membrane cAMP signals and pulsatile insulin release.

  11. Pulsed helium ionization detection system

    DOEpatents

    Ramsey, Roswitha S.; Todd, Richard A.

    1987-01-01

    A helium ionization detection system is provided which produces stable operation of a conventional helium ionization detector while providing improved sensitivity and linearity. Stability is improved by applying pulsed dc supply voltage across the ionization detector, thereby modifying the sampling of the detectors output current. A unique pulse generator is used to supply pulsed dc to the detector which has variable width and interval adjust features that allows up to 500 V to be applied in pulse widths ranging from about 150 nsec to about dc conditions.

  12. Pulsed helium ionization detection system

    DOEpatents

    Ramsey, R.S.; Todd, R.A.

    1985-04-09

    A helium ionization detection system is provided which produces stable operation of a conventional helium ionization detector while providing improved sensitivity and linearity. Stability is improved by applying pulsed dc supply voltage across the ionization detector, thereby modifying the sampling of the detectors output current. A unique pulse generator is used to supply pulsed dc to the detector which has variable width and interval adjust features that allows up to 500 V to be applied in pulse widths ranging from about 150 nsec to about dc conditions.

  13. Ultra-short pulse generator

    DOEpatents

    McEwan, Thomas E.

    1993-01-01

    An inexpensive pulse generating circuit is disclosed that generates ultra-short, 200 picosecond, and high voltage 100 kW, pulses suitable for wideband radar and other wideband applications. The circuit implements a nonlinear transmission line with series inductors and variable capacitors coupled to ground made from reverse biased diodes to sharpen and increase the amplitude of a high-voltage power MOSFET driver input pulse until it causes non-destructive transit time breakdown in a final avalanche shockwave diode, which increases and sharpens the pulse even more.

  14. Ultra-short pulse generator

    DOEpatents

    McEwan, T.E.

    1993-12-28

    An inexpensive pulse generating circuit is disclosed that generates ultra-short, 200 picosecond, and high voltage 100 kW, pulses suitable for wideband radar and other wideband applications. The circuit implements a nonlinear transmission line with series inductors and variable capacitors coupled to ground made from reverse biased diodes to sharpen and increase the amplitude of a high-voltage power MOSFET driver input pulse until it causes non-destructive transit time breakdown in a final avalanche shock wave diode, which increases and sharpens the pulse even more. 5 figures.

  15. Fast pulse nonthermal plasma reactor

    DOEpatents

    Rosocha, Louis A.

    2005-06-14

    A fast pulsed nonthermal plasma reactor includes a discharge cell and a charging assembly electrically connected thereto. The charging assembly provides plural high voltage pulses to the discharge cell. Each pulse has a rise time between one and ten nanoseconds and a duration of three to twenty nanoseconds. The pulses create nonthermal plasma discharge within the discharge cell. Accordingly, the nonthermal plasma discharge can be used to remove pollutants from gases or break the gases into smaller molecules so that they can be more efficiently combusted.

  16. Population inversion by chirped pulses

    SciTech Connect

    Lu Tianshi

    2011-09-15

    In this paper, we analyze the condition for complete population inversion by a chirped pulse over a finite duration. The nonadiabatic transition probability is mapped in the two-dimensional parameter space of coupling strength and detuning amplitude. Asymptotic forms of the probability are derived by the interference of nonadiabatic transitions for sinusoidal and triangular pulses. The qualitative difference between the maps for the two types of pulses is accounted for. The map is used for the design of stable inversion pulses under specific accuracy thresholds.

  17. Arterial pulse wave pressure transducer

    NASA Technical Reports Server (NTRS)

    Kim, C.; Gorelick, D.; Chen, W. (Inventor)

    1974-01-01

    An arterial pulse wave pressure transducer is introduced. The transducer is comprised of a fluid filled cavity having a flexible membrane disposed over the cavity and adapted to be placed on the skin over an artery. An arterial pulse wave creates pressure pulses in the fluid which are transduced, by a pressure sensitive transistor in direct contact with the fluid, into an electric signal. The electrical signal is representative of the pulse waves and can be recorded so as to monitor changes in the elasticity of the arterial walls.

  18. The Practice of Pulse Processing

    NASA Astrophysics Data System (ADS)

    Fowler, J. W.; Alpert, B. K.; Doriese, W. B.; Joe, Y.-I.; O'Neil, G. C.; Ullom, J. N.; Swetz, D. S.

    2016-07-01

    The analysis of data from X-ray microcalorimeters requires great care; their excellent intrinsic energy resolution cannot usually be achieved in practice without a statistically near-optimal pulse analysis and corrections for important systematic errors. We describe the essential parts of a pulse-analysis pipeline for data from X-ray microcalorimeters, including steps taken to reduce systematic gain variation and the unwelcome dependence of filtered pulse heights on the exact pulse-arrival time. We find these steps collectively to be essential tools for getting the best results from a microcalorimeter-based X-ray spectrometer.

  19. Low-noise pulse conditioner

    DOEpatents

    Bird, David A.

    1983-01-01

    A low-noise pulse conditioner is provided for driving electronic digital processing circuitry directly from differentially induced input pulses. The circuit uses a unique differential-to-peak detector circuit to generate a dynamic reference signal proportional to the input peak voltage. The input pulses are compared with the reference signal in an input network which operates in full differential mode with only a passive input filter. This reduces the introduction of circuit-induced noise, or jitter, generated in ground referenced input elements normally used in pulse conditioning circuits, especially speed transducer processing circuits.

  20. [Adrenaline and cyclic AMP stimulation of ketopentose and sedoheptulose formation in rat liver homogenates].

    PubMed

    Kolotilova, A I; Glushankov, E P; Epifanova, Iu E

    1976-01-01

    Formation of sedoheptulose-7-phosphate and ketopentose phosphate was studied in vitro as affected by epinephrine and cAMP. No effect of epinephrine on the activity of transketolase was found with ribose-5-phosphate as a substrate of the nonoxidative reactions of the pentose phosphate ccyle. Epinephrine and cAMP enhance the formation of ketopentoses and sedoheptulose with glycogen as a main carbohydrate source, which is most pronounced in the experiments with cold preincubation. The phosphorylase system mediate influence of epinephrine and cAMP on the nonoxidative reactions products may be assumed.

  1. The cAMP Pathway as Therapeutic Target in Autoimmune and Inflammatory Diseases

    PubMed Central

    Raker, Verena Katharina; Becker, Christian; Steinbrink, Kerstin

    2016-01-01

    Nucleotide signaling molecules contribute to the regulation of cellular pathways. In the immune system, cyclic adenosine monophosphate (cAMP) is well established as a potent regulator of innate and adaptive immune cell functions. Therapeutic strategies to interrupt or enhance cAMP generation or effects have immunoregulatory potential in autoimmune and inflammatory disorders. Here, we provide an overview of the cyclic AMP axis and its role as a regulator of immune functions and discuss the clinical and translational relevance of interventions with these processes. PMID:27065076

  2. Parathyroid hormone stimulates juxtaglomerular cell cAMP accumulation without stimulating renin release

    PubMed Central

    Atchison, Douglas K.; Harding, Pamela; Cecilia Ortiz-Capisano, M.; Peterson, Edward L.

    2012-01-01

    Parathyroid hormone (PTH) is positively coupled to the generation of cAMP via its actions on the PTH1R and PTH2R receptors. Renin secretion from juxtaglomerular (JG) cells is stimulated by elevated intracellular cAMP, and every stimulus that increases renin secretion is thought to do so via increasing cAMP. Thus we hypothesized that PTH increases renin release from primary cultures of mouse JG cells by elevating intracellular cAMP via the PTH1R receptor. We found PTH1R, but not PTH2R, mRNA expressed in JG cells. While PTH increased JG cell cAMP content from (log10 means ± SE) 3.27 ± 0.06 to 3.92 ± 0.12 fmol/mg protein (P < 0.001), it did not affect renin release. The PTH1R-specific agonist, parathyroid hormone-related protein (PTHrP), also increased JG cell cAMP from 3.13 ± 0.09 to 3.93 ± 0.09 fmol/mg protein (P < 0.001), again without effect on renin release. PTH2R receptor agonists had no effect on cAMP or renin release. PTHrP increased cAMP in the presence of both low and high extracellular calcium from 3.31 ± 0.17 to 3.83 ± 0.20 fmol/mg protein (P < 0.01) and from 3.29 ± 0.18 to 3.63 ± 0.22 fmol/mg protein (P < 0.05), respectively, with no effect on renin release. PTHrP increased JG cell cAMP in the presence of adenylyl cyclase-V inhibition from 2.85 ± 0.17 to 3.44 ± 0.14 fmol/mg protein (P < 0.001) without affecting renin release. As a positive control, forskolin increased JG cell cAMP from 3.39 ± 0.13 to 4.48 ± 0.07 fmol/mg protein (P < 0.01) and renin release from 2.96 ± 0.10 to 3.29 ± 0.08 ng ANG I·mg prot−1·h−1 (P < 0.01). Thus PTH increases JG cell cAMP via non-calcium-sensitive adenylate cyclases without affecting renin release. These data suggest compartmentalization of cAMP signaling in JG cells. PMID:22896038

  3. Parathyroid hormone stimulates juxtaglomerular cell cAMP accumulation without stimulating renin release.

    PubMed

    Atchison, Douglas K; Harding, Pamela; Cecilia Ortiz-Capisano, M; Peterson, Edward L; Beierwaltes, William H

    2012-10-15

    Parathyroid hormone (PTH) is positively coupled to the generation of cAMP via its actions on the PTH1R and PTH2R receptors. Renin secretion from juxtaglomerular (JG) cells is stimulated by elevated intracellular cAMP, and every stimulus that increases renin secretion is thought to do so via increasing cAMP. Thus we hypothesized that PTH increases renin release from primary cultures of mouse JG cells by elevating intracellular cAMP via the PTH1R receptor. We found PTH1R, but not PTH2R, mRNA expressed in JG cells. While PTH increased JG cell cAMP content from (log(10) means ± SE) 3.27 ± 0.06 to 3.92 ± 0.12 fmol/mg protein (P < 0.001), it did not affect renin release. The PTH1R-specific agonist, parathyroid hormone-related protein (PTHrP), also increased JG cell cAMP from 3.13 ± 0.09 to 3.93 ± 0.09 fmol/mg protein (P < 0.001), again without effect on renin release. PTH2R receptor agonists had no effect on cAMP or renin release. PTHrP increased cAMP in the presence of both low and high extracellular calcium from 3.31 ± 0.17 to 3.83 ± 0.20 fmol/mg protein (P < 0.01) and from 3.29 ± 0.18 to 3.63 ± 0.22 fmol/mg protein (P < 0.05), respectively, with no effect on renin release. PTHrP increased JG cell cAMP in the presence of adenylyl cyclase-V inhibition from 2.85 ± 0.17 to 3.44 ± 0.14 fmol/mg protein (P < 0.001) without affecting renin release. As a positive control, forskolin increased JG cell cAMP from 3.39 ± 0.13 to 4.48 ± 0.07 fmol/mg protein (P < 0.01) and renin release from 2.96 ± 0.10 to 3.29 ± 0.08 ng ANG I·mg prot(-1)·h(-1) (P < 0.01). Thus PTH increases JG cell cAMP via non-calcium-sensitive adenylate cyclases without affecting renin release. These data suggest compartmentalization of cAMP signaling in JG cells.

  4. Analysis of Advanced Modular Power Systems (AMPS) for Deep Space Exploration

    NASA Technical Reports Server (NTRS)

    Oeftering, Richard; Soeder, James F.; Beach, Ray

    2014-01-01

    The Advanced Modular Power Systems (AMPS) project is developing a modular approach to spacecraft power systems for exploration beyond Earth orbit. AMPS is intended to meet the need of reducing the cost of design development, test and integration and also reducing the operational logistics cost of supporting exploration missions. AMPS seeks to establish modular power building blocks with standardized electrical, mechanical, thermal and data interfaces that can be applied across multiple exploration vehicles. The presentation discusses the results of a cost analysis that compares the cost of the modular approach against a traditional non-modular approach.

  5. Phase A conceptual design study of the Atmospheric, Magnetospheric and Plasmas in Space (AMPS) payload

    NASA Technical Reports Server (NTRS)

    1974-01-01

    The 12 month Phase A Conceptual Design Study of the Atmospheric, Magnetospheric and Plasmas in Space (AMPS) payload performed within the Program Development Directorate of the Marshall Space Flight Center is presented. The AMPS payload makes use of the Spacelab pressurized module and pallet, is launched by the space shuttle, and will have initial flight durations of 7 days. Scientific instruments including particle accelerators, high power transmitters, optical instruments, and chemical release devices are mounted externally on the Spacelab pallet and are controlled by the experimenters from within the pressurized module. The capability of real-time scientist interaction on-orbit with the experiment is a major characteristic of AMPS.

  6. Cyclic AMP regulates the biosynthesis of cellobiohydrolase in Cellulomonas flavigena growing in sugar cane bagasse.

    PubMed

    Herrera-Herrera, Jesús Antonio; Pérez-Avalos, Odilia; Salgado, Luis M; Ponce-Noyola, Teresa

    2009-10-01

    Cellulomonas flavigena produces a battery of cellulase components that act concertedly to degrade cellulose. The addition of cAMP to repressed C. flavigena cultures released catabolic repression, while addition of cAMP to induced C. flavigena cultures led to a cellobiohydrolase hyperproduction. Exogenous cAMP showed positive regulation on cellobiohydrolase production in C. flavigena grown on sugar cane bagasse. A C. flavigena cellobiohydrolase gene was cloned (named celA), which coded for a 71- kDa enzyme. Upstream, a repressor celR1, identified as a 38 kDa protein, was monitored by use of polyclonal antibodies.

  7. New insight into the binding modes of TNP-AMP to human liver fructose-1,6-bisphosphatase

    NASA Astrophysics Data System (ADS)

    Han, Xinya; Huang, Yunyuan; Zhang, Rui; Xiao, San; Zhu, Shuaihuan; Qin, Nian; Hong, Zongqin; Wei, Lin; Feng, Jiangtao; Ren, Yanliang; Feng, Lingling; Wan, Jian

    2016-08-01

    Human liver fructose-1,6-bisphosphatase (FBPase) contains two binding sites, a substrate fructose-1,6-bisphosphate (FBP) active site and an adenosine monophosphate (AMP) allosteric site. The FBP active site works by stabilizing the FBPase, and the allosteric site impairs the activity of FBPase through its binding of a nonsubstrate molecule. The fluorescent AMP analogue, 2‧,3‧-O-(2,4,6-trinitrophenyl)adenosine 5‧-monophosphate (TNP-AMP) has been used as a fluorescent probe as it is able to competitively inhibit AMP binding to the AMP allosteric site and, therefore, could be used for exploring the binding modes of inhibitors targeted on the allosteric site. In this study, we have re-examined the binding modes of TNP-AMP to FBPase. However, our present enzyme kinetic assays show that AMP and FBP both can reduce the fluorescence from the bound TNP-AMP through competition for FBPase, suggesting that TNP-AMP binds not only to the AMP allosteric site but also to the FBP active site. Mutagenesis assays of K274L (located in the FBP active site) show that the residue K274 is very important for TNP-AMP to bind to the active site of FBPase. The results further prove that TNP-AMP is able to bind individually to the both sites. Our present study provides a new insight into the binding mechanism of TNP-AMP to the FBPase. The TNP-AMP fluorescent probe can be used to exam the binding site of an inhibitor (the active site or the allosteric site) using FBPase saturated by AMP and FBP, respectively, or the K247L mutant FBPase.

  8. Activation of f-channels by cAMP analogues in macropatches from rabbit sino-atrial node myocytes.

    PubMed Central

    Bois, P; Renaudon, B; Baruscotti, M; Lenfant, J; DiFrancesco, D

    1997-01-01

    1. The action of the two diastereometric phosphorothioate derivatives of cAMP, Rp-cAMPs and Sp-cAMPs, was investigated on hyperpolarization-activated 'pacemaker' current (i(f)) recorded in inside-out macropatches from rabbit sino-atrial (SA) node myocytes. 2. When superfused on the intracellular side of f-channels at the concentration of 10 microM, both cAMP derivatives accelerated i(f) activation; their action was moderately less pronounced than that due to the same concentration of cAMP. 3. The measurement of the i(f) conductance-voltage relation by voltage ramp protocols indicated that both cAMP analogues shift the activation curve of i(f) to more positive voltages with no change in maximal (fully activated) conductance. 4. Dose-response relationships of the shift of the i(f) activation curve showed that both Rp-cAMPs and Sp-cAMPs act as agonists in the cAMP-dependent direct f-channel activation. Fitting data to the Hill equation resulted in maximal shifts of 9.6 and 9.5 mV, apparent dissociation constants of 0.82 and 5.4 microM, and Hill coefficients of 0.82 and 1.12 for Sp-cAMPs and Rp-cAMPs, respectively. 5. The activating action of Rp-cAMPs, a known antagonist of cAMP in the activation of cAMP-dependent protein kinase, confirms previously established evidence that f-channel activation does not involve phosphorylation. These results also suggest that the cAMP binding site of f-channels may be structurally similar to the cyclic nucleotide binding site of olfactory receptor channels. PMID:9218217

  9. Pulse-by-pulse method to characterize partially coherent pulse propagation in instantaneous nonlinear media.

    PubMed

    Lajunen, Hanna; Torres-Company, Víctor; Lancis, Jesús; Silvestre, Enrique; Andrès, Pedro

    2010-07-01

    We propose a numerical method for analyzing extensively the evolution of the coherence functions of nonstationary optical pulses in dispersive, instantaneous nonlinear Kerr media. Our approach deals with the individual propagation of samples from a properly selected ensemble that reproduces the coherence properties of the input pulsed light. In contrast to the usual strategy assuming Gaussian statistics, our numerical algorithm allows us to model the propagation of arbitrary partially coherent pulses in media with strong and instantaneous nonlinearities. PMID:20639984

  10. Pulsed depressed collector

    DOEpatents

    Kemp, Mark A

    2015-11-03

    A high power RF device has an electron beam cavity, a modulator, and a circuit for feed-forward energy recovery from a multi-stage depressed collector to the modulator. The electron beam cavity include a cathode, an anode, and the multi-stage depressed collector, and the modulator is configured to provide pulses to the cathode. Voltages of the electrode stages of the multi-stage depressed collector are allowed to float as determined by fixed impedances seen by the electrode stages. The energy recovery circuit includes a storage capacitor that dynamically biases potentials of the electrode stages of the multi-stage depressed collector and provides recovered energy from the electrode stages of the multi-stage depressed collector to the modulator. The circuit may also include a step-down transformer, where the electrode stages of the multi-stage depressed collector are electrically connected to separate taps on the step-down transformer.

  11. Pulsed Plasma Accelerator Modeling

    NASA Technical Reports Server (NTRS)

    Goodman, M.; Kazeminezhad, F.; Owens, T.

    2009-01-01

    This report presents the main results of the modeling task of the PPA project. The objective of this task is to make major progress towards developing a new computational tool with new capabilities for simulating cylindrically symmetric 2.5 dimensional (2.5 D) PPA's. This tool may be used for designing, optimizing, and understanding the operation of PPA s and other pulsed power devices. The foundation for this task is the 2-D, cylindrically symmetric, magnetohydrodynamic (MHD) code PCAPPS (Princeton Code for Advanced Plasma Propulsion Simulation). PCAPPS was originally developed by Sankaran (2001, 2005) to model Lithium Lorentz Force Accelerators (LLFA's), which are electrode based devices, and are typically operated in continuous magnetic field to the model, and implementing a first principles, self-consistent algorithm to couple the plasma and power circuit that drives the plasma dynamics.

  12. Nanofabrication with Pulsed Lasers

    PubMed Central

    2010-01-01

    An overview of pulsed laser-assisted methods for nanofabrication, which are currently developed in our Institute (LP3), is presented. The methods compass a variety of possibilities for material nanostructuring offered by laser–matter interactions and imply either the nanostructuring of the laser-illuminated surface itself, as in cases of direct laser ablation or laser plasma-assisted treatment of semiconductors to form light-absorbing and light-emitting nano-architectures, as well as periodic nanoarrays, or laser-assisted production of nanoclusters and their controlled growth in gaseous or liquid medium to form nanostructured films or colloidal nanoparticles. Nanomaterials synthesized by laser-assisted methods have a variety of unique properties, not reproducible by any other route, and are of importance for photovoltaics, optoelectronics, biological sensing, imaging and therapeutics. PMID:20672069

  13. PULSED ION SOURCE

    DOEpatents

    Anderson, C.E.; Ehlers, K.W.

    1958-06-17

    An ion source is described for producing very short high density pulses of ions without bcam scattering. The ions are created by an oscillating electron discharge within a magnetic field. After the ions are drawn from the ionization chamber by an accelerating electrode the ion beam is under the influence of the magnetic field for separation of the ions according to mass and, at the same time, passes between two neutralizing plntes maintained nt equal negative potentials. As the plates are formed of a material having a high ratio of secondary electrons to impinging ions, the ion bombardment of the plntes emits electrons which neutralize the frirge space-charge of the beam and tend to prevent widening of the beam cross section due to the mutual repulsion of the ions.

  14. Pulsed ion beam source

    DOEpatents

    Greenly, John B.

    1997-01-01

    An improved pulsed ion beam source having a new biasing circuit for the fast magnetic field. This circuit provides for an initial negative bias for the field created by the fast coils in the ion beam source which pre-ionize the gas in the source, ionize the gas and deliver the gas to the proper position in the accelerating gap between the anode and cathode assemblies in the ion beam source. The initial negative bias improves the interaction between the location of the nulls in the composite magnetic field in the ion beam source and the position of the gas for pre-ionization and ionization into the plasma as well as final positioning of the plasma in the accelerating gap. Improvements to the construction of the flux excluders in the anode assembly are also accomplished by fabricating them as layered structures with a high melting point, low conductivity material on the outsides with a high conductivity material in the center.

  15. Supersonic Pulsed Injection

    NASA Technical Reports Server (NTRS)

    Cutler, A. D.; Harding, G. C.; Diskin, G. S.

    2001-01-01

    An injector has been developed to provide high-speed high-frequency (order 10 kHz) pulsed a supersonic crossflow. The injector nozzle is formed between the fixed internal surface of the nozzle and a freely rotating three- or four-sided wheel embedded within the device. Flow-induced rotation of the wheel causes the nozzle throat to open and close at a frequency proportional to the speed of sound of the injected gas. Measurements of frequency and mass flow rate as a function of supply pressure are discussed for various injector designs. Preliminary results are presented for wall-normal injection of helium into a Mach-2 ducted airflow. The data include schlieren images in the injectant plume in a plane normal to the flow, downstream of injection.

  16. Capacitor discharge pulse analysis.

    SciTech Connect

    Baker, Michael Sean; Griffiths, Stewart K.; Tanner, Danelle Mary

    2013-08-01

    Capacitors used in firing sets and other high discharge current applications are discharge tested to verify performance of the capacitor against the application requirements. Parameters such as capacitance, inductance, rise time, pulse width, peak current and current reversal must be verified to ensure that the capacitor will meet the application needs. This report summarizes an analysis performed on the discharge current data to extract these parameters by fitting a second-order system model to the discharge data and using this fit to determine the resulting performance metrics. Details of the theory and implementation are presented. Using the best-fit second-order system model to extract these metrics results in less sensitivity to noise in the measured data and allows for direct extraction of the total series resistance, inductance, and capacitance.

  17. MULTI-CHANNEL ELECTRIC PULSE HEIGHT ANALYZER

    DOEpatents

    Gallagher, J.D. et al.

    1960-11-22

    An apparatus is given for converting binary information into coded decimal form comprising means, in combination with a binary adder, a live memory and a source of bigit pulses, for synchronizing the bigit pulses and the adder output pulses; a source of digit pulses synchronized with every fourth bigit pulse; means for generating a conversion pulse in response to the time coincidence of the adder output pulse and a digit pulse: means having a delay equal to two bigit pulse periods coupling the adder output with the memory; means for promptly impressing said conversion pulse on the input of said memory: and means having a delay equal to one bigit pulse period for again impressing the conversion pulse on the input of the memory whereby a fourth bigit adder pulse results in the insertion into the memory of second, third and fourth bigits.

  18. Switching power pulse system

    DOEpatents

    Aaland, Kristian

    1983-01-01

    A switching system for delivering pulses of power from a source (10) to a load (20) using a storage capacitor (C3) charged through a rectifier (D1, D2), and maintained charged to a reference voltage level by a transistor switch (Q1) and voltage comparator (12). A thyristor (22) is triggered to discharge the storage capacitor through a saturable reactor (18) and fractional turn saturable transformer (16) having a secondary to primary turn ratio N of n:l/n=n.sup.2. The saturable reactor (18) functions as a "soaker" while the thyristor reaches saturation, and then switches to a low impedance state. The saturable transformer functions as a switching transformer with high impedance while a load coupling capacitor (C4) charges, and then switches to a low impedance state to dump the charge of the storage capacitor (C3) into the load through the coupling capacitor (C4). The transformer is comprised of a multilayer core (26) having two secondary windings (28, 30) tightly wound and connected in parallel to add their output voltage and reduce output inductance, and a number of single turn windings connected in parallel at nodes (32, 34) for the primary winding, each single turn winding linking a different one of the layers of the multilayer core. The load may be comprised of a resistive beampipe (40) for a linear particle accelerator and capacitance of a pulse forming network (42). To hold off discharge of the capacitance until it is fully charged, a saturable core (44) is provided around the resistive beampipe (40) to isolate the beampipe from the capacitance (42) until it is fully charged.

  19. Pulsed electron beam precharger

    SciTech Connect

    Finney, W.C.; Shelton, W.N.

    1991-01-01

    Quarter Eight of the Pulsed Electron Precharging project was principally devoted to the operation of the E-beam precharger in the pulsed anode mode. We shall first briefly review the motivation for carrying out this project and the experimental approach used. The combustion of low sulfur coal for the purpose of generating electric energy in power plants results in the production of a flue gas containing very high resistivity fly ash. This fly ash is not easily collected by conventional electrostatic precipitators due to the large electric potential difference which develops across the layer of fly ash on the collector plate. If this layer of collected material is allowed to reach a thickness as great as is normally desirable before rapping'' the plates, then the collected fly ash is subject to re-entrainment into the flue gas stream due to back-corona. The back-corona corona problem is described more fully in the next section of this report. This re-entrainment problem can be eliminated through reduction of the voltage applied across the high voltage wires and the grounded plates of the electrostatic precipitator. This is not a good solution to the problem since the charging capability and collection efficiency of the precipitator system are both greatly reduced at the low voltages required to avoid the back-corona problem. Another approach to solving the problems inherent in collecting high resistivity fly ash in an electrostatic precipitator is to decouple the charging and collecting functions. At FSU an electron beam precharger is employed directly before (upstream in the flue gas pathway) the precipitator. This precharger can be optimized for the charging function while the downstream collector can be optimized for collection of the high-resistivity fly ash.

  20. Template Reproduction of GRB Pulse Light Curves

    NASA Astrophysics Data System (ADS)

    Hakkila, Jon E.; Preece, R. D.; Loredo, T. J.; Wolpert, R. L.; Broadbent, M. E.

    2014-01-01

    A study of well-isolated pulses in gamma ray burst light curves indicates that simple models having smooth and monotonic pulse rises and decays are inadequate. Departures from the Norris et al. (2005) pulse shape are in the form of a wave-like pre-peak residual that is mirrored and stretched following the peak. Pulse shape departures are present in GRB pulses of all durations, but placement of the departures relative to pulse peaks correlates with asymmetry. This establishes an additional link between temporal structure and spectral evolution, as pulse asymmetry is related to initial hardness while pulse duration indicates the rate of hard-to-soft pulse evolution.

  1. Binding of the Citrobacter freundii AmpR regulator to a single DNA site provides both autoregulation and activation of the inducible ampC beta-lactamase gene.

    PubMed Central

    Lindquist, S; Lindberg, F; Normark, S

    1989-01-01

    Citrobacter freundii encodes an inducible chromosomal beta-lactamase. Induction requires the product of the ampR gene, which is transcribed in the opposite orientation from the ampC beta-lactamase gene. We show here that the AmpR protein acts as a transcriptional activator by binding to a DNA region immediately upstream of the ampC promoter. The DNase I footprint pattern was not affected by growth in the presence of beta-lactam inducer or by the use of extracts prepared from cells carrying the ampD2 allele leading to semiconstitutive production of beta-lactamase. It is suggested that activation of AmpR facilitates binding or open complex formation for RNA polymerase at the ampC promoter. The AmpR-binding site overlaps the ampR promoter, and beta-galactosidase activity was decreased from an ampR-lacZ transcriptional fusion when AmpR was expressed from a coresident plasmid, suggesting that ampR is autogenously controlled. The AmpR protein belongs to a family of highly homologous transcriptional activators that includes LysR, which regulates the E. coli lysine synthetase gene, and the NodD protein, which regulates expression of a number of genes involved in nodulation in Rhizobium. The lack of sequence homology to any known beta-lactam-binding protein suggests that AmpR does not bind directly to the beta-lactam inducer but interacts with a second messenger of unknown nature. Images PMID:2786868

  2. Generating Independent Preionizing Pulses for Lasers

    NASA Technical Reports Server (NTRS)

    Pacala, T. J.

    1986-01-01

    Simple pulse-coupling winding on saturable reactor core lets core act as pulse transformer, passing preionizing pulse from winding to tapered transmission line, then to laser. Laser prepared for independent firing pulse, which follows preionizing pulse. Winding is simple, light in weight, low in bulk and power consumption, and inexpensive.

  3. Resistor pulse-handling capability

    SciTech Connect

    Horner, L.E.

    1981-04-01

    Methods for calculating pulse-handling capabilities of various resistor types are described. The work represents a compilation of studies derived from various sources, as indicated in the bibliography. The results indicate that resistors may be subjected to short-duration pulses exceeding their rated powers without sustaining permanent damage.

  4. Pulsed atmospheric fluidized bed combustion

    SciTech Connect

    Not Available

    1992-08-01

    The general specifications for a Pulsed Atmospheric Fluidized Bed Combustor Design Report (PAFBC) plant are presented. The design tasks for the PAFBC are described in the following areas: Coal/Limestone preparation and feed system; pulse combustor; fluidized bed; boiler parts; and ash handling system.

  5. Optical pulse propagation through clouds.

    PubMed

    Matter, J C; Bradley, R G

    1981-02-15

    The cloud impulse response (spatial and temporal) to optical pulse propagation has been measured. Experimental data are reported for the radiance function, pulse stretching, and (the first published) delay time. The results have been confirmed by Monte Carlo modeling. A geometric scattering model is presented explaining the temporal results for the test conditions.

  6. Optical pulse propagation through clouds.

    PubMed

    Matter, J C; Bradley, R G

    1981-07-01

    The cloud impulse response (spatial and temporal) to optical pulse propagation has been measured. Experimental data are reported for the radiance function, pulse stretching, and (the first published) delay time. The results have been confirmed by Monte Carlo modeling. A geometric scattering model is presented explaining the temporal results for the test conditions.

  7. High-speed pulse camera

    NASA Technical Reports Server (NTRS)

    Lawson, J. R.

    1968-01-01

    Miniaturized, 16 mm high speed pulse camera takes spectral photometric photographs upon instantaneous command. The design includes a low-friction, low-inertia film transport, a very thin beryllium shutter driven by a low-inertia stepper motor for minimum actuation time after a pulse command, and a binary encoder.

  8. Gene Expression Patterns Define Key Transcriptional Events InCell-Cycle Regulation By cAMP And Protein Kinase A

    SciTech Connect

    Zambon, Alexander C.; Zhang, Lingzhi; Minovitsky, Simon; Kanter, Joan R.; Prabhakar, Shyam; Salomonis, Nathan; Vranizan, Karen; Dubchak Inna,; Conklin, Bruce R.; Insel, Paul A.

    2005-06-01

    Although a substantial number of hormones and drugs increase cellular cAMP levels, the global impact of cAMP and its major effector mechanism, protein kinase A (PKA), on gene expression is not known. Here we show that treatment of murine wild-type S49 lymphoma cells for 24 h with 8-(4-chlorophenylthio)-cAMP (8-CPTcAMP), a PKA-selective cAMP analog, alters the expression of approx equal to 4,500 of approx. equal to 13,600 unique genes. By contrast, gene expression was unaltered in Kin- S49 cells (that lack PKA) incubated with 8-CPTcAMP. Changes in mRNA and protein expression of several cell cycle regulators accompanied cAMP-induced G1-phase cell-cycle arrest of wild-type S49 cells. Within 2h, 8-CPT-cAMP altered expression of 152 genes that contain evolutionarily conserved cAMP-response elements within 5 kb of transcriptional start sites, including the circadian clock gene Per1. Thus, cAMP through its activation of PKA produces extensive transcriptional regulation in eukaryotic cells. These transcriptional networks include a primary group of cAMP-response element-containing genes and secondary networks that include the circadian clock.

  9. Selective Phosphonylation of 5'-Adenosine Monophosphate (5'-AMP) via Pyrophosphite [PPi(III)

    NASA Astrophysics Data System (ADS)

    Kaye, Karl; Bryant, David E.; Marriott, Katie E. R.; Ohara, Shohei; Fishwick, Colin W. G.; Kee, Terence P.

    2016-11-01

    We describe here experiments which demonstrate the selective phospho-transfer from a plausibly prebiotic condensed phosphorus (P) salt, pyrophosphite [H2P2O5 2-; PPi(III)], to the phosphate group of 5'-adenosine mono phosphate (5'-AMP). We show further that this P-transfer process is accelerated both by divalent metal ions (M2+) and by organic co-factors such as acetate (AcO-). In this specific case of P-transfer from PPi(III) to 5'-AMP, we show a synergistic enhancement of transfer in the combined presence of M2+ & AcO-. Isotopic labelling studies demonstrate that hydrolysis of the phosphonylated 5'-AMP, [P(III)P(V)-5'-AMP], proceeds via nuceophilic attack of water at the Pi(III) terminus.

  10. Atmospheric, Magnetospheric, and Plasmas in Space (AMPS) spacelab payload definition study, appendixes

    NASA Technical Reports Server (NTRS)

    Keeley, J. T.

    1976-01-01

    An equipment list, instrument baseline data, engineering drawings, mass properties computer printouts, electrical energy management, and control and display functional analysis pertinent to the AMPS (Satellite Payload) are presented.

  11. A new traveling wave phenomenon of Dictyostelium in the presence of cAMP

    NASA Astrophysics Data System (ADS)

    Ševčíková, Hana; Čejková, Jitka; Krausová, Lenka; Přibyl, Michal; Štěpánek, František; Marek, Miloš

    2010-06-01

    The emergence of wave patterns in chemical and biological systems is of interest for the understanding of development, differentiation, signaling, and other phenomena. In this work we report a new type of wave pattern - called the “global wave” - which was observed in populations of Dictyostelium discoideum cells exposed to an excess of cyclic adenosine- 3‧, 5‧- monophosphate (cAMP) added to the supporting agar. It has been found that the addition of different amounts of cAMP to the agar leads to important deviations from the standard course of aggregation: (i) the formation and propagation of a global wave that has not been observed before; (ii) the delayed onset or absence of cAMP waves patterning; (iii) an atypical mechanism of cells clustering; and (iv) a faster or incomplete developmental cycle. We suggest that the global wave is a chemotactic response of the Dictyostelium cells to a wave of the cAMP concentration.

  12. Selective Phosphonylation of 5'-Adenosine Monophosphate (5'-AMP) via Pyrophosphite [PPi(III)

    NASA Astrophysics Data System (ADS)

    Kaye, Karl; Bryant, David E.; Marriott, Katie E. R.; Ohara, Shohei; Fishwick, Colin W. G.; Kee, Terence P.

    2016-05-01

    We describe here experiments which demonstrate the selective phospho-transfer from a plausibly prebiotic condensed phosphorus (P) salt, pyrophosphite [H2P2O5 2-; PPi(III)], to the phosphate group of 5'-adenosine mono phosphate (5'-AMP). We show further that this P-transfer process is accelerated both by divalent metal ions (M2+) and by organic co-factors such as acetate (AcO-). In this specific case of P-transfer from PPi(III) to 5'-AMP, we show a synergistic enhancement of transfer in the combined presence of M2+ & AcO-. Isotopic labelling studies demonstrate that hydrolysis of the phosphonylated 5'-AMP, [P(III)P(V)-5'-AMP], proceeds via nuceophilic attack of water at the Pi(III) terminus.

  13. Hepatitis C virus NS2 protein activates cellular cyclic AMP-dependent pathways

    SciTech Connect

    Kim, Kyoung Mi; Kwon, Shi-Nae; Kang, Ju-Il; Lee, Song Hee; Jang, Sung Key; Ahn, Byung-Yoon; Kim, Yoon Ki . E-mail: yk-kim@korea.ac.kr

    2007-05-18

    Chronic infection of the hepatitis C virus (HCV) leads to liver cirrhosis and cancer. The mechanism leading to viral persistence and hepatocellular carcinoma, however, has not been fully understood. In this study, we show that the HCV infection activates cellular cAMP-dependent pathways. Expression of a luciferase reporter gene controlled by a basic promoter with the cAMP response element (CRE) was significantly elevated in human hepatoma Huh-7 cells infected with the HCV JFH1. Analysis with viral subgenomic replicons indicated that the HCV NS2 protein is responsible for the effect. Furthermore, the level of cellular transcripts whose stability is known to be regulated by cAMP was specifically reduced in cells harboring NS2-expressing replicons. These results allude to the HCV NS2 protein having a novel function of regulating cellular gene expression and proliferation through the cAMP-dependent pathway.

  14. N-Acetyl-D- and L-esters of 5'-AMP hydrolyze at different rates

    NASA Technical Reports Server (NTRS)

    Wickramasinghe, N. S.; Lacey, J. C. Jr; Lacey JC, J. r. (Principal Investigator)

    1993-01-01

    Studies of the properties of aminoacyl derivatives of 5'-AMP are aimed at understanding the origin of the process of protein synthesis. Aminoacyl (2',3') esters of 5'-AMP can serve as models of the 3'-terminus of aminoacyl tRNA. We report here on the relative rates of hydrolysis of Ac-D- and L-Phe AMP esters as a function of pH. At all pHs above 3, the rate constant of hydrolysis of the Ac-L-Phe ester is 1.7 to 2.1 times that of Ac-D-Phe ester. The D-isomer seems partially protected from hydrolysis by a stronger association with the adenine ring of the 5'-AMP.

  15. Role of the cAMP Pathway in Glucose and Lipid Metabolism.

    PubMed

    Ravnskjaer, Kim; Madiraju, Anila; Montminy, Marc

    2016-01-01

    3'-5'-Cyclic adenosine monophosphate (cyclic AMP or cAMP) was first described in 1957 as an intracellular second messenger mediating the effects of glucagon and epinephrine on hepatic glycogenolysis (Berthet et al., J Biol Chem 224(1):463-475, 1957). Since this initial characterization, cAMP has been firmly established as a versatile molecular signal involved in both central and peripheral regulation of energy homeostasis and nutrient partitioning. Many of these effects appear to be mediated at the transcriptional level, in part through the activation of the transcription factor CREB and its coactivators. Here we review current understanding of the mechanisms by which the cAMP signaling pathway triggers metabolic programs in insulin-responsive tissues.

  16. The plasma cyclic AMP response to catecholamines as potentiated by phentolamine in rats.

    PubMed

    Kunitada, S; Ui, M

    1978-05-15

    Norepinephrine failed to increase plasma cyclic AMP when injected alone into fasted rats, in contrast with sharp increases elicited by isoproterenol, epinephrine or tyramine. In rats pretreated with 6-hydroxydopamine or cocain, however, there was significant increase in plasma cyclic AMP after norepinephrine injection, suggesting that the rapid neuronal catecholamine uptake was at least partly responsible for the lack of norepinephrine action. Phentolamine was very effective in enhancing the epinephrine-, norepinephrine- or tyramine-induced increase in plasma cyclic AMP but without effect on the isoproterenol-induced increase. Blockade of postsynaptic alpha-adrenoceptors, rather than of presynaptic receptors, is likely to be involved in the phentolamine potentiation, since it was even observed in rats treated with 6-hydroxydopamine or cocaine. A discussion is presented regarding the mechanism by which cyclic AMP generation is influenced by the alpha- and beta-adrenoceptor interaction on effector cell membranes.

  17. Is a decrease in cyclic AMP a necessary and sufficient signal for maturation of amphibian oocytes

    SciTech Connect

    Gelerstein, S.; Shapira, H.; Dascal, N.; Yekuel, R.; Oron, Y.

    1988-05-01

    Acetylcholine rapidly lowered the intracellular levels of cyclic AMP in stage 5 and 6 Xenopus laevis oocytes. Acetylcholine alone did not induce oocyte maturation, though it did accelerate maturation induced by progesterone. The effect of acetylcholine on oocyte maturation was independent of extracellular calcium concentration. Adenosine increased cyclic AMP and abolished the progesterone-induced decrease in cyclic AMP levels in follicles and in denuded oocytes. This effect of adenosine was blocked by the Ra purinergic receptor antagonist, theophylline. Despite those effects, adenosine alone induced maturation in stage 6 oocytes and accelerated progesterone-induced maturation in both stage 5 and 6 cells. Adenosine also induced a significant increase in the rate of /sup 45/Ca efflux from oocytes in the presence and the absence of external calcium. We suggest that the activation of cell surface receptors involved in the release of calcium from cellular stores may induce or accelerate oocyte maturation independently of small changes in intracellular cyclic AMP concentration.

  18. Atmospheric, Magnetospheric, and Plasmas in Space (AMPS) spacelab payload definition study, technical summary document

    NASA Technical Reports Server (NTRS)

    Keeley, J. T.

    1976-01-01

    Some 60 instrument candidates and 80 possible science investigations were evaluated. The early analysis emphasized the science aspect in terms of the functional requirements for each of the potential experiments identified by the AMPS science working group. These requirements were then used for the grouping of instruments into practical payloads which would fit the capabilities of the Shuttle/Spacelab. This analysis resulted in the definition of eleven different AMPS configurations. The data were then used to define a typical set of requirements for a flexible AMPS laboratory. The data gathered to this point showed that a planned sequential buildup of the laboratory would be necessary to meet both physical and funding limitations. This led to the definition of five strawman payloads by the science working group, which were used to establish a conceptual laboratory and to define preliminary design of a configuration which could satisfy AMPS needs during the early program period.

  19. NMR studies of the AMP-binding site and mechanism of adenylate kinase.

    PubMed

    Fry, D C; Kuby, S A; Mildvan, A S

    1987-03-24

    NMR has previously been used to determine the conformation of enzyme-bound MgATP and to locate the MgATP-binding site on adenylate kinase [Fry, D. C., Kuby, S. A., & Mildvan, A. S. (1985) Biochemistry 24, 4680-4694]. To determine the conformation and location of the other substrate, AMP, distances have been measured from Cr3+AMPPCP, a linear competitive inhibitor with respect to MgATP, to six protons and to the phosphorus atom of AMP on adenylate kinase, with the paramagnetic probe-T1 method. Time-dependent nuclear Overhauser effects (NOEs) have been used to measure five interproton distances on enzyme-bound AMP. These distances were used to determine the conformation of bound AMP in addition to its position with respect to metal-ATP. Enzyme-bound AMP exhibits a high anti-glycosyl torsional angle (chi = 110 +/- 10 degrees), a 3'-endo,2'-exo ribose pucker (delta = 105 +/- 10 degrees), and gauche-trans orientations about the C4'-C5' bond (gamma = 180 +/- 10 degrees) and the C5'-O5' bond (beta = 170 +/- 20 degrees). The distance from Cr3+ to the phosphorus of AMP is 5.9 +/- 0.3 A, indicating a reaction coordinate distance of approximately 3 A, which is consistent with an associative SN2 mechanism for the phosphoryl transfer. Ten intermolecular NOEs, from protons of the enzyme to those of AMP, were detected, indicating the proximity of at least three hydrophobic amino acids to bound AMP. These constraints, together with the conformation of AMP and the intersubstrate distances, were used to position AMP into the X-ray structure of adenylate kinase. The AMP binding site is found to be near (less than or equal to 4 A from) Leu-116, Arg-171, Val-173, Val-182, and Leu-190; all of these residues have been found to be invariant in muscle-type rabbit, calf, human, porcine [Kuby, S. A., Palmieri, R. H., Frischat, A., Fischer, A. H., Wu, L. H., Maland, L., & Manship, M. (1984) Biochemistry 23, 2393-2399], and chicken adenylate kinase [Kishi, F., Maruyama, M., Tanizawa, Y

  20. Vv-AMP1, a ripening induced peptide from Vitis vinifera shows strong antifungal activity

    PubMed Central

    de Beer, Abré; Vivier, Melané A

    2008-01-01

    Background Latest research shows that small antimicrobial peptides play a role in the innate defense system of plants. These peptides typically contribute to preformed defense by developing protective barriers around germinating seeds or between different tissue layers within plant organs. The encoding genes could also be upregulated by abiotic and biotic stimuli during active defense processes. The peptides display a broad spectrum of antimicrobial activities. Their potent anti-pathogenic characteristics have ensured that they are promising targets in the medical and agricultural biotechnology sectors. Results A berry specific cDNA sequence designated Vv-AMP1, Vitis vinifera antimicrobial peptide 1, was isolated from Vitis vinifera. Vv-AMP1 encodes for a 77 amino acid peptide that shows sequence homology to the family of plant defensins. Vv-AMP1 is expressed in a tissue specific, developmentally regulated manner, being only expressed in berry tissue at the onset of berry ripening and onwards. Treatment of leaf and berry tissue with biotic or abiotic factors did not lead to increased expression of Vv-AMP1 under the conditions tested. The predicted signal peptide of Vv-AMP1, fused to the green fluorescent protein (GFP), showed that the signal peptide allowed accumulation of its product in the apoplast. Vv-AMP1 peptide, produced in Escherichia coli, had a molecular mass of 5.495 kDa as determined by mass spectrometry. Recombinant Vv-AMP1 was extremely heat-stable and showed strong antifungal activity against a broad spectrum of plant pathogenic fungi, with very high levels of activity against the wilting disease causing pathogens Fusarium oxysporum and Verticillium dahliae. The Vv-AMP1 peptide did not induce morphological changes on the treated fungal hyphae, but instead strongly inhibited hyphal elongation. A propidium iodide uptake assay suggested that the inhibitory activity of Vv-AMP1 might be associated with altering the membrane permeability of the fungal