Cytoplasmic CopZ-Like Protein and Periplasmic Rusticyanin and AcoP Proteins as Possible Copper Resistance Determinants in Acidithiobacillus ferrooxidans ATCC 23270

PubMed Central

Navarro, Claudio A.; von Bernath, Diego; Martínez-Bussenius, Cristóbal; Castillo, Rodrigo A.

2015-01-01

Acidophilic organisms, such as Acidithiobacillus ferrooxidans, possess high-level resistance to copper and other metals. A. ferrooxidans contains canonical copper resistance determinants present in other bacteria, such as CopA ATPases and RND efflux pumps, but these components do not entirely explain its high metal tolerance. The aim of this study was to find other possible copper resistance determinants in this bacterium. Transcriptional expression of A. ferrooxidans genes coding for a cytoplasmic CopZ-like copper-binding chaperone and the periplasmic copper-binding proteins rusticyanin and AcoP, which form part of an iron-oxidizing supercomplex, was found to increase when the microorganism was grown in the presence of copper. All of these proteins conferred more resistance to copper when expressed heterologously in a copper-sensitive Escherichia coli strain. This effect was absent when site-directed-mutation mutants of these proteins with altered copper-binding sites were used in this metal sensitivity assay. These results strongly suggest that the three copper-binding proteins analyzed here are copper resistance determinants in this extremophile and contribute to the high-level metal resistance of this industrially important biomining bacterium. PMID:26637599

Regulation of the alpha-glucuronidase-encoding gene ( aguA) from Aspergillus niger.

PubMed

de Vries, R P; van de Vondervoort, P J I; Hendriks, L; van de Belt, M; Visser, J

2002-09-01

The alpha-glucuronidase gene aguA from Aspergillus niger was cloned and characterised. Analysis of the promoter region of aguA revealed the presence of four putative binding sites for the major carbon catabolite repressor protein CREA and one putative binding site for the transcriptional activator XLNR. In addition, a sequence motif was detected which differed only in the last nucleotide from the XLNR consensus site. A construct in which part of the aguA coding region was deleted still resulted in production of a stable mRNA upon transformation of A. niger. The putative XLNR binding sites and two of the putative CREA binding sites were mutated individually in this construct and the effects on expression were examined in A. niger transformants. Northern analysis of the transformants revealed that the consensus XLNR site is not actually functional in the aguA promoter, whereas the sequence that diverges from the consensus at a single position is functional. This indicates that XLNR is also able to bind to the sequence GGCTAG, and the XLNR binding site consensus should therefore be changed to GGCTAR. Both CREA sites are functional, indicating that CREA has a strong influence on aguA expression. A detailed expression analysis of aguA in four genetic backgrounds revealed a second regulatory system involved in activation of aguA gene expression. This system responds to the presence of glucuronic and galacturonic acids, and is not dependent on XLNR.

Active-site copper reduction promotes substrate binding of fungal lytic polysaccharide monooxygenase and reduces stability.

PubMed

Kracher, Daniel; Andlar, Martina; Furtmüller, Paul G; Ludwig, Roland

2018-02-02

Lytic polysaccharide monooxygenases (LPMOs) are a class of copper-containing enzymes that oxidatively degrade insoluble plant polysaccharides and soluble oligosaccharides. Upon reductive activation, they cleave the substrate and promote biomass degradation by hydrolytic enzymes. In this study, we employed LPMO9C from Neurospora crassa , which is active toward cellulose and soluble β-glucans, to study the enzyme-substrate interaction and thermal stability. Binding studies showed that the reduction of the mononuclear active-site copper by ascorbic acid increased the affinity and the maximum binding capacity of LPMO for cellulose. The reduced redox state of the active-site copper and not the subsequent formation of the activated oxygen species increased the affinity toward cellulose. The lower affinity of oxidized LPMO could support its desorption after catalysis and allow hydrolases to access the cleavage site. It also suggests that the copper reduction is not necessarily performed in the substrate-bound state of LPMO. Differential scanning fluorimetry showed a stabilizing effect of the substrates cellulose and xyloglucan on the apparent transition midpoint temperature of the reduced, catalytically active enzyme. Oxidative auto-inactivation and destabilization were observed in the absence of a suitable substrate. Our data reveal the determinants of LPMO stability under turnover and non-turnover conditions and indicate that the reduction of the active-site copper initiates substrate binding. © 2018 by The American Society for Biochemistry and Molecular Biology, Inc.

The LacI family protein GlyR3 co-regulates the celC operon and manB in Clostridium thermocellum

DOE PAGES

Choi, Jinlyung; Klingeman, Dawn M.; Brown, Steven D.; ...

2017-06-24

In this paper, we demonstrate that the GlyR3 protein mediates the regulation of manB. We first identify putative GlyR3 binding sites within or just upstream of the coding regions of manB and celT. Using an electrophoretic mobility shift assay (EMSA), we determined that a higher concentration of GlyR3 is required to effectively bind to the putative manB site in comparison to the celC site. Neither the putative celT site nor random DNA significantly binds GlyR3. While laminaribiose interfered with GlyR3 binding to the celC binding site, binding to the manB site was unaffected. In the presence of laminaribiose, in vivomore » transcription of the celC–glyR3–licA gene cluster increases, while manB expression is repressed, compared to in the absence of laminaribiose, consistent with the results from the EMSA. An in vitro transcription assay demonstrated that GlyR3 and laminaribiose interactions were responsible for the observed patters of in vivo transcription.« less

Using XAS and SXRF to Study Copper in Wilson Disease at the Molecular and Tissue Level

NASA Astrophysics Data System (ADS)

Ralle, Martina; Blackburn, Ninian J.; Lutsenko, Svetlana

2007-02-01

Wilson disease (WD) is a genetic disorder of copper metabolism associated with severe hepatic, neurological, and psychiatric abnormalities. In WD, the billiary copper excretion is impaired and copper accumulates in tissues, particularly in the liver and the brain. The affected gene, ATP7B, encodes the copper transporting ATPase, Wilson disease protein (WNDP). WNDP has six copper binding sites in the N-terminal portion of the molecule. Each site includes the conserved amino acid sequence MXCXXC, and binds 1 Cu(I) through its 2 cysteine residues. We performed X-ray absorption studies at the Cu Kα-edge on the recombinant N-terminal domain of WNDP (N-WNDP). Copper was bound to N-WNDP either in vivo or in vitro in the presence of different reducing agents. We found that in N-WNDP copper is predominantly coordinated in a linear fashion by two cysteines, with the appearance of a Cu-Cu interaction when all metal binding sites are filled. Increasing amounts of reducing agents containing sulfide or phosphine groups led to binding of the exogenous ligands to copper thereby increasing the coordination number of copper from two to three. To better understand the role of copper in WD, we utilized livers of the 6-weeks-old Atp7b-/- mice (an animal model for WD) in which the copper concentration was 10-20-fold higher compared to that of the control mice. The distribution of copper in hepatocytes was evaluated by synchrotron based X-ray fluorescence microprobe (SXRF). We demonstrate that we can prepare liver slices that retain copper and can detect copper with subcellular resolution. On the same sections μ-XANES (spot size: 5 micron) was used to determine the oxidation state of copper.

Cytoplasmic CopZ-Like Protein and Periplasmic Rusticyanin and AcoP Proteins as Possible Copper Resistance Determinants in Acidithiobacillus ferrooxidans ATCC 23270.

PubMed

Navarro, Claudio A; von Bernath, Diego; Martínez-Bussenius, Cristóbal; Castillo, Rodrigo A; Jerez, Carlos A

2016-02-15

Acidophilic organisms, such as Acidithiobacillus ferrooxidans, possess high-level resistance to copper and other metals. A. ferrooxidans contains canonical copper resistance determinants present in other bacteria, such as CopA ATPases and RND efflux pumps, but these components do not entirely explain its high metal tolerance. The aim of this study was to find other possible copper resistance determinants in this bacterium. Transcriptional expression of A. ferrooxidans genes coding for a cytoplasmic CopZ-like copper-binding chaperone and the periplasmic copper-binding proteins rusticyanin and AcoP, which form part of an iron-oxidizing supercomplex, was found to increase when the microorganism was grown in the presence of copper. All of these proteins conferred more resistance to copper when expressed heterologously in a copper-sensitive Escherichia coli strain. This effect was absent when site-directed-mutation mutants of these proteins with altered copper-binding sites were used in this metal sensitivity assay. These results strongly suggest that the three copper-binding proteins analyzed here are copper resistance determinants in this extremophile and contribute to the high-level metal resistance of this industrially important biomining bacterium. Copyright © 2016, American Society for Microbiology. All Rights Reserved.

/sup 3/H)pirenzepine and (-)-(/sup 3/H)quinuclidinyl benzilate binding to rat cerebral cortical and cardiac muscarinic cholinergic sites. I. Characterization and regulation of agonist binding to putative muscarinic subtypes

DOE Office of Scientific and Technical Information (OSTI.GOV)

Watson, M.; Yamamura, H.I.; Roeske, W.R.

The binding and regulation of selected muscarinic agonists to putative subtypes in rat cerebral cortex and heart were studied. Parallel inhibition studies of (/sup 3/H)pirenzepine ((/sup 3/H)PZ) and (-)-(/sup 3/H)quinuclidinylbenzilate ((-)-(/sup 3/H)QNB)-labeled membranes were done with and without 30 microM guanyl-5'-yl imidodiphosphate (Gpp(NH)p) at 25 degrees C in 10 mM Na-K-phosphate buffer which enhances PZ binding affinity and in modified Krebs-phosphate buffer, which mimics physiological conditions. Classical agonists such as carbachol, oxotremorine and acetylcholine inhibited (-)-(/sup 3/H)QNB binding to membranes with shallow Hill values (nH less than 1), were better fit to a 2-state model, were Gpp(NH)p-regulated and showed lowermore » affinity in modified Krebs-phosphate buffer than in 10 mM Na-K-phosphate buffer. Some agonists were not significantly better fit to a 2-state model in (/sup 3/H)PZ-labeled cortical membranes, especially in 10 mM Na-K-phosphate buffer. Whereas putative M1 and M2 binding sites distinguished by PZ possessed multiple agonist affinity states, as judged by carbachol, and agonist binding to (/sup 3/H)PZ-labeled sites were Gpp(NH)p modulated, the partial agonist pilocarpine and nonclassical agonist McN-A-343 (3-(m-chlorophenylcarbamoyloxy)-2-butynyl trimethylammonium chloride) showed little Gpp(NH)p-induced shift in (/sup 3/H)PZ-labeled cortical membranes in physiological conditions. Agonist binding to (-)-(/sup 3/H)QNB-labeled putative M2 cardiac sites was more sensitive to Gpp(NH)p than (-)-(/sup 3/H)QNB-labeled cortical sites. Carbachol and acetylcholine showed significant selectivity for putative M2 sites.« less

SITEHOUND-web: a server for ligand binding site identification in protein structures.

PubMed

Hernandez, Marylens; Ghersi, Dario; Sanchez, Roberto

2009-07-01

SITEHOUND-web (http://sitehound.sanchezlab.org) is a binding-site identification server powered by the SITEHOUND program. Given a protein structure in PDB format SITEHOUND-web will identify regions of the protein characterized by favorable interactions with a probe molecule. These regions correspond to putative ligand binding sites. Depending on the probe used in the calculation, sites with preference for different ligands will be identified. Currently, a carbon probe for identification of binding sites for drug-like molecules, and a phosphate probe for phosphorylated ligands (ATP, phoshopeptides, etc.) have been implemented. SITEHOUND-web will display the results in HTML pages including an interactive 3D representation of the protein structure and the putative sites using the Jmol java applet. Various downloadable data files are also provided for offline data analysis.

Copper attachment to prion protein at a non-octarepeat site

NASA Astrophysics Data System (ADS)

Hodak, Miroslav; Bernholc, Jerry

2011-03-01

Prion protein (PrP) plays a causative role in a group of neurodegenerative diseases, which include ``mad cow disease'' or its human form variant Creutzfeld-Jacob disease. Normal function of PrP remains unknown, but it is now well established that PrP can efficiently bind copper ions and this ability has been linked to its function. The primary binding sites are located in the so-called octarepeat region located between residues 60-91. While these are by now well characterized, the sites located outside these region remain mostly undetermined. In this work, we investigate the properties of Cu binding site located at His 111 using recently developed hybrid Kohn-Sham/orbital-free density functional simulations. Experimental data indicate that copper is coordinated by either four nitrogens or three nitrogens and one oxygen. We investigate both possibilities, comparing their energetics and attachment geometries. Similarities and differences with other binding sites and implications for PrP function will also be discussed.

Engineering Copper Carboxylate Functionalities on Water Stable Metal–Organic Frameworks for Enhancement of Ammonia Removal Capacities

DOE Office of Scientific and Technical Information (OSTI.GOV)

Joshi, Jayraj N.; Garcia-Gutierrez, Erika Y.; Moran, Colton M.

Functionalization of copper carboxylate groups on a series of UiO-66 metal organic framework (MOF) analogues and their corresponding impact on humid and dry ammonia adsorption behavior were studied. Relative locations of possible carboxylic acid binding sites for copper on the MOF analogues were varied on ligand and missing linker defect sites. Materials after copper incorporation exhibited increased water vapor and ammonia affinity during isothermal adsorption and breakthrough experiments, respectively. The introduction of copper markedly increased ammonia adsorption capacities for all adsorbents possessing carboxyl binding sites. In particular, the new MOF UiO-66-(COOCu)2 displayed the highest ammonia breakthrough capacities of 6.38 andmore » 6.84 mmol g–1 under dry and humid conditions, respectively, while retaining crystallinity and porosity. Relative carboxylic acid site locations were also found to impact sorbent stability, as missing linker defect functionalized materials degraded under humid conditions after copper incorporation. Postsynthetic metal insertion provides a method for adding sites that are analogous to open metal sites while maintaining good structural stability.« less

Direct Measurement of the Nanomechanical Stability of a Redox Protein Active Site and Its Dependence upon Metal Binding.

PubMed

Giannotti, Marina I; Cabeza de Vaca, Israel; Artés, Juan M; Sanz, Fausto; Guallar, Victor; Gorostiza, Pau

2015-09-10

The structural basis of the low reorganization energy of cupredoxins has long been debated. These proteins reconcile a conformationally heterogeneous and exposed metal-chelating site with the highly rigid copper center required for efficient electron transfer. Here we combine single-molecule mechanical unfolding experiments with statistical analysis and computer simulations to show that the metal-binding region of apo-azurin is mechanically flexible and that high mechanical stability is imparted by copper binding. The unfolding pathway of the metal site depends on the pulling residue and suggests that partial unfolding of the metal-binding site could be facilitated by the physical interaction with certain regions of the redox protein.

Resolving distinct molecular origins for copper effects on PAI-1.

PubMed

Bucci, Joel C; McClintock, Carlee S; Chu, Yuzhuo; Ware, Gregory L; McConnell, Kayla D; Emerson, Joseph P; Peterson, Cynthia B

2017-10-01

Components of the fibrinolytic system are subjected to stringent control to maintain proper hemostasis. Central to this regulation is the serpin plasminogen activator inhibitor-1 (PAI-1), which is responsible for specific and rapid inhibition of fibrinolytic proteases. Active PAI-1 is inherently unstable and readily converts to a latent, inactive form. The binding of vitronectin and other ligands influences stability of active PAI-1. Our laboratory recently observed reciprocal effects on the stability of active PAI-1 in the presence of transition metals, such as copper, depending on the whether vitronectin was also present (Thompson et al. Protein Sci 20:353-365, 2011). To better understand the molecular basis for these copper effects on PAI-1, we have developed a gel-based copper sensitivity assay that can be used to assess the copper concentrations that accelerate the conversion of active PAI-1 to a latent form. The copper sensitivity of wild-type PAI-1 was compared with variants lacking N-terminal histidine residues hypothesized to be involved in copper binding. In these PAI-1 variants, we observed significant differences in copper sensitivity, and these data were corroborated by latency conversion kinetics and thermodynamics of copper binding by isothermal titration calorimetry. These studies identified a copper-binding site involving histidines at positions 2 and 3 that confers a remarkable stabilization of PAI-1 beyond what is observed with vitronectin alone. A second site, independent from the two histidines, binds metal and increases the rate of the latency conversion.

Copper-zinc-superoxide dismutase (CuZnSOD), an antioxidant gene from seahorse (Hippocampus abdominalis); molecular cloning, sequence characterization, antioxidant activity and potential peroxidation function of its recombinant protein.

PubMed

Perera, N C N; Godahewa, G I; Lee, Jehee

2016-10-01

Copper-zinc-superoxide dismutase (CuZnSOD) from Hippocampus abdominalis (HaCuZnSOD) is a metalloenzyme which belongs to the ubiquitous family of SODs. Here, we determined the characteristic structural features of HaCuZnSOD, analyzed its evolutionary relationships, and identified its potential immune responses and biological functions in relation to antioxidant defense mechanisms in the seahorse. The gene had a 5' untranslated region (UTR) of 67 bp, a coding sequence of 465 bp and a 3' UTR of 313 bp. The putative peptide consists of 154 amino acids. HaCuZnSOD had a predicted molecular mass of 15.94 kDa and a theoretical pI value of 5.73, which is favorable for copper binding activity. In silico analysis revealed that HaCuZnSOD had a prominent Cu-Zn_superoxide_dismutase domain, two Cu/Zn signature sequences, a putative N-glycosylation site, and several active sites including Cu(2+) and Zn(2+) binding sites. The three dimensional structure indicated a β-sheet barrel with 8 β-sheets and two short α-helical regions. Multiple alignment analyses revealed many conserved regions and active sites among its orthologs. The highest amino acid identity to HaCuZnSOD was found in Siniperca chuatsi (87.4%), while Maylandia zebra shared a close relationship in the phylogenetic analysis. Functional assays were performed to assess the antioxidant, biophysical and biochemical properties of overexpressed recombinant (r) HaCuZnSOD. A xanthine/XOD assay gave optimum results at pH 9 and 25 °C indicating these may be the best conditions for its antioxidant action in the seahorse. An MTT assay and flow cytometry confirmed that rHaCuZnSOD showed peroxidase activity in the presence of HCO3(-). In all the functional assays, the level of antioxidant activity of rHaCuZnSOD was concentration dependent; metal ion supplementation also increased its activity. The highest mRNA expressional level of HaCuZnSOD was found in blood. Temporal assessment under pathological stress showed a delay response by HaCuZnSOD. Our findings demonstrated that HaCuZnSOD is an important antioxidant, which might be involved in the host antioxidant defense mechanism against oxidative stress. Copyright © 2016 Elsevier Ltd. All rights reserved.

Structural analysis of the receptor binding domain of botulinum neurotoxin serotype D

DOE Office of Scientific and Technical Information (OSTI.GOV)

Zhang, Yanfeng; Buchko, Garry W.; Qin, Lin

2010-10-28

Botulinum neurotoxins (BoNTs) are the most toxic proteins known. The mechanism for entry into neuronal cells for serotypes A, B, E, F, and G involves a well understood dual receptor (protein and ganglioside) process, however, the mechanism of entry for serotypes C and D remains unclear. To provide structural insights into how BoNT/D enters neuronal cells, the crystal structure of the receptor binding domain (S863-E1276) for this serotype (BoNT/D-HCR) was determined at 1.65 Å resolution. While BoNT/D-HCR adopts an overall fold similar to that observed in other known BoNT HCRs, several major structural differences are present. These structural differences aremore » located at, or near, putative receptor binding sites and may be responsible for BoNT/D host preferences. Two loops, S1195-I1204 and K1236-N1244, located on both sides of the putative protein receptor binding pocket, are displaced >10 Å relative to the corresponding residues in the crystal structures of BoNT/B and G. Obvious clashes were observed in the putative protein receptor binding site when the BoNT/B protein receptor synaptotagmin II was modeled into the BoNT/D-HCR structure. Although a ganglioside binding site has never been unambiguously identified in BoNT/D-HCR, a shallow cavity in an analogous location to the other BoNT serotypes HCR domains is observed in BoNT/D-HCR that has features compatible with membrane binding. A portion of a loop near the putative receptor binding site, K1236-N1244, is hydrophobic and solvent-exposed and may directly bind membrane lipids. Liposome-binding experiments with BoNT/D-HCR demonstrate that this membrane lipid may be phosphatidylethanolamine.« less

Structural Analysis of the Receptor Binding Domain of Botulinum Neurotoxin Serotype D

DOE Office of Scientific and Technical Information (OSTI.GOV)

Y Zhang; G Buchko; L Qin

2011-12-31

Botulinum neurotoxins (BoNTs) are the most toxic proteins known. The mechanism for entry into neuronal cells for serotypes A, B, E, F, and G involves a well understood dual receptor (protein and ganglioside) process, however, the mechanism of entry for serotypes C and D remains unclear. To provide structural insights into how BoNT/D enters neuronal cells, the crystal structure of the receptor binding domain (S863-E1276) for this serotype (BoNT/D-HCR) was determined at 1.65{angstrom} resolution. While BoNT/D-HCR adopts an overall fold similar to that observed in other known BoNT HCRs, several major structural differences are present. These structural differences are locatedmore » at, or near, putative receptor binding sites and may be responsible for BoNT/D host preferences. Two loops, S1195-I1204 and K1236-N1244, located on both sides of the putative protein receptor binding pocket, are displaced >10{angstrom} relative to the corresponding residues in the crystal structures of BoNT/B and G. Obvious clashes were observed in the putative protein receptor binding site when the BoNT/B protein receptor synaptotagmin II was modeled into the BoNT/D-HCR structure. Although a ganglioside binding site has never been unambiguously identified in BoNT/D-HCR, a shallow cavity in an analogous location to the other BoNT serotypes HCR domains is observed in BoNT/D-HCR that has features compatible with membrane binding. A portion of a loop near the putative receptor binding site, K1236-N1244, is hydrophobic and solvent-exposed and may directly bind membrane lipids. Liposome-binding experiments with BoNT/D-HCR demonstrate that this membrane lipid may be phosphatidylethanolamine.« less

Elucidation of the Human Serum Albumin (HSA) Binding Site for the Cu-PTSM and Cu-ATSM Radiopharmaceuticals

PubMed Central

Basken, Nathan E.; Mathias, Carla J.; Green, Mark A.

2008-01-01

The Cu-PTSM (pyruvaldehyde bis(N4-methylthiosemicarbazonato)copper(II)) and Cu-ATSM (diacetyl bis(N4-methylthiosemicarbazonato)copper(II)) radiopharmaceuticals exhibit strong, species-dependent binding to human serum albumin (HSA), while Cu-ETS (ethylglyoxal bis(thiosemicarbazonato)copper(II)) appears to only exhibit non-specific binding to human and animal serum albumins. This study examines the structural basis for HSA binding of Cu-PTSM and Cu-ATSM via competition with drugs having known albumin binding sites. Warfarin, furosemide, ibuprofen, phenylbutazone, benzylpenicillin, and cephmandole were added to HSA solutions at drug:HSA mole ratios from 0 to 8:1, followed by quantification of radiopharmaceutical binding to HSA by ultrafiltration. Warfarin, a site IIA drug, progressively displaced both [64Cu]Cu-PTSM and [64Cu]Cu-ATSM from HSA. At 8:1 warfarin:HSA mole ratios, free [64Cu]Cu-PTSM and [64Cu]Cu-ATSM levels increased 300–500%. This was in contrast to solutions containing ibuprofen, a site IIIA drug; no increase in free [64Cu]Cu-PTSM or [64Cu]Cu-ATSM was observed except at high ibuprofen:HSA ratios, where secondary ibuprofen binding to the IIA site may cause modest radiopharmaceutical displacement. By contrast, and consistent with earlier findings suggesting Cu-ETS exhibits only non-specific associations, [64Cu]Cu-ETS binding to HSA was unaffected by the addition of drugs that bind in either site. We conclude that the species-dependence of Cu-PTSM and Cu-ATSM albumin binding arises from interaction(s) with the IIA site of HSA. PMID:18937368

Proton and metal ion binding to natural organic polyelectrolytes-II. Preliminary investigation with a peat and a humic acid

USGS Publications Warehouse

Marinsky, J.A.; Reddy, M.M.

1984-01-01

We summarize here experimental studies of proton and metal ion binding to a peat and a humic acid. Data analysis is based on a unified physico-chemical model for reaction of simple ions with polyelectrolytes employing a modified Henderson-Hasselbalch equation. Peat exhibited an apparent intrinsic acid dissociation constant of 10-4.05, and an apparent intrinsic metal ion binding constant of: 400 for cadmium ion; 600 for zinc ion; 4000 for copper ion; 20000 for lead ion. A humic acid was found to have an apparent intrinsic proton binding constant of 10-2.6. Copper ion binding to this humic acid sample occurred at two types of sites. The first site exhibited reaction characteristics which were independent of solution pH and required the interaction of two ligands on the humic acid matrix to simultaneously complex with each copper ion. The second complex species is assumed to be a simple monodentate copper ion-carboxylate species with a stability constant of 18. ?? 1984.

Copper speciation and binding by organic matter in copper-contaminated streamwater

USGS Publications Warehouse

Breault, R.F.; Colman, J.A.; Aiken, G.R.; McKnight, D.

1996-01-01

Fulvic acid binding sites (1.3-70 ??M) and EDTA (0.0017-0.18 ??M) accounted for organically bound Cu in seven stream samples measured by potentiometric titration. Cu was 84-99% organically bound in filtrates with 200 nM total Cu. Binding of Cu by EDTA was limited by competition from other trace metals. Water hardness was inversely related to properties of dissolved organic carbon (DOC) that enhance fulvic acid binding: DOC concentration, percentage of DOC that is fulvic acid, and binding sites per fulvic acid carbon. Dissolved trace metals, stabilized by organic binding, occurred at increased concentration in soft water as compared to hard water.

Identification of Interactions between Abscisic Acid and Ribulose-1,5-Bisphosphate Carboxylase/Oxygenase

PubMed Central

Galka, Marek M.; Rajagopalan, Nandhakishore; Buhrow, Leann M.; Nelson, Ken M.; Switala, Jacek; Cutler, Adrian J.; Palmer, David R. J.; Loewen, Peter C.; Abrams, Suzanne R.; Loewen, Michele C.

2015-01-01

Abscisic acid ((+)-ABA) is a phytohormone involved in the modulation of developmental processes and stress responses in plants. A chemical proteomics approach using an ABA mimetic probe was combined with in vitro assays, isothermal titration calorimetry (ITC), x-ray crystallography and in silico modelling to identify putative (+)-ABA binding-proteins in crude extracts of Arabidopsis thaliana. Ribulose-1,5-bisphosphate carboxylase/oxygenase (Rubisco) was identified as a putative ABA-binding protein. Radiolabelled-binding assays yielded a Kd of 47 nM for (+)-ABA binding to spinach Rubisco, which was validated by ITC, and found to be similar to reported and experimentally derived values for the native ribulose-1,5-bisphosphate (RuBP) substrate. Functionally, (+)-ABA caused only weak inhibition of Rubisco catalytic activity (Ki of 2.1 mM), but more potent inhibition of Rubisco activation (Ki of ~ 130 μM). Comparative structural analysis of Rubisco in the presence of (+)-ABA with RuBP in the active site revealed only a putative low occupancy (+)-ABA binding site on the surface of the large subunit at a location distal from the active site. However, subtle distortions in electron density in the binding pocket and in silico docking support the possibility of a higher affinity (+)-ABA binding site in the RuBP binding pocket. Overall we conclude that (+)-ABA interacts with Rubisco. While the low occupancy (+)-ABA binding site and weak non-competitive inhibition of catalysis may not be relevant, the high affinity site may allow ABA to act as a negative effector of Rubisco activation. PMID:26197050

Identification of Interactions between Abscisic Acid and Ribulose-1,5-Bisphosphate Carboxylase/Oxygenase.

PubMed

Galka, Marek M; Rajagopalan, Nandhakishore; Buhrow, Leann M; Nelson, Ken M; Switala, Jacek; Cutler, Adrian J; Palmer, David R J; Loewen, Peter C; Abrams, Suzanne R; Loewen, Michele C

2015-01-01

Abscisic acid ((+)-ABA) is a phytohormone involved in the modulation of developmental processes and stress responses in plants. A chemical proteomics approach using an ABA mimetic probe was combined with in vitro assays, isothermal titration calorimetry (ITC), x-ray crystallography and in silico modelling to identify putative (+)-ABA binding-proteins in crude extracts of Arabidopsis thaliana. Ribulose-1,5-bisphosphate carboxylase/oxygenase (Rubisco) was identified as a putative ABA-binding protein. Radiolabelled-binding assays yielded a Kd of 47 nM for (+)-ABA binding to spinach Rubisco, which was validated by ITC, and found to be similar to reported and experimentally derived values for the native ribulose-1,5-bisphosphate (RuBP) substrate. Functionally, (+)-ABA caused only weak inhibition of Rubisco catalytic activity (Ki of 2.1 mM), but more potent inhibition of Rubisco activation (Ki of ~ 130 μM). Comparative structural analysis of Rubisco in the presence of (+)-ABA with RuBP in the active site revealed only a putative low occupancy (+)-ABA binding site on the surface of the large subunit at a location distal from the active site. However, subtle distortions in electron density in the binding pocket and in silico docking support the possibility of a higher affinity (+)-ABA binding site in the RuBP binding pocket. Overall we conclude that (+)-ABA interacts with Rubisco. While the low occupancy (+)-ABA binding site and weak non-competitive inhibition of catalysis may not be relevant, the high affinity site may allow ABA to act as a negative effector of Rubisco activation.

Combined copper/zinc attachment to prion protein

NASA Astrophysics Data System (ADS)

Hodak, Miroslav; Bernholc, Jerry

2013-03-01

Misfolding of prion protein (PrP) is responsible for diseases such as ``mad-cow disease'' in cattle and Creutzfeldt-Jacob in humans. Extensive experimental investigation has established that this protein strongly interacts with copper ions, and this ability has been linked to its still unknown function. Attachment of other metal ions (zinc, iron, manganese) have been demonstrated as well, but none of them could outcompete copper. Recent finding, however, indicates that at intermediate concentrations both copper and zinc ions can attach to the PrP at the octarepeat region, which contains high affinity metal binding sites. Based on this evidence, we have performed density functional theory simulations to investigate the combined Cu/Zn attachment. We consider all previously reported binding modes of copper at the octarepeat region and examine a possibility simultaneous Cu/Zn attachment. We find that this can indeed occur for only one of the known binding sites, when copper changes its coordination mode to allow for attachment of zinc ion. The implications of the simultaneous attachment on neural function remain to be explored.

Absence of specific binding of several putative neuro-transmitters to human fibroblasts.

PubMed

Berrettini, W H; Nadi, N S; Gershon, E S

1983-01-01

Fibroblasts were examined for specific binding sites of ten putative neurotransmitters to determine whether this tissue could be used in receptor studies of neurologic and psychiatric disorders. Stereospecific saturable binding was not found for any of the ligands: arginine vasopressin, neurotensin, somatostatin, angiotensin II, thyrotropin-releasing hormone (TRH), alpha-bungarotoxin, LSD, dihydromorphine, muscimol and spiperone.

An Expanding Range of Functions for the Copper Chaperone/Antioxidant Protein Atox1

PubMed Central

Hatori, Yuta

2013-01-01

Abstract Significance: Antioxidant protein 1 (Atox1 in human cells) is a copper chaperone for the copper export pathway with an essential role in cellular copper distribution. In vitro, Atox1 binds and transfers copper to the copper-transporting ATPases, stimulating their catalytic activity. Inactivation of Atox1 in cells inhibits maturation of secreted cuproenzymes as well as copper export from cells. Recent Advances: Accumulating data suggest that cellular functions of Atox1 are not limited to its copper-trafficking role and may include storage of labile copper, modulation of transcription, and antioxidant defense. The conserved metal binding site of Atox1, CxGC, differs from the metal-binding sites of copper-transporting ATPases and has a physiologically relevant redox potential that equilibrates with the GSH:GSSG pair. Critical Issues: Tight relationship appears to exist between intracellular copper levels and glutathione (GSH) homeostasis. The biochemical properties of Atox1 place it at the intersection of cellular networks that regulate copper distribution and cellular redox balance. Mechanisms through which Atox1 facilitates copper export and contributes to oxidative defense are not fully understood. Future Directions: The current picture of cellular redox homeostasis and copper physiology will be enhanced by further mechanistic studies of functional interactions between the GSH:GSSG pair and copper-trafficking machinery. Antioxid. Redox Signal. 19, 945–957. PMID:23249252

Putative melatonin receptors in a human biological clock

DOE Office of Scientific and Technical Information (OSTI.GOV)

Reppert, S.M.; Weaver, D.R.; Rivkees, S.A.

In vitro autoradiography with /sup 125/I-labeled melatonin was used to examine melatonin binding sites in human hypothalamus. Specific /sup 125/I-labeled melatonin binding was localized to the suprachiasmatic nuclei, the site of a putative biological clock, and was not apparent in other hypothalamic regions. Specific /sup 125/I-labeled melatonin binding was consistently found in the suprachiasmatic nuclei of hypothalami from adults and fetuses. Densitometric analysis of competition experiments with varying concentrations of melatonin showed monophasic competition curves, with comparable half-maximal inhibition values for the suprachiasmatic nuclei of adults (150 picomolar) and fetuses (110 picomolar). Micromolar concentrations of the melatonin agonist 6-chloromelatonin completelymore » inhibited specific /sup 125/I-labeled melatonin binding, whereas the same concentrations of serotonin and norepinephrine caused only a partial reduction in specific binding. The results suggest that putative melatonin receptors are located in a human biological clock.« less

Discrimination of putative M1 and M2 muscarinic receptor subtypes in rat brain by N-ethoxycarbonyl-2-ethoxy-1,2-dihydroquinoline (EEDQ)

DOE Office of Scientific and Technical Information (OSTI.GOV)

Norman, A.B.; Creese, I.

1986-03-01

The EC/sub 50/ of EEDQ for the inhibition of (/sup 3/H)(-)QNB binding in vitro was approximately 3 fold lower for homogenates of hippocampus than brainstem (containing predominantly putative M/sub 1/ and M/sub 2/ muscarinic receptor subtypes respectively). Furthermore, the time-dependent loss of (/sup 3/H)(-)QNB binding produced by 100 ..mu..M EEDQ was faster in homogenates of hippocampus than brainstem. Administration of EEDQ (20 mg/kg i.p.) irreversibly reduced the Bmax of (/sup 3/H)(-)QNB binding by 56% and 34% in hippocampus and brainstem respectively. Pirenzepine competition for the remaining (/sup 3/H)(-)QNB binding sites following in vitro and in vivo treatment with EEDQ revealedmore » a significant increase in the proportion of (/sup 3/H)(-)QNB binding sites having low affinity for pirenzepine (M/sub 2/ receptors), indicating that the high affinity pirenzepine binding sites (M/sub 1/ receptors) were selectively and irreversibly lost. Thus, EEDQ discriminates the same putative M/sub 1/ and M/sub 2/ muscarinic receptor subtypes that are discriminated by pirenzepine. The reduction of (/sup 3/H)(-)QNB binding could be prevented both in vitro and in vivo by atropine or scopolamine. These data may indicate differences in the accessibility of these putative receptor subtypes to EEDQ or, alternatively, differences in the availability of carboxyl groups able to interact with EEDQ at the ligand recognition site of M/sub 1/ and M/sub 2/ muscarinic receptors.« less

Characterization of calcineurin-dependent response element binding protein and its involvement in copper-metallothionein gene expression in Neurospora

DOE Office of Scientific and Technical Information (OSTI.GOV)

Kumar, Kalari Satish; Ravi Kumar, B.; Siddavattam, Dayananda

2006-07-07

In continuation of our recent observations indicating the presence of a lone calcineurin-dependent response element (CDRE) in the -3730 bp upstream region of copper-induced metallothionein (CuMT) gene of Neurospora [K.S. Kumar, S. Dayananda, C. Subramanyam, Copper alone, but not oxidative stress, induces copper-metallothionein gene in Neurospora crassa, FEMS Microbiol. Lett. 242 (2005) 45-50], we isolated and characterized the CDRE-binding protein. The cloned upstream region of CuMT gene was used as the template to specifically amplify CDRE element, which was immobilized on CNBr-activated Sepharose 4B for use as the affinity matrix to purify the CDRE binding protein from nuclear extracts obtainedmore » from Neurospora cultures grown in presence of copper. Two-dimensional gel electrophoresis of the affinity purified protein revealed the presence of a single 17 kDa protein, which was identified and characterized by MALDI-TOF. Peptide mass finger printing of tryptic digests and analysis of the 17 kDa protein matched with the regulatory {beta}-subunit of calcineurin (Ca{sup 2+}-calmodulin dependent protein phosphatase). Parallel identification of nuclear localization signals in this protein by in silico analysis suggests a putative role for calcineurin in the regulation of CuMT gene expression.« less

Copper and the oxidation of hemoglobin: a comparison of horse and human hemoglobins.

PubMed

Rifkind, J M; Lauer, L D; Chiang, S C; Li, N C

1976-11-30

Oxidation studies of hemoglobin by Cu(II) indicate that for horse hemoglobin, up to a Cu(II)/heme molar ratio of 0.5, all of the Cu(II) added is used to rapidly oxidize the heme. On the other hand, most of the Cu(II) added to human hemoglobin at low Cu(II)/heme molar ratios is unable to oxidize the heme. Only at Cu(II)/heme molar ratios greater than 0.5 does the amount of oxidation per added Cu(II) approach that of horse hemoglobin. At the same time, binding studies indicate that human hemoglobin has an additional binding site involving one copper for every two hemes, which has a higher copper affinity than the single horse hemoglobin binding site. The Cu(II) oxidation of human hemoglobin is explained utilizing this additional binding site by a mechanism where a transfer of electrons cannot occur between the heme and the Cu(II) bound to the high affinity human binding site. The electron transfer must involve the Cu(II) bound to the lower affinity human hemoglobin binding site, which is similar to the only horse hemoglobin site. The involvement of beta-2 histidine in the binding of this additional copper is indicated by a comparison of the amino acid sequences of various hemoglobins which possess the additional site, with the amino acid sequences of hemoglobins which do not possess the additional site. Zn(II), Hg(II), and N-ethylmaleimide (NEM) are found to decrease the Cu(II) oxidation of hemoglobin. The sulfhydryl reagents, Hg(II) and NEM, produce a very dramatic decrease in the rate of oxidation, which can only be explained by an effect on the rate for the actual transfer of electrons between the Cu(II) and the Fe(II). The effect of Zn(II) is much smaller and can, for the most part, be explained by the increased oxygen affinity, which affects the ligand dissociation process that must precede the electron transfer process.

Testing the Underlying Chemical Principles of the Biotic Ligand Model (BLM) to Marine Copper Systems: Measuring Copper Speciation Using Fluorescence Quenching.

PubMed

Tait, Tara N; McGeer, James C; Smith, D Scott

2018-01-01

Speciation of copper in marine systems strongly influences the ability of copper to cause toxicity. Natural organic matter (NOM) contains many binding sites which provides a protective effect on copper toxicity. The purpose of this study was to characterize copper binding with NOM using fluorescence quenching techniques. Fluorescence quenching of NOM with copper was performed on nine sea water samples. The resulting stability constants and binding capacities were consistent with literature values of marine NOM, showing strong binding with [Formula: see text] values from 7.64 to 10.2 and binding capacities ranging from 15 to 3110 nmol mg [Formula: see text] Free copper concentrations estimated at total dissolved copper concentrations corresponding to previously published rotifer effect concentrations, in the same nine samples, were statistically the same as the range of free copper calculated for the effect concentration in NOM-free artificial seawater. These data confirms the applicability of fluorescence spectroscopy techniques for NOM and copper speciation characterization in sea water and demonstrates that such measured speciation is consistent with the chemical principles underlying the biotic ligand model approach for bioavailability-based metals risk assessment.

3D local structure around copper site of rabbit prion-related protein: Quantitative determination by XANES spectroscopy combined with multiple-scattering calculations

NASA Astrophysics Data System (ADS)

Cui, P. X.; Lian, F. L.; Wang, Y.; Wen, Yi; Chu, W. S.; Zhao, H. F.; Zhang, S.; Li, J.; Lin, D. H.; Wu, Z. Y.

2014-02-01

Prion-related protein (PrP), a cell-surface copper-binding glycoprotein, is considered to be responsible for a number of transmissible spongiform encephalopathies (TSEs). The structural conversion of PrP from the normal cellular isoform (PrPC) to the post-translationally modified form (PrPSc) is thought to be relevant to Cu2+ binding to histidine residues. Rabbits are one of the few mammalian species that appear to be resistant to TSEs, because of the structural characteristics of the rabbit prion protein (RaPrPC) itself. Here we determined the three-dimensional local structure around the C-terminal high-affinity copper-binding sites using X-ray absorption near-edge structure combined with ab initio calculations in the framework of the multiple-scattering (MS) theory. Result shows that two amino acid resides, Gln97 and Met108, and two histidine residues, His95 and His110, are involved in binding this copper(II) ion. It might help us understand the roles of copper in prion conformation conversions, and the molecular mechanisms of prion-involved diseases.

Metal Dyshomeostasis and Inflammation in Alzheimer's and Parkinson's Diseases: Possible Impact of Environmental Exposures

PubMed Central

Myhre, Oddvar; Utkilen, Hans; Duale, Nur; Brunborg, Gunnar; Hofer, Tim

2013-01-01

A dysregulated metal homeostasis is associated with both Alzheimer's (AD) and Parkinson's (PD) diseases; AD patients have decreased cortex and elevated serum copper levels along with extracellular amyloid-beta plaques containing copper, iron, and zinc. For AD, a putative hepcidin-mediated lowering of cortex copper mechanism is suggested. An age-related mild chronic inflammation and/or elevated intracellular iron can trigger hepcidin production followed by its binding to ferroportin which is the only neuronal iron exporter, thereby subjecting it to lysosomal degradation. Subsequently raised neuronal iron levels can induce translation of the ferroportin assisting and copper binding amyloid precursor protein (APP); constitutive APP transmembrane passage lowers the copper pool which is important for many enzymes. Using in silico gene expression analyses, we here show significantly decreased expression of copper-dependent enzymes in AD brain and metallothioneins were upregulated in both diseases. Although few AD exposure risk factors are known, AD-related tauopathies can result from cyanobacterial microcystin and β-methylamino-L-alanine (BMAA) intake. Several environmental exposures may represent risk factors for PD; for this disease neurodegeneration is likely to involve mitochondrial dysfunction, microglial activation, and neuroinflammation. Administration of metal chelators and anti-inflammatory agents could affect disease outcomes. PMID:23710288

Control of copper resistance and inorganic sulfur metabolism by paralogous regulators in Staphylococcus aureus.

PubMed

Grossoehme, Nicholas; Kehl-Fie, Thomas E; Ma, Zhen; Adams, Keith W; Cowart, Darin M; Scott, Robert A; Skaar, Eric P; Giedroc, David P

2011-04-15

All strains of Staphylococcus aureus encode a putative copper-sensitive operon repressor (CsoR) and one other CsoR-like protein of unknown function. We show here that NWMN_1991 encodes a bona fide Cu(I)-inducible CsoR of a genetically unlinked copA-copZ copper resistance operon in S. aureus strain Newman. In contrast, an unannotated open reading frame found between NWMN_0027 and NWMN_0026 (denoted NWMN_0026.5) encodes a CsoR-like regulator that represses expression of adjacent genes by binding specifically to a pair of canonical operator sites positioned in the NWMN_0027-0026.5 intergenic region. Inspection of these regulated genes suggests a role in assimilation of inorganic sulfur from thiosulfate and vectorial sulfur transfer, and we designate NWMN_0026.5 as CstR (CsoR-like sulfur transferase repressor). Expression analysis demonstrates that CsoR and CstR control their respective regulons in response to distinct stimuli with no overlap in vivo. Unlike CsoR, CstR does not form a stable complex with Cu(I); operator binding is instead inhibited by oxidation of the intersubunit cysteine pair to a mixture of disulfide and trisulfide linkages by a likely metabolite of thiosulfate assimilation, sulfite. CsoR is unreactive toward sulfite under the same conditions. We conclude that CsoR and CstR are paralogs in S. aureus that function in the same cytoplasm to control distinct physiological processes.

Control of Copper Resistance and Inorganic Sulfur Metabolism by Paralogous Regulators in Staphylococcus aureus*

PubMed Central

Grossoehme, Nicholas; Kehl-Fie, Thomas E.; Ma, Zhen; Adams, Keith W.; Cowart, Darin M.; Scott, Robert A.; Skaar, Eric P.; Giedroc, David P.

2011-01-01

All strains of Staphylococcus aureus encode a putative copper-sensitive operon repressor (CsoR) and one other CsoR-like protein of unknown function. We show here that NWMN_1991 encodes a bona fide Cu(I)-inducible CsoR of a genetically unlinked copA-copZ copper resistance operon in S. aureus strain Newman. In contrast, an unannotated open reading frame found between NWMN_0027 and NWMN_0026 (denoted NWMN_0026.5) encodes a CsoR-like regulator that represses expression of adjacent genes by binding specifically to a pair of canonical operator sites positioned in the NWMN_0027–0026.5 intergenic region. Inspection of these regulated genes suggests a role in assimilation of inorganic sulfur from thiosulfate and vectorial sulfur transfer, and we designate NWMN_0026.5 as CstR (CsoR-like sulfur transferase repressor). Expression analysis demonstrates that CsoR and CstR control their respective regulons in response to distinct stimuli with no overlap in vivo. Unlike CsoR, CstR does not form a stable complex with Cu(I); operator binding is instead inhibited by oxidation of the intersubunit cysteine pair to a mixture of disulfide and trisulfide linkages by a likely metabolite of thiosulfate assimilation, sulfite. CsoR is unreactive toward sulfite under the same conditions. We conclude that CsoR and CstR are paralogs in S. aureus that function in the same cytoplasm to control distinct physiological processes. PMID:21339296

Pharmacophore screening of the protein data bank for specific binding site chemistry.

PubMed

Campagna-Slater, Valérie; Arrowsmith, Andrew G; Zhao, Yong; Schapira, Matthieu

2010-03-22

A simple computational approach was developed to screen the Protein Data Bank (PDB) for putative pockets possessing a specific binding site chemistry and geometry. The method employs two commonly used 3D screening technologies, namely identification of cavities in protein structures and pharmacophore screening of chemical libraries. For each protein structure, a pocket finding algorithm is used to extract potential binding sites containing the correct types of residues, which are then stored in a large SDF-formatted virtual library; pharmacophore filters describing the desired binding site chemistry and geometry are then applied to screen this virtual library and identify pockets matching the specified structural chemistry. As an example, this approach was used to screen all human protein structures in the PDB and identify sites having chemistry similar to that of known methyl-lysine binding domains that recognize chromatin methylation marks. The selected genes include known readers of the histone code as well as novel binding pockets that may be involved in epigenetic signaling. Putative allosteric sites were identified on the structures of TP53BP1, L3MBTL3, CHEK1, KDM4A, and CREBBP.

Pirenzepine binding to membrane-bound, solubilized and purified muscarinic receptor subtypes

DOE Office of Scientific and Technical Information (OSTI.GOV)

Baumgold, J.

1986-05-01

Muscarinic receptors were purified to near-homogeneity from bovine cortex, an area rich in the putative M1 subtype, and from bovine pons/medulla, an area rich in the putative M2 subtype. In both cases, the receptors were solubilized in digitonin and purified over an affinity column. Both the cortical and pons/medulla preparations yielded receptor proteins of 70,000 daltons. Pirenzepine binding was deduced from its competition with /sup 3/H-N-methyl scopolamine. The binding of pirenzepine to membrane-bound receptors from cortex was best described by a two site model, with approximately half the sites having a Ki of 6.4 x 10/sup -9/ M and themore » remaining sites having a Ki of 3.5 x 10/sup -7/ M. Membrane-bound receptors from pons/medulla bound pirenzepine according to a one-site model with a Ki of 1.1 x 10/sup -7/ M. After solubilization the two-site binding of cortical receptors became a one-site binding, Ki = 1.1 x 10/sup -7/M. This value was still five-fold lower than that of soluble receptors from pons/medulla. After purification however the affinity of pirenzepine for the pons/medulla receptor increased so that the two putative subtypes bound pirenzepine with approximately the same affinity. These findings suggest that the different pirenzepine binding characteristics used to define muscarinic receptor subtypes are not inherent in the receptor protein itself but may be due to coupling factors associated with the receptor.« less

The Phylogeny and Active Site Design of Eukaryotic Copper-only Superoxide Dismutases*

PubMed Central

Peterson, Ryan L.; Galaleldeen, Ahmad; Villarreal, Johanna; Taylor, Alexander B.; Cabelli, Diane E.; Hart, P. John; Culotta, Valeria C.

2016-01-01

In eukaryotes the bimetallic Cu/Zn superoxide dismutase (SOD) enzymes play important roles in the biology of reactive oxygen species by disproportionating superoxide anion. Recently, we reported that the fungal pathogen Candida albicans expresses a novel copper-only SOD, known as SOD5, that lacks the zinc cofactor and electrostatic loop (ESL) domain of Cu/Zn-SODs for substrate guidance. Despite these abnormalities, C. albicans SOD5 can disproportionate superoxide at rates limited only by diffusion. Here we demonstrate that this curious copper-only SOD occurs throughout the fungal kingdom as well as in phylogenetically distant oomycetes or “pseudofungi” species. It is the only form of extracellular SOD in fungi and oomycetes, in stark contrast to the extracellular Cu/Zn-SODs of plants and animals. Through structural biology and biochemical approaches we demonstrate that these copper-only SODs have evolved with a specialized active site consisting of two highly conserved residues equivalent to SOD5 Glu-110 and Asp-113. The equivalent positions are zinc binding ligands in Cu/Zn-SODs and have evolved in copper-only SODs to control catalysis and copper binding in lieu of zinc and the ESL. Similar to the zinc ion in Cu/Zn-SODs, SOD5 Glu-110 helps orient a key copper-coordinating histidine and extends the pH range of enzyme catalysis. SOD5 Asp-113 connects to the active site in a manner similar to that of the ESL in Cu/Zn-SODs and assists in copper cofactor binding. Copper-only SODs are virulence factors for certain fungal pathogens; thus this unique active site may be a target for future anti-fungal strategies. PMID:27535222

The Phylogeny and Active Site Design of Eukaryotic Copper-only Superoxide Dismutases

DOE PAGES

Peterson, Ryan L.; Galaleldeen, Ahmad; Villarreal, Johanna; ...

2016-08-17

In eukaryotes the bimetallic Cu/Zn superoxide dismutase (SOD) enzymes play important roles in the biology of reactive oxygen species by disproportionating superoxide anion. We reported that the fungal pathogen Candida albicans expresses a novel copper-only SOD, known as SOD5, that lacks the zinc cofactor and electrostatic loop (ESL) domain of Cu/Zn-SODs for substrate guidance. In spite of these abnormalities, C. albicans SOD5 can disproportionate superoxide at rates limited only by diffusion. Here we demonstrate that this curious copper-only SOD occurs throughout the fungal kingdom as well as in phylogenetically distant oomycetes or “pseudofungi” species. It is the only form ofmore » extracellular SOD in fungi and oomycetes, in stark contrast to the extracellular Cu/Zn-SODs of plants and animals. Through structural biology and biochemical approaches we demonstrate that these copper-only SODs have evolved with a specialized active site consisting of two highly conserved residues equivalent to SOD5 Glu-110 and Asp-113. The equivalent positions are zinc binding ligands in Cu/Zn-SODs and have evolved in copper-only SODs to control catalysis and copper binding in lieu of zinc and the ESL. Similar to the zinc ion in Cu/Zn-SODs, SOD5 Glu-110 helps orient a key copper-coordinating histidine and extends the pH range of enzyme catalysis. Furthermore, SOD5 Asp-113 connects to the active site in a manner similar to that of the ESL in Cu/Zn-SODs and assists in copper cofactor binding. Copper-only SODs are virulence factors for certain fungal pathogens; thus this unique active site may be a target for future anti-fungal strategies.« less

The interaction of escitalopram and R-citalopram at the human serotonin transporter investigated in the mouse.

PubMed

Jacobsen, Jacob P R; Plenge, Per; Sachs, Benjamin D; Pehrson, Alan L; Cajina, Manuel; Du, Yunzhi; Roberts, Wendy; Rudder, Meghan L; Dalvi, Prachiti; Robinson, Taylor J; O'Neill, Sharon P; Khoo, King S; Morillo, Connie Sanchez; Zhang, Xiaodong; Caron, Marc G

2014-12-01

Escitalopram appears to be a superior antidepressant to racemic citalopram. It has been hypothesized that binding of R-citalopram to the serotonin transporter (SERT) antagonizes escitalopram binding to and inhibition of the SERT, there by curtailing the elevation of extracellular 5-hydroxytryptamine (5-HTExt), and hence anti-depressant efficacy. Further, it has been suggested that a putative allosteric binding site is important for binding of escitalopram to the primary, orthosteric, site, and for R-citalopram's inhibition here of. Primary: Investigate at the human (h)SERT, at clinical relevant doses, whether R-citalopram antagonizes escitalopram-induced 5-HTExt elevation. Secondary: Investigate whether abolishing the putative allosteric site affects escitalopram-induced 5-HTExt elevation and/or modulates the effect of R-citalopram. Recombinant generation of hSERT transgenic mice; in vivo microdialysis; SERT binding; pharmacokinetics; 5-HT sensitive behaviors (tail suspension, marble burying). We generated mice expressing either the wild-type human SERT (hSERT(WT)) or hSERT carrying amino acid substitutions (A505V, L506F, I507L, S574T and I575T) collectively abolishing the putative allosteric site (hSERT(ALI/VFL+SI/TT)). One mg/kg escitalopram yielded clinical relevant plasma levels and brain levels consistent with therapeutic SERT occupancy. The hSERT mice showed normal basal 5-HTExt levels. Escitalopram-induced 5-HTExt elevation was not decreased by R-citalopram co-treatment and was unaffected by loss of the allosteric site. The behavioral effects of the clinically relevant escitalopram dose were small and tended to be enhanced by R-citalopram co-administration. We find no evidence that R-citalopram directly antagonizes escitalopram or that the putative allosteric site is important for hSERT inhibition by escitalopram.

MONKEY: Identifying conserved transcription-factor binding sitesin multiple alignments using a binding site-specific evolutionarymodel

DOE Office of Scientific and Technical Information (OSTI.GOV)

Moses, Alan M.; Chiang, Derek Y.; Pollard, Daniel A.

2004-10-28

We introduce a method (MONKEY) to identify conserved transcription-factor binding sites in multispecies alignments. MONKEY employs probabilistic models of factor specificity and binding site evolution, on which basis we compute the likelihood that putative sites are conserved and assign statistical significance to each hit. Using genomes from the genus Saccharomyces, we illustrate how the significance of real sites increases with evolutionary distance and explore the relationship between conservation and function.

Characterization of Cu(II)-reconstituted ACC Oxidase using experimental and theoretical approaches.

PubMed

El Bakkali-Tahéri, Nadia; Tachon, Sybille; Orio, Maylis; Bertaina, Sylvain; Martinho, Marlène; Robert, Viviane; Réglier, Marius; Tron, Thierry; Dorlet, Pierre; Simaan, A Jalila

2017-06-01

1-Aminocyclopropane-1-carboxylic acid oxidase (ACCO) is a non heme iron(II) containing enzyme that catalyzes the final step of the ethylene biosynthesis in plants. The iron(II) ion is bound in a facial triad composed of two histidines and one aspartate (H177, D179 and H234). Several active site variants were generated to provide alternate binding motifs and the enzymes were reconstituted with copper(II). Continuous wave (cw) and pulsed Electron Paramagnetic Resonance (EPR) spectroscopies as well as Density Functional Theory (DFT) calculations were performed and models for the copper(II) binding sites were deduced. In all investigated enzymes, the copper ion is equatorially coordinated by the two histidine residues (H177 and H234) and probably two water molecules. The copper-containing enzymes are inactive, even when hydrogen peroxide is used in peroxide shunt approach. EPR experiments and DFT calculations were undertaken to investigate substrate's (ACC) binding on the copper ion and the results were used to rationalize the lack of copper-mediated activity. Copyright © 2017 Elsevier Inc. All rights reserved.

Conformational and thermodynamic hallmarks of DNA operator site specificity in the copper sensitive operon repressor from Streptomyces lividans

PubMed Central

Tan, Benedict G.; Vijgenboom, Erik; Worrall, Jonathan A. R.

2014-01-01

Metal ion homeostasis in bacteria relies on metalloregulatory proteins to upregulate metal resistance genes and enable the organism to preclude metal toxicity. The copper sensitive operon repressor (CsoR) family is widely distributed in bacteria and controls the expression of copper efflux systems. CsoR operator sites consist of G-tract containing pseudopalindromes of which the mechanism of operator binding is poorly understood. Here, we use a structurally characterized CsoR from Streptomyces lividans (CsoRSl) together with three specific operator targets to reveal the salient features pertaining to the mechanism of DNA binding. We reveal that CsoRSl binds to its operator site through a 2-fold axis of symmetry centred on a conserved 5′-TAC/GTA-3′ inverted repeat. Operator recognition is stringently dependent not only on electropositive residues but also on a conserved polar glutamine residue. Thermodynamic and circular dichroic signatures of the CsoRSl–DNA interaction suggest selectivity towards the A-DNA-like topology of the G-tracts at the operator site. Such properties are enhanced on protein binding thus enabling the symmetrical binding of two CsoRSl tetramers. Finally, differential binding modes may exist in operator sites having more than one 5′-TAC/GTA-3′ inverted repeat with implications in vivo for a mechanism of modular control. PMID:24121681

The interaction of escitalopram and R-citalopram at the human serotonin transporter investigated in the mouse

PubMed Central

Jacobsen, Jacob P.R.; Plenge, Per; Sachs, Benjamin D.; Pehrson, Alan L.; Cajina, Manuel; Du, Yunzhi; Roberts, Wendy; Rudder, Meghan L.; Dalvi, Prachiti; Robinson, Taylor J.; O’Neill, Sharon P.; Khoo, King S.; Morillo, Connie Sanchez; Zhang, Xiaodong; Caron, Marc G.

2015-01-01

Rationale Escitalopram is a superior antidepressant to racemic citalopram. It has been hypothesized that binding of R-citalopram to the serotonin transporter (SERT) antagonizes escitalopram binding to and inhibition of the SERT, curtailing the elevation of extracellular 5-hydroxytryptamine (5-HTExt), and antidepressant efficacy. Further, it has been suggested that a putative allosteric binding site is important for binding of escitalopram to the primary, orthosteric, site, and for R-citalopram’s inhibition hereof. Objectives Primary: Investigate at the human (h)SERT, at clinical relevant doses, whether R-citalopram antagonizes escitalopram-induced 5-HTExt elevation. Secondary: Investigate whether abolishing the putative allosteric site affects escitalopram-induced 5-HTExt elevation and/or modulates the effect of R-citalopram. Methods Recombinant technology; in vivo microdialysis; receptor binding; pharmacokinetics; 5-HT sensitive behaviors (tail suspension, marble burying). Results We generated mice expressing either the wild-type human SERT (hSERTWT) or hSERT carrying amino acid substitutions (A505V, L506F, I507L, S574T and I575T) collectively abolishing the putative allosteric site (hSERTALI/VFL+SI/TT). One mg/kg escitalopram yielded clinical relevant plasma levels and brain levels consistent with therapeutic SERT occupancy. Importantly, escitalopram-induced 5-HTExt elevation was not decreased by R-citalopram co-treatment. Further, escitalopram-induced 5-HTExt elevation was not affected by loss of the allosteric site. The behavioral effects of the clinically relevant escitalopram dose were small, tending to be enhanced by R-citalopram co-administration. Conclusions We find no evidence that R-citalopram directly antagonizes escitalopram or that the putative allosteric site is important for hSERT inhibition by escitalopram. Our findings points to mechanisms for R-citalopram antagonism of escitalopram’s antidepressant action other than direct antagonistic binding interactions at the hSERT. PMID:24810106

Tumour suppressor protein p53 regulates the stress activated bilirubin oxidase cytochrome P450 2A6

DOE Office of Scientific and Technical Information (OSTI.GOV)

Hu, Hao, E-mail: hao.hu1@uqconnect.edu.au; Yu, Ting, E-mail: t.yu2@uq.edu.au; Arpiainen, Satu, E-mail: Satu.Juhila@orion.fi

2015-11-15

Human cytochrome P450 (CYP) 2A6 enzyme has been proposed to play a role in cellular defence against chemical-induced oxidative stress. The encoding gene is regulated by various stress activated transcription factors. This paper demonstrates that p53 is a novel transcriptional regulator of the gene. Sequence analysis of the CYP2A6 promoter revealed six putative p53 binding sites in a 3 kb proximate promoter region. The site closest to transcription start site (TSS) is highly homologous with the p53 consensus sequence. Transfection with various stepwise deletions of CYP2A6-5′-Luc constructs – down to − 160 bp from the TSS – showed p53 responsivenessmore » in p53 overexpressed C3A cells. However, a further deletion from − 160 to − 74 bp, including the putative p53 binding site, totally abolished the p53 responsiveness. Electrophoretic mobility shift assay with a probe containing the putative binding site showed specific binding of p53. A point mutation at the binding site abolished both the binding and responsiveness of the recombinant gene to p53. Up-regulation of the endogenous p53 with benzo[α]pyrene – a well-known p53 activator – increased the expression of the p53 responsive positive control and the CYP2A6-5′-Luc construct containing the intact p53 binding site but not the mutated CYP2A6-5′-Luc construct. Finally, inducibility of the native CYP2A6 gene by benzo[α]pyrene was demonstrated by dose-dependent increases in CYP2A6 mRNA and protein levels along with increased p53 levels in the nucleus. Collectively, the results indicate that p53 protein is a regulator of the CYP2A6 gene in C3A cells and further support the putative cytoprotective role of CYP2A6. - Highlights: • CYP2A6 is an immediate target gene of p53. • Six putative p53REs located on 3 kb proximate CYP2A6 promoter region. • The region − 160 bp from TSS is highly homologous with the p53 consensus sequence. • P53 specifically bind to the p53RE on the − 160 bp region. • HNF4α may interact with p53 in regulating CYP2A6 expression.« less

A new crystal form of Aspergillus oryzae catechol oxidase and evaluation of copper site structures in coupled binuclear copper enzymes.

PubMed

Penttinen, Leena; Rutanen, Chiara; Saloheimo, Markku; Kruus, Kristiina; Rouvinen, Juha; Hakulinen, Nina

2018-01-01

Coupled binuclear copper (CBC) enzymes have a conserved type 3 copper site that binds molecular oxygen to oxidize various mono- and diphenolic compounds. In this study, we found a new crystal form of catechol oxidase from Aspergillus oryzae (AoCO4) and solved two new structures from two different crystals at 1.8-Å and at 2.5-Å resolutions. These structures showed different copper site forms (met/deoxy and deoxy) and also differed from the copper site observed in the previously solved structure of AoCO4. We also analysed the electron density maps of all of the 56 CBC enzyme structures available in the protein data bank (PDB) and found that many of the published structures have vague copper sites. Some of the copper sites were then re-refined to find a better fit to the observed electron density. General problems in the refinement of metalloproteins and metal centres are discussed.

The binding sites of inhibitory monoclonal antibodies on acetylcholinesterase. Identification of a novel regulatory site at the putative "back door".

PubMed

Simon, S; Le Goff, A; Frobert, Y; Grassi, J; Massoulié, J

1999-09-24

We investigated the target sites of three inhibitory monoclonal antibodies on Electrophorus acetylcholinesterase (AChE). Previous studies showed that Elec-403 and Elec-410 are directed to overlapping but distinct epitopes in the peripheral site, at the entrance of the catalytic gorge, whereas Elec-408 binds to a different region. Using Electrophorus/rat AChE chimeras, we identified surface residues that differed between sensitive and insensitive AChEs: the replacement of a single Electrophorus residue by its rat homolog was able to abolish binding and inhibition, for each antibody. Reciprocally, binding and inhibition by Elec-403 and by Elec-410 could be conferred to rat AChE by the reverse mutation. Elec-410 appears to bind to one side of the active gorge, whereas Elec-403 covers its opening, explaining why the AChE-Elec-410 complex reacts faster than the AChE-Elec-403 or AChE-fasciculin complexes with two active site inhibitors, m-(N,N, N-trimethyltammonio)trifluoro-acetophenone and echothiophate. Elec-408 binds to the region of the putative "back door," distant from the peripheral site, and does not interfere with the access of inhibitors to the active site. The binding of an antibody to this novel regulatory site may inhibit the enzyme by blocking the back door or by inducing a conformational distortion within the active site.

Communication between the N and C Termini Is Required for Copper-stimulated Ser/Thr Phosphorylation of Cu(I)-ATPase (ATP7B)*

PubMed Central

Braiterman, Lelita T.; Gupta, Arnab; Chaerkady, Raghothama; Cole, Robert N.; Hubbard, Ann L.

2015-01-01

The Wilson disease protein ATP7B exhibits copper-dependent trafficking. In high copper, ATP7B exits the trans-Golgi network and moves to the apical domain of hepatocytes where it facilitates elimination of excess copper through the bile. Copper levels also affect ATP7B phosphorylation. ATP7B is basally phosphorylated in low copper and becomes more phosphorylated (“hyperphosphorylated”) in elevated copper. The functional significance of hyperphosphorylation remains unclear. We showed that hyperphosphorylation occurs even when ATP7B is restricted to the trans-Golgi network. We performed comprehensive phosphoproteomics of ATP7B in low versus high copper, which revealed that 24 Ser/Thr residues in ATP7B could be phosphorylated, and only four of these were copper-responsive. Most of the phosphorylated sites were found in the N- and C-terminal cytoplasmic domains. Using truncation and mutagenesis, we showed that inactivation or elimination of all six N-terminal metal binding domains did not block copper-dependent, reversible, apical trafficking but did block hyperphosphorylation in hepatic cells. We showed that nine of 15 Ser/Thr residues in the C-terminal domain were phosphorylated. Inactivation of 13 C-terminal phosphorylation sites reduced basal phosphorylation and eliminated hyperphosphorylation, suggesting that copper binding at the N terminus propagates to the ATP7B C-terminal region. C-terminal mutants with either inactivating or phosphomimetic substitutions showed little effect upon copper-stimulated trafficking, indicating that trafficking does not depend on phosphorylation at these sites. Thus, our studies revealed that copper-dependent conformational changes in the N-terminal region lead to hyperphosphorylation at C-terminal sites, which seem not to affect trafficking and may instead fine-tune copper sequestration. PMID:25666620

Effect of Dioxygen on Copper(II) Binding to α-Synuclein

PubMed Central

Lucas, Heather R.; Lee, Jennifer C.

2010-01-01

Using the fluorescent amino acid tryptophan (Trp), we have characterized the copper(II) binding of F4W α-synuclein in the presence and absence of dioxygen at neutral pH. Variations in Trp fluorescence indicate that copper(II) binding is enhanced by the presence of dioxygen, with the apparent dissociation constant (Kd(app)) changing from 100 nM (anaerobic) to 10 nM (aerobic). To investigate the possible role of methionine oxidation, complementary work focused on synthetic peptide models of the N-terminal Cu(II)-α-syn site, MDV(F/W) and M*DV(F/W), where M*= methionine sulfoxide. Furthermore, we employed circular dichroism (CD) spectroscopy to demonstrate that the phenyl-to-indole (F→W) substitution does not alter copper(II) binding properties and to confirm the 1:1 metal-peptide binding stoichiometry. CD comparisons also revealed that Met1 oxidation does not affect the copper-peptide conformation and further suggested the possible existence of a CuII-Trp/Phe (cation-π) interaction. PMID:20064662

Molecular Features of the Copper Binding Sites in the Octarepeat Domain of the Prion Protein†

PubMed Central

Burns, Colin S.; Aronoff-Spencer, Eliah; Dunham, Christine M.; Lario, Paula; Avdievich, Nikolai I.; Antholine, William E.; Olmstead, Marilyn M.; Vrielink, Alice; Gerfen, Gary J.; Peisach, Jack; Scott, William G.; Millhauser, Glenn L.

2010-01-01

Recent evidence suggests that the prion protein (PrP) is a copper binding protein. The N-terminal region of human PrP contains four sequential copies of the highly conserved octarepeat sequence PHGGGWGQ spanning residues 60–91. This region selectively binds Cu2+ in vivo. In a previous study using peptide design, EPR, and CD spectroscopy, we showed that the HGGGW segment within each octarepeat comprises the fundamental Cu2+ binding unit [Aronoff-Spencer et al. (2000) Biochemistry 40, 13760–13771]. Here we present the first atomic resolution view of the copper binding site within an octarepeat. The crystal structure of HGGGW in a complex with Cu2+ reveals equatorial coordination by the histidine imidazole, two deprotonated glycine amides, and a glycine carbonyl, along with an axial water bridging to the Trp indole. Companion S-band EPR, X-band ESEEM, and HYSCORE experiments performed on a library of 15N-labeled peptides indicate that the structure of the copper binding site in HGGGW and PHGGGWGQ in solution is consistent with that of the crystal structure. Moreover, EPR performed on PrP(23–28, 57–91) and an 15N-labeled analogue demonstrates that the identified structure is maintained in the full PrP octarepeat domain. It has been shown that copper stimulates PrP endocytosis. The identified Gly–Cu linkage is unstable below pH ≈6.5 and thus suggests a pH-dependent molecular mechanism by which PrP detects Cu2+ in the extracellular matrix or releases PrP-bound Cu2+ within the endosome. The structure also reveals an unusual complementary interaction between copper-structured HGGGW units that may facilitate molecular recognition between prion proteins, thereby suggesting a mechanism for transmembrane signaling and perhaps conversion to the pathogenic form. PMID:11900542

Methanobactin and the Link between Copper and Bacterial Methane Oxidation

PubMed Central

Semrau, Jeremy D.; Murrell, J. Colin; Gallagher, Warren H.; Dennison, Christopher; Vuilleumier, Stéphane

2016-01-01

SUMMARY Methanobactins (mbs) are low-molecular-mass (<1,200 Da) copper-binding peptides, or chalkophores, produced by many methane-oxidizing bacteria (methanotrophs). These molecules exhibit similarities to certain iron-binding siderophores but are expressed and secreted in response to copper limitation. Structurally, mbs are characterized by a pair of heterocyclic rings with associated thioamide groups that form the copper coordination site. One of the rings is always an oxazolone and the second ring an oxazolone, an imidazolone, or a pyrazinedione moiety. The mb molecule originates from a peptide precursor that undergoes a series of posttranslational modifications, including (i) ring formation, (ii) cleavage of a leader peptide sequence, and (iii) in some cases, addition of a sulfate group. Functionally, mbs represent the extracellular component of a copper acquisition system. Consistent with this role in copper acquisition, mbs have a high affinity for copper ions. Following binding, mbs rapidly reduce Cu2+ to Cu1+. In addition to binding copper, mbs will bind most transition metals and near-transition metals and protect the host methanotroph as well as other bacteria from toxic metals. Several other physiological functions have been assigned to mbs, based primarily on their redox and metal-binding properties. In this review, we examine the current state of knowledge of this novel type of metal-binding peptide. We also explore its potential applications, how mbs may alter the bioavailability of multiple metals, and the many roles mbs may play in the physiology of methanotrophs. PMID:26984926

Elucidating the mechanism for the reduction of nitrite by copper nitrite reductase--a contribution from quantum chemical studies.

PubMed

De Marothy, S A; Blomberg, M R A; Siegbahn, P E M

2007-01-30

Density functional methods have been applied to investigate the properties of the active site of copper-containing nitrite reductases and possible reaction mechanisms for the enzyme catalysis. The results for a model of the active site indicate that a hydroxyl intermediate is not formed during the catalytic cycle, but rather a state with a protonated nitrite bound to the reduced copper. Electron affinity calculations indicate that reduction of the T2 copper site does not occur immediately after nitrite binding. Proton affinity calculations are indicative of substantial pK(a) differences between different states of the T2 site. The calculations further suggest that the reaction does not proceed until uptake of a second proton from the bulk solution. They also indicate that Asp-92 may play both a key role as a proton donor to the substrate, and a structural role in promoting catalysis. In the D92N mutant another base, presumably a nearby histidine (His-249) may take the role as the proton donor. On the basis of these model calculations and available experimental evidence, an ordered reaction mechanism for the reduction of nitrite is suggested. An investigation of the binding modes of the nitric oxide product and the nitrite substrate to the model site has also been made, indicating that nitric oxide prefers to bind in an end-on fashion to the reduced T2 site.

Spectroscopic Characterization of a Green Copper Site in a Single-Domain Cupredoxin

PubMed Central

Roger, Magali; Biaso, Frédéric; Castelle, Cindy J.; Bauzan, Marielle; Chaspoul, Florence; Lojou, Elisabeth; Sciara, Giuliano; Caffarri, Stefano; Giudici-Orticoni, Marie-Thérèse; Ilbert, Marianne

2014-01-01

Cupredoxins are widespread copper-binding proteins, mainly involved in electron transfer pathways. They display a typical rigid greek key motif consisting of an eight stranded β-sandwich. A fascinating feature of cupredoxins is the natural diversity of their copper center geometry. These geometry variations give rise to drastic changes in their color, such as blue, green, red or purple. Based on several spectroscopic and structural analyses, a connection between the geometry of their copper-binding site and their color has been proposed. However, little is known about the relationship between such diversity of copper center geometry in cupredoxins and possible implications for function. This has been difficult to assess, as only a few naturally occurring green and red copper sites have been described so far. We report herein the spectrocopic characterization of a novel kind of single domain cupredoxin of green color, involved in a respiratory pathway of the acidophilic organism Acidithiobacillus ferrooxidans. Biochemical and spectroscopic characterization coupled to bioinformatics analysis reveal the existence of some unusual features for this novel member of the green cupredoxin sub-family. This protein has the highest redox potential reported to date for a green-type cupredoxin. It has a constrained green copper site insensitive to pH or temperature variations. It is a green-type cupredoxin found for the first time in a respiratory pathway. These unique properties might be explained by a region of unknown function never found in other cupredoxins, and by an unusual length of the loop between the second and the fourth copper ligands. These discoveries will impact our knowledge on non-engineered green copper sites, whose involvement in respiratory chains seems more widespread than initially thought. PMID:24932914

Spectroscopic characterization of a green copper site in a single-domain cupredoxin.

PubMed

Roger, Magali; Biaso, Frédéric; Castelle, Cindy J; Bauzan, Marielle; Chaspoul, Florence; Lojou, Elisabeth; Sciara, Giuliano; Caffarri, Stefano; Giudici-Orticoni, Marie-Thérèse; Ilbert, Marianne

2014-01-01

Cupredoxins are widespread copper-binding proteins, mainly involved in electron transfer pathways. They display a typical rigid greek key motif consisting of an eight stranded β-sandwich. A fascinating feature of cupredoxins is the natural diversity of their copper center geometry. These geometry variations give rise to drastic changes in their color, such as blue, green, red or purple. Based on several spectroscopic and structural analyses, a connection between the geometry of their copper-binding site and their color has been proposed. However, little is known about the relationship between such diversity of copper center geometry in cupredoxins and possible implications for function. This has been difficult to assess, as only a few naturally occurring green and red copper sites have been described so far. We report herein the spectrocopic characterization of a novel kind of single domain cupredoxin of green color, involved in a respiratory pathway of the acidophilic organism Acidithiobacillus ferrooxidans. Biochemical and spectroscopic characterization coupled to bioinformatics analysis reveal the existence of some unusual features for this novel member of the green cupredoxin sub-family. This protein has the highest redox potential reported to date for a green-type cupredoxin. It has a constrained green copper site insensitive to pH or temperature variations. It is a green-type cupredoxin found for the first time in a respiratory pathway. These unique properties might be explained by a region of unknown function never found in other cupredoxins, and by an unusual length of the loop between the second and the fourth copper ligands. These discoveries will impact our knowledge on non-engineered green copper sites, whose involvement in respiratory chains seems more widespread than initially thought.

Metal stabilization of collagen and de novo designed mimetic peptides

PubMed Central

Parmar, Avanish S.; Xu, Fei; Pike, Douglas H.; Belure, Sandeep V.; Hasan, Nida F.; Drzewiecki, Kathryn E.; Shreiber, David I.; Nanda, Vikas

2017-01-01

We explore the design of metal binding sites to modulate triple-helix stability of collagen and collagen-mimetic peptides. Globular proteins commonly utilize metals to connect tertiary structural elements that are well separated in sequence, constraining structure and enhancing stability. It is more challenging to engineer structural metals into fibrous protein scaffolds, which lack the extensive tertiary contacts seen in globular proteins. In the collagen triple helix, the structural adjacency of the carboxy-termini of the three chains makes this region an attractive target for introducing metal binding sites. We engineered His3 sites based on structural modeling constraints into a series of designed homotrimeric and heterotrimeric peptides, assessing the capacity of metal binding to improve stability and in the case of heterotrimers, affect specificity of assembly. Notable enhancements in stability for both homo and heteromeric systems were observed upon addition of zinc(II) and several other metal ions only when all three histidine ligands were present. Metal binding affinities were consistent with the expected Irving-Williams series for imidazole. Unlike other metals tested, copper(II) also bound to peptides lacking histidine ligands. Acetylation of the peptide N-termini prevented copper binding, indicating proline backbone amide metal-coordination at this site. Copper similarly stabilized animal extracted Type I collagen in a metal specific fashion, highlighting the potential importance of metal homeostasis within the extracellular matrix. PMID:26225466

Metal Stabilization of Collagen and de Novo Designed Mimetic Peptides.

PubMed

Parmar, Avanish S; Xu, Fei; Pike, Douglas H; Belure, Sandeep V; Hasan, Nida F; Drzewiecki, Kathryn E; Shreiber, David I; Nanda, Vikas

2015-08-18

We explore the design of metal binding sites to modulate triple-helix stability of collagen and collagen-mimetic peptides. Globular proteins commonly utilize metals to connect tertiary structural elements that are well separated in sequence, constraining structure and enhancing stability. It is more challenging to engineer structural metals into fibrous protein scaffolds, which lack the extensive tertiary contacts seen in globular proteins. In the collagen triple helix, the structural adjacency of the carboxy-termini of the three chains makes this region an attractive target for introducing metal binding sites. We engineered His3 sites based on structural modeling constraints into a series of designed homotrimeric and heterotrimeric peptides, assessing the capacity of metal binding to improve stability and in the case of heterotrimers, affect specificity of assembly. Notable enhancements in stability for both homo- and heteromeric systems were observed upon addition of zinc(II) and several other metal ions only when all three histidine ligands were present. Metal binding affinities were consistent with the expected Irving-Williams series for imidazole. Unlike other metals tested, copper(II) also bound to peptides lacking histidine ligands. Acetylation of the peptide N-termini prevented copper binding, indicating proline backbone amide metal-coordination at this site. Copper similarly stabilized animal extracted Type I collagen in a metal-specific fashion, highlighting the potential importance of metal homeostasis within the extracellular matrix.

Searching for putative binding sites of the bispyridinium compound MB327 in the nicotinic acetylcholine receptor.

PubMed

Wein, Thomas; Höfner, Georg; Rappenglück, Sebastian; Sichler, Sonja; Niessen, Karin V; Seeger, Thomas; Worek, Franz; Thiermann, Horst; Wanner, Klaus T

2018-09-01

Irreversible inhibition of the acetylcholine esterase upon intoxication with organophosphorus compounds leads to an accumulation of acetylcholine in the synaptic cleft and a subsequent desensitization of nicotinic acetylcholine receptors which may ultimately result in respiratory failure. The bispyridinium compound MB327 has been found to restore functional activity of nAChR thus representing a promising starting point for the development of new drugs for the treatment of organophosphate poisoning. In order to optimize the resensitizing effect of MB327 on nAChR, it would be very helpful to know the MB327 specific binding site to apply structure based molecular modeling. The binding site for MB327 at the nAChR is not known and so far goal of speculations, but it has been shown that MB327 does not bind to the orthosteric acetylcholine binding site. We have used docking calculations to screen the surface of nAChR for possible binding sites of MB327. The results indicate that at least two potential binding sites for MB327 at nAChR are present inside the channel pore. In these binding sites, MB327 intercalates between the γ-α and β-δ subunits of nAChR, respectively. Both putative MB327 binding sites show an unsymmetrical distribution of surrounding hydrophilic and lipophilic amino acids. This suggests that substitution of MB327-related bispyridinium compounds on one of the two pyridinium rings with polar substituents should have a favorable effect on the pharmacological function. Copyright © 2017 Elsevier B.V. All rights reserved.

DOE Office of Scientific and Technical Information (OSTI.GOV)

Peterson, Ryan L.; Galaleldeen, Ahmad; Villarreal, Johanna

In eukaryotes the bimetallic Cu/Zn superoxide dismutase (SOD) enzymes play important roles in the biology of reactive oxygen species by disproportionating superoxide anion. We reported that the fungal pathogen Candida albicans expresses a novel copper-only SOD, known as SOD5, that lacks the zinc cofactor and electrostatic loop (ESL) domain of Cu/Zn-SODs for substrate guidance. In spite of these abnormalities, C. albicans SOD5 can disproportionate superoxide at rates limited only by diffusion. Here we demonstrate that this curious copper-only SOD occurs throughout the fungal kingdom as well as in phylogenetically distant oomycetes or “pseudofungi” species. It is the only form ofmore » extracellular SOD in fungi and oomycetes, in stark contrast to the extracellular Cu/Zn-SODs of plants and animals. Through structural biology and biochemical approaches we demonstrate that these copper-only SODs have evolved with a specialized active site consisting of two highly conserved residues equivalent to SOD5 Glu-110 and Asp-113. The equivalent positions are zinc binding ligands in Cu/Zn-SODs and have evolved in copper-only SODs to control catalysis and copper binding in lieu of zinc and the ESL. Similar to the zinc ion in Cu/Zn-SODs, SOD5 Glu-110 helps orient a key copper-coordinating histidine and extends the pH range of enzyme catalysis. Furthermore, SOD5 Asp-113 connects to the active site in a manner similar to that of the ESL in Cu/Zn-SODs and assists in copper cofactor binding. Copper-only SODs are virulence factors for certain fungal pathogens; thus this unique active site may be a target for future anti-fungal strategies.« less

Cholesterol-Binding Sites in GIRK Channels: The Devil is in the Details.

PubMed

Rosenhouse-Dantsker, Avia

2018-01-01

In recent years, it has become evident that cholesterol plays a direct role in the modulation of a variety of ion channels. In most cases, cholesterol downregulates channel activity. In contrast, our earlier studies have demonstrated that atrial G protein inwardly rectifying potassium (GIRK) channels are upregulated by cholesterol. Recently, we have shown that hippocampal GIRK currents are also upregulated by cholesterol. A combined computational-experimental approach pointed to putative cholesterol-binding sites in the transmembrane domain of the GIRK2 channel, the primary subunit in hippocampal GIRK channels. In particular, the principal cholesterol-binding site was located in the center of the transmembrane domain in between the inner and outer α-helices of 2 adjacent subunits. Further studies pointed to a similar cholesterol-binding site in GIRK4, a major subunit in atrial GIRK channels. However, a close look at a sequence alignment of the transmembrane helices of the 2 channels reveals surprising differences among the residues that interact with the cholesterol molecule in these 2 channels. Here, we compare the residues that form putative cholesterol-binding sites in GIRK2 and GIRK4 and discuss the similarities and differences among them.

Structural and Functional Analysis of a Lytic Polysaccharide Monooxygenase Important for Efficient Utilization of Chitin in Cellvibrio japonicus*

PubMed Central

Forsberg, Zarah; Nelson, Cassandra E.; Dalhus, Bjørn; Mekasha, Sophanit; Loose, Jennifer S. M.; Crouch, Lucy I.; Røhr, Åsmund K.; Gardner, Jeffrey G.; Eijsink, Vincent G. H.; Vaaje-Kolstad, Gustav

2016-01-01

Cellvibrio japonicus is a Gram-negative soil bacterium that is primarily known for its ability to degrade plant cell wall polysaccharides through utilization of an extensive repertoire of carbohydrate-active enzymes. Several putative chitin-degrading enzymes are also found among these carbohydrate-active enzymes, such as chitinases, chitobiases, and lytic polysaccharide monooxygenases (LPMOs). In this study, we have characterized the chitin-active LPMO, CjLPMO10A, a tri-modular enzyme containing a catalytic family AA10 LPMO module, a family 5 chitin-binding module, and a C-terminal unclassified module of unknown function. Characterization of the latter module revealed tight and specific binding to chitin, thereby unraveling a new family of chitin-binding modules (classified as CBM73). X-ray crystallographic elucidation of the CjLPMO10A catalytic module revealed that the active site of the enzyme combines structural features previously only observed in either cellulose or chitin-active LPMO10s. Analysis of the copper-binding site by EPR showed a signal signature more similar to those observed for cellulose-cleaving LPMOs. The full-length LPMO shows no activity toward cellulose but is able to bind and cleave both α- and β-chitin. Removal of the chitin-binding modules reduced LPMO activity toward α-chitin compared with the full-length enzyme. Interestingly, the full-length enzyme and the individual catalytic LPMO module boosted the activity of an endochitinase equally well, also yielding similar amounts of oxidized products. Finally, gene deletion studies show that CjLPMO10A is needed by C. japonicus to obtain efficient growth on both purified chitin and crab shell particles. PMID:26858252

Structural and Functional Analysis of a Lytic Polysaccharide Monooxygenase Important for Efficient Utilization of Chitin in Cellvibrio japonicus.

PubMed

Forsberg, Zarah; Nelson, Cassandra E; Dalhus, Bjørn; Mekasha, Sophanit; Loose, Jennifer S M; Crouch, Lucy I; Røhr, Åsmund K; Gardner, Jeffrey G; Eijsink, Vincent G H; Vaaje-Kolstad, Gustav

2016-04-01

Cellvibrio japonicusis a Gram-negative soil bacterium that is primarily known for its ability to degrade plant cell wall polysaccharides through utilization of an extensive repertoire of carbohydrate-active enzymes. Several putative chitin-degrading enzymes are also found among these carbohydrate-active enzymes, such as chitinases, chitobiases, and lytic polysaccharide monooxygenases (LPMOs). In this study, we have characterized the chitin-active LPMO,CjLPMO10A, a tri-modular enzyme containing a catalytic family AA10 LPMO module, a family 5 chitin-binding module, and a C-terminal unclassified module of unknown function. Characterization of the latter module revealed tight and specific binding to chitin, thereby unraveling a new family of chitin-binding modules (classified as CBM73). X-ray crystallographic elucidation of theCjLPMO10A catalytic module revealed that the active site of the enzyme combines structural features previously only observed in either cellulose or chitin-active LPMO10s. Analysis of the copper-binding site by EPR showed a signal signature more similar to those observed for cellulose-cleaving LPMOs. The full-length LPMO shows no activity toward cellulose but is able to bind and cleave both α- and β-chitin. Removal of the chitin-binding modules reduced LPMO activity toward α-chitin compared with the full-length enzyme. Interestingly, the full-length enzyme and the individual catalytic LPMO module boosted the activity of an endochitinase equally well, also yielding similar amounts of oxidized products. Finally, gene deletion studies show thatCjLPMO10A is needed byC. japonicusto obtain efficient growth on both purified chitin and crab shell particles. © 2016 by The American Society for Biochemistry and Molecular Biology, Inc.

Copper-zinc superoxide dismutase is activated through a sulfenic acid intermediate at a copper ion entry site.

PubMed

Fetherolf, Morgan M; Boyd, Stefanie D; Taylor, Alexander B; Kim, Hee Jong; Wohlschlegel, James A; Blackburn, Ninian J; Hart, P John; Winge, Dennis R; Winkler, Duane D

2017-07-21

Metallochaperones are a diverse family of trafficking molecules that provide metal ions to protein targets for use as cofactors. The copper chaperone for superoxide dismutase (Ccs1) activates immature copper-zinc superoxide dismutase (Sod1) by delivering copper and facilitating the oxidation of the Sod1 intramolecular disulfide bond. Here, we present structural, spectroscopic, and cell-based data supporting a novel copper-induced mechanism for Sod1 activation. Ccs1 binding exposes an electropositive cavity and proposed "entry site" for copper ion delivery on immature Sod1. Copper-mediated sulfenylation leads to a sulfenic acid intermediate that eventually resolves to form the Sod1 disulfide bond with concomitant release of copper into the Sod1 active site. Sod1 is the predominant disulfide bond-requiring enzyme in the cytoplasm, and this copper-induced mechanism of disulfide bond formation obviates the need for a thiol/disulfide oxidoreductase in that compartment. © 2017 by The American Society for Biochemistry and Molecular Biology, Inc.

Characteristics of functional enrichment and gene expression level of human putative transcriptional target genes.

PubMed

Osato, Naoki

2018-01-19

Transcriptional target genes show functional enrichment of genes. However, how many and how significantly transcriptional target genes include functional enrichments are still unclear. To address these issues, I predicted human transcriptional target genes using open chromatin regions, ChIP-seq data and DNA binding sequences of transcription factors in databases, and examined functional enrichment and gene expression level of putative transcriptional target genes. Gene Ontology annotations showed four times larger numbers of functional enrichments in putative transcriptional target genes than gene expression information alone, independent of transcriptional target genes. To compare the number of functional enrichments of putative transcriptional target genes between cells or search conditions, I normalized the number of functional enrichment by calculating its ratios in the total number of transcriptional target genes. With this analysis, native putative transcriptional target genes showed the largest normalized number of functional enrichments, compared with target genes including 5-60% of randomly selected genes. The normalized number of functional enrichments was changed according to the criteria of enhancer-promoter interactions such as distance from transcriptional start sites and orientation of CTCF-binding sites. Forward-reverse orientation of CTCF-binding sites showed significantly higher normalized number of functional enrichments than the other orientations. Journal papers showed that the top five frequent functional enrichments were related to the cellular functions in the three cell types. The median expression level of transcriptional target genes changed according to the criteria of enhancer-promoter assignments (i.e. interactions) and was correlated with the changes of the normalized number of functional enrichments of transcriptional target genes. Human putative transcriptional target genes showed significant functional enrichments. Functional enrichments were related to the cellular functions. The normalized number of functional enrichments of human putative transcriptional target genes changed according to the criteria of enhancer-promoter assignments and correlated with the median expression level of the target genes. These analyses and characters of human putative transcriptional target genes would be useful to examine the criteria of enhancer-promoter assignments and to predict the novel mechanisms and factors such as DNA binding proteins and DNA sequences of enhancer-promoter interactions.

Competition between Metals for Binding to Methanobactin Enables Expression of Soluble Methane Monooxygenase in the Presence of Copper

PubMed Central

Kalidass, Bhagyalakshmi; Ul-Haque, Muhammad Farhan; Baral, Bipin S.; DiSpirito, Alan A.

2014-01-01

It is well known that copper is a key factor regulating expression of the two forms of methane monooxygenase found in proteobacterial methanotrophs. Of these forms, the cytoplasmic, or soluble, methane monooxygenase (sMMO) is expressed only at low copper concentrations. The membrane-bound, or particulate, methane monooxygenase (pMMO) is constitutively expressed with respect to copper, and such expression increases with increasing copper. Recent findings have shown that copper uptake is mediated by a modified polypeptide, or chalkophore, termed methanobactin. Although methanobactin has high specificity for copper, it can bind other metals, e.g., gold. Here we show that in Methylosinus trichosporium OB3b, sMMO is expressed and active in the presence of copper if gold is also simultaneously present. Such expression appears to be due to gold binding to methanobactin produced by M. trichosporium OB3b, thereby limiting copper uptake. Such expression and activity, however, was significantly reduced if methanobactin preloaded with copper was also added. Further, quantitative reverse transcriptase PCR (RT-qPCR) of transcripts of genes encoding polypeptides of both forms of MMO and SDS-PAGE results indicate that both sMMO and pMMO can be expressed when copper and gold are present, as gold effectively competes with copper for binding to methanobactin. Such findings suggest that under certain geochemical conditions, both forms of MMO may be expressed and active in situ. Finally, these findings also suggest strategies whereby field sites can be manipulated to enhance sMMO expression, i.e., through the addition of a metal that can compete with copper for binding to methanobactin. PMID:25416758

Competition between metals for binding to methanobactin enables expression of soluble methane monooxygenase in the presence of copper.

PubMed

Kalidass, Bhagyalakshmi; Ul-Haque, Muhammad Farhan; Baral, Bipin S; DiSpirito, Alan A; Semrau, Jeremy D

2015-02-01

It is well known that copper is a key factor regulating expression of the two forms of methane monooxygenase found in proteobacterial methanotrophs. Of these forms, the cytoplasmic, or soluble, methane monooxygenase (sMMO) is expressed only at low copper concentrations. The membrane-bound, or particulate, methane monooxygenase (pMMO) is constitutively expressed with respect to copper, and such expression increases with increasing copper. Recent findings have shown that copper uptake is mediated by a modified polypeptide, or chalkophore, termed methanobactin. Although methanobactin has high specificity for copper, it can bind other metals, e.g., gold. Here we show that in Methylosinus trichosporium OB3b, sMMO is expressed and active in the presence of copper if gold is also simultaneously present. Such expression appears to be due to gold binding to methanobactin produced by M. trichosporium OB3b, thereby limiting copper uptake. Such expression and activity, however, was significantly reduced if methanobactin preloaded with copper was also added. Further, quantitative reverse transcriptase PCR (RT-qPCR) of transcripts of genes encoding polypeptides of both forms of MMO and SDS-PAGE results indicate that both sMMO and pMMO can be expressed when copper and gold are present, as gold effectively competes with copper for binding to methanobactin. Such findings suggest that under certain geochemical conditions, both forms of MMO may be expressed and active in situ. Finally, these findings also suggest strategies whereby field sites can be manipulated to enhance sMMO expression, i.e., through the addition of a metal that can compete with copper for binding to methanobactin. Copyright © 2015, American Society for Microbiology. All Rights Reserved.

Metal-Mediated Modulation of Streptococcal Cysteine Protease Activity and Its Biological Implications

PubMed Central

Chella Krishnan, Karthickeyan; Mukundan, Santhosh; Landero Figueroa, Julio A.; Caruso, Joseph A.

2014-01-01

Streptococcal cysteine protease (SpeB), the major secreted protease produced by group A streptococcus (GAS), cleaves both host and bacterial proteins and contributes importantly to the pathogenesis of invasive GAS infections. Modulation of SpeB expression and/or its activity during invasive GAS infections has been shown to affect bacterial virulence and infection severity. Expression of SpeB is regulated by the GAS CovR-CovS two-component regulatory system, and we demonstrated that bacteria with mutations in the CovR-CovS two-component regulatory system are selected for during localized GAS infections and that these bacteria lack SpeB expression and exhibit a hypervirulent phenotype. Additionally, in a separate study, we showed that expression of SpeB can also be modulated by human transferrin- and/or lactoferrin-mediated iron chelation. Accordingly, the goal of this study was to investigate the possible roles of iron and other metals in modulating SpeB expression and/or activity in a manner that would potentiate bacterial virulence. Here, we report that the divalent metals zinc and copper inhibit SpeB activity at the posttranslational level. Utilizing online metal-binding site prediction servers, we identified two putative metal-binding sites in SpeB, one of which involves the catalytic-dyad residues 47Cys and 195His. Based on our findings, we propose that zinc and/or copper availability in the bacterial microenvironment can modulate the proteolytic activity of SpeB in a manner that preserves the integrity of several other virulence factors essential for bacterial survival and dissemination within the host and thereby may exacerbate the severity of invasive GAS infections. PMID:24799625

Binding of Copper and Silver to Single-Site Variants of Peptidylglycine Monooxygenase Reveals the Structure and Chemistry of the Individual Metal Centers

PubMed Central

2015-01-01

Peptidylglycine monooxygenase (PHM) catalyzes the final step in the biosynthesis of amidated peptides that serve as important signaling molecules in numerous endocrine pathways. The catalytic mechanism has attracted much attention because of a number of unique attributes, including the presence of a pair of uncoupled copper centers separated by 11 Å (termed CuH and CuM), an unusual Cu(I)SMet interaction at the oxygen binding M-site, and the postulated Cu(II)–superoxo intermediate. Understanding the mechanism requires determining the catalytic roles of the individual copper centers and how they change during catalysis, a task made more difficult by the overlapping spectral signals from each copper center in the wild-type (WT) protein. To aid in this effort, we constructed and characterized two PHM variants that bound metal at only one site. The H242A variant bound copper at the H-center, while the H107AH108A double mutant bound copper at the M-center; both mutants were devoid of catalytic activity. Oxidized Cu(II) forms showed electron paramagnetic resonance and extended X-ray absorption fine structure (EXAFS) spectra consistent with their previously determined Cu(II)His3O and Cu(II)His2O2 ligand sets for the H- and M-centers, respectively. Cu(I) forms, on the other hand, showed unique chemistry. The M-center bound two histidines and a methionine at all pHs, while the H-center was two-coordinate at neutral pH but coordinated a new methionine S ligand at low pH. Fourier transform infrared studies confirmed and extended previous assignments of CO binding and showed unambiguously that the 2092 cm–1 absorbing species observed in the WT and many variant forms is an M-site Cu(I)–CO adduct. Silver binding was also investigated. When H107AH108A and M109I (a WT analogue with both sites intact) were incubated with excess AgNO3, each variant bound a single Ag(I) ion, from which it was inferred that Ag(I) binds selectively at the M-center with little or no affinity for the H-center. EXAFS at the Ag K-edge established a strong degree of similarity between the ligand sets of Cu and Ag bound at the M-center. These studies validate previous spectral assignments and provide new insights into the detailed chemistry of each metal site. PMID:24471980

An Angular Overlap Model for Cu(II) Ion in the AMOEBA Polarizable Force Field

PubMed Central

Xiang, Jin Yu; Ponder, Jay W.

2014-01-01

An extensible polarizable force field for transition metal ion was developed based on AMOEBA and the angular overlap model (AOM) with consistent treatment of electrostatics for all atoms. Parameters were obtained by fitting molecular mechanics (MM) energies to various ab initio gas-phase calculations. The results of parameterization were presented for copper (II) ion ligated to water and model fragments of amino acid residues involved in the copper binding sites of type 1 copper proteins. Molecular dynamics (MD) simulations were performed on aqueous copper (II) ion at various temperatures, as well as plastocyanin (1AG6) and azurin (1DYZ). Results demonstrated that the AMOEBA-AOM significantly improves the accuracy of classical MM in a number of test cases when compared to ab initio calculations. The Jahn-Teller distortion for hexa-aqua copper (II) complex was handled automatically without specifically designating axial and in-plane ligands. Analyses of MD trajectories resulted in a 6-coordination first solvation shell for aqueous copper (II) ion and a 1.8ns average residence time of water molecules. The ensemble average geometries of 1AG6 and 1DYZ copper binding sites were in general agreement with X-ray and previous computational studies. PMID:25045338

Identification of Candidate Transcription Factor Binding Sites in the Cattle Genome

PubMed Central

Bickhart, Derek M.; Liu, George E.

2013-01-01

A resource that provides candidate transcription factor binding sites (TFBSs) does not currently exist for cattle. Such data is necessary, as predicted sites may serve as excellent starting locations for future omics studies to develop transcriptional regulation hypotheses. In order to generate this resource, we employed a phylogenetic footprinting approach—using sequence conservation across cattle, human and dog—and position-specific scoring matrices to identify 379,333 putative TFBSs upstream of nearly 8000 Mammalian Gene Collection (MGC) annotated genes within the cattle genome. Comparisons of our predictions to known binding site loci within the PCK1, ACTA1 and G6PC promoter regions revealed 75% sensitivity for our method of discovery. Additionally, we intersected our predictions with known cattle SNP variants in dbSNP and on the Illumina BovineHD 770k and Bos 1 SNP chips, finding 7534, 444 and 346 overlaps, respectively. Due to our stringent filtering criteria, these results represent high quality predictions of putative TFBSs within the cattle genome. All binding site predictions are freely available at http://bfgl.anri.barc.usda.gov/BovineTFBS/ or http://199.133.54.77/BovineTFBS. PMID:23433959

Protein and gene structure of a blue laccase from Pleurotus ostreatus1.

PubMed Central

Giardina, P; Palmieri, G; Scaloni, A; Fontanella, B; Faraco, V; Cennamo, G; Sannia, G

1999-01-01

A new laccase isoenzyme (POXA1b, where POX is phenol oxidase), produced by Pleurotus ostreatus in cultures supplemented with copper sulphate, has been purified and fully characterized. The main characteristics of this protein (molecular mass in native and denaturing conditions, pI and catalytic properties) are almost identical to the previously studied laccase POXA1w. However, POXA1b contains four copper atoms per molecule instead of one copper, two zinc and one iron atom per molecule of POXA1w. Furthermore, POXA1b shows an unusually high stability at alkaline pH. The gene and cDNA coding for POXA1b have been cloned and sequenced. The gene coding sequence contains 1599 bp, interrupted by 15 introns. Comparison of the structure of the poxa1b gene with the two previously studied P. ostreatus laccase genes (pox1 and poxc) suggests that these genes belong to two different subfamilies. The amino acid sequence of POXA1b deduced from the cDNA sequence has been almost completely verified by means of matrix-assisted laser desorption ionization MS. It has been demonstrated that three out of six putative glycosylation sites are post-translationally modified and the structure of the bound glycosidic moieties has been determined, whereas two other putative glycosylation sites are unmodified. PMID:10417329

Spectroscopic and Theoretical Study of CuI Binding to His111 in the Human Prion Protein Fragment 106–115

PubMed Central

2016-01-01

The ability of the cellular prion protein (PrPC) to bind copper in vivo points to a physiological role for PrPC in copper transport. Six copper binding sites have been identified in the nonstructured N-terminal region of human PrPC. Among these sites, the His111 site is unique in that it contains a MKHM motif that would confer interesting CuI and CuII binding properties. We have evaluated CuI coordination to the PrP(106–115) fragment of the human PrP protein, using NMR and X-ray absorption spectroscopies and electronic structure calculations. We find that Met109 and Met112 play an important role in anchoring this metal ion. CuI coordination to His111 is pH-dependent: at pH >8, 2N1O1S species are formed with one Met ligand; in the range of pH 5–8, both methionine (Met) residues bind to CuI, forming a 1N1O2S species, where N is from His111 and O is from a backbone carbonyl or a water molecule; at pH <5, only the two Met residues remain coordinated. Thus, even upon drastic changes in the chemical environment, such as those occurring during endocytosis of PrPC (decreased pH and a reducing potential), the two Met residues in the MKHM motif enable PrPC to maintain the bound CuI ions, consistent with a copper transport function for this protein. We also find that the physiologically relevant CuI-1N1O2S species activates dioxygen via an inner-sphere mechanism, likely involving the formation of a copper(II) superoxide complex. In this process, the Met residues are partially oxidized to sulfoxide; this ability to scavenge superoxide may play a role in the proposed antioxidant properties of PrPC. This study provides further insight into the CuI coordination properties of His111 in human PrPC and the molecular mechanism of oxygen activation by this site. PMID:26930130

Copper Metallochaperones

PubMed Central

Robinson, Nigel J.; Winge, Dennis R.

2014-01-01

The current state of knowledge on how copper metallochaperones support the maturation of cuproproteins is reviewed. Copper is needed within mitochondria to supply the CuA and intramembrane CuB sites of cytochrome oxidase, within the trans-Golgi network to supply secreted cuproproteins and within the cytosol to supply superoxide dismutase 1 (Sod1). Subpopulations of copper-zinc superoxide dismutase also localize to mitochondria, the secretory system, the nucleus and, in plants, the chloroplast, which also requires copper for plastocyanin. Prokaryotic cuproproteins are found in the cell membrane and in the periplasm of gram-negative bacteria. Cu(I) and Cu(II) form tight complexes with organic molecules and drive redox chemistry, which unrestrained would be destructive. Copper metallochaperones assist copper in reaching vital destinations without inflicting damage or becoming trapped in adventitious binding sites. Copper ions are specifically released from copper metallochaperones upon contact with their cognate cuproproteins and metal transfer is thought to proceed by ligand substitution. PMID:20205585

Nature of the Active Sites for CO Reduction on Copper Nanoparticles; Suggestions for Optimizing Performance.

PubMed

Cheng, Tao; Xiao, Hai; Goddard, William A

2017-08-30

Recent experiments show that the grain boundaries (GBs) of copper nanoparticles (NPs) lead to an outstanding performance in reducing CO 2 and CO to alcohol products. We report here multiscale simulations that simulate experimental synthesis conditions to predict the structure of a 10 nm Cu NP (158 555 atoms). To identify active sites, we first predict the CO binding at a large number of sites and select four exhibiting CO binding stronger than the (211) step surface. Then, we predict the formation energy of the *OCCOH intermediate as a descriptor for C-C coupling, identifying two active sites, both of which have an under-coordinated surface square site adjacent to a subsurface stacking fault. We then propose a periodic Cu surface (4 by 4 supercell) with a similar site that substantially decreases the formation energy of *OCCOH, by 0.14 eV.

Positron trapping at defects in copper oxide superconductors

NASA Astrophysics Data System (ADS)

McMullen, T.; Jena, P.; Khanna, S. N.; Li, Yi; Jensen, Kjeld O.

1991-05-01

Positron states and lifetimes at defects in the copper oxide superconductors La2-xSrxCuO4, YBa2Cu3O7-x, and Bi2Sr2CaCu2O8+x are calculated with use of the superposed-atom model. In the Bi2Sr2CaCu2O8+x compound, we find that the smaller metal-ion vacancies appear to only bind positrons weakly, while missing oxygens do not trap positrons. In contrast, metal-ion vacancies in La2-xSrxCuO4 and YBa2Cu3O7-x bind positrons by ~1 eV, and oxygen-related defects appear to be the weak-binding sites in these materials. The sites that bind positrons only weakly, by energies ~kBT, are of particular interest in view of the complex temperature dependences of the annihilation characteristics that are observed in these materials.

Structural analysis of the 5{prime} region of mouse and human Huntington disease genes reveals conservation of putative promoter region and Di- and trinucleotide polymorphisms

DOE Office of Scientific and Technical Information (OSTI.GOV)

Lin, Biaoyang; Nasir, J.; Kalchman, M.A.

1995-02-10

We have previously cloned and characterized the murine homologue of the Huntington disease (HD) gene and shown that it maps to mouse chromosome 5 within a region of conserved synteny with human chromosome 4p16.3. Here we present a detailed comparison of the sequence of the putative promoter and the organization of the 5{prime} genomic region of the murine (Hdh) and human HD genes encompassing the first five exons. We show that in this region these two genes share identical exon boundaries, but have different-size introns. Two dinucleotide (CT) and one trinucleotide intronic polymorphism in Hdh and an intronic CA polymorphismmore » in the HD gene were identified. Comparison of 940-bp sequence 5{prime} to the putative translation start site reveals a highly conserved region (78.8% nucleotide identity) between Hdh and the HD gene from nucleotide -56 to -206 (of Hdh). Neither Hdh nor the HD gene have typical TATA or CCAAT elements, but both show one putative AP2 binding site and numerous potential Sp1 binding sites. The high sequence identity between Hdh and the HD gene for approximately 200 bp 5{prime} to the putative translation start site indicates that these sequences may play a role in regulating expression of the Huntington disease gene. 30 refs., 4 figs., 2 tabs.« less

Reactivity Study of Unsymmetrical β-Diketiminato Copper(I) Complexes: Effect of the Chelating Ring.

PubMed

Chuang, Wan-Jung; Hsu, Sung-Po; Chand, Kuldeep; Yu, Fu-Lun; Tsai, Cheng-Long; Tseng, Yu-Hsuan; Lu, Yuh-Hsiu; Kuo, Jen-Yu; Carey, James R; Chen, Hsuan-Ying; Chen, Hsing-Yin; Chiang, Michael Y; Hsu, Sodio C N

2017-03-06

β-Diketiminato copper(I) complexes play important roles in bioinspired catalytic chemistry and in applications to the materials industry. However, it has been observed that these complexes are very susceptible to disproportionation. Coordinating solvents or Lewis bases are typically used to prevent disproportionation and to block the coordination sites of the copper(I) center from further decomposition. Here, we incorporate this coordination protection directly into the molecule in order to increase the stability and reactivity of these complexes and to discover new copper(I) binding motifs. Here we describe the synthesis, structural characterization, and reactivity of a series of unsymmetrical N-aryl-N'-alkylpyridyl β-diketiminato copper(I) complexes and discuss the structures and reactivity of these complexes with respect to the length of the pyridyl arm. All of the aforementioned unsymmetrical ß-diketiminato copper(I) complexes bind CO reversibly and are stable to disproportionation. The binding ability of CO and the rate of pyridyl ligand decoordination of these copper(I) complexes are directly related to the competition between the degree of puckering of the chelate system and the steric demands of the N-aryl substituent.

Arabidopsis Polycomb Repressive Complex 2 binding sites contain putative GAGA factor binding motifs within coding regions of genes

PubMed Central

2013-01-01

Background Polycomb Repressive Complex 2 (PRC2) is an essential regulator of gene expression that maintains genes in a repressed state by marking chromatin with trimethylated Histone H3 lysine 27 (H3K27me3). In Arabidopsis, loss of PRC2 function leads to pleiotropic effects on growth and development thought to be due to ectopic expression of seed and embryo-specific genes. While there is some understanding of the mechanisms by which specific genes are targeted by PRC2 in animal systems, it is still not clear how PRC2 is recruited to specific regions of plant genomes. Results We used ChIP-seq to determine the genome-wide distribution of hemagglutinin (HA)-tagged FERTLIZATION INDEPENDENT ENDOSPERM (FIE-HA), the Extra Sex Combs homolog protein present in all Arabidopsis PRC2 complexes. We found that the FIE-HA binding sites co-locate with a subset of the H3K27me3 sites in the genome and that the associated genes were more likely to be de-repressed in mutants of PRC2 components. The FIE-HA binding sites are enriched for three sequence motifs including a putative GAGA factor binding site that is also found in Drosophila Polycomb Response Elements (PREs). Conclusions Our results suggest that PRC2 binding sites in plant genomes share some sequence features with Drosophila PREs. However, unlike Drosophila PREs which are located in promoters and devoid of H3K27me3, Arabidopsis FIE binding sites tend to be in gene coding regions and co-localize with H3K27me3. PMID:24001316

Copper and the Prion Protein: Methods, Structures, Function, and Disease

NASA Astrophysics Data System (ADS)

Millhauser, Glenn L.

2007-05-01

The transmissible spongiform encephalopathies (TSEs) arise from conversion of the membrane-bound prion protein from PrPC to PrPSc. Examples of the TSEs include mad cow disease, chronic wasting disease in deer and elk, scrapie in goats and sheep, and kuru and Creutzfeldt-Jakob disease in humans. Although the precise function of PrPC in healthy tissues is not known, recent research demonstrates that it binds Cu(II) in an unusual and highly conserved region of the protein termed the octarepeat domain. This review describes recent connections between copper and PrPC, with an emphasis on the electron paramagnetic resonance elucidation of the specific copper-binding sites, insights into PrPC function, and emerging connections between copper and prion disease.

Design and synthesis of inositolphosphoglycan putative insulin mediators.

PubMed

López-Prados, Javier; Cuevas, Félix; Reichardt, Niels-Christian; de Paz, José-Luis; Morales, Ezequiel Q; Martín-Lomas, Manuel

2005-03-07

The binding modes of a series of molecules, containing the glucosamine (1-->6) myo-inositol structural motif, into the ATP binding site of the catalytic subunit of cAMP-dependent protein kinase (PKA) have been analysed using molecular docking. These calculations predict that the presence of a phosphate group at the non-reducing end in pseudodisaccharide and pseudotrisaccharide structures properly orientate the molecule into the binding site and that pseudotrisaccharide structures present the best shape complementarity. Therefore, pseudodisaccharides and pseudotrisaccharides have been synthesised from common intermediates using effective synthetic strategies. On the basis of this synthetic chemistry, the feasibility of constructing small pseudotrisaccharide libraries on solid-phase using the same intermediates has been explored. The results from the biological evaluation of these molecules provide additional support to an insulin-mediated signalling system which involves the intermediacy of inositolphosphoglycans as putative insulin mediators.

gamma. -Preprotachykinin-(72-92)-peptide amide: An endogenous preprotachykinin I gene-derived peptide that preferentially binds to neurokinin-2 receptors

DOE Office of Scientific and Technical Information (OSTI.GOV)

Dam, T.V.; Takeda, Y.; Krause, J.E.

1990-01-01

The presence of N-terminally extended forms of neurokinin A has recently been reported in the mammalian brain. Among them, gamma-preprotachykinin-(72-92)-peptide amide (gamma-PPT-(72-92)-NH2), a peptide derived by posttranslational processing of gamma-preprotachykinin, is most prominent. We report here that this peptide most likely acts on neurokinin-2 receptor sites since neurokinin A (a putative neurokinin-2 agonist) and gamma-PPT-(72-92)-NH2 are potent competitors of 125I-labeled gamma-PPT-(72-92)-NH2 binding whereas selective neurokinin-1 and -3 agonists are not. Moreover, the distribution of 125I-labeled gamma-PPT-(72-92)-NH2 and 125I-labeled neurokinin A binding sites are very similar in rat brain. On the other hand, 125I-labeled Bolton-Hunter-substance P (a neurokinin-1 ligand) and 125I-labeledmore » Bolton-Hunter-eledoisin (a neurokinin-3 ligand) binding sites are differentially located in this tissue. Thus, it appears that gamma-PPT-(72-92)-NH2 binds to neurokinin-2 receptors and should be considered as a putative endogenous ligand for this receptor class.« less

The non-octarepeat copper binding site of the prion protein is a key regulator of prion conversion

NASA Astrophysics Data System (ADS)

Giachin, Gabriele; Mai, Phuong Thao; Tran, Thanh Hoa; Salzano, Giulia; Benetti, Federico; Migliorati, Valentina; Arcovito, Alessandro; Longa, Stefano Della; Mancini, Giordano; D'Angelo, Paola; Legname, Giuseppe

2015-10-01

The conversion of the prion protein (PrPC) into prions plays a key role in transmissible spongiform encephalopathies. Despite the importance for pathogenesis, the mechanism of prion formation has escaped detailed characterization due to the insoluble nature of prions. PrPC interacts with copper through octarepeat and non-octarepeat binding sites. Copper coordination to the non-octarepeat region has garnered interest due to the possibility that this interaction may impact prion conversion. We used X-ray absorption spectroscopy to study copper coordination at pH 5.5 and 7.0 in human PrPC constructs, either wild-type (WT) or carrying pathological mutations. We show that mutations and pH cause modifications of copper coordination in the non-octarepeat region. In the WT at pH 5.5, copper is anchored to His96 and His111, while at pH 7 it is coordinated by His111. Pathological point mutations alter the copper coordination at acidic conditions where the metal is anchored to His111. By using in vitro approaches, cell-based and computational techniques, we propose a model whereby PrPC coordinating copper with one His in the non-octarepeat region converts to prions at acidic condition. Thus, the non-octarepeat region may act as the long-sought-after prion switch, critical for disease onset and propagation.

Characterization of binding site heterogeneity for copper within dissolved organic matter fractions using two-dimensional correlation fluorescence spectroscopy.

PubMed

Hur, Jin; Lee, Bo-Mi

2011-06-01

The heterogeneity of copper binding characteristics for dissolved organic matter (DOM) fractions was investigated based on the fluorescence quenching of the synchronous fluorescence spectra upon the addition of copper and two-dimensional correlation spectroscopy (2D-COS). Hydrophobic acid (HoA) and hydrophilic (Hi) fractions of two different DOM (algal and leaf litter DOM) were used for this study. For both DOM, fluorescence quenching occurred at a wider range of wavelengths for the HoA fractions compared to the Hi fractions. The combined information of the synchronous and asynchronous maps derived from 2D-COS provided a clear picture of the heterogeneous distribution of the copper binding sites within each DOM fraction, which was not readily recognized by a simple comparison of the changes in the synchronous fluorescence spectra upon the addition of copper. For the algal DOM, higher stability constants were exhibited for the HoA versus the Hi fractions. The logarithms of the stability constants ranged from 4.8 to 6.1 and from 4.5 to 5.0 for the HoA and the Hi fractions of the algal DOM, respectively, depending on the associated wavelength and the fitted models. In contrast, no distinctive difference in the binding characteristics was found between the two fractions of the leaf litter DOM. This suggests that influences of the structural and chemical properties of DOM on copper binding may differ for DOM from different sources. The relative difference of the calculated stability constants within the DOM fractions were consistent with the sequential orders interpreted from the asynchronous 2D-COS. It is expected that 2D-COS will be widely applied to other DOM studies requiring detailed information on the heterogeneous nature and subsequent effects under a range of environmental conditions. Copyright © 2011 Elsevier Ltd. All rights reserved.

Functional characterization of transcription factor binding sites for HNF1-alpha, HNF3-beta (FOXA2), HNF4-alpha, Sp1 and Sp3 in the human prothrombin gene enhancer.

PubMed

Ceelie, H; Spaargaren-Van Riel, C C; De Jong, M; Bertina, R M; Vos, H L

2003-08-01

Prothrombin is a key component in blood coagulation. Overexpression of prothrombin leads to an increased risk of venous thrombosis. Therefore, the study of the transcriptional regulation of the prothrombin gene may help to identify mechanisms of overexpression. The aim of our study was to localize the regions within the prothrombin enhancer responsible for its activity, to identify the proteins binding to these regions, and to establish their functional importance. We constructed a set of prothrombin promoter 5' deletion constructs containing the firefly luciferase reporter gene, which were transiently transfected in HepG2, HuH7 and HeLa cells. Putative transcription factor (TF) binding sites were evaluated by electrophoretic mobility shift assays. The functional importance of each TF binding site was evaluated by site directed mutagenesis and transient transfection of the mutant constructs. We confirmed the major contribution of the enhancer region to the transcriptional activity of the prothrombin promoter. Analysis of this region revealed putative binding sites for hepatocyte nuclear factor HNF4, HNF3-beta and specificity protein(Sp)1. We identified six different TFs binding to three evolutionary conserved sites in the enhancer: HNF4-alpha (site 1), HNF1-alpha, HNF3-beta and an as yet unidentified TF (site 2) and the ubiquitously expressed TFs Sp1 and Sp3 (site 3). Mutagenesis studies showed that loss of binding of HNF3-beta resulted in a considerable decrease of enhancer activity, whereas loss of HNF4-alpha or Sp1/Sp3 resulted in milder reductions. The prothrombin enhancer plays a major role in regulation of prothrombin expression. Six different TFs are able to bind to this region. At least three of these TFs, HNF4-alpha, HNF3-beta and Sp1/Sp3, are important in regulation of prothrombin expression.

Trimeric Structure of (+)-Pinoresinol-forming Dirigent Protein at 1.95 Å Resolution with Three Isolated Active Sites

DOE PAGES

Kim, Kye-Won; Smith, Clyde A.; Daily, Michael D.; ...

2014-11-19

Control over phenoxy radical-radical coupling reactions in vivo in vascular plants was enigmatic until our discovery of dirigent proteins (DPs, from the Latin dirigere, to guide or align). The first three-dimensional structure of a DP ((+)-pinoresinol-forming DP, 1.95 Å resolution, rhombohedral space group H32)) is reported herein. It has a tightly packed trimeric structure with an eight-stranded β-barrel topology for each DP monomer. Each putative substrate binding and orientation coupling site is located on the trimer surface but too far apart for intermolecular coupling between sites. It is proposed that each site enables stereoselective coupling (using either two coniferyl alcoholmore » radicals or a radical and a monolignol). Interestingly, there are six differentially conserved residues in DPs affording either the (+)- or (₋)-antipodes in the vicinity of the putative binding site and region known to control stereoselectivity. We find DPs are involved in lignan biosynthesis, whereas dirigent domains/sites have been implicated in lignin deposition.« less

The second Cu(II)-binding site in a proton-rich environment interferes with the aggregation of amyloid-beta(1-40) into amyloid fibrils.

PubMed

Jun, Sangmi; Gillespie, Joel R; Shin, Byong-kyu; Saxena, Sunil

2009-11-17

The overall morphology and Cu(II) ion coordination for the aggregated amyloid-beta(1-40) [Abeta(1-40)] in N-ethylmorpholine (NEM) buffer are affected by Cu(II) ion concentration. This effect is investigated by transmission electron microscopy (TEM), atomic force microscopy (AFM), and electron spin echo envelope modulation (ESEEM) spectroscopy. At lower than equimolar concentrations of Cu(II) ions, fibrillar aggregates of Abeta(1-40) are observed. At these concentrations of Cu(II), the monomeric and fibrillar Abeta(1-40) ESEEM data indicate that the Cu(II) ion is coordinated by histidine residues. For aggregated Abeta(1-40) at a Cu(II):Abeta molar ratio of 2:1, TEM and AFM images show both linear fibrils and granular amorphous aggregates. The ESEEM spectra show that the multi-histidine coordination for Cu(II) ion partially breaks up and becomes exposed to water or exchangeable protons of the peptide at a higher Cu(II) concentration. Since the continuous-wave electron spin resonance results also suggest two copper-binding sites in Abeta(1-40), the proton ESEEM peak may arise from the second copper-binding site, which may be significantly involved in the formation of granular amorphous aggregates. Thioflavin T fluorescence and circular dichroism experiments also show that Cu(II) inhibits the formation of fibrils and induces a nonfibrillar beta-sheet conformation. Therefore, we propose that Abeta(1-40) has a second copper-binding site in a proton-rich environment and the second binding Cu(II) ion interferes with a conformational transition into amyloid fibrils, inducing the formation of granular amorphous aggregates.

Quantum mechanical calculations suggest that lytic polysaccharide monooxygenases use a copper-oxyl, oxygen-rebound mechanism

PubMed Central

Kim, Seonah; Ståhlberg, Jerry; Sandgren, Mats; Paton, Robert S.; Beckham, Gregg T.

2014-01-01

Lytic polysaccharide monooxygenases (LPMOs) exhibit a mononuclear copper-containing active site and use dioxygen and a reducing agent to oxidatively cleave glycosidic linkages in polysaccharides. LPMOs represent a unique paradigm in carbohydrate turnover and exhibit synergy with hydrolytic enzymes in biomass depolymerization. To date, several features of copper binding to LPMOs have been elucidated, but the identity of the reactive oxygen species and the key steps in the oxidative mechanism have not been elucidated. Here, density functional theory calculations are used with an enzyme active site model to identify the reactive oxygen species and compare two hypothesized reaction pathways in LPMOs for hydrogen abstraction and polysaccharide hydroxylation; namely, a mechanism that employs a η1-superoxo intermediate, which abstracts a substrate hydrogen and a hydroperoxo species is responsible for substrate hydroxylation, and a mechanism wherein a copper-oxyl radical abstracts a hydrogen and subsequently hydroxylates the substrate via an oxygen-rebound mechanism. The results predict that oxygen binds end-on (η1) to copper, and that a copper-oxyl–mediated, oxygen-rebound mechanism is energetically preferred. The N-terminal histidine methylation is also examined, which is thought to modify the structure and reactivity of the enzyme. Density functional theory calculations suggest that this posttranslational modification has only a minor effect on the LPMO active site structure or reactivity for the examined steps. Overall, this study suggests the steps in the LPMO mechanism for oxidative cleavage of glycosidic bonds. PMID:24344312

DOE Office of Scientific and Technical Information (OSTI.GOV)

Streltsov, Victor A.; Titmuss, Stephen J.; Epa, V. Chandana

Neurodegeneration observed in Alzheimer disease (AD) is believed to be related to the toxicity from reactive oxygen species (ROS) produced in the brain by the amyloid-{beta} (A{beta}) protein bound primarily to copper ions. The evidence for an oxidative stress role of A{beta}-Cu redox chemistry is still incomplete. Details of the copper binding site in A{beta} may be critical to the etiology of AD. Here we present the structure determined by combining x-ray absorption spectroscopy (XAS) and density functional theory analysis of A{beta} peptides complexed with Cu{sup 2+} in solution under a range of buffer conditions. Phosphate-buffered saline buffer salt (NaCl)more » concentration does not affect the high-affinity copper binding mode but alters the second coordination sphere. The XAS spectra for truncated and full-length A{beta}-Cu{sup 2+} peptides are similar. The novel distorted six-coordinated (3N3O) geometry around copper in the A{beta}-Cu{sup 2+} complexes include three histidines: glutamic, or/and aspartic acid, and axial water. The structure of the high-affinity Cu{sup 2+} binding site is consistent with the hypothesis that the redox activity of the metal ion bound to A{beta} can lead to the formation of dityrosine-linked dimers found in AD.« less

Human Lineage-Specific Transcriptional Regulation through GA-Binding Protein Transcription Factor Alpha (GABPa)

PubMed Central

Perdomo-Sabogal, Alvaro; Nowick, Katja; Piccini, Ilaria; Sudbrak, Ralf; Lehrach, Hans; Yaspo, Marie-Laure; Warnatz, Hans-Jörg; Querfurth, Robert

2016-01-01

A substantial fraction of phenotypic differences between closely related species are likely caused by differences in gene regulation. While this has already been postulated over 30 years ago, only few examples of evolutionary changes in gene regulation have been verified. Here, we identified and investigated binding sites of the transcription factor GA-binding protein alpha (GABPa) aiming to discover cis-regulatory adaptations on the human lineage. By performing chromatin immunoprecipitation-sequencing experiments in a human cell line, we found 11,619 putative GABPa binding sites. Through sequence comparisons of the human GABPa binding regions with orthologous sequences from 34 mammals, we identified substitutions that have resulted in 224 putative human-specific GABPa binding sites. To experimentally assess the transcriptional impact of those substitutions, we selected four promoters for promoter-reporter gene assays using human and African green monkey cells. We compared the activities of wild-type promoters to mutated forms, where we have introduced one or more substitutions to mimic the ancestral state devoid of the GABPa consensus binding sequence. Similarly, we introduced the human-specific substitutions into chimpanzee and macaque promoter backgrounds. Our results demonstrate that the identified substitutions are functional, both in human and nonhuman promoters. In addition, we performed GABPa knock-down experiments and found 1,215 genes as strong candidates for primary targets. Further analyses of our data sets link GABPa to cognitive disorders, diabetes, KRAB zinc finger (KRAB-ZNF), and human-specific genes. Thus, we propose that differences in GABPa binding sites played important roles in the evolution of human-specific phenotypes. PMID:26814189

Activation of both acfA and acfD transcription by Vibrio cholerae ToxT requires binding to two centrally located DNA sites in an inverted repeat conformation.

PubMed

Withey, Jeffrey H; DiRita, Victor J

2005-05-01

The Gram-negative bacterium Vibrio cholerae is the infectious agent responsible for the disease Asiatic cholera. The genes required for V. cholerae virulence, such as those encoding the cholera toxin (CT) and toxin-coregulated pilus (TCP), are controlled by a cascade of transcriptional activators. Ultimately, the direct transcriptional activator of the majority of V. cholerae virulence genes is the AraC/XylS family member ToxT protein, the expression of which is activated by the ToxR and TcpP proteins. Previous studies have identified the DNA sites to which ToxT binds upstream of the ctx operon, encoding CT, and the tcpA operon, encoding, among other products, the major subunit of the TCP. These known ToxT binding sites are seemingly dissimilar in sequence other than being A/T rich. Further results suggested that ctx and tcpA each has a pair of ToxT binding sites arranged in a direct repeat orientation upstream of the core promoter elements. In this work, using both transcriptional lacZ fusions and in vitro copper-phenanthroline footprinting experiments, we have identified the ToxT binding sites between the divergently transcribed acfA and acfD genes, which encode components of the accessory colonization factor required for efficient intestinal colonization by V. cholerae. Our results indicate that ToxT binds to a pair of DNA sites between acfA and acfD in an inverted repeat orientation. Moreover, a mutational analysis of the ToxT binding sites indicates that both binding sites are required by ToxT for transcriptional activation of both acfA and acfD. Using copper-phenanthroline footprinting to assess the occupancy of ToxT on DNA having mutations in one of these binding sites, we found that protection by ToxT of the unaltered binding site was not affected, whereas protection by ToxT of the mutant binding site was significantly reduced in the region of the mutations. The results of further footprinting experiments using DNA templates having +5 bp and +10 bp insertions between the two ToxT binding sites indicate that both binding sites are occupied by ToxT regardless of their positions relative to each other. Based on these results, we propose that ToxT binds independently to two DNA sites between acfA and acfD to activate transcription of both genes.

Copper Complexation Screen Reveals Compounds with Potent Antibiotic Properties against Methicillin-Resistant Staphylococcus aureus

PubMed Central

Haeili, Mehri; Moore, Casey; Davis, Christopher J. C.; Cochran, James B.; Shah, Santosh; Shrestha, Tej B.; Zhang, Yaofang; Bossmann, Stefan H.; Benjamin, William H.

2014-01-01

Macrophages take advantage of the antibacterial properties of copper ions in the killing of bacterial intruders. However, despite the importance of copper for innate immune functions, coordinated efforts to exploit copper ions for therapeutic interventions against bacterial infections are not yet in place. Here we report a novel high-throughput screening platform specifically developed for the discovery and characterization of compounds with copper-dependent antibacterial properties toward methicillin-resistant Staphylococcus aureus (MRSA). We detail how one of the identified compounds, glyoxal-bis(N4-methylthiosemicarbazone) (GTSM), exerts its potent strictly copper-dependent antibacterial properties on MRSA. Our data indicate that the activity of the GTSM-copper complex goes beyond the general antibacterial effects of accumulated copper ions and suggest that, in contrast to prevailing opinion, copper complexes can indeed exhibit species- and target-specific activities. Based on experimental evidence, we propose that copper ions impose structural changes upon binding to the otherwise inactive GTSM ligand and transfer antibacterial properties to the chelate. In turn, GTSM determines target specificity and utilizes a redox-sensitive release mechanism through which copper ions are deployed at or in close proximity to a putative target. According to our proof-of-concept screen, copper activation is not a rare event and even extends to already established drugs. Thus, copper-activated compounds could define a novel class of anti-MRSA agents that amplify copper-dependent innate immune functions of the host. To this end, we provide a blueprint for a high-throughput drug screening campaign which considers the antibacterial properties of copper ions at the host-pathogen interface. PMID:24752262

Tracing Cytoplasmic Ca2+ Ion and Water Access Points in the Ca2+-ATPase

PubMed Central

Musgaard, Maria; Thøgersen, Lea; Schiøtt, Birgit; Tajkhorshid, Emad

2012-01-01

Sarco(endo)plasmic reticulum Ca2+-ATPase (SERCA) transports two Ca2+ ions across the membrane of the sarco(endo)plasmic reticulum against the concentration gradient, harvesting the required energy by hydrolyzing one ATP molecule during each transport cycle. Although SERCA is one of the best structurally characterized membrane transporters, it is still largely unknown how the transported Ca2+ ions reach their transmembrane binding sites in SERCA from the cytoplasmic side. Here, we performed extended all-atom molecular dynamics simulations of SERCA. The calculated electrostatic potential of the protein reveals a putative mechanism by which cations may be attracted to and bind to the Ca2+-free state of the transporter. Additional molecular dynamics simulations performed on a Ca2+-bound state of SERCA reveal a water-filled pathway that may be used by the Ca2+ ions to reach their buried binding sites from the cytoplasm. Finally, several residues that are involved in attracting and guiding the cations toward the possible entry channel are identified. The results point to a single Ca2+ entry site close to the kinked part of the first transmembrane helix, in a region loaded with negatively charged residues. From this point, a water pathway outlines a putative Ca2+ translocation pathway toward the transmembrane ion-binding sites. PMID:22339863

Using Tryptophan Mutants To Probe the Structural and Functional Status of BsSCO, a Copper Binding, Cytochrome c Oxidase Assembly Protein from Bacillus subtilis.

PubMed

Hussain, Shina; Andrews, Diann; Hill, Bruce C

2017-12-05

The synthesis of cytochrome c oxidase protein from Bacillus subtilis (i.e., BsSCO) binds copper with picomolar affinity, which increases the protein's melting temperature (i.e., T M ) by 20 °C. Here two native tryptophans (i.e., W36 and W101) are identified as major contributors to BsSCO's structural form, and their contributions to the stability, intrinsic fluorescence, and copper binding properties of BsSCO are explored. Single mutations of tryptophan to phenylalanine decrease the T M by 10 °C and the folding free energy by 3-4 kcal/mol. A more severe change to alanine (i.e., W36A BsSCO) decreases the T M by 20 °C and the stability by 9 kcal/mol. However, these mutants bind copper with high affinity and assemble cytochrome c oxidase in vivo. Replacing phenylalanine at a position near (∼5 Å) the copper binding site with tryptophan (i.e., F42W) increases the T M of apo-BsSCO by 3 °C but diminishes the effect of copper binding. When both native tryptophans are changed to alanine, apo-BsSCO is unfolded in vitro and is not functional in cytochrome c oxidase assembly in vivo. A double-mutant of BsSCO in which W36A is combined with F42W exhibits a form of metastability. Apo-W36A/F42W BsSCO melts at 37 °C, which upon binding of copper shifts to 65 °C. B. subtilis expressing W36A/F42W BsSCO and grown at 37 °C does not assemble cytochrome c oxidase. However, when these cells are cooled to 25 °C, cytochrome c oxidase activity is recovered. Our results illustrate the subtle relationship between the structural stability and functional properties of BsSCO in the assembly of cytochrome c oxidase.

Cu(I)-mediated Allosteric Switching in a Copper-sensing Operon Repressor (CsoR)*

PubMed Central

Chang, Feng-Ming James; Coyne, H. Jerome; Cubillas, Ciro; Vinuesa, Pablo; Fang, Xianyang; Ma, Zhen; Ma, Dejian; Helmann, John D.; García-de los Santos, Alejandro; Wang, Yun-Xing; Dann, Charles E.; Giedroc, David P.

2014-01-01

The copper-sensing operon repressor (CsoR) is representative of a major Cu(I)-sensing family of bacterial metalloregulatory proteins that has evolved to prevent cytoplasmic copper toxicity. It is unknown how Cu(I) binding to tetrameric CsoRs mediates transcriptional derepression of copper resistance genes. A phylogenetic analysis of 227 DUF156 protein members, including biochemically or structurally characterized CsoR/RcnR repressors, reveals that Geobacillus thermodenitrificans (Gt) CsoR characterized here is representative of CsoRs from pathogenic bacilli Listeria monocytogenes and Bacillus anthracis. The 2.56 Å structure of Cu(I)-bound Gt CsoR reveals that Cu(I) binding induces a kink in the α2-helix between two conserved copper-ligating residues and folds an N-terminal tail (residues 12–19) over the Cu(I) binding site. NMR studies of Gt CsoR reveal that this tail is flexible in the apo-state with these dynamics quenched upon Cu(I) binding. Small angle x-ray scattering experiments on an N-terminally truncated Gt CsoR (Δ2–10) reveal that the Cu(I)-bound tetramer is hydrodynamically more compact than is the apo-state. The implications of these findings for the allosteric mechanisms of other CsoR/RcnR repressors are discussed. PMID:24831014

Structural and Biochemical Characterization of a Copper-Binding Mutant of the Organomercurial Lyase MerB: Insight into the Key Role of the Active Site Aspartic Acid in Hg-Carbon Bond Cleavage and Metal Binding Specificity.

PubMed

Wahba, Haytham M; Lecoq, Lauriane; Stevenson, Michael; Mansour, Ahmed; Cappadocia, Laurent; Lafrance-Vanasse, Julien; Wilkinson, Kevin J; Sygusch, Jurgen; Wilcox, Dean E; Omichinski, James G

2016-02-23

In bacterial resistance to mercury, the organomercurial lyase (MerB) plays a key role in the detoxification pathway through its ability to cleave Hg-carbon bonds. Two cysteines (C96 and C159; Escherichia coli MerB numbering) and an aspartic acid (D99) have been identified as the key catalytic residues, and these three residues are conserved in all but four known MerB variants, where the aspartic acid is replaced with a serine. To understand the role of the active site serine, we characterized the structure and metal binding properties of an E. coli MerB mutant with a serine substituted for D99 (MerB D99S) as well as one of the native MerB variants containing a serine residue in the active site (Bacillus megaterium MerB2). Surprisingly, the MerB D99S protein copurified with a bound metal that was determined to be Cu(II) from UV-vis absorption, inductively coupled plasma mass spectrometry, nuclear magnetic resonance, and electron paramagnetic resonance studies. X-ray structural studies revealed that the Cu(II) is bound to the active site cysteine residues of MerB D99S, but that it is displaced following the addition of either an organomercurial substrate or an ionic mercury product. In contrast, the B. megaterium MerB2 protein does not copurify with copper, but the structure of the B. megaterium MerB2-Hg complex is highly similar to the structure of the MerB D99S-Hg complexes. These results demonstrate that the active site aspartic acid is crucial for both the enzymatic activity and metal binding specificity of MerB proteins and suggest a possible functional relationship between MerB and its only known structural homologue, the copper-binding protein NosL.

Two-Dimensional Wetting of a Stepped Copper Surface

NASA Astrophysics Data System (ADS)

Lin, C.; Avidor, N.; Corem, G.; Godsi, O.; Alexandrowicz, G.; Darling, G. R.; Hodgson, A.

2018-02-01

Highly corrugated, stepped surfaces present regular 1D arrays of binding sites, creating a complex, heterogeneous environment to water. Rather than decorating the hydrophilic step sites to form 1D chains, water on stepped Cu(511) forms an extended 2D network that binds strongly to the steps but bridges across the intervening hydrophobic Cu(100) terraces. The hydrogen-bonded network contains pentamer, hexamer, and octomer water rings that leave a third of the stable Cu step sites unoccupied in order to bind water H down close to the step dipole and complete three hydrogen bonds per molecule.

The Copper Active Site of CBM33 Polysaccharide Oxygenases

PubMed Central

2013-01-01

The capacity of metal-dependent fungal and bacterial polysaccharide oxygenases, termed GH61 and CBM33, respectively, to potentiate the enzymatic degradation of cellulose opens new possibilities for the conversion of recalcitrant biomass to biofuels. GH61s have already been shown to be unique metalloenzymes containing an active site with a mononuclear copper ion coordinated by two histidines, one of which is an unusual τ-N-methylated N-terminal histidine. We now report the structural and spectroscopic characterization of the corresponding copper CBM33 enzymes. CBM33 binds copper with high affinity at a mononuclear site, significantly stabilizing the enzyme. X-band EPR spectroscopy of Cu(II)-CBM33 shows a mononuclear type 2 copper site with the copper ion in a distorted axial coordination sphere, into which azide will coordinate as evidenced by the concomitant formation of a new absorption band in the UV/vis spectrum at 390 nm. The enzyme’s three-dimensional structure contains copper, which has been photoreduced to Cu(I) by the incident X-rays, confirmed by X-ray absorption/fluorescence studies of both aqueous solution and intact crystals of Cu-CBM33. The single copper(I) ion is ligated in a T-shaped configuration by three nitrogen atoms from two histidine side chains and the amino terminus, similar to the endogenous copper coordination geometry found in fungal GH61. PMID:23540833

Identification of functional domains in Arabidopsis thaliana mRNA decapping enzyme (AtDcp2)

PubMed Central

Gunawardana, Dilantha; Cheng, Heung-Chin; Gayler, Kenwyn R.

2008-01-01

The Arabidopsis thaliana decapping enzyme (AtDcp2) was characterized by bioinformatics analysis and by biochemical studies of the enzyme and mutants produced by recombinant expression. Three functionally significant regions were detected: (i) a highly disordered C-terminal region with a putative PSD-95, Discs-large, ZO-1 (PDZ) domain-binding motif, (ii) a conserved Nudix box constituting the putative active site and (iii) a putative RNA binding domain consisting of the conserved Box B and a preceding loop region. Mutation of the putative PDZ domain-binding motif improved the stability of recombinant AtDcp2 and secondary mutants expressed in Escherichia coli. Such recombinant AtDcp2 specifically hydrolysed capped mRNA to produce 7-methyl GDP and decapped RNA. AtDcp2 activity was Mn2+- or Mg2+-dependent and was inhibited by the product 7-methyl GDP. Mutation of the conserved glutamate-154 and glutamate-158 in the Nudix box reduced AtDcp2 activity up to 400-fold and showed that AtDcp2 employs the catalytic mechanism conserved amongst Nudix hydrolases. Unlike many Nudix hydrolases, AtDcp2 is refractory to inhibition by fluoride ions. Decapping was dependent on binding to the mRNA moiety rather than to the 7-methyl diguanosine triphosphate cap of the substrate. Mutational analysis of the putative RNA-binding domain confirmed the functional significance of an 11-residue loop region and the conserved Box B. PMID:18025047

The involvement of coordinative interactions in the binding of dihydrolipoamide dehydrogenase to titanium dioxide-Localization of a putative binding site.

PubMed

Dayan, Avraham; Babin, Gilad; Ganoth, Assaf; Kayouf, Nivin Samir; Nitoker Eliaz, Neta; Mukkala, Srijana; Tsfadia, Yossi; Fleminger, Gideon

2017-08-01

Titanium (Ti) and its alloys are widely used in orthodontic and orthopedic implants by virtue to their high biocompatibility, mechanical strength, and high resistance to corrosion. Biointegration of the implants with the tissue requires strong interactions, which involve biological molecules, proteins in particular, with metal oxide surfaces. An exocellular high-affinity titanium dioxide (TiO 2 )-binding protein (TiBP), purified from Rhodococcus ruber, has been previously studied in our lab. This protein was shown to be homologous with the orthologous cytoplasmic rhodococcal dihydrolipoamide dehydrogenase (rhDLDH). We have found that rhDLDH and its human homolog (hDLDH) share the TiO 2 -binding capabilities with TiBP. Intrigued by the unique TiO 2 -binding properties of hDLDH, we anticipated that it may serve as a molecular bridge between Ti-based medical structures and human tissues. The objective of the current study was to locate the region and the amino acids of the protein that mediate the protein-TiO 2 surface interaction. We demonstrated the role of acidic amino acids in the nonelectrostatic enzyme/dioxide interactions at neutral pH. The observation that the interaction of DLDH with various metal oxides is independent of their isoelectric values strengthens this notion. DLDH does not lose its enzymatic activity upon binding to TiO 2 , indicating that neither the enzyme undergoes major conformational changes nor the TiO 2 binding site is blocked. Docking predictions suggest that both rhDLDH and hDLDH bind TiO 2 through similar regions located far from the active site and the dimerization sites. The putative TiO 2 -binding regions of both the bacterial and human enzymes were found to contain a CHED (Cys, His, Glu, Asp) motif, which has been shown to participate in metal-binding sites in proteins. Copyright © 2017 John Wiley & Sons, Ltd.

Subsurface Oxygen in Oxide-Derived Copper Electrocatalysts for Carbon Dioxide Reduction

DOE PAGES

Eilert, Andre; Cavalca, Filippo; Roberts, F. Sloan; ...

2016-12-16

Copper electrocatalysts derived from an oxide have shown extraordinary electrochemical properties for the carbon dioxide reduction reaction (CO 2RR). Using in situ ambient pressure X-ray photoelectron spectroscopy and quasi in situ electron energy-loss spectroscopy in a transmission electron microscope, we show that there is a substantial amount of residual oxygen in nanostructured, oxide-derived copper electrocatalysts but no residual copper oxide. On the basis of these findings in combination with density functional theory simulations, we propose that residual subsurface oxygen changes the electronic structure of the catalyst and creates sites with higher carbon monoxide binding energy. If such sites are stablemore » under the strongly reducing conditions found in CO 2RR, these findings would explain the high efficiencies of oxide-derived copper in reducing carbon dioxide to multicarbon compounds such as ethylene.« less

Putative Prostate Cancer Risk SNP in an Androgen Receptor‐Binding Site of the Melanophilin Gene Illustrates Enrichment of Risk SNPs in Androgen Receptor Target Sites

PubMed Central

Bu, Huajie; Narisu, Narisu; Schlick, Bettina; Rainer, Johannes; Manke, Thomas; Schäfer, Georg; Pasqualini, Lorenza; Chines, Peter; Schweiger, Michal R.; Fuchsberger, Christian

2015-01-01

ABSTRACT Genome‐wide association studies have identified genomic loci, whose single‐nucleotide polymorphisms (SNPs) predispose to prostate cancer (PCa). However, the mechanisms of most of these variants are largely unknown. We integrated chromatin‐immunoprecipitation‐coupled sequencing and microarray expression profiling in TMPRSS2‐ERG gene rearrangement positive DUCaP cells with the GWAS PCa risk SNPs catalog to identify disease susceptibility SNPs localized within functional androgen receptor‐binding sites (ARBSs). Among the 48 GWAS index risk SNPs and 3,917 linked SNPs, 80 were found located in ARBSs. Of these, rs11891426:T>G in an intron of the melanophilin gene (MLPH) was within a novel putative auxiliary AR‐binding motif, which is enriched in the neighborhood of canonical androgen‐responsive elements. T→G exchange attenuated the transcriptional activity of the ARBS in an AR reporter gene assay. The expression of MLPH in primary prostate tumors was significantly lower in those with the G compared with the T allele and correlated significantly with AR protein. Higher melanophilin level in prostate tissue of patients with a favorable PCa risk profile points out a tumor‐suppressive effect. These results unravel a hidden link between AR and a functional putative PCa risk SNP, whose allele alteration affects androgen regulation of its host gene MLPH. PMID:26411452

Fusaric acid induces a notochord malformation in zebrafish via copper chelation.

PubMed

Yin, Emily S; Rakhmankulova, Malika; Kucera, Kaury; de Sena Filho, Jose Guedes; Portero, Carolina E; Narváez-Trujillo, Alexandra; Holley, Scott A; Strobel, Scott A

2015-08-01

Over a thousand extracts were tested for phenotypic effects in developing zebrafish embryos to identify bioactive molecules produced by endophytic fungi. One extract isolated from Fusarium sp., a widely distributed fungal genus found in soil and often associated with plants, induced an undulated notochord in developing zebrafish embryos. The active compound was isolated and identified as fusaric acid. Previous literature has shown this phenotype to be associated with copper chelation from the active site of lysyl oxidase, but the ability of fusaric acid to bind copper ions has not been well described. Isothermal titration calorimetry revealed that fusaric acid is a modest copper chelator with a binding constant of 4.4 × 10(5) M(-1). These results shed light on the toxicity of fusaric acid and the potential teratogenic effects of consuming plants infected with Fusarium sp.

Characterization and localization of arginine vasotocin receptors in the brain and kidney of an amphibian

DOE Office of Scientific and Technical Information (OSTI.GOV)

Boyd, S.K.

1987-01-01

Because arginine vasotocin (AVT) activates male sexual behaviors in the rough-skinned newt (Taricha granulosa), quantitative autoradiography with radiolabeled arginine vasopressin (/sup 3/H-AVP) was used to localize and characterize putative AVT receptors in the brain of this amphibian. Binding of /sup 3/H-AVP to sites within the medial pallium was saturable, specific, reversible, of high affinity and low capacity. These binding sites appear to represent authentic central nervous system receptors for AVT. Furthermore, ligand specificity for the binding sites in this amphibian differs from that reported for AVP binding sites in rat brains. Dense concentrations of specific binding sites were located inmore » the olfactory nerve as it entered the olfactory bulb within the medial pallium, dorsal pallium, and amygdala pars lateralis of the telencephalon, and in the tegmental region of the medulla. Concentrations of binding sites differed significantly among various brain regions. A comparison of male and female newts collected during the breeding season revealed no sexual dimorphism. These areas may represent site(s) of action where AVT elicits sexual behaviors in male T. granulosa.« less

Trimeric structure of (+)-pinoresinol-forming dirigent protein at 1.95 Å resolution with three isolated active sites.

PubMed

Kim, Kye-Won; Smith, Clyde A; Daily, Michael D; Cort, John R; Davin, Laurence B; Lewis, Norman G

2015-01-16

Control over phenoxy radical-radical coupling reactions in vivo in vascular plants was enigmatic until our discovery of dirigent proteins (DPs, from the Latin dirigere, to guide or align). The first three-dimensional structure of a DP ((+)-pinoresinol-forming DP, 1.95 Å resolution, rhombohedral space group H32)) is reported herein. It has a tightly packed trimeric structure with an eight-stranded β-barrel topology for each DP monomer. Each putative substrate binding and orientation coupling site is located on the trimer surface but too far apart for intermolecular coupling between sites. It is proposed that each site enables stereoselective coupling (using either two coniferyl alcohol radicals or a radical and a monolignol). Interestingly, there are six differentially conserved residues in DPs affording either the (+)- or (-)-antipodes in the vicinity of the putative binding site and region known to control stereoselectivity. DPs are involved in lignan biosynthesis, whereas dirigent domains/sites have been implicated in lignin deposition. © 2015 by The American Society for Biochemistry and Molecular Biology, Inc.

Ethylene Receptor 1 (ETR1) Is Sufficient and Has the Predominant Role in Mediating Inhibition of Ethylene Responses by Silver in Arabidopsis thaliana*

PubMed Central

McDaniel, Brittany K.; Binder, Brad M.

2012-01-01

Ethylene influences many processes in Arabidopsis thaliana through the action of five receptor isoforms. All five isoforms use copper as a cofactor for binding ethylene. Previous research showed that silver can substitute for copper as a cofactor for ethylene binding activity in the ETR1 ethylene receptor yet also inhibit ethylene responses in plants. End-point and rapid kinetic analyses of dark-grown seedling growth revealed that the effects of silver are mostly dependent upon ETR1, and ETR1 alone is sufficient for the effects of silver. Ethylene responses in etr1-6 etr2-3 ein4-4 triple mutants were not blocked by silver. Transformation of these triple mutants with cDNA for each receptor isoform under the promoter control of ETR1 revealed that the cETR1 transgene completely rescued responses to silver while the cETR2 transgene failed to rescue these responses. The other three isoforms partially rescued responses to silver. Ethylene binding assays on the binding domains of the five receptor isoforms expressed in yeast showed that silver supports ethylene binding to ETR1 and ERS1 but not the other isoforms. Thus, silver may have an effect on ethylene signaling outside of the ethylene binding pocket of the receptors. Ethylene binding to ETR1 with silver was ∼30% of binding with copper. However, alterations in the Kd for ethylene binding to ETR1 and the half-time of ethylene dissociation from ETR1 do not underlie this lower binding. Thus, it is likely that the lower ethylene binding activity of ETR1 with silver is due to fewer ethylene binding sites generated with silver versus copper. PMID:22692214

DOE Office of Scientific and Technical Information (OSTI.GOV)

Unterberger, Claudia; Hanson, Steven; Department of Infection, Immunity and Inflammation, University of Leicester, University Road, Leicester LE1 9HN

Little is known about determinants regulating expression of Mannan-binding lectin associated serine protease-2 (MASP-2), the effector component of the lectin pathway of complement activation. Comparative bioinformatic analysis of the MASP2 promoter regions in human, mouse, and rat, revealed conservation of two putative Stat binding sites, termed StatA and StatB. Site directed mutagenesis specific for these sites was performed. Transcription activity was decreased 5-fold when StatB site was mutated in the wildtype reporter gene construct. Gel retardation and competition assays demonstrated that proteins contained in the nuclear extract prepared from HepG2 specifically bound double-stranded StatB oligonucleotides. Supershift analysis revealed Stat3 tomore » be the major specific binding protein. We conclude that Stat3 binding is important for MASP2 promoter activity.« less

A Purple Cupredoxin from Nitrosopumilus maritimus Containing a Mononuclear Type 1 Copper Center with an Open Binding Site

DOE Office of Scientific and Technical Information (OSTI.GOV)

Hosseinzadeh, Parisa; Tian, Shiliang; Marshall, Nicholas M.

2016-05-25

Mononuclear cupredoxin proteins usually contain a coordinately saturated type 1 copper (T1Cu) center and function exclusively as electron carriers. Here we report a cupredoxin isolated from the nitrifying archaeon Nitrosopumilus maritimus SCM1, called Nmar1307, that contains a T1Cu center with an open binding site containing water. It displays a deep purple color due to strong absorptions around 413 nm (1880 M –1 cm –1) and 558 nm (2290 M –1 cm –1) in the UV–vis electronic spectrum. EPR studies suggest the protein contains two Cu(II) species of nearly equal population, one nearly axial, with hyperfine constant A∥ = 98 ×more » 10 –4 cm –1, and another more rhombic, with a smaller A∥ value of 69 × 10 –4 cm –1. The X-ray crystal structure at 1.6 Å resolution confirms that it contains a Cu atom coordinated by two His and one Cys in a trigonal plane, with an axial H2O at 2.25 Å. Both UV–vis absorption and EPR spectroscopic studies suggest that the Nmar1307 can oxidize NO to nitrite, an activity that is attributable to the high reduction potential (354 mV vs SHE) of the copper site. These results suggest that mononuclear cupredoxins can have a wide range of structural features, including an open binding site containing water, making this class of proteins even more versatile.« less

Structural and Genetic Analyses of the Mycobacterium tuberculosis Protein Kinase B Sensor Domain Identify a Potential Ligand-binding Site.

PubMed

Prigozhin, Daniil M; Papavinasasundaram, Kadamba G; Baer, Christina E; Murphy, Kenan C; Moskaleva, Alisa; Chen, Tony Y; Alber, Tom; Sassetti, Christopher M

2016-10-28

Monitoring the environment with serine/threonine protein kinases is critical for growth and survival of Mycobacterium tuberculosis, a devastating human pathogen. Protein kinase B (PknB) is a transmembrane serine/threonine protein kinase that acts as an essential regulator of mycobacterial growth and division. The PknB extracellular domain (ECD) consists of four repeats homologous to penicillin-binding protein and serine/threonine kinase associated (PASTA) domains, and binds fragments of peptidoglycan. These properties suggest that PknB activity is modulated by ECD binding to peptidoglycan substructures, however, the molecular mechanisms underpinning PknB regulation remain unclear. In this study, we report structural and genetic characterization of the PknB ECD. We determined the crystal structures of overlapping ECD fragments at near atomic resolution, built a model of the full ECD, and discovered a region on the C-terminal PASTA domain that has the properties of a ligand-binding site. Hydrophobic interaction between this surface and a bound molecule of citrate was observed in a crystal structure. Our genetic analyses in M. tuberculosis showed that nonfunctional alleles were produced either by deletion of any of single PASTA domain or by mutation of individual conserved residues lining the putative ligand-binding surface of the C-terminal PASTA repeat. These results define two distinct structural features necessary for PknB signal transduction, a fully extended ECD and a conserved, membrane-distal putative ligand-binding site. © 2016 by The American Society for Biochemistry and Molecular Biology, Inc.

Bioinorganic Chemistry of Parkinson's Disease: Affinity and Structural Features of Cu(I) Binding to the Full-Length β-Synuclein Protein.

PubMed

Miotto, Marco C; Pavese, Mayra D; Quintanar, Liliana; Zweckstetter, Markus; Griesinger, Christian; Fernández, Claudio O

2017-09-05

Alterations in the levels of copper in brain tissue and formation of α-synuclein (αS)-copper complexes might play a key role in the amyloid aggregation of αS and the onset of Parkinson's disease (PD). Recently, we demonstrated that formation of the high-affinity Cu(I) complex with the N-terminally acetylated form of the protein αS substantially increases and stabilizes local conformations with α-helical secondary structure and restricted motility. In this work, we performed a detailed NMR-based structural characterization of the Cu(I) complexes with the full-length acetylated form of its homologue β-synuclein (βS), which is colocalized with αS in vivo and can bind copper ions. Our results show that, similarly to αS, the N-terminal region of βS constitutes the preferential binding interface for Cu(I) ions, encompassing two independent and noninteractive Cu(I) binding sites. According to these results, βS binds the metal ion with higher affinity than αS, in a coordination environment that involves the participation of Met-1, Met-5, and Met-10 residues (site 1). Compared to αS, the shift of His from position 50 to 65 in the N-terminal region of βS does not change the Cu(I) affinity features at that site (site 2). Interestingly, the formation of the high-affinity βS-Cu(I) complex at site 1 in the N-terminus promotes a short α-helix conformation that is restricted to the 1-5 segment of the AcβS sequence, which differs with the substantial increase in α-helix conformations seen for N-terminally acetylated αS upon Cu(I) complexation. Our NMR data demonstrate conclusively that the differences observed in the conformational transitions triggered by Cu(I) binding to AcαS and AcβS find a correlation at the level of their backbone dynamic properties; added to the potential biological implications of these findings, this fact opens new avenues of investigations into the bioinorganic chemistry of PD.

Effects of cell condition, pH, and temperature on lead, zinc, and copper sorption to Acidithiobacillus caldus strain BC13

DOE Office of Scientific and Technical Information (OSTI.GOV)

John E. Aston; William A. Apel; Brady D. Lee

2010-12-01

This study describes the effects of cell condition, pH, and temperature on lead, zinc, and copper sorption to Acidithiobacillus caldus strain BC13 with a Langmuir model. Copper exhibited the highest loading capacity, 4.76 ± 0.28 mmol g-1, to viable cells at pH 5.5. The highest kL (binding-site affinity) observed was 61.2 ± 3.0 L mmol-1 to dehydrated cells at pH 4.0. The pHs that maximized loading capacities and binding-site affinities were generally between 4.0 and 5.5, where the sum of free-proton and complexed-metal concentrations was near a minimum. Of additional importance, lead, zinc, and copper sorbed to viable cells atmore » pH values as low as 1.5. Previous studies with other acidithiobacilli did not measure viable-cell sorption below pH 4.0. In separate experiments, desorption studies showed that far less copper was recovered from viable cells than any other metal or cell condition, suggesting that uptake may play an important role in copper sorption by At. caldus strain BC13. To reflect an applied system, the sorption of metal mixtures was also studied. In these experiments, lead, zinc, and copper sorption from a tertiary mixture were 40.2 ± 4.3%, 28.7 ± 3.8%, and 91.3 ± 3.0%, respectively, of that sorbed in single-metal systems.« less

Characterization of the recombinant copper chaperone (CCS) from the plant Glycine (G.) max.

PubMed

Sagasti, Sara; Yruela, Inmaculada; Bernal, Maria; Lujan, Maria A; Frago, Susana; Medina, Milagros; Picorel, Rafael

2011-02-01

The goal of the present work was to characterize the recombinant copper chaperone (CCS) from soybean. Very little is known about plant copper chaperones, which makes this study of current interest, and allows for a comparison with the better known homologues from yeast and humans. To obtain sizeable amounts of pure protein suitable for spectroscopic characterization, we cloned and overexpressed the G. max CCS chaperone in E. coli in the presence of 0.5 mM CuSO(4) and 0.5 mM ZnSO(4) in the broth. A pure protein preparation was obtained by using two IMAC steps and pH gradient chromatography. Most of the proteins were obtained as apo-form, devoid of copper atoms. The chaperone showed a high content (i.e., over 40%) of loops, turns and random coil as determined both by circular dichroism and homology modelling. The homology 3-D structural model suggests the protein might fold in three structural protein domains. The 3-D model along with the primary structure and spectroscopic data may suggest that copper atoms occupy the two metal binding sites, MKCEGC and CTC, within the N-terminal domain I and C-terminal domain III, respectively. But only one Zn-binding site was obtained spectroscopically.

The CopRS Two-Component System Is Responsible for Resistance to Copper in the Cyanobacterium Synechocystis sp. PCC 68031[C][W][OA

PubMed Central

Giner-Lamia, Joaquín; López-Maury, Luis; Reyes, José C.; Florencio, Francisco J.

2012-01-01

Photosynthetic organisms need copper for cytochrome oxidase and for plastocyanin in the fundamental processes of respiration and photosynthesis. However, excess of free copper is detrimental inside the cells and therefore organisms have developed homeostatic mechanisms to tightly regulate its acquisition, sequestration, and efflux. Herein we show that the CopRS two-component system (also known as Hik31-Rre34) is essential for copper resistance in Synechocystis sp. PCC 6803. It regulates expression of a putative heavy-metal efflux-resistance nodulation and division type copper efflux system (encoded by copBAC) as well as its own expression (in the copMRS operon) in response to the presence of copper in the media. Mutants in this two-component system or the efflux system render cells more sensitive to the presence of copper in the media and accumulate more intracellular copper than the wild type. Furthermore, CopS periplasmic domain is able to bind copper, suggesting that CopS could be able to detect copper directly. Both operons (copMRS and copBAC) are also induced by the photosynthetic inhibitor 2,5-dibromo-3-methyl-6-isopropyl-p-benzoquinone but this induction requires the presence of copper in the media. The reduced response of two mutant strains to copper, one lacking plastocyanin and a second one impaired in copper transport to the thylakoid, due to the absence of the PI-type ATPases PacS and CtaA, suggests that CopS can detect intracellular copper. In addition, a tagged version of CopS with a triple HA epitope localizes to both the plasma and the thylakoid membranes, suggesting that CopS could be involved in copper detection in both the periplasm and the thylakoid lumen. PMID:22715108

Copper complexation screen reveals compounds with potent antibiotic properties against methicillin-resistant Staphylococcus aureus.

PubMed

Haeili, Mehri; Moore, Casey; Davis, Christopher J C; Cochran, James B; Shah, Santosh; Shrestha, Tej B; Zhang, Yaofang; Bossmann, Stefan H; Benjamin, William H; Kutsch, Olaf; Wolschendorf, Frank

2014-07-01

Macrophages take advantage of the antibacterial properties of copper ions in the killing of bacterial intruders. However, despite the importance of copper for innate immune functions, coordinated efforts to exploit copper ions for therapeutic interventions against bacterial infections are not yet in place. Here we report a novel high-throughput screening platform specifically developed for the discovery and characterization of compounds with copper-dependent antibacterial properties toward methicillin-resistant Staphylococcus aureus (MRSA). We detail how one of the identified compounds, glyoxal-bis(N4-methylthiosemicarbazone) (GTSM), exerts its potent strictly copper-dependent antibacterial properties on MRSA. Our data indicate that the activity of the GTSM-copper complex goes beyond the general antibacterial effects of accumulated copper ions and suggest that, in contrast to prevailing opinion, copper complexes can indeed exhibit species- and target-specific activities. Based on experimental evidence, we propose that copper ions impose structural changes upon binding to the otherwise inactive GTSM ligand and transfer antibacterial properties to the chelate. In turn, GTSM determines target specificity and utilizes a redox-sensitive release mechanism through which copper ions are deployed at or in close proximity to a putative target. According to our proof-of-concept screen, copper activation is not a rare event and even extends to already established drugs. Thus, copper-activated compounds could define a novel class of anti-MRSA agents that amplify copper-dependent innate immune functions of the host. To this end, we provide a blueprint for a high-throughput drug screening campaign which considers the antibacterial properties of copper ions at the host-pathogen interface. Copyright © 2014, American Society for Microbiology. All Rights Reserved.

The CopRS two-component system is responsible for resistance to copper in the cyanobacterium Synechocystis sp. PCC 6803.

PubMed

Giner-Lamia, Joaquín; López-Maury, Luis; Reyes, José C; Florencio, Francisco J

2012-08-01

Photosynthetic organisms need copper for cytochrome oxidase and for plastocyanin in the fundamental processes of respiration and photosynthesis. However, excess of free copper is detrimental inside the cells and therefore organisms have developed homeostatic mechanisms to tightly regulate its acquisition, sequestration, and efflux. Herein we show that the CopRS two-component system (also known as Hik31-Rre34) is essential for copper resistance in Synechocystis sp. PCC 6803. It regulates expression of a putative heavy-metal efflux-resistance nodulation and division type copper efflux system (encoded by copBAC) as well as its own expression (in the copMRS operon) in response to the presence of copper in the media. Mutants in this two-component system or the efflux system render cells more sensitive to the presence of copper in the media and accumulate more intracellular copper than the wild type. Furthermore, CopS periplasmic domain is able to bind copper, suggesting that CopS could be able to detect copper directly. Both operons (copMRS and copBAC) are also induced by the photosynthetic inhibitor 2,5-dibromo-3-methyl-6-isopropyl-p-benzoquinone but this induction requires the presence of copper in the media. The reduced response of two mutant strains to copper, one lacking plastocyanin and a second one impaired in copper transport to the thylakoid, due to the absence of the P(I)-type ATPases PacS and CtaA, suggests that CopS can detect intracellular copper. In addition, a tagged version of CopS with a triple HA epitope localizes to both the plasma and the thylakoid membranes, suggesting that CopS could be involved in copper detection in both the periplasm and the thylakoid lumen.

DOE Office of Scientific and Technical Information (OSTI.GOV)

Eilert, Andre; Cavalca, Filippo; Roberts, F. Sloan

Copper electrocatalysts derived from an oxide have shown extraordinary electrochemical properties for the carbon dioxide reduction reaction (CO 2RR). Using in situ ambient pressure X-ray photoelectron spectroscopy and quasi in situ electron energy-loss spectroscopy in a transmission electron microscope, we show that there is a substantial amount of residual oxygen in nanostructured, oxide-derived copper electrocatalysts but no residual copper oxide. On the basis of these findings in combination with density functional theory simulations, we propose that residual subsurface oxygen changes the electronic structure of the catalyst and creates sites with higher carbon monoxide binding energy. If such sites are stablemore » under the strongly reducing conditions found in CO 2RR, these findings would explain the high efficiencies of oxide-derived copper in reducing carbon dioxide to multicarbon compounds such as ethylene.« less

Roles of glutamates and metal ions in a rationally designed nitric oxide reductase based on myoglobin

DOE Office of Scientific and Technical Information (OSTI.GOV)

Lin, Y.W.; Robinson, H.; Yeung, N.

2010-05-11

A structural and functional model of bacterial nitric oxide reductase (NOR) has been designed by introducing two glutamates (Glu) and three histidines (His) in sperm whale myoglobin. X-ray structural data indicate that the three His and one Glu (V68E) residues bind iron, mimicking the putative FeB site in NOR, while the second Glu (I107E) interacts with a water molecule and forms a hydrogen bonding network in the designed protein. Unlike the first Glu (V68E), which lowered the heme reduction potential by {approx}110 mV, the second Glu has little effect on the heme potential, suggesting that the negatively charged Glu hasmore » a different role in redox tuning. More importantly, introducing the second Glu resulted in a {approx}100% increase in NOR activity, suggesting the importance of a hydrogen bonding network in facilitating proton delivery during NOR reactivity. In addition, EPR and X-ray structural studies indicate that the designed protein binds iron, copper, or zinc in the FeB site, each with different effects on the structures and NOR activities, suggesting that both redox activity and an intermediate five-coordinate heme-NO species are important for high NOR activity. The designed protein offers an excellent model for NOR and demonstrates the power of using designed proteins as a simpler and more well-defined system to address important chemical and biological issues.« less

Roles of Glutamates and Metal ions in a Rationally Designed Nitric Oxide Reductase Based on Myoglobin

DOE Office of Scientific and Technical Information (OSTI.GOV)

Y Lin; N Yeung; Y Gao

2011-12-31

A structural and functional model of bacterial nitric oxide reductase (NOR) has been designed by introducing two glutamates (Glu) and three histidines (His) in sperm whale myoglobin. X-ray structural data indicate that the three His and one Glu (V68E) residues bind iron, mimicking the putative FeB site in NOR, while the second Glu (I107E) interacts with a water molecule and forms a hydrogen bonding network in the designed protein. Unlike the first Glu (V68E), which lowered the heme reduction potential by {approx}110 mV, the second Glu has little effect on the heme potential, suggesting that the negatively charged Glu hasmore » a different role in redox tuning. More importantly, introducing the second Glu resulted in a {approx}100% increase in NOR activity, suggesting the importance of a hydrogen bonding network in facilitating proton delivery during NOR reactivity. In addition, EPR and X-ray structural studies indicate that the designed protein binds iron, copper, or zinc in the FeB site, each with different effects on the structures and NOR activities, suggesting that both redox activity and an intermediate five-coordinate heme-NO species are important for high NOR activity. The designed protein offers an excellent model for NOR and demonstrates the power of using designed proteins as a simpler and more well-defined system to address important chemical and biological issues.« less

Structural analysis of a putative SAM-dependent methyltransferase, YtqB, from Bacillus subtilis.

PubMed

Park, Sun Cheol; Song, Wan Seok; Yoon, Sung-il

2014-04-18

S-adenosyl-L-methionine (SAM)-dependent methyltransferases (MTases) methylate diverse biological molecules using a SAM cofactor. The ytqB gene of Bacillus subtilis encodes a putative MTase and its biological function has never been characterized. To reveal the structural features and the cofactor binding mode of YtqB, we have determined the crystal structures of YtqB alone and in complex with its cofactor, SAM, at 1.9 Å and 2.2 Å resolutions, respectively. YtqB folds into a β-sheet sandwiched by two α-helical layers, and assembles into a dimeric form. Each YtqB monomer contains one SAM binding site, which shapes SAM into a slightly curved conformation and exposes the reactive methyl group of SAM potentially to a substrate. Our comparative structural analysis of YtqB and its homologues indicates that YtqB is a SAM-dependent class I MTase, and provides insights into the substrate binding site of YtqB. Copyright © 2014 Elsevier Inc. All rights reserved.

GATA-1 directly regulates Nanog in mouse embryonic stem cells

DOE Office of Scientific and Technical Information (OSTI.GOV)

Li, Wen-Zhong; Ai, Zhi-Ying; Key Laboratory of Animal Biotechnology, Ministry of Agriculture, Northwest A&F University, Yangling 712100

2015-09-25

Nanog safeguards pluripotency in mouse embryonic stem cells (mESCs). Insight into the regulation of Nanog is important for a better understanding of the molecular mechanisms that control pluripotency of mESCs. In a silico analysis, we identify four GATA-1 putative binding sites in Nanog proximal promoter. The Nanog promoter activity can be significantly repressed by ectopic expression of GATA-1 evidenced by a promoter reporter assay. Mutation studies reveal that one of the four putative binding sites counts for GATA-1 repressing Nanog promoter activity. Direct binding of GATA-1 on Nanog proximal promoter is confirmed by electrophoretic mobility shift assay and chromatin immunoprecipitation.more » Our data provide new insights into the expanded regulatory circuitry that coordinates Nanog expression. - Highlights: • The Nanog proximal promoter conceives functional element for GATA-1. • GATA-1 occupies the Nanog proximal promoter in vitro and in vivo. • GATA-1 transcriptionally suppresses Nanog.« less

Autoradiographic demonstration of oxytocin-binding sites in the macula densa

DOE Office of Scientific and Technical Information (OSTI.GOV)

Stoeckel, M.E.; Freund-Mercier, M.J.

1989-08-01

Specific oxytocin (OT)-binding sites were localized in the rat kidney with use of a selective {sup 125}I-labeled OT antagonist ({sup 125}I-OTA). High concentrations of OT binding sites were detected on the juxtaglomerular apparatus with use of the conventional film autoradiographic technique. No labeling occurred on other renal structures. The cellular localization of the OT binding sites within the juxtaglomerular apparatus was studied in light microscope autoradiography, on semithin sections from paraformaldehyde-fixed kidney slices incubated in the presence of {sup 125}I-OTA. These preparations revealed selective labeling of the macula densa, mainly concentrated at the basal pole of the cells. Control experimentsmore » showed first that {sup 125}I-OTA binding characteristics were not noticeably altered by prior paraformaldehyde fixation of the kidneys and second that autoradiographic detection of the binding sites was not impaired by histological treatments following binding procedures. In view of the role of the macula densa in the tubuloglomerular feedback, the putative OT receptors of this structure might mediate the stimulatory effect of OT on glomerular filtration.« less

Distinct oxidative cleavage and modification of bovine [Cu-Zn]-SOD by an ascorbic acid/Cu(II) system: Identification of novel copper binding site on SOD molecule

PubMed Central

Uehara, Hiroshi; Luo, Shen; Aryal, Baikuntha; Levine, Rodney L.; Rao, V. Ashutosh

2016-01-01

We investigated the combined effect of ascorbate and copper [Asc/Cu(II)] on the integrity of bovine [Cu-Zn]-superoxide dismutase (bSOD1) as a model system to study the metal catalyzed oxidation (MCO) and fragmentation of proteins. We found Asc/Cu(II) mediates specific cleavage of bSOD1 and generates 12.5 and 3.2 kDa fragments in addition to oxidation/carbonylation of the protein. The effect of other tested transition metals, a metal chelator, and hydrogen peroxide on the cleavage and oxidation indicated that binding of copper to a previously unknown site on SOD1 is responsible for the Asc/Cu(II) specific cleavage and oxidation. We utilized tandem mass spectrometry to identify the specific cleavage sites of Asc/Cu(II)-treated bSOD1. Analyses of tryptic- and AspN-peptides have demonstrated the cleavage to occur at Gly31 with peptide bond breakage with Thr30 and Ser32 through diamide and α-amidation pathways, respectively. The three-dimensional structure of bSOD1 reveals the imidazole ring of His19 localized within 5 Angstrom from the α-carbon of Gly31 providing a structural basis that copper ion, most likely coordinated by His19, catalyzes the specific cleavage reaction. PMID:26872685

Distinct oxidative cleavage and modification of bovine [Cu- Zn]-SOD by an ascorbic acid/Cu(II) system: Identification of novel copper binding site on SOD molecule.

PubMed

Uehara, Hiroshi; Luo, Shen; Aryal, Baikuntha; Levine, Rodney L; Rao, V Ashutosh

2016-05-01

We investigated the combined effect of ascorbate and copper [Asc/Cu(II)] on the integrity of bovine [Cu-Zn]-superoxide dismutase (bSOD1) as a model system to study the metal catalyzed oxidation (MCO) and fragmentation of proteins. We found Asc/Cu(II) mediates specific cleavage of bSOD1 and generates 12.5 and 3.2kDa fragments in addition to oxidation/carbonylation of the protein. The effect of other tested transition metals, a metal chelator, and hydrogen peroxide on the cleavage and oxidation indicated that binding of copper to a previously unknown site on SOD1 is responsible for the Asc/Cu(II) specific cleavage and oxidation. We utilized tandem mass spectrometry to identify the specific cleavage sites of Asc/Cu(II)-treated bSOD1. Analyses of tryptic- and AspN-peptides have demonstrated the cleavage to occur at Gly31 with peptide bond breakage with Thr30 and Ser32 through diamide and α-amidation pathways, respectively. The three-dimensional structure of bSOD1 reveals the imidazole ring of His19 localized within 5Å from the α-carbon of Gly31 providing a structural basis that copper ion, most likely coordinated by His19, catalyzes the specific cleavage reaction. Published by Elsevier Inc.

PPARγ regulates exocrine pancreas lipase.

PubMed

Danino, Hila; Naor, Ronny Peri-; Fogel, Chen; Ben-Harosh, Yael; Kadir, Rotem; Salem, Hagit; Birk, Ruth

2016-12-01

Pancreatic lipase (triacylglycerol lipase EC 3.1.1.3) is an essential enzyme in hydrolysis of dietary fat. Dietary fat, especially polyunsaturated fatty acids (PUFA), regulate pancreatic lipase (PNLIP); however, the molecular mechanism underlying this regulation is mostly unknown. As PUFA are known to regulate expression of proliferator-activated receptor gamma (PPARγ), and as we identified in-silico putative PPARγ binding sites within the putative PNLIP promoter sequence, we hypothesized that PUFA regulation of PNLIP might be mediated by PPARγ. We used in silico bioinformatics tools, reporter luciferase assay, PPARγ agonists and antagonists, PPARγ overexpression in exocrine pancreas AR42J and primary cells to study PPARγ regulation of PNLIP. Using in silico bioinformatics tools we mapped PPARγ binding sites (PPRE) to the putative promoter region of PNLIP. Reporter luciferase assay in AR42J rat exocrine pancreas acinar cells transfected with various constructs of the putative PNLIP promoter showed that PNLIP transcription is significantly enhanced by PPARγ dose-dependently, reaching maximal levels with multi PPRE sites. This effect was significantly augmented in the presence of PPARγ agonists and reduced by PPARγ antagonists or mutagenesis abrogating PPRE sites. Over-expression of PPARγ significantly elevated PNLIP transcript and protein levels in AR42J cells and in primary pancreas cells. Moreover, PNLIP expression was up-regulated by PPARγ agonists (pioglitazone and 15dPGJ2) and significantly down-regulated by PPARγ antagonists in non-transfected rat exocrine pancreas AR42J cell line cells. PPARγ transcriptionally regulates PNLIP gene expression. This transcript regulation resolves part of the missing link between dietary PUFA direct regulation of PNLIP. Copyright © 2016 Elsevier B.V. All rights reserved.

A purple cupredoxin from Nitrosopumilus maritimus containing a mononuclear type 1 copper center with an open binding site

DOE PAGES

Hosseinzadeh, Parisa; Tian, Shiliang; Marshall, Nicholas M.; ...

2016-04-27

Mononuclear cupredoxin proteins usually contain a coordinately saturated type 1 copper (T1Cu) center and function exclusively as electron carriers. Here we report a cupredoxin isolated from the nitrifying archaeon Nitrosopumilus maritimus SCM1, called Nmar1307, that contains a T1Cu center with an open binding site containing water. It displays a deep purple color due to strong absorptions around 413 nm (1880 M –1 cm –1) and 558 nm (2290 M –1 cm –1) in the UV–vis electronic spectrum. EPR studies suggest the protein contains two Cu(II) species of nearly equal population, one nearly axial, with hyperfine constant A ∥ = 98more » × 10 –4 cm –1, and another more rhombic, with a smaller A ∥ value of 69 × 10 –4 cm –1. The X-ray crystal structure at 1.6 Å resolution confirms that it contains a Cu atom coordinated by two His and one Cys in a trigonal plane, with an axial H 2O at 2.25 Å. Both UV–vis absorption and EPR spectroscopic studies suggest that the Nmar1307 can oxidize NO to nitrite, an activity that is attributable to the high reduction potential (354 mV vs SHE) of the copper site. Lastly, these results suggest that mononuclear cupredoxins can have a wide range of structural features, including an open binding site containing water, making this class of proteins even more versatile.« less

Enantiospecific adsorption of propranolol enantiomers on naturally chiral copper surface: A molecular dynamics simulation investigation

NASA Astrophysics Data System (ADS)

Sedghamiz, Tahereh; Bahrami, Maryam; Ghatee, Mohammad Hadi

2017-04-01

Adsorption of propranolol enantiomers on naturally chiral copper (Cu(3,1,17)S) and achiral copper (Cu(100)) surfaces were studied by molecular dynamics simulation to unravel the features of adsorbate-adsorbent enantioselectivity. Adsorption of S- and R-propranolol on Cu(3,1,17)S terraces (with 100 plane) leads mainly to endo- and exo-conformers, respectively. Simulated pair correlation function (g(r)) and mean square displacement (MSD) were analyzed to identify adsorption sites of enantiomers on Cu(3,1,17)S substrate surface, and their simulated binding energies were used to access the adsorption strength. According to (g(r)), R-propranolol adsorbs via naphtyl group while S-propranolol mainly adsorbs through chain group. R-enantiomer binds more tightly to the chiral substrate surface than S-enantiomer as indicated by a higher simulated binding energy by 2.74 kJ mol-1 per molecule. The difference in binding energies of propranolol enantiomers on naturally chiral Cu(3,1,17)S is almost six times larger than on the achiral Cu(100) surface, which substantiates the appreciably strong specific enantioselective adsorption on the former surface.

Diurnal rhythm of melatonin binding in the rat suprachiasmatic nucleus

DOE Office of Scientific and Technical Information (OSTI.GOV)

Laitinen, J.T.; Castren, E.; Vakkuri, O.

1989-03-01

We used quantitative in vitro autoradiography to localize and characterize 2-/sup 125/I-melatonin binding sites in the rat suprachiasmatic nuclei in relation to pineal melatonin production. In a light:dark cycle of 12:12 h, binding density exhibited significant diurnal variation with a peak at the dark-light transition and a trough 12 hours later. Saturation studies suggested that the decreased binding at light-dark transition might be due to a shift of the putative melatonin receptor to a low affinity state.

Acceleration of Binding Site Comparisons by Graph Partitioning.

PubMed

Krotzky, Timo; Klebe, Gerhard

2015-08-01

The comparison of protein binding sites is a prominent task in computational chemistry and has been studied in many different ways. For the automatic detection and comparison of putative binding cavities the Cavbase system has been developed which uses a coarse-grained set of pseudocenters to represent the physicochemical properties of a binding site and employs a graph-based procedure to calculate similarities between two binding sites. However, the comparison of two graphs is computationally quite demanding which makes large-scale studies such as the rapid screening of entire databases hardly feasible. In a recent work, we proposed the method Local Cliques (LC) for the efficient comparison of Cavbase binding sites. It employs a clique heuristic to detect the maximum common subgraph of two binding sites and an extended graph model to additionally compare the shape of individual surface patches. In this study, we present an alternative to further accelerate the LC method by partitioning the binding-site graphs into disjoint components prior to their comparisons. The pseudocenter sets are split with regard to their assigned phyiscochemical type, which leads to seven much smaller graphs than the original one. Applying this approach on the same test scenarios as in the former comprehensive way results in a significant speed-up without sacrificing accuracy. © 2015 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

Proton-coupled electron transfer in the catalytic cycle of Alcaligenes xylosoxidans copper-dependent nitrite reductase.

PubMed

Leferink, Nicole G H; Han, Cong; Antonyuk, Svetlana V; Heyes, Derren J; Rigby, Stephen E J; Hough, Michael A; Eady, Robert R; Scrutton, Nigel S; Hasnain, S Samar

2011-05-17

We demonstrated recently that two protons are involved in reduction of nitrite to nitric oxide through a proton-coupled electron transfer (ET) reaction catalyzed by the blue Cu-dependent nitrite reductase (Cu NiR) of Alcaligenes xylosoxidans (AxNiR). Here, the functionality of two putative proton channels, one involving Asn90 and the other His254, is studied using single (N90S, H254F) and double (N90S--H254F) mutants. All mutants studied are active, indicating that protons are still able to reach the active site. The H254F mutation has no effect on the catalytic activity, while the N90S mutation results in ~70% decrease in activity. Laser flash-photolysis experiments show that in H254F and wild-type enzyme electrons enter at the level of the T1Cu and then redistribute between the two Cu sites. Complete ET from T1Cu to T2Cu occurs only when nitrite binds at the T2Cu site. This indicates that substrate binding to T2Cu promotes ET from T1Cu, suggesting that the enzyme operates an ordered mechanism. In fact, in the N90S and N90S--H254F variants, where the T1Cu site redox potential is elevated by ∼60 mV, inter-Cu ET is only observed in the presence of nitrite. From these results it is evident that the Asn90 channel is the main proton channel in AxNiR, though protons can still reach the active site if this channel is disrupted. Crystallographic structures provide a clear structural rationale for these observations, including restoration of the proton delivery via a significant movement of the loop connecting the T1Cu ligands Cys130 and His139 that occurs on binding of nitrite. Notably, a role for this loop in facilitating interaction of cytochrome c(551) with Cu NiR has been suggested previously based on a crystal structure of the binary complex.

The structure and inhibition of human diamine oxidase†,‡

PubMed Central

McGrath, Aaron P; Hilmer, Kimberly M; Collyer, Charles A; Shepard, Eric M; Elmore, Bradley O.; Brown, Doreen E; Dooley, David M; Guss, J Mitchell

2009-01-01

Humans have three functioning genes that code for copper-containing amine oxidases. The product of the AOC1 gene is a so-called diamine oxidase (hDAO), named for its substrate preference for diamines, particularly histamine. hDAO has been cloned and expressed in insect cells and the structure of the native enzyme determined by X-ray crystallography to a resolution of 1.8 Å. The homodimeric structure has the archetypal amine oxidase fold. Two active sites, one in each subunit, are characterized by the presence of a copper ion and a topaquinone residue formed by the post-translational modification of a tyrosine. Although hDAO shares 37.9 % sequence identity with another human copper amine oxidase, semicarbazide sensitive amine oxidase or vascular adhesion protein-1, its substrate binding pocket and entry channel are distinctly different in accord with the different substrate specificities. The structures of two inhibitor complexes of hDAO, berenil and pentamidine, have been refined to resolutions of 2.1 Å and 2.2 Å, respectively. They bind non-covalently in the active site channel. The inhibitor binding suggests that an aspartic acid residue, conserved in all diamine oxidases but absent from other amine oxidases, is responsible for the diamine specificity by interacting with the second amino group of preferred diamine substrates. PMID:19764817

Crystal structure of Agaricus bisporus mushroom tyrosinase: identity of the tetramer subunits and interaction with tropolone.

PubMed

Ismaya, Wangsa T; Rozeboom, Henriëtte J; Weijn, Amrah; Mes, Jurriaan J; Fusetti, Fabrizia; Wichers, Harry J; Dijkstra, Bauke W

2011-06-21

Tyrosinase catalyzes the conversion of phenolic compounds into their quinone derivatives, which are precursors for the formation of melanin, a ubiquitous pigment in living organisms. Because of its importance for browning reactions in the food industry, the tyrosinase from the mushroom Agaricus bisporus has been investigated in depth. In previous studies the tyrosinase enzyme complex was shown to be a H(2)L(2) tetramer, but no clues were obtained of the identities of the subunits, their mode of association, and the 3D structure of the complex. Here we unravel this tetramer at the molecular level. Its 2.3 Å resolution crystal structure is the first structure of the full fungal tyrosinase complex. The complex comprises two H subunits of ∼392 residues and two L subunits of ∼150 residues. The H subunit originates from the ppo3 gene and has a fold similar to other tyrosinases, but it is ∼100 residues larger. The L subunit appeared to be the product of orf239342 and has a lectin-like fold. The H subunit contains a binuclear copper-binding site in the deoxy-state, in which three histidine residues coordinate each copper ion. The side chains of these histidines have their orientation fixed by hydrogen bonds or, in the case of His85, by a thioether bridge with the side chain of Cys83. The specific tyrosinase inhibitor tropolone forms a pre-Michaelis complex with the enzyme. It binds near the binuclear copper site without directly coordinating the copper ions. The function of the ORF239342 subunits is not known. Carbohydrate binding sites identified in other lectins are not conserved in ORF239342, and the subunits are over 25 Å away from the active site, making a role in activity unlikely. The structures explain how calcium ions stabilize the tetrameric state of the enzyme.

Investigating MUC1/ICAM-1 Binding Induced Signaling in Breast Cancer Metastasis

DTIC Science & Technology

2011-05-01

expected that covalently linked species would remain intact. Reducing (R, + !-mercaptoethanol) and non-reducing (NR, no !-mercaptoethanol) samples were...binding site, containing both proline and arginine residues. We mutated the SH2 and/or putative SH3 binding domains on the MUC1-CFP-Fv plasmid...Structure and regulation of Src family kinases. Oncogene 2004, 23:7918- 7927. 31. Li SSC: Specificity and versatility of SH3 and other proline -recognition

Roles of Copper-Binding Proteins in Breast Cancer.

PubMed

Blockhuys, Stéphanie; Wittung-Stafshede, Pernilla

2017-04-20

Copper ions are needed in several steps of cancer progression. However, the underlying mechanisms, and involved copper-binding proteins, are mainly elusive. Since most copper ions in the body (in and outside cells) are protein-bound, it is important to investigate what copper-binding proteins participate and, for these, how they are loaded with copper by copper transport proteins. Mechanistic information for how some copper-binding proteins, such as extracellular lysyl oxidase (LOX), play roles in cancer have been elucidated but there is still much to learn from a biophysical molecular viewpoint. Here we provide a summary of copper-binding proteins and discuss ones reported to have roles in cancer. We specifically focus on how copper-binding proteins such as mediator of cell motility 1 (MEMO1), LOX, LOX-like proteins, and secreted protein acidic and rich in cysteine (SPARC) modulate breast cancer from molecular and clinical aspects. Because of the importance of copper for invasion/migration processes, which are key components of cancer metastasis, further insights into the actions of copper-binding proteins may provide new targets to combat cancer.

Probing the Active Surface Sites for CO Reduction on Oxide-Derived Copper Electrocatalysts

DOE PAGES

Verdaguer-Casadevall, Arnau; Li, Christina W.; Johansson, Tobias P.; ...

2015-07-30

CO electroreduction activity on oxide-derived Cu (OD-Cu) was found to correlate with metastable surface features that bind CO strongly. OD-Cu electrodes prepared by H 2 reduction of Cu 2O precursors reduce CO to acetate and ethanol with nearly 50% Faradaic efficiency at moderate overpotential. Temperature-programmed desorption of CO on OD-Cu revealed the presence of surface sites with strong CO binding that are distinct from the terraces and stepped sites found on polycrystalline Cu foil. After annealing at 350 °C, the surface-area corrected current density for CO reduction is 44-fold lower and the Faradaic efficiency is less than 5%. These changesmore » are accompanied by a reduction in the proportion of strong CO binding sites. Here, we propose that the active sites for CO reduction on OD-Cu surfaces are strong CO binding sites that are supported by grain boundaries. Uncovering these sites is a first step toward understanding the surface chemistry necessary for efficient CO electroreduction.« less

Regulation of the aceI multidrug efflux pump gene in Acinetobacter baumannii.

PubMed

Liu, Qi; Hassan, Karl A; Ashwood, Heather E; Gamage, Hasinika K A H; Li, Liping; Mabbutt, Bridget C; Paulsen, Ian T

2018-06-01

To investigate the function of AceR, a putative transcriptional regulator of the chlorhexidine efflux pump gene aceI in Acinetobacter baumannii. Chlorhexidine susceptibility and chlorhexidine induction of aceI gene expression were determined by MIC and quantitative real-time PCR, respectively, in A. baumannii WT and ΔaceR mutant strains. Recombinant AceR was prepared as both a full-length protein and as a truncated protein, AceR (86-299), i.e. AceRt, which has the DNA-binding domain deleted. The binding interaction of the purified AceR protein and its putative operator region was investigated by electrophoretic mobility shift assays and DNase I footprinting assays. The binding of AceRt with its putative ligand chlorhexidine was examined using surface plasmon resonance and tryptophan fluorescence quenching assays. MIC determination assays indicated that the ΔaceI and ΔaceR mutant strains both showed lower resistance to chlorhexidine than the parental strain. Chlorhexidine-induced expression of aceI was abolished in a ΔaceR background. Electrophoretic mobility shift assays and DNase I footprinting assays demonstrated chlorhexidine-stimulated binding of AceR with two sites upstream of the putative aceI promoter. Surface plasmon resonance and tryptophan fluorescence quenching assays suggested that the purified ligand-binding domain of the AceR protein was able to bind with chlorhexidine with high affinity. This study provides strong evidence that AceR is an activator of aceI gene expression when challenged with chlorhexidine. This study is the first characterization, to our knowledge, of a regulator controlling expression of a PACE family multidrug efflux pump.

Determination of the Bridging Ligand in the Active Site of Tyrosinase.

PubMed

Zou, Congming; Huang, Wei; Zhao, Gaokun; Wan, Xiao; Hu, Xiaodong; Jin, Yan; Li, Junying; Liu, Junjun

2017-10-28

Tyrosinase is a type-3 copper enzyme that is widely distributed in plants, fungi, insects, and mammals. Developing high potent inhibitors against tyrosinase is of great interest in diverse fields including tobacco curing, food processing, bio-insecticides development, cosmetic development, and human healthcare-related research. In the crystal structure of Agaricus bisporus mushroom tyrosinase, there is an oxygen atom bridging the two copper ions in the active site. It is unclear whether the identity of this bridging oxygen is a water molecule or a hydroxide anion. In the present study, we theoretically determine the identity of this critical bridging oxygen by performing first-principles hybrid quantum mechanics/molecular mechanics/Poisson-Boltzmann-surface area (QM/MM-PBSA) calculations along with a thermodynamic cycle that aim to improve the accuracy. Our results show that the binding with water molecule is energy favored and the QM/MM-optimized structure is very close to the crystal structure, whereas the binding with hydroxide anions causes the increase of energy and significant structural changes of the active site, indicating that the identity of the bridging oxygen must be a water molecule rather than a hydroxide anion. The different binding behavior between water and hydroxide anions may explain why molecules with a carboxyl group or too many negative charges have lower inhibitory activity. In light of this, the design of high potent active inhibitors against tyrosinase should satisfy both the affinity to the copper ions and the charge neutrality of the entire molecule.

Isolation of copper-binding proteins from activated sludge culture.

PubMed

Fukushi, K; Kato, S; Antsuki, T; Omura, T

2001-01-01

Six copper-binding microbial proteins were isolated from activated sludge cultures grown on media containing copper at various concentrations. Molecular weights among isolated proteins were ranged from 1.3k to 1 74k dalton. Isolated proteins were compared for their copper binding capabilities. Proteins isolated from cultures grown in the presence of copper in the growth media exhibited higher copper binding capabilities than those isolated from the culture grown in the absence of copper. The highest metal uptake of 61.23 (mol copper/mol protein) was observed by a protein isolated from a culture grown with copper at a concentration of 0.25 mM. This isolated protein (CBP2) had a molecular weight of 24k dalton. Other protein exhibited copper binding capability of 4.8-32.5 (mol copper/mol protein).

Levels of plasma ceruloplasmin protein are markedly lower following dietary copper deficiency in rodents

PubMed Central

Broderius, Margaret; Mostad, Elise; Wendroth, Krista; Prohaska, Joseph R.

2010-01-01

Ceruloplasmin (Cp) is a multicopper oxidase and the most abundant copper binding protein in vertebrate plasma. Loss of function mutations in humans or experimental deletion in mice result in iron overload consistent with a putative ferroxidase function. Prior work suggested plasma may contain multiple ferroxidases. Studies were conducted in Holtzman rats (Rattus novegicus), albino mice (Mus musculus), Cp -/- mice, and adult humans (Homo sapiens) to investigate the copper-iron interaction. Dietary copper-deficient (CuD) rats and mice were produced using a modified AIN-76A diet. Results confirmed that o-dianisidine is a better substrate than paraphenylene diamine (PPD) for assessing diamine oxidase activity of Cp. Plasma from CuD rat dams and pups, and CuD and Cp -/- mice contained no detectable Cp diamine oxidase activity. Importantly, no ferroxidase activity was detectable for CuD rats, mice, or Cp -/- mice compared to robust activity for copper-adequate (CuA) rodent controls using western membrane assay. Immunoblot protocols detected major reductions (60-90%) in Cp protein in plasma of CuD rodents but no alteration in liver mRNA levels by qRT-PCR. Data are consistent with apo-Cp being less stable than holo-Cp. Further research is needed to explain normal plasma iron in CuD mice. Reduction in Cp is a sensitive biomarker for copper deficiency. PMID:20170749

Nuclear factor Y regulates ancient budgerigar hepadnavirus core promoter activity

DOE Office of Scientific and Technical Information (OSTI.GOV)

Shen, Zhongliang; Liu, Yanfeng; Luo, Mengjun

Endogenous viral elements (EVE) in animal genomes are the fossil records of ancient viruses and provide invaluable information on the origin and evolution of extant viruses. Extant hepadnaviruses include avihepadnaviruses of birds and orthohepadnaviruses of mammals. The core promoter (Cp) of hepadnaviruses is vital for viral gene expression and replication. We previously identified in the budgerigar genome two EVEs that contain the full-length genome of an ancient budgerigar hepadnavirus (eBHBV1 and eBHBV2). Here, we found eBHBV1 Cp and eBHBV2 Cp were active in several human and chicken cell lines. A region from nt −85 to −11 in eBHBV1 Cp was critical formore » the promoter activity. Bioinformatic analysis revealed a putative binding site of nuclear factor Y (NF-Y), a ubiquitous transcription factor, at nt −64 to −50 in eBHBV1 Cp. The NF-Y core binding site (ATTGG, nt −58 to −54) was essential for eBHBV1 Cp activity. The same results were obtained with eBHBV2 Cp and duck hepatitis B virus Cp. The subunit A of NF-Y (NF-YA) was recruited via the NF-Y core binding site to eBHBV1 Cp and upregulated the promoter activity. Finally, the NF-Y core binding site is conserved in the Cps of all the extant avihepadnaviruses but not of orthohepadnaviruses. Interestingly, a putative and functionally important NF-Y core binding site is located at nt −21 to −17 in the Cp of human hepatitis B virus. In conclusion, our findings have pinpointed an evolutionary conserved and functionally critical NF-Y binding element in the Cps of avihepadnaviruses. - Highlights: • Endogenous budgerigar hepadnavirus (eBHBV) core promoters (Cps) are active in cells. • NF-Y binding site exists in the Cps of eBHBVs and all the extant avihepadnaviruses. • NF-Y binding and mediated upregulation is critical for eBHBV Cp activity.« less

Conserved active site residues limit inhibition of a copper-containing nitrite reductase by small molecules.

PubMed

Tocheva, Elitza I; Eltis, Lindsay D; Murphy, Michael E P

2008-04-15

The interaction of copper-containing dissimilatory nitrite reductase from Alcaligenes faecalis S-6 ( AfNiR) with each of five small molecules was studied using crystallography and steady-state kinetics. Structural studies revealed that each small molecule interacted with the oxidized catalytic type 2 copper of AfNiR. Three small molecules (formate, acetate and nitrate) mimic the substrate by having at least two oxygen atoms for bidentate coordination to the type 2 copper atom. These three anions bound to the copper ion in the same asymmetric, bidentate manner as nitrite. Consistent with their weak inhibition of the enzyme ( K i >50 mM), the Cu-O distances in these AfNiR-inhibitor complexes were approximately 0.15 A longer than that observed in the AfNiR-nitrite complex. The binding mode of each inhibitor is determined in part by steric interactions with the side chain of active site residue Ile257. Moreover, the side chain of Asp98, a conserved residue that hydrogen bonds to type 2 copper-bound nitrite and nitric oxide, was either disordered or pointed away from the inhibitors. Acetate and formate inhibited AfNiR in a mixed fashion, consistent with the occurrence of second acetate binding site in the AfNiR-acetate complex that occludes access to the type 2 copper. A fourth small molecule, nitrous oxide, bound to the oxidized metal in a side-on fashion reminiscent of nitric oxide to the reduced copper. Nevertheless, nitrous oxide bound at a farther distance from the metal. The fifth small molecule, azide, inhibited the reduction of nitrite by AfNiR most strongly ( K ic = 2.0 +/- 0.1 mM). This ligand bound to the type 2 copper center end-on with a Cu-N c distance of approximately 2 A, and was the only inhibitor to form a hydrogen bond with Asp98. Overall, the data substantiate the roles of Asp98 and Ile257 in discriminating substrate from other small anions.

Inhibition of cyclin-dependent kinase CDK1 by oxindolimine ligands and corresponding copper and zinc complexes.

PubMed

Miguel, Rodrigo Bernardi; Petersen, Philippe Alexandre Divina; Gonzales-Zubiate, Fernando A; Oliveira, Carla Columbano; Kumar, Naresh; do Nascimento, Rafael Rodrigues; Petrilli, Helena Maria; da Costa Ferreira, Ana Maria

2015-10-01

Oxindolimine-copper(II) and zinc(II) complexes that previously have shown to induce apoptosis, with DNA and mitochondria as main targets, exhibit here significant inhibition of kinase CDK1/cyclin B protein. Copper species are more active than the corresponding zinc, and the free ligand shows to be less active, indicating a major influence of coordination in the process, and a further modulation by the coordinated ligand. Molecular docking and classical molecular dynamics provide a better understanding of the effectiveness and kinase inhibition mechanism by these compounds, showing that the metal complex provides a stronger interaction than the free ligand with the ATP-binding site. The metal ion introduces charge in the oxindole species, giving it a more rigid conformation that then becomes more effective in its interactions with the protein active site. Analogous experiments resulted in no significant effect regarding phosphatase inhibition. These results can explain the cytotoxicity of these metal complexes towards different tumor cells, in addition to its capability of binding to DNA, and decreasing membrane potential of mitochondria.

Distinct p53 genomic binding patterns in normal and cancer-derived human cells

PubMed Central

McCorkle, Sean R; McCombie, WR; Dunn, John J

2011-01-01

Here, we report genome-wide analysis of the tumor suppressor p53 binding sites in normal human cells. 743 high-confidence ChIP-seq peaks representing putative genomic binding sites were identified in normal IMR90 fibroblasts using a reference chromatin sample. More than 40% were located within 2 kb of a transcription start site (TSS), a distribution similar to that documented for individually studied, functional p53 binding sites and, to date, not observed by previous p53 genome-wide studies. Nearly half of the high-confidence binding sites in the IMR90 cells reside in CpG islands in marked contrast to sites reported in cancer-derived cells. The distinct genomic features of the IMR90 binding sites do not reflect a distinct preference for specific sequences, since the de novo developed p53 motif based on our study is similar to those reported by genome-wide studies of cancer cells. More likely, the different chromatin landscape in normal, compared with cancer-derived cells, influences p53 binding via modulating availability of the sites. We compared the IMR90 ChIP-seq peaks to the recently published IMR90 methylome1 and demonstrated that they are enriched at hypomethylated DNA. Our study represents the first genome-wide, de novo mapping of p53 binding sites in normal human cells and reveals that p53 binding sites reside in distinct genomic landscapes in normal and cancer-derived human cells. PMID:22127205

Impact of copper ligand mutations on a cupredoxin with a green copper center.

PubMed

Roger, Magali; Sciara, Giuliano; Biaso, Frédéric; Lojou, Elisabeth; Wang, Xie; Bauzan, Marielle; Giudici-Orticoni, Marie-Thérèse; Vila, Alejandro J; Ilbert, Marianne

2017-05-01

Mononuclear cupredoxins contain a type 1 copper center with a trigonal or tetragonal geometry usually maintained by four ligands, a cystein, two histidines and a methionine. The recent discovery of new members of this family with unusual properties demonstrates, however, the versatility of this class of proteins. Changes in their ligand set lead to drastic variation in their metal site geometry and in the resulting spectroscopic and redox features. In our work, we report the identification of the copper ligands in the recently discovered cupredoxin AcoP. We show that even though AcoP possesses a classical copper ligand set, it has a highly perturbed copper center. In depth studies of mutant's properties suggest a high degree of constraint existing in the copper center of the wild type protein and even the addition of exogenous ligands does not lead to the reconstitution of the initial copper center. Not only the chemical nature of the axial ligand but also constraints brought by its covalent binding to the protein backbone might be critical to maintain a green copper site with high redox potential. This work illustrates the importance of experimentally dissecting the molecular diversity of cupredoxins to determine the molecular determinants responsible for their copper center geometry and redox potential. Copyright © 2017 Elsevier B.V. All rights reserved.

Crystal structure of secretory abundant heat soluble protein 4 from one of the toughest “water bears” micro‐animals Ramazzottius Varieornatus

PubMed Central

Fukuda, Yohta

2018-01-01

Abstract Though anhydrobiotic tardigrades (micro‐animals also known as water bears) possess many genes of secretory abundant heat soluble (SAHS) proteins unique to Tardigrada, their functions are unknown. A previous crystallographic study revealed that a SAHS protein (RvSAHS1) from one of the toughest tardigrades, Ramazzottius varieornatus, has a β‐barrel architecture similar to fatty acid binding proteins (FABPs) and two putative ligand binding sites (LBS1 and LBS2) where fatty acids can bind. However, some SAHS proteins such as RvSAHS4 have different sets of amino acid residues at LBS1 and LBS2, implying that they prefer other ligands and have different functions. Here RvSAHS4 was crystallized and analyzed under a condition similar to that for RvSAHS1. There was no electron density corresponding to a fatty acid at LBS1 of RvSAHS4, where a putative fatty acid was observed in RvSAHS1. Instead, LBS2 of RvSAHS4, which was composed of uncharged residues, captured a putative polyethylene glycol molecule. These results suggest that RvSAHS4 mainly uses LBS2 for the binding of uncharged molecules. PMID:29493034

Molecular and functional characterization of the promoter of ETS2, the human c-ets-2 gene.

PubMed Central

Mavrothalassitis, G J; Watson, D K; Papas, T S

1990-01-01

The 5' end of the human c-ets-2 gene, ETS2, was cloned and characterized. The major transcription initiation start sites were identified, and the pertinent sequences surrounding the ETS2 promoter were determined. The promoter region of ETS2 does not possess typical "TATA" and "CAAT" elements. However, this promoter contains several repeat regions, as well as two consensus AP2 binding sites and three putative Sp1 sites. There is also a palindromic region similar to the serum response element of the c-fos gene, located 1400 base pairs (bp) upstream from the first major transcription initiation site. A G + C-rich sequence (GC element) with dyad symmetry can be seen in the ETS2 promoter, immediately following an unusually long (approximately 250-bp) polypurine-polypyrimidine tract. A series of deletion fragments from the putative promoter region were ligated in front of the bacterial chloramphenicol acetyltransferase gene and tested for activity following transfection into HeLa cells. The 5' boundary of the region needed for maximum promoter activity was found to be 159 bp upstream of the major initiation site. This region of 159 bp contains putative binding sites for transcription factors Sp1 and AP2 (one for each), the GC element, one small forward repeat, one inverted repeat, and half of the polypurine-pyrimidine tract. The promoter of ETS2 (within the polypyrimidine tract) serves to illustrate an alternative structure that may be present in genes with "TATA-less" promoters. Images PMID:2405393

The Cu(II) affinity of the N-terminus of human copper transporter CTR1: Comparison of human and mouse sequences.

PubMed

Bossak, Karolina; Drew, Simon C; Stefaniak, Ewelina; Płonka, Dawid; Bonna, Arkadiusz; Bal, Wojciech

2018-05-01

Copper Transporter 1 (CTR1) is a homotrimeric membrane protein providing the main route of copper transport into eukaryotic cells from the extracellular milieu. Its N-terminal extracellular domain, rich in His and Met residues, is considered responsible for directing copper into the transmembrane channel. Most of vertebrate CTR1 proteins contain the His residue in position three from N-terminus, creating a well-known Amino Terminal Cu(II)- and Ni(II)-Binding (ATCUN) site. CTR1 from humans, primates and many other species contains the Met-Asp-His (MDH) sequence, while some rodents including mouse have the Met-Asn-His (MNH) N-terminal sequence. CTR1 is thought to collect Cu(II) ions from blood copper transport proteins, including albumin, but previous reports indicated that the affinity of N-terminal peptide/domain of CTR1 is significantly lower than that of albumin, casting serious doubt on this aspect of CTR1 function. Using potentiometry and spectroscopic techniques we demonstrated that MDH-amide, a tripeptide model of human CTR1 N-terminus, binds Cu(II) with K of 1.3 × 10 13  M -1 at pH 7.4, ~13 times stronger than Human Serum Albumin (HSA), and MNH-amide is even stronger, K of 3.2 × 10 14  M -1 at pH 7.4. These results indicate that the N-terminus of CTR1 may serve as intermediate binding site during Cu(II) transfer from blood copper carriers to the transporter. MDH-amide, but not MNH-amide also forms a low abundance complex with non-ATCUN coordination involving the Met amine, His imidazole and Asp carboxylate. This species might assist Cu(II) relay down the peptide chain or its reduction to Cu(I), both steps necessary for the CTR1 function. Copyright © 2018 Elsevier Inc. All rights reserved.

Binding Selectivity of Methanobactin from Methylosinus trichosporium OB3b for Copper(I), Silver(I), Zinc(II), Nickel(II), Cobalt(II), Manganese(II), Lead(II), and Iron(II)

NASA Astrophysics Data System (ADS)

McCabe, Jacob W.; Vangala, Rajpal; Angel, Laurence A.

2017-12-01

Methanobactin (Mb) from Methylosinus trichosporium OB3b is a member of a class of metal binding peptides identified in methanotrophic bacteria. Mb will selectively bind and reduce Cu(II) to Cu(I), and is thought to mediate the acquisition of the copper cofactor for the enzyme methane monooxygenase. These copper chelating properties of Mb make it potentially useful as a chelating agent for treatment of diseases where copper plays a role including Wilson's disease, cancers, and neurodegenerative diseases. Utilizing traveling wave ion mobility-mass spectrometry (TWIMS), the competition for the Mb copper binding site from Ag(I), Pb(II), Co(II), Fe(II), Mn(II), Ni(II), and Zn(II) has been determined by a series of metal ion titrations, pH titrations, and metal ion displacement titrations. The TWIMS analyses allowed for the explicit identification and quantification of all the individual Mb species present during the titrations and measured their collision cross-sections and collision-induced dissociation patterns. The results showed Ag(I) and Ni(II) could irreversibly bind to Mb and not be effectively displaced by Cu(I), whereas Ag(I) could also partially displace Cu(I) from the Mb complex. At pH ≈ 6.5, the Mb binding selectivity follows the order Ag(I)≈Cu(I)>Ni(II)≈Zn(II)>Co(II)>>Mn(II)≈Pb(II)>Fe(II), and at pH 7.5 to 10.4 the order is Ag(I)>Cu(I)>Ni(II)>Co(II)>Zn(II)>Mn(II)≈Pb(II)>Fe(II). Breakdown curves of the disulfide reduced Cu(I) and Ag(I) complexes showed a correlation existed between their relative stability and their compact folded structure indicated by their CCS. Fluorescence spectroscopy, which allowed the determination of the binding constant, compared well with the TWIMS analyses, with the exception of the Ni(II) complex. [Figure not available: see fulltext.

Binding Selectivity of Methanobactin from Methylosinus trichosporium OB3b for Copper(I), Silver(I), Zinc(II), Nickel(II), Cobalt(II), Manganese(II), Lead(II), and Iron(II).

PubMed

McCabe, Jacob W; Vangala, Rajpal; Angel, Laurence A

2017-12-01

Methanobactin (Mb) from Methylosinus trichosporium OB3b is a member of a class of metal binding peptides identified in methanotrophic bacteria. Mb will selectively bind and reduce Cu(II) to Cu(I), and is thought to mediate the acquisition of the copper cofactor for the enzyme methane monooxygenase. These copper chelating properties of Mb make it potentially useful as a chelating agent for treatment of diseases where copper plays a role including Wilson's disease, cancers, and neurodegenerative diseases. Utilizing traveling wave ion mobility-mass spectrometry (TWIMS), the competition for the Mb copper binding site from Ag(I), Pb(II), Co(II), Fe(II), Mn(II), Ni(II), and Zn(II) has been determined by a series of metal ion titrations, pH titrations, and metal ion displacement titrations. The TWIMS analyses allowed for the explicit identification and quantification of all the individual Mb species present during the titrations and measured their collision cross-sections and collision-induced dissociation patterns. The results showed Ag(I) and Ni(II) could irreversibly bind to Mb and not be effectively displaced by Cu(I), whereas Ag(I) could also partially displace Cu(I) from the Mb complex. At pH ≈ 6.5, the Mb binding selectivity follows the order Ag(I)≈Cu(I)>Ni(II)≈Zn(II)>Co(II)>Mn(II)≈Pb(II)>Fe(II), and at pH 7.5 to 10.4 the order is Ag(I)>Cu(I)>Ni(II)>Co(II)>Zn(II)>Mn(II)≈Pb(II)>Fe(II). Breakdown curves of the disulfide reduced Cu(I) and Ag(I) complexes showed a correlation existed between their relative stability and their compact folded structure indicated by their CCS. Fluorescence spectroscopy, which allowed the determination of the binding constant, compared well with the TWIMS analyses, with the exception of the Ni(II) complex. Graphical abstract ᅟ.

A horizontally gene transferred copper resistance locus confers hyper‐resistance to antibacterial copper toxicity and enables survival of community acquired methicillin resistant Staphylococcus aureus USA300 in macrophages

PubMed Central

Purves, Joanne; Thomas, Jamie; Riboldi, Gustavo P.; Zapotoczna, Marta; Tarrant, Emma; Andrew, Peter W.; Londoño, Alejandra; Planet, Paul J.; Geoghegan, Joan A.; Waldron, Kevin J.

2018-01-01

Summary Excess copper is highly toxic and forms part of the host innate immune system's antibacterial arsenal, accumulating at sites of infection and acting within macrophages to kill engulfed pathogens. We show for the first time that a novel, horizontally gene transferred copper resistance locus (copXL), uniquely associated with the SCCmec elements of the highly virulent, epidemic, community acquired methicillin resistant Staphylococcus aureus (CA‐MRSA) USA300, confers copper hyper‐resistance. These genes are additional to existing core genome copper resistance mechanisms, and are not found in typical S. aureus lineages, but are increasingly identified in emerging pathogenic isolates. Our data show that CopX, a putative P1B‐3‐ATPase efflux transporter, and CopL, a novel lipoprotein, confer copper hyper‐resistance compared to typical S. aureus strains. The copXL genes form an operon that is tightly repressed in low copper environments by the copper regulator CsoR. Significantly, CopX and CopL are important for S. aureus USA300 intracellular survival within macrophages. Therefore, the emergence of new S. aureus clones with the copXL locus has significant implications for public health because these genes confer increased resistance to antibacterial copper toxicity, enhancing bacterial fitness by altering S. aureus interaction with innate immunity. PMID:29521441

The RNA-Binding Site of Poliovirus 3C Protein Doubles as a Phosphoinositide-Binding Domain.

PubMed

Shengjuler, Djoshkun; Chan, Yan Mei; Sun, Simou; Moustafa, Ibrahim M; Li, Zhen-Lu; Gohara, David W; Buck, Matthias; Cremer, Paul S; Boehr, David D; Cameron, Craig E

2017-12-05

Some viruses use phosphatidylinositol phosphate (PIP) to mark membranes used for genome replication or virion assembly. PIP-binding motifs of cellular proteins do not exist in viral proteins. Molecular-docking simulations revealed a putative site of PIP binding to poliovirus (PV) 3C protein that was validated using nuclear magnetic resonance spectroscopy. The PIP-binding site was located on a highly dynamic α helix, which also functions in RNA binding. Broad PIP-binding activity was observed in solution using a fluorescence polarization assay or in the context of a lipid bilayer using an on-chip, fluorescence assay. All-atom molecular dynamics simulations of the 3C protein-membrane interface revealed PIP clustering and perhaps PIP-dependent conformations. PIP clustering was mediated by interaction with residues that interact with the RNA phosphodiester backbone. We conclude that 3C binding to membranes will be determined by PIP abundance. We suggest that the duality of function observed for 3C may extend to RNA-binding proteins of other viruses. Copyright © 2017 Elsevier Ltd. All rights reserved.

The Zur regulon of Corynebacterium glutamicum ATCC 13032

PubMed Central

2010-01-01

Background Zinc is considered as an essential element for all living organisms, but it can be toxic at large concentrations. Bacteria therefore tightly regulate zinc metabolism. The Cg2502 protein of Corynebacterium glutamicum was a candidate to control zinc metabolism in this species, since it was classified as metalloregulator of the zinc uptake regulator (Zur) subgroup of the ferric uptake regulator (Fur) family of DNA-binding transcription regulators. Results The cg2502 (zur) gene was deleted in the chromosome of C. glutamicum ATCC 13032 by an allelic exchange procedure to generate the zur-deficient mutant C. glutamicum JS2502. Whole-genome DNA microarray hybridizations and real-time RT-PCR assays comparing the gene expression in C. glutamicum JS2502 with that of the wild-type strain detected 18 genes with enhanced expression in the zur mutant. The expression data were combined with results from cross-genome comparisons of shared regulatory sites, revealing the presence of candidate Zur-binding sites in the mapped promoter regions of five transcription units encoding components of potential zinc ABC-type transporters (cg0041-cg0042/cg0043; cg2911-cg2912-cg2913), a putative secreted protein (cg0040), a putative oxidoreductase (cg0795), and a putative P-loop GTPase of the COG0523 protein family (cg0794). Enhanced transcript levels of the respective genes in C. glutamicum JS2502 were verified by real-time RT-PCR, and complementation of the mutant with a wild-type zur gene reversed the effect of differential gene expression. The zinc-dependent expression of the putative cg0042 and cg2911 operons was detected in vivo with a gfp reporter system. Moreover, the zinc-dependent binding of purified Zur protein to double-stranded 40-mer oligonucleotides containing candidate Zur-binding sites was demonstrated in vitro by DNA band shift assays. Conclusion Whole-genome expression profiling and DNA band shift assays demonstrated that Zur directly represses in a zinc-dependent manner the expression of nine genes organized in five transcription units. Accordingly, the Zur (Cg2502) protein is the key transcription regulator for genes involved in zinc homeostasis in C. glutamicum. PMID:20055984

Neuronal differentiation is associated with a redox-regulated increase of copper flow to the secretory pathway

PubMed Central

Hatori, Yuta; Yan, Ye; Schmidt, Katharina; Furukawa, Eri; Hasan, Nesrin M.; Yang, Nan; Liu, Chin-Nung; Sockanathan, Shanthini; Lutsenko, Svetlana

2016-01-01

Brain development requires a fine-tuned copper homoeostasis. Copper deficiency or excess results in severe neuro-pathologies. We demonstrate that upon neuronal differentiation, cellular demand for copper increases, especially within the secretory pathway. Copper flow to this compartment is facilitated through transcriptional and metabolic regulation. Quantitative real-time imaging revealed a gradual change in the oxidation state of cytosolic glutathione upon neuronal differentiation. Transition from a broad range of redox states to a uniformly reducing cytosol facilitates reduction of the copper chaperone Atox1, liberating its metal-binding site. Concomitantly, expression of Atox1 and its partner, a copper transporter ATP7A, is upregulated. These events produce a higher flux of copper through the secretory pathway that balances copper in the cytosol and increases supply of the cofactor to copper-dependent enzymes, expression of which is elevated in differentiated neurons. Direct link between glutathione oxidation and copper compartmentalization allows for rapid metabolic adjustments essential for normal neuronal function. PMID:26879543

Neuronal differentiation is associated with a redox-regulated increase of copper flow to the secretory pathway.

PubMed

Hatori, Yuta; Yan, Ye; Schmidt, Katharina; Furukawa, Eri; Hasan, Nesrin M; Yang, Nan; Liu, Chin-Nung; Sockanathan, Shanthini; Lutsenko, Svetlana

2016-02-16

Brain development requires a fine-tuned copper homoeostasis. Copper deficiency or excess results in severe neuro-pathologies. We demonstrate that upon neuronal differentiation, cellular demand for copper increases, especially within the secretory pathway. Copper flow to this compartment is facilitated through transcriptional and metabolic regulation. Quantitative real-time imaging revealed a gradual change in the oxidation state of cytosolic glutathione upon neuronal differentiation. Transition from a broad range of redox states to a uniformly reducing cytosol facilitates reduction of the copper chaperone Atox1, liberating its metal-binding site. Concomitantly, expression of Atox1 and its partner, a copper transporter ATP7A, is upregulated. These events produce a higher flux of copper through the secretory pathway that balances copper in the cytosol and increases supply of the cofactor to copper-dependent enzymes, expression of which is elevated in differentiated neurons. Direct link between glutathione oxidation and copper compartmentalization allows for rapid metabolic adjustments essential for normal neuronal function.

Metallofullerenol Gd@C82(OH)22 distracts the proline-rich-motif from putative binding on the SH3 domain

NASA Astrophysics Data System (ADS)

Kang, Seung-Gu; Huynh, Tien; Zhou, Ruhong

2013-03-01

Biocompatibility is often regarded as one important aspect of de novo designed nanomaterials for biosafety. However, the toxicological effect, appearing along with its latency, is much more difficult to address by linearly mapping physicochemical properties of related nanomaterials with biological effects such as immune or cellular regulatory responses due to the complicated protein-protein interactions. Here, we investigate a potential interference of a metallofullerenol, Gd@C82(OH)22, on the function of SH3 domain, a highly promiscuous protein-protein interaction mediator involved in signaling and regulatory pathways through its binding with the proline-rich motif (PRM) peptides, using the atomistic molecular dynamics simulation. Our study shows that when only Gd@C82(OH)22 and the SH3 domain are present (without the PRM ligand), Gd@C82(OH)22 can interact with the SH3 domain by either directly blocking the hydrophobic active site or binding with a hydrophilic off-site with almost equal probability, which can be understood from its intrinsic amphiphilic nature. In a binding competition with the PRM onto the SH3 domain, however, the on-site binding mode is depleted while Gd@C82(OH)22 effectively intercepts the PRM from the putative binding site of the SH3 domain, implying that Gd@C82(OH)22 can disturb protein-protein interactions mediated by the SH3 domain. Despite a successful surface modification in an aqueous biological medium and a more recent demonstration as potential de novo cancer therapeutics, our study indicates that greater attention is needed in assessing the potential cytotoxicity of these nanomaterials.Biocompatibility is often regarded as one important aspect of de novo designed nanomaterials for biosafety. However, the toxicological effect, appearing along with its latency, is much more difficult to address by linearly mapping physicochemical properties of related nanomaterials with biological effects such as immune or cellular regulatory responses due to the complicated protein-protein interactions. Here, we investigate a potential interference of a metallofullerenol, Gd@C82(OH)22, on the function of SH3 domain, a highly promiscuous protein-protein interaction mediator involved in signaling and regulatory pathways through its binding with the proline-rich motif (PRM) peptides, using the atomistic molecular dynamics simulation. Our study shows that when only Gd@C82(OH)22 and the SH3 domain are present (without the PRM ligand), Gd@C82(OH)22 can interact with the SH3 domain by either directly blocking the hydrophobic active site or binding with a hydrophilic off-site with almost equal probability, which can be understood from its intrinsic amphiphilic nature. In a binding competition with the PRM onto the SH3 domain, however, the on-site binding mode is depleted while Gd@C82(OH)22 effectively intercepts the PRM from the putative binding site of the SH3 domain, implying that Gd@C82(OH)22 can disturb protein-protein interactions mediated by the SH3 domain. Despite a successful surface modification in an aqueous biological medium and a more recent demonstration as potential de novo cancer therapeutics, our study indicates that greater attention is needed in assessing the potential cytotoxicity of these nanomaterials. Electronic supplementary information (ESI) available. See DOI: 10.1039/c3nr33756a

CisMiner: Genome-Wide In-Silico Cis-Regulatory Module Prediction by Fuzzy Itemset Mining

PubMed Central

Navarro, Carmen; Lopez, Francisco J.; Cano, Carlos; Garcia-Alcalde, Fernando; Blanco, Armando

2014-01-01

Eukaryotic gene control regions are known to be spread throughout non-coding DNA sequences which may appear distant from the gene promoter. Transcription factors are proteins that coordinately bind to these regions at transcription factor binding sites to regulate gene expression. Several tools allow to detect significant co-occurrences of closely located binding sites (cis-regulatory modules, CRMs). However, these tools present at least one of the following limitations: 1) scope limited to promoter or conserved regions of the genome; 2) do not allow to identify combinations involving more than two motifs; 3) require prior information about target motifs. In this work we present CisMiner, a novel methodology to detect putative CRMs by means of a fuzzy itemset mining approach able to operate at genome-wide scale. CisMiner allows to perform a blind search of CRMs without any prior information about target CRMs nor limitation in the number of motifs. CisMiner tackles the combinatorial complexity of genome-wide cis-regulatory module extraction using a natural representation of motif combinations as itemsets and applying the Top-Down Fuzzy Frequent- Pattern Tree algorithm to identify significant itemsets. Fuzzy technology allows CisMiner to better handle the imprecision and noise inherent to regulatory processes. Results obtained for a set of well-known binding sites in the S. cerevisiae genome show that our method yields highly reliable predictions. Furthermore, CisMiner was also applied to putative in-silico predicted transcription factor binding sites to identify significant combinations in S. cerevisiae and D. melanogaster, proving that our approach can be further applied genome-wide to more complex genomes. CisMiner is freely accesible at: http://genome2.ugr.es/cisminer. CisMiner can be queried for the results presented in this work and can also perform a customized cis-regulatory module prediction on a query set of transcription factor binding sites provided by the user. PMID:25268582

Substitutions of PrP N-terminal histidine residues modulate scrapie disease pathogenesis and incubation time in transgenic mice

PubMed Central

Eigenbrod, Sabina; Frick, Petra; Bertsch, Uwe; Mitteregger-Kretzschmar, Gerda; Mielke, Janina; Maringer, Marko; Piening, Niklas; Hepp, Alexander; Daude, Nathalie; Windl, Otto; Levin, Johannes; Giese, Armin; Sakthivelu, Vignesh; Tatzelt, Jörg

2017-01-01

Prion diseases have been linked to impaired copper homeostasis and copper induced-oxidative damage to the brain. Divalent metal ions, such as Cu2+ and Zn2+, bind to cellular prion protein (PrPC) at octapeptide repeat (OR) and non-OR sites within the N-terminal half of the protein but information on the impact of such binding on conversion to the misfolded isoform often derives from studies using either OR and non-OR peptides or bacterially-expressed recombinant PrP. Here we created new transgenic mouse lines expressing PrP with disrupted copper binding sites within all four histidine-containing OR's (sites 1–4, H60G, H68G, H76G, H84G, "TetraH>G" allele) or at site 5 (composed of residues His-95 and His-110; "H95G" allele) and monitored the formation of misfolded PrP in vivo. Novel transgenic mice expressing PrP(TetraH>G) at levels comparable to wild-type (wt) controls were susceptible to mouse-adapted scrapie strain RML but showed significantly prolonged incubation times. In contrast, amino acid replacement at residue 95 accelerated disease progression in corresponding PrP(H95G) mice. Neuropathological lesions in terminally ill transgenic mice were similar to scrapie-infected wt controls, but less severe. The pattern of PrPSc deposition, however, was not synaptic as seen in wt animals, but instead dense globular plaque-like accumulations of PrPSc in TgPrP(TetraH>G) mice and diffuse PrPSc deposition in (TgPrP(H95G) mice), were observed throughout all brain sections. We conclude that OR and site 5 histidine substitutions have divergent phenotypic impacts and that cis interactions between the OR region and the site 5 region modulate pathogenic outcomes by affecting the PrP globular domain. PMID:29220360

The structure of free L11 and functional dynamics of L11 in free, L11-rRNA(58 nt) binary and L11-rRNA(58 nt)-thiostrepton ternary complexes.

PubMed

Lee, Donghan; Walsh, Joseph D; Yu, Ping; Markus, Michelle A; Choli-Papadopoulou, Theodora; Schwieters, Charles D; Krueger, Susan; Draper, David E; Wang, Yun-Xing

2007-04-06

The L11 binding site is one of the most important functional sites in the ribosome. The N-terminal domain of L11 has been implicated as a "reversible switch" in facilitating the coordinated movements associated with EF-G-driven GTP hydrolysis. The reversible switch mechanism has been hypothesized to require conformational flexibility involving re-orientation and re-positioning of the two L11 domains, and warrants a close examination of the structure and dynamics of L11. Here we report the solution structure of free L11, and relaxation studies of free L11, L11 complexed to its 58 nt RNA recognition site, and L11 in a ternary complex with the RNA and thiostrepton antibiotic. The binding site of thiostrepton on L11 was also defined by analysis of structural and dynamics data and chemical shift mapping. The conclusions of this work are as follows: first, the binding of L11 to RNA leads to sizable conformation changes in the regions flanking the linker and in the hinge area that links a beta-sheet and a 3(10)-helix-turn-helix element in the N terminus. Concurrently, the change in the relative orientation may lead to re-positioning of the N terminus, as implied by a decrease of radius of gyration from 18.5 A to 16.2 A. Second, the regions, which undergo large conformation changes, exhibit motions on milliseconds-microseconds or nanoseconds-picoseconds time scales. Third, binding of thiostrepton results in more rigid conformations near the linker (Thr71) and near its putative binding site (Leu12). Lastly, conformational changes in the putative thiostrepton binding site are implicated by the re-emergence of cross-correlation peaks in the spectrum of the ternary complex, which were missing in that of the binary complex. Our combined analysis of both the chemical shift perturbation and dynamics data clearly indicates that thiostrepton binds to a pocket involving residues in the 3(10)-helix in L11.

The Structure of Free L11 and Functional Dynamics of L11 in Free, L11-rRNA(58nt) Binary and L11-rRNA(58nt)-thiostrepton Ternary Complexes

PubMed Central

Lee, Donghan; Walsh, Joseph D.; Yu, Ping; Markus, Michelle A.; Choli-Papadopoulou, Theodora; Schwieters, Charles D.; Krueger, Susan; Draper, David E.; Wang, Yun-Xing

2007-01-01

Summary The L11 binding site is one of the most important functional sites in the ribosome. The N-terminal domain of L11 has been implicated as a “reversible switch” in facilitating the coordinated movements associated with EF-G–driven GTP hydrolysis. The “reversible switch” mechanism has been hypothesized to require conformational flexibility involving re-orientation and re-positioning of the two L11 domains, and warrants a close examination of the structure and dynamics of L11. Here we report the solution structure of free L11, and relaxation studies of free L11, L11complexed to its 58 nt RNA recognition site, and L11 in a ternary complex with the RNA and thiostrepton antibiotic. The binding site of thiostrepton on L11 was also defined by analysis of structural and dynamics data and chemical shift mapping. The conclusions of this work are as follows: First, the binding of L11 to RNA leads to sizable conformation changes in the regions flanking the linker and in the hinge area that links a β-sheets and a 310-helix-turn-helix element in the N-terminus. Concurrently, the change in the relative orientation may lead to re-positioning of the N-terminus, as implied by a decrease of radius of gyration from 18.5 Å to 16.2 Å. Second, the regions, which undergo large conformation changes, exhibit motions on ms-μs or ns-ps time scales. Third, binding of thiostrepton results in more rigid conformations near the linker (Thr71) and near its putative binding site (Leu12). Lastly, conformational changes in the putative thiostrepton binding site are implicated by the re-emergence of cross-correlation peaks in the spectrum of the ternary complex, which were missing in that of the binary complex. Our combined analysis of both the chemical shift perturbation and dynamics data clearly indicates that thiostrepton binds to a pocket involving residues in the 310-helix in L11. PMID:17292917

Spatial variability of total dissolved copper and copper speciation in the inshore waters of Bermuda.

PubMed

Oldham, V E; Swenson, M M; Buck, K N

2014-02-15

Total dissolved copper (Cu) and Cu speciation were examined from inshore waters of Bermuda, in October 2009 and July-August 2010, to determine the relationship between total dissolved Cu, Cu-binding ligands and bioavailable, free, hydrated Cu(2+) concentrations. Speciation was performed using competitive ligand exchange-adsorptive cathodic stripping voltammetry (CLE-ACSV). Mean total dissolved Cu concentrations ranged from 1.4 nM to 19.2 nM, with lowest concentrations at sites further from shore, consistent with previous measurements in the Sargasso Sea, and localized Cu enrichment inshore in enclosed harbors. Ligand concentrations exceeded dissolved [Cu] at most sites, and [Cu(2+)] were correspondingly low at those sites, typically <10(-13) M. One site, Hamilton Harbour, was found to have [Cu] in excess of ligands, resulting in [Cu(2+)] of 10(-10.7) M, and indicating that Cu may be toxic to phytoplankton here. Copyright © 2013 Elsevier Ltd. All rights reserved.

Complexation of copper by aquatic humic substances from different environments

USGS Publications Warehouse

McKnight, Diane M.; Feder, Gerald L.; Thurman, E. Michael; Wershaw, Robert L.

1983-01-01

The copper-complexing properties of aquatic humic substances isolated from eighteen different environments were characterized by potentiometric titration, using a cupric ion selective electrode. Potentiometric data were analyzed using FITEQL, a computer program for the determination of chemical equilibrium constants from experimental data. All the aquatic humic substances could be modelled as having two types of Cu(II)-binding sites: one with K equal to about 106 and a concentration of 1.0 ± 0.4 × 10−6 M(mg C)−1 and another with K equal to about 108 and a concentration of 2.6 ± 1.6 × 10−7 M(mg C)−1.A method is described for estimating the Cu(II)-binding sites associated with dissolved humic substances in natural water based on a measurement of dissolved organic carbon, which may be helpful in evaluating chemical processes controlling speciation of Cu and bioavailability of Cu to aquatic organisms.

DFT Study on Nitrite Reduction Mechanism in Copper-Containing Nitrite Reductase.

PubMed

Lintuluoto, Masami; Lintuluoto, Juha M

2016-01-12

Dissimilatory reduction of nitrite by copper-containing nitrite reductase (CuNiR) is an important step in the geobiochemical nitrogen cycle. The proposed mechanisms for the reduction of nitrite by CuNiRs include intramolecular electron and proton transfers, and these two events are understood to couple. Proton-coupled electron transfer is one of the key processes in enzyme reactions. We investigated the geometric structure of bound nitrite and the mechanism of nitrite reduction on CuNiR using density functional theory calculations. Also, the proton transfer pathway, the key residues, and their roles in the reaction mechanism were clarified in this study. In our results, the reduction of T2 Cu site promotes the proton transfer, and the hydrogen bond network around the binding site has an important role not only to stabilize the nitrite binding but also to promote the proton transfer to nitrite.

Species B adenovirus serotypes 3, 7, 11 and 35 share similar binding sites on the membrane cofactor protein CD46 receptor.

PubMed

Fleischli, Christoph; Sirena, Dominique; Lesage, Guillaume; Havenga, Menzo J E; Cattaneo, Roberto; Greber, Urs F; Hemmi, Silvio

2007-11-01

We recently characterized the domains of the human cofactor protein CD46 involved in binding species B2 adenovirus (Ad) serotype 35. Here, the CD46 binding determinants are mapped for the species B1 Ad serotypes 3 and 7 and for the species B2 Ad11. Ad3, 7 and 11 bound and transduced CD46-positive rodent BHK cells at levels similar to Ad35. By using antibody-blocking experiments, hybrid CD46-CD4 receptor constructs and CD46 single point mutants, it is shown that Ad3, 7 and 11 share many of the Ad35-binding features on CD46. Both CD46 short consensus repeat domains SCR I and SCR II were necessary and sufficient for optimal binding and transgene expression, provided that they were positioned at an appropriate distance from the cell membrane. Similar to Ad35, most of the putative binding residues of Ad3, 7 and 11 were located on the same glycan-free, solvent-exposed face of the SCR I or SCR II domains, largely overlapping with the binding surface of the recently solved fiber knob Ad11-SCR I-II three-dimensional structure. Differences between species B1 and B2 Ads were documented with competition experiments based on anti-CD46 antibodies directed against epitopes flanking the putative Ad-binding sites, and with competition experiments based on soluble CD46 protein. It is concluded that the B1 and B2 species of Ad engage CD46 through similar binding surfaces.

New copper resistance determinants in the extremophile acidithiobacillus ferrooxidans: a quantitative proteomic analysis.

PubMed

Almárcegui, Rodrigo J; Navarro, Claudio A; Paradela, Alberto; Albar, Juan Pablo; von Bernath, Diego; Jerez, Carlos A

2014-02-07

Acidithiobacillus ferrooxidans is an extremophilic bacterium used in biomining processes to recover metals. The presence in A. ferrooxidans ATCC 23270 of canonical copper resistance determinants does not entirely explain the extremely high copper concentrations this microorganism is able to stand, suggesting the existence of other efficient copper resistance mechanisms. New possible copper resistance determinants were searched by using 2D-PAGE, real time PCR (qRT-PCR) and quantitative proteomics with isotope-coded protein labeling (ICPL). A total of 594 proteins were identified of which 120 had altered levels in cells grown in the presence of copper. Of this group of proteins, 76 were up-regulated and 44 down-regulated. The up-regulation of RND-type Cus systems and different RND-type efflux pumps was observed in response to copper, suggesting that these proteins may be involved in copper resistance. An overexpression of most of the genes involved in histidine synthesis and several of those annotated as encoding for cysteine production was observed in the presence of copper, suggesting a possible direct role for these metal-binding amino acids in detoxification. Furthermore, the up-regulation of putative periplasmic disulfide isomerases was also seen in the presence of copper, suggesting that they restore copper-damaged disulfide bonds to allow cell survival. Finally, the down-regulation of the major outer membrane porin and some ionic transporters was seen in A. ferrooxidans grown in the presence of copper, indicating a general decrease in the influx of the metal and other cations into the cell. Thus, A. ferrooxidans most likely uses additional copper resistance strategies in which cell envelope proteins are key components. This knowledge will not only help to understand the mechanism of copper resistance in this extreme acidophile but may help also to select the best fit members of the biomining community to attain more efficient industrial metal leaching processes.

Inhibition of tyrosinase by 4H-chromene analogs: Synthesis, kinetic studies, and computational analysis.

PubMed

Brasil, Edikarlos M; Canavieira, Luciana M; Cardoso, Érica T C; Silva, Edilene O; Lameira, Jerônimo; Nascimento, José L M; Eifler-Lima, Vera L; Macchi, Barbarella M; Sriram, Dharmarajan; Bernhardt, Paul V; Silva, José Rogério Araújo; Williams, Craig M; Alves, Cláudio N

2017-11-01

Inhibition of mushroom tyrosinase was observed with synthetic dihydropyrano[3,2-b]chromenediones. Among them, DHPC04 displayed the most potent tyrosinase inhibitory activity with a K i value of 4 μm, comparable to the reference standard inhibitor kojic acid. A kinetic study suggested that these synthetic heterocyclic compounds behave as competitive inhibitors for the L-DOPA binding site of the enzyme. Furthermore, molecular modeling provided important insight into the mechanism of binding interactions with the tyrosinase copper active site. © 2017 John Wiley & Sons A/S.

Copper Resistance of the Emerging Pathogen Acinetobacter baumannii

PubMed Central

Williams, Caitlin L.; Neu, Heather M.; Gilbreath, Jeremy J.; Michel, Sarah L. J.; Zurawski, Daniel V.

2016-01-01

ABSTRACT Acinetobacter baumannii is an important emerging pathogen that is capable of causing many types of severe infection, especially in immunocompromised hosts. Since A. baumannii can rapidly acquire antibiotic resistance genes, many infections are on the verge of being untreatable, and novel therapies are desperately needed. To investigate the potential utility of copper-based antibacterial strategies against Acinetobacter infections, we characterized copper resistance in a panel of recent clinical A. baumannii isolates. Exposure to increasing concentrations of copper in liquid culture and on solid surfaces resulted in dose-dependent and strain-dependent effects; levels of copper resistance varied broadly across isolates, possibly resulting from identified genotypic variation among strains. Examination of the growth-phase-dependent effect of copper on A. baumannii revealed that resistance to copper increased dramatically in stationary phase. Moreover, A. baumannii biofilms were more resistant to copper than planktonic cells but were still susceptible to copper toxicity. Exposure of bacteria to subinhibitory concentrations of copper allowed them to better adapt to and grow in high concentrations of copper; this copper tolerance response is likely achieved via increased expression of copper resistance mechanisms. Indeed, genomic analysis revealed numerous putative copper resistance proteins that share amino acid homology to known proteins in Escherichia coli and Pseudomonas aeruginosa. Transcriptional analysis revealed significant upregulation of these putative copper resistance genes following brief copper exposure. Future characterization of copper resistance mechanisms may aid in the search for novel antibiotics against Acinetobacter and other highly antibiotic-resistant pathogens. IMPORTANCE Acinetobacter baumannii causes many types of severe nosocomial infections; unfortunately, some isolates have acquired resistance to almost every available antibiotic, and treatment options are incredibly limited. Copper is an essential nutrient but becomes toxic at high concentrations. The inherent antimicrobial properties of copper give it potential for use in novel therapeutics against drug-resistant pathogens. We show that A. baumannii clinical isolates are sensitive to copper in vitro, both in liquid and on solid metal surfaces. Since bacterial resistance to copper is mediated though mechanisms of efflux and detoxification, we identified genes encoding putative copper-related proteins in A. baumannii and showed that expression of some of these genes is regulated by the copper concentration. We propose that the antimicrobial effects of copper may be beneficial in the development of future therapeutics that target multidrug-resistant bacteria. PMID:27520808

Beyond the binding site: in vivo identification of tbx2, smarca5 and wnt5b as molecular targets of CNBP during embryonic development.

PubMed

Armas, Pablo; Margarit, Ezequiel; Mouguelar, Valeria S; Allende, Miguel L; Calcaterra, Nora B

2013-01-01

CNBP is a nucleic acid chaperone implicated in vertebrate craniofacial development, as well as in myotonic dystrophy type 2 (DM2) and sporadic inclusion body myositis (sIBM) human muscle diseases. CNBP is highly conserved among vertebrates and has been implicated in transcriptional regulation; however, its DNA binding sites and molecular targets remain elusive. The main goal of this work was to identify CNBP DNA binding sites that might reveal target genes involved in vertebrate embryonic development. To accomplish this, we used a recently described yeast one-hybrid assay to identify DNA sequences bound in vivo by CNBP. Bioinformatic analyses revealed that these sequences are G-enriched and show high frequency of putative G-quadruplex DNA secondary structure. Moreover, an in silico approach enabled us to establish the CNBP DNA-binding site and to predict CNBP putative targets based on gene ontology terms and synexpression with CNBP. The direct interaction between CNBP and candidate genes was proved by EMSA and ChIP assays. Besides, the role of CNBP upon the identified genes was validated in loss-of-function experiments in developing zebrafish. We successfully confirmed that CNBP up-regulates tbx2b and smarca5, and down-regulates wnt5b gene expression. The highly stringent strategy used in this work allowed us to identify new CNBP target genes functionally important in different contexts of vertebrate embryonic development. Furthermore, it represents a novel approach toward understanding the biological function and regulatory networks involving CNBP in the biology of vertebrates.

Lack of variation in voltage-gated sodium channels of common bottlenose dolphins (Tursiops truncatus) exposed to neurotoxic algal blooms.

PubMed

Cammen, Kristina M; Rosel, Patricia E; Wells, Randall S; Read, Andrew J

2014-12-01

In coastal marine ecosystems, neurotoxins produced by harmful algal blooms (HABs) often result in large-scale mortality events of many marine species. Historical and frequent exposure to HABs therefore may provide a strong selective pressure for adaptations that result in toxin resistance. Neurotoxin resistance has independently evolved in a variety of terrestrial and marine species via mutations in genes encoding the toxin binding sites within the voltage-gated sodium channel gene complex. Accordingly, we tested the hypothesis that genetic variation in the putative binding site of brevetoxins in common bottlenose dolphins (Tursiops truncatus) explains differences among individuals or populations in resistance to harmful Karenia brevis blooms in the Gulf of Mexico. We found very little variation in the sodium channel exons encoding the putative brevetoxin binding site among bottlenose dolphins from central-west Florida and the Florida Panhandle. Our study included samples from several bottlenose dolphin mortality events associated with HABs, but we found no association between genetic variation and survival. We observed a significant effect of geographic region on genetic variation for some sodium channel isoforms, but this can be primarily explained by rare private alleles and is more likely a reflection of regional genetic differentiation than the cause of different levels of HAB resistance between regions. In contrast to many other previously studied neurotoxin-resistant species, we conclude that bottlenose dolphins have not evolved resistance to HABs via mutations in genes encoding the brevetoxin binding site on the voltage-gated sodium channels. Copyright © 2014 Elsevier B.V. All rights reserved.

Beyond the Binding Site: In Vivo Identification of tbx2, smarca5 and wnt5b as Molecular Targets of CNBP during Embryonic Development

PubMed Central

Mouguelar, Valeria S.; Allende, Miguel L.; Calcaterra, Nora B.

2013-01-01

CNBP is a nucleic acid chaperone implicated in vertebrate craniofacial development, as well as in myotonic dystrophy type 2 (DM2) and sporadic inclusion body myositis (sIBM) human muscle diseases. CNBP is highly conserved among vertebrates and has been implicated in transcriptional regulation; however, its DNA binding sites and molecular targets remain elusive. The main goal of this work was to identify CNBP DNA binding sites that might reveal target genes involved in vertebrate embryonic development. To accomplish this, we used a recently described yeast one-hybrid assay to identify DNA sequences bound in vivo by CNBP. Bioinformatic analyses revealed that these sequences are G-enriched and show high frequency of putative G-quadruplex DNA secondary structure. Moreover, an in silico approach enabled us to establish the CNBP DNA-binding site and to predict CNBP putative targets based on gene ontology terms and synexpression with CNBP. The direct interaction between CNBP and candidate genes was proved by EMSA and ChIP assays. Besides, the role of CNBP upon the identified genes was validated in loss-of-function experiments in developing zebrafish. We successfully confirmed that CNBP up-regulates tbx2b and smarca5, and down-regulates wnt5b gene expression. The highly stringent strategy used in this work allowed us to identify new CNBP target genes functionally important in different contexts of vertebrate embryonic development. Furthermore, it represents a novel approach toward understanding the biological function and regulatory networks involving CNBP in the biology of vertebrates. PMID:23667590

Regulatory elements of the floral homeotic gene AGAMOUS identified by phylogenetic footprinting and shadowing.

DOE Office of Scientific and Technical Information (OSTI.GOV)

Hong, R. L., Hamaguchi, L., Busch, M. A., and Weigel, D.

2003-06-01

OAK-B135 In Arabidopsis thaliana, cis-regulatory sequences of the floral homeotic gene AGAMOUS (AG) are located in the second intron. This 3 kb intron contains binding sites for two direct activators of AG, LEAFY (LFY) and WUSCHEL (WUS), along with other putative regulatory elements. We have used phylogenetic footprinting and the related technique of phylogenetic shadowing to identify putative cis-regulatory elements in this intron. Among 29 Brassicaceae, several other motifs, but not the LFY and WUS binding sites previously identified, are largely invariant. Using reporter gene analyses, we tested six of these motifs and found that they are all functionally importantmore » for activity of AG regulatory sequences in A. thaliana. Although there is little obvious sequence similarity outside the Brassicaceae, the intron from cucumber AG has at least partial activity in A. thaliana. Our studies underscore the value of the comparative approach as a tool that complements gene-by-gene promoter dissection, but also highlight that sequence-based studies alone are insufficient for a complete identification of cis-regulatory sites.« less

Microbial Copper-binding Siderophores at the Host-Pathogen Interface*

PubMed Central

Koh, Eun-Ik; Henderson, Jeffrey P.

2015-01-01

Numerous pathogenic microorganisms secrete small molecule chelators called siderophores defined by their ability to bind extracellular ferric iron, making it bioavailable to microbes. Recently, a siderophore produced by uropathogenic Escherichia coli, yersiniabactin, was found to also bind copper ions during human infections. The ability of yersiniabactin to protect E. coli from copper toxicity and redox-based phagocyte defenses distinguishes it from other E. coli siderophores. Here we compare yersiniabactin to other extracellular copper-binding molecules and review how copper-binding siderophores may confer virulence-associated gains of function during infection pathogenesis. PMID:26055720

Structural basis for the interaction of antibiotics with peptidyl transferase center in eubacteria

DOE Office of Scientific and Technical Information (OSTI.GOV)

Schlunzen, Frank; Zarivach, Raz; Harms, Jörg

2009-10-07

Ribosomes, the site of protein synthesis, are a major target for natural and synthetic antibiotics. Detailed knowledge of antibiotic binding sites is central to understanding the mechanisms of drug action. Conversely, drugs are excellent tools for studying the ribosome function. To elucidate the structural basis of ribosome-antibiotic interactions, we determined the high-resolution X-ray structures of the 50S ribosomal subunit of the eubacterium Deinococcus radiodurans, complexed with the clinically relevant antibiotics chloramphenicol, clindamycin and the three macrolides erythromycin, clarithromycin and roxithromycin. We found that antibiotic binding sites are composed exclusively of segments of 23S ribosomal RNA at the peptidyl transferase cavitymore » and do not involve any interaction of the drugs with ribosomal proteins. Here we report the details of antibiotic interactions with the components of their binding sites. Our results also show the importance of putative Mg{sup +2} ions for the binding of some drugs. This structural analysis should facilitate rational drug design.« less

Structural evidence for a copper-bound carbonate intermediate in the peroxidase and dismutase activities of superoxide dismutase.

PubMed

Strange, Richard W; Hough, Michael A; Antonyuk, Svetlana V; Hasnain, S Samar

2012-01-01

Copper-zinc superoxide dismutase (SOD) is of fundamental importance to our understanding of oxidative damage. Its primary function is catalysing the dismutation of superoxide to O(2) and H(2)O(2). SOD also reacts with H(2)O(2), leading to the formation of a strong copper-bound oxidant species that can either inactivate the enzyme or oxidise other substrates. In the presence of bicarbonate (or CO(2)) and H(2)O(2), this peroxidase activity is enhanced and produces the carbonate radical. This freely diffusible reactive oxygen species is proposed as the agent for oxidation of large substrates that are too bulky to enter the active site. Here, we provide direct structural evidence, from a 2.15 Å resolution crystal structure, of (bi)carbonate captured at the active site of reduced SOD, consistent with the view that a bound carbonate intermediate could be formed, producing a diffusible carbonate radical upon reoxidation of copper. The bound carbonate blocks direct access of substrates to Cu(I), suggesting that an adjunct to the accepted mechanism of SOD catalysed dismutation of superoxide operates, with Cu(I) oxidation by superoxide being driven via a proton-coupled electron transfer mechanism involving the bound carbonate rather than the solvent. Carbonate is captured in a different site when SOD is oxidised, being located in the active site channel adjacent to the catalytically important Arg143. This is the probable route of diffusion from the active site following reoxidation of the copper. In this position, the carbonate is poised for re-entry into the active site and binding to the reduced copper.

Structural Evidence for a Copper-Bound Carbonate Intermediate in the Peroxidase and Dismutase Activities of Superoxide Dismutase

PubMed Central

Strange, Richard W.; Hough, Michael A.; Antonyuk, Svetlana V.; Hasnain, S. Samar

2012-01-01

Copper-zinc superoxide dismutase (SOD) is of fundamental importance to our understanding of oxidative damage. Its primary function is catalysing the dismutation of superoxide to O2 and H2O2. SOD also reacts with H2O2, leading to the formation of a strong copper-bound oxidant species that can either inactivate the enzyme or oxidise other substrates. In the presence of bicarbonate (or CO2) and H2O2, this peroxidase activity is enhanced and produces the carbonate radical. This freely diffusible reactive oxygen species is proposed as the agent for oxidation of large substrates that are too bulky to enter the active site. Here, we provide direct structural evidence, from a 2.15 Å resolution crystal structure, of (bi)carbonate captured at the active site of reduced SOD, consistent with the view that a bound carbonate intermediate could be formed, producing a diffusible carbonate radical upon reoxidation of copper. The bound carbonate blocks direct access of substrates to Cu(I), suggesting that an adjunct to the accepted mechanism of SOD catalysed dismutation of superoxide operates, with Cu(I) oxidation by superoxide being driven via a proton-coupled electron transfer mechanism involving the bound carbonate rather than the solvent. Carbonate is captured in a different site when SOD is oxidised, being located in the active site channel adjacent to the catalytically important Arg143. This is the probable route of diffusion from the active site following reoxidation of the copper. In this position, the carbonate is poised for re-entry into the active site and binding to the reduced copper. PMID:22984565

The Copper Homeostasis Transcription Factor CopR Is Involved in H2O2 Stress in Lactobacillus plantarum CAUH2

PubMed Central

Yang, Yang; Yin, Jia; Liu, Jie; Xu, Qi; Lan, Tian; Ren, Fazheng; Hao, Yanling

2017-01-01

Transcriptional factors (TFs) play important roles in the responses to oxidative, acid, and other environmental stresses in Gram-positive bacteria, but the regulatory mechanism of TFs involved in oxidative stress remains unknown in lactic acid bacteria. In the present work, homologous overexpression strains with 43 TFs were constructed in the Lactobacillus plantarum CAUH2 parent strain. The strain overexpressing CopR displayed the highest sensitivity and a 110-fold decrease in survival rate under H2O2 challenge. The importance of CopR in the response to H2O2 stress was further confirmed by a 10.8-fold increase in the survival of a copR insertion mutant. In silico analysis of the genes flanking copR revealed putative CopR-binding “cop box” sequences in the promoter region of the adjacent gene copB encoding a Cu2+-exporting ATPase. Electrophoretic mobility shift assay (EMSA) analysis demonstrated the specific binding of CopR with copB in vitro, suggesting copB is a target gene of CopR in L. plantarum. The role of CopB involved in oxidative stress was verified by the significantly decreased survival in the copB mutant. Furthermore, a growth defect in copper-containing medium demonstrated that CopB functions as an export ATPase for copper ions. Furthermore, EMSAs revealed that CopR functions as a regulator that negatively regulates copB gene and Cu2+ serves as inducer of CopR to activate the expression of CopB in response to H2O2 stress in L. plantarum CAUH2. Our findings indicated that CopR plays an important role in enhancing oxidative resistance by regulating copB to modulate copper homeostasis. PMID:29089937

Structure of the Zinc-Bound Amino-Terminal Domain of the NMDA Receptor NR2B Subunit

DOE Office of Scientific and Technical Information (OSTI.GOV)

Karakas, E.; Simorowski, N; Furukawa, H

2009-01-01

N-methyl-D-aspartate (NMDA) receptors belong to the family of ionotropic glutamate receptors (iGluRs) that mediate the majority of fast excitatory synaptic transmission in the mammalian brain. One of the hallmarks for the function of NMDA receptors is that their ion channel activity is allosterically regulated by binding of modulator compounds to the extracellular amino-terminal domain (ATD) distinct from the L-glutamate-binding domain. The molecular basis for the ATD-mediated allosteric regulation has been enigmatic because of a complete lack of structural information on NMDA receptor ATDs. Here, we report the crystal structures of ATD from the NR2B NMDA receptor subunit in the zinc-freemore » and zinc-bound states. The structures reveal the overall clamshell-like architecture distinct from the non-NMDA receptor ATDs and molecular determinants for the zinc-binding site, ion-binding sites, and the architecture of the putative phenylethanolamine-binding site.« less

Characterization of the binding of 2-mercaptobenzimidazole to bovine serum albumin.

PubMed

Teng, Yue; Zou, Luyi; Huang, Ming; Zong, Wansong

2015-04-01

2-Mercaptobenzimidazole (MBI) is widely utilized as a corrosion inhibitor, copper-plating brightener and rubber accelerator. The residue of MBI in the environment is potentially harmful to human health. In this article, the interaction of MBI with bovine serum albumin (BSA) was explored using spectroscopic and molecular docking methods under physiological conditions. The positively charged MBI can spontaneously bind with the negatively charged BSA through electrostatic forces with one binding site. The site marker competition experiments and the molecular docking study revealed that MBI bound into site II (subdomain IIIA) of BSA, which further led to some secondary structure and microenvironmental changes of BSA. This work provides useful information on understanding the toxicological actions of MBI at the molecular level. Copyright © 2015 John Wiley & Sons, Ltd.

Using RSAT to scan genome sequences for transcription factor binding sites and cis-regulatory modules.

PubMed

Turatsinze, Jean-Valery; Thomas-Chollier, Morgane; Defrance, Matthieu; van Helden, Jacques

2008-01-01

This protocol shows how to detect putative cis-regulatory elements and regions enriched in such elements with the regulatory sequence analysis tools (RSAT) web server (http://rsat.ulb.ac.be/rsat/). The approach applies to known transcription factors, whose binding specificity is represented by position-specific scoring matrices, using the program matrix-scan. The detection of individual binding sites is known to return many false predictions. However, results can be strongly improved by estimating P value, and by searching for combinations of sites (homotypic and heterotypic models). We illustrate the detection of sites and enriched regions with a study case, the upstream sequence of the Drosophila melanogaster gene even-skipped. This protocol is also tested on random control sequences to evaluate the reliability of the predictions. Each task requires a few minutes of computation time on the server. The complete protocol can be executed in about one hour.

Concentration-dependent Cu(II) binding to prion protein

NASA Astrophysics Data System (ADS)

Hodak, Miroslav; Lu, Wenchang; Bernholc, Jerry

2008-03-01

The prion protein plays a causative role in several neurodegenerative diseases, including mad cow disease in cattle and Creutzfeldt-Jakob disease in humans. The normal function of the prion protein is unknown, but it has been linked to its ability to bind copper ions. Experimental evidence suggests that copper can be bound in three distinct modes depending on its concentration, but only one of those binding modes has been fully characterized experimentally. Using a newly developed hybrid DFT/DFT method [1], which combines Kohn-Sham DFT with orbital-free DFT, we have examined all the binding modes and obtained their detailed binding geometries and copper ion binding energies. Our results also provide explanation for experiments, which have found that when the copper concentration increases the copper binding mode changes, surprisingly, from a stronger to a weaker one. Overall, our results indicate that prion protein can function as a copper buffer. 1. Hodak, Lu, Bernholc, JCP, in press.

X-ray structural studies of the fungal laccase from Cerrena maxima.

PubMed

Lyashenko, Andrey V; Bento, Isabel; Zaitsev, Viatcheslav N; Zhukhlistova, Nadezhda E; Zhukova, Yuliya N; Gabdoulkhakov, Azat G; Morgunova, Ekaterina Y; Voelter, Wolfgang; Kachalova, Galina S; Stepanova, Elena V; Koroleva, Ol'ga V; Lamzin, Victor S; Tishkov, Vladimir I; Betzel, Christian; Lindley, Peter F; Mikhailov, Al'bert M

2006-11-01

Laccases are members of the blue multi-copper oxidase family. These enzymes oxidize substrate molecules by accepting electrons at a mononuclear copper centre and transferring them to a trinuclear centre. Dioxygen binds to the trinuclear centre and following the transfer of four electrons is reduced to two molecules of water. The X-ray structure of a laccase from Cerrena maxima has been elucidated at 1.9 A resolution using synchrotron data and the molecular replacement technique. The final refinement coefficients are Rcryst = 16.8% and Rfree = 23.0%, with root mean square deviations on bond lengths and bond angles of 0.015 A and 1.51 degrees , respectively. The type 1 copper centre has an isoleucine residue at the axial position and the "resting" state of the trinuclear centre comprises a single oxygen (OH) moiety asymmetrically disposed between the two type 3 copper ions and a water molecule attached to the type 2 ion. Several carbohydrate binding sites have been identified and the glycan chains appear to promote the formation of well-ordered crystals. Two tyrosine residues near the protein surface have been found in a nitrated state.

Active-site protein dynamics and solvent accessibility in native Achromobacter cycloclastes copper nitrite reductase.

PubMed

Sen, Kakali; Horrell, Sam; Kekilli, Demet; Yong, Chin W; Keal, Thomas W; Atakisi, Hakan; Moreau, David W; Thorne, Robert E; Hough, Michael A; Strange, Richard W

2017-07-01

Microbial nitrite reductases are denitrifying enzymes that are a major component of the global nitrogen cycle. Multiple structures measured from one crystal (MSOX data) of copper nitrite reductase at 240 K, together with molecular-dynamics simulations, have revealed protein dynamics at the type 2 copper site that are significant for its catalytic properties and for the entry and exit of solvent or ligands to and from the active site. Molecular-dynamics simulations were performed using different protonation states of the key catalytic residues (Asp CAT and His CAT ) involved in the nitrite-reduction mechanism of this enzyme. Taken together, the crystal structures and simulations show that the Asp CAT protonation state strongly influences the active-site solvent accessibility, while the dynamics of the active-site 'capping residue' (Ile CAT ), a determinant of ligand binding, are influenced both by temperature and by the protonation state of Asp CAT . A previously unobserved conformation of Ile CAT is seen in the elevated temperature series compared with 100 K structures. DFT calculations also show that the loss of a bound water ligand at the active site during the MSOX series is consistent with reduction of the type 2 Cu atom.

Determination of Surface-Exposed, Functional Domains of Gonococcal Transferrin-Binding Protein A

PubMed Central

Yost-Daljev, Mary Kate; Cornelissen, Cynthia Nau

2004-01-01

The gonococcal transferrin receptor is composed of two distinct proteins, TbpA and TbpB. TbpA is a member of the TonB-dependent family of integral outer membrane transporters, while TbpB is lipid modified and thought to be peripherally surface exposed. We previously proposed a hypothetical topology model for gonococcal TbpA that was based upon computer predictions and similarity with other TonB-dependent transporters for which crystal structures have been determined. In the present study, the hemagglutinin epitope was inserted into TbpA to probe the surface topology of this protein and secondarily to test the functional impacts of site-specific mutagenesis. Twelve epitope insertion mutants were constructed, five of which allowed us to confirm the surface exposure of loops 2, 3, 5, 7, and 10. In contrast to the predictions set forth by the hypothetical model, insertion into the plug region resulted in an epitope that was surface accessible, while epitope insertions into two putative loops (9 and 11) were not surface accessible. Insertions into putative loop 3 and β strand 9 abolished transferrin binding and utilization, and the plug insertion mutant exhibited decreased transferrin-binding affinity concomitant with an inability to utilize it. Insertion into putative β strand 16 generated a mutant that was able to bind transferrin normally but that was unable to mediate utilization. Mutants with insertions into putative loops 2, 9, and 11 maintained wild-type binding affinity but could utilize only transferrin in the presence of TbpB. This is the first demonstration of the ability of TbpB to compensate for a mutation in TbpA. PMID:14977987

AutoSite: an automated approach for pseudo-ligands prediction—from ligand-binding sites identification to predicting key ligand atoms

PubMed Central

Ravindranath, Pradeep Anand; Sanner, Michel F.

2016-01-01

Motivation: The identification of ligand-binding sites from a protein structure facilitates computational drug design and optimization, and protein function assignment. We introduce AutoSite: an efficient software tool for identifying ligand-binding sites and predicting pseudo ligand corresponding to each binding site identified. Binding sites are reported as clusters of 3D points called fills in which every point is labelled as hydrophobic or as hydrogen bond donor or acceptor. From these fills AutoSite derives feature points: a set of putative positions of hydrophobic-, and hydrogen-bond forming ligand atoms. Results: We show that AutoSite identifies ligand-binding sites with higher accuracy than other leading methods, and produces fills that better matches the ligand shape and properties, than the fills obtained with a software program with similar capabilities, AutoLigand. In addition, we demonstrate that for the Astex Diverse Set, the feature points identify 79% of hydrophobic ligand atoms, and 81% and 62% of the hydrogen acceptor and donor hydrogen ligand atoms interacting with the receptor, and predict 81.2% of water molecules mediating interactions between ligand and receptor. Finally, we illustrate potential uses of the predicted feature points in the context of lead optimization in drug discovery projects. Availability and Implementation: http://adfr.scripps.edu/AutoDockFR/autosite.html Contact: sanner@scripps.edu Supplementary information: Supplementary data are available at Bioinformatics online. PMID:27354702

Identification of estrogen-responsive genes using a genome-wide analysis of promoter elements for transcription factor binding sites.

PubMed

Kamalakaran, Sitharthan; Radhakrishnan, Senthil K; Beck, William T

2005-06-03

We developed a pipeline to identify novel genes regulated by the steroid hormone-dependent transcription factor, estrogen receptor, through a systematic analysis of upstream regions of all human and mouse genes. We built a data base of putative promoter regions for 23,077 human and 19,984 mouse transcripts from National Center for Biotechnology Information annotation and 8793 human and 6785 mouse promoters from the Data Base of Transcriptional Start Sites. We used this data base of putative promoters to identify potential targets of estrogen receptor by identifying estrogen response elements (EREs) in their promoters. Our program correctly identified EREs in genes known to be regulated by estrogen in addition to several new genes whose putative promoters contained EREs. We validated six genes (KIAA1243, NRIP1, MADH9, NME3, TPD52L, and ABCG2) to be estrogen-responsive in MCF7 cells using reverse transcription PCR. To allow for extensibility of our program in identifying targets of other transcription factors, we have built a Web interface to access our data base and programs. Our Web-based program for Promoter Analysis of Genome, PAGen@UIC, allows a user to identify putative target genes for vertebrate transcription factors through the analysis of their upstream sequences. The interface allows the user to search the human and mouse promoter data bases for potential target genes containing one or more listed transcription factor binding sites (TFBSs) in their upstream elements, using either regular expression-based consensus or position weight matrices. The data base can also be searched for promoters harboring user-defined TFBSs given as a consensus or a position weight matrix. Furthermore, the user can retrieve putative promoter sequences for any given gene together with identified TFBSs located on its promoter. Orthologous promoters are also analyzed to determine conserved elements.

A ternary metal binding site in the C2 domain of phosphoinositide-specific phospholipase C-delta1.

PubMed

Essen, L O; Perisic, O; Lynch, D E; Katan, M; Williams, R L

1997-03-11

We have determined the crystal structures of complexes of phosphoinositide-specific phospholipase C-delta1 from rat with calcium, barium, and lanthanum at 2.5-2.6 A resolution. Binding of these metal ions is observed in the active site of the catalytic TIM barrel and in the calcium binding region (CBR) of the C2 domain. The C2 domain of PLC-delta1 is a circularly permuted topological variant (P-variant) of the synaptotagmin I C2A domain (S-variant). On the basis of sequence analysis, we propose that both the S-variant and P-variant topologies are present among other C2 domains. Multiple adjacent binding sites in the C2 domain were observed for calcium and the other metal/enzyme complexes. The maximum number of binding sites observed was for the calcium analogue lanthanum. This complex shows an array-like binding of three lanthanum ions (sites I-III) in a crevice on one end of the C2 beta-sandwich. Residues involved in metal binding are contained in three loops, CBR1, CBR2, and CBR3. Sites I and II are maintained in the calcium and barium complexes, whereas sites II and III coincide with a binary calcium binding site in the C2A domain of synaptotagmin I. Several conformers for CBR1 are observed. The conformation of CBR1 does not appear to be strictly dependent on metal binding; however, metal binding may stabilize certain conformers. No significant structural changes are observed for CBR2 or CBR3. The surface of this ternary binding site provides a cluster of freely accessible liganding positions for putative phospholipid ligands of the C2 domain. It may be that the ternary metal binding site is also a feature of calcium-dependent phospholipid binding in solution. A ternary metal binding site might be a conserved feature among C2 domains that contain the critical calcium ligands in their CBR's. The high cooperativity of calcium-mediated lipid binding by C2 domains described previously is explained by this novel type of calcium binding site.

Kinetic and Spectroscopic Studies of Bicupin Oxalate Oxidase and Putative Active Site Mutants

PubMed Central

Moomaw, Ellen W.; Hoffer, Eric; Moussatche, Patricia; Salerno, John C.; Grant, Morgan; Immelman, Bridget; Uberto, Richard; Ozarowski, Andrew; Angerhofer, Alexander

2013-01-01

Ceriporiopsis subvermispora oxalate oxidase (CsOxOx) is the first bicupin enzyme identified that catalyzes manganese-dependent oxidation of oxalate. In previous work, we have shown that the dominant contribution to catalysis comes from the monoprotonated form of oxalate binding to a form of the enzyme in which an active site carboxylic acid residue must be unprotonated. CsOxOx shares greatest sequence homology with bicupin microbial oxalate decarboxylases (OxDC) and the 241-244DASN region of the N-terminal Mn binding domain of CsOxOx is analogous to the lid region of OxDC that has been shown to determine reaction specificity. We have prepared a series of CsOxOx mutants to probe this region and to identify the carboxylate residue implicated in catalysis. The pH profile of the D241A CsOxOx mutant suggests that the protonation state of aspartic acid 241 is mechanistically significant and that catalysis takes place at the N-terminal Mn binding site. The observation that the D241S CsOxOx mutation eliminates Mn binding to both the N- and C- terminal Mn binding sites suggests that both sites must be intact for Mn incorporation into either site. The introduction of a proton donor into the N-terminal Mn binding site (CsOxOx A242E mutant) does not affect reaction specificity. Mutation of conserved arginine residues further support that catalysis takes place at the N-terminal Mn binding site and that both sites must be intact for Mn incorporation into either site. PMID:23469254

The delivery of copper for thylakoid import observed by NMR

PubMed Central

Banci, Lucia; Bertini, Ivano; Ciofi-Baffoni, Simone; Kandias, Nikolaos G.; Robinson, Nigel J.; Spyroulias, Georgios A.; Su, Xun-Cheng; Tottey, Stephen; Vanarotti, Murugendra

2006-01-01

The thylakoid compartments of plant chloroplasts are a vital destination for copper. Copper is needed to form holo-plastocyanin, which must shuttle electrons between photosystems to convert light into biologically useful chemical energy. Copper can bind tightly to proteins, so it has been hypothesized that copper partitions onto ligand-exchange pathways to reach intracellular locations without inflicting damage en route. The copper metallochaperone Atx1 of chloroplast-related cyanobacteria (ScAtx1) engages in bacterial two-hybrid interactions with N-terminal domains of copper-transporting ATPases CtaA (cell import) and PacS (thylakoid import). Here we visualize copper delivery. The N-terminal domain PacSN has a ferredoxin-like fold that forms copper-dependent heterodimers with ScAtx1. Removal of copper, by the addition of the cuprous-ion chelator bathocuproine disulfonate, disrupts this heterodimer, as shown from a reduction of the overall tumbling rate of the protein mixture. The NMR spectral changes of the heterodimer versus the separate proteins reveal that loops 1, 3, and 5 (the carboxyl tail) of the ScAtx1 Cu(I) site switch to an apo-like configuration in the heterodimer. NMR data (2JNH couplings in the imidazole ring of 15N ScAtx1 His-61) also show that His-61, bound to copper(I) in [Cu(I)ScAtx1]2, is not coordinated to copper in the heterodimer. A model for the PacSN/Cu(I)/ScAtx1 complex is presented. Contact with PacSN induces change to the ScAtx1 copper-coordination sphere that drives copper release for thylakoid import. These data also elaborate on the mechanism to keep copper(I) out of the ZiaAN ATPase zinc sites. PMID:16707580

PDZ Binding Domains, Structural Disorder and Phosphorylation: A Menage-a-trois Tailing Dcp2 mRNA Decapping Enzymes.

PubMed

Gunawardana, Dilantha

2016-01-01

Diverse cellular activities are mediated through the interaction of protein domains and their binding partners. One such protein domain widely distributed in the higher metazoan world is the PDZ domain, which facilitates abundant protein-protein interactions. The PDZ domain-PDZ binding domain interaction has been implicated in several pathologies including Alzheimer's disease, Parkinson's disease and Down syndrome. PDZ domains bind to C-terminal peptides/proteins which have either of the following combinations: S/T-X-hydrophobic-COOH for type I, hydrophobic-Xhydrophobic- COOH for type II, and D/E-X-hydrophobic-COOH for type III, although hydrophobicity in the termini form the key characteristic of the PDZ-binding domains. We identified and characterized a Dcp2 type mRNA decapping enzyme from Arabidopsis thaliana, a protein containing a putative PDZ-binding domain using mutagenesis and protein biochemistry. Now we are using bioinformatics to study the Cterminal end of mRNA decapping enzymes from complex metazoans with the aim of (1) identifying putative PDZ-binding domains (2) Correlating structural disorder with PDZ binding domains and (3) Demonstrating the presence of phosphorylation sites in C-terminal extremities of Dcp2 type mRNA decapping enzymes. It is proposed here that the trinity of PDZbinding domains, structural disorder and phosphorylation-susceptible sites are a feature of the Dcp2 family of decapping enzymes and perhaps is a wider trick in protein evolution where scaffolding/tethering is a requirement for localization and function. It is critical though laboratory-based supporting evidence is sought to back-up this bioinformatics exploration into tail regions of mRNA decapping enzymes.

( sup 3 H)RO15-4513 binding to cerebellar diazepam-sensitive and insensitive GABAA receptors is unchanged by one week of ethanol intake

DOE Office of Scientific and Technical Information (OSTI.GOV)

Martin, M.W.; Chen, J.P.; Wallis, C.

1992-02-26

({sup 3}H)RO15-4513, a partial inverse agonist at GABAA receptors, binds to two sites in cerebellar membranes, one sensitive (DZ-S) and one insensitive (DZ-IS) to inhibition by diazepam. These binding sites may represent different isoforms of the GABAA receptor and may play a role in ethanol (EtOH) dependence. The authors tested the hypothesis that chronic intake of EtOH induces changes in the binding properties of one or both of these putative GABBA receptors. Rats were fed a liquid diet of 4.5% EtOH for 7 d, gavaged with a 3g/kg dose of EtOH, and then sacrificed after 2 h, 12 h, ormore » 4.5 d. Binding of ({sup 3}H)RO15-4513 to cerebellar membranes was performed in the absence or presence of 10{mu}M diazepam (DZ-IS binding); DZ-S binding was calculated as the difference between total and DZ-IS. Nonlinear regression analysis showed that each class of binding site fit a model of mass action binding to a single, noninteractive population of sites. No significant difference was observed between any of the treatment groups in the apparent affinity (Kd) for ({sup 3}H)RO15-4513 at total, DZ-S, or DZ-IS sites following chronic EtOH intake or withdrawal. In addition, no significant difference was observed in the apparent number of DZ-S or DZ-IS binding sites or the ratio of DZ-S to DZ-IS.« less

DOE Office of Scientific and Technical Information (OSTI.GOV)

Singh, Mahavir; Wang, Zhonghua; Cascio, Duilio

Shq1 is an essential protein involved in the early steps of biogenesis and assembly of H/ACA ribonucleoprotein particles (RNPs). Shq1 binds to dyskerin (Cbf5 in yeast) at an early step of H/ACA RNP assembly and is subsequently displaced by the H/ACA RNA. Shq1 contains an N-terminal CS and a C-terminal Shq1-specific domain (SSD). Dyskerin harbors many mutations associated with dyskeratosis congenita. Structures of yeast Shq1 SSD bound to Cbf5 revealed that only a subset of these mutations is in the SSD binding site, implicating another subset in the putative CS binding site. Here in this paper, we present the crystalmore » structure of human Shq1 CS (hCS) and the nuclear magnetic resonance (NMR) and crystal structures of hCS containing a serine substitution for proline 22 that is associated with some prostate cancers. The structure of hCS is similar to yeast Shq1 CS domain (yCS) and consists of two β-sheets that form an immunoglobulin-like β-sandwich fold. The N-terminal affinity tag sequence AHHHHHH associates with a neighboring protein in the crystal lattice to form an extra β-strand. Deletion of this tag was required to get spectra suitable for NMR structure determination, while the tag was required for crystallization. NMR chemical shift perturbation (CSP) experiments with peptides derived from putative CS binding sites on dyskerin and Cbf5 revealed a conserved surface on CS important for Cbf5/dyskerin binding. A HADDOCK (high-ambiguity-driven protein-protein docking) model of a Shq1-Cbf5 complex that defines the position of CS domain in the pre-H/ACA RNP was calculated using the CSP data.« less

Structure and Interactions of the CS Domain of Human H/ACA RNP Assembly Protein Shq1

DOE PAGES

Singh, Mahavir; Wang, Zhonghua; Cascio, Duilio; ...

2014-12-29

Shq1 is an essential protein involved in the early steps of biogenesis and assembly of H/ACA ribonucleoprotein particles (RNPs). Shq1 binds to dyskerin (Cbf5 in yeast) at an early step of H/ACA RNP assembly and is subsequently displaced by the H/ACA RNA. Shq1 contains an N-terminal CS and a C-terminal Shq1-specific domain (SSD). Dyskerin harbors many mutations associated with dyskeratosis congenita. Structures of yeast Shq1 SSD bound to Cbf5 revealed that only a subset of these mutations is in the SSD binding site, implicating another subset in the putative CS binding site. Here in this paper, we present the crystalmore » structure of human Shq1 CS (hCS) and the nuclear magnetic resonance (NMR) and crystal structures of hCS containing a serine substitution for proline 22 that is associated with some prostate cancers. The structure of hCS is similar to yeast Shq1 CS domain (yCS) and consists of two β-sheets that form an immunoglobulin-like β-sandwich fold. The N-terminal affinity tag sequence AHHHHHH associates with a neighboring protein in the crystal lattice to form an extra β-strand. Deletion of this tag was required to get spectra suitable for NMR structure determination, while the tag was required for crystallization. NMR chemical shift perturbation (CSP) experiments with peptides derived from putative CS binding sites on dyskerin and Cbf5 revealed a conserved surface on CS important for Cbf5/dyskerin binding. A HADDOCK (high-ambiguity-driven protein-protein docking) model of a Shq1-Cbf5 complex that defines the position of CS domain in the pre-H/ACA RNP was calculated using the CSP data.« less

The DNA Maturation Domain of gpA, the DNA Packaging Motor Protein of Bacteriophage Lambda, Contains an ATPase Site Associated with Endonuclease Activity

PubMed Central

Ortega, Marcos E.; Gaussier, Helene; Catalano, Carlos E.

2007-01-01

Summary Terminase enzymes are common to double-stranded DNA (dsDNA) viruses and are responsible for packaging viral DNA into the confines of an empty capsid shell. In bacteriophage lambda the catalytic terminase subunit is gpA, which is responsible for maturation of the genome end prior to packaging and subsequent translocation of the matured DNA into the capsid. DNA packaging requires an ATPase catalytic site situated in the N-terminus of the protein. A second ATPase catalytic site associated with the DNA maturation activities of the protein has been proposed; however, direct demonstration of this putative second site is lacking. Here we describe biochemical studies that define protease-resistant peptides of gpA and expression of these putative domains in E. coli. Biochemical characterization of gpA-ΔN179, a construct in which the N-terminal 179 residues of gpA have been deleted, indicates that this protein encompasses the DNA maturation domain of gpA. The construct is folded, soluble and possesses an ATP-dependent nuclease activity. Moreover, the construct binds and hydrolyzes ATP despite the fact that the DNA packaging ATPase site in the N-terminus of gpA has been deleted. Mutation of lysine 497, which alters the conserved lysine in a predicted Walker A “P-loop” sequence, does not affect ATP binding but severely impairs ATP hydrolysis. Further, this mutation abrogates the ATP-dependent nuclease activity of the protein. These studies provide direct evidence for the elusive nucleotide-binding site in gpA that is directly associated with the DNA maturation activity of the protein. The implications of these results with respect to the two roles of the terminase holoenzyme – DNA maturation and DNA packaging – are discussed. PMID:17870092

Effects of Zinc on Particulate Methane Monooxygenase Activity and Structure*

PubMed Central

Sirajuddin, Sarah; Barupala, Dulmini; Helling, Stefan; Marcus, Katrin; Stemmler, Timothy L.; Rosenzweig, Amy C.

2014-01-01

Particulate methane monooxygenase (pMMO) is a membrane-bound metalloenzyme that oxidizes methane to methanol in methanotrophic bacteria. Zinc is a known inhibitor of pMMO, but the details of zinc binding and the mechanism of inhibition are not understood. Metal binding and activity assays on membrane-bound pMMO from Methylococcus capsulatus (Bath) reveal that zinc inhibits pMMO at two sites that are distinct from the copper active site. The 2.6 Å resolution crystal structure of Methylocystis species strain Rockwell pMMO reveals two previously undetected bound lipids, and metal soaking experiments identify likely locations for the two zinc inhibition sites. The first is the crystallographic zinc site in the pmoC subunit, and zinc binding here leads to the ordering of 10 previously unobserved residues. A second zinc site is present on the cytoplasmic side of the pmoC subunit. Parallels between these results and zinc inhibition studies of several respiratory complexes suggest that zinc might inhibit proton transfer in pMMO. PMID:24942740

Activity-dependent shedding of the NMDA receptor glycine binding site by matrix metalloproteinase 3: a PUTATIVE mechanism of postsynaptic plasticity.

PubMed

Pauly, Thorsten; Ratliff, Miriam; Pietrowski, Eweline; Neugebauer, Rainer; Schlicksupp, Andrea; Kirsch, Joachim; Kuhse, Jochen

2008-07-16

Functional and structural alterations of clustered postsynaptic ligand gated ion channels in neuronal cells are thought to contribute to synaptic plasticity and memory formation in the human brain. Here, we describe a novel molecular mechanism for structural alterations of NR1 subunits of the NMDA receptor. In cultured rat spinal cord neurons, chronic NMDA receptor stimulation induces disappearance of extracellular epitopes of NMDA receptor NR1 subunits, which was prevented by inhibiting matrix metalloproteinases (MMPs). Immunoblotting revealed the digestion of solubilized NR1 subunits by MMP-3 and identified a fragment of about 60 kDa as MMPs-activity-dependent cleavage product of the NR1 subunit in cultured neurons. The expression of MMP-3 in the spinal cord culture was shown by immunoblotting and immunofluorescence microscopy. Recombinant NR1 glycine binding protein was used to identify MMP-3 cleavage sites within the extracellular S1 and S2-domains. N-terminal sequencing and site-directed mutagenesis revealed S542 and L790 as two putative major MMP-3 cleavage sites of the NR1 subunit. In conclusion, our data indicate that MMPs, and in particular MMP-3, are involved in the activity dependent alteration of NMDA receptor structure at postsynaptic membrane specializations in the CNS.

Activity-Dependent Shedding of the NMDA Receptor Glycine Binding Site by Matrix Metalloproteinase 3: A PUTATIVE Mechanism of Postsynaptic Plasticity

PubMed Central

Pietrowski, Eweline; Neugebauer, Rainer; Schlicksupp, Andrea; Kirsch, Joachim; Kuhse, Jochen

2008-01-01

Functional and structural alterations of clustered postsynaptic ligand gated ion channels in neuronal cells are thought to contribute to synaptic plasticity and memory formation in the human brain. Here, we describe a novel molecular mechanism for structural alterations of NR1 subunits of the NMDA receptor. In cultured rat spinal cord neurons, chronic NMDA receptor stimulation induces disappearance of extracellular epitopes of NMDA receptor NR1 subunits, which was prevented by inhibiting matrix metalloproteinases (MMPs). Immunoblotting revealed the digestion of solubilized NR1 subunits by MMP-3 and identified a fragment of about 60 kDa as MMPs-activity-dependent cleavage product of the NR1 subunit in cultured neurons. The expression of MMP-3 in the spinal cord culture was shown by immunoblotting and immunofluorescence microscopy. Recombinant NR1 glycine binding protein was used to identify MMP-3 cleavage sites within the extracellular S1 and S2-domains. N-terminal sequencing and site-directed mutagenesis revealed S542 and L790 as two putative major MMP-3 cleavage sites of the NR1 subunit. In conclusion, our data indicate that MMPs, and in particular MMP-3, are involved in the activity dependent alteration of NMDA receptor structure at postsynaptic membrane specializations in the CNS. PMID:18629001

Structural and electronic snapshots during the transition from a Cu(II) to Cu(I) metal center of a lytic polysaccharide monooxygenase by X-ray photoreduction.

PubMed

Gudmundsson, Mikael; Kim, Seonah; Wu, Miao; Ishida, Takuya; Momeni, Majid Hadadd; Vaaje-Kolstad, Gustav; Lundberg, Daniel; Royant, Antoine; Ståhlberg, Jerry; Eijsink, Vincent G H; Beckham, Gregg T; Sandgren, Mats

2014-07-04

Lytic polysaccharide monooxygenases (LPMOs) are a recently discovered class of enzymes that employ a copper-mediated, oxidative mechanism to cleave glycosidic bonds. The LPMO catalytic mechanism likely requires that molecular oxygen first binds to Cu(I), but the oxidation state in many reported LPMO structures is ambiguous, and the changes in the LPMO active site required to accommodate both oxidation states of copper have not been fully elucidated. Here, a diffraction data collection strategy minimizing the deposited x-ray dose was used to solve the crystal structure of a chitin-specific LPMO from Enterococcus faecalis (EfaCBM33A) in the Cu(II)-bound form. Subsequently, the crystalline protein was photoreduced in the x-ray beam, which revealed structural changes associated with the conversion from the initial Cu(II)-oxidized form with two coordinated water molecules, which adopts a trigonal bipyramidal geometry, to a reduced Cu(I) form in a T-shaped geometry with no coordinated water molecules. A comprehensive survey of Cu(II) and Cu(I) structures in the Cambridge Structural Database unambiguously shows that the geometries observed in the least and most reduced structures reflect binding of Cu(II) and Cu(I), respectively. Quantum mechanical calculations of the oxidized and reduced active sites reveal little change in the electronic structure of the active site measured by the active site partial charges. Together with a previous theoretical investigation of a fungal LPMO, this suggests significant functional plasticity in LPMO active sites. Overall, this study provides molecular snapshots along the reduction process to activate the LPMO catalytic machinery and provides a general method for solving LPMO structures in both copper oxidation states. © 2014 by The American Society for Biochemistry and Molecular Biology, Inc.

BLSSpeller: exhaustive comparative discovery of conserved cis-regulatory elements.

PubMed

De Witte, Dieter; Van de Velde, Jan; Decap, Dries; Van Bel, Michiel; Audenaert, Pieter; Demeester, Piet; Dhoedt, Bart; Vandepoele, Klaas; Fostier, Jan

2015-12-01

The accurate discovery and annotation of regulatory elements remains a challenging problem. The growing number of sequenced genomes creates new opportunities for comparative approaches to motif discovery. Putative binding sites are then considered to be functional if they are conserved in orthologous promoter sequences of multiple related species. Existing methods for comparative motif discovery usually rely on pregenerated multiple sequence alignments, which are difficult to obtain for more diverged species such as plants. As a consequence, misaligned regulatory elements often remain undetected. We present a novel algorithm that supports both alignment-free and alignment-based motif discovery in the promoter sequences of related species. Putative motifs are exhaustively enumerated as words over the IUPAC alphabet and screened for conservation using the branch length score. Additionally, a confidence score is established in a genome-wide fashion. In order to take advantage of a cloud computing infrastructure, the MapReduce programming model is adopted. The method is applied to four monocotyledon plant species and it is shown that high-scoring motifs are significantly enriched for open chromatin regions in Oryza sativa and for transcription factor binding sites inferred through protein-binding microarrays in O.sativa and Zea mays. Furthermore, the method is shown to recover experimentally profiled ga2ox1-like KN1 binding sites in Z.mays. BLSSpeller was written in Java. Source code and manual are available at http://bioinformatics.intec.ugent.be/blsspeller Klaas.Vandepoele@psb.vib-ugent.be or jan.fostier@intec.ugent.be. Supplementary data are available at Bioinformatics online. © The Author 2015. Published by Oxford University Press.

BLSSpeller: exhaustive comparative discovery of conserved cis-regulatory elements

PubMed Central

De Witte, Dieter; Van de Velde, Jan; Decap, Dries; Van Bel, Michiel; Audenaert, Pieter; Demeester, Piet; Dhoedt, Bart; Vandepoele, Klaas; Fostier, Jan

2015-01-01

Motivation: The accurate discovery and annotation of regulatory elements remains a challenging problem. The growing number of sequenced genomes creates new opportunities for comparative approaches to motif discovery. Putative binding sites are then considered to be functional if they are conserved in orthologous promoter sequences of multiple related species. Existing methods for comparative motif discovery usually rely on pregenerated multiple sequence alignments, which are difficult to obtain for more diverged species such as plants. As a consequence, misaligned regulatory elements often remain undetected. Results: We present a novel algorithm that supports both alignment-free and alignment-based motif discovery in the promoter sequences of related species. Putative motifs are exhaustively enumerated as words over the IUPAC alphabet and screened for conservation using the branch length score. Additionally, a confidence score is established in a genome-wide fashion. In order to take advantage of a cloud computing infrastructure, the MapReduce programming model is adopted. The method is applied to four monocotyledon plant species and it is shown that high-scoring motifs are significantly enriched for open chromatin regions in Oryza sativa and for transcription factor binding sites inferred through protein-binding microarrays in O.sativa and Zea mays. Furthermore, the method is shown to recover experimentally profiled ga2ox1-like KN1 binding sites in Z.mays. Availability and implementation: BLSSpeller was written in Java. Source code and manual are available at http://bioinformatics.intec.ugent.be/blsspeller Contact: Klaas.Vandepoele@psb.vib-ugent.be or jan.fostier@intec.ugent.be Supplementary information: Supplementary data are available at Bioinformatics online. PMID:26254488

Genome-Wide Identification and Characterization of Novel Laccase Genes in the White-Rot Fungus Flammulina velutipes

PubMed Central

Kim, Hong-Il; Kwon, O-Chul; Kong, Won-Sik; Lee, Chang-Soo

2014-01-01

The aim of this study was to identify and characterize new Flammulina velutipes laccases from its whole-genome sequence. Of the 15 putative laccase genes detected in the F. velutipes genome, four new laccase genes (fvLac-1, fvLac-2, fvLac3, and fvLac-4) were found to contain four complete copper-binding regions (ten histidine residues and one cysteine residue) and four cysteine residues involved in forming disulfide bridges, fvLac-1, fvLac-2, fvLac3, and fvLac-4, encoding proteins consisting of 516, 518, 515, and 533 amino acid residues, respectively. Potential N-glycosylation sites (Asn-Xaa-Ser/Thr) were identified in the cDNA sequence of fvLac-1 (Asn-454), fvLac-2 (Asn-437 and Asn-455), fvLac-3 (Asn-111 and Asn-237), and fvLac4 (Asn-402 and Asn-457). In addition, the first 19~20 amino acid residues of these proteins were predicted to comprise signal peptides. Laccase activity assays and reverse transcription polymerase chain reaction analyses clearly reveal that CuSO4 affects the induction and the transcription level of these laccase genes. PMID:25606003

The crystal structure of Rv1347c, a putative antibiotic resistance protein from Mycobacterium tuberculosis, reveals a GCN5-related fold and suggests an alternative function in siderophore biosynthesis

DOE Office of Scientific and Technical Information (OSTI.GOV)

Card, G L; Peterson, N A; Smith, C A

2005-02-15

Mycobacterium tuberculosis, the cause of TB, is a devastating human pathogen. The emergence of multi-drug resistance in recent years has prompted a search for new drug targets and for a better understanding of mechanisms of resistance. Here we focus on the gene product of an open reading frame from M. tuberculosis, Rv1347c, which is annotated as a putative aminoglycoside N-acetyltransferase. The Rv1347c protein does not show this activity, however, and we show from its crystal structure, coupled with functional and bioinformatic data, that its most likely role is in the biosynthesis of mycobactin, the M. tuberculosis siderophore. The crystal structuremore » of Rv1347c was determined by MAD phasing from selenomethionine-substituted protein and refined at 2.2 {angstrom} resolution (R = 0.227, R{sub free} = 0.257). The protein is monomeric, with a fold that places it in the GCN5-related N-acetyltransferase (GNAT) family of acyltransferases. Features of the structure are an acylCoA binding site that is shared with other GNAT family members, and an adjacent hydrophobic channel leading to the surface that could accommodate long-chain acyl groups. Modeling the postulated substrate, the N{sup {var_epsilon}}-hydroxylysine side chain of mycobactin, into the acceptor substrate binding groove identifies two residues at the active site, His130 and Asp168, that have putative roles in substrate binding and catalysis.« less

Evidence for a G protein-coupled diadenosine-5',5'''-P1,P4-tetraphosphate (Ap4A) receptor binding site in lung membranes from rat.

PubMed

Laubinger, W; Reiser, G

1999-01-29

Nucleotide receptors are of considerable importance in the treatment of lung diseases, such as cystic fibrosis. Because diadenosine polyphosphates may also be of significance as signalling molecules in lung, as they are in a variety of tissues, in the present work we investigated the binding sites for [3H]diadenosine-5',5'''-P1,P4-tetraphosphate (Ap4A) in plasma membranes from rat lung and studied their possible coupling to G proteins. We present evidence for a single high-affinity binding site for [3H]Ap4A with similar affinity for other diadenosine polyphosphates ApnA (n = 2 to 6). Displacement studies with different nucleotides revealed that the [3H]Ap4A binding site was different from P2X and P2Y2 receptor binding sites. Pretreatment of lung membranes with GTPgammaS or GTP in the presence of Mg2+ increased the Ki for Ap4A from 91 nM to 5.1 microM, which is indicative of G protein coupling. The putative coupling to G proteins was further confirmed by the enhancement of [35S]GTPgammaS binding (to Galpha proteins) to lung membranes by Ap4A (63% increase over basal) in a concentration-dependent manner. Therefore, our data for the first time provide evidence of a G protein-coupled Ap4A binding site in lung membranes.

A three-dimensional model of mammalian tyrosinase active site accounting for loss of function mutations.

PubMed

Schweikardt, Thorsten; Olivares, Concepción; Solano, Francisco; Jaenicke, Elmar; García-Borrón, José Carlos; Decker, Heinz

2007-10-01

Tyrosinases are the first and rate-limiting enzymes in the synthesis of melanin pigments responsible for colouring hair, skin and eyes. Mutation of tyrosinases often decreases melanin production resulting in albinism, but the effects are not always understood at the molecular level. Homology modelling of mouse tyrosinase based on recently published crystal structures of non-mammalian tyrosinases provides an active site model accounting for loss-of-function mutations. According to the model, the copper-binding histidines are located in a helix bundle comprising four densely packed helices. A loop containing residues M374, S375 and V377 connects the CuA and CuB centres, with the peptide oxygens of M374 and V377 serving as hydrogen acceptors for the NH-groups of the imidazole rings of the copper-binding His367 and His180. Therefore, this loop is essential for the stability of the active site architecture. A double substitution (374)MS(375) --> (374)GG(375) or a single M374G mutation lead to a local perturbation of the protein matrix at the active site affecting the orientation of the H367 side chain, that may be unable to bind CuB reliably, resulting in loss of activity. The model also accounts for loss of function in two naturally occurring albino mutations, S380P and V393F. The hydroxyl group in S380 contributes to the correct orientation of M374, and the substitution of V393 for a bulkier phenylalanine sterically impedes correct side chain packing at the active site. Therefore, our model explains the mechanistic necessity for conservation of not only active site histidines but also adjacent amino acids in tyrosinase.

Hemoglobin and Myoglobin as Reducing Agents in Biological Systems. Redox Reactions of Globins with Copper and Iron Salts and Complexes.

PubMed

Postnikova, G B; Shekhovtsova, E A

2016-12-01

In addition to reversible O2 binding, respiratory proteins of the globin family, hemoglobin (Hb) and myoglobin (Mb), participate in redox reactions with various metal complexes, including biologically significant ones, such as those of copper and iron. HbO 2 and MbO 2 are present in cells in large amounts and, as redox agents, can contribute to maintaining cell redox state and resisting oxidative stress. Divalent copper complexes with high redox potentials (E 0 , 200-600 mV) and high stability constants, such as [Cu(phen) 2 ] 2+ , [Cu(dmphen) 2 ] 2+ , and CuDTA oxidize ferrous heme proteins by the simple outer-sphere electron transfer mechanism through overlapping π-orbitals of the heme and the copper complex. Weaker oxidants, such as Cu2+, CuEDTA, CuNTA, CuCit, CuATP, and CuHis (E 0 ≤ 100-150 mV) react with HbO 2 and MbO 2 through preliminary binding to the protein with substitution of the metal ligands with protein groups and subsequent intramolecular electron transfer in the complex (the site-specific outer-sphere electron transfer mechanism). Oxidation of HbO 2 and MbO 2 by potassium ferricyanide and Fe(3) complexes with NTA, EDTA, CDTA, ATP, 2,3-DPG, citrate, and pyrophosphate PP i proceeds mainly through the simple outer-sphere electron transfer mechanism via the exposed heme edge. According to Marcus theory, the rate of this reaction correlates with the difference in redox potentials of the reagents and their self-exchange rates. For charged reagents, the reaction may be preceded by their nonspecific binding to the protein due to electrostatic interactions. The reactions of LbO 2 with carboxylate Fe complexes, unlike its reactions with ferricyanide, occur via the site-specific outer-sphere electron transfer mechanism, even though the same reagents oxidize structurally similar MbO 2 and cytochrome b 5 via the simple outer-sphere electron transfer mechanism. Of particular biological interest is HbO 2 and MbO 2 transformation into met-forms in the presence of small amounts of metal ions or complexes (catalysis), which, until recently, had been demonstrated only for copper compounds with intermediate redox potentials. The main contribution to the reaction rate comes from copper binding to the "inner" histidines, His97 (0.66 nm from the heme) that forms a hydrogen bond with the heme propionate COO - group, and the distal His64. The affinity of both histidines for copper is much lower than that of the surface histidines residues, and they are inaccessible for modification with chemical reagents. However, it was found recently that the high-potential Fe(3) complex, potassium ferricyanide (400 mV), at a 5 to 20% of molar protein concentration can be an efficient catalyst of MbO 2 oxidation into metMb. The catalytic process includes binding of ferrocyanide anion in the region of the His119 residue due to the presence there of a large positive local electrostatic potential and existence of a "pocket" formed by Lys16, Ala19, Asp20, and Arg118 that is sufficient to accommodate [Fe(CN) 6 ] 4- . Fast, proton-assisted reoxidation of the bound ferrocyanide by oxygen (which is required for completion of the catalytic cycle), unlike slow [Fe(CN) 6 ] 4- oxidation in solution, is provided by the optimal location of neighboring protonated His113 and His116, as it occurs in the enzyme active site.

Four second-sphere residues of Thermus thermophilus SG0.5JP17-16 laccase tune the catalysis by hydrogen-bonding networks.

PubMed

Liu, Huiping; Zhu, Yanyun; Yang, Xiaorong; Lin, Ying

2018-05-01

The multicopper oxidases catalyze 1-electron oxidation of four substrate molecules and concomitantly 4-electron reduction of dioxygen to water. The substrate loses the electrons at the type 1 copper (T1 Cu) site of the enzyme, while the dioxygen is reduced to water at the trinuclear copper center. A highly conserved Glu residue, which is at the dioxygen-entering channel, shuttles the proton to break the O-O bond of dioxygen. At the water-leaving channel, an Asp residue was found to be important in the protonation mechanism. In this study, laccase from Thermus thermophilus SG0.5JP17-16 (lacTT) was investigated to address how four second-sphere residues E356, E456, D106, and D423 affect the activity of the enzyme. Kinetic data indicate that catalytic activities of the enzyme are altered by site-directed mutagenesis on four second-sphere residues. The structural model of lacTT was generated by homology modeling. Structural and spectral data indicate that the E356 residue is situated at the substrate-binding site, responsible for the binding of the substrate and the geometry of the T1 Cu site by hydrogen-bonding networks; the E456 residue, located at the dioxygen-entering channel, plays a critical role in stabilizing the structure of all active copper centers and shuttling the proton to the trinuclear copper cluster (TNC) for the reductive reaction of dioxygen; the D106 and D423 residues are at the water-leaving channel, and they are important for the essential geometry of the TNC and the release of the water molecules. Altogether, this study contributes to the further understanding of the basic mechanism involving the oxidation of the substrate, electron transfer, and the reduction of dioxygen in lacTT.

Interaction of a copper (II) complex containing an artificial sweetener (aspartame) with calf thymus DNA.

PubMed

Shahabadi, Nahid; Khodaei, Mohammad Mehdi; Kashanian, Soheila; Kheirdoosh, Fahimeh

2014-01-01

A copper (II) complex containing aspartame (APM) as ligand, Cu(APM)2Cl2⋅2H2O, was synthesized and characterized. In vitro binding interaction of this complex with native calf thymus DNA (CT-DNA) was studied at physiological pH. The interaction was studied using different methods: spectrophotometric, spectrofluorometric, competition experiment, circular dichroism (CD) and viscosimetric techniques. Hyperchromicity was observed in UV absorption band of Cu(APM)2Cl2⋅2H2O. A strong fluorescence quenching reaction of DNA to Cu(APM)2Cl2⋅2H2O was observed and the binding constants (Kf) and corresponding numbers of binding sites (n) were calculated at different temperatures. Thermodynamic parameters, enthalpy change (ΔH) and entropy change (ΔS) were calculated to be+89.3 kJ mol(-1) and+379.3 J mol(-1) K(-1) according to Van't Hoff equation which indicated that reaction is predominantly entropically driven. Experimental results from spectroscopic methods were comparable and further supported by viscosity measurements. We suggest that Cu(APM)2Cl2⋅2H2O interacts with calf thymus DNA via a groove interaction mode with an intrinsic binding constant of 8×10+4 M(-1). Binding of this copper complex to DNA was found to be stronger compared to aspartame which was studied recently. Copyright © 2013 Elsevier B.V. All rights reserved.

Copper(II) binding by dissolved organic matter: Importance of the copper-to-dissolved organic matter ratio and implications for the Biotic Ligand Model

USGS Publications Warehouse

Craven, Alison M.; Aiken, George R.; Ryan, Joseph N.

2012-01-01

The ratio of copper to dissolved organic matter (DOM) is known to affect the strength of copper binding by DOM, but previous methods to determine the Cu2+–DOM binding strength have generally not measured binding constants over the same Cu:DOM ratios. In this study, we used a competitive ligand exchange–solid-phase extraction (CLE-SPE) method to determine conditional stability constants for Cu2+–DOM binding at pH 6.6 and 0.01 M ionic strength over a range of Cu:DOM ratios that bridge the detection windows of copper-ion-selective electrode and voltammetry measurements. As the Cu:DOM ratio increased from 0.0005 to 0.1 mg of Cu/mg of DOM, the measured conditional binding constant (cKCuDOM) decreased from 1011.5 to 105.6 M–1. A comparison of the binding constants measured by CLE-SPE with those measured by copper-ion-selective electrode and voltammetry demonstrates that the Cu:DOM ratio is an important factor controlling Cu2+–DOM binding strength even for DOM isolates of different types and different sources and for whole water samples. The results were modeled with Visual MINTEQ and compared to results from the biotic ligand model (BLM). The BLM was found to over-estimate Cu2+ at low total copper concentrations and under-estimate Cu2+ at high total copper concentrations.

Theory on the mechanism of site-specific DNA-protein interactions in the presence of traps

NASA Astrophysics Data System (ADS)

Niranjani, G.; Murugan, R.

2016-08-01

The speed of site-specific binding of transcription factor (TFs) proteins with genomic DNA seems to be strongly retarded by the randomly occurring sequence traps. Traps are those DNA sequences sharing significant similarity with the original specific binding sites (SBSs). It is an intriguing question how the naturally occurring TFs and their SBSs are designed to manage the retarding effects of such randomly occurring traps. We develop a simple random walk model on the site-specific binding of TFs with genomic DNA in the presence of sequence traps. Our dynamical model predicts that (a) the retarding effects of traps will be minimum when the traps are arranged around the SBS such that there is a negative correlation between the binding strength of TFs with traps and the distance of traps from the SBS and (b) the retarding effects of sequence traps can be appeased by the condensed conformational state of DNA. Our computational analysis results on the distribution of sequence traps around the putative binding sites of various TFs in mouse and human genome clearly agree well the theoretical predictions. We propose that the distribution of traps can be used as an additional metric to efficiently identify the SBSs of TFs on genomic DNA.

Molecular modeling and identification of novel glucokinase activators through stepwise virtual screening.

PubMed

Behera, Pabitra Mohan; Behera, Deepak Kumar; Satpati, Suresh; Agnihotri, Geetanjali; Nayak, Sanghamitra; Padhi, Payodhar; Dixit, Anshuman

2015-04-01

The glucose phosphorylating enzyme glucokinase (GK) is a 50kD monomeric protein having 465 amino acids. It maintains glucose homeostasis inside cells, acts as a glucose sensor in pancreatic β-cells and as a rate controlling enzyme for hepatic glucose clearance and glycogen synthesis. It has two binding sites, one for binding d-glucose and the other for a putative allosteric activator named glucokinase activator (GKA). The GKAs interact with the same region of the GK enzyme that is commonly affected by naturally occurring mutations in humans. However, many GKAs do not bind to GK in the absence of glucose. Recently, it has been reported that GKAs are highly effective in patients with type 2 diabetes mellitus. In this milieu a molecular modeling study has been carried out on three natural variants of GK that lie in the GKA binding site and are known to cause maturity onset diabetes of young (MODY). Additionally, a 10ns molecular dynamics simulation was done on each of the modeled variant in order to explore the flexibility of this site. Subsequently, a systematic virtual screening study was done to identify compounds which can bind with high affinity at GKA binding site of mutant GK. Copyright © 2015 Elsevier Inc. All rights reserved.

Copper coordination in the Glycine receptor by electron spin resonance

NASA Astrophysics Data System (ADS)

Ruthstein, Sharon; Stone, Katherine; Cascio, Michael; Saxena, Sunil

2009-03-01

We describe the use of Electron Spin Resonance (ESR) to identify the coordination environment of copper in the extracellular domain of the protein, as well as the number of copper atoms that bind to Glycine receptor (GlyR). The GlyR channel mediates inhibitory neurotransmission in the central nervous system. It belongs to the superfamily of nicotincoid receptors. These receptors are formed by pentameric arrangement of subunits, each sharing a common topology having a large extracellular domain (ECD) and a transmembrane (TM) domain comprised of four membrane-spanning segments (TM1-TM4). For GlyR, four subunits (1-4) and one subunit have been identified to date, although the homomeric expression of just the α1 subunit of GlyR is sufficient to reconstitute native-like activity. The results are expected to shed light on the role of metals ion in modulating ion permeation in such receptor. In addition, an identification of copper binding sites will allow the measurement of large range distance constraints in the receptor by pulsed ESR. Such structural information on the GlyR in various allosteric states is essential in order to shed light on the gating mechanism of this protein membrane.

Heterogeneity of signal transduction by Na-K-ATPase α-isoforms: role of Src interaction.

PubMed

Yu, Hui; Cui, Xiaoyu; Zhang, Jue; Xie, Joe X; Banerjee, Moumita; Pierre, Sandrine V; Xie, Zijian

2018-02-01

Of the four Na-K-ATPase α-isoforms, the ubiquitous α1 Na-K-ATPase possesses both ion transport and Src-dependent signaling functions. Mechanistically, we have identified two putative pairs of domain interactions between α1 Na-K-ATPase and Src that are critical for α1 signaling function. Our subsequent report that α2 Na-K-ATPase lacks these putative Src-binding sites and fails to carry on Src-dependent signaling further supported our proposed model of direct interaction between α1 Na-K-ATPase and Src but fell short of providing evidence for a causative role. This hypothesis was specifically tested here by introducing key residues of the two putative Src-interacting domains present on α1 but not α2 sequence into the α2 polypeptide, generating stable cell lines expressing this mutant, and comparing its signaling properties to those of α2-expressing cells. The mutant α2 was fully functional as a Na-K-ATPase. In contrast to wild-type α2, the mutant gained α1-like signaling function, capable of Src interaction and regulation. Consistently, the expression of mutant α2 redistributed Src into caveolin-1-enriched fractions and allowed ouabain to activate Src-mediated signaling cascades, unlike wild-type α2 cells. Finally, mutant α2 cells exhibited a growth phenotype similar to that of the α1 cells and proliferated much faster than wild-type α2 cells. These findings reveal the structural requirements for the Na-K-ATPase to function as a Src-dependent receptor and provide strong evidence of isoform-specific Src interaction involving the identified key amino acids. The sequences surrounding the putative Src-binding sites in α2 are highly conserved across species, suggesting that the lack of Src binding may play a physiologically important and isoform-specific role.

The crystal structure of the Rv0301-Rv0300 VapBC-3 toxin-antitoxin complex from M. tuberculosis reveals a Mg 2+ ion in the active site and a putative RNA-binding site

DOE Office of Scientific and Technical Information (OSTI.GOV)

Min, Andrew B; Miallau, Linda; Sawaya, Michael R

VapBC pairs account for 45 out of 88 identified toxin-antitoxin (TA) pairs in the Mycobacterium tuberculosis (Mtb) H37Rv genome. A working model suggests that under times of stress, antitoxin molecules are degraded, releasing the toxins to slow the metabolism of the cell, which in the case of VapC toxins is via their RNase activity. Otherwise the TA pairs remain bound to their promoters, autoinhibiting transcription. The crystal structure of Rv0301-Rv0300, an Mtb VapBC TA complex determined at 1.49 Å resolution, suggests a mechanism for these three functions: RNase activity, its inhibition by antitoxin, and its ability to bind promoter DNA.more » The Rv0301 toxin consists of a core of five parallel beta strands flanked by alpha helices. Three proximal aspartates coordinate a Mg2+ ion forming the putative RNase active site. The Rv0300 antitoxin monomer is extended in structure, consisting of an N-terminal beta strand followed by four helices. The last two helices wrap around the toxin and terminate near the putative RNase active site, but with different conformations. In one conformation, the C-terminal arginine interferes with Mg2+ ion coordination, suggesting a mechanism by which the antitoxin can inhibit toxin activity. At the N-terminus of the antitoxin, two pairs of Ribbon-Helix-Helix (RHH) motifs are related by crystallographic twofold symmetry. The resulting hetero-octameric complex is similar to the FitAB system, but the two RHH motifs are about 30 Å closer together in the Rv0301-Rv0300 complex, suggesting either a different span of the DNA recognition sequence or a conformational change.« less

NF-{kappa}B p65 represses {beta}-catenin-activated transcription of cyclin D1

DOE Office of Scientific and Technical Information (OSTI.GOV)

Hwang, Injoo; Choi, Yong Seok; Jeon, Mi-Ya

2010-12-03

Research highlights: {yields} Cyclin D1 transcription is directly activated by {beta}-catenin; however, {beta}-catenin-induced cyclin D1 transcription is reduced by NF-{kappa}B p65. {yields} Protein-protein interaction between NF-{kappa}B p65 and {beta}-catenin might be responsible for p65-mediated repression of cyclin D1. {yields} One of five putative binding sites, located further upstream of other sites, is the major {beta}-catenin binding site in the cyclin D1 promoter. {yields} NF-{kappa}B binding site in cyclin D1 is occupied not only by p65 but also by {beta}-catenin, which is dynamically regulated by the signal. -- Abstract: Signaling crosstalk between the {beta}-catenin and NF-{kappa}B pathways represents a functional network.more » To test whether the crosstalk also occurs on their common target genes, the cyclin D1 promoter was used as a model because it contains binding sites for both proteins. {beta}-catenin activated transcription from the cyclin D1 promoter, while co-expression of NF-{kappa}B p65 reduced {beta}-catenin-induced transcription. Chromatin immunoprecipitation revealed lithium chloride-induced binding of {beta}-catenin on one of the T-cell activating factor binding sites. More interestingly, {beta}-catenin binding was greatly reduced by NF-{kappa}B p65, possibly by the protein-protein interaction between the two proteins. Such a dynamic and complex binding of {beta}-catenin and NF-{kappa}B on promoters might contribute to the regulated expression of their target genes.« less

Crystal structure of Anoxybacillus α-amylase provides insights into maltose binding of a new glycosyl hydrolase subclass.

PubMed

Chai, Kian Piaw; Othman, Noor Farhan Binti; Teh, Aik-Hong; Ho, Kok Lian; Chan, Kok-Gan; Shamsir, Mohd Shahir; Goh, Kian Mau; Ng, Chyan Leong

2016-03-15

A new subfamily of glycosyl hydrolase family GH13 was recently proposed for α-amylases from Anoxybacillus species (ASKA and ADTA), Geobacillus thermoleovorans (GTA, Pizzo, and GtamyII), Bacillus aquimaris (BaqA), and 95 other putative protein homologues. To understand this new GH13 subfamily, we report crystal structures of truncated ASKA (TASKA). ASKA is a thermostable enzyme capable of producing high levels of maltose. Unlike GTA, biochemical analysis showed that Ca(2+) ion supplementation enhances the catalytic activities of ASKA and TASKA. The crystal structures reveal the presence of four Ca(2+) ion binding sites, with three of these binding sites are highly conserved among Anoxybacillus α-amylases. This work provides structural insights into this new GH13 subfamily both in the apo form and in complex with maltose. Furthermore, structural comparison of TASKA and GTA provides an overview of the conformational changes accompanying maltose binding at each subsite.

Rate and Regulation of Copper Transport by Human Copper Transporter 1 (hCTR1)*

PubMed Central

Maryon, Edward B.; Molloy, Shannon A.; Ivy, Kristin; Yu, Huijun; Kaplan, Jack H.

2013-01-01

Human copper transporter 1 (hCTR1) is a homotrimer of a 190-amino acid monomer having three transmembrane domains believed to form a pore for copper permeation through the plasma membrane. The hCTR1-mediated copper transport mechanism is not well understood, nor has any measurement been made of the rate at which copper ions are transported by hCTR1. In this study, we estimated the rate of copper transport by the hCTR1 trimer in cultured cells using 64Cu uptake assays and quantification of plasma membrane hCTR1. For endogenous hCTR1, we estimated a turnover number of about 10 ions/trimer/s. When overexpressed in HEK293 cells, a second transmembrane domain mutant of hCTR1 (H139R) had a 3-fold higher Km value and a 4-fold higher turnover number than WT. Truncations of the intracellular C-terminal tail and an AAA substitution of the putative metal-binding HCH C-terminal tripeptide (thought to be required for transport) also exhibited elevated transport rates and Km values when compared with WT hCTR1. Unlike WT hCTR1, H139R and the C-terminal mutants did not undergo regulatory endocytosis in elevated copper. hCTR1 mutants combining methionine substitutions that block transport (M150L,M154L) on the extracellular side of the pore and the high transport H139R or AAA intracellular side mutations exhibited the blocked transport of M150L,M154L, confirming that Cu+ first interacts with the methionines during permeation. Our results show that hCTR1 elements on the intracellular side of the hCTR1 pore, including the carboxyl tail, are not essential for permeation, but serve to regulate the rate of copper entry. PMID:23658018

The Evolving Field of Biodefence: Therapeutic Developments and Diagnostics

DTIC Science & Technology

2005-04-01

several ways. One method would be to interfere with the furin -medi- ated cleavage of PA to its active form (PA 63 ) following host-cell receptor binding4...b | The inactive form of protective antigen (PA83) binds to a host-cell receptor, where it is cleaved by a furin -related protease, to give active PA63...explore whether a putative target, such as furin cleavage site of Ebola virus, is essential for viral infection88. Compared with filoviruses, poxvirus

Identification and expression analysis of a putative fatty acidbinding protein gene in the Asian honeybee, Apis cerana cerana.

PubMed

Yu, Xiaoli; Kang, Mingjiang; Liu, Li; Guo, Xingqi; Xu, Baohua

2013-01-01

Fatty acid-binding proteins (FABPs) play pivotal roles in cellular signaling, gene transcription, and lipid metabolism in vertebrates and invertebrates. In this study, a putative FABP gene, referred to as AccFABP, was isolated from the Asian honeybee, Apis cerana cerana Fabricius (Hymenoptera: Apidae). The full-length cDNA consisted of 725 bp, and encoded a protein of 204 amino acids. Homology and phylogenetic analysis indicated that AccFABP was a member of the FABP multifamily. The genomic structure of this gene, which was common among FABP multifamily members, spanned 1,900 bp, and included four exons and three introns. Gene expression analysis revealed that AccFABP was highly expressed in the dark-pigmented phase of pupal development, with peak expression observed in the fat bodies of the dark-pigmented phase pupae. The AccFABP transcripts in the fat body were upregulated by exposure to dietary fatty acids such as conjugated linoleic acid, docosahexaenoic acid, and arachidonic acid. Transcription factor binding sites for Caudal-Related Homeobox and functional CCAAT/enhancer binding site, which were respectively associated with tissue expression and lipid metabolism, were detected in the 5' promoter sequence. The evidence provided in the present study suggests that AccFABP may regulate insect growth and development, and lipid metabolism.

Differences in Transcriptional Activity of Human Papillomavirus Type 6 Molecular Variants in Recurrent Respiratory Papillomatosis

PubMed Central

Measso do Bonfim, Caroline; Simão Sobrinho, João; Lacerda Nogueira, Rodrigo; Salgado Kupper, Daniel; Cardoso Pereira Valera, Fabiana; Lacerda Nogueira, Maurício; Villa, Luisa Lina; Rahal, Paula; Sichero, Laura

2015-01-01

A significant proportion of recurrent respiratory papillomatosis (RRP) is caused by human papillomavirus type 6 (HPV-6). The long control region (LCR) contains cis-elements for regulation of transcription. Our aim was to characterize LCR HPV-6 variants in RRP cases, compare promoter activity of these isolates and search for cellular transcription factors (TFs) that could explain the differences observed. The complete LCR from 13 RRP was analyzed. Transcriptional activity of 5 variants was compared using luciferase assays. Differences in putative TFs binding sites among variants were revealed using the TRANSFAC database. Chromatin immunoprecipation (CHIP) and luciferase assays were used to evaluate TF binding and impact upon transcription, respectively. Juvenile-onset RRP cases harbored exclusively HPV-6vc related variants, whereas among adult-onset cases HPV-6a variants were more prevalent. The HPV-6vc reference was more transcriptionally active than the HPV-6a reference. Active FOXA1, ELF1 and GATA1 binding sites overlap variable nucleotide positions among isolates and influenced LCR activity. Furthermore, our results support a crucial role for ELF1 on transcriptional downregulation. We identified TFs implicated in the regulation of HPV-6 early gene expression. Many of these factors are mutated in cancer or are putative cancer biomarkers, and must be further studied. PMID:26151558

Facile O-atom insertion into CC and CH bonds by a trinuclear copper complex designed to harness a singlet oxene

PubMed Central

Chen, Peter P.-Y.; Yang, Richard B.-G.; Lee, Jason C.-M.; Chan, Sunney I.

2007-01-01

Two trinuclear copper [CuICuICuI(L)]1+ complexes have been prepared with the multidentate ligands (L) 3,3′-(1,4-diazepane-1,4-diyl)bis(1-((2-(dimethylamino)ethyl)(methyl)amino)propan-2-ol) (7-Me) and (3,3′-(1,4-diazepane-1,4-diyl)bis(1-((2-(diethylamino) ethyl)(ethyl) amino)propan-2-ol) (7-Et) as models for the active site of the particulate methane monooxygenase (pMMO). The ligands were designed to form the proper spatial and electronic geometry to harness a “singlet oxene,” according to the mechanism previously suggested by our laboratory. Consistent with the design strategy, both [CuICuICuI(L)]1+ reacted with dioxygen to form a putative bis(μ3-oxo)CuIICuIICuIII species, capable of facile O-atom insertion across the central CC bond of benzil and 2,3-butanedione at ambient temperature and pressure. These complexes also catalyze facile O-atom transfer to the CH bond of CH3CN to form glycolonitrile. These results, together with our recent biochemical studies on pMMO, provide support for our hypothesis that the hydroxylation site of pMMO contains a trinuclear copper cluster that mediates CH bond activation by a singlet oxene mechanism. PMID:17804786

Structure of a Thermobifida fusca lytic polysaccharide monooxygenase and mutagenesis of key residues

DOE Office of Scientific and Technical Information (OSTI.GOV)

Kruer-Zerhusen, Nathan; Alahuhta, Markus; Lunin, Vladimir V.

Auxiliary activity (AA) enzymes are produced by numerous bacterial and fungal species to assist in the degradation of biomass. These enzymes are abundant but have yet to be fully characterized. Here, we report the X-ray structure of Thermobifida fusca AA10A (TfAA10A), investigate mutational characterization of key surface residues near its active site, and explore the importance of the various domains of Thermobifida fusca AA10B (TfAA10B). The structure of TfAA10A is similar to other bacterial LPMOs (lytic polysaccharide monooxygenases), including signs of photo-reduction and a distorted active site, with mixed features showing both type I and II copper coordination. The pointmore » mutation experiments of TfAA10A show that Trp82 and Asn83 are needed for binding, but only Trp82 affects activity. The TfAA10B domain truncation mutants reveal that CBM2 is crucial for the binding of substrate, but that the X1 module does not affect binding or activity. In TfAA10A, Trp82 and Asn83 are needed for binding, but only Trp82 affects activity. The TfAA10B domain truncation mutants reveal that CBM2 is crucial for substrate binding, but that the X1 module does not affect binding or activity. The structure of TfAA10A is similar to other bacterial lytic polysaccharide monooxygenases with mixed features showing both type I and II copper coordination. The role of LPMOs and the variability of abundance in genomes are not fully explored. LPMOs likely perform initial attacks into crystalline cellulose to allow larger processive cellulases to bind and attack, but the precise nature of their synergistic behavior remains to be definitively characterized.« less

Structure of a Thermobifida fusca lytic polysaccharide monooxygenase and mutagenesis of key residues

DOE PAGES

Kruer-Zerhusen, Nathan; Alahuhta, Markus; Lunin, Vladimir V.; ...

2017-11-30

Auxiliary activity (AA) enzymes are produced by numerous bacterial and fungal species to assist in the degradation of biomass. These enzymes are abundant but have yet to be fully characterized. Here, we report the X-ray structure of Thermobifida fusca AA10A (TfAA10A), investigate mutational characterization of key surface residues near its active site, and explore the importance of the various domains of Thermobifida fusca AA10B (TfAA10B). The structure of TfAA10A is similar to other bacterial LPMOs (lytic polysaccharide monooxygenases), including signs of photo-reduction and a distorted active site, with mixed features showing both type I and II copper coordination. The pointmore » mutation experiments of TfAA10A show that Trp82 and Asn83 are needed for binding, but only Trp82 affects activity. The TfAA10B domain truncation mutants reveal that CBM2 is crucial for the binding of substrate, but that the X1 module does not affect binding or activity. In TfAA10A, Trp82 and Asn83 are needed for binding, but only Trp82 affects activity. The TfAA10B domain truncation mutants reveal that CBM2 is crucial for substrate binding, but that the X1 module does not affect binding or activity. The structure of TfAA10A is similar to other bacterial lytic polysaccharide monooxygenases with mixed features showing both type I and II copper coordination. The role of LPMOs and the variability of abundance in genomes are not fully explored. LPMOs likely perform initial attacks into crystalline cellulose to allow larger processive cellulases to bind and attack, but the precise nature of their synergistic behavior remains to be definitively characterized.« less

The Role of the EGF Receptor First Intron in Its Regulation in Breast Canceer.

DTIC Science & Technology

1997-08-01

of EGFR, to malignantly transform mammary glands in transgenic mice (46). Future work could determine if these putative oncogene factor binding sites...general transcription factors, and the use or overuse of one promoter could monopolize the abundance of these transcription factors within a cell. The ideal

Identification of regulatory targets for the bacterial Nus factor complex.

PubMed

Baniulyte, Gabriele; Singh, Navjot; Benoit, Courtney; Johnson, Richard; Ferguson, Robert; Paramo, Mauricio; Stringer, Anne M; Scott, Ashley; Lapierre, Pascal; Wade, Joseph T

2017-12-11

Nus factors are broadly conserved across bacterial species, and are often essential for viability. A complex of five Nus factors (NusB, NusE, NusA, NusG and SuhB) is considered to be a dedicated regulator of ribosomal RNA folding, and has been shown to prevent Rho-dependent transcription termination. Here, we identify an additional cellular function for the Nus factor complex in Escherichia coli: repression of the Nus factor-encoding gene, suhB. This repression occurs primarily by translation inhibition, followed by Rho-dependent transcription termination. Thus, the Nus factor complex can prevent or promote Rho activity depending on the gene context. Conservation of putative NusB/E binding sites upstream of Nus factor genes suggests that Nus factor autoregulation occurs in many bacterial species. Additionally, many putative NusB/E binding sites are also found upstream of other genes in diverse species, and we demonstrate Nus factor regulation of one such gene in Citrobacter koseri. We conclude that Nus factors have an evolutionarily widespread regulatory function beyond ribosomal RNA, and that they are often autoregulatory.

Comparative Analyses of the β-Tubulin Gene and Molecular Modeling Reveal Molecular Insight into the Colchicine Resistance in Kinetoplastids Organisms

PubMed Central

Luis, Luis; Serrano, María Luisa; Hidalgo, Mariana; Mendoza-León, Alexis

2013-01-01

Differential susceptibility to microtubule agents has been demonstrated between mammalian cells and kinetoplastid organisms such as Leishmania spp. and Trypanosoma spp. The aims of this study were to identify and characterize the architecture of the putative colchicine binding site of Leishmania spp. and investigate the molecular basis of colchicine resistance. We cloned and sequenced the β-tubulin gene of Leishmania (Viannia) guyanensis and established the theoretical 3D model of the protein, using the crystallographic structure of the bovine protein as template. We identified mutations on the Leishmania   β-tubulin gene sequences on regions related to the putative colchicine-binding pocket, which generate amino acid substitutions and changes in the topology of this region, blocking the access of colchicine. The same mutations were found in the β-tubulin sequence of kinetoplastid organisms such as Trypanosoma cruzi, T. brucei, and T. evansi. Using molecular modelling approaches, we demonstrated that conformational changes include an elongation and torsion of an α-helix structure and displacement to the inside of the pocket of one β-sheet that hinders access of colchicine. We propose that kinetoplastid organisms show resistance to colchicine due to amino acids substitutions that generate structural changes in the putative colchicine-binding domain, which prevent colchicine access. PMID:24083244

eF-seek: prediction of the functional sites of proteins by searching for similar electrostatic potential and molecular surface shape.

PubMed

Kinoshita, Kengo; Murakami, Yoichi; Nakamura, Haruki

2007-07-01

We have developed a method to predict ligand-binding sites in a new protein structure by searching for similar binding sites in the Protein Data Bank (PDB). The similarities are measured according to the shapes of the molecular surfaces and their electrostatic potentials. A new web server, eF-seek, provides an interface to our search method. It simply requires a coordinate file in the PDB format, and generates a prediction result as a virtual complex structure, with the putative ligands in a PDB format file as the output. In addition, the predicted interacting interface is displayed to facilitate the examination of the virtual complex structure on our own applet viewer with the web browser (URL: http://eF-site.hgc.jp/eF-seek).

Key amino acid residues involved in multi-point binding interactions between brazzein, a sweet protein, and the T1R2-T1R3 human sweet receptor

PubMed Central

Assadi-Porter, Fariba M.; Maillet, Emeline L.; Radek, James T.; Quijada, Jeniffer; Markley, John L.; Max, Marianna

2010-01-01

The sweet protein brazzein activates the human sweet receptor, a heterodimeric G-protein coupled receptor (GPCR) composed of subunits T1R2 and T1R3. In order to elucidate the key amino acid(s) responsible for this interaction, we mutated residues in brazzein and each of the two subunits of the receptor. The effects of brazzein mutations were assayed by a human taste panel and by an in vitro assay involving receptor subunits expressed recombinantly in human embryonic kidney cells; the effects of the receptor mutations were assayed by the in vitro assay. We mutated surface residues of brazzein at three putative interaction sites: Site 1 (Loop43), Site 2 (N- and C-terminus and adjacent Glu36, Loop33), and Site 3 (Loop9–19). Basic residues in Site 1 and acidic residues in Site 2 were essential for positive responses from each assay. Mutation of Y39A (Site 1) greatly reduced positive responses. A bulky side chain at position 54 (Site 2), rather than a side chain with hydrogen bonding potential, was required for positive responses as was the presence of the native disulfide bond in Loop 9–19 (Site 3). Results from mutagenesis and chimeras of the receptor indicated that brazzein interacts with both T1R2 and T1R3 and that the Venus fly trap module of T1R2 is important for brazzein agonism. With one exception, all mutations of receptor residues at putative interaction sites predicted by wedge models failed to yield the expected decrease in the brazzein response. The exception, hT1R2:R217A-hT1R3, which contained a substitution in lobe 2 at the interface between the two subunits, exhibited a small selective decrease in brazzein activity. However, because the mutation was found to increase the positive cooperativity of binding by multiple ligands proposed to bind both T1R subunits (brazzein, monellin, and sucralose) but not those that bind to a single subunit (neotame and cyclamate), we suggest that this site in involved in subunit-subunit interaction rather than direct brazzein binding. Results from this study support a multipoint interaction between brazzein and the sweet receptor by some mechanism other than the proposed wedge models. PMID:20302879

Interaction of the putative tyrosine recombinases RipX (UU145), XerC (UU222), and CodV (UU529) of Ureaplasma parvum serovar 3 with specific DNA

PubMed Central

Zimmerman, Carl-Ulrich R; Rosengarten, Renate; Spergser, Joachim

2013-01-01

Phase variation of two loci (‘mba locus’ and ‘UU172 phase-variable element’) in Ureaplasma parvum serovar 3 has been suggested as result of site-specific DNA inversion occurring at short inverted repeats. Three potential tyrosine recombinases (RipX, XerC, and CodV encoded by the genes UU145, UU222, and UU529) have been annotated in the genome of U. parvum serovar 3, which could be mediators in the proposed recombination event. We document that only orthologs of the gene xerC are present in all strains that show phase variation in the two loci. We demonstrate in vitro binding of recombinant maltose-binding protein fusions of XerC to the inverted repeats of the phase-variable loci, of RipX to a direct repeat that flanks a 20-kbp region, which has been proposed as putative pathogenicity island, and of CodV to a putative dif site. Co-transformation of the model organism Mycoplasma pneumoniae M129 with both the ‘mba locus’ and the recombinase gene xerC behind an active promoter region resulted in DNA inversion in the ‘mba locus’. Results suggest that XerC of U. parvum serovar 3 is a mediator in the proposed DNA inversion event of the two phase-variable loci. PMID:23305333

Mitochondrial Copper Metabolism and Delivery to Cytochrome c Oxidase

PubMed Central

Horn, Darryl; Barrientos, Antoni

2010-01-01

Summary Metals are essential elements of all living organisms. Among them, copper is required for a multiplicity of functions including mitochondrial oxidative phosphorylation and protection against oxidative stress. Here we will focus on describing the pathways involved in the delivery of copper to cytochrome c oxidase (COX), a mitochondrial metalloenzyme acting as the terminal enzyme of the mitochondrial respiratory chain. The catalytic core of COX is formed by three mitochondrially-encoded subunits and contains three copper atoms. Two copper atoms bound to subunit 2 constitute the CuA site, the primary acceptor of electrons from ferrocytochrome c. The third copper, CuB, is associated with the high-spin heme a3 group of subunit 1. Recent studies, mostly performed in the yeast Saccharomyces cerevisiae, have provided new clues about 1- the source of the copper used for COX metallation; 2- the roles of Sco1p and Cox11p, the proteins involved in the direct delivery of copper to the CuA and CuB sites, respectively; 3- the action mechanism of Cox17p, a copper chaperone that provides copper to Sco1p and Cox11p; 4- the existence of at least four Cox17p homologues carrying a similar twin CX9C domain suggestive of metal binding, Cox19p, Cox23p, Pet191p and Cmc1p, that could be part of the same pathway; and 5- the presence of a disulfide relay system in the intermembrane space of mitochondria that mediates import of proteins with conserved cysteines motifs such as the CX9C characteristic of Cox17p and its homologues. The different pathways are reviewed and discussed in the context of both mitochondrial COX assembly and copper homeostasis. PMID:18459161

Bioinformatic prediction of gene functions regulated by quorum sensing in the bioleaching bacterium Acidithiobacillus ferrooxidans.

PubMed

Banderas, Alvaro; Guiliani, Nicolas

2013-08-16

The biomining bacterium Acidithiobacillus ferrooxidans oxidizes sulfide ores and promotes metal solubilization. The efficiency of this process depends on the attachment of cells to surfaces, a process regulated by quorum sensing (QS) cell-to-cell signalling in many Gram-negative bacteria. At. ferrooxidans has a functional QS system and the presence of AHLs enhances its attachment to pyrite. However, direct targets of the QS transcription factor AfeR remain unknown. In this study, a bioinformatic approach was used to infer possible AfeR direct targets based on the particular palindromic features of the AfeR binding site. A set of Hidden Markov Models designed to maintain palindromic regions and vary non-palindromic regions was used to screen for putative binding sites. By annotating the context of each predicted binding site (PBS), we classified them according to their positional coherence relative to other putative genomic structures such as start codons, RNA polymerase promoter elements and intergenic regions. We further used the Multiple EM for Motif Elicitation algorithm (MEME) to further filter out low homology PBSs. In summary, 75 target-genes were identified, 34 of which have a higher confidence level. Among the identified genes, we found afeR itself, zwf, genes encoding glycosyltransferase activities, metallo-beta lactamases, and active transport-related proteins. Glycosyltransferases and Zwf (Glucose 6-phosphate-1-dehydrogenase) might be directly involved in polysaccharide biosynthesis and attachment to minerals by At. ferrooxidans cells during the bioleaching process.

Bioinformatic Prediction of Gene Functions Regulated by Quorum Sensing in the Bioleaching Bacterium Acidithiobacillus ferrooxidans

PubMed Central

Banderas, Alvaro; Guiliani, Nicolas

2013-01-01

The biomining bacterium Acidithiobacillus ferrooxidans oxidizes sulfide ores and promotes metal solubilization. The efficiency of this process depends on the attachment of cells to surfaces, a process regulated by quorum sensing (QS) cell-to-cell signalling in many Gram-negative bacteria. At. ferrooxidans has a functional QS system and the presence of AHLs enhances its attachment to pyrite. However, direct targets of the QS transcription factor AfeR remain unknown. In this study, a bioinformatic approach was used to infer possible AfeR direct targets based on the particular palindromic features of the AfeR binding site. A set of Hidden Markov Models designed to maintain palindromic regions and vary non-palindromic regions was used to screen for putative binding sites. By annotating the context of each predicted binding site (PBS), we classified them according to their positional coherence relative to other putative genomic structures such as start codons, RNA polymerase promoter elements and intergenic regions. We further used the Multiple EM for Motif Elicitation algorithm (MEME) to further filter out low homology PBSs. In summary, 75 target-genes were identified, 34 of which have a higher confidence level. Among the identified genes, we found afeR itself, zwf, genes encoding glycosyltransferase activities, metallo-beta lactamases, and active transport-related proteins. Glycosyltransferases and Zwf (Glucose 6-phosphate-1-dehydrogenase) might be directly involved in polysaccharide biosynthesis and attachment to minerals by At. ferrooxidans cells during the bioleaching process. PMID:23959118

The hepta-beta-glucoside elicitor-binding proteins from legumes represent a putative receptor family.

PubMed

Mithöfer, A; Fliegmann, J; Neuhaus-Url, G; Schwarz, H; Ebel, J

2000-08-01

The ability of legumes to recognize and respond to beta-glucan elicitors by synthesizing phytoalexins is consistent with the existence of a membrane-bound beta-glucan-binding site. Related proteins of approximately 75 kDa and the corresponding mRNAs were detected in various species of legumes which respond to beta-glucans. The cDNAs for the beta-glucan-binding proteins of bean and soybean were cloned. The deduced 75-kDa proteins are predominantly hydrophilic and constitute a unique class of glucan-binding proteins with no currently recognizable functional domains. Heterologous expression of the soybean beta-glucan-binding protein in tomato cells resulted in the generation of a high-affinity binding site for the elicitor-active hepta-beta-glucoside conjugate (Kd = 4.5 nM). Ligand competition experiments with the recombinant binding sites demonstrated similar ligand specificities when compared with soybean. In both soybean and transgenic tomato, membrane-bound, active forms of the glucan-binding proteins coexist with immunologically detectable, soluble but inactive forms of the proteins. Reconstitution of a soluble protein fraction into lipid vesicles regained beta-glucoside-binding activity but with lower affinity (Kd = 130 nM). We conclude that the beta-glucan elicitor receptors of legumes are composed of the 75 kDa glucan-binding proteins as the critical components for ligand-recognition, and of an as yet unknown membrane anchor constituting the plasma membrane-associated receptor complex.

CisMapper: predicting regulatory interactions from transcription factor ChIP-seq data

PubMed Central

O'Connor, Timothy; Bodén, Mikael

2017-01-01

Abstract Identifying the genomic regions and regulatory factors that control the transcription of genes is an important, unsolved problem. The current method of choice predicts transcription factor (TF) binding sites using chromatin immunoprecipitation followed by sequencing (ChIP-seq), and then links the binding sites to putative target genes solely on the basis of the genomic distance between them. Evidence from chromatin conformation capture experiments shows that this approach is inadequate due to long-distance regulation via chromatin looping. We present CisMapper, which predicts the regulatory targets of a TF using the correlation between a histone mark at the TF's bound sites and the expression of each gene across a panel of tissues. Using both chromatin conformation capture and differential expression data, we show that CisMapper is more accurate at predicting the target genes of a TF than the distance-based approaches currently used, and is particularly advantageous for predicting the long-range regulatory interactions typical of tissue-specific gene expression. CisMapper also predicts which TF binding sites regulate a given gene more accurately than using genomic distance. Unlike distance-based methods, CisMapper can predict which transcription start site of a gene is regulated by a particular binding site of the TF. PMID:28204599

Modeling of three dimensional structure of human alpha-fetoprotein complexed with diethylstilbestrol: docking and molecular dynamics simulation study.

PubMed

Terentiev, Alexander A; Moldogazieva, Nurbubu T; Levtsova, Olga V; Maximenko, Dmitry M; Borozdenko, Denis A; Shaitan, Konstantin V

2012-04-01

It has been long experimentally demonstrated that human alpha-fetoprotein (HAFP) has an ability to bind immobilized estrogens with the most efficiency for synthetic estrogen analog - diethylstilbestrol (DES). However, the question remains why the human AFP (HAFP), unlike rodent AFP, cannot bind free estrogens. Moreover, despite the fact that AFP was first discovered more than 50 years ago and is presently recognized as a "golden standard" among onco-biomarkers, its three-dimensional (3D) structure has not been experimentally solved yet. In this work using MODELLER program, we generated 3D model of HAFP on the basis of homology with human serum albumin (HSA) and Vitamin D-binding protein (VTDB) with subsequent molecular docking of DES to the model structure and molecular dynamics (MD) simulation study of the complex obtained. The model constructed has U-shaped structure in which a cavity may be distinguished. In this cavity the putative estrogen-binding site is localized. Validation by RMSD calculation and with the use of PROCHECK program showed good quality of the model and stability of extended region of four alpha-helical structures that contains putative hormone-binding residues. Data extracted from MD simulation trajectory allow proposing two types of interactions between amino acid residues of HAFP and DES molecule: (1) hydrogen bonding with involvement of residues S445, R452, and E551; (2) hydrophobic interactions with participation of L138, M448, and M548 residues. A suggestion is made that immobilization of the hormone using a long spacer provides delivery of the estrogen molecule to the binding site and, thereby, facilitates interaction between HAFP and the hormone.

Mechanistic studies of copper(II)-aminoglycoside mediated DNA damage and magnesium catalyzed nuclease activity of hammerhead ribozyme

NASA Astrophysics Data System (ADS)

Patwardhan, Anjali A.

The antibacterial activity of aminoglycosides stems from their high affinity binding to the 16S rRNA in bacteria resulting in inhibition of protein synthesis. Used to treat acute bacterial infections these antibiotics have limited applications due to their high dosage requirements and the emergence of resistant strains. We have synthesized and characterized Cu(II) derivatives of the aminoglycosides, kanamycin A, tobramycin, neamine, kanamycin B, neomycin B, and paromomycin. The first three exhibit preferential and tight binding to Cu(II) as against neomycin B and kanamycin B and paromomycin. EPR of frozen solutions and UV-visible spectroscopy suggest a change in geometry around the Cu(II) but the stabilities of the complexes in water differ. These copper derivatives efficiently cleave plasmid DNA at micromolar concentrations (hydrolytic) and at nanomolar concentrations in the presence co-reactants like hydrogen peroxide or ascorbic acid. Hydrolysis is multi turnover and exhibits Michelis-Menten kinetics with enzyme-like behavior whereas oxidative cleavage is highly specific with C-4' H abstraction resulting in characteristic base propenal and nucleotide base products. Hydroxyl radicals generated are copper based and are generated in close proximity of the substrate. Hammerhead ribozymes are selectively hydrolyzed in the presence of divalent ions with Mg2+ being the metal ion of choice in vivo . Our studies with complex ions like cobalt hexaammine and fac-triamminetriaquochromium(III) establish outer sphere interactions of Mg2+ with the hammerhead in the catalytic site. There are two sets of sites, one structural and one catalytic. Complex ions in the catalytic site and divalent ions in the structural site result in a slow but active hammerhead ribozyme suggesting that the complex ions are not inhibitory, contrary to what was suggested previously.

Interactions between copper(II) and DOM in the urban stormwater runoff: modeling and characterizations.

PubMed

Zhao, Chen; Wang, Chong-Chen; Li, Jun-Qi; Wang, Peng; Ou, Jia-Qi; Cui, Jing-Rui

2018-01-01

Dissolved organic matter (DOM) can strongly interact with both organic and inorganic contaminants to influence their transportation, transformation, bioavailability, toxicity and even their ultimate fate. Within this work, DOM was extracted from urban stormwater runoff samples collected from a regular sampling site of a typical residential area in Beijing, China. Copper(II) ions were selected as model to investigate the interactions between DOM and typical heavy metals. Both ultraviolet (UV) absorbance and fluorescence titration methods were introduced to determine the complex capacities (C L ) and conditional stability constants (log K M ) of bonding between DOM and copper (II) ions, which revealed that the values of C L were 85.62 and 87.23 μmol mg -1 and the log K M values were 5.37 and 5.48, respectively. The results suggested the successful complexation between DOM and copper(II) ions. Furthermore, morphology of the DOM binding to copper(II) ions was confirmed by both energy-dispersive X-ray spectroscopy (EDX) and X-ray photoelectron spectroscopy (XPS), which can facilitate to clarify the corresponding mechanism. The Cu 2p 3/2 peak at 933.7 eV and the characteristic shake-up peaks of Cu-O were found in the XPS spectra, implying that copper(II) ions might coordinate with hydroxyl (aliphatic or phenolic) or carboxyl groups. With these profitable results, it can be concluded that DOM in urban stormwater runoff has a strong binding affinity with copper(II) ions, which may further lead to potentially significant influence on their migration and transformation.

1-Aminocyclopropane-1-carboxylic acid oxidase reaction mechanism and putative post-translational activities of the ACCO protein

PubMed Central

Dilley, David R.; Wang, Zhenyong; Kadirjan-Kalbach, Deena K.; Ververidis, Fillipos; Beaudry, Randolph; Padmanabhan, Kallaithe

2013-01-01

1-Aminocyclopropane-1-carboxylic acid (ACC) oxidase (ACCO) catalyses the final step in ethylene biosynthesis converting ACC to ethylene, cyanide, CO2, dehydroascorbate and water with inputs of Fe(II), ascorbate, bicarbonate (as activators) and oxygen. Cyanide activates ACCO. A ‘nest’ comprising several positively charged amino acid residues from the C-terminal α-helix 11 along with Lys158 and Arg299 are proposed as binding sites for ascorbate and bicarbonate to coordinately activate the ACCO reaction. The binding sites for ACC, bicarbonate and ascorbic acid for Malus domestica ACCO1 include Arg175, Arg244, Ser246, Lys158, Lys292, Arg299 and Phe300. Glutamate 297, Phe300 and Glu301 in α-helix 11 are also important for the ACCO reaction. Our proposed reaction pathway incorporates cyanide as an ACCO/Fe(II) ligand after reaction turnover. The cyanide ligand is likely displaced upon binding of ACC and ascorbate to provide a binding site for oxygen. We propose that ACCO may be involved in the ethylene signal transduction pathway not directly linked to the ACCO reaction. ACC oxidase has significant homology with Lycopersicon esculentum cysteine protease LeCp, which functions as a protease and as a regulator of 1-aminocyclopropane-1-carboxylic acid synthase (Acs2) gene expression. ACC oxidase may play a similar role in signal transduction after post-translational processing. ACC oxidase becomes inactivated by fragmentation and apparently has intrinsic protease and transpeptidase activity. ACC oxidase contains several amino acid sequence motifs for putative protein–protein interactions, phosphokinases and cysteine protease. ACC oxidase is subject to autophosphorylaton in vitro and promotes phosphorylation of some apple fruit proteins in a ripening-dependent manner. PMID:24244837

Binding site feature description of 2-substituted benzothiazoles as potential AcrAB-TolC efflux pump inhibitors in E. coli.

PubMed

Yilmaz, S; Altinkanat-Gelmez, G; Bolelli, K; Guneser-Merdan, D; Ufuk Over-Hasdemir, M; Aki-Yalcin, E; Yalcin, I

2015-01-01

The resistance-nodulation-division (RND) family efflux pumps are important in the antibiotic resistance of Gram-negative bacteria. However, although a number of bacterial RND efflux pump inhibitors have been developed, there has been no clinically available RND efflux pump inhibitor to date. A set of BSN-coded 2-substituted benzothiazoles were tested alone and in combinations with ciprofloxacin (CIP) against the AcrAB-TolC overexpressor Escherichia coli AG102 clinical strain. The results indicated that the BSN compounds did not show intrinsic antimicrobial activity when tested alone. However, when used in combinations with CIP, a reversal in the antibacterial activity of CIP with up to 10-fold better MIC values was observed. In order to describe the binding site features of these BSN compounds with AcrB, docking studies were performed using the CDocker method. The performed docking poses and the calculated binding energy scores revealed that the tested compounds BSN-006, BSN-023, and BSN-004 showed significant binding interactions with the phenylalanine-rich region in the distal binding site of the AcrB binding monomer. Moreover, the tested compounds BSN-006 and BSN-023 possessed stronger binding energies than CIP, verifying that BSN compounds are acting as the putative substrates of AcrB.

Deconstructing the DGAT1 enzyme: membrane interactions at substrate binding sites.

PubMed

Lopes, Jose L S; Beltramini, Leila M; Wallace, Bonnie A; Araujo, Ana P U

2015-01-01

Diacylglycerol acyltransferase 1 (DGAT1) is a key enzyme in the triacylglyceride synthesis pathway. Bovine DGAT1 is an endoplasmic reticulum membrane-bound protein associated with the regulation of fat content in milk and meat. The aim of this study was to evaluate the interaction of DGAT1 peptides corresponding to putative substrate binding sites with different types of model membranes. Whilst these peptides are predicted to be located in an extramembranous loop of the membrane-bound protein, their hydrophobic substrates are membrane-bound molecules. In this study, peptides corresponding to the binding sites of the two substrates involved in the reaction were examined in the presence of model membranes in order to probe potential interactions between them that might influence the subsequent binding of the substrates. Whilst the conformation of one of the peptides changed upon binding several types of micelles regardless of their surface charge, suggesting binding to hydrophobic domains, the other peptide bound strongly to negatively-charged model membranes. This binding was accompanied by a change in conformation, and produced leakage of the liposome-entrapped dye calcein. The different hydrophobic and electrostatic interactions observed suggest the peptides may be involved in the interactions of the enzyme with membrane surfaces, facilitating access of the catalytic histidine to the triacylglycerol substrates.

Independent signaling by Drosophila insulin receptor for axon guidance and growth.

PubMed

Li, Caroline R; Guo, Dongyu; Pick, Leslie

2013-01-01

The Drosophila insulin receptor (DInR) regulates a diverse array of biological processes including growth, axon guidance, and sugar homeostasis. Growth regulation by DInR is mediated by Chico, the Drosophila homolog of vertebrate insulin receptor substrate proteins IRS1-4. In contrast, DInR regulation of photoreceptor axon guidance in the developing visual system is mediated by the SH2-SH3 domain adaptor protein Dreadlocks (Dock). In vitro studies by others identified five NPXY motifs, one in the juxtamembrane region and four in the signaling C-terminal tail (C-tail), important for interaction with Chico. Here we used yeast two-hybrid assays to identify regions in the DInR C-tail that interact with Dock. These Dock binding sites were in separate portions of the C-tail from the previously identified Chico binding sites. To test whether these sites are required for growth or axon guidance in whole animals, a panel of DInR proteins, in which the putative Chico and Dock interaction sites had been mutated individually or in combination, were tested for their ability to rescue viability, growth and axon guidance defects of dinr mutant flies. Sites required for viability were identified. Unexpectedly, mutation of both putative Dock binding sites, either individually or in combination, did not lead to defects in photoreceptor axon guidance. Thus, either sites also required for viability are necessary for DInR function in axon guidance and/or there is redundancy built into the DInR/Dock interaction such that Dock is able to interact with multiple regions of DInR. We also found that simultaneous mutation of all five NPXY motifs implicated in Chico interaction drastically decreased growth in both male and female adult flies. These animals resembled chico mutants, supporting the notion that DInR interacts directly with Chico in vivo to control body size. Mutation of these five NPXY motifs did not affect photoreceptor axon guidance, segregating the roles of DInR in the processes of growth and axon guidance.

Structural and functional characterisation of multi-copper oxidase CueO from lignin-degrading bacterium Ochrobactrum sp. reveal its activity towards lignin model compounds and lignosulfonate.

PubMed

Granja-Travez, Rommel Santiago; Wilkinson, Rachael C; Persinoti, Gabriela Felix; Squina, Fabio M; Fülöp, Vilmos; Bugg, Timothy D H

2018-05-01

The identification of enzymes responsible for oxidation of lignin in lignin-degrading bacteria is of interest for biotechnological valorization of lignin to renewable chemical products. The genome sequences of two lignin-degrading bacteria, Ochrobactrum sp., and Paenibacillus sp., contain no B-type DyP peroxidases implicated in lignin degradation in other bacteria, but contain putative multicopper oxidase genes. Multi-copper oxidase CueO from Ochrobactrum sp. was expressed and reconstituted as a recombinant laccase-like enzyme, and kinetically characterized. Ochrobactrum CueO shows activity for oxidation of β-aryl ether and biphenyl lignin dimer model compounds, generating oxidized dimeric products, and shows activity for oxidation of Ca-lignosulfonate, generating vanillic acid as a low molecular weight product. The crystal structure of Ochrobactrum CueO (OcCueO) has been determined at 1.1 Å resolution (PDB: 6EVG), showing a four-coordinate mononuclear type I copper center with ligands His495, His434 and Cys490 with Met500 as an axial ligand, similar to that of Escherichia coli CueO and bacterial azurin proteins, whereas fungal laccase enzymes contain a three-coordinate type I copper metal center. A trinuclear type 2/3 copper cluster was modeled into the active site, showing similar structure to E. coli CueO and fungal laccases, and three solvent channels leading to the active site. Site-directed mutagenesis was carried out on amino acid residues found in the solvent channels, indicating the importance for residues Asp102, Gly103, Arg221, Arg223, and Asp462 for catalytic activity. The work identifies a new bacterial multicopper enzyme with activity for lignin oxidation, and implicates a role for bacterial laccase-like multicopper oxidases in some lignin-degrading bacteria. Structural data are available in the PDB under the accession number 6EVG. © 2018 Federation of European Biochemical Societies.

The wheat homolog of putative nucleotide-binding site-leucine-rich repeat resistance gene TaRGA contributes to resistance against powdery mildew.

PubMed

Wang, Defu; Wang, Xiaobing; Mei, Yu; Dong, Hansong

2016-03-01

Powdery mildew, one of the most destructive wheat diseases worldwide, is caused by Blumeria graminis f. sp. tritici (Bgt), a fungal species with a consistently high mutation rate that makes individual resistance (R) genes ineffective. Therefore, effective resistance-related gene cloning is vital for breeding and studying the resistance mechanisms of the disease. In this study, a putative nucleotide-binding site-leucine-rich repeat (NBS-LRR) R gene (TaRGA) was cloned using a homology-based cloning strategy and analyzed for its effect on powdery mildew disease and wheat defense responses. Real-time reverse transcription-PCR (RT-PCR) analyses revealed that a Bgt isolate 15 and salicylic acid stimulation significantly induced TaRGA in the resistant variety. Furthermore, the silencing of TaRGA in powdery mildew-resistant plants increased susceptibility to Bgt15 and prompted conidia propagation at the infection site. However, the expression of TaRGA in leaf segments after single-cell transient expression assay highly increased the defense responses to Bgt15 by enhancing callose deposition and phenolic autofluorogen accumulation at the pathogen invading sites. Meanwhile, the expression of pathogenesis-related genes decreased in the TaRGA-silenced plants and increased in the TaRGA-transient-overexpressing leaf segments. These results implied that the TaRGA gene positively regulates the defense response to powdery mildew disease in wheat.

An investigation into the unusual linkage isomerization and nitrite reduction activity of a novel tris(2-pyridyl) copper complex

NASA Astrophysics Data System (ADS)

Roger, Isolda; Wilson, Claire; Senn, Hans M.; Sproules, Stephen; Symes, Mark D.

2017-08-01

The copper-containing nitrite reductases (CuNIRs) are a class of enzymes that mediate the reduction of nitrite to nitric oxide in biological systems. Metal-ligand complexes that reproduce the salient features of the active site of CuNIRs are therefore of fundamental interest, both for elucidating the possible mode of action of the enzymes and for developing biomimetic catalysts for nitrite reduction. Herein, we describe the synthesis and characterization of a new tris(2-pyridyl) copper complex ([Cu1(NO2)2]) that binds two molecules of nitrite, and displays all three of the common binding modes for NO2-, with one nitrite bound in an asymmetric quasi-bidentate κ2-ONO manner and the other bound in a monodentate fashion with a linkage isomerism between the κ1-ONO and κ1-NO2 binding modes. We use density functional theory to help rationalize the presence of all three of these linkage isomers in one compound, before assessing the redox activity of [Cu1(NO2)2]. These latter studies show that the complex is not a competent nitrite reduction electrocatalyst in non-aqueous solvent, even in the presence of additional proton donors, a finding which may have implications for the design of biomimetic catalysts for nitrite reduction.

Regulation of CYBB Gene Expression in Human Phagocytes by a Distant Upstream NF-κB Binding Site.

PubMed

Frazão, Josias B; Thain, Alison; Zhu, Zhiqing; Luengo, Marcos; Condino-Neto, Antonio; Newburger, Peter E

2015-09-01

The human CYBB gene encodes the gp91-phox component of the phagocyte oxidase enzyme complex, which is responsible for generating superoxide and other downstream reactive oxygen species essential to microbial killing. In the present study, we have identified by sequence analysis a putative NF-κB binding site in a DNase I hypersensitive site, termed HS-II, located in the distant 5' flanking region of the CYBB gene. Electrophoretic mobility assays showed binding of the sequence element by recombinant NF-κB protein p50 and by proteins in nuclear extract from the HL-60 myeloid leukemia cell line corresponding to p50 and to p50/p65 heterodimers. Chromatin immunoprecipitation demonstrated NF-κB binding to the site in intact HL-60 cells. Chromosome conformation capture (3C) assays demonstrated physical interaction between the NF-κB binding site and the CYBB promoter region. Inhibition of NF-κB activity by salicylate reduced CYBB expression in peripheral blood neutrophils and differentiated U937 monocytic leukemia cells. U937 cells transfected with a mutant inhibitor of κB "super-repressor" showed markedly diminished CYBB expression. Luciferase reporter analysis of the NF-κB site linked to the CYBB 5' flanking promoter region revealed enhanced expression, augmented by treatment with interferon-γ. These studies indicate a role for this distant, 15 kb upstream, binding site in NF-κB regulation of the CYBB gene, an essential component of phagocyte-mediated host defense. © 2015 Wiley Periodicals, Inc.

A Novel Fucose-binding Lectin from Photorhabdus luminescens (PLL) with an Unusual Heptabladed β-Propeller Tetrameric Structure*

PubMed Central

Kumar, Atul; Sýkorová, Petra; Demo, Gabriel; Dobeš, Pavel; Hyršl, Pavel

2016-01-01

Photorhabdus luminescens is known for its symbiosis with the entomopathogenic nematode Heterorhabditis bacteriophora and its pathogenicity toward insect larvae. A hypothetical protein from P. luminescens was identified, purified from the native source, and characterized as an l-fucose-binding lectin, named P. luminescens lectin (PLL). Glycan array and biochemical characterization data revealed PLL to be specific toward l-fucose and the disaccharide glycan 3,6-O-Me2-Glcβ1–4(2,3-O-Me2)Rhaα-O-(p-C6H4)-OCH2CH2NH2. PLL was discovered to be a homotetramer with an intersubunit disulfide bridge. The crystal structures of native and recombinant PLL revealed a seven-bladed β-propeller fold creating seven putative fucose-binding sites per monomer. The crystal structure of the recombinant PLL·l-fucose complex confirmed that at least three sites were fucose-binding. Moreover, the crystal structures indicated that some of the other sites are masked either by the tetrameric nature of the lectin or by incorporation of the C terminus of the lectin into one of these sites. PLL exhibited an ability to bind to insect hemocytes and the cuticular surface of a nematode, H. bacteriophora. PMID:27758853

Human cytoplasmic copper chaperones Atox1 and CCS exchange copper ions in vitro.

PubMed

Petzoldt, Svenja; Kahra, Dana; Kovermann, Michael; Dingeldein, Artur P G; Niemiec, Moritz S; Ådén, Jörgen; Wittung-Stafshede, Pernilla

2015-06-01

After Ctr1-mediated copper ion (Cu) entry into the human cytoplasm, chaperones Atox1 and CCS deliver Cu to P1B-type ATPases and to superoxide dismutase, respectively, via direct protein-protein interactions. Although the two Cu chaperones are presumed to work along independent pathways, we here assessed cross-reactivity between Atox1 and the first domain of CCS (CCS1) using biochemical and biophysical methods in vitro. By NMR we show that CCS1 is monomeric although it elutes differently from Atox1 in size exclusion chromatography (SEC). This property allows separation of Atox1 and CCS1 by SEC and, combined with the 254/280 nm ratio as an indicator of Cu loading, we demonstrate that Cu can be transferred from one protein to the other. Cu exchange also occurs with full-length CCS and, as expected, the interaction involves the metal binding sites since mutation of Cu-binding cysteine in Atox1 eliminates Cu transfer from CCS1. Cross-reactivity between CCS and Atox1 may aid in regulation of Cu distribution in the cytoplasm.

Analyzing multiple data sets by interconnecting RSAT programs via SOAP Web services: an example with ChIP-chip data.

PubMed

Sand, Olivier; Thomas-Chollier, Morgane; Vervisch, Eric; van Helden, Jacques

2008-01-01

This protocol shows how to access the Regulatory Sequence Analysis Tools (RSAT) via a programmatic interface in order to automate the analysis of multiple data sets. We describe the steps for writing a Perl client that connects to the RSAT Web services and implements a workflow to discover putative cis-acting elements in promoters of gene clusters. In the presented example, we apply this workflow to lists of transcription factor target genes resulting from ChIP-chip experiments. For each factor, the protocol predicts the binding motifs by detecting significantly overrepresented hexanucleotides in the target promoters and generates a feature map that displays the positions of putative binding sites along the promoter sequences. This protocol is addressed to bioinformaticians and biologists with programming skills (notions of Perl). Running time is approximately 6 min on the example data set.

The structure of cell adhesion molecule uvomorulin. Insights into the molecular mechanism of Ca2+-dependent cell adhesion.

PubMed Central

Ringwald, M; Schuh, R; Vestweber, D; Eistetter, H; Lottspeich, F; Engel, J; Dölz, R; Jähnig, F; Epplen, J; Mayer, S

1987-01-01

We have determined the amino acid sequence of the Ca2+-dependent cell adhesion molecule uvomorulin as it appears on the cell surface. The extracellular part of the molecule exhibits three internally repeated domains of 112 residues which are most likely generated by gene duplication. Each of the repeated domains contains two highly conserved units which could represent putative Ca2+-binding sites. Secondary structure predictions suggest that the putative Ca2+-binding units are located in external loops at the surface of the protein. The protein sequence exhibits a single membrane-spanning region and a cytoplasmic domain. Sequence comparison reveals extensive homology to the chicken L-CAM. Both uvomorulin and L-CAM are identical in 65% of their entire amino acid sequence suggesting a common origin for both CAMs. Images Fig. 1. Fig. 4. Fig. 7. PMID:3501370

Factors affecting catalysis of copper corrosion products in NDMA formation from DMA in simulated premise plumbing.

PubMed

Zhang, Hong; Andrews, Susan A

2013-11-01

This study investigated the effects of corrosion products of copper, a metal commonly employed in household plumbing systems, on N-nitrosodimethylamine (NDMA) formation from a known NDMA precursor, dimethylamine (DMA). Copper-catalyzed NDMA formation increased with increasing copper concentrations, DMA concentrations, alkalinity and hardness, but decreased with increasing natural organic matter (NOM) concentration. pH influenced the speciation of chloramine and the interactions of copper with DMA. The transformation of monochloramine (NH2Cl) to dichloramine and complexation of copper with DMA were involved in elevating the formation of NDMA by copper at pH 7.0. The inhibiting effect of NOM on copper catalysis was attributed to the rapid consumption of NH2Cl by NOM and/or the competitive complexation of NOM with copper to limit the formation of DMA-copper complexes. Hardness ions, as represented by Ca(2+), also competed with copper for binding sites on NOM, thereby weakening the inhibitory effect of NOM on NDMA formation. Common copper corrosion products also participated in these reactions but in different ways. Aqueous copper released from malachite [Cu2CO3(OH)2] was shown to promote NDMA formation while NDMA formation decreased in the presence of CuO, most likely due to the adsorption of DMA. Copyright © 2013 Elsevier Ltd. All rights reserved.

Affinity cleavage at the putative metal-binding site of pigeon liver malic enzyme by the Fe(2+)-ascorbate system.

PubMed

Wei, C H; Chou, W Y; Huang, S M; Lin, C C; Chang, G G

1994-06-28

Pigeon liver malic enzyme was rapidly inactivated by micromolar concentrations of ferrous sulfate in the presence of ascorbate at neutral pH and 0 or 25 degrees C. Omitting the ascorbate or replacing the ferrous ion with manganese ion did not lead to any inactivation. Manganese, magnesium, zinc, cobalt, or calcium ion at 200 molar excess over ferrous ion offered complete protection of the enzyme from Fe(2+)-induced inactivation. Ni2+ provided partial protection, while Ba2+ or imidazole was ineffective in protection. Addition of 4 mM Mn2+ or 5 mM EDTA into a partially modified enzyme stopped further inactivation of the enzyme. Inclusion of substrates (L-malate or NADP+, singly or in combination) in the incubation mixture did not affect the inactivation rate. The enzyme inactivation was demonstrated to be followed by protein cleavage. Native pigeon liver malic enzyme had a subunit M(r) of 65,000. The inactivated enzyme with residual activity of only 0.3% was cleaved into two fragments with M(r) of 31,000 and 34,000, respectively. The cleavage site was identified as the peptide bond between Asp258 and Ile259. Native pigeon liver malic enzyme was blocked at the N-terminus. Cleavage at the putative metal-binding site exposed a new N-terminus, which was identified to be at the 34-kDa fragment containing the C-terminal half of original sequence 259-557. Our results indicated that Fe2+ catalyzed a specific oxidation of pigeon liver malic enzyme at Asp258 and/or some other essential amino acid residues that caused enzyme inactivation. The modified enzyme was then affinity cleaved at the Mn(2+)-binding site.

Ras-dva Is a Novel Pit-1- and Glucocorticoid-Regulated Gene in the Embryonic Anterior Pituitary Gland

PubMed Central

Ellestad, Laura E.

2013-01-01

Glucocorticoids play a role in functional differentiation of pituitary somatotrophs and lactotrophs during embryogenesis. Ras-dva was identified as a gene regulated by anterior neural fold protein-1/homeobox expressed in embryonic stem cells-1, a transcription factor known to be critical in pituitary development, and has an expression profile in the chicken embryonic pituitary gland that is consistent with in vivo regulation by glucocorticoids. The objective of this study was to characterize expression and regulation of ras-dva mRNA in the developing chicken anterior pituitary. Pituitary ras-dva mRNA levels increased during embryogenesis to a maximum on embryonic day (e) 18 and then decreased and remained low or undetectable after hatch. Ras-dva expression was highly enriched in the pituitary gland on e18 relative to other tissues examined. Glucocorticoid treatment of pituitary cells from mid- and late-stage embryos rapidly increased ras-dva mRNA, suggesting it may be a direct transcriptional target of glucocorticoids. A reporter construct driven by 4 kb of the chicken ras-dva 5′-flanking region, containing six putative pituitary-specific transcription factor-1 (Pit-1) binding sites and two potential glucocorticoid receptor (GR) binding sites, was highly activated in embryonic pituitary cells and up-regulated by corticosterone. Mutagenesis of the most proximal Pit-1 site decreased promoter activity in chicken e11 pituitary cells, indicating regulation of ras-dva by Pit-1. However, mutating putative GR binding sites did not substantially reduce induction of ras-dva promoter activity by corticosterone, suggesting additional DNA elements within the 5′-flanking region are responsible for glucocorticoid regulation. We have identified ras-dva as a glucocorticoid-regulated gene that is likely expressed in cells of the Pit-1 lineage within the developing anterior pituitary gland. PMID:23161868

Ras-dva is a novel Pit-1- and glucocorticoid-regulated gene in the embryonic anterior pituitary gland.

PubMed

Ellestad, Laura E; Porter, Tom E

2013-01-01

Glucocorticoids play a role in functional differentiation of pituitary somatotrophs and lactotrophs during embryogenesis. Ras-dva was identified as a gene regulated by anterior neural fold protein-1/homeobox expressed in embryonic stem cells-1, a transcription factor known to be critical in pituitary development, and has an expression profile in the chicken embryonic pituitary gland that is consistent with in vivo regulation by glucocorticoids. The objective of this study was to characterize expression and regulation of ras-dva mRNA in the developing chicken anterior pituitary. Pituitary ras-dva mRNA levels increased during embryogenesis to a maximum on embryonic day (e) 18 and then decreased and remained low or undetectable after hatch. Ras-dva expression was highly enriched in the pituitary gland on e18 relative to other tissues examined. Glucocorticoid treatment of pituitary cells from mid- and late-stage embryos rapidly increased ras-dva mRNA, suggesting it may be a direct transcriptional target of glucocorticoids. A reporter construct driven by 4 kb of the chicken ras-dva 5'-flanking region, containing six putative pituitary-specific transcription factor-1 (Pit-1) binding sites and two potential glucocorticoid receptor (GR) binding sites, was highly activated in embryonic pituitary cells and up-regulated by corticosterone. Mutagenesis of the most proximal Pit-1 site decreased promoter activity in chicken e11 pituitary cells, indicating regulation of ras-dva by Pit-1. However, mutating putative GR binding sites did not substantially reduce induction of ras-dva promoter activity by corticosterone, suggesting additional DNA elements within the 5'-flanking region are responsible for glucocorticoid regulation. We have identified ras-dva as a glucocorticoid-regulated gene that is likely expressed in cells of the Pit-1 lineage within the developing anterior pituitary gland.

Atomic and Molecular Adsorption on Cu(111)

DOE PAGES

Xu, Lang; Lin, Joshua; Bai, Yunhai; ...

2018-05-15

Here, due to the wide use of copper-based catalysts in industrial chemical processes, fundamental understanding of the interactions between copper surfaces and various reaction intermediates is highly desired. Here, we performed periodic, self-consistent density functional theory (DFT-GGA) calculations to study the adsorption of five atomic species (H, C, N, O, and S), seven molecular species (NH 3, CH 4, N 2, CO, HCN, NO, and HCOOH), and 13 molecular fragments (CH, CH 2, CH 3, NH, NH 2, OH, CN, COH, HCO, COOH, HCOO, NOH, and HNO) on the Cu(111) surface at a coverage of 0.25 monolayer. The preferred bindingmore » site, binding energy, and the corresponding surface deformation energy of each species were determined, as well as the estimated diffusion barrier and diffusion pathway. The binding strengths calculated using the PW91 functional decreased in the following order: CH > C > O > S > CN > NH > N > CH 2 > OH > HCOO > COH > H > NH 2 > NOH > COOH > HNO > HCO > CH 3 > NO > CO > NH 3 > HCOOH. No stable binding structures were observed for N 2, HCN, and CH 4. The adsorbate–surface and intramolecular vibrational modes of all the adsorbates at their preferred binding sites were deternined. Using the calculated adsorption energetics, potential energy surfaces were constructed for the direct decomposition of CO, CO 2, NO, N 2, NH 3, and CH 4 and the hydrogen-assisted decomposition of CO, CO 2, and NO.« less

Atomic and Molecular Adsorption on Cu(111)

DOE Office of Scientific and Technical Information (OSTI.GOV)

Xu, Lang; Lin, Joshua; Bai, Yunhai

Here, due to the wide use of copper-based catalysts in industrial chemical processes, fundamental understanding of the interactions between copper surfaces and various reaction intermediates is highly desired. Here, we performed periodic, self-consistent density functional theory (DFT-GGA) calculations to study the adsorption of five atomic species (H, C, N, O, and S), seven molecular species (NH 3, CH 4, N 2, CO, HCN, NO, and HCOOH), and 13 molecular fragments (CH, CH 2, CH 3, NH, NH 2, OH, CN, COH, HCO, COOH, HCOO, NOH, and HNO) on the Cu(111) surface at a coverage of 0.25 monolayer. The preferred bindingmore » site, binding energy, and the corresponding surface deformation energy of each species were determined, as well as the estimated diffusion barrier and diffusion pathway. The binding strengths calculated using the PW91 functional decreased in the following order: CH > C > O > S > CN > NH > N > CH 2 > OH > HCOO > COH > H > NH 2 > NOH > COOH > HNO > HCO > CH 3 > NO > CO > NH 3 > HCOOH. No stable binding structures were observed for N 2, HCN, and CH 4. The adsorbate–surface and intramolecular vibrational modes of all the adsorbates at their preferred binding sites were deternined. Using the calculated adsorption energetics, potential energy surfaces were constructed for the direct decomposition of CO, CO 2, NO, N 2, NH 3, and CH 4 and the hydrogen-assisted decomposition of CO, CO 2, and NO.« less

Structural insights into xenobiotic and inhibitor binding to human aldehyde oxidase.

PubMed

Coelho, Catarina; Foti, Alessandro; Hartmann, Tobias; Santos-Silva, Teresa; Leimkühler, Silke; Romão, Maria João

2015-10-01

Aldehyde oxidase (AOX) is a xanthine oxidase (XO)-related enzyme with emerging importance due to its role in the metabolism of drugs and xenobiotics. We report the first crystal structures of human AOX1, substrate free (2.6-Å resolution) and in complex with the substrate phthalazine and the inhibitor thioridazine (2.7-Å resolution). Analysis of the protein active site combined with steady-state kinetic studies highlight the unique features, including binding and substrate orientation at the active site, that characterize human AOX1 as an important drug-metabolizing enzyme. Structural analysis of the complex with the noncompetitive inhibitor thioridazine revealed a new, unexpected and fully occupied inhibitor-binding site that is structurally conserved among mammalian AOXs and XO. The new structural insights into the catalytic and inhibition mechanisms of human AOX that we now report will be of great value for the rational analysis of clinical drug interactions involving inhibition of AOX1 and for the prediction and design of AOX-stable putative drugs.

Regulation of E2s: A Role for Additional Ubiquitin Binding Sites?

PubMed

Middleton, Adam J; Wright, Joshua D; Day, Catherine L

2017-11-10

Attachment of ubiquitin to proteins relies on a sophisticated enzyme cascade that is tightly regulated. The machinery of ubiquitylation responds to a range of signals, which remarkably includes ubiquitin itself. Thus, ubiquitin is not only the central player in the ubiquitylation cascade but also a key regulator. The ubiquitin E3 ligases provide specificity to the cascade and often bind the substrate, while the ubiquitin-conjugating enzymes (E2s) have a pivotal role in determining chain linkage and length. Interaction of ubiquitin with the E2 is important for activity, but the weak nature of these contacts has made them hard to identify and study. By reviewing available crystal structures, we identify putative ubiquitin binding sites on E2s, which may enhance E2 processivity and the assembly of chains of a defined linkage. The implications of these new sites are discussed in the context of known E2-ubiquitin interactions. Copyright © 2017 Elsevier Ltd. All rights reserved.

Structural Basis for Xenon Inhibition in a Cationic Pentameric Ligand-Gated Ion Channel

PubMed Central

Sauguet, Ludovic; Fourati, Zeineb; Prangé, Thierry; Delarue, Marc; Colloc'h, Nathalie

2016-01-01

GLIC receptor is a bacterial pentameric ligand-gated ion channel whose action is inhibited by xenon. Xenon has been used in clinical practice as a potent gaseous anaesthetic for decades, but the molecular mechanism of interactions with its integral membrane receptor targets remains poorly understood. Here we characterize by X-ray crystallography the xenon-binding sites within both the open and “locally-closed” (inactive) conformations of GLIC. Major binding sites of xenon, which differ between the two conformations, were identified in three distinct regions that all belong to the trans-membrane domain of GLIC: 1) in an intra-subunit cavity, 2) at the interface between adjacent subunits, and 3) in the pore. The pore site is unique to the locally-closed form where the binding of xenon effectively seals the channel. A putative mechanism of the inhibition of GLIC by xenon is proposed, which might be extended to other pentameric cationic ligand-gated ion channels. PMID:26910105

Structural Basis for Xenon Inhibition in a Cationic Pentameric Ligand-Gated Ion Channel.

PubMed

Sauguet, Ludovic; Fourati, Zeineb; Prangé, Thierry; Delarue, Marc; Colloc'h, Nathalie

2016-01-01

GLIC receptor is a bacterial pentameric ligand-gated ion channel whose action is inhibited by xenon. Xenon has been used in clinical practice as a potent gaseous anaesthetic for decades, but the molecular mechanism of interactions with its integral membrane receptor targets remains poorly understood. Here we characterize by X-ray crystallography the xenon-binding sites within both the open and "locally-closed" (inactive) conformations of GLIC. Major binding sites of xenon, which differ between the two conformations, were identified in three distinct regions that all belong to the trans-membrane domain of GLIC: 1) in an intra-subunit cavity, 2) at the interface between adjacent subunits, and 3) in the pore. The pore site is unique to the locally-closed form where the binding of xenon effectively seals the channel. A putative mechanism of the inhibition of GLIC by xenon is proposed, which might be extended to other pentameric cationic ligand-gated ion channels.

Highly porous non-precious bimetallic electrocatalysts for efficient hydrogen evolution

DOE PAGES

Lu, Qi; Hutchings, Gregory S.; Yu, Weiting; ...

2015-03-16

One of the key components of carbon dioxide-free hydrogen production is a robust and efficient non-precious metal catalyst for the hydrogen evolution reaction. We report that a hierarchical nanoporous copper-titanium bimetallic electrocatalyst is able to produce hydrogen from water under a mild overpotential at more than twice the rate of state-of-the- art carbon-supported platinum catalyst. Although both copper and titanium are known to be poor hydrogen evolution catalysts, the combination of these two elements creates unique copper-copper-titanium hollow sites, which have a hydrogen-binding energy very similar to that of platinum, resulting in an exceptional hydrogen evolution activity. Moreover, the hierarchicalmore » porosity of the nanoporous-copper titanium catalyst also contributes to its high hydrogen evolution activity, because it provides a large-surface area for electrocatalytic hydrogen evolution, and improves the mass transport properties. Moreover, the catalyst is self-supported, eliminating the overpotential associated with the catalyst/support interface.« less

Mutations in a CCHC zinc-binding motif of the reovirus sigma 3 protein decrease its intracellular stability.

PubMed Central

Mabrouk, T; Lemay, G

1994-01-01

It has been demonstrated that the sigma 3 protein of reovirus harbors a zinc-binding domain in its amino-terminal portion. A putative zinc finger in the CCHH form is located in this domain and was considered to be a good candidate for the zinc-binding motif. We performed site-directed mutagenesis to substitute amino acids in this region and demonstrated that many of these mutants, although expressed in COS cells, were unstable compared with the wild-type protein. Further analysis revealed that zinc-binding capability, as measured by retention on a zinc chelate affinity adsorbent, correlates with stability. These studies also allowed us to identify a CCHC box as the most probable zinc-binding motif. Images PMID:8035527

Interaction of human, rat, and mouse immunoglobulin A (IgA) with Staphylococcal superantigen-like 7 (SSL7) decoy protein and leukocyte IgA receptor.

PubMed

Wines, Bruce D; Ramsland, Paul A; Trist, Halina M; Gardam, Sandra; Brink, Robert; Fraser, John D; Hogarth, P Mark

2011-09-23

Host survival depends on an effective immune system and pathogen survival on the effectiveness of immune evasion mechanisms. Staphylococcus aureus utilizes a number of molecules to modulate host immunity, including the SSL family of which SSL7 binds IgA and inhibits Fcα receptor I (FcαRI)-mediated function. Other Gram-positive bacterial pathogens produce IgA binding proteins, which, similar to SSL7, also bind the Fc at the CH2/CH3 interface (the junction between constant domains 2 and 3 of the heavy chain). The opposing activities of the host FcαRI-IgA receptor ligand pair and the pathogen decoy proteins select for host and pathogen variants, which exert stronger protection or evasion, respectively. Curiously, mouse but not rat IgA contains a putative N-linked glycosylation site in the center of this host receptor and pathogen-binding site. Here, we demonstrate that this site is glycosylated and that the effect of amino acid changes and glycosylation of the CH2/CH3 interface inhibits interaction with the pathogen IgA binding protein SSL7, while maintaining binding of pIgR, essential to the biosynthesis and transport of SIgA.

Inorganic Polyphosphate, Exopolyphosphatase, and Pho84-Like Transporters May Be Involved in Copper Resistance in Metallosphaera sedula DSM 5348T

PubMed Central

Rivero, Matías; Torres-Paris, Constanza; Muñoz, Rodrigo; Cabrera, Ricardo; Navarro, Claudio A.

2018-01-01

Polyphosphates (PolyP) are linear polymers of orthophosphate residues that have been proposed to participate in metal resistance in bacteria and archaea. In addition of having a CopA/CopB copper efflux system, the thermoacidophilic archaeon Metallosphaera sedula contains electron-dense PolyP-like granules and a putative exopolyphosphatase (PPXMsed, Msed_0891) and four presumed pho84-like phosphate transporters (Msed_0846, Msed_0866, Msed_1094, and Msed_1512) encoded in its genome. In the present report, the existence of a possible PolyP-based copper-resistance mechanism in M. sedula DSM 5348T was evaluated. M. sedula DSM 5348T accumulated high levels of phosphorous in the form of granules, and its growth was affected in the presence of 16 mM copper. PolyP levels were highly reduced after the archaeon was subjected to an 8 mM CuSO4 shift. PPXMsed was purified, and the enzyme was found to hydrolyze PolyP in vitro. Essential residues for catalysis of PPXMsed were E111 and E113 as shown by a site-directed mutagenesis of the implied residues. Furthermore, M. sedula ppx, pho84-like, and copTMA genes were upregulated upon copper exposure, as determined by qRT-PCR analysis. The results obtained support the existence of a PolyP-dependent copper-resistance system that may be of great importance in the adaptation of this thermoacidophilic archaeon to its harsh environment. PMID:29692683

Carotenoid biosynthesis in bacteria: In vitro studies of a crt/bch transcription factor from Rhodobacter capsulatus and carotenoid enzymes from Erwinia herbicola

DOE Office of Scientific and Technical Information (OSTI.GOV)

O'Brien, D.A.

1992-11-01

A putative transcription factor in Rhodobactor capsulatus which binds upstream of the crt and bch pigment biosynthesis operons and appears to play a role in the adaptation of the organism from the aerobic to the anaerobic-photosynthetic growth mode was characterized. Chapter 2 describes the identification of this factor through an in vitro mobility shift assay, as well as the determination of its binding properties and sequence specificity. Chapter 3 focuses on the isolation of this factor. Biochemistry of later carotenoid biosynthesis enzymes derived from the non-photosynthetic bacterium, Erwinia herbicola. Chapter 4 describes the separate overexpression and in vitro analysis ofmore » two enzymes involved in the main sequence of the carotenoid biosynthesis pathway, lycopene cyclase and 5-carotene hydroxylase. Chapter 5 examines the overexpression and enzymology of functionally active zeaxanthin glucosyltransferase, an enzyme which carries out a more unusual transformation, converting a carotenoid into its more hydrophilic mono- and diglucoside derivatives. In addition, amino acid homology with other glucosyltransferases suggests a putative binding site for the UDP-activated glucose substrate.« less

Structural effects of Cu(II)-coordination in the octapeptide region of the human prion protein.

PubMed

Riihimäki, Eva-Stina; Martínez, José Manuel; Kloo, Lars

2008-05-14

The copper-binding ability of the prion protein is thought to be central to its function. The structural effects of copper coordination in the octapeptide region of the human prion protein have been investigated by molecular dynamics simulations. Simulations were performed with the apo state, in order to investigate the behavior of the region without copper ions, as well as with the octapeptide region in the presence of copper ions. While the structure of the apo state is greatly influenced by the interaction between the rings in the histidine, tryptophan and proline residues, the region shows evidence of highly ordered coordination sites in the presence of copper ions. The position of the tryptophan indole ring is stabilized by cation-pi interactions. Two stable orientations of the indole ring with respect to the equatorial coordination plane of copper were observed, which showed that the indole ring can reside on both sides of the coordination plane. The interaction with the indole ring was found to occur without a mediating axial water molecule.

Structural motif screening reveals a novel, conserved carbohydrate-binding surface in the pathogenesis-related protein PR-5d.

PubMed

Doxey, Andrew C; Cheng, Zhenyu; Moffatt, Barbara A; McConkey, Brendan J

2010-08-03

Aromatic amino acids play a critical role in protein-glycan interactions. Clusters of surface aromatic residues and their features may therefore be useful in distinguishing glycan-binding sites as well as predicting novel glycan-binding proteins. In this work, a structural bioinformatics approach was used to screen the Protein Data Bank (PDB) for coplanar aromatic motifs similar to those found in known glycan-binding proteins. The proteins identified in the screen were significantly associated with carbohydrate-related functions according to gene ontology (GO) enrichment analysis, and predicted motifs were found frequently within novel folds and glycan-binding sites not included in the training set. In addition to numerous binding sites predicted in structural genomics proteins of unknown function, one novel prediction was a surface motif (W34/W36/W192) in the tobacco pathogenesis-related protein, PR-5d. Phylogenetic analysis revealed that the surface motif is exclusive to a subfamily of PR-5 proteins from the Solanaceae family of plants, and is absent completely in more distant homologs. To confirm PR-5d's insoluble-polysaccharide binding activity, a cellulose-pulldown assay of tobacco proteins was performed and PR-5d was identified in the cellulose-binding fraction by mass spectrometry. Based on the combined results, we propose that the putative binding site in PR-5d may be an evolutionary adaptation of Solanaceae plants including potato, tomato, and tobacco, towards defense against cellulose-containing pathogens such as species of the deadly oomycete genus, Phytophthora. More generally, the results demonstrate that coplanar aromatic clusters on protein surfaces are a structural signature of glycan-binding proteins, and can be used to computationally predict novel glycan-binding proteins from 3 D structure.

Polymorphisms A387P in thrombospondin-4 and N700S in thrombospondin-1 perturb calcium binding sites.

PubMed

Stenina, Olga I; Ustinov, Valentin; Krukovets, Irene; Marinic, Tina; Topol, Eric J; Plow, Edward F

2005-11-01

Recent genetic studies have associated members of the thrombospondin (TSP) gene family with premature cardiovascular disease. The disease-associated polymorphisms lead to single amino acid changes in TSP-4 (A387P) and TSP-1 (N700S). These substitutions reside in adjacent domains of these highly homologous proteins. Secondary structural predictive programs and the homology of the domains harboring these amino acid substitutions to those in other proteins pointed to potential alterations of putative Ca2+ binding sites that reside in close proximity to the polymorphic amino acids. Since Ca2+ binding is critical for the structure and function of TSP family members, direct evidence for differences in Ca2+ binding by the polymorphic forms was sought. Using synthetic peptides and purified recombinant variant fragments bearing the amino acid substitutions, we measured differences in Tb3+ luminescence as an index of Ca2+ binding. The Tb3+ binding constants placed the TSP-1 region affected by N700S polymorphism among other high-affinity Ca2+ binding sites. The affinity of Ca2+ binding was lower for peptides (3.5-fold) and recombinant fragments (10-fold) containing the S700 vs. the N700 form. In TSP-4, the P387 form acquired an additional Ca2+ binding site absent in the A387 form. The results of our study suggest that both substitutions (A387P in TSP-4 and N700S in TSP-1) alter Ca2+ binding properties. Since these substitutions exert the opposite effects on Ca2+ binding, a decrease in TSP-1 and an increase in TSP-4, the two TSP variants are likely to influence cardiovascular functions in distinct but yet pathogenic ways.

Transition-metal prion protein attachment: Competition with copper

NASA Astrophysics Data System (ADS)

Hodak, Miroslav; Bernholc, Jerry

2012-02-01

Prion protein, PrP, is a protein capable of binding copper ions in multiple modes depending on their concentration. Misfolded PrP is implicated in a group of neurodegenerative diseases, which include ``mad cow disease'' and its human form, variant Creutzfeld-Jacob disease. An increasing amount of evidence suggests that attachment of non-copper metal ions to PrP triggers transformations to abnormal forms similar to those observed in prion diseases. In this work, we use hybrid Kohn-Sham/orbital-free density functional theory simulations to investigate copper replacement by other transition metals that bind to PrP, including zinc, iron and manganese. We consider all known copper binding modes in the N-terminal domain of PrP. Our calculations identify modes most susceptible to copper replacement and reveal metals that can successfully compete with copper for attachment to PrP.

Carbon repression of cellobiose dehydrogenase production in the white rot fungus Trametes versicolor is mediated at the level of gene transcription.

PubMed

Stapleton, P C; Dobson, A D W

2003-04-25

Cellobiose dehydrogenase (CDH) production in Trametes versicolor is induced in the presence of cellulose, but decreases when additional carbon sources such as glucose and maltose are added to the fungal cultures. Using T. versicolor-specific cdh primers in a reverse transcription-polymerase chain reaction-based approach, it appears that this repression in CDH production is being mediated at the level of gene transcription. When a 1.6-kb upstream region of the T. versicolor cdh gene was cloned and sequenced, a number of putative CreA-like binding sites were observed. We propose that these sites may be involved in mediating this repressive effect, based on their similarity to the consensus [5'-SYGGRGG-3'] site for binding of the CreA and Cre1 repressor proteins.

Characterization and copper binding properties of human COMMD1 (MURR1).

PubMed

Narindrasorasak, Suree; Kulkarni, Prasad; Deschamps, Patrick; She, Yi-Min; Sarkar, Bibudhendra

2007-03-20

COMMD1 (copper metabolism gene MURR1 (mouse U2af1-rs1 region1) domain) belongs to a family of multifunctional proteins that inhibit nuclear factor NF-kappaB. COMMD1 was implicated as a regulator of copper metabolism by the discovery that a deletion of exon 2 of COMMD1 causes copper toxicosis in Bedlington terriers. Here, we report the detailed characterization and specific copper binding properties of purified recombinant human COMMD1 as well as that of the exon 2 product, COMMD(61-154). By using various techniques including native-PAGE, EPR, UV-visible electronic absorption, intrinsic fluorescence spectroscopies as well as DEPC modification of histidines, we demonstrate that COMMD1 specifically binds copper as Cu(II) in 1:1 stoichiometry and does not bind other divalent metals. Moreover, the exon 2 product, COMMD(61-154), alone was able to bind Cu(II) as well as the wild type protein, with a stoichiometry of 1 mol of Cu(II) per protein monomer. The protection of DEPC modification of COMMD1 by Cu(II) implied that Cu(II) binding involves His residues. Further investigation by DEPC modification of COMMD(61-154) and subsequent MALDI MS mapping and MS/MS sequencing identified the protection of His101 and His134 residues in the presence of Cu(II). Fluorescence studies of single point mutants of the full-length protein revealed the involvement of M110 in addition to H134 in direct Cu(II) binding. Taken together, the data provide insight into the function of COMMD1 and especially COMMD(61-154), a product of exon 2 that is deleted in terriers affected by copper toxicosis, as a regulator of copper homeostasis.

A membrane-embedded pathway delivers general anesthetics to two interacting binding sites in the Gloeobacter violaceus ion channel.

PubMed

Arcario, Mark J; Mayne, Christopher G; Tajkhorshid, Emad

2017-06-09

General anesthetics exert their effects on the central nervous system by acting on ion channels, most notably pentameric ligand-gated ion channels. Although numerous studies have focused on pentameric ligand-gated ion channels, the details of anesthetic binding and channel modulation are still debated. A better understanding of the anesthetic mechanism of action is necessary for the development of safer and more efficacious drugs. Herein, we present a computational study identifying two anesthetic binding sites in the transmembrane domain of the Gloeobacter violaceus ligand-gated ion channel (GLIC) channel, characterize the putative binding pathway, and observe structural changes associated with channel function. Molecular simulations of desflurane reveal a binding pathway to GLIC via a membrane-embedded tunnel using an intrasubunit protein lumen as the conduit, an observation that explains the Meyer-Overton hypothesis, or why the lipophilicity of an anesthetic and its potency are generally proportional. Moreover, employing high concentrations of ligand led to the identification of a second transmembrane site (TM2) that inhibits dissociation of anesthetic from the TM1 site and is consistent with the high concentrations of anesthetics required to achieve clinical effects. Finally, asymmetric binding patterns of anesthetic to the channel were found to promote an iris-like conformational change that constricts and dehydrates the ion pore, creating a 13.5 kcal/mol barrier to ion translocation. Together with previous studies, the simulations presented herein demonstrate a novel anesthetic binding site in GLIC that is accessed through a membrane-embedded tunnel and interacts with a previously known site, resulting in conformational changes that produce a non-conductive state of the channel. © 2017 by The American Society for Biochemistry and Molecular Biology, Inc.

Structural investigation of C4b-binding protein by molecular modeling: localization of putative binding sites.

PubMed

Villoutreix, B O; Härdig, Y; Wallqvist, A; Covell, D G; García de Frutos, P; Dahlbäck, B

1998-06-01

C4b-binding protein (C4BP) contributes to the regulation of the classical pathway of the complement system and plays an important role in blood coagulation. The main human C4BP isoform is composed of one beta-chain and seven alpha-chains essentially built from three and eight complement control protein (CCP) modules, respectively, followed by a nonrepeat carboxy-terminal region involved in polymerization of the chains. C4BP is known to interact with heparin, C4b, complement factor I, serum amyloid P component, streptococcal Arp and Sir proteins, and factor VIII/VIIIa via its alpha-chains and with protein S through its beta-chain. The principal aim of the present study was to localize regions of C4BP involved in the interaction with C4b, Arp, and heparin. For this purpose, a computer model of the 8 CCP modules of C4BP alpha-chain was constructed, taking into account data from previous electron microscopy (EM) studies. This structure was investigated in the context of known and/or new experimental data. Analysis of the alpha-chain model, together with monoclonal antibody studies and heparin binding experiments, suggests that a patch of positively charged residues, at the interface between the first and second CCP modules, plays an important role in the interaction between C4BP and C4b/Arp/Sir/heparin. Putative binding sites, secondary-structure prediction for the central core, and an overall reevaluation of the size of the C4BP molecule are also presented. An understanding of these intermolecular interactions should contribute to the rational design of potential therapeutic agents aiming at interfering specifically some of these protein-protein interactions.

Zuotin, a putative Z-DNA binding protein in Saccharomyces cerevisiae

NASA Technical Reports Server (NTRS)

Zhang, S.; Lockshin, C.; Herbert, A.; Winter, E.; Rich, A.

1992-01-01

A putative Z-DNA binding protein, named zuotin, was purified from a yeast nuclear extract by means of a Z-DNA binding assay using [32P]poly(dG-m5dC) and [32P]oligo(dG-Br5dC)22 in the presence of B-DNA competitor. Poly(dG-Br5dC) in the Z-form competed well for the binding of a zuotin containing fraction, but salmon sperm DNA, poly(dG-dC) and poly(dA-dT) were not effective. Negatively supercoiled plasmid pUC19 did not compete, whereas an otherwise identical plasmid pUC19(CG), which contained a (dG-dC)7 segment in the Z-form was an excellent competitor. A Southwestern blot using [32P]poly(dG-m5dC) as a probe in the presence of MgCl2 identified a protein having a molecular weight of 51 kDa. The 51 kDa zuotin was partially sequenced at the N-terminal and the gene, ZUO1, was cloned, sequenced and expressed in Escherichia coli; the expressed zuotin showed similar Z-DNA binding activity, but with lower affinity than zuotin that had been partially purified from yeast. Zuotin was deduced to have a number of potential phosphorylation sites including two CDC28 (homologous to the human and Schizosaccharomyces pombe cdc2) phosphorylation sites. The hexapeptide motif KYHPDK was found in zuotin as well as in several yeast proteins, DnaJ of E.coli, csp29 and csp32 proteins of Drosophila and the small t and large T antigens of the polyoma virus. A 60 amino acid segment of zuotin has similarity to several histone H1 sequences. Disruption of ZUO1 in yeast resulted in a slow growth phenotype.

Copper Tolerance and Characterization of a Copper-Responsive Operon, copYAZ, in an M1T1 Clinical Strain of Streptococcus pyogenes

PubMed Central

Gordon, Lily D.; Fang, Zhong; Holder, Robert C.; Reid, Sean D.

2015-01-01

ABSTRACT Infection with Streptococcus pyogenes is associated with a breadth of clinical manifestations ranging from mild pharyngitis to severe necrotizing fasciitis. Elevated levels of intracellular copper are highly toxic to this bacterium, and thus, the microbe must tightly regulate the level of this metal ion by one or more mechanisms, which have, to date, not been clearly defined. In this study, we have identified two virulence mechanisms by which S. pyogenes protects itself against copper toxicity. We defined a set of putative genes, copY (for a regulator), copA (for a P1-type ATPase), and copZ (for a copper chaperone), whose expression is regulated by copper. Our results indicate that these genes are highly conserved among a range of clinical S. pyogenes isolates. The copY, copA, and copZ genes are induced by copper and are transcribed as a single unit. Heterologous expression assays revealed that S. pyogenes CopA can confer copper tolerance in a copper-sensitive Escherichia coli mutant by preventing the accumulation of toxic levels of copper, a finding that is consistent with a role for CopA in copper export. Evaluation of the effect of copper stress on S. pyogenes in a planktonic or biofilm state revealed that biofilms may aid in protection during initial exposure to copper. However, copper stress appears to prevent the shift from the planktonic to the biofilm state. Therefore, our results indicate that S. pyogenes may use several virulence mechanisms, including altered gene expression and a transition to and from planktonic and biofilm states, to promote survival during copper stress. IMPORTANCE Bacterial pathogens encounter multiple stressors at the host-pathogen interface. This study evaluates a virulence mechanism(s) utilized by S. pyogenes to combat copper at sites of infection. A better understanding of pathogen tolerance to stressors such as copper is necessary to determine how host-pathogen interactions impact bacterial survival during infections. These insights may lead to the identification of novel therapeutic targets that can be used to address antibiotic resistance. PMID:26013489

Copper Tolerance and Characterization of a Copper-Responsive Operon, copYAZ, in an M1T1 Clinical Strain of Streptococcus pyogenes.

PubMed

Young, Christie A; Gordon, Lily D; Fang, Zhong; Holder, Robert C; Reid, Sean D

2015-08-01

Infection with Streptococcus pyogenes is associated with a breadth of clinical manifestations ranging from mild pharyngitis to severe necrotizing fasciitis. Elevated levels of intracellular copper are highly toxic to this bacterium, and thus, the microbe must tightly regulate the level of this metal ion by one or more mechanisms, which have, to date, not been clearly defined. In this study, we have identified two virulence mechanisms by which S. pyogenes protects itself against copper toxicity. We defined a set of putative genes, copY (for a regulator), copA (for a P1-type ATPase), and copZ (for a copper chaperone), whose expression is regulated by copper. Our results indicate that these genes are highly conserved among a range of clinical S. pyogenes isolates. The copY, copA, and copZ genes are induced by copper and are transcribed as a single unit. Heterologous expression assays revealed that S. pyogenes CopA can confer copper tolerance in a copper-sensitive Escherichia coli mutant by preventing the accumulation of toxic levels of copper, a finding that is consistent with a role for CopA in copper export. Evaluation of the effect of copper stress on S. pyogenes in a planktonic or biofilm state revealed that biofilms may aid in protection during initial exposure to copper. However, copper stress appears to prevent the shift from the planktonic to the biofilm state. Therefore, our results indicate that S. pyogenes may use several virulence mechanisms, including altered gene expression and a transition to and from planktonic and biofilm states, to promote survival during copper stress. Bacterial pathogens encounter multiple stressors at the host-pathogen interface. This study evaluates a virulence mechanism(s) utilized by S. pyogenes to combat copper at sites of infection. A better understanding of pathogen tolerance to stressors such as copper is necessary to determine how host-pathogen interactions impact bacterial survival during infections. These insights may lead to the identification of novel therapeutic targets that can be used to address antibiotic resistance. Copyright © 2015, American Society for Microbiology. All Rights Reserved.

Crystal structures of two novel dye-decolorizing peroxidases reveal a beta-barrel fold with a conserved heme-binding motif.

PubMed

Zubieta, Chloe; Krishna, S Sri; Kapoor, Mili; Kozbial, Piotr; McMullan, Daniel; Axelrod, Herbert L; Miller, Mitchell D; Abdubek, Polat; Ambing, Eileen; Astakhova, Tamara; Carlton, Dennis; Chiu, Hsiu-Ju; Clayton, Thomas; Deller, Marc C; Duan, Lian; Elsliger, Marc-André; Feuerhelm, Julie; Grzechnik, Slawomir K; Hale, Joanna; Hampton, Eric; Han, Gye Won; Jaroszewski, Lukasz; Jin, Kevin K; Klock, Heath E; Knuth, Mark W; Kumar, Abhinav; Marciano, David; Morse, Andrew T; Nigoghossian, Edward; Okach, Linda; Oommachen, Silvya; Reyes, Ron; Rife, Christopher L; Schimmel, Paul; van den Bedem, Henry; Weekes, Dana; White, Aprilfawn; Xu, Qingping; Hodgson, Keith O; Wooley, John; Deacon, Ashley M; Godzik, Adam; Lesley, Scott A; Wilson, Ian A

2007-11-01

BtDyP from Bacteroides thetaiotaomicron (strain VPI-5482) and TyrA from Shewanella oneidensis are dye-decolorizing peroxidases (DyPs), members of a new family of heme-dependent peroxidases recently identified in fungi and bacteria. Here, we report the crystal structures of BtDyP and TyrA at 1.6 and 2.7 A, respectively. BtDyP assembles into a hexamer, while TyrA assembles into a dimer; the dimerization interface is conserved between the two proteins. Each monomer exhibits a two-domain, alpha+beta ferredoxin-like fold. A site for heme binding was identified computationally, and modeling of a heme into the proposed active site allowed for identification of residues likely to be functionally important. Structural and sequence comparisons with other DyPs demonstrate a conservation of putative heme-binding residues, including an absolutely conserved histidine. Isothermal titration calorimetry experiments confirm heme binding, but with a stoichiometry of 0.3:1 (heme:protein). (c) 2007 Wiley-Liss, Inc.

Crystal structure of Anoxybacillus α-amylase provides insights into maltose binding of a new glycosyl hydrolase subclass

PubMed Central

Chai, Kian Piaw; Othman, Noor Farhan Binti; Teh, Aik-Hong; Ho, Kok Lian; Chan, Kok-Gan; Shamsir, Mohd Shahir; Goh, Kian Mau; Ng, Chyan Leong

2016-01-01

A new subfamily of glycosyl hydrolase family GH13 was recently proposed for α-amylases from Anoxybacillus species (ASKA and ADTA), Geobacillus thermoleovorans (GTA, Pizzo, and GtamyII), Bacillus aquimaris (BaqA), and 95 other putative protein homologues. To understand this new GH13 subfamily, we report crystal structures of truncated ASKA (TASKA). ASKA is a thermostable enzyme capable of producing high levels of maltose. Unlike GTA, biochemical analysis showed that Ca2+ ion supplementation enhances the catalytic activities of ASKA and TASKA. The crystal structures reveal the presence of four Ca2+ ion binding sites, with three of these binding sites are highly conserved among Anoxybacillus α-amylases. This work provides structural insights into this new GH13 subfamily both in the apo form and in complex with maltose. Furthermore, structural comparison of TASKA and GTA provides an overview of the conformational changes accompanying maltose binding at each subsite. PMID:26975884

Functional characterization of the copper transcription factor AfMac1 from Aspergillus fumigatus.

PubMed

Park, Yong-Sung; Kim, Tae-Hyoung; Yun, Cheol-Won

2017-07-03

Although copper functions as a cofactor in many physiological processes, copper overload leads to harmful effects in living cells. Thus, copper homeostasis is tightly regulated. However, detailed copper metabolic pathways have not yet been identified in filamentous fungi. In this report, we investigated the copper transcription factor AfMac1 ( A spergillus f umigatus Mac1 homolog) and identified its regulatory mechanism in A. fumigatus AfMac1 has domains homologous to the DNA-binding and copper-binding domains of Mac1 from Saccharomyces cerevisiae , and AfMac1 efficiently complemented Mac1 in S. cerevisiae Expression of Afmac1 resulted in CTR1 up-regulation, and mutation of the DNA-binding domain of Afmac1 failed to activate CTR1 expression in S. cerevisiae The Afmac1 deletion strain of A. fumigatus failed to grow in copper-limited media, and its growth was restored by introducing ctrC We found that AfMac1 specifically bound to the promoter region of ctrC based on EMSA. The AfMac1-binding motif 5'-TGTGCTCA-3' was identified from the promoter region of ctrC , and the addition of mutant ctrC lacking the AfMac1-binding motif failed to up-regulate ctrC in A. fumigatus Furthermore, deletion of Afmac1 significantly reduced strain virulence and activated conidial killing activity by neutrophils and macrophages. Taken together, these results suggest that AfMac1 is a copper transcription factor that regulates cellular copper homeostasis in A. fumigatus . © 2017 The Author(s); published by Portland Press Limited on behalf of the Biochemical Society.

Mutagenesis of the C2 domain of protein kinase C-alpha. Differential roles of Ca2+ ligands and membrane binding residues.

PubMed

Medkova, M; Cho, W

1998-07-10

The C2 domains of conventional protein kinase C (PKC) have been implicated in their Ca2+-dependent membrane binding. The C2 domain of PKC-alpha contains several Ca2+ ligands that bind multiple Ca2+ ions and other putative membrane binding residues. To understand the roles of individual Ca2+ ligands and protein-bound Ca2+ ions in the membrane binding and activation of PKC-alpha, we mutated five putative Ca2+ ligands (D187N, D193N, D246N, D248N, and D254N) and measured the effects of mutations on vesicle binding, enzyme activity, and monolayer penetration of PKC-alpha. Altered properties of these mutants indicate that individual Ca2+ ions and their ligands have different roles in the membrane binding and activation of PKC-alpha. The binding of Ca2+ to Asp187, Asp193, and Asp246 of PKC-alpha is important for the initial binding of protein to membrane surfaces. On the other hand, the binding of another Ca2+ to Asp187, Asp246, Asp248, and Asp254 induces the conformational change of PKC-alpha, which in turn triggers its membrane penetration and activation. Among these Ca2+ ligands, Asp246 was shown to be most essential for both membrane binding and activation of PKC-alpha, presumably due to its coordination to multiple Ca2+ ions. Furthermore, to identify the residues in the C2 domain that are involved in membrane binding of PKC-alpha, we mutated four putative membrane binding residues (Trp245, Trp247, Arg249, and Arg252). Membrane binding and enzymatic properties of two double-site mutants (W245A/W247A and R249A/R252A) indicate that Arg249 and Arg252 are involved in electrostatic interactions of PKC-alpha with anionic membranes, whereas Trp245 and Trp247 participate in its penetration into membranes and resulting hydrophobic interactions. Taken together, these studies provide the first experimental evidence for the role of C2 domain of conventional PKC as a membrane docking unit as well as a module that triggers conformational changes to activate the protein.

Interactions of a Pop5/Rpp1 heterodimer with the catalytic domain of RNase MRP.

PubMed

Perederina, Anna; Khanova, Elena; Quan, Chao; Berezin, Igor; Esakova, Olga; Krasilnikov, Andrey S

2011-10-01

Ribonuclease (RNase) MRP is a multicomponent ribonucleoprotein complex closely related to RNase P. RNase MRP and eukaryotic RNase P share most of their protein components, as well as multiple features of their catalytic RNA moieties, but have distinct substrate specificities. While RNase P is practically universally found in all three domains of life, RNase MRP is essential in eukaryotes. The structural organizations of eukaryotic RNase P and RNase MRP are poorly understood. Here, we show that Pop5 and Rpp1, protein components found in both RNase P and RNase MRP, form a heterodimer that binds directly to the conserved area of the putative catalytic domain of RNase MRP RNA. The Pop5/Rpp1 binding site corresponds to the protein binding site in bacterial RNase P RNA. Structural and evolutionary roles of the Pop5/Rpp1 heterodimer in RNases P and MRP are discussed.

Interactions of a Pop5/Rpp1 heterodimer with the catalytic domain of RNase MRP

PubMed Central

Perederina, Anna; Khanova, Elena; Quan, Chao; Berezin, Igor; Esakova, Olga; Krasilnikov, Andrey S.

2011-01-01

Ribonuclease (RNase) MRP is a multicomponent ribonucleoprotein complex closely related to RNase P. RNase MRP and eukaryotic RNase P share most of their protein components, as well as multiple features of their catalytic RNA moieties, but have distinct substrate specificities. While RNase P is practically universally found in all three domains of life, RNase MRP is essential in eukaryotes. The structural organizations of eukaryotic RNase P and RNase MRP are poorly understood. Here, we show that Pop5 and Rpp1, protein components found in both RNase P and RNase MRP, form a heterodimer that binds directly to the conserved area of the putative catalytic domain of RNase MRP RNA. The Pop5/Rpp1 binding site corresponds to the protein binding site in bacterial RNase P RNA. Structural and evolutionary roles of the Pop5/Rpp1 heterodimer in RNases P and MRP are discussed. PMID:21878546

Propeptide cleavage conditions sortilin/neurotensin receptor-3 for ligand binding.

PubMed

Munck Petersen, C; Nielsen, M S; Jacobsen, C; Tauris, J; Jacobsen, L; Gliemann, J; Moestrup, S K; Madsen, P

1999-02-01

We recently reported the isolation and sequencing of sortilin, a new putative sorting receptor that binds receptor-associated protein (RAP). The luminal N-terminus of sortilin comprises a consensus sequence for cleavage by furin, R41WRR44, which precedes a truncation originally found in sortilin isolated from human brain. We now show that the truncation results from cellular processing. Sortilin is synthesized as a proform which, in late Golgi compartments, is converted to the mature receptor by furin-mediated cleavage of a 44 residue N-terminal propeptide. We further demonstrate that the propeptide exhibits pH-dependent high affinity binding to fully processed sortilin, that the binding is competed for by RAP and the newly discovered sortilin ligand neurotensin, and that prevention of propeptide cleavage essentially prevents binding of RAP and neurotensin. The findings evidence that the propeptide sterically hinders ligands from gaining access to overlapping binding sites in prosortilin, and that cleavage and release of the propeptide preconditions sortilin for full functional activity. Although proteolytic processing is involved in the maturation of several receptors, the described exposure of previously concealed ligand-binding sites after furin-mediated cleavage of propeptide represents a novel mechanism in receptor activation.

Propeptide cleavage conditions sortilin/neurotensin receptor-3 for ligand binding.

PubMed Central

Munck Petersen, C; Nielsen, M S; Jacobsen, C; Tauris, J; Jacobsen, L; Gliemann, J; Moestrup, S K; Madsen, P

1999-01-01

We recently reported the isolation and sequencing of sortilin, a new putative sorting receptor that binds receptor-associated protein (RAP). The luminal N-terminus of sortilin comprises a consensus sequence for cleavage by furin, R41WRR44, which precedes a truncation originally found in sortilin isolated from human brain. We now show that the truncation results from cellular processing. Sortilin is synthesized as a proform which, in late Golgi compartments, is converted to the mature receptor by furin-mediated cleavage of a 44 residue N-terminal propeptide. We further demonstrate that the propeptide exhibits pH-dependent high affinity binding to fully processed sortilin, that the binding is competed for by RAP and the newly discovered sortilin ligand neurotensin, and that prevention of propeptide cleavage essentially prevents binding of RAP and neurotensin. The findings evidence that the propeptide sterically hinders ligands from gaining access to overlapping binding sites in prosortilin, and that cleavage and release of the propeptide preconditions sortilin for full functional activity. Although proteolytic processing is involved in the maturation of several receptors, the described exposure of previously concealed ligand-binding sites after furin-mediated cleavage of propeptide represents a novel mechanism in receptor activation. PMID:9927419

The Serum Response Factor and a Putative Novel Transcription Factor Regulate Expression of the Immediate-Early Gene Arc/Arg3.1 in Cultured Cortical Neurons

PubMed Central

Pintchovski, Sean A.; Peebles, Carol L.; Kim, Hong Joo; Verdin, Eric; Finkbeiner, Steven

2010-01-01

The immediate-early effector gene Arc/Arg3.1 is robustly upregulated by synaptic activity associated with learning and memory. Here we show in primary cortical neuron culture that diverse stimuli induce Arc expression through new transcription. Searching for regulatory regions important for Arc transcription, we found nine DNaseI-sensitive nucleosome-depleted sites at this genomic locus. A reporter gene encompassing these sites responded to synaptic activity in an NMDA receptor–dependent manner, consistent with endogenous Arc mRNA. Responsiveness mapped to two enhancer regions ∼6.5 kb and ∼1.4 kb upstream of Arc. We dissected these regions further and found that the proximal enhancer contains a functional and conserved “Zeste-like” response element that binds a putative novel nuclear protein in neurons. Therefore, activity regulates Arc transcription partly by a novel signaling pathway. We also found that the distal enhancer has a functional and highly conserved serum response element. This element binds serum response factor, which is recruited by synaptic activity to regulate Arc. Thus, Arc is the first target of serum response factor that functions at synapses to mediate plasticity. PMID:19193899

Cloning and characterization of largemouth bass ( Micropterus salmoides) myostatin encoding gene and its promoter

NASA Astrophysics Data System (ADS)

Li, Shengjie; Bai, Junjie; Wang, Lin

2008-08-01

Myostatin or GDF-8, a member of the transforming growth factor-β (TGF-β) superfamily, has been demonstrated to be a negative regulator of skeletal muscle mass in mammals. In the present study, we obtained a 5.64 kb sequence of myostatin encoding gene and its promoter from largemouth bass ( Micropterus salmoides). The myostatin encoding gene consisted of three exons (488 bp, 371 bp and 1779 bp, respectively) and two introns (390 bp and 855 bp, respectively). The intron-exon boundaries were conservative in comparison with those of mammalian myostatin encoding genes, whereas the size of introns was smaller than that of mammals. Sequence analysis of 1.569 kb of the largemouth bass myostatin gene promoter region revealed that it contained two TATA boxes, one CAAT box and nine putative E-boxes. Putative muscle growth response elements for myocyte enhancer factor 2 (MEF2), serum response factor (SRF), activator protein 1 (AP1), etc., and muscle-specific Mt binding site (MTBF) were also detected. Some of the transcription factor binding sites were conserved among five teleost species. This information will be useful for studying the transcriptional regulation of myostatin in fish.

The binding sites for benztropines and dopamine in the dopamine transporter overlap

PubMed Central

Bisgaard, Heidi; Larsen, M. Andreas B.; Mazier, Sonia; Beuming, Thijs; Newman, Amy Hauck; Weinstein, Harel; Shi, Lei; Loland, Claus J.; Gether, Ulrik

2013-01-01

Analogues of benztropines (BZTs) are potent inhibitors of the dopamine transporter (DAT) but are less effective than cocaine as behavioral stimulants. As a result, there have been efforts to evaluate these compounds as leads for potential medication for cocaine addiction. Here we use computational modeling together with site-directed mutagenesis to characterize the binding site for BZTs in DAT. Docking into molecular models based on the structure of the bacterial homologue LeuT supported a BZT binding site that overlaps with the substrate binding pocket. In agreement, mutations of residues within the pocket, including Val1523.46* to Ala or Ile, Ser4228.60 to Ala and Asn1573.51 to Cys or Ala, resulted in decreased affinity for BZT and the analog JHW007, as assessed in [3H]dopamine uptake inhibition assays and/or [3H]CFT competition binding assay. A putative polar interaction of one of the phenyl ring fluorine substituents in JHW007 with Asn1573.51 was used as a criterion for determining likely binding poses and establish a structural context for the mutagenesis findings. The analysis positioned the other fluorine substituted phenyl ring of JHW007 in close proximity to Ala47910.51/Ala48010.52 in transmembrane segment (TM) 10. The lack of such an interaction for BZT led to a more tilted orientation, as compared to JHW007, bringing one of the phenyl rings even closer to Ala47910.51/Ala48010.52. Mutation of Ala47910.51 and Ala48010.52 to valines supported these predictions with a larger decrease in the affinity for BZT than for JHW007. Summarized, our data suggest that BZTs display a classical competitive binding mode with binding sites overlapping those of cocaine and dopamine. PMID:20816875

The Structure of the Metal Transporter Tp34 and its Affinity for Divalent Metal Ions

NASA Astrophysics Data System (ADS)

Knutsen, Gregory; Deka, Ranjit; Brautigam, Chad; Tomchick, Diana; Machius, Mischa; Norgard, Michael

2007-10-01

Tp34 is periplasmic membrane protein of the nonculitvatable spirochete Treponema pallidum, the pathogen of syphillis. It was proposed that Tp34 is a divalent metal transporter, but the identity of the preferred metal ion(s) was unclear. In this study we investigated the ability of divalent metal ions to induce rTp34 dimerization using hydrodynamic techniques and determine the crystal structure of metal bound forms. Using analytical ultracentrifugation sedimentation velocity experiments, we determined that cobalt is superior to nickel at inducing the dimerization of rTp34. rTp34 was crystallized and selected crystals were incubated at a pH 7.5 with CuSO4 and NiSO4. Diffraction experiments were conducted and the processed electron density maps showed that copper was bound to the major metal binding site as well as to three additional minor binding sites. By contrast nickel was only bound to the major metal binding site in one monomer and to three additional minor sites. These results along with previous findings support evidence of Tp34 being involved with metal transport and/or iron utilization.

Novel biphenyl ester derivatives as tyrosinase inhibitors: Synthesis, crystallographic, spectral analysis and molecular docking studies.

PubMed

Kwong, Huey Chong; Chidan Kumar, C S; Mah, Siau Hui; Chia, Tze Shyang; Quah, Ching Kheng; Loh, Zi Han; Chandraju, Siddegowda; Lim, Gin Keat

2017-01-01

Biphenyl-based compounds are clinically important for the treatments of hypertension and inflammatory, while many more are under development for pharmaceutical uses. In the present study, a series of 2-([1,1'-biphenyl]-4-yl)-2-oxoethyl benzoates, 2(a-q), and 2-([1,1'-biphenyl]-4-yl)-2-oxoethyl pyridinecarboxylate, 2(r-s) were synthesized by reacting 1-([1,1'-biphenyl]-4-yl)-2-bromoethan-1-one with various carboxylic acids using potassium carbonate in dimethylformamide at ambient temperature. Single-crystal X-ray diffraction studies revealed a more closely packed crystal structure can be produced by introduction of biphenyl moiety. Five of the compounds among the reported series exhibited significant anti-tyrosinase activities, in which 2p, 2r and 2s displayed good inhibitions which are comparable to standard inhibitor kojic acid at concentrations of 100 and 250 μg/mL. The inhibitory effects of these active compounds were further confirmed by computational molecular docking studies and the results revealed the primary binding site is active-site entrance instead of inner copper binding site which acted as the secondary binding site.

Copper binding to soil fulvic and humic acids: NICA-Donnan modeling and conditional affinity spectra.

PubMed

Xu, Jinling; Tan, Wenfeng; Xiong, Juan; Wang, Mingxia; Fang, Linchuan; Koopal, Luuk K

2016-07-01

Binding of Cu(II) to soil fulvic acid (JGFA), soil humic acids (JGHA, JLHA), and lignite-based humic acid (PAHA) was investigated through NICA-Donnan modeling and conditional affinity spectrum (CAS). It is to extend the knowledge of copper binding by soil humic substances (HS) both in respect of enlarging the database of metal ion binding to HS and obtaining a good insight into Cu binding to the functional groups of FA and HA by using the NICA-Donnan model to unravel the intrinsic and conditional affinity spectra. Results showed that Cu binding to HS increased with increasing pH and decreasing ionic strength. The amount of Cu bound to the HAs was larger than the amount bound to JGFA. Milne's generic parameters did not provide satisfactory predictions for the present soil HS samples, while material-specific NICA-Donnan model parameters described and predicted Cu binding to the HS well. Both the 'low' and 'high' concentration fitting procedures indicated a substantial bidentate structure of the Cu complexes with HS. By means of CAS underlying NICA isotherm, which was scarcely used, the nature of the binding at different solution conditions for a given sample and the differences in binding mode were illustrated. It was indicated that carboxylic group played an indispensable role in Cu binding to HS in that the carboxylic CAS had stronger conditional affinity than the phenolic distribution due to its large degree of proton dissociation. The fact was especially true for JGFA and JLHA which contain much larger amount of carboxylic groups, and the occupation of phenolic sites by Cu was negligible. Comparable amounts of carboxylic and phenolic groups on PAHA and JGHA, increased the occupation of phenolic type sites by Cu. The binding strength of PAHA-Cu and JGHA-Cu was stronger than that of JGFA-Cu and JLHA-Cu. The presence of phenolic groups increased the chance of forming more stable complexes, such as the salicylate-Cu or catechol-Cu type structures. Copyright © 2016. Published by Elsevier Inc.

DNA/RNA binding and anticancer/antimicrobial activities of polymer-copper(II) complexes

NASA Astrophysics Data System (ADS)

Lakshmipraba, Jagadeesan; Arunachalam, Sankaralingam; Riyasdeen, Anvarbatcha; Dhivya, Rajakumar; Vignesh, Sivanandham; Akbarsha, Mohammad Abdulkader; James, Rathinam Arthur

2013-05-01

Water soluble polymer-copper(II) complexes with various degrees of coordination in the polymer chain were synthesized and characterized by elemental analysis, IR, UV-visible and EPR spectra. The DNA/RNA binding behavior of these polymer-copper(II) complexes was examined by UV-visible absorption, emission and circular dichroism spectroscopic methods, and cyclic voltammetry techniques. The binding of the polymer-copper(II) complexes with DNA/RNA was mainly through intercalation but some amount of electrostatic interaction was also observed. This binding capacity increased with the degree of coordination of the complexes. The polymer-copper(II) complex having the highest degree of coordination was subjected to analysis of cytotoxic and antimicrobial properties. The cytotoxicity study indicated that the polymer-copper(II) complexes affected the viability of MCF-7 mammary carcinoma cells, and the cells responded to the treatment with mostly through apoptosis although a few cells succumbed to necrosis. The antimicrobial screening showed activity against some human pathogens.

[Structure-functional organization of eukaryotic high-affinity copper importer CTR1 determines its ability to transport copper, silver and cisplatin].

PubMed

Skvortsov, A N; Zatulovskiĭ, E A; Puchkova, L V

2012-01-01

It was shown recently, that high affinity Cu(I) importer eukaryotic protein CTR1 can also transport in vitro abiogenic Ag(I) ions and anticancer drug cisplatin. At present there is no rational explanation how CTR1 can transfer platinum group, which is different by coordination properties from highly similar Cu(I) and Ag(I). To understand this phenomenon we analyzed 25 sequences of chordate CTR1 proteins, and found out conserved patterns of organization of N-terminal extracellular part of CTR1 which correspond to initial metal binding. Extracellular copper-binding motifs were qualified by their coordination properties. It was shown that relative position of Met- and His-rich copper-binding motifs in CTR1 predisposes the extracellular CTR1 part to binding of copper, silver and cisplatin. Relation between tissue-specific expression of CTR1 gene, steady-state copper concentration, and silver and platinum accumulation in organs of mice in vivo was analyzed. Significant positive but incomplete correlation exists between these variables. Basing on structural and functional peculiarities of N-terminal part of CTR1 a hypothesis of coupled transport of copper and cisplatin has been suggested, which avoids the disagreement between CTR1-mediated cisplatin transport in vitro, and irreversible binding of platinum to Met-rich peptides.

Characterization studies on cadmium-mycophosphatin from the mushroom Agaricus macrosporus.

PubMed Central

Meisch, H U; Schmitt, J A

1986-01-01

A low molecular weight Cd-binding phosphoglycoprotein, cadmium-mycophosphatin, has been isolated from the mushroom Agaricus macrosporus. This protein has a molecular weight of 12,000 dalton and contains no sulfur but a high amount of acid amino acids (Glu, Asp), and carbohydrates (glucose, galactose). Cadmium-mycophosphatin has an isoelectric point less than pH 2, binds cadmium with a dissociation constant of KD = 1.59 X 10 M (pKD = 6.8) and is saturated with 13.5 mole Cd/mole, all Cd-binding sites being equivalent. It is suggested that Cd is bound by phosphoserine groups, similar relations being known from calcium-binding proteins in animals. From A. macrosporus four other low-molecular weight glycoproteins have been isolated which contain sulfur and bind cadmium and copper. The biological significance of these Cd-binding proteins is discussed. PMID:3709455

Serum zinc, copper, retinol-binding protein, prealbumin, and ceruloplasmin concentrations in infants receiving intravenous zinc and copper supplementation.

PubMed

Lockitch, G; Godolphin, W; Pendray, M R; Riddell, D; Quigley, G

1983-02-01

One hundred twenty-seven newborn infants requiring parenteral nutrition were randomly assigned to receive differing amounts of zinc (40 to 400 micrograms/kg/day) and copper (20 or 40 micrograms/kg/day) supplementation within five birth weight groups (600 to 2,500 gm). The serum zinc concentration remained relatively constant in the group receiving the most zinc supplementation after two weeks of therapy, but declined sharply in the groups receiving less supplementation. No effect of increased copper intake was noted on ceruloplasmin values, but a difference in serum copper concentrations was noted at two weeks. No correlation was noted between serum zinc and copper values or among those for serum zinc, retinol-binding protein, and prealbumin. Reference ranges were defined for serum zinc, copper, retinol-binding protein, prealbumin, and ceruloplasmin in the preterm infant.

Differential affinity of BsSCO for Cu(II) and Cu(I) suggests a redox role in copper transfer to the Cu(A) center of cytochrome c oxidase.

PubMed

Hill, Bruce C; Andrews, Diann

2012-06-01

SCO (synthesis of cytochrome c oxidase) proteins are involved in the assembly of the respiratory chain enzyme cytochrome c oxidase acting to assist in the assembly of the Cu(A) center contained within subunit II of the oxidase complex. The Cu(A) center receives electrons from the reductive substrate ferrocytochrome c, and passes them on to the cytochrome a center. Cytochrome a feeds electrons to the oxygen reaction site composed of cytochrome a(3) and Cu(B). Cu(A) consists of two copper ions positioned within bonding distance and ligated by two histidine side chains, one methionine, a backbone carbonyl and two bridging cysteine residues. The complex structure and redox capacity of Cu(A) present a potential assembly challenge. SCO proteins are members of the thioredoxin family which led to the early suggestion of a disulfide exchange function for SCO in Cu(A) assembly, whereas the copper binding capacity of the Bacillus subtilis version of SCO (i.e., BsSCO) suggests a direct role for SCO proteins in copper transfer. We have characterized redox and copper exchange properties of apo- and metalated-BsSCO. The release of copper (II) from its complex with BsSCO is best achieved by reducing it to Cu(I). We propose a mechanism involving both disulfide and copper exchange between BsSCO and the apo-Cu(A) site. This article is part of a Special Issue entitled: Biogenesis/Assembly of Respiratory Enzyme Complexes. Copyright © 2011 Elsevier B.V. All rights reserved.

Structure, Regulation, and Putative Function of the Arginine Deiminase System of Streptococcus suis

PubMed Central

Gruening, Petra; Fulde, Marcus; Valentin-Weigand, Peter; Goethe, Ralph

2006-01-01

Streptococcus suis is an important cause of infectious diseases in young pigs. Little is known about the virulence factors or protective antigens of S. suis. Recently, we have identified two proteins of the arginine deiminase system (ADS) of S. suis, which were temperature induced and expressed on the streptococcal surface (N. Winterhoff, R. Goethe, P. Gruening, M. Rohde, H. Kalisz, H. E. Smith, and P. Valentin-Weigand, J. Bacteriol. 184:6768-6776, 2002). In the present study, we analyzed the complete ADS of S. suis. Due to their homologies to the recently published S. gordonii ADS genes, the genes for arginine deiminase, ornithine carbamoyl-transferase, and carbamate kinase, which were previously designated adiS, octS, and ckS, respectively, were renamed arcA, arcB, and arcC, respectively. Our data revealed that arcA, arcB, and arcC of the S. suis ADS are transcribed from an operon (arcABC operon). Additionally, putative ADS-associated genes were cloned and sequenced which, however, did not belong to the arcABC operon. These were the flpS gene upstream of the arcABC operon with homology to the flp transcription regulator of S. gordonii and the arcD, arcT, arcH, and argR genes downstream of the arcABC operon with high homologies to a putative arginine-ornithine antiporter, a putative dipeptidase of S. gordonii, a putative β-N-acetylhexosaminidase of S. pneumoniae, and a putative arginine repressor of S. gordonii, respectively. The transcriptional start point of the arcABC operon was determined, and promoter analysis provided evidence that multiple factors contribute to the regulation of the ADS. Thus, a putative binding site for a transcription regulator of the Crp/Fnr family, an ArgR-binding site, and two cis-acting catabolite response elements were identified in the promoter-operator region of the operon. Consistent with this, we could demonstrate that the ADS of S. suis is inducible by arginine and reduced O2 tension and subject to carbon catabolite repression. Furthermore, comparing an arcA knockout mutant in which expression of the three operon-encoded proteins was abolished with the parental wild-type strain showed that the arcABC operon of S. suis contributes to survival under acidic conditions. PMID:16385025

Structure, regulation, and putative function of the arginine deiminase system of Streptococcus suis.

PubMed

Gruening, Petra; Fulde, Marcus; Valentin-Weigand, Peter; Goethe, Ralph

2006-01-01

Streptococcus suis is an important cause of infectious diseases in young pigs. Little is known about the virulence factors or protective antigens of S. suis. Recently, we have identified two proteins of the arginine deiminase system (ADS) of S. suis, which were temperature induced and expressed on the streptococcal surface (N. Winterhoff, R. Goethe, P. Gruening, M. Rohde, H. Kalisz, H. E. Smith, and P. Valentin-Weigand, J. Bacteriol. 184:6768-6776, 2002). In the present study, we analyzed the complete ADS of S. suis. Due to their homologies to the recently published S. gordonii ADS genes, the genes for arginine deiminase, ornithine carbamoyl-transferase, and carbamate kinase, which were previously designated adiS, octS, and ckS, respectively, were renamed arcA, arcB, and arcC, respectively. Our data revealed that arcA, arcB, and arcC of the S. suis ADS are transcribed from an operon (arcABC operon). Additionally, putative ADS-associated genes were cloned and sequenced which, however, did not belong to the arcABC operon. These were the flpS gene upstream of the arcABC operon with homology to the flp transcription regulator of S. gordonii and the arcD, arcT, arcH, and argR genes downstream of the arcABC operon with high homologies to a putative arginine-ornithine antiporter, a putative dipeptidase of S. gordonii, a putative beta-N-acetylhexosaminidase of S. pneumoniae, and a putative arginine repressor of S. gordonii, respectively. The transcriptional start point of the arcABC operon was determined, and promoter analysis provided evidence that multiple factors contribute to the regulation of the ADS. Thus, a putative binding site for a transcription regulator of the Crp/Fnr family, an ArgR-binding site, and two cis-acting catabolite response elements were identified in the promoter-operator region of the operon. Consistent with this, we could demonstrate that the ADS of S. suis is inducible by arginine and reduced O2 tension and subject to carbon catabolite repression. Furthermore, comparing an arcA knockout mutant in which expression of the three operon-encoded proteins was abolished with the parental wild-type strain showed that the arcABC operon of S. suis contributes to survival under acidic conditions.

Two distinctive β subunits are separately involved in two binding sites of imidacloprid with different affinities in Locusta migratoria manilensis.

PubMed

Bao, Haibo; Liu, Yang; Zhang, Yixi; Liu, Zewen

2017-08-01

Due to great diversity of nicotinic acetylcholine receptor (nAChR) subtypes in insects, one β subunit may be contained in numerous nAChR subtypes. In the locust Locusta migratoria, a model insect species with agricultural importance, the third β subunits (Locβ3) was identified in this study, which reveals at least three β subunits in this insect species. Imidacloprid was found to bind nAChRs in L. migratoria central nervous system at two sites with different affinities, with K d values of 0.16 and 10.31nM. The specific antisera (L1-1, L2-1 and L3-1) were raised against fusion proteins at the large cytoplasmic loop of Locβ1, Locβ2 and Locβ3 respectively. Specific immunodepletion of Locβ1 with antiserum L1-1 resulted in the selective loss of the low affinity binding site for imidacloprid, whereas the immunodepletion of Locβ3 with L3-1 caused the selective loss of the high affinity site. Dual immunodepletion with L1-1 and L3-1 could completely abolish imidacloprid binding. In contrast, the immunodepletion of Locβ2 had no significant effect on the specific [ 3 H]imidacloprid binding. Taken together, these data indicated that Locβ1 and Locβ3 were respectively contained in the low- and high-affinity binding sites for imidacloprid in L. migratoria, which is different to the previous finding in Nilaparvata lugens that Nlβ1 was in two binding sites for imidacloprid. The involvement of two β subunits separately in two binding sites may decrease the risk of imidacloprid resistance due to putative point mutations in β subunits in L. migratoria. Copyright © 2017 Elsevier B.V. All rights reserved.

Tracking metal ions through a Cu/Ag efflux pump assigns the functional roles of the periplasmic proteins

DOE PAGES

Chacon, Kelly N.; Mealman, Tiffany D.; McEvoy, Megan M.; ...

2014-10-13

Copper is an essential nutrient for all aerobic organisms but is toxic in excess. At the host–pathogen interface, macrophages respond to bacterial infection by copper-dependent killing mechanisms, whereas the invading bacteria are thought to counter with an up-regulation of copper transporters and efflux pumps. The tripartite efflux pump CusCBA and its metallochaperone CusF are vital to the detoxification of copper and silver ions in the periplasm of Escherichia coli. However, the mechanism of efflux by this complex, which requires the activation of the inner membrane pump CusA, is poorly understood. In this paper, we use selenomethionine (SeM) active site labelsmore » in a series of biological X-ray absorption studies at the selenium, copper, and silver edges to establish a “switch” role for the membrane fusion protein CusB. We determine that metal-bound CusB is required for activation of cuprous ion transfer from CusF directly to a site in the CusA antiporter, showing for the first time (to our knowledge) the in vitro activation of the Cus efflux pump. This metal-binding site of CusA is unlike that observed in the crystal structures of the CusA protein and is composed of one oxygen and two sulfur ligands. Finally, our results suggest that metal transfer occurs between CusF and apo-CusB, and that, when metal-loaded, CusB plays a role in the regulation of metal ion transfer from CusF to CusA in the periplasm.« less

Tracking metal ions through a Cu/Ag efflux pump assigns the functional roles of the periplasmic proteins.

PubMed

Chacón, Kelly N; Mealman, Tiffany D; McEvoy, Megan M; Blackburn, Ninian J

2014-10-28

Copper is an essential nutrient for all aerobic organisms but is toxic in excess. At the host-pathogen interface, macrophages respond to bacterial infection by copper-dependent killing mechanisms, whereas the invading bacteria are thought to counter with an up-regulation of copper transporters and efflux pumps. The tripartite efflux pump CusCBA and its metallochaperone CusF are vital to the detoxification of copper and silver ions in the periplasm of Escherichia coli. However, the mechanism of efflux by this complex, which requires the activation of the inner membrane pump CusA, is poorly understood. Here, we use selenomethionine (SeM) active site labels in a series of biological X-ray absorption studies at the selenium, copper, and silver edges to establish a "switch" role for the membrane fusion protein CusB. We determine that metal-bound CusB is required for activation of cuprous ion transfer from CusF directly to a site in the CusA antiporter, showing for the first time (to our knowledge) the in vitro activation of the Cus efflux pump. This metal-binding site of CusA is unlike that observed in the crystal structures of the CusA protein and is composed of one oxygen and two sulfur ligands. Our results suggest that metal transfer occurs between CusF and apo-CusB, and that, when metal-loaded, CusB plays a role in the regulation of metal ion transfer from CusF to CusA in the periplasm.

Analysis of drug binding pockets and repurposing opportunities for twelve essential enzymes of ESKAPE pathogens

PubMed Central

Naz, Sadia; Ngo, Tony; Farooq, Umar

2017-01-01

Background The rapid increase in antibiotic resistance by various bacterial pathogens underlies the significance of developing new therapies and exploring different drug targets. A fraction of bacterial pathogens abbreviated as ESKAPE by the European Center for Disease Prevention and Control have been considered a major threat due to the rise in nosocomial infections. Here, we compared putative drug binding pockets of twelve essential and mostly conserved metabolic enzymes in numerous bacterial pathogens including those of the ESKAPE group and Mycobacterium tuberculosis. The comparative analysis will provide guidelines for the likelihood of transferability of the inhibitors from one species to another. Methods Nine bacterial species including six ESKAPE pathogens, Mycobacterium tuberculosis along with Mycobacterium smegmatis and Eschershia coli, two non-pathogenic bacteria, have been selected for drug binding pocket analysis of twelve essential enzymes. The amino acid sequences were obtained from Uniprot, aligned using ICM v3.8-4a and matched against the Pocketome encyclopedia. We used known co-crystal structures of selected target enzyme orthologs to evaluate the location of their active sites and binding pockets and to calculate a matrix of pairwise sequence identities across each target enzyme across the different species. This was used to generate sequence maps. Results High sequence identity of enzyme binding pockets, derived from experimentally determined co-crystallized structures, was observed among various species. Comparison at both full sequence level and for drug binding pockets of key metabolic enzymes showed that binding pockets are highly conserved (sequence similarity up to 100%) among various ESKAPE pathogens as well as Mycobacterium tuberculosis. Enzymes orthologs having conserved binding sites may have potential to interact with inhibitors in similar way and might be helpful for design of similar class of inhibitors for a particular species. The derived pocket alignments and distance-based maps provide guidelines for drug discovery and repurposing. In addition they also provide recommendations for the relevant model bacteria that may be used for initial drug testing. Discussion Comparing ligand binding sites through sequence identity calculation could be an effective approach to identify conserved orthologs as drug binding pockets have shown higher level of conservation among various species. By using this approach we could avoid the problems associated with full sequence comparison. We identified essential metabolic enzymes among ESKAPE pathogens that share high sequence identity in their putative drug binding pockets (up to 100%), of which known inhibitors can potentially antagonize these identical pockets in the various species in a similar manner. PMID:28948099

Analysis of drug binding pockets and repurposing opportunities for twelve essential enzymes of ESKAPE pathogens.

PubMed

Naz, Sadia; Ngo, Tony; Farooq, Umar; Abagyan, Ruben

2017-01-01

The rapid increase in antibiotic resistance by various bacterial pathogens underlies the significance of developing new therapies and exploring different drug targets. A fraction of bacterial pathogens abbreviated as ESKAPE by the European Center for Disease Prevention and Control have been considered a major threat due to the rise in nosocomial infections. Here, we compared putative drug binding pockets of twelve essential and mostly conserved metabolic enzymes in numerous bacterial pathogens including those of the ESKAPE group and Mycobacterium tuberculosis . The comparative analysis will provide guidelines for the likelihood of transferability of the inhibitors from one species to another. Nine bacterial species including six ESKAPE pathogens, Mycobacterium tuberculosis along with Mycobacterium smegmatis and Eschershia coli , two non-pathogenic bacteria, have been selected for drug binding pocket analysis of twelve essential enzymes. The amino acid sequences were obtained from Uniprot, aligned using ICM v3.8-4a and matched against the Pocketome encyclopedia. We used known co-crystal structures of selected target enzyme orthologs to evaluate the location of their active sites and binding pockets and to calculate a matrix of pairwise sequence identities across each target enzyme across the different species. This was used to generate sequence maps. High sequence identity of enzyme binding pockets, derived from experimentally determined co-crystallized structures, was observed among various species. Comparison at both full sequence level and for drug binding pockets of key metabolic enzymes showed that binding pockets are highly conserved (sequence similarity up to 100%) among various ESKAPE pathogens as well as Mycobacterium tuberculosis . Enzymes orthologs having conserved binding sites may have potential to interact with inhibitors in similar way and might be helpful for design of similar class of inhibitors for a particular species. The derived pocket alignments and distance-based maps provide guidelines for drug discovery and repurposing. In addition they also provide recommendations for the relevant model bacteria that may be used for initial drug testing. Comparing ligand binding sites through sequence identity calculation could be an effective approach to identify conserved orthologs as drug binding pockets have shown higher level of conservation among various species. By using this approach we could avoid the problems associated with full sequence comparison. We identified essential metabolic enzymes among ESKAPE pathogens that share high sequence identity in their putative drug binding pockets (up to 100%), of which known inhibitors can potentially antagonize these identical pockets in the various species in a similar manner.

Neurokinin B and serum albumin limit copper binding to mammalian gonadotropin releasing hormone.

PubMed

Gul, Ahmad Samir; Tran, Kevin K; Jones, Christopher E

2018-02-26

Gonadotropin releasing hormone (GnRH) triggers secretion of luteinizing hormone and follicle stimulating hormone from gonadotropic cells in the anterior pituitary gland. GnRH is able to bind copper, and both in vitro and in vivo studies have suggested that the copper-GnRH complex is more potent at triggering gonadotropin release than GnRH alone. However, it remains unclear whether copper-GnRH is the active species in vivo. To explore this we have estimated the GnRH-copper affinity and have examined whether GnRH remains copper-bound in the presence of serum albumin and the neuropeptide neurokinin B, both copper-binding proteins that GnRH will encounter in vivo. We show that GnRH has a copper dissociation constant of ∼0.9 × 10 -9  M, however serum albumin and neurokinin B can extract metal from the copper-GnRH complex. It is therefore unlikely that a copper-GnRH complex will survive transit through the pituitary portal circulation and that any effect of copper must occur outside the bloodstream in the absence of neurokinin B. Copyright © 2018 Elsevier Inc. All rights reserved.

Modeling dioxygen reduction at multicopper oxidase cathodes.

PubMed

Agbo, Peter; Heath, James R; Gray, Harry B

2014-10-01

We report a general kinetics model for catalytic dioxygen reduction on multicopper oxidase (MCO) cathodes. Our rate equation combines Butler-Volmer (BV) electrode kinetics and the Michaelis-Menten (MM) formalism for enzymatic catalysis, with the BV model accounting for interfacial electron transfer (ET) between the electrode surface and the MCO type 1 copper site. Extending the principles of MM kinetics to this system produced an analytical expression incorporating the effects of subsequent intramolecular ET and dioxygen binding to the trinuclear copper cluster into the cumulative model. We employed experimental electrochemical data on Thermus thermophilus laccase as benchmarks to validate our model, which we suggest will aid in the design of more efficient MCO cathodes. In addition, we demonstrate the model's utility in determining estimates for both the electronic coupling and average distance between the laccase type-1 active site and the cathode substrate.

Catalytic site identification—a web server to identify catalytic site structural matches throughout PDB

PubMed Central

Kirshner, Daniel A.; Nilmeier, Jerome P.; Lightstone, Felice C.

2013-01-01

The catalytic site identification web server provides the innovative capability to find structural matches to a user-specified catalytic site among all Protein Data Bank proteins rapidly (in less than a minute). The server also can examine a user-specified protein structure or model to identify structural matches to a library of catalytic sites. Finally, the server provides a database of pre-calculated matches between all Protein Data Bank proteins and the library of catalytic sites. The database has been used to derive a set of hypothesized novel enzymatic function annotations. In all cases, matches and putative binding sites (protein structure and surfaces) can be visualized interactively online. The website can be accessed at http://catsid.llnl.gov. PMID:23680785

Catalytic site identification--a web server to identify catalytic site structural matches throughout PDB.

PubMed

Kirshner, Daniel A; Nilmeier, Jerome P; Lightstone, Felice C

2013-07-01

The catalytic site identification web server provides the innovative capability to find structural matches to a user-specified catalytic site among all Protein Data Bank proteins rapidly (in less than a minute). The server also can examine a user-specified protein structure or model to identify structural matches to a library of catalytic sites. Finally, the server provides a database of pre-calculated matches between all Protein Data Bank proteins and the library of catalytic sites. The database has been used to derive a set of hypothesized novel enzymatic function annotations. In all cases, matches and putative binding sites (protein structure and surfaces) can be visualized interactively online. The website can be accessed at http://catsid.llnl.gov.

Open and Lys–His Hexacoordinated Closed Structures of a Globin with Swapped Proximal and Distal Sites

PubMed Central

Teh, Aik-Hong; Saito, Jennifer A.; Najimudin, Nazalan; Alam, Maqsudul

2015-01-01

Globins are haem-binding proteins with a conserved fold made up of α-helices and can possess diverse properties. A putative globin-coupled sensor from Methylacidiphilum infernorum, HGbRL, contains an N-terminal globin domain whose open and closed structures reveal an untypical dimeric architecture. Helices E and F fuse into an elongated helix, resulting in a novel site-swapped globin fold made up of helices A–E, hence the distal site, from one subunit and helices F–H, the proximal site, from another. The open structure possesses a large cavity binding an imidazole molecule, while the closed structure forms a unique Lys–His hexacoordinated species, with the first turn of helix E unravelling to allow Lys52(E10) to bind to the haem. Ligand binding induces reorganization of loop CE, which is stabilized in the closed form, and helix E, triggering a large conformational movement in the open form. These provide a mechanical insight into how a signal may be relayed between the globin domain and the C-terminal domain of HGbRL, a Roadblock/LC7 domain. Comparison with HGbI, a closely related globin, further underlines the high degree of structural versatility that the globin fold is capable of, enabling it to perform a diversity of functions. PMID:26094577

Prediction of Protein-Protein Interaction Sites Using Electrostatic Desolvation Profiles

PubMed Central

Fiorucci, Sébastien; Zacharias, Martin

2010-01-01

Abstract Protein-protein complex formation involves removal of water from the interface region. Surface regions with a small free energy penalty for water removal or desolvation may correspond to preferred interaction sites. A method to calculate the electrostatic free energy of placing a neutral low-dielectric probe at various protein surface positions has been designed and applied to characterize putative interaction sites. Based on solutions of the finite-difference Poisson equation, this method also includes long-range electrostatic contributions and the protein solvent boundary shape in contrast to accessible-surface-area-based solvation energies. Calculations on a large set of proteins indicate that in many cases (>90%), the known binding site overlaps with one of the six regions of lowest electrostatic desolvation penalty (overlap with the lowest desolvation region for 48% of proteins). Since the onset of electrostatic desolvation occurs even before direct protein-protein contact formation, it may help guide proteins toward the binding region in the final stage of complex formation. It is interesting that the probe desolvation properties associated with residue types were found to depend to some degree on whether the residue was outside of or part of a binding site. The probe desolvation penalty was on average smaller if the residue was part of a binding site compared to other surface locations. Applications to several antigen-antibody complexes demonstrated that the approach might be useful not only to predict protein interaction sites in general but to map potential antigenic epitopes on protein surfaces. PMID:20441756

CsrA Represses Translation of sdiA, Which Encodes the N-Acylhomoserine-l-Lactone Receptor of Escherichia coli, by Binding Exclusively within the Coding Region of sdiA mRNA ▿ †

PubMed Central

Yakhnin, Helen; Baker, Carol S.; Berezin, Igor; Evangelista, Michael A.; Rassin, Alisa; Romeo, Tony; Babitzke, Paul

2011-01-01

The RNA binding protein CsrA is the central component of a conserved global regulatory system that activates or represses gene expression posttranscriptionally. In every known example of CsrA-mediated translational control, CsrA binds to the 5′ untranslated region of target transcripts, thereby repressing translation initiation and/or altering the stability of the RNA. Furthermore, with few exceptions, repression by CsrA involves binding directly to the Shine-Dalgarno sequence and blocking ribosome binding. sdiA encodes the quorum-sensing receptor for N-acyl-l-homoserine lactone in Escherichia coli. Because sdiA indirectly stimulates transcription of csrB, which encodes a small RNA (sRNA) antagonist of CsrA, we further explored the relationship between sdiA and the Csr system. Primer extension analysis revealed four putative transcription start sites within 85 nucleotides of the sdiA initiation codon. Potential σ70-dependent promoters were identified for each of these primer extension products. In addition, two CsrA binding sites were predicted in the initially translated region of sdiA. Expression of chromosomally integrated sdiA′-′lacZ translational fusions containing the entire promoter and CsrA binding site regions indicates that CsrA represses sdiA expression. The results from gel shift and footprint studies demonstrate that tight binding of CsrA requires both of these sites. Furthermore, the results from toeprint and in vitro translation experiments indicate that CsrA represses translation of sdiA by directly competing with 30S ribosomal subunit binding. Thus, this represents the first example of CsrA preventing translation by interacting solely within the coding region of an mRNA target. PMID:21908661

Characterization and crystal structure of lysine insensitive Corynebacterium glutamicum dihydrodipicolinate synthase (cDHDPS) protein

DOE Office of Scientific and Technical Information (OSTI.GOV)

Rice, E.A.; Bannon, G.A.; Glenn, K.C.

2008-11-21

The lysine insensitive Corynebacterium glutamicum dihydrodipicolinate synthase enzyme (cDHDPS) was recently successfully introduced into maize plants to enhance the level of lysine in the grain. To better understand lysine insensitivity of the cDHDPS, we expressed, purified, kinetically characterized the protein, and solved its X-ray crystal structure. The cDHDPS enzyme has a fold and overall structure that is highly similar to other DHDPS proteins. A noteworthy feature of the active site is the evidence that the catalytic lysine residue forms a Schiff base adduct with pyruvate. Analyses of the cDHDPS structure in the vicinity of the putative binding site for S-lysinemore » revealed that the allosteric binding site in the Escherichia coli DHDPS protein does not exist in cDHDPS due to three non-conservative amino acids substitutions, and this is likely why cDHDPS is not feedback inhibited by lysine.« less

NF-Y, a CCAAT box-binding protein, is one of the trans-acting factors necessary for the response of the murine ERp72 gene to protein traffic.

PubMed

Marcus, N; Green, M

1997-09-01

The accumulation of incompletely assembled immunoglobulin mu heavy chain in transfected COS cells stimulates the cellular response to protein traffic that results in the increased transcription and elevated synthesis of several ER chaperones, including ERP72, a member of the protein disulfide isomerase family of molecular chaperones. The ERp72 promoter contains an 82 bp ER protein traffic response element (ERPTRE) that is sufficient to mediate this response. Previously, it had been shown that the alteration of a putative AP-2 site and a CCAAT and inverted CCAAT site within the ERPTRE significantly decreased the response of ERp72 promoter to mu chain accumulation. We have extended these findings by demonstrating a role for NF-Y and a potentially novel DNA-binding protein in the regulation of transcription from the ERp72 promoter. The fact that NF-Y binding to the ERPTRE is observed in extracts from both control cells and cells in which the response to protein traffic has been activated indicates that the binding of NF-Y, while necessary, is not sufficient to account for the response. Each of the two CCAAT sites in the ERPTRE can bind NF-Y independently, but both sites must be intact for full ERPTRE function. A second protein can bind to the ERPTRE independently of NF-Y and at a site overlapping or close to the 3' end of the reverse CCAAT site. It is possible that interactions between NF-Y, this protein and perhaps other factors are responsible for the regulation of the protein traffic response.

Ubiquitin vinyl methyl ester binding orients the misaligned active site of the ubiquitin hydrolase UCHL1 into productive conformation

DOE Office of Scientific and Technical Information (OSTI.GOV)

Boudreaux, David A.; Maiti, Tushar K.; Davies, Christopher W.

Ubiquitin carboxy-terminal hydrolase L1 (UCHL1) is a Parkinson disease-associated, putative cysteine protease found abundantly and selectively expressed in neurons. The crystal structure of apo UCHL1 showed that the active-site residues are not aligned in a canonical form, with the nucleophilic cysteine being 7.7 {angstrom} from the general base histidine, an arrangement consistent with an inactive form of the enzyme. Here we report the crystal structures of the wild type and two Parkinson disease-associated variants of the enzyme, S18Y and I93M, bound to a ubiquitin-based suicide substrate, ubiquitin vinyl methyl ester. These structures reveal that ubiquitin vinyl methyl ester binds primarilymore » at two sites on the enzyme, with its carboxy terminus at the active site and with its amino-terminal {beta}-hairpin at the distal site - a surface-exposed hydrophobic crevice 17 {angstrom} away from the active site. Binding at the distal site initiates a cascade of side-chain movements in the enzyme that starts at a highly conserved, surface-exposed phenylalanine and is relayed to the active site resulting in the reorientation and proximal placement of the general base within 4 {angstrom} of the catalytic cysteine, an arrangement found in productive cysteine proteases. Mutation of the distal-site, surface-exposed phenylalanine to alanine reduces ubiquitin binding and severely impairs the catalytic activity of the enzyme. These results suggest that the activity of UCHL1 may be regulated by its own substrate.« less

SH3 domain-mediated binding of the Drk protein to Dos is an important step in signaling of Drosophila receptor tyrosine kinases.

PubMed

Feller, Stephan M; Wecklein, Heike; Lewitzky, Marc; Kibler, Eike; Raabe, Thomas

2002-08-01

Activation of the Sevenless (Sev) receptor tyrosine kinase (RTK) in the developing Drosophila eye is required for the specification of the R7 photoreceptor cell fate. Daughter of Sevenless (Dos), a putative multi-site adaptor protein, is a substrate of the Sev kinase and is known to associate with the tyrosine phosphatase Corkscrew (Csw). Binding of Csw to Dos depends on the Csw Src homology 2 (SH2) domains and is an essential step for signaling by the Sev RTK. Dos, however, lacks a recognizable phosphotyrosine interaction domain and it was previously unclear how it is recruited to the Sev receptor. Here it is shown that the SH2/SH3 domain adaptor protein Drk can provide this link. Drk binds with its SH2 domain to the autophosphorylated Sev receptor while the C-terminal SH3 domain is able to associate with Dos. The Drk SH3 domain binding motifs on Dos were mapped to two sites which do not conform the known Drk SH3 domain binding motif (PxxPxR) but instead have the consensus PxxxRxxKP. Mutational analysis in vitro and in vivo provided evidence that both Drk binding sites fulfil an important function in the context of Sev and Drosophila epidermal growth factor receptor mediated signaling processes.

Agonist trapped in ATP-binding sites of the P2X2 receptor.

PubMed

Jiang, Ruotian; Lemoine, Damien; Martz, Adeline; Taly, Antoine; Gonin, Sophie; Prado de Carvalho, Lia; Specht, Alexandre; Grutter, Thomas

2011-05-31

ATP-gated P2X receptors are trimeric ion channels, as recently confirmed by X-ray crystallography. However, the structure was solved without ATP and even though extracellular intersubunit cavities surrounded by conserved amino acid residues previously shown to be important for ATP function were proposed to house ATP, the localization of the ATP sites remains elusive. Here we localize the ATP-binding sites by creating, through a proximity-dependent "tethering" reaction, covalent bonds between a synthesized ATP-derived thiol-reactive P2X2 agonist (NCS-ATP) and single cysteine mutants engineered in the putative binding cavities of the P2X2 receptor. By combining whole-cell and single-channel recordings, we report that NCS-ATP covalently and specifically labels two previously unidentified positions N140 and L186 from two adjacent subunits separated by about 18 Å in a P2X2 closed state homology model, suggesting the existence of at least two binding modes. Tethering reaction at both positions primes subsequent agonist binding, yet with distinct functional consequences. Labeling of one position impedes subsequent ATP function, which results in inefficient gating, whereas tethering of the other position, although failing to produce gating by itself, enhances subsequent ATP function. Our results thus define a large and dynamic intersubunit ATP-binding pocket and suggest that receptors trapped in covalently agonist-bound states differ in their ability to gate the ion channel.

Independent signaling by Drosophila insulin receptor for axon guidance and growth

PubMed Central

Li, Caroline R.; Guo, Dongyu; Pick, Leslie

2014-01-01

The Drosophila insulin receptor (DInR) regulates a diverse array of biological processes including growth, axon guidance, and sugar homeostasis. Growth regulation by DInR is mediated by Chico, the Drosophila homolog of vertebrate insulin receptor substrate proteins IRS1–4. In contrast, DInR regulation of photoreceptor axon guidance in the developing visual system is mediated by the SH2-SH3 domain adaptor protein Dreadlocks (Dock). In vitro studies by others identified five NPXY motifs, one in the juxtamembrane region and four in the signaling C-terminal tail (C-tail), important for interaction with Chico. Here we used yeast two-hybrid assays to identify regions in the DInR C-tail that interact with Dock. These Dock binding sites were in separate portions of the C-tail from the previously identified Chico binding sites. To test whether these sites are required for growth or axon guidance in whole animals, a panel of DInR proteins, in which the putative Chico and Dock interaction sites had been mutated individually or in combination, were tested for their ability to rescue viability, growth and axon guidance defects of dinr mutant flies. Sites required for viability were identified. Unexpectedly, mutation of both putative Dock binding sites, either individually or in combination, did not lead to defects in photoreceptor axon guidance. Thus, either sites also required for viability are necessary for DInR function in axon guidance and/or there is redundancy built into the DInR/Dock interaction such that Dock is able to interact with multiple regions of DInR. We also found that simultaneous mutation of all five NPXY motifs implicated in Chico interaction drastically decreased growth in both male and female adult flies. These animals resembled chico mutants, supporting the notion that DInR interacts directly with Chico in vivo to control body size. Mutation of these five NPXY motifs did not affect photoreceptor axon guidance, segregating the roles of DInR in the processes of growth and axon guidance. PMID:24478707

C-Terminal β9-Strand of the Cyclic Nucleotide-Binding Homology Domain Stabilizes Activated States of Kv11.1 Channels

PubMed Central

Ng, Chai Ann; Ke, Ying; Perry, Matthew D.; Tan, Peter S.; Hill, Adam P.; Vandenberg, Jamie I.

2013-01-01

Kv11.1 potassium channels are important for regulation of the normal rhythm of the heartbeat. Reduced activity of Kv11.1 channels causes long QT syndrome type 2, a disorder that increases the risk of cardiac arrhythmias and sudden cardiac arrest. Kv11.1 channels are members of the KCNH subfamily of voltage-gated K+ channels. However, they also share many similarities with the cyclic nucleotide gated ion channel family, including having a cyclic nucleotide-binding homology (cNBH) domain. Kv11.1 channels, however, are not directly regulated by cyclic nucleotides. Recently, crystal structures of the cNBH domain from mEAG and zELK channels, both members of the KCNH family of voltage-gated potassium channels, revealed that a C-terminal β9-strand in the cNBH domain occupied the putative cyclic nucleotide-binding site thereby precluding binding of cyclic nucleotides. Here we show that mutations to residues in the β9-strand affect the stability of the open state relative to the closed state of Kv11.1 channels. We also show that disrupting the structure of the β9-strand reduces the stability of the inactivated state relative to the open state. Clinical mutations located in this β9-strand result in reduced trafficking efficiency, which suggests that binding of the C-terminal β9-strand to the putative cyclic nucleotide-binding pocket is also important for assembly and trafficking of Kv11.1 channels. PMID:24204727

PdhR, the pyruvate dehydrogenase repressor, does not regulate lipoic acid synthesis.

PubMed

Feng, Youjun; Cronan, John E

2014-01-01

Lipoic acid is a covalently-bound enzyme cofactor required for central metabolism all three domains of life. In the last 20 years the pathway of lipoic acid synthesis and metabolism has been established in Escherichia coli. Expression of the genes of the lipoic acid biosynthesis pathway was believed to be constitutive. However, in 2010 Kaleta and coworkers (BMC Syst. Biol. 4:116) predicted a binding site for the pyruvate dehydrogenase operon repressor, PdhR (referred to lipA site 1) upstream of lipA, the gene encoding lipoic acid synthase and concluded that PdhR regulates lipA transcription. We report in vivo and in vitro evidence that lipA is not controlled by PdhR and that the putative regulatory site deduced by the prior workers is nonfunctional and physiologically irrelevant. E. coli PdhR was purified to homogeneity and used for electrophoretic mobility shift assays. The lipA site 1 of Kaleta and coworkers failed to bind PdhR. The binding detected by these workers is due to another site (lipA site 3) located far upstream of the lipA promoter. Relative to the canonical PdhR binding site lipA site 3 is a half-palindrome and as expected had only weak PdhR binding ability. Manipulation of lipA site 3 to construct a palindrome gave significantly enhanced PdhR binding affinity. The native lipA promoter and the version carrying the artificial lipA3 palindrome were transcriptionally fused to a LacZ reporter gene to directly assay lipA expression. Deletion of pdhR gave no significant change in lipA promoter-driven β-galactosidase activity with either the native or constructed palindrome upstream sequences, indicating that PdhR plays no physiological role in regulation of lipA expression. Copyright © 2014 Institut Pasteur. Published by Elsevier Masson SAS. All rights reserved.

Precipitation of the thyrotropin receptor and identification of thyroid autoantigens using Graves' disease immunoglobulins.

PubMed Central

Heyma, P; Harrison, L C

1984-01-01

The thyrotropin (TSH) receptor is a putative target for autoantibodies in Graves' hyperthyroidism and therefore, should be capable of being identified, isolated, and structurally characterized by immunological means. To this end, four sera from patients with hyperthyroidism, three of which inhibited the binding of 125I-TSH to Triton-solubilized human thyroid membranes, were used to isolate TSH receptors by immunoprecipitation. To account for an effect of TSH binding or receptor occupancy on the ability of Graves' immunoglobulins to precipitate TSH receptors, two approaches were taken: (a) specific 125I-TSH binding activity was measured after solubilized thyroid membranes had been incubated with Graves' sera followed by precipitation with Staphylococcus protein A ("receptor depletion"); (b) TSH binding sites were labeled with 125I-TSH and the complexes were precipitated using Graves' sera and Staphylococcus protein A ("receptor precipitation"). The three sera which inhibited 125I-TSH binding depleted 125I-TSH binding activity between 30-80%. Preformed complexes between Staphylococcus protein A and immunoglobulins in these sera were also able to deplete 125I-TSH binding activity. However, after receptor depletion, the one serum that did not inhibit 125I-TSH binding was associated with a significant increase in 125I-TSH binding. All four sera specifically precipitated 80-100% of receptors identified by prelabeling with 125I-TSH. The dilutions of sera that precipitated 50% of 125I-TSH-receptor complexes ranged from 1:150-1:20. Complexes were partially precipitated by high concentrations of control sera (1:20), but the relative potency of control sera was at least fourfold less than Graves' sera. Immunoprecipitates of 125I-labeled thyroid membranes were analysed by sodium dodecyl sulfate-polyacrylamide gel electrophoresis and autoradiography to reveal Graves'-specific bands of reduced molecular weights of 100-110,000, 80-90,000, and 70-75,000. These bands were similar to those obtained from 125I-labeled thyroid membranes purified by TSH affinity chromatography. Thus, Graves' immunoglobulins: (a) precipitate unoccupied and occupied TSH receptors, (b) in one case, neither inhibit binding nor immunodeplete the unoccupied receptor but immunoprecipitate 125I-TSH-receptor complexes, suggesting that binding of TSH may initiate an interaction between the binding site and a separate immunoreactive molecule, and (c) identify the molecular structure of Graves' autoantigens, putatively, the TSH receptor. Images PMID:6088581

Characterization studies on cadmium-mycophosphatin from the mushroom Agaricus macrosporus

DOE Office of Scientific and Technical Information (OSTI.GOV)

Meisch, H.U.; Schmitt, J.A.

A low molecular weight Cd-binding phosphoglycoprotein, cadmium-mycophosphatin, has been isolated from the mushroom Agaricus macrosporus. This protein has a molecular weight of 12,000 dalton and contains no sulfur but a high amount of acid amino acids (Glu, Asp), and carbohydrates (glucose, galactose). Cadmium-mycophosphatin has an isoelectric point less than pH 2, binds cadmium with a dissociation constant of K/sub D/ = 1.59 x 10 M (pK/sub D/ = 6.8) and is saturated with 13.5 mole Cd/mole, all Cd-binding sites being equivalent. It is suggested that Cd is bound by phosphoserine groups, similar relations being known from calcium-binding proteins in animals.more » From A. macrosporus four other low-molecular weight glycoproteins have been isolated which contain sulfur and bind cadmium and copper. The biological significance of these Cd-binding proteins is discussed.« less

Multi-species comparative analysis of the equine ACE gene identifies a highly conserved potential transcription factor binding site in intron 16.

PubMed

Hamilton, Natasha A; Tammen, Imke; Raadsma, Herman W

2013-01-01

Angiotensin converting enzyme (ACE) is essential for control of blood pressure. The human ACE gene contains an intronic Alu indel (I/D) polymorphism that has been associated with variation in serum enzyme levels, although the functional mechanism has not been identified. The polymorphism has also been associated with cardiovascular disease, type II diabetes, renal disease and elite athleticism. We have characterized the ACE gene in horses of breeds selected for differing physical abilities. The equine gene has a similar structure to that of all known mammalian ACE genes. Nine common single nucleotide polymorphisms (SNPs) discovered in pooled DNA were found to be inherited in nine haplotypes. Three of these SNPs were located in intron 16, homologous to that containing the Alu polymorphism in the human. A highly conserved 18 bp sequence, also within that intron, was identified as being a potential binding site for the transcription factors Oct-1, HFH-1 and HNF-3β, and lies within a larger area of higher than normal homology. This putative regulatory element may contribute to regulation of the documented inter-individual variation in human circulating enzyme levels, for which a functional mechanism is yet to be defined. Two equine SNPs occurred within the conserved area in intron 16, although neither of them disrupted the putative binding site. We propose a possible regulatory mechanism of the ACE gene in mammalian species which was previously unknown. This advance will allow further analysis leading to a better understanding of the mechanisms underpinning the associations seen between the human Alu polymorphism and enzyme levels, cardiovascular disease states and elite athleticism.

Multi-Species Comparative Analysis of the Equine ACE Gene Identifies a Highly Conserved Potential Transcription Factor Binding Site in Intron 16

PubMed Central

Hamilton, Natasha A.; Tammen, Imke; Raadsma, Herman W.

2013-01-01

Angiotensin converting enzyme (ACE) is essential for control of blood pressure. The human ACE gene contains an intronic Alu indel (I/D) polymorphism that has been associated with variation in serum enzyme levels, although the functional mechanism has not been identified. The polymorphism has also been associated with cardiovascular disease, type II diabetes, renal disease and elite athleticism. We have characterized the ACE gene in horses of breeds selected for differing physical abilities. The equine gene has a similar structure to that of all known mammalian ACE genes. Nine common single nucleotide polymorphisms (SNPs) discovered in pooled DNA were found to be inherited in nine haplotypes. Three of these SNPs were located in intron 16, homologous to that containing the Alu polymorphism in the human. A highly conserved 18 bp sequence, also within that intron, was identified as being a potential binding site for the transcription factors Oct-1, HFH-1 and HNF-3β, and lies within a larger area of higher than normal homology. This putative regulatory element may contribute to regulation of the documented inter-individual variation in human circulating enzyme levels, for which a functional mechanism is yet to be defined. Two equine SNPs occurred within the conserved area in intron 16, although neither of them disrupted the putative binding site. We propose a possible regulatory mechanism of the ACE gene in mammalian species which was previously unknown. This advance will allow further analysis leading to a better understanding of the mechanisms underpinning the associations seen between the human Alu polymorphism and enzyme levels, cardiovascular disease states and elite athleticism. PMID:23408978

DNA binding and biological studies of some novel water-soluble polymer-copper(II)-phenanthroline complexes.

PubMed

Kumar, Rajendran Senthil; Arunachalam, Sankaralingam; Periasamy, Vaiyapuri Subbarayan; Preethy, Christo Paul; Riyasdeen, Anvarbatcha; Akbarsha, Mohammad Abdulkader

2008-10-01

Some novel water-soluble polymer-copper(II)-phenanthroline complex samples, [Cu(phen)2(BPEI)]Cl(2).4H2O (phen=1,10-phenanthroline, BPEI=branched polyethyleneimine), with different degrees of copper complex content in the polymer chain have been prepared by ligand substitution method in water-ethanol medium and characterized by infrared, UV-visible, EPR spectral and elemental analysis methods. The binding of these complex samples with DNA has been investigated by electronic absorption spectroscopy, emission spectroscopy and gel retardation assay. Electrostatic interactions between DNA molecule and polymer-copper(II) complex molecule containing many high positive charges have been observed. Besides these ionic interactions, van der Waals interactions, hydrogen bonding and other partial intercalation binding modes may also exist in this system. The polymer-copper(II) complex with higher degree of copper complex content was screened for its antimicrobial activity and antitumor activity.

Localization of prefoldin interaction sites in the hyperthermophilic group II chaperonin and correlations between binding rate and protein transfer rate.

PubMed

Zako, Tamotsu; Murase, Yosuke; Iizuka, Ryo; Yoshida, Takao; Kanzaki, Taro; Ide, Naoki; Maeda, Mizuo; Funatsu, Takashi; Yohda, Masafumi

2006-11-17

Prefoldin is a molecular chaperone that captures a protein-folding intermediate and transfers it to a group II chaperonin for correct folding. The manner by which prefoldin interacts with a group II chaperonin is poorly understood. Here, we have examined the prefoldin interaction site in the archaeal group II chaperonin, comparing the interaction of two Thermococcus chaperonins and their mutants with Pyrococcus prefoldin by surface plasmon resonance. We show that the mutations of Lys250 and Lys256 of Thermococcus alpha chaperonin residues to Glu residues increase the affinity to Pyrococcus prefoldin to the level of Thermococcus beta chaperonin and Pyrococcus chaperonin, indicating that their Glu250 and Glu256 residues of the helical protrusion region are responsible for relatively stronger binding to Pyrococcus prefoldin than Thermococcus alpha chaperonin. Since the putative chaperonin binding sites in the distal ends of Pyrococcus prefoldin are rich in basic residues, electrostatic interaction seems to be important for their interaction. The substrate protein transfer rate from prefoldin correlates well with its affinity for chaperonin.

GPU-Based Point Cloud Superpositioning for Structural Comparisons of Protein Binding Sites.

PubMed

Leinweber, Matthias; Fober, Thomas; Freisleben, Bernd

2018-01-01

In this paper, we present a novel approach to solve the labeled point cloud superpositioning problem for performing structural comparisons of protein binding sites. The solution is based on a parallel evolution strategy that operates on large populations and runs on GPU hardware. The proposed evolution strategy reduces the likelihood of getting stuck in a local optimum of the multimodal real-valued optimization problem represented by labeled point cloud superpositioning. The performance of the GPU-based parallel evolution strategy is compared to a previously proposed CPU-based sequential approach for labeled point cloud superpositioning, indicating that the GPU-based parallel evolution strategy leads to qualitatively better results and significantly shorter runtimes, with speed improvements of up to a factor of 1,500 for large populations. Binary classification tests based on the ATP, NADH, and FAD protein subsets of CavBase, a database containing putative binding sites, show average classification rate improvements from about 92 percent (CPU) to 96 percent (GPU). Further experiments indicate that the proposed GPU-based labeled point cloud superpositioning approach can be superior to traditional protein comparison approaches based on sequence alignments.

Sequence characterization of S100A8 gene reveals structural differences of protein and transcriptional factor binding sites in water buffalo and yak.

PubMed

Kathiravan, P; Goyal, S; Kataria, R S; Mishra, B P; Jayakumar, S; Joshi, B K

2011-01-01

The present study was undertaken to characterize the structure of S100A8 gene and its promoter in water buffalo and yak. Sequence data of 2.067 kb, 2.071 kb, and 2.052 kb with respect to complete S100A8 gene including 5' flanking region was generated in river buffalo, swamp buffalo, and yak, respectively. BLAST analysis of coding DNA sequences (CDS) of S100A8 gene revealed 95% homology of buffalo sequence with cattle, 85% with pig and horse, 83% with dog, 72-73% with murines, and around 79% with primates and humans. Phylogenetic analysis of predicted CDS revealed distinct clustering of murines, primates, and domestic animals with bovines and bubalines forming a subcluster among farm animals. In silico translation of predicted CDS revealed a sequence of 89 amino acids with 7 amino acid changes between cattle and buffalo and 2 changes between cattle and yak. The search for Pfam family revealed the N-terminal calcium binding domain and the noncanonical EF hand domain in the carboxy terminus, with more variations being observed in the N-terminal domain among different species. Two amino acid changes observed in carboxy terminal EF hand domain resulted in altered secondary structure of yak S100A8 protein. Analysis of S100A8 gene promoter revealed 14 putative motifs for transcriptional factor binding sites. Two putative motifs viz. C/EBP and v-Myb were found to be absent in swamp buffalo as compared to river buffalo and cattle. Differences in the structure of S100A8 protein and the transcriptional factor binding sites identified in the present study need to be analyzed further for their functional significance in yak and swamp buffalo respectively. Copyright © Taylor & Francis Group, LLC

Copper tolerance in Frankia sp. strain EuI1c involves surface binding and copper transport.

PubMed

Rehan, Medhat; Furnholm, Teal; Finethy, Ryan H; Chu, Feixia; El-Fadly, Gomaah; Tisa, Louis S

2014-09-01

Several Frankia strains have been shown to be copper-tolerant. The mechanism of their copper tolerance was investigated for Frankia sp. strain EuI1c. Copper binding was shown by binding studies. Unusual globular structures were observed on the surface of the bacterium. These globular structures were composed of aggregates containing many relatively smaller "leaf-like" structures. Scanning electron microscopy with energy-dispersive X-ray (SEM-EDAX) analysis of these structures indicated elevated copper and phosphate levels compared to the control cells. Fourier transform infrared spectroscopy (FTIR) analysis indicated an increase in extracellular phosphate on the cell surface of copper-stressed cells. Bioinformatics' analysis of the Frankia sp. strain EuI1c genome revealed five potential cop genes: copA, copZ, copC, copCD, and copD. Experiments with Frankia sp. strain EuI1c using qRT-PCR indicated an increase in messenger RNA (mRNA) levels of the five cop genes upon Cu(2+) stress. After 5 days of Cu(2+) stress, the copA, copZ, copC, copCD, and copD mRNA levels increased 25-, 8-, 18-, 18-, and 25-fold, respectively. The protein profile of Cu(2+)-stressed Frankia sp. strain EuI1c cells revealed the upregulation of a 36.7 kDa protein that was identified as FraEuI1c_1092 (sulfate-binding periplasmic transport protein). Homologues of this gene were only present in the genomes of the Cu(2+)-resistant Frankia strains (EuI1c, DC12, and CN3). These data indicate that copper tolerance by Frankia sp. strain EuI1c involved the binding of copper to the cell surface and transport proteins.

DOE Office of Scientific and Technical Information (OSTI.GOV)

Stojanoski, Vlatko; Sankaran, Banumathi; Prasad, B. V. Venkataram

Due to the paucity of novel antibiotics, colistin has become a last resort antibiotic for treating multidrug resistant bacteria. Colistin acts by binding the lipid A component of lipopolysaccharides and subsequently disrupting the bacterial membrane. The recently identified plasmid-encoded MCR-1 enzyme is the first transmissible colistin resistance determinant and is a cause for concern for the spread of this resistance trait. MCR-1 is a phosphoethanolamine transferase that catalyzes the addition of phosphoethanolamine to lipid A to decrease colistin affinity. The structure of the catalytic domain of MCR-1 at 1.32 Å reveals the active site is similar to that of relatedmore » phosphoethanolamine transferases. The putative nucleophile for catalysis, threonine 285, is phosphorylated in cMCR-1 and a zinc is present at a conserved site in addition to three zincs more peripherally located in the active site. As noted for catalytic domains of other phosphoethanolamine transferases, binding sites for the lipid A and phosphatidylethanolamine substrates are not apparent in the cMCR-1 structure, suggesting that they are present in the membrane domain.« less

Crystal Structure of Phosphatidylglycerophosphatase (PGPase), a Putative Membrane-Bound Lipid Phosphatase, Reveals a Novel Binuclear Metal Binding Site and Two Proton Wires

DOE Office of Scientific and Technical Information (OSTI.GOV)

Kumaran,D.; Bonnano, J.; Burley, S.

2006-01-01

Phosphatidylglycerophosphatase (PGPase), an enzyme involved in lipid metabolism, catalyzes formation of phosphatidylglycerol from phosphatidylglycerophosphate. Phosphatidylglycerol is a multifunctional phospholipid, found in the biological membranes of many organisms. Here, we report the crystal structure of Listeria monocytogenes PGPase at 1.8 Angstroms resolution. PGPase, an all-helical molecule, forms a homotetramer. Each protomer contains an independent active site with two metal ions, Ca{sup 2+} and Mg{sup 2+}, forming a hetero-binuclear center located in a hydrophilic cavity near the surface of the molecule. The binuclear center, conserved ligands, metal-bound water molecules, and an Asp-His dyad form the active site. The catalytic mechanism of thismore » enzyme is likely to proceed via binuclear metal activated nucleophilic water. The binuclear metal-binding active-site environment of this structure should provide insights into substrate binding and metal-dependent catalysis. A long channel with inter-linked linear water chains, termed 'proton wires', is observed at the tetramer interface. Comparison of similar water chain structures in photosynthetic reaction centers (RCs), Cytochrome f, gramicidin, and bacteriorhodopsin, suggests that PGPase may conduct protons via proton wires.« less

Mutational analysis of the antigenomic trans-acting delta ribozyme: the alterations of the middle nucleotides located on the P1 stem.

PubMed Central

Ananvoranich, S; Lafontaine, D A; Perreault, J P

1999-01-01

Our previous report on delta ribozyme cleavage using a trans -acting antigenomic delta ribozyme and a collection of short substrates showed that the middle nucleotides of the P1 stem, the substrate binding site, are essential for the cleavage activity. Here we have further investigated the effect of alterations in the P1 stem on the kinetic and thermodynamic parameters of delta ribozyme cleavage using various ribozyme variants carrying single base mutations at putative positions reported. The kinetic and thermodynamic values obtained in mutational studies of the two middle nucleotides of the P1 stem suggest that the binding and active sites of the delta ribozyme are uniquely formed. Firstly, the substrate and the ribozyme are engaged in the formation of a helix, known as the P1 stem, which may contain a weak hydrogen bond(s) or a bulge. Secondly, a tertiary interaction involving the base moieties in the middle of the P1 stem likely plays a role in defining the chemical environment. As a con-sequence, the active site might form simultaneously or subsequently to the binding site during later steps of the pathway. PMID:10037808

JET2 Viewer: a database of predicted multiple, possibly overlapping, protein-protein interaction sites for PDB structures.

PubMed

Ripoche, Hugues; Laine, Elodie; Ceres, Nicoletta; Carbone, Alessandra

2017-01-04

The database JET2 Viewer, openly accessible at http://www.jet2viewer.upmc.fr/, reports putative protein binding sites for all three-dimensional (3D) structures available in the Protein Data Bank (PDB). This knowledge base was generated by applying the computational method JET 2 at large-scale on more than 20 000 chains. JET 2 strategy yields very precise predictions of interacting surfaces and unravels their evolutionary process and complexity. JET2 Viewer provides an online intelligent display, including interactive 3D visualization of the binding sites mapped onto PDB structures and suitable files recording JET 2 analyses. Predictions were evaluated on more than 15 000 experimentally characterized protein interfaces. This is, to our knowledge, the largest evaluation of a protein binding site prediction method. The overall performance of JET 2 on all interfaces are: Sen = 52.52, PPV = 51.24, Spe = 80.05, Acc = 75.89. The data can be used to foster new strategies for protein-protein interactions modulation and interaction surface redesign. © The Author(s) 2016. Published by Oxford University Press on behalf of Nucleic Acids Research.

FINDSITE-metal: Integrating evolutionary information and machine learning for structure-based metal binding site prediction at the proteome level

PubMed Central

Brylinski, Michal; Skolnick, Jeffrey

2010-01-01

The rapid accumulation of gene sequences, many of which are hypothetical proteins with unknown function, has stimulated the development of accurate computational tools for protein function prediction with evolution/structure-based approaches showing considerable promise. In this paper, we present FINDSITE-metal, a new threading-based method designed specifically to detect metal binding sites in modeled protein structures. Comprehensive benchmarks using different quality protein structures show that weakly homologous protein models provide sufficient structural information for quite accurate annotation by FINDSITE-metal. Combining structure/evolutionary information with machine learning results in highly accurate metal binding annotations; for protein models constructed by TASSER, whose average Cα RMSD from the native structure is 8.9 Å, 59.5% (71.9%) of the best of top five predicted metal locations are within 4 Å (8 Å) from a bound metal in the crystal structure. For most of the targets, multiple metal binding sites are detected with the best predicted binding site at rank 1 and within the top 2 ranks in 65.6% and 83.1% of the cases, respectively. Furthermore, for iron, copper, zinc, calcium and magnesium ions, the binding metal can be predicted with high, typically 70-90%, accuracy. FINDSITE-metal also provides a set of confidence indexes that help assess the reliability of predictions. Finally, we describe the proteome-wide application of FINDSITE-metal that quantifies the metal binding complement of the human proteome. FINDSITE-metal is freely available to the academic community at http://cssb.biology.gatech.edu/findsite-metal/. PMID:21287609

Modeling the Concentrations and Efficiencies for the Interacting Species of Pyropheophorbide Methyl Ester-Copper Association

NASA Astrophysics Data System (ADS)

Al-Omari, S.

2013-07-01

The interaction between pyropheophorbide methyl ester (PPME) and Cu2+ was investigated using UV-vis and fluorescence spectrscopy. Study of the binding interaction between PPME and Cu2+ could contribute to understanding of its pharmacokinetics and pharmacodynamics. Parameters of the static and dynamic fluorescence quenching of PPME-Cu2+ association were calculated at different temperatures. For binding site of 1:1 at 299 K, the static binding constant (kS), the static isosbestic concentration (CS{ iso}), the dynamic binding constant (kD), and the dynamic isosbestic concentration (CD{ iso }) are, respectively, 61 M-1, 0.0164 M, 75 M-1, and 0.0133 M. The concentrations and efficiencies of the intermediates species were modeled. Satisfactory correspondence between the experimental and calculated results was found.

Novel Yeast-based Strategy Unveils Antagonist Binding Regions on the Nuclear Xenobiotic Receptor PXR*

PubMed Central

Li, Hao; Redinbo, Matthew R.; Venkatesh, Madhukumar; Ekins, Sean; Chaudhry, Anik; Bloch, Nicolin; Negassa, Abdissa; Mukherjee, Paromita; Kalpana, Ganjam; Mani, Sridhar

2013-01-01

The pregnane X receptor (PXR) is a master regulator of xenobiotic metabolism, and its activity is critical toward understanding the pathophysiology of several diseases, including inflammation, cancer, and steatosis. Previous studies have demonstrated that ketoconazole binds to ligand-activated PXR and antagonizes receptor control of gene expression. Structure-function as well as computational docking analysis suggested a putative binding region containing critical charge clamp residues Gln-272, and Phe-264 on the AF-2 surface of PXR. To define the antagonist binding surface(s) of PXR, we developed a novel assay to identify key amino acid residues on PXR based on a yeast two-hybrid screen that examined mutant forms of PXR. This screen identified multiple “gain-of-function” mutants that were “resistant” to the PXR antagonist effects of ketoconazole. We then compared our screen results identifying key PXR residues to those predicted by computational methods. Of 15 potential or putative binding residues based on docking, we identified three residues in the yeast screen that were then systematically verified to functionally interact with ketoconazole using mammalian assays. Among the residues confirmed by our study was Ser-208, which is on the opposite side of the protein from the AF-2 region critical for receptor regulation. The identification of new locations for antagonist binding on the surface or buried in PXR indicates novel aspects to the mechanism of receptor antagonism. These results significantly expand our understanding of antagonist binding sites on the surface of PXR and suggest new avenues to regulate this receptor for clinical applications. PMID:23525103

Challenging the Metallothionein (MT) Gene of Biomphalaria glabrata: Unexpected Response Patterns Due to Cadmium Exposure and Temperature Stress.

PubMed

Niederwanger, Michael; Dvorak, Martin; Schnegg, Raimund; Pedrini-Martha, Veronika; Bacher, Katharina; Bidoli, Massimo; Dallinger, Reinhard

2017-08-11

Metallothioneins (MTs) are low-molecular-mass, cysteine-rich, metal binding proteins. In most animal species, they are involved in metal homeostasis and detoxification, and provide protection from oxidative stress. Gastropod MTs are highly diversified, exhibiting unique features and adaptations like metal specificity and multiplications of their metal binding domains. Here, we show that the MT gene of Biomphalaria glabrata , one of the largest MT genes identified so far, is composed in a unique way. The encoding for an MT protein has a three-domain structure and a C-terminal, Cys-rich extension. Using a bioinformatic approach involving structural and in silico analysis of putative transcription factor binding sites (TFBs), we found that this MT gene consists of five exons and four introns. It exhibits a regulatory promoter region containing three metal-responsive elements (MREs) and several TFBs with putative involvement in environmental stress response, and regulation of gene expression. Quantitative real-time polymerase chain reaction (qRT-PCR) data indicate that the MT gene is not inducible by cadmium (Cd) nor by temperature challenges (heat and cold), despite significant Cd uptake within the midgut gland and the high Cd tolerance of metal-exposed snails.

Challenging the Metallothionein (MT) Gene of Biomphalaria glabrata: Unexpected Response Patterns Due to Cadmium Exposure and Temperature Stress

PubMed Central

Dvorak, Martin; Schnegg, Raimund; Pedrini-Martha, Veronika; Bacher, Katharina; Bidoli, Massimo; Dallinger, Reinhard

2017-01-01

Metallothioneins (MTs) are low-molecular-mass, cysteine-rich, metal binding proteins. In most animal species, they are involved in metal homeostasis and detoxification, and provide protection from oxidative stress. Gastropod MTs are highly diversified, exhibiting unique features and adaptations like metal specificity and multiplications of their metal binding domains. Here, we show that the MT gene of Biomphalaria glabrata, one of the largest MT genes identified so far, is composed in a unique way. The encoding for an MT protein has a three-domain structure and a C-terminal, Cys-rich extension. Using a bioinformatic approach involving structural and in silico analysis of putative transcription factor binding sites (TFBs), we found that this MT gene consists of five exons and four introns. It exhibits a regulatory promoter region containing three metal-responsive elements (MREs) and several TFBs with putative involvement in environmental stress response, and regulation of gene expression. Quantitative real-time polymerase chain reaction (qRT-PCR) data indicate that the MT gene is not inducible by cadmium (Cd) nor by temperature challenges (heat and cold), despite significant Cd uptake within the midgut gland and the high Cd tolerance of metal-exposed snails. PMID:28800079

Transposable Elements and DNA Methylation Create in Embryonic Stem Cells Human-Specific Regulatory Sequences Associated with Distal Enhancers and Noncoding RNAs

PubMed Central

Glinsky, Gennadi V.

2015-01-01

Despite significant progress in the structural and functional characterization of the human genome, understanding of the mechanisms underlying the genetic basis of human phenotypic uniqueness remains limited. Here, I report that transposable element-derived sequences, most notably LTR7/HERV-H, LTR5_Hs, and L1HS, harbor 99.8% of the candidate human-specific regulatory loci (HSRL) with putative transcription factor-binding sites in the genome of human embryonic stem cells (hESC). A total of 4,094 candidate HSRL display selective and site-specific binding of critical regulators (NANOG [Nanog homeobox], POU5F1 [POU class 5 homeobox 1], CCCTC-binding factor [CTCF], Lamin B1), and are preferentially located within the matrix of transcriptionally active DNA segments that are hypermethylated in hESC. hESC-specific NANOG-binding sites are enriched near the protein-coding genes regulating brain size, pluripotency long noncoding RNAs, hESC enhancers, and 5-hydroxymethylcytosine-harboring regions immediately adjacent to binding sites. Sequences of only 4.3% of hESC-specific NANOG-binding sites are present in Neanderthals’ genome, suggesting that a majority of these regulatory elements emerged in Modern Humans. Comparisons of estimated creation rates of novel TF-binding sites revealed that there was 49.7-fold acceleration of creation rates of NANOG-binding sites in genomes of Chimpanzees compared with the mouse genomes and further 5.7-fold acceleration in genomes of Modern Humans compared with the Chimpanzees genomes. Preliminary estimates suggest that emergence of one novel NANOG-binding site detectable in hESC required 466 years of evolution. Pathway analysis of coding genes that have hESC-specific NANOG-binding sites within gene bodies or near gene boundaries revealed their association with physiological development and functions of nervous and cardiovascular systems, embryonic development, behavior, as well as development of a diverse spectrum of pathological conditions such as cancer, diseases of cardiovascular and reproductive systems, metabolic diseases, multiple neurological and psychological disorders. A proximity placement model is proposed explaining how a 33–47% excess of NANOG, CTCF, and POU5F1 proteins immobilized on a DNA scaffold may play a functional role at distal regulatory elements. PMID:25956794

Methanobactin: a copper binding compound having antibiotic and antioxidant activity isolated from methanotrophic bacteria

DOEpatents

DiSpirito, Alan A [Ames, IA; Zahn, James A [Harbor Beach, MI; Graham, David W [Lawrence, KS; Kim, Hyung J [St. Paul, MN; Alterman, Michail [Lawrence, KS; Larive, Cynthia [Lawrence, KS

2007-04-03

A means and method for treating bacterial infection, providing antioxidant activity, and chelating copper using a copper binding compound produced by methanotrophic bacteria is described. The compound, known as methanobactin, is the first of a new class of antibiotics having gram-positive activity. Methanobactin has been sequenced, and its structural formula determined.

Selective Capture of Cesium and Thallium from Natural Waters and Simulated Wastes with Copper Ferrocyanide Functionalized Mesoporous Silica

DOE Office of Scientific and Technical Information (OSTI.GOV)

Sangvanich, Thanapon; Sukwarotwat, Vichaya; Wiacek, Robert J.

2010-10-15

Copper(II) ferrocyanide immobilized inside mesoporous silica MCM-41 supports (Cu-FC-EDA-SAMMSTM) has been evaluated against iron(III) hexacyanoferrate(II) (insoluble Prussian blue) for the sorption of cesium (Cs+) and thallium (Tl+) from natural waters and simulated wastes. The affinities (in term of distribution coefficients, Kd) of both sorbents for Cs and Tl were measured as a function of solution pH, competing cations, and matrices. For the entire pH studied (pH 0.1 to 7.3), Cu-FC-EDA-SAMMS had higher affinities for Cs and Tl (one to two orders of magnitude higher Kd) than Prussian blue and was less negatively impacted by the solution pH, competing cations, andmore » matrices. The adsorption isotherms and kinetics of the two sorbents for Cs and/or Tl were also determined in seawater and simulated acid and alkaline wastes. SAMMS outperformed Prussian blue in terms of maximum adsorption capacity (e.g., 21.7 versus 2.6 mg Cs/g in acid waste stimulant, pH 1.1), and rate (e.g., over 95 wt% of Cs was removed after 2 minutes with SAMMS, while only 75 wt% was removed with Prussian blue). The lower affinity, capacity, and rate of Cs and Tl sorption on Prussian blue than those on Cu-FC-EDA-SAMMS were attributed to the molecular pore sizes, which restrict mass transport, and the insoluble Cs abducts of the Prussian blue, which restrict the ability of neighboring binding sites to further bind Cs ions. On the other hand, the large pores of SAMMS not only enable faster diffusion and faster binding chemistry, but they also allow isolation of binding sites so that one Cs binding event does not impact further Cs binding. In addition, iron (Fe) dissolved from insoluble Prussian blue over 10-fold of that from Cu-FC-EDA-SAMMS after 24 hours of contact time, indicating poorer material stability of Prussian blue.« less

Identification of polyproline II regions derived from the proline-rich nuclear receptor coactivators PNRC and PNRC2: new insights for ERα coactivator interactions.

PubMed

Byrne, C; Miclet, E; Broutin, I; Gallo, D; Pelekanou, V; Kampa, M; Castanas, E; Leclercq, G; Jacquot, Y

2013-10-01

Protein-protein interactions are crucial for signal transductions required for cell differentiation and proliferation. Their modulation is therefore key to the development of therapeutic alternatives, particularly in the context of cancer. According to literature data, the polyproline-rich nuclear receptor coactivators PNRC and PNRC2 interact with estrogen receptor (ERα) through their PxxP SH3-binding motifs. In a search to identify the molecular features governing this interaction, we explored using electronic circular dichroism (ECD) spectroscopy and molecular dynamics (MD) calculations, the capacity of a range of putative biologically active peptides derived from these proteins and containing this PxxP motif(s) to form polyproline II (PPII) domains. An additional more exhaustive structural study on a lead PPII peptide was also performed using 2D nuclear magnetic resonance (NMR) spectroscopy. With the exception of one of all the investigated peptides (PNRC-D), binding assays failed to detect any affinity for Grb2 SH3 domains, suggesting that PPII motifs issued from Grb2 antagonists have a binding mode distinct from those derived from Grb2 agonists. Instead, the peptides revealed a competitive binding ability against a synthetic peptide (ERα17p) with a putative PPII-cognate domain located within a coregulator recruitment region of ERα (AF-2 site). Our work, which constitutes the first structure-related interaction study concerning PNRC and PNRC2, supports not only the existence of PxxP-induced PPII sequences in these coregulators, but also confirms the presence of a PPII recognition site in the AF-2 of the steroid receptor ERα, a region important for transcription regulation. © 2013 Wiley Periodicals, Inc.

One precursor, three apolipoproteins: the relationship between two crustacean lipoproteins, the large discoidal lipoprotein and the high density lipoprotein/β-glucan binding protein.

PubMed

Stieb, Stefanie; Roth, Ziv; Dal Magro, Christina; Fischer, Sabine; Butz, Eric; Sagi, Amir; Khalaila, Isam; Lieb, Bernhard; Schenk, Sven; Hoeger, Ulrich

2014-12-01

The novel discoidal lipoprotein (dLp) recently detected in the crayfish, differs from other crustacean lipoproteins in its large size, apoprotein composition and high lipid binding capacity, We identified the dLp sequence by transcriptome analyses of the hepatopancreas and mass spectrometry. Further de novo assembly of the NGS data followed by BLAST searches using the sequence of the high density lipoprotein/1-glucan binding protein (HDL-BGBP) of Astacus leptodactylus as query revealed a putative precursor molecule with an open reading frame of 14.7 kb and a deduced primary structure of 4889 amino acids. The presence of an N-terminal lipid bind- ing domain and a DUF 1943 domain suggests the relationship with the large lipid transfer proteins. Two-putative dibasic furin cleavage sites were identified bordering the sequence of the HDL-BGBP. When subjected to mass spectroscopic analyses, tryptic peptides of the large apoprotein of dLp matched the N-terminal part of the precursor, while the peptides obtained for its small apoprotein matched the C-terminal part. Repeating the analysis in the prawn Macrobrachium rosenbergii revealed a similar protein with identical domain architecture suggesting that our findings do not represent an isolated instance. Our results indicate that the above three apolipoproteins (i.e HDL-BGBP and both the large and the small subunit of dLp) are translated as a large precursor. Cleavage at the furin type sites releases two subunits forming a heterodimeric dLP particle, while the remaining part forms an HDL-BGBP whose relationship with other lipoproteins as well as specific functions are yet to be elucidated.

Non-B-DNA structures on the interferon-beta promoter?

PubMed

Robbe, K; Bonnefoy, E

1998-01-01

The high mobility group (HMG) I protein intervenes as an essential factor during the virus induced expression of the interferon-beta (IFN-beta) gene. It is a non-histone chromatine associated protein that has the dual capacity of binding to a non-B-DNA structure such as cruciform-DNA as well as to AT rich B-DNA sequences. In this work we compare the binding affinity of HMGI for a synthetic cruciform-DNA to its binding affinity for the HMGI-binding-site present in the positive regulatory domain II (PRDII) of the IFN-beta promoter. Using gel retardation experiments, we show that HMGI protein binds with at least ten times more affinity to the synthetic cruciform-DNA structure than to the PRDII B-DNA sequence. DNA hairpin sequences are present in both the human and the murine PRDII-DNAs. We discuss in this work the presence of, yet putative, non-B-DNA structures in the IFN-beta promoter.

Structural Basis for Sialoglycan Binding by the Streptococcus sanguinis SrpA Adhesin*♦

PubMed Central

Bensing, Barbara A.; Loukachevitch, Lioudmila V.; McCulloch, Kathryn M.; Yu, Hai; Vann, Kendra R.; Wawrzak, Zdzislaw; Anderson, Spencer; Chen, Xi; Sullam, Paul M.; Iverson, T. M.

2016-01-01

Streptococcus sanguinis is a leading cause of infective endocarditis, a life-threatening infection of the cardiovascular system. An important interaction in the pathogenesis of infective endocarditis is attachment of the organisms to host platelets. S. sanguinis expresses a serine-rich repeat adhesin, SrpA, similar in sequence to platelet-binding adhesins associated with increased virulence in this disease. In this study, we determined the first crystal structure of the putative binding region of SrpA (SrpABR) both unliganded and in complex with a synthetic disaccharide ligand at 1.8 and 2.0 Å resolution, respectively. We identified a conserved Thr-Arg motif that orients the sialic acid moiety and is required for binding to platelet monolayers. Furthermore, we propose that sequence insertions in closely related family members contribute to the modulation of structural and functional properties, including the quaternary structure, the tertiary structure, and the ligand-binding site. PMID:26833566

Copper removal by algal biomass: biosorbents characterization and equilibrium modelling.

PubMed

Vilar, Vítor J P; Botelho, Cidália M S; Pinheiro, José P S; Domingos, Rute F; Boaventura, Rui A R

2009-04-30

The general principles of Cu(II) binding to algal waste from agar extraction, composite material and algae Gelidium, and different modelling approaches, are discussed. FTIR analyses provided a detailed description of the possible binding groups present in the biosorbents, as carboxylic groups (D-glucuronic and pyruvic acids), hydroxyl groups (cellulose, agar and floridean starch) and sulfonate groups (sulphated galactans). Potentiometric acid-base titrations showed a heterogeneous distribution of two major binding groups, carboxyl and hydroxyl, following the quasi-Gaussian affinity constant distribution suggested by Sips, which permitted to estimate the maximum amount of acid functional groups (0.36, 0.25 and 0.1 mmol g(-1)) and proton binding parameters (pK(H)=5.0, 5.3 and 4.4; m(H)=0.43, 0.37, 0.33), respectively for algae Gelidium, algal waste and composite material. A non-ideal, semi-empirical, thermodynamically consistent (NICCA) isotherm fitted better the experimental ion binding data for different pH values and copper concentrations, considering only the acid functional groups, than the discrete model. Values of pK(M) (3.2; 3.6 and 3.3), n(M) (0.98, 0.91, 1.0) and p (0.67, 0.53 and 0.43) were obtained, respectively for algae Gelidium, algal waste and composite material. NICCA model reflects the complex macromolecular systems that take part in biosorption considering the heterogeneity of the biosorbent, the competition between protons and metals ions to the binding sites and the stoichiometry for different ions.

Crystal Structures of Copper-depleted and Copper-bound Fungal Pro-tyrosinase

PubMed Central

Fujieda, Nobutaka; Yabuta, Shintaro; Ikeda, Takuya; Oyama, Takuji; Muraki, Norifumi; Kurisu, Genji; Itoh, Shinobu

2013-01-01

Tyrosinase, a dinuclear copper monooxygenase/oxidase, plays a crucial role in the melanin pigment biosynthesis. The structure and functions of tyrosinase have so far been studied extensively, but the post-translational maturation process from the pro-form to the active form has been less explored. In this study, we provide the crystal structures of Aspergillus oryzae full-length pro-tyrosinase in the holo- and the apo-forms at 1.39 and 2.05 Å resolution, respectively, revealing that Phe513 on the C-terminal domain is accommodated in the substrate-binding site as a substrate analog to protect the dicopper active site from substrate access (proteolytic cleavage of the C-terminal domain or deformation of the C-terminal domain by acid treatment transforms the pro-tyrosinase to the active enzyme (Fujieda, N., Murata, M., Yabuta, S., Ikeda, T., Shimokawa, C., Nakamura, Y., Hata, Y., and Itoh, S. (2012) ChemBioChem. 13, 193–201 and Fujieda, N., Murata, M., Yabuta, S., Ikeda, T., Shimokawa, C., Nakamura, Y., Hata, Yl, and Itoh, S. (2013) J. Biol. Inorg. Chem. 18, 19–26). Detailed crystallographic analysis and structure-based mutational studies have shown that the copper incorporation into the active site is governed by three cysteines as follows: Cys92, which is covalently bound to His94 via an unusual thioether linkage in the holo-form, and Cys522 and Cys525 of the CXXC motif located on the C-terminal domain. Molecular mechanisms of the maturation processes of fungal tyrosinase involving the accommodation of the dinuclear copper unit, the post-translational His-Cys thioether cross-linkage formation, and the proteolytic C-terminal cleavage to produce the active tyrosinase have been discussed on the basis of the detailed structural information. PMID:23749993

The Hydrogenase Activity of the Molybdenum/Copper-containing Carbon Monoxide Dehydrogenase of Oligotropha carboxidovorans*

PubMed Central

Wilcoxen, Jarett; Hille, Russ

2013-01-01

The reaction of the air-tolerant CO dehydrogenase from Oligotropha carboxidovorans with H2 has been examined. Like the Ni-Fe CO dehydrogenase, the enzyme can be reduced by H2 with a limiting rate constant of 5.3 s−1 and a dissociation constant Kd of 525 μm; both kred and kred/Kd, reflecting the breakdown of the Michaelis complex and the reaction of free enzyme with free substrate in the low [S] regime, respectively, are largely pH-independent. During the reaction with H2, a new EPR signal arising from the Mo/Cu-containing active site of the enzyme is observed which is distinct from the signal seen when the enzyme is reduced by CO, with greater g anisotropy and larger hyperfine coupling to the active site 63,65Cu. The signal also exhibits hyperfine coupling to at least two solvent-exchangeable protons of bound substrate that are rapidly exchanged with solvent. Proton coupling is also evident in the EPR signal seen with the dithionite-reduced native enzyme, and this coupling is lost in the presence of bicarbonate. We attribute the coupled protons in the dithionite-reduced enzyme to coordinated water at the copper site in the native enzyme and conclude that bicarbonate is able to displace this water from the copper coordination sphere. On the basis of our results, a mechanism for H2 oxidation is proposed which involves initial binding of H2 to the copper of the binuclear center, displacing the bound water, followed by sequential deprotonation through a copper-hydride intermediate to reduce the binuclear center. PMID:24165123

Incorporating evolution of transcription factor binding sites into annotated alignments.

PubMed

Bais, Abha S; Grossmann, Stefen; Vingron, Martin

2007-08-01

Identifying transcription factor binding sites (TFBSs) is essential to elucidate putative regulatory mechanisms. A common strategy is to combine cross-species conservation with single sequence TFBS annotation to yield "conserved TFBSs". Most current methods in this field adopt a multi-step approach that segregates the two aspects. Again, it is widely accepted that the evolutionary dynamics of binding sites differ from those of the surrounding sequence. Hence, it is desirable to have an approach that explicitly takes this factor into account. Although a plethora of approaches have been proposed for the prediction of conserved TFBSs, very few explicitly model TFBS evolutionary properties, while additionally being multi-step. Recently, we introduced a novel approach to simultaneously align and annotate conserved TFBSs in a pair of sequences. Building upon the standard Smith-Waterman algorithm for local alignments, SimAnn introduces additional states for profiles to output extended alignments or annotated alignments. That is, alignments with parts annotated as gaplessly aligned TFBSs (pair-profile hits)are generated. Moreover,the pair- profile related parameters are derived in a sound statistical framework. In this article, we extend this approach to explicitly incorporate evolution of binding sites in the SimAnn framework. We demonstrate the extension in the theoretical derivations through two position-specific evolutionary models, previously used for modelling TFBS evolution. In a simulated setting, we provide a proof of concept that the approach works given the underlying assumptions,as compared to the original work. Finally, using a real dataset of experimentally verified binding sites in human-mouse sequence pairs,we compare the new approach (eSimAnn) to an existing multi-step tool that also considers TFBS evolution. Although it is widely accepted that binding sites evolve differently from the surrounding sequences, most comparative TFBS identification methods do not explicitly consider this.Additionally, prediction of conserved binding sites is carried out in a multi-step approach that segregates alignment from TFBS annotation. In this paper, we demonstrate how the simultaneous alignment and annotation approach of SimAnn can be further extended to incorporate TFBS evolutionary relationships. We study how alignments and binding site predictions interplay at varying evolutionary distances and for various profile qualities.

ChIPpeakAnno: a Bioconductor package to annotate ChIP-seq and ChIP-chip data

PubMed Central

2010-01-01

Background Chromatin immunoprecipitation (ChIP) followed by high-throughput sequencing (ChIP-seq) or ChIP followed by genome tiling array analysis (ChIP-chip) have become standard technologies for genome-wide identification of DNA-binding protein target sites. A number of algorithms have been developed in parallel that allow identification of binding sites from ChIP-seq or ChIP-chip datasets and subsequent visualization in the University of California Santa Cruz (UCSC) Genome Browser as custom annotation tracks. However, summarizing these tracks can be a daunting task, particularly if there are a large number of binding sites or the binding sites are distributed widely across the genome. Results We have developed ChIPpeakAnno as a Bioconductor package within the statistical programming environment R to facilitate batch annotation of enriched peaks identified from ChIP-seq, ChIP-chip, cap analysis of gene expression (CAGE) or any experiments resulting in a large number of enriched genomic regions. The binding sites annotated with ChIPpeakAnno can be viewed easily as a table, a pie chart or plotted in histogram form, i.e., the distribution of distances to the nearest genes for each set of peaks. In addition, we have implemented functionalities for determining the significance of overlap between replicates or binding sites among transcription factors within a complex, and for drawing Venn diagrams to visualize the extent of the overlap between replicates. Furthermore, the package includes functionalities to retrieve sequences flanking putative binding sites for PCR amplification, cloning, or motif discovery, and to identify Gene Ontology (GO) terms associated with adjacent genes. Conclusions ChIPpeakAnno enables batch annotation of the binding sites identified from ChIP-seq, ChIP-chip, CAGE or any technology that results in a large number of enriched genomic regions within the statistical programming environment R. Allowing users to pass their own annotation data such as a different Chromatin immunoprecipitation (ChIP) preparation and a dataset from literature, or existing annotation packages, such as GenomicFeatures and BSgenome, provides flexibility. Tight integration to the biomaRt package enables up-to-date annotation retrieval from the BioMart database. PMID:20459804

Learning from oligosaccharide soaks of crystals of an AA13 lytic polysaccharide monooxygenase: crystal packing, ligand binding and active-site disorder.

PubMed

Frandsen, Kristian E H; Poulsen, Jens Christian Navarro; Tovborg, Morten; Johansen, Katja S; Lo Leggio, Leila

2017-01-01

Lytic polysaccharide monooxygenases (LPMOs) are a class of copper-dependent enzymes discovered within the last ten years. They oxidatively cleave polysaccharides (chitin, lignocellulose, hemicellulose and starch-derived), presumably making recalcitrant substrates accessible to glycoside hydrolases. Recently, the first crystal structure of an LPMO-substrate complex was reported, giving insights into the interaction of LPMOs with β-linked substrates (Frandsen et al., 2016). The LPMOs acting on α-linked glycosidic bonds (family AA13) display binding surfaces that are quite different from those of LPMOs that act on β-linked glycosidic bonds (families AA9-AA11), as revealed from the first determined structure (Lo Leggio et al., 2015), and thus presumably the AA13s interact with their substrate in a distinct fashion. Here, several new structures of the same AA13 enzyme, Aspergillus oryzae AA13, are presented. Crystals obtained in the presence of high zinc-ion concentrations were used, as they can be obtained more reproducibly than those used to refine the deposited copper-containing structure. One structure with an ordered zinc-bound active site was solved at 1.65 Å resolution, and three structures from crystals soaked with maltooligosaccharides in solutions devoid of zinc ions were solved at resolutions of up to 1.10 Å. Despite similar unit-cell parameters, small rearrangements in the crystal packing occur when the crystals are depleted of zinc ions, resulting in a more occluded substrate-binding surface. In two of the three structures maltooligosaccharide ligands are bound, but not at the active site. Two of the structures presented show a His-ligand conformation that is incompatible with metal-ion binding. In one of these structures this conformation is the principal one (80% occupancy), giving a rare atomic resolution view of a substantially misfolded enzyme that is presumably rendered inactive.

Divergent assembly mechanisms of the manganese/iron cofactors in R2lox and R2c proteins.

PubMed

Kutin, Yuri; Srinivas, Vivek; Fritz, Matthieu; Kositzki, Ramona; Shafaat, Hannah S; Birrell, James; Bill, Eckhard; Haumann, Michael; Lubitz, Wolfgang; Högbom, Martin; Griese, Julia J; Cox, Nicholas

2016-09-01

A manganese/iron cofactor which performs multi-electron oxidative chemistry is found in two classes of ferritin-like proteins, the small subunit (R2) of class Ic ribonucleotide reductase (R2c) and the R2-like ligand-binding oxidase (R2lox). It is unclear how a heterodimeric Mn/Fe metallocofactor is assembled in these two related proteins as opposed to a homodimeric Fe/Fe cofactor, especially considering the structural similarity and proximity of the two metal-binding sites in both protein scaffolds and the similar first coordination sphere ligand preferences of Mn II and Fe II . Using EPR and Mössbauer spectroscopies as well as X-ray anomalous dispersion, we examined metal loading and cofactor activation of both proteins in vitro (in solution). We find divergent cofactor assembly mechanisms for the two systems. In both cases, excess Mn II promotes heterobimetallic cofactor assembly. In the absence of Fe II , R2c cooperatively binds Mn II at both metal sites, whereas R2lox does not readily bind Mn II at either site. Heterometallic cofactor assembly is favored at substoichiometric Fe II concentrations in R2lox. Fe II and Mn II likely bind to the protein in a stepwise fashion, with Fe II binding to site 2 initiating cofactor assembly. In R2c, however, heterometallic assembly is presumably achieved by the displacement of Mn II by Fe II at site 2. The divergent metal loading mechanisms are correlated with the putative in vivo functions of R2c and R2lox, and most likely with the intracellular Mn II /Fe II concentrations in the host organisms from which they were isolated. Copyright © 2016 Elsevier Inc. All rights reserved.

Agonist and antagonist actions of antipsychotic agents at 5-HT1A receptors: a [35S]GTPgammaS binding study.

PubMed

Newman-Tancredi, A; Gavaudan, S; Conte, C; Chaput, C; Touzard, M; Verrièle, L; Audinot, V; Millan, M J

1998-08-21

Recombinant human (h) 5-HT1A receptor-mediated G-protein activation was characterised in membranes of transfected Chinese hamster ovary (CHO) cells by use of guanosine-5'-O-(3-[35S]thio)-triphosphate ([35S]GTPgammaS binding). The potency and efficacy of 21 5-HT receptor agonists and antagonists was determined. The agonists, 5-CT (carboxamidotryptamine) and flesinoxan displayed high affinity (subnanomolar Ki values) and high efficacy (Emax > 90%, relative to 5-HT = 100%). In contrast, ipsapirone, zalospirone and buspirone displayed partial agonist activity. EC50s for agonist stimulation of [35S]GTPgammaS binding correlated well with Ki values from competition binding (r = +0.99). Among the compounds tested for antagonist activity, methiothepin and (+)butaclamol exhibited 'inverse agonist' behaviour, inhibiting basal [35S]GTPgammaS binding. The actions of 17 antipsychotic agents were investigated. Clozapine and several putatively 'atypical' antipsychotic agents, including ziprasidone, quetiapine and tiospirone, exhibited partial agonist activity and marked affinity at h5-HT1A receptors, similar to their affinity at hD2 dopamine receptors. In contrast, risperidone and sertindole displayed low affinity at h5-HT1A receptors and behaved as 'neutral' antagonists, inhibiting 5-HT-stimulated [35S]GTPgammaS binding. Likewise the 'typical' neuroleptics, haloperidol, pimozide, raclopride and chlorpromazine exhibited relatively low affinity and 'neutral' antagonist activity at h5-HT1A receptors with Ki values which correlated with their respective Kb values. The present data show that (i) [35S]GTPgammaS binding is an effective method to evaluate the efficacy and potency of agonists and antagonists at recombinant human 5-HT1A receptors. (ii) Like clozapine, several putatively 'atypical' antipsychotic drugs display balanced serotonin h5-HT1A/dopamine hD2 receptor affinity and partial agonist activity at h5-HT1A receptors. (iii) Several 'typical' and some putatively 'atypical' antipsychotic agents displayed antagonist properties at h5-HT1A sites with generally much lower affinity than at hD2 dopamine receptors. It is suggested that agonist activity at 5-HT1A receptors may be of utility for certain antipsychotic agents.

Characterization and functional analysis of the Paralichthys olivaceus prdm1 gene promoter.

PubMed

Li, Peizhen; Wang, Bo; Cao, Dandan; Liu, Yuezhong; Zhang, Quanqi; Wang, Xubo

2017-10-01

PR domain containing protein 1 (Prdm1) is a transcriptional repressor identified in various species and plays multiple important roles in immune response and embryonic development. However, little is known about the transcriptional regulation of the prdm1 gene. This study aims to characterize the promoter of Paralichthys olivaceus prdm1 (Po-prdm1) gene and determine the regulatory mechanism of Po-prdm1 expression. A 2000bp-long 5'-flanking region (translation initiation site designated as +1) of the Po-prdm1 gene was isolated and characterized. The regulatory elements in this fragment were then investigated and many putative transcription factor (TF) binding sites involved in immunity and multiple tissue development were identified. A 5'-deletion analysis was then conducted, and the ability of the deletion mutants to promote luciferase and green fluorescent protein (GFP) expression in a flounder gill cell line was examined. The results revealed that the minimal promoter is located in the region between -446 and -13bp, and the region between -1415 and -13bp enhanced the promoter activity. Site-directed mutation analysis was subsequently performed on the putative regulatory elements sites, and the results indicated that FOXP1, MSX and BCL6 binding sites play negative functional roles in the regulation of the Po-prdm1 expression in FG cells. In vivo analysis demonstrated that a GFP reporter gene containing 1.4kb-long promoter fragment (-1415/-13) was expressed in the head and trunk muscle fibres of transient transgenic zebrafish embryos. Our study provided the basic information for the exploration of Po-prdm1 regulation and expression. Copyright © 2017 Elsevier Inc. All rights reserved.

Prediction of protein-protein interaction sites using electrostatic desolvation profiles.

PubMed

Fiorucci, Sébastien; Zacharias, Martin

2010-05-19

Protein-protein complex formation involves removal of water from the interface region. Surface regions with a small free energy penalty for water removal or desolvation may correspond to preferred interaction sites. A method to calculate the electrostatic free energy of placing a neutral low-dielectric probe at various protein surface positions has been designed and applied to characterize putative interaction sites. Based on solutions of the finite-difference Poisson equation, this method also includes long-range electrostatic contributions and the protein solvent boundary shape in contrast to accessible-surface-area-based solvation energies. Calculations on a large set of proteins indicate that in many cases (>90%), the known binding site overlaps with one of the six regions of lowest electrostatic desolvation penalty (overlap with the lowest desolvation region for 48% of proteins). Since the onset of electrostatic desolvation occurs even before direct protein-protein contact formation, it may help guide proteins toward the binding region in the final stage of complex formation. It is interesting that the probe desolvation properties associated with residue types were found to depend to some degree on whether the residue was outside of or part of a binding site. The probe desolvation penalty was on average smaller if the residue was part of a binding site compared to other surface locations. Applications to several antigen-antibody complexes demonstrated that the approach might be useful not only to predict protein interaction sites in general but to map potential antigenic epitopes on protein surfaces. Copyright (c) 2010 Biophysical Society. Published by Elsevier Inc. All rights reserved.

Atox1 Contains Positive Residues That Mediate Membrane Association and Aid Subsequent Copper Loading

PubMed Central

Flores, Adrian G.; Unger, Vinzenz M.

2013-01-01

Copper chaperones bind intracellular copper and ensure proper trafficking to downstream targets via protein-protein interactions. In contrast to the mechanisms of copper binding and transfer to downstream targets, the mechanisms of initial copper loading of the chaperones are largely unknown. Here we demonstrate that antioxidant protein 1 (Atox1 in human cells), the principal cellular copper chaperone responsible for delivery of copper to the secretory pathway, possesses the ability to interact with negatively charged lipid headgroups via distinct surface lysine residues. Moreover, loss of these residues lowers the efficiency of copper loading of Atox1 in vivo, suggesting that the membrane may play a scaffolding role in copper distribution to Atox1. These findings complement the recent discovery that the membrane also facilitates copper loading of the copper chaperone for superoxide dismutase 1 and provide further support for the emerging paradigm that the membrane bilayer plays a central role in cellular copper acquisition and distribution. PMID:24036897

Atox1 contains positive residues that mediate membrane association and aid subsequent copper loading.

PubMed

Flores, Adrian G; Unger, Vinzenz M

2013-12-01

Copper chaperones bind intracellular copper and ensure proper trafficking to downstream targets via protein-protein interactions. In contrast to the mechanisms of copper binding and transfer to downstream targets, the mechanisms of initial copper loading of the chaperones are largely unknown. Here, we demonstrate that antioxidant protein 1 (Atox1 in human cells), the principal cellular copper chaperone responsible for delivery of copper to the secretory pathway, possesses the ability to interact with negatively charged lipid headgroups via distinct surface lysine residues. Moreover, loss of these residues lowers the efficiency of copper loading of Atox1 in vivo, suggesting that the membrane may play a scaffolding role in copper distribution to Atox1. These findings complement the recent discovery that the membrane also facilitates copper loading of the copper chaperone for superoxide dismutase 1 and provide further support for the emerging paradigm that the membrane bilayer plays a central role in cellular copper acquisition and distribution.

The distal short consensus repeats 1 and 2 of the membrane cofactor protein CD46 and their distance from the cell membrane determine productive entry of species B adenovirus serotype 35.

PubMed

Fleischli, Christoph; Verhaagh, Sandra; Havenga, Menzo; Sirena, Dominique; Schaffner, Walter; Cattaneo, Roberto; Greber, Urs F; Hemmi, Silvio

2005-08-01

The human regulator of complement activation membrane cofactor protein (CD46) has recently been identified as an attachment receptor for most species B adenoviruses (Ads), including Ad type 3 (Ad3), Ad11, and Ad35, as well as species D Ad37. To characterize the interaction between Ad35 and CD46, hybrid receptors composed of different CD46 short consensus repeat (SCR) domains fused to immunoglobulin-like domains of CD4 and a set of 36 CD46 mutants containing semiconservative changes of single amino acids within SCR domains I and II were tested in binding and in Ad35-mediated luciferase transduction assays. In addition, anti-CD46 antibodies and soluble polypeptides constituting various CD46 domains were used in binding inhibition studies. Our data indicate that (i) CD46 SCR I or SCR II alone confers low but significant Ad35 binding; (ii) the presence of SCR I and II is required for optimal binding and transgene expression; (iii) transduction efficiencies equivalent to that of full-length CD46 are obtained if SCR I and II are at an appropriate distance from the cell membrane; (iv) ablation of the N-glycan attached to SCR I has no influence on receptor function, whereas ablation of the SCR II N-glycan results in about a two- to threefold reduction of binding and transgene expression; (v) most putative Ad35 binding residues are located on the same solvent-exposed face of the SCR I or SCR II domain, which are twisted by about 90 degrees ; and (vi) the putative Ad35 binding sites partly overlap with the measles virus binding surface.

The Distal Short Consensus Repeats 1 and 2 of the Membrane Cofactor Protein CD46 and Their Distance from the Cell Membrane Determine Productive Entry of Species B Adenovirus Serotype 35

PubMed Central

Fleischli, Christoph; Verhaagh, Sandra; Havenga, Menzo; Sirena, Dominique; Schaffner, Walter; Cattaneo, Roberto; Greber, Urs F.; Hemmi, Silvio

2005-01-01

The human regulator of complement activation membrane cofactor protein (CD46) has recently been identified as an attachment receptor for most species B adenoviruses (Ads), including Ad type 3 (Ad3), Ad11, and Ad35, as well as species D Ad37. To characterize the interaction between Ad35 and CD46, hybrid receptors composed of different CD46 short consensus repeat (SCR) domains fused to immunoglobulin-like domains of CD4 and a set of 36 CD46 mutants containing semiconservative changes of single amino acids within SCR domains I and II were tested in binding and in Ad35-mediated luciferase transduction assays. In addition, anti-CD46 antibodies and soluble polypeptides constituting various CD46 domains were used in binding inhibition studies. Our data indicate that (i) CD46 SCR I or SCR II alone confers low but significant Ad35 binding; (ii) the presence of SCR I and II is required for optimal binding and transgene expression; (iii) transduction efficiencies equivalent to that of full-length CD46 are obtained if SCR I and II are at an appropriate distance from the cell membrane; (iv) ablation of the N-glycan attached to SCR I has no influence on receptor function, whereas ablation of the SCR II N-glycan results in about a two- to threefold reduction of binding and transgene expression; (v) most putative Ad35 binding residues are located on the same solvent-exposed face of the SCR I or SCR II domain, which are twisted by about 90°; and (vi) the putative Ad35 binding sites partly overlap with the measles virus binding surface. PMID:16014961

A Specific Two-pore Domain Potassium Channel Blocker Defines the Structure of the TASK-1 Open Pore*

PubMed Central

Streit, Anne K.; Netter, Michael F.; Kempf, Franca; Walecki, Magdalena; Rinné, Susanne; Bollepalli, Murali K.; Preisig-Müller, Regina; Renigunta, Vijay; Daut, Jürgen; Baukrowitz, Thomas; Sansom, Mark S. P.; Stansfeld, Phillip J.; Decher, Niels

2011-01-01

Two-pore domain potassium (K2P) channels play a key role in setting the membrane potential of excitable cells. Despite their role as putative targets for drugs and general anesthetics, little is known about the structure and the drug binding site of K2P channels. We describe A1899 as a potent and highly selective blocker of the K2P channel TASK-1. As A1899 acts as an open-channel blocker and binds to residues forming the wall of the central cavity, the drug was used to further our understanding of the channel pore. Using alanine mutagenesis screens, we have identified residues in both pore loops, the M2 and M4 segments, and the halothane response element to form the drug binding site of TASK-1. Our experimental data were used to validate a K2P open-pore homology model of TASK-1, providing structural insights for future rational design of drugs targeting K2P channels. PMID:21362619

Atomistic Molecular Dynamics Simulations of Mitochondrial DNA Polymerase γ: Novel Mechanisms of Function and Pathogenesis.

PubMed

Euro, Liliya; Haapanen, Outi; Róg, Tomasz; Vattulainen, Ilpo; Suomalainen, Anu; Sharma, Vivek

2017-03-07

DNA polymerase γ (Pol γ) is a key component of the mitochondrial DNA replisome and an important cause of neurological diseases. Despite the availability of its crystal structures, the molecular mechanism of DNA replication, the switch between polymerase and exonuclease activities, the site of replisomal interactions, and functional effects of patient mutations that do not affect direct catalysis have remained elusive. Here we report the first atomistic classical molecular dynamics simulations of the human Pol γ replicative complex. Our simulation data show that DNA binding triggers remarkable changes in the enzyme structure, including (1) completion of the DNA-binding channel via a dynamic subdomain, which in the apo form blocks the catalytic site, (2) stabilization of the structure through the distal accessory β-subunit, and (3) formation of a putative transient replisome-binding platform in the "intrinsic processivity" subdomain of the enzyme. Our data indicate that noncatalytic mutations may disrupt replisomal interactions, thereby causing Pol γ-associated neurodegenerative disorders.

Unfolding pathway of CotA-laccase and the role of copper on the prevention of refolding through aggregation of the unfolded state

DOE Office of Scientific and Technical Information (OSTI.GOV)

Fernandes, Andre T.; Lopes, Carlos; Martins, Ligia O.

2012-06-08

Highlights: Black-Right-Pointing-Pointer CotA-laccase unfolds with an intermediate state. Black-Right-Pointing-Pointer Copper stabilizes the native and the intermediate state. Black-Right-Pointing-Pointer Copper binding to the unfolded state prevents refolding through protein aggregation. Black-Right-Pointing-Pointer Copper incorporation in CotA-laccase occurs as a later step during folding. -- Abstract: Copper is a redox-active metal and the main player in electron transfer reactions occurring in multicopper oxidases. The role of copper in the unfolding pathway and refolding of the multicopper oxidase CotA laccase in vitro was solved using double-jump stopped-flow experiments. Unfolding of apo- and holo-CotA was described as a three-state process with accumulation of an intermediatemore » in between the native and unfolded state. Copper stabilizes the native holo-CotA but also the intermediate state showing that copper is still bound to this state. Also, copper binds to unfolded holo-CotA in a non-native coordination promoting CotA aggregation and preventing refolding to the native structure. These results gather information on unfolding/folding pathways of multicopper oxidases and show that copper incorporation in vivo should be a tight controlled process as copper binding to the unfolded state under native conditions promotes protein aggregation.« less

PIXE-electrophoresis shows starving collembolan reallocates protein-bound metals.

PubMed

Bengtsson, Göran; Pallon, Jan; Nilsson, Christina; Triebskorn, Rita; Köhler, Heinz-R

2016-01-01

One of multiple functions of metalloproteins is to provide detoxification to excess metal levels in organisms. Here we address the induction and persistence of a range of low to high molecular weight copper- and zinc binding proteins in the collembolan species Tetrodontophora bielanensis exposed to copper- and zinc-enriched food, followed by a period of recovery from metal exposure, in absence and presence of food. After 10 days of feeding copper and zinc contaminated yeast, specimens were either moved to ample of leaf litter material from their woodland stand of origin or starved (no food offered). The molecular weight distribution of metal binding proteins was determined by native polyacryl gel electrophoresis. One gel was stained with Comassie brilliant blue and a duplicate gel dried and scanned for the amount of copper and zinc by particle-induced X-ray emission. Specimens exposed to copper and recovered from it with ample of food had copper bound to two groups of rather low molecular weight proteins (40-50 kDa) and two of intermediate size (70-80 kDa). Most zinc in specimens from the woodland stand was bound to two large proteins of about 104 and 106 kDa. The same proteins were holding some zinc in metal-exposed specimens, but most zinc was found in proteins <40 kDa in size. Specimens recovered from metal exposure in presence of ample of food had the same distribution pattern of zinc binding proteins, whereas starved specimens had zinc as well as copper mainly bound to two proteins of 8 and 10 kDa in size. Thus, the induction and distribution of copper- and zinc-binding proteins depend on exposure conditions, and the presence of low molecular weight binding proteins, characteristic of metallothioneins, was mainly limited to starving conditions.

Multispectroscopic and molecular modeling studies on the interaction of copper-ibuprofenate complex with bovine serum albumin (BSA).

PubMed

Shiri, Farshad; Rahimi-Nasrabadi, Mehdi; Ahmadi, Farhad; Ehrlich, Hermann

2018-05-31

Bovine serum albumin (BSA) represents the well recognized model protein for investigations of diverse intermolecular reactions in studies on pharmacological activities of modern drugs. In the present work, the interaction between copper ibuprofenate ([Cu2(IBU)4]) and BSA under simulative physiological conditions was investigated by the using of diverse spectral methods including fluorescence, UV-vis absorption, CD spectroscopy and also molecular docking. The obtained results showed that there was a strong fluorescence quenching of BSA by [Cu2(IBU)4] (2.964E+4 M -1 at room temperature). Using the continuous variation method, a single class of binding sites, (1:1), for [Cu2(IBU)4] on BSA was put in evidence. The Stern-Volmer analysis of fluorescence quenching data shows the presence of the static quenching mechanism. The binding constants K b were calculated and the thermodynamic parameters ∆G°, ∆H° and ∆S° were given. The obtained thermodynamic values and the change observed in the alpha-helical content signature suggests that hydrogen bonding and hydrophobic forces play a major role in the [Cu2(IBU)4]-BSA binding interaction. Site marker competitive experiments indicated that the binding of [Cu2(IBU)4] to BSA primarily took place in sub-domain IIA that this observation were substantiated by molecular docking studies. The results of CD and UV-vis spectroscopy showed for the first time that the presence of [Cu2(IBU)4] increased the ɑ-helical content of BSA (from 48.56% to 55.71%) and conformational changes of BSA molecules. Copyright © 2017 Elsevier B.V. All rights reserved.

Organic Complexation of Dissolved Copper and Iron from Shipboard Incubations in the Central California Current System: Investigating the Impacts of Light Conditions and Phytoplankton Growth on Iron- and Copper-Binding Ligand Characteristics

NASA Astrophysics Data System (ADS)

Mellett, T.; Parker, C.; Brown, M.; Coale, T.; Duckham, C.; Chappell, D.; Maldonado, M. T.; Bruland, K. W.; Buck, K. N.

2016-02-01

Two shipboard incubation experiments were carried out in July of 2014 to investigate potential sources and sinks of iron- and copper-binding organic ligands in the surface ocean. Seawater for the experiments was collected from the central California Current System (cCCS) and incubated under varying light conditions and in the presence and absence of natural phytoplankton communities. Incubation treatments were sampled over a period of up to 3 days for measurements of total dissolved copper and iron, and for the concentration and conditional stability constants of copper- and iron-binding organic ligands. Dissolved copper and iron were determined by inductively coupled plasma-mass spectrometry (ICP-MS) following preconcentration on a Nobias PA1 resin. Organic ligand characteristics for iron and copper were determined using a method of competitive ligand exchange-absorptive cathodic stripping voltammetry (CLE-ACSV) with the added competing ligand salicylaldoxime. Trends in ligand concentrations and conditional stability constants across the different treatments and over the course of the incubation experiments will be presented.

Occupancy of the Zinc-binding Site by Transition Metals Decreases the Substrate Affinity of the Human Dopamine Transporter by an Allosteric Mechanism*

PubMed Central

Li, Yang; Mayer, Felix P.; Hasenhuetl, Peter S.; Burtscher, Verena; Schicker, Klaus; Sitte, Harald H.; Freissmuth, Michael; Sandtner, Walter

2017-01-01

The human dopamine transporter (DAT) has a tetrahedral Zn2+-binding site. Zn2+-binding sites are also recognized by other first-row transition metals. Excessive accumulation of manganese or of copper can lead to parkinsonism because of dopamine deficiency. Accordingly, we examined the effect of Mn2+, Co2+, Ni2+, and Cu2+ on transport-associated currents through DAT and DAT-H193K, a mutant with a disrupted Zn2+-binding site. All transition metals except Mn2+ modulated the transport cycle of wild-type DAT with affinities in the low micromolar range. In this concentration range, they were devoid of any action on DAT-H193K. The active transition metals reduced the affinity of DAT for dopamine. The affinity shift was most pronounced for Cu2+, followed by Ni2+ and Zn2+ (= Co2+). The extent of the affinity shift and the reciprocal effect of substrate on metal affinity accounted for the different modes of action: Ni2+ and Cu2+ uniformly stimulated and inhibited, respectively, the substrate-induced steady-state currents through DAT. In contrast, Zn2+ elicited biphasic effects on transport, i.e. stimulation at 1 μm and inhibition at 10 μm. A kinetic model that posited preferential binding of transition metal ions to the outward-facing apo state of DAT and a reciprocal interaction of dopamine and transition metals recapitulated all experimental findings. Allosteric activation of DAT via the Zn2+-binding site may be of interest to restore transport in loss-of-function mutants. PMID:28096460

Genome-wide Expression Profiling, In Vivo DNA Binding Analysis, and Probabilistic Motif Prediction Reveal Novel Abf1 Target Genes during Fermentation, Respiration, and Sporulation in Yeast

PubMed Central

Schlecht, Ulrich; Erb, Ionas; Demougin, Philippe; Robine, Nicolas; Borde, Valérie; van Nimwegen, Erik; Nicolas, Alain

2008-01-01

The autonomously replicating sequence binding factor 1 (Abf1) was initially identified as an essential DNA replication factor and later shown to be a component of the regulatory network controlling mitotic and meiotic cell cycle progression in budding yeast. The protein is thought to exert its functions via specific interaction with its target site as part of distinct protein complexes, but its roles during mitotic growth and meiotic development are only partially understood. Here, we report a comprehensive approach aiming at the identification of direct Abf1-target genes expressed during fermentation, respiration, and sporulation. Computational prediction of the protein's target sites was integrated with a genome-wide DNA binding assay in growing and sporulating cells. The resulting data were combined with the output of expression profiling studies using wild-type versus temperature-sensitive alleles. This work identified 434 protein-coding loci as being transcriptionally dependent on Abf1. More than 60% of their putative promoter regions contained a computationally predicted Abf1 binding site and/or were bound by Abf1 in vivo, identifying them as direct targets. The present study revealed numerous loci previously unknown to be under Abf1 control, and it yielded evidence for the protein's variable DNA binding pattern during mitotic growth and meiotic development. PMID:18305101

PoSSuM v.2.0: data update and a new function for investigating ligand analogs and target proteins of small-molecule drugs.

PubMed

Ito, Jun-ichi; Ikeda, Kazuyoshi; Yamada, Kazunori; Mizuguchi, Kenji; Tomii, Kentaro

2015-01-01

PoSSuM (http://possum.cbrc.jp/PoSSuM/) is a database for detecting similar small-molecule binding sites on proteins. Since its initial release in 2011, PoSSuM has grown to provide information related to 49 million pairs of similar binding sites discovered among 5.5 million known and putative binding sites. This enlargement of the database is expected to enhance opportunities for biological and pharmaceutical applications, such as predictions of new functions and drug discovery. In this release, we have provided a new service named PoSSuM drug search (PoSSuMds) at http://possum.cbrc.jp/PoSSuM/drug_search/, in which we selected 194 approved drug compounds retrieved from ChEMBL, and detected their known binding pockets and pockets that are similar to them. Users can access and download all of the search results via a new web interface, which is useful for finding ligand analogs as well as potential target proteins. Furthermore, PoSSuMds enables users to explore the binding pocket universe within PoSSuM. Additionally, we have improved the web interface with new functions, including sortable tables and a viewer for visualizing and downloading superimposed pockets. © The Author(s) 2014. Published by Oxford University Press on behalf of Nucleic Acids Research.

Genetic variation in the MITF promoter affects skin colour and transcriptional activity in black-boned chickens.

PubMed

Wang, G; Liao, J; Tang, M; Yu, S

2018-02-01

1. Microphthalmia-associated transcription factor (MITF) plays a pivotal role in melanocyte development by regulating the transcription of major pigmentation enzymes (e.g. TYR, TYRP1 and DCT). A single-nucleotide polymorphism (SNP), c.-638T>C, was identified in the MITF promoter, and genotyping of a population (n = 426) revealed that SNP c.-638T>C was associated with skin colour in black-boned chickens. 2. Individuals with genotypes CC and TC exhibited greater MTIF expression than those with genotype TT. Luciferase assays also revealed that genotype CC and TC promoters had higher activity levels than genotype TT. Expression of melanogenesis-related gene (TYR) was higher in the skin of chickens with the CC and CT genotype compared to TT chickens (P < 0.05). 3. Transcription factor-binding site analyses showed that the c.-638C allele contains a putative binding site for transcription factor sterol regulatory element-binding transcription factor 2, aryl hydrocarbon receptor nuclear translocator, transcription factor binding to IGHM enhancer 3 and upstream transcription factor 2. In contrast, the c.-638T allele contains binding sites for Sp3 transcription factor and Krüppel-like factor 1. 4. It was concluded that MITF promoter polymorphisms affected chicken skin colour. SNP c.-638T>C could be used for the marker-assisted selection of skin colour in black-boned chicken breeding.

Regulation of the copper chaperone CCS by XIAP-mediated ubiquitination.

PubMed

Brady, Graham F; Galbán, Stefanie; Liu, Xuwen; Basrur, Venkatesha; Gitlin, Jonathan D; Elenitoba-Johnson, Kojo S J; Wilson, Thomas E; Duckett, Colin S

2010-04-01

In order to balance the cellular requirements for copper with its toxic properties, an elegant set of mechanisms has evolved to regulate and buffer intracellular copper. The X-linked inhibitor of apoptosis (XIAP) protein was recently identified as a copper-binding protein and regulator of copper homeostasis, although the mechanism by which XIAP binds copper in the cytosol is unclear. Here we describe the identification of the copper chaperone for superoxide dismutase (CCS) as a mediator of copper delivery to XIAP in cells. We also find that CCS is a target of the E3 ubiquitin ligase activity of XIAP, although interestingly, ubiquitination of CCS by XIAP was found to lead to enhancement of its chaperone activity toward its physiologic target, superoxide dismutase 1, rather than proteasomal degradation. Collectively, our results reveal novel links among apoptosis, copper metabolism, and redox regulation through the XIAP-CCS complex.

Intestinal microbiota and lipid metabolism responses in the common carp (Cyprinus carpio L.) following copper exposure.

PubMed

Meng, Xiao-Lin; Li, Shuai; Qin, Chao-Bin; Zhu, Zhen-Xiang; Hu, Wen-Pan; Yang, Li-Ping; Lu, Rong-Hua; Li, Wen-Jun; Nie, Guo-Xing

2018-09-30

The present study was conducted to determine the effects of waterborne copper exposure on the lipid metabolism and intestinal microbiota of juvenile common carp (Cyprinus carpio L.). Common carp were exposed to four waterborne copper (Cu) concentrations (0 (control), 0.07 (low), 0.14 (medium), and 0.28 (high) mg Cu/L) for 8 weeks. Exposure to a high concentration of Cu had a negative effect on growth indices (weight gain rate (WGR) and specific growth rate (SGR)). The biochemical indices measured in serum (low-density lipoprotein (LDL) and triglycerides (TGs)) were significantly affected by exposure to medium concentration levels of Cu. The mRNA levels of lipogenic enzymes (acetyl-CoA carboxylase 1 (ACC-1) and fatty acid synthase (FAS)) and sterol-regulator element-binding protein-1 (SREBP-1) in liver tissue and tight binding protein genes (ZO-1 and occludin) in intestinal epithelial tissue were significantly downregulated in the 0.14 and 0.28 mg/L Cu treatment groups, accompanied by upregulated mRNA levels of lipolysis enzymes (lipoprotein lipase (LPL) and carnitine palmitoyl transferase 1 (CPT-1)) in the liver. The data also showed that the composition of intestinal microbiota was changed following Cu exposure and could alter the α-diversity and β-diversity. The abundances of few putative short-chain fatty acid (SCFA)-producing bacteria, including Allobaculum, Blautia, Coprococcus, Faecalibacterium, Roseburia, and Ruminococcus, decreased significantly. More specifically, Roseburia sequences were positively associated with lipogenic enzymes, total protein (TP), and TGs and negatively associated with lipolysis enzymes. Other sequences related to probiotics (Lactobacillus, Bacillus and Akkermansia) were also found to decrease, accompanied by an increase in sequences related to pathogens (Pseudomonas and Acinetobacter). To the best of our knowledge, the present study provides the first evidence that waterborne, chronic Cu exposure can disturb the composition of intestinal microbiota related to lipid metabolism and immunity in freshwater fish, thereby increasing the risk of pathogen invasion. Copyright © 2018 Elsevier Inc. All rights reserved.

Cloning, overexpression and interaction of recombinant Fur from the cyanobacterium Anabaena PCC 7119 with isiB and its own promoter.

PubMed

Bes, M T; Hernández, J A; Peleato, M L; Fillat, M F

2001-01-15

A gene coding for a Fur (ferric uptake regulation) protein from the cyanobacterium Anabaena PCC 7119 has been cloned and overexpressed in Escherichia coli. DNA sequence analysis confirmed the presence of a 151-amino-acid open reading frame that showed homology with the Fur proteins reported for the unicellular cyanobacteria Synechococcus 7942 and Synechocystis PCC 6803. Two putative Fur-binding sites were detected in the promoter regions of the fur gene from Anabaena. Partially purified recombinant Fur binds to the flavodoxin promoter as well as its own promoter. This suggests that the Fur gene is autoregulated in Anabaena.

Combined sequence and structure analysis of the fungal laccase family.

PubMed

Kumar, S V Suresh; Phale, Prashant S; Durani, S; Wangikar, Pramod P

2003-08-20

Plant and fungal laccases belong to the family of multi-copper oxidases and show much broader substrate specificity than other members of the family. Laccases have consequently been of interest for potential industrial applications. We have analyzed the essential sequence features of fungal laccases based on multiple sequence alignments of more than 100 laccases. This has resulted in identification of a set of four ungapped sequence regions, L1-L4, as the overall signature sequences that can be used to identify the laccases, distinguishing them within the broader class of multi-copper oxidases. The 12 amino acid residues in the enzymes serving as the copper ligands are housed within these four identified conserved regions, of which L2 and L4 conform to the earlier reported copper signature sequences of multi-copper oxidases while L1 and L3 are distinctive to the laccases. The mapping of regions L1-L4 on to the three-dimensional structure of the Coprinus cinerius laccase indicates that many of the non-copper-ligating residues of the conserved regions could be critical in maintaining a specific, more or less C-2 symmetric, protein conformational motif characterizing the active site apparatus of the enzymes. The observed intraprotein homologies between L1 and L3 and between L2 and L4 at both the structure and the sequence levels suggest that the quasi C-2 symmetric active site conformational motif may have arisen from a structural duplication event that neither the sequence homology analysis nor the structure homology analysis alone would have unraveled. Although the sequence and structure homology is not detectable in the rest of the protein, the relative orientation of region L1 with L2 is similar to that of L3 with L4. The structure duplication of first-shell and second-shell residues has become cryptic because the intraprotein sequence homology noticeable for a given laccase becomes significant only after comparing the conservation pattern in several fungal laccases. The identified motifs, L1-L4, can be useful in searching the newly sequenced genomes for putative laccase enzymes. Copyright 2003 Wiley Periodicals, Inc. Biotechnol Bioeng 83: 386-394, 2003.

Development of new composite biosorbents from olive pomace wastes

NASA Astrophysics Data System (ADS)

Pagnanelli, Francesca; Viggi, Carolina Cruz; Toro, Luigi

2010-06-01

In this study olive pomace was used as a source of binding substances for the development of composite biosorbents to be used in heavy metal removal from aqueous solutions. The aim was to obtain biosorbent material with an increased concentration of binding sites. The effects of two different extraction procedures (one using only methanol and the other one hexane followed by methanol) on the binding properties of olive pomace were tested by potentiometric titrations and batch biosorption tests for copper and cadmium removal. Titration modelling evidenced that both kinds of extractions generated a solid with a reduced amount of protonatable sites. Biosorption tests were organized according to full factorial designs. Analysis of variance denoted that both kinds of extractions determined a statistically significant negative effect on metal biosorption. In the case of cadmium extractions also determined a significant decrease of selectivity with respect to olive pomace. When the acid-base and binding properties of the substances extracted were determined, they were adsorbed onto a synthetic resin (octadecylsilane) and calcium alginate beads. In this way two kinds of composite biosorbents have been obtained both having an increased concentration of binding substances with respect to native olive pomace, also working more efficiently in metal removal.

Combining modelling and mutagenesis studies of synaptic vesicle protein 2A to identify a series of residues involved in racetam binding.

PubMed

Shi, Jiye; Anderson, Dina; Lynch, Berkley A; Castaigne, Jean-Gabriel; Foerch, Patrik; Lebon, Florence

2011-10-01

LEV (levetiracetam), an antiepileptic drug which possesses a unique profile in animal models of seizure and epilepsy, has as its unique binding site in brain, SV2A (synaptic vesicle protein 2A). Previous studies have used a chimaeric and site-specific mutagenesis approach to identify three residues in the putative tenth transmembrane helix of SV2A that, when mutated, alter binding of LEV and related racetam derivatives to SV2A. In the present paper, we report a combined modelling and mutagenesis study that successfully identifies another 11 residues in SV2A that appear to be involved in ligand binding. Sequence analysis and modelling of SV2A suggested residues equivalent to critical functional residues of other MFS (major facilitator superfamily) transporters. Alanine scanning of these and other SV2A residues resulted in the identification of residues affecting racetam binding, including Ile273 which differentiated between racetam analogues, when mutated to alanine. Integrating mutagenesis results with docking analysis led to the construction of a mutant in which six SV2A residues were replaced with corresponding SV2B residues. This mutant showed racetam ligand-binding affinity intermediate to the affinities observed for SV2A and SV2B.

SP-A binding sites on bovine alveolar macrophages.

PubMed

Plaga, S; Plattner, H; Schlepper-Schaefer, J

1998-11-25

Surfactant protein A (SP-A) binding to bovine alveolar macrophages was examined in order to characterize SP-A binding proteins on the cell surface and to isolate putative receptors from these cells that could be obtained in large amounts. Human SP-A, unlabeled or labeled with gold particles, was bound to freshly isolated macrophages and analyzed with ELISA or the transmission electron microscope. Binding of SP-A was inhibited by Ca2+ chelation, by an excess of unlabeled SP-A, or by the presence of 20 mg/ml mannan. We conclude that bovine alveolar macrophages expose binding sites for SP-A that are specific and that depend on Ca2+ and on mannose residues. For isolation of SP-A receptors with homologous SP-A as ligand we isolated SP-A from bovine lung lavage. SDS-PAGE analysis of the purified SP-A showed a protein of 32-36 kDa. Functional integrity of the protein was demonstrated. Bovine SP-A bound to Dynabeads was used to isolate SP-A binding proteins. From the fractionated and blotted proteins of the receptor preparation two proteins bound SP-A in a Ca2+-dependent manner, a 40-kDa protein showing mannose dependency and a 210-kDa protein, showing no mannose sensitivity. Copyright 1998 Academic Press.

Agonist trapped in ATP-binding sites of the P2X2 receptor

PubMed Central

Jiang, Ruotian; Lemoine, Damien; Martz, Adeline; Taly, Antoine; Gonin, Sophie; Prado de Carvalho, Lia; Specht, Alexandre; Grutter, Thomas

2011-01-01

ATP-gated P2X receptors are trimeric ion channels, as recently confirmed by X-ray crystallography. However, the structure was solved without ATP and even though extracellular intersubunit cavities surrounded by conserved amino acid residues previously shown to be important for ATP function were proposed to house ATP, the localization of the ATP sites remains elusive. Here we localize the ATP-binding sites by creating, through a proximity-dependent “tethering” reaction, covalent bonds between a synthesized ATP-derived thiol-reactive P2X2 agonist (NCS-ATP) and single cysteine mutants engineered in the putative binding cavities of the P2X2 receptor. By combining whole-cell and single-channel recordings, we report that NCS-ATP covalently and specifically labels two previously unidentified positions N140 and L186 from two adjacent subunits separated by about 18 Å in a P2X2 closed state homology model, suggesting the existence of at least two binding modes. Tethering reaction at both positions primes subsequent agonist binding, yet with distinct functional consequences. Labeling of one position impedes subsequent ATP function, which results in inefficient gating, whereas tethering of the other position, although failing to produce gating by itself, enhances subsequent ATP function. Our results thus define a large and dynamic intersubunit ATP-binding pocket and suggest that receptors trapped in covalently agonist-bound states differ in their ability to gate the ion channel. PMID:21576497

Carbon-dot-based fluorescent turn-on sensor for selectively detecting sulfide anions in totally aqueous media and imaging inside live cells.

PubMed

Hou, Xianfeng; Zeng, Fang; Du, Fangkai; Wu, Shuizhu

2013-08-23

Sulfide anions are generated not only as a byproduct from industrial processes but also in biosystems. Hence, robust fluorescent sensors for detecting sulfide anions which are fast-responding, water soluble and biocompatible are highly desirable. Herein, we report a carbon-dot-based fluorescent sensor, which features excellent water solubility, low cytotoxicity and a short response time. This sensor is based on the ligand/Cu(II) approach so as to achieve fast sensing of sulfide anions. The carbon dot (CD) serves as the fluorophore as well as the anchoring site for the ligands which bind with copper ions. For this CD-based system, as copper ions bind with the ligands which reside on the surface of the CD, the paramagnetic copper ions efficiently quench the fluorescence of the CD, affording the system a turn-off sensor for copper ions. More importantly, the subsequently added sulfide anions can extract Cu(2+) from the system and form very stable CuS with Cu(2+), resulting in fluorescence enhancement and affording the system a turn-on sensor for sulfide anions. This fast-responding and selective sensor can operate in totally aqueous solution or in physiological milieu with a low detection limit of 0.78 μM. It displays good biocompatibility, and excellent cell membrane permeability, and can be used to monitor S(2-) levels in running water and living cells.

Identification of the prooxidant site of human ceruloplasmin: a model for oxidative damage by copper bound to protein surfaces

NASA Technical Reports Server (NTRS)

Mukhopadhyay, C. K.; Mazumder, B.; Lindley, P. F.; Fox, P. L.

1997-01-01

Free transition metal ions oxidize lipids and lipoproteins in vitro; however, recent evidence suggests that free metal ion-independent mechanisms are more likely in vivo. We have shown previously that human ceruloplasmin (Cp), a serum protein containing seven Cu atoms, induces low density lipoprotein oxidation in vitro and that the activity depends on the presence of a single, chelatable Cu atom. We here use biochemical and molecular approaches to determine the site responsible for Cp prooxidant activity. Experiments with the His-specific reagent diethylpyrocarbonate (DEPC) showed that one or more His residues was specifically required. Quantitative [14C]DEPC binding studies indicated the importance of a single His residue because only one was exposed upon removal of the prooxidant Cu. Plasmin digestion of [14C]DEPC-treated Cp (and N-terminal sequence analysis of the fragments) showed that the critical His was in a 17-kDa region containing four His residues in the second major sequence homology domain of Cp. A full length human Cp cDNA was modified by site-directed mutagenesis to give His-to-Ala substitutions at each of the four positions and was transfected into COS-7 cells, and low density lipoprotein oxidation was measured. The prooxidant site was localized to a region containing His426 because CpH426A almost completely lacked prooxidant activity whereas the other mutants expressed normal activity. These observations support the hypothesis that Cu bound at specific sites on protein surfaces can cause oxidative damage to macromolecules in their environment. Cp may serve as a model protein for understanding mechanisms of oxidant damage by copper-containing (or -binding) proteins such as Cu, Zn superoxide dismutase, and amyloid precursor protein.

Co(II) derivatives of Cu,Zn-superoxide dismutase with the cobalt bound in the place of copper. A new spectroscopic tool for the study of the active site.

PubMed

Desideri, A; Cocco, D; Calabrese, L; Rotilio, G

1984-03-29

Co(II) derivatives of Cu,Zn-superoxide dismutase having cobalt substituted for the copper (Co,Zn-superoxide dismutase and Co,Co-superoxide dismutase) were studied by optical and EPR spectroscopy. EPR and electronic absorption spectra of Co,Zn-superoxide dismutase are sensitive to solvent perturbation, and in particular to the presence of phosphate. This behaviour suggests that cobalt in Co,Zn-superoxide dismutase is open to solvent access, at variance with the Co(II) of the Cu,Co-superoxide dismutase, which is substituted for the Zn. Phosphate binding as monitored by optical titration is dependent on pH with an apparent pKa = 8.2. The absorption spectrum of Co,Zn-superoxide dismutase in water has three weak bands in the visible region (epsilon = 75 M-1 X cm-1 at 456 nm; epsilon = 90 M-1 X cm-1 at 520 nm; epsilon = 70 M-1 X cm-1 at 600 nm) and three bands in the near infrared region, at 790 nm (epsilon = 18 M-1 X cm-1), 916 nm (epsilon = 27 M-1 X cm-1) and 1045 nm (epsilon = 25 M-1 X cm-1). This spectrum is indicative of five-coordinate geometry. In the presence of phosphate, three bands are still present in the visible region but they have higher intensity (epsilon = 225 M-1 X cm-1 at 544 nm; epsilon = 315 M-1 X cm-1 at 575 nm; epsilon = 330 M-1 X cm-1 at 603 nm), whilst the lowest wavelength band in the near infrared region is at much lower energy, 1060 nm (epsilon = 44 M-1 X cm-1). The latter property suggests a tetrahedral coordination around the Co(II) centre. Addition of 1 equivalent of CN- gives rise to a stable Co(II) low-spin intermediate, which is characterized by an EPR spectrum with a highly rhombic line shape. Formation of this CN- complex was found to require more cyanide equivalents in the case of the phosphate adduct, suggesting that binding of phosphate may inhibit binding of other anions. Titration of the Co,Co-derivative with CN- provided evidence for magnetic interaction between the two metal centres. These results substantiate the contention that Co(II) can replace the copper of Cu,Zn-superoxide dismutase in a way that reproduces the properties of the native copper-binding site.

Computational analysis of protein-protein interfaces involving an alpha helix: insights for terphenyl-like molecules binding.

PubMed

Isvoran, Adriana; Craciun, Dana; Martiny, Virginie; Sperandio, Olivier; Miteva, Maria A

2013-06-14

Protein-Protein Interactions (PPIs) are key for many cellular processes. The characterization of PPI interfaces and the prediction of putative ligand binding sites and hot spot residues are essential to design efficient small-molecule modulators of PPI. Terphenyl and its derivatives are small organic molecules known to mimic one face of protein-binding alpha-helical peptides. In this work we focus on several PPIs mediated by alpha-helical peptides. We performed computational sequence- and structure-based analyses in order to evaluate several key physicochemical and surface properties of proteins known to interact with alpha-helical peptides and/or terphenyl and its derivatives. Sequence-based analysis revealed low sequence identity between some of the analyzed proteins binding alpha-helical peptides. Structure-based analysis was performed to calculate the volume, the fractal dimension roughness and the hydrophobicity of the binding regions. Besides the overall hydrophobic character of the binding pockets, some specificities were detected. We showed that the hydrophobicity is not uniformly distributed in different alpha-helix binding pockets that can help to identify key hydrophobic hot spots. The presence of hydrophobic cavities at the protein surface with a more complex shape than the entire protein surface seems to be an important property related to the ability of proteins to bind alpha-helical peptides and low molecular weight mimetics. Characterization of similarities and specificities of PPI binding sites can be helpful for further development of small molecules targeting alpha-helix binding proteins.

Dynamics of the metal binding domains and regulation of the human copper transporters ATP7B and ATP7A.

PubMed

Yu, Corey H; Dolgova, Natalia V; Dmitriev, Oleg Y

2017-04-01

Copper transporters ATP7A and ATP7B regulate copper levels in the human cells and deliver copper to the biosynthetic pathways. ATP7A and ATP7B belong to the P-type ATPases and share much of the domain architecture and the mechanism of ATP hydrolysis with the other, well-studied, enzymes of this type. A unique structural feature of the copper ATPases is the chain of six cytosolic metal-binding domains (MBDs), which are believed to be involved in copper-dependent regulation of the activity and intracellular localization of these enzymes. Although the structures of all the MBDs have been solved, the mechanism of copper-dependent regulation of ATP7B and ATP7A, the roles of individual MBDs, and the relationship between the regulatory and catalytic copper binding are still unknown. We describe the structure and dynamics of the MBDs, review the current knowledge about their functional roles and propose a mechanism of regulation of ATP7B by copper-dependent changes in the dynamics and conformation of the MBD chain. Transient interactions between the MBDs, rather than transitions between distinct static conformations are likely to form the structural basis of regulation of the ATP-dependent copper transporters in human cells. © 2016 IUBMB Life, 69(4):226-235, 2017. © 2017 International Union of Biochemistry and Molecular Biology.

Newer putative central neurotransmitters: roles in thermoregulation. Hypothalamic substances in the control of body temperature: general characteristics

DOE Office of Scientific and Technical Information (OSTI.GOV)

Blatteis, C.M.

1981-11-01

Although it has been demonstrated that their central, exogenous application induces thermal responses, it is not yet established whether various substances found in the hypothalami of many species function as neurotransmitters in central thermoregulatory pathways. Available data concerning their presence, synthesis, release, possible binding sites, and inactivation are reviewed in the light of established criteria for determining a neurotransmitter role for such substances.

Computational evaluation of sub-nanometer cluster activity of singly exposed copper atom with various coordinative environment in catalytic CO2 transformation

NASA Astrophysics Data System (ADS)

Shanmugam, Ramasamy; Thamaraichelvan, Arunachalam; Ganesan, Tharumeya Kuppusamy; Viswanathan, Balasubramanian

2017-02-01

Metal cluster, at sub-nanometer level has a unique property in the activation of small molecules, in contrast to that of bulk surface. In the present work, singly exposed active site of copper metal cluster at sub-nanometer level was designed to arrive at the energy minimised configurations, binding energy, electrostatic potential map, frontier molecular orbitals and partial density of states. The ab initio molecular dynamics was carried out to probe the catalytic nature of the cluster. Further, the stability of the metal cluster and its catalytic activity in the electrochemical reduction of CO2 to CO were evaluated by means of computational hydrogen electrode via calculation of the free energy profile using DFT/B3LYP level of theory in vacuum. The activity of the cluster is ascertained from the fact that the copper atom, present in a two coordinative environment, performs a more selective conversion of CO2 to CO at an applied potential of -0.35 V which is comparatively lower than that of higher coordinative sites. The present study helps to design any sub-nano level metal catalyst for electrochemical reduction of CO2 to various value added chemicals.

Crystal Structure of the C-terminal Region of Streptococcus mutans Antigen I/II and Characterization of Salivary Agglutinin Adherence Domains

DOE Office of Scientific and Technical Information (OSTI.GOV)

Larson, Matthew R.; Rajashankar, Kanagalaghatta R.; Crowley, Paula J.

2012-05-29

The Streptococcus mutans antigen I/II (AgI/II) is a cell surface-localized protein that adheres to salivary components and extracellular matrix molecules. Here we report the 2.5 {angstrom} resolution crystal structure of the complete C-terminal region of AgI/II. The C-terminal region is comprised of three major domains: C{sub 1}, C{sub 2}, and C{sub 3}. Each domain adopts a DE-variant IgG fold, with two {beta}-sheets whose A and F strands are linked through an intramolecular isopeptide bond. The adherence of the C-terminal AgI/II fragments to the putative tooth surface receptor salivary agglutinin (SAG), as monitored by surface plasmon resonance, indicated that the minimalmore » region of binding was contained within the first and second DE-variant-IgG domains (C{sub 1} and C{sub 2}) of the C terminus. The minimal C-terminal region that could inhibit S. mutans adherence to SAG was also confirmed to be within the C{sub 1} and C{sub 2} domains. Competition experiments demonstrated that the C- and N-terminal regions of AgI/II adhere to distinct sites on SAG. A cleft formed at the intersection between these C{sub 1} and C{sub 2} domains bound glucose molecules from the cryo-protectant solution, revealing a putative binding site for its highly glycosylated receptor SAG. Finally, electron microscopy images confirmed the elongated structure of AgI/II and enabled building a composite tertiary model that encompasses its two distinct binding regions.« less

Analysis of Glucose Transporter Topology and Structural Dynamics*

PubMed Central

Blodgett, David M.; Graybill, Christopher; Carruthers, Anthony

2008-01-01

Homology modeling and scanning cysteine mutagenesis studies suggest that the human glucose transport protein GLUT1 and its distant bacterial homologs LacY and GlpT share similar structures. We tested this hypothesis by mapping the accessibility of purified, reconstituted human erythrocyte GLUT1 to aqueous probes. GLUT1 contains 35 potential tryptic cleavage sites. Fourteen of 16 lysine residues and 18 of 19 arginine residues were accessible to trypsin. GLUT1 lysine residues were modified by isothiocyanates and N-hydroxysuccinimide (NHS) esters in a substrate-dependent manner. Twelve lysine residues were accessible to sulfo-NHS-LC-biotin. GLUT1 trypsinization released full-length transmembrane helix 1, cytoplasmic loop 6–7, and the long cytoplasmic C terminus from membranes. Trypsin-digested GLUT1 retained cytochalasin B and d-glucose binding capacity and released full-length transmembrane helix 8 upon cytochalasin B (but not d-glucose) binding. Transmembrane helix 8 release did not abrogate cytochalasin B binding. GLUT1 was extensively proteolyzed by α-chymotrypsin, which cuts putative pore-forming amphipathic α-helices 1, 2, 4, 7, 8, 10, and 11 at multiple sites to release transmembrane peptide fragments into the aqueous solvent. Putative scaffolding membrane helices 3, 6, 9, and 12 are strongly hydrophobic, resistant to α-chymotrypsin, and retained by the membrane bilayer. These observations provide experimental support for the proposed GLUT1 architecture; indicate that the proposed topology of membrane helices 5, 6, and 12 requires adjustment; and suggest that the metastable conformations of transmembrane helices 1 and 8 within the GLUT1 scaffold destabilize a sugar translocation intermediate. PMID:18981181

Identification and analysis of cytochrome P450IID6 antigenic sites recognized by anti-liver-kidney microsome type-1 antibodies (LKM1).

PubMed

Yamamoto, A M; Cresteil, D; Boniface, O; Clerc, F F; Alvarez, F

1993-05-01

Anti-liver-kidney microsome type-1 antibodies (LKM1), present in sera from a group of patients with autoimmune hepatitis, are directed against P450IID6. Previous work, using cDNA constructions spanning most of the P450IID6 protein defined the main immunogenic site between the amino acids (aa), 254-271 and predicted the presence of other putative immunogenic sites in the molecule. Fusion proteins from new cDNA constructions, spanning so-far-untested regions between aa 1-125 and 431-522, were not recognized by LKM1-positive sera. Synthetic peptides, representing sequences from putative immunogenic regions or previously untested regions, allowed a precise definition of four antigenic sites located between peptides 257-269, 321-351, 373-389 and 410-429, which were recognized, respectively, by 14, 8, 1 and 2 out of 15 LKM1-positive sera tested. The minimal sequence of the main antigenic site (peptide 257-269) recognized by the autoantibody was established to be WDPAQPPRD (peptide 262-270). In addition, deletion and replacement experiments showed that aa 263 (Asp) was essential for the binding of the autoantibody to peptide 262-270. Analysis of the second most frequently recognized peptide between aa 321-351, was performed using peptides 321-339 and 340-351 in competitive inhibition studies. Complete elimination of antibody binding to peptide 321-351 obtained by absorption of both shorter peptides indicated that peptide 321-351 is a discontinuous antigenic site. LKM1-positive sera reacting against peptide 321-351 recognized either both the shorter peptides or just one of them preferentially. Results of the present study suggest that the production of LKM1 antibodies is an antigen-driven, poly- or oligoclonal B cell response. The identification of antigenic sites will allow: (i) the development of specific diagnostic tests and (ii) further studies on the pathogenic value of LKM1 antibodies in autoimmune hepatitis.

Identification and analysis of pig chimeric mRNAs using RNA sequencing data

PubMed Central

2012-01-01

Background Gene fusion is ubiquitous over the course of evolution. It is expected to increase the diversity and complexity of transcriptomes and proteomes through chimeric sequence segments or altered regulation. However, chimeric mRNAs in pigs remain unclear. Here we identified some chimeric mRNAs in pigs and analyzed the expression of them across individuals and breeds using RNA-sequencing data. Results The present study identified 669 putative chimeric mRNAs in pigs, of which 251 chimeric candidates were detected in a set of RNA-sequencing data. The 618 candidates had clear trans-splicing sites, 537 of which obeyed the canonical GU-AG splice rule. Only two putative pig chimera variants whose fusion junction was overlapped with that of a known human chimeric mRNA were found. A set of unique chimeric events were considered middle variances in the expression across individuals and breeds, and revealed non-significant variance between sexes. Furthermore, the genomic region of the 5′ partner gene shares a similar DNA sequence with that of the 3′ partner gene for 458 putative chimeric mRNAs. The 81 of those shared DNA sequences significantly matched the known DNA-binding motifs in the JASPAR CORE database. Four DNA motifs shared in parental genomic regions had significant similarity with known human CTCF binding sites. Conclusions The present study provided detailed information on some pig chimeric mRNAs. We proposed a model that trans-acting factors, such as CTCF, induced the spatial organisation of parental genes to the same transcriptional factory so that parental genes were coordinatively transcribed to give birth to chimeric mRNAs. PMID:22925561

KCNE1 induces fenestration in the Kv7.1/KCNE1 channel complex that allows for highly specific pharmacological targeting

NASA Astrophysics Data System (ADS)

Wrobel, Eva; Rothenberg, Ina; Krisp, Christoph; Hundt, Franziska; Fraenzel, Benjamin; Eckey, Karina; Linders, Joannes T. M.; Gallacher, David J.; Towart, Rob; Pott, Lutz; Pusch, Michael; Yang, Tao; Roden, Dan M.; Kurata, Harley T.; Schulze-Bahr, Eric; Strutz-Seebohm, Nathalie; Wolters, Dirk; Seebohm, Guiscard

2016-10-01

Most small-molecule inhibitors of voltage-gated ion channels display poor subtype specificity because they bind to highly conserved residues located in the channel's central cavity. Using a combined approach of scanning mutagenesis, electrophysiology, chemical ligand modification, chemical cross-linking, MS/MS-analyses and molecular modelling, we provide evidence for the binding site for adamantane derivatives and their putative access pathway in Kv7.1/KCNE1 channels. The adamantane compounds, exemplified by JNJ303, are highly potent gating modifiers that bind to fenestrations that become available when KCNE1 accessory subunits are bound to Kv7.1 channels. This mode of regulation by auxiliary subunits may facilitate the future development of potent and highly subtype-specific Kv channel inhibitors.

Fluorescence properties and conformational stability of the beta-hemocyanin of Helix pomatia.

PubMed

Idakieva, Krassimira; Siddiqui, Nurul I; Parvanova, Katja; Nikolov, Peter; Gielens, Constant

2006-04-01

The beta-hemocyanin (beta-HpH) is one of the three dioxygen-binding proteins found freely dissolved in the hemolymph of the gastropodan mollusc Helix pomatia. The didecameric molecule (molecular mass 9 MDa) is built up of only one type of subunits. The fluorescence properties of the oxygenated and apo-form (copper-deprived) of the didecamer and its subunits were characterized. Upon excitation of the hemocyanins at 295 or 280 nm, tryptophyl residues buried in the hydrophobic interior of the protein determine the fluorescence emission. This is confirmed by quenching experiments with acrylamide, cesium chloride and potassium iodide. The copper-dioxygen system at the binuclear active site quenches the tryptophan emission of the oxy-beta-HpH. The removal of this system increases the fluorescence quantum yield and causes structural rearrangement of the microenvironment of the emitting tryptophyl residues in the apo-form. Time-resolved fluorescence measurements show that the oxygenated and copper-deprived forms of the beta-HpH and its subunits exist in different conformations. The thermal stability of the oxy- and apo-beta-HpH is characterized by a transition temperature (Tm) of 84 degrees C and 63 degrees C, respectively, obtained by differential scanning calorimetry. Increase of the temperature influences the active site at lower temperatures than the environments of tryptophans and tyrosines causing a loss of oxygen bound to the copper atoms. This process is, at least partially, reversible as after cooling of the protein samples, around 60% reinstatement of the copper-peroxide band has been observed. The results confirm the role of the copper-dioxygen complex for the stabilization of the hemocyanin structure in solution. The other important stabilizing factor is oligomerization of the hemocyanin molecule.

Study on the interaction of a copper(II) complex containing the artificial sweetener aspartame with human serum albumin.

PubMed

Shahabadi, Nahid; Khodaei, Mohammad Mehdi; Kashanian, Soheila; Kheirdoosh, Fahimeh; Filli, Soraya Moradi

2014-05-01

A copper(II) complex containing aspartame (APM) as ligand, Cu(APM)2Cl2·2H2O, was synthesized and characterized. In vitro binding interaction of this complex with human serum albumin (HSA) was studied at physiological pH. Binding studies of this complex with HSA are useful for understanding the Cu(APM)2Cl2·2H2O-HSA interaction mechanism and providing guidance for the application and design of new and more efficient artificial sweeteners drive. The interaction was investigated by spectrophotometric, spectrofluorometric, competition experiment and circular dichroism. Hyperchromicity observed in UV absorption band of Cu(APM)2Cl2·2H2O. A strong fluorescence quenching reaction of HSA to Cu(APM)2Cl2·2H2O was observed and the binding constant (Kf) and corresponding numbers of binding sites (n) were calculated at different temperatures. Thermodynamic parameters, enthalpy change (∆H) and entropy change (∆S) were calculated to be -458.67 kJ mol(-1) and -1,339 J mol(-1 )K(-1) respectively. According to the van't Hoff equation, the reaction is predominantly enthalpically driven. In conformity with experimental results, we suggest that Cu(APM)2Cl2·2H2O interacts with HSA. In comparison with previous study, it is found that the Cu(II) complex binds stronger than aspartame.

Crystal Structure and Computational Characterization of the Lytic Polysaccharide Monooxygenase GH61D from the Basidiomycota Fungus Phanerochaete chrysosporium*

PubMed Central

Wu, Miao; Beckham, Gregg T.; Larsson, Anna M.; Ishida, Takuya; Kim, Seonah; Payne, Christina M.; Himmel, Michael E.; Crowley, Michael F.; Horn, Svein J.; Westereng, Bjørge; Igarashi, Kiyohiko; Samejima, Masahiro; Ståhlberg, Jerry; Eijsink, Vincent G. H.; Sandgren, Mats

2013-01-01

Carbohydrate structures are modified and degraded in the biosphere by a myriad of mostly hydrolytic enzymes. Recently, lytic polysaccharide mono-oxygenases (LPMOs) were discovered as a new class of enzymes for cleavage of recalcitrant polysaccharides that instead employ an oxidative mechanism. LPMOs employ copper as the catalytic metal and are dependent on oxygen and reducing agents for activity. LPMOs are found in many fungi and bacteria, but to date no basidiomycete LPMO has been structurally characterized. Here we present the three-dimensional crystal structure of the basidiomycete Phanerochaete chrysosporium GH61D LPMO, and, for the first time, measure the product distribution of LPMO action on a lignocellulosic substrate. The structure reveals a copper-bound active site common to LPMOs, a collection of aromatic and polar residues near the binding surface that may be responsible for regio-selectivity, and substantial differences in loop structures near the binding face compared with other LPMO structures. The activity assays indicate that this LPMO primarily produces aldonic acids. Last, molecular simulations reveal conformational changes, including the binding of several regions to the cellulose surface, leading to alignment of three tyrosine residues on the binding face of the enzyme with individual cellulose chains, similar to what has been observed for family 1 carbohydrate-binding modules. A calculated potential energy surface for surface translation indicates that P. chrysosporium GH61D exhibits energy wells whose spacing seems adapted to the spacing of cellobiose units along a cellulose chain. PMID:23525113

(/sup 3/H)Ethylketocyclazocine binding to mouse brain membranes: evidence for a kappa opioid receptor type

DOE Office of Scientific and Technical Information (OSTI.GOV)

Garzon, J.; Sanchez-Blazquez, P.; Lee, N.M.

1984-10-01

The binding of the putative kappa agonist ethylketocyclazocine (EKC) to synaptosomal membranes of mouse brain was studied. This benzomorphan was able to bind to different opioid receptors. A portion of this binding was not inhibited by the agonist naloxone, even at high concentrations (10 microM). This population of receptors, to which opioate alkaloids and opiod peptides display very low affinity, is probably the sigma receptor. Another class of binding sites was identified by the simultaneous addition of the selective agonists Sandoz FK-33824 and D-Ala2-D-Leu5-enkephalin, which blocked the access of EKC to mu and delta opioid receptors, respectively, leaving a portionmore » of naloxone-displaceable benzomorphan binding still detectable. Analysis of this remaining binding revealed a small population of receptors of high affinity, the kappa receptor. Therefore, EKC binds to the mu, delta, kappa and sigma receptors in the mouse brain, with similar affinities for the mu and kappa (0.22 and 0.15 nM). These results confirm the existence of a kappa opioid receptor type in the mouse brain.« less

In Silico Prediction and Validation of Novel RNA Binding Proteins and Residues in the Human Proteome.

PubMed

Chowdhury, Shomeek; Zhang, Jian; Kurgan, Lukasz

2018-05-28

Deciphering a complete landscape of protein-RNA interactions in the human proteome remains an elusive challenge. We computationally elucidate RNA binding proteins (RBPs) using an approach that complements previous efforts. We employ two modern complementary sequence-based methods that provide accurate predictions from the structured and the intrinsically disordered sequences, even in the absence of sequence similarity to the known RBPs. We generate and analyze putative RNA binding residues on the whole proteome scale. Using a conservative setting that ensures low, 5% false positive rate, we identify 1511 putative RBPs that include 281 known RBPs and 166 RBPs that were previously predicted. We empirically demonstrate that these overlaps are statistically significant. We also validate the putative RBPs based on two major hallmarks of their RNA binding residues: high levels of evolutionary conservation and enrichment in charged amino acids. Moreover, we show that the novel RBPs are significantly under-annotated functionally which coincides with the fact that they were not yet found to interact with RNAs. We provide two examples of our novel putative RBPs for which there is recent evidence of their interactions with RNAs. The dataset of novel putative RBPs and RNA binding residues for the future hypothesis generation is provided in the Supporting Information. © 2018 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

In Vivo Chromatin Targets of the Transcription Factor Yin Yang 2 in Trophoblast Stem Cells

PubMed Central

Pérez-Palacios, Raquel; Macías-Redondo, Sofía; Climent, María; Contreras-Moreira, Bruno; Muniesa, Pedro; Schoorlemmer, Jon

2016-01-01

Background Yin Yang 2 (YY2) is a zinc finger protein closely related to the well-characterized Yin Yang 1 (YY1). YY1 is a DNA-binding transcription factor, with defined functions in multiple developmental processes, such as implantation, cell differentiation, X inactivation, imprinting and organogenesis. Yy2 has been treated as a largely immaterial duplication of Yy1, as they share high homology in the Zinc Finger-region and similar if not identical in vitro binding sites. In contrast to these similarities, gene expression alterations in HeLa cells with attenuated levels of either Yy1 or Yy2 were to some extent gene-specific. Moreover, the chromatin binding sites for YY2, except for its association with transposable retroviral elements (RE) and Endogenous Retroviral Elements (ERVs), remain to be identified. As a first step towards defining potential Yy2 functions matching or complementary to Yy1, we considered in vivo DNA binding sites of YY2 in trophoblast stem (TS) cells. Results We report the presence of YY2 protein in mouse-derived embryonic stem (ES) and TS cell lines. Following up on our previous report on ERV binding by YY2 in TS cells, we investigated the tissue-specificity of REX1 and YY2 binding and confirm binding to RE/ERV targets in both ES cells and TS cells. Because of the higher levels of expression, we chose TS cells to understand the role of Yy2 in gene and chromatin regulation. We used in vivo YY2 association as a measure to identify potential target genes. Sequencing of chromatin obtained in chromatin-immunoprecipitation (ChIP) assays carried out with αYY2 serum allowed us to identify a limited number of chromatin targets for YY2. Some putative binding sites were validated in regular ChIP assays and gene expression of genes nearby was altered in the absence of Yy2. Conclusions YY2 binding to ERVs is not confined to TS cells. In vivo binding sites share the presence of a consensus binding motif. Selected sites were uniquely bound by YY2 as opposed to YY1, suggesting that YY2 exerts unique contributions to gene regulation. YY2 binding was not generally associated with gene promoters. However, several YY2 binding sites are linked to long noncoding RNA (lncRNA) genes and we show that the expression levels of a few of those are Yy2-dependent. PMID:27191592

Structural Insights into the Protease-like Antigen Plasmodium falciparum SERA5 and Its Noncanonical Active-Site Serine

DOE Office of Scientific and Technical Information (OSTI.GOV)

Hodder, Anthony N.; Malby, Robyn L.; Clarke, Oliver B.

The sera genes of the malaria-causing parasite Plasmodium encode a family of unique proteins that are maximally expressed at the time of egress of parasites from infected red blood cells. These multi-domain proteins are unique, containing a central papain-like cysteine-protease fragment enclosed between the disulfide-linked N- and C-terminal domains. However, the central fragment of several members of this family, including serine repeat antigen 5 (SERA5), contains a serine (S596) in place of the active-site cysteine. Here we report the crystal structure of the central protease-like domain of Plasmodium falciparum SERA5, revealing a number of anomalies in addition to the putativemore » nucleophilic serine: (1) the structure of the putative active site is not conducive to binding substrate in the canonical cysteine-protease manner; (2) the side chain of D594 restricts access of substrate to the putative active site; and (3) the S{sub 2} specificity pocket is occupied by the side chain of Y735, reducing this site to a small depression on the protein surface. Attempts to determine the structure in complex with known inhibitors were not successful. Thus, despite having revealed its structure, the function of the catalytic domain of SERA5 remains an enigma.« less

Structure of the bacteriophage T4 long tail fiber receptor-binding tip

PubMed Central

Bartual, Sergio G.; Otero, José M.; Garcia-Doval, Carmela; Llamas-Saiz, Antonio L.; Kahn, Richard; Fox, Gavin C.; van Raaij, Mark J.

2010-01-01

Bacteriophages are the most numerous organisms in the biosphere. In spite of their biological significance and the spectrum of potential applications, little high-resolution structural detail is available on their receptor-binding fibers. Here we present the crystal structure of the receptor-binding tip of the bacteriophage T4 long tail fiber, which is highly homologous to the tip of the bacteriophage lambda side tail fibers. This structure reveals an unusual elongated six-stranded antiparallel beta-strand needle domain containing seven iron ions coordinated by histidine residues arranged colinearly along the core of the biological unit. At the end of the tip, the three chains intertwine forming a broader head domain, which contains the putative receptor interaction site. The structure reveals a previously unknown beta-structured fibrous fold, provides insights into the remarkable stability of the fiber, and suggests a framework for mutations to expand or modulate receptor-binding specificity. PMID:21041684

Functional Analysis of the Citrate Activator CitO from Enterococcus faecalis Implicates a Divalent Metal in Ligand Binding

PubMed Central

Blancato, Víctor S.; Pagliai, Fernando A.; Magni, Christian; Gonzalez, Claudio F.; Lorca, Graciela L.

2016-01-01

The regulator of citrate metabolism, CitO, from Enterococcus faecalis belongs to the FCD family within the GntR superfamily. In the presence of citrate, CitO binds to cis-acting sequences located upstream of the cit promoters inducing the expression of genes involved in citrate utilization. The quantification of the molecular binding affinities, performed by isothermal titration calorimetry (ITC), indicated that CitO has a high affinity for citrate (KD = 1.2 ± 0.2 μM), while it did not recognize other metabolic intermediates. Based on a structural model of CitO where a putative small molecule and a metal binding site were identified, it was hypothesized that the metal ion is required for citrate binding. In agreement with this model, citrate binding to CitO sharply decreased when the protein was incubated with EDTA. This effect was reverted by the addition of Ni2+, and Zn2+ to a lesser extent. Structure-based site-directed mutagenesis was conducted and it was found that changes to alanine in residues Arg97 and His191 resulted in decreased binding affinities for citrate, as determined by EMSA and ITC. Further assays using lacZ fusions confirmed that these residues in CitO are involved in sensing citrate in vivo. These results indicate that the molecular modifications induced by a ligand and a metal binding in the C-terminal domain of CitO are required for optimal DNA binding activity, and consequently, transcriptional activation. PMID:26903980

The metal chaperone Atox1 regulates the activity of the human copper transporter ATP7B by modulating domain dynamics.

PubMed

Yu, Corey H; Yang, Nan; Bothe, Jameson; Tonelli, Marco; Nokhrin, Sergiy; Dolgova, Natalia V; Braiterman, Lelita; Lutsenko, Svetlana; Dmitriev, Oleg Y

2017-11-03

The human transporter ATP7B delivers copper to the biosynthetic pathways and maintains copper homeostasis in the liver. Mutations in ATP7B cause the potentially fatal hepatoneurological disorder Wilson disease. The activity and intracellular localization of ATP7B are regulated by copper, but the molecular mechanism of this regulation is largely unknown. We show that the copper chaperone Atox1, which delivers copper to ATP7B, and the group of the first three metal-binding domains (MBD1-3) are central to the activity regulation of ATP7B. Atox1-Cu binding to ATP7B changes domain dynamics and interactions within the MBD1-3 group and activates ATP hydrolysis. To understand the mechanism linking Atox1-MBD interactions and enzyme activity, we have determined the MBD1-3 conformational space using small angle X-ray scattering and identified changes in MBD dynamics caused by apo -Atox1 and Atox1-Cu by solution NMR. The results show that copper transfer from Atox1 decreases domain interactions within the MBD1-3 group and increases the mobility of the individual domains. The N-terminal segment of MBD1-3 was found to interact with the nucleotide-binding domain of ATP7B, thus physically coupling the domains involved in copper binding and those involved in ATP hydrolysis. Taken together, the data suggest a regulatory mechanism in which Atox1-mediated copper transfer activates ATP7B by releasing inhibitory constraints through increased freedom of MBD1-3 motions. © 2017 by The American Society for Biochemistry and Molecular Biology, Inc.

Interleukin 2 transcription factors as molecular targets of cAMP inhibition: delayed inhibition kinetics and combinatorial transcription roles

PubMed Central

1994-01-01

Elevation of cAMP can cause gene-specific inhibition of interleukin 2 (IL-2) expression. To investigate the mechanism of this effect, we have combined electrophoretic mobility shift assays and in vivo genomic footprinting to assess both the availability of putative IL-2 transcription factors in forskolin-treated cells and the functional capacity of these factors to engage their sites in vivo. All observed effects of forskolin depended upon protein kinase A, for they were blocked by introduction of a dominant negative mutant subunit of protein kinase A. In the EL4.E1 cell line, we report specific inhibitory effects of cAMP elevation both on NF-kappa B/Rel family factors binding at -200 bp, and on a novel, biochemically distinct "TGGGC" factor binding at -225 bp with respect to the IL-2 transcriptional start site. Neither NF-AT nor AP-1 binding activities are detectably inhibited in gel mobility shift assays. Elevation of cAMP inhibits NF-kappa B activity with delayed kinetics in association with a delayed inhibition of IL-2 RNA accumulation. Activation of cells in the presence of forskolin prevents the maintenance of stable protein- DNA interactions in vivo, not only at the NF-kappa B and TGGGC sites of the IL-2 enhancer, but also at the NF-AT, AP-1, and other sites. This result, and similar results in cyclosporin A-treated cells, imply that individual IL-2 transcription factors cannot stably bind their target sequences in vivo without coengagement of all other distinct factors at neighboring sites. It is proposed that nonhierarchical, cooperative enhancement of binding is a structural basis of combinatorial transcription factor action at the IL-2 locus. PMID:8113685

Genetic variants related to disease susceptibility and immunotolerance in the Duffy antigen receptor for chemokines (DARC, Fy) gene in the black lion tamarin (Leontopithecus chrysopygus, primates).

PubMed

Ansel, Ashley; Lewis, James D; Melnick, Don J; Martins, Cristiana; Valladares-Padua, Claudio; Perez-Sweeney, Beatriz

2017-10-01

The DARC (Duffy antigen receptor for chemokines) gene encodes the DARC protein, which serves multiple roles in the immune system, as a binding site for the malarial parasites Plasmodium vivax and Plasmodium knowlesi, a promiscuous chemokine receptor and a blood group antigen. Variation in DARC may play particularly significant roles in innate immunity, immunotolerance and pathogen entry in callitrichines, such as the black lion tamarin (Leontopithecus chrysopygus). We compared amino acid sequences of DARC in the black lion tamarin (BLT) to non-human Haplorhine primates and Homo sapiens. Consistent with prior studies in other Haplorhines, we observed that the chemokine receptor experiences two opposing selection forces: (1) positive selection on the Plasmodium binding site and (2) purifying selection. We observed also that D21N, F22L, and V25L differentiated BLT from humans at a critical site for P. vivax and P. knowlesi binding. One amino acid residue, F22L, was subject to both positive selection and fixation in New World monkeys, suggesting a beneficial role as an adaptive barrier to Plasmodium entry. Unlike in humans, we observed no variation in DARC among BLTs, suggesting that the protein does not play a role in immunotolerance. In addition, lion tamarins differed from humans at the blood compatibility Fy a /Fy b antigen-binding site 44, as well as at the putative destabilizing residues A61, T68, A187, and L215, further supporting a difference in the functional role of DARC in these primates compared with humans. Further research is needed to determine whether changes in the Plasmodium and Fy a /Fy b antigen-binding sites disrupt DARC function in callitrichines. © 2017 Wiley Periodicals, Inc.

Cobra CRISP functions as an inflammatory modulator via a novel Zn2+- and heparan sulfate-dependent transcriptional regulation of endothelial cell adhesion molecules.

PubMed

Wang, Yu-Ling; Kuo, Je-Hung; Lee, Shao-Chen; Liu, Jai-Shin; Hsieh, Yin-Cheng; Shih, Yu-Tsung; Chen, Chun-Jung; Chiu, Jeng-Jiann; Wu, Wen-Guey

2010-11-26

Cysteine-rich secretory proteins (CRISPs) have been identified as a toxin family in most animal venoms with biological functions mainly associated with the ion channel activity of cysteine-rich domain (CRD). CRISPs also bind to Zn(2+) at their N-terminal pathogenesis-related (PR-1) domain, but their function remains unknown. Interestingly, similar the Zn(2+)-binding site exists in all CRISP family, including those identified in a wide range of organisms. Here, we report that the CRISP from Naja atra (natrin) could induce expression of vascular endothelial cell adhesion molecules, i.e. intercellular adhesion molecule-1, vascular adhesion molecule-1, and E-selectin, to promote monocytic cell adhesion in a heparan sulfate (HS)- and Zn(2+)-dependent manner. Using specific inhibitors and small interfering RNAs, the activation mechanisms are shown to involve both mitogen-activated protein kinases and nuclear factor-κB. Biophysical characterization of natrin by using fluorescence, circular dichroism, and x-ray crystallographic methods further reveals the presence of two Zn(2+)-binding sites for natrin. The strong binding site is located near the putative Ser-His-Glu catalytic triad of the N-terminal domain. The weak binding site remains to be characterized, but it may modulate HS binding by enhancing its interaction with long chain HS. Our results strongly suggest that natrin may serve as an inflammatory modulator that could perturb the wound-healing process of the bitten victim by regulating adhesion molecule expression in endothelial cells. Our finding uncovers a new aspect of the biological role of CRISP family in immune response and is expected to facilitate future development of new therapeutic strategy for the envenomed victims.

Adsorption of aqueous copper on peanut hulls

NASA Astrophysics Data System (ADS)

Davis, Kanika Octavia

A method was established for measuring the adsorption of Cu(II) from aqueous solution to unmodified and modified peanut hulls at constant temperature and pH. Modification of the hulls was performed by oxidation with alkaline hydrogen peroxide. During the modification process, the hydrogen peroxide solubilizes the lignin component, making the surface more porous which increases the availability of binding sites, while simultaneously oxidizing the cellulose. The oxidation of alcohol groups creates more binding sites by creating functional groups such as COO-, which increases chelation to metal ions. Fourier transform infrared spectroscopy confirms delignification of the peanut hulls by the disappearance of carboxyl peaks of the modified hulls, which were originally produced from the lignin content. Although, oxidation is not fully confirmed, it is not ruled out because the expected carboxylate peak (1680 cm-1) maybe overshadowed by a broad peak due to OH bending of water adsorbed to the hulls. Hulls adsorbed copper from solutions in the concentration range of 50-1000 ppm of CuCl2. Concentrations of pre- and post-adsorption solutions were determined using inductively coupled plasma optical emission spectroscopy. The adsorption isotherms were fit to known two and three-parameter models, evaluated and the binding mechanism was inferred. Maximum surface coverage was 3.5 +/- 0.6 mg Cu2+ /g hull for unmodified hulls and 11 +/- 1 mg Cu2+/g hull for modified hulls. The adsorption for the hulls is best described by the Langmuir model, suggesting monolayer, homogeneous adsorption. With a free energy of adsorption of 10.5 +/- 0.9 kJ/mol for unmodified hulls and 14.5 +/-0.4 kJ/mol for modified hulls, the process is categorized as chemisorption for both types of hulls. The adsorption for both hulls is also described by the Redlich-Peterson model, giving beta nearer to 1 than 0, which further suggests homogeneous adsorption described by the Langmuir model. After rinsing the hulls, scanning electron microscopy images coupled with energy dispersive X-ray spectroscopy showed that the percentage of copper on the modified hulls (2.5 %) was greater than on the unmodified hulls (1.6 %). This study concluded that the adsorption of copper using peanut hulls is a potential method for wastewater treatment and delignification and oxidation of the hulls increases the adsorption capacity approximately three-fold.

Structure of the catalytic domain of the colistin resistance enzyme MCR-1

DOE PAGES

Stojanoski, Vlatko; Sankaran, Banumathi; Prasad, B. V. Venkataram; ...

2016-09-21

Due to the paucity of novel antibiotics, colistin has become a last resort antibiotic for treating multidrug resistant bacteria. Colistin acts by binding the lipid A component of lipopolysaccharides and subsequently disrupting the bacterial membrane. The recently identified plasmid-encoded MCR-1 enzyme is the first transmissible colistin resistance determinant and is a cause for concern for the spread of this resistance trait. MCR-1 is a phosphoethanolamine transferase that catalyzes the addition of phosphoethanolamine to lipid A to decrease colistin affinity. The structure of the catalytic domain of MCR-1 at 1.32 Å reveals the active site is similar to that of relatedmore » phosphoethanolamine transferases. The putative nucleophile for catalysis, threonine 285, is phosphorylated in cMCR-1 and a zinc is present at a conserved site in addition to three zincs more peripherally located in the active site. As noted for catalytic domains of other phosphoethanolamine transferases, binding sites for the lipid A and phosphatidylethanolamine substrates are not apparent in the cMCR-1 structure, suggesting that they are present in the membrane domain.« less

Alteration of the Copper-Binding Capacity of Iron-Rich Humic Colloids during Transport from Peatland to Marine Waters.

PubMed

Muller, François L L; Cuscov, Marco

2017-03-21

Blanket bogs contain vast amounts of Sphagnum-derived organic substances which can act as powerful chelators for dissolved iron and thus enhance its export to the coastal ocean. To investigate the variations in quantity and quality of these exports, adsorptive cathodic stripping voltammetry (CSV) was used to characterize the metal binding properties of molecular weight-fractionated dissolved organic matter (MW-fractionated DOM) in the catchment and coastal plume of a small peat-draining river over a seasonal cycle. Within the plume, both iron- and copper-binding organic ligands showed a linear, conservative distribution with increasing salinity, illustrating the high stability of peatland-derived humic substances (HS). Within the catchment, humic colloids lost up to 50% of their copper-binding capacity, expressed as a molar ratio to organic carbon, after residing for 1 week or more in the main reservoir of the catchment. Immediately downstream of the reservoir, the molar ratio [L 2 ]/[C org ], where L 2 was the second strongest copper-binding ligand, was 0.75 × 10 -4 when the reservoir residence time was 5 h but 0.34 × 10 -4 when it was 25 days. Residence time did not affect the carbon specific iron-binding capacity of the humic substances which was [L]/[C org ] = (0.80 ± 0.20) × 10 -2 . Our results suggest that the loss of copper-binding capacity with increasing residence time is caused by intracolloidal interactions between iron and HS during transit from peat soil to river mouth.

Molecular Basis for Differential Anion Binding and Proton Coupling in the Cl−/H+ Exchanger ClC-ec1

PubMed Central

Jiang, Tao; Han, Wei; Maduke, Merritt; Tajkhorshid, Emad

2016-01-01

Cl−/H+ transporters of the CLC superfamily form a ubiquitous class of membrane proteins that catalyze stoichiometrically coupled exchange of Cl− and H+ across biological membranes. CLC transporters exchange H+ for halides and certain polyatomic anions, but exclude cations, F−, and larger physiological anions, such as PO43− and SO42−. Despite comparable transport rates of different anions, the H+ coupling in CLC transporters varies significantly depending on the chemical nature of the transported anion. Although the molecular mechanism of exchange remains unknown, studies on bacterial ClC-ec1 transporter revealed that Cl− binding to the central anion-binding site (Scen) is crucial for the anion-coupled H+ transport. Here, we show that Cl−, F−, NO3−, and SCN− display distinct binding coordinations at the Scen site and are hydrated in different manners. Consistent with the observation of differential bindings, ClC-ec1 exhibits markedly variable ability to support the formation of the transient water wires, which are necessary to support the connection of the two H+ transfer sites (Gluin and Gluex), in the presence of different anions. While continuous water wires are frequently observed in the presence of physiologically transported Cl−, binding of F− or NO3− leads to the formation of pseudo-water-wires that are substantially different from the wires formed with Cl−. Binding of SCN−, however, eliminates the water wires altogether. These findings provide structural details of anion binding in ClC-ec1 and reveal a putative atomic-level mechanism for the decoupling of H+ transport to the transport of anions other than Cl−. PMID:26880377

Two DNA-binding factors recognize specific sequences at silencers, upstream activating sequences, autonomously replicating sequences, and telomeres in Saccharomyces cerevisiae

DOE Office of Scientific and Technical Information (OSTI.GOV)

Buchman, A.R.; Kimmerly, W.J.; Rine, J.

1988-01-01

Two DNA-binding factors from Saccharomyces cerevisiae have been characterized, GRFI (general regulatory factor I) and ABFI (ARS-binding factor I), that recognize specific sequences within diverse genetic elements. GRFI bound to sequences at the negative regulatory elements (silencers) of the silent mating type loci HML E and HMR E and to the upstream activating sequence (UAS) required for transcription of the MAT ..cap alpha.. genes. A putative conserved UAS located at genes involved in translation (RPG box) was also recognized by GRFI. In addition, GRFI bound with high affinity to sequences within the (C/sub 1-3/A)-repeat region at yeast telomeres. Binding sitesmore » for GRFI with the highest affinity appeared to be of the form 5'-(A/G)(A/C)ACCCAN NCA(T/C)(T/C)-3', where N is any nucleotide. ABFI-binding sites were located next to autonomously replicating sequences (ARSs) at controlling elements of the silent mating type loci HMR E, HMR I, and HML I and were associated with ARS1, ARS2, and the 2..mu..m plasmid ARS. Two tandem ABFI binding sites were found between the HIS3 and DED1 genes, several kilobase pairs from any ARS, indicating that ABFI-binding sites are not restricted to ARSs. The sequences recognized by AFBI showed partial dyad-symmetry and appeared to be variations of the consensus 5'-TATCATTNNNNACGA-3'. GRFI and ABFI were both abundant DNA-binding factors and did not appear to be encoded by the SIR genes, whose product are required for repression of the silent mating type loci. Together, these results indicate that both GRFI and ABFI play multiple roles within the cell.« less

Construction of a high efficiency copper adsorption bacterial system via peptide display and its application on copper dye polluted wastewater.

PubMed

Maruthamuthu, Murali Kannan; Nadarajan, Saravanan Prabhu; Ganesh, Irisappan; Ravikumar, Sambandam; Yun, Hyungdon; Yoo, Ik-Keun; Hong, Soon Ho

2015-11-01

For the construction of an efficient copper waste treatment system, a cell surface display strategy was employed. The copper adsorption ability of recombinant bacterial strains displaying three different copper binding peptides were evaluated in LB Luria-Bertani medium (LB), artificial wastewater, and copper phthalocyanine containing textile dye industry wastewater samples. Structural characteristics of the three peptides were also analyzed by similarity-based structure modeling. The best binding peptide was chosen for the construction of a dimeric peptide display and the adsorption ability of the monomeric and dimeric peptide displayed strains were compared. The dimeric peptide displayed strain showed superior copper adsorption in all three tested conditions (LB, artificial wastewater, and textile dye industry wastewater). When the strains were exposed to copper phthalocyanine dye polluted wastewater, the dimeric peptide display [543.27 µmol/g DCW dry cell weight (DCW)] showed higher adsorption of copper when compared with the monomeric strains (243.53 µmol/g DCW).

The Leptospiral Antigen Lp49 is a Two-Domain Protein with Putative Protein Binding Function

DOE Office of Scientific and Technical Information (OSTI.GOV)

Oliveira Giuseppe,P.; Oliveira Neves, F.; Nascimento, A.

2008-01-01

Pathogenic Leptospira is the etiological agent of leptospirosis, a life-threatening disease that affects populations worldwide. Currently available vaccines have limited effectiveness and therapeutic interventions are complicated by the difficulty in making an early diagnosis of leptospirosis. The genome of Leptospira interrogans was recently sequenced and comparative genomic analysis contributed to the identification of surface antigens, potential candidates for development of new vaccines and serodiagnosis. Lp49 is a membrane-associated protein recognized by antibodies present in sera from early and convalescent phases of leptospirosis patients. Its crystal structure was determined by single-wavelength anomalous diffraction using selenomethionine-labelled crystals and refined at 2.0 Angstromsmore » resolution. Lp49 is composed of two domains and belongs to the all-beta-proteins class. The N-terminal domain folds in an immunoglobulin-like beta-sandwich structure, whereas the C-terminal domain presents a seven-bladed beta-propeller fold. Structural analysis of Lp49 indicates putative protein-protein binding sites, suggesting a role in Leptospira-host interaction. This is the first crystal structure of a leptospiral antigen described to date.« less

CopM is a novel copper-binding protein involved in copper resistance in Synechocystis sp. PCC 6803.

PubMed

Giner-Lamia, Joaquín; López-Maury, Luis; Florencio, Francisco J

2015-02-01

Copper resistance system in the cyanobacterium Synechocystis sp. PCC 6803 comprises two operons, copMRS and copBAC, which are expressed in response to copper in the media. copBAC codes for a heavy-metal efflux-resistance nodulation and division (HME-RND) system, while copMRS codes for a protein of unknown function, CopM, and a two-component system CopRS, which controls the expression of these two operons. Here, we report that CopM is a periplasmic protein able to bind Cu(I) with high affinity (KD ~3 × 10(-16) ). Mutants lacking copM showed a sensitive copper phenotype similar to mutants affected in copB, but lower than mutants of the two-component system CopRS, suggesting that CopBAC and CopM constitute two independent resistance mechanisms. Moreover, constitutive expression of copM is able to partially suppress the copper sensitivity of the copR mutant strain, pointing out that CopM per se is able to confer copper resistance. Furthermore, constitutive expression of copM was able to reduce total cellular copper content of the copR mutant to the levels determined in the wild-type (WT) strain. Finally, CopM was localized not only in the periplasm but also in the extracellular space, suggesting that CopM can also prevent copper accumulation probably by direct copper binding outside the cell. © 2014 The Authors. MicrobiologyOpen published by John Wiley & Sons Ltd.

CopM is a novel copper-binding protein involved in copper resistance in Synechocystis sp. PCC 6803

PubMed Central

Giner-Lamia, Joaquín; López-Maury, Luis; Florencio, Francisco J

2015-01-01

Copper resistance system in the cyanobacterium Synechocystis sp. PCC 6803 comprises two operons, copMRS and copBAC, which are expressed in response to copper in the media. copBAC codes for a heavy-metal efflux–resistance nodulation and division (HME-RND) system, while copMRS codes for a protein of unknown function, CopM, and a two-component system CopRS, which controls the expression of these two operons. Here, we report that CopM is a periplasmic protein able to bind Cu(I) with high affinity (KD ∼3 × 10−16). Mutants lacking copM showed a sensitive copper phenotype similar to mutants affected in copB, but lower than mutants of the two-component system CopRS, suggesting that CopBAC and CopM constitute two independent resistance mechanisms. Moreover, constitutive expression of copM is able to partially suppress the copper sensitivity of the copR mutant strain, pointing out that CopM per se is able to confer copper resistance. Furthermore, constitutive expression of copM was able to reduce total cellular copper content of the copR mutant to the levels determined in the wild-type (WT) strain. Finally, CopM was localized not only in the periplasm but also in the extracellular space, suggesting that CopM can also prevent copper accumulation probably by direct copper binding outside the cell. PMID:25545960

Direct activation of the olfactory cyclic nucleotide-gated channel through modification of sulfhydryl groups by NO compounds.

PubMed

Broillet, M C; Firestein, S

1996-02-01

The activation of a cyclic nucleotide-gated channel is the final step in sensory transduction in olfaction. Normally, this channel is opened by the intracellular cyclic nucleotide second messenger cAMP or cGMP. However, in single channel recordings we found that donors of nitric oxide, a putative intercellular messenger, could directly activate the native olfactory neuron channel. Its action was independent of the presence of the normal ligand and did not involve the cyclic nucleotide binding site, suggesting an alternate site on the molecule that is critical in channel gating. The biochemical pathway appears to utilize nitric oxide in one of its alternate redox states, the nitrosonium ion, transnitrosylating a free sulfhydryl group belonging to a cysteine residue tentatively identified as being in the region linking the S6 transmembrane domain to the ligand binding domain.

Picornavirus Modification of a Host mRNA Decay Protein

PubMed Central

Rozovics, Janet M.; Chase, Amanda J.; Cathcart, Andrea L.; Chou, Wayne; Gershon, Paul D.; Palusa, Saiprasad; Wilusz, Jeffrey; Semler, Bert L.

2012-01-01

ABSTRACT Due to the limited coding capacity of picornavirus genomic RNAs, host RNA binding proteins play essential roles during viral translation and RNA replication. Here we describe experiments suggesting that AUF1, a host RNA binding protein involved in mRNA decay, plays a role in the infectious cycle of picornaviruses such as poliovirus and human rhinovirus. We observed cleavage of AUF1 during poliovirus or human rhinovirus infection, as well as interaction of this protein with the 5′ noncoding regions of these viral genomes. Additionally, the picornavirus proteinase 3CD, encoded by poliovirus or human rhinovirus genomic RNAs, was shown to cleave all four isoforms of recombinant AUF1 at a specific N-terminal site in vitro. Finally, endogenous AUF1 was found to relocalize from the nucleus to the cytoplasm in poliovirus-infected HeLa cells to sites adjacent to (but distinct from) putative viral RNA replication complexes. PMID:23131833

GBshape: a genome browser database for DNA shape annotations

PubMed Central

Chiu, Tsu-Pei; Yang, Lin; Zhou, Tianyin; Main, Bradley J.; Parker, Stephen C.J.; Nuzhdin, Sergey V.; Tullius, Thomas D.; Rohs, Remo

2015-01-01

Many regulatory mechanisms require a high degree of specificity in protein-DNA binding. Nucleotide sequence does not provide an answer to the question of why a protein binds only to a small subset of the many putative binding sites in the genome that share the same core motif. Whereas higher-order effects, such as chromatin accessibility, cooperativity and cofactors, have been described, DNA shape recently gained attention as another feature that fine-tunes the DNA binding specificities of some transcription factor families. Our Genome Browser for DNA shape annotations (GBshape; freely available at http://rohslab.cmb.usc.edu/GBshape/) provides minor groove width, propeller twist, roll, helix twist and hydroxyl radical cleavage predictions for the entire genomes of 94 organisms. Additional genomes can easily be added using the GBshape framework. GBshape can be used to visualize DNA shape annotations qualitatively in a genome browser track format, and to download quantitative values of DNA shape features as a function of genomic position at nucleotide resolution. As biological applications, we illustrate the periodicity of DNA shape features that are present in nucleosome-occupied sequences from human, fly and worm, and we demonstrate structural similarities between transcription start sites in the genomes of four Drosophila species. PMID:25326329

A Zn(II)2Cys6 DNA binding protein regulates the sirodesmin PL biosynthetic gene cluster in Leptosphaeria maculans

PubMed Central

Fox, Ellen M.; Gardiner, Donald M.; Keller, Nancy P.; Howlett, Barbara J.

2008-01-01

A gene, sirZ, encoding a Zn(II)2Cys6 DNA binding protein is present in a cluster of genes responsible for the biosynthesis of the epipolythiodioxopiperazine (ETP) toxin, sirodesmin PL in the ascomycete plant pathogen, Leptosphaeria maculans. RNA-mediated silencing of sirZ gives rise to transformants that produce only residual amounts of sirodesmin PL and display a decrease in the transcription of several sirodesmin PL biosynthetic genes. This indicates that SirZ is a major regulator of this gene cluster. Proteins similar to SirZ are encoded in the gliotoxin biosynthetic gene cluster of Aspergillus fumigatus (gliZ) and in an ETP-like cluster in Penicillium lilacinoechinulatum (PlgliZ). Despite its high level of sequence similarity to gliZ, PlgliZ is unable to complement the gliotoxin-deficiency of a mutant of gliZ in A. fumigatus. Putative binding sites for these regulatory proteins in the promoters of genes in these clusters were predicted using bioinformatic analysis. These sites are similar to those commonly bound by other proteins with Zn(II)2Cys6 DNA binding domains. PMID:18023597

Ligand Entry and Exit Pathways in the β2-adrenergic Receptor

PubMed Central

Wang, Ting; Duan, Yong

2009-01-01

The recently determined crystal structure of the human β2-adrenergic (β2AR) G-protein coupled receptor provides an excellent structural basis for exploring β2AR -ligand binding and dissociation process. Based on this crystal structure, we simulated ligand exit from the β2AR receptor by applying the random acceleration molecular dynamics (RAMD) simulation method. The simulation results showed that the extracellular opening on the receptor surface was the most frequently observed egress point (referred to as pathway A) and a few other pathways through inter-helical clefts were also observed with significantly lower frequencies. In the egress trajectories along pathway A, the D192-K305 salt bridge between the extracellular loop 2 (ECL2) and the apex of the transmembrane helix 7 (TM7) was exclusively broken. The spatial occupancy maps of the ligand computed from the 100 RAMD simulation trajectories indicated that the receptor-ligand interactions that restrained the ligand in the binding pocket were the major resistance encountered by the ligand during exit and no second barrier was notable. We next performed RAMD simulations by using a putative ligand-free conformation of the receptor as input structure. This conformation was obtained in a standard MD simulation in the absence of the ligand and it differed from the ligand-bound conformation in a hydrophobic patch bridging ECL2 and TM7 due to the rotation of F193 of ECL2. Results from the RAMD simulations with this putative ligand-free conformation suggest that the cleft formed by the hydrophobic bridge, TM2, TM3 and TM7 on the extracellular surface likely serves as a more specific ligand-entry site and the ECL2-TM7 hydrophobic junction can be partially interrupted upon the entry of ligand that pushes F193 to rotate, resulting in a conformation as observed in the ligand-bound crystal structure. These results may help design β2AR-targeting drugs with improved efficacy as well as understand the receptor subtype-selectivity of ligand binding in the β family of the adrenergic receptors that share almost identical ligand-binding pockets but show notable amino acid sequence divergence in the putative ligand-entry site, including ECL2 and the extracellular end of TM7. PMID:19665031

Potassium and the K+/H+ Exchanger Kha1p Promote Binding of Copper to ApoFet3p Multi-copper Ferroxidase*

PubMed Central

Wu, Xiaobin; Kim, Heejeong; Seravalli, Javier; Barycki, Joseph J.; Hart, P. John; Gohara, David W.; Di Cera, Enrico; Jung, Won Hee; Kosman, Daniel J.; Lee, Jaekwon

2016-01-01

Acquisition and distribution of metal ions support a number of biological processes. Here we show that respiratory growth of and iron acquisition by the yeast Saccharomyces cerevisiae relies on potassium (K+) compartmentalization to the trans-Golgi network via Kha1p, a K+/H+ exchanger. K+ in the trans-Golgi network facilitates binding of copper to the Fet3p multi-copper ferroxidase. The effect of K+ is not dependent on stable binding with Fet3p or alteration of the characteristics of the secretory pathway. The data suggest that K+ acts as a chemical factor in Fet3p maturation, a role similar to that of cations in folding of nucleic acids. Up-regulation of KHA1 gene in response to iron limitation via iron-specific transcription factors indicates that K+ compartmentalization is linked to cellular iron homeostasis. Our study reveals a novel functional role of K+ in the binding of copper to apoFet3p and identifies a K+/H+ exchanger at the secretory pathway as a new molecular factor associated with iron uptake in yeast. PMID:26966178

Identity of a peptide domain of human C9 that is bound by the cell-surface complement inhibitor, CD59.

PubMed

Chang, C P; Hüsler, T; Zhao, J; Wiedmer, T; Sims, P J

1994-10-21

The CD59 antigen is a plasma membrane glycoprotein that serves as an inhibitor of the C5b-9 complex of complement. This inhibitory activity appears related to the capacity of CD59 to bind with high affinity to sites that are nascently exposed in the alpha-chain subunit of human C8, as well as within the C9b domain (amino acid residues 245-538) of human C9, during assembly of the C5b-9 complex on the target membrane (Ninomiya, H., and Sims, P. J. (1992) J. Biol. Chem. 267, 13675-13680). The CD59 binding site in C9 was first investigated by N-terminal sequencing of CD59-binding peptides generated by limited digest of the isolated C9b domain. These experiments revealed a 17-kDa fragment (starting at C9 residue Thr-320) that retained affinity for CD59, suggesting the possibility for localizing the CD59 binding site by mapping with small C9-derived peptides. Peptides spanning the entire C9b sequence were expressed in Escherichia coli and then probed with CD59. CD59 bound specifically to all peptides starting N-terminal to C9 residue 359 with C termini extending beyond residue 411. Little to no CD59 binding was observed for various C9-derived peptides that started C-terminal to residue 359 or that were truncated N-terminal to residue 411. Affinity-purified antibody against C9 residues 320-411 inhibited CD59 binding to C9 by > 50% and completely inhibited its binding to the isolated C9b domain. Little to no specific binding of CD59 was detected for peptides restricted to the putative hinge domain within C9b (residues 245-271). These results indicate that a CD59 binding site is located between residues 320 and 411 of the C9 polypeptide and suggest that the affinity of this site is principally determined by residues 359-411.

Evaluation of Cu(i) binding to the E2 domain of the amyloid precursor protein - a lesson in quantification of metal binding to proteins via ligand competition.

PubMed

Young, Tessa R; Wedd, Anthony G; Xiao, Zhiguang

2018-01-24

The extracellular domain E2 of the amyloid precursor protein (APP) features a His-rich metal-binding site (denoted as the M1 site). In conjunction with surrounding basic residues, the site participates in interactions with components of the extracellular matrix including heparins, a class of negatively charged polysaccharide molecules of varying length. This work studied the chemistry of Cu(i) binding to APP E2 with the probe ligands Bcs, Bca, Fz and Fs. APP E2 forms a stable Cu(i)-mediated ternary complex with each of these anionic ligands. The complex with Bca was selected for isolation and characterization and was demonstrated, by native ESI-MS analysis, to have the stoichiometry E2 : Cu(i) : Bca = 1 : 1 : 1. Formation of these ternary complexes is specific for the APP E2 domain and requires Cu(i) coordination to the M1 site. Mutation of the M1 site was consistent with the His ligands being part of the E2 ligand set. It is likely that interactions between the negatively charged probe ligands and a positively charged patch on the surface of APP E2 are one aspect of the generation of the stable ternary complexes. Their formation prevented meaningful quantification of the affinity of Cu(i) binding to the M1 site with these probe ligands. However, the ternary complexes are disrupted by heparin, allowing reliable determination of a picomolar Cu(i) affinity for the E2/heparin complex with the Fz or Bca probe ligands. This is the first documented example of the formation of stable ternary complexes between a Cu(i) binding protein and a probe ligand. The ready disruption of the complexes by heparin identified clear 'tell-tale' signs for diagnosis of ternary complex formation and allowed a systematic review of conditions and criteria for reliable determination of affinities for metal binding via ligand competition. This study also provides new insights into a potential correlation of APP functions regulated by copper binding and heparin interaction.

Structural Basis for Sialoglycan Binding by the Streptococcus sanguinis SrpA Adhesin.

PubMed

Bensing, Barbara A; Loukachevitch, Lioudmila V; McCulloch, Kathryn M; Yu, Hai; Vann, Kendra R; Wawrzak, Zdzislaw; Anderson, Spencer; Chen, Xi; Sullam, Paul M; Iverson, T M

2016-04-01

Streptococcus sanguinisis a leading cause of infective endocarditis, a life-threatening infection of the cardiovascular system. An important interaction in the pathogenesis of infective endocarditis is attachment of the organisms to host platelets.S. sanguinisexpresses a serine-rich repeat adhesin, SrpA, similar in sequence to platelet-binding adhesins associated with increased virulence in this disease. In this study, we determined the first crystal structure of the putative binding region of SrpA (SrpABR) both unliganded and in complex with a synthetic disaccharide ligand at 1.8 and 2.0 Å resolution, respectively. We identified a conserved Thr-Arg motif that orients the sialic acid moiety and is required for binding to platelet monolayers. Furthermore, we propose that sequence insertions in closely related family members contribute to the modulation of structural and functional properties, including the quaternary structure, the tertiary structure, and the ligand-binding site. © 2016 by The American Society for Biochemistry and Molecular Biology, Inc.

Aurora Kinase B, a novel regulator of TERF1 binding and telomeric integrity

PubMed Central

Chan, Foong Lyn; Vinod, Benjamin; Novy, Karel; Schittenhelm, Ralf B.; Huang, Cheng; Udugama, Maheshi; Nunez-Iglesias, Juan; Lin, Jane I.; Hii, Linda; Chan, Julie; Pickett, Hilda A.; Daly, Roger J.

2017-01-01

Abstract AURKB (Aurora Kinase B) is a serine/threonine kinase better known for its role at the mitotic kinetochore during chromosome segregation. Here, we demonstrate that AURKB localizes to the telomeres in mouse embryonic stem cells, where it interacts with the essential telomere protein TERF1. Loss of AURKB function affects TERF1 telomere binding and results in aberrant telomere structure. In vitro kinase experiments successfully identified Serine 404 on TERF1 as a putative AURKB target site. Importantly, in vivo overexpression of S404-TERF1 mutants results in fragile telomere formation. These findings demonstrate that AURKB is an important regulator of telomere structural integrity. PMID:29040668

Interrelations of secondary structure stability and DNA-binding affinity in the bacteriophage SPO1-encoded type II DNA-binding protein TF1.

PubMed

Andera, L; Spangler, C J; Galeone, A; Mayol, L; Geiduschek, E P

1994-02-11

TF1, a homodimeric DNA-binding and -bending protein with a preference for hydroxymethyluracil-containing DNA is the Bacillus subtilis-encoded homolog of the bacterial HU proteins and of the E. coli integration host factor. A temperature-sensitive mutation at amino acid 25 of TF1 (L25-->A) and two intragenic second site revertants at amino acids 15 (E15-->G) and 32 (L32-->I) were previously identified and their effects on virus development were examined. The DNA-binding properties of these proteins and the thermal stability of their secondary structures have now been analyzed. Amino acids 15 and 32 are far removed from the putative DNA-binding domains of TF1 but changes there exert striking effects on DNA affinity that correlate with effects on structure. The double mutant protein TF1-G15I32 binds to a preferred site in hydroxymethyluracil-containing DNA 40 times more tightly, denatures at higher temperature (delta tm = 21 degrees C), and also exchanges subunits much more slowly than does the wild-type protein. The L25-->A mutation makes TF1 secondary structure and DNA-binding highly salt concentration-dependent. The E15-->G mutation partly suppresses this effect: secondary structure of TF1-A25G15 is restored at 21 degrees C by 1 M NaCl or, at low NaCl concentration, by binding to DNA.

Intracellular signaling of the Ufo/Axl receptor tyrosine kinase is mediated mainly by a multi-substrate docking-site.

PubMed

Braunger, J; Schleithoff, L; Schulz, A S; Kessler, H; Lammers, R; Ullrich, A; Bartram, C R; Janssen, J W

1997-06-05

Ufo/Axl belongs to a new family of receptor tyrosine kinases with an extracellular structure similar to that of neural cell adhesion molecules. In order to elucidate intracellular signaling, the cytoplasmic moiety of Ufo/Axl was used to screen an expression library according to the CORT (cloning of receptor targets) method. Three putative Ufo substrates were identified: phospholipase Cgamma1 (PLCgamma), as well as p85alpha and p85beta subunits of phosphatidylinositol 3'-kinase (PI3-kinase). Subsequently, chimeric EGFR/Ufo receptors consisting of the extracellular domains of the epidermal growth factor receptor (EGFR) and the transmembrane and intracellular moiety of Ufo were engineered. Using different far-Western blot analyses and coimmunoprecipitation assays, receptor binding of PLCgamma and p85 proteins as well as GRB2, c-src and lck was examined in vitro and in vivo. Competitive inhibition of substrate binding and mutagenesis experiments with EGFR/Ufo constructs revealed C-terminal tyrosine 821 (EILpYVNMDEG) as a docking site for multiple effectors, namely PLCgamma, p85 proteins, GRB2, c-src and lck. Tyrosine 779 (DGLpYALMSRC) demonstrated an additional, but lower binding affinity for the p85 proteins in vitro. In addition, binding of PLCgamma occurred through tyrosine 866 (AGRpYVLCPST). Moreover, our in vivo data indicate that further direct or indirect binding sites for PLCgamma, GRB2, c-src and lck on the human Ufo receptor may exist.

Characterization of the colorectal cancer-associated enhancer MYC-335 at 8q24: the role of rs67491583.

PubMed

Tuupanen, Sari; Yan, Jian; Turunen, Mikko; Gylfe, Alexandra E; Kaasinen, Eevi; Li, Li; Eng, Charis; Culver, Daniel A; Kalady, Matthew F; Pennison, Michael J; Pasche, Boris; Manne, Upender; de la Chapelle, Albert; Hampel, Heather; Henderson, Brian E; Marchand, Loic Le; Hautaniemi, Sampsa; Askhtorab, Hassan; Smoot, Duane; Sandler, Robert S; Keku, Temitope; Kupfer, Sonia S; Ellis, Nathan A; Haiman, Christopher A; Taipale, Jussi; Aaltonen, Lauri A

2012-01-01

Recent genome-wide association studies have identified multiple regions at 8q24 that confer susceptibility to many cancers. In our previous work, we showed that the colorectal cancer (CRC) risk variant rs6983267 at 8q24 resides within a TCF4 binding site at the MYC-335 enhancer, with the risk allele G having a stronger binding capacity and Wnt responsiveness. Here, we searched for other potential functional variants within MYC-335. Genetic variation within MYC-335 was determined in samples from individuals of European, African, and Asian descent, with emphasis on variants in putative transcription factor binding sites. A 2-bp GA deletion rs67491583 was found to affect a growth factor independent (GFI) binding site and was present only in individuals with African ancestry. Chromatin immunoprecipitation performed in heterozygous cells showed that the GA deletion had an ability to reduce binding of the transcriptional repressors GFI1 and GFI1b. Screening of 1,027 African American colorectal cancer cases and 1,773 healthy controls did not reveal evidence for association (odds ratio: 1.17, 95% confidence interval: 0.97-1.41, P = 0.095). In this study, rs67491583 was identified as another functional variant in the CRC-associated enhancer MYC-335, but further studies are needed to establish the role of rs67491583 in the colorectal cancer predisposition of African Americans. Copyright © 2012 Elsevier Inc. All rights reserved.

Isolation of a gene (pbsC) required for siderophore biosynthesis in fluorescent Pseudomonas sp. strain M114.

PubMed

Adams, C; Dowling, D N; O'Sullivan, D J; O'Gara, F

1994-06-03

An iron-regulated gene, pbsC, required for siderophore production in fluorescent Pseudomonas sp. strain M114 has been identified. A kanamycin-resistance cassette was inserted at specific restriction sites within a 7 kb genomic fragment of M114 DNA and by marker exchange two siderophore-negative mutants, designated M1 and M2, were isolated. The nucleotide sequence of approximately 4 kb of the region flanking the insertion sites was determined and a large open reading frame (ORF) extending for 2409 bp was identified. This gene was designated pbsC (pseudobactin synthesis C) and its putative protein product termed PbsC. PbsC was found to be homologous to a family of enzymes involved in the biosynthesis of secondary metabolites, including EntF of Escherichia coli. These enzymes are believed to act via ATP-dependent binding of AMP to their substrate. Several areas of high sequence homology between these proteins and PbsC were observed, including a conserved AMP-binding domain. The expression of pbsC is iron-regulated as revealed when a DNA fragment containing the upstream region was cloned in a promoter probe vector and conjugated into the wild-type strain, M114. The nucleotide sequence upstream of the putative translational start site contains a region homologous to previously defined -16 to -25 sequences of iron-regulated genes but did not contain an iron-box consensus sequence. It was noted that inactivation of the pbsC gene also affected other iron-regulated phenotypes of Pseudomonas M114.

DOE Office of Scientific and Technical Information (OSTI.GOV)

Gough, Mallory, E-mail: m.gough1@lancaster.ac.uk; Blanthorn-Hazell, Sophee, E-mail: s.blanthorn-hazell@lancaster.ac.uk; Delury, Craig, E-mail: c.delury@lancaster.ac.uk

Highlights: • Copper levels are elevated in the tumour microenvironment. • APP mitigates copper-induced growth inhibition of DU145 prostate cancer (PCa) cells. • The APP intracellular domain is a prerequisite; soluble forms have no effect. • The E1 CuBD of APP is also a prerequisite. • APP copper binding potentially mitigates copper-induced PCa cell growth inhibition. - Abstract: Copper plays an important role in the aetiology and growth of tumours and levels of the metal are increased in the serum and tumour tissue of patients affected by a range of cancers including prostate cancer (PCa). The molecular mechanisms that enablemore » cancer cells to proliferate in the presence of elevated copper levels are, therefore, of key importance in our understanding of tumour growth progression. In the current study, we have examined the role played by the amyloid precursor protein (APP) in mitigating copper-induced growth inhibition of the PCa cell line, DU145. A range of APP molecular constructs were stably over-expressed in DU145 cells and their effects on cell proliferation in the presence of copper were monitored. Our results show that endogenous APP expression was induced by sub-toxic copper concentrations in DU145 cells and over-expression of the wild-type protein was able to mitigate copper-induced growth inhibition via a mechanism involving the cytosolic and E1 copper binding domains of the full-length protein. APP likely represents one of a range of copper binding proteins that PCa cells employ in order to ensure efficient proliferation despite elevated concentrations of the metal within the tumour microenvironment. Targeting the expression of such proteins may contribute to therapeutic strategies for the treatment of cancers.« less

Progesterone receptor membrane component-1 (PGRMC1) is the mediator of progesterone's antiapoptotic action in spontaneously immortalized granulosa cells as revealed by PGRMC1 small interfering ribonucleic acid treatment and functional analysis of PGRMC1 mutations.

PubMed

Peluso, John J; Romak, Jonathan; Liu, Xiufang

2008-02-01

Progesterone (P4) receptor membrane component-1 (PGRMC1) and its binding partner, plasminogen activator inhibitor 1 RNA binding protein (PAIRBP1) are thought to form a complex that functions as membrane receptor for P4. The present investigations confirm PGRMC1's role in this membrane receptor complex by demonstrating that depleting PGMRC1 with PGRMC1 small interfering RNA results in a 60% decline in [(3)H]P4 binding and the loss of P4's antiapoptotic action. Studies conducted on partially purified GFP-PGRMC1 fusion protein indicate that [(3)H]P4 specifically binds to PGRMC1 at a single site with an apparent K(d) of about 35 nm. In addition, experiments using various deletion mutations reveal that the entire PGRMC1 molecule is required for maximal [(3)H]P4 binding and P4 responsiveness. Analysis of the binding data also suggests that the P4 binding site is within a segment of PGRMC1 that is composed of the transmembrane domain and the initial segment of the C terminus. Interestingly, PAIRBP1 appears to bind to the C terminus between amino acids 70-130, which is distal to the putative P4 binding site. Taken together, these data provide compelling evidence that PGRMC1 is the P4 binding protein that mediates P4's antiapoptotic action. Moreover, the deletion mutation studies indicate that each domain of PGRMC1 plays an essential role in modulating PGRMC1's capacity to both bind and respond to P4. Additional studies are required to more precisely delineate the role of each PGRMC1 domain in transducing P4's antiapoptotic action.

Identification and removal of low-complexity sites in allele-specific analysis of ChIP-seq data.

PubMed

Waszak, Sebastian M; Kilpinen, Helena; Gschwind, Andreas R; Orioli, Andrea; Raghav, Sunil K; Witwicki, Robert M; Migliavacca, Eugenia; Yurovsky, Alisa; Lappalainen, Tuuli; Hernandez, Nouria; Reymond, Alexandre; Dermitzakis, Emmanouil T; Deplancke, Bart

2014-01-15

High-throughput sequencing technologies enable the genome-wide analysis of the impact of genetic variation on molecular phenotypes at unprecedented resolution. However, although powerful, these technologies can also introduce unexpected artifacts. We investigated the impact of library amplification bias on the identification of allele-specific (AS) molecular events from high-throughput sequencing data derived from chromatin immunoprecipitation assays (ChIP-seq). Putative AS DNA binding activity for RNA polymerase II was determined using ChIP-seq data derived from lymphoblastoid cell lines of two parent-daughter trios. We found that, at high-sequencing depth, many significant AS binding sites suffered from an amplification bias, as evidenced by a larger number of clonal reads representing one of the two alleles. To alleviate this bias, we devised an amplification bias detection strategy, which filters out sites with low read complexity and sites featuring a significant excess of clonal reads. This method will be useful for AS analyses involving ChIP-seq and other functional sequencing assays. The R package abs filter for library clonality simulations and detection of amplification-biased sites is available from http://updepla1srv1.epfl.ch/waszaks/absfilter

Structure and Biochemestry of Laccases from the Lignin-Degrading Basidiomycete, Ganoderma lucidum

DOE Office of Scientific and Technical Information (OSTI.GOV)

C.A.Reddy, PI

2005-06-30

G. lucidum is one of the most important and widely distributed ligninolytic white rot fungi from habitats such as forest soils, agricultural soils, and tropical mangrove ecosystems and produce laccases as an important family of lignin modifying enzymes. Biochemically, laccases are blue multi copper oxidases that couple four electron reduction of molecular oxygen to water. There is a growing interest in the use of laccases for a variety of industrial applications such as bio-pulping and biobleaching as well as in their ability to detoxify a wide variety of toxic environmental pollutants. These key oxidative enzymes are found in all themore » three domains of life: Eukaryota. Prokarya, and Archaea. Ganoderma lucidum (strain no.103561) produces laccase with some of the highest activity (17,000 micro katals per mg of protein) reported for any laccases to date. Our results showed that this organism produces at least 11 different isoforms of laccase based on variation in mol. weight and/or PI. Our Studies showed that the presence of copper in the medium yields 15- to 20-fold greater levels of enzyme by G. lucidum. Dialysation of extra cellular fluid of G. lucidum against 10mM sodium tartrate (pH5.5) gave an additional 15 to 17 fold stimulation of activity with an observed specific activity of 17,000 {micro}katals/mg protein. Dialysis against acetate buffer gave five fold increase in activity while dialysis against glycine showed inhibition of activity. Purification by FPLC and preparative gel electrophoresis gave purified fractions that resolved into eleven isoforms as separated by isoelectric focusing, and the PI,s were 4.7, 4.6, 4.5, 4.3, 4.2, 4.1, 3.8, 3.7, 3.5, 3.4 and 3.3. Genomic clones of laccase were isolated using G. lucidum DNA as a template and using inverse PCR and forward/reverse primers corresponding to the sequences of the conserved copper binding region in the N-terminal domain of one of the laccases of this organism. Inverse PCR amplication of HindIII digested and ligated G.lucidum DNA was done using ABI Geneamp XL PCR kit in Ribocycler. The 5 conserved copper binding region of laccase was used for designing forward primer (5TCGACAATTCTTTCCTGTACG3) and reverse primer (5 TGGAGATGGG ACACT GGCTTATC 3). The PCR profile was 95 C for 3min, 94 C for 1min, 57 C for 30 sec and 68 C for 5min. for 30 cycles, and the final extension was at 72 C for 10min. The resulting {approx}2.7 Kb inverse PCR fragment was cloned into ZERO TOPOII blunt ligation vector (INVITROGEN) and screened on Kanamycin plates. Selected putative clones containing inserts were digested with a battery of restriction enzymes and analyzed on 1% agarose gels. Restriction digestion of these clones with BamHI, PstI, SalI, PvuII, EcoRI, and XhoI revealed 8 distinct patterns suggesting gene diversity. Two clones were sequenced using overlapping primers on ABI system. The sequences were aligned using Bioedit program. The aa sequences of the clones were deduced by Genewise2 program using Aspergillus as the reference organism. Eukaryotic gene regulatory sequences were identified using GeneWise2 Program. Laccase sequence alignments and similarity indexes were calculated using ClustalW and BioEdit programs. Blast analysis of two distinct BamHI clones, lac1 and lac4, showed that the proteins encoded by these clones are fungal laccase sequences. The coding sequence of lac1gene is interrupted by 6 introns ranging in size from 37-55 nt and encodes a mature protein consisting of 456 aa (Mr: 50,160), preceded by a putative 37-aa signal sequence. This predicted Mr is in agreement with the range of Mrs previously reported by us for the laccases of G. lucidum. The deduced aa sequence of LAC1 showed relatively high degree of homology with laccases of other basidiomycetes. It showed 96% homology to full-length LAC4 protein and 47-53% similarity to unpublished partial laccase sequences of other G. lucidum strains. Among the other basidiomycete laccases, LAC1 showed the highest similarity of 53-55% to Trametes versicolorLAC3 and LAC4. The consensus copper-binding domains found in other basidiomycete laccases are conserved in the LAC1 protein of G.lucidum. Eight putative N-glycosylation sites as well as consensus eukaryotic promoter sequence and polyadenylation signal sequences are also found. Coding sequence of lac4 is interrupted by 7 introns, encodes a mature protein of 525aa (Mr: 57,750), and has 98% nt homology to lac1, but was otherwise identical. Molecular masses of GLAC1 and GLAC4 were 49.8 kDa (462aa) and 52.5 kDa (524aa) in comparison to T. versicolr laccase which was 56.3 kDa (524aa). Predicted PI values of GLAC1, GLAC4 and T. versicolor laccase are, respectively 4.5, 4.7, and 4.2. Eight other laccase clones, distinct from lac1 and lac4 have recently been isolated from G. lucidum Our results show the existence of a laccase multi-gene family in G. lucidum in agreement with our earlier results showing multiple isoforms of laccase in this organism.« less

Small molecule correctors of F508del-CFTR discovered by structure-based virtual screening

NASA Astrophysics Data System (ADS)

Kalid, Ori; Mense, Martin; Fischman, Sharon; Shitrit, Alina; Bihler, Hermann; Ben-Zeev, Efrat; Schutz, Nili; Pedemonte, Nicoletta; Thomas, Philip J.; Bridges, Robert J.; Wetmore, Diana R.; Marantz, Yael; Senderowitz, Hanoch

2010-12-01

Folding correctors of F508del-CFTR were discovered by in silico structure-based screening utilizing homology models of CFTR. The intracellular segment of CFTR was modeled and three cavities were identified at inter-domain interfaces: (1) Interface between the two Nucleotide Binding Domains (NBDs); (2) Interface between NBD1 and Intracellular Loop (ICL) 4, in the region of the F508 deletion; (3) multi-domain interface between NBD1:2:ICL1:2:4. We hypothesized that compounds binding at these interfaces may improve the stability of the protein, potentially affecting the folding yield or surface stability. In silico structure-based screening was performed at the putative binding-sites and a total of 496 candidate compounds from all three sites were tested in functional assays. A total of 15 compounds, representing diverse chemotypes, were identified as F508del folding correctors. This corresponds to a 3% hit rate, tenfold higher than hit rates obtained in corresponding high-throughput screening campaigns. The same binding sites also yielded potentiators and, most notably, compounds with a dual corrector-potentiator activity (dual-acting). Compounds harboring both activity types may prove to be better leads for the development of CF therapeutics than either pure correctors or pure potentiators. To the best of our knowledge this is the first report of structure-based discovery of CFTR modulators.

Homology modeling, molecular dynamics, and docking studies of pattern-recognition transmembrane protein-lipopolysaccharide and β-1,3 glucan-binding protein from Fenneropenaeus indicus.

PubMed

Sivakamavalli, Jeyachandran; Tripathi, Sunil Kumar; Singh, Sanjeev Kumar; Vaseeharan, Baskaralingam

2015-01-01

Lipopolysaccharide and β-1,3 glucan-binding protein (LGBP) is a family of pattern-recognition transmembrane proteins (PRPs) which plays a vital role in the immune mechanism of crustaceans in adverse conditions. Fenneropenaeus indicus LGBP-deduced amino acid has conserved potential recognition motif for β-1,3 linkages of polysaccharides and putative RGD (Arg-Gly-Asp) cell adhesion sites for the activation of innate defense mechanism. In order to understand the stimulating activity of β-1,3 glucan (β-glucan) and its interaction with LGBP, a 3D model of LGBP is generated. Molecular docking is performed with this model, and the results indicate Arg71 with strong hydrogen bond from RGD domain of LGBP. Moreover, from the docking studies, we also suggest that Arg34, Lys68, Val135, and Ala146 in LGBP are important amino acid residues in binding as they have strong bonding interaction in the active site of LGBP. In our in vitro studies, yeast agglutination results suggest that shrimp F. indicus LGBP possesses sugar binding and recognition sites in its structure, which is responsible for agglutination reaction. Our results were synchronized with the already reported evidence both in vivo and in vitro experiments. This investigation may be valuable for further experimental investigation in the synthesis of novel immunomodulator.

Streptococcus pneumonia YlxR at 1.35 A shows a putative new fold.

PubMed

Osipiuk, J; Górnicki, P; Maj, L; Dementieva, I; Laskowski, R; Joachimiak, A

2001-11-01

The structure of the YlxR protein of unknown function from Streptococcus pneumonia was determined to 1.35 A. YlxR is expressed from the nusA/infB operon in bacteria and belongs to a small protein family (COG2740) that shares a conserved sequence motif GRGA(Y/W). The family shows no significant amino-acid sequence similarity with other proteins. Three-wavelength diffraction MAD data were collected to 1.7 A from orthorhombic crystals using synchrotron radiation and the structure was determined using a semi-automated approach. The YlxR structure resembles a two-layer alpha/beta sandwich with the overall shape of a cylinder and shows no structural homology to proteins of known structure. Structural analysis revealed that the YlxR structure represents a new protein fold that belongs to the alpha-beta plait superfamily. The distribution of the electrostatic surface potential shows a large positively charged patch on one side of the protein, a feature often found in nucleic acid-binding proteins. Three sulfate ions bind to this positively charged surface. Analysis of potential binding sites uncovered several substantial clefts, with the largest spanning 3/4 of the protein. A similar distribution of binding sites and a large sharply bent cleft are observed in RNA-binding proteins that are unrelated in sequence and structure. It is proposed that YlxR is an RNA-binding protein.

From reads to regions: a Bioconductor workflow to detect differential binding in ChIP-seq data

PubMed Central

Lun, Aaron T. L.; Smyth, Gordon K.

2016-01-01

Chromatin immunoprecipitation with massively parallel sequencing (ChIP-seq) is widely used to identify the genomic binding sites for protein of interest. Most conventional approaches to ChIP-seq data analysis involve the detection of the absolute presence (or absence) of a binding site. However, an alternative strategy is to identify changes in the binding intensity between two biological conditions, i.e., differential binding (DB). This may yield more relevant results than conventional analyses, as changes in binding can be associated with the biological difference being investigated. The aim of this article is to facilitate the implementation of DB analyses, by comprehensively describing a computational workflow for the detection of DB regions from ChIP-seq data. The workflow is based primarily on R software packages from the open-source Bioconductor project and covers all steps of the analysis pipeline, from alignment of read sequences to interpretation and visualization of putative DB regions. In particular, detection of DB regions will be conducted using the counts for sliding windows from the csaw package, with statistical modelling performed using methods in the edgeR package. Analyses will be demonstrated on real histone mark and transcription factor data sets. This will provide readers with practical usage examples that can be applied in their own studies. PMID:26834993

Homology modeling study toward identifying structural properties in the HA2 B-loop that would influence the HA1 receptor-binding site.

PubMed

Cueno, Marni E; Imai, Kenichi; Shimizu, Kazufumi; Ochiai, Kuniyasu

2013-07-01

Influenza hemagglutinin (HA) consists of a fibrous globular stem (HA2) inserted into the viral membrane supporting a globular head (HA1). HA1 receptor-binding has been hypothesized to be structurally correlated to the HA2 B-loop, however, this was never fully understood. Here, we elucidated the structural relationship between the HA2 B-loop and the HA1 receptor-binding site (RBS). Throughout this study, we analyzed 2486 H1N1 HA homology models obtained from human, swine and avian strains during 1976-2012. Quality of all homology models were verified before further analyses. We established that amino acid residue 882 is putatively strain-conserved and differs in the human (K882), swine (H882) and avian (N882) strains. Moreover, we observed that the amino acid at residue 882 and, similarly, its orientation has the potential to influence the HA1 RBS diameter measurements which we hypothesize may consequentially affect influenza H1N1 viral infectivity, immune escape, transmissibility, and evolution. Copyright © 2013 Elsevier Inc. All rights reserved.

Exploring the recognized bio-mimicry materials for gas sensing.

PubMed

Wu, T Z; Lo, Y R; Chan, E C

2001-12-01

This study was undertaken to synthesize peptides that are partially similar to the binding sites of human olfactory receptor protein. First, a putative 3-D model structure of human olfactory receptor protein (P30953) was modeled using a molecular simulation method. The computer docking simulation was then performed to determine the most plausible binding sites between the model structure and target gases, trimethylamine, ammonia, acetic acid, and o-xylene. According to the simulation result, a series of polypeptide sequences, horp61 for TMA, horp103 for o-xylene, horp109 for ammonia, and horp193 for acetic acid as recognized molecules were designed for gas sensing purposes. Preparing these peptides as corresponding gas sensing probes, the results showed a high relative sensitivity response of 6.7 for TMA (probe horp61), 5.1 for o-xylene (probe horp103), 11 for ammonia (probe horp109), and 28 for acetic acid (probe horp193), respectively. These results indicate that peptide mimicking of binding domain on olfactory receptor opens a new window and offers a novel strategy for the further development of recognized materials for gas sensing.

The pure anti-oestrogen ICI 182,780 (Faslodex™) activates large conductance Ca2+-activated K+ channels in smooth muscle

PubMed Central

Dick, Gregory M

2002-01-01

Oestrogen and tamoxifen activate large conductance Ca2+-activated K+ (BKCa) channels in smooth muscle through a non-genomic mechanism that depends on the regulatory β1 subunit and an extracellular binding site. It is unknown whether a ‘pure' anti-oestrogen such as ICI 182,780 (Faslodex™), that has no known oestrogenic properties, would have any effect on BKCa channels. Using single channel patch clamp techniques on canine colonic myocytes, the hypothesis that ICI 182,780 would activate BKCa channels was tested. ICI 182,780 increased the open probability of BKCa channels in inside-out patches with an EC50 of 1 μM. These data suggest that molecules with the ability to bind nuclear oestrogen receptors, regardless of oestrogenic or anti-oestrogenic nature, activate BKCa channels through this nongenomic, membrane-delimited mechanism. The identity and characteristics of this putative binding site remain unclear; however, it has pharmacological similarity to oestrogen receptors α and β, as ICI 182,780 interacts with it. PMID:12145095

Negative modulation of the chicken infectious anemia virus promoter by COUP-TF1 and an E box-like element at the transcription start site binding deltaEF1.

PubMed

Miller, Myrna M; Jarosinski, Keith W; Schat, Karel A

2008-12-01

Expression of enhanced green fluorescent protein (EGFP) under control of the promoter-enhancer of chicken infectious anemia virus (CAV) is increased in an oestrogen receptor-enhanced cell line when treated with oestrogen and the promoter-enhancer binds unidentified proteins that recognize a consensus oestrogen response element (ERE). Co-transfection assays with the CAV promoter and the nuclear receptor chicken ovalbumin upstream promoter transcription factor 1 (COUP-TF1) showed that expression of EGFP was decreased by 50 to 60 % in DF-1 and LMH cells. The CAV promoter that included sequences at and downstream of the transcription start point had less expression than a short promoter construct. Mutation of a putative E box at this site restored expression levels. Electromobility shift assays showed that the transcription regulator delta-EF1 (deltaEF1) binds to this E box region. These findings indicate that the CAV promoter activity can be affected directly or indirectly by COUP-TF1 and deltaEF1.

IspE Inhibitors Identified by a Combination of In Silico and In Vitro High-Throughput Screening

PubMed Central

Tidten-Luksch, Naomi; Grimaldi, Raffaella; Torrie, Leah S.; Frearson, Julie A.; Hunter, William N.; Brenk, Ruth

2012-01-01

CDP-ME kinase (IspE) contributes to the non-mevalonate or deoxy-xylulose phosphate (DOXP) pathway for isoprenoid precursor biosynthesis found in many species of bacteria and apicomplexan parasites. IspE has been shown to be essential by genetic methods and since it is absent from humans it constitutes a promising target for antimicrobial drug development. Using in silico screening directed against the substrate binding site and in vitro high-throughput screening directed against both, the substrate and co-factor binding sites, non-substrate-like IspE inhibitors have been discovered and structure-activity relationships were derived. The best inhibitors in each series have high ligand efficiencies and favourable physico-chemical properties rendering them promising starting points for drug discovery. Putative binding modes of the ligands were suggested which are consistent with established structure-activity relationships. The applied screening methods were complementary in discovering hit compounds, and a comparison of both approaches highlights their strengths and weaknesses. It is noteworthy that compounds identified by virtual screening methods provided the controls for the biochemical screens. PMID:22563402

Long non-coding RNA HOTAIR, a c-Myc activated driver of malignancy, negatively regulates miRNA-130a in gallbladder cancer

PubMed Central

2014-01-01

Background Protein coding genes account for only about 2% of the human genome, whereas the vast majority of transcripts are non-coding RNAs including long non-coding RNAs. A growing volume of literature has proposed that lncRNAs are important players in cancer. HOTAIR was previously shown to be an oncogene and negative prognostic factor in a variety of cancers. However, the factors that contribute to its upregulation and the interaction between HOTAIR and miRNAs are largely unknown. Methods A computational screen of HOTAIR promoter was conducted to search for transcription-factor-binding sites. HOTAIR promoter activities were examined by luciferase reporter assay. The function of the c-Myc binding site in the HOTAIR promoter region was tested by a promoter assay with nucleotide substitutions in the putative E-box. The association of c-Myc with the HOTAIR promoter in vivo was confirmed by chromatin immunoprecipitation assay and Electrophoretic mobility shift assay. A search for miRNAs with complementary base paring with HOTAIR was performed utilizing online software program. Gain and loss of function approaches were employed to investigate the expression changes of HOTAIR or miRNA-130a. The expression levels of HOTAIR, c-Myc and miRNA-130a were examined in 65 matched pairs of gallbladder cancer tissues. The effects of HOTAIR and miRNA-130a on gallbladder cancer cell invasion and proliferation was tested using in vitro cell invasion and flow cytometric assays. Results We demonstrate that HOTAIR is a direct target of c-Myc through interaction with putative c-Myc target response element (RE) in the upstream region of HOTAIR in gallbladder cancer cells. A positive correlation between c-Myc and HOTAIR mRNA levels was observed in gallbladder cancer tissues. We predicted that HOTAIR harbors a miRNA-130a binding site. Our data showed that this binding site is vital for the regulation of miRNA-130a by HOTAIR. Moreover, a negative correlation between HOTAIR and miRNA-130a was observed in gallbladder cancer tissues. Finally, we demonstrate that the oncogenic activity of HOTAIR is in part through its negative regulation of miRNA-130a. Conclusion Together, these results suggest that HOTAIR is a c-Myc-activated driver of malignancy, which acts in part through repression of miRNA-130a. PMID:24953832

A genetic screen reveals a periplasmic copper chaperone required for nitrite reductase activity in pathogenic Neisseria.

PubMed

Jen, Freda E-C; Djoko, Karrera Y; Bent, Stephen J; Day, Christopher J; McEwan, Alastair G; Jennings, Michael P

2015-09-01

Under conditions of low oxygen availability, Neisseria meningitidis and Neisseria gonorrhoeae are able to respire via a partial denitrification pathway in which nitrite is converted to nitrous oxide. In this process, nitrite reductase (AniA), a copper (Cu)-containing protein converts nitrite to NO, and this product is converted to nitrous oxide by nitric oxide reductase (NorB). NorB also confers protection against toxic NO, and so we devised a conditional lethal screen, using a norB mutant, to identify mutants that were resistant to nitrite-dependent killing. After random-deletion mutagenesis of N. meningitidis, this genetic screen identified a gene encoding a Cu chaperone that is essential for AniA function, AccA. Purified AccA binds one Cu (I) ion and also possesses a second binding site for Cu (II). This novel periplasmic Cu chaperone (AccA) appears to be essential for provision of Cu ions to AniA of pathogenic Neisseria to generate an active nitrite reductase. Apart from the Neisseria genus, AccA is distributed across a wide range of environmental Proteobacteria species. © FASEB.

Integrative analysis of the Caenorhabditis elegans genome by the modENCODE project.

PubMed

Gerstein, Mark B; Lu, Zhi John; Van Nostrand, Eric L; Cheng, Chao; Arshinoff, Bradley I; Liu, Tao; Yip, Kevin Y; Robilotto, Rebecca; Rechtsteiner, Andreas; Ikegami, Kohta; Alves, Pedro; Chateigner, Aurelien; Perry, Marc; Morris, Mitzi; Auerbach, Raymond K; Feng, Xin; Leng, Jing; Vielle, Anne; Niu, Wei; Rhrissorrakrai, Kahn; Agarwal, Ashish; Alexander, Roger P; Barber, Galt; Brdlik, Cathleen M; Brennan, Jennifer; Brouillet, Jeremy Jean; Carr, Adrian; Cheung, Ming-Sin; Clawson, Hiram; Contrino, Sergio; Dannenberg, Luke O; Dernburg, Abby F; Desai, Arshad; Dick, Lindsay; Dosé, Andréa C; Du, Jiang; Egelhofer, Thea; Ercan, Sevinc; Euskirchen, Ghia; Ewing, Brent; Feingold, Elise A; Gassmann, Reto; Good, Peter J; Green, Phil; Gullier, Francois; Gutwein, Michelle; Guyer, Mark S; Habegger, Lukas; Han, Ting; Henikoff, Jorja G; Henz, Stefan R; Hinrichs, Angie; Holster, Heather; Hyman, Tony; Iniguez, A Leo; Janette, Judith; Jensen, Morten; Kato, Masaomi; Kent, W James; Kephart, Ellen; Khivansara, Vishal; Khurana, Ekta; Kim, John K; Kolasinska-Zwierz, Paulina; Lai, Eric C; Latorre, Isabel; Leahey, Amber; Lewis, Suzanna; Lloyd, Paul; Lochovsky, Lucas; Lowdon, Rebecca F; Lubling, Yaniv; Lyne, Rachel; MacCoss, Michael; Mackowiak, Sebastian D; Mangone, Marco; McKay, Sheldon; Mecenas, Desirea; Merrihew, Gennifer; Miller, David M; Muroyama, Andrew; Murray, John I; Ooi, Siew-Loon; Pham, Hoang; Phippen, Taryn; Preston, Elicia A; Rajewsky, Nikolaus; Rätsch, Gunnar; Rosenbaum, Heidi; Rozowsky, Joel; Rutherford, Kim; Ruzanov, Peter; Sarov, Mihail; Sasidharan, Rajkumar; Sboner, Andrea; Scheid, Paul; Segal, Eran; Shin, Hyunjin; Shou, Chong; Slack, Frank J; Slightam, Cindie; Smith, Richard; Spencer, William C; Stinson, E O; Taing, Scott; Takasaki, Teruaki; Vafeados, Dionne; Voronina, Ksenia; Wang, Guilin; Washington, Nicole L; Whittle, Christina M; Wu, Beijing; Yan, Koon-Kiu; Zeller, Georg; Zha, Zheng; Zhong, Mei; Zhou, Xingliang; Ahringer, Julie; Strome, Susan; Gunsalus, Kristin C; Micklem, Gos; Liu, X Shirley; Reinke, Valerie; Kim, Stuart K; Hillier, LaDeana W; Henikoff, Steven; Piano, Fabio; Snyder, Michael; Stein, Lincoln; Lieb, Jason D; Waterston, Robert H

2010-12-24

We systematically generated large-scale data sets to improve genome annotation for the nematode Caenorhabditis elegans, a key model organism. These data sets include transcriptome profiling across a developmental time course, genome-wide identification of transcription factor-binding sites, and maps of chromatin organization. From this, we created more complete and accurate gene models, including alternative splice forms and candidate noncoding RNAs. We constructed hierarchical networks of transcription factor-binding and microRNA interactions and discovered chromosomal locations bound by an unusually large number of transcription factors. Different patterns of chromatin composition and histone modification were revealed between chromosome arms and centers, with similarly prominent differences between autosomes and the X chromosome. Integrating data types, we built statistical models relating chromatin, transcription factor binding, and gene expression. Overall, our analyses ascribed putative functions to most of the conserved genome.

Using two-dimensional correlation size exclusion chromatography (2D-CoSEC) to explore the size-dependent heterogeneity of humic substances for copper binding.

PubMed

Lee, Yun-Kyung; Hur, Jin

2017-08-01

Knowledge of the heterogeneous distribution of humic substances (HS) reactivities along a continuum of molecular weight (MW) is crucial for the systems where the HS MW is subject to change. In this study, two dimensional correlation spectroscopy combined with size exclusion chromatography (2D-CoSEC) was first utilized to obtain a continuous and heterogeneous presence of copper binding characteristics within bulk HS with respect to MW. HS solutions with varying copper concentrations were directly injected into a size exclusion chromatography (SEC) system with Tris-HCl buffer as a mobile phase. Several validation tests confirmed neither structural disruption of HS nor competition effect of the mobile phase used. Similar to batch systems, fluorescence quenching was observed in the chromatograms over a wide range of HS MW. 2D-CoSEC maps of a soil-derived HS (Elliot soil humic acid) showed the greater fluorescence quenching degrees with respect to the apparent MW on the order of 12500 Da > 10600 Da > 7000 Da > 15800 Da. The binding constants calculated based on modified Stern-Volmer equation were consistent with the 2D-CoSEC results. More heterogeneity of copper binding affinities within bulk HS was found for the soil-derived HS versus an aquatic HS. The traditional fluorescence quenching titration method using ultrafiltered HS size fractions failed to delineate detailed distribution of the copper binding characteristics, exhibiting a much shorter range of the binding constants than those obtained from the 2D-CoSEC. Our proposed technique demonstrated a great potential to describe metal binding characteristics of HS at high MW resolution, providing a clear picture of the size-dependent metal-HS interactions. Copyright © 2017 Elsevier Ltd. All rights reserved.

Search for Partner Proteins of A. thaliana Immunophilins Involved in the Control of Plant Immunity.

PubMed

Abdeeva, Inna A; Pogorelko, Gennady V; Maloshenok, Liliya G; Mokrykova, Maria V; Fursova, Oksana V; Bruskin, Sergey A

2018-04-19

The involvement of plant immunophilins in multiple essential processes such as development, various ways of adapting to biotic and abiotic stresses, and photosynthesis has already been established. Previously, research has demonstrated the involvement of three immunophilin genes ( AtCYP19-1/ROC3 , AtFKBP65/ROF2 , and AtCYP57 ) in the control of plant response to invasion by various pathogens. Current research attempts to identify host target proteins for each of the selected immunophilins. As a result, candidate interactors have been determined and confirmed using a yeast 2-hybrid (Y2H) system for protein⁻protein interaction assays. The generation of mutant isoforms of ROC3 and AtCYP57 harboring substituted amino acids in the in silico-predicted active sites became essential to achieving significant binding to its target partners. This data shows that ROF2 targets calcium-dependent lipid-binding domain-containing protein (At1g70790; AT1) and putative protein phosphatase (At2g30020; АТ2), whereas ROC3 interacts with GTP-binding protein (At1g30580; ENGD-1) and RmlC-like cupin (At5g39120). The immunophilin AtCYP57 binds to putative pyruvate decarboxylase-1 (Pdc1) and clathrin adaptor complex-related protein (At5g05010). Identified interactors confirm our previous findings that immunophilins ROC3 , ROF2 , and AtCYP57 are directly involved with stress response control. Further, these findings extend our understanding of the molecular functional pathways of these immunophilins.

Internal electron transfer between hemes and Cu(II) bound at cysteine beta93 promotes methemoglobin reduction by carbon monoxide.

PubMed

Bonaventura, C; Godette, G; Tesh, S; Holm, D E; Bonaventura, J; Crumbliss, A L; Pearce, L L; Peterson, J

1999-02-26

Previous studies showed that CO/H2O oxidation provides electrons to drive the reduction of oxidized hemoglobin (metHb). We report here that Cu(II) addition accelerates the rate of metHb beta chain reduction by CO by a factor of about 1000. A mechanism whereby electron transfer occurs via an internal pathway coupling CO/H2O oxidation to Fe(III) and Cu(II) reduction is suggested by the observation that the copper-induced rate enhancement is inhibited by blocking Cys-beta93 with N-ethylmaleimide. Furthermore, this internal electron-transfer pathway is more readily established at low Cu(II) concentrations in Hb Deer Lodge (beta2His --> Arg) and other species lacking His-beta2 than in Hb A0. This difference is consistent with preferential binding of Cu(II) in Hb A0 to a high affinity site involving His-beta2, which is ineffective in promoting electron exchange between Cu(II) and the beta heme iron. Effective electron transfer is thus affected by Hb type but is not governed by the R left arrow over right arrow T conformational equilibrium. The beta hemes in Cu(II)-metHb are reduced under CO at rates close to those observed for cytochrome c oxidase, where heme and copper are present together in the oxygen-binding site and where internal electron transfer also occurs.

Chemical and structural characterization of copper adsorbed on mosses (Bryophyta).

PubMed

González, Aridane G; Jimenez-Villacorta, Felix; Beike, Anna K; Reski, Ralf; Adamo, Paola; Pokrovsky, Oleg S

2016-05-05

The adsorption of copper on passive biomonitors (devitalized mosses Hypnum sp., Sphagnum denticulatum, Pseudoscleropodium purum and Brachythecium rutabulum) was studied under different experimental conditions such as a function of pH and Cu concentration in solution. Cu assimilation by living Physcomitrella patents was also investigated. Molecular structure of surface adsorbed and incorporated Cu was studied by X-ray Absorption Spectroscopy (XAS). Devitalized mosses exhibited the universal adsorption pattern of Cu as a function of pH, with a total binding sites number 0.05-0.06 mmolg(dry)(-1) and a maximal adsorption capacity of 0.93-1.25 mmolg(dry)(-1) for these devitalized species. The Extended X-ray Absorption Fine Structure (EXAFS) fit of the first neighbor demonstrated that for all studied mosses there are ∼4.5 O/N atoms around Cu at ∼1.95 Å likely in a pseudo-square geometry. The X-ray Absorption Near Edge Structure (XANES) analysis demonstrated that Cu(II)-cellulose (representing carboxylate groups) and Cu(II)-phosphate are the main moss surface binding moieties, and the percentage of these sites varies as a function of solution pH. P. patens exposed during one month to Cu(2+) yielded ∼20% of Cu(I) in the form of Cu-S(CN) complexes, suggesting metabolically-controlled reduction of adsorbed and assimilated Cu(2+). Copyright © 2016 Elsevier B.V. All rights reserved.

Transcription activation mediated by a cyclic AMP receptor protein from Thermus thermophilus HB8.

PubMed

Shinkai, Akeo; Kira, Satoshi; Nakagawa, Noriko; Kashihara, Aiko; Kuramitsu, Seiki; Yokoyama, Shigeyuki

2007-05-01

The extremely thermophilic bacterium Thermus thermophilus HB8, which belongs to the phylum Deinococcus-Thermus, has an open reading frame encoding a protein belonging to the cyclic AMP (cAMP) receptor protein (CRP) family present in many bacteria. The protein named T. thermophilus CRP is highly homologous to the CRP family proteins from the phyla Firmicutes, Actinobacteria, and Cyanobacteria, and it forms a homodimer and interacts with cAMP. CRP mRNA and intracellular cAMP were detected in this strain, which did not drastically fluctuate during cultivation in a rich medium. The expression of several genes was altered upon disruption of the T. thermophilus CRP gene. We found six CRP-cAMP-dependent promoters in in vitro transcription assays involving DNA fragments containing the upstream regions of the genes exhibiting decreased expression in the CRP disruptant, indicating that the CRP is a transcriptional activator. The consensus T. thermophilus CRP-binding site predicted upon nucleotide sequence alignment is 5'-(C/T)NNG(G/T)(G/T)C(A/C)N(A/T)NNTCACAN(G/C)(G/C)-3'. This sequence is unique compared with the known consensus binding sequences of CRP family proteins. A putative -10 hexamer sequence resides at 18 to 19 bp downstream of the predicted T. thermophilus CRP-binding site. The CRP-regulated genes found in this study comprise clustered regularly interspaced short palindromic repeat (CRISPR)-associated (cas) ones, and the genes of a putative transcriptional regulator, a protein containing the exonuclease III-like domain of DNA polymerase, a GCN5-related acetyltransferase homolog, and T. thermophilus-specific proteins of unknown function. These results suggest a role for cAMP signal transduction in T. thermophilus and imply the T. thermophilus CRP is a cAMP-responsive regulator.

The orphan nuclear receptor NR4A1 attenuates oxidative stress-induced β cells apoptosis via up-regulation of glutathione peroxidase 1.

PubMed

Yang, Yingfeng; Xie, Fangyu; Qin, Dandan; Zong, Chen; Han, Feng; Pu, Zeqing; Liu, Dong; Li, Xia; Zhang, Yuchao; Liu, Yuantao; Wang, Xiangdong

2018-06-15

Our previous study showed that NR4A1 protects against oxidative stress-induced cell apoptosis. However, the targets downstream of NR4A1 are incompletely known. Glutathione peroxidase 1 (GPX1) is the most common antioxidant enzyme in the glutathione peroxidase class. In this study, we aimed to investigate whether GPX1 is a mediator of the protective effects of NR4A1 in pancreatic β cells. A pancreatic β cell line, MIN6, was used to generate NR4A1 over-expression cell line. GPX1 expression and GPX1 promoter trans-activation in these cells was determined. These cells were then treated with H 2 O 2 , and the active caspase3 level was determined. NR4A1 over-expression in MIN6 cells resulted in increased GPX1 expression at both mRNA and protein levels. Dual luciferase assay showed that NR4A1 over-expression was able to enhance the trans-activation of GPX1 promoter, and the critical regulatory elements were narrowed down between 0 to -2000 bp in GPX1 promoter with a putative NR4A1 binding site (-273 to -268). ChIP assays demonstrated that NR4A1 physically associates with the GPX1 promoter. Over-expression of GPX1 reduced the active level of Caspase3 after H 2 O 2 treatment. NR4A1 increases the expression of GPX1 by enhancing the trans-activation of GPX1 promoter through binding to the putative binding site on GPX1 promoter. NR4A1 potentially protects pancreatic β cells against oxidative stress-induced apoptosis by increasing GPX1 expression. Copyright © 2018 Elsevier Inc. All rights reserved.

Systems biology approach in Chlamydomonas reveals connections between copper nutrition and multiple metabolic steps.

PubMed

Castruita, Madeli; Casero, David; Karpowicz, Steven J; Kropat, Janette; Vieler, Astrid; Hsieh, Scott I; Yan, Weihong; Cokus, Shawn; Loo, Joseph A; Benning, Christoph; Pellegrini, Matteo; Merchant, Sabeeha S

2011-04-01

In this work, we query the Chlamydomonas reinhardtii copper regulon at a whole-genome level. Our RNA-Seq data simulation and analysis pipeline validated a 2-fold cutoff and 10 RPKM (reads per kilobase of mappable length per million mapped reads) (~1 mRNA per cell) to reveal 63 CRR1 targets plus another 86 copper-responsive genes. Proteomic and immunoblot analyses captured 25% of the corresponding proteins, whose abundance was also dependent on copper nutrition, validating transcriptional regulation as a major control mechanism for copper signaling in Chlamydomonas. The impact of copper deficiency on the expression of several O₂-dependent enzymes included steps in lipid modification pathways. Quantitative lipid profiles indicated increased polyunsaturation of fatty acids on thylakoid membrane digalactosyldiglycerides, indicating a global impact of copper deficiency on the photosynthetic apparatus. Discovery of a putative plastid copper chaperone and a membrane protease in the thylakoid suggest a mechanism for blocking copper utilization in the chloroplast. We also found an example of copper sparing in the N assimilation pathway: the replacement of copper amine oxidase by a flavin-dependent backup enzyme. Forty percent of the targets are previously uncharacterized proteins, indicating considerable potential for new discovery in the biology of copper.

Zinc stress induces copper depletion in Acinetobacter baumannii.

PubMed

Hassan, Karl A; Pederick, Victoria G; Elbourne, Liam D H; Paulsen, Ian T; Paton, James C; McDevitt, Christopher A; Eijkelkamp, Bart A

2017-03-11

The first row transition metal ions zinc and copper are essential to the survival of many organisms, although in excess these ions are associated with significant toxicity. Here, we examined the impact of zinc and copper stress on Acinetobacter baumannii, a common opportunistic pathogen. We show that extracellular zinc stress induces a copper-specific depletion phenotype in A. baumannii ATCC 17978. Supplementation with copper not only fails to rescue this phenotype, but further exacerbates the copper depletion. Extensive analysis of the A. baumannii ATCC 17978 genome identified 13 putative zinc/copper resistance efflux pumps. Transcriptional analyses show that four of these transporters are responsive to zinc stress, five to copper stress and seven to the combination of zinc and copper stress, thereby revealing a likely foundation for the zinc-induced copper starvation in A. baumannii. In addition, we show that zinc and copper play crucial roles in management of oxidative stress and the membrane composition of A. baumannii. Further, we reveal that zinc and copper play distinct roles in macrophage-mediated killing of this pathogen. Collectively, this study supports the targeting of metal ion homeostatic mechanisms as an effective antimicrobial strategy against multi-drug resistant bacterial pathogens.

Genistein Binding to Copper(II)-Solvent Dependence and Effects on Radical Scavenging.

PubMed

Yang, Jing; Xu, Yi; Liu, Hao-Yu; Han, Rui-Min; Zhang, Jian-Ping; Skibsted, Leif H

2017-10-18

Genistein, but not daidzein, binds to copper(II) with a 1:2 stoichiometry in ethanol and with a 1:1 stoichiometry in methanol, indicating chelation by the 5-phenol and the 4-keto group of the isoflavonoid as demonstrated by the Jobs method and UV-visible absorption spectroscopy. In ethanol, the stability constants had the value 1.12 × 10 11 L²∙mol -2 for the 1:2 complex and in methanol 6.0 × 10⁵ L∙mol -1 for the 1:1 complex at 25 °C. Binding was not detected in water, as confirmed by an upper limit for the 1:1 stability constant of K = 5 mol -1 L as calculated from the difference in solvation free energy of copper(II) between methanol and the more polar water. Solvent molecules compete with genistein as demonstrated in methanol where binding stoichiometry changes from 1:2 to 1:1 compared to ethanol and methanol/chloroform (7/3, v / v ). Genistein binding to copper(II) increases the scavenging rate of the stable, neutral 2,2-diphenyl-1-picrylhydrazyl radical by more than a factor of four, while only small effects were seen for the short-lived but more oxidizing β -carotene radical cation using laser flash photolysis. The increased efficiency of coordinated genistein is concluded to depend on kinetic rather than on thermodynamic factors, as confirmed by the small change in reduction potential of -0.016 V detected by cyclic voltammetry upon binding of genistein to copper(II) in methanol/chloroform solutions.

Removal of a putative inhibitory element reduces the calcium-dependent calmodulin activation of neuronal nitric-oxide synthase.

PubMed

Montgomery, H J; Romanov, V; Guillemette, J G

2000-02-18

Neuronal nitric-oxide synthase (NOS) and endothelial NOS are constitutive NOS isoforms that are activated by binding calmodulin in response to elevated intracellular calcium. In contrast, the inducible NOS isoform binds calmodulin at low basal levels of calcium in resting cells. Primary sequence comparisons show that each constitutive NOS isozyme contains a polypeptide segment within its reductase domain, which is absent in the inducible NOS enzyme. To study a possible link between the presence of these additional polypeptide segments in constitutive NOS enzymes and their calcium-dependent calmodulin activation, three deletion mutants were created. The putative inhibitory insert was removed from the FMN binding regions of the neuronal NOS holoenzyme and from two truncated neuronal NOS reductase enzymes in which the calmodulin binding region was either included or deleted. All three mutant enzymes showed reduced incorporation of FMN and required reconstitution with exogenous FMN for activity. The combined removal of both the calmodulin binding domain and the putative inhibitory insert did not result in a calmodulin-independent neuronal NOS reductase. Thus, although the putative inhibitory element has an effect on the calcium-dependent calmodulin activation of neuronal NOS, it does not have the properties of the typical autoinhibitory domain found in calmodulin-activated enzymes.

A resource for characterizing genome-wide binding and putative target genes of transcription factors expressed during secondary growth and wood formation in Populus

Treesearch

Lijun Liu; Trevor Ramsay; Matthew S. Zinkgraf; David Sundell; Nathaniel Robert Street; Vladimir Filkov; Andrew Groover

2015-01-01

Identifying transcription factor target genes is essential for modeling the transcriptional networks underlying developmental processes. Here we report a chromatin immunoprecipitation sequencing (ChIP-seq) resource consisting of genome-wide binding regions and associated putative target genes for four Populus homeodomain transcription factors...

DOE Office of Scientific and Technical Information (OSTI.GOV)

Kendall, Amy; Bian, Wen; Maris, Alexander

We have used fiber diffraction, cryo-electron microscopy, and scanning transmission electron microscopy to confirm the symmetry of three potexviruses, potato virus X, papaya mosaic virus, and narcissus mosaic virus, and to determine their low-resolution structures. All three viruses have slightly less than nine subunits per turn of the viral helix. Our data strongly support the view that all potexviruses have approximately the same symmetry. The structures are dominated by a large domain at high radius in the virion, with a smaller domain, which includes the putative RNA-binding site, extending to low radius.

Heterogeneity of Opioid Binding Sites in Guinea Pig Spinal Cord

DTIC Science & Technology

1984-11-30

the release of substance P from spinal cord. Substance P is one of the putative transmitters of y nociceptive i m p u l ^ (Lembeck et al., 1981), and...is located in primary afferents of spinal cord (Jessel et al., 1978). Demonstration of morphine’s abil it/ to inhibit the relea^ of substance P ...demonstrate enkephalin’s ability to inhibit substance P relea^ from senajry neurons in culture as well as to cteirease the action potential of these

Mapping a nucleolar targeting sequence of an RNA binding nucleolar protein, Nop25

DOE Office of Scientific and Technical Information (OSTI.GOV)

Fujiwara, Takashi; Suzuki, Shunji; Kanno, Motoko

2006-06-10

Nop25 is a putative RNA binding nucleolar protein associated with rRNA transcription. The present study was undertaken to determine the mechanism of Nop25 localization in the nucleolus. Deletion experiments of Nop25 amino acid sequence showed Nop25 to contain a nuclear targeting sequence in the N-terminal and a nucleolar targeting sequence in the C-terminal. By expressing derivative peptides from the C-terminal as GFP-fusion proteins in the cells, a lysine and arginine residue-enriched peptide (KRKHPRRAQDSTKKPPSATRTSKTQRRRR) allowed a GFP-fusion protein to be transported and fully retained in the nucleolus. When the peptide was fused with cMyc epitope and expressed in the cells, amore » cMyc epitope was then detected in the nucleolus. Nop25 did not localize in the nucleolus by deletion of the peptide from Nop25. Furthermore, deletion of a subdomain (KRKHPRRAQ) in the peptide or amino acid substitution of lysine and arginine residues in the subdomain resulted in the loss of Nop25 nucleolar localization. These results suggest that the lysine and arginine residue-enriched peptide is the most prominent nucleolar targeting sequence of Nop25 and that the long stretch of basic residues might play an important role in the nucleolar localization of Nop25. Although Nop25 contained putative SUMOylation, phosphorylation and glycosylation sites, the amino acid substitution in these sites had no effect on the nucleolar localization, thus suggesting that these post-translational modifications did not contribute to the localization of Nop25 in the nucleolus. The treatment of the cells, which expressed a GFP-fusion protein with a nucleolar targeting sequence of Nop25, with RNase A resulted in a complete dislocation of the protein from the nucleolus. These data suggested that the nucleolar targeting sequence might therefore play an important role in the binding of Nop25 to RNA molecules and that the RNA binding of Nop25 might be essential for the nucleolar localization of Nop25.« less

Site-Specific 64Cu Labeling of the Serine Protease, Active Site Inhibited Factor Seven Azide (FVIIai-N3), Using Copper Free Click Chemistry.

PubMed

Jeppesen, Troels E; Kristensen, Lotte K; Nielsen, Carsten H; Petersen, Lars C; Kristensen, Jesper B; Behrens, Carsten; Madsen, Jacob; Kjaer, Andreas

2018-01-17

A method for site-specific radiolabeling of the serine protease active site inhibited factor seven (FVIIai) with 64 Cu has been applied using a biorthogonal click reaction. FVIIai binds to tissue factor (TF), a trans-membrane protein involved in hemostasis, angiogenesis, proliferation, cell migration, and survival of cancer cells. First a single azide moiety was introduced in the active site of this 50 kDa protease. Then a NOTA moiety was introduced via a strain promoted azide-alkyne reaction and the corresponding conjugate was labeled with 64 Cu. Binding to TF and the stability was evaluated in vitro. TF targeting capability of the radiolabeled conjugate was tested in vivo by positron emission tomography (PET) imaging in pancreatic human xenograft cancer mouse models with various TF expressions. The conjugate showed good stability (>91% at 16 h), an immunoreactivity of 93.5%, and a mean tumor uptake of 2.1 ± 0.2%ID/g at 15 h post injection. In conclusion, FVIIai was radiolabeled with 64 Cu in single well-defined position of the protein. This method can be utilized to prepare conjugates from serine proteases with the label at a specific position.

The DnaK Chaperone Uses Different Mechanisms To Promote and Inhibit Replication of Vibrio cholerae Chromosome 2

DOE Office of Scientific and Technical Information (OSTI.GOV)

Jha, Jyoti K.; Li, Mi; Ghirlando, Rodolfo

Replication of Vibrio cholerae chromosome 2 (Chr2) depends on molecular chaperone DnaK to facilitate binding of the initiator (RctB) to the replication origin. The binding occurs at two kinds of site, 12-mers and 39-mers, which promote and inhibit replication, respectively. Here we show that DnaK employs different mechanisms to enhance the two kinds of binding. We found that mutations inrctBthat reduce DnaK binding also reduce 12-mer binding and initiation. The initiation defect is suppressed by second-site mutations that increase 12-mer binding only marginally. Instead, they reduce replication inhibitory mechanisms: RctB dimerization and 39-mer binding. One suppressing change was in amore » dimerization domain which is folded similarly to the initiator of an iteron plasmid—the presumed progenitor of Chr2. In plasmids, DnaK promotes initiation by reducing dimerization. A different mutation was in the 39-mer binding domain of RctB and inactivated it, indicating an alternative suppression mechanism. Paradoxically, although DnaK increases 39-mer binding, the increase was also achieved by inactivating the DnaK binding site of RctB. This result suggests that the site inhibits the 39-mer binding domain (via autoinhibition) when prevented from binding DnaK. Taken together, our results reveal an important feature of the transition from plasmid to chromosome: the Chr2 initiator retains the plasmid-like dimerization domain and its control by chaperones but uses the chaperones in an unprecedented way to control the inhibitory 39-mer binding. IMPORTANCE The capacity of proteins to undergo remodeling provides opportunities to control their function. However, remodeling remains a poorly understood aspect of the structure-function paradigm due to its dynamic nature. Here we have studied remodeling of the initiator of replication ofVibrio choleraeChr2 by the molecular chaperone, DnaK. We show that DnaK binds to a site on the Chr2 initiator (RctB) that promotes initiation by reducing the initiator’s propensity to dimerize. Dimerization of the initiator of the putative plasmid progenitor of Chr2 is also reduced by DnaK, which promotes initiation. Paradoxically, the DnaK binding also promotes replication inhibition by reducing an autoinhibitory activity of RctB. In the plasmid-to-chromosome transition, it appears that the initiator has acquired an autoinhibitory activity and along with it a new chaperone activity that apparently helps to control replication inhibition independently of replication promotion.« less

The structural flexibility of the human copper chaperone Atox1: Insights from combined pulsed EPR studies and computations.

PubMed

Levy, Ariel R; Turgeman, Meital; Gevorkyan-Aiapetov, Lada; Ruthstein, Sharon

2017-08-01

Metallochaperones are responsible for shuttling metal ions to target proteins. Thus, a metallochaperone's structure must be sufficiently flexible both to hold onto its ion while traversing the cytoplasm and to transfer the ion to or from a partner protein. Here, we sought to shed light on the structure of Atox1, a metallochaperone involved in the human copper regulation system. Atox1 shuttles copper ions from the main copper transporter, Ctr1, to the ATP7b transporter in the Golgi apparatus. Conventional biophysical tools such as X-ray or NMR cannot always target the various conformational states of metallochaperones, owing to a requirement for crystallography or low sensitivity and resolution. Electron paramagnetic resonance (EPR) spectroscopy has recently emerged as a powerful tool for resolving biological reactions and mechanisms in solution. When coupled with computational methods, EPR with site-directed spin labeling and nanoscale distance measurements can provide structural information on a protein or protein complex in solution. We use these methods to show that Atox1 can accommodate at least four different conformations in the apo state (unbound to copper), and two different conformations in the holo state (bound to copper). We also demonstrate that the structure of Atox1 in the holo form is more compact than in the apo form. Our data provide insight regarding the structural mechanisms through which Atox1 can fulfill its dual role of copper binding and transfer. © 2017 The Protein Society.

HHM motif at the CuH-site of peptidylglycine monooxygenase is a pH-dependent conformational switch.

PubMed

Kline, Chelsey D; Mayfield, Mary; Blackburn, Ninian J

2013-04-16

Peptidylglycine monooxygenase is a copper-containing enzyme that catalyzes the amidation of neuropeptides hormones, the first step of which is the conversion of a glycine-extended pro-peptide to its α-hydroxyglcine intermediate. The enzyme contains two mononuclear Cu centers termed CuM (ligated to imidazole nitrogens of H242, H244 and the thioether S of M314) and CuH (ligated to imidazole nitrogens of H107, H108, and H172) with a Cu-Cu separation of 11 Å. During catalysis, the M site binds oxygen and substrate, and the H site donates the second electron required for hydroxylation. The WT enzyme shows maximum catalytic activity at pH 5.8 and undergoes loss of activity at lower pHs due to a protonation event with a pKA of 4.6. Low pH also causes a unique structural transition in which a new S ligand coordinates to copper with an identical pKA, manifest by a large increase in Cu-S intensity in the X- ray absorption spectroscopy. In previous work (Bauman, A. T., Broers, B. A., Kline, C. D., and Blackburn, N. J. (2011) Biochemistry 50, 10819-10828), we tentatively assigned the new Cu-S interaction to binding of M109 to the H-site (part of an HHM conserved motif common to all but one member of the family). Here we follow up on these findings via studies on the catalytic activity, pH-activity profiles, and spectroscopic (electron paramagnetic resonance, XAS, and Fourier transform infrared) properties of a number of H-site variants, including H107A, H108A, H172A, and M109I. Our results establish that M109 is indeed the coordinating ligand and confirm the prediction that the low pH structural transition with associated loss of activity is abrogated when the M109 thioether is absent. The histidine mutants show more complex behavior, but the almost complete lack of activity in all three variants coupled with only minor differences in their spectroscopic properties suggests that unique structural elements at H are critical for functionality. The data suggest a more general utility for the HHM motif as a copper- and pH-dependent conformational switch.

BSA binding and antimicrobial studies of branched polyethyleneimine-copper(II)bipyridine/phenanthroline complexes

NASA Astrophysics Data System (ADS)

Vignesh, Gopalaswamy; Arunachalam, Sankaralingam; Vignesh, Sivanandham; James, Rathinam Arthur

2012-10-01

The interaction of two water soluble branched polyethyleneimine-copper(II) complexes containing bipyridine/phenanthroline with bovine serum albumin (BSA) was studied by, UV-Visible absorption, fluorescence, lifetime measurements and circular dichroism spectroscopic techniques. The polymer-copper(II) complexes strongly quench the intrinsic fluorescence of BSA is the static quenching mechanism through hydrogen bonds and van der Waal's attraction. The distance r, between the BSA and the complexes seems to be less than 2 nm indicating that the energy transfer between the donor and acceptor occurs with high probability. Synchronous fluorescence studies indicate the binding of polymer-copper(II) complexes with BSA mostly changes the polarity around tryptophan residues rather than tyrosine residues. The circular dichroism studies indicate that the binding has induced considerable amount of conformational changes in the protein. The complexes also show some antibacterial and antifungal properties.

The Phosphatidic Acid Binding Site of the Arabidopsis Trigalactosyldiacylglycerol 4 (TGD4) Protein Required for Lipid Import into Chloroplasts*

PubMed Central

Wang, Zhen; Anderson, Nicholas Scott; Benning, Christoph

2013-01-01

Chloroplast membrane lipid synthesis relies on the import of glycerolipids from the ER. The TGD (TriGalactosylDiacylglycerol) proteins are required for this lipid transfer process. The TGD1, -2, and -3 proteins form a putative ABC (ATP-binding cassette) transporter transporting ER-derived lipids through the inner envelope membrane of the chloroplast, while TGD4 binds phosphatidic acid (PtdOH) and resides in the outer chloroplast envelope. We identified two sequences in TGD4, amino acids 1–80 and 110–145, which are necessary and sufficient for PtdOH binding. Deletion of both sequences abolished PtdOH binding activity. We also found that TGD4 from 18:3 plants bound specifically and with increased affinity PtdOH. TGD4 did not interact with other proteins and formed a homodimer both in vitro and in vivo. Our results suggest that TGD4 is an integral dimeric β-barrel lipid transfer protein that binds PtdOH with its N terminus and contains dimerization domains at its C terminus. PMID:23297418

Ubiquinol-binding site in the alternative oxidase: mutagenesis reveals features important for substrate binding and inhibition.

PubMed

Albury, Mary S; Elliott, Catherine; Moore, Anthony L

2010-12-01

The alternative oxidase (AOX) is a non-protonmotive ubiquinol oxidase that is found in all plants, some fungi, green algae, bacteria and pathogenic protozoa. The lack of AOX in the mammalian host renders this protein an important potential therapeutic target in the treatment of pathogenic protozoan infections. Bioinformatic searches revealed that, within a putative ubiquinol-binding crevice in AOX, Gln242, Asn247, Tyr253, Ser256, His261 and Arg262 were highly conserved. To confirm that these amino-acid residues are important for ubiquinol-binding and hence activity substitution mutations were generated and characterised. Assessment of AOX activity in isolated Schizosaccharomyces pombe mitochondria revealed that mutation of either Gln242, Ser256, His261 and Arg262 resulted in >90% inhibition of antimycin A-insensitive respiration suggesting that hydroxyl, guanidino, imidazole groups, polar and charged residues in addition to the size of the amino-acid chain are important for ubiquinone-binding. Substitution of Asn247 with glutamine or Tyr253 with phenylalanine had little effect upon the respiratory rate indicating that these residues are not critical for AOX activity. However replacement of Tyr253 by alanine resulted in a 72% loss of activity suggesting that the benzoquinone group and not hydroxyl group is important for quinol binding. These results provide important new insights into the ubiquinol-binding site of the alternative oxidase, the identity of which maybe important for future rational drug design. Copyright © 2010 Elsevier B.V. All rights reserved.

N‐Heterocyclic Carbene Self‐assembled Monolayers on Copper and Gold: Dramatic Effect of Wingtip Groups on Binding, Orientation and Assembly

PubMed Central

Larrea, Christian R.; Narouz, Mina R.; Mosey, Nicholas J.; Horton, J. Hugh; Crudden, Cathleen M.

2017-01-01

Abstract Self‐assembled monolayers of N‐heterocyclic carbenes (NHCs) on copper are reported. The monolayer structure is highly dependent on the N,N‐substituents on the NHC. On both Cu(111) and Au(111), bulky isopropyl substituents force the NHC to bind perpendicular to the metal surface while methyl‐ or ethyl‐substituted NHCs lie flat. Temperature‐programmed desorption studies show that the NHC binds to Cu(111) with a desorption energy of E des=152±10 kJ mol−1. NHCs that bind upright desorb cleanly, while flat‐lying NHCs decompose leaving adsorbed organic residues. Scanning tunneling microscopy of methylated NHCs reveals arrays of covalently linked dimers which transform into adsorbed (NHC)2Cu species by extraction of a copper atom from the surface after annealing. PMID:28960768

The leukemia associated ETO nuclear repressor gene is regulated by the GATA-1 transcription factor in erythroid/megakaryocytic cells

PubMed Central

2010-01-01

Background The Eight-Twenty-One (ETO) nuclear co-repressor gene belongs to the ETO homologue family also containing Myeloid Translocation Gene on chromosome 16 (MTG16) and myeloid translocation Gene-Related protein 1 (MTGR1). By chromosomal translocations ETO and MTG16 become parts of fusion proteins characteristic of morphological variants of acute myeloid leukemia. Normal functions of ETO homologues have as yet not been examined. The goal of this work was to identify structural and functional promoter elements upstream of the coding sequence of the ETO gene in order to explore lineage-specific hematopoietic expression and get hints to function. Results A putative proximal ETO promoter was identified within 411 bp upstream of the transcription start site. Strong ETO promoter activity was specifically observed upon transfection of a promoter reporter construct into erythroid/megakaryocytic cells, which have endogeneous ETO gene activity. An evolutionary conserved region of 228 bp revealed potential cis-elements involved in transcription of ETO. Disruption of the evolutionary conserved GATA -636 consensus binding site repressed transactivation and disruption of the ETS1 -705 consensus binding site enhanced activity of the ETO promoter. The promoter was stimulated by overexpression of GATA-1 into erythroid/megakaryocytic cells. Electrophoretic mobility shift assay with erythroid/megakaryocytic cells showed specific binding of GATA-1 to the GATA -636 site. Furthermore, results from chromatin immunoprecipitation showed GATA-1 binding in vivo to the conserved region of the ETO promoter containing the -636 site. The results suggest that the GATA -636 site may have a role in activation of the ETO gene activity in cells with erythroid/megakaryocytic potential. Leukemia associated AML1-ETO strongly suppressed an ETO promoter reporter in erythroid/megakaryocytic cells. Conclusions We demonstrate that the GATA-1 transcription factor binds and transactivates the ETO proximal promoter in an erythroid/megakaryocytic-specific manner. Thus, trans-acting factors that are essential in erythroid/megakaryocytic differentiation govern ETO expression. PMID:20487545

γ-secretase binding sites in aged and Alzheimer's disease human cerebrum: the choroid plexus as a putative origin of CSF Aβ.

PubMed

Liu, Fei; Xue, Zhi-Qin; Deng, Si-Hao; Kun, Xiong; Luo, Xue-Gang; Patrylo, Peter R; Rose, Gregory M; Cai, Huaibin; Struble, Robert G; Cai, Yan; Yan, Xiao-Xin

2013-05-01

Deposition of β -amyloid (Aβ) peptides, cleavage products of β-amyloid precursor protein (APP) by β-secretase-1 (BACE1) and γ-secretase, is a neuropathological hallmark of Alzheimer's disease (AD). γ-Secretase inhibition is a therapeutical anti-Aβ approach, although changes in the enzyme's activity in AD brain are unclear. Cerebrospinal fluid (CSF) Aβ peptides are thought to derive from brain parenchyma and thus may serve as biomarkers for assessing cerebral amyloidosis and anti-Aβ efficacy. The present study compared active γ-secretase binding sites with Aβ deposition in aged and AD human cerebrum, and explored the possibility of Aβ production and secretion by the choroid plexus (CP). The specific binding density of [(3) H]-L-685,458, a radiolabeled high-affinity γ-secretase inhibitor, in the temporal neocortex and hippocampal formation was similar for AD and control cases with similar ages and post-mortem delays. The CP in post-mortem samples exhibited exceptionally high [(3) H]-L-685,458 binding density, with the estimated maximal binding sites (Bmax) reduced in the AD relative to control groups. Surgically resected human CP exhibited APP, BACE1 and presenilin-1 immunoreactivity, and β-site APP cleavage enzymatic activity. In primary culture, human CP cells also expressed these amyloidogenic proteins and released Aβ40 and Aβ42 into the medium. Overall, our results suggest that γ-secretase activity appears unaltered in the cerebrum in AD and is not correlated with regional amyloid plaque pathology. The CP appears to be a previously unrecognised non-neuronal contributor to CSF Aβ, probably at reduced levels in AD. © 2013 Federation of European Neuroscience Societies and John Wiley & Sons Ltd.

γ-Secretase binding sites in aged and Alzheimer’s disease human cerebrum: The choroid plexus as a putative origin of CSF Aβ

PubMed Central

Liu, Fei; Xue, Zhi-Qin; Deng, Si-Hao; Kun, Xiong; Luo, Xue-Gang; Patrylo, Peter R.; Rose, Gregory M.; Cai, Huaibin; Struble, Robert G.; Cai, Yan; Yan, Xiao-Xin

2013-01-01

Deposition of β-amyloid (Aβ) peptides, cleavage products of β-amyloid precursor protein (APP) by β-secretase-1 (BACE1) and γ-secretase, is a neuropathological hallmark of Alzheimer’s disease (AD). γ-Secretase inhibition is a therapeutical anti-Aβ approach, although less is clear about the change of the enzyme’s activity in AD brain. Cerebrospinal fluid (CSF) Aβ peptides are considered to derive from brain parenchyma, thus may serve as biomarkers for assessing cerebral amyloidosis and anti-Aβ efficacy. The present study compared active γ-secretase binding sites with Aβ deposition in aged and AD human cerebrum, and explored a possibility of Aβ production and secretion by the choroid plexus (CP). Specific binding density of [3H]-L-685,458, a radiolabeled high affinity γ-secretase inhibitor, in the temporal neocortex and hippocampal formation was similar for AD and control cases with comparable ages and postmortem delays. The CP in postmortem samples exhibited exceptionally high [3H]-L-685,458 binding density, with the estimated maximal binding sites (Bmax) reduced in the AD relative to control groups. Surgically resected human CP exhibited APP, BACE1 and presenilin-1 immunoreactivity, and β-site APP cleavage enzymatic activity. In primary culture, human CP cells also expressed these amyloidogenic proteins but released Aβ40 and Aβ42 into the medium. These results suggest that γ-secretase activity appears not altered in the cerebrum in AD related to aged control, nor correlated with regional amyloid plaque pathology. The choroid plexus appears to represent a novel non-neuronal source in the brain that may contribute Aβ into cerebrospinal fluid, probably at reduced levels in AD. PMID:23432732

A novel paired domain DNA recognition motif can mediate Pax2 repression of gene transcription.

PubMed

Håvik, B; Ragnhildstveit, E; Lorens, J B; Saelemyr, K; Fauske, O; Knudsen, L K; Fjose, A

1999-12-20

The paired domain (PD) is an evolutionarily conserved DNA-binding domain encoded by the Pax gene family of developmental regulators. The Pax proteins are transcription factors and are involved in a variety of processes such as brain development, patterning of the central nervous system (CNS), and B-cell development. In this report we demonstrate that the zebrafish Pax2 PD can interact with a novel type of DNA sequences in vitro, the triple-A motif, consisting of a heptameric nucleotide sequence G/CAAACA/TC with an invariant core of three adjacent adenosines. This recognition sequence was found to be conserved in known natural Pax5 repressor elements involved in controlling the expression of the p53 and J-chain genes. By identifying similar high affinity binding sites in potential target genes of the Pax2 protein, including the pax2 gene itself, we obtained further evidence that the triple-A sites are biologically significant. The putative natural target sites also provide a basis for defining an extended consensus recognition sequence. In addition, we observed in transformation assays a direct correlation between Pax2 repressor activity and the presence of triple-A sites. The results suggest that a transcriptional regulatory function of Pax proteins can be modulated by PD binding to different categories of target sequences. Copyright 1999 Academic Press.

Full-length cellular β-secretase has a trimeric subunit stoichiometry, and its sulfur-rich transmembrane interaction site modulates cytosolic copper compartmentalization.

PubMed

Liebsch, Filip; Aurousseau, Mark R P; Bethge, Tobias; McGuire, Hugo; Scolari, Silvia; Herrmann, Andreas; Blunck, Rikard; Bowie, Derek; Multhaup, Gerd

2017-08-11

The β-secretase (BACE1) initiates processing of the amyloid precursor protein (APP) into Aβ peptides, which have been implicated as central players in the pathology of Alzheimer disease. BACE1 has been described as a copper-binding protein and its oligomeric state as being monomeric, dimeric, and/or multimeric, but the native cellular stoichiometry has remained elusive. Here, by using single-molecule fluorescence and in vitro cross-linking experiments with photo-activatable unnatural amino acids, we show that full-length BACE1, independently of its subcellular localization, exists as trimers in human cells. We found that trimerization requires the BACE1 transmembrane sequences (TMSs) and cytoplasmic domains, with residues Ala 463 and Cys 466 buried within the trimer interface of the sulfur-rich core of the TMSs. Our 3D model predicts that the sulfur-rich core of the trimeric BACE1 TMS is accessible to metal ions, but copper ions did not trigger trimerization. The results of functional assays of endogenous BACE1 suggest that it has a role in intracellular copper compartmentalization by transferring cytosolic copper to intracellular compartments, while leaving the overall cellular copper concentration unaltered. Adding to existing physiological models, our results provide novel insight into the atypical interactions between copper and BACE1 and into its non-enzymatic activities. In conclusion, therapeutic Alzheimer disease prevention strategies aimed at decreasing BACE1 protein levels should be regarded with caution, because adverse effects in copper homeostasis may occur. © 2017 by The American Society for Biochemistry and Molecular Biology, Inc.

Characterization and copper binding of humic and nonhumic organic matter isolated from the South Platte River: Evidence for the presence of nitrogenous binding site

USGS Publications Warehouse

Croue, J.-P.; Benedetti, M.F.; Violleau, D.; Leenheer, J.A.

2003-01-01

Humic substances typically constitute 40-60% of the dissolved organic matter (DOM) in surface waters. However, little information is available regarding the metal binding properties of the nonhumic hydrophilic portion of the DOM. In this study, humic and nonhumic DOM samples were isolated from the South Platte River (Colorado, DOC = 2.6 mg??L-1, SUVA254 = 2.4 L/mg??m) using a two-column array of XAD-8 and XAD-4 resins. The three major isolated fractions of DOM, which accounted for 57% of the bulk DOM, were characterized using a variety of analytical tools. Proton and copper binding properties were studied for each fraction. The main objective of this work was to compare the structural and chemical characteristics of the isolated fractions and test models describing DOM reactivity toward metal ions. The characterization work showed significant structural differences between the three isolated fractions of DOM. The hydrophobic acid fraction (i.e., humic substances isolated from the XAD-8 resin) gave the largest C/H, C/O, and C/N ratios and aromatic carbon content among the three isolated fractions. The transphilic acid (TPHA) fraction ("transphilic" meaning fraction of intermediate polarity isolated from the XAD-4 resin) was found to incorporate the highest proportion of polysaccharides, whereas the transphilic neutral (TPHN) fraction was almost entirely proteinaceous. The gradual increase of the charge with pH for the three DOM fractions is most likely caused by a large distribution of proton affinity constants for the carboxylic groups, as well as a second type of group more generally considered to be phenolic. In the case of the DOM fraction enriched in proteinaceous material (i.e., TPHN fraction), the results showed that the amino groups are reponsible for the charge reversal. For low copper concentrations, nitrogen-containing functional groups similar to those of amino acids are likely to be involved in complexation, in agreement with previously published data.

Engineering Klebsiella sp. 601 multicopper oxidase enhances the catalytic efficiency towards phenolic substrates.

PubMed

Li, Yadong; Gong, Zijun; Li, Xin; Li, Yang; Wang, Xing-Guo

2011-05-31

Structural comparison between bacterial CueO and fungal laccases has suggested that a charged residue Glu (E106) in CueO replaces the corresponding residue Phe in fungal laccases at the gate of the tunnel connecting type II copper to the protein surface and an extra α-helix (L351-G378) near the type I copper site covers the substrate binding pocket and might compromise the electron transfer from substrate to type I copper. To test this hypothesis, several mutants were made in Klebsiella sp. 601 multicopper oxidase, which is highly homologous to E. coli CueO with a similarity of 90% and an identity of 78%. The E106F mutant gave smaller K(m) (2.4-7 fold) and k(cat) (1-4.4 fold) values for all three substrates DMP, ABTS and SGZ as compared with those for the wild-type enzyme. Its slightly larger k(cat)/K(m) values for three substrates mainly come from the decreased K(m). Deleting α-helix (L351-G378) resulted in the formation of inactive inclusion body when the mutant (Δ)α351-378 was expressed in E. coli. Another mutant α351-380M was then made via substitution of seven amino acid residues in the α-helix (L351-G378) region. The α351-380M mutant was active, and displayed a far-UV CD spectrum markedly different from that for wild-type enzyme. Kinetic studies showed the α351-380M mutant gave very low K(m) values for DMP, ABTS and SGZ, 4.5-, 1.9- and 7-fold less than those for the wild type. In addition, k(cat)/K(m) values were increased, 9.4-fold for DMP, similar for ABTS and 3-fold for SGZ. The Glu residue at position 106 appears not to be the only factor affecting the copper binding, and it may also play a role in maintaining enzyme conformation. The α-helix (L351-G378) may not only block access to the type I copper site but also play a role in substrate specificities of bacterial MCOs. The α351-380M mutant catalyzing oxidation of the phenolic substrate DMP effectively would be very useful in green chemistry.

Developing Hypothetical Inhibition Mechanism of Novel Urea Transporter B Inhibitor

NASA Astrophysics Data System (ADS)

Li, Min; Tou, Weng Ieong; Zhou, Hong; Li, Fei; Ren, Huiwen; Chen, Calvin Yu-Chian; Yang, Baoxue

2014-07-01

Urea transporter B (UT-B) is a membrane channel protein that specifically transports urea. UT-B null mouse exhibited urea selective urine concentrating ability deficiency, which suggests the potential clinical applications of the UT-B inhibitors as novel diuretics. Primary high-throughput virtual screening (HTVS) of 50000 small-molecular drug-like compounds identified 2319 hit compounds. These 2319 compounds were screened by high-throughput screening using an erythrocyte osmotic lysis assay. Based on the pharmacological data, putative UT-B binding sites were identified by structure-based drug design and validated by ligand-based and QSAR model. Additionally, UT-B structural and functional characteristics under inhibitors treated and untreated conditions were simulated by molecular dynamics (MD). As the result, we identified four classes of compounds with UT-B inhibitory activity and predicted a human UT-B model, based on which computative binding sites were identified and validated. A novel potential mechanism of UT-B inhibitory activity was discovered by comparing UT-B from different species. Results suggest residue PHE198 in rat and mouse UT-B might block the inhibitor migration pathway. Inhibitory mechanisms of UT-B inhibitors and the functions of key residues in UT-B were proposed. The binding site analysis provides a structural basis for lead identification and optimization of UT-B inhibitors.

Harmane: an atypical neurotransmitter?

PubMed

Abu Ghazaleh, Haya; Lalies, Maggie D; Nutt, David J; Hudson, Alan L

2015-03-17

Harmane is an active component of clonidine displacing substance and a candidate endogenous ligand for imidazoline binding sites. The neurochemistry of tritiated harmane was investigated in the present study examining its uptake and release properties in the rat brain central nervous system (CNS) in vitro. At physiological temperature, [(3)H]harmane was shown to be taken up in rat brain cortex. Further investigations demonstrated that treatment with monoamine uptake blockers (citalopram, nomifensine and nisoxetine) did not alter [(3)H]harmane uptake implicating that the route of [(3)H]harmane transport was distinct from the monoamine uptake systems. Furthermore, imidazoline ligands (rilmenidine, efaroxan, 2-BFI and idazoxan) showed no prominent effect on [(3)H]harmane uptake suggesting the lack of involvement of imidazoline binding sites. Subsequent analyses showed that disruption of the Na(+) gradient using ouabain or choline chloride did not block [(3)H]harmane uptake suggesting a Na(+)-independent transport mechanism. Moreover, higher temperatures (50°C) failed to impede [(3)H]harmane uptake implying a non-physiological transporter. The failure of potassium to evoke the release of preloaded [(3)H]harmane from rat brain cortex indicates that the properties of this putative endogenous ligand for imidazoline binding sites do not resemble that of a conventional neurotransmitter. Copyright © 2015 Elsevier Ireland Ltd. All rights reserved.

Regulation of extracellular copper-binding proteins in copper-resistant and copper-sensitive mutants of Vibrio alginolyticus.

PubMed Central

Harwood, V J; Gordon, A S

1994-01-01

Extracellular proteins of wild-type Vibrio alginolyticus were compared with those of copper-resistant and copper-sensitive mutants. One copper-resistant mutant (Cu40B3) constitutively produced an extracellular protein with the same apparent molecular mass (21 kDa) and chromatographic behavior as copper-binding protein (CuBP), a copper-induced supernatant protein which has been implicated in copper detoxification in wild-type V. alginolyticus. Copper-sensitive V. alginolyticus mutants displayed a range of alterations in supernatant protein profiles. CuBP was not detected in supernatants of one copper-sensitive mutant after cultures had been stressed with 50 microM copper. Increased resistance to copper was not induced by preincubation with subinhibitory levels of copper in the wild type or in the copper-resistant mutant Cu40B3. Copper-resistant mutants maintained the ability to grow on copper-amended agar after 10 or more subcultures on nonselective agar, demonstrating the stability of the phenotype. A derivative of Cu40B3 with wild-type sensitivity to copper which no longer constitutively expressed CuBP was isolated. The simultaneous loss of both constitutive CuBP production and copper resistance in Cu40B3 indicates that constitutive CuBP production is necessary for copper resistance in this mutant. These data support the hypothesis that the extracellular, ca. 20-kDa protein(s) of V. alginolyticus is an important factor in survival and growth of the organism at elevated copper concentrations. The range of phenotypes observed in copper-resistant and copper-sensitive V. alginolyticus indicate that altered sensitivity to copper was mediated by a variety of physiological changes. Images PMID:8031076

The HhH(2)/NDD Domain of the Drosophila Nod Chromokinesin-like Protein Is Required for Binding to Chromosomes in the Oocyte Nucleus

PubMed Central

Cui, Wei; Hawley, R. Scott

2005-01-01

Nod is a chromokinesin-like protein that plays a critical role in segregating achiasmate chromosomes during female meiosis. The C-terminal half of the Nod protein contains two putative DNA-binding domains. The first of these domains, known as the HMGN domain, consists of three tandemly repeated high-mobility group N motifs. This domain was previously shown to be both necessary and sufficient for binding of the C-terminal half of Nod to mitotic chromosomes in embryos. The second putative DNA-binding domain, denoted HhH(2)/NDD, is a helix-hairpin-helix(2)/Nod-like DNA-binding domain. Although the HhH(2)/NDD domain is not required or sufficient for chromosome binding in embryos, several well-characterized nod mutations have been mapped in this domain. To characterize the role of the HhH(2)/NDD domain in mediating Nod function, we created a series of UAS-driven transgene constructs capable of expressing either a wild-type Nod-GFP fusion protein or proteins in which the HhH(2)/NDD domain had been altered by site-directed mutagenesis. Although wild-type Nod-GFP localizes to the oocyte chromosomes and rescues the segregation defect in nod mutant oocytes, two of three proteins carrying mutants in the HhH(2)/NDD domain fail to either rescue the nod mutant phenotype or bind to oocyte chromosomes. However, these mutant proteins do bind to the polytene chromosomes in nurse-cell nuclei and enter the oocyte nucleus. Thus, even though the HhH(2)/NDD domain is not essential for chromosome binding in other cell types, it is required for chromosome binding in the oocyte. These HhH(2)/NDD mutants also block the localization of Nod to the posterior pole of stage 9–10A oocytes, a process that is thought to facilitate the interaction of Nod with the plus ends of microtubules (Cui et al. 2005). This observation suggests that the Nod HhH2/NDD domain may play other roles in addition to binding Nod to meiotic chromosomes. PMID:16143607

Biosorption of metal ions from aqueous solutions

DOE Office of Scientific and Technical Information (OSTI.GOV)

Chen, Jiaping; Yiacoumi, Sotira

1997-01-01

Copper biosorption from aqueous solutions by calcium alginate is reported in this paper. The experimental section includes potentiometric titrations of biosorbents, batch equilibrium and kinetic studies of copper biosorption, as well as fixed-bed biosorption experiments. The potentiometric titration results show that the surface charge increases with decreasing pH. The biosorption of copper strongly depends on solution pH; the metal ion binding increases from 0 to 90 percent in pH ranging from 1.5 to 5.0. In addition, a decrease in ionic strength results in an increase of copper ion removal. Kinetic studies indicate that mass transfer plays an important role inmore » the biosorption rate. Furthermore, a fixed-bed biosorption experiment shows that calcium alginate has a significant capacity for copper ion removal. The two-pK Basic Stem model successfully represents the surface charge and equilibrium biosorption experimental data. The calculation results demonstrate that the copper removal may result from the binding of free copper and its hydroxide with surface functional groups of the biosorbents.« less

The molecular mechanism for interaction of ceruloplasmin and myeloperoxidase

NASA Astrophysics Data System (ADS)

Bakhautdin, Bakytzhan; Bakhautdin, Esen Göksöy

2016-04-01

Ceruloplasmin (Cp) is a copper-containing ferroxidase with potent antioxidant activity. Cp is expressed by hepatocytes and activated macrophages and has been known as physiologic inhibitor of myeloperoxidase (MPO). Enzymatic activity of MPO produces anti-microbial agents and strong prooxidants such as hypochlorous acid and has a potential to damage host tissue at the sites of inflammation and infection. Thus Cp-MPO interaction and inhibition of MPO has previously been suggested as an important control mechanism of excessive MPO activity. Our aim in this study was to identify minimal Cp domain or peptide that interacts with MPO. We first confirmed Cp-MPO interaction by ELISA and surface plasmon resonance (SPR). SPR analysis of the interaction yielded 30 nM affinity between Cp and MPO. We then designed and synthesized 87 overlapping peptides spanning the entire amino acid sequence of Cp. Each of the peptides was tested whether it binds to MPO by direct binding ELISA. Two of the 87 peptides, P18 and P76 strongly interacted with MPO. Amino acid sequence analysis of identified peptides revealed high sequence and structural homology between them. Further structural analysis of Cp's crystal structure by PyMOL software unfolded that both peptides represent surface-exposed sites of Cp and face nearly the same direction. To confirm our finding we raised anti-P18 antisera in rabbit and demonstrated that this antisera disrupts Cp-MPO binding and rescues MPO activity. Collectively, our results confirm Cp-MPO interaction and identify two nearly identical sites on Cp that specifically bind MPO. We propose that inhibition of MPO by Cp requires two nearly identical sites on Cp to bind homodimeric MPO simultaneously and at an angle of at least 120 degrees, which, in turn, exerts tension on MPO and results in conformational change.

Novel Broad Spectrum Inhibitors Targeting the Flavivirus Methyltransferase

PubMed Central

Liu, Binbin; Banavali, Nilesh K.; Jones, Susan A.; Zhang, Jing; Li, Zhong; Kramer, Laura D.; Li, Hongmin

2015-01-01

The flavivirus methyltransferase (MTase) is an essential enzyme that sequentially methylates the N7 and 2’-O positions of the viral RNA cap, using S-adenosyl-L-methionine (SAM) as a methyl donor. We report here that small molecule compounds, which putatively bind to the SAM-binding site of flavivirus MTase and inhibit its function, were identified by using virtual screening. In vitro methylation experiments demonstrated significant MTase inhibition by 13 of these compounds, with the most potent compound displaying sub-micromolar inhibitory activity. The most active compounds showed broad spectrum activity against the MTase proteins of multiple flaviviruses. Two of these compounds also exhibited low cytotoxicity and effectively inhibited viral replication in cell-based assays, providing further structural insight into flavivirus MTase inhibition. PMID:26098995

Yersinia Type III Secretion System Master Regulator LcrF

PubMed Central

Schwiesow, Leah; Lam, Hanh

2015-01-01

Many Gram-negative pathogens express a type III secretion (T3SS) system to enable growth and survival within a host. The three human-pathogenic Yersinia species, Y. pestis, Y. pseudotuberculosis, and Y. enterocolitica, encode the Ysc T3SS, whose expression is controlled by an AraC-like master regulator called LcrF. In this review, we discuss LcrF structure and function as well as the environmental cues and pathways known to regulate LcrF expression. Similarities and differences in binding motifs and modes of action between LcrF and the Pseudomonas aeruginosa homolog ExsA are summarized. In addition, we present a new bioinformatics analysis that identifies putative LcrF binding sites within Yersinia target gene promoters. PMID:26644429

Inheritable copper tolerance in the chlorophyte macroalga Enteromorpha intestinalis

DOE Office of Scientific and Technical Information (OSTI.GOV)

Lewis, S.; Williams, P.; Donkin, M.

1995-12-31

A study was carried out to determine if a population of Enteromorpha intestinalis, from a metal polluted site, exhibited copper tolerance. This work was in preparation for investigating stress protein patterns in copper tolerant and sensitive populations. The effects of copper on growth of E. intestinalis from three clean and one metal polluted site were compared. Growth was assessed by incubating thallus sections in a range of copper solutions and measuring increase in length. Offspring were cultured from clean and polluted sites and the effects of copper on their growth assessed, to determine if any tolerance was inheritable. Concentrations ofmore » the trace metals; copper, zinc and manganese in the populations were also determined. Over the range of copper concentrations tested (0--150 {micro}g/i), growth of the polluted site populations was not significantly affected (P > 0.05). However growth of the clean site populations was significantly depressed by exposure to 50 {micro}g/l. This pattern of response was also exhibited by the offspring. Trace metal concentrations in the clean site populations were very similar, however the polluted site population contained {sup {minus}}10 times the control site values of manganese and {approximately}35 times the values of zinc and copper. The results suggest that the polluted site population of E. intestinalis has developed a degree of copper tolerance which appears to have a genetic basis. This investigation is consistent with previous work into copper tolerance in ship-fouling populations of E. intestinalis var. compressa. A commercially available HSP70 antibody with a high degree of cross-reactivity to E. intestinalis has been identified and used to screen samples of the seaweed from the aforementioned populations.« less

Engineering vanilloid-sensitivity into the rat TRPV2 channel

PubMed Central

Zhang, Feng; Hanson, Sonya M; Jara-Oseguera, Andres; Krepkiy, Dmitriy; Bae, Chanhyung; Pearce, Larry V; Blumberg, Peter M; Newstead, Simon; Swartz, Kenton J

2016-01-01

The TRPV1 channel is a detector of noxious stimuli, including heat, acidosis, vanilloid compounds and lipids. The gating mechanisms of the related TRPV2 channel are poorly understood because selective high affinity ligands are not available, and the threshold for heat activation is extremely high (>50°C). Cryo-EM structures of TRPV1 and TRPV2 reveal that they adopt similar structures, and identify a putative vanilloid binding pocket near the internal side of TRPV1. Here we use biochemical and electrophysiological approaches to investigate the resiniferatoxin(RTx) binding site in TRPV1 and to explore the functional relationships between TRPV1 and TRPV2. Collectively, our results support the interaction of vanilloids with the proposed RTx binding pocket, and demonstrate an allosteric influence of a tarantula toxin on vanilloid binding. Moreover, we show that sensitivity to RTx can be engineered into TRPV2, demonstrating that the gating and permeation properties of this channel are similar to TRPV1. DOI: http://dx.doi.org/10.7554/eLife.16409.001 PMID:27177419

Engineering vanilloid-sensitivity into the rat TRPV2 channel.

PubMed

Zhang, Feng; Hanson, Sonya M; Jara-Oseguera, Andres; Krepkiy, Dmitriy; Bae, Chanhyung; Pearce, Larry V; Blumberg, Peter M; Newstead, Simon; Swartz, Kenton J

2016-05-13

The TRPV1 channel is a detector of noxious stimuli, including heat, acidosis, vanilloid compounds and lipids. The gating mechanisms of the related TRPV2 channel are poorly understood because selective high affinity ligands are not available, and the threshold for heat activation is extremely high (>50°C). Cryo-EM structures of TRPV1 and TRPV2 reveal that they adopt similar structures, and identify a putative vanilloid binding pocket near the internal side of TRPV1. Here we use biochemical and electrophysiological approaches to investigate the resiniferatoxin(RTx) binding site in TRPV1 and to explore the functional relationships between TRPV1 and TRPV2. Collectively, our results support the interaction of vanilloids with the proposed RTx binding pocket, and demonstrate an allosteric influence of a tarantula toxin on vanilloid binding. Moreover, we show that sensitivity to RTx can be engineered into TRPV2, demonstrating that the gating and permeation properties of this channel are similar to TRPV1.

Binding characteristics of levetiracetam to synaptic vesicle protein 2A (SV2A) in human brain and in CHO cells expressing the human recombinant protein.

PubMed

Gillard, Michel; Chatelain, Pierre; Fuks, Bruno

2006-04-24

A specific binding site for the antiepileptic drug levetiracetam (2S-(oxo-1-pyrrolidinyl)butanamide, Keppra) in rat brain, referred to as the levetiracetam binding site, was discovered several years ago. More recently, this binding site has been identified as the synaptic vesicle protein 2A (SV2A), a protein present in synaptic vesicles [Lynch, B., Lambeng, N., Nocka, K., Kensel-Hammes, P., Bajjalieh, S.M., Matagne, A., Fuks, B., 2004. The synaptic vesicle protein SV2A is the binding site for the antiepileptic drug levetiracetam. Proc. Natl. Acad. Sci. USA, 101, 9861-9866.]. In this study, we characterized the binding properties of levetiracetam in post-mortem human brain and compared them to human SV2A expressed in Chinese hamster ovary (CHO) cells. The results showed that the binding properties of levetiracetam and [3H]ucb 30889, an analogue that was previously characterized as a suitable ligand for levetiracetam binding site/SV2A in rat brain [Gillard, M., Fuks, B., Michel, P., Vertongen, P., Massingham, R. Chatelain, P., 2003. Binding characteristics of [3H]ucb 30889 to levetiracetam binding sites in rat brain. Eur. J. Pharmacol. 478, 1-9.], are almost identical in human brain samples (cerebral cortex, hippocampus and cerebellum) and in CHO cell membranes expressing the human SV2A protein. Moreover, the results are also similar to those previously obtained in rat brain. [3H]ucb 30889 binding in human brain and to SV2A was saturable and reversible. At 4 degrees C, its binding kinetics were best fitted assuming a two-phase model in all tissues. The half-times of association for the fast component ranged between 1 to 2 min and represent 30% to 36% of the sites whereas the half-times for the slow component ranged from 20 to 29 min. In dissociation experiments, the half-times were from 2 to 4 min for the fast component (33% to 49% of the sites) and 20 to 41 min for the slow component. Saturation binding curves led to Kd values for [3H]ucb 30889 of 53+/-7, 55+/-9, 70+/-11 and 75+/-33 nM in human cerebral cortex, hippocampus, cerebellum and CHO cells expressing SV2A respectively. Bmax values around 3-4 pmol/mg protein were calculated in all brain regions. Some of the saturation curves displayed curvilinear Scatchard plots indicating the presence of high and low affinity binding sites. When this was the case, Kd values from 25 to 30 nM for the high affinity sites (24% to 34% of total sites) and from 200 to 275 nM for the low affinity sites were calculated. This was observed in all brain regions and in CHO cell membranes expressing the SV2A protein. It cannot be explained by putative binding of [3H]ucb 30889 to SV2B or C isoforms but may reflect different patterns of SV2A glycosylation or the formation of SV2A oligomers. Competition experiments were performed to determine the affinities for SV2A of a variety of compounds including levetiracetam, some of its analogues and other molecules known to interact with levetiracetam binding sites in rat brain such as bemegride, pentylenetetrazol and chlordiazepoxide. We found an excellent correlation between the affinities of these compounds measured in human brain, rat brain and CHO cells expressing human SV2A. In conclusion, we report for the first time that the binding characteristics of native levetiracetam binding sites/SV2A in human brain and rat brain share very similar properties with human recombinant SV2A expressed in CHO cells.

miRWalk--database: prediction of possible miRNA binding sites by "walking" the genes of three genomes.

PubMed

Dweep, Harsh; Sticht, Carsten; Pandey, Priyanka; Gretz, Norbert

2011-10-01

MicroRNAs are small, non-coding RNA molecules that can complementarily bind to the mRNA 3'-UTR region to regulate the gene expression by transcriptional repression or induction of mRNA degradation. Increasing evidence suggests a new mechanism by which miRNAs may regulate target gene expression by binding in promoter and amino acid coding regions. Most of the existing databases on miRNAs are restricted to mRNA 3'-UTR region. To address this issue, we present miRWalk, a comprehensive database on miRNAs, which hosts predicted as well as validated miRNA binding sites, information on all known genes of human, mouse and rat. All mRNAs, mitochondrial genes and 10 kb upstream flanking regions of all known genes of human, mouse and rat were analyzed by using a newly developed algorithm named 'miRWalk' as well as with eight already established programs for putative miRNA binding sites. An automated and extensive text-mining search was performed on PubMed database to extract validated information on miRNAs. Combined information was put into a MySQL database. miRWalk presents predicted and validated information on miRNA-target interaction. Such a resource enables researchers to validate new targets of miRNA not only on 3'-UTR, but also on the other regions of all known genes. The 'Validated Target module' is updated every month and the 'Predicted Target module' is updated every 6 months. miRWalk is freely available at http://mirwalk.uni-hd.de/. Copyright © 2011 Elsevier Inc. All rights reserved.

Mechanism of Protein Denaturation: Partial Unfolding of the P22 Coat Protein I-Domain by Urea Binding

PubMed Central

Newcomer, Rebecca L.; Fraser, LaTasha C.R.; Teschke, Carolyn M.; Alexandrescu, Andrei T.

2015-01-01

The I-domain is an insertion domain of the bacteriophage P22 coat protein that drives rapid folding and accounts for over half of the stability of the full-length protein. We sought to determine the role of hydrogen bonds (H-bonds) in the unfolding of the I-domain by examining 3JNC’ couplings transmitted through H-bonds, the temperature and urea-concentration dependence of 1HN and 15N chemical shifts, and native-state hydrogen exchange at urea concentrations where the domain is predominantly folded. The native-state hydrogen-exchange data suggest that the six-stranded β-barrel core of the I-domain is more stable against unfolding than a smaller subdomain comprised of a short α-helix and three-stranded β-sheet. H-bonds, separately determined from solvent protection and 3JNC’ H-bond couplings, are identified with an accuracy of 90% by 1HN temperature coefficients. The accuracy is improved to 95% when 15N temperature coefficients are also included. In contrast, the urea dependence of 1HN and 15N chemical shifts is unrelated to H-bonding. The protein segments with the largest chemical-shift changes in the presence of urea show curved or sigmoidal titration curves suggestive of direct urea binding. Nuclear Overhauser effects to urea for these segments are also consistent with specific urea-binding sites in the I-domain. Taken together, the results support a mechanism of urea unfolding in which denaturant binds to distinct sites in the I-domain. Disordered segments bind urea more readily than regions in stable secondary structure. The locations of the putative urea-binding sites correlate with the lower stability of the structure against solvent exchange, suggesting that partial unfolding of the structure is related to urea accessibility. PMID:26682823

Substrate channel in nitrogenase revealed by a molecular dynamics approach.

PubMed

Smith, Dayle; Danyal, Karamatullah; Raugei, Simone; Seefeldt, Lance C

2014-04-15

Mo-dependent nitrogenase catalyzes the biological reduction of N2 to two NH3 molecules at FeMo-cofactor buried deep inside the MoFe protein. Access of substrates, such as N2, to the active site is likely restricted by the surrounding protein, requiring substrate channels that lead from the surface to the active site. Earlier studies on crystallographic structures of the MoFe protein have suggested three putative substrate channels. Here, we have utilized submicrosecond atomistic molecular dynamics simulations to allow the nitrogenase MoFe protein to explore its conformational space in an aqueous solution at physiological ionic strength, revealing a putative substrate channel. The viability of this observed channel was tested by examining the free energy of passage of N2 from the surface through the channel to FeMo-cofactor, resulting in the discovery of a very low energy barrier. These studies point to a viable substrate channel in nitrogenase that appears during thermal motions of the protein in an aqueous environment and that approaches a face of FeMo-cofactor earlier implicated in substrate binding.

DOE Office of Scientific and Technical Information (OSTI.GOV)

Smith, Dayle; Danyal, Karamatullah; Raugei, Simone

Mo-dependent nitrogenase catalyzes the biological reduction of N 2 to 2NH 3 at the FeMo-cofactor buried deep inside the MoFe protein. Access of substrates, such as N 2, to the active site is likely restricted by the surrounding protein, requiring substrate channels that lead from the surface to the active site. Earlier studies on crystallographic structures of the MoFe protein have suggested three putative substrate channels. Here, we have utilized sub-microsecond atomistic molecular dynamics simulations to allow the nitrogenase MoFe protein to explore its conformational space in an aqueous solution at physiological ionic strength, revealing a putative substrate channel notmore » previously reported. The viability of the proposed channel was tested by examining the free energy of passage of N 2 from the surface through the channel to FeMo-cofactor, with discovery of a very low energy barrier. These studies point to a viable substrate channel in nitrogenase that appears during thermal motions of the protein in an aqueous environment that approaches a face of FeMo-cofactor earlier implicated in substrate binding.« less

Acetylcholine receptors in the human retina

DOE Office of Scientific and Technical Information (OSTI.GOV)

Hutchins, J.B.; Hollyfield, J.G.

1985-11-01

Evidence for a population of acetylcholine (ACh) receptors in the human retina is presented. The authors have used the irreversible ligand TH-propylbenzilylcholine mustard (TH-PrBCM) to label muscarinic receptors. TH- or SVI-alpha-bungarotoxin (alpha-BTx) was used to label putative nicotinic receptors. Muscarinic receptors are apparently present in the inner plexiform layer of the retina. Autoradiographic grain densities are reduced in the presence of saturating concentrations of atropine, quinuclidinyl benzilate or scopolamine; this indicates that TH-PrBCM binding is specific for a population of muscarinic receptors in the human retina. Binding sites for radiolabeled alpha-BTx are found predominantly in the inner plexiform layer ofmore » the retina. Grain densities are reduced in the presence of d-tubocurarine, indicating that alpha-BTx may bind to a pharmacologically relevant nicotinic ACh receptor. This study provides evidence for cholinergic neurotransmission in the human retina.« less

G =  MAT: linking transcription factor expression and DNA binding data.

PubMed

Tretyakov, Konstantin; Laur, Sven; Vilo, Jaak

2011-01-31

Transcription factors are proteins that bind to motifs on the DNA and thus affect gene expression regulation. The qualitative description of the corresponding processes is therefore important for a better understanding of essential biological mechanisms. However, wet lab experiments targeted at the discovery of the regulatory interplay between transcription factors and binding sites are expensive. We propose a new, purely computational method for finding putative associations between transcription factors and motifs. This method is based on a linear model that combines sequence information with expression data. We present various methods for model parameter estimation and show, via experiments on simulated data, that these methods are reliable. Finally, we examine the performance of this model on biological data and conclude that it can indeed be used to discover meaningful associations. The developed software is available as a web tool and Scilab source code at http://biit.cs.ut.ee/gmat/.

G = MAT: Linking Transcription Factor Expression and DNA Binding Data

PubMed Central

Tretyakov, Konstantin; Laur, Sven; Vilo, Jaak

2011-01-01

Transcription factors are proteins that bind to motifs on the DNA and thus affect gene expression regulation. The qualitative description of the corresponding processes is therefore important for a better understanding of essential biological mechanisms. However, wet lab experiments targeted at the discovery of the regulatory interplay between transcription factors and binding sites are expensive. We propose a new, purely computational method for finding putative associations between transcription factors and motifs. This method is based on a linear model that combines sequence information with expression data. We present various methods for model parameter estimation and show, via experiments on simulated data, that these methods are reliable. Finally, we examine the performance of this model on biological data and conclude that it can indeed be used to discover meaningful associations. The developed software is available as a web tool and Scilab source code at http://biit.cs.ut.ee/gmat/. PMID:21297945

Redox-dependent open and closed forms of the active site of the bacterial respiratory nitric-oxide reductase revealed by cyanide binding studies.

PubMed

Grönberg, Karin L C; Watmough, Nicholas J; Thomson, Andrew J; Richardson, David J; Field, Sarah J

2004-04-23

The bacterial respiratory nitric-oxide reductase (NOR) catalyzes the respiratory detoxification of nitric oxide in bacteria and Archaea. It is a member of the well known super-family of heme-copper oxidases but has a [heme Fe-non-heme Fe] active site rather than the [heme Fe-Cu(B)] active site normally associated with oxygen reduction. Paracoccus denitrificans NOR is spectrally characterized by a ligand-to-metal charge transfer absorption band at 595 nm, which arises from the high spin ferric heme iron of a micro-oxo-bridged [heme Fe(III)-O-Fe(III)] active site. On reduction of the nonheme iron, the micro-oxo bridge is broken, and the ferric heme iron is hydroxylated or hydrated, depending on the pH. At present, the catalytic cycle of NOR is a matter of much debate, and it is not known to which redox state(s) of the enzyme nitric oxide can bind. This study has used cyanide to probe the nature of the active site in a number of different redox states. Our observations suggest that the micro-oxo-bridged [heme Fe(III)-O-Fe(III)] active site represents a closed or resting state of NOR that can be opened by reduction of the non-heme iron.

Horizontal transfer of a large and highly toxic secondary metabolic gene cluster between fungi.

PubMed

Slot, Jason C; Rokas, Antonis

2011-01-25

Genes involved in intermediary and secondary metabolism in fungi are frequently physically linked or clustered. For example, in Aspergillus nidulans the entire pathway for the production of sterigmatocystin (ST), a highly toxic secondary metabolite and a precursor to the aflatoxins (AF), is located in a ∼54 kb, 23 gene cluster. We discovered that a complete ST gene cluster in Podospora anserina was horizontally transferred from Aspergillus. Phylogenetic analysis shows that most Podospora cluster genes are adjacent to or nested within Aspergillus cluster genes, although the two genera belong to different taxonomic classes. Furthermore, the Podospora cluster is highly conserved in content, sequence, and microsynteny with the Aspergillus ST/AF clusters and its intergenic regions contain 14 putative binding sites for AflR, the transcription factor required for activation of the ST/AF biosynthetic genes. Examination of ∼52,000 Podospora expressed sequence tags identified transcripts for 14 genes in the cluster, with several expressed at multiple life cycle stages. The presence of putative AflR-binding sites and the expression evidence for several cluster genes, coupled with the recent independent discovery of ST production in Podospora [1], suggest that this HGT event probably resulted in a functional cluster. Given the abundance of metabolic gene clusters in fungi, our finding that one of the largest known metabolic gene clusters moved intact between species suggests that such transfers might have significantly contributed to fungal metabolic diversity. PAPERFLICK: Copyright © 2011 Elsevier Ltd. All rights reserved.

Effects of mutations at amino acid 61 in the arm of TF1 on its DNA-binding properties.

PubMed

Sayre, M H; Geiduschek, E P

1990-12-20

Transcription factor 1 (TF1) is the Bacillus subtilis phage SPO1-encoded member of the family of bacterial DNA-binding proteins that includes Escherichia coli HU and integration host factor (IHF). We have initiated a mutational analysis of the TF1 molecule to understand better its unique DNA-binding properties and to investigate its physiological function. We report here the consequences of mutating the putative DNA-binding "arms" of TF1. At position 61 in its primary sequence, TF1 contains a Phe residue in place of the Arg residue found in all other known members of the HU family. Substituting polar, uncharged residues for Phe61 substantially reduced the DNA-binding affinity and site-selectivity of TF1 in vitro, whereas the substitution of Tyr had no effect. Substituting Trp or Arg for Phe61 had little effect on the affinity of TF1 for SPO1 DNA, but altered the electrophoretic mobilities of protein-DNA complexes in non-denaturing gels. The Arg61 substitution increased the affinity of the protein for non-specific sites on thymine-containing DNA, thus reducing the natural preference of TF1 for (5-hydroxymethyluracil)-containing DNA. The Phe61-to-Arg mutation was also correlated with decreased phage yield and aberrant regulation of viral protein synthesis in vivo.

Novel antibody binding determinants on the capsid surface of serotype O foot-and-mouth disease virus

PubMed Central

Asfor, Amin S.; Upadhyaya, Sasmita; Knowles, Nick J.; King, Donald P.; Paton, David J.

2014-01-01

Five neutralizing antigenic sites have been described for serotype O foot-and-mouth disease viruses (FMDV) based on monoclonal antibody (mAb) escape mutant studies. However, a mutant virus selected to escape neutralization of mAb binding at all five sites was previously shown to confer complete cross-protection with the parental virus in guinea pig challenge studies, suggesting that amino acid residues outside the mAb binding sites contribute to antibody-mediated in vivo neutralization of FMDV. Comparison of the ability of bovine antisera to neutralize a panel of serotype O FMDV identified three novel putative sites at VP2-74, VP2-191 and VP3-85, where amino acid substitutions correlated with changes in sero-reactivity. The impact of these positions was tested using site-directed mutagenesis to effect substitutions at critical amino acid residues within an infectious copy of FMDV O1 Kaufbeuren (O1K). Recovered viruses containing additional mutations at VP2-74 and VP2-191 exhibited greater resistance to neutralization with both O1K guinea pig and O BFS bovine antisera than a virus that was engineered to include only mutations at the five known antigenic sites. The changes at VP2-74 and VP3-85 are adjacent to critical amino acids that define antigenic sites 2 and 4, respectively. However VP2-191 (17 Å away from VP2-72), located at the threefold axis and more distant from previously identified antigenic sites, exhibited the most profound effect. These findings extend our knowledge of the surface features of the FMDV capsid known to elicit neutralizing antibodies, and will improve our strategies for vaccine strain selection and rational vaccine design. PMID:24584474