Transcription activation mediated by a cyclic AMP receptor protein from Thermus thermophilus HB8.
Shinkai, Akeo; Kira, Satoshi; Nakagawa, Noriko; Kashihara, Aiko; Kuramitsu, Seiki; Yokoyama, Shigeyuki
2007-05-01
The extremely thermophilic bacterium Thermus thermophilus HB8, which belongs to the phylum Deinococcus-Thermus, has an open reading frame encoding a protein belonging to the cyclic AMP (cAMP) receptor protein (CRP) family present in many bacteria. The protein named T. thermophilus CRP is highly homologous to the CRP family proteins from the phyla Firmicutes, Actinobacteria, and Cyanobacteria, and it forms a homodimer and interacts with cAMP. CRP mRNA and intracellular cAMP were detected in this strain, which did not drastically fluctuate during cultivation in a rich medium. The expression of several genes was altered upon disruption of the T. thermophilus CRP gene. We found six CRP-cAMP-dependent promoters in in vitro transcription assays involving DNA fragments containing the upstream regions of the genes exhibiting decreased expression in the CRP disruptant, indicating that the CRP is a transcriptional activator. The consensus T. thermophilus CRP-binding site predicted upon nucleotide sequence alignment is 5'-(C/T)NNG(G/T)(G/T)C(A/C)N(A/T)NNTCACAN(G/C)(G/C)-3'. This sequence is unique compared with the known consensus binding sequences of CRP family proteins. A putative -10 hexamer sequence resides at 18 to 19 bp downstream of the predicted T. thermophilus CRP-binding site. The CRP-regulated genes found in this study comprise clustered regularly interspaced short palindromic repeat (CRISPR)-associated (cas) ones, and the genes of a putative transcriptional regulator, a protein containing the exonuclease III-like domain of DNA polymerase, a GCN5-related acetyltransferase homolog, and T. thermophilus-specific proteins of unknown function. These results suggest a role for cAMP signal transduction in T. thermophilus and imply the T. thermophilus CRP is a cAMP-responsive regulator.
Stapleton, Melanie; Haq, Ihtshamul; Hunt, Debbie M.; Arnvig, Kristine B.; Artymiuk, Peter J.; Buxton, Roger S.; Green, Jeffrey
2010-01-01
The pathogen Mycobacterium tuberculosis produces a burst of cAMP upon infection of macrophages. Bacterial cyclic AMP receptor proteins (CRP) are transcription factors that respond to cAMP by binding at target promoters when cAMP concentrations increase. Rv3676 (CRPMt) is a CRP family protein that regulates expression of genes (rpfA and whiB1) that are potentially involved in M. tuberculosis persistence and/or emergence from the dormant state. Here, the CRPMt homodimer is shown to bind two molecules of cAMP (one per protomer) at noninteracting sites. Furthermore, cAMP binding by CRPMt was relatively weak, entropy driven, and resulted in a relatively small enhancement in DNA binding. Tandem CRPMt-binding sites (CRP1 at −58.5 and CRP2 at −37.5) were identified at the whiB1 promoter (PwhiB1). In vitro transcription reactions showed that CRP1 is an activating site and that CRP2, which was only occupied in the presence of cAMP or at high CRPMt concentrations in the absence of cAMP, is a repressing site. Binding of CRPMt to CRP1 was not essential for open complex formation but was required for transcription activation. Thus, these data suggest that binding of CRPMt to the PwhiB1 CRP1 site activates transcription at a step after open complex formation. In contrast, high cAMP concentrations allowed occupation of both CRP1 and CRP2 sites, resulting in inhibition of open complex formation. Thus, M. tuberculosis CRP has evolved several distinct characteristics, compared with the Escherichia coli CRP paradigm, to allow it to regulate gene expression against a background of high concentrations of cAMP. PMID:20028978
Binding of the cyclic AMP receptor protein of Escherichia coli to RNA polymerase.
Pinkney, M; Hoggett, J G
1988-01-01
Fluorescence polarization studies were used to study the interaction of a fluorescein-labelled conjugate of the Escherichia coli cyclic AMP receptor protein (F-CRP) and RNA polymerase. Under conditions of physiological ionic strength, F-CRP binds to RNA polymerase holoenzyme in a cyclic AMP-dependent manner; the dissociation constant was about 3 microM in the presence of cyclic AMP and about 100 microM in its absence. Binding to core RNA polymerase under the same conditions was weak (Kdiss. approx. 80-100 microM) and independent of cyclic AMP. Competition experiments established that native CRP and F-CRP compete for the same binding site on RNA polymerase holoenzyme and that the native protein binds about 3 times more strongly than does F-CRP. Analytical ultracentrifuge studies showed that CRP binds predominantly to the monomeric rather than the dimeric form of RNA polymerase. PMID:2839152
Binding of the cyclic AMP receptor protein of Escherichia coli to RNA polymerase.
Pinkney, M; Hoggett, J G
1988-03-15
Fluorescence polarization studies were used to study the interaction of a fluorescein-labelled conjugate of the Escherichia coli cyclic AMP receptor protein (F-CRP) and RNA polymerase. Under conditions of physiological ionic strength, F-CRP binds to RNA polymerase holoenzyme in a cyclic AMP-dependent manner; the dissociation constant was about 3 microM in the presence of cyclic AMP and about 100 microM in its absence. Binding to core RNA polymerase under the same conditions was weak (Kdiss. approx. 80-100 microM) and independent of cyclic AMP. Competition experiments established that native CRP and F-CRP compete for the same binding site on RNA polymerase holoenzyme and that the native protein binds about 3 times more strongly than does F-CRP. Analytical ultracentrifuge studies showed that CRP binds predominantly to the monomeric rather than the dimeric form of RNA polymerase.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Ren, Y.L.; Garges, S.; Adhya, S.
1988-06-01
Four cAMP-independent receptor protein mutants (designated CRP* mutants) isolated previously are able to activate in vivo gene transcription in the absence of cAMP and their activity can be enhanced by cAMP or cGMP. One of the four mutant proteins, CRP*598 (Arg-142 to His, Ala-144 to Thr), has been characterized with regard to its conformational properties and ability to bind to and support abortive initiation from the lac promoter. Binding of wild-type CRP to its site on the lac promoter and activation of abortive initiation by RNA polymerase on this promoter are effected by cAMP but not by cGMP. CRP*598 canmore » activate lacP{sup +}-directed abortive initiation in the presence of cAMP and less efficiently in the presence of cGMP or in the absence of cyclic nucleotide. DNase I protection (footprinting) indicates that cAMP-CRP* binds to its site on the lac promoter whereas unliganded CRP* and cGMP-CRP* form a stable complex with the ({sup 32}P)lacP{sup +} fragment only in the presence of RNA polymerase, showing cooperative binding of two heterologous proteins. This cooperative binding provides strong evidence for a contact between CRP and RNA polymerase for activation of transcription. Although cGMP binds to CRP, it cannot replace cAMP in effecting the requisite conformational transition necessary for site-specific promoter binding.« less
Zhan, Lingjun; Han, Yanping; Yang, Lei; Geng, Jing; Li, Yingli; Gao, He; Guo, Zhaobiao; Fan, Wei; Li, Gang; Zhang, Lianfeng; Qin, Chuan; Zhou, Dongsheng; Yang, Ruifu
2008-11-01
The cyclic AMP receptor protein (CRP) is a bacterial regulator that controls more than 100 promoters, including those involved in catabolite repression. In the present study, a null deletion of the crp gene was constructed for Yersinia pestis bv. microtus strain 201. Microarray expression analysis disclosed that at least 6% of Y. pestis genes were affected by this mutation. Further reverse transcription-PCR and electrophoretic mobility shift assay analyses disclosed a set of 37 genes or putative operons to be the direct targets of CRP, and thus they constitute the minimal CRP regulon in Y. pestis. Subsequent primer extension and DNase I footprinting assays mapped transcriptional start sites, core promoter elements, and CRP binding sites within the DNA regions upstream of pla and pst, revealing positive and direct control of these two laterally acquired plasmid genes by CRP. The crp disruption affected both in vitro and in vivo growth of the mutant and led to a >15,000-fold loss of virulence after subcutaneous infection but a <40-fold increase in the 50% lethal dose by intravenous inoculation. Therefore, CRP is required for the virulence of Y. pestis and, particularly, is more important for infection by subcutaneous inoculation. It can further be concluded that the reduced in vivo growth phenotype of the crp mutant should contribute, at least partially, to its attenuation of virulence by both routes of infection. Consistent with a previous study of Y. pestis bv. medievalis, lacZ reporter fusion analysis indicated that the crp deletion resulted in the almost absolute loss of pla promoter activity. The plasminogen activator encoded by pla was previously shown to specifically promote Y. pestis dissemination from peripheral infection routes (subcutaneous infection [flea bite] or inhalation). The above evidence supports the notion that in addition to the reduced in vivo growth phenotype, the defect of pla expression in the crp mutant will greatly contribute to the huge loss of virulence of this mutant strain in subcutaneous infection.
Stella, Nicholas A; Lahr, Roni M; Brothers, Kimberly M; Kalivoda, Eric J; Hunt, Kristin M; Kwak, Daniel H; Liu, Xinyu; Shanks, Robert M Q
2015-08-01
Serratia marcescens generates secondary metabolites and secreted enzymes, and it causes hospital infections and community-acquired ocular infections. Previous studies identified cyclic AMP (cAMP) receptor protein (CRP) as an indirect inhibitor of antimicrobial secondary metabolites. Here, we identified a putative two-component regulator that suppressed crp mutant phenotypes. Evidence supports that the putative response regulator eepR was directly transcriptionally inhibited by cAMP-CRP. EepR and the putative sensor kinase EepS were necessary for the biosynthesis of secondary metabolites, including prodigiosin- and serratamolide-dependent phenotypes, swarming motility, and hemolysis. Recombinant EepR bound to the prodigiosin and serratamolide promoters in vitro. Together, these data introduce a novel regulator of secondary metabolites that directly connects the broadly conserved metabolism regulator CRP with biosynthetic genes that may contribute to competition with other microbes. This study identifies a new transcription factor that is directly controlled by a broadly conserved transcription factor, CRP. CRP is well studied in its role to help bacteria respond to the amount of nutrients in their environment. The new transcription factor EepR is essential for the bacterium Serratia marcescens to produce two biologically active compounds, prodigiosin and serratamolide. These two compounds are antimicrobial and may allow S. marcescens to compete for limited nutrients with other microorganisms. Results from this study tie together the CRP environmental nutrient sensor with a new regulator of antimicrobial compounds. Beyond microbial ecology, prodigiosin and serratamolide have therapeutic potential; therefore, understanding their regulation is important for both applied and basic science. Copyright © 2015, American Society for Microbiology. All Rights Reserved.
C-reactive protein specifically binds to Fcgamma receptor type I on a macrophage-like cell line.
Tron, Kyrylo; Manolov, Dimitar E; Röcker, Carlheinz; Kächele, Martin; Torzewski, Jan; Nienhaus, G Ulrich
2008-05-01
C-reactive protein (CRP) is a prototype acute-phase protein that may be intimately involved in human disease. Its cellular receptors are still under debate; the main candidates are FcR for immunoglobulin G, as CRP was shown to bind specifically to FcgammaRI and FcgammaRIIa. Using ultrasensitive confocal live-cell imaging, we have studied CRP binding to FcgammaR naturally expressed in the plasma membranes of cells from a human leukemia cell line (Mono Mac 6). These macrophage-like cells express high levels of FcgammaRI and FcgammaRII. They were shown to bind fluorescently labeled CRP with micromolar affinity, KD = (6.6 +/- 1.5) microM. CRP binding could be inhibited by pre-incubation with human but not mouse IgG and was thus FcgammaR-specific. Blocking of FcgammaRI by an FcgammaRI-specific antibody abolished CRP binding essentially completely, whereas application of antibodies against FcgammaRII did not have a noticeable effect. In fluorescence images of Mono Mac 6 cells, the intensity patterns of bound CRP were correlated with those of FcgammaRI, but not FcgammaRII. These results provide clear evidence of specific interactions between CRP and FcgammaR (predominantly FcgammaRI) naturally expressed on macrophage-like cells.
Hufnagel, David A; Evans, Margery L; Greene, Sarah E; Pinkner, Jerome S; Hultgren, Scott J; Chapman, Matthew R
2016-12-15
The extracellular matrix protects Escherichia coli from immune cells, oxidative stress, predation, and other environmental stresses. Production of the E. coli extracellular matrix is regulated by transcription factors that are tuned to environmental conditions. The biofilm master regulator protein CsgD upregulates curli and cellulose, the two major polymers in the extracellular matrix of uropathogenic E. coli (UPEC) biofilms. We found that cyclic AMP (cAMP) regulates curli, cellulose, and UPEC biofilms through csgD The alarmone cAMP is produced by adenylate cyclase (CyaA), and deletion of cyaA resulted in reduced extracellular matrix production and biofilm formation. The catabolite repressor protein (CRP) positively regulated csgD transcription, leading to curli and cellulose production in the UPEC isolate, UTI89. Glucose, a known inhibitor of CyaA activity, blocked extracellular matrix formation when added to the growth medium. The mutant strains ΔcyaA and Δcrp did not produce rugose biofilms, pellicles, curli, cellulose, or CsgD. Three putative CRP binding sites were identified within the csgD-csgB intergenic region, and purified CRP could gel shift the csgD-csgB intergenic region. Additionally, we found that CRP binded upstream of kpsMT, which encodes machinery for K1 capsule production. Together our work shows that cAMP and CRP influence E. coli biofilms through transcriptional regulation of csgD IMPORTANCE The catabolite repressor protein (CRP)-cyclic AMP (cAMP) complex influences the transcription of ∼7% of genes on the Escherichia coli chromosome (D. Zheng, C. Constantinidou, J. L. Hobman, and S. D. Minchin, Nucleic Acids Res 32:5874-5893, 2004, https://dx.doi.org/10.1093/nar/gkh908). Glucose inhibits E. coli biofilm formation, and ΔcyaA and Δcrp mutants show impaired biofilm formation (D. W. Jackson, J.W. Simecka, and T. Romeo, J Bacteriol 184:3406-3410, 2002, https://dx.doi.org/10.1128/JB.184.12.3406-3410.2002). We determined that the cAMP-CRP complex regulates curli and cellulose production and the formation of rugose and pellicle biofilms through csgD Additionally, we propose that cAMP may work as a signaling compound for uropathogenic E. coli (UPEC) to transition from the bladder lumen to inside epithelial cells for intracellular bacterial community formation through K1 capsule regulation. Copyright © 2016, American Society for Microbiology. All Rights Reserved.
The cAMP receptor protein CRP can function as an osmoregulator of transcription in Escherichia coli.
Landis, L; Xu, J; Johnson, R C
1999-12-01
Transcription of the P1 promoter of the Escherichia coli proP gene, which encodes a transporter of osmoprotectants, is strongly induced by a shift to hyperosmotic media. Unlike most other osmotically regulated promoters, the induction occurs for a brief period of time, corresponding to the replacement of intracellular K(+) glutamate with osmoprotecting compounds. This burst of proP transcription is correlated with the osmolarity-dependent binding of the cAMP receptor protein CRP to a site within the proP P1 promoter. We show that CRP-cAMP functions as an osmotically sensitive repressor of proP P1 transcription in vitro. Binding of CRP to the proP promoter in vivo is transiently destabilized after a hyperosmotic shift with kinetics that correspond to the derepression of transcription, whereas Fis and Lac repressor binding is not osmotically sensitive. Similar osmotic regulation of proP P1 transcription by the CRP* mutant implies that binding of cAMP is not responsible for the unusual osmotic sensitivity of CRP activity. Osmotic regulation of CRP activity is not limited to proP. Activation of the lac promoter by CRP is also transiently inhibited after an osmotic upshift, as is the binding of CRP to the galdelta4P1 promoter. These findings suggest that CRP functions in certain contexts to regulate gene expression in response to osmotic changes, in addition to its role in catabolite control.
The cAMP receptor protein CRP can function as an osmoregulator of transcription in Escherichia coli
Landis, Lenore; Xu, Jimin; Johnson, Reid C.
1999-01-01
Transcription of the P1 promoter of the Escherichia coli proP gene, which encodes a transporter of osmoprotectants, is strongly induced by a shift to hyperosmotic media. Unlike most other osmotically regulated promoters, the induction occurs for a brief period of time, corresponding to the replacement of intracellular K+ glutamate with osmoprotecting compounds. This burst of proP transcription is correlated with the osmolarity-dependent binding of the cAMP receptor protein CRP to a site within the proP P1 promoter. We show that CRP–cAMP functions as an osmotically sensitive repressor of proP P1 transcription in vitro. Binding of CRP to the proP promoter in vivo is transiently destabilized after a hyperosmotic shift with kinetics that correspond to the derepression of transcription, whereas Fis and Lac repressor binding is not osmotically sensitive. Similar osmotic regulation of proP P1 transcription by the CRP* mutant implies that binding of cAMP is not responsible for the unusual osmotic sensitivity of CRP activity. Osmotic regulation of CRP activity is not limited to proP. Activation of the lac promoter by CRP is also transiently inhibited after an osmotic upshift, as is the binding of CRP to the galΔ4 P1 promoter. These findings suggest that CRP functions in certain contexts to regulate gene expression in response to osmotic changes, in addition to its role in catabolite control. PMID:10601034
Brierley, I; Hoggett, J G
1992-07-01
The binding of the Escherichia coli cyclic AMP receptor protein (CRP) to its specific site on the P4 promoter of pBR322 has been studied by gel electrophoresis. Binding to the P4 site was about 40-50-fold weaker than to the principal CRP site on the lactose promoter at both low (0.01 M) and high (0.1 M) ionic strengths. CRP-induced bending at the P4 site was investigated from the mobilities of CRP bound to circularly permuted P4 fragments. The estimated bending angle, based on comparison with Zinkel & Crothers [(1990) Biopolymers 29, 29-38] A-tract bending standards, was found to be approximately 96 degrees, similar to that found for binding to the lac site. These observations suggest that there is not a simple relationship between strength of CRP binding and the extent of induced bending for different CRP sites. The apparent centre of bending in P4 is displaced about 6-8 bp away from the conserved TGTGA sequence and the P4 transcription start site.
Brierley, I; Hoggett, J G
1992-01-01
The binding of the Escherichia coli cyclic AMP receptor protein (CRP) to its specific site on the P4 promoter of pBR322 has been studied by gel electrophoresis. Binding to the P4 site was about 40-50-fold weaker than to the principal CRP site on the lactose promoter at both low (0.01 M) and high (0.1 M) ionic strengths. CRP-induced bending at the P4 site was investigated from the mobilities of CRP bound to circularly permuted P4 fragments. The estimated bending angle, based on comparison with Zinkel & Crothers [(1990) Biopolymers 29, 29-38] A-tract bending standards, was found to be approximately 96 degrees, similar to that found for binding to the lac site. These observations suggest that there is not a simple relationship between strength of CRP binding and the extent of induced bending for different CRP sites. The apparent centre of bending in P4 is displaced about 6-8 bp away from the conserved TGTGA sequence and the P4 transcription start site. Images Fig. 1. Fig. 3. Fig. 4. PMID:1322129
Theoretical Analysis of Allosteric and Operator Binding for Cyclic-AMP Receptor Protein Mutants
NASA Astrophysics Data System (ADS)
Einav, Tal; Duque, Julia; Phillips, Rob
2018-02-01
Allosteric transcription factors undergo binding events both at their inducer binding sites as well as at distinct DNA binding domains, and it is often difficult to disentangle the structural and functional consequences of these two classes of interactions. In this work, we compare the ability of two statistical mechanical models - the Monod-Wyman-Changeux (MWC) and the Koshland-N\\'emethy-Filmer (KNF) models of protein conformational change - to characterize the multi-step activation mechanism of the broadly acting cyclic-AMP receptor protein (CRP). We first consider the allosteric transition resulting from cyclic-AMP binding to CRP, then analyze how CRP binds to its operator, and finally investigate the ability of CRP to activate gene expression. In light of these models, we examine data from a beautiful recent experiment that created a single-chain version of the CRP homodimer, thereby enabling each subunit to be mutated separately. Using this construct, six mutants were created using all possible combinations of the wild type subunit, a D53H mutant subunit, and an S62F mutant subunit. We demonstrate that both the MWC and KNF models can explain the behavior of all six mutants using a small, self-consistent set of parameters. In comparing the results, we find that the MWC model slightly outperforms the KNF model in the quality of its fits, but more importantly the parameters inferred by the MWC model are more in line with structural knowledge of CRP. In addition, we discuss how the conceptual framework developed here for CRP enables us to not merely analyze data retrospectively, but has the predictive power to determine how combinations of mutations will interact, how double mutants will behave, and how each construct would regulate gene expression.
Affinity of C-Reactive Protein toward FcγRI Is Strongly Enhanced by the γ-Chain
Röcker, Carlheinz; Manolov, Dimitar E.; Kuzmenkina, Elza V.; Tron, Kyrylo; Slatosch, Holger; Torzewski, Jan; Nienhaus, G. Ulrich
2007-01-01
C-reactive protein (CRP), the prototype human acute phase protein, is widely regarded as a key player in cardiovascular disease, but the identity of its cellular receptor is still under debate. By using ultrasensitive confocal imaging analysis, we have studied CRP binding to transfected COS-7 cells expressing the high-affinity IgG receptor FcγRI. Here we show that CRP binds to FcγRI on intact cells, with a kd of 10 ± 3 μmol/L. Transfection of COS-7 cells with a plasmid coding for both FcγRI and its functional counterpart, the γ-chain, markedly increases CRP affinity to FcγRI, resulting in a kd of 0.35 ± 0.10 μmol/L. The affinity increase results from an ∼30-fold enhanced association rate coefficient. The pronounced enhancement of affinity by the γ-chain suggests its crucial involvement in the CRP receptor interaction, possibly by mediating interactions between the transmembrane moieties of the receptors. Dissociation of CRP from the cell surfaces cannot be detected throughout the time course of several hours and is thus extremely slow. Considering the pentameric structure of CRP, this result indicates that multivalent binding and receptor clustering are crucially involved in the interaction of CRP with nucleated cells. PMID:17255341
Targeting C-reactive protein for the treatment of cardiovascular disease
NASA Astrophysics Data System (ADS)
Pepys, Mark B.; Hirschfield, Gideon M.; Tennent, Glenys A.; Ruth Gallimore, J.; Kahan, Melvyn C.; Bellotti, Vittorio; Hawkins, Philip N.; Myers, Rebecca M.; Smith, Martin D.; Polara, Alessandra; Cobb, Alexander J. A.; Ley, Steven V.; Andrew Aquilina, J.; Robinson, Carol V.; Sharif, Isam; Gray, Gillian A.; Sabin, Caroline A.; Jenvey, Michelle C.; Kolstoe, Simon E.; Thompson, Darren; Wood, Stephen P.
2006-04-01
Complement-mediated inflammation exacerbates the tissue injury of ischaemic necrosis in heart attacks and strokes, the most common causes of death in developed countries. Large infarct size increases immediate morbidity and mortality and, in survivors of the acute event, larger non-functional scars adversely affect long-term prognosis. There is thus an important unmet medical need for new cardioprotective and neuroprotective treatments. We have previously shown that human C-reactive protein (CRP), the classical acute-phase protein that binds to ligands exposed in damaged tissue and then activates complement, increases myocardial and cerebral infarct size in rats subjected to coronary or cerebral artery ligation, respectively. Rat CRP does not activate rat complement, whereas human CRP activates both rat and human complement. Administration of human CRP to rats is thus an excellent model for the actions of endogenous human CRP. Here we report the design, synthesis and efficacy of 1,6-bis(phosphocholine)-hexane as a specific small-molecule inhibitor of CRP. Five molecules of this palindromic compound are bound by two pentameric CRP molecules, crosslinking and occluding the ligand-binding B-face of CRP and blocking its functions. Administration of 1,6-bis(phosphocholine)-hexane to rats undergoing acute myocardial infarction abrogated the increase in infarct size and cardiac dysfunction produced by injection of human CRP. Therapeutic inhibition of CRP is thus a promising new approach to cardioprotection in acute myocardial infarction, and may also provide neuroprotection in stroke. Potential wider applications include other inflammatory, infective and tissue-damaging conditions characterized by increased CRP production, in which binding of CRP to exposed ligands in damaged cells may lead to complement-mediated exacerbation of tissue injury.
Feuerbacher, Leigh A.; Burgum, Alex; Kolodrubetz, David
2011-01-01
The cyclic-AMP receptor protein (CRP) acts as a global regulatory protein among bacteria. Here, the CRP regulon has been defined in Aggregatibacter actinomycetemcomitans using microarray analysis of A. actinomycetemcomitans strain JP2 wild type cells compared to an isogenic crp deletion mutant. Genes whose expression levels changed at least 2-fold with p ≤ 0.05 were considered significant. Of the 300 genes identified as being CRP-regulated, 139 were CRP-activated, including leukotoxin, with the remaining being CRP-repressed. The 300 genes represent 14.2% of ORFs probed which is significantly higher than what has been reported for CRP regulons in other bacteria. If the CRP-regulated genes are put into 17 functional classes, all 17 categories had at least 1 CRP-regulated gene. Several functional categories, mainly transport and binding proteins and energy metabolism proteins, were disproportionately represented in the CRP-regulated subset of genes relative to their overall representation in the genome. This is similar to the patterns seen in other bacteria. Finally, quantitative RT-PCR was used to show that the leukotoxin RNA levels were repressed 16-fold in the CRP mutant indicating that CRP activates leukotoxin transcription. However, this regulation appears to be acting through another regulatory protein since the leukotoxin promoter, unlike ~129 other promoters of CRP-regulated genes, does not have a match to the consensus CRP binding site. Several candidate genes for this intermediary transcription factor have been identified in the CRP-regulon. PMID:21575705
Kumaresan, Pappanaicken R; Devaraj, Sridevi; Huang, Wenzhe; Lau, Edmond Y; Liu, Ruiwu; Lam, Kit S; Jialal, Ishwarlal
2013-06-01
Numerous studies have shown that high C-reactive protein (CRP) levels predict cardiovascular disease and augur a poor prognosis in patients with acute coronary syndromes. Much in vitro and in vivo data support of a role for CRP in atherogenesis. There is an urgent need to develop inhibitors that specifically block the biological effects of CRP in vivo. The one-bead-one-compound (OBOC) combinatorial library method has been used to discover ligands against several biological targets. In this study, we use a novel fluorescence-based screening method to screen an OBOC combinatorial library for the discovery of peptides against human CRP. Human CRP was labeled with fluorescein isothiocyanate (FITC) and human serum albumin (HuSA) was labeled with phycoerythrin (PE) and used for screening. The OBOC library LWH-01 was synthesized on TentaGel resin beads using a standard solid-phase "split/mix" approach. By subtraction screening, eight peptides that bind specifically to CRP and not to HuSA were identified. In human aortic endothelial cells (HAECs) incubated with CRP, inhibitors CRPi-2, CRPi-3, and CRPi-6 significantly inhibited CRP-induced superoxide, cytokine release, and nuclear factor-κB (NFκB) activity. Molecular docking studies demonstrate that CRPi-2 interacts with the two Ca(2+) ions in the single subunit of CRP. The binding of CRPi-2 is reminiscent of choline binding. Future studies will examine the utility of this inhibitor in animal models and clinical trials.
Lloyd, G S; Busby, S J; Savery, N J
1998-01-01
During transcription initiation at bacterial promoters, the C-terminal domain of the RNA polymerase alpha subunit (alphaCTD) can interact with DNA-sequence elements (known as UP elements) and with activator proteins. We have constructed a series of semi-synthetic promoters carrying both an UP element and a consensus DNA-binding site for the Escherichia coli cAMP receptor protein (CRP; a factor that activates transcription by making direct contacts with alphaCTD). At these promoters, the UP element was located at a variety of distances upstream of the CRP-binding site, which was fixed at position -41.5 bp upstream of the transcript start. At some positions, the UP element caused enhanced promoter activity whereas, at other positions, it had very little effect. In no case was the CRP-dependence of the promoter relieved. DNase I and hydroxyl-radical footprinting were used to study ternary RNA polymerase-CRP-promoter complexes formed at two of the most active of these promoters, and co-operativity between the binding of CRP and purified alpha subunits was studied. The footprints show that alphaCTD binds to the UP element as it is displaced upstream but that this displacement does not prevent alphaCTD from being contacted by CRP. Models to account for this are discussed. PMID:9461538
Ranganathan, Sridevi; Cheung, Jonah; Cassidy, Michael; Ginter, Christopher; Pata, Janice D; McDonough, Kathleen A
2018-01-09
Mycobacterium tuberculosis (Mtb) encodes two CRP/FNR family transcription factors (TF) that contribute to virulence, Cmr (Rv1675c) and CRPMt (Rv3676). Prior studies identified distinct chromosomal binding profiles for each TF despite their recognizing overlapping DNA motifs. The present study shows that Cmr binding specificity is determined by discriminator nucleotides at motif positions 4 and 13. X-ray crystallography and targeted mutational analyses identified an arginine-rich loop that expands Cmr's DNA interactions beyond the classical helix-turn-helix contacts common to all CRP/FNR family members and facilitates binding to imperfect DNA sequences. Cmr binding to DNA results in a pronounced asymmetric bending of the DNA and its high level of cooperativity is consistent with DNA-facilitated dimerization. A unique N-terminal extension inserts between the DNA binding and dimerization domains, partially occluding the site where the canonical cAMP binding pocket is found. However, an unstructured region of this N-terminus may help modulate Cmr activity in response to cellular signals. Cmr's multiple levels of DNA interaction likely enhance its ability to integrate diverse gene regulatory signals, while its novel structural features establish Cmr as an atypical CRP/FNR family member. © The Author(s) 2017. Published by Oxford University Press on behalf of Nucleic Acids Research.
A new regulatory mechanism for bacterial lipoic acid synthesis
Zhang, Huimin; Luo, Qixia; Gao, Haichun; Feng, Youjun
2015-01-01
Lipoic acid, an essential enzyme cofactor, is required in three domains of life. In the past 60 years since its discovery, most of the pathway for lipoic acid synthesis and metabolism has been elucidated. However, genetic control of lipoic acid synthesis remains unclear. Here, we report integrative evidence that bacterial cAMP-dependent signaling is linked to lipoic acid synthesis in Shewanella species, the certain of unique marine-borne bacteria with special ability of metal reduction. Physiological requirement of protein lipoylation in γ-proteobacteria including Shewanella oneidensis was detected using Western blotting with rabbit anti-lipoyl protein primary antibody. The two genes (lipB and lipA) encoding lipoic acid synthesis pathway were proved to be organized into an operon lipBA in Shewanella, and the promoter was mapped. Electrophoretic mobility shift assays confirmed that the putative CRP-recognizable site (AAGTGTGATCTATCTTACATTT) binds to cAMP-CRP protein with origins of both Escherichia coli and Shewanella. The native lipBA promoter of Shewanella was fused to a LacZ reporter gene to create a chromosome lipBA-lacZ transcriptional fusion in E. coli and S. oneidensis, allowing us to directly assay its expression level by β-galactosidase activity. As anticipated, the removal of E. coli crp gene gave above fourfold increment of lipBA promoter-driven β-gal expression. The similar scenario was confirmed by both the real-time quantitative PCR and the LacZ transcriptional fusion in the crp mutant of Shewanella. Furthermore, the glucose effect on the lipBA expression of Shewanella was evaluated in the alternative microorganism E. coli. As anticipated, an addition of glucose into media effectively induces the transcriptional level of Shewanella lipBA in that the lowered cAMP level relieves the repression of lipBA by cAMP-CRP complex. Therefore, our finding might represent a first paradigm mechanism for genetic control of bacterial lipoic acid synthesis. PMID:25611823
A new regulatory mechanism for bacterial lipoic acid synthesis.
Zhang, Huimin; Luo, Qixia; Gao, Haichun; Feng, Youjun
2015-01-22
Lipoic acid, an essential enzyme cofactor, is required in three domains of life. In the past 60 years since its discovery, most of the pathway for lipoic acid synthesis and metabolism has been elucidated. However, genetic control of lipoic acid synthesis remains unclear. Here, we report integrative evidence that bacterial cAMP-dependent signaling is linked to lipoic acid synthesis in Shewanella species, the certain of unique marine-borne bacteria with special ability of metal reduction. Physiological requirement of protein lipoylation in γ-proteobacteria including Shewanella oneidensis was detected using Western blotting with rabbit anti-lipoyl protein primary antibody. The two genes (lipB and lipA) encoding lipoic acid synthesis pathway were proved to be organized into an operon lipBA in Shewanella, and the promoter was mapped. Electrophoretic mobility shift assays confirmed that the putative CRP-recognizable site (AAGTGTGATCTATCTTACATTT) binds to cAMP-CRP protein with origins of both Escherichia coli and Shewanella. The native lipBA promoter of Shewanella was fused to a LacZ reporter gene to create a chromosome lipBA-lacZ transcriptional fusion in E. coli and S. oneidensis, allowing us to directly assay its expression level by β-galactosidase activity. As anticipated, the removal of E. coli crp gene gave above fourfold increment of lipBA promoter-driven β-gal expression. The similar scenario was confirmed by both the real-time quantitative PCR and the LacZ transcriptional fusion in the crp mutant of Shewanella. Furthermore, the glucose effect on the lipBA expression of Shewanella was evaluated in the alternative microorganism E. coli. As anticipated, an addition of glucose into media effectively induces the transcriptional level of Shewanella lipBA in that the lowered cAMP level relieves the repression of lipBA by cAMP-CRP complex. Therefore, our finding might represent a first paradigm mechanism for genetic control of bacterial lipoic acid synthesis. © 2015 The Authors. MicrobiologyOpen published by John Wiley & Sons Ltd.
Hicks, Matt N; Gunasekara, Sanjiva; Serate, Jose; Park, Jin; Mosharaf, Pegah; Zhou, Yue; Lee, Jin-Won; Youn, Hwan
2017-10-01
The Escherichia coli cAMP receptor protein (CRP) utilizes the helix-turn-helix motif for DNA binding. The CRP's recognition helix, termed F-helix, includes a stretch of six amino acids (Arg180, Glu181, Thr182, Val183, Gly184, and Arg185) for direct DNA contacts. Arg180, Glu181 and Arg185 are known as important residues for DNA binding and specificity, but little has been studied for the other residues. Here we show that Gly184 is another F-helix residue critical for the transcriptional activation function of CRP. First, glycine was repeatedly selected at CRP position 184 for its unique ability to provide wild type-level transcriptional activation activity. To dissect the glycine requirement, wild type CRP and mutants G184A, G184F, G184S, and G184Y were purified and their in vitro DNA-binding activity was measured. G184A and G184F displayed reduced DNA binding, which may explain their low transcriptional activation activity. However, G184S and G184Y displayed apparently normal DNA affinity. Therefore, an additional factor is needed to account for the diminished transcriptional activation function in G184S and G184Y, and the best explanation is perturbations in their interaction with RNA polymerase. The fact that glycine is the smallest amino acid could not fully warrant its suitability, as shown in this study. We hypothesize that Gly184 fulfills the dual functions of DNA binding and RNA polymerase interaction by conferring conformational flexibility to the F-helix.
Structure, Regulation, and Putative Function of the Arginine Deiminase System of Streptococcus suis
Gruening, Petra; Fulde, Marcus; Valentin-Weigand, Peter; Goethe, Ralph
2006-01-01
Streptococcus suis is an important cause of infectious diseases in young pigs. Little is known about the virulence factors or protective antigens of S. suis. Recently, we have identified two proteins of the arginine deiminase system (ADS) of S. suis, which were temperature induced and expressed on the streptococcal surface (N. Winterhoff, R. Goethe, P. Gruening, M. Rohde, H. Kalisz, H. E. Smith, and P. Valentin-Weigand, J. Bacteriol. 184:6768-6776, 2002). In the present study, we analyzed the complete ADS of S. suis. Due to their homologies to the recently published S. gordonii ADS genes, the genes for arginine deiminase, ornithine carbamoyl-transferase, and carbamate kinase, which were previously designated adiS, octS, and ckS, respectively, were renamed arcA, arcB, and arcC, respectively. Our data revealed that arcA, arcB, and arcC of the S. suis ADS are transcribed from an operon (arcABC operon). Additionally, putative ADS-associated genes were cloned and sequenced which, however, did not belong to the arcABC operon. These were the flpS gene upstream of the arcABC operon with homology to the flp transcription regulator of S. gordonii and the arcD, arcT, arcH, and argR genes downstream of the arcABC operon with high homologies to a putative arginine-ornithine antiporter, a putative dipeptidase of S. gordonii, a putative β-N-acetylhexosaminidase of S. pneumoniae, and a putative arginine repressor of S. gordonii, respectively. The transcriptional start point of the arcABC operon was determined, and promoter analysis provided evidence that multiple factors contribute to the regulation of the ADS. Thus, a putative binding site for a transcription regulator of the Crp/Fnr family, an ArgR-binding site, and two cis-acting catabolite response elements were identified in the promoter-operator region of the operon. Consistent with this, we could demonstrate that the ADS of S. suis is inducible by arginine and reduced O2 tension and subject to carbon catabolite repression. Furthermore, comparing an arcA knockout mutant in which expression of the three operon-encoded proteins was abolished with the parental wild-type strain showed that the arcABC operon of S. suis contributes to survival under acidic conditions. PMID:16385025
Structure, regulation, and putative function of the arginine deiminase system of Streptococcus suis.
Gruening, Petra; Fulde, Marcus; Valentin-Weigand, Peter; Goethe, Ralph
2006-01-01
Streptococcus suis is an important cause of infectious diseases in young pigs. Little is known about the virulence factors or protective antigens of S. suis. Recently, we have identified two proteins of the arginine deiminase system (ADS) of S. suis, which were temperature induced and expressed on the streptococcal surface (N. Winterhoff, R. Goethe, P. Gruening, M. Rohde, H. Kalisz, H. E. Smith, and P. Valentin-Weigand, J. Bacteriol. 184:6768-6776, 2002). In the present study, we analyzed the complete ADS of S. suis. Due to their homologies to the recently published S. gordonii ADS genes, the genes for arginine deiminase, ornithine carbamoyl-transferase, and carbamate kinase, which were previously designated adiS, octS, and ckS, respectively, were renamed arcA, arcB, and arcC, respectively. Our data revealed that arcA, arcB, and arcC of the S. suis ADS are transcribed from an operon (arcABC operon). Additionally, putative ADS-associated genes were cloned and sequenced which, however, did not belong to the arcABC operon. These were the flpS gene upstream of the arcABC operon with homology to the flp transcription regulator of S. gordonii and the arcD, arcT, arcH, and argR genes downstream of the arcABC operon with high homologies to a putative arginine-ornithine antiporter, a putative dipeptidase of S. gordonii, a putative beta-N-acetylhexosaminidase of S. pneumoniae, and a putative arginine repressor of S. gordonii, respectively. The transcriptional start point of the arcABC operon was determined, and promoter analysis provided evidence that multiple factors contribute to the regulation of the ADS. Thus, a putative binding site for a transcription regulator of the Crp/Fnr family, an ArgR-binding site, and two cis-acting catabolite response elements were identified in the promoter-operator region of the operon. Consistent with this, we could demonstrate that the ADS of S. suis is inducible by arginine and reduced O2 tension and subject to carbon catabolite repression. Furthermore, comparing an arcA knockout mutant in which expression of the three operon-encoded proteins was abolished with the parental wild-type strain showed that the arcABC operon of S. suis contributes to survival under acidic conditions.
Circuitry Linking the Catabolite Repression and Csr Global Regulatory Systems of Escherichia coli.
Pannuri, Archana; Vakulskas, Christopher A; Zere, Tesfalem; McGibbon, Louise C; Edwards, Adrianne N; Georgellis, Dimitris; Babitzke, Paul; Romeo, Tony
2016-11-01
Cyclic AMP (cAMP) and the cAMP receptor protein (cAMP-CRP) and CsrA are the principal regulators of the catabolite repression and carbon storage global regulatory systems, respectively. cAMP-CRP controls the transcription of genes for carbohydrate metabolism and other processes in response to carbon nutritional status, while CsrA binds to diverse mRNAs and regulates translation, RNA stability, and/or transcription elongation. CsrA also binds to the regulatory small RNAs (sRNAs) CsrB and CsrC, which antagonize its activity. The BarA-UvrY two-component signal transduction system (TCS) directly activates csrB and csrC (csrB/C) transcription, while CsrA does so indirectly. We show that cAMP-CRP inhibits csrB/C transcription without negatively regulating phosphorylated UvrY (P-UvrY) or CsrA levels. A crp deletion caused an elevation in CsrB/C levels in the stationary phase of growth and increased the expression of csrB-lacZ and csrC-lacZ transcriptional fusions, although modest stimulation of CsrB/C turnover by the crp deletion partially masked the former effects. DNase I footprinting and other studies demonstrated that cAMP-CRP bound specifically to three sites located upstream from the csrC promoter, two of which overlapped the P-UvrY binding site. These two proteins competed for binding at the overlapping sites. In vitro transcription-translation experiments confirmed direct repression of csrC-lacZ expression by cAMP-CRP. In contrast, cAMP-CRP effects on csrB transcription may be mediated indirectly, as it bound nonspecifically to csrB DNA. In the reciprocal direction, CsrA bound to crp mRNA with high affinity and specificity and yet exhibited only modest, conditional effects on expression. Our findings are incorporated into an emerging model for the response of Csr circuitry to carbon nutritional status. Csr (Rsm) noncoding small RNAs (sRNAs) CsrB and CsrC of Escherichia coli use molecular mimicry to sequester the RNA binding protein CsrA (RsmA) away from lower-affinity mRNA targets, thus eliciting major shifts in the bacterial lifestyle. CsrB/C transcription and turnover are activated by carbon metabolism products (e.g., formate and acetate) and by a preferred carbon source (glucose), respectively. We show that cAMP-CRP, a mediator of classical catabolite repression, inhibits csrC transcription by binding to the upstream region of this gene and also inhibits csrB transcription, apparently indirectly. We propose that glucose availability activates pathways for both synthesis and turnover of CsrB/C, thus shaping the dynamics of global signaling in response to the nutritional environment by poising CsrB/C sRNA levels for rapid response. Copyright © 2016, American Society for Microbiology. All Rights Reserved.
Circuitry Linking the Catabolite Repression and Csr Global Regulatory Systems of Escherichia coli
Pannuri, Archana; Vakulskas, Christopher A.; Zere, Tesfalem; McGibbon, Louise C.; Edwards, Adrianne N.; Georgellis, Dimitris; Babitzke, Paul
2016-01-01
ABSTRACT Cyclic AMP (cAMP) and the cAMP receptor protein (cAMP-CRP) and CsrA are the principal regulators of the catabolite repression and carbon storage global regulatory systems, respectively. cAMP-CRP controls the transcription of genes for carbohydrate metabolism and other processes in response to carbon nutritional status, while CsrA binds to diverse mRNAs and regulates translation, RNA stability, and/or transcription elongation. CsrA also binds to the regulatory small RNAs (sRNAs) CsrB and CsrC, which antagonize its activity. The BarA-UvrY two-component signal transduction system (TCS) directly activates csrB and csrC (csrB/C) transcription, while CsrA does so indirectly. We show that cAMP-CRP inhibits csrB/C transcription without negatively regulating phosphorylated UvrY (P-UvrY) or CsrA levels. A crp deletion caused an elevation in CsrB/C levels in the stationary phase of growth and increased the expression of csrB-lacZ and csrC-lacZ transcriptional fusions, although modest stimulation of CsrB/C turnover by the crp deletion partially masked the former effects. DNase I footprinting and other studies demonstrated that cAMP-CRP bound specifically to three sites located upstream from the csrC promoter, two of which overlapped the P-UvrY binding site. These two proteins competed for binding at the overlapping sites. In vitro transcription-translation experiments confirmed direct repression of csrC-lacZ expression by cAMP-CRP. In contrast, cAMP-CRP effects on csrB transcription may be mediated indirectly, as it bound nonspecifically to csrB DNA. In the reciprocal direction, CsrA bound to crp mRNA with high affinity and specificity and yet exhibited only modest, conditional effects on expression. Our findings are incorporated into an emerging model for the response of Csr circuitry to carbon nutritional status. IMPORTANCE Csr (Rsm) noncoding small RNAs (sRNAs) CsrB and CsrC of Escherichia coli use molecular mimicry to sequester the RNA binding protein CsrA (RsmA) away from lower-affinity mRNA targets, thus eliciting major shifts in the bacterial lifestyle. CsrB/C transcription and turnover are activated by carbon metabolism products (e.g., formate and acetate) and by a preferred carbon source (glucose), respectively. We show that cAMP-CRP, a mediator of classical catabolite repression, inhibits csrC transcription by binding to the upstream region of this gene and also inhibits csrB transcription, apparently indirectly. We propose that glucose availability activates pathways for both synthesis and turnover of CsrB/C, thus shaping the dynamics of global signaling in response to the nutritional environment by poising CsrB/C sRNA levels for rapid response. PMID:27551019
Herrera, M. Carmen; Daddaoua, Abdelali; Fernández-Escamilla, Ana
2012-01-01
The phhAB operon encodes a phenylalanine hydroxylase involved in the conversion of l-phenylalanine into l-tyrosine in Pseudomonas putida. The phhAB promoter is transcribed by RNA polymerase sigma-70 and is unusual in that the specific regulator PhhR acts as an enhancer protein that binds to two distant upstream sites (−75 to −92 and −132 to −149). There is an integration host factor (IHF) binding site that overlaps the proximal PhhR box, and, consequently, IHF acts as an inhibitor of transcription. Use of l-phenylalanine is compromised in a crp-deficient background due to reduced expression from the phhAB promoter. Electrophoretic mobility shift assays and DNase I footprinting assays reveal that Crp binds at a site centered at −109 only in the presence of cyclic AMP (cAMP). We show, using circular permutation analysis, that the simultaneous binding of Crp/cAMP and PhhR bends DNA to bring positive regulators and RNA polymerase into close proximity. This nucleoprotein complex promotes transcription from phhA only in response to l-phenylalanine. PMID:22081386
Impact of C-reactive protein (CRP) on surfactant function
DOE Office of Scientific and Technical Information (OSTI.GOV)
Li, J.J.; Sanders, R.L.; McAdam, K.P.
1989-12-01
Plasma levels of the acute-phase reactant, C-reactive protein (CRP), increase up to one thousand-fold as a result of trauma or inflammation. CRP binds to phosphorylcholine (PC) in a calcium-ion dependent manner. The structural homology between PC and the major phospholipid component of surfactant, dipalmitoyl phosphatidylcholine (DPPC), led to the present study in which we examined if CRP levels might be increased in patients with adult respiratory distress syndrome (ARDS), and subsequently interfere with surfactant function. Our results showed that CRP levels in the bronchoalveolar fluid (BALF) was increased in patients with ARDS (97.8 +/- 84.2 micrograms/mg total protein vs. 4.04more » +/- 2.2 micrograms/mg total protein in normals). Our results show that CRP binds to liposomes containing DPPC and phosphatidylglycerol (PG). As a result of this interaction, CRP inhibits the surface activity of a PG-DPPC mixture when tested with a Wilhelmy surfactometer or with the Enhorning pulsating bubble apparatus. Furthermore, the surface activity of a clinically used surfactant replacement, Surfactant TA (2 mg/ml), was also severely impaired by CRP in a dose-dependent manner (doses used ranging from 24.5 to 1,175 micrograms/ml). In contrast, human serum albumin (HSA) at 500 and 900 micrograms/ml had no inhibitory effect on Surfactant TA surface activity. These results suggest that CRP, although not an initiating insult in ARDS, may contribute to the subsequent abnormalities of surfactant function and thus the pathogenesis of the pulmonary dysfunction seen in ARDS.« less
Cox, Nehemiah; Pilling, Darrell; Gomer, Richard H
2015-07-07
Fibrosis is caused by scar tissue formation in internal organs and is associated with 45% of deaths in the United States. Two closely related human serum proteins, serum amyloid P (SAP) and C-reactive protein (CRP), strongly affect fibrosis. In multiple animal models, and in Phase 1 and Phase 2 clinical trials, SAP affects several aspects of the innate immune system to reduce fibrosis, whereas CRP appears to potentiate fibrosis. However, SAP and CRP bind the same Fcγ receptors (FcγR) with similar affinities, and why SAP and CRP have opposing effects is unknown. Here, we report that SAP but not CRP binds the receptor DC-SIGN (SIGN-R1) to affect the innate immune system, and that FcγR are not necessary for SAP function. A polycyclic aminothiazole DC-SIGN ligand and anti-DC-SIGN antibodies mimic SAP effects in vitro. In mice, the aminothiazole reduces neutrophil accumulation in a model of acute lung inflammation and, at 0.001 mg/kg, alleviates pulmonary fibrosis by increasing levels of the immunosuppressant IL-10. DC-SIGN (SIGN-R1) is present on mouse lung epithelial cells, and SAP and the aminothiazole potentiate IL-10 production from these cells. Our data suggest that SAP activates DC-SIGN to regulate the innate immune system differently from CRP, and that DC-SIGN is a target for antifibrotics.
Crystal Structure of the Pseudomonas aeruginosa Virulence Factor Regulator
DOE Office of Scientific and Technical Information (OSTI.GOV)
Cordes, Timothy J.; Worzalla, Gregory A.; Ginster, Aaron M.
2012-09-07
Virulence factor regulator (Vfr) enhances Pseudomonas aeruginosa pathogenicity through its role as a global transcriptional regulator. The crystal structure of Vfr shows that it is a winged-helix DNA-binding protein like its homologue cyclic AMP receptor protein (CRP). In addition to an expected primary cyclic AMP-binding site, a second ligand-binding site is nestled between the N-terminal domain and the C-terminal helix-turn-helix domain. Unlike CRP, Vfr is a symmetric dimer in the absence of DNA. Removal of seven disordered N-terminal residues of Vfr prvents the growth of P. aeruginosa.
NASA Astrophysics Data System (ADS)
Orito, N.; Umekage, S.; Sato, K.; Kawauchi, S.; Tanaka, H.; Sakai, E.; Tanaka, T.; Kikuchi, Y.
2012-03-01
We have developed a modified SELEX (systematic evolution of ligands by exponential enrichment) method to obtain RNA aptamers with high affinity to C-reactive protein (CRP). CRP is a clinical biomarker present in plasma, the level of which increases in response to infections and noninfectious inflammation. The CRP level is also an important prognostic indicator in patients with several syndromes. At present, CRP content in blood is measured immunochemically using antibodies. To develop a more sensitive method using RNA aptamers, we have attempted to obtain high-affinity RNA aptamers to CRP. We succeeded in obtaining an RNA aptamer with high affinity to CRP using a CRP-immobilized Sepharose column and pre-elution procedure. Pre-elution is a method that removes the weak binding portion from a selected RNA population by washing for a short time with buffer containing CRP. By surface plasmon-resonance (SPR) analysis, the affinity constant of this aptamer for CRP was calculated to be KD = 2.25×10-9 (M). The secondary structure, contact sites with CRP protein, and application of this aptamer will be described.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Sjoewall, Christopher; Wetteroe, Jonas; Bengtsson, Torbjoern
2007-01-05
C-reactive protein (CRP) interacts with phosphorylcholine (PC), Fc{gamma} receptors, complement factor C1q and cell nuclear constituents, yet its biological roles are insufficiently understood. The aim was to characterize CRP-induced complement activation by ellipsometry. PC conjugated with keyhole limpet hemocyanin (PC-KLH) was immobilized to cross-linked fibrinogen. A low-CRP serum with different amounts of added CRP was exposed to the PC-surfaces. The total serum protein deposition was quantified and deposition of IgG, C1q, C3c, C4, factor H, and CRP detected with polyclonal antibodies. The binding of serum CRP to PC-KLH dose-dependently triggered activation of the classical pathway. Unexpectedly, the activation was efficientlymore » down-regulated at CRP levels >150 mg/L. Using radial immunodiffusion, CRP-C1q interaction was observed in serum samples with high CRP concentrations. We propose that the underlying mechanism depends on fluid-phase interaction between C1q and CRP. This might constitute another level of complement regulation, which has implications for systemic lupus erythematosus where CRP is often low despite flare-ups.« less
Zhang, Jing; Yang, Lifeng; Anand, Ganesh Srinivasan; Ho, Bow; Ding, Jeak Ling
2011-10-01
Although homeostatic disturbance of the blood pH and calcium in the vicinity of tissue injury/malignancy/local infection seems subtle, it can cause substantial pathophysiological consequences, a phenomenon which has remained largely unexplored. The fibrinogen-related proteins (FREPs) containing fibrinogen-like domain (FBG) represent a conserved protein family with a common calcium-binding region, implying the presence of elements responsive to physiological perturbation. Here, we studied the molecular interaction between a representative FREP, the M-ficolin, and an acute phase blood protein, the C-reactive protein (CRP), both of which are known to trigger and control seminal pathways in infection and injury. Using hydrogen-deuterium exchange mass spectrometry, we showed that the C-terminal region of M-ficolin FBG underwent dramatic conformational change upon pH and calcium perturbations. Biochemical and biophysical assays showed that under defined pathophysiological condition (pH 6.5, 2.0 mM calcium), the FBG:CRP interaction occurred more strongly compared to that under physiological condition (pH 7.4, 2.5 mM calcium). We identified the binding interface between CRP and FBG, locating it to the pH- and calcium-sensitive C-terminal region of FBG. By site-directed mutagenesis, we determined H284 in the N-acetylglucosamine (GlcNAc)-binding pocket of the FBG, to be the critical CRP-binding residue. This conformational switch involving H284, explains how the pathophysiologically-driven FBG:CRP interaction diverts the M-ficolin away from GlcNAc/pathogen-recognition to host protein-protein interaction, thus enabling the host to regain homeostatic control. Our elucidation of the binding interface at the flexible FBG domain provides insights into the bioactive centre of the M-ficolin, and possibly other FREPs, which might aid future development of immunomodulators. Copyright © 2011 Elsevier Masson SAS. All rights reserved.
NASA Astrophysics Data System (ADS)
Hwang, Jangsun; Seo, Youngmin; Jo, Yeonho; Son, Jaewoo; Choi, Jonghoon
2016-10-01
C-reactive protein (CRP) is a pentameric protein that is present in the bloodstream during inflammatory events, e.g., liver failure, leukemia, and/or bacterial infection. The level of CRP indicates the progress and prognosis of certain diseases; it is therefore necessary to measure CRP levels in the blood accurately. The normal concentration of CRP is reported to be 1-3 mg/L. Inflammatory events increase the level of CRP by up to 500 times; accordingly, CRP is a biomarker of acute inflammatory disease. In this study, we demonstrated the preparation of DNA aptamer-conjugated peripheral blood mononuclear cells (Apt-PBMCs) that specifically capture human CRP. Live PBMCs functionalized with aptamers could detect different levels of human CRP by producing immune complexes with reporter antibody. The binding behavior of Apt-PBMCs toward highly concentrated CRP sites was also investigated. The immune responses of Apt-PBMCs were evaluated by measuring TNF-alpha secretion after stimulating the PBMCs with lipopolysaccharides. In summary, engineered Apt-PBMCs have potential applications as live cell based biosensors and for in vitro tracing of CRP secretion sites.
Cox, Nehemiah; Pilling, Darrell; Gomer, Richard H.
2015-01-01
Fibrosis is caused by scar tissue formation in internal organs and is associated with 45% of deaths in the United States. Two closely related human serum proteins, serum amyloid P (SAP) and C-reactive protein (CRP), strongly affect fibrosis. In multiple animal models, and in Phase 1 and Phase 2 clinical trials, SAP affects several aspects of the innate immune system to reduce fibrosis, whereas CRP appears to potentiate fibrosis. However, SAP and CRP bind the same Fcγ receptors (FcγR) with similar affinities, and why SAP and CRP have opposing effects is unknown. Here, we report that SAP but not CRP binds the receptor DC-SIGN (SIGN-R1) to affect the innate immune system, and that FcγR are not necessary for SAP function. A polycyclic aminothiazole DC-SIGN ligand and anti–DC-SIGN antibodies mimic SAP effects in vitro. In mice, the aminothiazole reduces neutrophil accumulation in a model of acute lung inflammation and, at 0.001 mg/kg, alleviates pulmonary fibrosis by increasing levels of the immunosuppressant IL-10. DC-SIGN (SIGN-R1) is present on mouse lung epithelial cells, and SAP and the aminothiazole potentiate IL-10 production from these cells. Our data suggest that SAP activates DC-SIGN to regulate the innate immune system differently from CRP, and that DC-SIGN is a target for antifibrotics. PMID:26106150
Hoggett, J G; Brierley, I
1992-01-01
The activation of transcription initiation from the P4 promoter of pBR322 by the Escherichia coli cyclic AMP receptor protein (CRP) has been investigated using a fluorescence abortive initiation assay. The effect of the cyclic-AMP/CRP complex on the linear P4 promoter was to increase the initial binding (KB) of RNA polymerase to the promoter by about a factor of 10, but the rate of isomerization of closed to open complex (kf) was unaffected. One molecule of CRP per promoter was required for activation, and the concentration of cyclic AMP producing half-maximal stimulation was about 7-8 microM. Supercoiling caused a 2-3-fold increase in the rate of isomerization of the CRP-activated promoter, but weakened the initial binding of polymerase by about one order of magnitude. The unactivated supercoiled promoter was too weak to allow reliable assessment of kinetic parameters against the high background rate originating from the rest of the plasmid. PMID:1445251
Hoggett, J G; Brierley, I
1992-11-01
The activation of transcription initiation from the P4 promoter of pBR322 by the Escherichia coli cyclic AMP receptor protein (CRP) has been investigated using a fluorescence abortive initiation assay. The effect of the cyclic-AMP/CRP complex on the linear P4 promoter was to increase the initial binding (KB) of RNA polymerase to the promoter by about a factor of 10, but the rate of isomerization of closed to open complex (kf) was unaffected. One molecule of CRP per promoter was required for activation, and the concentration of cyclic AMP producing half-maximal stimulation was about 7-8 microM. Supercoiling caused a 2-3-fold increase in the rate of isomerization of the CRP-activated promoter, but weakened the initial binding of polymerase by about one order of magnitude. The unactivated supercoiled promoter was too weak to allow reliable assessment of kinetic parameters against the high background rate originating from the rest of the plasmid.
Shankar, A; Li, J
2008-08-01
Previous epidemiologic studies have demonstrated a positive association between serum C-reactive protein (CRP) level and diabetes mellitus. However among US race-ethnicities, the putative association between CRP and diabetes mellitus in non-Hispanic Blacks is not clear. We specifically examined the association between high-sensitivity CRP level and diabetes mellitus in a representative sample of US non-Hispanic blacks. Cross-sectional study among 1,479 National Health and Nutrition Examination Survey 1999-2002 non-Hispanic black participants aged > or = 20 years. Main outcome-of-interest was the presence of diabetes mellitus (fasting plasma glucose > or = 126 mg/dL, non-fasting plasma glucose > or = 200 mg/dL, or self-reported current use of oral hypoglycemic medication or insulin) (n=204). Higher CRP levels were positively associated with diabetes mellitus, independent of smoking, waist circumference, hypertension, and other confounders. Multivariable odds ratio (OR) [95% confidence intervals (CI)] comparing elevated CRP level (>3 mg/L) to low CRP level (<1 mg/L) was 3.12 (1.77-5.48), p-trend<0.0001. This association persisted in separate analysis among men and women. The results were consistent in subgroup analyses by categories of age, smoking, body mass index, and hypertension status. In nonparametric models, the positive association between serum CRP and diabetes mellitus appeared to be present across the full range of CRP, without any threshold effect. Higher serum high-sensitivity CRP levels are positively associated with diabetes mellitus in a sample of US non-Hispanic blacks. Inflammatory processes previously shown to be related to diabetes mellitus in other race-ethnicities may be involved in non-Hispanic blacks also.
Slevin, Mark; Matou-Nasri, Sabine; Turu, Marta; Luque, Ana; Rovira, Norma; Badimon, Lina; Boluda, Susana; Potempa, Lawrence; Sanfeliu, Coral; de Vera, Nuria; Krupinski, Jerzy
2010-01-01
Native C-reactive protein (nCRP) is a pentameric oligo-protein and an acute phase reactant whose serum expression is increased in patients with inflammatory disease. We have identified by immunohistochemistry, significant expression of a tissue-binding insoluble modified version or monomeric form of CRP (mCRP) associated with angiogenic microvessels in peri-infarcted regions of patients studied with acute ischaemic stroke. mCRP, but not nCRP was expressed in the cytoplasm and nucleus of damaged neurons. mCRP co-localized with CD105, a marker of angiogenesis in regions of revascularisation. In vitro investigations demonstrated that mCRP was preferentially expressed in human brain microvessel endothelial cells following oxygen-glucose deprivation and mCRP (but not column purified nCRP) associated with the endothelial cell surface, and was angiogenic to vascular endothelial cells, stimulating migration and tube formation in matrigel more strongly than fibroblast growth factor-2. The mechanism of signal transduction was not through the CD16 receptor. Western blotting showed that mCRP stimulated phosphorylation of the key down-stream mitogenic signalling protein ERK1/2. Pharmacological inhibition of ERK1/2 phosphorylation blocked the angiogenic effects of mCRP. We propose that mCRP may contribute to the neovascularization process and because of its abundant presence, be important in modulating angiogenesis in both acute stroke and later during neuro-recovery.
Townsend, Philip D.; Jungwirth, Britta; Pojer, Florence; Bußmann, Michael; Money, Victoria A.; Cole, Stewart T.; Pühler, Alfred; Tauch, Andreas; Bott, Michael; Cann, Martin J.; Pohl, Ehmke
2014-01-01
The cyclic AMP-dependent transcriptional regulator GlxR from Corynebacterium glutamicum is a member of the super-family of CRP/FNR (cyclic AMP receptor protein/fumarate and nitrate reduction regulator) transcriptional regulators that play central roles in bacterial metabolic regulatory networks. In C. glutamicum, which is widely used for the industrial production of amino acids and serves as a non-pathogenic model organism for members of the Corynebacteriales including Mycobacterium tuberculosis, the GlxR homodimer controls the transcription of a large number of genes involved in carbon metabolism. GlxR therefore represents a key target for understanding the regulation and coordination of C. glutamicum metabolism. Here we investigate cylic AMP and DNA binding of GlxR from C. glutamicum and describe the crystal structures of apo GlxR determined at a resolution of 2.5 Å, and two crystal forms of holo GlxR at resolutions of 2.38 and 1.82 Å, respectively. The detailed structural analysis and comparison of GlxR with CRP reveals that the protein undergoes a distinctive conformational change upon cyclic AMP binding leading to a dimer structure more compatible to DNA-binding. As the two binding sites in the GlxR homodimer are structurally identical dynamic changes upon binding of the first ligand are responsible for the allosteric behavior. The results presented here show how dynamic and structural changes in GlxR lead to optimization of orientation and distance of its two DNA-binding helices for optimal DNA recognition. PMID:25469635
Tharia, Hazel A; Shrive, Annette K; Mills, John D; Arme, Chris; Williams, Gwyn T; Greenhough, Trevor J
2002-02-22
The serum amyloid P component (SAP)-like pentraxin Limulus polyphemus SAP is a recently discovered, distinct pentraxin species, of known structure, which does not bind phosphocholine and whose N-terminal sequence has been shown to differ markedly from the highly conserved N terminus of all other known horseshoe crab pentraxins. The complete cDNA sequence of Limulus SAP, and the derived amino acid sequence, the first invertebrate SAP-like pentraxin sequence, have been determined. Two sequences were identified that differed only in the length of the 3' untranslated region. Limulus SAP is synthesised as a precursor protein of 234 amino acid residues, the first 17 residues encoding a signal peptide that is absent from the mature protein. Phylogenetic analysis clusters Limulus SAP pentraxin with the horseshoe crab C-reactive proteins (CRPs) rather than the mammalian SAPs, which are clustered with mammalian CRPs. The deduced amino acid sequence shares 22% identity with both human SAP and CRP, which are 51% identical, and 31-35% with horseshoe crab CRPs. These analyses indicate that gene duplication of CRP (or SAP), followed by sequence divergence and the evolution of CRP and/or SAP function, occurred independently along the chordate and arthropod evolutionary lines rather than in a common ancestor. They further indicate that the CRP/SAP gene duplication event in Limulus occurred before both the emergence of the Limulus CRP variants and the mammalian CRP/SAP gene duplication. Limulus SAP, which does not exhibit the CRP characteristic of calcium-dependent binding to phosphocholine, is established as a pentraxin species distinct from all other known horseshoe crab pentraxins that exist in many variant forms sharing a high level of sequence homology. Copyright 2002 Elsevier Science Ltd.
Nanocrystalline diamond sensor targeted for selective CRP detection: an ATR-FTIR spectroscopy study.
Andersson, Per Ola; Viberg, Pernilla; Forsberg, Pontus; Nikolajeff, Fredrik; Österlund, Lars; Karlsson, Mikael
2016-05-01
Protein immobilization on functionalized fluorine-terminated nanocrystalline (NCD) films was studied by attenuated total reflection Fourier transform infrared (ATR-FTIR) spectroscopy using an immobilization protocol developed to specifically bind C-reactive protein (CRP). Using an ATR-FTIR spectroscopy method employing a force-controlled anvil-type configuration, three critical steps of the ex situ CRP immobilization were analyzed. First, the NCD surface was passivated by deposition of a copolymer layer consisting of polyethylene oxide and polypropylene oxide. Second, a synthetic modified polypeptide binder with high affinity to CRP was covalently attached to the polymeric film. Third, CRP dissolved in aqueous buffer in concentrations of 10-20 μg/mL was added on the functionalized NCD surface. Both the amide I and II bands, due to the polypeptide binder and CRP, were clearly observed in ATR-FTIR spectra. CRP amide I bands were extracted from difference spectra and yielded bands that agreed well with the reported amide I band of free (non-bonded) CRP in solution. Thus, our results show that CRP retains its secondary structure when it is attached to the polypeptide binders. Compared to previous IR studies of CRP in solution, about 200 times lower concentration was applied in the present study. Graphical Abstract Direct non-destructive ATR-FTIR analysis of C-reactive protein (CRP) selectively bound to functionalized nanocrystalline diamond (NCD) sensor surface.
NASA Astrophysics Data System (ADS)
Rajesh, Sharma, Vikash; Puri, Nitin K.; Mulchandani, Ashok; Kotnala, Ravinder K.
2016-12-01
We report a single-walled carbon nanotube (SWNT) field-effect transistor (FET) functionalized with Polyamidoamine (PAMAM) dendrimer with 128 carboxyl groups as anchors for site specific biomolecular immobilization of protein antibody for C-reactive protein (CRP) detection. The FET device was characterized by scanning electron microscopy and current-gate voltage (I-Vg) characteristic studies. A concentration-dependent decrease in the source-drain current was observed in the regime of clinical significance, with a detection limit of ˜85 pM and a high sensitivity of 20% change in current (ΔI/I) per decade CRP concentration, showing SWNT being locally gated by the binding of CRP to antibody (anti-CRP) on the FET device. The low value of the dissociation constant (Kd = 0.31 ± 0.13 μg ml-1) indicated a high affinity of the device towards CRP analyte arising due to high anti-CRP loading with a better probe orientation on the 3-dimensional PAMAM structure.
Attey, A; Belyaeva, T; Savery, N; Hoggett, J; Fujita, N; Ishihama, A; Busby, S
1994-10-25
DNAase I footprinting has been used to study open complexes between Escherichia coli RNA polymerase and the galactose operon P1 promoter, both in the absence and the presence of CRP (the cyclic AMP receptor protein, a transcription activator). From the effects of deletion of the C-terminal part of the RNA polymerase alpha subunit, we deduce that alpha binds at the upstream end of both the binary RNA polymerase-galP1 and ternary RNA polymerase-CRP-galP1 complexes. Disruption of the alpha-upstream contact suppresses open complex formation at galP1 at lower temperatures. In ternary RNA polymerase-CRP-galP1 complexes, alpha appears to make direct contact with Activating Region 1 in CRP. DNAase I footprinting has been used to detect and quantify interactions between purified alpha and CRP bound at galP1.
Attey, A; Belyaeva, T; Savery, N; Hoggett, J; Fujita, N; Ishihama, A; Busby, S
1994-01-01
DNAase I footprinting has been used to study open complexes between Escherichia coli RNA polymerase and the galactose operon P1 promoter, both in the absence and the presence of CRP (the cyclic AMP receptor protein, a transcription activator). From the effects of deletion of the C-terminal part of the RNA polymerase alpha subunit, we deduce that alpha binds at the upstream end of both the binary RNA polymerase-galP1 and ternary RNA polymerase-CRP-galP1 complexes. Disruption of the alpha-upstream contact suppresses open complex formation at galP1 at lower temperatures. In ternary RNA polymerase-CRP-galP1 complexes, alpha appears to make direct contact with Activating Region 1 in CRP. DNAase I footprinting has been used to detect and quantify interactions between purified alpha and CRP bound at galP1. Images PMID:7971267
Pavare, Jana; Grope, Ilze; Kalnins, Imants; Gardovska, Dace
2010-02-16
Even though sepsis is one of the common causes of children morbidity and mortality, specific inflammatory markers for identifying sepsis are less studied in children. The main aim of this study was to compare the levels of high-mobility group box-1 protein (HMGB1), Lipopolysaccharide-binding protein (LBP), Interleukin-6 (IL-6) and C-reactive protein (CRP) between infected children without systemic inflammatory response syndrome (SIRS) and children with severe and less severe sepsis. The second aim was to examine HMGB1, LBP, IL6 and CRP as markers for of bacteraemia. Totally, 140 children with suspected or proven infections admitted to the Children's Clinical University Hospital of Latvia during 2008 and 2009 were included. Clinical and demographical information as well as infection focus were assessed in all patients. HMGB1, LBP, IL-6 and CRP blood samples were determined. Children with suspected or diagnosed infections were categorized into three groups of severity of infection: (i) infected without SIRS (n = 36), (ii) sepsis (n = 91) and, (iii) severe sepsis (n = 13). They were furthermore classified according bacteraemia into (i) bacteremia (n = 30) and (ii) no bacteraemia (n = 74). There was no statistically significant difference in HMGB1 levels between children with different levels of sepsis or with and without bacteraemia. The levels of LBP, IL-6 and CRP were statistically significantly higher among patients with sepsis compared to those infected but without SIRS (p < 0.001). Furthermore, LBP, IL-6 and CRP were significantly higher in children with severe sepsis compared to those ones with less severe sepsis (p < 0.001). Median values of LBP, IL6 and CRP were significantly higher in children with bacteraemia compared to those without bacteraemia. The area under the receiver operating curve (ROC) for detecting bacteraemia was 0.87 for both IL6 and CRP and 0.82 for LBP, respectively. Elevated levels of LBP, IL-6 and CRP were associated with a more severe level of infection in children. Whereas LBP, IL-6 and CRP seem to be good markers to detect patients with bacteraemia, HMGB1 seem to be of minor importance. LBP, IL-6 and CRP levels may serve as good biomarkers for identifying children with severe sepsis and bacteraemia and, thus, may be routinely used in clinical practice.
Tugirimana, Pierrot; Speeckaert, Marijn M; Fiers, Tom; De Buyzere, Marc L; Kint, Jos; Benoit, Dominique; Delanghe, Joris R
2013-04-01
C-reactive protein (CRP) is able to bind phospholipids in the presence of calcium. We wanted to investigate the reaction of CRP with various commercial fat emulsions and to explore the impact of CRP agglutination on serum CRP levels. Serum specimens were mixed with Intralipid 20% (soybean oil-based fat emulsion), Structolipid (structured oil-based fat emulsion), Omegaven (fish oil-based fat emulsion), or SMOFlipid (mixed soybean oil-, olive oil-, and fish oil-based emulsion) in Tris-calcium buffer (pH 7.5). After 30 minutes of incubation at 37°C, CRP-phospholipid complexes were turbidimetrically quantified and flow cytometric analysis was performed. Similarly, CRP complexes were monitored in vivo, following administration of fat emulsion. CRP was able to agglutinate phospholipid-containing lipid droplets present in the soybean oil-based fat emulsion and the structured oil-based fat emulsion. To a lesser extent, agglutination was observed for fish oil-containing fat emulsions, whereas no agglutination was noticed for the mixed soybean oil-, olive oil-, and fish oil-based emulsion. Results for propofol-containing emulsions were comparable. Agglutination correlated with phospholipid content of the emulsions. When in vivo agglutination occurred, plasma CRP values dropped due to consumption of CRP by phospholipid-induced agglutination. In this in vitro experiment, we demonstrated agglutination of CRP with phospholipids in various fat emulsions. Research studies are required in patients to determine which effects occur with various intravenous fat emulsions.
Preparation of Mach-Zehnder interferometric photonic biosensors by inkjet printing technology
NASA Astrophysics Data System (ADS)
Strasser, Florian; Melnik, Eva; Muellner, Paul; Jiménez-Meneses, Pilar; Nechvile, Magdalena; Koppitsch, Guenther; Lieberzeit, Peter; Laemmerhofer, Michael; Heer, Rudolf; Hainberger, Rainer
2017-05-01
Inkjet printing is a versatile method to apply surface modification procedures in a spatially controlled, cost-effective and mass-fabrication compatible manner. Utilizing this technology, we investigate two different approaches for functionalizing label-free optical waveguide based biosensors: a) surface modification with amine-based functional polymers (biotin-modified polyethylenimine (PEI-B)) employing active ester chemistry and b) modification with dextran based hydrogel thin films employing photoactive benzophenone crosslinker moieties. Whereas the modification with PEI-B ensures high receptor density at the surface, the hydrogel films can serve both as a voluminous matrix binding matrix and as a semipermeable separation layer between the sensor surface and the sample. We use the two surface modification strategies both individually and in combination for binding studies towards the detection of the protein inflammation biomarker, C-reactive protein (CRP). For the specific detection of CRP, we compare two kinds of capture molecules, namely biotinylated antibodies and biotinylated CRP-specific DNA based aptamers. Both kinds of capture molecules were immobilized on the PEI-B by means of streptavidin-biotin affinity binding. As transducer, we use an integrated four-channel silicon nitride (Si3N4) waveguide based Mach-Zehnder interferometric (MZI) photonic sensing platform operating at a wavelength of 850nm (TM-mode).
Sjöwall, Christopher; Eriksson, Per; Almer, Sven; Skogh, Thomas
2002-11-01
The occurrence of antibodies to human C-reactive protein (CRP) was analysed by enzyme-linked immunosorbent assay (ELISA) in 56 patient sera known to contain antibodies to double-stranded DNA (dsDNA) and in 16 sera from patients with primary Sjögren's syndrome (SS), 15 rheumatoid arthritis, 31 Crohn's disease, and 37 ulcerative colitis. Eighty-seven per cent of the patients with anti-dsDNA antibodies had systemic lupus erythematosus (SLE) and the remaining had autoimmune hepatitis. The cut-off for positive anti-CRP test was set at the 95th percentile of 100 healthy blood donors. Twenty of 56 anti-dsDNA sera (36%) and two of 16 SS sera (13%) had antibodies reactive with human CRP, whereas all other samples were negative. Thirteen of 27 SLE patients (48%) were positive on at least one occasion. The sera containing anti-CRP antibodies only reacted with surface-bound antigen, but not with native CRP in solution. In conclusion, we found that autoantibodies to CRP are common in sera from patients with anti-dsDNA antibodies. It is not likely that this explains the relative failure of CRP response in patients with active SLE. However, it cannot be excluded that anti-CRP autoantibodies have other biological potentials of pathophysiological interest in SLE, for instance by binding to CRP deposited on cell and tissue surfaces.
2010-01-01
Introduction Even though sepsis is one of the common causes of children morbidity and mortality, specific inflammatory markers for identifying sepsis are less studied in children. The main aim of this study was to compare the levels of high-mobility group box-1 protein (HMGB1), Lipopolysaccharide-binding protein (LBP), Interleukin-6 (IL-6) and C-reactive protein (CRP) between infected children without systemic inflammatory response syndrome (SIRS) and children with severe and less severe sepsis. The second aim was to examine HMGB1, LBP, IL6 and CRP as markers for of bacteraemia. Methods Totally, 140 children with suspected or proven infections admitted to the Children's Clinical University Hospital of Latvia during 2008 and 2009 were included. Clinical and demographical information as well as infection focus were assessed in all patients. HMGB1, LBP, IL-6 and CRP blood samples were determined. Children with suspected or diagnosed infections were categorized into three groups of severity of infection: (i) infected without SIRS (n = 36), (ii) sepsis (n = 91) and, (iii) severe sepsis (n = 13). They were furthermore classified according bacteraemia into (i) bacteremia (n = 30) and (ii) no bacteraemia (n = 74). Results There was no statistically significant difference in HMGB1 levels between children with different levels of sepsis or with and without bacteraemia. The levels of LBP, IL-6 and CRP were statistically significantly higher among patients with sepsis compared to those infected but without SIRS (p < 0.001). Furthermore, LBP, IL-6 and CRP were significantly higher in children with severe sepsis compared to those ones with less severe sepsis (p < 0.001). Median values of LBP, IL6 and CRP were significantly higher in children with bacteraemia compared to those without bacteraemia. The area under the receiver operating curve (ROC) for detecting bacteraemia was 0.87 for both IL6 and CRP and 0.82 for LBP, respectively. Conclusion Elevated levels of LBP, IL-6 and CRP were associated with a more severe level of infection in children. Whereas LBP, IL-6 and CRP seem to be good markers to detect patients with bacteraemia, HMGB1 seem to be of minor importance. LBP, IL-6 and CRP levels may serve as good biomarkers for identifying children with severe sepsis and bacteraemia and, thus, may be routinely used in clinical practice. PMID:20158885
Absence of specific binding of several putative neuro-transmitters to human fibroblasts.
Berrettini, W H; Nadi, N S; Gershon, E S
1983-01-01
Fibroblasts were examined for specific binding sites of ten putative neurotransmitters to determine whether this tissue could be used in receptor studies of neurologic and psychiatric disorders. Stereospecific saturable binding was not found for any of the ligands: arginine vasopressin, neurotensin, somatostatin, angiotensin II, thyrotropin-releasing hormone (TRH), alpha-bungarotoxin, LSD, dihydromorphine, muscimol and spiperone.
Effects of Antimalarial Tafenoquine on Blood Platelet Activity and Survival.
Cao, Hang; Bissinger, Rosi; Umbach, Anja T; Al Mamun Bhuyan, A; Lang, Florian; Gawaz, Meinrad
2017-01-01
The 8-aminoquinoline tafenoquine has been shown to be effective against Plasmodia, Leishmania and Trypanosoma. The substance is at least in part effective by triggering apoptosis of the parasites. Moreover, tafenoquine has been shown to trigger eryptosis, the suicidal erythrocyte death characterized by cell shrinkage and cell membrane scrambling with phosphatidylserine translocation to the erythrocyte surface. The effect of tafenoquine on eryptosis is in part due to stimulation of Ca2+ entry and oxidative stress. Ca2+ entry is a critical event in the activation of blood platelets by thrombin and collagen related peptide (CRP). The present study explored, whether tafenoquine influences Ca2+ entry, activation and apoptosis of blood platelets. Platelets isolated from wild-type mice were exposed for 30 minutes to tafenoquine (2.5 µg/ml) without or with an additional treatment with thrombin (0.01 U/ml) or CRP (2 µg/ml or 5 µg/ml). Flow cytometry was employed to estimate cytosolic Ca2+-activity ([Ca2+] i ) from Fluo-3 fluorescence, platelet degranulation from P-selectin abundance, integrin activation from α IIb β 3 integrin abundance, phosphatidylserine abundance from annexin-V-binding, relative platelet volume from forward scatter, reactive oxygen species (ROS) from DCF fluorescence, caspase 3 activity with an active caspase-3 Staining kit, and aggregation utilizing staining with CD9-APC and CD9-PE. Both, thrombin (0.01 U/ml) and CRP (2 µg/ml or 5 µg/ml), significantly increased [Ca2+] i , P-selectin abundance, active α IIb β 3 integrin, and annexin-V-binding, and both significantly decreased platelet volume, activated caspase 3 and stimulated aggregation. Administration of tafenoquine (2.5 µg/ml, 30 min) significantly decreased [Ca2+] i both, in the absence and presence of thrombin and CRP. Tafenoquine significantly blunted the effect of thrombin and CRP on [Ca2+] i , P-selectin abundance, and active α IIb β 3 integrin, but significantly increased ROS and annexin-V-binding, significantly augmented the effect of thrombin on caspase 3 activity and platelet volume and significantly enhanced platelet aggregation. Tafenoquine counteracts thrombin and CRP induced increase of cytosolic Ca2+ activity and platelet activation, but enhances platelet apoptosis and platelet aggregation. © 2017 The Author(s) Published by S. Karger AG, Basel.
Discovery of a cAMP Deaminase That Quenches Cyclic AMP-Dependent Regulation
Goble, Alissa M.; Feng, Youjun; Raushel, Frank M.; Cronan, John E.
2013-01-01
An enzyme of unknown function within the amidohydrolase superfamily was discovered to catalyze the hydrolysis of the universal second messenger, cyclic-3’, 5’-adenosine monophosphate (cAMP). The enzyme, which we have named CadD, is encoded by the human pathogenic bacterium Leptospira interrogans. Although CadD is annotated as an adenosine deaminase, the protein specifically deaminates cAMP to cyclic-3’, 5’-inosine monophosphate (cIMP) with a kcat/Km of 2.7 ± 0.4 × 105 M−1 s−1 and has no activity on adenosine, adenine, or 5’-adenosine monophosphate (AMP). This is the first identification of a deaminase specific for cAMP. Expression of CadD in Escherichia coli mimics the loss of adenylate cyclase in that it blocks growth on carbon sources that require the cAMP-CRP transcriptional activator complex for expression of the cognate genes. The cIMP reaction product cannot replace cAMP as the ligand for CRP binding to DNA in vitro and cIMP is a very poor competitor of cAMP activation of CRP for DNA binding. Transcriptional analyses indicate that CadD expression represses expression of several cAMP-CRP dependent genes. CadD adds a new activity to the cAMP metabolic network and may be a useful tool in intracellular study of cAMP-dependent processes. PMID:24074367
Ebert, Matthias; Laaß, Sebastian; Thürmer, Andrea; Roselius, Louisa; Eckweiler, Denitsa; Daniel, Rolf; Härtig, Elisabeth; Jahn, Dieter
2017-01-01
The heterotrophic marine bacterium Dinoroseobacter shibae utilizes aerobic respiration and anaerobic denitrification supplemented with aerobic anoxygenic photosynthesis for energy generation. The aerobic to anaerobic transition is controlled by four Fnr/Crp family regulators in a unique cascade-type regulatory network. FnrL is utilizing an oxygen-sensitive Fe-S cluster for oxygen sensing. Active FnrL is inducing most operons encoding the denitrification machinery and the corresponding heme biosynthesis. Activation of gene expression of the high oxygen affinity cbb3-type and repression of the low affinity aa3-type cytochrome c oxidase is mediated by FnrL. Five regulator genes including dnrE and dnrF are directly controlled by FnrL. Multiple genes of the universal stress protein (USP) and cold shock response are further FnrL targets. DnrD, most likely sensing NO via a heme cofactor, co-induces genes of denitrification, heme biosynthesis, and the regulator genes dnrE and dnrF. DnrE is controlling genes for a putative Na+/H+ antiporter, indicating a potential role of a Na+ gradient under anaerobic conditions. The formation of the electron donating primary dehydrogenases is coordinated by FnrL and DnrE. Many plasmid encoded genes were DnrE regulated. DnrF is controlling directly two regulator genes including the Fe-S cluster biosynthesis regulator iscR, genes of the electron transport chain and the glutathione metabolism. The genes for nitrate reductase and CO dehydrogenase are repressed by DnrD and DnrF. Both regulators in concert with FnrL are inducing the photosynthesis genes. One of the major denitrification operon control regions, the intergenic region between nirS and nosR2, contains one Fnr/Dnr binding site. Using regulator gene mutant strains, lacZ-reporter gene fusions in combination with promoter mutagenesis, the function of the single Fnr/Dnr binding site for FnrL-, DnrD-, and partly DnrF-dependent nirS and nosR2 transcriptional activation was shown. Overall, the unique regulatory network of the marine bacterium D. shibae for the transition from aerobic to anaerobic growth composed of four Crp/Fnr family regulators was elucidated. PMID:28473807
Storz, Gisela
2011-01-01
Hfq-binding small RNAs (sRNAs) are critical regulators that form limited base-pairing interactions with target mRNAs in bacteria. These sRNAs have been linked to diverse environmental responses, yet little is known how Hfq-binding sRNAs participate in the regulatory networks associated with each response. We recently described how the Hfq-binding sRNA Spot 42 in Escherichia coli contributes to catabolite repression, a regulatory phenomenon that allows bacteria to consume some carbon sources over others. Spot 42 base pairs with numerous mRNAs encoding enzymes in central and secondary metabolism, redox balancing, and the uptake and consumption of non-preferred carbon sources. Many of the corresponding genes are transcriptionally activated by the Spot 42-repressor CRP, forming a regulatory circuit called a multi-output feedforward loop. We found that this loop influences both the steady-state levels and dynamics of gene regulation. In this article, we discuss how the CRP-Spot 42 feedforward loop is integrated into encompassing networks and how this loop may benefit enteric bacteria facing uncertain and changing nutrient conditions. PMID:21788732
Ganguly, Rituparna; Sahu, Soumyadip; Ohanyan, Vahagn; Haney, Rebecca; Chavez, Ronaldo J; Shah, Shivani; Yalamanchili, Siri; Raman, Priya
2017-03-27
Increasing evidence suggests thrombospondin-1 (TSP-1), a potent proatherogenic matricellular protein, as a putative link between hyperglycemia and atherosclerotic complications in diabetes. We previously reported that the micronutrient chromium picolinate (CrP), with long-standing cardiovascular benefits, inhibits TSP-1 expression in glucose-stimulated human aortic smooth muscle cells in vitro. Here, we investigated the atheroprotective action of orally administered CrP in type 1 diabetic apolipoprotein E-deficient (ApoE -/- ) mice and elucidated the role of TSP-1 in this process. CrP decreased lipid burden and neointimal thickness in aortic root lesions of hyperglycemic ApoE -/- mice; also, smooth muscle cell (SMC), macrophage and leukocyte abundance was prevented coupled with reduced cell proliferation. Attenuated lesion progression was accompanied with inhibition of hyperglycemia-induced TSP-1 expression and reduced protein O-glycosylation following CrP treatment; also, PCNA and vimentin (SMC synthetic marker) expression were reduced while SM-MHC (SMC contractile marker) levels were increased. To confirm a direct role of TSP-1 in diabetic atherosclerosis, hyperglycemic TSP-1 -/- /ApoE -/- double knockout mice were compared with age-matched hyperglycemic ApoE -/- littermates. Lack of TSP-1 prevented lesion formation in hyperglycemic ApoE -/- mice, mimicking the atheroprotective phenotype of CrP-treated mice. These results suggest that therapeutic TSP-1 inhibition may have important atheroprotective potential in diabetic vascular disease.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Karim, Mohammad Azharul; Ohta, Kohji; Matsuda, Ichiro
1996-01-15
The LIM domain is present in a wide variety of proteins with diverse functions and exhibits characteristic arrangements of Cys and His residues with a novel zinc-binding motif. LIM domain proteins have been implicated in development, cell regulation, and cell structure. A LIM domain protein was identified by screening a human cDNA library with rat cysteine-rich intestinal protein (CRIP) as a probe, under conditions of low stringency. Comparison of the predicted amino acid sequence with several LIM domain proteins revealed 93% of the residues to be identical to rat LIM domain protein, termed ESP1 or CRP2. Thus, the protein ismore » hereafter referred to as human ESP1/CRP2. The cDNA encompasses a 1171-base region, including 26, 624, and 521 bases in the 5{prime}-noncoding region, coding region, and 3{prime}-noncoding regions, respectively, and encodes the entire ESP1/CRP2 protein has two LIM domains, and each shares 35.1% and 77 or 79% identical residues with human cysteine-rich protein (CRP) and rat CRIP, respectively. Northern blot analysis of ESP1/CRP2 in various human tissues showed distinct tissue distributions compared with CRP and CRIP, suggesting that each might serve related but specific roles in tissue organization or function. Using a panel of human-rodent somatic cell hybrids, the ESP1/CRP2 locus was assigned to chromosome 14. Fluorescence in situ hybridization, using cDNA and a genome DNA fragment of the ESP1/CRP2 as probes, confirms this assignment and relegates regional localization to band 14q32.3 47 refs., 7 figs.« less
Putative melatonin receptors in a human biological clock
DOE Office of Scientific and Technical Information (OSTI.GOV)
Reppert, S.M.; Weaver, D.R.; Rivkees, S.A.
In vitro autoradiography with /sup 125/I-labeled melatonin was used to examine melatonin binding sites in human hypothalamus. Specific /sup 125/I-labeled melatonin binding was localized to the suprachiasmatic nuclei, the site of a putative biological clock, and was not apparent in other hypothalamic regions. Specific /sup 125/I-labeled melatonin binding was consistently found in the suprachiasmatic nuclei of hypothalami from adults and fetuses. Densitometric analysis of competition experiments with varying concentrations of melatonin showed monophasic competition curves, with comparable half-maximal inhibition values for the suprachiasmatic nuclei of adults (150 picomolar) and fetuses (110 picomolar). Micromolar concentrations of the melatonin agonist 6-chloromelatonin completelymore » inhibited specific /sup 125/I-labeled melatonin binding, whereas the same concentrations of serotonin and norepinephrine caused only a partial reduction in specific binding. The results suggest that putative melatonin receptors are located in a human biological clock.« less
Chowdhury, Shomeek; Zhang, Jian; Kurgan, Lukasz
2018-05-28
Deciphering a complete landscape of protein-RNA interactions in the human proteome remains an elusive challenge. We computationally elucidate RNA binding proteins (RBPs) using an approach that complements previous efforts. We employ two modern complementary sequence-based methods that provide accurate predictions from the structured and the intrinsically disordered sequences, even in the absence of sequence similarity to the known RBPs. We generate and analyze putative RNA binding residues on the whole proteome scale. Using a conservative setting that ensures low, 5% false positive rate, we identify 1511 putative RBPs that include 281 known RBPs and 166 RBPs that were previously predicted. We empirically demonstrate that these overlaps are statistically significant. We also validate the putative RBPs based on two major hallmarks of their RNA binding residues: high levels of evolutionary conservation and enrichment in charged amino acids. Moreover, we show that the novel RBPs are significantly under-annotated functionally which coincides with the fact that they were not yet found to interact with RNAs. We provide two examples of our novel putative RBPs for which there is recent evidence of their interactions with RNAs. The dataset of novel putative RBPs and RNA binding residues for the future hypothesis generation is provided in the Supporting Information. © 2018 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.
Pavcnik-Arnol, Maja; Hojker, Sergej; Derganc, Metka
2004-07-01
To evaluate markers of infection in critically ill neonates and children, comparing lipopolysaccharide-binding protein (LBP) with procalcitonin (PCT), interleukin-6 (IL-6), and C-reactive protein (CRP). Prospective, observational study in the level III multidisciplinary neonatal and pediatric intensive care unit. Sixty patients with systemic inflammatory response syndrome (SIRS) and suspected infection classified into two groups: SIRS/sepsis ( n=33) and SIRS/no sepsis ( n=27). We included 29 neonates aged less than 48 h (neonates <48 h), 12 neonates older than 48 h (neonates >48 h), and 19 children. Median disease severity was high in neonates aged under 48 h and moderate in neonates aged over 48 h and children. Serum LBP, PCT, IL-6, and CRP were measured on two consecutive days. Area under the receiver operating characteristic (ROC) curve (AUC), sensitivity, specificity, and predictive values were evaluated. Serum LBP was higher in patients with SIRS/sepsis than in patients with SIRS/no sepsis. AUC for LBP on the first day of suspected infection was 0.89 in the younger neonates, 0.93 in the older neonates, and 0.91 in children. In critically ill neonates aged under 48 h LBP on the first day of suspected infection is a better marker of sepsis than IL-6 and PCT, and is similar to CRP. In critically ill neonates aged over 48 h and children LBP is a better marker than IL-6 and CRP, and is similar to PCT.
Slatter, David A; Bihan, Dominique G; Jarvis, Gavin E; Stone, Rachael; Pugh, Nicholas; Giddu, Sumana; Farndale, Richard W
2012-07-01
Recently, the ability of polymeric collagen-like peptides to regulate cell behavior has generated great interest. A triple-helical peptide known as collagen-related peptide (CRP) contains the sequence (Gly-Pro-Hyp)(10). With Gly-Pro-Cys triplets appended to both of its termini, designated CRP(cys), chemical cross-linking using heterobifunctional reagents generates CRP(cys)-XL, a potent, widely used, polymeric agonist for platelet Glycoprotein VI, whereas non-cross-linked, monomeric CRP(cys) antagonizes Glycoprotein VI. Here, we describe how cysteine in these triplets may also undergo random air-induced oxidation, especially upon prolonged storage or repeated freeze-thawing, to form disulphide bonds, resulting in a lesser degree of polymerization than with chemical cross-linking. We investigated the monomeric and polymeric states of these and other cysteine-containing collagen-derived peptides, using gel filtration and dynamic light scattering, allowing the size of a CRP-XL aggregate to be estimated. The effect of cysteine thiols upon peptide adsorption to surfaces and subsequent platelet responses was investigated. This demonstrated that cysteine is required for strong binding to glass coverslips and to plastic plates used in ELISA assays. Copyright © 2012 Elsevier Inc. All rights reserved.
Structural analysis of the receptor binding domain of botulinum neurotoxin serotype D
DOE Office of Scientific and Technical Information (OSTI.GOV)
Zhang, Yanfeng; Buchko, Garry W.; Qin, Lin
2010-10-28
Botulinum neurotoxins (BoNTs) are the most toxic proteins known. The mechanism for entry into neuronal cells for serotypes A, B, E, F, and G involves a well understood dual receptor (protein and ganglioside) process, however, the mechanism of entry for serotypes C and D remains unclear. To provide structural insights into how BoNT/D enters neuronal cells, the crystal structure of the receptor binding domain (S863-E1276) for this serotype (BoNT/D-HCR) was determined at 1.65 Å resolution. While BoNT/D-HCR adopts an overall fold similar to that observed in other known BoNT HCRs, several major structural differences are present. These structural differences aremore » located at, or near, putative receptor binding sites and may be responsible for BoNT/D host preferences. Two loops, S1195-I1204 and K1236-N1244, located on both sides of the putative protein receptor binding pocket, are displaced >10 Å relative to the corresponding residues in the crystal structures of BoNT/B and G. Obvious clashes were observed in the putative protein receptor binding site when the BoNT/B protein receptor synaptotagmin II was modeled into the BoNT/D-HCR structure. Although a ganglioside binding site has never been unambiguously identified in BoNT/D-HCR, a shallow cavity in an analogous location to the other BoNT serotypes HCR domains is observed in BoNT/D-HCR that has features compatible with membrane binding. A portion of a loop near the putative receptor binding site, K1236-N1244, is hydrophobic and solvent-exposed and may directly bind membrane lipids. Liposome-binding experiments with BoNT/D-HCR demonstrate that this membrane lipid may be phosphatidylethanolamine.« less
Structural Analysis of the Receptor Binding Domain of Botulinum Neurotoxin Serotype D
DOE Office of Scientific and Technical Information (OSTI.GOV)
Y Zhang; G Buchko; L Qin
2011-12-31
Botulinum neurotoxins (BoNTs) are the most toxic proteins known. The mechanism for entry into neuronal cells for serotypes A, B, E, F, and G involves a well understood dual receptor (protein and ganglioside) process, however, the mechanism of entry for serotypes C and D remains unclear. To provide structural insights into how BoNT/D enters neuronal cells, the crystal structure of the receptor binding domain (S863-E1276) for this serotype (BoNT/D-HCR) was determined at 1.65{angstrom} resolution. While BoNT/D-HCR adopts an overall fold similar to that observed in other known BoNT HCRs, several major structural differences are present. These structural differences are locatedmore » at, or near, putative receptor binding sites and may be responsible for BoNT/D host preferences. Two loops, S1195-I1204 and K1236-N1244, located on both sides of the putative protein receptor binding pocket, are displaced >10{angstrom} relative to the corresponding residues in the crystal structures of BoNT/B and G. Obvious clashes were observed in the putative protein receptor binding site when the BoNT/B protein receptor synaptotagmin II was modeled into the BoNT/D-HCR structure. Although a ganglioside binding site has never been unambiguously identified in BoNT/D-HCR, a shallow cavity in an analogous location to the other BoNT serotypes HCR domains is observed in BoNT/D-HCR that has features compatible with membrane binding. A portion of a loop near the putative receptor binding site, K1236-N1244, is hydrophobic and solvent-exposed and may directly bind membrane lipids. Liposome-binding experiments with BoNT/D-HCR demonstrate that this membrane lipid may be phosphatidylethanolamine.« less
Identification of functional domains in Arabidopsis thaliana mRNA decapping enzyme (AtDcp2)
Gunawardana, Dilantha; Cheng, Heung-Chin; Gayler, Kenwyn R.
2008-01-01
The Arabidopsis thaliana decapping enzyme (AtDcp2) was characterized by bioinformatics analysis and by biochemical studies of the enzyme and mutants produced by recombinant expression. Three functionally significant regions were detected: (i) a highly disordered C-terminal region with a putative PSD-95, Discs-large, ZO-1 (PDZ) domain-binding motif, (ii) a conserved Nudix box constituting the putative active site and (iii) a putative RNA binding domain consisting of the conserved Box B and a preceding loop region. Mutation of the putative PDZ domain-binding motif improved the stability of recombinant AtDcp2 and secondary mutants expressed in Escherichia coli. Such recombinant AtDcp2 specifically hydrolysed capped mRNA to produce 7-methyl GDP and decapped RNA. AtDcp2 activity was Mn2+- or Mg2+-dependent and was inhibited by the product 7-methyl GDP. Mutation of the conserved glutamate-154 and glutamate-158 in the Nudix box reduced AtDcp2 activity up to 400-fold and showed that AtDcp2 employs the catalytic mechanism conserved amongst Nudix hydrolases. Unlike many Nudix hydrolases, AtDcp2 is refractory to inhibition by fluoride ions. Decapping was dependent on binding to the mRNA moiety rather than to the 7-methyl diguanosine triphosphate cap of the substrate. Mutational analysis of the putative RNA-binding domain confirmed the functional significance of an 11-residue loop region and the conserved Box B. PMID:18025047
DOE Office of Scientific and Technical Information (OSTI.GOV)
Watson, M.; Yamamura, H.I.; Roeske, W.R.
The binding and regulation of selected muscarinic agonists to putative subtypes in rat cerebral cortex and heart were studied. Parallel inhibition studies of (/sup 3/H)pirenzepine ((/sup 3/H)PZ) and (-)-(/sup 3/H)quinuclidinylbenzilate ((-)-(/sup 3/H)QNB)-labeled membranes were done with and without 30 microM guanyl-5'-yl imidodiphosphate (Gpp(NH)p) at 25 degrees C in 10 mM Na-K-phosphate buffer which enhances PZ binding affinity and in modified Krebs-phosphate buffer, which mimics physiological conditions. Classical agonists such as carbachol, oxotremorine and acetylcholine inhibited (-)-(/sup 3/H)QNB binding to membranes with shallow Hill values (nH less than 1), were better fit to a 2-state model, were Gpp(NH)p-regulated and showed lowermore » affinity in modified Krebs-phosphate buffer than in 10 mM Na-K-phosphate buffer. Some agonists were not significantly better fit to a 2-state model in (/sup 3/H)PZ-labeled cortical membranes, especially in 10 mM Na-K-phosphate buffer. Whereas putative M1 and M2 binding sites distinguished by PZ possessed multiple agonist affinity states, as judged by carbachol, and agonist binding to (/sup 3/H)PZ-labeled sites were Gpp(NH)p modulated, the partial agonist pilocarpine and nonclassical agonist McN-A-343 (3-(m-chlorophenylcarbamoyloxy)-2-butynyl trimethylammonium chloride) showed little Gpp(NH)p-induced shift in (/sup 3/H)PZ-labeled cortical membranes in physiological conditions. Agonist binding to (-)-(/sup 3/H)QNB-labeled putative M2 cardiac sites was more sensitive to Gpp(NH)p than (-)-(/sup 3/H)QNB-labeled cortical sites. Carbachol and acetylcholine showed significant selectivity for putative M2 sites.« less
Sinner, Moritz F.; Stepas, Katherine A.; Moser, Carlee B.; Krijthe, Bouwe P.; Aspelund, Thor; Sotoodehnia, Nona; Fontes, João D.; Janssens, A. Cecile J.W.; Kronmal, Richard A.; Magnani, Jared W.; Witteman, Jacqueline C.; Chamberlain, Alanna M.; Lubitz, Steven A.; Schnabel, Renate B.; Vasan, Ramachandran S.; Wang, Thomas J.; Agarwal, Sunil K.; McManus, David D.; Franco, Oscar H.; Yin, Xiaoyan; Larson, Martin G.; Burke, Gregory L.; Launer, Lenore J.; Hofman, Albert; Levy, Daniel; Gottdiener, John S.; Kääb, Stefan; Couper, David; Harris, Tamara B.; Astor, Brad C.; Ballantyne, Christie M.; Hoogeveen, Ron C.; Arai, Andrew E.; Soliman, Elsayed Z.; Ellinor, Patrick T.; Stricker, Bruno H.C.; Gudnason, Vilmundur; Heckbert, Susan R.; Pencina, Michael J.; Benjamin, Emelia J.; Alonso, Alvaro
2014-01-01
Aims B-type natriuretic peptide (BNP) and C-reactive protein (CRP) predict atrial fibrillation (AF) risk. However, their risk stratification abilities in the broad community remain uncertain. We sought to improve risk stratification for AF using biomarker information. Methods and results We ascertained AF incidence in 18 556 Whites and African Americans from the Atherosclerosis Risk in Communities Study (ARIC, n=10 675), Cardiovascular Health Study (CHS, n = 5043), and Framingham Heart Study (FHS, n = 2838), followed for 5 years (prediction horizon). We added BNP (ARIC/CHS: N-terminal pro-B-type natriuretic peptide; FHS: BNP), CRP, or both to a previously reported AF risk score, and assessed model calibration and predictive ability [C-statistic, integrated discrimination improvement (IDI), and net reclassification improvement (NRI)]. We replicated models in two independent European cohorts: Age, Gene/Environment Susceptibility Reykjavik Study (AGES), n = 4467; Rotterdam Study (RS), n = 3203. B-type natriuretic peptide and CRP were significantly associated with AF incidence (n = 1186): hazard ratio per 1-SD ln-transformed biomarker 1.66 [95% confidence interval (CI), 1.56–1.76], P < 0.0001 and 1.18 (95% CI, 1.11–1.25), P < 0.0001, respectively. Model calibration was sufficient (BNP, χ2 = 17.0; CRP, χ2 = 10.5; BNP and CRP, χ2 = 13.1). B-type natriuretic peptide improved the C-statistic from 0.765 to 0.790, yielded an IDI of 0.027 (95% CI, 0.022–0.032), a relative IDI of 41.5%, and a continuous NRI of 0.389 (95% CI, 0.322–0.455). The predictive ability of CRP was limited (C-statistic increment 0.003). B-type natriuretic peptide consistently improved prediction in AGES and RS. Conclusion B-type natriuretic peptide, not CRP, substantially improved AF risk prediction beyond clinical factors in an independently replicated, heterogeneous population. B-type natriuretic peptide may serve as a benchmark to evaluate novel putative AF risk biomarkers. PMID:25037055
... Cancer Therapy Glucose Tests Gonorrhea Testing Gram Stain Growth Hormone Haptoglobin hCG Pregnancy hCG Tumor Marker HDL Cholesterol ... Semen Analysis Serotonin Serum Free Light Chains Sex Hormone Binding Globulin ... Transferrin Receptor Stool Culture Stool Elastase Strep ...
Global Analysis of Photosynthesis Transcriptional Regulatory Networks
Imam, Saheed; Noguera, Daniel R.; Donohue, Timothy J.
2014-01-01
Photosynthesis is a crucial biological process that depends on the interplay of many components. This work analyzed the gene targets for 4 transcription factors: FnrL, PrrA, CrpK and MppG (RSP_2888), which are known or predicted to control photosynthesis in Rhodobacter sphaeroides. Chromatin immunoprecipitation followed by high-throughput sequencing (ChIP-seq) identified 52 operons under direct control of FnrL, illustrating its regulatory role in photosynthesis, iron homeostasis, nitrogen metabolism and regulation of sRNA synthesis. Using global gene expression analysis combined with ChIP-seq, we mapped the regulons of PrrA, CrpK and MppG. PrrA regulates ∼34 operons encoding mainly photosynthesis and electron transport functions, while CrpK, a previously uncharacterized Crp-family protein, regulates genes involved in photosynthesis and maintenance of iron homeostasis. Furthermore, CrpK and FnrL share similar DNA binding determinants, possibly explaining our observation of the ability of CrpK to partially compensate for the growth defects of a ΔFnrL mutant. We show that the Rrf2 family protein, MppG, plays an important role in photopigment biosynthesis, as part of an incoherent feed-forward loop with PrrA. Our results reveal a previously unrealized, high degree of combinatorial regulation of photosynthetic genes and significant cross-talk between their transcriptional regulators, while illustrating previously unidentified links between photosynthesis and the maintenance of iron homeostasis. PMID:25503406
Global analysis of photosynthesis transcriptional regulatory networks.
Imam, Saheed; Noguera, Daniel R; Donohue, Timothy J
2014-12-01
Photosynthesis is a crucial biological process that depends on the interplay of many components. This work analyzed the gene targets for 4 transcription factors: FnrL, PrrA, CrpK and MppG (RSP_2888), which are known or predicted to control photosynthesis in Rhodobacter sphaeroides. Chromatin immunoprecipitation followed by high-throughput sequencing (ChIP-seq) identified 52 operons under direct control of FnrL, illustrating its regulatory role in photosynthesis, iron homeostasis, nitrogen metabolism and regulation of sRNA synthesis. Using global gene expression analysis combined with ChIP-seq, we mapped the regulons of PrrA, CrpK and MppG. PrrA regulates ∼34 operons encoding mainly photosynthesis and electron transport functions, while CrpK, a previously uncharacterized Crp-family protein, regulates genes involved in photosynthesis and maintenance of iron homeostasis. Furthermore, CrpK and FnrL share similar DNA binding determinants, possibly explaining our observation of the ability of CrpK to partially compensate for the growth defects of a ΔFnrL mutant. We show that the Rrf2 family protein, MppG, plays an important role in photopigment biosynthesis, as part of an incoherent feed-forward loop with PrrA. Our results reveal a previously unrealized, high degree of combinatorial regulation of photosynthetic genes and significant cross-talk between their transcriptional regulators, while illustrating previously unidentified links between photosynthesis and the maintenance of iron homeostasis.
Ganguly, Rituparna; Sahu, Soumyadip; Ohanyan, Vahagn; Haney, Rebecca; Chavez, Ronaldo J.; Shah, Shivani; Yalamanchili, Siri; Raman, Priya
2017-01-01
Increasing evidence suggests thrombospondin-1 (TSP-1), a potent proatherogenic matricellular protein, as a putative link between hyperglycemia and atherosclerotic complications in diabetes. We previously reported that the micronutrient chromium picolinate (CrP), with long-standing cardiovascular benefits, inhibits TSP-1 expression in glucose-stimulated human aortic smooth muscle cells in vitro. Here, we investigated the atheroprotective action of orally administered CrP in type 1 diabetic apolipoprotein E-deficient (ApoE−/−) mice and elucidated the role of TSP-1 in this process. CrP decreased lipid burden and neointimal thickness in aortic root lesions of hyperglycemic ApoE−/− mice; also, smooth muscle cell (SMC), macrophage and leukocyte abundance was prevented coupled with reduced cell proliferation. Attenuated lesion progression was accompanied with inhibition of hyperglycemia-induced TSP-1 expression and reduced protein O-glycosylation following CrP treatment; also, PCNA and vimentin (SMC synthetic marker) expression were reduced while SM-MHC (SMC contractile marker) levels were increased. To confirm a direct role of TSP-1 in diabetic atherosclerosis, hyperglycemic TSP-1−/−/ApoE−/− double knockout mice were compared with age-matched hyperglycemic ApoE−/− littermates. Lack of TSP-1 prevented lesion formation in hyperglycemic ApoE−/− mice, mimicking the atheroprotective phenotype of CrP-treated mice. These results suggest that therapeutic TSP-1 inhibition may have important atheroprotective potential in diabetic vascular disease. PMID:28345659
Torres-Escobar, Ascención; Juárez-Rodríguez, María Dolores; Lamont, Richard J.
2013-01-01
Autoinducer-2 (AI-2) is required for biofilm formation and virulence of the oral pathogen Aggregatibacter actinomycetemcomitans, and we previously showed that lsrB codes for a receptor for AI-2. The lsrB gene is expressed as part of the lsrACDBFG operon, which is divergently transcribed from an adjacent lsrRK operon. In Escherichia coli, lsrRK encodes a repressor and AI-2 kinase that function to regulate lsrACDBFG. To determine if lsrRK controls lsrACDBFG expression and influences biofilm growth of A. actinomycetemcomitans, we first defined the promoters for each operon. Transcriptional reporter plasmids containing the 255-bp lsrACDBFG-lsrRK intergenic region (IGR) fused to lacZ showed that essential elements of lsrR promoter reside 89 to 255 bp upstream from the lsrR start codon. Two inverted repeat sequences that represent potential binding sites for LsrR and two sequences resembling the consensus cyclic AMP receptor protein (CRP) binding site were identified in this region. Using electrophoretic mobility shift assay (EMSA), purified LsrR and CRP proteins were shown to bind probes containing these sequences. Surprisingly, the 255-bp IGR did not contain the lsrA promoter. Instead, a fragment encompassing nucleotides +1 to +159 of lsrA together with the 255-bp IGR was required to promote lsrA transcription. This suggests that a region within the lsrA coding sequence influences transcription, or alternatively that the start codon of A. actinomycetemcomitans lsrA has been incorrectly annotated. Transformation of ΔlsrR, ΔlsrK, ΔlsrRK, and Δcrp deletion mutants with lacZ reporters containing the lsrA or lsrR promoter showed that LsrR negatively regulates and CRP positively regulates both lsrACDBFG and lsrRK. However, in contrast to what occurs in E. coli, deletion of lsrK had no effect on the transcriptional activity of the lsrA or lsrR promoters, suggesting that another kinase may be capable of phosphorylating AI-2 in A. actinomycetemcomitans. Finally, biofilm formation of the ΔlsrR, ΔlsrRK, and Δcrp mutants was significantly reduced relative to that of the wild type, indicating that proper regulation of the lsr locus is required for optimal biofilm growth by A. actinomycetemcomitans. PMID:23104800
Montgomery, H J; Romanov, V; Guillemette, J G
2000-02-18
Neuronal nitric-oxide synthase (NOS) and endothelial NOS are constitutive NOS isoforms that are activated by binding calmodulin in response to elevated intracellular calcium. In contrast, the inducible NOS isoform binds calmodulin at low basal levels of calcium in resting cells. Primary sequence comparisons show that each constitutive NOS isozyme contains a polypeptide segment within its reductase domain, which is absent in the inducible NOS enzyme. To study a possible link between the presence of these additional polypeptide segments in constitutive NOS enzymes and their calcium-dependent calmodulin activation, three deletion mutants were created. The putative inhibitory insert was removed from the FMN binding regions of the neuronal NOS holoenzyme and from two truncated neuronal NOS reductase enzymes in which the calmodulin binding region was either included or deleted. All three mutant enzymes showed reduced incorporation of FMN and required reconstitution with exogenous FMN for activity. The combined removal of both the calmodulin binding domain and the putative inhibitory insert did not result in a calmodulin-independent neuronal NOS reductase. Thus, although the putative inhibitory element has an effect on the calcium-dependent calmodulin activation of neuronal NOS, it does not have the properties of the typical autoinhibitory domain found in calmodulin-activated enzymes.
Lijun Liu; Trevor Ramsay; Matthew S. Zinkgraf; David Sundell; Nathaniel Robert Street; Vladimir Filkov; Andrew Groover
2015-01-01
Identifying transcription factor target genes is essential for modeling the transcriptional networks underlying developmental processes. Here we report a chromatin immunoprecipitation sequencing (ChIP-seq) resource consisting of genome-wide binding regions and associated putative target genes for four Populus homeodomain transcription factors...
Over-expression of phage HK022 Nun protein is toxic for Escherichia coli
Uc-Mass, Augusto; Khodursky, Arkady; Brown, Lewis; Gottesman, Max E.
2008-01-01
The Nun protein of coliphage HK022 excludes superinfecting λ phage. Nun recognizes and binds to the N utilization (nut) sites on phage λ nascent RNA and induces transcription termination. Over-expression of Nun from a high-copy plasmid is toxic for E.coli, despite the fact that nut sites are not encoded in the E.coli genome. Cells expressing Nun cannot exit stationary phase. Toxicity is related to transcription termination, since host and nun mutations that block termination also suppress cell killing. Nun inhibits expression of wild-type lacZ, but not lacZ expressed from the Crp/cAMP–independent lacUV5 promoter. Microarray and proteomics analyses show Nun down-regulates crp and tnaA. Crp over-expression and high indole concentrations partially reverse Nun-mediated toxicity and restore lacZ expression. PMID:18571198
Larson, Leila Margaret; Addo, O Yaw; Sandalinas, Fanny; Faigao, Katherine; Kupka, Roland; Flores-Ayala, Rafael; Suchdev, Parminder S
2017-04-01
Vitamin A deficiency (VAD) is an important contributor to child morbidity and mortality. The prevalence of VAD, measured by retinol-binding protein (RBP) or retinol, is overestimated in populations with a high prevalence of inflammation. We aimed to quantify and adjust for the effect of inflammation on VAD prevalence in a nationally representative survey of Liberian children 6 to 35 months of age. We compared five approaches to adjust RBP for inflammation and estimate VAD prevalence (defined as RBP < 0.7 µmol/L): (1) ignoring inflammation; (2) excluding individuals with inflammation (C-reactive protein (CRP) >5 mg/L or alpha1-acid glycoprotein (AGP) >1 g/)L; (3) multiplying each individual's RBP by an internal correction factor; (4) by an external correction factor; and (5) using regression (corrected RBP = exp(InRBP - β 1 (lnCRP obs -lnCRP ref ) - β 2 (lnAGP obs -lnAGP ref )). Corrected RBP was based on a regression model where reference lnCRP and lnAGP were set to the maximum of the lowest decile. The unadjusted prevalence of VAD was 24.7%. Children with elevated CRP and/or AGP had significantly lower RBP concentrations than their apparently healthy peers (geometric mean RBP 0.79 µmol/L (95% CI: 0.76, 0.82) vs. 0.95 µmol/L (95% CI: 0.92, 0.97), P < 0.001). Using approaches 2-5 resulted in a prevalence of VAD of 11.6%, 14.3%, 13.5% and 7.3%, respectively. Depending on the approach, the VAD prevalence is reduced 10-17 percentage points when inflammation is taken into account. Further quantification of the influence of inflammation on biomarkers of vitamin A status from other national surveys is needed to compare and recommend the preferred adjustment approach across populations. © 2016 John Wiley & Sons Ltd.
Bustamante, Alejandro; Vilar-Bergua, Andrea; Guettier, Sophie; Sánchez-Poblet, Josep; García-Berrocoso, Teresa; Giralt, Dolors; Fluri, Felix; Topakian, Raffi; Worthmann, Hans; Hug, Andreas; Molnar, Tihamer; Waje-Andreassen, Ulrike; Katan, Mira; Smith, Craig J; Montaner, Joan
2017-04-01
We conducted a systematic review and individual participant data meta-analysis to explore the role of C-reactive protein (CRP) in early detection or prediction of post-stroke infections. CRP, an acute-phase reactant binds to the phosphocholine expressed on the surface of dead or dying cells and some bacteria, thereby activating complement and promoting phagocytosis by macrophages. We searched PubMed up to May-2015 for studies measuring CRP in stroke and evaluating post-stroke infections. Individual participants' data were merged into a single database. CRP levels were standardized and divided into quartiles. Factors independently associated with post-stroke infections were determined by logistic regression analysis and the additional predictive value of CRP was assessed by comparing areas under receiver operating characteristic curves and integrated discrimination improvement index. Data from seven studies including 699 patients were obtained. Standardized CRP levels were higher in patients with post-stroke infections beyond 24 h. Standardized CRP levels in the fourth quartile were independently associated with infection in two different logistic regression models, model 1 [stroke severity and dysphagia, odds ratio = 9.70 (3.10-30.41)] and model 2 [age, sex, and stroke severity, odds ratio = 3.21 (1.93-5.32)]. Addition of CRP improved discrimination in both models [integrated discrimination improvement = 9.83% (0.89-18.77) and 5.31% (2.83-7.79), respectively], but accuracy was only improved for model 1 (area under the curve 0.806-0.874, p = 0.036). In this study, CRP was independently associated with development of post-stroke infections, with the optimal time-window for measurement at 24-48 h. However, its additional predictive value is moderate over clinical information. Combination with other biomarkers in a panel seems a promising strategy for future studies. © 2017 International Society for Neurochemistry.
Sun, Liying; Andika, Ida Bagus; Shen, Jiangfeng; Yang, Di; Ratti, Claudio; Chen, Jianping
2013-10-01
Some viruses use alternative translation initiation at non-AUG codons as a strategy to produce multiple proteins during gene expression. Here we show that, using this strategy, Chinese wheat mosaic virus (CWMV; Furovirus) expresses a larger form of coat protein (N-ext/CP) in infected plants. Site-directed mutagenesis and transient expression analysis confirmed that CWMV N-ext/CP is initiated at an upstream in-frame CUG codon at nucleotide position 207-209 of RNA 2, which adds a 39 amino acid (aa) N-terminal extension to the major CP. Interestingly, in planta and in vitro analyses indicated that CWMV N-ext/CP but not CP interacts with the CWMV cysteine-rich protein (CRP), an RNA silencing suppressor. We further determined that the N-terminal 39 aa extension, particularly the 10 aa region immediately upstream of the major CP coding region is responsible for the interaction of N-ext/CP with CRP. In an Agrobacterium co-infiltration assay, co-expression with N-ext/CP did not affect CRP silencing suppression activity. Thus the alternative translation initiation at a CUG codon provides the CWMV N-ext/CP with the ability to bind to the viral silencing suppressor. Copyright © 2013 Elsevier B.V. All rights reserved.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Norman, A.B.; Creese, I.
1986-03-01
The EC/sub 50/ of EEDQ for the inhibition of (/sup 3/H)(-)QNB binding in vitro was approximately 3 fold lower for homogenates of hippocampus than brainstem (containing predominantly putative M/sub 1/ and M/sub 2/ muscarinic receptor subtypes respectively). Furthermore, the time-dependent loss of (/sup 3/H)(-)QNB binding produced by 100 ..mu..M EEDQ was faster in homogenates of hippocampus than brainstem. Administration of EEDQ (20 mg/kg i.p.) irreversibly reduced the Bmax of (/sup 3/H)(-)QNB binding by 56% and 34% in hippocampus and brainstem respectively. Pirenzepine competition for the remaining (/sup 3/H)(-)QNB binding sites following in vitro and in vivo treatment with EEDQ revealedmore » a significant increase in the proportion of (/sup 3/H)(-)QNB binding sites having low affinity for pirenzepine (M/sub 2/ receptors), indicating that the high affinity pirenzepine binding sites (M/sub 1/ receptors) were selectively and irreversibly lost. Thus, EEDQ discriminates the same putative M/sub 1/ and M/sub 2/ muscarinic receptor subtypes that are discriminated by pirenzepine. The reduction of (/sup 3/H)(-)QNB binding could be prevented both in vitro and in vivo by atropine or scopolamine. These data may indicate differences in the accessibility of these putative receptor subtypes to EEDQ or, alternatively, differences in the availability of carboxyl groups able to interact with EEDQ at the ligand recognition site of M/sub 1/ and M/sub 2/ muscarinic receptors.« less
Hugouvieux-Cotte-Pattat, Nicole; Shevchik, Vladimir E.; Nasser, William
2002-01-01
Erwinia chrysanthemi 3937 secretes an arsenal of pectinolytic enzymes, including at least eight endo-pectate lyases encoded by pel genes, which play a major role in the soft-rot disease caused by this bacterium on various plants. E. chrysanthemi also produces some hydrolases that cleave pectin. Three adjacent hydrolase genes, pehV, pehW, and pehX, encoding exo-poly-α-d-galacturonosidases, have been characterized. These enzymes liberate digalacturonides from the nonreducing end of pectin. We report the identification of a novel gene, named pehN, encoding a protein homologous to the glycosyl hydrolases of family 28, which includes mainly polygalacturonases. PehN has a low hydrolase activity on polygalacturonate and on various pectins. PehN action favors the activity of the secreted endo-pectate lyases, mainly PelB and PelC, and that of the periplasmic exo-pectate lyase PelX. However, removal of the pehN gene does not significantly alter the virulence of E. chrysanthemi. Regulation of pehN transcription was analyzed by using gene fusions. Like other pectinase genes, pehN transcription is dependent on several environmental conditions. It is induced by pectic catabolic products and is affected by growth phase, catabolite repression, osmolarity, anaerobiosis, nitrogen starvation, and the presence of calcium ions. The transcription of pehN is modulated by the repressor KdgR, which controls almost all the steps of pectin catabolism, and by cyclic AMP receptor protein (CRP), the global activator of sugar catabolism. The regulator PecS, which represses the transcription of the pel genes but activates that of pehV, pehW, and pehX, also activates transcription of pehN. The three regulators KdgR, PecS, and CRP act by direct interaction with the pehN promoter region. The sequences involved in the binding of these three regulators and of RNA polymerase have been precisely defined. Analysis of the simultaneous binding of these proteins indicates that CRP and RNA polymerase bind cooperatively and that the binding of KdgR could prevent pehN transcription. In contrast, the activator effect of PecS is not linked to competition with KdgR or to cooperation with CRP or RNA polymerase. This effect probably results from competition between PecS and an unidentified repressor involved in peh regulation. PMID:11976295
Regulation of the alpha-glucuronidase-encoding gene ( aguA) from Aspergillus niger.
de Vries, R P; van de Vondervoort, P J I; Hendriks, L; van de Belt, M; Visser, J
2002-09-01
The alpha-glucuronidase gene aguA from Aspergillus niger was cloned and characterised. Analysis of the promoter region of aguA revealed the presence of four putative binding sites for the major carbon catabolite repressor protein CREA and one putative binding site for the transcriptional activator XLNR. In addition, a sequence motif was detected which differed only in the last nucleotide from the XLNR consensus site. A construct in which part of the aguA coding region was deleted still resulted in production of a stable mRNA upon transformation of A. niger. The putative XLNR binding sites and two of the putative CREA binding sites were mutated individually in this construct and the effects on expression were examined in A. niger transformants. Northern analysis of the transformants revealed that the consensus XLNR site is not actually functional in the aguA promoter, whereas the sequence that diverges from the consensus at a single position is functional. This indicates that XLNR is also able to bind to the sequence GGCTAG, and the XLNR binding site consensus should therefore be changed to GGCTAR. Both CREA sites are functional, indicating that CREA has a strong influence on aguA expression. A detailed expression analysis of aguA in four genetic backgrounds revealed a second regulatory system involved in activation of aguA gene expression. This system responds to the presence of glucuronic and galacturonic acids, and is not dependent on XLNR.
NASA Astrophysics Data System (ADS)
Tsao, Shih-Ming; Lai, Ji-Ching; Horng, Horng-Er; Liu, Tu-Chen; Hong, Chin-Yih
2017-04-01
Aptamers are oligonucleotides that can bind to specific target molecules. Most aptamers are generated using random libraries in the standard systematic evolution of ligands by exponential enrichment (SELEX). Each random library contains oligonucleotides with a randomized central region and two fixed primer regions at both ends. The fixed primer regions are necessary for amplifying target-bound sequences by PCR. However, these extra-sequences may cause non-specific bindings, which potentially interfere with good binding for random sequences. The Magnetic-Assisted Rapid Aptamer Selection (MARAS) is a newly developed protocol for generating single-strand DNA aptamers. No repeat selection cycle is required in the protocol. This study proposes and demonstrates a method to isolate aptamers for C-reactive proteins (CRP) from a randomized ssDNA library containing no fixed sequences at 5‧ and 3‧ termini using the MARAS platform. Furthermore, the isolated primer-free aptamer was sequenced and binding affinity for CRP was analyzed. The specificity of the obtained aptamer was validated using blind serum samples. The result was consistent with monoclonal antibody-based nephelometry analysis, which indicated that a primer-free aptamer has high specificity toward targets. MARAS is a feasible platform for efficiently generating primer-free aptamers for clinical diagnoses.
The LacI family protein GlyR3 co-regulates the celC operon and manB in Clostridium thermocellum
Choi, Jinlyung; Klingeman, Dawn M.; Brown, Steven D.; ...
2017-06-24
In this paper, we demonstrate that the GlyR3 protein mediates the regulation of manB. We first identify putative GlyR3 binding sites within or just upstream of the coding regions of manB and celT. Using an electrophoretic mobility shift assay (EMSA), we determined that a higher concentration of GlyR3 is required to effectively bind to the putative manB site in comparison to the celC site. Neither the putative celT site nor random DNA significantly binds GlyR3. While laminaribiose interfered with GlyR3 binding to the celC binding site, binding to the manB site was unaffected. In the presence of laminaribiose, in vivomore » transcription of the celC–glyR3–licA gene cluster increases, while manB expression is repressed, compared to in the absence of laminaribiose, consistent with the results from the EMSA. An in vitro transcription assay demonstrated that GlyR3 and laminaribiose interactions were responsible for the observed patters of in vivo transcription.« less
DOE Office of Scientific and Technical Information (OSTI.GOV)
Short, M.T.; Osmand, A.P.
The acute phase of inflammation is characterized by numerous changes in blood composition, perhaps the most dramatic of these being the elevation of C-reactive protein levels. C-reactive protein (CRP) is known to bind to molecules containing phosphocholine-substituents following reaction with Ca/sup 2 +/ ions. Lumines
Donovan, Grant T.; Norton, J. Paul; Bower, Jean M.
2013-01-01
In many bacteria, the second messenger cyclic AMP (cAMP) interacts with the transcription factor cAMP receptor protein (CRP), forming active cAMP-CRP complexes that can control a multitude of cellular activities, including expanded carbon source utilization, stress response pathways, and virulence. Here, we assessed the role of cAMP-CRP as a regulator of stress resistance and virulence in uropathogenic Escherichia coli (UPEC), the principal cause of urinary tract infections worldwide. Deletion of genes encoding either CRP or CyaA, the enzyme responsible for cAMP synthesis, attenuates the ability of UPEC to colonize the bladder in a mouse infection model, dependent on intact innate host defenses. UPEC mutants lacking cAMP-CRP grow normally in the presence of glucose but are unable to utilize alternate carbon sources like amino acids, the primary nutrients available to UPEC within the urinary tract. Relative to the wild-type UPEC isolate, the cyaA and crp deletion mutants are sensitive to nitrosative stress and the superoxide generator methyl viologen but remarkably resistant to hydrogen peroxide (H2O2) and acid stress. In the mutant strains, H2O2 resistance correlates with elevated catalase activity attributable in part to enhanced translation of the alternate sigma factor RpoS. Acid resistance was promoted by both RpoS-independent and RpoS-dependent mechanisms, including expression of the RpoS-regulated DNA-binding ferritin-like protein Dps. We conclude that balanced input from many cAMP-CRP-responsive elements, including RpoS, is critical to the ability of UPEC to handle the nutrient limitations and severe environmental stresses present within the mammalian urinary tract. PMID:23115037
Liu, Lijun; Ramsay, Trevor; Zinkgraf, Matthew; Sundell, David; Street, Nathaniel Robert; Filkov, Vladimir; Groover, Andrew
2015-06-01
Identifying transcription factor target genes is essential for modeling the transcriptional networks underlying developmental processes. Here we report a chromatin immunoprecipitation sequencing (ChIP-seq) resource consisting of genome-wide binding regions and associated putative target genes for four Populus homeodomain transcription factors expressed during secondary growth and wood formation. Software code (programs and scripts) for processing the Populus ChIP-seq data are provided within a publically available iPlant image, including tools for ChIP-seq data quality control and evaluation adapted from the human Encyclopedia of DNA Elements (ENCODE) project. Basic information for each transcription factor (including members of Class I KNOX, Class III HD ZIP, BEL1-like families) binding are summarized, including the number and location of binding regions, distribution of binding regions relative to gene features, associated putative target genes, and enriched functional categories of putative target genes. These ChIP-seq data have been integrated within the Populus Genome Integrative Explorer (PopGenIE) where they can be analyzed using a variety of web-based tools. We present an example analysis that shows preferential binding of transcription factor ARBORKNOX1 to the nearest neighbor genes in a pre-calculated co-expression network module, and enrichment for meristem-related genes within this module including multiple orthologs of Arabidopsis KNOTTED-like Arabidopsis 2/6. © 2015 Society for Experimental Biology and John Wiley & Sons Ltd This article has been contributed to by US Government employees and their work is in the public domain in the USA.
Regulation of the aceI multidrug efflux pump gene in Acinetobacter baumannii.
Liu, Qi; Hassan, Karl A; Ashwood, Heather E; Gamage, Hasinika K A H; Li, Liping; Mabbutt, Bridget C; Paulsen, Ian T
2018-06-01
To investigate the function of AceR, a putative transcriptional regulator of the chlorhexidine efflux pump gene aceI in Acinetobacter baumannii. Chlorhexidine susceptibility and chlorhexidine induction of aceI gene expression were determined by MIC and quantitative real-time PCR, respectively, in A. baumannii WT and ΔaceR mutant strains. Recombinant AceR was prepared as both a full-length protein and as a truncated protein, AceR (86-299), i.e. AceRt, which has the DNA-binding domain deleted. The binding interaction of the purified AceR protein and its putative operator region was investigated by electrophoretic mobility shift assays and DNase I footprinting assays. The binding of AceRt with its putative ligand chlorhexidine was examined using surface plasmon resonance and tryptophan fluorescence quenching assays. MIC determination assays indicated that the ΔaceI and ΔaceR mutant strains both showed lower resistance to chlorhexidine than the parental strain. Chlorhexidine-induced expression of aceI was abolished in a ΔaceR background. Electrophoretic mobility shift assays and DNase I footprinting assays demonstrated chlorhexidine-stimulated binding of AceR with two sites upstream of the putative aceI promoter. Surface plasmon resonance and tryptophan fluorescence quenching assays suggested that the purified ligand-binding domain of the AceR protein was able to bind with chlorhexidine with high affinity. This study provides strong evidence that AceR is an activator of aceI gene expression when challenged with chlorhexidine. This study is the first characterization, to our knowledge, of a regulator controlling expression of a PACE family multidrug efflux pump.
Childress, Catherine; Feuerbacher, Leigh A.; Phillips, Linda; Burgum, Alex
2013-01-01
Aggregatibacter actinomycetemcomitans, a periodontal pathogen, synthesizes leukotoxin (LtxA), a protein that helps the bacterium evade the host immune response. Transcription of the ltxA operon is induced during anaerobic growth. The cyclic AMP (cAMP) receptor protein (CRP) indirectly increases ltxA expression, but the intermediary regulator is unknown. Integration host factor (IHF) binds to and represses the leukotoxin promoter, but neither CRP nor IHF is responsible for the anaerobic induction of ltxA RNA synthesis. Thus, we have undertaken studies to identify other regulators of leukotoxin transcription and to demonstrate how these proteins work together to modulate leukotoxin synthesis. First, analyses of ltxA RNA expression from defined leukotoxin promoter mutations in the chromosome identify positions −69 to −35 as the key control region and indicate that an activator protein modulates leukotoxin transcription. We show that Mlc, which is a repressor in Escherichia coli, functions as a direct transcriptional activator in A. actinomycetemcomitans; an mlc deletion mutant reduces leukotoxin RNA synthesis, and recombinant Mlc protein binds specifically at the −68 to −40 region of the leukotoxin promoter. Furthermore, we show that CRP activates ltxA expression indirectly by increasing the levels of Mlc. Analyses of Δmlc, Δihf, and Δihf Δmlc strains demonstrate that Mlc can increase RNA polymerase (RNAP) activity directly and that IHF represses ltxA RNA synthesis mainly by blocking Mlc binding. Finally, a Δihf Δmlc mutant still induces ltxA during anaerobic growth, indicating that there are additional factors involved in leukotoxin transcriptional regulation. A model for the coordinated regulation of leukotoxin transcription is presented. PMID:23475968
Osato, Naoki
2018-01-19
Transcriptional target genes show functional enrichment of genes. However, how many and how significantly transcriptional target genes include functional enrichments are still unclear. To address these issues, I predicted human transcriptional target genes using open chromatin regions, ChIP-seq data and DNA binding sequences of transcription factors in databases, and examined functional enrichment and gene expression level of putative transcriptional target genes. Gene Ontology annotations showed four times larger numbers of functional enrichments in putative transcriptional target genes than gene expression information alone, independent of transcriptional target genes. To compare the number of functional enrichments of putative transcriptional target genes between cells or search conditions, I normalized the number of functional enrichment by calculating its ratios in the total number of transcriptional target genes. With this analysis, native putative transcriptional target genes showed the largest normalized number of functional enrichments, compared with target genes including 5-60% of randomly selected genes. The normalized number of functional enrichments was changed according to the criteria of enhancer-promoter interactions such as distance from transcriptional start sites and orientation of CTCF-binding sites. Forward-reverse orientation of CTCF-binding sites showed significantly higher normalized number of functional enrichments than the other orientations. Journal papers showed that the top five frequent functional enrichments were related to the cellular functions in the three cell types. The median expression level of transcriptional target genes changed according to the criteria of enhancer-promoter assignments (i.e. interactions) and was correlated with the changes of the normalized number of functional enrichments of transcriptional target genes. Human putative transcriptional target genes showed significant functional enrichments. Functional enrichments were related to the cellular functions. The normalized number of functional enrichments of human putative transcriptional target genes changed according to the criteria of enhancer-promoter assignments and correlated with the median expression level of the target genes. These analyses and characters of human putative transcriptional target genes would be useful to examine the criteria of enhancer-promoter assignments and to predict the novel mechanisms and factors such as DNA binding proteins and DNA sequences of enhancer-promoter interactions.
Fang, Caiyun; Zhang, Lei; Zhang, Xiaoqin; Lu, Haojie
2015-06-21
Metal binding proteins play many important roles in a broad range of biological processes. Characterization of metal binding proteins is important for understanding their structure and biological functions, thus leading to a clear understanding of metal associated diseases. The present study is the first to investigate the effectiveness of magnetic microspheres functionalized with metal cations (Ca(2+), Cu(2+), Zn(2+) and Fe(3+)) as the absorbent matrix in IMAC technology to enrich metal containing/binding proteins. The putative metal binding proteins in rat liver were then globally characterized by using this strategy which is very easy to handle and can capture a number of metal binding proteins effectively. In total, 185 putative metal binding proteins were identified from rat liver including some known less abundant and membrane-bound metal binding proteins such as Plcg1, Acsl5, etc. The identified proteins are involved in many important processes including binding, catalytic activity, translation elongation factor activity, electron carrier activity, and so on.
The Long Pentraxin PTX3 Promotes Fibrocyte Differentiation
Pilling, Darrell; Cox, Nehemiah; Vakil, Varsha; Verbeek, J. Sjef; Gomer, Richard H.
2015-01-01
Monocyte-derived, fibroblast-like cells called fibrocytes are associated with fibrotic lesions. The plasma protein serum amyloid P component (SAP; also known as pentraxin-2, PTX2) inhibits fibrocyte differentiation in vitro, and injections of SAP inhibit fibrosis in vivo. SAP is a member of the pentraxin family of proteins that includes C-reactive protein (CRP; PTX1) and pentraxin-3 (PTX3). All three pentraxins are associated with fibrosis, but only SAP and CRP have been studied for their effects on fibrocyte differentiation. We find that compared to SAP and CRP, PTX3 promotes human and murine fibrocyte differentiation. The effect of PTX3 is dependent on FcγRI. In competition studies, the fibrocyte-inhibitory activity of SAP is dominant over PTX3. Binding competition studies indicate that SAP and PTX3 bind human FcγRI at different sites. In murine models of lung fibrosis, PTX3 is present in fibrotic areas, and the PTX3 distribution is associated with collagen deposition. In lung tissue from pulmonary fibrosis patients, PTX3 has a widespread distribution, both in unaffected tissue and in fibrotic lesions, whereas SAP is restricted to areas adjacent to vessels, and absent from fibrotic areas. These data suggest that the relative levels of SAP and PTX3 present at sites of fibrosis may have a significant effect on the ability of monocytes to differentiate into fibrocytes. PMID:25774777
Apolipoproteins C-II and C-III as nutritional markers unaffected by inflammation.
Isshiki, Miwa; Hirayama, Satoshi; Ueno, Tsuyoshi; Ito, Masayuki; Furuta, Ayaka; Yano, Kouji; Yamatani, Kotoko; Sugihara, Masami; Idei, Mayumi; Miida, Takashi
2018-06-01
Rapid turnover proteins (RTPs), such as transthyretin (TTR), retinol binding protein (RBP), and transferrin (Tf), provide an accurate assessment of nutritional status but are susceptible to inflammation. Lipid-related markers, which have short half-lives in serum, may be better suited for nutritional assessment. We sought to identify sensitive nutritional markers unaffected by inflammation. Fasting serum samples were collected from 30 malnourished inpatients and 25 healthy volunteers. Malnourished inpatients were divided into 2 groups: a low-C-reactive protein (CRP) group (CRP < 20 mg/l, n = 15) and a high-CRP group (CRP ≥ 20 mg/l, n = 15). Lipid-related markers, traditional nutritional markers, RTPs, micronutrients, and ketone bodies were measured and compared among the groups. Apolipoprotein (Apo)C-II and ApoC-III concentrations were lower in malnourished inpatients than in the control group. There was no significant difference in ApoC-II and ApoC-III between the low- and high-CRP groups. Carnitine transporters and ketone bodies did not show a significant difference among the three groups. Albumin, TTR, RBP, and Tf concentrations were lowest in the high-CRP group, intermediate in the low-CRP group, and highest in the control group. These results indicate that ApoC-II and ApoC-III are appropriate nutritional biomarkers unaffected by inflammation. Copyright © 2018 Elsevier B.V. All rights reserved.
Functionalized nanoparticles for measurement of biomarkers using a SERS nanochannel platform
NASA Astrophysics Data System (ADS)
Benford, Melodie; Wang, Miao; Kameoka, Jun; Good, Theresa; Cote, Gerard
2010-02-01
The overall goal of this research is to develop a new point-of-care system for early detection and characterization of cardiac markers to aid in diagnosis of acute coronary syndrome. The envisioned final technology platform incorporates functionalized gold colloidal nanoparticles trapped at the entrance to a nanofluidic device providing a robust means for analyte detection at trace levels using surface enhanced Raman spectroscopy (SERS). To discriminate a specific biomarker, we designed an assay format analogous to a competitive ELISA. Notably, the biomarker would be captured by an antibody and in turn displace a peptide fragment, containing the binding epitope of the antibody labeled with a Raman reporter molecule that would not interfere with blood serum proteins. To demonstrate the feasibility of this approach, we used C-reactive protein (CRP) as a surrogate biomarker. We functionalized agarose beads with anti-CRP that were placed outside the nanochannel, then added either Rhodamine-6-G (R6G) labeled-CRP and gold (as a surrogate of a sample without analyte present), or R6G labeled CRP, gold, and unlabeled CRP (as a surrogate of a sample with analyte present). Analyzing the spectra we see an increase in peak intensity in the presence of analyte at characteristic peaks for R6G specifically, 1284 and1567 cm- 1. Further, our results illustrate the reproducibility of the Raman spectra collected for R6G-labeled CRP in the nanochannel. Overall, we believe that this method will provide the advantage of sensitivity and narrow line widths characteristic of SERS as well as the specificity toward the biomarker of interest.
Aas, Monica; Dieset, Ingrid; Hope, Sigrun; Hoseth, Eva; Mørch, Ragni; Reponen, Elina; Steen, Nils Eiel; Laskemoen, Jannicke Fjæra; Ueland, Thor; Aukrust, Pål; Agartz, Ingrid; Andreassen, Ole A; Melle, Ingrid
2017-10-01
Several studies have described an association between childhood maltreatment and inflammatory markers in the psychotic disorders (schizophrenia [SZ] and bipolar disorder [BD]). Previous studies have been relatively small (<50 participants), and the severity of abuse and the putative influence of body mass index (BMI) have not been properly investigated. The combined effects of childhood abuse severity and clinical diagnosis on inflammatory markers were investigated in a large sample (n=483) of patients with a disorder on the psychosis spectrum and in healthy controls (HCs). Plasma levels of inflammatory markers (high-sensitivity C-reactive protein [hs-CRP], soluble tumor necrosis factor receptor type 1 [TNFR-R1], glycoprotein 130 [gp130]) were analyzed, and BMI and data on childhood trauma events, on the basis of the Childhood Trauma Questionnaire (CTQ), were obtained from all participants. Patients had increased levels of hs-CRP (P<0.001, Cohens d=0.4), lower levels of gp130 (P<0.001, Cohens d=0.5), higher BMI (P<0.001, Cohens d=0.5) and reported more childhood maltreatment experiences (P<0.001, Cohens d=1.2) than the HC group. The severity of childhood abuse (up to three types of abuse: sexual abuse, physical abuse, and emotional abuse) was associated with elevated BMI (f=8.46, P<0.001, Cohen's d=0.5) and hs-CRP (f=5.47, P=0.001, Cohen's d=0.3). Combined effects of patient status and severity of childhood abuse were found for elevated hs-CRP (f=4.76, P<0.001, Cohen's d=0.4). Differences among the groups disappeared when BMI was added to the model. Trauma-altered immune activation via elevated hs-CRP in patients with SZ and BD may be mediated by higher BMI; however, the direction of this association needs further clarification. Copyright © 2017 Elsevier Inc. All rights reserved.
Wang, Jie; Feng, Mei-Jun; Zhang, Rui; Yu, De-Min; Zhou, Sai-Jun; Chen, Rui; Yu, Pei
2016-10-01
Oxidized low-density lipoprotein (oxLDL) can bind to β2-glycoprotein I (β2GPI) and C-reactive protein (CRP) to form stable complexes, which exert certain effects in diabetic cardiovascular disease. A previous study by our group has confirmed that the resulting complexes promote atherosclerosis in diabetic BALB/c mice. The present study was designed to investigate the effects and potential mechanisms of oxLDL complexes on lipid accumulation and inflammatory reactions in RAW264.7 macrophages cultured in a hyperglycemic environment. Cultured cells were divided into seven groups, which were treated with phosphate‑buffered saline (control), CRP, β2GPI, oxLDL, CRP/oxLDL, oxLDL/β2GPI or CRP/oxLDL/β2GPI. The results revealed the formation of foam cells in the oxLDL, CRP/oxLDL, oxLDL/β2GPI as well as CRP/oxLDL/β2GPI groups. Compared with oxLDL, the three complexes induced less lipid accumulation (P<0.05) through inhibiting the expression of CD36 mRNA and promoting the expression of and ABCG1 mRNA (P<0.05 vs. oxLDL). Furthermore, the levels of inflammatory factors interleukin (IL)‑1β, IL‑6 and tumor necrosis factor‑α were elevated in the CRP/oxLDL and CRP/oxLDL/β2GPI groups (P>0.05 vs. oxLDL), and obvious effects on p38/mitogen‑activated protein kinase and nuclear factor (NF)‑κB phosphorylation were also observed in these groups (P<0.05 vs. oxLDL). These results suggested that CRP/oxLDL/βG2P1 complexes may induce lipid accumulation and inflammation in macrophages via the p38/MAPK and NF‑κB signaling pathways. However, some differences were observed between the complexes, which may be attributed to the property of each constituent; therefore, further studies are required.
Lyell, Noreen L.; Colton, Deanna M.; Bose, Jeffrey L.; Tumen-Velasquez, Melissa P.; Kimbrough, John H.
2013-01-01
Bioluminescence in Vibrio fischeri ES114 is activated by autoinducer pheromones, and this regulation serves as a model for bacterial cell-cell signaling. As in other bacteria, pheromone concentration increases with cell density; however, pheromone synthesis and perception are also modulated in response to environmental stimuli. Previous studies suggested that expression of the pheromone-dependent bioluminescence activator LuxR is regulated in response to glucose by cyclic AMP (cAMP) receptor protein (CRP) (P. V. Dunlap and E. P. Greenberg, J. Bacteriol. 164:45–50, 1985; P. V. Dunlap and E. P. Greenberg, J. Bacteriol. 170:4040–4046, 1988; P. V. Dunlap, J. Bacteriol. 171:1199–1202, 1989; and W. F. Friedrich and E. P. Greenberg, Arch. Microbiol. 134:87–91, 1983). Consistent with this model, we found that bioluminescence in V. fischeri ES114 is modulated by glucose and stimulated by cAMP. In addition, a Δcrp mutant was ∼100-fold dimmer than ES114 and did not increase luminescence in response to added cAMP, even though cells lacking crp were still metabolically capable of producing luminescence. We further discovered that CRP regulates not only luxR but also the alternative pheromone synthase gene ainS. We found that His-tagged V. fischeri CRP could bind sequences upstream of both luxR and ainS, supporting bioinformatic predictions of direct regulation at both promoters. Luminescence increased in response to cAMP if either the ainS or luxR system was under native regulation, suggesting cAMP-CRP significantly increases luminescence through both systems. Finally, using transcriptional reporters in transgenic Escherichia coli, we elucidated two additional regulatory connections. First, LuxR-independent basal transcription of the luxI promoter was enhanced by CRP. Second, the effect of CRP on the ainS promoter depended on whether the V. fischeri regulatory gene litR was also introduced. These results suggest an integral role for CRP in pheromone signaling that goes beyond sensing cell density. PMID:23995643
Thrombopoietin contributes to enhanced platelet activation in patients with unstable angina.
Lupia, Enrico; Bosco, Ornella; Bergerone, Serena; Dondi, Anna Erna; Goffi, Alberto; Oliaro, Elena; Cordero, Marco; Del Sorbo, Lorenzo; Trevi, Giampaolo; Montrucchio, Giuseppe
2006-12-05
We sought to investigate the potential role of elevated levels of thrombopoietin (TPO) in platelet activation during unstable angina (UA). Thrombopoietin is a humoral growth factor that does not induce platelet aggregation per se, but primes platelet activation in response to several agonists. No data concerning its contribution to platelet function abnormalities described in patients with UA are available. We studied 15 patients with UA and, as controls, 15 patients with stable angina (SA) and 15 healthy subjects. We measured TPO and C-reactive protein (CRP), as well as monocyte-platelet binding and the platelet expression of P-selectin and of the TPO receptor, c-Mpl. The priming activity of patient or control plasma on platelet aggregation and monocyte-platelet binding and the role of TPO in this effect also were studied. Patients with UA showed higher circulating TPO levels, as well as increased monocyte-platelet binding, platelet P-selectin expression, and CRP levels, than those with SA and healthy control subjects. The UA patients also showed reduced platelet expression of the TPO receptor, c-Mpl. In vitro, the plasma from UA patients, but not from SA patients or healthy controls, primed platelet aggregation and monocyte-platelet binding, which were both reduced when an inhibitor of TPO was used. Thrombopoietin may enhance platelet activation in the early phases of UA, potentially participating in the pathogenesis of acute coronary syndromes.
Konami, Y; Yamamoto, K; Osawa, T; Irimura, T
1995-04-01
The complete amino acid sequence of a lactose-binding Cytisus sessilifolius anti-H(O) lectin II (CSA-II) was determined using a protein sequencer. After digestion of CSA-II with endoproteinase Lys-C or Asp-N, the resulting peptides were purified by reversed-phase high performance liquid chromatography (HPLC) and then subjected to sequence analysis. Comparison of the complete amino acid sequence of CSA-II with the sequences of other leguminous seed lectins revealed regions of extensive homology. The amino acid sequence of a putative carbohydrate-binding domain of CSA-II was found to be similar to those of several anti-H(O) leguminous lectins, especially to that of the L-fucose-binding Ulex europaeus lectin I (UEA-I).
Galka, Marek M.; Rajagopalan, Nandhakishore; Buhrow, Leann M.; Nelson, Ken M.; Switala, Jacek; Cutler, Adrian J.; Palmer, David R. J.; Loewen, Peter C.; Abrams, Suzanne R.; Loewen, Michele C.
2015-01-01
Abscisic acid ((+)-ABA) is a phytohormone involved in the modulation of developmental processes and stress responses in plants. A chemical proteomics approach using an ABA mimetic probe was combined with in vitro assays, isothermal titration calorimetry (ITC), x-ray crystallography and in silico modelling to identify putative (+)-ABA binding-proteins in crude extracts of Arabidopsis thaliana. Ribulose-1,5-bisphosphate carboxylase/oxygenase (Rubisco) was identified as a putative ABA-binding protein. Radiolabelled-binding assays yielded a Kd of 47 nM for (+)-ABA binding to spinach Rubisco, which was validated by ITC, and found to be similar to reported and experimentally derived values for the native ribulose-1,5-bisphosphate (RuBP) substrate. Functionally, (+)-ABA caused only weak inhibition of Rubisco catalytic activity (Ki of 2.1 mM), but more potent inhibition of Rubisco activation (Ki of ~ 130 μM). Comparative structural analysis of Rubisco in the presence of (+)-ABA with RuBP in the active site revealed only a putative low occupancy (+)-ABA binding site on the surface of the large subunit at a location distal from the active site. However, subtle distortions in electron density in the binding pocket and in silico docking support the possibility of a higher affinity (+)-ABA binding site in the RuBP binding pocket. Overall we conclude that (+)-ABA interacts with Rubisco. While the low occupancy (+)-ABA binding site and weak non-competitive inhibition of catalysis may not be relevant, the high affinity site may allow ABA to act as a negative effector of Rubisco activation. PMID:26197050
Galka, Marek M; Rajagopalan, Nandhakishore; Buhrow, Leann M; Nelson, Ken M; Switala, Jacek; Cutler, Adrian J; Palmer, David R J; Loewen, Peter C; Abrams, Suzanne R; Loewen, Michele C
2015-01-01
Abscisic acid ((+)-ABA) is a phytohormone involved in the modulation of developmental processes and stress responses in plants. A chemical proteomics approach using an ABA mimetic probe was combined with in vitro assays, isothermal titration calorimetry (ITC), x-ray crystallography and in silico modelling to identify putative (+)-ABA binding-proteins in crude extracts of Arabidopsis thaliana. Ribulose-1,5-bisphosphate carboxylase/oxygenase (Rubisco) was identified as a putative ABA-binding protein. Radiolabelled-binding assays yielded a Kd of 47 nM for (+)-ABA binding to spinach Rubisco, which was validated by ITC, and found to be similar to reported and experimentally derived values for the native ribulose-1,5-bisphosphate (RuBP) substrate. Functionally, (+)-ABA caused only weak inhibition of Rubisco catalytic activity (Ki of 2.1 mM), but more potent inhibition of Rubisco activation (Ki of ~ 130 μM). Comparative structural analysis of Rubisco in the presence of (+)-ABA with RuBP in the active site revealed only a putative low occupancy (+)-ABA binding site on the surface of the large subunit at a location distal from the active site. However, subtle distortions in electron density in the binding pocket and in silico docking support the possibility of a higher affinity (+)-ABA binding site in the RuBP binding pocket. Overall we conclude that (+)-ABA interacts with Rubisco. While the low occupancy (+)-ABA binding site and weak non-competitive inhibition of catalysis may not be relevant, the high affinity site may allow ABA to act as a negative effector of Rubisco activation.
Lines, Simon W.; Carter, Angela M.; Dunn, Emma J.; Lindley, Elizabeth J.; Tattersall, James E.; Wright, Mark J.
2014-01-01
Background Vitamin E (VE) bonded polysulfone dialysis membranes have putative erythropoiesis stimulating agent (ESA)-sparing and anti-inflammatory properties based on data from a small number of studies. We sought to investigate this in a large, prospective 12-month randomized controlled trial. Methods Two-hundred and sixty prevalent haemodialysis (HD) patients were randomized to dialysis with VE-bonded polysulfone membranes or non-VE-bonded equivalents. All ESA-dosing was performed by means of a computer-based anaemia management decision support system. Monthly data were used to calculate the ESA resistance index (ERI) and blood tests were performed at baseline, 6 and 12 months for measurement of C-reactive protein (CRP) levels. Results Of the 260 patients, 123 were randomized to dialysis with the VE-membrane and 12-month data was available for 220 patients. At the study population level, no beneficial effect of the VE membranes on the ERI or CRP levels was observed. Post hoc analyses indicated that there was a significant fall in ERI for patients with the highest baseline ESA resistance dialysed with the VE (9.28 [7.70–12.5] versus 7.70 [5.34–12.7] IU/week/kg/g/dL Hb, P = 0.01) but not the control membranes (9.45 [7.62–12.3] versus 8.14 [4.44–15.6] IU/week/kg/g/dL Hb, P = 0.41); this was not attributable to changes in CRP levels. Conclusions Wholesale switching of all chronic HD patients to dialysis with VE-bonded polysulfone membranes appears not to be associated with improvements in ESA-responsiveness or CRP. These membranes may have utility in patients with heightened ESA resistance. PMID:24293660
Noveck, Robert; Stroes, Erik S. G.; Flaim, JoAnn D.; Baker, Brenda F.; Hughes, Steve; Graham, Mark J.; Crooke, Rosanne M.; Ridker, Paul M
2014-01-01
Background C‐reactive protein (CRP) binds to damaged cells, activates the classical complement pathway, is elevated in multiple inflammatory conditions, and provides prognostic information on risk of future atherosclerotic events. It is controversial, however, as to whether inhibiting CRP synthesis would have any direct anti‐inflammatory effects in humans. Methods and Results A placebo‐controlled study was used to evaluate the effects of ISIS 329993 (ISIS‐CRPRx) on the acute‐phase response after endotoxin challenge in 30 evaluable subjects. Healthy adult males were randomly allocated to receive 6 injections over a 22‐day period of placebo or active therapy with ISIS 329993 at 400‐ or 600‐mg doses. Eligible subjects were subsequently challenged with a bolus of endotoxin (2 ng/kg). Inflammatory and hematological biomarkers were measured before and serially after the challenge. ISIS‐CRPRx was well tolerated with no serious adverse events. Median CRP levels increased more than 50‐fold from baseline 24 hours after endotoxin challenge in the placebo group. In contrast, the median increase in CRP levels was attenuated by 37% (400 mg) and 69% (600 mg) in subjects pretreated with ISIS‐CRPRx (P<0.05 vs. placebo). All other aspects of the acute inflammatory response were similar between treatment groups. Conclusion Pretreatment of subjects with ISIS‐CRPRx selectively reduced the endotoxin‐induced increase in CRP levels in a dose‐dependent manner, without affecting other components of the acute‐phase response. These data demonstrate the specificity of antisense oligonucleotides and provide an investigative tool to further define the role of CRP in human pathological conditions. PMID:25012289
Zhu, Y; Lin, E C
1988-05-01
L-Fucose is used by Escherichia coli through an inducible pathway mediated by a fucP-encoded permease, a fucI-encoded isomerase, a fucK-encoded kinase, and a fucA-encoded aldolase. The adolase catalyzes the formation of dihydroxyacetone phosphate and L-lactaldehyde. Anaerobically, lactaldehyde is converted by a fucO-encoded oxidoreductase to L-1,2-propanediol, which is excreted. The fuc genes belong to a regulon comprising four linked operons: fucO, fucA, fucPIK, and fucR. The positive regulator encoded by fucR responds to fuculose 1-phosphate as the effector. Mutants serially selected for aerobic growth on propanediol became constitutive in fucO and fucA [fucO(Con) fucA(Con)], but noninducible in fucPIK [fucPIK(Non)]. An external suppressor mutation that restored growth on fucose caused constitutive expression of fucPIK. Results from this study indicate that this suppressor mutation occurred in crp, which encodes the cyclic AMP-binding (or receptor) protein. When the suppressor allele (crp-201) was transduced into wild-type strains, the recipient became fucose negative and fucose sensitive (with glycerol as the carbon and energy source) because of impaired expression of fucA. The fucPIK operon became hyperinducible. The growth rate on maltose was significantly reduced, but growth on L-rhamnose, D-galactose, L-arabinose, glycerol, or glycerol 3-phosphate was close to normal. Lysogenization of fuc+ crp-201 cells by a lambda bacteriophage bearing crp+ restored normal growth ability on fucose. In contrast, lysogenization of [fucO(Con)fucA(Con)fucPIK(Non)crp-201] cells by the same phage retarded their growth on fucose.
Zhu, Y; Lin, E C
1988-01-01
L-Fucose is used by Escherichia coli through an inducible pathway mediated by a fucP-encoded permease, a fucI-encoded isomerase, a fucK-encoded kinase, and a fucA-encoded aldolase. The adolase catalyzes the formation of dihydroxyacetone phosphate and L-lactaldehyde. Anaerobically, lactaldehyde is converted by a fucO-encoded oxidoreductase to L-1,2-propanediol, which is excreted. The fuc genes belong to a regulon comprising four linked operons: fucO, fucA, fucPIK, and fucR. The positive regulator encoded by fucR responds to fuculose 1-phosphate as the effector. Mutants serially selected for aerobic growth on propanediol became constitutive in fucO and fucA [fucO(Con) fucA(Con)], but noninducible in fucPIK [fucPIK(Non)]. An external suppressor mutation that restored growth on fucose caused constitutive expression of fucPIK. Results from this study indicate that this suppressor mutation occurred in crp, which encodes the cyclic AMP-binding (or receptor) protein. When the suppressor allele (crp-201) was transduced into wild-type strains, the recipient became fucose negative and fucose sensitive (with glycerol as the carbon and energy source) because of impaired expression of fucA. The fucPIK operon became hyperinducible. The growth rate on maltose was significantly reduced, but growth on L-rhamnose, D-galactose, L-arabinose, glycerol, or glycerol 3-phosphate was close to normal. Lysogenization of fuc+ crp-201 cells by a lambda bacteriophage bearing crp+ restored normal growth ability on fucose. In contrast, lysogenization of [fucO(Con)fucA(Con)fucPIK(Non)crp-201] cells by the same phage retarded their growth on fucose. PMID:2834341
Tretyachenko-Ladokhina, Vira; Cocco, Melanie J; Senear, Donald F
2006-09-15
Interactions between DNA-bound transcription factors CytR and CRP regulate the promoters of the Escherichia coli CytR regulon. A distinctive feature of the palindromic CytR operators is highly variable length central spacers (0-9 bp). Previously we demonstrated distinct modes of CytR binding to operators that differ in spacer length. These different modes are characterized by opposite enthalpic and entropic contributions at 25 degrees C. Of particular note were radically different negative DeltaCp values suggesting variable contribution from coupled protein folding and/or DNA structural transitions. We proposed that the CytR DNA binding-domain adopts either a more rigid or flexible DNA-bound conformation in response to the different spacer lengths. More recently, similar effects were shown to contribute to discrimination between operator and non-specific DNA binding by LacR, a CytR homolog. Here we have extended the thermodynamic analysis to the remaining natural CytR operators plus a set of synthetic operators designed to isolate spacing as the single variable. The thermodynamic results show a broad and monotonic range of effects that are primarily dependent on spacer length. The magnitude of effects suggests participation by more than the DNA-binding domain. 15N HSQC NMR and CD spectral analyses were employed to characterize the structural basis for these effects. The results indicate that while CytR forms a well-ordered structure in solution, it is highly dynamic. We propose a model in which a large ensemble of native state conformations narrows upon binding, to an extent governed by operator spacing. This in turn is expected to constrain intermolecular interactions in the CytR-CRP-DNA complex, thus generating operator-specific effects on repression and induction of transcription.
PuTmiR: A database for extracting neighboring transcription factors of human microRNAs
2010-01-01
Background Some of the recent investigations in systems biology have revealed the existence of a complex regulatory network between genes, microRNAs (miRNAs) and transcription factors (TFs). In this paper, we focus on TF to miRNA regulation and provide a novel interface for extracting the list of putative TFs for human miRNAs. A putative TF of an miRNA is considered here as those binding within the close genomic locality of that miRNA with respect to its starting or ending base pair on the chromosome. Recent studies suggest that these putative TFs are possible regulators of those miRNAs. Description The interface is built around two datasets that consist of the exhaustive lists of putative TFs binding respectively in the 10 kb upstream region (USR) and downstream region (DSR) of human miRNAs. A web server, named as PuTmiR, is designed. It provides an option for extracting the putative TFs for human miRNAs, as per the requirement of a user, based on genomic locality, i.e., any upstream or downstream region of interest less than 10 kb. The degree distributions of the number of putative TFs and miRNAs against each other for the 10 kb USR and DSR are analyzed from the data and they explore some interesting results. We also report about the finding of a significant regulatory activity of the YY1 protein over a set of oncomiRNAs related to the colon cancer. Conclusion The interface provided by the PuTmiR web server provides an important resource for analyzing the direct and indirect regulation of human miRNAs. While it is already an established fact that miRNAs are regulated by TFs binding to their USR, this database might possibly help to study whether an miRNA can also be regulated by the TFs binding to their DSR. PMID:20398296
The effect of the systemic inflammatory response on plasma zinc and selenium adjusted for albumin.
Ghashut, Rawia A; McMillan, Donald C; Kinsella, John; Vasilaki, Aikaterini T; Talwar, Dinesh; Duncan, Andrew
2016-04-01
The magnitude of systemic inflammatory response, as evidenced by C-reactive protein (CRP), is a major factor associated with lower zinc and selenium. They may also be influenced by their binding proteins, such as albumin. The aim of the present study was to examine the relationships between plasma zinc, selenium and the systemic inflammatory response in a large cohort of patients referred for nutritional screen and also to examine these relationships in patients with critical illness. Patients referred for nutritional assessment of zinc (n = 743) and selenium (n = 833) and 114 patients with critical illness were examined. Intra-assay imprecision was <10% for these analytes. In the nutritional screen cohort, plasma zinc was significantly associated with CRP (rs = -0.404, p < 0.001) and albumin (rs = 0.588, p < 0.001). For each CRP category (≤10, 11-80, >80 mg/l) the zinc/albumin ratio x100 was similar (31, 33 and 32 respectively, p = 0.029). Plasma selenium was significantly associated with CRP (rs = -0.489, p < 0.001) and albumin (rs = 0.600, p < 0.001). With increasing CRP category (≤10, 11-80, >80 mg/l) the selenium/albumin ratio ×100 was lower (2.3, 2.1 and 1.8 respectively, p < 0.001). Similar relationships were also observed in the cohort of patients with critical illness. Plasma zinc was associated with both CRP and albumin. The impact of the systemic inflammatory response could be largely adjusted by albumin concentrations. Plasma selenium was associated with both CRP and albumin. The impact of the systemic inflammatory response on plasma selenium concentrations could not be reasonably adjusted by albumin concentrations. Copyright © 2015 Elsevier Ltd and European Society for Clinical Nutrition and Metabolism. All rights reserved.
Ün, B; Dolapçıoğlu, K S; Güler Okyay, A; Şahin, H; Beyazıt, A
2016-09-01
In this study, we aimed to evaluate two cardiovascular risk markers, hs-CRP and visseral adiposity index, in patients with policystic ovary syndrome in association with clinical and laboratory findings. Study group included 75 patients who were diagnosed as PCOS according to the criteria of AE-PCOS 2006 and control group included 75 non-PCOS patients who were subsequently admitted to outpatient clinic for smear control, with urinary or vaginal symptoms. Physical and sonographic examinations were made to all subjects. Mean arterial pressure, waist/hip ratio and body mass index were calculated. Fasting blood glucose and insulin, HbA1c, lipids, high sensitivity C-reactive protein (hs-CRP), estradiol, follicle stimulating hormon, luteinising hormone, tiroid stimulating hormone, prolaktin, total testosteron and sex hormone binding globulin were tested in venous blood samples collected from cases following overnight fast in follicular phase of spontaneous or induced menstruation. Visceral adiposity index was also calculated. No statistically significant difference was found between PCOS group and control group concerning hs-CRP and VAI (p>0.05). When patients in PCOS group were further grouped as obese and non-obese, hs-CRP and VAI values in obese group were significantly higher than those in non-obese group (p<0.001). However, when control group were further grouped as obese and non-obese, there was no significant difference in terms of hs-CRP between groups (p>0.05), VAI values were significantly higher in obese control group (p<0.05). According to the results of our study, hs-CRP stands for a better and more specific marker than VAI to determine metabolic components and predictive risks for cardiovascular diseases in patients with PCOS. Further studies with larger populations are needed in order to determine cardiovascular risks particularly in young PCOS patients. Copyright © 2016 Elsevier Ireland Ltd. All rights reserved.
Henderson, Amanda M.; Samson, Kaitlyn L. I.; Aljaadi, Abeer M.; Devlin, Angela M.; Becquey, Elodie; Wirth, James P.
2018-01-01
Recently, a multiplex ELISA (Quansys Biosciences) was developed that measures ferritin, soluble transferrin receptor (sTfR), retinol-binding protein (RBP), C-reactive protein (CRP), α1-acid glycoprotein (AGP), thyroglobulin, and histidine-rich protein 2. Our primary aim was to conduct a method-comparison study to compare five biomarkers (ferritin, sTfR, RBP, CRP, and AGP) measured with the Quansys assay and a widely-used s-ELISA (VitMin Lab, Willstaett, Germany) with use of serum samples from 180 women and children from Burkina Faso, Cambodia, and Malaysia. Bias and concordance were used to describe the agreement in values measured by the two methods. We observed poor overall agreement between the methods, both with regard to biomarker concentrations and deficiency prevalence estimates. Several measurements were outside of the limit of detection with use of the Quansys ELISA (total n = 42 for ferritin, n = 2 for sTfR, n = 0 for AGP, n = 5 for CRP, n = 22 for RBP), limiting our ability to interpret assay findings. Although the Quansys ELISA has great potential to simplify laboratory analysis of key nutritional and inflammation biomarkers, there are some weaknesses in the procedures. Overall, we found poor comparability of results between methods. Besides addressing procedural issues, additional validation of the Quansys against a gold standard method is warranted for future research. PMID:29393894
Oh, Man Hwan; Lee, Sung Min; Lee, Dong Hwan; Choi, Sang Ho
2009-03-01
Availability of free iron is extremely limited in the mammalian host, and the acquisition of iron in the host is essential for successful infection by pathogenic bacteria. Expression of many genes involved in acquiring iron is regulated in response to the level of iron availability, and iron regulation is mediated by Fur. In this study, cellular levels of Vibrio vulnificus HupA, a heme receptor protein, and the hupA transcript were found to increase in cells grown at 40 degrees C compared to cells grown at 30 degrees C. The results suggested that change in growth temperature, in addition to iron availability, is an environmental cue controlling the expression of the hupA gene. The influence of global regulatory proteins on the expression of hupA was examined, and the cyclic AMP receptor protein (CRP) was found to activate the expression of hupA at the transcriptional level. CRP exerts its effects by directly binding to DNA upstream of the hupA promoter P(hupA), and a CRP binding site, centered at 174 bp upstream of the transcription start site, was identified by a DNase I protection assay. Finally, a hupA mutant showed reduced virulence in mice and in tissue cultures, in which growth of the hupA mutant was impaired, indicating that HupA of V. vulnificus is essential for survival and multiplication during infection.
Oh, Man Hwan; Lee, Sung Min; Lee, Dong Hwan; Choi, Sang Ho
2009-01-01
Availability of free iron is extremely limited in the mammalian host, and the acquisition of iron in the host is essential for successful infection by pathogenic bacteria. Expression of many genes involved in acquiring iron is regulated in response to the level of iron availability, and iron regulation is mediated by Fur. In this study, cellular levels of Vibrio vulnificus HupA, a heme receptor protein, and the hupA transcript were found to increase in cells grown at 40°C compared to cells grown at 30°C. The results suggested that change in growth temperature, in addition to iron availability, is an environmental cue controlling the expression of the hupA gene. The influence of global regulatory proteins on the expression of hupA was examined, and the cyclic AMP receptor protein (CRP) was found to activate the expression of hupA at the transcriptional level. CRP exerts its effects by directly binding to DNA upstream of the hupA promoter PhupA, and a CRP binding site, centered at 174 bp upstream of the transcription start site, was identified by a DNase I protection assay. Finally, a hupA mutant showed reduced virulence in mice and in tissue cultures, in which growth of the hupA mutant was impaired, indicating that HupA of V. vulnificus is essential for survival and multiplication during infection. PMID:19139193
SITEHOUND-web: a server for ligand binding site identification in protein structures.
Hernandez, Marylens; Ghersi, Dario; Sanchez, Roberto
2009-07-01
SITEHOUND-web (http://sitehound.sanchezlab.org) is a binding-site identification server powered by the SITEHOUND program. Given a protein structure in PDB format SITEHOUND-web will identify regions of the protein characterized by favorable interactions with a probe molecule. These regions correspond to putative ligand binding sites. Depending on the probe used in the calculation, sites with preference for different ligands will be identified. Currently, a carbon probe for identification of binding sites for drug-like molecules, and a phosphate probe for phosphorylated ligands (ATP, phoshopeptides, etc.) have been implemented. SITEHOUND-web will display the results in HTML pages including an interactive 3D representation of the protein structure and the putative sites using the Jmol java applet. Various downloadable data files are also provided for offline data analysis.
Fukuda, Yohta
2018-01-01
Abstract Though anhydrobiotic tardigrades (micro‐animals also known as water bears) possess many genes of secretory abundant heat soluble (SAHS) proteins unique to Tardigrada, their functions are unknown. A previous crystallographic study revealed that a SAHS protein (RvSAHS1) from one of the toughest tardigrades, Ramazzottius varieornatus, has a β‐barrel architecture similar to fatty acid binding proteins (FABPs) and two putative ligand binding sites (LBS1 and LBS2) where fatty acids can bind. However, some SAHS proteins such as RvSAHS4 have different sets of amino acid residues at LBS1 and LBS2, implying that they prefer other ligands and have different functions. Here RvSAHS4 was crystallized and analyzed under a condition similar to that for RvSAHS1. There was no electron density corresponding to a fatty acid at LBS1 of RvSAHS4, where a putative fatty acid was observed in RvSAHS1. Instead, LBS2 of RvSAHS4, which was composed of uncharged residues, captured a putative polyethylene glycol molecule. These results suggest that RvSAHS4 mainly uses LBS2 for the binding of uncharged molecules. PMID:29493034
Tumour suppressor protein p53 regulates the stress activated bilirubin oxidase cytochrome P450 2A6
DOE Office of Scientific and Technical Information (OSTI.GOV)
Hu, Hao, E-mail: hao.hu1@uqconnect.edu.au; Yu, Ting, E-mail: t.yu2@uq.edu.au; Arpiainen, Satu, E-mail: Satu.Juhila@orion.fi
2015-11-15
Human cytochrome P450 (CYP) 2A6 enzyme has been proposed to play a role in cellular defence against chemical-induced oxidative stress. The encoding gene is regulated by various stress activated transcription factors. This paper demonstrates that p53 is a novel transcriptional regulator of the gene. Sequence analysis of the CYP2A6 promoter revealed six putative p53 binding sites in a 3 kb proximate promoter region. The site closest to transcription start site (TSS) is highly homologous with the p53 consensus sequence. Transfection with various stepwise deletions of CYP2A6-5′-Luc constructs – down to − 160 bp from the TSS – showed p53 responsivenessmore » in p53 overexpressed C3A cells. However, a further deletion from − 160 to − 74 bp, including the putative p53 binding site, totally abolished the p53 responsiveness. Electrophoretic mobility shift assay with a probe containing the putative binding site showed specific binding of p53. A point mutation at the binding site abolished both the binding and responsiveness of the recombinant gene to p53. Up-regulation of the endogenous p53 with benzo[α]pyrene – a well-known p53 activator – increased the expression of the p53 responsive positive control and the CYP2A6-5′-Luc construct containing the intact p53 binding site but not the mutated CYP2A6-5′-Luc construct. Finally, inducibility of the native CYP2A6 gene by benzo[α]pyrene was demonstrated by dose-dependent increases in CYP2A6 mRNA and protein levels along with increased p53 levels in the nucleus. Collectively, the results indicate that p53 protein is a regulator of the CYP2A6 gene in C3A cells and further support the putative cytoprotective role of CYP2A6. - Highlights: • CYP2A6 is an immediate target gene of p53. • Six putative p53REs located on 3 kb proximate CYP2A6 promoter region. • The region − 160 bp from TSS is highly homologous with the p53 consensus sequence. • P53 specifically bind to the p53RE on the − 160 bp region. • HNF4α may interact with p53 in regulating CYP2A6 expression.« less
Jacobsen, Jacob P R; Plenge, Per; Sachs, Benjamin D; Pehrson, Alan L; Cajina, Manuel; Du, Yunzhi; Roberts, Wendy; Rudder, Meghan L; Dalvi, Prachiti; Robinson, Taylor J; O'Neill, Sharon P; Khoo, King S; Morillo, Connie Sanchez; Zhang, Xiaodong; Caron, Marc G
2014-12-01
Escitalopram appears to be a superior antidepressant to racemic citalopram. It has been hypothesized that binding of R-citalopram to the serotonin transporter (SERT) antagonizes escitalopram binding to and inhibition of the SERT, there by curtailing the elevation of extracellular 5-hydroxytryptamine (5-HTExt), and hence anti-depressant efficacy. Further, it has been suggested that a putative allosteric binding site is important for binding of escitalopram to the primary, orthosteric, site, and for R-citalopram's inhibition here of. Primary: Investigate at the human (h)SERT, at clinical relevant doses, whether R-citalopram antagonizes escitalopram-induced 5-HTExt elevation. Secondary: Investigate whether abolishing the putative allosteric site affects escitalopram-induced 5-HTExt elevation and/or modulates the effect of R-citalopram. Recombinant generation of hSERT transgenic mice; in vivo microdialysis; SERT binding; pharmacokinetics; 5-HT sensitive behaviors (tail suspension, marble burying). We generated mice expressing either the wild-type human SERT (hSERT(WT)) or hSERT carrying amino acid substitutions (A505V, L506F, I507L, S574T and I575T) collectively abolishing the putative allosteric site (hSERT(ALI/VFL+SI/TT)). One mg/kg escitalopram yielded clinical relevant plasma levels and brain levels consistent with therapeutic SERT occupancy. The hSERT mice showed normal basal 5-HTExt levels. Escitalopram-induced 5-HTExt elevation was not decreased by R-citalopram co-treatment and was unaffected by loss of the allosteric site. The behavioral effects of the clinically relevant escitalopram dose were small and tended to be enhanced by R-citalopram co-administration. We find no evidence that R-citalopram directly antagonizes escitalopram or that the putative allosteric site is important for hSERT inhibition by escitalopram.
Determination of Surface-Exposed, Functional Domains of Gonococcal Transferrin-Binding Protein A
Yost-Daljev, Mary Kate; Cornelissen, Cynthia Nau
2004-01-01
The gonococcal transferrin receptor is composed of two distinct proteins, TbpA and TbpB. TbpA is a member of the TonB-dependent family of integral outer membrane transporters, while TbpB is lipid modified and thought to be peripherally surface exposed. We previously proposed a hypothetical topology model for gonococcal TbpA that was based upon computer predictions and similarity with other TonB-dependent transporters for which crystal structures have been determined. In the present study, the hemagglutinin epitope was inserted into TbpA to probe the surface topology of this protein and secondarily to test the functional impacts of site-specific mutagenesis. Twelve epitope insertion mutants were constructed, five of which allowed us to confirm the surface exposure of loops 2, 3, 5, 7, and 10. In contrast to the predictions set forth by the hypothetical model, insertion into the plug region resulted in an epitope that was surface accessible, while epitope insertions into two putative loops (9 and 11) were not surface accessible. Insertions into putative loop 3 and β strand 9 abolished transferrin binding and utilization, and the plug insertion mutant exhibited decreased transferrin-binding affinity concomitant with an inability to utilize it. Insertion into putative β strand 16 generated a mutant that was able to bind transferrin normally but that was unable to mediate utilization. Mutants with insertions into putative loops 2, 9, and 11 maintained wild-type binding affinity but could utilize only transferrin in the presence of TbpB. This is the first demonstration of the ability of TbpB to compensate for a mutation in TbpA. PMID:14977987
USDA-ARS?s Scientific Manuscript database
Chitin-binding proteins (CBPs) existed in various species and involved in different biology processes. In the present study, we cloned a full length cDNA of chitin-binding protein-like (PpCBP-like) from Pteromalus puparum, a pupal endoparasitoid of Pieris rapae. PpCBP-like encoded a 96 putative amin...
Pirenzepine binding to membrane-bound, solubilized and purified muscarinic receptor subtypes
DOE Office of Scientific and Technical Information (OSTI.GOV)
Baumgold, J.
1986-05-01
Muscarinic receptors were purified to near-homogeneity from bovine cortex, an area rich in the putative M1 subtype, and from bovine pons/medulla, an area rich in the putative M2 subtype. In both cases, the receptors were solubilized in digitonin and purified over an affinity column. Both the cortical and pons/medulla preparations yielded receptor proteins of 70,000 daltons. Pirenzepine binding was deduced from its competition with /sup 3/H-N-methyl scopolamine. The binding of pirenzepine to membrane-bound receptors from cortex was best described by a two site model, with approximately half the sites having a Ki of 6.4 x 10/sup -9/ M and themore » remaining sites having a Ki of 3.5 x 10/sup -7/ M. Membrane-bound receptors from pons/medulla bound pirenzepine according to a one-site model with a Ki of 1.1 x 10/sup -7/ M. After solubilization the two-site binding of cortical receptors became a one-site binding, Ki = 1.1 x 10/sup -7/M. This value was still five-fold lower than that of soluble receptors from pons/medulla. After purification however the affinity of pirenzepine for the pons/medulla receptor increased so that the two putative subtypes bound pirenzepine with approximately the same affinity. These findings suggest that the different pirenzepine binding characteristics used to define muscarinic receptor subtypes are not inherent in the receptor protein itself but may be due to coupling factors associated with the receptor.« less
Jacobsen, Jacob P.R.; Plenge, Per; Sachs, Benjamin D.; Pehrson, Alan L.; Cajina, Manuel; Du, Yunzhi; Roberts, Wendy; Rudder, Meghan L.; Dalvi, Prachiti; Robinson, Taylor J.; O’Neill, Sharon P.; Khoo, King S.; Morillo, Connie Sanchez; Zhang, Xiaodong; Caron, Marc G.
2015-01-01
Rationale Escitalopram is a superior antidepressant to racemic citalopram. It has been hypothesized that binding of R-citalopram to the serotonin transporter (SERT) antagonizes escitalopram binding to and inhibition of the SERT, curtailing the elevation of extracellular 5-hydroxytryptamine (5-HTExt), and antidepressant efficacy. Further, it has been suggested that a putative allosteric binding site is important for binding of escitalopram to the primary, orthosteric, site, and for R-citalopram’s inhibition hereof. Objectives Primary: Investigate at the human (h)SERT, at clinical relevant doses, whether R-citalopram antagonizes escitalopram-induced 5-HTExt elevation. Secondary: Investigate whether abolishing the putative allosteric site affects escitalopram-induced 5-HTExt elevation and/or modulates the effect of R-citalopram. Methods Recombinant technology; in vivo microdialysis; receptor binding; pharmacokinetics; 5-HT sensitive behaviors (tail suspension, marble burying). Results We generated mice expressing either the wild-type human SERT (hSERTWT) or hSERT carrying amino acid substitutions (A505V, L506F, I507L, S574T and I575T) collectively abolishing the putative allosteric site (hSERTALI/VFL+SI/TT). One mg/kg escitalopram yielded clinical relevant plasma levels and brain levels consistent with therapeutic SERT occupancy. Importantly, escitalopram-induced 5-HTExt elevation was not decreased by R-citalopram co-treatment. Further, escitalopram-induced 5-HTExt elevation was not affected by loss of the allosteric site. The behavioral effects of the clinically relevant escitalopram dose were small, tending to be enhanced by R-citalopram co-administration. Conclusions We find no evidence that R-citalopram directly antagonizes escitalopram or that the putative allosteric site is important for hSERT inhibition by escitalopram. Our findings points to mechanisms for R-citalopram antagonism of escitalopram’s antidepressant action other than direct antagonistic binding interactions at the hSERT. PMID:24810106
Buchet, Anne; Eichler, Knut; Mandrand-Berthelot, Marie-Andrée
1998-01-01
The divergent structural operons caiTABCDE and fixABCX of Escherichia coli are required for anaerobic carnitine metabolism. Transcriptional monocopy lacZ fusion studies showed that both operons are coexpressed during anaerobic growth in the presence of carnitine, respond to common environmental stimuli (like glucose and nitrate), and are modulated positively by the same general regulators, CRP and FNR, and negatively by H-NS. Overproduction of the CaiF specific regulatory protein mediating the carnitine signal restored induction in an fnr mutant, corresponding to its role as the primary target for anaerobiosis. Transcript analysis identified two divergent transcription start points initiating 289 bp apart. DNase I footprinting revealed three sites with various affinities for the binding of the cAMP-CRP complex inside this regulatory region. Site-directed mutagenesis experiments indicated that previously reported perfect CRP motif 1, centered at −41.5 of the cai transcriptional start site, plays a direct role in the sole cai activation. In contrast, mutation in CRP site 2, positioned at −69.5 of the fix promoter, caused only a threefold reduction in fix expression. Thus, the role of the third CRP site, located at −126.5 of fix, might be to reinforce the action of site 2. A critical 50-bp cis-acting sequence overlapping the fix mRNA start site was found, by deletion analysis, to be necessary for cai transcription. This region is thought to be involved in transduction of the signal mediated by the CaiF regulator. PMID:9573142
Increased systemic elastase and C-reactive protein in aggressive periodontitis (CLOI-D-00160R2).
Wohlfeil, Martin; Scharf, Susanne; Siegelin, Yasemin; Schacher, Beate; Oremek, Gerhard M; Sauer-Eppel, Hildegund; Schubert, Ralf; Eickholz, Peter
2012-08-01
The inflammatory mediators, serum elastase and C-reactive protein (CRP), are associated with an increased risk for coronary heart disease. Thus, the aim of this study is to compare systemic inflammatory mediators in periodontally healthy controls (C), patients with untreated aggressive (AgP) and chronic (ChP) periodontitis. C [periodontal pocket probing depth (PPD) <3.6 or <5 mm without bleeding (BOP), BOP < 10%], ChP (PDD ≥ 3.6 mm and probing attachment loss ≥5 mm at >30% of sites; age >35 years), and AgP (clinically healthy; PDD ≥ 3.6 mm at >30% of sites, bone loss ≥50% at ≥2 teeth; age ≤35 years) were examined clinically, and the body mass index was assessed. Blood was sampled for assessment of serum levels of elastase, CRP, lipopolysaccharide binding protein (LBP), interleukin (IL) 6, 8, and leukocyte counts. Thirty C, 31 ChP, and 29 AgP were analyzed. Elastase, CRP, LBP, and IL-6 levels were elevated in AgP compared to C (p < 0.013), whereas leukocyte counts and IL-8 were similar. Multiple regression analysis identified AgP (p < 0.001) and education level (p < 0.001) to explain 47% of the variation of elastase. AgP (p = 0.003), African origin (p = 0.006), female sex (p = 0.002), and BMI (p < 0.001) explained 39% of the variation of CRP. Serum elastase and CRP are significantly elevated in AgP compared to C. AgP patients exhibit a stronger systemic inflammatory burden than C patients.
Zhang, Xue; Li, Diandian; Wang, Hao; Pang, Caishuang; Wu, Yanqiu; Wen, Fuqiang
2016-01-01
COPD (chronic obstructive pulmonary disease) is characterized by airway inflammation and increases the likelihood of the development of atherosclerosis. Recent studies have indicated that FABP4 (fatty-acid-binding protein 4), an intracellular lipid chaperone of low molecular mass, plays an important role in the regulation of inflammation and atherosclerosis. We carried out a preliminary clinical study aiming at investigating the relationships between circulating FABP4 levels in patients with COPD and inflammation and lung function. We enrolled 50 COPD patients and 39 healthy controls in the study. Lung function tests were performed in all subjects. Plasma levels of FABP4 and adiponectin, TNFα (tumour necrosis factor α) and CRP (C-reactive protein) were measured. The correlations between FABP4 and lung function, adipokine (adiponectin), inflammatory factors and BMI (body mass index) were analysed. Compared with both males with COPD and healthy females, plasma FABP4 levels in females with COPD were significantly increased. Adiponectin and CRP levels were significantly higher in patients with COPD. Furthermore, we found that FABP4 levels were inversely correlated with FEV1% predicted (FEV1 is forced expiratory volume in 1 s) and positively correlated with adiponectin and TNFα in COPD patients. In addition, a positive correlation between plasma FABP4 and CRP was found in females with COPD. However, FABP4 levels were not correlated with BMI. Our results underline a gender difference in FABP4 secretion in stable COPD patients. Further studies are warranted to clarify the exact role of FABP4 in the pathogenesis of COPD. PMID:26823558
Thrombopoietin contributes to enhanced platelet activation in cigarette smokers.
Lupia, Enrico; Bosco, Ornella; Goffi, Alberto; Poletto, Cesare; Locatelli, Stefania; Spatola, Tiziana; Cuccurullo, Alessandra; Montrucchio, Giuseppe
2010-05-01
Thrombopoietin (TPO) is a humoral growth factor that primes platelet activation in response to several agonists. We recently showed that TPO enhances platelet activation in unstable angina and sepsis. Aim of this study was to investigate the role of TPO in platelet function abnormalities described in cigarette smokers. In a case-control study we enrolled 20 healthy cigarette smokers and 20 nonsmokers, and measured TPO and C-reactive protein (CRP), as well as platelet-leukocyte binding and P-selectin expression. In vitro we evaluated the priming activity of smoker or control plasma on platelet activation, and the role of TPO in this effect. We then studied the effects of acute smoking and smoking cessation on TPO levels and platelet activation indices. Chronic cigarette smokers had higher circulating TPO levels than nonsmoking controls, as well as increased platelet-leukocyte binding, P-selectin expression, and CRP levels. Serum cotinine concentrations correlated with TPO concentrations, platelet-monocyte aggregates and P-selectin expression. In addition, TPO levels significantly correlated with ex vivo platelet-monocyte aggregation and P-selectin expression. In vitro, the plasma from cigarette smokers, but not from nonsmoking controls, primed platelet-monocyte binding, which was reduced when an inhibitor of TPO was used. We also found that acute smoking slightly increased TPO levels, but did not affect platelet-leukocyte binding, whereas smoking cessation induced a significant decrease in both circulating TPO and platelet-leukocyte aggregation. Elevated TPO contributes to enhance platelet activation and platelet-monocyte cross-talk in cigarette smokers. Copyright 2009 Elsevier Ireland Ltd. All rights reserved.
Poudel-Tandukar, Kalpana; Poudel, Krishna C; Jimba, Masamine; Kobayashi, Jun; Johnson, C Anderson; Palmer, Paula H
2013-03-01
Human immunodeficiency virus (HIV) infection has frequently been associated with vitamin D deficiency as well as chronic inflammatory response. We tested the hypothesis of an independent relationship between serum concentrations of 25-hydroxyvitamin D [25(OH)D] and high-sensitivity C-reactive protein (CRP) in a cohort of HIV-positive people. A cross-sectional survey was conducted among 316 HIV-positive people (181 men and 135 women) aged 16 to 60 years residing in the Kathmandu Valley, Nepal. Serum high-sensitivity CRP concentrations and serum 25(OH)D levels were measured by the latex agglutination nephelometry method and the competitive protein-binding assay, respectively. The relationship between serum CRP concentrations and 25(OH)D serum level was assessed using multiple logistic regression analysis with adjustment of potential cardiovascular and HIV-related factors. The proportions of participants with 25(OH)D serum levels <20 ng/ml, 20-30 ng/ml, and ≥30 ng/ml were 83.2%, 15.5%, and 1.3%, respectively. The mean 25(OH)D serum levels in men and women were 15.3 ng/ml and 14.4 ng/ml, respectively. Participants with a 25(OH)D serum level of <20 ng/ml had a 3.2-fold higher odds of high CRP (>3 mg/liter) compared to those with a 25(OH)D serum level of ≥20 ng/ml (p=0.005). Men and women with a 25(OH)D serum level of <20 ng/ml had 3.2- and 2.7-fold higher odds of high CRP (>3 mg/liter), respectively, compared to those with a 25(OH)D serum level of ≥20 ng/ml. The relationships remained significant only in men (p =0.02) but not in women (p=0.28). The risk of having a high level of inflammation (CRP>3 mg/liter) may be high among HIV-positive men and women with a 25(OH)D serum level of <20 ng/ml.
Pharmacophore screening of the protein data bank for specific binding site chemistry.
Campagna-Slater, Valérie; Arrowsmith, Andrew G; Zhao, Yong; Schapira, Matthieu
2010-03-22
A simple computational approach was developed to screen the Protein Data Bank (PDB) for putative pockets possessing a specific binding site chemistry and geometry. The method employs two commonly used 3D screening technologies, namely identification of cavities in protein structures and pharmacophore screening of chemical libraries. For each protein structure, a pocket finding algorithm is used to extract potential binding sites containing the correct types of residues, which are then stored in a large SDF-formatted virtual library; pharmacophore filters describing the desired binding site chemistry and geometry are then applied to screen this virtual library and identify pockets matching the specified structural chemistry. As an example, this approach was used to screen all human protein structures in the PDB and identify sites having chemistry similar to that of known methyl-lysine binding domains that recognize chromatin methylation marks. The selected genes include known readers of the histone code as well as novel binding pockets that may be involved in epigenetic signaling. Putative allosteric sites were identified on the structures of TP53BP1, L3MBTL3, CHEK1, KDM4A, and CREBBP.
Guaita-Esteruelas, Sandra; Saavedra-García, Paula; Bosquet, Alba; Borràs, Joan; Girona, Josefa; Amiliano, Kepa; Rodríguez-Balada, Marta; Heras, Mercedes; Masana, Luís; Gumà, Josep
2017-11-01
Adipose tissue is an endocrine organ that could play a role in tumor progression via its secreted adipokines. The role of adipose-derived fatty acid-binding protein (FABP) 4 and FABP5 in breast cancer is presently under study, but their circulating levels in this pathology are poorly known. We analyzed the blood concentrations of FABP4 and FABP5 in breast cancer patients to determine whether there is an association between them and breast cancer. We studied 294 women in the oncology department with a family history of breast cancer; 198 of the women had breast cancer, and 96 were healthy controls. The levels of FABP4, FABP5, lipid profile, standard biochemical parameter, and high-sensitivity C-reactive protein (hsCRP) were determined. We analyzed the association of FABP4 and FABP5 with breast cancer, while adjusting for demographic, anthropometric, and biochemical parameters. Breast cancer patients had a 24.8% ( p < .0001) and 11.4% ( p < .05) higher blood concentration of FABP4 and FABP5, respectively. Fatty acid-binding protein 4 was positively associated with age, body mass index (BMI), FABP5, very-low-density lipoprotein cholesterol (VLDLc), non-high-density lipoprote in cholesterol (non-HDLc), Apolipoprotein B 100 (ApoB100), triglycerides, glycerol, glucose, and hsCRP ( p < .05), and was negatively associated with HDLc ( p < .005) in breast cancer patients. Fatty acid-binding protein 5 was positively associated with BMI, FABP4, VLDLc, triglycerides, glycerol, and hsCRP ( p < .05), and was negatively associated with HDLc and Apolipoprotein AI (ApoAI) ( p < .05) in breast cancer patients. Using a logistic regression analysis and adjusting for age, BMI, hsCRP, non-HDLc, and triglycerides, FABP4 was independently associated with breast cancer (odds ratio [OR]: 1.091 [95% CI: 1.037-1.149]). Moreover, total cholesterol, VLDLc, non-HDLc, ApoB100, triglycerides, and hsCRP were significantly increased in breast cancer patients ( p < .005). In contrast, the non-esterified fatty acids concentrations were significantly decreased in breast cancer patients ( p < .05). Circulating FABP4 and FABP5 levels were increased in breast cancer patients compared with controls. The positive association of FABP4 with breast cancer was maintained after adjusting for important covariates, while the association with FABP5 was lost. Our data reinforce the role of adipose tissue and their adipokines in breast cancer. Despite these data, further studies must be performed to better explain the prognosis or diagnostic value of these blood parameters and their possible role in breast cancer. We focus on the effect of adipose tissue on cancer, which is increasingly recognized. The association between adipocyte-derived adipokines and breast cancer opens new diagnosis and therapy perspectives. In this study, we provide original data concerning FABP4 and FABP5 plasma concentrations in breast cancer patients. Compared to control group, breast cancer patients show higher FABP4 and FABP5 blood levels. Our data suggest that, particularly, circulating FABP4 levels could be considered a new independent breast cancer biomarker. Our work translates basic science data to clinic linking the relationship between adipose tissue and lipid metabolism to breast cancer. © 2017 The Authors. The Oncologist published by Wiley Periodicals, Inc. on behalf of AlphaMed Press.
Neuroinflammatory and morphological changes in late-life depression: the NIMROD study.
Su, L; Faluyi, Y O; Hong, Y T; Fryer, T D; Mak, E; Gabel, S; Hayes, L; Soteriades, S; Williams, G B; Arnold, R; Passamonti, L; Rodríguez, P Vázquez; Surendranathan, A; Bevan-Jones, R W; Coles, J; Aigbirhio, F; Rowe, J B; O'Brien, J T
2016-12-01
We studied neuroinflammation in individuals with late-life depression, as a risk factor for dementia, using [ 11 C]PK11195 positron emission tomography (PET). Five older participants with major depression and 13 controls underwent PET and multimodal 3T magnetic resonance imaging (MRI), with blood taken to measure C-reactive protein (CRP). We found significantly higher CRP levels in those with late-life depression and raised [ 11 C]PK11195 binding compared with controls in brain regions associated with depression, including subgenual anterior cingulate cortex, and significant hippocampal subfield atrophy in cornu ammonis 1 and subiculum. Our findings suggest neuroinflammation requires further investigation in late-life depression, both as a possible aetiological factor and a potential therapeutic target. © The Royal College of Psychiatrists 2016.
Ontology- and graph-based similarity assessment in biological networks.
Wang, Haiying; Zheng, Huiru; Azuaje, Francisco
2010-10-15
A standard systems-based approach to biomarker and drug target discovery consists of placing putative biomarkers in the context of a network of biological interactions, followed by different 'guilt-by-association' analyses. The latter is typically done based on network structural features. Here, an alternative analysis approach in which the networks are analyzed on a 'semantic similarity' space is reported. Such information is extracted from ontology-based functional annotations. We present SimTrek, a Cytoscape plugin for ontology-based similarity assessment in biological networks. http://rosalind.infj.ulst.ac.uk/SimTrek.html francisco.azuaje@crp-sante.lu Supplementary data are available at Bioinformatics online.
Paillaud, Elena; Bastuji-Garin, Sylvie; Plonquet, Anne; Foucat, Emile; Fournier, Bénédicte; Boutin, Emmanuelle; Le Thuaut, Aurélie; Levy, Yves; Hue, Sophie
2018-01-16
We hypothesized that low-grade inflammation was driven by microbial translocation and associated with an increased risk of health care-associated infections (HAIs). We included 121 patients aged 75 years or over in this prospective cohort study. High-sensitivity C-reactive protein (hs-CRP), I-FABP, and sCD14-as markers for low-grade inflammation, intestinal epithelial barrier integrity, and monocyte activation, respectively-were measured at admission. HAIs occurred during hospitalization in 62 (51%) patients. Elevated hs-CRP (≥6.02 mg/L, ie, the median) was associated with a significantly higher HAI risk when I-FABP was in the highest quartile (odds ratio [OR], 4; 95% confidence interval [95% CI], 1.39-11.49; p = .010). In patients with hs-CRP elevation and highest-quartile I-FABP, sCD14 elevation (≥0.65 µg/mL, ie, the median) was associated with an 11-fold higher HAI risk (OR, 10.8; 95% CI, 2.28-51.1; p = .003). Multivariate analyses adjusted for invasive procedures and comorbidities did not change the associations linking the three markers to the HAI risk. Increased levels of hs-CRP, I-FABP, and sCD14 may reflect loss of intestinal epithelial barrier integrity with microbial translocation leading to monocyte activation and low-grade inflammation. In our cohort, these markers identified patients at high risk for HAIs. © The Author 2017. Published by Oxford University Press on behalf of The Gerontological Society of America. All rights reserved. For permissions, please e-mail: journals.permissions@oup.com.
Beysel, Selvihan; Kizilgul, Muhammed; Ozbek, Mustafa; Caliskan, Mustafa; Kan, Seyfullah; Apaydin, Mahmut; Ozcelik, Ozgur; Cakal, Erman
2017-01-01
Cardiovascular disease (CVD) is reported to be higher in elderly diabetics. Serum heart-type fatty acid binding protein (H-FABP) is a serum marker of myocardial ischemia. We aimed to investigate the association between serum H-FABP level and conventional cardiovascular risk factors, inflammatory markers and subclinical atherosclerosis in elderly diabetics without overt CVD. A total of 50 elderly diabetic patients without overt CVD and 30 age-, sex- and body mass index (BMI)-matched healthy controls were enrolled. Anthropometric and biochemical parameters, serum H-FABP, high-sensitivity C-reactive protein (hs-CRP), fibrinogen and carotid intima-media thickness (CIMT) were measured. Logistic regression analyses (adjustments for age, sex, hypertension, smoking, diabetes, BMI, blood pressure, lipid, blood glucose, hemoglobin A1c, hs-CRP and fibrinogen) were performed to evaluate the association between H-FABP and cardiovascular risk factors and atherosclerosis indices. Serum fibrinogen (421.50±85.52 mg/dL vs 319.17±30.77 mg/dL, p =0.023), CIMT (0.70±0.12 mm vs 0.59±0.06 mm, p <0.001) and hs-CRP (5.72±4.50 mg/dL vs 1.60±0.72 mg/dL, p <0.001) were significantly higher in diabetic patients than controls. The mean serum H-FABP level did not differ between groups (1571.79±604.60 ng/mL vs 1500.25±463.35 ng/mL, p =0.905). H-FABP was positively correlated with fibrinogen ( r 2 =0.473, p <0.001), hs-CRP ( r 2 =0.323, p =0.003) and CIMT ( r 2 =0.467, p <0.001). After full adjustments, the serum H-FABP level was independently associated with an increase in the fibrinogen level (odds ratio [OR] =4.21, 95% confidence level [CI] =1.49-11.90). Serum H-FABP was similar in the elderly diabetic patients without known CVD when compared with the nondiabetic control group. H-FABP does not possess a high diagnostic value as a cardiovascular marker when used alone; however, it may add supplementary information in patients with a high fibrinogen level.
Barbaglia, Allison M.; Tamot, Banita; Greve, Veronica; ...
2016-04-28
Global climate changes inversely affect our ability to grow the food required for an increasing world population. To combat future crop loss due to abiotic stress, we need to understand the signals responsible for changes in plant development and the resulting adaptations, especially the signaling molecules traveling long-distance through the plant phloem. Using a proteomics approach, we had identified several putative lipid-binding proteins in the phloem exudates. Simultaneously, we identified several complex lipids as well as jasmonates. These findings prompted us to propose that phloem (phospho-) lipids could act as long-distance developmental signals in response to abiotic stress, and thatmore » they are released, sensed, and moved by phloem lipid-binding proteins (Benning et al., 2012). Indeed, the proteins we identified include lipases that could release a signaling lipid into the phloem, putative receptor components, and proteins that could mediate lipid-movement. To test this possible protein-based lipid-signaling pathway, three of the proteins, which could potentially act in a relay, are characterized here: (I) a putative GDSL-motif lipase (II) a PIG-P-like protein, with a possible receptor-like function; (III) and PLAFP (phloem lipid-associated family protein), a predicted lipid-binding protein of unknown function. Here we show that all three proteins bind lipids, in particular phosphatidic acid (PtdOH), which is known to participate in intracellular stress signaling. Genes encoding these proteins are expressed in the vasculature, a prerequisite for phloem transport. Cellular localization studies show that the proteins are not retained in the endoplasmic reticulum but surround the cell in a spotted pattern that has been previously observed with receptors and plasmodesmatal proteins. Abiotic signals that induce the production of PtdOH also regulate the expression of GDSL-lipase and PLAFP, albeit in opposite patterns. Our findings suggest that while all three proteins are indeed lipid-binding and act in the vasculature possibly in a function related to long-distance signaling, the three proteins do not act in the same but rather in distinct pathways. Furthermore, it points toward PLAFP as a prime candidate to investigate long-distance lipid signaling in the plant drought response.« less
DOE Office of Scientific and Technical Information (OSTI.GOV)
Barbaglia, Allison M.; Tamot, Banita; Greve, Veronica
Global climate changes inversely affect our ability to grow the food required for an increasing world population. To combat future crop loss due to abiotic stress, we need to understand the signals responsible for changes in plant development and the resulting adaptations, especially the signaling molecules traveling long-distance through the plant phloem. Using a proteomics approach, we had identified several putative lipid-binding proteins in the phloem exudates. Simultaneously, we identified several complex lipids as well as jasmonates. These findings prompted us to propose that phloem (phospho-) lipids could act as long-distance developmental signals in response to abiotic stress, and thatmore » they are released, sensed, and moved by phloem lipid-binding proteins (Benning et al., 2012). Indeed, the proteins we identified include lipases that could release a signaling lipid into the phloem, putative receptor components, and proteins that could mediate lipid-movement. To test this possible protein-based lipid-signaling pathway, three of the proteins, which could potentially act in a relay, are characterized here: (I) a putative GDSL-motif lipase (II) a PIG-P-like protein, with a possible receptor-like function; (III) and PLAFP (phloem lipid-associated family protein), a predicted lipid-binding protein of unknown function. Here we show that all three proteins bind lipids, in particular phosphatidic acid (PtdOH), which is known to participate in intracellular stress signaling. Genes encoding these proteins are expressed in the vasculature, a prerequisite for phloem transport. Cellular localization studies show that the proteins are not retained in the endoplasmic reticulum but surround the cell in a spotted pattern that has been previously observed with receptors and plasmodesmatal proteins. Abiotic signals that induce the production of PtdOH also regulate the expression of GDSL-lipase and PLAFP, albeit in opposite patterns. Our findings suggest that while all three proteins are indeed lipid-binding and act in the vasculature possibly in a function related to long-distance signaling, the three proteins do not act in the same but rather in distinct pathways. Furthermore, it points toward PLAFP as a prime candidate to investigate long-distance lipid signaling in the plant drought response.« less
Ischaemia-modified albumin: a marker of bacterial infection in hospitalized patients with cirrhosis.
Giannone, Ferdinando A; Domenicali, Marco; Baldassarre, Maurizio; Bartoletti, Michele; Naldi, Marina; Laggetta, Maristella; Bertucci, Carlo; Colecchia, Antonio; Viale, Pierluigi; Bernardi, Mauro; Caraceni, Paolo
2015-11-01
Patients with cirrhosis present structural changes of human serum albumin (HSA) affecting non-oncotic functions. Ischaemia-modified albumin (IMA), which reflects the capacity to bind cobalt, has been associated to patient mortality during acute-on-chronic liver failure. This study aimed to assess whether circulating IMA is elevated in advanced cirrhosis and its relationship with severity of cirrhosis and specific complications. A total of 127 cirrhotic patients hospitalized for an acute complication of the disease and 44 healthy controls were enrolled. Plasma IMA and IMA to albumin ratio (IMAr) were measured with a cobalt-binding assay. HSA isoforms carrying post-transcriptional molecular changes were assessed with HPLC-ESI-MS. The effect of endotoxemia on IMA was evaluated in rats with CCl4 -cirrhosis. IMA/IMAr is significantly higher in cirrhotic patients than in controls, but no correlations were found with prognostic scores. IMA did not correlate with the altered HSA isoforms. Ascites, renal impairment and hepatic encephalopathy did not influence IMA/IMAr levels. In contrast, IMA/IMAr is significantly higher in infected than non-infected patients. ROC curves showed that IMA/IMAr had similar discriminating performances for bacterial infection as C-reactive protein (CRP). Moreover, CRP and IMA were independently associated with bacterial infection. Consistently, endotoxin injection significantly increased IMA in cirrhotic, but not in healthy rats. IMA is elevated in patients with advanced cirrhosis. The IMA level does not correlate with disease severity scores, but it is specifically associated to bacterial infection, showing a discriminating performance similar to CRP. Further investigations to assess IMA as a novel diagnostic test for bacterial infection are advocated. © 2015 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.
Serum LBP Is Associated with Insulin Resistance in Women with PCOS.
Zhu, Qibo; Zhou, Huang; Zhang, Aipin; Gao, Rufei; Yang, Shumin; Zhao, Changhong; Wang, Yue; Hu, Jinbo; Goswami, Richa; Gong, Lilin; Li, Qifu
2016-01-01
Lipopolysaccharide-binding protein (LBP) is closely associated with many metabolic disorders. However, no study has been done to explore the relationship between LBP and polycystic ovary syndrome (PCOS). The objective of this study was to investigate whether the serum LBP level is elevated and associated with insulin resistance (IR) in PCOS. In this cross-sectional study, 117 PCOS patients and 121 age-matched controls were recruited. Hyperinsulinemic-euglycemic clamp was performed with an expression of M value for insulin sensitivity. Fasting serum samples were collected to detect LBP, lipids, insulin, sex hormones and high sensitive C reactive protein (hs-CRP). Pearson's correlation and multiple linear regression was used to analyze the associations between M value and LBP level. The study was performed in a clinical research center. Compared with controls, PCOS subjects had a significantly higher LBP concentration (33.03±14.59 vs. 24.35±10.31 μg/ml, p<0.001), and lower M value (8.21±3.06 vs. 12.31±1.72 mg/min/kg, p<0.001). Both in lean and overweight/obese individuals, serum LBP level was higher in PCOS subjects than that in controls. M value was negatively correlated with body mass index (BMI), fasting serum insulin, triglycerides, low-density lipoprotein cholesterol (LDL-c), free testosterone, high sensitive C reactive protein (hs-CRP) and LBP, whereas positively correlated with high-density lipoprotein cholesterol (HDL-c) and sex hormone binding globulin (SHBG). Serum LBP level was associated with M value after adjusting for BMI, fasting serum insulin, SHBG, as well as hs-CRP. Serum LBP level significantly is elevated in PCOS, and is independently associated with IR in PCOS.
Medkova, M; Cho, W
1998-07-10
The C2 domains of conventional protein kinase C (PKC) have been implicated in their Ca2+-dependent membrane binding. The C2 domain of PKC-alpha contains several Ca2+ ligands that bind multiple Ca2+ ions and other putative membrane binding residues. To understand the roles of individual Ca2+ ligands and protein-bound Ca2+ ions in the membrane binding and activation of PKC-alpha, we mutated five putative Ca2+ ligands (D187N, D193N, D246N, D248N, and D254N) and measured the effects of mutations on vesicle binding, enzyme activity, and monolayer penetration of PKC-alpha. Altered properties of these mutants indicate that individual Ca2+ ions and their ligands have different roles in the membrane binding and activation of PKC-alpha. The binding of Ca2+ to Asp187, Asp193, and Asp246 of PKC-alpha is important for the initial binding of protein to membrane surfaces. On the other hand, the binding of another Ca2+ to Asp187, Asp246, Asp248, and Asp254 induces the conformational change of PKC-alpha, which in turn triggers its membrane penetration and activation. Among these Ca2+ ligands, Asp246 was shown to be most essential for both membrane binding and activation of PKC-alpha, presumably due to its coordination to multiple Ca2+ ions. Furthermore, to identify the residues in the C2 domain that are involved in membrane binding of PKC-alpha, we mutated four putative membrane binding residues (Trp245, Trp247, Arg249, and Arg252). Membrane binding and enzymatic properties of two double-site mutants (W245A/W247A and R249A/R252A) indicate that Arg249 and Arg252 are involved in electrostatic interactions of PKC-alpha with anionic membranes, whereas Trp245 and Trp247 participate in its penetration into membranes and resulting hydrophobic interactions. Taken together, these studies provide the first experimental evidence for the role of C2 domain of conventional PKC as a membrane docking unit as well as a module that triggers conformational changes to activate the protein.
GENETIC VARIANTS, IMMUNE FUNCTION AND RISK OF PRE-ECLAMPSIA AMONG AMERICAN INDIANS
Best, Lyle G.; Nadeau, Melanie; Davis, Kylie; Lamb, Felicia; Bercier, Shellee; Anderson, Cindy M.
2011-01-01
Objective To determine the prevalence in an American Indian population of genetic variants with putative effects on immune function and determine if they are associated with pre-eclampsia. Methods In a study of 66 cases and 130 matched controls, six single nucleotide polymorphisms (SNP) with either previously demonstrated or postulated modulating effects on the immune system were genotyped. Allele frequencies and various genetic models were evaluated by conditional logistic regression in both univariate and multiply adjusted models. Results Although most genetic variants lacked evidence of association with pre-eclampsia, the minor allele of the CRP related, rs1205 SNP in a dominant model with adjustment for age at delivery, nulliparity and body mass index, exhibited an odds ratio of 0.259 (95% CI of 0.08 – 0.81, p=0.020) in relation to severe pre-eclampsia (48 cases). The allelic prevalence of this variant was 46.1% in this population. Conclusion Of the six SNPs related to immune function in this study, a functional variant in the 3'UTR of the CRP gene was shown to be associated with severe pre-eclampsia in an American Indian population. PMID:22004660
Rajesh; Singal, Shobhita; Kotnala, Ravinder K
2017-10-01
A biofunctionalized reduced graphene oxide (rGO)-modified screen-printed carbon electrode (SPCE) was constructed as an immunosensor for C-reactive protein (CRP) detection, a biomarker released in early stage acute myocardial infarction. A different approach of single frequency analysis (SFA) study was utilized for the biomolecular sensing, by monitoring the response in phase angle changes obtained at an optimized frequency resulting from antigen-antibody interactions. A set of measurements were carried out to optimize a frequency where a maximum change in phase angle was observed, and in this case, we found it at around 10 Hz. The bioelectrode was characterized by contact angle measurements, scanning electron microscopy, and electrochemical techniques. A concentration-dependent response of immunosensor to CRP with the change in phase angle, at a fixed frequency of 10 Hz, was found to be in the range of 10 ng mL -1 to 10 μg mL -1 in PBS and was fit quantitative well with the Hill-Langmuir equation. Based on the concentration-response data, the dissociation constant (K d ) was found to be 3.5 nM (with a Hill coefficient n = 0.57), which indicated a negative cooperativity with high anti-CRP (antibody)-CRP (antigen) binding at the electrode surface. A low-frequency analysis of sensing with an ease of measurement on a disposable electroactive rGO-modified electrode with high selectivity and sensitivity makes it a potential tool for biological sensors.
Eickholz, Peter; Siegelin, Yasemin; Scharf, Susanne; Schacher, Beate; Oremek, Gerhard M; Sauer-Eppel, Hildegund; Schubert, Ralf; Wohlfeil, Martin
2013-04-01
Assessment of the effect of non-surgical periodontal therapy (SRP) on serum inflammatory parameters in patients with untreated aggressive (AgP) and chronic (ChP) periodontitis. Overall, 31 ChP and 29 AgP were examined clinically prior to and 12 weeks after SRP (subgingival scaling of all pockets within 2 days) with systemic antibiotics for patients positive for Aggregatibacter actinomycetemcomitans (14 AgP, 9 ChP). Blood was sampled prior to, one day, 6, and 12 weeks after the first SRP visit. Serum elastase, C-reactive protein (CRP), lipopolysaccharide-binding protein (LBP), interleukin (IL) 6, 8, and leukocyte counts were assessed. At baseline, serum elastase, CRP, and LBP were significantly (p < 0.01) higher in AgP than ChP. Serum elastase, CRP, LBP, and IL-6 were significantly (p < 0.001) elevated one day after scaling in both groups. Both groups showed significant clinical improvement (p < 0.001). A significant difference was observed regarding change of serum elastase 12 weeks after SRP between AgP and ChP (p = 0.015). Multiple regression analysis revealed AgP, African origin, and bleeding on probing to be associated with more pronounced elastase reduction. CRP reduction was associated with African origin, systemic antibiotics, and baseline probing pocket depth. SRP results in serum elastase reduction in AgP but not in ChP. © 2013 John Wiley & Sons A/S.
Sarsero, Doreen; Molenaar, Peter; Kaumann, Alberto J; Freestone, Nicholas S
1999-01-01
We identified putative β4-adrenoceptors by radioligand binding, measured increases in ventricular contractile force by (−)-CGP 12177 and (±)-cyanopindolol and demonstrated increased Ca2+ transients by (−)-CGP 12177 in rat cardiomyocytes.(−)-[3H]-CGP 12177 labelled 13–22 fmol mg−1 protein ventricular β1, β2-adrenoceptors (pKD ∼9.0) and 50–90 fmol mg−1 protein putative β4-adrenoceptors (pKD ∼7.3). The affinity values (pKi) for (β1,β2-) and putative β4-adrenoceptors, estimated from binding inhibition, were (−)-propranolol 8.4, 5.7; (−)-bupranolol 9.7, 5.8; (±)-cyanopindolol 10.0,7.4.In left ventricular papillary muscle, in the presence of 30 μM 3-isobutyl-1-methylxanthine, (−)-CGP 12177 and (±)-cyanopindolol caused positive inotropic effects, (pEC50, (−)-CGP 12177, 7.6; (±)-cyanopindolol, 7.0) which were antagonized by (−)-bupranolol (pKB 6.7–7.0) and (−)-CGP 20712A (pKB 6.3–6.6). The cardiostimulant effects of (−)-CGP 12177 in papillary muscle, left and right atrium were antagonized by (±)-cyanopindolol (pKP 7.0–7.4).(−)-CGP 12177 (1 μM) in the presence of 200 nM (−)-propranolol increased Ca2+ transient amplitude by 56% in atrial myocytes, but only caused a marginal increase in ventricular myocytes. In the presence of 1 μM 3-isobutyl-1-methylxanthine and 200 nM (−)-propranolol, 1 μM (−)-CGP 12177 caused a 73% increase in Ca2+ transient amplitude in ventricular myocytes. (−)-CGP 12177 elicited arrhythmic transients in some atrial and ventricular myocytes.Probably by preventing cyclic AMP hydrolysis, 3-isobutyl-1-methylxanthine facilitates the inotropic function of ventricular putative β4-adrenoceptors, suggesting coupling to Gs protein-adenylyl cyclase. The receptor-mediated increases in contractile force are related to increases of Ca2+ in atrial and ventricular myocytes. The agreement of binding affinities of agonists with cardiostimulant potencies is consistent with mediation through putative β4-adrenoceptors labelled with (−)-[3H]-CGP 12177. PMID:10602323
Kowalczyk, Agata; Sęk, Jakub P; Kasprzak, Artur; Poplawska, Magdalena; Grudzinski, Ireneusz P; Nowicka, Anna M
2018-06-13
Simple, selective and sensitive analytical devices are of a great importance for medical application. Herein, we developed highly selective immunosensor for electrochemical detection of C-reactive protein (CRP) in blood sample. Branched polyethylenimine functionalized with ferrocene residues (PEI-Fc) was the main element of the recognition layer, which allowed: (i) covalent binding of an antibody in its most favorable orientation and (ii) voltammetric detection of the C-reactive protein. Anchoring of PEI-Fc to the electrode surface through the electrodeposition process leads to the formation of thin, stable and reproducible layers, which is extremely important in the case of electrochemical immunosensing. The proposed analytical device is characterized by high selectivity and sensitivity and can be successfully used in the concentration range of CRP from 1 to 5·10 4 ng mL -1 . The determined limit of detection was circa 0.5 and 2.5 ng mL -1 for voltammetric and impedance analysis, respectively. The developed analytical device has also been successfully applied for the analysis of CRP level in rat blood samples. Copyright © 2018. Published by Elsevier B.V.
Bernard, Elyse D; Nguyen, Kathy C; DeRosa, Maria C; Tayabali, Azam F; Aranda-Rodriguez, Rocio
2017-01-01
Aptamers are short oligonucleotide sequences used in detection systems because of their high affinity binding to a variety of macromolecules. With the introduction of aptamers over 25 years ago came the exploration of their use in many different applications as a substitute for antibodies. Aptamers have several advantages; they are easy to synthesize, can bind to analytes for which it is difficult to obtain antibodies, and in some cases bind better than antibodies. As such, aptamer applications have significantly expanded as an adjunct to a variety of different immunoassay designs. The Multiple-Analyte Profiling (xMAP) technology developed by Luminex Corporation commonly uses antibodies for the detection of analytes in small sample volumes through the use of fluorescently coded microbeads. This technology permits the simultaneous detection of multiple analytes in each sample tested and hence could be applied in many research fields. Although little work has been performed adapting this technology for use with apatmers, optimizing aptamer-based xMAP assays would dramatically increase the versatility of analyte detection. We report herein on the development of an xMAP bead-based aptamer/antibody sandwich assay for a biomarker of inflammation (C-reactive protein or CRP). Protocols for the coupling of aptamers to xMAP beads, validation of coupling, and for an aptamer/antibody sandwich-type assay for CRP are detailed. The optimized conditions, protocols and findings described in this research could serve as a starting point for the development of new aptamer-based xMAP assays.
Design and synthesis of inositolphosphoglycan putative insulin mediators.
López-Prados, Javier; Cuevas, Félix; Reichardt, Niels-Christian; de Paz, José-Luis; Morales, Ezequiel Q; Martín-Lomas, Manuel
2005-03-07
The binding modes of a series of molecules, containing the glucosamine (1-->6) myo-inositol structural motif, into the ATP binding site of the catalytic subunit of cAMP-dependent protein kinase (PKA) have been analysed using molecular docking. These calculations predict that the presence of a phosphate group at the non-reducing end in pseudodisaccharide and pseudotrisaccharide structures properly orientate the molecule into the binding site and that pseudotrisaccharide structures present the best shape complementarity. Therefore, pseudodisaccharides and pseudotrisaccharides have been synthesised from common intermediates using effective synthetic strategies. On the basis of this synthetic chemistry, the feasibility of constructing small pseudotrisaccharide libraries on solid-phase using the same intermediates has been explored. The results from the biological evaluation of these molecules provide additional support to an insulin-mediated signalling system which involves the intermediacy of inositolphosphoglycans as putative insulin mediators.
Doolin, Kelly; Allers, Kelly A; Pleiner, Sina; Liesener, Andre; Farrell, Chloe; Tozzi, Leonardo; O'Hanlon, Erik; Roddy, Darren; Frodl, Thomas; Harkin, Andrew; O'Keane, Veronica
2018-05-19
Tryptophan depletion is a well-replicated biological finding in Major Depressive Disorder (MDD). The kynurenine pathway (KP) and its rate-limiting tryptophan degrading enzyme, indolamine 2,3 dioxygenase (IDO), have been implicated in the pathogenesis of depression. IDO expression is driven by inflammatory cytokines, providing a putative link between inflammation and neuropathology. This study examined circulating concentrations of C-reactive protein (CRP), plasma tryptophan, kynurenine (KYN), kynurenic acid (KYNA) and quinolinic acid (QUIN) and whole blood mRNA expression of IDO in patients with major depressive disorder (MDD) compared with healthy controls (HC). A diagnosis of major depression was made according to DSM-IV. Depression severity was assessed using the Hamilton depression (HAM-D) rating scale. 74 MDD patients, 39 with a first presentation of MDD (fpMDD) and 35 with chronic or recurrent episodes (rMDD), and 37 HC were recruited to the study. Whole blood and plasma samples were collected. Expression of markers in whole blood were measured by PCR, circulating CRP by ELISA and KP metabolites by LC-MS/MS. Hippocampal cornu ammonis (CA) and subiculum volumes were determined by MRI and calculated using FreeSurfer. Tryptophan concentrations were significantly reduced in MDD compared to HC. There was a positive correlation between QUIN and both CRP concentrations and whole blood IDO1 in MDD. KYNA concentrations were reduced in MDD patients presenting with a first episode (fpMDD) compared to those presenting with recurrent depression (rMDD) and HC. By contrast QUIN concentrations were elevated in rMDD compared to fpMDD and HC. KYNA/QUIN was reduced in MDD and rMDD but not fpMDD compared to HC. Hippocampal subfield volumes were smaller in MDD patients than HC for CA1 (left only), CA2/3 (left and right) and CA4 (right only). CRP and CA1 volumes were negatively correlated bilaterally in MDD patients. KYNA and subiculum volume were positively correlated bilaterally. This study found evidence of KP metabolism imbalance in MDD patients in addition to tryptophan reduction and mild immune activation. Relationships between CRP and KYNA with some hippocampal subfield volumes in MDD patients suggest that this inflammatory signature may be associated with reduced hippocampal subfield volumes in depression. Copyright © 2018 Elsevier Ltd. All rights reserved.
Whole-Genome Survey of the Putative ATP-Binding Cassette Transporter Family Genes in Vitis vinifera
Çakır, Birsen; Kılıçkaya, Ozan
2013-01-01
The ATP-binding cassette (ABC) protein superfamily constitutes one of the largest protein families known in plants. In this report, we performed a complete inventory of ABC protein genes in Vitis vinifera, the whole genome of which has been sequenced. By comparison with ABC protein members of Arabidopsis thaliana, we identified 135 putative ABC proteins with 1 or 2 NBDs in V. vinifera. Of these, 120 encode intrinsic membrane proteins, and 15 encode proteins missing TMDs. V. vinifera ABC proteins can be divided into 13 subfamilies with 79 “full-size,” 41 “half-size,” and 15 “soluble” putative ABC proteins. The main feature of the Vitis ABC superfamily is the presence of 2 large subfamilies, ABCG (pleiotropic drug resistance and white-brown complex homolog) and ABCC (multidrug resistance-associated protein). We identified orthologs of V. vinifera putative ABC transporters in different species. This work represents the first complete inventory of ABC transporters in V. vinifera. The identification of Vitis ABC transporters and their comparative analysis with the Arabidopsis counterparts revealed a strong conservation between the 2 species. This inventory could help elucidate the biological and physiological functions of these transporters in V. vinifera. PMID:24244377
DOE Office of Scientific and Technical Information (OSTI.GOV)
Moses, Alan M.; Chiang, Derek Y.; Pollard, Daniel A.
2004-10-28
We introduce a method (MONKEY) to identify conserved transcription-factor binding sites in multispecies alignments. MONKEY employs probabilistic models of factor specificity and binding site evolution, on which basis we compute the likelihood that putative sites are conserved and assign statistical significance to each hit. Using genomes from the genus Saccharomyces, we illustrate how the significance of real sites increases with evolutionary distance and explore the relationship between conservation and function.
Granja, Luiz Fernando Zmetek; Pinto, Lysianne; Almeida, Cátia Amancio; Alviano, Daniela Sales; Da Silva, Maria Helena; Ejzemberg, Regina; Alviano, Celuta Sales
2010-03-01
Complement activation by spores of Mucor ramosissimus, Mucor plumbeus and Mucor circinelloides was studied using absorbed human serum in the presence or absence of chelators (EGTA or EDTA). We found that the spore caused full complement activation when incubated with EGTA-Mg2+ or without chelators, indicating that the alternative pathway is mainly responsible for this response. In order to compare activation profiles from each species, ELISAs for C3 and C4 fragments, mannan binding lectin (MBL), C-reactive protein (CRP) and IgG studies were carried out. All proteins were present on the species tested. Immunofluorescence tests demonstrated the presence of C3 fragments on the surface of all samples, which were confluent throughout fungal surfaces. The same profile of C3, C4, MBL, CRP and IgG deposition, observed in all species, suggests a similar activation behavior for these species.
Structure of the choline-binding domain of Spr1274 in Streptococcus pneumoniae.
Zhang, Zhenyi; Li, Wenzhe; Frolet, Cecile; Bao, Rui; di Guilmi, Anne Marie; Vernet, Thierry; Chen, Yuxing
2009-08-01
Spr1274 is a putative choline-binding protein that is bound to the cell wall of Streptococcus pneumoniae through noncovalent interactions with the choline moieties of teichoic and lipoteichoic acids. Its function is still unknown. The crystal structure of the choline-binding domain of Spr1274 (residues 44-129) was solved at 2.38 A resolution with three molecules in the asymmetric unit. It may provide a structural basis for functional analysis of choline-binding proteins.
Diurnal rhythm of melatonin binding in the rat suprachiasmatic nucleus
DOE Office of Scientific and Technical Information (OSTI.GOV)
Laitinen, J.T.; Castren, E.; Vakkuri, O.
1989-03-01
We used quantitative in vitro autoradiography to localize and characterize 2-/sup 125/I-melatonin binding sites in the rat suprachiasmatic nuclei in relation to pineal melatonin production. In a light:dark cycle of 12:12 h, binding density exhibited significant diurnal variation with a peak at the dark-light transition and a trough 12 hours later. Saturation studies suggested that the decreased binding at light-dark transition might be due to a shift of the putative melatonin receptor to a low affinity state.
Yen, Yi-Kuang; Lai, Yu-Cheng; Hong, Wei-Ting; Pheanpanitporn, Yotsapoom; Chen, Chuin-Shan; Huang, Long-Sun
2013-01-01
This study demonstrates a novel method for electrical detection of C-reactive protein (CRP) as a means of identifying an infection in the body, or as a cardiovascular disease risk assay. The method uses a single free-standing, thermally controlled piezoresistive microcantilever biosensor. In a commonly used sensing arrangement of conventional dual cantilevers in the Wheatstone bridge circuit, reference and gold-coated sensing cantilevers that inherently have heterogeneous surface materials and different multilayer structures may yield independent responses to the liquid environmental changes of chemical substances, flow field and temperature, leading to unwanted signal disturbance for biosensing targets. In this study, the single free-standing microcantilever for biosensing applications is employed to resolve the dual-beam problem of individual responses in chemical solutions and, in a thermally controlled system, to maintain its sensor performance due to the sensitive temperature effect. With this type of single temperature-controlled microcantilever sensor, the electrical detection of various CRP concentrations from 1 μg/mL to 200 μg/mL was performed, which covers the clinically relevant range. Induced surface stresses were measured at between 0.25 N/m and 3.4 N/m with high reproducibility. Moreover, the binding affinity (KD) of CRP and anti-CRP interaction was found to be 18.83 ± 2.99 μg/mL, which agreed with results in previous reported studies. This biosensing technique thus proves valuable in detecting inflammation, and in cardiovascular disease risk assays. PMID:23899933
Iron Status and Inflammation in Early Stages of Chronic Kidney Disease.
Łukaszyk, Ewelina; Łukaszyk, Mateusz; Koc-Żórawska, Ewa; Tobolczyk, Jolanta; Bodzenta-Łukaszyk, Anna; Małyszko, Jolanta
2015-01-01
One of the most common causes of anemia of chronic disease (ACD) is chronic kidney disease. The main pathomechanism responsible for ACD is subclinical inflammation. The key element involved in iron metabolism is hepcidin, however, studies on new indices of iron status are in progress.The aim of the study was to assess the iron status in patients in early stages of chronic kidney disease, iron correlation with inflammation parameters and novel biomarkers of iron metabolism. The study included 69 patients. Standard laboratory measurements were used to measure the iron status, complete blood count, fibrinogen, prothrombin index, C-reactive protein concentration (CRP), creatinine, urea, uric acid. Commercially available kits were used to measure high-sensitivity CRP, interleukin 6 (IL-6), hepcidin-25, hemojuvelin, soluble transferrin receptor (sTfR), growth differentiation factor-15 (GDF-15) and zonulin. Absolute iron deficiency was present in 17% of the patients, functional iron deficiency was present in 12% of the patients. Functional iron deficiency was associated with significantly higher serum levels of fibrinogen, ferritin, transferrin saturation, total iron binding capacity, hepcidin and older age relative to patients with absolute iron deficiency. In comparison with patients without iron deficiency, patients with functional iron deficiency were older, with lower prothrombin index, higher fibrinogen, CRP, hsCRP, sTfR, GDF-15, urea and lower eGFR. Hepcidin was predicted by markers of inflammation:ferritin, fibrinogen and IL-6. Inflammation is correlated with iron status. Novel biomarkers of iron metabolism might be useful to distinguish iron deficiency anemia connected with inflammation and absolute iron deficiency. © 2015 S. Karger AG, Basel.
Cholesterol-Binding Sites in GIRK Channels: The Devil is in the Details.
Rosenhouse-Dantsker, Avia
2018-01-01
In recent years, it has become evident that cholesterol plays a direct role in the modulation of a variety of ion channels. In most cases, cholesterol downregulates channel activity. In contrast, our earlier studies have demonstrated that atrial G protein inwardly rectifying potassium (GIRK) channels are upregulated by cholesterol. Recently, we have shown that hippocampal GIRK currents are also upregulated by cholesterol. A combined computational-experimental approach pointed to putative cholesterol-binding sites in the transmembrane domain of the GIRK2 channel, the primary subunit in hippocampal GIRK channels. In particular, the principal cholesterol-binding site was located in the center of the transmembrane domain in between the inner and outer α-helices of 2 adjacent subunits. Further studies pointed to a similar cholesterol-binding site in GIRK4, a major subunit in atrial GIRK channels. However, a close look at a sequence alignment of the transmembrane helices of the 2 channels reveals surprising differences among the residues that interact with the cholesterol molecule in these 2 channels. Here, we compare the residues that form putative cholesterol-binding sites in GIRK2 and GIRK4 and discuss the similarities and differences among them.
Transcriptional regulation of podoplanin expression by Prox1 in lymphatic endothelial cells.
Pan, Yanfang; Wang, Wen-di; Yago, Tadayuki
2014-07-01
Transcription factor prospero homeobox 1 (Prox-1) and podoplanin (PDPN), mucin-type transmembane protein, are both constantly expressed in lymphatic endothelial cells (LECs) and appear to function in an LEC-autonomous manner. Mice globally lacking PDPN (Pdpn(-/-)) develop abnormal and blood-filled lymphatic vessels that highly resemble those in inducible mice lacking Prox-1 (Prox1(-/-)). Prox1 has also been reported to induce PDPN expression in cultured ECs. Thus, we hypothesize that PDPN functions downstream of Prox1 and that its expression is regulated by Prox1 in LECs at the transcriptional level. We first identified four putative binding elements for Prox1 in the 5' upstream regulatory region of Pdpn gene and found that Prox1 directly binds to the 5' regulatory sequence of Pdpn gene in LECs by chromatin immunoprecipitation assay. DNA pull down assay confirmed that Prox1 binds to the putative binding element. In addition, luciferase reporter assay indicated that Prox1 binding to the 5' regulatory sequence of Pdpn regulates Pdpn gene expression. We are therefore the first to experimentally demonstrate that Prox1 regulates PDPN expression at the transcriptional level in the lymphatic vascular system. Copyright © 2014 Elsevier Inc. All rights reserved.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Dam, T.V.; Takeda, Y.; Krause, J.E.
1990-01-01
The presence of N-terminally extended forms of neurokinin A has recently been reported in the mammalian brain. Among them, gamma-preprotachykinin-(72-92)-peptide amide (gamma-PPT-(72-92)-NH2), a peptide derived by posttranslational processing of gamma-preprotachykinin, is most prominent. We report here that this peptide most likely acts on neurokinin-2 receptor sites since neurokinin A (a putative neurokinin-2 agonist) and gamma-PPT-(72-92)-NH2 are potent competitors of 125I-labeled gamma-PPT-(72-92)-NH2 binding whereas selective neurokinin-1 and -3 agonists are not. Moreover, the distribution of 125I-labeled gamma-PPT-(72-92)-NH2 and 125I-labeled neurokinin A binding sites are very similar in rat brain. On the other hand, 125I-labeled Bolton-Hunter-substance P (a neurokinin-1 ligand) and 125I-labeledmore » Bolton-Hunter-eledoisin (a neurokinin-3 ligand) binding sites are differentially located in this tissue. Thus, it appears that gamma-PPT-(72-92)-NH2 binds to neurokinin-2 receptors and should be considered as a putative endogenous ligand for this receptor class.« less
Niskanen, Einari A; Hytönen, Vesa P; Grapputo, Alessandro; Nordlund, Henri R; Kulomaa, Markku S; Laitinen, Olli H
2005-01-01
Background A chicken egg contains several biotin-binding proteins (BBPs), whose complete DNA and amino acid sequences are not known. In order to identify and characterise these genes and proteins we studied chicken cDNAs and genes available in the NCBI database and chicken genome database using the reported N-terminal amino acid sequences of chicken egg-yolk BBPs as search strings. Results Two separate hits showing significant homology for these N-terminal sequences were discovered. For one of these hits, the chromosomal location in the immediate proximity of the avidin gene family was found. Both of these hits encode proteins having high sequence similarity with avidin suggesting that chicken BBPs are paralogous to avidin family. In particular, almost all residues corresponding to biotin binding in avidin are conserved in these putative BBP proteins. One of the found DNA sequences, however, seems to encode a carboxy-terminal extension not present in avidin. Conclusion We describe here the predicted properties of the putative BBP genes and proteins. Our present observations link BBP genes together with avidin gene family and shed more light on the genetic arrangement and variability of this family. In addition, comparative modelling revealed the potential structural elements important for the functional and structural properties of the putative BBP proteins. PMID:15777476
Luis, Luis; Serrano, María Luisa; Hidalgo, Mariana; Mendoza-León, Alexis
2013-01-01
Differential susceptibility to microtubule agents has been demonstrated between mammalian cells and kinetoplastid organisms such as Leishmania spp. and Trypanosoma spp. The aims of this study were to identify and characterize the architecture of the putative colchicine binding site of Leishmania spp. and investigate the molecular basis of colchicine resistance. We cloned and sequenced the β-tubulin gene of Leishmania (Viannia) guyanensis and established the theoretical 3D model of the protein, using the crystallographic structure of the bovine protein as template. We identified mutations on the Leishmania β-tubulin gene sequences on regions related to the putative colchicine-binding pocket, which generate amino acid substitutions and changes in the topology of this region, blocking the access of colchicine. The same mutations were found in the β-tubulin sequence of kinetoplastid organisms such as Trypanosoma cruzi, T. brucei, and T. evansi. Using molecular modelling approaches, we demonstrated that conformational changes include an elongation and torsion of an α-helix structure and displacement to the inside of the pocket of one β-sheet that hinders access of colchicine. We propose that kinetoplastid organisms show resistance to colchicine due to amino acids substitutions that generate structural changes in the putative colchicine-binding domain, which prevent colchicine access. PMID:24083244
Simon, S; Le Goff, A; Frobert, Y; Grassi, J; Massoulié, J
1999-09-24
We investigated the target sites of three inhibitory monoclonal antibodies on Electrophorus acetylcholinesterase (AChE). Previous studies showed that Elec-403 and Elec-410 are directed to overlapping but distinct epitopes in the peripheral site, at the entrance of the catalytic gorge, whereas Elec-408 binds to a different region. Using Electrophorus/rat AChE chimeras, we identified surface residues that differed between sensitive and insensitive AChEs: the replacement of a single Electrophorus residue by its rat homolog was able to abolish binding and inhibition, for each antibody. Reciprocally, binding and inhibition by Elec-403 and by Elec-410 could be conferred to rat AChE by the reverse mutation. Elec-410 appears to bind to one side of the active gorge, whereas Elec-403 covers its opening, explaining why the AChE-Elec-410 complex reacts faster than the AChE-Elec-403 or AChE-fasciculin complexes with two active site inhibitors, m-(N,N, N-trimethyltammonio)trifluoro-acetophenone and echothiophate. Elec-408 binds to the region of the putative "back door," distant from the peripheral site, and does not interfere with the access of inhibitors to the active site. The binding of an antibody to this novel regulatory site may inhibit the enzyme by blocking the back door or by inducing a conformational distortion within the active site.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Lin, Biaoyang; Nasir, J.; Kalchman, M.A.
1995-02-10
We have previously cloned and characterized the murine homologue of the Huntington disease (HD) gene and shown that it maps to mouse chromosome 5 within a region of conserved synteny with human chromosome 4p16.3. Here we present a detailed comparison of the sequence of the putative promoter and the organization of the 5{prime} genomic region of the murine (Hdh) and human HD genes encompassing the first five exons. We show that in this region these two genes share identical exon boundaries, but have different-size introns. Two dinucleotide (CT) and one trinucleotide intronic polymorphism in Hdh and an intronic CA polymorphismmore » in the HD gene were identified. Comparison of 940-bp sequence 5{prime} to the putative translation start site reveals a highly conserved region (78.8% nucleotide identity) between Hdh and the HD gene from nucleotide -56 to -206 (of Hdh). Neither Hdh nor the HD gene have typical TATA or CCAAT elements, but both show one putative AP2 binding site and numerous potential Sp1 binding sites. The high sequence identity between Hdh and the HD gene for approximately 200 bp 5{prime} to the putative translation start site indicates that these sequences may play a role in regulating expression of the Huntington disease gene. 30 refs., 4 figs., 2 tabs.« less
Investigating MUC1/ICAM-1 Binding Induced Signaling in Breast Cancer Metastasis
2011-05-01
expected that covalently linked species would remain intact. Reducing (R, + !-mercaptoethanol) and non-reducing (NR, no !-mercaptoethanol) samples were...binding site, containing both proline and arginine residues. We mutated the SH2 and/or putative SH3 binding domains on the MUC1-CFP-Fv plasmid...Structure and regulation of Src family kinases. Oncogene 2004, 23:7918- 7927. 31. Li SSC: Specificity and versatility of SH3 and other proline -recognition
Fleischli, Christoph; Sirena, Dominique; Lesage, Guillaume; Havenga, Menzo J E; Cattaneo, Roberto; Greber, Urs F; Hemmi, Silvio
2007-11-01
We recently characterized the domains of the human cofactor protein CD46 involved in binding species B2 adenovirus (Ad) serotype 35. Here, the CD46 binding determinants are mapped for the species B1 Ad serotypes 3 and 7 and for the species B2 Ad11. Ad3, 7 and 11 bound and transduced CD46-positive rodent BHK cells at levels similar to Ad35. By using antibody-blocking experiments, hybrid CD46-CD4 receptor constructs and CD46 single point mutants, it is shown that Ad3, 7 and 11 share many of the Ad35-binding features on CD46. Both CD46 short consensus repeat domains SCR I and SCR II were necessary and sufficient for optimal binding and transgene expression, provided that they were positioned at an appropriate distance from the cell membrane. Similar to Ad35, most of the putative binding residues of Ad3, 7 and 11 were located on the same glycan-free, solvent-exposed face of the SCR I or SCR II domains, largely overlapping with the binding surface of the recently solved fiber knob Ad11-SCR I-II three-dimensional structure. Differences between species B1 and B2 Ads were documented with competition experiments based on anti-CD46 antibodies directed against epitopes flanking the putative Ad-binding sites, and with competition experiments based on soluble CD46 protein. It is concluded that the B1 and B2 species of Ad engage CD46 through similar binding surfaces.
Wein, Thomas; Höfner, Georg; Rappenglück, Sebastian; Sichler, Sonja; Niessen, Karin V; Seeger, Thomas; Worek, Franz; Thiermann, Horst; Wanner, Klaus T
2018-09-01
Irreversible inhibition of the acetylcholine esterase upon intoxication with organophosphorus compounds leads to an accumulation of acetylcholine in the synaptic cleft and a subsequent desensitization of nicotinic acetylcholine receptors which may ultimately result in respiratory failure. The bispyridinium compound MB327 has been found to restore functional activity of nAChR thus representing a promising starting point for the development of new drugs for the treatment of organophosphate poisoning. In order to optimize the resensitizing effect of MB327 on nAChR, it would be very helpful to know the MB327 specific binding site to apply structure based molecular modeling. The binding site for MB327 at the nAChR is not known and so far goal of speculations, but it has been shown that MB327 does not bind to the orthosteric acetylcholine binding site. We have used docking calculations to screen the surface of nAChR for possible binding sites of MB327. The results indicate that at least two potential binding sites for MB327 at nAChR are present inside the channel pore. In these binding sites, MB327 intercalates between the γ-α and β-δ subunits of nAChR, respectively. Both putative MB327 binding sites show an unsymmetrical distribution of surrounding hydrophilic and lipophilic amino acids. This suggests that substitution of MB327-related bispyridinium compounds on one of the two pyridinium rings with polar substituents should have a favorable effect on the pharmacological function. Copyright © 2017 Elsevier B.V. All rights reserved.
Russo Krauss, Irene; Ramaswamy, Sneha; Neidle, Stephen; Haider, Shozeb; Parkinson, Gary N
2016-02-03
We report here on an X-ray crystallographic and molecular modeling investigation into the complex 3' interface formed between putative parallel stranded G-quadruplexes and a duplex DNA sequence constructed from the human telomeric repeat sequence TTAGGG. Our crystallographic approach provides a detailed snapshot of a telomeric 3' quadruplex-duplex junction: a junction that appears to have the potential to form a unique molecular target for small molecule binding and interference with telomere-related functions. This unique target is particularly relevant as current high-affinity compounds that bind putative G-quadruplex forming sequences only rarely have a high degree of selectivity for a particular quadruplex. Here DNA junctions were assembled using different putative quadruplex-forming scaffolds linked at the 3' end to a telomeric duplex sequence and annealed to a complementary strand. We successfully generated a series of G-quadruplex-duplex containing crystals, both alone and in the presence of ligands. The structures demonstrate the formation of a parallel folded G-quadruplex and a B-form duplex DNA stacked coaxially. Most strikingly, structural data reveals the consistent formation of a TAT triad platform between the two motifs. This triad allows for a continuous stack of bases to link the quadruplex motif with the duplex region. For these crystal structures formed in the absence of ligands, the TAT triad interface occludes ligand binding at the 3' quadruplex-duplex interface, in agreement with in silico docking predictions. However, with the rearrangement of a single nucleotide, a stable pocket can be produced, thus providing an opportunity for the binding of selective molecules at the interface.
Mutations That Stimulate flhDC Expression in Escherichia coli K-12.
Fahrner, Karen A; Berg, Howard C
2015-10-01
Motility is a beneficial attribute that enables cells to access and explore new environments and to escape detrimental ones. The organelle of motility in Escherichia coli is the flagellum, and its production is initiated by the activating transcription factors FlhD and FlhC. The expression of these factors by the flhDC operon is highly regulated and influenced by environmental conditions. The flhDC promoter is recognized by σ(70) and is dependent on the transcriptional activator cyclic AMP (cAMP)-cAMP receptor protein complex (cAMP-CRP). A number of K-12 strains exhibit limited motility due to low expression levels of flhDC. We report here a large number of mutations that stimulate flhDC expression in such strains. They include single nucleotide changes in the -10 element of the promoter, in the promoter spacer, and in the cAMP-CRP binding region. In addition, we show that insertion sequence (IS) elements or a kanamycin gene located hundreds of base pairs upstream of the promoter can effectively enhance transcription, suggesting that the topology of a large upstream region plays a significant role in the regulation of flhDC expression. None of the mutations eliminated the requirement for cAMP-CRP for activation. However, several mutations allowed expression in the absence of the nucleoid organizing protein, H-NS, which is normally required for flhDC expression. The flhDC operon of Escherichia coli encodes transcription factors that initiate flagellar synthesis, an energetically costly process that is highly regulated. Few deregulating mutations have been reported thus far. This paper describes new single nucleotide mutations that stimulate flhDC expression, including a number that map to the promoter spacer region. In addition, this work shows that insertion sequence elements or a kanamycin gene located far upstream from the promoter or repressor binding sites also stimulate transcription, indicating a role of regional topology in the regulation of flhDC expression. Copyright © 2015, American Society for Microbiology. All Rights Reserved.
Larson, Leila Margaret; Addo, O. Yaw; Sandalinas, Fanny; Faigao, Katherine; Kupka, Roland; Flores-Ayala, Rafael; Suchdev, Parminder S.
2016-01-01
Vitamin A deficiency (VAD) is an important contributor to child morbidity and mortality. The prevalence of VAD, measured by retinol-binding protein (RBP) or retinol, is overestimated in populations with a high prevalence of inflammation. We aimed to quantify and adjust for the effect of inflammation on VAD prevalence in a nationally representative survey of Liberian children 6 to 35 months of age. We compared five approaches to adjust RBP for inflammation and estimate VAD prevalence (defined as RBP <0.7 μmol/L): (1) ignoring inflammation; (2) excluding individuals with inflammation (C-reactive protein (CRP) >5 mg/L or alpha1-acid glycoprotein (AGP) >1 g/)L; (3) multiplying each individual’s RBP by an internal correction factor; (4) by an external correction factor; and (5) using regression (corrected RBP = exp(InRBP – β1(lnCRPobs-lnCRPref) – β2(lnAGPobs-lnAGPref)). Corrected RBP was based on a regression model where reference lnCRP and lnAGP were set to the maximum of the lowest decile. The unadjusted prevalence of VAD was 24.7%. Children with elevated CRP and/or AGP had significantly lower RBP concentrations than their apparently healthy peers (geometric mean RBP 0.79 μmol/L (95% CI: 0.76, 0.82) vs. 0.95 μmol/L (95% CI: 0.92, 0.97), P <0.001). Using approaches 2–5 resulted in a prevalence of VAD of 11.6%, 14.3%, 13.5% and 7.3%, respectively. Depending on the approach, the VAD prevalence is reduced 10–17 percentage points when inflammation is taken into account. Further quantification of the influence of inflammation on biomarkers of vitamin A status from other national surveys is needed to compare and recommend the preferred adjustment approach across populations. PMID:26842430
Işlak Mutcalı, Sibel; Saltoğlu, Neşe; Balkan, İlker İnanç; Özaras, Reşat; Yemişen, Mücahit; Tabak, Fehmi; Mert, Ali; Öztürk, Recep; Öngören, Şeniz; Başlar, Zafer; Aydın, Yıldız; Ferhanoğlu, Burhan; Soysal, Teoman
2016-12-01
The significance of mannose-binding lectin (MBL) and H-ficolin deficiency in febrile neutropenic (FN) patients and the correlation of these markers along with consecutive C-reactive protein (CRP) and procalcitonin (PCT) levels during the infectious process are investigated. Patients with any hematological malignancies who were defined to have "microbiologically confirmed infection", "clinically documented infection", or "fever of unknown origin" were included in this single-center prospective observational study. Serum levels of CRP, PCT, MBL, and H-ficolin were determined on 3 separate occasions: at baseline (between hospital admission and chemotherapy), at the onset of fever, and at the 72nd hour of fever. Forty-six patients (54% male, mean age 41.7 years) with 61 separate episodes of FN were evaluated. Eleven patients (23.9%) had "microbiologically confirmed infection", 17 (37%) had "clinically documented infection", and 18 (39.1%) had "fever of unknown origin". Fourteen (30.4%) patients had low (<500 ng/mL) initial MBL levels and 7 (15.21%) had low (<12,000 ng/mL) H-ficolin levels. Baseline MBL and H-ficolin levels did not significantly change on the first and third days of fever (p=0.076). Gram-negative bacteremia more frequently occurred in those with low initial MBL levels (p=0.006). PCT levels were significantly higher in those with microbiologically documented infections. Mean and median PCT levels were significantly higher in cases with bacteremia. There was no significant difference between hemoculture-positive and-negative patients in terms of CRP levels. Monitoring serum H-ficolin levels was shown to be of no benefit in terms of predicting severe infection. Low baseline MBL levels were correlated with high risk of gram-negative bacteremia; however, no significant correlation was shown in the follow-up. Close monitoring of PCT levels is warranted to provide more accurate and specific data while monitoring cases of bacteremia.
Jeong, Ji Hun; Seo, Yiel Hea; Ahn, Jeong Yeal; Kim, Kyung Hee; Seo, Ja Young; Kim, Moon Jin; Lee, Hwan Tae; Park, Pil Whan
2016-09-01
Amino-terminal pro-B type natriuretic peptide (NT-proBNP) is a well-established prognostic factor in heart failure (HF). However, numerous causes may lead to elevations in NT-proBNP, and thus, an increased NT-proBNP level alone is not sufficient to predict outcome. The aim of this study was to evaluate the utility of two acute response markers, high sensitivity C-reactive protein (hsCRP) and heart-type fatty acid binding protein (H-FABP), in patients with an increased NT-proBNP level. The 278 patients were classified into three groups by etiology: 1) acute coronary syndrome (ACS) (n=62), 2) non-ACS cardiac disease (n=156), and 3) infectious disease (n=60). Survival was determined on day 1, 7, 14, 21, 28, 60, 90, 120, and 150 after enrollment. H-FABP (P<0.001), NT-proBNP (P=0.006), hsCRP (P<0.001) levels, and survival (P<0.001) were significantly different in the three disease groups. Patients were divided into three classes by using receiver operating characteristic curves for NT-proBNP, H-FABP, and hsCRP. Patients with elevated NT-proBNP (≥3,856 pg/mL) and H-FABP (≥8.8 ng/mL) levels were associated with higher hazard ratio for mortality (5.15 in NT-proBNP and 3.25 in H-FABP). Area under the receiver operating characteristic curve analysis showed H-FABP was a better predictor of 60-day mortality than NT-proBNP. The combined measurement of H-FABP with NT-proBNP provides a highly reliable means of short-term mortality prediction for patients hospitalized for ACS, non-ACS cardiac disease, or infectious disease.
USDA-ARS?s Scientific Manuscript database
In the natural environment, the longhorned beetle, Batocera horsfieldi (Hope) (Coleoptera: Cerambycidae), finds it’s maturation-feeding and host plants by using chemical cues. In this study, we described the identification and characterization of four new cDNAs that encode Minus-C odorant binding pr...
Newman-Tancredi, A; Gavaudan, S; Conte, C; Chaput, C; Touzard, M; Verrièle, L; Audinot, V; Millan, M J
1998-08-21
Recombinant human (h) 5-HT1A receptor-mediated G-protein activation was characterised in membranes of transfected Chinese hamster ovary (CHO) cells by use of guanosine-5'-O-(3-[35S]thio)-triphosphate ([35S]GTPgammaS binding). The potency and efficacy of 21 5-HT receptor agonists and antagonists was determined. The agonists, 5-CT (carboxamidotryptamine) and flesinoxan displayed high affinity (subnanomolar Ki values) and high efficacy (Emax > 90%, relative to 5-HT = 100%). In contrast, ipsapirone, zalospirone and buspirone displayed partial agonist activity. EC50s for agonist stimulation of [35S]GTPgammaS binding correlated well with Ki values from competition binding (r = +0.99). Among the compounds tested for antagonist activity, methiothepin and (+)butaclamol exhibited 'inverse agonist' behaviour, inhibiting basal [35S]GTPgammaS binding. The actions of 17 antipsychotic agents were investigated. Clozapine and several putatively 'atypical' antipsychotic agents, including ziprasidone, quetiapine and tiospirone, exhibited partial agonist activity and marked affinity at h5-HT1A receptors, similar to their affinity at hD2 dopamine receptors. In contrast, risperidone and sertindole displayed low affinity at h5-HT1A receptors and behaved as 'neutral' antagonists, inhibiting 5-HT-stimulated [35S]GTPgammaS binding. Likewise the 'typical' neuroleptics, haloperidol, pimozide, raclopride and chlorpromazine exhibited relatively low affinity and 'neutral' antagonist activity at h5-HT1A receptors with Ki values which correlated with their respective Kb values. The present data show that (i) [35S]GTPgammaS binding is an effective method to evaluate the efficacy and potency of agonists and antagonists at recombinant human 5-HT1A receptors. (ii) Like clozapine, several putatively 'atypical' antipsychotic drugs display balanced serotonin h5-HT1A/dopamine hD2 receptor affinity and partial agonist activity at h5-HT1A receptors. (iii) Several 'typical' and some putatively 'atypical' antipsychotic agents displayed antagonist properties at h5-HT1A sites with generally much lower affinity than at hD2 dopamine receptors. It is suggested that agonist activity at 5-HT1A receptors may be of utility for certain antipsychotic agents.
Jia, Yuqi; Lu, Liping; Yuan, Caixia; Feng, Sisi; Zhu, Miaoli
2017-05-01
Recent researches indicated that a copper complex-binding proteome that potently interacted with copper complexes and then influenced cellular metabolism might exist in organism. In order to explore the copper complex-binding proteome, a copper chelating ion-immobilized affinity chromatography (Cu-IMAC) column and mass spectrometry were used to separate and identify putative Cu-binding proteins in primary rat hepatocytes. A total of 97 putative Cu-binding proteins were isolated and identified. Five higher abundance proteins, aspartate aminotransferase (AST), malate dehydrogenase (MDH), catalase (CAT), calreticulin (CRT) and albumin (Alb) were further purified using a SP-, and (or) Q-Sepharose Fast Flow column. The interaction between the purified proteins and selected 11 copper complexes and CuCl 2 was investigated. The enzymes inhibition tests demonstrated that AST was potently inhibited by copper complexes while MDH and CAT were weakly inhibited. Schiff-based copper complexes 6 and 7 potently inhibited AST with the IC 50 value of 3.6 and 7.2μM, respectively and exhibited better selectivity over MDH and CAT. Fluorescence titration results showed the two complexes tightly bound to AST with binding constant of 3.89×10 6 and 3.73×10 6 M -1 , respectively and a stoichiometry ratio of 1:1. Copper complex 6 was able to enter into HepG2 cells and further inhibit intracellular AST activity. Copyright © 2017 Elsevier Inc. All rights reserved.
Munc13-4 reconstitutes calcium-dependent SNARE-mediated membrane fusion
Boswell, Kristin L.; James, Declan J.; Esquibel, Joseph M.; Bruinsma, Stephen; Shirakawa, Ryutaro; Horiuchi, Hisanori
2012-01-01
Munc13-4 is a widely expressed member of the CAPS/Munc13 protein family proposed to function in priming secretory granules for exocytosis. Munc13-4 contains N- and C-terminal C2 domains (C2A and C2B) predicted to bind Ca2+, but Ca2+-dependent regulation of Munc13-4 activity has not been described. The C2 domains bracket a predicted SNARE-binding domain, but whether Munc13-4 interacts with SNARE proteins is unknown. We report that Munc13-4 bound Ca2+ and restored Ca2+-dependent granule exocytosis to permeable cells (platelets, mast, and neuroendocrine cells) dependent on putative Ca2+-binding residues in C2A and C2B. Munc13-4 exhibited Ca2+-stimulated SNARE interactions dependent on C2A and Ca2+-dependent membrane binding dependent on C2B. In an apparent coupling of membrane and SNARE binding, Munc13-4 stimulated SNARE-dependent liposome fusion dependent on putative Ca2+-binding residues in both C2A and C2B domains. Munc13-4 is the first priming factor shown to promote Ca2+-dependent SNARE complex formation and SNARE-mediated liposome fusion. These properties of Munc13-4 suggest its function as a Ca2+ sensor at rate-limiting priming steps in granule exocytosis. PMID:22508512
Munc13-4 reconstitutes calcium-dependent SNARE-mediated membrane fusion.
Boswell, Kristin L; James, Declan J; Esquibel, Joseph M; Bruinsma, Stephen; Shirakawa, Ryutaro; Horiuchi, Hisanori; Martin, Thomas F J
2012-04-16
Munc13-4 is a widely expressed member of the CAPS/Munc13 protein family proposed to function in priming secretory granules for exocytosis. Munc13-4 contains N- and C-terminal C2 domains (C2A and C2B) predicted to bind Ca(2+), but Ca(2+)-dependent regulation of Munc13-4 activity has not been described. The C2 domains bracket a predicted SNARE-binding domain, but whether Munc13-4 interacts with SNARE proteins is unknown. We report that Munc13-4 bound Ca(2+) and restored Ca(2+)-dependent granule exocytosis to permeable cells (platelets, mast, and neuroendocrine cells) dependent on putative Ca(2+)-binding residues in C2A and C2B. Munc13-4 exhibited Ca(2+)-stimulated SNARE interactions dependent on C2A and Ca(2+)-dependent membrane binding dependent on C2B. In an apparent coupling of membrane and SNARE binding, Munc13-4 stimulated SNARE-dependent liposome fusion dependent on putative Ca(2+)-binding residues in both C2A and C2B domains. Munc13-4 is the first priming factor shown to promote Ca(2+)-dependent SNARE complex formation and SNARE-mediated liposome fusion. These properties of Munc13-4 suggest its function as a Ca(2+) sensor at rate-limiting priming steps in granule exocytosis.
Peumans, Willy J.; Proost, Paul; Swennen, Rony L.; Van Damme, Els J.M.
2002-01-01
Analyses of the protein content and composition revealed dramatic changes in gene expression during in situ banana (Musa spp.) fruit formation/ripening. The total banana protein content rapidly increases during the first 60 to 70 d, but remains constant for the rest of fruit formation/ripening. During the phase of rapid protein accumulation, an inactive homolog of class III chitinases accounts for up to 40% (w/v) of the total protein. Concomitant with the arrest of net protein accumulation, the chitinase-related protein (CRP) progressively decreases and several novel proteins appear in the electropherograms. Hence, CRP behaves as a fruit-specific vegetative storage protein that accumulates during early fruit formation and serves as a source of amino acids for the synthesis of ripening-associated proteins. Analyses of individual proteins revealed that a thaumatin-like protein, a β-1,3-glucanase, a class I chitinase, and a mannose-binding lectin are the most abundant ripening-associated proteins. Because during the ripening of prematurely harvested bananas, similar changes take place as in the in situ ripening bananas, CRP present in immature fruits is a sufficient source of amino acids for a quasi-normal synthesis of ripening-associated proteins. However, it is evident that the conversion of CRP in ripening-associated proteins takes place at an accelerated rate, especially when climacteric ripening is induced by ethylene. The present report also includes a discussion of the accumulation of the major banana allergens and the identification of suitable promoters for the production of vaccines in transgenic bananas. PMID:12376669
Cell-derived microparticles and complement activation in preeclampsia versus normal pregnancy.
Biró, E; Lok, C A R; Hack, C E; van der Post, J A M; Schaap, M C L; Sturk, A; Nieuwland, R
2007-01-01
Inflammation plays a major role in the vascular dysfunction seen in preeclampsia, and several studies suggest involvement of the complement system. To investigate whether complement activation on the surface of microparticles is increased in plasma of preeclamptic patients versus healthy pregnant controls. Microparticles from plasma of preeclamptic (n=10), healthy pregnant (n=10) and healthy nonpregnant (n=10) women were analyzed by flow cytometry for bound complement components (C1q, C4, C3) and complement activator molecules (C-reactive protein [CRP], serum amyloid P component [SAP], immunoglobulin [Ig]M, IgG). Fluid phase complement activation products and activator molecules were also determined. Levels of microparticles with bound complement components showed no increase in complement activation on the microparticle surface in preeclamptic women, in line with levels of fluid phase complement activation products. In healthy nonpregnant and pregnant women, bound CRP was associated with classical pathway activation on the microparticle surface, and in healthy pregnant women IgM and IgG molecules also contributed. In preeclamptic women, microparticles with bound SAP and those with IgG seemed to contribute to C1q binding without a clear association to further classical pathway activation. Furthermore, significantly increased levels of microparticles with bound CRP were present in preeclamptic compared with healthy pregnant women (median 178x10(6)/L versus 47x10(6)/L, P<0.01), but without concomitant increases in complement activation. We found no evidence of increased complement activation on the microparticle surface in preeclamptic women. Microparticles with bound CRP were significantly increased, but in contrast to healthy pregnant and nonpregnant women, this was not associated with increased classical pathway activation on the surface of the microparticles.
Structural analysis of a putative SAM-dependent methyltransferase, YtqB, from Bacillus subtilis.
Park, Sun Cheol; Song, Wan Seok; Yoon, Sung-il
2014-04-18
S-adenosyl-L-methionine (SAM)-dependent methyltransferases (MTases) methylate diverse biological molecules using a SAM cofactor. The ytqB gene of Bacillus subtilis encodes a putative MTase and its biological function has never been characterized. To reveal the structural features and the cofactor binding mode of YtqB, we have determined the crystal structures of YtqB alone and in complex with its cofactor, SAM, at 1.9 Å and 2.2 Å resolutions, respectively. YtqB folds into a β-sheet sandwiched by two α-helical layers, and assembles into a dimeric form. Each YtqB monomer contains one SAM binding site, which shapes SAM into a slightly curved conformation and exposes the reactive methyl group of SAM potentially to a substrate. Our comparative structural analysis of YtqB and its homologues indicates that YtqB is a SAM-dependent class I MTase, and provides insights into the substrate binding site of YtqB. Copyright © 2014 Elsevier Inc. All rights reserved.
GATA-1 directly regulates Nanog in mouse embryonic stem cells
DOE Office of Scientific and Technical Information (OSTI.GOV)
Li, Wen-Zhong; Ai, Zhi-Ying; Key Laboratory of Animal Biotechnology, Ministry of Agriculture, Northwest A&F University, Yangling 712100
2015-09-25
Nanog safeguards pluripotency in mouse embryonic stem cells (mESCs). Insight into the regulation of Nanog is important for a better understanding of the molecular mechanisms that control pluripotency of mESCs. In a silico analysis, we identify four GATA-1 putative binding sites in Nanog proximal promoter. The Nanog promoter activity can be significantly repressed by ectopic expression of GATA-1 evidenced by a promoter reporter assay. Mutation studies reveal that one of the four putative binding sites counts for GATA-1 repressing Nanog promoter activity. Direct binding of GATA-1 on Nanog proximal promoter is confirmed by electrophoretic mobility shift assay and chromatin immunoprecipitation.more » Our data provide new insights into the expanded regulatory circuitry that coordinates Nanog expression. - Highlights: • The Nanog proximal promoter conceives functional element for GATA-1. • GATA-1 occupies the Nanog proximal promoter in vitro and in vivo. • GATA-1 transcriptionally suppresses Nanog.« less
Bu, Huajie; Narisu, Narisu; Schlick, Bettina; Rainer, Johannes; Manke, Thomas; Schäfer, Georg; Pasqualini, Lorenza; Chines, Peter; Schweiger, Michal R.; Fuchsberger, Christian
2015-01-01
ABSTRACT Genome‐wide association studies have identified genomic loci, whose single‐nucleotide polymorphisms (SNPs) predispose to prostate cancer (PCa). However, the mechanisms of most of these variants are largely unknown. We integrated chromatin‐immunoprecipitation‐coupled sequencing and microarray expression profiling in TMPRSS2‐ERG gene rearrangement positive DUCaP cells with the GWAS PCa risk SNPs catalog to identify disease susceptibility SNPs localized within functional androgen receptor‐binding sites (ARBSs). Among the 48 GWAS index risk SNPs and 3,917 linked SNPs, 80 were found located in ARBSs. Of these, rs11891426:T>G in an intron of the melanophilin gene (MLPH) was within a novel putative auxiliary AR‐binding motif, which is enriched in the neighborhood of canonical androgen‐responsive elements. T→G exchange attenuated the transcriptional activity of the ARBS in an AR reporter gene assay. The expression of MLPH in primary prostate tumors was significantly lower in those with the G compared with the T allele and correlated significantly with AR protein. Higher melanophilin level in prostate tissue of patients with a favorable PCa risk profile points out a tumor‐suppressive effect. These results unravel a hidden link between AR and a functional putative PCa risk SNP, whose allele alteration affects androgen regulation of its host gene MLPH. PMID:26411452
Prigozhin, Daniil M; Papavinasasundaram, Kadamba G; Baer, Christina E; Murphy, Kenan C; Moskaleva, Alisa; Chen, Tony Y; Alber, Tom; Sassetti, Christopher M
2016-10-28
Monitoring the environment with serine/threonine protein kinases is critical for growth and survival of Mycobacterium tuberculosis, a devastating human pathogen. Protein kinase B (PknB) is a transmembrane serine/threonine protein kinase that acts as an essential regulator of mycobacterial growth and division. The PknB extracellular domain (ECD) consists of four repeats homologous to penicillin-binding protein and serine/threonine kinase associated (PASTA) domains, and binds fragments of peptidoglycan. These properties suggest that PknB activity is modulated by ECD binding to peptidoglycan substructures, however, the molecular mechanisms underpinning PknB regulation remain unclear. In this study, we report structural and genetic characterization of the PknB ECD. We determined the crystal structures of overlapping ECD fragments at near atomic resolution, built a model of the full ECD, and discovered a region on the C-terminal PASTA domain that has the properties of a ligand-binding site. Hydrophobic interaction between this surface and a bound molecule of citrate was observed in a crystal structure. Our genetic analyses in M. tuberculosis showed that nonfunctional alleles were produced either by deletion of any of single PASTA domain or by mutation of individual conserved residues lining the putative ligand-binding surface of the C-terminal PASTA repeat. These results define two distinct structural features necessary for PknB signal transduction, a fully extended ECD and a conserved, membrane-distal putative ligand-binding site. © 2016 by The American Society for Biochemistry and Molecular Biology, Inc.
Kemperman, Robèr; Jonker, Marnix; Nauta, Arjen; Kuipers, Oscar P.; Kok, Jan
2003-01-01
A region of 12 kb flanking the structural gene of the cyclic antibacterial peptide circularin A of Clostridium beijerinckii ATCC 25752 was sequenced, and the putative proteins involved in the production and secretion of circularin A were identified. The genes are tightly organized in overlapping open reading frames. Heterologous expression of circularin A in Enterococcus faecalis was achieved, and five genes were identified as minimally required for bacteriocin production and secretion. Two of the putative proteins, CirB and CirC, are predicted to contain membrane-spanning domains, while CirD contains a highly conserved ATP-binding domain. Together with CirB and CirC, this ATP-binding protein is involved in the production of circularin A. The fifth gene, cirE, confers immunity towards circularin A when expressed in either Lactococcus lactis or E. faecalis and is needed in order to allow the bacteria to produce bacteriocin. Additional resistance against circularin A is conferred by the activity of the putative transporter consisting of CirB and CirD. PMID:14532033
Roma, E; Krini, M; Hantzi, E; Sakka, S; Panayiotou, I; Margeli, A; Papassotiriou, I; Kanaka-Gantenbein, C
2012-10-01
Retinol Binding Protein-4 (RBP-4), the action of which was initially thought to be only the transport of vitamin A, is a major circulating adipocytokine involved in the inflammation. We evaluated the serum RBP-4 levels in children with inflammatory bowel disease (IBD) and correlated them with transthyretin (TTR), inflammation markers, disease activity, and body mass index (BMI). In 41 children of mean age 11.9 ± 3.6 years (range 5-17.7 y) with IBD (19 with Crohn's disease (CD) and 22 with Ulcerative colitis (UC) serum RBP-4, TTR, Amyloid A (SAA), C-Reactive Protein (CRP), Erythrocyte Sedimentation Rate (ESR), disease activity and BMI were prospectively determined and compared with those of 42 matched controls. No difference in the RBP-4 and TTR serum levels, between patients and controls as well as between active and remission state of the disease was noticed. A negative correlation of serum RBP-4 with the disease activity, SAA and ESR and a positive correlation with TTR was found, but no significant correlation with CRP or BMI was found. Inflammation markers were significantly increased in patients compared to controls and had a positive correlation with the disease activity. RBP-4 negatively correlated with disease activity of children with IBD probably indicating a protective anti-inflammatory mechanism of action in addition to transport of vitamin A.
Perdomo-Sabogal, Alvaro; Nowick, Katja; Piccini, Ilaria; Sudbrak, Ralf; Lehrach, Hans; Yaspo, Marie-Laure; Warnatz, Hans-Jörg; Querfurth, Robert
2016-01-01
A substantial fraction of phenotypic differences between closely related species are likely caused by differences in gene regulation. While this has already been postulated over 30 years ago, only few examples of evolutionary changes in gene regulation have been verified. Here, we identified and investigated binding sites of the transcription factor GA-binding protein alpha (GABPa) aiming to discover cis-regulatory adaptations on the human lineage. By performing chromatin immunoprecipitation-sequencing experiments in a human cell line, we found 11,619 putative GABPa binding sites. Through sequence comparisons of the human GABPa binding regions with orthologous sequences from 34 mammals, we identified substitutions that have resulted in 224 putative human-specific GABPa binding sites. To experimentally assess the transcriptional impact of those substitutions, we selected four promoters for promoter-reporter gene assays using human and African green monkey cells. We compared the activities of wild-type promoters to mutated forms, where we have introduced one or more substitutions to mimic the ancestral state devoid of the GABPa consensus binding sequence. Similarly, we introduced the human-specific substitutions into chimpanzee and macaque promoter backgrounds. Our results demonstrate that the identified substitutions are functional, both in human and nonhuman promoters. In addition, we performed GABPa knock-down experiments and found 1,215 genes as strong candidates for primary targets. Further analyses of our data sets link GABPa to cognitive disorders, diabetes, KRAB zinc finger (KRAB-ZNF), and human-specific genes. Thus, we propose that differences in GABPa binding sites played important roles in the evolution of human-specific phenotypes. PMID:26814189
Reactive arthritis and serum levels of mannose binding lectin – lack of association
LOCHT, H; CHRISTIANSEN, M; LAURSEN, I
2003-01-01
The purpose was to evaluate the possible association of serum mannose binding lectin (s-MBL) levels on type of triggering microbe, duration of diarrhoea, incidence and course of reactive arthritis (ReA) caused by Salmonella, Yersinia and Campylobacter. Sixty patients with ReA of 1–228 months duration, 173 patients with ReA or uncomplicated enterocolitis caused by Campylobacter, 226 sera from patients with elevated antibody levels against Salmonella, Yersinia or Campylobacter, and 114 blood donors were tested for s-MBL using ELISA technique, both direct mannan binding assay and sandwich ELISA. s-MBL was compared with C-reactive protein (CRP) levels and with the ability of activating complement C4. Among the 114 donors 9% had s-MBL <50 µg/l, 16% had from 50–500 µg/l and 75% had >500 µg/l. The distribution of s-MBL levels in the three-patient groups did not differ significantly from the controls. There were no indications that low s-MBL was associated with prolonged duration of arthritis, diarrhoea or individual bacterial infections. The two MBL assays were comparable with respect to serum concentrations, indicating that the actual circulating MBL was also functionally active. s-MBL exhibited acute phase reactant behaviour and correlated to CRP level, but only in patients with s-MBL concentrations exceeding 1000 µg/l. MBL in 10 randomly selected ReA sera were tested for the ability to activate complement C4. The results did not differ from those of donor controls. This study demonstrates that the distributions of s-MBL levels in serum among patients with ReA are not different from donor controls. The course, outcome or triggering bacteria are not associated with a particular level of s-MBL. PMID:12519401
USDA-ARS?s Scientific Manuscript database
Pratylenchus penetrans is one of the most important plant-parasitic nematodes and can act as a limiting factor of important agricultural, horticultural and industrial crops. Fatty acid- and retinoid- (FAR) binding proteins are unique to nematodes. The cDNA corresponding to a putative P. penetrans FA...
Fraiberg, Milana; Borovok, Ilya; Bayer, Edward A.; Weiner, Ronald M.; Lamed, Raphael
2011-01-01
The complex polysaccharide-degrading marine bacterium Saccharophagus degradans strain 2-40 produces putative proteins that contain numerous cadherin and cadherin-like domains involved in intercellular contact interactions. The current study reveals that both domain types exhibit reversible calcium-dependent binding to different complex polysaccharides which serve as growth substrates for the bacterium. PMID:21036994
Linden, H; Macino, G
1997-01-01
A saturating genetic dissection of 'blind' mutants in Neurospora crassa has identified a total of two non-redundant loci (wc-1 and wc-2) each of which is required for blue-light perception/signal transduction. Previously, we demonstrated that WC1 is a putative zinc finger transcription factor able to bind specifically to a light-regulated promoter. Here, we present the cloning and characterization of the wc-2 gene. We demonstrate using mutation analysis and in vitro DNA-binding assays that WC2, the second partner of this light signal transduction system, encodes a functional zinc finger DNA-binding protein with putative PAS dimerization and transcription activation domains. This molecular genetic dissection of the second of two components of this light signal transduction system has enabled us to devise a model whereby WC1 and WC2 are proposed to interact via homologous PAS domains, bind to promoters of light-regulated genes and activate transcription. As such, this study provides the first insight into two co-operating partners in blue-light signal transduction in any organism and describes the molecular tools with which to dissect this enigmatic process. PMID:9009271
Identification of Candidate Transcription Factor Binding Sites in the Cattle Genome
Bickhart, Derek M.; Liu, George E.
2013-01-01
A resource that provides candidate transcription factor binding sites (TFBSs) does not currently exist for cattle. Such data is necessary, as predicted sites may serve as excellent starting locations for future omics studies to develop transcriptional regulation hypotheses. In order to generate this resource, we employed a phylogenetic footprinting approach—using sequence conservation across cattle, human and dog—and position-specific scoring matrices to identify 379,333 putative TFBSs upstream of nearly 8000 Mammalian Gene Collection (MGC) annotated genes within the cattle genome. Comparisons of our predictions to known binding site loci within the PCK1, ACTA1 and G6PC promoter regions revealed 75% sensitivity for our method of discovery. Additionally, we intersected our predictions with known cattle SNP variants in dbSNP and on the Illumina BovineHD 770k and Bos 1 SNP chips, finding 7534, 444 and 346 overlaps, respectively. Due to our stringent filtering criteria, these results represent high quality predictions of putative TFBSs within the cattle genome. All binding site predictions are freely available at http://bfgl.anri.barc.usda.gov/BovineTFBS/ or http://199.133.54.77/BovineTFBS. PMID:23433959
Evaluation of blood and serum markers in spinal cord injured patients with pressure sores.
Gurcay, Eda; Bal, Ajda; Gurcay, Ahmet G; Cakci, Aytul
2009-03-01
To evaluate blood and serum markers in traumatic spinal cord injured (SCI) patients, with and without pressure sores. This cross-sectional study was performed at the Ministry of Health Diskapi Yildirim Beyazit, and Numune Education and Research Hospitals, Ankara, Turkey, from 2006-2008. A total of 23 SCI patients with pressure sores (group I) and a control group of 25 SCI patients without pressure sores (group II) were evaluated. Characteristics of sores were examined with respect to duration, location, grade, tissue types, surface area, and exudate amount. Recorded laboratory parameters included erythrocyte sedimentation rates (ESR), C-reactive protein (CRP), hemoglobin (Hb), hematocrit (Htc), lymphocytes, white blood cells (WBC), red blood cells (RBC), serum iron, transferrin, total iron-binding capacity (TIBC), ferritin, total protein, albumin, vitamin B12, and zinc. The most common pressure sore location was the sacrum (38%). Compared to the control group, the patients with pressure sores showed anemia with reduced serum iron, transferrin, TIBC, and increased ferritin. They also had increased ESR, CRP, and WBC and reduced lymphocytes, total protein, albumin and zinc. Statistically significant correlations were found between CRP, Hb, Htc, lymphocytes, RBC, WBC, and serum protein levels, and grade of pressure sores. Clinicians should regularly screen patients with respect to blood and serum markers, in order to determine any risks for pressure sores, and they should perform immediate preventive measures based on the patient's condition.
Lanziotti, Vanessa Soares; Póvoa, Pedro; Prata-Barbosa, Arnaldo; Pulcheri, Lucas Berbet; Rabello, Ligia S C F; Lapa E Silva, José Roberto; Soares, Marcio; Salluh, Jorge I F
2018-04-01
Evaluate sequential C-reactive protein (CRP) measurements and patterns of CRP-ratio response to antibiotic therapy during first 7days in Pediatric Intensive Care Unit (PICU) of septic children. Prospective, cohort study of children (1month-12years) admitted at 3 PICUs, with diagnosis of sepsis with <72h course. CRP-ratio was calculated in relation to D0_CRP value. Children were classified according to an individual pattern of CRP-ratio response: fast - CRP_D4 of therapy was <0.4 of D0_CRP; slow - continuous but slow decrease of CRP; non - CRP remained ≥0.8 of D0_CRP; biphasic - initial CRP decrease to levels <0.8 of D0_CRP followed by secondary rise ≥0.8. 103 septic children (age-median: 2yrs; 54% male) were prospectively included (infection focus: 65% respiratory, 12.5% central nervous system). Overall PICU mortality was 11.7%. 102 children could be classified according to a predefined CRP-ratio response pattern. Time-dependent analysis of CRP-ratio and CRP course of the different patterns were significantly different. Besides, PICU mortality rate was significantly different according CRP-ratio response patterns: fast response 4.5%; slow response 5.8%; non-response 29.4%; biphasic response 42.8%. In pediatric sepsis, CRP-ratio serial evaluation was useful in early identification of patients with poor outcome. Copyright © 2017 Elsevier Inc. All rights reserved.
Seppala, Susanna; Solomon, Kevin V.; Gilmore, Sean P.; ...
2016-12-20
Here, engineered cell factories that convert biomass into value-added compounds are emerging as a timely alternative to petroleum-based industries. Although often overlooked, integral membrane proteins such as solute transporters are pivotal for engineering efficient microbial chassis. Anaerobic gut fungi, adapted to degrade raw plant biomass in the intestines of herbivores, are a potential source of valuable transporters for biotechnology, yet very little is known about the membrane constituents of these non-conventional organisms. Here, we mined the transcriptome of three recently isolated strains of anaerobic fungi to identify membrane proteins responsible for sensing and transporting biomass hydrolysates within a competitive andmore » rather extreme environment. Using sequence analyses and homology, we identified membrane protein-coding sequences from assembled transcriptomes from three strains of anaerobic gut fungi: Neocallimastix californiae, Anaeromyces robustus, and Piromyces finnis. We identified nearly 2000 transporter components: about half of these are involved in the general secretory pathway and intracellular sorting of proteins; the rest are predicted to be small-solute transporters. Unexpectedly, we found a number of putative sugar binding proteins that are associated with prokaryotic uptake systems; and approximately 100 class C G-protein coupled receptors (GPCRs) with non-canonical putative sugar binding domains. In conclusion, we report the first comprehensive characterization of the membrane protein machinery of biotechnologically relevant anaerobic gut fungi. Apart from identifying conserved machinery for protein sorting and secretion, we identify a large number of putative solute transporters that are of interest for biotechnological applications. Notably, our data suggests that the fungi display a plethora of carbohydrate binding domains at their surface, perhaps as a means to sense and sequester some of the sugars that their biomass degrading, extracellular enzymes produce.« less
Seppälä, Susanna; Solomon, Kevin V; Gilmore, Sean P; Henske, John K; O'Malley, Michelle A
2016-12-20
Engineered cell factories that convert biomass into value-added compounds are emerging as a timely alternative to petroleum-based industries. Although often overlooked, integral membrane proteins such as solute transporters are pivotal for engineering efficient microbial chassis. Anaerobic gut fungi, adapted to degrade raw plant biomass in the intestines of herbivores, are a potential source of valuable transporters for biotechnology, yet very little is known about the membrane constituents of these non-conventional organisms. Here, we mined the transcriptome of three recently isolated strains of anaerobic fungi to identify membrane proteins responsible for sensing and transporting biomass hydrolysates within a competitive and rather extreme environment. Using sequence analyses and homology, we identified membrane protein-coding sequences from assembled transcriptomes from three strains of anaerobic gut fungi: Neocallimastix californiae, Anaeromyces robustus, and Piromyces finnis. We identified nearly 2000 transporter components: about half of these are involved in the general secretory pathway and intracellular sorting of proteins; the rest are predicted to be small-solute transporters. Unexpectedly, we found a number of putative sugar binding proteins that are associated with prokaryotic uptake systems; and approximately 100 class C G-protein coupled receptors (GPCRs) with non-canonical putative sugar binding domains. We report the first comprehensive characterization of the membrane protein machinery of biotechnologically relevant anaerobic gut fungi. Apart from identifying conserved machinery for protein sorting and secretion, we identify a large number of putative solute transporters that are of interest for biotechnological applications. Notably, our data suggests that the fungi display a plethora of carbohydrate binding domains at their surface, perhaps as a means to sense and sequester some of the sugars that their biomass degrading, extracellular enzymes produce.
Gimenez, Ana Paula Lappas; Richter, Larissa Morato Luciani; Atherino, Mariana Campos; Beirão, Breno Castello Branco; Fávaro, Celso; Costa, Michele Dietrich Moura; Zanata, Silvio Marques; Malnic, Bettina; Mercadante, Adriana Frohlich
2015-01-01
ABSTRACT Prion diseases involve the conversion of the endogenous cellular prion protein, PrPC, into a misfolded infectious isoform, PrPSc. Several functions have been attributed to PrPC, and its role has also been investigated in the olfactory system. PrPC is expressed in both the olfactory bulb (OB) and olfactory epithelium (OE) and the nasal cavity is an important route of transmission of diseases caused by prions. Moreover, Prnp−/− mice showed impaired behavior in olfactory tests. Given the high PrPC expression in OE and its putative role in olfaction, we screened a mouse OE cDNA library to identify novel PrPC-binding partners. Ten different putative PrPC ligands were identified, which were involved in functions such as cellular proliferation and apoptosis, cytoskeleton and vesicle transport, ubiquitination of proteins, stress response, and other physiological processes. In vitro binding assays confirmed the interaction of PrPC with STIP1 homology and U-Box containing protein 1 (Stub1) and are reported here for the first time. Stub1 is a co-chaperone with ubiquitin E3-ligase activity, which is associated with neurodegenerative diseases characterized by protein misfolding and aggregation. Physiological and pathological implications of PrPC-Stub1 interaction are under investigation. The PrPC-binding proteins identified here are not exclusive to the OE, suggesting that these interactions may occur in other tissues and play general biological roles. These data corroborate the proposal that PrPC is part of a multiprotein complex that modulates several cellular functions and provide a platform for further studies on the physiological and pathological roles of prion protein. PMID:26237451
DOE Office of Scientific and Technical Information (OSTI.GOV)
Li, Jingzhi; Sha, Bingdong, E-mail: bdsha@uab.edu
2015-08-25
The Tim50 crystal structure indicates that the IMS domain of Tim50 exhibits significant structural plasticity within the putative presequence-binding groove. Mitochondrial preproteins are transported through the translocase of the outer membrane (TOM) complex. Tim50 and Tim23 then transfer preproteins with N-terminal targeting presequences through the intermembrane space (IMS) across the inner membrane. The crystal structure of the IMS domain of Tim50 [Tim50(164–361)] has previously been determined to 1.83 Å resolution. Here, the crystal structure of Tim50(164–361) at 2.67 Å resolution that was crystallized using a different condition is reported. Compared with the previously determined Tim50(164–361) structure, significant conformational changes occurmore » within the protruding β-hairpin of Tim50 and the nearby helix A2. These findings indicate that the IMS domain of Tim50 exhibits significant structural plasticity within the putative presequence-binding groove, which may play important roles in the function of Tim50 as a receptor protein in the TIM complex that interacts with the presequence and multiple other proteins. More interestingly, the crystal packing indicates that helix A1 from the neighboring monomer docks into the putative presequence-binding groove of Tim50(164–361), which may mimic the scenario of Tim50 and the presequence complex. Tim50 may recognize and bind the presequence helix by utilizing the inner side of the protruding β-hairpin through hydrophobic interactions. Therefore, the protruding β-hairpin of Tim50 may play critical roles in receiving the presequence and recruiting Tim23 for subsequent protein translocations.« less
Kulcinskaja, Evelina; Rosengren, Anna; Ibrahim, Romany; Kolenová, Katarína
2013-01-01
The gene encoding β-mannanase (EC 3.2.1.78) BaMan26A from the bacterium Bifidobacterium adolescentis (living in the human gut) was cloned and the gene product characterized. The enzyme was found to be modular and to contain a putative signal peptide. It possesses a catalytic module of the glycoside hydrolase family 26, a predicted immunoglobulin-like module, and two putative carbohydrate-binding modules (CBMs) of family 23. The enzyme is likely cell attached either by the sortase mechanism (LPXTG motif) or via a C-terminal transmembrane helix. The gene was expressed in Escherichia coli without the native signal peptide or the cell anchor. Two variants were made: one containing all four modules, designated BaMan26A-101K, and one truncated before the CBMs, designated BaMan26A-53K. BaMan26A-101K, which contains the CBMs, showed an affinity to carob galactomannan having a dissociation constant of 0.34 μM (8.8 mg/liter), whereas BaMan26A-53K did not bind, showing that at least one of the putative CBMs of family 23 is mannan binding. For BaMan26A-53K, kcat was determined to be 444 s−1 and Km 21.3 g/liter using carob galactomannan as the substrate at the optimal pH of 5.3. Both of the enzyme variants hydrolyzed konjac glucomannan, as well as carob and guar gum galactomannans to a mixture of oligosaccharides. The dominant product from ivory nut mannan was found to be mannotriose. Mannobiose and mannotetraose were produced to a lesser extent, as shown by high-performance anion-exchange chromatography. Mannobiose was not hydrolyzed, and mannotriose was hydrolyzed at a significantly lower rate than the longer oligosaccharides. PMID:23064345
The Zur regulon of Corynebacterium glutamicum ATCC 13032
2010-01-01
Background Zinc is considered as an essential element for all living organisms, but it can be toxic at large concentrations. Bacteria therefore tightly regulate zinc metabolism. The Cg2502 protein of Corynebacterium glutamicum was a candidate to control zinc metabolism in this species, since it was classified as metalloregulator of the zinc uptake regulator (Zur) subgroup of the ferric uptake regulator (Fur) family of DNA-binding transcription regulators. Results The cg2502 (zur) gene was deleted in the chromosome of C. glutamicum ATCC 13032 by an allelic exchange procedure to generate the zur-deficient mutant C. glutamicum JS2502. Whole-genome DNA microarray hybridizations and real-time RT-PCR assays comparing the gene expression in C. glutamicum JS2502 with that of the wild-type strain detected 18 genes with enhanced expression in the zur mutant. The expression data were combined with results from cross-genome comparisons of shared regulatory sites, revealing the presence of candidate Zur-binding sites in the mapped promoter regions of five transcription units encoding components of potential zinc ABC-type transporters (cg0041-cg0042/cg0043; cg2911-cg2912-cg2913), a putative secreted protein (cg0040), a putative oxidoreductase (cg0795), and a putative P-loop GTPase of the COG0523 protein family (cg0794). Enhanced transcript levels of the respective genes in C. glutamicum JS2502 were verified by real-time RT-PCR, and complementation of the mutant with a wild-type zur gene reversed the effect of differential gene expression. The zinc-dependent expression of the putative cg0042 and cg2911 operons was detected in vivo with a gfp reporter system. Moreover, the zinc-dependent binding of purified Zur protein to double-stranded 40-mer oligonucleotides containing candidate Zur-binding sites was demonstrated in vitro by DNA band shift assays. Conclusion Whole-genome expression profiling and DNA band shift assays demonstrated that Zur directly represses in a zinc-dependent manner the expression of nine genes organized in five transcription units. Accordingly, the Zur (Cg2502) protein is the key transcription regulator for genes involved in zinc homeostasis in C. glutamicum. PMID:20055984
[Relationship between C-reactive protein gene polymorphaisms and chronic periodontitis].
Liu, Juan; Meng, Shu; Ding, Yi; Wu, Ya-fei
2010-06-01
To investigate the relationship between C-reactive protein (CRP) + 1444C/T, CRP+1059G/C polymorphisms and chronic periodontitis (CP) in a Han Chinese population. Clinical periodontal parameters [attachment loss (AL) probing depth (PD) and bleeding on probing (BOP)], and serum CRP levels were examined in CP patients (n = 126) and healthy subjects (n = 113). The mean serum CRP level [(1.74 ± 1.67) mg/L] was significantly higher in the CP group than in the control group [(0.57 ± 0.39) mg/L], P < 0.001. In the control group, serum CRP levels were significantly lower in subjects with the CRP +1059 GC and CC genotypes than those with the CRP +1059 GG genotype (P < 0.01). There was no significant difference between genotypes in the CP group. In CP and the control groups, serum CRP levels were significantly higher in subjects with the CRP + 1444 CT and TT genotypes compared to those with the CRP + 1444 CC genotype (P < 0.5). The percentage of CRP + 1059 C allele was 6.7% (17/252) in the CP group and 4.9% (11/226) in the control group. The percentage of CRP + 1444 T allele was 6.3% (16/252) in the CP group and 5.3% (12/226) in the control group (P > 0.5). There was no significant difference between groups in both allele frequencies (P > 0.5). The association of CRP + 1059G/C, CRP + 1444 C/T polymorphisms with CP was not found in a regression model (P > 0.5). The presence of a CRP + 1059C-allele was associated with lower serum CRP levels and the presence of a CRP + 1444T-allele was associated with higher serum CRP levels. However, the data suggested that CRP + 1059G/C, CRP + 1444 C/T polymorphisms were not significantly associated with serum CRP levels of chronic periodontitis patients in ethnic Han Chinese.
Machado, Pedro; Navarro-Compán, Victoria; Landewé, Robert; van Gaalen, Floris A; Roux, Christian; van der Heijde, Désirée
2015-02-01
The Ankylosing Spondylitis Disease Activity Score (ASDAS) is a composite measure of disease activity in axial spondyloarthritis. The aims of this study were to determine the most appropriate method for calculating the ASDAS using the C-reactive protein (CRP) level when the conventional CRP level was below the limit of detection, to determine how low CRP values obtained by high-sensitivity CRP (hsCRP) measurement influence ASDAS-CRP results, and to test agreement between different ASDAS formulae. Patients with axial spondyloarthritis who had a conventional CRP level below the limit of detection (5 mg/liter) were selected (n = 257). The ASDAS–conventional CRP with 11 different imputations for the conventional CRP value (range 0–5 mg/liter, at 0.5-mg/liter intervals) was calculated. The ASDAS-hsCRP and ASDAS using the erythrocyte sedimentation rate (ESR) were also calculated. Agreement between the ASDAS formulae was tested. The ASDAS-hsCRP showed better agreement with the ASDAS-CRP calculated using the conventional CRP imputation values of 1.5 and 2.0 mg/liter and with the ASDAS-ESR than with other imputed formulae. Disagreement occurred mainly in lower disease activity states (inactive/moderate disease activity). When the CRP value was <2 mg/liter, the resulting ASDAS-CRP scores may have been inappropriately low. When the conventional CRP level is below the limit of detection or when the hsCRP level is <2 mg/liter, the constant value of 2 mg/liter should be used to calculate the ASDAS-CRP score. There is good agreement between the ASDAS-hsCRP and ASDAS-ESR; however, formulae are not interchangeable.
Shield-Artin, Kristy L; Bailey, Mark J; Oliva, Karen; Liovic, Ana K; Barker, Gillian; Dellios, Nicole L; Reisman, Simone; Ayhan, Mustafa; Rice, Gregory E
2012-04-01
To evaluate the utility of an enhanced biomarker discovery approach in order to identify potential biomarkers relevant to ovarian cancer detection. We combined immuno-depletion, liquid-phase IEF, 1D-DIGE, MALDI-TOF/MS and LC-MS/MS to identify differentially expressed proteins in the plasma of symptomatic ovarian cancer patients, stratified by stage, compared to samples obtained from normal subjects. We demonstrate that this approach is a practical alternative to traditional 2D gel techniques and that it has some advantages, most notably increased protein capacity. Proteins were identified in all 76 bands excised from the gels in this project and confirmed the cancer-associated expression of several well-established biomarkers of ovarian cancer. These included C-reactive protein (CRP), haptoglobin, alpha-2 macroglobulin and A1A2. We also identified new ovarian cancer candidate biomarkers, Protein S100-A9 (S100A9) and multimerin-2. The cancer-associated differential expression of CRP and S100A9 was further confirmed by Western blot and ELISA. The methods developed in this study allow for the increased loading of plasma proteins into the analytical stream when compared to traditional 2D-DIGE. This increased protein identification sensitivity allowed us to identify new putative ovarian cancer biomarkers. © 2012 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.
Ng, Chai Ann; Ke, Ying; Perry, Matthew D.; Tan, Peter S.; Hill, Adam P.; Vandenberg, Jamie I.
2013-01-01
Kv11.1 potassium channels are important for regulation of the normal rhythm of the heartbeat. Reduced activity of Kv11.1 channels causes long QT syndrome type 2, a disorder that increases the risk of cardiac arrhythmias and sudden cardiac arrest. Kv11.1 channels are members of the KCNH subfamily of voltage-gated K+ channels. However, they also share many similarities with the cyclic nucleotide gated ion channel family, including having a cyclic nucleotide-binding homology (cNBH) domain. Kv11.1 channels, however, are not directly regulated by cyclic nucleotides. Recently, crystal structures of the cNBH domain from mEAG and zELK channels, both members of the KCNH family of voltage-gated potassium channels, revealed that a C-terminal β9-strand in the cNBH domain occupied the putative cyclic nucleotide-binding site thereby precluding binding of cyclic nucleotides. Here we show that mutations to residues in the β9-strand affect the stability of the open state relative to the closed state of Kv11.1 channels. We also show that disrupting the structure of the β9-strand reduces the stability of the inactivated state relative to the open state. Clinical mutations located in this β9-strand result in reduced trafficking efficiency, which suggests that binding of the C-terminal β9-strand to the putative cyclic nucleotide-binding pocket is also important for assembly and trafficking of Kv11.1 channels. PMID:24204727
Hioki, Hirofumi; Watanabe, Yusuke; Kozuma, Ken; Yamamoto, Masanori; Naganuma, Toru; Araki, Motoharu; Tada, Norio; Shirai, Shinichi; Yamanaka, Futoshi; Higashimori, Akihiro; Mizutani, Kazuki; Tabata, Minoru; Takagi, Kensuke; Ueno, Hiroshi; Hayashida, Kentaro
2018-04-12
The relation between C-reactive protein (CRP) level on admission and mortality after transcatheter aortic valve implantation (TAVI) remains unclear. To evaluate the impact of serum CRP level on mortality after TAVI, we assessed 1,016 patients with CRP who underwent TAVI and 538 patients with high-sensitive CRP (hs-CRP) level who underwent TAVI on admission in the OCEAN (Optimized Transcatheter Valvular Intervention)-TAVI registry. Study population was stratified into 2 groups (high/low), according to the median of CRP and hs-CRP on admission. We assessed the impact of high CRP and hs-CRP level on all-cause death after TAVI. During 2-year follow-up, all-cause death after TAVI was 9.4% in patients with CRP and 11.9% in patients with hs-CRP. Median value of serum CRP was 0.10 mg/dl in both CRP and hs-CRP. Patients with high CRP (>0.10 mg/dl) had significantly higher incidence of all-cause death compared with those with low CRP (11.5% vs 7.6%, log-rank p = 0.015). Multivariate Cox regression analysis with a time-varying covariate demonstrated that high CRP was an independent predictor of all-cause death within the first 3 months (hazard ratio 2.78, 95% CI 1.30 to 5.95) compared with from 3 months to 2 years (hazard ratio 0.80, 95% CI 0.47 to 1.36) (P for interaction = 0.008). Inversely, these results were not observed in the stratification using hs-CRP on admission. In conclusion, high CRP on admission was significantly associated with an increased risk of all-cause death after TAVI, particularly within the first 3 months after TAVI. Risk stratification using CRP may be a simple and useful strategy to identify high-risk patients who undergo TAVI. Copyright © 2018 Elsevier Inc. All rights reserved.
West, Graham M.; Willard, Francis S.; Sloop, Kyle W.; Showalter, Aaron D.; Pascal, Bruce D.; Griffin, Patrick R.
2014-01-01
Activation of the glucagon-like peptide-1 receptor (GLP-1R) in pancreatic β-cells potentiates insulin production and is a current therapeutic target for the treatment of type 2 diabetes mellitus (T2DM). Like other class B G protein-coupled receptors (GPCRs), the GLP-1R contains an N-terminal extracellular ligand binding domain. N-terminal truncations on the peptide agonist generate antagonists capable of binding to the extracellular domain, but not capable of activating full length receptor. The main objective of this study was to use Hydrogen/deuterium exchange (HDX) to identify how the amide hydrogen bonding network of peptide ligands and the extracellular domain of GLP-1R (nGLP-1R) were altered by binding interactions and to then use this platform to validate direct binding events for putative GLP-1R small molecule ligands. The HDX studies presented here for two glucagon-like peptide-1 receptor (GLP-1R) peptide ligands indicates that the antagonist exendin-4[9-39] is significantly destabilized in the presence of nonionic detergents as compared to the agonist exendin-4. Furthermore, HDX can detect stabilization of exendin-4 and exendin-4[9-39] hydrogen bonding networks at the N-terminal helix [Val19 to Lys27] upon binding to the N-terminal extracellular domain of GLP-1R (nGLP-1R). In addition we show hydrogen bonding network stabilization on nGLP-1R in response to ligand binding, and validate direct binding events with the extracellular domain of the receptor for putative GLP-1R small molecule ligands. PMID:25180755
Li, Hao; Redinbo, Matthew R.; Venkatesh, Madhukumar; Ekins, Sean; Chaudhry, Anik; Bloch, Nicolin; Negassa, Abdissa; Mukherjee, Paromita; Kalpana, Ganjam; Mani, Sridhar
2013-01-01
The pregnane X receptor (PXR) is a master regulator of xenobiotic metabolism, and its activity is critical toward understanding the pathophysiology of several diseases, including inflammation, cancer, and steatosis. Previous studies have demonstrated that ketoconazole binds to ligand-activated PXR and antagonizes receptor control of gene expression. Structure-function as well as computational docking analysis suggested a putative binding region containing critical charge clamp residues Gln-272, and Phe-264 on the AF-2 surface of PXR. To define the antagonist binding surface(s) of PXR, we developed a novel assay to identify key amino acid residues on PXR based on a yeast two-hybrid screen that examined mutant forms of PXR. This screen identified multiple “gain-of-function” mutants that were “resistant” to the PXR antagonist effects of ketoconazole. We then compared our screen results identifying key PXR residues to those predicted by computational methods. Of 15 potential or putative binding residues based on docking, we identified three residues in the yeast screen that were then systematically verified to functionally interact with ketoconazole using mammalian assays. Among the residues confirmed by our study was Ser-208, which is on the opposite side of the protein from the AF-2 region critical for receptor regulation. The identification of new locations for antagonist binding on the surface or buried in PXR indicates novel aspects to the mechanism of receptor antagonism. These results significantly expand our understanding of antagonist binding sites on the surface of PXR and suggest new avenues to regulate this receptor for clinical applications. PMID:23525103
Wen, Li; Liu, Gai; Zhang, Zai-Jun; Tao, Jun; Wan, Cui-Xiang; Zhu, Ying-Guo
2006-03-01
The proteins of HL type cytoplasmic male sterility rice anther of YTA (CMS) and YTB (maintenance line) were separated by two-dimensional electrophoresis with immobilized ph (3-10 non-linear) gradients as the first dimension and SDS-PAGE as the second. The silver-stained proteins spots were analyzed using Image Master 2D software, there were about 1800 detectable spots on each 2D-gel, and about 85 spots were differential expressed. With direct MALDI-TOF mass spectrometry analysis and protein database searching, 9 protein spots out of 16 were identified. Among those proteins, there were Putative nucleic acid binding protein, glucose-1-phosphate adenylyltransferase (ADP-glucose pyrophosphorylase, AGPase) (EC: 2.7.7.27) large chain, UDP-glucuronic acid decarboxylase, putative calcium-binding protein annexin, putative acetyl-CoA synthetase and putative lipoamide dehydrogenase etc. They were closely associated with metabolism, protein biosynthesis, transcription, signal transduction and so on, all of which are cell activities that are essential to pollen development. Some of the identified proteins, i.e. AGPase, putative lipoamide dehydrogenase and putative acetyl-CoA synthetase were deeply discussed on the relationship to CMS. AGPase catalyzes a very important step in the biosynthesis of alpha 1,4-glucans (glycogen or starch) in bacteria and plants: synthesis of the activated glucosyl donor, ADP-glucose, from glucose-1-phosphate and ATP. The lack of the AGPase in male sterile line might directly result in the reduction of starch, and the synthesis of starch was the most important processes during the development of pollen. In present research, the descent or reduction of putative lipoamide dehydrogenase and putative acetyl-CoA synthetase seemed involved in pollen sterility in rice. The degeneration and formation of various tissues during pollen development may impose high demands for energy and key biosynthetic intermediates. Under such conditions, the TCA cycle needs to operate fully, because the TCA cycle is an important source for many intermediates required for biosynthetic pathways, in addition to performing an oxidative, energy-producing role. Thus, it seemed reasonable to infer that the decrease of putative lipoamide dehydrogenase and putative acetyl-CoA synthetase in anther might prevent the conversion of pyruvate into acetyl-CoA, and as a result, the TCA cycle could no longer operate at a sufficient rate to meet all requirements in anther cells, leading to pollen sterility. This study gave new insights into the mechanism of CMS in rice and demonstrated the power of the proteomic approach in plant biology studies.
Soejima, Hirofumi; Ogawa, Hisao; Morimoto, Takeshi; Nakayama, Masafumi; Okada, Sadanori; Sakuma, Mio; Uemura, Shiro; Kanauchi, Masao; Doi, Naofumi; Jinnouchi, Hideaki; Sugiyama, Seigo; Waki, Masako; Saito, Yoshihiko
2013-09-01
There are few data that demonstrate a significant effect of aspirin therapy for diabetic patients as primary prevention for cardiovascular events. A guideline recommends the use of aspirin as a primary prevention strategy in patients with diabetes who are at increased cardiovascular risk including those who have additional risk factors. To clarify the effect of primary prevention with aspirin therapy on diabetic patients, the relationship between C-reactive protein (CRP) and the incidence of atherosclerotic events was investigated in participants in the Japanese primary prevention of atherosclerosis with aspirin for diabetes (JPAD) trial. We divided the JPAD participants according to the CRP level at enrollment; CRP ≥0.1mg/dl: high CRP group, CRP <0.1mg/dl: low CRP group. The high CRP group consisted of 1131 patients and the low CRP group consisted of 398 patients. There was no significant difference in the incidence of primary atherosclerotic events between the high CRP group and the low CRP group. Of the atherosclerotic events, the incidence of cerebrovascular events, however, was significantly higher in the high CRP group than in the low CRP group. The incidence of cerebrovascular events was higher in the high CRP group than in the low CRP group in patients without aspirin therapy, although there was no significant difference in the incidence of the cerebrovascular events between the high CRP group and the low CRP group in patients undergoing aspirin therapy. Aspirin therapy may reduce cerebrovascular events in diabetic patients with higher CRP. Aspirin therapy could be an additional strategy as primary prevention for diabetic patients with higher CRP. Copyright © 2013 Japanese College of Cardiology. Published by Elsevier Ltd. All rights reserved.
Thiele, Jan R; Zeller, Johannes; Kiefer, Jurij; Braig, David; Kreuzaler, Sheena; Lenz, Yvonne; Potempa, Lawrence A; Grahammer, Florian; Huber, Tobias B; Huber-Lang, M; Bannasch, Holger; Stark, G Björn; Peter, Karlheinz; Eisenhardt, Steffen U
2018-01-01
C-reactive protein circulates as a pentameric protein (pCRP). pCRP is a well-established diagnostic marker as plasma levels rise in response to tissue injury and inflammation. We recently described pro-inflammatory properties of CRP, which are mediated by conformational changes from pCRP to bioactive isoforms expressing pro-inflammatory neo-epitopes [pCRP* and monomeric C-reactive protein (mCRP)]. Here, we investigate the role of CRP isoforms in renal ischemia/reperfusion injury (IRI). Rat kidneys in animals with and without intraperitoneally injected pCRP were subjected to IRI by the time of pCRP exposure and were subsequently analyzed for monocyte infiltration, caspase-3 expression, and tubular damage. Blood urea nitrogen (BUN) was analyzed pre-ischemia and post-reperfusion. CRP effects on leukocyte recruitment were investigated via intravital imaging of rat-striated muscle IRI. Localized conformational CRP changes were analyzed by immunohistochemistry using conformation specific antibodies. 1,6-bis(phosphocholine)-hexane (1,6-bisPC), which stabilizes CRP in its native pentameric form was used to validate CRP effects. Leukocyte activation was assessed by quantification of reactive oxygen species (ROS) induction by CRP isoforms ex vivo and in vitro through electron spin resonance spectroscopy. Signaling pathways were analyzed by disrupting lipid rafts with nystatin and subsequent ROS detection. In order to confirm the translational relevance of our findings, biopsies of microsurgical human free tissue transfers before and after IRI were examined by immunofluorescence for CRP deposition and co-localization of CD68 + leukocytes. The application of pCRP aggravates tissue damage in renal IRI. 1,6-bisPC reverses these effects via inhibition of the conformational change that leads to exposure of pro-inflammatory epitopes in CRP (pCRP* and mCRP). Structurally altered CRP induces leukocyte-endothelial interaction and induces ROS formation in leukocytes, the latter can be abrogated by blocking lipid raft-dependent signaling pathways with Nystatin. Stabilizing pCRP in its native pentameric state abrogates these pro-inflammatory effects. Importantly, these findings are confirmed in human IRI challenged muscle tissue. These results suggest that CRP is a potent modulator of IRI. Stabilizing the native pCRP conformation represents a promising anti-inflammatory therapeutic strategy by attenuation of leukocyte recruitment and ROS formation, the primary pathomechanisms of IRI.
Template Based Design of Anti-Metastatic Drugs from the Active Conformation of Laminin Peptide II
2001-01-01
p40 (LBP/p40) gene Maeda, M., Kawasaki, K., Mu, Y., Kamada, H., during sea urchin development. Exp. Cell Res. 221, Tsutsumi, Y., Smith, T. J. & Mayumi...represents the average of six replicates + SEM . minance of putative heparin-binding phage recov- ered from elution with peptide 11. Putative heparin...scrambled sequence peptide, WAQADSTPE, was used as a sequence specificity control. The data shown is the average of six replicate wells ± SEM . Statistics were
The MB2 gene family of Plasmodium species has a unique combination of S1 and GTP-binding domains
Romero, Lisa C; Nguyen, Thanh V; Deville, Benoit; Ogunjumo, Oluwasanmi; James, Anthony A
2004-01-01
Background Identification and characterization of novel Plasmodium gene families is necessary for developing new anti-malarial therapeutics. The products of the Plasmodium falciparum gene, MB2, were shown previously to have a stage-specific pattern of subcellular localization and proteolytic processing. Results Genes homologous to MB2 were identified in five additional parasite species, P. knowlesi, P. gallinaceum, P. berghei, P. yoelii, and P. chabaudi. Sequence comparisons among the MB2 gene products reveal amino acid conservation of structural features, including putative S1 and GTP-binding domains, and putative signal peptides and nuclear localization signals. Conclusions The combination of domains is unique to this gene family and indicates that MB2 genes comprise a novel family and therefore may be a good target for drug development. PMID:15222903
Lee, P T; Bird, S; Zou, J; Martin, S A M
2017-06-01
The acute phase response (APR) is an early innate immune function that is initiated by inflammatory signals, leading to the release of acute phase proteins to the bloodstream to re-establish homeostasis following microbial infection. In this study we analysed the Atlantic salmon (Salmo salar) whole-genome database and identified five C-reactive protein (CRP)/serum amyloid P component (SAP) like molecules namely CRP/SAP-1a, CRP/SAP-1b, CRP/SAP-1c, CRP/SAP-2 and CRP/SAP-3. These CRP/SAP genes formed two distinct sub-families, a universal group (group I) present in all vertebrates and a fish/amphibian specific group (group II). Salmon CRP/SAP-1a, CRP/SAP-1b and CRP/SAP-1c and CRP/SAP-2 belong to the group I family whilst salmon CRP/SAP-3 is a member of group II. Gene expression analysis showed that the salmon CRP/SAP-1a as well as serum amyloid A-5 (SAA-5), one of the major acute phase proteins, were significantly up-regulated by recombinant cytokines (rIL-1β and rIFNγ) in primary head kidney cells whilst the other four CRP/SAPs remained refractory. Furthermore, SAA-5 was produced as the main acute phase protein (APP) in Atlantic salmon challenged with Aeromonas salmonicida (aroA(-) strain) whilst salmon CRP/SAPs remained unaltered. Overall, these data illustrate the potential different functions of expanded salmon CRP/SAPs to their mammalian homologues. Copyright © 2017 The Authors. Published by Elsevier Ltd.. All rights reserved.
Fleischli, Christoph; Verhaagh, Sandra; Havenga, Menzo; Sirena, Dominique; Schaffner, Walter; Cattaneo, Roberto; Greber, Urs F; Hemmi, Silvio
2005-08-01
The human regulator of complement activation membrane cofactor protein (CD46) has recently been identified as an attachment receptor for most species B adenoviruses (Ads), including Ad type 3 (Ad3), Ad11, and Ad35, as well as species D Ad37. To characterize the interaction between Ad35 and CD46, hybrid receptors composed of different CD46 short consensus repeat (SCR) domains fused to immunoglobulin-like domains of CD4 and a set of 36 CD46 mutants containing semiconservative changes of single amino acids within SCR domains I and II were tested in binding and in Ad35-mediated luciferase transduction assays. In addition, anti-CD46 antibodies and soluble polypeptides constituting various CD46 domains were used in binding inhibition studies. Our data indicate that (i) CD46 SCR I or SCR II alone confers low but significant Ad35 binding; (ii) the presence of SCR I and II is required for optimal binding and transgene expression; (iii) transduction efficiencies equivalent to that of full-length CD46 are obtained if SCR I and II are at an appropriate distance from the cell membrane; (iv) ablation of the N-glycan attached to SCR I has no influence on receptor function, whereas ablation of the SCR II N-glycan results in about a two- to threefold reduction of binding and transgene expression; (v) most putative Ad35 binding residues are located on the same solvent-exposed face of the SCR I or SCR II domain, which are twisted by about 90 degrees ; and (vi) the putative Ad35 binding sites partly overlap with the measles virus binding surface.
Fleischli, Christoph; Verhaagh, Sandra; Havenga, Menzo; Sirena, Dominique; Schaffner, Walter; Cattaneo, Roberto; Greber, Urs F.; Hemmi, Silvio
2005-01-01
The human regulator of complement activation membrane cofactor protein (CD46) has recently been identified as an attachment receptor for most species B adenoviruses (Ads), including Ad type 3 (Ad3), Ad11, and Ad35, as well as species D Ad37. To characterize the interaction between Ad35 and CD46, hybrid receptors composed of different CD46 short consensus repeat (SCR) domains fused to immunoglobulin-like domains of CD4 and a set of 36 CD46 mutants containing semiconservative changes of single amino acids within SCR domains I and II were tested in binding and in Ad35-mediated luciferase transduction assays. In addition, anti-CD46 antibodies and soluble polypeptides constituting various CD46 domains were used in binding inhibition studies. Our data indicate that (i) CD46 SCR I or SCR II alone confers low but significant Ad35 binding; (ii) the presence of SCR I and II is required for optimal binding and transgene expression; (iii) transduction efficiencies equivalent to that of full-length CD46 are obtained if SCR I and II are at an appropriate distance from the cell membrane; (iv) ablation of the N-glycan attached to SCR I has no influence on receptor function, whereas ablation of the SCR II N-glycan results in about a two- to threefold reduction of binding and transgene expression; (v) most putative Ad35 binding residues are located on the same solvent-exposed face of the SCR I or SCR II domain, which are twisted by about 90°; and (vi) the putative Ad35 binding sites partly overlap with the measles virus binding surface. PMID:16014961
Gunawardana, Dilantha
2016-01-01
Diverse cellular activities are mediated through the interaction of protein domains and their binding partners. One such protein domain widely distributed in the higher metazoan world is the PDZ domain, which facilitates abundant protein-protein interactions. The PDZ domain-PDZ binding domain interaction has been implicated in several pathologies including Alzheimer's disease, Parkinson's disease and Down syndrome. PDZ domains bind to C-terminal peptides/proteins which have either of the following combinations: S/T-X-hydrophobic-COOH for type I, hydrophobic-Xhydrophobic- COOH for type II, and D/E-X-hydrophobic-COOH for type III, although hydrophobicity in the termini form the key characteristic of the PDZ-binding domains. We identified and characterized a Dcp2 type mRNA decapping enzyme from Arabidopsis thaliana, a protein containing a putative PDZ-binding domain using mutagenesis and protein biochemistry. Now we are using bioinformatics to study the Cterminal end of mRNA decapping enzymes from complex metazoans with the aim of (1) identifying putative PDZ-binding domains (2) Correlating structural disorder with PDZ binding domains and (3) Demonstrating the presence of phosphorylation sites in C-terminal extremities of Dcp2 type mRNA decapping enzymes. It is proposed here that the trinity of PDZbinding domains, structural disorder and phosphorylation-susceptible sites are a feature of the Dcp2 family of decapping enzymes and perhaps is a wider trick in protein evolution where scaffolding/tethering is a requirement for localization and function. It is critical though laboratory-based supporting evidence is sought to back-up this bioinformatics exploration into tail regions of mRNA decapping enzymes.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Zhang, Lei; Zhang, Qing; Yang, Yu
Highlights: • RNA recognition motif domains of RBM5 are essential for cell proliferation inhibition. • RNA recognition motif domains of RBM5 are essential for apoptosis induction. • RNA recognition motif domains of RBM5 are essential for RNA binding. • RNA recognition motif domains of RBM5 are essential for caspase-2 alternative splicing. - Abstract: RBM5 is a known putative tumor suppressor gene that has been shown to function in cell growth inhibition by modulating apoptosis. RBM5 also plays a critical role in alternative splicing as an RNA binding protein. However, it is still unclear which domains of RBM5 are required formore » RNA binding and related functional activities. We hypothesized the two putative RNA recognition motif (RRM) domains of RBM5 spanning from amino acids 98–178 and 231–315 are essential for RBM5-mediated cell growth inhibition, apoptosis regulation, and RNA binding. To investigate this hypothesis, we evaluated the activities of the wide-type and mutant RBM5 gene transfer in low-RBM5 expressing A549 cells. We found that, unlike wild-type RBM5 (RBM5-wt), a RBM5 mutant lacking the two RRM domains (RBM5-ΔRRM), is unable to bind RNA, has compromised caspase-2 alternative splicing activity, lacks cell proliferation inhibition and apoptosis induction function in A549 cells. These data provide direct evidence that the two RRM domains of RBM5 are required for RNA binding and the RNA binding activity of RBM5 contributes to its function on apoptosis induction and cell growth inhibition.« less
Zhang, Yan-qiong; Wang, Song-song; Zhu, Wei-liang; Ma, Yan; Zhang, Fang-bo; Liang, Ri-xin; Xu, Hai-yu; Yang, Hong-jun
2015-01-01
Aim: Huanglian-Jie-Du decoction (HLJDD) is an important multiherb remedy in TCM, which is recently demonstrated to be effective to treat ischemic stroke. Here, we aimed to investigate the pharmacological mechanisms of HLJDD in the treatment of ischemic stroke using systems biology approaches. Methods: Putative targets of HLJDD were predicted using MetaDrug. An interaction network of putative HLJDD targets and known therapeutic targets for the treatment of ischemic stroke was then constructed, and candidate HLJDD targets were identified by calculating topological features, including 'Degree', 'Node-betweenness', 'Closeness', and 'K-coreness'. The binding efficiencies of the candidate HLJDD targets with the corresponding compositive compounds were further validated by a molecular docking simulation. Results: A total of 809 putative targets were obtained for 168 compositive compounds in HLJDD. Additionally, 39 putative targets were common to all four herbs of HLJDD. Next, 49 major nodes were identified as candidate HLJDD targets due to their network topological importance. The enrichment analysis based on the Gene Ontology (GO) annotation system and the Kyoto Encyclopedia of Genes and Genomes (KEGG) pathway demonstrated that candidate HLJDD targets were more frequently involved in G-protein-coupled receptor signaling pathways, neuroactive ligand-receptor interactions and gap junctions, which all played important roles in the progression of ischemic stroke. Finally, the molecular docking simulation showed that 170 pairs of chemical components and candidate HLJDD targets had strong binding efficiencies. Conclusion: This study has developed for the first time a comprehensive systems approach integrating drug target prediction, network analysis and molecular docking simulation to reveal the relationships between the herbs contained in HLJDD and their putative targets and ischemic stroke-related pathways. PMID:25937634
DOE Office of Scientific and Technical Information (OSTI.GOV)
O'Brien, D.A.
1992-11-01
A putative transcription factor in Rhodobactor capsulatus which binds upstream of the crt and bch pigment biosynthesis operons and appears to play a role in the adaptation of the organism from the aerobic to the anaerobic-photosynthetic growth mode was characterized. Chapter 2 describes the identification of this factor through an in vitro mobility shift assay, as well as the determination of its binding properties and sequence specificity. Chapter 3 focuses on the isolation of this factor. Biochemistry of later carotenoid biosynthesis enzymes derived from the non-photosynthetic bacterium, Erwinia herbicola. Chapter 4 describes the separate overexpression and in vitro analysis ofmore » two enzymes involved in the main sequence of the carotenoid biosynthesis pathway, lycopene cyclase and 5-carotene hydroxylase. Chapter 5 examines the overexpression and enzymology of functionally active zeaxanthin glucosyltransferase, an enzyme which carries out a more unusual transformation, converting a carotenoid into its more hydrophilic mono- and diglucoside derivatives. In addition, amino acid homology with other glucosyltransferases suggests a putative binding site for the UDP-activated glucose substrate.« less
Hyperactive antifreeze proteins from longhorn beetles: some structural insights.
Kristiansen, Erlend; Wilkens, Casper; Vincents, Bjarne; Friis, Dennis; Lorentzen, Anders Blomkild; Jenssen, Håvard; Løbner-Olesen, Anders; Ramløv, Hans
2012-11-01
This study reports on structural characteristics of hyperactive antifreeze proteins (AFPs) from two species of longhorn beetles. In Rhagium mordax, eight unique mRNAs coding for five different mature AFPs were identified from cold-hardy individuals. These AFPs are apparently homologues to a previously characterized AFP from the closely related species Rhagium inquisitor, and consist of six identifiable repeats of a putative ice binding motif TxTxTxT spaced irregularly apart by segments varying in length from 13 to 20 residues. Circular dichroism spectra show that the AFPs from both species have a high content of β-sheet and low levels of α-helix and random coil. Theoretical predictions of residue-specific secondary structure locate these β-sheets within the putative ice-binding motifs and the central parts of the segments separating them, consistent with an overall β-helical structure with the ice-binding motifs stacked in a β-sheet on one side of the coil. Molecular dynamics models based on these findings show that these AFPs would be energetically stable in a β-helical conformation. Copyright © 2012 Elsevier Ltd. All rights reserved.
Hajjo, Rima; Setola, Vincent; Roth, Bryan L.; Tropsha, Alexander
2012-01-01
We have devised a chemocentric informatics methodology for drug discovery integrating independent approaches to mining biomolecular databases. As a proof of concept, we have searched for novel putative cognition enhancers. First, we generated Quantitative Structure- Activity Relationship (QSAR) models of compounds binding to 5-hydroxytryptamine-6 receptor (5HT6R), a known target for cognition enhancers, and employed these models for virtual screening to identify putative 5-HT6R actives. Second, we queried chemogenomics data from the Connectivity Map (http://www.broad.mit.edu/cmap/) with the gene expression profile signatures of Alzheimer’s disease patients to identify compounds putatively linked to the disease. Thirteen common hits were tested in 5-HT6R radioligand binding assays and ten were confirmed as actives. Four of them were known selective estrogen receptor modulators that were never reported as 5-HT6R ligands. Furthermore, nine of the confirmed actives were reported elsewhere to have memory-enhancing effects. The approaches discussed herein can be used broadly to identify novel drug-target-disease associations. PMID:22537153
Toxicological effect of TiO2 nanoparticle-induced myocarditis in mice
NASA Astrophysics Data System (ADS)
Hong, Fashui; Wang, Ling; Yu, Xiaohong; Zhou, Yingjun; Hong, Jie; Sheng, Lei
2015-08-01
Currently, impacts of exposure to TiO2 nanoparticles (NPs) on the cardiovascular system are not well understood. The aim of this study was to investigate whether TiO2 NPs induce myocarditis and its underlying molecular mechanism in the cardiac inflammation in mice. Mice were exposed to TiO2 NPs for 6 months; biochemical parameters of serum and expression of Th1-related and Th2-related cytokines in the heart were investigated. The results showed that TiO2 NP exposure resulted in cardiac lesions coupling with pulmonary inflammation; increases of aspartate aminotransferase (AST), creatine kinase (CK), C-reaction protein (CRP), lactate dehydrogenase (LDH), alpha-hydroxybutyrate dehydrogenase (HBDH), adhesion molecule-1 (ICAM-1), and monocyte chemoattractant protein-1 (MCP-1) levels; and a reduction of nitric oxide (NOx) level in the serum. These were associated with increases of nuclear factor-κB (NF-κB), tumor necrosis factor-α (TNF-α), interleukin (IL)-4, IL-6, transforming growth factor-β (TGF-β), creatine kinase, CRP, adhesion molecule-1, and monocyte chemoattractant protein-1, interferon-γ (IFN-γ), signal transducers and activators of transcription (STAT)1, STAT3, or STAT6, GATA-binding domain-3, GATA-binding domain-4, endothelin-1 expression levels, and T-box expressed in T cells expression level that is the master regulator of pro-inflammatory cytokines and transcription factors in the heart. These findings imply that TiO2 NP exposure may increase the occurrence and development of cardiovascular diseases.
Tracing Cytoplasmic Ca2+ Ion and Water Access Points in the Ca2+-ATPase
Musgaard, Maria; Thøgersen, Lea; Schiøtt, Birgit; Tajkhorshid, Emad
2012-01-01
Sarco(endo)plasmic reticulum Ca2+-ATPase (SERCA) transports two Ca2+ ions across the membrane of the sarco(endo)plasmic reticulum against the concentration gradient, harvesting the required energy by hydrolyzing one ATP molecule during each transport cycle. Although SERCA is one of the best structurally characterized membrane transporters, it is still largely unknown how the transported Ca2+ ions reach their transmembrane binding sites in SERCA from the cytoplasmic side. Here, we performed extended all-atom molecular dynamics simulations of SERCA. The calculated electrostatic potential of the protein reveals a putative mechanism by which cations may be attracted to and bind to the Ca2+-free state of the transporter. Additional molecular dynamics simulations performed on a Ca2+-bound state of SERCA reveal a water-filled pathway that may be used by the Ca2+ ions to reach their buried binding sites from the cytoplasm. Finally, several residues that are involved in attracting and guiding the cations toward the possible entry channel are identified. The results point to a single Ca2+ entry site close to the kinked part of the first transmembrane helix, in a region loaded with negatively charged residues. From this point, a water pathway outlines a putative Ca2+ translocation pathway toward the transmembrane ion-binding sites. PMID:22339863
Liu, Youchang; Iwasaki, Tadashi; Watarai, Shinobu; Kodama, Hiroshi
2004-09-01
The effect of turpentine oil on C-reactive protein (CRP) production was studied in rainbow trout (Oncorhynchus mykiss). Serum CRP concentration was estimated by sandwich enzyme-linked immunosorbent assay using anti-rainbow trout CRP monoclonal antibody (mAb) AC4 and polyclonal antibody. Intracellular CRP was demonstrated by flow cytometry using anti-trout CRP mAb. Hepatocytes, head kidney macrophages, spleen lymphocytes and peripheral blood lymphocytes showed reaction against AC4, but RTG-2 fibroblastic line cells, derived from rainbow trout gonad did not. This is the first report on the detection of intracellular CRP in fish. CRP levels decreased significantly 1 day after intramuscular injection of turpentine oil and remained low for 14 days. Significant decreases in the expression of CRP in hepatocytes, head kidney macrophages and spleen lymphocytes after injection of turpentine oil were found. The reduction of serum CRP concentration after turpentine oil injection may be attributed to decreases in intracellular CRP synthesis.
Heterogeneity of signal transduction by Na-K-ATPase α-isoforms: role of Src interaction.
Yu, Hui; Cui, Xiaoyu; Zhang, Jue; Xie, Joe X; Banerjee, Moumita; Pierre, Sandrine V; Xie, Zijian
2018-02-01
Of the four Na-K-ATPase α-isoforms, the ubiquitous α1 Na-K-ATPase possesses both ion transport and Src-dependent signaling functions. Mechanistically, we have identified two putative pairs of domain interactions between α1 Na-K-ATPase and Src that are critical for α1 signaling function. Our subsequent report that α2 Na-K-ATPase lacks these putative Src-binding sites and fails to carry on Src-dependent signaling further supported our proposed model of direct interaction between α1 Na-K-ATPase and Src but fell short of providing evidence for a causative role. This hypothesis was specifically tested here by introducing key residues of the two putative Src-interacting domains present on α1 but not α2 sequence into the α2 polypeptide, generating stable cell lines expressing this mutant, and comparing its signaling properties to those of α2-expressing cells. The mutant α2 was fully functional as a Na-K-ATPase. In contrast to wild-type α2, the mutant gained α1-like signaling function, capable of Src interaction and regulation. Consistently, the expression of mutant α2 redistributed Src into caveolin-1-enriched fractions and allowed ouabain to activate Src-mediated signaling cascades, unlike wild-type α2 cells. Finally, mutant α2 cells exhibited a growth phenotype similar to that of the α1 cells and proliferated much faster than wild-type α2 cells. These findings reveal the structural requirements for the Na-K-ATPase to function as a Src-dependent receptor and provide strong evidence of isoform-specific Src interaction involving the identified key amino acids. The sequences surrounding the putative Src-binding sites in α2 are highly conserved across species, suggesting that the lack of Src binding may play a physiologically important and isoform-specific role.
C-Reactive Protein and Resistance Exercise in Community Dwelling Old Adults.
Ramel, A; Geirsdottir, O G; Jonsson, P V; Thorsdottiri, I
2015-08-01
C-reactive protein (CRP), an acute phase reactant, has been associated with atherosclerosis and has also been discussed as a target for intervention. The effects of resistance exercise on CRP are currently not clear. The present analysis investigated the response of CRP to resistance exercise in old adults. Intervention study. Community. Old Icelandic adults (N = 235, 73.7 ± 5.7 years, 58.2% female). Twelve-week resistance exercise program (3 times/week; 3 sets, 6-8 repetitions at 75-80% of the 1-repetition maximum) designed to increase strength and muscle mass of major muscle groups. C-reactive protein (CRP). Mean CRP levels were 7.1 ± 4.6 mg/dL at baseline, thirty-six (15.6%) subjects had abnormally high CRP (>10 mg/L) values at baseline. After the resistance exercise program the overall changes in CRP were minor and not significant. However, CRP decreased considerably in participants with high CRP at baseline (-4.28 ± 9.41 mg/L; P = 0.015) but increased slightly in participants with normal CRP (0.81 ± 4.58 mg/L, P = 0.021). Our study shows that the concentrations of circulating CRP decreased considerably after a 12-week resistance exercise program in participants with abnormally high CRP at baseline, possibly reducing thus risk for future disease. CRP changed little in participants with normal CRP at the start of the study.
Trion, A; de Maat, M P M; Jukema, J W; van der Laarse, A; Maas, M C; Offerman, E H; Havekes, L M; Szalai, A J; Princen, H M G; Emeis, J J
2005-08-01
C-reactive protein (CRP) has been associated with risk of cardiovascular disease. It is not clear whether CRP is causally involved in the development of atherosclerosis. Mouse CRP is not expressed at high levels under normal conditions and increases in concentration only several-fold during an acute phase response. Because the dynamic range of human CRP is much larger, apolipoprotein E*3-Leiden (E3L) transgenic mice carrying the human CRP gene offer a unique model to study the role(s) of CRP in atherosclerosis development. Atherosclerosis development was studied in 15 male and 15 female E3L/CRP mice; E3L transgenic littermates were used as controls. The mice were fed a hypercholesterolemic diet to induce atherosclerosis development. Cholesterol exposure did not differ between E3L/CRP and E3L mice. Plasma CRP levels were on average 10.2+/-6.5 mg/L in male E3L/CRP mice, 0.2+/-0.1 mg/L in female E3L/CRP mice, and undetectable in E3L mice. Quantification of atherosclerosis showed that lesion area in E3L/CRP mice was not different from that in E3L mice. This study demonstrates that mildly elevated levels of CRP in plasma do not contribute to the development of early atherosclerosis in hypercholesterolemic E3L/CRP mice.
Nomura, N; Saito, K; Ikeda, M; Yuasa, S; Pastore, M; Chabert, C; Kono, E; Sakai, A; Tanaka, H; Ikemoto, T; Takubo, T
2015-08-01
We evaluated the basic performance of Microsemi CRP, an unique automated hematology analyzer which can simultaneously measure CBC including 3-part WBC differential (3-Diff) and CRP using whole blood treated with EDTA-2K anticoagulant. We found that it produced generally the acceptable results for all parameters performed (repeatability, reproducibility, linearity, interference effect, carry over, and correlation) using control materials, fresh human whole bloods, and serum samples. CBC data examined using Microsemi CRP showed the good correlation with the previous model, Micros CRP200 (r ≧ 0.9), and also those obtained using the routine analyzer, ADVIA 2120i (r ≧ 0.989). Concerning the 3-Diff, both GRA (%) and LYM (%) showed the excellent correlation coefficient between Microsemi CRP and Micros CRP200 (r ≧ 0.992) as well as ADVIA 2120i (r ≧ 0.957). MON (%) showed good correlation between Microsemi CRP and Micros CRP200 (r = 0.959), but lower correlation between Microsemi CRP and ADVIA 2120 i (r = 0.471). CRP data showed the good correlation with HITACHI7600 (r ≧ 0.997) and Micros CRP200 (r ≧ 0.997). From these findings, we concluded that Microsemi CRP seemed the convenient laboratory analyzer in the setting of point of care testing (POCT) especially at NICU or primary care unit. © 2014 John Wiley & Sons Ltd.
Sóvágó, Judit; Farde, Lars; Halldin, Christer; Langer, Oliver; Laszlovszky, István; Kiss, Béla; Gulyás, Balázs
2004-10-01
The dopamine-D3 receptor is of special interest due to its postulated role in the pathophysiology and treatment of schizophrenia and Parkinson's Disease. Increasing evidences support the assumption that the D3 receptors are occupied to a high degree by dopamine at physiological conditions. Research on the functional role of the D3 receptors in brain has however been hampered by the lack of D3 selective ligands. In the present Positron Emission Tomography (PET) study the binding of the novel, putative dopamine-D3 receptor ligand, [11C]RGH-1756 was characterized in the cynomolgus monkey brain. [11C]RGH-1756 was rather homogenously distributed in brain and the regional binding potential (BP) values ranged between 0.17 and 0.48. Pretreatment with unlabelled RGH-1756 decreased radioligand binding to the level of the cerebellum in most brain areas. The regional BP values were lower after intravenous injection of a higher mass of RGH-1756, indicating saturable binding of [11C]RGH-1756. The D2/D3 antagonist raclopride partly inhibited the binding of [11C]RGH-1756 in several brain areas, including the striatum, mesencephalon and neocortex, whereas the 5HT(1A) antagonist WAY-100635 had no evident effect on [11C]RGH-1756 binding. Despite the promising binding characteristics of RGH-1756 in vitro the present PET-study indicates that [11C]RGH-1756 provides a low signal for specific binding to the D3 receptor in vivo. One explanation is that the favorable binding characteristics of RGH-1756 in vitro are not manifested in vivo. Alternatively, the results may support the hypothesis that the dopamine-D3 receptors are indeed occupied to a high extent by dopamine in vivo and thus not available for radioligand binding.
Dayan, Avraham; Babin, Gilad; Ganoth, Assaf; Kayouf, Nivin Samir; Nitoker Eliaz, Neta; Mukkala, Srijana; Tsfadia, Yossi; Fleminger, Gideon
2017-08-01
Titanium (Ti) and its alloys are widely used in orthodontic and orthopedic implants by virtue to their high biocompatibility, mechanical strength, and high resistance to corrosion. Biointegration of the implants with the tissue requires strong interactions, which involve biological molecules, proteins in particular, with metal oxide surfaces. An exocellular high-affinity titanium dioxide (TiO 2 )-binding protein (TiBP), purified from Rhodococcus ruber, has been previously studied in our lab. This protein was shown to be homologous with the orthologous cytoplasmic rhodococcal dihydrolipoamide dehydrogenase (rhDLDH). We have found that rhDLDH and its human homolog (hDLDH) share the TiO 2 -binding capabilities with TiBP. Intrigued by the unique TiO 2 -binding properties of hDLDH, we anticipated that it may serve as a molecular bridge between Ti-based medical structures and human tissues. The objective of the current study was to locate the region and the amino acids of the protein that mediate the protein-TiO 2 surface interaction. We demonstrated the role of acidic amino acids in the nonelectrostatic enzyme/dioxide interactions at neutral pH. The observation that the interaction of DLDH with various metal oxides is independent of their isoelectric values strengthens this notion. DLDH does not lose its enzymatic activity upon binding to TiO 2 , indicating that neither the enzyme undergoes major conformational changes nor the TiO 2 binding site is blocked. Docking predictions suggest that both rhDLDH and hDLDH bind TiO 2 through similar regions located far from the active site and the dimerization sites. The putative TiO 2 -binding regions of both the bacterial and human enzymes were found to contain a CHED (Cys, His, Glu, Asp) motif, which has been shown to participate in metal-binding sites in proteins. Copyright © 2017 John Wiley & Sons, Ltd.
Allender, Matthew C; Junge, Randall E; Baker-Wylie, Sarah; Hileman, Eric T; Faust, Lisa J; Cray, Carolyn
2015-12-01
The purpose of this study was to establish reference intervals of the protein electrophoretic fractions and the acute-phase proteins hemoglobin binding protein (as determined by the haptoglobin assay) and C-reactive protein (CRP) and assess any possible correlations between varying age class, sex, location (Illinois or Michigan), year, or presence of snake fungal disease (SFD). Banked plasma samples were assayed from 130 eastern massasaugas from 2009 to 2014 in Illinois and Michigan. Snakes from Michigan had higher total protein (mean: 5.50 g/dl), albumin/globulin ratio (0.42), albumin (1.59 g/dl), and gamma globulins (0.55 g/dl) than from snakes in Illinois (4.72 g/dl, 0.29, 1.03 g/dl, 0.38 g/dl, respectively). Snakes in Illinois (22.19 g/ml) had higher CRP than snakes in Michigan (10.89 mg/ml). Adults had higher gamma globulins (0.47 g/dl) than juveniles (0.28 g/dl). Males had higher alpha-2 globulins (0.98 g/dl) and CRP (21.4 mg/ml) than females (0.85, 11.6, respectively). There were no significant differences in absolute plasma proteins in SFD-positive snakes, but the percentage of gamma globulins was significantly higher in positive snakes. Future research in this area can now build on this data to determine changes in population health over time or due to specific environmental or disease threats.
Pérez-Morales, Deyanira; Bustamante, Víctor H
2016-02-01
A novel connection between two regulatory systems controlling crucial biological processes in bacteria, the carbon storage regulator (Csr) system and the glucose-specific phosphotransferase system (PTS), is reported by Leng et al. in this issue. This involves the interaction of unphosphorylated EIIA(Glc), a component of the glucose-specific PTS, with the CsrD protein, which accelerates the decay of the CsrB and CsrC small RNAs via RNase E in Escherichia coli. As unphosphorylated EIIA(G) (lc) is generated in the presence of glucose, the PTS thus acts as a sensor of glucose for the Csr system. Interestingly, another pathway can operate for communication between the Csr system and the glucose-specific PTS. The absence of glucose generates phosphorylated EIIA(Glc) , which activates the enzyme adenylate cyclase to produce cyclic adenosine monophosphate (cAMP) that, in turn, binds to the regulator cAMP receptor protein (CRP). Leng et al. show that the complex cAMP-CRP modestly reduces CsrB decay independently of CsrD. On the other hand, a previous study indicates that the complex cAMP-CRP positively regulates the transcription of CsrB and CsrC in Salmonella enterica. Therefore, EIIA(G) (lc) could work as a molecular switch that regulates the activity of the Csr system, in response to its phosphorylation state determined by the presence or absence of glucose, in order to control gene expression. © 2015 John Wiley & Sons Ltd.
Saito, Tomoyuki; Murata, Miho; Otani, Taeko; Tamemoto, Hiroyuki; Kawakami, Masanobu; Ishikawa, San-E
2012-01-01
The goal of the study was to examine the association of subcutaneous and visceral fat mass with serum concentrations of adipokines in 130 subjects with type 2 diabetes mellitus. The levels of serum high sensitivity C-reactive protein (HS-CRP), adiponectin, high-molecular-weight (HMW) adiponectin, interleukin-18, and retinol-binding protein 4 were measured. Percentage body fat was determined by dual energy X-ray absorptiometry, and subcutaneous and visceral fat areas were measured by abdominal CT. HS-CRP had significant positive correlations with percentage body fat and subcutaneous fat area, and a particularly significant positive correlation with visceral fat area. Serum adiponectin had a negative correlation with the subcutaneous and visceral fat areas, with the strongest correlation with the visceral fat area. Similar results were obtained for HMW adiponectin. Serum adiponectin had a negative correlation with visceral fat area in subjects with a visceral fat area < 100 cm², but not in those with a visceral fat area ≥ 100 cm². In contrast, serum HS-CRP showed a positive correlation with visceral fat area in subjects with visceral fat area ≥ 100 cm², but not in those with a visceral fat area < 100 cm². These findings indicate that an increased visceral fat area is associated with inflammatory changes, and that inflammatory reactions may alter the functional properties of visceral fat in type 2 diabetes mellitus.
Computer Simulation of the Virulome of Bacillus anthracis Using Proteomics
2006-07-31
hypothetical protein gi|47526566 spermidine /putrescine ABC transporter, spermidine /putrescine-binding protein gi|47526625 oligoendopeptidase F, putative gi...glutamyl-trna(gln) amidotransferase, a subunit x gi|50196927 aspartate aminotransferase x gi|50196970 spermidine synthase x
Sand, Olivier; Thomas-Chollier, Morgane; Vervisch, Eric; van Helden, Jacques
2008-01-01
This protocol shows how to access the Regulatory Sequence Analysis Tools (RSAT) via a programmatic interface in order to automate the analysis of multiple data sets. We describe the steps for writing a Perl client that connects to the RSAT Web services and implements a workflow to discover putative cis-acting elements in promoters of gene clusters. In the presented example, we apply this workflow to lists of transcription factor target genes resulting from ChIP-chip experiments. For each factor, the protocol predicts the binding motifs by detecting significantly overrepresented hexanucleotides in the target promoters and generates a feature map that displays the positions of putative binding sites along the promoter sequences. This protocol is addressed to bioinformaticians and biologists with programming skills (notions of Perl). Running time is approximately 6 min on the example data set.
Ringwald, M; Schuh, R; Vestweber, D; Eistetter, H; Lottspeich, F; Engel, J; Dölz, R; Jähnig, F; Epplen, J; Mayer, S
1987-01-01
We have determined the amino acid sequence of the Ca2+-dependent cell adhesion molecule uvomorulin as it appears on the cell surface. The extracellular part of the molecule exhibits three internally repeated domains of 112 residues which are most likely generated by gene duplication. Each of the repeated domains contains two highly conserved units which could represent putative Ca2+-binding sites. Secondary structure predictions suggest that the putative Ca2+-binding units are located in external loops at the surface of the protein. The protein sequence exhibits a single membrane-spanning region and a cytoplasmic domain. Sequence comparison reveals extensive homology to the chicken L-CAM. Both uvomorulin and L-CAM are identical in 65% of their entire amino acid sequence suggesting a common origin for both CAMs. Images Fig. 1. Fig. 4. Fig. 7. PMID:3501370
Udani, M; Zen, Q; Cottman, M; Leonard, N; Jefferson, S; Daymont, C; Truskey, G; Telen, M J
1998-01-01
Sickle red cells bind significant amounts of soluble laminin, whereas normal red cells do not. Solid phase assays demonstrate that B-CAM/LU binds laminin on intact sickle red cells and that red cell B-CAM/LU binds immobilized laminin, whereas another putative laminin binding protein, CD44, does not. Ligand blots also identify B-CAM/LU as the only erythrocyte membrane protein(s) that binds laminin. Finally, transfection of murine erythroleukemia cells with human B-CAM cDNA induces binding of both soluble and immobilized laminin. Thus, B-CAM/LU appears to be the major laminin-binding protein of sickle red cells. Previously reported overexpression of B-CAM/LU by epithelial cancer cells suggests that this protein may also serve as a laminin receptor in malignant tumors. PMID:9616226
Herrou, Julien; Willett, Jonathan W; Czyż, Daniel M; Babnigg, Gyorgy; Kim, Youngchang; Crosson, Sean
2017-03-01
Brucella abortus σ E1 is an EcfG family sigma factor that regulates the transcription of dozens of genes in response to diverse stress conditions and is required for maintenance of chronic infection in a mouse model. A putative ATP-binding cassette transporter operon, bab1_0223-bab1_0226 , is among the most highly activated gene sets in the σ E1 regulon. The proteins encoded by the operon resemble quaternary ammonium-compatible solute importers but are most similar in sequence to the broadly conserved YehZYXW system, which remains largely uncharacterized. Transcription of yehZYXW is activated by the general stress sigma factor σ S in Enterobacteriaceae , which suggests a functional role for this transport system in bacterial stress response across the classes Alphaproteobacteria and Gammaproteobacteria We present evidence that B. abortus YehZYXW does not function as an importer of known compatible solutes under physiological conditions and does not contribute to the virulence defect of a σ E1 -null strain. The sole in vitro phenotype associated with genetic disruption of this putative transport system is reduced growth in the presence of high Li + ion concentrations. A crystal structure of B. abortus YehZ revealed a class II periplasmic binding protein fold with significant structural homology to Archaeoglobus fulgidus ProX, which binds glycine betaine. However, the structure of the YehZ ligand-binding pocket is incompatible with high-affinity binding to glycine betaine. This is consistent with weak measured binding of YehZ to glycine betaine and related compatible solutes. We conclude that YehZYXW is a conserved, stress-regulated transport system that is phylogenetically and functionally distinct from quaternary ammonium-compatible solute importers. IMPORTANCE Brucella abortus σ E1 regulates transcription in response to stressors encountered in its mammalian host and is necessary for maintenance of chronic infection in a mouse model. The functions of the majority of genes regulated by σ E1 remain undefined. We present a functional/structural analysis of a conserved putative membrane transport system (YehZYXW) whose expression is strongly activated by σ E1 Though annotated as a quaternary ammonium osmolyte uptake system, experimental physiological studies and measured ligand-binding properties of the periplasmic binding protein (PBP), YehZ, are inconsistent with this function. A crystal structure of B. abortus YehZ provides molecular insight into differences between bona fide quaternary ammonium osmolyte importers and YehZ-related proteins, which form a distinct phylogenetic and functional group of PBPs. Copyright © 2017 American Society for Microbiology.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Herrou, Julien; Willett, Jonathan W.; Czyż, Daniel M.
ABSTRACT Brucella abortusσ E1is an EcfG family sigma factor that regulates the transcription of dozens of genes in response to diverse stress conditions and is required for maintenance of chronic infection in a mouse model. A putative ATP-binding cassette transporter operon,bab1_0223-bab1_0226, is among the most highly activated gene sets in the σ E1regulon. The proteins encoded by the operon resemble quaternary ammonium-compatible solute importers but are most similar in sequence to the broadly conserved YehZYXW system, which remains largely uncharacterized. Transcription ofyehZYXWis activated by the general stress sigma factor σ SinEnterobacteriaceae, which suggests a functional role for this transport systemmore » in bacterial stress response across the classesAlphaproteobacteriaandGammaproteobacteria. We present evidence thatB. abortusYehZYXW does not function as an importer of known compatible solutes under physiological conditions and does not contribute to the virulence defect of a σ E1-null strain. The solein vitrophenotype associated with genetic disruption of this putative transport system is reduced growth in the presence of high Li +ion concentrations. A crystal structure ofB. abortusYehZ revealed a class II periplasmic binding protein fold with significant structural homology toArchaeoglobus fulgidusProX, which binds glycine betaine. However, the structure of the YehZ ligand-binding pocket is incompatible with high-affinity binding to glycine betaine. This is consistent with weak measured binding of YehZ to glycine betaine and related compatible solutes. We conclude that YehZYXW is a conserved, stress-regulated transport system that is phylogenetically and functionally distinct from quaternary ammonium-compatible solute importers. IMPORTANCEBrucella abortusσ E1regulates transcription in response to stressors encountered in its mammalian host and is necessary for maintenance of chronic infection in a mouse model. The functions of the majority of genes regulated by σ E1remain undefined. We present a functional/structural analysis of a conserved putative membrane transport system (YehZYXW) whose expression is strongly activated by σ E1. Though annotated as a quaternary ammonium osmolyte uptake system, experimental physiological studies and measured ligand-binding properties of the periplasmic binding protein (PBP), YehZ, are inconsistent with this function. A crystal structure ofB. abortusYehZ provides molecular insight into differences between bona fide quaternary ammonium osmolyte importers and YehZ-related proteins, which form a distinct phylogenetic and functional group of PBPs.« less
DOE Office of Scientific and Technical Information (OSTI.GOV)
Herrou, Julien; Willett, Jonathan W.; Czyż, Daniel M.
ABSTRACT Brucella abortusσ E1is an EcfG family sigma factor that regulates the transcription of dozens of genes in response to diverse stress conditions and is required for maintenance of chronic infection in a mouse model. A putative ATP-binding cassette transporter operon,bab1_0223-bab1_0226, is among the most highly activated gene sets in the σ E1regulon. The proteins encoded by the operon resemble quaternary ammonium-compatible solute importers but are most similar in sequence to the broadly conserved YehZYXW system, which remains largely uncharacterized. Transcription ofyehZYXWis activated by the general stress sigma factor σ SinEnterobacteriaceae, which suggests a functional role for this transport systemmore » in bacterial stress response across the classesAlphaproteobacteriaandGammaproteobacteria. We present evidence thatB. abortusYehZYXW does not function as an importer of known compatible solutes under physiological conditions and does not contribute to the virulence defect of a σ E1-null strain. The solein vitrophenotype associated with genetic disruption of this putative transport system is reduced growth in the presence of high Li +ion concentrations. A crystal structure ofB. abortusYehZ revealed a class II periplasmic binding protein fold with significant structural homology toArchaeoglobus fulgidusProX, which binds glycine betaine. However, the structure of the YehZ ligand-binding pocket is incompatible with high-affinity binding to glycine betaine. This is consistent with weak measured binding of YehZ to glycine betaine and related compatible solutes. We conclude that YehZYXW is a conserved, stress-regulated transport system that is phylogenetically and functionally distinct from quaternary ammonium-compatible solute importers. IMPORTANCEBrucella abortusσ E1regulates transcription in response to stressors encountered in its mammalian host and is necessary for maintenance of chronic infection in a mouse model. The functions of the majority of genes regulated by σ E1remain undefined. We present a functional/structural analysis of a conserved putative membrane transport system (YehZYXW) whose expression is strongly activated by σ E1. Though annotated as a quaternary ammonium osmolyte uptake system, experimental physiological studies and measured ligand-binding properties of the periplasmic binding protein (PBP), YehZ, are inconsistent with this function. A crystal structure ofB. abortusYehZ provides molecular insight into differences between bona fide quaternary ammonium osmolyte importers and YehZ-related proteins, which form a distinct phylogenetic and functional group of PBPs.« less
2013-01-01
Background Polycomb Repressive Complex 2 (PRC2) is an essential regulator of gene expression that maintains genes in a repressed state by marking chromatin with trimethylated Histone H3 lysine 27 (H3K27me3). In Arabidopsis, loss of PRC2 function leads to pleiotropic effects on growth and development thought to be due to ectopic expression of seed and embryo-specific genes. While there is some understanding of the mechanisms by which specific genes are targeted by PRC2 in animal systems, it is still not clear how PRC2 is recruited to specific regions of plant genomes. Results We used ChIP-seq to determine the genome-wide distribution of hemagglutinin (HA)-tagged FERTLIZATION INDEPENDENT ENDOSPERM (FIE-HA), the Extra Sex Combs homolog protein present in all Arabidopsis PRC2 complexes. We found that the FIE-HA binding sites co-locate with a subset of the H3K27me3 sites in the genome and that the associated genes were more likely to be de-repressed in mutants of PRC2 components. The FIE-HA binding sites are enriched for three sequence motifs including a putative GAGA factor binding site that is also found in Drosophila Polycomb Response Elements (PREs). Conclusions Our results suggest that PRC2 binding sites in plant genomes share some sequence features with Drosophila PREs. However, unlike Drosophila PREs which are located in promoters and devoid of H3K27me3, Arabidopsis FIE binding sites tend to be in gene coding regions and co-localize with H3K27me3. PMID:24001316
Identification and application of self-binding zipper-like sequences in SARS-CoV spike protein.
Zhang, Si Min; Liao, Ying; Neo, Tuan Ling; Lu, Yanning; Liu, Ding Xiang; Vahlne, Anders; Tam, James P
2018-05-22
Self-binding peptides containing zipper-like sequences, such as the Leu/Ile zipper sequence within the coiled coil regions of proteins and the cross-β spine steric zippers within the amyloid-like fibrils, could bind to the protein-of-origin through homophilic sequence-specific zipper motifs. These self-binding sequences represent opportunities for the development of biochemical tools and/or therapeutics. Here, we report on the identification of a putative self-binding β-zipper-forming peptide within the severe acute respiratory syndrome-associated coronavirus spike (S) protein and its application in viral detection. Peptide array scanning of overlapping peptides covering the entire length of S protein identified 34 putative self-binding peptides of six clusters, five of which contained octapeptide core consensus sequences. The Cluster I consensus octapeptide sequence GINITNFR was predicted by the Eisenberg's 3D profile method to have high amyloid-like fibrillation potential through steric β-zipper formation. Peptide C6 containing the Cluster I consensus sequence was shown to oligomerize and form amyloid-like fibrils. Taking advantage of this, C6 was further applied to detect the S protein expression in vitro by fluorescence staining. Meanwhile, the coiled-coil-forming Leu/Ile heptad repeat sequences within the S protein were under-represented during peptide array scanning, in agreement with that long peptide lengths were required to attain high helix-mediated interaction avidity. The data suggest that short β-zipper-like self-binding peptides within the S protein could be identified through combining the peptide scanning and predictive methods, and could be exploited as biochemical detection reagents for viral infection. Copyright © 2018. Published by Elsevier Ltd.
Marques, Alda; Oliveira, Ana; Machado, Ana; Jácome, Cristina; Cruz, Joana; Pinho, Tânia; Hall, Andreia; Alvelos, Helena; Brooks, Dina
2018-05-07
We investigated Portuguese physiotherapy students' and physiotherapists' (1) perceptions of cardiorespiratory physiotherapy (CRP); (2) factors that influenced their decision to pursue a career in CRP; and (3) suggestions to develop CRP. Online surveys were disseminated to final year students and physiotherapists. A number of 189 students (mean age 23 [SD 6] years; 78% ♀) and 375 physiotherapists (mean age 31 [SD 8] years; 78% ♀) participated. Students' opinions about CRP were positively influenced by lecturers (n = 112, 69%), clinical experiences (n = 110, 68%), and scientific evidence (n = 93, 57%). Only 13% of students were "extremely interested" in specializing in CRP. Interest in the area and clinical exposure were the main factors influencing students to pursue a career in CRP. A percentage of 15 of responding physiotherapists were working in CRP. Their decision to pursue a CRP career was most influenced by their interest in the area (n = 37, 67%) and opportunity to work in acute settings (n = 31; 56%). Main suggestions to develop CRP were (1) include placements in CRP; (2) emphasize health promotion within the curriculum; and (3) develop CRP skills in broader contexts and training. Strategies focusing on changing the curriculum, increasing exposure to CRP, providing good mentorship, developing health promotion activities, and creating postgraduate courses may increase the attractiveness for CRP.
Rydenfelt, Mattias; Cox, Robert Sidney; Garcia, Hernan; Phillips, Rob
2014-01-01
Transcription factors (TFs) with regulatory action at multiple promoter targets is the rule rather than the exception, with examples ranging from the cAMP receptor protein (CRP) in E. coli that regulates hundreds of different genes simultaneously to situations involving multiple copies of the same gene, such as plasmids, retrotransposons, or highly replicated viral DNA. When the number of TFs heavily exceeds the number of binding sites, TF binding to each promoter can be regarded as independent. However, when the number of TF molecules is comparable to the number of binding sites, TF titration will result in correlation (“promoter entanglement”) between transcription of different genes. We develop a statistical mechanical model which takes the TF titration effect into account and use it to predict both the level of gene expression for a general set of promoters and the resulting correlation in transcription rates of different genes. Our results show that the TF titration effect could be important for understanding gene expression in many regulatory settings. PMID:24580252
Ener, Kemal; Keske, Murat; Aldemir, Mustafa; Özcan, Muhammet Fuat; Okulu, Emrah; Özayar, Asım; Ergin, Merve; Doluoğlu, Ömer Gökhan; Çakmak, Serdar; Erel, Özcan
2015-08-01
This study aimed to investigate oxidative stress in etiopathogenesis by analyzing serum total antioxidant capacity (TAC), total oxidant status (TOS), binding capacity of exogenous cobalt to human albumin (IMA), serum advanced oxidation protein products (AOPP), paraoxonase (PON), arylesterase, IgE, and C-reactive protein (CRP) in bladder pain syndrome/interstitial cystitis (BPS/IC). The study included 16 female patients diagnosed with BPS/IC and 25 healthy female subjects forming the control group. A bladder biopsy was performed on all patients in the BPS/IC group by carrying out cystoscopy with hydrodistention under general anesthesia. The results of serum TAC, TOS, IMA, AOPP, PON, arylesterase, IgE, and CRP of the subjects in both groups were compared. The mean age of the 16 female patients in the BPS/IC group was 43.6 ± 14.5 years, and the mean age of the 25 healthy subjects in the control group was 42.0 ± 10.3 years. According to the criteria of International Society for the Study of Interstitial Cystitis (ESSIC), eight patients were classified as Type 2A, three patients as Type 2B, four patients as Type 2C, and one patient as Type 3C. In the BPS/IC group, while TAC was found significantly lower than in the control group, IMA, IgE, and CRP were found significantly higher (P < 0.05). When binary logistic regression analysis was performed, the created model was determined to have 81.3 % sensitivity and 80 % specifity. In the etiology of BPS/IC, mechanism of oxidative damage comes into prominence. In the diagnosis of BPS/IC, IgE, CRP, and TAC are not specific markers when used separately; however, a higher specifity and sensitivity could be reached when used jointly in the suspected patients.
Vrazic, Hrvoje; Haller, Bernhard; Braun, Siegmund; Petzold, Tobias; Ott, Ilka; Lennerz, Agnes; Michel, Jonathan; Blažek, Patrick; Deisenhofer, Isabel; Whittaker, Peter; Kolb, Christof
2017-01-01
Background The use of cardiac implantable electronic devices (CIED) has risen steadily, yet the rate of cardiac device infections (CDI) has disproportionately increased. Amongst all cardiac device infections, the pocket infection is the most challenging diagnosis. Therefore, we aimed to improve diagnosis of such pocket infection by identifying relevant biomarkers. Methods We enrolled 25 consecutive patients with invasively and microbiologically confirmed pocket infection. None of the patients had any confounding conditions. Pre-operative levels of 14 biomarkers were compared in infected and control (n = 50) patients. Our selected biomarkers included white blood cell count (WBC), C-reactive protein (CRP), procalcitonin (PCT), lipopolysaccharide binding protein, high-sensitivity C-reactive protein (HS-CRP), polymorphonuclear-elastase, presepsin, various interleukins, tumor necrosis factor α (TNF-α), and granulocyte macrophage colony-stimulating factor (GM-CSF). Results Of the 25 patients with isolated pocket infection (70±13years, 76% male, 40% ICDs), none presented with leukocytosis. In contrast, they had higher serum levels of HS-CRP (p = 0.019) and PCT (p = 0.010) than control patients. Median PCT-level was 0.06 ng/mL (IQR 0.03–0.07 ng/mL) in the study group versus 0.03 ng/mL (IQR 0.02–0.04 ng/mL) in controls. An optimized PCT cut-off value of 0.05 ng/mL suggests pocket infection with a sensitivity of 60% and specificity of 82%. In addition TNF-α- and GM-CSF-levels were lower in the study group. Other biomarkers did not differ between groups. Conclusion Diagnosis of isolated pocket infections requires clinical awareness, physical examination, evaluation of blood cultures and echocardiography assessment. Nevertheless, measurement of PCT- and HS-CRP-levels can aid diagnosis. However, no conclusion can be drawn from normal WBC-values. Clinical trial registration clinicaltrials.gov identifier: NCT01619267 PMID:28264059
Genetic Variation Affects C-Reactive Protein Elevations in Crohn's Disease.
Moran, Christopher J; Kaplan, Jess L; Winter, Harland S
2018-04-28
C-reactive protein (CRP) is a serum marker that is used to measure disease activity in Crohn's disease (CD). However, a subset of CD patients have normal CRP during flares. In rheumatoid arthritis and lupus, genetic variants can restrict CRP elevations during flares. This study sought to determine if common CRP genetic variants affect CRP values during active CD. Subjects with CD who participated in the Partners HealthCare BioBank were genotyped for 5 common CRP genetic variants (rs2794520, rs3122012, rs3093077, rs2808635, and rs1800947). Medical records were reviewed to determine disease activity and the highest CRP value during active CD. CRP values during active infection or malignancy at the time of the test were excluded. CRP values were compared by genotype using the Mann-Whitney test. The study included 199 subjects with active CD (21 to 86 years of age). Subjects with the rs2794520 TT genotype had a lower CRP than subjects with the CC genotype (58.3 mg/L vs 28.4 mg/L, P = 0.008). Subjects with the rs1800947 CG genotype had a lower CRP than those with the CC genotype (54.3 mg/L vs 22.4 mg/L, P < 0.0001); 41.6% of TT subjects had a normal CRP compared with 24.1% of CT subjects and 16.5% of CC subjects (P = 0.041). This study demonstrates that rs2794520 and rs1800947 are associated with a restriction of CRP elevations during active CD. While CRP is typically a reliable biomarker in CD, there is a subset of CD patients with a genetically determined restriction of CRP in whom other disease markers should be utilized.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Card, G L; Peterson, N A; Smith, C A
2005-02-15
Mycobacterium tuberculosis, the cause of TB, is a devastating human pathogen. The emergence of multi-drug resistance in recent years has prompted a search for new drug targets and for a better understanding of mechanisms of resistance. Here we focus on the gene product of an open reading frame from M. tuberculosis, Rv1347c, which is annotated as a putative aminoglycoside N-acetyltransferase. The Rv1347c protein does not show this activity, however, and we show from its crystal structure, coupled with functional and bioinformatic data, that its most likely role is in the biosynthesis of mycobactin, the M. tuberculosis siderophore. The crystal structuremore » of Rv1347c was determined by MAD phasing from selenomethionine-substituted protein and refined at 2.2 {angstrom} resolution (R = 0.227, R{sub free} = 0.257). The protein is monomeric, with a fold that places it in the GCN5-related N-acetyltransferase (GNAT) family of acyltransferases. Features of the structure are an acylCoA binding site that is shared with other GNAT family members, and an adjacent hydrophobic channel leading to the surface that could accommodate long-chain acyl groups. Modeling the postulated substrate, the N{sup {var_epsilon}}-hydroxylysine side chain of mycobactin, into the acceptor substrate binding groove identifies two residues at the active site, His130 and Asp168, that have putative roles in substrate binding and catalysis.« less
Does Lactation Mitigate Triple Negative/Basal Breast Cancer Progression
2013-11-01
protein; calponin, a calcium binding cytoskeletal protein [41-43]; and the transcription factor p63, a putative tumor suppressor [8, 12, 44], to...development of wound-induced tumors in chickens infected with Rous sarcoma virus. Cancer Res 1994, 54(16):4334-4341. 31. Stuelten CH, Barbul A, Busch JI...gizzard calponin. Interactions of the 145-163 region with F-actin, calcium -binding proteins, and tropomyosin. J Biol Chem 1995, 270(15):8867-8876. 51
D'Aiuto, Francesco; Casas, Juan P; Shah, Tina; Humphries, Steve E; Hingorani, Aroon D; Tonetti, Maurizio S
2005-04-01
Elevations in C-reactive protein (CRP) concentration are associated with an increased risk of future coronary events in prospective studies and it has been suggested that CRP could be used to aid risk prediction. A +1444C>T polymorphism in the CRP gene has been associated with differences in CRP concentration. We investigated the effect of this polymorphism on the CRP response to periodontal therapy, an intermediate inflammatory stimulus. Clinical parameters, CRP, and interleukin-6 (IL-6) concentrations were evaluated in 55 consecutive patients suffering from periodontitis at baseline, 1, 7 and 30 days after an intensive course of periodontal treatment. In a multivariate analysis individuals homozygous for the +1444T allele showed higher CRP concentrations (day 1, 21.10+/-4.81 mg/L and day 7, 4.89+/-0.74 mg/L) compared with C-allele carriers (day 1, 12.37+/-1.61 mg/L and day 7, 3.08+/-2.00 mg/L). This effect was independent of conventional cardiovascular risk factors and inflammatory factors known to affect CRP concentrations. CRP genotype may need to be considered when CRP values are used in coronary risk prediction.
Rabello, Ligia S C F; Póvoa, Pedro; Lapa E Silva, Jose R; Azevedo, Luciano C P; da Silva Ramos, Fernando Jose; Lisboa, Thiago; Soares, Marcio; Salluh, Jorge I F
2017-12-01
Describe the patterns of C-reactive protein relative changes in response to antibiotic therapy in critically ill cancer patients with healthcare-associated pneumonia (HCAP) and its ability to predict outcome. Secondary analysis of a prospective cohort of critically ill cancer patients with HCAP. CRP was sampled every other day from D0 to D6 of antibiotic therapy. Patients were classified according to an individual pattern of CRP-ratio response: fast - CRP at D4 of therapy was <0.4 of D0 CRP; slow - a continuous but slow decrease of CRP; non - CRP remained ≥0.8 of D0 CRP; biphasic - initial CRP decrease to levels <0.8 of the D0 CRP followed by a secondary rise ≥0.8. 129 patients were included and septic shock was present in 74% and invasive mechanical ventilation was used in 73%. Intensive care unit (ICU) and hospital mortality rates were 47% and 64%, respectively. By D4, both CRP and CRP-ratio of survivors were significantly lower than in nonsurvivors (p<0.001 and p=0.004, respectively). Both time-dependent analysis of CRP-ratio of the four previously defined patterns (p<0.001) as ICU mortality were consistently different [fast 12.9%, slow 43.2%, biphasic 66.7% and non 71.8% (p<0.001)]. CRP-ratio was useful in the early prediction of poor outcomes in cancer patients with HCAP. Copyright © 2017 Elsevier Inc. All rights reserved.
2013-01-01
Background Obesity and serum C-reactive protein (CRP) (a sensitive marker of inflammatory activity) are associated with most chronic diseases. Abdominal adiposity along with age is the strongest determinant of baseline CRP levels in healthy subjects. The mechanism of the association of serum CRP with disease is uncertain. We hypothesized that baseline serum CRP is a marker of inflammatory responsiveness to injury and that abdominal adiposity is the main determinant of this responsiveness. We studied the effect of abdominal adiposity, age and other environmental risk factors for chronic disease on the CRP response to a standardised surgical insult, unilateral hernia repair to not only test this hypothesis but to inform the factors which must be taken into account when assessing systemic inflammatory responses to surgery. Methods 102 male subjects aged 24-94 underwent unilateral hernia repair by a single operator. CRP was measured at 0, 6, 24 and 48 hrs. Response was defined as the peak CRP adjusted for baseline CRP. Results Age and waist:hip ratio (WHR) were associated both with basal CRP and CRP response with similar effect sizes after adjustment for a wide-range of covariates. The adjusted proportional difference in CRP response per 10% increase in WHR was 1.50 (1.17-1.91) p = 0.0014 and 1.15(1.00-1.31) p = 0.05 per decade increase in age. There was no evidence of important effects of other environmental cardiovascular risk factors on CRP response. Conclusion Waist:hip ratio and age need to be considered when studying the inflammatory response to surgery. The finding that age and waist:hip ratio influence baseline and post-operative CRP levels to a similar extent suggests that baseline CRP is a measure of inflammatory responsiveness to casual stimuli and that higher age and obesity modulate the generic excitability of the inflammatory system leading to both higher baseline CRP and higher CRP response to surgery. The mechanism for the association of baseline CRP and waist:hip ratio to chronic disease outcomes could be through this increase in inflammatory system excitability. PMID:23391158
Coelho, Luís M; Salluh, Jorge I F; Soares, Márcio; Bozza, Fernando A; Verdeal, Juan Carlos R; Castro-Faria-Neto, Hugo C; Lapa e Silva, José Roberto; Bozza, Patrícia T; Póvoa, Pedro
2012-12-12
Community-acquired pneumonia (CAP) requiring intensive care unit (ICU) admission remains a severe medical condition, presenting ICU mortality rates reaching 30%. The aim of this study was to assess the value of different patterns of C-reactive protein (CRP)-ratio response to antibiotic therapy in patients with severe CAP requiring ICU admission as an early maker of outcome. In total, 191 patients with severe CAP were prospectively included and CRP was sampled every other day from D1 to D7 of antibiotic prescription. CRP-ratio was calculated in relation to D1 CRP concentration. Patients were classified according to an individual pattern of CRP-ratio response with the following criteria: fast response - when D5 CRP was less than or equal to 0.4 of D1 CRP concentration; slow response - when D5 CRP was > 0.4 and D7 less than or equal to 0.8 of D1 CRP concentration; nonresponse - when D7 CRP was > 0.8 of D1 CRP concentration. Comparison between ICU survivors and non-survivors was performed. CRP-ratio from D1 to D7 decreased faster in survivors than in non-survivors (p = 0.01). The ability of CRP-ratio by D5 to predict ICU outcome assessed by the area under the ROC curve was 0.73 (95% Confidence Interval, 0.64 - 0.82). By D5, a CRP concentration above 0.5 of the initial level was a marker of poor outcome (sensitivity 0.81, specificity 0.58, positive likelihood ratio 1.93, negative likelihood ratio 0.33). The time-dependent analysis of CRP-ratio of the three patterns (fast response n = 66; slow response n = 81; nonresponse n = 44) was significantly different between groups (p < 0.001). The ICU mortality rate was considerably different according to the patterns of CRP-ratio response: fast response 4.8%, slow response 17.3% and nonresponse 36.4% (p < 0.001). In severe CAP, sequential evaluation of CRP-ratio was useful in the early identification of patients with poor outcome. The evaluation of CRP-ratio pattern of response to antibiotics during the first week of therapy was useful in the recognition of the individual clinical evolution.
Serum C-reactive protein concentrations in healthy Miniature Schnauzer dogs.
Wong, Valerie M; Kidney, Beverly A; Snead, Elisabeth C R; Myers, Sherry L; Jackson, Marion L
2011-09-01
C-reactive protein (CRP) is a sensitive marker for inflammation in people and dogs. In people, an association between CRP concentration and atherosclerosis has been reported. Atherosclerosis is rare in dogs, but the Miniature Schnauzer breed may be at increased risk for developing this vascular disease. It is not known if CRP concentrations in Miniature Schnauzer dogs differ from those in other dog breeds. Our objectives were to validate an automated human CRP assay for measuring CRP in dogs and compare CRP concentrations in healthy Miniature Schnauzer dogs with those in non-Miniature Schnauzer breeds. Sera from 37 non-Miniature Schnauzer dogs with inflammatory disease were pooled and used to validate a human CRP immunoturbidimetric assay for measuring canine CRP. Blood was collected from 20 healthy Miniature Schnauzer dogs and 41 healthy dogs of other breeds. Median serum CRP concentration of healthy Miniature Schnauzer dogs was compared with that of healthy non-Miniature Schnauzer dogs. The human CRP assay measured CRP reliably with linearity between 0 and 20 mg/L. CRP concentration for healthy Miniature Schnauzer dogs (median 4.0 mg/L, minimum-maximum 0-18.2 mg/L) was significantly higher than for the healthy non-Miniature Schnauzer dogs (median 0.1 mg/L, minimum-maximum 0-10.7 mg/L); 17 of the 20 Miniature Schnauzer dogs had values that overlapped with those of the non-Miniature Schnauzer dogs. Median CRP concentration of Miniature Schnauzer dogs was slightly higher than that of other breeds of dogs. A relationship between higher CRP concentration in Miniature Schnauzer dogs and idiopathic hyperlipidemia, pancreatitis, and possible increased risk for atherosclerosis remains to be determined. ©2011 American Society for Veterinary Clinical Pathology.
Huang, Xiaoshuai; Ye, Haihui; Chung, J Sook
2017-08-01
Insulin-like androgenic gland factor (IAG) that is produced by the male androgenic gland (AG), plays a role in sexual differentiation and maintenance of male secondary sex characteristics in decapod crustaceans. With an earlier finding of IAG expression in a female Callinectes sapidus ovary, we aimed to examine a putative role of IAG during the ovarian development of this species. To this end, the full-length cDNA sequence of the ovarian CasIAG (termed CasIAG-ova) has been isolated. The predicted mature peptide sequence of CasIAG-ova is identical to that of the IAG from the AG, except in their signal peptide regions. The CasIAG-ova contains an alternative initiation codon (UUG) as the start codon, which suggests that the translational regulation of CasIAG-ova may differ from that of the IAG from AG. To define the function of CasIAG-ova, the expressions of CasIAG-ova as well as its putative binding protein, insulin-like peptide binding protein (ILPBP), are measured in the ovaries at various developmental stages obtained from different seasons. Season affects both CasIAG and ILPBP expression in the ovary. Overall, summer females at earlier ovarian stages contain high levels of CasIAG and ILPBP than spring or fall females. These findings indicate that CasIAG-ova and CasILPBP may be involved in the ovarian development. When comparing the levels of CasIAG and CasILPBP in the ovary, the latter are much higher (∼10-10000 fold) than the former. Expression patterns of CasILPBP differ from those of CasIAG-ova during ovarian development and by season, suggesting that ILPBP may have an additional role in ovarian development rather than a function of a putative binding protein of IAG. Copyright © 2017 Elsevier Inc. All rights reserved.
Budachetri, Khemraj; Crispell, Gary; Karim, Shahid
2017-09-01
Selenium, a vital trace element, is incorporated into selenoproteins to produce selenocysteine. Our previous studies have revealed an adaptive co-evolutionary process that has enabled the spotted fever-causing tick-borne pathogen Rickettsia parkeri to survive by manipulating an antioxidant defense system associated with selenium, which includes a full set of selenoproteins and other antioxidants in ticks. Here, we conducted a systemic investigation of SECIS binding protein 2 (SBP2) and putative selenoprotein P (SELENOP) by transcript silencing in adult female Gulf-coast ticks (Amblyomma maculatum). Knockdown of the SBP2 and SELENOP genes depleted the respective transcript levels of these tick selenogenes, and caused differential regulation of other antioxidants. Importantly, the selenium level in the immature and mature tick stages increased significantly after a blood meal, but the selenium level decreased in ticks after the SBP2 and SELENOP knockdowns. Moreover, the SBP2 knockdown significantly impaired both transovarial transmission of R. parkeri to tick eggs and egg hatching. Overall, our data offer new insight into the relationship between the SBP2 selenoprotein synthesis gene and the putative tick SELENOP gene. It also augments our understanding of selenoprotein synthesis, selenium maintenance and utilization, and bacterial colonization of a tick vector. Copyright © 2017 Elsevier Ltd. All rights reserved.
Glucocorticoid Regulation of the Vitamin D Receptor
Hidalgo, Alejandro A.; Trump, Donald L.; Johnson, Candace S.
2010-01-01
Many studies indicate calcitriol has potent anti-tumor activity in different types of cancers. However, high levels of vitamin D can produce hypercalcemia in some patients. Glucocorticoids are used to ameliorate hypercalcemia and to enhance calcitriol anti-tumor activity. Calcitriol in combination with the glucocorticoid dexamethasone (Dex) increased vitamin D receptor (VDR) protein levels and ligand binding in squamous cell carcinoma VII (SCC). In this study we found that both calcitriol and Dex induce VDR- and glucocorticoid receptor (GR)-mediated transcription respectively, indicating both hormone receptors are active in SCC. Pre-treatment with Dex increases VDR-mediated transcription at the human CYP24A1 promoter. Whereas, pre-treatment with other steroid hormones, including dihydrotestosterone and R1881, has no effect on VDR-mediated transcription. Real-time PCR indicates treatment with Dex increases Vdr transcripts in a time-dependent manner, suggesting Dex may directly regulate expression of Vdr. Numerous putative glucocorticoid response elements (GREs) were found in the Vdr gene. Chromatin immunoprecipitation (ChIP) assay demonstrated GR binding at several putative GREs located within the mouse Vdr gene. However, none of the putative GREs studied increase GR-mediated transcription in luciferase reporter assays. In an attempt to identify the response element responsible for Vdr transcript regulation, future studies will continue to analyze newly identified GREs more distal from the Vdr gene promoter. PMID:20398752
The human fatty acid-binding protein family: Evolutionary divergences and functions
2011-01-01
Fatty acid-binding proteins (FABPs) are members of the intracellular lipid-binding protein (iLBP) family and are involved in reversibly binding intracellular hydrophobic ligands and trafficking them throughout cellular compartments, including the peroxisomes, mitochondria, endoplasmic reticulum and nucleus. FABPs are small, structurally conserved cytosolic proteins consisting of a water-filled, interior-binding pocket surrounded by ten anti-parallel beta sheets, forming a beta barrel. At the superior surface, two alpha-helices cap the pocket and are thought to regulate binding. FABPs have broad specificity, including the ability to bind long-chain (C16-C20) fatty acids, eicosanoids, bile salts and peroxisome proliferators. FABPs demonstrate strong evolutionary conservation and are present in a spectrum of species including Drosophila melanogaster, Caenorhabditis elegans, mouse and human. The human genome consists of nine putatively functional protein-coding FABP genes. The most recently identified family member, FABP12, has been less studied. PMID:21504868
Prahl, Ulrica; Wikstrand, John; Bergström, Göran M L; Behre, Carl Johan; Hulthe, Johannes; Fagerberg, Björn
2010-11-01
We examined whether high-sensitivity C-reactive protein (hsCRP) ≥2.0 mg/L was associated with increased intima-media thickness (IMT), plaque burden, and plaque echolucency in carotid arteries. Women (n = 635) from a population sample of 64-year-old females with varying degrees of glucose tolerance underwent risk factor assessment, measurement of hsCRP, and ultrasound examinations of the carotid arteries. Participants with hsCRP levels ≥2.0 mg/L had elevated carotid bulb IMT independently of other cardiovascular risk factors compared with those with hsCRP <2.0 mg/L. The participants with plaques in the highhsCRP group had larger total plaque area compared to those with plaque in the lower hsCRP group. Plaque echolucency did not differ between groups. High-sensitivity CRP levels ≥2.0 mg/L were accompanied by elevated IMT in the carotid bulbs independently of other cardiovascular risk factors. Total plaque area was larger among women with plaques in the high hsCRP group versus the lower hsCRP group.
Niederwanger, Michael; Dvorak, Martin; Schnegg, Raimund; Pedrini-Martha, Veronika; Bacher, Katharina; Bidoli, Massimo; Dallinger, Reinhard
2017-08-11
Metallothioneins (MTs) are low-molecular-mass, cysteine-rich, metal binding proteins. In most animal species, they are involved in metal homeostasis and detoxification, and provide protection from oxidative stress. Gastropod MTs are highly diversified, exhibiting unique features and adaptations like metal specificity and multiplications of their metal binding domains. Here, we show that the MT gene of Biomphalaria glabrata , one of the largest MT genes identified so far, is composed in a unique way. The encoding for an MT protein has a three-domain structure and a C-terminal, Cys-rich extension. Using a bioinformatic approach involving structural and in silico analysis of putative transcription factor binding sites (TFBs), we found that this MT gene consists of five exons and four introns. It exhibits a regulatory promoter region containing three metal-responsive elements (MREs) and several TFBs with putative involvement in environmental stress response, and regulation of gene expression. Quantitative real-time polymerase chain reaction (qRT-PCR) data indicate that the MT gene is not inducible by cadmium (Cd) nor by temperature challenges (heat and cold), despite significant Cd uptake within the midgut gland and the high Cd tolerance of metal-exposed snails.
Dvorak, Martin; Schnegg, Raimund; Pedrini-Martha, Veronika; Bacher, Katharina; Bidoli, Massimo; Dallinger, Reinhard
2017-01-01
Metallothioneins (MTs) are low-molecular-mass, cysteine-rich, metal binding proteins. In most animal species, they are involved in metal homeostasis and detoxification, and provide protection from oxidative stress. Gastropod MTs are highly diversified, exhibiting unique features and adaptations like metal specificity and multiplications of their metal binding domains. Here, we show that the MT gene of Biomphalaria glabrata, one of the largest MT genes identified so far, is composed in a unique way. The encoding for an MT protein has a three-domain structure and a C-terminal, Cys-rich extension. Using a bioinformatic approach involving structural and in silico analysis of putative transcription factor binding sites (TFBs), we found that this MT gene consists of five exons and four introns. It exhibits a regulatory promoter region containing three metal-responsive elements (MREs) and several TFBs with putative involvement in environmental stress response, and regulation of gene expression. Quantitative real-time polymerase chain reaction (qRT-PCR) data indicate that the MT gene is not inducible by cadmium (Cd) nor by temperature challenges (heat and cold), despite significant Cd uptake within the midgut gland and the high Cd tolerance of metal-exposed snails. PMID:28800079
The protein network surrounding the human telomere repeat binding factors TRF1, TRF2, and POT1
DOE Office of Scientific and Technical Information (OSTI.GOV)
Giannone, Richard J; McDonald, W Hayes; Hurst, Gregory
Telomere integrity (including telomere length and capping) is critical in overall genomic stability. Telomere repeat binding factors and their associated proteins play vital roles in telomere length regulation and end protection. In this study, we explore the protein network surrounding telomere repeat binding factors, TRF1, TRF2, and POT1 using dual-tag affinity purification in combination with multidimensional protein identification technology liquid chromatography - tandem mass spectrometry (MudPIT LC-MS/MS). After control subtraction and data filtering, we found that TRF2 and POT1 co-purified all six members of the telomere protein complex, while TRF1 identified five of six components at frequencies that lend evidencemore » towards the currently accepted telomere architecture. Many of the known TRF1 or TRF2 interacting proteins were also identified. Moreover, putative associating partners identified for each of the three core components fell into functional categories such as DNA damage repair, ubiquitination, chromosome cohesion, chromatin modification/remodeling, DNA replication, cell cycle and transcription regulation, nucleotide metabolism, RNA processing, and nuclear transport. These putative protein-protein associations may participate in different biological processes at telomeres or, intriguingly, outside telomeres.« less
PPARγ regulates exocrine pancreas lipase.
Danino, Hila; Naor, Ronny Peri-; Fogel, Chen; Ben-Harosh, Yael; Kadir, Rotem; Salem, Hagit; Birk, Ruth
2016-12-01
Pancreatic lipase (triacylglycerol lipase EC 3.1.1.3) is an essential enzyme in hydrolysis of dietary fat. Dietary fat, especially polyunsaturated fatty acids (PUFA), regulate pancreatic lipase (PNLIP); however, the molecular mechanism underlying this regulation is mostly unknown. As PUFA are known to regulate expression of proliferator-activated receptor gamma (PPARγ), and as we identified in-silico putative PPARγ binding sites within the putative PNLIP promoter sequence, we hypothesized that PUFA regulation of PNLIP might be mediated by PPARγ. We used in silico bioinformatics tools, reporter luciferase assay, PPARγ agonists and antagonists, PPARγ overexpression in exocrine pancreas AR42J and primary cells to study PPARγ regulation of PNLIP. Using in silico bioinformatics tools we mapped PPARγ binding sites (PPRE) to the putative promoter region of PNLIP. Reporter luciferase assay in AR42J rat exocrine pancreas acinar cells transfected with various constructs of the putative PNLIP promoter showed that PNLIP transcription is significantly enhanced by PPARγ dose-dependently, reaching maximal levels with multi PPRE sites. This effect was significantly augmented in the presence of PPARγ agonists and reduced by PPARγ antagonists or mutagenesis abrogating PPRE sites. Over-expression of PPARγ significantly elevated PNLIP transcript and protein levels in AR42J cells and in primary pancreas cells. Moreover, PNLIP expression was up-regulated by PPARγ agonists (pioglitazone and 15dPGJ2) and significantly down-regulated by PPARγ antagonists in non-transfected rat exocrine pancreas AR42J cell line cells. PPARγ transcriptionally regulates PNLIP gene expression. This transcript regulation resolves part of the missing link between dietary PUFA direct regulation of PNLIP. Copyright © 2016 Elsevier B.V. All rights reserved.
Cui, Wei; Hawley, R. Scott
2005-01-01
Nod is a chromokinesin-like protein that plays a critical role in segregating achiasmate chromosomes during female meiosis. The C-terminal half of the Nod protein contains two putative DNA-binding domains. The first of these domains, known as the HMGN domain, consists of three tandemly repeated high-mobility group N motifs. This domain was previously shown to be both necessary and sufficient for binding of the C-terminal half of Nod to mitotic chromosomes in embryos. The second putative DNA-binding domain, denoted HhH(2)/NDD, is a helix-hairpin-helix(2)/Nod-like DNA-binding domain. Although the HhH(2)/NDD domain is not required or sufficient for chromosome binding in embryos, several well-characterized nod mutations have been mapped in this domain. To characterize the role of the HhH(2)/NDD domain in mediating Nod function, we created a series of UAS-driven transgene constructs capable of expressing either a wild-type Nod-GFP fusion protein or proteins in which the HhH(2)/NDD domain had been altered by site-directed mutagenesis. Although wild-type Nod-GFP localizes to the oocyte chromosomes and rescues the segregation defect in nod mutant oocytes, two of three proteins carrying mutants in the HhH(2)/NDD domain fail to either rescue the nod mutant phenotype or bind to oocyte chromosomes. However, these mutant proteins do bind to the polytene chromosomes in nurse-cell nuclei and enter the oocyte nucleus. Thus, even though the HhH(2)/NDD domain is not essential for chromosome binding in other cell types, it is required for chromosome binding in the oocyte. These HhH(2)/NDD mutants also block the localization of Nod to the posterior pole of stage 9–10A oocytes, a process that is thought to facilitate the interaction of Nod with the plus ends of microtubules (Cui et al. 2005). This observation suggests that the Nod HhH2/NDD domain may play other roles in addition to binding Nod to meiotic chromosomes. PMID:16143607
C-reactive protein as a marker of melanoma progression.
Fang, Shenying; Wang, Yuling; Sui, Dawen; Liu, Huey; Ross, Merrick I; Gershenwald, Jeffrey E; Cormier, Janice N; Royal, Richard E; Lucci, Anthony; Schacherer, Christopher W; Gardner, Julie M; Reveille, John D; Bassett, Roland L; Wang, Li-E; Wei, Qingyi; Amos, Christopher I; Lee, Jeffrey E
2015-04-20
To investigate the association between blood levels of C-reactive protein (CRP) in patients with melanoma and overall survival (OS), melanoma-specific survival (MSS), and disease-free survival. Two independent sets of plasma samples from a total of 1,144 patients with melanoma (587 initial and 557 confirmatory) were available for CRP determination. Kaplan-Meier method and Cox regression were used to evaluate the relationship between CRP and clinical outcome. Among 115 patients who underwent sequential blood draws, we evaluated the relationship between change in disease status and change in CRP using nonparametric tests. Elevated CRP level was associated with poorer OS and MSS in the initial, confirmatory, and combined data sets (combined data set: OS hazard ratio, 1.44 per unit increase of logarithmic CRP; 95% CI, 1.30 to 1.59; P < .001; MSS hazard ratio, 1.51 per unit increase of logarithmic CRP; 95% CI, 1.36 to 1.68; P < .001). These findings persisted after multivariable adjustment. As compared with CRP < 10 mg/L, CRP ≥ 10 mg/L conferred poorer OS in patients with any-stage, stage I/II, or stage III/IV disease and poorer disease-free survival in those with stage I/II disease. In patients who underwent sequential evaluation of CRP, an association was identified between an increase in CRP and melanoma disease progression. CRP is an independent prognostic marker in patients with melanoma. CRP measurement should be considered for incorporation into prospective studies of outcome in patients with melanoma and clinical trials of systemic therapies for those with melanoma. © 2015 by American Society of Clinical Oncology.
C-Reactive Protein As a Marker of Melanoma Progression
Fang, Shenying; Wang, Yuling; Sui, Dawen; Liu, Huey; Ross, Merrick I.; Gershenwald, Jeffrey E.; Cormier, Janice N.; Royal, Richard E.; Lucci, Anthony; Schacherer, Christopher W.; Gardner, Julie M.; Reveille, John D.; Bassett, Roland L.; Wang, Li-E; Wei, Qingyi; Amos, Christopher I.; Lee, Jeffrey E.
2015-01-01
Purpose To investigate the association between blood levels of C-reactive protein (CRP) in patients with melanoma and overall survival (OS), melanoma-specific survival (MSS), and disease-free survival. Patients and Methods Two independent sets of plasma samples from a total of 1,144 patients with melanoma (587 initial and 557 confirmatory) were available for CRP determination. Kaplan-Meier method and Cox regression were used to evaluate the relationship between CRP and clinical outcome. Among 115 patients who underwent sequential blood draws, we evaluated the relationship between change in disease status and change in CRP using nonparametric tests. Results Elevated CRP level was associated with poorer OS and MSS in the initial, confirmatory, and combined data sets (combined data set: OS hazard ratio, 1.44 per unit increase of logarithmic CRP; 95% CI, 1.30 to 1.59; P < .001; MSS hazard ratio, 1.51 per unit increase of logarithmic CRP; 95% CI, 1.36 to 1.68; P < .001). These findings persisted after multivariable adjustment. As compared with CRP < 10 mg/L, CRP ≥ 10 mg/L conferred poorer OS in patients with any-stage, stage I/II, or stage III/IV disease and poorer disease-free survival in those with stage I/II disease. In patients who underwent sequential evaluation of CRP, an association was identified between an increase in CRP and melanoma disease progression. Conclusion CRP is an independent prognostic marker in patients with melanoma. CRP measurement should be considered for incorporation into prospective studies of outcome in patients with melanoma and clinical trials of systemic therapies for those with melanoma. PMID:25779565
Metallated DNA Aptamers for Prostate Cancer Treatment
2013-03-01
minor groove while the new 320 nm maxima reflect the binding of N-methyl pyrrole moieties of netropsin in the minor groove of 3’FdU.(Zimmer, Marck...resonance assignment and those consistent with the pyrrole 1 H resonances of netropsin (Fig. 3). NOESY crosspeaks from FdU imino 1 H to putative...computational chemistry data from our laboratory and with netropsin binding in the minor groove based upon NOE data from pyrrole 1 H of netropsin and
Diagnostic properties of C-reactive protein for detecting pneumonia in children.
Koster, Madieke J; Broekhuizen, Berna D L; Minnaard, Margaretha C; Balemans, Walter A F; Hopstaken, Rogier M; de Jong, Pim A; Verheij, Theo J M
2013-07-01
The diagnostic value of C-reactive protein (CRP) level for pneumonia in children is unknown. As a first step in the assessment of the value of CRP, a diagnostic study was performed in children at an emergency department (ED). In this cross-sectional study, data were retrospectively collected from children presenting with suspected pneumonia at the ED of Antonius Hospital Nieuwegein in The Netherlands between January 2007 and January 2012. Diagnostic outcome was pneumonia yes/no according to independent radiologist. (Un)adjusted association between CRP level and pneumonia and diagnostic value of CRP were calculated. Of 687 presenting children, 286 underwent both CRP measurement and chest radiography. 148 had pneumonia (52%). The proportion of pneumonia increased with CRP level. Negative predictive values declined, but positive predictive values increased with higher CRP thresholds. Univariable odds ratio for the association between CRP level and pneumonia was 1.2 (95% CI 1.11-1.21) per 10 mg/L increase. After adjustment for baseline characteristics CRP level remained associated with pneumonia. CRP level has independent diagnostic value for pneumonia in children presenting at the ED with suspected pneumonia, but low levels do not exclude pneumonia in this setting. These results prompt evaluation of CRP in primary care children with LRTI. Copyright © 2013 Elsevier Ltd. All rights reserved.
Is C-reactive protein a marker of obstructive sleep apnea?
Li, Kun; Wei, Peng; Qin, Yanwen; Wei, Yongxiang
2017-01-01
Abstract Background: Obstructive sleep apnea (OSA) is a common disease, distinguished by recurrent episodes of upper airway obstruction during sleep, with an inflammatory component. C-reactive protein (CRP) and high-sensitivity C-reactive protein (hs-CRP) are markers of systemic inflammation and may serve as biomarkers of OSA. Methods: Scientific studies published from January 1, 2006, to January 1, 2016 were obtained via searches of PubMed, Embase, SCI, and China National Knowledge Internet (CNKI) using relevant terms. Studies concerning serum CRP level/ hs-CRP in OSA patients were reviewed by 2 independent reviewers. Studies were included if they conform with our specific criteria of inclusion. Eligible studies were subjected to quality review, data extraction, and meta-analysis by using RevMan (version 5.2) and STATA (version 12.0). Results: There were 15 studies that met inclusion criteria that included a total of 1297 subjects. Meta-analysis revealed that serum CRP levels in the OSA group were 1.98 mmol/L higher than those in control group (95% confidence interval: 1.39–2.58, P < .01). Similarly, serum hs-CRP levels in the OSA group were 1.57 mmol/L higher than that in the control group (95% confidence interval: 0.96–2.18, P < .01). Subgroup analysis showed greater differences between OSA patients and controls in the setting of obesity (body mass index)> = 30. The total weighted mean difference (WMD) between OSA and controls within the subgroup of subjects who had a CRP was 2.10; for hs-CRP, the WMD was 2.49. Comparing OSA patients of mean apnea hypopnea index> = 15 and controls, the total WMD for the CRP subgroup was 2.19; for the hs-CRP subgroup, the WMD was 1.70. Conclusion: In our meta-analysis, serum CRP/hs-CRP levels were discovered to be higher in OSA patients compared with control subjects. Those with higher body mass index and apnea hyponea index demonstrated larger differences in CRP/hs-CRP levels. These data are consistent with an inflammatory component of OSA pathophysiology and support the role of CRP/hs-CRP as a biomarker in this disease. PMID:28489776
Mabrouk, T; Lemay, G
1994-01-01
It has been demonstrated that the sigma 3 protein of reovirus harbors a zinc-binding domain in its amino-terminal portion. A putative zinc finger in the CCHH form is located in this domain and was considered to be a good candidate for the zinc-binding motif. We performed site-directed mutagenesis to substitute amino acids in this region and demonstrated that many of these mutants, although expressed in COS cells, were unstable compared with the wild-type protein. Further analysis revealed that zinc-binding capability, as measured by retention on a zinc chelate affinity adsorbent, correlates with stability. These studies also allowed us to identify a CCHC box as the most probable zinc-binding motif. Images PMID:8035527
7 CFR 1410.53 - Executed CRP contract not in conformity with regulations.
Code of Federal Regulations, 2010 CFR
2010-01-01
... 7 Agriculture 10 2010-01-01 2010-01-01 false Executed CRP contract not in conformity with... RESERVE PROGRAM § 1410.53 Executed CRP contract not in conformity with regulations. If, after a CRP contract is approved by CCC, it is discovered that such CRP contract is found to contain material errors of...
Wright, J F; Pernollet, M; Reboul, A; Aude, C; Colomb, M G
1992-05-05
Tetanus toxin was shown to contain a metal-binding site for zinc and copper. Equilibrium dialysis binding experiments using 65Zn indicated an association constant of 9-15 microM, with one zinc-binding site/toxin molecule. The zinc-binding site was localized to the toxin light chain as determined by binding of 65Zn to the light chain but not to the heavy chain after separation by sodium dodecyl sulfate-polyacrylamide gel electrophoresis and transfer to Immobilon membranes. Copper was an efficient inhibitor of 65Zn binding to tetanus toxin and caused two peptide bond cleavages in the toxin light chain in the presence of ascorbate. These metal-catalyzed oxidative cleavages were inhibited by the presence of zinc. Partial characterization of metal-catalyzed oxidative modifications of a peptide based on a putative metal-binding site (HELIH) in the toxin light chain was used to map the metal-binding site in the protein.
Ceelie, H; Spaargaren-Van Riel, C C; De Jong, M; Bertina, R M; Vos, H L
2003-08-01
Prothrombin is a key component in blood coagulation. Overexpression of prothrombin leads to an increased risk of venous thrombosis. Therefore, the study of the transcriptional regulation of the prothrombin gene may help to identify mechanisms of overexpression. The aim of our study was to localize the regions within the prothrombin enhancer responsible for its activity, to identify the proteins binding to these regions, and to establish their functional importance. We constructed a set of prothrombin promoter 5' deletion constructs containing the firefly luciferase reporter gene, which were transiently transfected in HepG2, HuH7 and HeLa cells. Putative transcription factor (TF) binding sites were evaluated by electrophoretic mobility shift assays. The functional importance of each TF binding site was evaluated by site directed mutagenesis and transient transfection of the mutant constructs. We confirmed the major contribution of the enhancer region to the transcriptional activity of the prothrombin promoter. Analysis of this region revealed putative binding sites for hepatocyte nuclear factor HNF4, HNF3-beta and specificity protein(Sp)1. We identified six different TFs binding to three evolutionary conserved sites in the enhancer: HNF4-alpha (site 1), HNF1-alpha, HNF3-beta and an as yet unidentified TF (site 2) and the ubiquitously expressed TFs Sp1 and Sp3 (site 3). Mutagenesis studies showed that loss of binding of HNF3-beta resulted in a considerable decrease of enhancer activity, whereas loss of HNF4-alpha or Sp1/Sp3 resulted in milder reductions. The prothrombin enhancer plays a major role in regulation of prothrombin expression. Six different TFs are able to bind to this region. At least three of these TFs, HNF4-alpha, HNF3-beta and Sp1/Sp3, are important in regulation of prothrombin expression.
González-Fernández, Doris; Pons, Emérita Del Carmen; Rueda, Delfina; Sinisterra, Odalis Teresa; Murillo, Enrique; Scott, Marilyn E; Koski, Kristine G
2017-06-02
The usefulness of C-reactive protein (CRP) as a non-specific marker of inflammation during pregnancy and lactation is unclear in impoverished populations where co-existing infections and vitamin deficiencies are common. This cross-sectional study in Panama recruited 120 pregnant and 99 lactating Ngäbe-Buglé women from 14 communities in rural Panama. Obstetric history, indoor wood smoke exposure, fieldwork, BMI, vitamins A, B 12 , D, and folic acid, and inflammation markers (CRP, neutrophil/lymphocyte ratio (NLR), plateletcrit and cytokines) were measured. Multiple regressions explored both associations of CRP with other inflammatory markers and associations of CRP and elevated CRP based on trimester-specific cut-offs with maternal factors, infections and vitamin deficiencies. CRP was higher in pregnancy (51.4 ± 4.7 nmol/L) than lactation (27.8 ± 3.5 nmol/L) and was elevated above trimester specific cut-offs in 21% of pregnant and 30% of lactating women. Vitamin deficiencies were common (vitamin A 29.6%; vitamin D 68.5%; vitamin B 12 68%; folic acid 25.5%) and over 50% of women had two or more concurrent deficiencies as well as multiple infections. Multiple regression models highlighted differences in variables associated with CRP between pregnancy and lactation. In pregnancy, CRP was positively associated with greater indoor wood smoke exposure, caries and hookworm and negatively associated with Ascaris and vaginal Lactobacillus and Bacteroides/Gardnerella scores. Consistent with this, greater wood smoke exposure, caries as well as higher diplococcal infection score increased the odds of trimester-elevated CRP concentrations whereas longer gestational age lowered the likelihood of a trimester-elevated CRP. During lactation, folic acid deficiency was associated with higher CRP whereas parity, number of eosinophils and Mobiluncus score were associated with lower CRP. Also, a higher BMI and Trichomonas vaginalis score increased the likelihood of an elevated CRP whereas higher parity and number of eosinophils were associated with lower likelihood of an elevated CRP. Infections both raise and lower CRP concentrations in pregnant and lactating mothers. Only folic acid deficiency during lactation was associated with higher CRP concentrations. Caution is required when interpreting CRP concentrations in pregnant and lactating women who have co-existing nutrient deficiencies and multiple infections.
Chen, Yan; Carrington-Lawrence, Stacy D.; Bai, Ping; Weller, Sandra K.
2005-01-01
Herpes simplex virus type 1 (HSV-1) encodes a heterotrimeric helicase-primase (UL5/8/52) complex. UL5 contains seven motifs found in helicase superfamily 1, and UL52 contains conserved motifs found in primases. The contributions of each subunit to the biochemical activities of the complex, however, remain unclear. We have previously demonstrated that a mutation in the putative zinc finger at UL52 C terminus abrogates not only primase but also ATPase, helicase, and DNA-binding activities of a UL5/UL52 subcomplex, indicating a complex interdependence between the two subunits. To test this hypothesis and to further investigate the role of the zinc finger in the enzymatic activities of the helicase-primase, a series of mutations were constructed in this motif. They differed in their ability to complement a UL52 null virus: totally defective, partial complementation, and potentiating. In this study, four of these mutants were studied biochemically after expression and purification from insect cells infected with recombinant baculoviruses. All mutants show greatly reduced primase activity. Complementation-defective mutants exhibited severe defects in ATPase, helicase, and DNA-binding activities. Partially complementing mutants displayed intermediate levels of these activities, except that one showed a wild-type level of helicase activity. These data suggest that the UL52 zinc finger motif plays an important role in the activities of the helicase-primase complex. The observation that mutations in UL52 affected helicase, ATPase, and DNA-binding activities indicates that UL52 binding to DNA via the zinc finger may be necessary for loading UL5. Alternatively, UL5 and UL52 may share a DNA-binding interface. PMID:15994803
Chen, Yan; Carrington-Lawrence, Stacy D; Bai, Ping; Weller, Sandra K
2005-07-01
Herpes simplex virus type 1 (HSV-1) encodes a heterotrimeric helicase-primase (UL5/8/52) complex. UL5 contains seven motifs found in helicase superfamily 1, and UL52 contains conserved motifs found in primases. The contributions of each subunit to the biochemical activities of the complex, however, remain unclear. We have previously demonstrated that a mutation in the putative zinc finger at UL52 C terminus abrogates not only primase but also ATPase, helicase, and DNA-binding activities of a UL5/UL52 subcomplex, indicating a complex interdependence between the two subunits. To test this hypothesis and to further investigate the role of the zinc finger in the enzymatic activities of the helicase-primase, a series of mutations were constructed in this motif. They differed in their ability to complement a UL52 null virus: totally defective, partial complementation, and potentiating. In this study, four of these mutants were studied biochemically after expression and purification from insect cells infected with recombinant baculoviruses. All mutants show greatly reduced primase activity. Complementation-defective mutants exhibited severe defects in ATPase, helicase, and DNA-binding activities. Partially complementing mutants displayed intermediate levels of these activities, except that one showed a wild-type level of helicase activity. These data suggest that the UL52 zinc finger motif plays an important role in the activities of the helicase-primase complex. The observation that mutations in UL52 affected helicase, ATPase, and DNA-binding activities indicates that UL52 binding to DNA via the zinc finger may be necessary for loading UL5. Alternatively, UL5 and UL52 may share a DNA-binding interface.
Terentiev, Alexander A; Moldogazieva, Nurbubu T; Levtsova, Olga V; Maximenko, Dmitry M; Borozdenko, Denis A; Shaitan, Konstantin V
2012-04-01
It has been long experimentally demonstrated that human alpha-fetoprotein (HAFP) has an ability to bind immobilized estrogens with the most efficiency for synthetic estrogen analog - diethylstilbestrol (DES). However, the question remains why the human AFP (HAFP), unlike rodent AFP, cannot bind free estrogens. Moreover, despite the fact that AFP was first discovered more than 50 years ago and is presently recognized as a "golden standard" among onco-biomarkers, its three-dimensional (3D) structure has not been experimentally solved yet. In this work using MODELLER program, we generated 3D model of HAFP on the basis of homology with human serum albumin (HSA) and Vitamin D-binding protein (VTDB) with subsequent molecular docking of DES to the model structure and molecular dynamics (MD) simulation study of the complex obtained. The model constructed has U-shaped structure in which a cavity may be distinguished. In this cavity the putative estrogen-binding site is localized. Validation by RMSD calculation and with the use of PROCHECK program showed good quality of the model and stability of extended region of four alpha-helical structures that contains putative hormone-binding residues. Data extracted from MD simulation trajectory allow proposing two types of interactions between amino acid residues of HAFP and DES molecule: (1) hydrogen bonding with involvement of residues S445, R452, and E551; (2) hydrophobic interactions with participation of L138, M448, and M548 residues. A suggestion is made that immobilization of the hormone using a long spacer provides delivery of the estrogen molecule to the binding site and, thereby, facilitates interaction between HAFP and the hormone.
7 CFR 623.6 - Transfer of lands from the CRP to the EWRP.
Code of Federal Regulations, 2010 CFR
2010-01-01
... 7 Agriculture 6 2010-01-01 2010-01-01 false Transfer of lands from the CRP to the EWRP. 623.6... Transfer of lands from the CRP to the EWRP. Land that is subject to an existing CRP contract administered... requested by the owner and approved by CCC, the CRP contract for the property will be terminated or...
Yoshida, Naoto; Shimura, Hanako; Masuta, Chikara
2018-06-01
Allexiviruses are economically important garlic viruses that are involved in garlic mosaic diseases. In this study, we characterized the allexivirus cysteine-rich protein (CRP) gene located just downstream of the coat protein (CP) gene in the viral genome. We determined the nucleotide sequences of the CP and CRP genes from numerous allexivirus isolates and performed a phylogenetic analysis. According to the resulting phylogenetic tree, we found that allexiviruses were clearly divided into two major groups (group I and group II) based on the sequences of the CP and CRP genes. In addition, the allexiviruses in group II had distinct sequences just before the CRP gene, while group I isolates did not. The inserted sequence between the CP and CRP genes was partially complementary to garlic 18S rRNA. Using a potato virus X vector, we showed that the CRPs affected viral accumulation and symptom induction in Nicotiana benthamiana, suggesting that the allexivirus CRP is a pathogenicity determinant. We assume that the inserted sequences before the CRP gene may have been generated during viral evolution to alter the termination-reinitiation mechanism for coupled translation of CP and CRP.
Jamshidpour, Boshra; Moghadam, Behrouz Attarbashi; Vasaghi-Gharamaleki, Behnoosh; Mirzaii-Dizgah, Iraj; Nejatian, Mostafa
2013-09-01
Cardiac rehabilitation is a key part in the treatment of coronary artery disease (CAD) by its anti-infammatory effects. However, the effect of exercise training programs on salivary concentrations of high-sensitivity C-reactive protein (hs-CRP) in patients with coronary artery disease has not been well studied. The objective of this study was to evaluate the effect of phase III cardiac rehabilitation on serum and salivary levels of hs-CRP, in relation to the anthropometric measurements of obesity and the relationship between salivary and serum levels of hs-CRP in CAD male patients. Forty male volunteers (45-75 years) with CAD participated in 6 to 8 weeks of moderate intensity aerobic exercise training consisting of 45 minutes sessions of treadmill, stationary bicycle and arm ergometer. Anthropometric measurements of obesity, serum level of hs-CRP, stimulated and nonstimulated salivary level of hs-CRP were measured at the beginning, in the middle and at the end of exercise sessions. All anthropometric measurements increased (p < 0.05) following cardiac rehabilitation except waist-hip ratio. Serum hs-CRP level reduced by 36% independent to the anthropometric measurements changes. Stimulated and nonstimulated salivary hs-CRP level decreased 68 and 54%, respectively, after 24 sessions of cardiac rehabilitation. Nonstimulated salivary hs-CRP levels correlated to serum levels of hs-CRP at baseline and after 24 sessions (p < 0.05). Phase III cardiac rehabilitation seems to be effective to improve serum and salivary hs-CRP concentrations independent of anthropometric measurements. Nonstimulated salivary hs-CRP measurement could be a surrogate for blood measurement of hs-CRP during cardiac rehabilitation in male patients with CAD.
Predictive value of C-reactive protein/albumin ratio in acute pancreatitis.
Kaplan, Mustafa; Ates, Ihsan; Akpinar, Muhammed Yener; Yuksel, Mahmut; Kuzu, Ufuk Baris; Kacar, Sabite; Coskun, Orhan; Kayacetin, Ertugrul
2017-08-15
Serum C-reactive protein (CRP) increases and albumin decreases in patients with inflammation and infection. However, their role in patients with acute pancreatitis is not clear. The present study was to investigate the predictive significance of the CRP/albumin ratio for the prognosis and mortality in acute pancreatitis patients. This study was performed retrospectively with 192 acute pancreatitis patients between January 2002 and June 2015. Ranson scores, Atlanta classification and CRP/albumin ratios of the patients were calculated. The CRP/albumin ratio was higher in deceased patients compared to survivors. The CRP/albumin ratio was positively correlated with Ranson score and Atlanta classification in particular and with important prognostic markers such as hospitalization time, CRP and erythrocyte sedimentation rate. In addition to the CRP/albumin ratio, necrotizing pancreatitis type, moderately severe and severe Atlanta classification, and total Ranson score were independent risk factors of mortality. It was found that an increase of 1 unit in the CRP/albumin ratio resulted in an increase of 1.52 times in mortality risk. A prediction value about CRP/albumin ratio >16.28 was found to be a significant marker in predicting mortality with 92.1% sensitivity and 58.0% specificity. It was seen that Ranson and Atlanta classification were higher in patients with CRP/albumin ratio >16.28 compared with those with CRP/albumin ratio ≤16.28. Patients with CRP/albumin ratio >16.28 had a 19.3 times higher chance of death. The CRP/albumin ratio is a novel but promising, easy-to-measure, repeatable, non-invasive inflammation-based prognostic score in acute pancreatitis. Copyright © 2017 The Editorial Board of Hepatobiliary & Pancreatic Diseases International. Published by Elsevier B.V. All rights reserved.
Shadyab, A H; Terkeltaub, R; Kooperberg, C; Reiner, A; Eaton, C B; Jackson, R D; Krok-Schoen, J L; Salem, R M; LaCroix, A Z
2018-05-22
To examine associations of high-sensitivity C-reactive protein (CRP) levels and polygenic CRP genetic risk scores (GRS) with risk of end-stage hip or knee osteoarthritis (OA), defined as incident total hip (THR) or knee replacement (TKR) for OA. This study included a cohort of postmenopausal white, African American, and Hispanic women from the Women's Health Initiative. Women were followed from baseline to date of THR or TKR, death, or December 31, 2014. Medicare claims data identified THR and TKR. Hs-CRP and genotyping data were collected at baseline. Three CRP GRS were constructed: 1) a 4-SNP GRS comprised of genetic variants representing variation in the CRP gene among European populations; 2) a multilocus 18-SNP GRS of genetic variants significantly associated with CRP levels in a meta-analysis of genome-wide association studies; and 3) a 5-SNP GRS of genetic variants significantly associated with CRP levels among African American women. In analyses conducted separately among each race and ethnic group, there were no significant associations of ln hs-CRP with risk of THR or TKR, after adjusting for age, body mass index, lifestyle characteristics, chronic diseases, hormone therapy use, and non-steroidal anti-inflammatory drug use. CRP GRS were not associated with risk of THR or TKR in any ethnic group. Serum levels of ln hs-CRP and genetically-predicted CRP levels were not associated with risk of THR or TKR for OA among a diverse cohort of women. Copyright © 2018 Osteoarthritis Research Society International. Published by Elsevier Ltd. All rights reserved.
Andersen, Stine Bang; Baunbæk Egelund, Gertrud; Jensen, Andreas Vestergaard; Petersen, Pelle Trier; Rohde, Gernot; Ravn, Pernille
2017-04-01
C-reactive protein (CRP) is a well-known acute phase protein used to monitor the patient's response during treatment in infectious diseases. Mortality from Community-acquired Pneumonia (CAP) remains high, particularly in hospitalized patients. Better risk prediction during hospitalization could improve management and ultimately reduce mortality levels. The aim of this study was to evaluate CRP on the 3rd day (CRP3) of hospitalization as a predictor for 30 days mortality. A retrospective multicentre cohort study of adult patients admitted with CAP at three Danish hospitals. Predictive associations of CRP3 (absolute levels and relative decline) and 30 days mortality were analysed using receiver operating characteristics and logistic regression. Eight hundred and fourteen patients were included and 90 (11%) died within 30 days. The area under the curve for CRP3 level and decline for predicting 30 days mortality were 0.64 (0.57-0.70) and 0.71 (0.65-0.76). Risk of death was increased in patients with CRP3 level >75 mg/l (OR 2.44; 95%CI 1.36-4.37) and in patients with a CRP3 decline <50% (OR 4.25; 95%CI 2.30-7.83). In the multivariate analysis, the highest mortality risk was seen in patients who failed to decline by 50%, irrespective of the actual level of CRP (OR 7.8; 95%CI 3.2-19.3). Mortality risk increased significantly according to CRP decline for all strata of CURB-65 score. CRP responses day 3 is a valuable predictor of 30 days mortality in hospitalized CAP patients. Failure to decline in CRP was associated with a poor prognosis irrespective of the actual level of CRP or CURB-65.
Kamalakaran, Sitharthan; Radhakrishnan, Senthil K; Beck, William T
2005-06-03
We developed a pipeline to identify novel genes regulated by the steroid hormone-dependent transcription factor, estrogen receptor, through a systematic analysis of upstream regions of all human and mouse genes. We built a data base of putative promoter regions for 23,077 human and 19,984 mouse transcripts from National Center for Biotechnology Information annotation and 8793 human and 6785 mouse promoters from the Data Base of Transcriptional Start Sites. We used this data base of putative promoters to identify potential targets of estrogen receptor by identifying estrogen response elements (EREs) in their promoters. Our program correctly identified EREs in genes known to be regulated by estrogen in addition to several new genes whose putative promoters contained EREs. We validated six genes (KIAA1243, NRIP1, MADH9, NME3, TPD52L, and ABCG2) to be estrogen-responsive in MCF7 cells using reverse transcription PCR. To allow for extensibility of our program in identifying targets of other transcription factors, we have built a Web interface to access our data base and programs. Our Web-based program for Promoter Analysis of Genome, PAGen@UIC, allows a user to identify putative target genes for vertebrate transcription factors through the analysis of their upstream sequences. The interface allows the user to search the human and mouse promoter data bases for potential target genes containing one or more listed transcription factor binding sites (TFBSs) in their upstream elements, using either regular expression-based consensus or position weight matrices. The data base can also be searched for promoters harboring user-defined TFBSs given as a consensus or a position weight matrix. Furthermore, the user can retrieve putative promoter sequences for any given gene together with identified TFBSs located on its promoter. Orthologous promoters are also analyzed to determine conserved elements.
Impact of the Conservation Reserve Program on duck recruitment in the U.S. Prairie Pothole Region
Reynolds, Ronald E.; Shaffer, Terry L.; Renner, Randy W.; Newton, Wesley E.; Batt, Bruce D.J.
2001-01-01
The U.S. Department of Agriculture (USDA)'s Conservation Reserve Program (CRP) resulted in the conversion of about 1.9 million ha of cropland to perennial grass cover in the Prairie Pothole Region of North Dakota, South Dakota, and northeastern Montana by 1992. Many wildlife managers believed this cover would provide benefits to wildlife, including upland nesting ducks. During 1992-1995, we evaluated success of 5 duck species nesting in CRP fields and nearby Waterfowl Production Areas (WPA) throughout the region. We examined relationships between daily survival rates (DSR) of duck nests in CRP cover and landscape-level habitat and population parameters. We computed DSR of duck nests in other major cover types in our study area from data collected during 1980-1984 (pre-CRP) and 1990-1994 (CRP) periods. We then applied recruitment models to estimate duck production in our study area during peak CRP years (1992-1997) and compared these results with those that simulated the scenario in which cropland was in place of CRP cover (i.e., the CRP had not occurred). DSR were higher in all habitats combined during the CRP period compared to the pre-CRP period. Regressions of DSR in CRP cover on the percent of each study plot in perennial cover and geographic location were significant (P < 0.01) for 4 of 5 duck (Anas spp.) species. Estimated nest success and recruitment rates for the 5 species combined during 1992-1997 were 46% and 30% higher, respectively, with CRP cover on the landscape compared to a scenario where we simulated cropland in place of CRP. Our model estimated an additional 12.4 million recruits from our study area to the fall flight as a consequence of the CRP during 1992-1997. Our results document benefits to 5 duck species in the northern plains associated with a farm program that provided financial incentives to landowners for planting undisturbed grass cover as an alternative to annual crops.
Parchim, Nicholas F; Wang, Wei; Iriyama, Takayuki; Ashimi, Olaide A; Siddiqui, Athar H; Blackwell, Sean; Sibai, Baha; Kellems, Rodney E; Xia, Yang
2015-02-01
C-reactive protein (CRP), an innate immune mediator, is elevated in the circulation before symptoms in patients with preeclampsia, a severe hypertensive pregnancy disorder with high mortality and morbidity. However, the specific sources underlying increased CRP and the role of elevated CRP in preeclampsia are undefined. Here, we report that circulating CRP levels are significantly increased in a large cohort of normotensive pregnant individuals when compared with nulligravid women and is further increased in patients with preeclampsia. These findings led us to discover further that placental syncytiotrophoblasts are previously unrecognized cellular sources of CRP and underlie elevated CRP in normotensive pregnant women and the additional increase in patients with preeclampsia. Next, we demonstrated that injection of CRP induces preeclampsia features, including hypertension (157 mm Hg CRP treated versus 119 mm Hg control), proteinuria (35.0 mg/μg CRP treated versus 14.1 mg/μg control), kidney, and placental damage and increased levels of sFlt-1 in pregnant mice but not in nonpregnant mice. Our study implicates that phosphocholine transferase, a placental-specific enzyme post-translationally modifying neurokinin B, is essential for the pathogenic role of CRP in preeclampsia through activation of the neurokinin 3 receptor. Overall, our studies have provided significant new insight on the pathogenic role of CRP in preeclampsia and highlighted innovative therapeutic strategies. © 2014 American Heart Association, Inc.
Janik, Stefan; Bekos, Christine; Hacker, Philipp; Raunegger, Thomas; Ghanim, Bahil; Einwallner, Elisa; Beer, Lucian; Klepetko, Walter; Müllauer, Leonhard; Ankersmit, Hendrik J.; Moser, Bernhard
2017-01-01
Objective Scarce information exists on the pathogenesis of thymic epithelial tumors (TETs), comprising thymomas, thymic carcinomas (TCs) and neuroendocrine tumors. C-reactive protein (CRP) increases during certain malignancies. We aimed to investigate the clinical relevance of CRP in patients with TETs. Results Pretreatment CRP serum concentrations were significantly elevated in patients with TETs, particularly TCs and metastatic TETs. After complete tumor resection CRP serum concentrations were decreased (p = 0.135) but increased significantly in case of tumor recurrence (p = 0.001). High pretreatment CRP was associated with significantly worse 5- and 10-year freedom-from recurrence (FFR) (p = 0.010) and was a negative prognostic factor for FFR (HR 3.30; p = 0.015). IL-6 (not IL-1β) serum concentrations were significantly elevated in patients with TETs but we did not detect CRP tissue expression in TETs. Materials and Methods Pretreatment CRP serum concentrations were retrospectively analyzed from 128 surgical patients (1990–2015). In a subset of 68 patients longitudinal analysis of CRP was performed. Additionally, immunohistochemical tumor CRP expression and serum concentrations of interleukin (IL)-6 and IL-1β were measured. Conclusions Hence, diagnostic measurement of serum CRP might be useful to indicate highly aggressive TETs and to make doctors consider tumor recurrences during oncological follow-up. PMID:28514756
A systematic review and meta-analyses on C-reactive protein in relation to periodontitis.
Paraskevas, Spiros; Huizinga, John D; Loos, Bruno G
2008-04-01
Elevated plasma C-reactive protein (CRP) is regarded as a risk predictor for cardiovascular diseases. This systematic review explored the robustness of observations that CRP is elevated in periodontitis. Similarly, the effect of periodontal therapy on CRP levels was investigated. Selection of publications was based on: (1) cross-sectional (case-control) studies; (2) longitudinal (treatment) studies; (3) high-sensitivity CRP measurement; (4) median and/or mean (+/-SD) values presented; and (5) subjects with no systemic disorders. Screening of the initially 448 identified studies and reference checking resulted in 18 suitable papers. The majority of the studies showed that CRP levels are higher in patients than in controls. Often, studies showed that patients had CRP levels >2.1 mg/l. A meta-analysis of 10 cross-sectional studies showed that the weighted mean difference (WMD) of CRP between patients and controls was 1.56 mg/l (p<0.00001). Evidence from available treatment studies (n=6) showed lower levels of CRP after periodontal therapy. Eligible treatment studies in a meta-analysis demonstrated a WMD of reductions of CRP after therapy of 0.50 mg/L (95% CI 0.08-0.93) (p=0.02). There is strong evidence from cross-sectional studies that plasma CRP in periodontitis is elevated compared with controls. There is modest evidence on the effect of periodontal therapy in lowering the levels of CRP.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Seppala, Susanna; Solomon, Kevin V.; Gilmore, Sean P.
Here, engineered cell factories that convert biomass into value-added compounds are emerging as a timely alternative to petroleum-based industries. Although often overlooked, integral membrane proteins such as solute transporters are pivotal for engineering efficient microbial chassis. Anaerobic gut fungi, adapted to degrade raw plant biomass in the intestines of herbivores, are a potential source of valuable transporters for biotechnology, yet very little is known about the membrane constituents of these non-conventional organisms. Here, we mined the transcriptome of three recently isolated strains of anaerobic fungi to identify membrane proteins responsible for sensing and transporting biomass hydrolysates within a competitive andmore » rather extreme environment. Using sequence analyses and homology, we identified membrane protein-coding sequences from assembled transcriptomes from three strains of anaerobic gut fungi: Neocallimastix californiae, Anaeromyces robustus, and Piromyces finnis. We identified nearly 2000 transporter components: about half of these are involved in the general secretory pathway and intracellular sorting of proteins; the rest are predicted to be small-solute transporters. Unexpectedly, we found a number of putative sugar binding proteins that are associated with prokaryotic uptake systems; and approximately 100 class C G-protein coupled receptors (GPCRs) with non-canonical putative sugar binding domains. In conclusion, we report the first comprehensive characterization of the membrane protein machinery of biotechnologically relevant anaerobic gut fungi. Apart from identifying conserved machinery for protein sorting and secretion, we identify a large number of putative solute transporters that are of interest for biotechnological applications. Notably, our data suggests that the fungi display a plethora of carbohydrate binding domains at their surface, perhaps as a means to sense and sequester some of the sugars that their biomass degrading, extracellular enzymes produce.« less
Characterization of two new putative adhesins of Leptospira interrogans.
Figueredo, Jupciana M; Siqueira, Gabriela H; de Souza, Gisele O; Heinemann, Marcos B; Vasconcellos, Silvio A; Chapola, Erica G B; Nascimento, Ana L T O
2017-01-01
We here report the characterization of two novel proteins encoded by the genes LIC11122 and LIC12287, identified in the genome sequences of Leptospira interrogans, annotated, respectively, as a putative sigma factor and a hypothetical protein. The CDSs LIC11122 and LIC12287 have signal peptide SPII and SPI and are predicted to be located mainly at the cytoplasmic membrane of the bacteria. The genes were cloned and the proteins expressed using Escherichia coli. Proteinase K digestion showed that both proteins are surface exposed. Evaluation of interaction of recombinant proteins with extracellular matrix components revealed that they are laminin binding and they were called Lsa19 (LIC11122) and Lsa14 (LIC12287), for Leptospiral-surface adhesin of 19 and 14 kDa, respectively. The bindings were dose-dependent on protein concentration, reaching saturation, fulfilling the ligand-binding criteria. Reactivity of the recombinant proteins with leptospirosis human sera has shown that Lsa19 and, to a lesser extent, Lsa14, are recognized by antibodies, suggesting that, most probably, Lsa19 is expressed during infection. The proteins interact with plasminogen and generate plasmin in the presence of urokinase-type plasminogen activator. Plasmin generation in Leptospira has been associated with tissue penetration and immune evasion strategies. The presence of a sigma factor on the cell surface playing a secondary role, probably mediating host -pathogen interaction, suggests that LIC11122 is a moonlighting protein candidate. Although the biological significance of these putative adhesins will require the generation of mutants, our data suggest that Lsa19 is a potential candidate for future evaluation of its role in adhesion/colonization activities during L. interrogans infection.
Chen, Qiang; Fischer, Joshua R; Benoit, Vivian M; Dufour, Nicholas P; Youderian, Philip; Leong, John M
2008-12-01
Borrelia burgdorferi is the causative agent of Lyme disease, the most common vector-borne illness in the Northern hemisphere. Low-passage-number infectious strains of B. burgdorferi exhibit extremely low transformation efficiencies-so low, in fact, as to hinder the genetic study of putative virulence factors. Two putative restriction-modification (R-M) systems, BBE02 contained on linear plasmid 25 (lp25) and BBQ67 contained on lp56, have been postulated to contribute to this poor transformability. Restriction barriers posed by other bacteria have been overcome by the in vitro methylation of DNA prior to transformation. To test whether a methylation-sensitive restriction system contributes to poor B. burgdorferi transformability, shuttle plasmids were treated with the CpG methylase M.SssI prior to the electroporation of a variety of strains harboring different putative R-M systems. We found that for B. burgdorferi strains that harbor lp56, in vitro methylation increased transformation by at least 1 order of magnitude. These results suggest that in vitro CpG methylation protects exogenous DNA from degradation by an lp56-contained R-M system, presumably BBQ67. The utility of in vitro methylation for the genetic manipulation of B. burgdorferi was exemplified by the ease of plasmid complementation of a B. burgdorferi B31 A3 BBK32 kanamycin-resistant (B31 A3 BBK32::Kan(r)) mutant, deficient in the expression of the fibronectin- and glycosaminoglycan (GAG)-binding adhesin BBK32. Consistent with the observation that several surface proteins may promote GAG binding, the B. burgdorferi B31 A3 BBK32::Kan(r) mutant demonstrated no defect in the ability to bind purified GAGs or GAGs expressed on the surfaces of cultured cells.
Tsfasman, Tatyana; Kost, Vladimir; Markushin, Stanislav; Lotte, Vera; Koptiaeva, Irina; Bogacheva, Elena; Baratova, Ludmila; Radyukhin, Victor
2015-12-02
The influenza virus matrix M1 protein is an amphitropic membrane-associated protein, forming the matrix layer immediately beneath the virus raft membrane, thereby ensuring the proper structure of the influenza virion. The objective of this study was to elucidate M1 fine structural characteristics, which determine amphitropic properties and raft membrane activities of the protein, via 3D in silico modelling with subsequent mutational analysis. Computer simulations suggest the amphipathic nature of the M1 α-helices and the existence of putative cholesterol binding (CRAC) motifs on six amphipathic α-helices. Our finding explains for the first time many features of this protein, particularly the amphitropic properties and raft/cholesterol binding potential. To verify these results, we generated mutants of the A/WSN/33 strain via reverse genetics. The M1 mutations included F32Y in the CRAC of α-helix 2, W45Y and W45F in the CRAC of α-helix 3, Y100S in the CRAC of α-helix 6, M128A and M128S in the CRAC of α-helix 8 and a double L103I/L130I mutation in both a putative cholesterol consensus motif and the nuclear localisation signal. All mutations resulted in viruses with unusual filamentous morphology. Previous experimental data regarding the morphology of M1-gene mutant influenza viruses can now be explained in structural terms and are consistent with the pivotal role of the CRAC-domains and amphipathic α-helices in M1-lipid interactions. Copyright © 2015 Elsevier B.V. All rights reserved.
How to Determine When Your Conservation Reserve Program (CRP) Pine Plantation is Ready to Thin
Andrew J. Londo; Timothy A. Traugott; Stephen G. Dicke; Scott D. Roberts
2002-01-01
The CRP program was initiated in 1986 by the United States Department of Agriculture, Farm Services Agency, to protect topsoil from erosion. There have been 308,000 acres of CRP pine plantations established in Mississippi, and 1.2 million acres of CRP plantations have been established nationwide. Many of the CRP pine plantations in Mississippi will soon be ready for...
Schuijt, Tim J; Boss, David S; Musson, Ruben E A; Demir, Ayse Y
2018-03-27
Bacterial resistance to antibiotics represents a serious global challenge that is associated with high morbidity and mortality. One of the most important causes of this threat is antibiotic overuse. The Dutch College of General Practitioners (DCGP) recommends the use of point-of-care (POC) testing for C-reactive protein (CRP) in two guidelines ('Acute Cough' and 'Diverticulitis') to achieve a more sensible prescription pattern of antibiotics. To evaluate the use of POC-CRP testing in light of the DCGP guidelines and the effect of CRP measurements on antibiotic prescription policy in primary care. In a prospective observational study, which included 1756 patients, general practitioners (GPs) were asked to complete a questionnaire after every POC-CRP testing, stating the indication for performing the test, the CRP result and their decision whether or not to prescribe antibiotics. Indications were verified against the DCGP guidelines and categorized. Antibiotic prescription was evaluated in relation to CRP concentrations. Indications to perform POC-CRP test and the prescription pattern of antibiotics based on CRP value varied considerably between GPs. Differences in antibiotic prescription rate were most obvious in patients who presented with CRP values between 20 and 100 mg/l, and could in part be explained by the indication for performing POC-CRP test and patient age. Most GPs followed the DCGP guidelines and used low CRP values to underpin their decision to refrain from antibiotic prescription. Peer-based reflection on differences in POC-CRP usage and antibiotic prescription rate amongst GPs may further nourish a more critical approach to prescription of antibiotics.
A new automated turbidimetric immunoassay for the measurement of canine C-reactive protein.
Piñeiro, Matilde; Pato, Raquel; Soler, Lourdes; Peña, Raquel; García, Natalia; Torrente, Carlos; Saco, Yolanda; Lampreave, Fermín; Bassols, Anna; Canalias, Francesca
2018-03-01
In dogs, as in humans, C-reactive protein (CRP) is a major acute phase protein that is rapidly and prominently increased after exposure to inflammatory stimuli. CRP measurements are used in the diagnosis and monitoring of infectious and inflammatory diseases. The study aim was to develop and validate a turbidimetric immunoassay for the quantification of canine CRP (cCRP), using canine-specific reagents and standards. A particle-enhanced turbidimetric immunoassay was developed. The assay was set up in a fully automated analyzer, and studies of imprecision, limits of linearity, limits of detection, prozone effects, and interferences were carried out. The new method was compared with 2 other commercially available automated immunoassays for cCRP: one turbidimetric immunoassay (Gentian CRP) and one point-of-care assay based on magnetic permeability (Life Assays CRP). The within-run and between-day imprecision were <1.7% and 4.2%, respectively. The assay quantified CRP proportionally in an analytic range up to 150 mg/L, with a prozone effect appearing at cCRP concentrations >320 mg/L. No interference from hemoglobin (20 g/L), triglycerides (10 g/L), or bilirubin (150 mg/L) was detected. Good agreement was observed between the results obtained with the new method and the Gentian cCRP turbidimetric immunoassay. The new turbidimetric immunoassay (Turbovet canine CRP, Acuvet Biotech) is a rapid, robust, precise, and accurate method for the quantification of cCRP. The method can be easily set up in automated analyzers, providing a suitable tool for routine clinical use. © 2018 American Society for Veterinary Clinical Pathology.
Tamoxifen Dependent Interaction Between the Estrogen Receptor and a Novel P21 Activated Kinase
2002-06-01
binding domain at the C Cv1 cells were cotransfected with ARE4-Luc reporter (100 teric G prti Tse bindin dominat the C ng), pRL-SV40 ( Renilla control...48 h and assayed for luciferase and Renilla Three of the four residues defining a putative het- activity. erotrimeric G protein binding motif were...nases. Taken together, these results demonstrated expression of the control Renilla reporter regulated by that the PAK6 CRIB domain was functional with re
The Evolving Field of Biodefence: Therapeutic Developments and Diagnostics
2005-04-01
several ways. One method would be to interfere with the furin -medi- ated cleavage of PA to its active form (PA 63 ) following host-cell receptor binding4...b | The inactive form of protective antigen (PA83) binds to a host-cell receptor, where it is cleaved by a furin -related protease, to give active PA63...explore whether a putative target, such as furin cleavage site of Ebola virus, is essential for viral infection88. Compared with filoviruses, poxvirus
Coccaro, Emil F; Lee, Royce; Coussons-Read, Mary
2015-02-01
C-reactive protein (CRP), in the plasma, serves as a marker of systemic inflammation and has been shown to correlate with history of actual aggressive behavior, and as a personality trait of aggressive tendency, in human subjects. This pilot study was conducted to determine if plasma CRP levels are correlated with cerebrospinal fluid levels (CSF CRP) and if CSF CRP also correlates with aggression. If so, this would suggest a role for central inflammatory processes in human aggression. Both plasma and basal lumbar CSF samples were obtained from 17 subjects with DSM-5 personality disorder and assayed for CRP. Plasma and CSF CRP levels were correlated (r = 0.65, p = 0.005) and each correlated with aggression (Plasma: r = 0.53, p = 0.029; CSF: r = 0.84, p < 0.001). When considered simultaneously, CSF CRP, but not plasma CRP, uniquely correlated with aggression. No relationship was seen with other measures of psychopathology. These data suggest a positive relationship between central nervous system CRP and aggression in humans.
Abd El-Aziz, Tarek A; Mohamed, Rasha H
2013-12-15
The aim of this study was to investigate the association between C-reactive protein (CRP) gene polymorphism and metabolic syndrome (MetS) with premature coronary artery disease (PCAD). 116 patients with PCAD (58 with MetS and 58 without MetS) and 119 controls were included in the study. CRP gene +1059 G>C polymorphism was analyzed by polymerase chain reaction. Serum hs-CRP was measured using high-sensitivity enzyme-linked immunosorbent assay. Carriers of C allele of the CRP +1059 G>C polymorphism had 3.37 fold increased risk to develop MetS in patients with PCAD. In addition CRP gene and hs-CRP levels were independent risk factors for PCAD and MetS. The present study provides new evidence that the presence of CRP +1059 G>C polymorphism and hs-CRP levels are independent determinants of PCAD and MetS in Egyptians. The results of our study suggest a synergistic effect of CRP C allele with classical risk factors such as hypertension, obesity, dyslipidemia and MetS. © 2013 Elsevier B.V. All rights reserved.
CRP in acute appendicitis--is it a necessary investigation?
Amalesh, T; Shankar, M; Shankar, R
2004-01-01
Appendectomy is one of the commonest procedures in surgery. In spite of various investigations used to improve the accuracy of diagnosis, the rate of normal appendices removed is still about 15-30%. Many studies have investigated the role of C-reactive protein (CRP) in acute appendicitis, but with conflicting results. In a prospective, double blind study, blood for the measurement of serum C-reactive protein was collected pre-operatively from 192 children before going to the operating theatre for appendectomy. The histopathology was grouped into positive (acute appendicitis) and negative (normal appendix) and this was correlated with CRP values. CRP was normal in 14 out of 33 negative explorations (normal appendix on histopathology). The specificity and sensitivity of serum CRP was 42% and 91% respectively. The predictive value of a positive (raised CRP) and negative (normal CRP) test is 88% and 48% respectively. We conclude that neither raised nor normal CRP value is helpful in the diagnosis of acute appendicitis. CRP is not a good tool for helping the surgeon make the diagnosis of appendicitis and it should not be measured in suspected appendicitis.
C-reactive protein response to a vegan lifestyle intervention.
Sutliffe, Jay T; Wilson, Lori D; de Heer, Hendrik D; Foster, Ray L; Carnot, Mary Jo
2015-02-01
This brief lifestyle intervention, including a vegan diet rich in fresh fruits and vegetables, whole grains and various legumes, nuts and seeds, significantly improved health risk factors and reduced systemic inflammation as measured by circulating CRP. The degree of improvement was associated with baseline CRP such that higher levels predicted greater decreases. The interaction between gender and baseline CRP was significant and showed that males with higher baseline CRP levels appeared to have a more robust decrease in CRP due to the intervention than did their female counterparts. It is likely that the vegetable and high fiber content of a vegan diet reduces CRP in the presences of obesity. Neither the quantity of exercise nor the length of stay was significant predictors of CRP reduction. Additionally, those participants who had a vegan diet prior to the intervention had the lowest CRP risk coming into the program. Direct measure of body fat composition, estrogen and other inflammatory mediators such as IL-6 and TNF-alpha would enhance current understanding of the specific mechanisms of CRP reduction related to lifestyle interventions. Copyright © 2014 Elsevier Ltd. All rights reserved.
A Study of Novice Science Teachers' Conceptualizations of Culturally Relevant Pedagogy
NASA Astrophysics Data System (ADS)
Redman, Elizabeth Horst
This qualitative study examined new science teachers' conceptualization of culturally relevant pedagogy (CRP). The study followed six novice science teachers from their preservice teaching placements into their first jobs as instructors of record, observing in their classrooms and interviewing them about their use of CRP. The study sought to understand (1) how the participating teachers conceptualize CRP in science, and (2) what challenges the teachers faced in trying to implement CRP. Findings suggest that the teachers conceptualized CRP in ways that were consistent with Enyedy, Danish and Fields' (2011) interpretations of relevance: relevance of authentic purpose, relevance of content and/or context, and relevance of practices. The teachers, however, translated those interpretations of relevance into their conceptualizations and classroom practice in a variety of ways. While they encountered difficulties in conceptualizing and practicing CRP, they also made productive moves in their practice and evidenced positive elements in their conceptualizations of CRP. In order to address the challenges these teachers faced in implementing CRP, I suggest an approach to teacher preparation in CRP that builds upon the understandings and productive moves the teachers evidenced in this study.
Yu, Xin; Sun, Shuang; Guo, Yuyan; Liu, Yan; Yang, Dayu; Li, Guoyu; Lü, Shaowa
2018-06-28
Citri Reticulatae Pericarpium (Rutaceae, CRP), commonly called as Chenpi () in Chinese, is most frequently used as a qi-regulating drug in thousands of Chinese medicine prescriptions. CRP is found mainly in major citrus-producing areas such as the Guangdong, Guangxi, Sichuan, Fujian, and Zhejiang Provinces of China. Since thousands of years in China, CRP has been used widely in clinical practice to treat nausea, vomiting, indigestion, anepithymia, diarrhea, cough, expectoration, and so on. Currently, CRP is listed in the Pharmacopoeia of the People's Republic of China. The present paper reviews the botany, ethnopharmacology, phytochemistry, pharmacology, quality control, and toxicology of CRP. Information on CRP was gathered from various sources including the books on traditional Chinese herbal medicine; scientific databases including Elsevier, PubMed, and ScienceDirect; Baidu Scholar; CNKI; and others and from different professional websites. Approximately 140 chemical compounds have been isolated and identified from CRP. Among them, volatile oils and flavonoids are generally considered as the main bioactive and characteristic ingredients. CRP possesses wide pharmacological effects such as having a beneficial effect on the cardiovascular, digestive, and respiratory systems, antitumor, antioxidant, and anti-inflammatory properties; and a protective effect on the liver and nerve. Moreover, hesperidin is chosen as an indicator in the quantitative determination of CRP, and the quantity of aflatoxin in CRP must not exceed the standard limit mentioned in the pharmacopoeia. In brief, CRP has a warming nature, and hence, it can be used in harmony with a lot of medicines. CRP not only exhibits its effects individually but also aids other medicines exhibit a better effect. CRP can be consumed with tea, food, alcohol, and medicine. Irrespective of the form it is being consumed, CRP not only shows a synergistic effect but also has strengths on its own. Modern pharmacological studies have demonstrated that CRP has marked bioactivities, especially on the diseases of the digestive and respiratory systems. The bioactivities of CRP are useful for its clinical application and provide prospects for the development of drugs as well as food and health products for people. Although CRP is a commonly used drug in the traditional Chinese herbal prescription, there is an urgent need for further research on its synergistic effect with other herbs based on the compatibility theory of TCM, which would further increase our understanding on the compatibility theory of TCM. Copyright © 2018 Elsevier B.V. All rights reserved.
Vitamin C treatment reduces elevated C-reactive protein
Block, Gladys; Jensen, Christopher D.; Dalvi, Tapashi B.; Norkus, Edward P.; Hudes, Mark; Crawford, Patricia B.; Holland, Nina; Fung, Ellen B.; Schumacher, Laurie; Harmatz, Paul
2009-01-01
Plasma C-reactive protein (CRP) is an inflammatory biomarker that predicts cardiovascular disease. We investigated whether vitamins C or E could reduce CRP. Healthy nonsmokers (n=396) were randomized to three groups:1000 mg/day vitamin C, 800 IU/day vitamin E, or placebo, for two months. Median baseline CRP was low, 0.85 mg/L. No treatment effect was seen when all participants are included. However, significant interaction was found, indicating that treatment effect depends on baseline CRP concentration. Among participants with CRP indicative of elevated cardiovascular risk (≥1.0 mg/L), vitamin C reduced median CRP by 25.3% vs. Placebo (p=0.02), (median reduction in the vitamin C group, 0.25 mg/L, 16.7%). These effects are similar to those of statins. The vitamin E effect was not significant. In summary, treatment with vitamin C but not E significantly reduced CRP among individuals with CRP ≥ 1.0 mg/L. Among the obese, 75% had CRP ≥ 1.0 mg/L. These data extend previous results in smokers, and identify CRP levels susceptible to reductions. Research is needed to determine whether reducing this inflammatory biomarker with vitamin C could reduce diseases associated with obesity. But research on clinical benefits of antioxidants should limit participants to persons with elevations in the target biomarkers. PMID:18952164
Predictive value of high sensitivity CRP in patients with diastolic heart failure.
Michowitz, Yoav; Arbel, Yaron; Wexler, Dov; Sheps, David; Rogowski, Ori; Shapira, Itzhak; Berliner, Shlomo; Keren, Gad; George, Jacob; Roth, Arie
2008-04-25
C-reactive protein (CRP) has been tested in patients with systolic heart failure (HF) and mixed results have been obtained with regards to its potential predictive value. However, the role of C-reactive protein (CRP) in patients with diastolic HF is not established. We studied the predictive role of high sensitivity CRP (hsCRP) in patients with diastolic HF. HsCRP levels were measured in a cohort of CHF outpatients, 77 patients with diastolic HF and 217 patients with systolic HF. Concentrations were compared to a large cohort of healthy population (n=7701) and associated with the HF admissions and mortality of the patients. Levels of hsCRP did not differ between patients with systolic and diastolic HF and were significantly elevated compared to the cohort of healthy subjects even after adjustment to various clinical parameters (p<0.0001). In patients with diastolic HF, hsCRP levels associated with New York Heart Association functional class (NYHA-FC) (r=0.31 p=0.01). On univariate Cox regression model hsCRP levels independently predicted hospitalizations in patients with systolic but not diastolic HF (p=0.047). HsCRP concentrations are elevated in patients with diastolic HF and correlate with disease severity; their prognostic value in this patient population should be further investigated.
Kim, Kye-Won; Smith, Clyde A.; Daily, Michael D.; ...
2014-11-19
Control over phenoxy radical-radical coupling reactions in vivo in vascular plants was enigmatic until our discovery of dirigent proteins (DPs, from the Latin dirigere, to guide or align). The first three-dimensional structure of a DP ((+)-pinoresinol-forming DP, 1.95 Å resolution, rhombohedral space group H32)) is reported herein. It has a tightly packed trimeric structure with an eight-stranded β-barrel topology for each DP monomer. Each putative substrate binding and orientation coupling site is located on the trimer surface but too far apart for intermolecular coupling between sites. It is proposed that each site enables stereoselective coupling (using either two coniferyl alcoholmore » radicals or a radical and a monolignol). Interestingly, there are six differentially conserved residues in DPs affording either the (+)- or (₋)-antipodes in the vicinity of the putative binding site and region known to control stereoselectivity. We find DPs are involved in lignan biosynthesis, whereas dirigent domains/sites have been implicated in lignin deposition.« less
NASA Astrophysics Data System (ADS)
Öztürk, Burcu Emine Tefon
2017-04-01
Whooping cough also known as pertussis is a contagious acute upper respiratory disease primarily caused by Bordetella pertussis. It is known that this disease may be fatal especially in infants and recently, the number of pertussis cases has been increased. Despite the fact that there are numbers of acellular vaccines on the market, the current acellular vaccine compositions are inadequate for providing sustainable immunity and avoiding subclinical disease cases. Hence, exploring novel proteins with high immune protective capacities is essential to enhance the clinical efficacy of current vaccines. In this study, genes of selected immunogenic proteins via -omics studies, namely Putative outer protein D (BopD) and Leucin/Isoleucine/Valin Binding Protein (LivJ) were first cloned into pGEM-T Easy vector and transformed to into E. coli DH5α cells and then cloned into the expression vector pET-28a(+) and transformed into E. coli BL21 (DE3) cells to express the proteins.
Koh, Young W.; Lee, Hyun W.
2017-01-01
Abstract Recent studies have indicated that the C-reactive protein (CRP)/albumin (CRP/Alb) ratio is associated with clinical outcomes in patients with various carcinomas. However, no studies have explored the association between the ratio of CRP/Alb and clinical outcome of inoperable patients with nonsmall cell lung cancers (NSCLCs). We examined the prognostic impact of CRP/Alb ratio on 165 stage IV NSCLC receiving palliative chemotherapy. The optimal cutoff level of CRP/Alb ratio was set at 0.195. The median follow-up time was 9 months (range, 1–74 months). On univariate analysis, high CRP/Alb ratio (≥0.195) was correlated (P < .001) with poorer overall survival (OS). Subgroup analysis of adenocarcinoma showed that CRP/Alb ratio was significantly (P < .001) associated with OS. Multivariate analysis showed that CRP/Alb ratio was an independent prognostic factor for OS (hazard ratio: 2.227, P = .001). Subgroup analysis revealed that the CRP/Alb ratio had a significant (P = .001) prognostic impact on adenocarcinoma patients receiving platinum chemotherapy. Elevated CRP/Alb ratio was significantly associated with male gender (P = .002) and smoking history (P = .009). The results of this study suggest that the CRP/Alb ratio might be used as a simple, inexpensive, and independent prognostic factor for OS of patients with advanced lung adenocarcinomas receiving platinum chemotherapy. PMID:28489774
Bangsund, Dean A; Hodur, Nancy M; Leistritz, F Larry
2004-07-01
The Conservation Reserve Program (CRP), created in 1985, provides conservation benefits and agricultural supply control through voluntary, long-term retirement of crop land. While the effects of the CRP on the agricultural sector are well understood, the implications of its conservation benefits for rural economies remain largely undocumented. To quantify the effects on rural economies, this study addressed the net economic effects of decreased agricultural activity and increased recreational activity associated with the CRP in six rural areas of North Dakota from 1996 to 2000. Based on the level of economic activity that would have occurred in the absence of the program, net revenues from CRP land if returned to agricultural production in the six study areas were estimated at $50.2 million annually or $37 per acre of land currently enrolled in the CRP. Recreational (hunting) revenues as a result of the CRP in the study areas were estimated at $12.8 million annually or $9.45 per CRP-acre. The net economic effect of the CRP (lost agricultural revenues and gains in recreational expenditures) indicated that several areas of the state are not as economically burdened by the CRP as previous research has suggested. In addition, the net economic effects of the program would appear more favourable if revenues from all CRP-based recreation were included. The degree that recreational revenues offset agricultural losses might be further enhanced by enterprises that capitalize on the economic opportunities associated with expanded recreational activities on CRP lands.
Modulatory Effect of Inflammation on Blood Pressure Reduction via Therapeutic Lifestyle Change.
Milani, Richard V; Lavie, Carl J
2009-01-01
Since inflammatory status, as determined by C-reactive protein (CRP) levels, is correlated with many cardiovascular (CV) disease risk factors and major CV events, we sought to determine if median levels of CRP can modulate blood pressure changes as well as other CV risk factors that are typically improved by therapeutic lifestyle changes with formal cardiac rehabilitation and exercise training (CRET) programs. We retrospectively evaluated CRP status and standard CV risk factors both before and after formal, phase II CRET programs (12 weeks; 36 educational and exercise sessions) in 635 consecutive patients with coronary artery disease after major CV events. The median CRP level at baseline was 3.2 mg/L (range, 0.2-80.1 mg/L; mean, 5.8±8.4 mg/L). After CRET, both the patients with high and those with low CRP concentrations exhibited statistically significant improvements in most CV risk factors when their CRP levels were divided by median levels. However, systolic, diastolic, and mean arterial blood pressure improved in patients with low CRP levels (each by -4%) but did not change significantly in patients with high CRP levels. In multiple regression models, only young age, low CRP levels, and low body mass index were significant independent predictors of improved mean arterial blood pressure after CRET. In contrast to patients with coronary artery disease and low levels of CRP, patients with high baseline CRP levels did not demonstrate significant reductions in blood pressure after therapeutic lifestyle changes via formal CRET programs.
Absence of diurnal variation of C-reactive protein concentrations in healthy human subjects
NASA Technical Reports Server (NTRS)
Meier-Ewert, H. K.; Ridker, P. M.; Rifai, N.; Price, N.; Dinges, D. F.; Mullington, J. M.
2001-01-01
BACKGROUND: The concentration of C-reactive protein (CRP) in otherwise healthy subjects has been shown to predict future risk of myocardial infarction and stroke. CRP is synthesized by the liver in response to interleukin-6, the serum concentration of which is subject to diurnal variation. METHODS: To examine the existence of a time-of-day effect for baseline CRP values, we determined CRP concentrations in hourly blood samples drawn from healthy subjects (10 males, 3 females; age range, 21-35 years) during a baseline day in a controlled environment (8 h of nighttime sleep). RESULTS: Overall CRP concentrations were low, with only three subjects having CRP concentrations >2 mg/L. Comparison of raw data showed stability of CRP concentrations throughout the 24 h studied. When compared with cutoff values of CRP quintile derived from population-based studies, misclassification of greater than one quintile did not occur as a result of diurnal variation in any of the subjects studied. Nonparametric ANOVA comparing different time points showed no significant differences for both raw and z-transformed data. Analysis for rhythmic diurnal variation using a method fitting a cosine curve to the group data was negative. CONCLUSIONS: Our data show that baseline CRP concentrations are not subject to time-of-day variation and thus help to explain why CRP concentrations are a better predictor of vascular risk than interleukin-6. Determination of CRP for cardiovascular risk prediction may be performed without concern for diurnal variation.
Serum C-Reactive Protein (CRP), Target for Therapy or Trouble?
Kraus, Virginia B; Jordan, Joanne M
2007-02-07
High sensitivity serum C-reactive protein (hs-CRP) has come into clinical use as a marker of risk for cardiovascular disease (CVD). In addition to a role as a marker of disease, CRP has also been implicated in the pathogenesis of CVD. Specific small-molecule inhibitors of CRP have recently been developed with the intent of mitigating cardiac damage during acute myocardial infarction. However, the use of CRP, both as a risk marker and a disease target are controversial for several reasons. Serum hs-CRP concentrations can be elevated on the basis of genetics, female gender, and non-Caucasian ethnicity. It is not clear, in these contexts, that elevations of hs-CRP have any pathological significance. As a non-specific indicator of inflammation, CRP is also not a specific indicator of a single disease state such as cardiovascular disease but elevated concentrations can be seen in association with other comorbidities including obesity and pulmonary disease. In sharp contrast to the proposed inhibition of CRP for cardiovascular disease treatment, the infusion of CRP has been shown to have profound therapeutic benefits for autoimmune disease and septic shock. The balance between the risks and benefits of these competing views of the role of CRP in disease and disease therapy is reminiscent of the ongoing controversy regarding the use of non-steroidal anti-inflammatory drugs (NSAIDs) for musculoskeletal disease and their cardiovascular side effects. Soon, NSAIDs may not be the only agents about which Rheumatologists and Cardiologists may spar.
Wang, Xiuling; Liu, Zhongchun; Wang, Peigang; Li, Shan; Zeng, Jie; Tu, Xiaoning; Yan, Qiujin; Xiao, Zheman; Pan, Mengxian; Zhu, Fan
2018-01-01
Schizophrenia is a devastating psychiatric disorder that impacts on social functioning and quality of life, and there is accumulating evidence that inflammation is a potential pathogenic mechanism of schizophrenia. However, the mechanism of inflammation possibly occurred in schizophrenia has not been well understood. The endogenous retroviral protein syncytin-1 and inflammatory marker CRP are both abnormally expressed in schizophrenia patients. CRP is one of the markers of bacterial infection generally. Less clear is whether virus or viral protein can trigger the activation of CRP. Here, we detected a robust increase of the levels of syncytin-1 and CRP in schizophrenia patients, and displayed a positive correlation and marked consistency between expressions of syncytin-1 and CRP in schizophrenia patients. Furthermore, overexpression of syncytin-1 significantly elevated the levels of CRP, TLR3, and IL-6 in both human microglia and astrocytes. TLR3 deficiency impaired the expressions of CRP and IL-6 induced by syncytin-1. Importantly, we observed a cellular co-localization and a direct interaction between syncytin-1 and TLR3. Additionally, knockdown of IL-6 inhibited the syncytin-1-induced CRP expression. Thus, the totality of these results showed that viral protein syncytin-1 could trigger the activation of CRP, which might explain the elevated CRP in sterile inflammation and exhibit a novel mechanism for regulation of inflammation by syncytin-1 in schizophrenia. Copyright © 2017 Elsevier Inc. All rights reserved.
Shih, P Betty; Manzi, Susan; Shaw, Penny; Kenney, Margaret; Kao, Amy H; Bontempo, Franklin; Barmada, M Michael; Kammerer, Candace; Kamboh, M Ilyas
2008-11-01
The gene coding for C-reactive protein (CRP) is located on chromosome 1q23.2, which falls within a linkage region thought to harbor a systemic lupus erythematosus (SLE) susceptibility gene. Recently, 2 single-nucleotide polymorphisms (SNP) in the CRP gene (+838, +2043) have been shown to be associated with CRP concentrations and/or SLE risk in a British family-based cohort. Our study was done to confirm the reported association in an independent population-based case-control cohort, and also to investigate the influence of 3 additional CRP tagSNP (-861, -390, +90) on SLE risk and serum CRP concentrations. DNA from 337 Caucasian women who met the American College of Rheumatology criteria for definite (n = 324) or probable (n = 13) SLE and 448 Caucasian healthy female controls was genotyped for 5 CRP tagSNP (-861, -390, +90, +838, +2043). Genotyping was performed using restriction fragment length polymorphism-polymerase chain reaction, pyrosequencing, or TaqMan assays. Serum CRP levels were measured using ELISA. Association studies were performed using the chi-squared distribution, Z-test, Fisher's exact test, and analysis of variance. Haplotype analysis was performed using EH software and the haplo.stats package in R 2.1.2. While none of the SNP were found to be associated with SLE risk individually, there was an association with the 5 SNP haplotypes (p < 0.001). Three SNP (-861, -390, +90) were found to significantly influence serum CRP level in SLE cases, both independently and as haplotypes. Our data suggest that unique haplotype combinations in the CRP gene may modify the risk of developing SLE and influence circulating CRP levels.
Chen, Fangfang; Wang, Wenpeng; Teng, Yue; Hou, Dongqing; Zhao, Xiaoyuan; Yang, Ping; Yan, Yinkun; Mi, Jie
2014-06-01
To explore the relationship between high-sensitivity C-reactive protein (hsCRP) and obesity/metabolic syndrome (MetS) related factors in children. 403 children aged 10-14 and born in Beijing were involved in this study. Height, weight, waist circumference, fat mass percentage (Fat%), blood pressure (BP), hsCRP, triglyceride (TG), total cholesterol (TC), fasting plasma glucose (FPG), high and low density lipoprotein cholesterol (HDL-C, LDL-C) were observed among these children. hsCRP was transformed with base 10 logarithm (lgCRP). MetS was defined according to the International Diabetes Federation 2007 definition. Associations between MetS related components and hsCRP were tested using partial correlation analysis, analysis of covariance and linear regression models. 1) lgCRP was positively correlated with BMI, waist circumference, Fat%,BP, FPG, LDL-C and TC while negatively correlated with HDL-C. With BMI under control, the relationships disappeared, but LDL-C (r = 0.102). 2) The distributions of lgCRP showed obvious differences in all the metabolic indices, in most groups, respectively. With BMI under control, close relationships between lgCRP and high blood pressure/high TG disappeared and the relationship with MetS weakened. 3) Through linear regression models, factors as waist circumference, BMI, Fat% were the strongest factors related to hsCRP, followed by systolic BP, HDL-C, diastolic BP, TG and LDL-C. With BMI under control, the relationships disappeared, but LDL-C(β = 0.045). hsCRP was correlated with child obesity, lipid metabolism and MetS. Waist circumference was the strongest factors related with hsCRP. Obesity was the strongest and the independent influencing factor of hsCRP.
Eltoft, Agnethe; Arntzen, Kjell Arne; Hansen, John-Bjarne; Wilsgaard, Tom; Mathiesen, Ellisiv B; Johnsen, Stein Harald
2017-08-01
CRP predicts cardiovascular disease (CVD) in large epidemiologic studies. The aim of the present study was to elucidate the role of CRP in atherosclerosis formation and progression in a prospective population-based study. 6503 middle-aged subjects from The Tromsø study had serum CRP, carotid ultrasound and complete covariate data collected at baseline in 1994. Of these, 4730 and 2917 attended follow-up surveys with repeated assessments in 2001 and 2007, respectively. The cross-sectional associations between CRP and subclinical carotid atherosclerosis, and the longitudinal associations between baseline CRP and novel plaque formation and plaque progression were assessed in generalized estimating equations and linear mixed models stratified by sex. At baseline, traditional risk factors and plaque prevalence increased by CRP risk categories (<1 mg/L, 1-3 mg/L, and >3 mg/L) in both sexes. In cross-sectional analyses, multivariable-adjusted CRP was associated with plaque prevalence and total plaque area (TPA) in men and women. Age-adjusted baseline CRP >3 mg/L compared to CRP <1 mg/L predicted novel plaque formation (OR 1.44, CI 1.08-1.92) and TPA progression (β = 0.0.029 (CI, 0.003-0.056)) in men, but not in women. In neither men nor women was baseline CRP a predictor of TPA-progression or novel plaque formation when adjusted for traditional risk factors. CRP was associated with plaque presence and TPA in cross-sectional analyses, but was not an independent predictor of novel plaque formation or plaque progression. Our findings suggest that CRP may link to CVD by other mechanisms than promoting formation and progression of atherosclerotic plaques. Copyright © 2017 Elsevier B.V. All rights reserved.
Kaplan, Marielle; Shur, Anna; Tendler, Yvgeny
2018-04-23
Arterial macrophages comprise a heterogeneous population: pro-inflammatory (M1) and anti-inflammatory (M2). Since C-reactive protein (CRP) is produced by macrophages in atherosclerotic lesions, understanding of CRP regulation in macrophages could be crucial to decipher inflammatory patterns in atherogenesis. We aimed to analyze CRP expression in M1/M2 macrophages and to question whether it involves NFκB signaling pathway. Furthermore, we questioned whether oxidative stress affect macrophage phenotype and modulate macrophage CRP expression. M1/M2 macrophage polarization was validated using THP-1 macrophages. CRP mRNA and protein expression were determined using real-time PCR and immunohistochemistry. Involvement of NFκB was determined by nuclear translocation of p50 subunit and the use of NFκB inhibitor. Involvement of oxidative stress in macrophage phenotypes induction was studied using oxidized-LDL (Ox-LDL) and antioxidants. M1 macrophages were characterized by elevated CRP mRNA expression (by 67%), CRP protein levels (by 108%), and upregulation of NFκB activation compared to control, but these features were not shared by M2 macrophages. Macrophages incubation with Ox-LDL led to a moderate M1 phenotype combined with a M2 phenotype, correlated with increased CRP mRNA expression. Antioxidants inhibited by up to 86% IL6 expression but did not significantly affect IL10 secretion. Antioxidants significantly inhibited CRP expression in M1 macrophages, but not in M2 macrophages. Elevated expression of CRP was characteristic of M1 macrophages rather than M2 through NFκB activation. Oxidative stress could be one of the endogenous triggers for macrophage activation to a mixed M1 and M2 phenotype, in association with increased expression of CRP.
Maekawa, Tomoki; Tabeta, Koichi; Kajita-Okui, Keiko; Nakajima, Takako; Yamazaki, Kazuhisa
2011-11-01
Epidemiological studies have suggested periodontitis as a risk factor for ischemic heart disease. High sensitive C-reactive protein (hs-CRP), a predictor of cardiovascular risk, is elevated in periodontitis patients. Therefore, local infection-induced elevation of systemic CRP could account for the relationship between the 2 diseases. However, the underlying mechanism of CRP production in the periodontal tissues has not been fully elucidated. Therefore, the aim of the present study was to clarify the mechanism of CRP production in periodontal tissues. Gene expression of CRP in gingival biopsies was analysed by quantitative PCR. Human gingival epithelial cells (HGECs), human gingival fibroblasts (HGFBs), and human coronary artery endothelial cells (HCAECs) were characterized for CRP-producing ability by incubating with interleukin (IL)-1β, IL-6, soluble IL-6 receptor (sIL-6R), and Porphyromonas gingivalis strain W83. Gene expression of CRP is significantly elevated in periodontitis lesions compared with gingivitis lesions. HCAECs, but not HGECs and HGFBs, produced CRP in response to IL-6 and IL-1β in the presence of sIL-6R. In contrast to IL-6, the effect of IL-1β on CRP production was indirect via induction of IL-6. IL-1β was produced by HGECs and HGFBs with stimulation of P. gingivalis antigens. These results suggest that CRP induced locally by periodontal infection may play another role in the pathogenesis of periodontal disease, and to a much lesser extent, has the potential to modulate systemic CRP level by extra-hepatic CRP production. Copyright © 2011 Elsevier Ltd. All rights reserved.
Heyma, P; Harrison, L C
1984-01-01
The thyrotropin (TSH) receptor is a putative target for autoantibodies in Graves' hyperthyroidism and therefore, should be capable of being identified, isolated, and structurally characterized by immunological means. To this end, four sera from patients with hyperthyroidism, three of which inhibited the binding of 125I-TSH to Triton-solubilized human thyroid membranes, were used to isolate TSH receptors by immunoprecipitation. To account for an effect of TSH binding or receptor occupancy on the ability of Graves' immunoglobulins to precipitate TSH receptors, two approaches were taken: (a) specific 125I-TSH binding activity was measured after solubilized thyroid membranes had been incubated with Graves' sera followed by precipitation with Staphylococcus protein A ("receptor depletion"); (b) TSH binding sites were labeled with 125I-TSH and the complexes were precipitated using Graves' sera and Staphylococcus protein A ("receptor precipitation"). The three sera which inhibited 125I-TSH binding depleted 125I-TSH binding activity between 30-80%. Preformed complexes between Staphylococcus protein A and immunoglobulins in these sera were also able to deplete 125I-TSH binding activity. However, after receptor depletion, the one serum that did not inhibit 125I-TSH binding was associated with a significant increase in 125I-TSH binding. All four sera specifically precipitated 80-100% of receptors identified by prelabeling with 125I-TSH. The dilutions of sera that precipitated 50% of 125I-TSH-receptor complexes ranged from 1:150-1:20. Complexes were partially precipitated by high concentrations of control sera (1:20), but the relative potency of control sera was at least fourfold less than Graves' sera. Immunoprecipitates of 125I-labeled thyroid membranes were analysed by sodium dodecyl sulfate-polyacrylamide gel electrophoresis and autoradiography to reveal Graves'-specific bands of reduced molecular weights of 100-110,000, 80-90,000, and 70-75,000. These bands were similar to those obtained from 125I-labeled thyroid membranes purified by TSH affinity chromatography. Thus, Graves' immunoglobulins: (a) precipitate unoccupied and occupied TSH receptors, (b) in one case, neither inhibit binding nor immunodeplete the unoccupied receptor but immunoprecipitate 125I-TSH-receptor complexes, suggesting that binding of TSH may initiate an interaction between the binding site and a separate immunoreactive molecule, and (c) identify the molecular structure of Graves' autoantigens, putatively, the TSH receptor. Images PMID:6088581
Sharma, Ashutosh; Kirkpatrick, Gordon; Chen, Virginia; Skolnik, Kate; Hollander, Zsuzsanna; Wilcox, Pearce; Quon, Bradley S
2017-01-01
C-reactive protein (CRP) is a systemic marker of inflammation that correlates with disease status in cystic fibrosis (CF). The clinical utility of CRP measurement to guide pulmonary exacerbation (PEx) treatment decisions remains uncertain. To determine whether monitoring CRP during PEx treatment can be used to predict treatment response. We hypothesized that early changes in CRP can be used to predict treatment response. We reviewed all PEx events requiring hospitalization for intravenous (IV) antibiotics over 2 years at our institution. 83 PEx events met our eligibility criteria. CRP levels from admission to day 5 were evaluated to predict treatment non-response, using a modified version of a prior published composite definition. CRP was also evaluated to predict time until next exacerbation (TUNE). 53% of 83 PEx events were classified as treatment non-response. Paradoxically, 24% of PEx events were characterized by a ≥ 50% increase in CRP levels within the first five days of treatment. Absolute change in CRP from admission to day 5 was not associated with treatment non-response (p = 0.58). Adjusted for FEV1% predicted, admission log10 CRP was associated with treatment non-response (OR: 2.39; 95% CI: 1.14 to 5.91; p = 0.03) and shorter TUNE (HR: 1.60; 95% CI: 1.13 to 2.27; p = 0.008). The area under the receiver operating characteristics (ROC) curve of admission CRP to predict treatment non-response was 0.72 (95% CI 0.61-0.83; p<0.001). 23% of PEx events were characterized by an admission CRP of > 75 mg/L with a specificity of 90% for treatment non-response. Admission CRP predicts treatment non-response and time until next exacerbation. A very elevated admission CRP (>75mg/L) is highly specific for treatment non-response and might be used to target high-risk patients for future interventional studies aimed at improving exacerbation outcomes.
Raitakari, M; Mansikkaniemi, K; Marniemi, J; Viikari, J S A; Raitakari, O T
2005-11-01
Elevated C-reactive protein (CRP) is a suggested risk marker for cardiovascular disease. We aimed at investigating the distribution and determinants of CRP levels in young adults. Population-based study. A total of 2,120 participants aged 24-39 years. Main outcome measures. Distribution of CRP, and the relationship between CRP and risk factors. CRP concentration (mean+/-SD) was 1.43+/-3.26 mg L(-1) in men, 1.36+/-2.36 mg L(-1) in women who did not use oral contraceptives (OC) and 3.69+/-6.01 mg L(-1) in women who used OCs. In total, 8.8% of men, 10.3% of non-OC user women and 35.3% of OC user women had CRP concentration >3 mg L(-1) (recommended cut-off point of high risk for cardiovascular disease). In univariate analysis, CRP was associated with obesity indices and physical activity amongst both sexes. In men, the multivariate correlates of CRP included waist circumference (P<0.0001), smoking (<0.0001) and HDL cholesterol (P=0.024) (inverse association). These three variables explained 21.9% (model R(2)) of the total variation in CRP, waist circumference having the greatest influence (partial R(2)=19.6%). In women, the multivariate correlates of CRP included OC use (P<0.0001), body mass index (BMI) (P<0.0001), triglycerides (<0.0001) and physical activity (P=0.025) (inverse association). These four variables explained 38.2% (model R(2)) of the total variation in CRP, with OC use (partial R(2)=18.4%) and BMI (partial R(2)=18.0%) having the greatest influence. The determinants of CRP level include obesity and smoking in men, and obesity, OC use and physical activity in women. About one in three of healthy women who use OCs have CRP concentration exceeding 3 mg L(-1).
Lee, Yvonne C; Hackett, James; Frits, Michelle; Iannaccone, Christine K; Shadick, Nancy A; Weinblatt, Michael E; Segurado, Oscar G; Sasso, Eric H
2016-04-01
To examine the association between a multibiomarker disease activity (MBDA) score, CRP and clinical disease activity measures among RA patients with and without concomitant FM. In an observational cohort of patients with established RA, we performed a cross-sectional analysis comparing MBDA scores with CRP by rank correlation and cross-classification. MBDA scores, CRP and clinical measures of disease activity were compared between patients with RA alone and RA with concomitant FM (RA and FM) by univariate and multivariate analyses. CRP was ⩽1.0 mg/dl for 184 of 198 patients (93%). MBDA scores correlated with CRP (r = 0.755, P < 0.001), but were often discordant, being moderate or high for 19%, 55% and 87% of patients with CRP ⩽0.1, 0.1 to ⩽0.3, or 0.3 to ⩽1.0 mg/dl, respectively. Among patients with CRP ⩽1.0 mg/dl, swollen joint count (SJC) increased linearly across levels of MBDA score, both with (P = 0.021) and without (P = 0.004) adjustment for CRP, whereas CRP was not associated with SJC. The 28-joint-DAS-CRP, other composite measures, and their non-joint-count component measures were significantly greater for patients with RA and FM (n = 25) versus RA alone (n = 173) (all P ⩽ 0.005). MBDA scores and CRP were similar between groups. MBDA scores frequently indicated RA disease activity when CRP did not. Neither one was significantly greater among patients with RA and FM versus RA alone. Thus, MBDA score may be a useful objective measure for identifying RA patients with active inflammation when CRP is low (⩽1.0 mg/dl), including RA patients with concomitant FM. © The Author 2015. Published by Oxford University Press on behalf of the British Society for Rheumatology.
Akinkugbe, A A; Avery, C L; Barritt, A S; Cole, S R; Lerch, M; Mayerle, J; Offenbacher, S; Petersmann, A; Nauck, M; Völzke, H; Slade, G D; Heiss, G; Kocher, T; Holtfreter, B
2017-11-01
An association between periodontitis and nonalcoholic fatty liver disease (NAFLD) has been reported by experimental animal and epidemiologic studies. This study investigated whether circulating levels of serum C-reactive protein (CRP) and a weighted genetic CRP score representing markers of inflammatory burden modify the association between periodontitis and NAFLD. Data came from 2,481 participants of the Study of Health in Pomerania who attended baseline examination that occurred between 1997 and 2001. Periodontitis was defined as the percentage of sites (0%, <30%, ≥30%) with probing pocket depth (PD) ≥4 mm, and NAFLD status was determined using liver ultrasound assessment. Serum CRP levels were assayed at a central laboratory, and single-nucleotide polymorphisms previously identified through genome-wide association studies as robustly associated with serum CRP were combined into a weighted genetic CRP score (wGS CRP ). Logistic regression models estimated the association between periodontitis and NAFLD within strata of serum CRP and separately within strata of the wGS CRP . The prevalence of NAFLD was 26.4% (95% confidence interval [CI], 24.6, 28.1) while 17.8% (95% CI, 16.0-19.6) had ≥30% of sites with PD ≥4 mm. Whereas the wGS CRP was not a modifier ( P interaction = 0.8) on the multiplicative scale, serum CRP modified the relationship between periodontitis and NAFLD ( P interaction = 0.01). The covariate-adjusted prevalence odds ratio of NAFLD comparing participants with ≥30% of sites with PD ≥4 mm to those with no site affected was 2.39 (95% CI, 1.32-4.31) among participants with serum CRP <1 mg/L. The corresponding estimate was 0.97 (95% CI, 0.57-1.66) for participants with serum CRP levels of 1 to 3 mg/L and 1.12 (95% CI, 0.65-1.93) for participants with serum CRP >3 mg/L. Periodontitis was positively associated with higher prevalence odds of NAFLD, and this relationship was modified by serum CRP levels.
Svensson, Elisabeth; Mor, Anil; Rungby, Jørgen; Berencsi, Klara; Nielsen, Jens Steen; Stidsen, Jacob V; Friborg, Søren; Brandslund, Ivan; Christiansen, Jens Sandahl; Beck-Nielsen, Henning; Sørensen, Henrik Toft; Thomsen, Reimar W
2014-08-28
We aimed to examine the prevalence of and modifiable factors associated with elevated C-reactive Protein (CRP), a marker of inflammation, in men and women with newly diagnosed Type 2 Diabetes mellitus (DM) in a population-based setting. CRP was measured in 1,037 patients (57% male) with newly diagnosed Type 2 DM included in the prospective nationwide Danish Centre for Strategic Research in Type 2 Diabetes (DD2) project. We assessed the prevalence of elevated CRP and calculated relative risks (RR) examining the association of CRP with lifestyle and clinical factors by Poisson regression, stratified by gender. We used linear regression to examine the association of CRP with other biomarkers. The median CRP value was 2.1 mg/L (interquartile range, 1.0 - 4.8 mg/L). In total, 405 out of the 1,037 Type 2 DM patients (40%) had elevated CRP levels (>3.0 mg/L). More women (46%) than men (34%) had elevated CRP. Among women, a lower risk of elevated CRP was observed in patients receiving statins (adjusted RR (aRR) 0.7 (95% confidence interval (CI) 0.6-0.9)), whereas a higher risk was seen in patients with central obesity (aRR 2.3 (95% CI 1.0-5.3)). For men, CRP was primarily elevated among patients with no regular physical activity (aRR 1.5 (95% CI 1.1-1.9)), previous cardiovascular disease (aRR1.5 (95% CI 1.2-1.9) and other comorbidity. For both genders, elevated CRP was 1.4-fold increased in those with weight gain >30 kg since age 20 years. Sensitivity analyses showed consistent results with the full analysis. The linear regression analysis conveyed an association between high CRP and increased fasting blood glucose. Among newly diagnosed Type 2 DM patients, 40% had elevated CRP levels. Important modifiable risk factors for elevated CRP may vary by gender, and include low physical activity for men and central obesity and absence of statin use for women.
Sensitive detection of C-reactive protein using optical fiber Bragg gratings.
Sridevi, S; Vasu, K S; Asokan, S; Sood, A K
2015-03-15
An accurate and highly sensitive sensor platform has been demonstrated for the detection of C-reactive protein (CRP) using optical fiber Bragg gratings (FBGs). The CRP detection has been carried out by monitoring the shift in Bragg wavelength (ΔλB) of an etched FBG (eFBG) coated with an anti-CRP antibody (aCRP)-graphene oxide (GO) complex. The complex is characterized by Fourier transform infrared spectroscopy, X-ray photoelectron spectroscopy and atomic force microscopy. A limit of detection of 0.01mg/L has been achieved with a linear range of detection from 0.01mg/L to 100mg/L which includes clinical range of CRP. The eFBG sensor coated with only aCRP (without GO) show much less sensitivity than that of aCRP-GO complex coated eFBG. The eFBG sensors show high specificity to CRP even in the presence of other interfering factors such as urea, creatinine and glucose. The affinity constant of ∼1.1×10(10)M(-1) has been extracted from the data of normalized shift (ΔλB/λB) as a function of CRP concentration. Copyright © 2014 Elsevier B.V. All rights reserved.
Serum C-reactive protein and white blood cell count in morbidly obese surgical patients.
Chen, Sheng-Bin; Lee, Yi-Chih; Ser, Kong-Han; Chen, Jung-Chien; Chen, Shu Chung; Hsieh, Hsing-Fang; Lee, Wei-Jei
2009-04-01
Obesity has been widely recognized as a chronic inflammatory condition and associated with elevated inflammatory indicators including C-reactive protein (CRP) and white blood cell count (WBC). Recent studies have shown elevated CRP or WBC is a significant risk factor for cardiac events and stroke but the clinical significance of CRP and WBC has not been clearly studied in morbidly obese patients. This study is aimed at the clinical significance of WBC and CRP in morbidly obese patients and the change after bariatric surgery. The study was a prospectively controlled clinical study. From December 1, 2001 to January 31, 2006, of 640 (442 females and 198 males) consecutive morbid obese patients enrolled in a surgically supervised weight loss program with at least 1 year's follow-up were examined. Of the patients, 476 (74.4%) had elevated CRP and 100 (15.6%) had elevated WBC at preoperative study. CRP and WBC were significantly related and both increased with increasing body mass index (BMI). CRP is also increased with increasing waist, glucose level, hemoglobin, albumin, Ca, insulin, C-peptide, and metabolic syndrome while WBC is increased with metabolic syndrome but decreased with increasing age. Multivariate analysis confirmed fasting glucose level and hemoglobin are independent predictors of the elevation of CRP while age is the only independent predictor for elevated WBC. Both WBC and CRP levels decreased rapidly after obesity surgery. These improvements resulted in a 69.8% reduction of CRP and 26.4% reduction of WBC 1 year after surgery. Although individuals who underwent laparoscopic gastric bypass lost significantly more weight (36.8 +/- 11.7 kg vs. 17.3 +/- 10.8 kg; p = 0.000) and achieved a lower BMI (27.8 +/- 4.6 vs. 35.0 +/- 5.5; p = 0.000) than individuals who underwent laparoscopic gastric banding, there was no difference in the resolution of elevated CRP 1 year after surgery (95.9% vs. 84.5%; p = 0.169) and WBC (99.4% vs. 98.3%; p = 0.323). Both baseline WBC and CRP are elevated in morbid obese patients but CRP has a better clinical significance. Significant weight reduction 1 year after surgery markedly reduced CRP and WBC with a resolution rate of 93.9% and 98.2% separately. Obesity surgery performed by laparoscopic surgery is recommended for obese patients with elevated CRP or WBC.
Dauncey, M J; Rudd, B T; White, D A; Shakespear, R A
1993-09-01
The regulation of plasma insulin-like growth factor binding proteins (IGFBPs) by energy status has been assessed in 2-month-old pigs. Energy balance was modified by altering thermoregulatory demand and energy intake, with litter-mates being kept for several weeks at either 35 or 10 degrees C on a high (H) or low (L) level of food intake (where H = 2L); plasma samples were taken 20-24 h after the last meal. The two major forms of circulating IGFBP, as estimated by Western blot analysis, were identified putatively as IGFBP-2 and IGFBP-3 (relative molecular weights of 34 and 40-45 kDa respectively). There were significant differences in IGFBP profiles between the four treatment groups of 35H, 35L, 10H and 10L: the 40-45 kDa IGFBP (putative IGFBP-3) was elevated both in the warm and on a high food intake (P < 0.001), and there was a marked reciprocal relation between the 40-45 and 34 kDa IGFBPs. The relative concentration of the 34 kDa IGFBP (putative IGFBP-2) was greatest in the 10L and least in the 35H group. It is concluded that long-term alterations in energy balance, induced by changes in either intake or thermoregulatory demand, can significantly affect the plasma profile of IGFBPs during the first two months of life.
Zimmerman, Carl-Ulrich R; Rosengarten, Renate; Spergser, Joachim
2013-01-01
Phase variation of two loci (‘mba locus’ and ‘UU172 phase-variable element’) in Ureaplasma parvum serovar 3 has been suggested as result of site-specific DNA inversion occurring at short inverted repeats. Three potential tyrosine recombinases (RipX, XerC, and CodV encoded by the genes UU145, UU222, and UU529) have been annotated in the genome of U. parvum serovar 3, which could be mediators in the proposed recombination event. We document that only orthologs of the gene xerC are present in all strains that show phase variation in the two loci. We demonstrate in vitro binding of recombinant maltose-binding protein fusions of XerC to the inverted repeats of the phase-variable loci, of RipX to a direct repeat that flanks a 20-kbp region, which has been proposed as putative pathogenicity island, and of CodV to a putative dif site. Co-transformation of the model organism Mycoplasma pneumoniae M129 with both the ‘mba locus’ and the recombinase gene xerC behind an active promoter region resulted in DNA inversion in the ‘mba locus’. Results suggest that XerC of U. parvum serovar 3 is a mediator in the proposed DNA inversion event of the two phase-variable loci. PMID:23305333
Tanaka, Atsunari; Shimizu, Toru
2008-12-16
Phosphodiesterase (Ec DOS) from Escherichia coli is a gas-sensor enzyme in which binding of gas molecules, such as O(2), CO, and NO, to the Fe(II)-protoporphyrin IX complex in the sensor domain stimulates phosphodiesterase activity toward cyclic-di-GMP. In this study, we report that external axial ligands, such as cyanide or imidazole, bind to Fe(III)-protoporphyrin IX in the sensor domain and induce a 10- to 11-fold increase (from 8.1 up to 86 min(-1)) in catalysis, which is more substantial than that (6.3 to 7.2-fold) observed for other gas-stimulated Fe(II) heme-bound enzymes. Catalytic activity (50 min(-1)) of the heme-free mutant, H77A, was comparable to that of the ligand-stimulated enzymes. Accordingly, we propose that the heme at the sensor domain inhibits catalysis and that ligand binding to the heme iron complex releases this catalytic suppression. Furthermore, mutations of Met95, Arg97, and Phe113 at the putative heme distal side suppressed the ligand effects on catalysis. The rate constants (19,000 x 10(-5) microM(-1)min(-1)) for cyanide binding to the M95A and M95L mutants of the full-length enzyme were 633-fold higher than that to wild-type Ec DOS (30 x 10(-5) microM(-1)min(-1)). The absorption spectrum of the F113Y mutant suggests that the Tyr O(-) group directly coordinates to the Fe(III) complex and that the cyanide binding rate to the mutant is very slow, compared with those of the wild-type and other mutant proteins. We observed a similar trend in the binding behavior of imidazole to full-length mutant enzymes. Therefore, while Met95 and Phe113 are not direct axial ligands for the Fe(III) complex, catalytic, spectroscopic, and ligand binding evidence suggests that these residues are located in the vicinity of the heme.
Wang, Min; Hancock, Timothy P; Chamberlain, Amanda J; Vander Jagt, Christy J; Pryce, Jennie E; Cocks, Benjamin G; Goddard, Mike E; Hayes, Benjamin J
2018-05-24
Topological association domains (TADs) are chromosomal domains characterised by frequent internal DNA-DNA interactions. The transcription factor CTCF binds to conserved DNA sequence patterns called CTCF binding motifs to either prohibit or facilitate chromosomal interactions. TADs and CTCF binding motifs control gene expression, but they are not yet well defined in the bovine genome. In this paper, we sought to improve the annotation of bovine TADs and CTCF binding motifs, and assess whether the new annotation can reduce the search space for cis-regulatory variants. We used genomic synteny to map TADs and CTCF binding motifs from humans, mice, dogs and macaques to the bovine genome. We found that our mapped TADs exhibited the same hallmark properties of those sourced from experimental data, such as housekeeping genes, transfer RNA genes, CTCF binding motifs, short interspersed elements, H3K4me3 and H3K27ac. We showed that runs of genes with the same pattern of allele-specific expression (ASE) (either favouring paternal or maternal allele) were often located in the same TAD or between the same conserved CTCF binding motifs. Analyses of variance showed that when averaged across all bovine tissues tested, TADs explained 14% of ASE variation (standard deviation, SD: 0.056), while CTCF explained 27% (SD: 0.078). Furthermore, we showed that the quantitative trait loci (QTLs) associated with gene expression variation (eQTLs) or ASE variation (aseQTLs), which were identified from mRNA transcripts from 141 lactating cows' white blood and milk cells, were highly enriched at putative bovine CTCF binding motifs. The linearly-furthermost, and most-significant aseQTL and eQTL for each genic target were located within the same TAD as the gene more often than expected (Chi-Squared test P-value < 0.001). Our results suggest that genomic synteny can be used to functionally annotate conserved transcriptional components, and provides a tool to reduce the search space for causative regulatory variants in the bovine genome.
CRP: Collaborative Research Project (A Mathematical Research Experience for Undergraduates)
ERIC Educational Resources Information Center
Parsley, Jason; Rusinko, Joseph
2017-01-01
The "Collaborative Research Project" ("CRP")--a mathematics research experience for undergraduates--offers a large-scale collaborative experience in research for undergraduate students. CRP seeks to widen the audience of students who participate in undergraduate research in mathematics. In 2015, the inaugural CRP had 100…
Haro-Acosta, María Elena; Ruíz Esparza-Cisneros, Josefina; Delgado-Valdez, Jesús Hernán; Díaz-Molina, Raúl; Ayala-Figueroa, Rafael Iván
2014-01-01
C-reactive protein (CRP) is a nonspecific marker of inflammation with low serum levels, which are not usually detectable. In order to assess cardiovascular risk in adults apparently healthy, ultrasensitive methods are used, and the CRP measured through these techniques is known as ultrasensitive C-reactive protein (US-CRP). Some researchers report an association of US-CRP with some anthropometric parameters in children with no apparent disease. The aim was to associate US-CRP with nutritional status and biochemical profiles in Mexican schoolchildren. In this cross-sectional study 300 healthy children (aged 10 to 12 years) were evaluated. Weight, height, body mass index (BMI), waist circumference, body fat percentage, glucose, lipid profiles and US-CRP were measured. Exclusion criteria was: US-CRP > 10mg/L. We used multivariate regression models. 53.7 % were girls and 46.3 % were boys. The US-CRP median was of 0.3 mg/L (range: 0.3 mg/L-6.8 mg/L), and it was positively and significantly correlated with BMI (ß = 0.226, p = 0.032) and LDL-C (ß = -0.267, p = 0.007) and negatively associated with cholesterol (ß = -0.267, p = 0.007). There is an association between US-CRP and cardiovascular risk indicators, such as obesity and some lipid disorder in childhood; therefore, US-CRP may be used for close examination in Mexican children.
[Comparison of two methods for rapid determination of C-reactive protein with the Tina-quant].
Oremek, G M; Luksaite, R; Bretschneider, I
2008-03-01
C-reactive protein (CRP) as an acute phase protein is an important diagnostic marker for the presence and course of human processes. Out of the acute phase proteins it is one of those the concentrations increase most rapidly with its sensitivity being superior to other markers of inflammation, such as leukocytosis, erythrocytic sedimentation rate, and fever. This study compared two-point-of-care assays with the standard laboratory method Tina-quant CRP processed on a Hitachi 917: the immunofiltration assay NycoCard CRP Whole Blood and the turbidimetric immunoassay Micros CRP. Both methods are carried in the presence of a patient, by using capillary or venous blood. Seventy-eight blood samples were analyzed first in the standard laboratory routine and then by both rapid test assays. The precision of both assays was determined from the confidence interval. The results were statistically analyzed by arithmetic standard deviation mean method, variation coefficient, Spearman correlation index, Wilcoxon and Bland-Altman tests, and Passing-Bablock regression. NycoCard CRP Whole Blood showed a correlation coefficient of R = 0.9838; the precision had a coefficient of variation of CV = 1.8759% while As compared with Tina-quant CRP had R = 0.9934 and CV = 0.9160%. Both assays indicated the same results as Tina-quant CRP. Both Tina-quant CRP and NycoCard CRP Whole Blood give the best fit for the rapid determination of CRP.
Simpson, R M; Prancan, A; Izzi, J M; Fiedel, B A
1982-01-01
The classical acute phase reactant, C-reactive protein (CRP), appears in markedly elevated concentration in the sera of individuals undergoing reactions of acute inflammation and tissue degradation. We previously demonstrated that like IgG, appropriately purified CRP could be thermally modified (H-CRP) such that it enhanced platelet activation in plasma and initiated platelet responses in isolated systems. We now report that this direct platelet activation by modified CRP results in the secretion of both platelet dense body and alpha-granule constituents, and is sensitive to non-steroidal anti-inflammatory drugs as well as the adenosine diphosphate (ADP)-removing enzyme system creatine phosphate/creatine phosphokinase. Thin-layer chromatographic (TLC) analysis of prostanoate endproducts following platelet activation with H-CRP revealed the formation of thromboxane B2 (the hydrated endproduct of thromboxane A2), an important endogenous platelet activator and contractor of vascular tissue; bioassay on rabbit aorta strips of supernatants obtained from platelets undergoing challenge with H-CRP supported the TLC analysis. Complexes formed between CRP and one major ligand, the polycation, were found to share certain platelet activating properties with H-CRP, as does latex-aggregated CRP. These data imply a potential agonist role for this acute phase reactant in platelet physiology and suggest that the interaction of modified forms of CRP with the platelet at sites of vascular damage could have pathological significance. PMID:7118160
DOE Office of Scientific and Technical Information (OSTI.GOV)
Kwon, Deug-Nam; Park, Mi-Ryung; Park, Jong-Yi
Highlights: {yields} The sequences of -604 to -84 bp of the pUPII promoter contained the region of a putative negative cis-regulatory element. {yields} The core promoter was located in the 5F-1. {yields} Transcription factor HNF4 can directly bind in the pUPII core promoter region, which plays a critical role in controlling promoter activity. {yields} These features of the pUPII promoter are fundamental to development of a target-specific vector. -- Abstract: Uroplakin II (UPII) is a one of the integral membrane proteins synthesized as a major differentiation product of mammalian urothelium. UPII gene expression is bladder specific and differentiation dependent, butmore » little is known about its transcription response elements and molecular mechanism. To identify the cis-regulatory elements in the pig UPII (pUPII) gene promoter region, we constructed pUPII 5' upstream region deletion mutants and demonstrated that each of the deletion mutants participates in controlling the expression of the pUPII gene in human bladder carcinoma RT4 cells. We also identified a new core promoter region and putative negative cis-regulatory element within a minimal promoter region. In addition, we showed that hepatocyte nuclear factor 4 (HNF4) can directly bind in the pUPII core promoter (5F-1) region, which plays a critical role in controlling promoter activity. Transient cotransfection experiments showed that HNF4 positively regulates pUPII gene promoter activity. Thus, the binding element and its binding protein, HNF4 transcription factor, may be involved in the mechanism that specifically regulates pUPII gene transcription.« less
Search for Partner Proteins of A. thaliana Immunophilins Involved in the Control of Plant Immunity.
Abdeeva, Inna A; Pogorelko, Gennady V; Maloshenok, Liliya G; Mokrykova, Maria V; Fursova, Oksana V; Bruskin, Sergey A
2018-04-19
The involvement of plant immunophilins in multiple essential processes such as development, various ways of adapting to biotic and abiotic stresses, and photosynthesis has already been established. Previously, research has demonstrated the involvement of three immunophilin genes ( AtCYP19-1/ROC3 , AtFKBP65/ROF2 , and AtCYP57 ) in the control of plant response to invasion by various pathogens. Current research attempts to identify host target proteins for each of the selected immunophilins. As a result, candidate interactors have been determined and confirmed using a yeast 2-hybrid (Y2H) system for protein⁻protein interaction assays. The generation of mutant isoforms of ROC3 and AtCYP57 harboring substituted amino acids in the in silico-predicted active sites became essential to achieving significant binding to its target partners. This data shows that ROF2 targets calcium-dependent lipid-binding domain-containing protein (At1g70790; AT1) and putative protein phosphatase (At2g30020; АТ2), whereas ROC3 interacts with GTP-binding protein (At1g30580; ENGD-1) and RmlC-like cupin (At5g39120). The immunophilin AtCYP57 binds to putative pyruvate decarboxylase-1 (Pdc1) and clathrin adaptor complex-related protein (At5g05010). Identified interactors confirm our previous findings that immunophilins ROC3 , ROF2 , and AtCYP57 are directly involved with stress response control. Further, these findings extend our understanding of the molecular functional pathways of these immunophilins.
Le, Shuai; He, Xuesong; Tan, Yinling; Huang, Guangtao; Zhang, Lin; Lux, Renate; Shi, Wenyuan; Hu, Fuquan
2013-01-01
The first step in bacteriophage infection is recognition and binding to the host receptor, which is mediated by the phage receptor binding protein (RBP). Different RBPs can lead to differential host specificity. In many bacteriophages, such as Escherichia coli and Lactococcal phages, RBPs have been identified as the tail fiber or protruding baseplate proteins. However, the tail fiber-dependent host specificity in Pseudomonas aeruginosa phages has not been well studied. This study aimed to identify and investigate the binding specificity of the RBP of P. aeruginosa phages PaP1 and JG004. These two phages share high DNA sequence homology but exhibit different host specificities. A spontaneous mutant phage was isolated and exhibited broader host range compared with the parental phage JG004. Sequencing of its putative tail fiber and baseplate region indicated a single point mutation in ORF84 (a putative tail fiber gene), which resulted in the replacement of a positively charged lysine (K) by an uncharged asparagine (N). We further demonstrated that the replacement of the tail fiber gene (ORF69) of PaP1 with the corresponding gene from phage JG004 resulted in a recombinant phage that displayed altered host specificity. Our study revealed the tail fiber-dependent host specificity in P. aeruginosa phages and provided an effective tool for its alteration. These contributions may have potential value in phage therapy. PMID:23874674
Devaraj, Sridevi; Kumaresan, Pappanaicken R; Jialal, Ishwarlal
2011-12-01
Inflammation is pivotal in atherosclerosis. A key early event in atherosclerosis is endothelial dysfunction. C-reactive protein (CRP), the prototypic marker of inflammation in humans, is a risk marker for cardiovascular disease, and there is mounting evidence to support its role in atherothrombosis. CRP has been shown to promote endothelial dysfunction both in vitro and in vivo. Emerging biomarkers of endothelial dysfunction include circulating endothelial cells (CECs) and endothelial microparticles (EMPs). However, there is a paucity of data examining the effect of CRP on CEC and EMP production in vitro and in vivo. In this report, we treated human aortic endothelial cells (HAECs) with increasing concentrations of CRP (0-50 μg/mL) or boiled CRP. We counted CECs and EMPs by flow cytometry. Although CRP treatment resulted in a significant increase in release of both CECs and EMPs, boiled CRP failed to have an effect. Pretreatment of HAECs with sepiapterin or diethylenetriamine NONOate, both of which preserve nitric oxide (NO), resulted in attenuation of CRP's effects on CECs and EMPs. CD32 and CD64 blocking antibodies but not CD16 antibody or lectin-like oxidized LDL receptor 1 small interfering RNA (LOX-1 siRNA) prevented CRP-induced production of CECs and EMPs. Furthermore, delivery of human CRP to Wistar rats compared with human serum albumin resulted in significantly increased CECs and EMPs, corroborating the in vitro findings. We provide novel data that CRP, via NO deficiency, promotes endothelial dysfunction by inducing release of CECs and EMPs, which are biomarkers of endothelial dysfunction.
Lin, Zi-Ying; Liang, Zhen-Xing; Zhuang, Pei-Lin; Chen, Jie-Wei; Cao, Yun; Yan, Li-Xu; Yun, Jing-Ping; Xie, Dan; Cai, Mu-Yan
2016-10-12
Serum C-reactive protein (CRP), an acute inflammatory response biomarker, has been recognized as an indicator of malignant disease progression. However, the prognostic significance of CRP levels collected before tumor removal in intrahepatic cholangiocarcinoma requires further investigation. We sampled the CRP levels in 140 patients with intrahepatic cholangiocarcinoma who underwent hepatectomies with regional lymphadenectomies between 2006 and 2013. A retrospective analysis of the clinicopathological data was performed. We focused on the impact of serum CRP on the patients' cancer-specific survival and recurrence-free survival rates. High levels of preoperative serum CRP were significantly associated with well-established clinicopathologic features, including gender, advanced tumor stage, and elevated carcinoembryonic antigen and carbohydrate antigen 19-9 levels (P < 0.05). Univariate analysis demonstrated a significant association between high levels of serum CRP and adverse cancer-specific survival (P = 0.001) and recurrence-free survival (P < 0.001). In patients with stage I/II intrahepatic cholangiocarcinoma, the serum CRP level was a prognostic indicator for cancer-specific survival. In patients with stage I/II or stage III/IV, the serum CRP level was a prognostic indicator for recurrence-free survival (P < 0.05). Additionally, multivariate analysis identified serum CRP level in intrahepatic cholangiocarcinoma as an independent prognostic factor (P < 0.05). We confirmed a significant association of elevated pre-operative CRP levels with poor clinical outcomes for the tested patients with intrahepatic cholangiocarcinoma. Our results indicate that the serum CRP level may represent a useful factor for patient stratification in intrahepatic cholangiocarcinoma management.
Major depression, C-reactive protein, and incident ischemic heart disease in healthy men and women.
Surtees, Paul G; Wainwright, Nicholas W J; Boekholdt, S Matthijs; Luben, Robert N; Wareham, Nicholas J; Khaw, Kay-Tee
2008-10-01
To investigate how C-reactive protein (CRP) and major depressive disorder (MDD) relate to each other and to incident ischemic heart disease (IHD). Studies have shown that both depression and raised CRP concentration predict IHD and that elevated CRP is linked with increased risk of depression. A prospective case-control study of healthy men and women, aged 45 to 79 years, was undertaken within the United Kingdom European Prospective Investigation into Cancer (EPIC)-Norfolk study. CRP concentration was measured for 726 (fatal or nonfatal) IHD cases and 1688 matched controls who completed a baseline MDD self-assessment, defined by restricted Diagnostic and Statistical Manual of Mental Disorders, 4th Edition diagnostic criteria. Past-year MDD was associated with increased CRP concentration levels (4.31 mg/L for participants who reported episodes of MDD in the past year versus 3.65 mg/L for those who did not; p = .003), and the odds ratio for incident IHD associated with higher CRP concentration was 2.02 (comparing the top versus bottom quartile of CRP; 95% Confidence Interval (CI) = 1.52-2.68), adjusted for cigarette smoking, diabetes, systolic blood pressure, body mass index, and cholesterol. The association between past-year MDD and IHD was independent of CRP (odds ratio = 1.55; 95% CI = 1.01-2.37, with adjustments as above, and additionally for CRP). Evidence from this study is supportive of an association between MDD and CRP although it suggests that CRP does not account for the association between MDD and future IHD.
Modulatory Effect of Inflammation on Blood Pressure Reduction via Therapeutic Lifestyle Change
Milani, Richard V.; Lavie, Carl J.
2009-01-01
Purpose: Since inflammatory status, as determined by C-reactive protein (CRP) levels, is correlated with many cardiovascular (CV) disease risk factors and major CV events, we sought to determine if median levels of CRP can modulate blood pressure changes as well as other CV risk factors that are typically improved by therapeutic lifestyle changes with formal cardiac rehabilitation and exercise training (CRET) programs. Methods: We retrospectively evaluated CRP status and standard CV risk factors both before and after formal, phase II CRET programs (12 weeks; 36 educational and exercise sessions) in 635 consecutive patients with coronary artery disease after major CV events. Results: The median CRP level at baseline was 3.2 mg/L (range, 0.2–80.1 mg/L; mean, 5.8±8.4 mg/L). After CRET, both the patients with high and those with low CRP concentrations exhibited statistically significant improvements in most CV risk factors when their CRP levels were divided by median levels. However, systolic, diastolic, and mean arterial blood pressure improved in patients with low CRP levels (each by −4%) but did not change significantly in patients with high CRP levels. In multiple regression models, only young age, low CRP levels, and low body mass index were significant independent predictors of improved mean arterial blood pressure after CRET. Conclusions: In contrast to patients with coronary artery disease and low levels of CRP, patients with high baseline CRP levels did not demonstrate significant reductions in blood pressure after therapeutic lifestyle changes via formal CRET programs. PMID:21603441
Dong, Meili; Wu, Jiandong; Ma, Zimin; Peretz-Soroka, Hagit; Zhang, Michael; Komenda, Paul; Tangri, Navdeep; Liu, Yong; Rigatto, Claudio; Lin, Francis
2017-03-26
Traditional diagnostic tests for chronic diseases are expensive and require a specialized laboratory, therefore limiting their use for point-of-care (PoC) testing. To address this gap, we developed a method for rapid and low-cost C-reactive protein (CRP) detection from blood by integrating a paper-based microfluidic immunoassay with a smartphone (CRP-Chip). We chose CRP for this initial development because it is a strong biomarker of prognosis in chronic heart and kidney disease. The microfluidic immunoassay is realized by lateral flow and gold nanoparticle-based colorimetric detection of the target protein. The test image signal is acquired and analyzed using a commercial smartphone with an attached microlens and a 3D-printed chip-phone interface. The CRP-Chip was validated for detecting CRP in blood samples from chronic kidney disease patients and healthy subjects. The linear detection range of the CRP-Chip is up to 2 μg/mL and the detection limit is 54 ng/mL. The CRP-Chip test result yields high reproducibility and is consistent with the standard ELISA kit. A single CRP-Chip can perform the test in triplicate on a single chip within 15 min for less than 50 US cents of material cost. This CRP-Chip with attractive features of low-cost, fast test speed, and integrated easy operation with smartphones has the potential to enable future clinical PoC chronic disease diagnosis and risk stratification by parallel measurements of a panel of protein biomarkers.
Dong, Meili; Wu, Jiandong; Ma, Zimin; Peretz-Soroka, Hagit; Zhang, Michael; Komenda, Paul; Tangri, Navdeep; Liu, Yong; Rigatto, Claudio; Lin, Francis
2017-01-01
Traditional diagnostic tests for chronic diseases are expensive and require a specialized laboratory, therefore limiting their use for point-of-care (PoC) testing. To address this gap, we developed a method for rapid and low-cost C-reactive protein (CRP) detection from blood by integrating a paper-based microfluidic immunoassay with a smartphone (CRP-Chip). We chose CRP for this initial development because it is a strong biomarker of prognosis in chronic heart and kidney disease. The microfluidic immunoassay is realized by lateral flow and gold nanoparticle-based colorimetric detection of the target protein. The test image signal is acquired and analyzed using a commercial smartphone with an attached microlens and a 3D-printed chip–phone interface. The CRP-Chip was validated for detecting CRP in blood samples from chronic kidney disease patients and healthy subjects. The linear detection range of the CRP-Chip is up to 2 μg/mL and the detection limit is 54 ng/mL. The CRP-Chip test result yields high reproducibility and is consistent with the standard ELISA kit. A single CRP-Chip can perform the test in triplicate on a single chip within 15 min for less than 50 US cents of material cost. This CRP-Chip with attractive features of low-cost, fast test speed, and integrated easy operation with smartphones has the potential to enable future clinical PoC chronic disease diagnosis and risk stratification by parallel measurements of a panel of protein biomarkers. PMID:28346363
Bryan, Craig J; May, Alexis M; Rozek, David C; Williams, Sean R; Clemans, Tracy A; Mintz, Jim; Leeson, Bruce; Burch, T Scott
2018-05-10
Previous research supports the efficacy of the crisis response plan (CRP) for the reduction of suicidal behaviors as compared to treatment as usual (TAU). Patient perspectives and use of the CRP, and their relationship to later suicidal thoughts, remain unknown. A secondary analysis of a randomized clinical trial comparing a standard CRP (S-CRP), a CRP enhanced with reasons for living (E-CRP), and TAU in a sample of 97 active-duty U.S. Army personnel was conducted. Participants were asked about their use, perceptions, and recall of each intervention. Generalized estimating equations were used to test the conditional effects of intervention use, perceptions, and recall on severity of suicide ideation during follow-up. Across all treatment groups, over 80% of participants retained their written CRP up to 6 months later, but less than 25% had the written plan in their physical possession at the time of each assessment. Participants in S-CRP and E-CRP were more likely to recall self-management strategies and sources of social support. Participants in TAU were more likely to recall use of professional healthcare services and crisis management services. All three interventions were rated as highly useful. More frequent use of the E-CRP and recall of its components were associated with significantly reduced suicide ideation as compared to TAU. Both CRPs have high acceptability ratings. The effect of both CRPs on reduced suicide ideation is associated with patient recall of components. More frequent use of the E-CRP is associated with larger reductions in suicide ideation. © 2018 Wiley Periodicals, Inc.
McIntyre, N.E.; Thompson, Thomas R.
2003-01-01
The Conservation Reserve Program (CRP) was designed to reduce soil erosion and curb agricultural overproduction by converting highly erodible agricultural land to various forms of perennial habitat. It has had an incidental benefit of providing habitat for wildlife and has been beneficial in reversing population declines of several grassland bird species. However, the mechanisms behind these reversals remain unknown. One such mechanism may be differences in food availability on CRP vs. non-CRP land or between different types of CRP. The influence of CRP habitat type on the abundance of arthropod prey used by grassland birds has not been previously explored. We compared the abundance and diversity of arthropods among four CRP habitat types in Texas [replicated plots of exotic lovegrass (Eragrostis curvula), Old World bluestem (Bothriochloa ischaemum), mixed native grasses with buffalograss (Buchloe?? dactyloides) and mixed native grasses without buffalograss] and native shortgrass prairie. Attention was focused on adult and juvenile spiders (Order Araneae), beetles (Coleoptera), orthopterans (Orthroptera: grasshoppers and crickets) and lepidopterans (Lepidoptera: butterflies and moths), as these taxa are the primary prey items of grassland birds during the breeding season. Arthropod diversity and abundance were higher on indigenous prairie compared to CRP, reflecting differences in vegetative diversity and structure, but there were no differences in arthropod richness or abundance among CRP types. These results indicate that, although CRP is not equivalent to native prairie in terms of vegetation or arthropod diversity, CRP lands do support arthropod prey for grassland birds. More direct assays of the survivorship and fitness of birds on CRP compared to native shortgrass prairie are clearly warranted.
Anitha, V; Nair, Sushma; Shivakumar, V; Shanmugam, M; Priya, B Meena; Rajesh, P
2015-01-01
HsCRP (Highly sensitive C reactive protein) is a global indicator for future vascular events in adults detected in blood stream 48 hours before the cardiovascular event. Periodontal disease may increase blood levels of inflammatory markers like IL-6, CRP and HsCRP. Hence the aim of the present study is to evaluate the presence of elevated HsCRP levels in chronic periodontitis patients. 100 patients who reported for cardiac master health check up were enrolled in the study. The periodontal status was assessed using periodontal probing pocket depth and clinical attachment level. The decayed, missing and filled tooth was recorded using DMFT index. The venous samples of these patients were obtained for recording HsCRP levels. Pearson correlation was used to analyze the relationship between HsCRP level and probing pocket depth, clinical attachment loss and DMFT. The correlation value was 0.051, 0.025 and 0.101 respectively, the correlation is statistically significant for probing pocket depth and clinical attachment level (P>0.05). Chi-square test was performed to study the association between gender and HsCRP, Diabetes Mellitus and HsCRP and Hypertension and HsCRP; the results showed that there is no significant association between any of the above mentioned factors and HsCRP level in blood. We found an increased level of HsCRP in patients with chronic periodontitis which revealed the susceptibility of these patients to cardiac diseases like myocardial infarction and stroke. Hence present day focus in the line of management of cardiac patient has changed from the periodontal perspective.
Nagarale, Girish; Ravindra, S; Thakur, Srinath; Setty, Swati
2010-10-01
C-reactive protein [CRP] levels increase to hundreds of mg/mL within hours following infection. Studies have shown that serum CRP levels were elevated in periodontal disease. However, in all the previous studies, CRP levels were measured by using high-sensitivity CRP assay kits with minimal detection limits of 0.1 to 3 mg/L, which was much below the normal value of 10 mg/L. These high-sensitivity CRP assays need a proper laboratory setup, and these methods cannot be used as a routine chair-side test in the dental office. The purpose of this study was to investigate the serum CRP levels in subjects with periodontal disease by using a rapid chair-side diagnostic test kit with a lower detection limit of 6 mg/L and to compare the CRP levels before and after periodontal therapy. A total of 45 systemically healthy subjects were selected for the study. Subjects were divided into three groups: group A: healthy controls, group B: gingivitis, group C: periodontitis. Serum levels of CRP were determined by using a latex slide agglutination method with commercially available kit with lower detection limit of 6 mg/L. CRP was negative in all the 15 subjects in groups A and B at baseline, 7th and 30th day. CRP was positive only in 2 subjects in Group C at baseline and 7th day. Estimation of serum CRP by using a rapid chair-side diagnostic test kit is not of any significance in subjects with periodontitis.
Nagarale, Girish; Ravindra, S.; Thakur, Srinath; Setty, Swati
2010-01-01
Background: C-reactive protein [CRP] levels increase to hundreds of mg/mL within hours following infection. Studies have shown that serum CRP levels were elevated in periodontal disease. However, in all the previous studies, CRP levels were measured by using high-sensitivity CRP assay kits with minimal detection limits of 0.1 to 3 mg/L, which was much below the normal value of 10 mg/L. These high-sensitivity CRP assays need a proper laboratory setup, and these methods cannot be used as a routine chair-side test in the dental office. Aim: The purpose of this study was to investigate the serum CRP levels in subjects with periodontal disease by using a rapid chair-side diagnostic test kit with a lower detection limit of 6 mg/L and to compare the CRP levels before and after periodontal therapy. Materials and Methods: A total of 45 systemically healthy subjects were selected for the study. Subjects were divided into three groups: group A: healthy controls, group B: gingivitis, group C: periodontitis. Serum levels of CRP were determined by using a latex slide agglutination method with commercially available kit with lower detection limit of 6 mg/L. Results: CRP was negative in all the 15 subjects in groups A and B at baseline, 7th and 30th day. CRP was positive only in 2 subjects in Group C at baseline and 7th day. Conclusion: Estimation of serum CRP by using a rapid chair-side diagnostic test kit is not of any significance in subjects with periodontitis. PMID:21731244
NASA Astrophysics Data System (ADS)
Herling, Therese; Linse, Sara; Knowles, Tuomas
2015-03-01
Non-covalent and transient protein-ligand interactions are integral to cellular function and malfunction. Key steps in signalling and regulatory pathways rely on reversible non-covalent protein-protein binding or ion chelation. Here we present a microfluidic free-flow electrophoresis method for detecting and characterising protein-ligand interactions in solution. We apply this method to probe the binding equilibria of calmodulin, a central protein to calcium signalling pathways. In this study we characterise the specific binding of calmodulin to phosphorylase kinase, a known target, and creatine kinase, which we identify as a putative binding partner through a protein array screen and surface plasmon resonance experiments. We verify the interaction between calmodulin and creatine kinase in solution using free-flow electrophoresis and investigate the effect of calcium and sodium chloride on the calmodulin-ligand binding affinity in free solution without the presence of a potentially interfering surface. Our results demonstrate the general applicability of quantitative microfluidic electrophoresis to characterise binding equilibria between biomolecules in solution.
Yu, Xiaoli; Kang, Mingjiang; Liu, Li; Guo, Xingqi; Xu, Baohua
2013-01-01
Fatty acid-binding proteins (FABPs) play pivotal roles in cellular signaling, gene transcription, and lipid metabolism in vertebrates and invertebrates. In this study, a putative FABP gene, referred to as AccFABP, was isolated from the Asian honeybee, Apis cerana cerana Fabricius (Hymenoptera: Apidae). The full-length cDNA consisted of 725 bp, and encoded a protein of 204 amino acids. Homology and phylogenetic analysis indicated that AccFABP was a member of the FABP multifamily. The genomic structure of this gene, which was common among FABP multifamily members, spanned 1,900 bp, and included four exons and three introns. Gene expression analysis revealed that AccFABP was highly expressed in the dark-pigmented phase of pupal development, with peak expression observed in the fat bodies of the dark-pigmented phase pupae. The AccFABP transcripts in the fat body were upregulated by exposure to dietary fatty acids such as conjugated linoleic acid, docosahexaenoic acid, and arachidonic acid. Transcription factor binding sites for Caudal-Related Homeobox and functional CCAAT/enhancer binding site, which were respectively associated with tissue expression and lipid metabolism, were detected in the 5' promoter sequence. The evidence provided in the present study suggests that AccFABP may regulate insect growth and development, and lipid metabolism.
Measso do Bonfim, Caroline; Simão Sobrinho, João; Lacerda Nogueira, Rodrigo; Salgado Kupper, Daniel; Cardoso Pereira Valera, Fabiana; Lacerda Nogueira, Maurício; Villa, Luisa Lina; Rahal, Paula; Sichero, Laura
2015-01-01
A significant proportion of recurrent respiratory papillomatosis (RRP) is caused by human papillomavirus type 6 (HPV-6). The long control region (LCR) contains cis-elements for regulation of transcription. Our aim was to characterize LCR HPV-6 variants in RRP cases, compare promoter activity of these isolates and search for cellular transcription factors (TFs) that could explain the differences observed. The complete LCR from 13 RRP was analyzed. Transcriptional activity of 5 variants was compared using luciferase assays. Differences in putative TFs binding sites among variants were revealed using the TRANSFAC database. Chromatin immunoprecipation (CHIP) and luciferase assays were used to evaluate TF binding and impact upon transcription, respectively. Juvenile-onset RRP cases harbored exclusively HPV-6vc related variants, whereas among adult-onset cases HPV-6a variants were more prevalent. The HPV-6vc reference was more transcriptionally active than the HPV-6a reference. Active FOXA1, ELF1 and GATA1 binding sites overlap variable nucleotide positions among isolates and influenced LCR activity. Furthermore, our results support a crucial role for ELF1 on transcriptional downregulation. We identified TFs implicated in the regulation of HPV-6 early gene expression. Many of these factors are mutated in cancer or are putative cancer biomarkers, and must be further studied. PMID:26151558
Hart, Thomas; Dider, Shihab; Han, Weiwei; Xu, Hua; Zhao, Zhongming; Xie, Lei
2016-01-01
Metformin, a drug prescribed to treat type-2 diabetes, exhibits anti-cancer effects in a portion of patients, but the direct molecular and genetic interactions leading to this pleiotropic effect have not yet been fully explored. To repurpose metformin as a precision anti-cancer therapy, we have developed a novel structural systems pharmacology approach to elucidate metformin’s molecular basis and genetic biomarkers of action. We integrated structural proteome-scale drug target identification with network biology analysis by combining structural genomic, functional genomic, and interactomic data. Through searching the human structural proteome, we identified twenty putative metformin binding targets and their interaction models. We experimentally verified the interactions between metformin and our top-ranked kinase targets. Notably, kinases, particularly SGK1 and EGFR were identified as key molecular targets of metformin. Subsequently, we linked these putative binding targets to genes that do not directly bind to metformin but whose expressions are altered by metformin through protein-protein interactions, and identified network biomarkers of phenotypic response of metformin. The molecular targets and the key nodes in genetic networks are largely consistent with the existing experimental evidence. Their interactions can be affected by the observed cancer mutations. This study will shed new light into repurposing metformin for safe, effective, personalized therapies. PMID:26841718
Slatter, David A.; Bihan, Dominique G.; Jarvis, Gavin E.; Stone, Rachael; Pugh, Nicholas; Giddu, Sumana; Farndale, Richard W.
2012-01-01
Recently, the ability of polymeric collagen-like peptides to regulate cell behavior has generated great interest. A triple-helical peptide known as collagen-related peptide (CRP) contains the sequence (Gly-Pro-Hyp)10. With Gly-Pro-Cys triplets appended to both of its termini, designated CRPcys, chemical cross-linking using heterobifunctional reagents generates CRPcys-XL, a potent, widely used, polymeric agonist for platelet Glycoprotein VI, whereas non-cross-linked, monomeric CRPcys antagonizes Glycoprotein VI. Here, we describe how cysteine in these triplets may also undergo random air-induced oxidation, especially upon prolonged storage or repeated freeze–thawing, to form disulphide bonds, resulting in a lesser degree of polymerization than with chemical cross-linking. We investigated the monomeric and polymeric states of these and other cysteine-containing collagen-derived peptides, using gel filtration and dynamic light scattering, allowing the size of a CRP-XL aggregate to be estimated. The effect of cysteine thiols upon peptide adsorption to surfaces and subsequent platelet responses was investigated. This demonstrated that cysteine is required for strong binding to glass coverslips and to plastic plates used in ELISA assays. PMID:22555281
The RNA-Binding Site of Poliovirus 3C Protein Doubles as a Phosphoinositide-Binding Domain.
Shengjuler, Djoshkun; Chan, Yan Mei; Sun, Simou; Moustafa, Ibrahim M; Li, Zhen-Lu; Gohara, David W; Buck, Matthias; Cremer, Paul S; Boehr, David D; Cameron, Craig E
2017-12-05
Some viruses use phosphatidylinositol phosphate (PIP) to mark membranes used for genome replication or virion assembly. PIP-binding motifs of cellular proteins do not exist in viral proteins. Molecular-docking simulations revealed a putative site of PIP binding to poliovirus (PV) 3C protein that was validated using nuclear magnetic resonance spectroscopy. The PIP-binding site was located on a highly dynamic α helix, which also functions in RNA binding. Broad PIP-binding activity was observed in solution using a fluorescence polarization assay or in the context of a lipid bilayer using an on-chip, fluorescence assay. All-atom molecular dynamics simulations of the 3C protein-membrane interface revealed PIP clustering and perhaps PIP-dependent conformations. PIP clustering was mediated by interaction with residues that interact with the RNA phosphodiester backbone. We conclude that 3C binding to membranes will be determined by PIP abundance. We suggest that the duality of function observed for 3C may extend to RNA-binding proteins of other viruses. Copyright © 2017 Elsevier Ltd. All rights reserved.
Direct binding of F actin to the cytoplasmic domain of the alpha 2 integrin chain in vitro
NASA Technical Reports Server (NTRS)
Kieffer, J. D.; Plopper, G.; Ingber, D. E.; Hartwig, J. H.; Kupper, T. S.
1995-01-01
The transmembrane integrins have been shown to interact with the cytoskeleton via noncovalent binding between cytoplasmic domains (CDs) of integrin beta chains and various actin binding proteins within the focal adhesion complex. Direct or indirect integrin alpha chain CD binding to the actin cytoskeleton has not been reported. We show here that actin, as an abundant constituent of focal adhesion complex proteins isolated from fibroblasts, binds strongly and specifically to alpha 2 CD, but not to alpha 1 CD peptide. Similar specific binding to alpha 2 CD peptide was seen for highly purified F actin, free of putative actin-binding proteins. The bound complex of actin and peptide was visualized directly by coprecipitation, and actin binding was abrogated by removal of a five amino acid sequence from the alpha 2 CD peptide. Our findings may explain the earlier observation that, while integrins alpha 2 beta 1 and alpha 1 beta 1 both bind to collagen, only alpha 2 beta 1 can mediate contraction of extracellular collagen matrices.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Unterberger, Claudia; Hanson, Steven; Department of Infection, Immunity and Inflammation, University of Leicester, University Road, Leicester LE1 9HN
Little is known about determinants regulating expression of Mannan-binding lectin associated serine protease-2 (MASP-2), the effector component of the lectin pathway of complement activation. Comparative bioinformatic analysis of the MASP2 promoter regions in human, mouse, and rat, revealed conservation of two putative Stat binding sites, termed StatA and StatB. Site directed mutagenesis specific for these sites was performed. Transcription activity was decreased 5-fold when StatB site was mutated in the wildtype reporter gene construct. Gel retardation and competition assays demonstrated that proteins contained in the nuclear extract prepared from HepG2 specifically bound double-stranded StatB oligonucleotides. Supershift analysis revealed Stat3 tomore » be the major specific binding protein. We conclude that Stat3 binding is important for MASP2 promoter activity.« less
Groselj-Grenc, Mojca; Ihan, Alojz; Pavcnik-Arnol, Maja; Kopitar, Andreja Natasa; Gmeiner-Stopar, Tanja; Derganc, Metka
2009-11-01
To compare the diagnostic accuracy of neutrophil and monocyte CD64 indexes (CD64in and CD64im) for sepsis in critically ill neonates and children with that of lipopolysaccharide-binding protein (LBP), procalcitonin (PCT) and C-reactive protein (CRP). Prospective, observational study in a level III multidisciplinary neonatal and pediatric intensive care unit (ICU). Forty-six neonates and 36 children with systemic inflammatory response syndrome (SIRS) and suspected infection, classified into two groups: those with bacterial sepsis (microbiologically proven or clinical sepsis) and those without bacterial sepsis (infection not supported by subsequent clinical course, laboratory data and microbiological tests). Flow cytometric CD64in and CD64im, serum LBP, PCT and CRP measurement on 2 consecutive days from admission to the ICU. There were 17 cases of bacterial sepsis in neonates and 24 cases of bacterial sepsis in children. All neonates and the majority of children were mechanically ventilated, and more than two-thirds of neonates with sepsis and one-third of children with sepsis needed inotropic/vasopressor drugs. The highest diagnostic accuracy for sepsis on the 1st day of suspected sepsis was achieved by LBP in neonates (0.86) and by CD64in in children (0.88) and 24 h later by CD64in in neonates (0.96) and children (0.98). Neutrophil CD64 index (CD64in) is the best individual marker for bacterial sepsis in children, while in neonates the highest diagnostic accuracy at the time of suspected sepsis was achieved by LBP and 24 h later by CD64in.
Biró, E; van den Goor, J M; de Mol, B A; Schaap, M C; Ko, L-Y; Sturk, A; Hack, C E; Nieuwland, R
2011-01-01
To investigate whether cell-derived microparticles play a role in complement activation in pericardial blood of patients undergoing cardiac surgery with cardiopulmonary bypass (CPB) and whether microparticles in pericardial blood contribute to systemic complement activation upon retransfusion. Pericardial blood of 13 patients was retransfused in 9 and discarded in 4 cases. Microparticles were isolated from systemic blood collected before anesthesia (T1) and at the end of CPB (T2), and from pericardial blood. The microparticles were analyzed by flow cytometry for bound complement components C1q, C4 and C3, and bound complement activator molecules C-reactive protein (CRP), serum amyloid P-component (SAP), immunoglobulin (Ig)M and IgG. Fluid-phase complement activation products (C4b/c, C3b/c) and activator molecules were determined by ELISA. Compared with systemic T1 blood, pericardial blood contained increased C4b/c and C3b/c, and increased levels of microparticles with bound complement components. In systemic T1 samples, microparticle-bound CRP, whereas in pericardial blood, microparticle-bound SAP and IgM were associated with complement activation. At the end of CPB, increased C3b/c (but not C4b/c) was present in systemic T2 blood compared with T1, while concentrations of microparticles binding complement components and of those binding complement activator molecules were similar. Concentrations of fluid-phase complement activation products and microparticles were similar in patients whether or not retransfused with pericardial blood. In pericardial blood of patients undergoing cardiac surgery with CPB, microparticles contribute to activation of the complement system via bound SAP and IgM. Retransfusion of pericardial blood, however, does not contribute to systemic complement activation.
ERIC Educational Resources Information Center
Sperduti, Marco; Pieron, Marie; Leboyer, Marion; Zalla, Tiziana
2014-01-01
Autism spectrum disorders (ASDs) are neurodevelopmental conditions that severely affect social interaction, communication and several behavioural and cognitive functions, such as planning and monitoring motor actions. A renewed interest in intrapersonal cognition has recently emerged suggesting a putative dissociation between impaired declarative…
7 CFR 1468.21 - Contract requirements.
Code of Federal Regulations, 2010 CFR
2010-01-01
... provisions of § 1468.24 of this part; (iv) Agree to forego participation in CRP, EQIP, and the cost-share... those practices transferred from terminated CRP and EQIP contracts and WRP cost-share agreements. For persons wishing to transfer from CRP, EQIP, or WRP to CFO, practices included in CRP or EQIP contracts or...
7 CFR 1410.51 - Transfer of land.
Code of Federal Regulations, 2010 CFR
2010-01-01
... of, the land subject to a CRP contract, as determined by the Deputy Administrator, such new owner or operator, upon the approval of CCC, may become a participant to a new CRP contract with CCC for the... existing CRP contract, the new owner or operator shall assume all obligations of the CRP contract of the...
Clyne, B; Olshaker, J S
1999-01-01
C-reactive protein (CRP) was identified in 1930 and was subsequently considered to be an "acute phase protein," an early indicator of infectious or inflammatory conditions. Since its discovery, CRP has been studied as a screening device for inflammation, a marker for disease activity, and as a diagnostic adjunct. Improved methods of quantifying CRP have led to increased application to clinical medicine. In the emergency department (ED), CRP must be interpreted in the clinical context; no single value can be used to rule in or rule out a specific diagnosis. We conclude that CRP has limited utility in the ED. It may be a useful adjunct to serial examinations in equivocal presentations of appendicitis in those centers without ready access to computed tomography (CT) scan. It may be elevated with complications or treatment failures in patients with pneumonia, pancreatitis, pelvic inflammatory disease (PID), and urinary tract infections. In patients with meningitis, neonatal sepsis, and occult bacteremia, CRP is usually elevated. However, CRP has no role in diagnosing these clinical entities, and a normal CRP level should never delay antibiotic coverage.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Latonen, Leena; Jaervinen, Paeivi M.; Haartman Institute, University of Helsinki, FIN-00014 Helsinki
2008-02-15
Members of the cysteine-rich protein (CRP) family are actin cytoskeleton-interacting LIM-domain proteins known to act in muscle cell differentiation. We have earlier found that CRP1, a founding member of this family, is transcriptionally induced by UV radiation in human diploid fibroblasts [M. Gentile, L. Latonen, M. Laiho, Cell cycle arrest and apoptosis provoked by UV radiation-induced DNA damage are transcriptionally highly divergent responses, Nucleic Acids Res. 31 (2003) 4779-4790]. Here we show that CRP1 is induced by growth-inhibitory signals, such as increased cellular density, and cytotoxic stress induced by UV radiation or staurosporine. We found that high levels of CRP1more » correlate with differentiation-associated morphology towards the myofibroblast lineage and that expression of ectopic CRP1 suppresses cell proliferation. Following UV- and staurosporine-induced stresses, expression of CRP1 provides a survival advantage evidenced by decreased cellular death and increased cellular metabolic activity and attachment. Our studies identify that CRP1 is a novel stress response factor, and provide evidence for its growth-inhibitory and cytoprotective functions.« less
Mallows, James L
2013-12-16
To examine the effect of an education campaign based around a gold coin fine on ordering of C-reactive protein (CRP) tests. A retrospective analysis of CRP test ordering before and after the intervention in the emergency department (ED) of a tertiary referral hospital in metropolitan Sydney that sees about 60,000 patients per annum. The date of the intervention - 2 August 2013 - corresponded with Jeans for Genes Day. Number of CRP tests ordered in the ED. 1290 CRP tests were ordered before the intervention (1-31 July), and 394 were ordered after the intervention (2-31 August). This decrease in CRP test ordering was despite an increased number of ED presentations in August compared with July (5219 v 5497 presentations). This represented an absolute reduction in the rate of CRP test ordering of 17.6% (95% CI, 16.2%-18.9%; P < 0.001). The threat of a gold coin fine for ordering a CRP test, as part of a broader education campaign, significantly reduced the number of CRP tests ordered in a tertiary referral ED.
Decreased C-reactive protein levels in Alzheimer disease.
O'Bryant, Sid E; Waring, Stephen C; Hobson, Valerie; Hall, James R; Moore, Carol B; Bottiglieri, Teodoro; Massman, Paul; Diaz-Arrastia, Ramon
2010-03-01
C-reactive protein (CRP) is an acute-phase reactant that has been found to be associated with Alzheimer disease (AD) in histopathological and longitudinal studies; however, little data exist regarding serum CRP levels in patients with established AD. The current study evaluated CRP levels in 192 patients diagnosed with probable AD (mean age = 75.8 +/- 8.2 years; 50% female) as compared to 174 nondemented controls (mean age = 70.6 +/- 8.2 years; 63% female). Mean CRP levels were found to be significantly decreased in AD (2.9 microg/mL) versus controls (4.9 microg/mL; P = .003). In adjusted models, elevated CRP significantly predicted poorer (elevated) Clinical Dementia Rating Scale sum of boxes (CDR SB) scores in patients with AD. In controls, CRP was negatively associated with Mini-Mental State Examination (MMSE) scores and positively associated with CDR SB scores. These findings, together with previously published results, are consistent with the hypothesis that midlife elevations in CRP are associated with increased risk of AD development though elevated CRP levels are not useful for prediction in the immediate prodrome years before AD becomes clinically manifest. However, for a subgroup of patients with AD, elevated CRP continues to predict increased dementia severity suggestive of a possible proinflammatory endophenotype in AD.
Decreased C-Reactive Protein Levels in Alzheimer Disease
O’Bryant, Sid E.; Waring, Stephen C.; Hobson, Valerie; Hall, James R.; Moore, Carol B.; Bottiglieri, Teodoro; Massman, Paul; Diaz-Arrastia, Ramon
2011-01-01
C-reactive protein (CRP) is an acute-phase reactant that has been found to be associated with Alzheimer disease (AD) in histo-pathological and longitudinal studies; however, little data exist regarding serum CRP levels in patients with established AD. The current study evaluated CRP levels in 192 patients diagnosed with probable AD (mean age = 75.8 ± 8.2 years; 50% female) as compared to 174 nondemented controls (mean age = 70.6 ± 8.2 years; 63% female). Mean CRP levels were found to be significantly decreased in AD (2.9 µg/mL) versus controls (4.9 µg/mL; P = .003). In adjusted models, elevated CRP significantly predicted poorer (elevated) Clinical Dementia Rating Scale sum of boxes (CDR SB) scores in patients with AD. In controls, CRP was negatively associated with Mini-Mental State Examination (MMSE) scores and positively associated with CDR SB scores. These findings, together with previously published results, are consistent with the hypothesis that midlife elevations in CRP are associated with increased risk of AD development though elevated CRP levels are not useful for prediction in the immediate prodrome years before AD becomes clinically manifest. However, for a subgroup of patients with AD, elevated CRP continues to predict increased dementia severity suggestive of a possible proinflammatory endophenotype in AD. PMID:19933496
Villoutreix, B O; Härdig, Y; Wallqvist, A; Covell, D G; García de Frutos, P; Dahlbäck, B
1998-06-01
C4b-binding protein (C4BP) contributes to the regulation of the classical pathway of the complement system and plays an important role in blood coagulation. The main human C4BP isoform is composed of one beta-chain and seven alpha-chains essentially built from three and eight complement control protein (CCP) modules, respectively, followed by a nonrepeat carboxy-terminal region involved in polymerization of the chains. C4BP is known to interact with heparin, C4b, complement factor I, serum amyloid P component, streptococcal Arp and Sir proteins, and factor VIII/VIIIa via its alpha-chains and with protein S through its beta-chain. The principal aim of the present study was to localize regions of C4BP involved in the interaction with C4b, Arp, and heparin. For this purpose, a computer model of the 8 CCP modules of C4BP alpha-chain was constructed, taking into account data from previous electron microscopy (EM) studies. This structure was investigated in the context of known and/or new experimental data. Analysis of the alpha-chain model, together with monoclonal antibody studies and heparin binding experiments, suggests that a patch of positively charged residues, at the interface between the first and second CCP modules, plays an important role in the interaction between C4BP and C4b/Arp/Sir/heparin. Putative binding sites, secondary-structure prediction for the central core, and an overall reevaluation of the size of the C4BP molecule are also presented. An understanding of these intermolecular interactions should contribute to the rational design of potential therapeutic agents aiming at interfering specifically some of these protein-protein interactions.
Arya, Gitanjali; Niven, Donald F
2011-03-24
Members of the Actinobacillus minor/"porcitonsillarum" complex are common inhabitants of the swine respiratory tract. Although avirulent or of low virulence for pigs, these organisms, like pathogens, do grow in vivo and must, therefore, be able to acquire iron within the host. Here, we investigated the abilities of six members of the A. minor/"porcitonsillarum" complex to acquire iron from transferrin and various haemoglobins. Using growth assays, all six strains were shown to acquire iron from porcine, bovine and human haemoglobins but not from porcine transferrin. Analyses of whole genome sequences revealed that A. minor strains NM305(T) and 202, unlike the swine-pathogenic actinobacilli, A. pleuropneumoniae and A. suis, lack not only the transferrin-binding protein genes, tbpA and tbpB, but also the haemoglobin-binding protein gene, hgbA. Strains NM305(T) and 202, however, were found to possess other putative haemin/haemoglobin-binding protein genes that were predicted to encode mature proteins of ∼ 72 and ∼ 75 kDa, respectively. An affinity procedure based on haemin-agarose allowed the isolation of ∼ 65 and ∼ 67 kDa iron-repressible outer membrane polypeptides from membranes derived from strains NM305(T) and 202, respectively, and mass spectrometry revealed that these polypeptides were the products of the putative haemin/haemoglobin-binding protein genes. PCR approaches allowed the amplification and sequencing of homologues of both haemin/haemoglobin-binding protein genes from each of the other four strains, strains 33PN and 7ATS of the A. minor/"porcitonsillarum" complex and "A. porcitonsillarum" strains 9953L55 and 0347, suggesting that such proteins are involved in the utilization of haemoglobin-bound iron, presumably as surface receptors, by all six strains investigated. Copyright © 2010 Elsevier B.V. All rights reserved.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Singh, Mahavir; Wang, Zhonghua; Cascio, Duilio
Shq1 is an essential protein involved in the early steps of biogenesis and assembly of H/ACA ribonucleoprotein particles (RNPs). Shq1 binds to dyskerin (Cbf5 in yeast) at an early step of H/ACA RNP assembly and is subsequently displaced by the H/ACA RNA. Shq1 contains an N-terminal CS and a C-terminal Shq1-specific domain (SSD). Dyskerin harbors many mutations associated with dyskeratosis congenita. Structures of yeast Shq1 SSD bound to Cbf5 revealed that only a subset of these mutations is in the SSD binding site, implicating another subset in the putative CS binding site. Here in this paper, we present the crystalmore » structure of human Shq1 CS (hCS) and the nuclear magnetic resonance (NMR) and crystal structures of hCS containing a serine substitution for proline 22 that is associated with some prostate cancers. The structure of hCS is similar to yeast Shq1 CS domain (yCS) and consists of two β-sheets that form an immunoglobulin-like β-sandwich fold. The N-terminal affinity tag sequence AHHHHHH associates with a neighboring protein in the crystal lattice to form an extra β-strand. Deletion of this tag was required to get spectra suitable for NMR structure determination, while the tag was required for crystallization. NMR chemical shift perturbation (CSP) experiments with peptides derived from putative CS binding sites on dyskerin and Cbf5 revealed a conserved surface on CS important for Cbf5/dyskerin binding. A HADDOCK (high-ambiguity-driven protein-protein docking) model of a Shq1-Cbf5 complex that defines the position of CS domain in the pre-H/ACA RNP was calculated using the CSP data.« less
Zuotin, a putative Z-DNA binding protein in Saccharomyces cerevisiae
NASA Technical Reports Server (NTRS)
Zhang, S.; Lockshin, C.; Herbert, A.; Winter, E.; Rich, A.
1992-01-01
A putative Z-DNA binding protein, named zuotin, was purified from a yeast nuclear extract by means of a Z-DNA binding assay using [32P]poly(dG-m5dC) and [32P]oligo(dG-Br5dC)22 in the presence of B-DNA competitor. Poly(dG-Br5dC) in the Z-form competed well for the binding of a zuotin containing fraction, but salmon sperm DNA, poly(dG-dC) and poly(dA-dT) were not effective. Negatively supercoiled plasmid pUC19 did not compete, whereas an otherwise identical plasmid pUC19(CG), which contained a (dG-dC)7 segment in the Z-form was an excellent competitor. A Southwestern blot using [32P]poly(dG-m5dC) as a probe in the presence of MgCl2 identified a protein having a molecular weight of 51 kDa. The 51 kDa zuotin was partially sequenced at the N-terminal and the gene, ZUO1, was cloned, sequenced and expressed in Escherichia coli; the expressed zuotin showed similar Z-DNA binding activity, but with lower affinity than zuotin that had been partially purified from yeast. Zuotin was deduced to have a number of potential phosphorylation sites including two CDC28 (homologous to the human and Schizosaccharomyces pombe cdc2) phosphorylation sites. The hexapeptide motif KYHPDK was found in zuotin as well as in several yeast proteins, DnaJ of E.coli, csp29 and csp32 proteins of Drosophila and the small t and large T antigens of the polyoma virus. A 60 amino acid segment of zuotin has similarity to several histone H1 sequences. Disruption of ZUO1 in yeast resulted in a slow growth phenotype.
González De León, Joenice; González Méndez, Ricardo; Cadilla, Carmen L; Rivera-Mariani, Félix E; Bolaños-Rosero, Benjamín
2018-01-01
Aspergillus penicillioides is a very common indoor xerophilic fungus and potential causative agent of respiratory conditions. Although people are constantly exposed to A. penicillioides, no proteins with allergenic potential have been described. Therefore, we aim to confirm allergic sensitization to A. penicillioides through reactivity in serological assays and detect immunoglobulin E (IgE)-binding proteins. In an indirect ELISA, we compared the serological reactivity to A. penicillioides between subjects with specific IgE (sIgE) (group 1, n = 54) and no sIgE reactivity (group 2, n = 15) against commercial allergens. Correlations and principal component analysis were performed to identify associations between reactivity to commercial allergens and A. penicillioides. IgE-binding proteins in A. penicillioides were visualized using Western blotting (WB) in group 1. The IgE-binding proteins with the highest reactivity were analyzed by mass spectrometry and confirmed by transcript matching. There was no statistical significance (p = 0.1656) between the study groups in serological reactivity. Correlations between reactivity to A. penicillioides, dog epithelia, Aspergillus fumigatus, and Penicillium chrysogenum were observed. WB experiments showed 6 IgE-binding proteins with molecular weights ranging from 45 to 145 kDa. Proteins of 108, 83, and 56 kDa showed higher reactivity. Mass spectrometry analysis of these 3 proteins led to the putative identification of NADP-specific glutamate dehydrogenase and catalase B. This was confirmed with transcriptome analysis. These results provide evidence of the presence of potential allergenic components in A. penicillioides. Further analysis of the putatively identified proteins should reveal their allergenic potential. © 2018 S. Karger AG, Basel.
Structure and Interactions of the CS Domain of Human H/ACA RNP Assembly Protein Shq1
Singh, Mahavir; Wang, Zhonghua; Cascio, Duilio; ...
2014-12-29
Shq1 is an essential protein involved in the early steps of biogenesis and assembly of H/ACA ribonucleoprotein particles (RNPs). Shq1 binds to dyskerin (Cbf5 in yeast) at an early step of H/ACA RNP assembly and is subsequently displaced by the H/ACA RNA. Shq1 contains an N-terminal CS and a C-terminal Shq1-specific domain (SSD). Dyskerin harbors many mutations associated with dyskeratosis congenita. Structures of yeast Shq1 SSD bound to Cbf5 revealed that only a subset of these mutations is in the SSD binding site, implicating another subset in the putative CS binding site. Here in this paper, we present the crystalmore » structure of human Shq1 CS (hCS) and the nuclear magnetic resonance (NMR) and crystal structures of hCS containing a serine substitution for proline 22 that is associated with some prostate cancers. The structure of hCS is similar to yeast Shq1 CS domain (yCS) and consists of two β-sheets that form an immunoglobulin-like β-sandwich fold. The N-terminal affinity tag sequence AHHHHHH associates with a neighboring protein in the crystal lattice to form an extra β-strand. Deletion of this tag was required to get spectra suitable for NMR structure determination, while the tag was required for crystallization. NMR chemical shift perturbation (CSP) experiments with peptides derived from putative CS binding sites on dyskerin and Cbf5 revealed a conserved surface on CS important for Cbf5/dyskerin binding. A HADDOCK (high-ambiguity-driven protein-protein docking) model of a Shq1-Cbf5 complex that defines the position of CS domain in the pre-H/ACA RNP was calculated using the CSP data.« less
Chan, Pei-Chi; Wang, Ya-Chin; Chen, Yi-Ling; Hsu, Wan-Ning; Tian, Yu-Feng; Hsieh, Po-Shiuan
2017-11-01
Elevations in C-reactive protein (CRP) levels are positively correlated with the progress of type 2 diabetes mellitus. However, the effect of CRP on pancreatic insulin secretion is unknown. Here, we showed that purified human CRP impaired insulin secretion in isolated mouse islets and NIT-1 insulin-secreting cells in dose- and time-dependent manners. CRP increased NADPH oxidase-mediated ROS (reactive oxygen species) production, which simultaneously promoted the production of nitrotyrosine (an indicator of RNS, reactive nitrogen species) and TNFα, to diminish cell viability, insulin secretion in islets and insulin-secreting cells. These CRP-mediated detrimental effects on cell viability and insulin secretion were significantly reversed by adding NAC (a potent antioxidant), apocynin (a selective NADPH oxidase inhibitor), L-NAME (a non-selective nitric oxide synthase (NOS) inhibitor), aminoguanidine (a selective iNOS inhibitor), PDTC (a selective NFκB inhibitor) or Enbrel (an anti-TNFα fusion protein). However, CRP-induced ROS production failed to change after adding L-NAME, aminoguanidine or PDTC. In isolated islets and NIT-1 cells, the elevated nitrotyrosine contents by CRP pretreatment were significantly suppressed by adding L-NAME but not PDTC. Conversely, CRP-induced increases in TNF-α production were significantly reversed by administration of PDTC but not L-NAME. In addition, wild-type mice treated with purified human CRP showed significant decreases in the insulin secretion index (HOMA-β cells) and the insulin stimulation index in isolated islets that were reversed by the addition of L-NAME, aminoguanidine or NAC. It is suggested that CRP-activated NADPH-oxidase redox signaling triggers iNOS-mediated RNS and NFκB-mediated proinflammatory cytokine production to cause β cell damage in state of inflammation. Copyright © 2017 Elsevier Inc. All rights reserved.
[Clinical Values of Combined Detection of CRP and D-D for AL Patients Complicated with DIC].
Ji, Xue-Hong
2015-12-01
To explore the clinical values of the combined detection of C-reactive protein (CRP) and D-dimer (D-D) for acute leukemia (AL) patients complicated with disseminated intravascular coagulation (DIC). Among 52 cases of AL, 20 cases of AL complicated with DIC were selected as AL+DIC group, 32 cases of AL were selected as AL group, 30 healthy volunteers were used as control group; the detected values of CRP and D-D in 3 groups were compared. The CRP and D-D levels in AL+DIC group were significantly higher than those in AL and control groups (P < 0.05); the CRP and D-D levels in AL group were significatly higher than those in control group (P < 0.05). The D-D level and complicated DIC rate in patients with CRP < 10 mg/L were significantly lower than those in patients with CRP 10-100 and >100 mg/L (P <0.05), while the D-D level and complicated DIC rate in patients with 10-100 mg/L were significantly lower than those in patients with CRP > 100 mg/L (P <0.05). After treatment of patients, the CRP and D-D levels in AL and AL+DIC groups were obviously reduced as compared with levels of these 2 groups before treatment (P <0.05); the CRP and D-D levels in AL+DIC after treatment were significantly higher than those in AL group (P <0.05). The combined detection of CRP and D-D possesses a higher reference value for diagnosis and differentiation of AL and AL complicated with DIC, thus also has an important role in evaluation of therapeutic efficacy of AL.
Jun, Ji Hye; Choi, Jong Ho; Bae, Si Hyun; Oh, Seh Hoon; Kim, Gi Jin
2016-09-01
Chronic liver disease leads to liver fibrosis, and although the liver does have a certain regenerative capacity, this disease is associated with dysfunction of the liver vessels. C-reactive protein (CRP) is produced in the liver and circulated from there for metabolism. CRP was recently shown to inhibit angiogenesis by inducing endothelial cell dysfunction. The objective of this study was to determine the effect of CRP levels on angiogenesis in a rat model of liver dysfunction induced by bile duct ligation (BDL). The diameter of the hepatic vein was analyzed in rat liver tissues using hematoxylin and eosin (H&E) staining. The expression levels of angiogenic factors, albumin, and CRP were analyzed by real-time PCR and Western blotting. A tube formation assay was performed to confirm the effect of CRP on angiogenesis in human umbilical vein endothelial cells (HUVECs) treated with lithocholic acid (LCA) and siRNA-CRP. The diameter of the hepatic portal vein increased significantly with the progression of cirrhosis. The expression levels of angiogenic factors were increased in the cirrhotic liver. In contrast, the expression levels of albumin and CRP were significantly lower in the liver tissue obtained from the BDL rat model than in the normal liver. The CRP level was correlated with the expression of albumin in hepatocytes treated with LCA and siRNA-CRP. Tube formation was significantly decreased in HUVECs when they were treated with LCA or a combination of LCA and siRNA-CRP. CRP seems to be involved in the abnormal formation of vessels in hepatic disease, and so it could be a useful diagnostic marker for hepatic disease.
Liu, Shou-Hsuan; Chen, Chao-Yu; Li, Yi-Jung; Wu, Hsin-Hsu; Lin, Chan-Yu; Chen, Yung-Chang; Chang, Ming-Yang; Hsu, Hsiang-Hao; Ku, Cheng-Lung; Tian, Ya-Chung
2017-01-01
C-reactive protein (CRP) is a useful biomarker for prediction of long-term outcomes in patients undergoing chronic dialysis. This observational cohort study evaluated whether the time-averaged serum high-sensitivity CRP (HS-CRP) level was a better predictor of clinical outcomes than a single HS-CRP level in patients undergoing peritoneal dialysis (PD). We classified 335 patients into three tertiles according to the time-averaged serum HS-CRP level and followed up regularly from January 2010 to December 2014. Clinical outcomes such as cardiovascular events, infection episodes, newly developed malignancy, encapsulating peritoneal sclerosis (EPS), dropout (death plus conversion to hemodialysis), and mortality were assessed. During a 5-year follow-up, 164 patients (49.0%) ceased PD; this included 52 patient deaths (15.5%), 100 patients (29.9%) who converted to hemodialysis, and 12 patients (3.6%) who received a kidney transplantation. The Kaplan-Meier survival analysis and log-rank test revealed a significantly worse survival accumulation in patients with high time-average HS-CRP levels. A multivariate Cox regression analysis revealed that a higher time-averaged serum HS-CRP level, older age, and the occurrence of cardiovascular events were independent mortality predictors. A higher time-averaged serum HS-CRP level, the occurrence of cardiovascular events, infection episodes, and EPS were important predictors of dropout. The receiver operating characteristic analysis verified that the value of the time-average HS-CRP level in predicting the 5-year mortality and dropout was superior to a single serum baseline HS-CRP level. This study shows that the time-averaged serum HS-CRP level is a better marker than a single baseline measurement in predicting the 5-year mortality and dropout in PD patients.
Le, Tham; O’Brien, Katherine L.; Murdoch, David R.; Prosperi, Christine; Baggett, Henry C.; Brooks, W. Abdullah; Feikin, Daniel R.; Hammitt, Laura L.; Howie, Stephen R. C.; Kotloff, Karen L.; Levine, Orin S.; Scott, J. Anthony G.; Thea, Donald M.; Awori, Juliet O.; Baillie, Vicky L.; Cascio, Stephanie; Chuananon, Somchai; DeLuca, Andrea N.; Driscoll, Amanda J.; Ebruke, Bernard E.; Endtz, Hubert P.; Kaewpan, Anek; Kahn, Geoff; Karani, Angela; Karron, Ruth A.; Moore, David P.; Park, Daniel E.; Rahman, Mohammed Ziaur; Salaudeen, Rasheed; Seidenberg, Phil; Somwe, Somwe Wa; Sylla, Mamadou; Tapia, Milagritos D.; Zeger, Scott L.; Deloria Knoll, Maria; Madhi, Shabir A.; O’Brien, Katherine L.; Levine, Orin S.; Knoll, Maria Deloria; Feikin, Daniel R.; DeLuca, Andrea N.; Driscoll, Amanda J.; Fancourt, Nicholas; Fu, Wei; Hammitt, Laura L.; Higdon, Melissa M.; Kagucia, E. Wangeci; Karron, Ruth A.; Li, Mengying; Park, Daniel E.; Prosperi, Christine; Wu, Zhenke; Zeger, Scott L.; Watson, Nora L.; Crawley, Jane; Murdoch, David R.; Brooks, W. Abdullah; Endtz, Hubert P.; Zaman, Khalequ; Goswami, Doli; Hossain, Lokman; Jahan, Yasmin; Ashraf, Hasan; Howie, Stephen R. C.; Ebruke, Bernard E.; Antonio, Martin; McLellan, Jessica; Machuka, Eunice; Shamsul, Arifin; Zaman, Syed M.A.; Mackenzie, Grant; Scott, J. Anthony G.; Awori, Juliet O.; Morpeth, Susan C.; Kamau, Alice; Kazungu, Sidi; Ominde, Micah Silaba; Kotloff, Karen L.; Tapia, Milagritos D.; Sow, Samba O.; Sylla, Mamadou; Tamboura, Boubou; Onwuchekwa, Uma; Kourouma, Nana; Toure, Aliou; Madhi, Shabir A.; Moore, David P.; Adrian, Peter V.; Baillie, Vicky L.; Kuwanda, Locadiah; Mudau, Azwifarwi; Groome, Michelle J.; Mahomed, Nasreen; Baggett, Henry C.; Thamthitiwat, Somsak; Maloney, Susan A.; Bunthi, Charatdao; Rhodes, Julia; Sawatwong, Pongpun; Akarasewi, Pasakorn; Thea, Donald M.; Mwananyanda, Lawrence; Chipeta, James; Seidenberg, Phil; Mwansa, James; Wa Somwe, Somwe; Kwenda, Geoffrey; Anderson, Trevor P.; Mitchell, Joanne
2017-01-01
Abstract Background. Lack of a gold standard for identifying bacterial and viral etiologies of pneumonia has limited evaluation of C-reactive protein (CRP) for identifying bacterial pneumonia. We evaluated the sensitivity and specificity of CRP for identifying bacterial vs respiratory syncytial virus (RSV) pneumonia in the Pneumonia Etiology Research for Child Health (PERCH) multicenter case-control study. Methods. We measured serum CRP levels in cases with World Health Organization–defined severe or very severe pneumonia and a subset of community controls. We evaluated the sensitivity and specificity of elevated CRP for “confirmed” bacterial pneumonia (positive blood culture or positive lung aspirate or pleural fluid culture or polymerase chain reaction [PCR]) compared to “RSV pneumonia” (nasopharyngeal/oropharyngeal or induced sputum PCR-positive without confirmed/suspected bacterial pneumonia). Receiver operating characteristic (ROC) curves were constructed to assess the performance of elevated CRP in distinguishing these cases. Results. Among 601 human immunodeficiency virus (HIV)–negative tested controls, 3% had CRP ≥40 mg/L. Among 119 HIV-negative cases with confirmed bacterial pneumonia, 77% had CRP ≥40 mg/L compared with 17% of 556 RSV pneumonia cases. The ROC analysis produced an area under the curve of 0.87, indicating very good discrimination; a cut-point of 37.1 mg/L best discriminated confirmed bacterial pneumonia (sensitivity 77%) from RSV pneumonia (specificity 82%). CRP ≥100 mg/L substantially improved specificity over CRP ≥40 mg/L, though at a loss to sensitivity. Conclusions. Elevated CRP was positively associated with confirmed bacterial pneumonia and negatively associated with RSV pneumonia in PERCH. CRP may be useful for distinguishing bacterial from RSV-associated pneumonia, although its role in discriminating against other respiratory viral-associated pneumonia needs further study. PMID:28575375
Shapiro, Adrienne E; Hong, Ting; Govere, Sabina; Thulare, Hilary; Moosa, Mahomed-Yunus; Dorasamy, Afton; Wallis, Carole L; Celum, Connie L; Grosset, Jacques; Drain, Paul K
2018-05-28
There is an urgent need for more accurate screening tests for tuberculosis(TB). We assessed the diagnostic accuracy of C-reactive protein (CRP) as a screening test for active TB in HIV-infected ambulatory adults. CRP levels were measured in blood collected at the time of HIV testing.Diagnostic accuracy of CRP for pulmonary TB was calculated (reference standard: TB culture), compared to the WHO 4-symptom screen, consisting of cough, fever, night sweats, and weight loss. Diagnostic accuracy was also calculated for CRP in a larger cohort of HIV-infected adults with a positive symptom screen (reference standard: clinical or microbiological TB). Among 425 HIV-infected outpatients systematically tested for pulmonary TB, TB culture was positive in 42 (10%), 279 (66%) had at least one TB-related symptom and 197 (46%) had a CRP >5 mg/L. The sensitivity of CRP and the TB symptom screen to detect TB was the same (90.5%; 95%CI 77.4-97.3) but specificity of CRP was higher than for the TB symptom screen (58.5% vs. 37.1%, p<0.001). Of persons with no symptoms and normal CRP, 99 (98%) had no TB. In another cohort of 749 patients presenting with at least one TB-related symptom and clinically evaluated, CRP had a sensitivity of 98.7% and specificity of 48.3%. In HIV-infected outpatients, CRP was as sensitive but substantially more specific than TB symptom screening. Use of CRP as a screening tool to exclude active TB could identify the same number of HIV-associated TB cases, but reduce the use of diagnostic sputum testing in TB-endemic regions.
Wu, Qiong; Nie, Jun; Wu, Fu-Xia; Zou, Xiu-Lan; Chen, Feng-Yi
2017-03-30
BACKGROUND To investigate the prognostic value of procalcitonin (PCT), high-sensitivity C-reactive protein (hs-CRP), and pancreatic stone protein (PSP) in children with sepsis. MATERIAL AND METHODS A total of 214 patients with sepsis during hospitalization were enrolled. Serum levels of PCT, hs-CRP, and PSP were measured on day 1 of hospitalization and the survival rates of children were recorded after a follow-up of 28 days. Pearson's correlation analysis was conducted to test the association of PCT, hs-CRP, and PSP with pediatric critical illness score (PCIS). Logistic regression models were used to analyze the risk factors contributing to patients' death. The AUC was used to determine the value of PCT, hs-CRP, and PSP in the prognosis of patients with sepsis. RESULTS The expression of PCT, hs-CRP, and PSP in the dying patients was higher than in the surviving patients (p<0.001). Pearson's correlation analysis showed that serum PCT, hs-CRP, and PSP levels were negatively correlated with PCIS (p<0.001). Multivariate logistic regression revealed that PCT, hs-CRP, and PSP were independent risk factors for the prognosis of patients with sepsis (p<0.001). ROC analysis showed the AUC values of PCT, hs-CRP, and PSP were 0.83 (95% CI, 0.77-0.88), 0.76 (95% CI, 0.70-0.82), and 0.73 (95% CI, 0.67-0.79), respectively. The combined AUC value of PCT, hs-CRP, and PSP, was 0.92 (95% CI, 0.87-0.95), which was significantly increased compared with PCT, hs-CRP, or PSP (p<0.001). CONCLUSIONS The combination of serum PCT, hs-CRP, and PSP represents a promising biomarker of risk, and is a useful clinical tool for risk stratification of children with sepsis.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Hellwinckel, Chad; Clark, Christopher; Langholtz, Matthew
We used a socioeconomic model to estimate the land-use implications on the U.S. Conservation Reserve Program from potential increases in second-generation biofuel production. A baseline scenario with no second-generation biofuel production is compared to a scenario where the Renewable Fuels Standard (RFS2) volumes are met by 2022. We allow for the possibility of converting expiring CRP lands to alternative uses such as conventional crops, dedicated second-generation biofuel crops, or harvesting existing CRP grasses for biomass. Our results indicate that RFS2 volumes (RFS2-v) can be met primarily with crop residues (78% of feedstock demand) and woody residues (19% of feedstock demand)more » compared with dedicated biomass (3% of feedstock demand), with only minimal conversion of cropland (0.27 million hectares, <1% of total cropland), pastureland (0.28 million hectares of pastureland, <1% of total pastureland), and CRP lands (0.29 million hectares of CRP lands, 3% of existing CRP lands) to biomass production. Meeting RFS2 volumes would reduce CRP re-enrollment by 0.19 million hectares, or 4%, below the baseline scenario where RFS2 is not met. Yet under RFS2-v scenario, expiring CRP lands are more likely to be converted to or maintain perennial cover, with 1.78 million hectares of CRP lands converting to hay production, and 0.29 million hectares being harvested for existing grasses. A small amount of CRP is harvested for existing biomass, but no conversion of CRP to dedicated biomass crops, such as switchgrass, are projected to occur. Although less land is enrolled in CRP under RFS2-v scenario, total land in perennial cover increases by 0.15 million hectares, or 2%, under RFS2-v. Sensitivity to yield, payment and residue retention assumptions are evaluated.« less
DOE Office of Scientific and Technical Information (OSTI.GOV)
Yuan, Guoyue, E-mail: yuanguoyue@hotmail.com; Jia, Jue; Di, Liangliang
Highlights: Black-Right-Pointing-Pointer CRP increases TNF-{alpha} and IL-6 genes expression in matured 3T3-L1 adipocytes. Black-Right-Pointing-Pointer CRP suppresses adiponectin, leptin and PPAR-{gamma} mRNA levels in matured 3T3-L1 cells. Black-Right-Pointing-Pointer Wortmannin reverses effects of CRP on adiponectin, TNF-{alpha} and leptin mRNA levels. Black-Right-Pointing-Pointer CRP may regulate IR, obesity and metabolic syndrome by this mechanism. -- Abstract: Adipose tissue is now recognized to be an important endocrine organ, secreting a variety of adipokines that are involved in the regulation of energy metabolism, insulin resistance and metabolic syndrome. C-reactive protein (CRP) is considered as one of the most sensitive markers of inflammation. A number ofmore » studies have shown that elevation of CRP concentrations is an independent predictive parameter of type 2 diabetes mellitus, which is also strongly associated with various components of the metabolic syndrome. The aim of the present study is to investigate the effects of CRP on adipokines genes expression in 3T3-L1 adipocytes. Quantitative real-time PCR analysis revealed that CRP inhibited adiponectin, leptin and peroxisome proliferator-activated receptor-gamma (PPAR-{gamma}) genes expression and raised tumor necrosis factor-{alpha} (TNF-{alpha}) and interleukin-6 (IL-6) mRNA levels in matured 3T3-L1 adipocytes in a dose and time-dependent manner. Pharmacological inhibition of phosphatidylinositol (PI)-3 kinase by wortmannin partially reversed the effects of CRP on adiponectin, TNF-{alpha} and leptin genes expression. These results collectively suggest that CRP regulates adiponectin, TNF-{alpha}, leptin, IL-6 and PPAR-{gamma} genes expression, and that might represent a mechanism by which CRP regulates insulin resistance, obesity and metabolic syndrome.« less
Kordass, Ulrike; Carlson, Regina; Stein, Veronika Maria; Tipold, Andrea
2016-01-08
The purpose of this study was to prove the hypothesis that C-reactive protein (CRP) and nerve growth factor (NGF) may be potential biomarkers for lower urinary tract disorders and may be able to distinguish between micturition dysfunctions of different origin in dogs with spinal cord diseases. NGF- and CRP- concentrations were measured in serum and urine samples using specific ELISA-Kits. Results in urine were standardized by urine-creatinine levels. CRP in serum was detectable in 32/76 and in urine samples in 40/76 patients. NGF could be measured in all serum and in 70/76 urine samples. Urinary CRP concentrations were significantly higher in dogs with micturition dysfunction (p = 0.0009) and in dogs with different neurological diseases (p = 0.0020) compared to the control group. However, comparing dogs with spinal cord disorders with and without associated micturition dysfunction no significant difference could be detected for NGF and CRP values in urine or serum samples. Additionally, levels did not decrease significantly, when measured at the time when the dogs regained the ability to urinate properly (urinary NGF p = 0.7962; urinary CRP p = 0.078). Urine samples with bacteria and/or leukocytes had no significant increase in urinary NGF (p = 0.1112) or CRP (p = 0.0534) concentrations, but higher CRP-levels in urine from dogs with cystitis were found compared to dogs without signs of cystitis. From these data we conclude that neither CRP nor NGF in urine or serum can be considered as reliable biomarkers for micturition disorders in dogs with spinal cord disorders in a clinical setting, but their production might be part of the pathogenesis of such disorders. Significantly higher levels of CRP could be found in the urine of dogs with micturition dysfunctions compared to control dogs. This phenomenon could potentially be explained by unspecific extrahepatic CRP production by smooth muscle cells in the dilated bladder.
Eriksson, Ulrika K.; van Bodegom, David; May, Linda; Boef, Anna G. C.; Westendorp, Rudi G. J.
2013-01-01
Background C-reactive protein (CRP) levels are reported to be elevated in populations of African descent living in affluent environments compared to populations of European ancestry. However, the natural history of CRP levels in populations of African descent living under adverse environments remains largely unknown. Methods CRP levels were measured with a high sensitivity assay in 624 apparently healthy individuals who contributed blood as part of a study on innate immune responsiveness in a traditional Ghanaian population living under adverse environmental conditions in a malaria endemic area. As a comparison, we included CRP measurements from 2931 apparently healthy individuals from the Dutch population that were included in the same batch of CRP analyses. Associations between CRP and body mass index (BMI), immune responsiveness, and P. falciparum parasitaemia were investigated. Results In an age- and sex-adjusted model, CRP levels were 0.54 mg/L lower in the Ghanaian compared to the Dutch cohort (1.52 vs. 0.98 mg/L, p<0.001). When accounting for the substantially higher average BMI in the Dutch compared to the Ghanaians (25.6 vs. 18.4 kg/m2) the difference in CRP levels disappeared. BMI associated positively with CRP in the Dutch but not in the Ghanaians. In individuals with an acute phase response, CRP levels were higher in the Ghanaian compared to the Dutch cohort (24.6 vs. 17.3 mg/L, p = 0.04). Levels of CRP were positively related to immune responsiveness and P. falciparum parasitaemia (all p<0.001) among Ghanaians. Conclusions Our study demonstrates that West-Africans do not exhibit an inherently high inflammatory state. The role of genes, environment and gene-environment interaction in explaining reports of elevated CRP levels in populations of African ancestry when compared to other ethnicities living in affluent environments thus merits further investigation. PMID:23922912
Muhlestein, Joseph B; May, Heidi T; Galenko, Oxana; Knowlton, Kirk U; Otvos, James D; Connelly, Margery A; Lappe, Donald L; Anderson, Jeffrey L
2018-04-06
GlycA is an inflammatory marker that is raised in patients with cardiometabolic diseases and associated with cardiovascular (CV) events. We sought to determine if GlycA adds independent value to hsCRP for CV risk prediction. Patients in the Intermountain Heart Collaborative Study who underwent coronary angiography and had plasma GlycA and hsCRP levels were studied (n = 2996). Patients were followed for 7.0 ± 2.8 years. GlycA and hsCRP were moderately correlated (r = 0.46, P < .0001). GlycA and hsCRP concentrations were stratified into high and low categories by their median values. Multivariable cox hazard regression was utilized to determine the associations of GlycA quartiles, as well as high and low categories of GlycA and hsCRP, with major adverse cardiovascular events (MACE) defined as the composite of death, myocardial infarction (MI), heart failure (HF) hospitalization, and stroke. The highest GlycA quartile was associated with future MACE [HR: 1.43; 95% CI: 1.22-1.69; P < .0001]. Patients with high GlycA and high hsCRP had more diabetes, hyperlipidemia, hypertension, HF, renal failure and MI, but not coronary artery disease. High GlycA and hsCRP (H/H) versus low GlycA and hsCRP (L/L) was associated with MACE, death and HF hospitalization, but not MI or stroke. Combined MACE rates were 33.5%, 41.3%, 35.7% and 49.1% for L/L, L/H, H/L and H/H categories of GlycA/hsCRP, respectively (P-trend < .0001). The interaction between GlycA and hsCRP was significant for the outcome of death (P = .03). In this study, levels of GlycA and hsCRP were independent and additive markers of risk for MACE, death and HF hospitalization. Copyright © 2018. Published by Elsevier Inc.
Tamhane, Ashutosh; Redden, David T; McGwin, Gerald; Brown, Elizabeth E; Westfall, Andrew O; Reynolds, Richard J; Hughes, Laura B; Conn, Doyt L; Callahan, Leigh F; Jonas, Beth L; Smith, Edwin A; Brasington, Richard D; Moreland, Larry W; Bridges, S Louis
2013-11-01
The Disease Activity Score based on 28 joints (DAS28) has been increasingly used in clinical practice and research studies of rheumatoid arthritis (RA). Studies have reported discordance between DAS28 based on erythrocyte sedimentation rate (ESR) versus C-reactive protein (CRP) in patients with RA. However, such comparison is lacking in African Americans with RA. This analysis included participants from the Consortium for the Longitudinal Evaluation of African Americans with Early Rheumatoid Arthritis (CLEAR) registry, which enrolls self-declared African Americans with RA. Using tender and swollen joint counts, separate ESR-based and CRP-based DAS28 scores (DAS28-ESR3 and DAS28-CRP3) were calculated, as were DAS28-ESR4 and DAS28-CRP4, which included the patient's assessment of disease activity. The scores were compared using paired t-test, simple agreement and κ, correlation coefficient, and Bland-Altman plots. Of the 233 included participants, 85% were women, mean age at enrollment was 52.6 years, and median disease duration at enrollment was 21 months. Mean DAS28-ESR3 was significantly higher than DAS28-CRP3 (4.8 vs 3.9; p < 0.001). Similarly, mean DAS28-ESR4 was significantly higher than DAS28-CRP4 (4.7 vs 3.9; p < 0.001). ESR-based DAS28 remained higher than CRP-based DAS28 even when stratified by age, sex, and disease duration. Overall agreement was not high between DAS28-ESR3 and DAS28-CRP3 (50%) or between DAS28-ESR4 and DAS28-CRP4 (59%). DAS28-CRP3 underestimated disease activity in 47% of the participants relative to DAS28-ESR3 and DAS28-CRP4 in 40% of the participants relative to DAS28-ESR4. There was significant discordance between the ESR-based and CRP-based DAS28, a situation that could affect clinical treatment decisions for African Americans with RA.
Eriksson, Ulrika K; van Bodegom, David; May, Linda; Boef, Anna G C; Westendorp, Rudi G J
2013-01-01
C-reactive protein (CRP) levels are reported to be elevated in populations of African descent living in affluent environments compared to populations of European ancestry. However, the natural history of CRP levels in populations of African descent living under adverse environments remains largely unknown. CRP levels were measured with a high sensitivity assay in 624 apparently healthy individuals who contributed blood as part of a study on innate immune responsiveness in a traditional Ghanaian population living under adverse environmental conditions in a malaria endemic area. As a comparison, we included CRP measurements from 2931 apparently healthy individuals from the Dutch population that were included in the same batch of CRP analyses. Associations between CRP and body mass index (BMI), immune responsiveness, and P. falciparum parasitaemia were investigated. In an age- and sex-adjusted model, CRP levels were 0.54 mg/L lower in the Ghanaian compared to the Dutch cohort (1.52 vs. 0.98 mg/L, p<0.001). When accounting for the substantially higher average BMI in the Dutch compared to the Ghanaians (25.6 vs. 18.4 kg/m(2)) the difference in CRP levels disappeared. BMI associated positively with CRP in the Dutch but not in the Ghanaians. In individuals with an acute phase response, CRP levels were higher in the Ghanaian compared to the Dutch cohort (24.6 vs. 17.3 mg/L, p = 0.04). Levels of CRP were positively related to immune responsiveness and P. falciparum parasitaemia (all p<0.001) among Ghanaians. Our study demonstrates that West-Africans do not exhibit an inherently high inflammatory state. The role of genes, environment and gene-environment interaction in explaining reports of elevated CRP levels in populations of African ancestry when compared to other ethnicities living in affluent environments thus merits further investigation.
Patil, Veena A; Desai, Manthan H
2013-03-01
The aim of the present study was to evaluate the effect of periodontal therapy on serum C-reactive protein (CRP) levels in patients with gingivitis and chronic periodontitis. A total of 60 subjects (30 males and 30 females) were included in the study with 20 subjects in each of the groups classified based on community periodontal index (CPI) scores: I: Healthy, II: Gingivitis, III: Mild periodontitis. Periodontal therapy was performed on groups II and III patients. Venous blood was collected from each subject at baseline and 3 months after periodontal therapy. The collected sample was subjected to biochemical analysis to detect CRP levels by using immunoturbidimetric method. The present study demonstrated that the periodontitis group had a higher mean CRP levels (2.49 ± 0.47 ng/ml) as compared to the gingivitis group (1.40 ± 0.32 ng/ml) and healthy group (0.56 ± 0.20 ng/ml). The mean CRP values after periodontal therapy were found to be reduced to 0.44 ± 0.23 ng/ml in group II and 1.30 ± 0.36 ng/ml in group III patients. Within the limitations of this study, it can be concluded that CRP level progressively increases from periodontal health to disease. A decrease in CRP levels with periodontal treatment was also observed. Due to its opsonizing abilities CRP plays an important role in the innate host defence. It can be hypothesized that CRP is a potential biomarker of periodontal disease. A number of studies have reported elevated serum CRP levels in periodontitis subjects. Long standing periodontal disease and raised CRP levels enhance the risk of cardiovascular disease, cerebrovascular accidents and preterm low birth weight infants. There is also evidence that effective periodontal therapy can lower serum CRP levels. However, the data of interventional studies on CRP in gingivitis and periodontitis is scarce.
George, Cindy; Evans, Juliet; Micklesfield, Lisa K; Olsson, Tommy; Goedecke, Julia H
2018-01-01
High-sensitivity C-reactive protein (hsCRP) is associated with metabolic risk, however it is unclear whether the relationship is confounded by racial/ethnic differences in socioeconomic status (SES), lifestyle factors or central adiposity. The aims of the study was, (1) to investigate whether hsCRP levels differ by race/ethnicity; (2) to examine the race/ethnic-specific associations between hsCRP, HOMA-IR and serum lipids [total cholesterol (TC), triglycerides (TG), high-density lipoproteins (HDL-C) and low-density lipoproteins (LDL-C)]; and (3) to determine whether race/ethnic-specific associations are explained by SES, lifestyle factors or waist circumference (WC). The convenience sample comprised 195 black and 153 white apparently health women, aged 18-45 years. SES (education, assets and housing density) and lifestyle factors (alcohol use, physical activity and contraceptive use) were collected by questionnaire. Weight, height and WC were measured, and fasting blood samples collected for hsCRP, glucose, insulin, and lipids. Black women had higher age- and BMI-adjusted hsCRP levels than white women ( p = 0.047). hsCRP was associated with HOMA-IR ( p < 0.001), TG (p < 0.001), TC ( p < 0.05), HDL-C (p < 0.05), and LDL-C ( p < 0.05), independent of age and race/ethnicity. The association between hsCRP and lipids differed by race/ethnicity, such that hsCRP was positively associated with TG and LDL-C in white women, and inversely associated with HDL-C in black women. Higher hsCRP was also associated with higher TC in white women and lower TC in black women. Furthermore, when adjusting for SES and lifestyle factors, the associations between hsCRP, and TC and TG, remained, however the associations between hsCRP, and HDL-C and LDL-C, were no longer significant. Although circulating hsCRP may identify individuals at increased metabolic risk, the heterogeneity in these associations between racial/ethnic groups highlights the need for prospective studies investigating the role of hsCRP for risk prediction in different populations.
Kim, Jiyoung; Sung, Gi-Ho
2018-03-19
Beauvericin is a mycotoxin which has insecticidal, anti-microbial, anti-viral and anti-cancer activities. Beauvericin biosynthesis is rapidly catalyzed by the beauvericin synthetase (BEAS) in Beauveria bassiana. Ca 2+ plays crucial roles in multiple signaling pathways in eukaryotic cells. These Ca 2+ signals are partially decoded by Ca 2+ sensor calmodulin (CaM). In this report, we describe that B. bassiana BEAS (BbBEAS) can interact with CaM in a Ca 2+ -dependent manner. A synthetic BbBEAS peptide, corresponding to the putative CaM-binding motif, formed a stable complex with CaM in the presence of Ca 2+ . In addition, in vitro CaM-binding assay revealed that the His-tagged BbBEAS (amino acids 2421-2538) binds to CaM in a Ca 2+ -dependent manner. Therefore, this work suggests that BbBEAS is a novel CaM-binding protein in B. bassiana.
Non-B-DNA structures on the interferon-beta promoter?
Robbe, K; Bonnefoy, E
1998-01-01
The high mobility group (HMG) I protein intervenes as an essential factor during the virus induced expression of the interferon-beta (IFN-beta) gene. It is a non-histone chromatine associated protein that has the dual capacity of binding to a non-B-DNA structure such as cruciform-DNA as well as to AT rich B-DNA sequences. In this work we compare the binding affinity of HMGI for a synthetic cruciform-DNA to its binding affinity for the HMGI-binding-site present in the positive regulatory domain II (PRDII) of the IFN-beta promoter. Using gel retardation experiments, we show that HMGI protein binds with at least ten times more affinity to the synthetic cruciform-DNA structure than to the PRDII B-DNA sequence. DNA hairpin sequences are present in both the human and the murine PRDII-DNAs. We discuss in this work the presence of, yet putative, non-B-DNA structures in the IFN-beta promoter.
Structural Basis for Sialoglycan Binding by the Streptococcus sanguinis SrpA Adhesin*♦
Bensing, Barbara A.; Loukachevitch, Lioudmila V.; McCulloch, Kathryn M.; Yu, Hai; Vann, Kendra R.; Wawrzak, Zdzislaw; Anderson, Spencer; Chen, Xi; Sullam, Paul M.; Iverson, T. M.
2016-01-01
Streptococcus sanguinis is a leading cause of infective endocarditis, a life-threatening infection of the cardiovascular system. An important interaction in the pathogenesis of infective endocarditis is attachment of the organisms to host platelets. S. sanguinis expresses a serine-rich repeat adhesin, SrpA, similar in sequence to platelet-binding adhesins associated with increased virulence in this disease. In this study, we determined the first crystal structure of the putative binding region of SrpA (SrpABR) both unliganded and in complex with a synthetic disaccharide ligand at 1.8 and 2.0 Å resolution, respectively. We identified a conserved Thr-Arg motif that orients the sialic acid moiety and is required for binding to platelet monolayers. Furthermore, we propose that sequence insertions in closely related family members contribute to the modulation of structural and functional properties, including the quaternary structure, the tertiary structure, and the ligand-binding site. PMID:26833566
Correlation of CRP, fasting serum triglycerides and obesity as cardiovascular risk factors.
Firdous, Samar
2014-05-01
To determine the correlation of C-reactive protein (CRP) with fasting triglycerides (TG) among pre-obese and obese patients without established diagnosis of coronary artery disease (CAD). A comparative cross-sectional study. Mayo Hospital, Lahore, from January to June 2010. Patients with BMI > 23 kg/m2 aged between 18 - 65 years were inducted and above variables were studied. Patients with signs of fluid retention, collagen vascular disease, CAD, patients on corticosteroids, immunomodulators or lipid lowering medications and febrile patients were not recruited. Body mass index was also determined. Independent sample t-test was applied to see the mean difference of age, CRP level and triglycerides level in relation to gender. Chi-square test was used to see the association between qualitative variables. ANOVA was applied to see CRP and fasting serum TG level in relation to BMI categories. Pearson correlation and simple linear regression was applied to see the dependency of CRP and triglycerides with BMI. P-value ² 0.05 was taken as significant. Raised CRP was major finding among all groups of BMI. Most of obese and pre-obese patients were young and middle aged and belonged to pre-obese group followed by class-1 and class-2 obesity. CRP level increased with body mass index. No such trend was observed for triglycerides. There was an intermediate positive correlation between CRP and BMI and triglycerides and BMI showed a weak negative correlation. If BMI increases by 1 unit on the average, CRP rises by 0.239 times and this unit rise was significant. Whereas 1 unit rise increase in triglycerides on the average cause CRP to decrease -0.006 times but this value was insignificant. Raised CRP and high fasting TG were major findings in all age groups especially among young and middle aged people. Obesity, hypertriglyceridemia and raised CRP are interrelated suggesting that obesity is not only linked to hypertriglyceridemia but vascular inflammation among pre-obese and obese without overt diabetes mellitus causes high CRP as well and this can be used as a marker to predict the future risk of CAD. However, in the absence of dyslipidaemia, raised CRP can still be considered as a strong predictor of CAD and stroke.
Familial aggregation of circulating C-reactive protein in polycystic ovary syndrome.
Sasidevi, Arunachalam; Vellanki, Priyathama; Kunselman, Allen R; Raja-Khan, Nazia; Dunaif, Andrea; Legro, Richard S
2013-03-01
What is the heritability of C-reactive protein (CRP) levels in women with polycystic ovary syndrome (PCOS) and their first-degree relatives? Women with PCOS and their siblings are more likely to have elevated CRP levels when both of their parents have elevated CRP. This PCOS family-based study indicates that CRP levels are likely a heritable trait. Previous studies have established that an elevated blood level of CRP is variably present in women with PCOS, and may be present independent of metabolic status. A familial based phenotyping study consisting of 81 families comprised of PCOS patients and their first-degree relatives for 305 subjects. Study conducted at an academic health center. An elevated CRP level was defined as >28.6 nmol/l. To account for familial clustering, generalized estimating equations with a logit link were used to model the association between elevated CRP levels in patients with PCOS and their siblings with their parental group (A = neither parent with elevated CRP; B = one parent with elevated CRP; C= both parents with elevated CRP), adjusting for gender, age and BMI of the offspring. We did additional heritability analyses by using a variance component estimation method for CRP levels, adjusting for sex, age and BMI. We observed elevated CRP levels in 94% of the offspring in group C, 45% in group B and 10% in group A after adjusting for age, gender and BMI of the offspring. The median BMI of the offspring in group A, B and C were 30.0, 28.7 and 31.2 kg/m², respectively. Heritability estimates of CRP levels ranged from 0.75 to 0.83 and remained significant after excluding for type 2 diabetes mellitus. Our small sample size increases the possibility of a type 1 error. This is a single report in an adequately powered but limited sample size study identifying the strong heritability of CRP levels. Replication in other large family cohorts is necessary. These findings support the concept that there is an increased cardiovascular disease risk profile in families of women with PCOS. This research was supported by National Institutes of Health grants U54HD-034449 and P50 HD044405 (A.D.). Priyathama Vellanki is supported in part by NIH/NIDDK Training Grant T32 DK007169.
Determinants of anemia among young children in rural India.
Pasricha, Sant-Rayn; Black, James; Muthayya, Sumithra; Shet, Anita; Bhat, Vijay; Nagaraj, Savitha; Prashanth, N S; Sudarshan, H; Biggs, Beverley-Ann; Shet, Arun S
2010-07-01
More than 75% of Indian toddlers are anemic. Data on factors associated with anemia in India are limited. The objective of this study was to determine biological, nutritional, and socioeconomic risk factors for anemia in this vulnerable age group. We conducted a cross-sectional study of children aged 12 to 23 months in 2 rural districts of Karnataka, India. Children were excluded if they were unwell or had received a blood transfusion. Hemoglobin, ferritin, folate, vitamin B(12), retinol-binding protein, and C-reactive protein (CRP) levels were determined. Children were also tested for hemoglobinopathy, malaria infection, and hookworm infestation. Anthropometric measurements, nutritional intake, family wealth, and food security were recorded. In addition, maternal hemoglobin level was measured. Anemia (hemoglobin level < 11.0 g/dL) was detected in 75.3% of the 401 children sampled. Anemia was associated with iron deficiency (low ferritin level), maternal anemia, and food insecurity. Children's ferritin levels were directly associated with their iron intake and CRP levels and with maternal hemoglobin level and inversely associated with continued breastfeeding and the child's energy intake. A multivariate model for the child's hemoglobin level revealed associations with log(ferritin level) (coefficient: 1.20; P < .001), folate level (0.05; P < .01), maternal hemoglobin level (0.16; P < .001), family wealth index (0.02; P < .05), child's age (0.05 per month; P < .005), hemoglobinopathy (-1.51; P < .001), CRP level (-0.18; P < .001), and male gender (-0.38; P < .05). Wealth index and food insecurity could be interchanged in this model. Hemoglobin level was primarily associated with iron status in these Indian toddlers; however, maternal hemoglobin level, family wealth, and food insecurity were also important factors. Strategies for minimizing childhood anemia must include optimized iron intake but should simultaneously address maternal anemia, poverty, and food insecurity.
Karim, Roksana; Stanczyk, Frank Z.; Hodis, Howard N.; Cushman, Mary; Lobo, Roger A.; Hwang, Juliana; Mack, Wendy J.
2010-01-01
Objective Hormone therapy has been shown to reduce markers of vascular inflammation in postmenopausal women. C-reactive protein (CRP), a marker of generalized inflammation, is raised by oral estradiol therapy. It is not known how sex hormone concentrations relate to the markers of inflammation in postmenopausal women taking or not taking hormone therapy. Methods This observational study includes postmenopausal women participating in the Estrogen in the Prevention of Atherosclerosis Trial (EPAT). Multiple measures of serum sex hormone and sex hormone binding globulin (SHBG) levels from 107 postmenopausal women taking oral estradiol therapy (ET) and 109 taking placebo over 2 years were correlated with markers of inflammation over the same time period using generalized estimating equations. Results Levels of soluble intercellular adhesion molecule-1 (sICAM-1) were significantly inversely associated with estrone (p = 0.05), total and free estradiol (p = 0.008 and 0.02, respectively), and SHBG (p = 0.03) only among oral ET users. Serum homocysteine levels were also inversely associated with estrone (p = 0.0001), total and free estradiol (p = 0.0006 and 0.0009, respectively) in ET-treated women only. No such associations were observed among women taking placebo. C-reactive protein (CRP) was positively associated with estrogens and SHBG among women taking oral ET but inversely associated with SHBG among the placebo group. Conclusions The inverse associations of estrogens with sICAM-1, and homocysteine support an anti-inflammatory property of estrogen, which was only observed at pharmacologic levels in postmenopausal women. The positive associations between estrogens and CRP in the ET-treated women can be explained by the first-pass hepatic effect rather than a pro-inflammatory response. PMID:20632462
Genetic Loci Influencing C-reactive Protein Levels and Risk of Coronary Heart Disease
Elliott, Paul; Chambers, John C.; Zhang, Weihua; Clarke, Robert; Hopewell, Jemma C.; Peden, John F.; Erdmann, Jeanette; Braund, Peter; Engert, James C.; Bennett, Derrick; Coin, Lachlan; Ashby, Deborah; Tzoulaki, Ioanna; Brown, Ian J.; Mt-Isa, Shahrul; McCarthy, Mark I.; Peltonen, Leena; Freimer, Nelson B.; Farrall, Martin; Ruokonen, Aimo; Hamsten, Anders; Lim, Noha; Froguel, Philippe; Waterworth, Dawn M.; Vollenweider, Peter; Waeber, Gerard; Jarvelin, Marjo-Riitta; Mooser, Vincent; Scott, James; Hall, Alistair S.; Schunkert, Heribert; Anand, Sonia S.; Collins, Rory; Samani, Nilesh J.; Watkins, Hugh; Kooner, Jaspal S.
2009-01-01
Context: Plasma levels of C-reactive protein (CRP) are independently associated with risk of coronary heart disease, but whether CRP is causally associated with coronary heart disease or merely a marker of underlying atherosclerosis is uncertain. Objective: To investigate association of genetic loci with CRP levels and risk of coronary heart disease. Design, setting and participants: We first carried out a genome-wide association (n=17,967) and replication study (n=14,747) to identify genetic loci associated with plasma CRP concentrations. Data collection took place between 1989 and 2008 and genotyping between 2003 and 2008. We carried out a Mendelian randomisation study of the most closely associated SNP in the CRP locus and published data on other CRP variants involving a total of 28,112 cases and 100,823 controls, to investigate the association of CRP variants with coronary heart disease. We compared our finding with that predicted from meta-analysis of observational studies of CRP levels and risk of coronary heart disease. For the other loci associated with CRP levels, we selected the most closely associated SNP for testing against coronary heart disease among 14,365 cases and 32,069 controls. Main outcome measure: Risk of coronary heart disease. Results: Polymorphisms in five genetic loci were strongly associated with CRP levels (% difference per minor allele): SNP rs6700896 in LEPR (−14.7% [95% Confidence Interval {CI}], −17.5 – −11.9, P=1.6×10−21), rs4537545 in IL6R (−10.8% [95% CI, −13.8 – −7.7], P=5.1×10−11), rs7553007 in CRP locus (−20.7% [95% CI, −23.5 – −17.9], P=3.3×10−38), rs1183910 in HNF1A (−13.6% [95% CI, −16.4 – −10.6], P=1.2×10−17) and rs4420638 in APOE-CI-CII (−21.8% [95% CI, −25.4 – −18.1], P=2.1×10−25). Association of SNP rs7553007 in the CRP locus with coronary heart disease gave odds ratio (OR) 0.98 (95% CI, 0.94 – 1.01) per 20% lower CRP. Our Mendelian randomisation study of variants in the CRP locus showed no association with coronary heart disease: OR 1.00 (95% CI, 0.97 – 1.02) per 20% lower CRP, compared with OR 0.94 (95% CI, 0.94 – 0.95) predicted from meta-analysis of the observational studies of CRP levels and coronary heart disease (Z-score −3.45, P<.001). SNPs rs6700896 in LEPR (OR 1.06 [95% CI, 1.02 – 1.09] per minor allele), rs4537545 in IL6R (OR 0.94 [95% CI, 0.91 – 0.97]) and rs4420638 in the APOE-CI-CII cluster (OR 1.16 [95% CI, 1.12 – 1.21]) were all associated with risk of coronary heart disease. Conclusions: The lack of concordance between the effect on coronary heart disease risk of CRP genotypes and CRP levels argues against a causal association of CRP with coronary heart disease. PMID:19567438
Nuclear factor Y regulates ancient budgerigar hepadnavirus core promoter activity
DOE Office of Scientific and Technical Information (OSTI.GOV)
Shen, Zhongliang; Liu, Yanfeng; Luo, Mengjun
Endogenous viral elements (EVE) in animal genomes are the fossil records of ancient viruses and provide invaluable information on the origin and evolution of extant viruses. Extant hepadnaviruses include avihepadnaviruses of birds and orthohepadnaviruses of mammals. The core promoter (Cp) of hepadnaviruses is vital for viral gene expression and replication. We previously identified in the budgerigar genome two EVEs that contain the full-length genome of an ancient budgerigar hepadnavirus (eBHBV1 and eBHBV2). Here, we found eBHBV1 Cp and eBHBV2 Cp were active in several human and chicken cell lines. A region from nt −85 to −11 in eBHBV1 Cp was critical formore » the promoter activity. Bioinformatic analysis revealed a putative binding site of nuclear factor Y (NF-Y), a ubiquitous transcription factor, at nt −64 to −50 in eBHBV1 Cp. The NF-Y core binding site (ATTGG, nt −58 to −54) was essential for eBHBV1 Cp activity. The same results were obtained with eBHBV2 Cp and duck hepatitis B virus Cp. The subunit A of NF-Y (NF-YA) was recruited via the NF-Y core binding site to eBHBV1 Cp and upregulated the promoter activity. Finally, the NF-Y core binding site is conserved in the Cps of all the extant avihepadnaviruses but not of orthohepadnaviruses. Interestingly, a putative and functionally important NF-Y core binding site is located at nt −21 to −17 in the Cp of human hepatitis B virus. In conclusion, our findings have pinpointed an evolutionary conserved and functionally critical NF-Y binding element in the Cps of avihepadnaviruses. - Highlights: • Endogenous budgerigar hepadnavirus (eBHBV) core promoters (Cps) are active in cells. • NF-Y binding site exists in the Cps of eBHBVs and all the extant avihepadnaviruses. • NF-Y binding and mediated upregulation is critical for eBHBV Cp activity.« less
DOE Office of Scientific and Technical Information (OSTI.GOV)
Lee, Dong-Hwa; Ha, Ji-Hyang; Kim, Yul
Highlights: {yields} Identification of a conserved BH3 motif in C-terminal coiled coil region of nCLU. {yields} The nCLU BH3 domain binds to BH3 peptide-binding grooves in both Bcl-X{sub L} and Bcl-2. {yields} A conserved binding mechanism of nCLU BH3 and the other pro-apoptotic BH3 peptides with Bcl-X{sub L}. {yields} The absolutely conserved Leu323 and Asp328 of nCLU BH3 domain are critical for binding to Bcl-X{sub L.} {yields} Molecular understanding of the pro-apoptotic function of nCLU as a novel BH3-only protein. -- Abstract: Clusterin (CLU) is a multifunctional glycoprotein that is overexpressed in prostate and breast cancers. Although CLU is knownmore » to be involved in the regulation of apoptosis and cell survival, the precise molecular mechanism underlying the pro-apoptotic function of nuclear CLU (nCLU) remains unclear. In this study, we identified a conserved BH3 motif in C-terminal coiled coil (CC2) region of nCLU by sequence analysis and characterized the molecular interaction of the putative nCLU BH3 domain with anti-apoptotic Bcl-2 family proteins by nuclear magnetic resonance (NMR) spectroscopy. The chemical shift perturbation data demonstrated that the nCLU BH3 domain binds to pro-apoptotic BH3 peptide-binding grooves in both Bcl-X{sub L} and Bcl-2. A structural model of the Bcl-X{sub L}/nCLU BH3 peptide complex reveals that the binding mode is remarkably similar to those of other Bcl-X{sub L}/BH3 peptide complexes. In addition, mutational analysis confirmed that Leu323 and Asp328 of nCLU BH3 domain, absolutely conserved in the BH3 motifs of BH3-only protein family, are critical for binding to Bcl-X{sub L}. Taken altogether, our results suggest a molecular basis for the pro-apoptotic function of nCLU by elucidating the residue specific interactions of the BH3 motif in nCLU with anti-apoptotic Bcl-2 family proteins.« less
DOE Office of Scientific and Technical Information (OSTI.GOV)
Garzon, J.; Sanchez-Blazquez, P.; Lee, N.M.
1984-10-01
The binding of the putative kappa agonist ethylketocyclazocine (EKC) to synaptosomal membranes of mouse brain was studied. This benzomorphan was able to bind to different opioid receptors. A portion of this binding was not inhibited by the agonist naloxone, even at high concentrations (10 microM). This population of receptors, to which opioate alkaloids and opiod peptides display very low affinity, is probably the sigma receptor. Another class of binding sites was identified by the simultaneous addition of the selective agonists Sandoz FK-33824 and D-Ala2-D-Leu5-enkephalin, which blocked the access of EKC to mu and delta opioid receptors, respectively, leaving a portionmore » of naloxone-displaceable benzomorphan binding still detectable. Analysis of this remaining binding revealed a small population of receptors of high affinity, the kappa receptor. Therefore, EKC binds to the mu, delta, kappa and sigma receptors in the mouse brain, with similar affinities for the mu and kappa (0.22 and 0.15 nM). These results confirm the existence of a kappa opioid receptor type in the mouse brain.« less
Stirling, Aaron D; Moran, Neil R; Kelly, Michael E; Ridgway, Paul F; Conlon, Kevin C
2017-10-01
Using revised Atlanta classification defined outcomes, we compare absolute values in C-reactive protein (CRP), with interval changes in CRP, for severity stratification in acute pancreatitis (AP). A retrospective study of all first incidence AP was conducted over a 5-year period. Interval change in CRP values from admission to day 1, 2 and 3 was compared against the absolute values. Receiver-operator characteristic (ROC) curve and likelihood ratios (LRs) were used to compare ability to predict severe and mild disease. 337 cases of first incidence AP were included in our analysis. ROC curve analysis demonstrated the second day as the most useful time for repeat CRP measurement. A CRP interval change >90 mg/dL at 48 h (+LR 2.15, -LR 0.26) was equivalent to an absolute value of >150 mg/dL within 48 h (+LR 2.32, -LR 0.25). The optimal cut-off for absolute CRP based on new, more stringent definition of severity was >190 mg/dL (+LR 2.72, -LR 0.24). Interval change in CRP is a comparable measure to absolute CRP in the prognostication of AP severity. This study suggests a rise of >90 mg/dL from admission or an absolute value of >190 mg/dL at 48 h predicts severe disease with the greatest accuracy. Copyright © 2017 International Hepato-Pancreato-Biliary Association Inc. Published by Elsevier Ltd. All rights reserved.
Nienaber-Rousseau, Cornelie; Swanepoel, Bianca; Dolman, Robin C; Pieters, Marlien; Conradie, Karin R; Towers, G Wayne
2014-11-11
Inflammation, as indicated by C-reactive protein concentrations (CRP), is a risk factor for chronic diseases. Both genetic and environmental factors affect susceptibility to inflammation. As dietary interventions can influence inflammatory status, we hypothesized that dietary effects could be influenced by interactions with single nucleotide polymorphisms (SNPs) in the CRP gene. We determined 12 CRP SNPs, as well as various nutrition status markers in 2010 black South Africans and analyzed their effect on CRP. Interactions were observed for several genotypes with obesity in determining CRP. Lipid intake modulated the pro-inflammatory effects of some SNPs, i.e., an increase in both saturated fatty acid and monounsaturated fatty acid intake in those homozygous for the polymorphic allele at rs2808630 was associated with a larger increase in CRP. Those harboring the minor alleles at rs3093058 and rs3093062 presented with significantly higher CRP in the presence of increased triglyceride or cholesterol intake. When harboring the minor allele of these SNPs, a high omega-6 to -3 ratio was, however, found to be anti-inflammatory. Carbohydrate intake also modulated CRP SNPs, as HbA1C and fasting glucose levels interacted with some SNPs to influence the CRP. This investigation highlights the impact that nutritional status can have on reducing the inherent genetic susceptibility to a heightened systemic inflammatory state.
Jämsä, Joel; Ala-Kokko, Tero; Huotari, Virva; Ohtonen, Pasi; Savolainen, Eeva-Riitta; Syrjälä, Hannu
2018-02-01
We were interested in whether C-reactive protein (CRP) and procalcitonin (PCT) distinguish sepsis from non-septic controls and whether a combination of CRP, PCT, and neutrophil CD64 improves identification of sepsis in the intensive care unit (ICU). We analyzed the CRP and PCT concentrations from 27 patients with sepsis and 15 ICU controls. In addition, CD64 on neutrophils was measured using quantitative flow cytometry. We present a multiple marker analysis for sepsis diagnostics combining neutrophil CD64, CRP, and PCT using post-test analysis. The CRP and PCT values separated sepsis and non-septic ICU patients. In post-test analysis, CRP provided a positive probability of 0.48 and a negative probability of 0.053 for sepsis in the ICU; while, the corresponding values were 0.35 and 0.0059, respectively, for PCT and 0.62 and 0.0013, respectively, for neutrophil CD64. When neutrophil CD64 was analyzed with PCT and CRP, the probabilities were 0.98 and <0.001, respectively. Neutrophil CD64 expression was superior to PCT and CRP for the identification of sepsis in ICU. Positive post-test probability for any combinations of simultaneously analyzed CRP, PCT and CD64 showed improved diagnostic accuracy for sepsis. This approach may be useful for guiding antibiotic treatment in ICU. Copyright © 2017 Elsevier Inc. All rights reserved.
A novel interdigitated capacitor based biosensor for detection of cardiovascular risk marker.
Quershi, Anjum; Gurbuz, Yasar; Kang, Weng P; Davidson, Jimmy L
2009-12-15
C-reactive protein (CRP) is a potential biomarker whose elevated levels in humans determine cardiovascular disease risk and inflammation. In this study, we have developed a novel capacitive biosensor for detection of CRP-antigen using capacitor with interdigitated gold (GID) electrodes on nanocrystalline diamond (NCD) surface. The NCD surface served as a dielectric layer between the gold electrodes. GID-surface was functionalized by antibodies and the immobilization was confirmed by Fourier transform spectroscopy (FT-IR) and contact angle measurements. The CRP-antigen detection was performed by capacitive/dielectric-constant measurements. The relaxation time and polarizability constants were estimated using Cole-Cole model. Our results showed that the relaxation time constant (tau) of only CRP-antibody was within 10(-16)-10(-13)s, which was increased to 10(-11)s after the incubation with CRP-antigen, suggesting that the CRP-antigen was captured by the antibodies on GID-surface. In addition, polarizability constant (m) of CRP was also increased upon incubation with increasing concentration of CRP-antigen. Our results showed that the response of GID-NCD-based capacitive biosensor for CRP-antigen was dependent on both concentration (25-800ng/ml) as well as frequency (50-350MHz). Furthermore, using optimized conditions, the GID-NCD based capacitive biosensor developed in this study can potentially be used for detection of elevated levels of protein risk markers in suspected subjects for early diagnosis of disease.
Mannava, Padmakanth; Gokhale, Sunil; Pujari, Sudarshan; Biswas, Krishna P; Kaliappan, Satish; Vijapure, Shashank
2016-06-01
Inflammation of tooth supporting structures is referred to as periodontitis. C-reactive proteins (CRP) levels are usually increased in case of chronic inflammatory process like periodontitis. Association of CRP with pregnancy has been observed in the past, which includes most commonly preterm delivery, preeclampsia, etc. Therefore, it can be hypothesized that CRP may act as a link between periodontitis and adverse pregnancy outcomes. Hence, we aim to evaluate the plasma CRP levels in pregnant women with and without periodontal pathologies. The study included 210 pregnant women who reported to the hospital with periodontal problems and for routine checkups. All the patients were divided into three groups based on the presence and absence of periodontal pathologies. Russell's Periodontal Index Score was used for the evaluation of periodontal status of the subjects. While comparing the mean CRP levels in all the three study groups, statistically significant results were obtained. Statistically significant results were obtained while comparing the mean CRP levels in group C patients before treatment and after treatment therapy. The CRP levels were estimated by taking blood samples. Paired t-test and one-way analysis of variance was used to assess the correlation between the two parameters. Casual association might exist between the CRP levels and periodontal diseases in pregnant women and the CRP levels may also get elevated in pregnant women.
Kallio, Markku J. T.; Kallio, Pentti E.; Peltola, Heikki
2009-01-01
In addition to the examination of clinical signs, several laboratory markers have been measured for diagnostics and monitoring of pediatric septic bone and joint infections. Traditionally erythrocyte sedimentation rate (ESR) and leukocyte cell count have been used, whereas C-reactive protein (CRP) has gained in popularity. We monitored 265 children at ages 3 months to 15 years with culture-positive osteoarticular infections with a predetermined series of ESR, CRP, and leukocyte count measurements. On admission, ESR exceeded 20 mm/hour in 94% and CRP exceeded 20 mg/L in 95% of the cases, the mean (± standard error of the mean) being 51 ± 2 mm/hour and 87 ± 4 mg/L, respectively. ESR normalized in 24 days and CRP in 10 days. Elevated CRP gave a slightly better sensitivity in diagnostics than ESR, but best sensitivity was gained with the combined use of ESR and CRP (98%). Elevated ESR or CRP was seen in all cases during the first 3 days. Measuring ESR and CRP on admission can help the clinician rule out an acute osteoarticular infection. CRP normalizes faster than ESR, providing a clear advantage in monitoring recovery. Level of Evidence: Level II, diagnostic study. See Guidelines for Authors for a complete description of levels of evidence. PMID:19533263
NASA Astrophysics Data System (ADS)
Kang, Seung-Gu; Huynh, Tien; Zhou, Ruhong
2013-03-01
Biocompatibility is often regarded as one important aspect of de novo designed nanomaterials for biosafety. However, the toxicological effect, appearing along with its latency, is much more difficult to address by linearly mapping physicochemical properties of related nanomaterials with biological effects such as immune or cellular regulatory responses due to the complicated protein-protein interactions. Here, we investigate a potential interference of a metallofullerenol, Gd@C82(OH)22, on the function of SH3 domain, a highly promiscuous protein-protein interaction mediator involved in signaling and regulatory pathways through its binding with the proline-rich motif (PRM) peptides, using the atomistic molecular dynamics simulation. Our study shows that when only Gd@C82(OH)22 and the SH3 domain are present (without the PRM ligand), Gd@C82(OH)22 can interact with the SH3 domain by either directly blocking the hydrophobic active site or binding with a hydrophilic off-site with almost equal probability, which can be understood from its intrinsic amphiphilic nature. In a binding competition with the PRM onto the SH3 domain, however, the on-site binding mode is depleted while Gd@C82(OH)22 effectively intercepts the PRM from the putative binding site of the SH3 domain, implying that Gd@C82(OH)22 can disturb protein-protein interactions mediated by the SH3 domain. Despite a successful surface modification in an aqueous biological medium and a more recent demonstration as potential de novo cancer therapeutics, our study indicates that greater attention is needed in assessing the potential cytotoxicity of these nanomaterials.Biocompatibility is often regarded as one important aspect of de novo designed nanomaterials for biosafety. However, the toxicological effect, appearing along with its latency, is much more difficult to address by linearly mapping physicochemical properties of related nanomaterials with biological effects such as immune or cellular regulatory responses due to the complicated protein-protein interactions. Here, we investigate a potential interference of a metallofullerenol, Gd@C82(OH)22, on the function of SH3 domain, a highly promiscuous protein-protein interaction mediator involved in signaling and regulatory pathways through its binding with the proline-rich motif (PRM) peptides, using the atomistic molecular dynamics simulation. Our study shows that when only Gd@C82(OH)22 and the SH3 domain are present (without the PRM ligand), Gd@C82(OH)22 can interact with the SH3 domain by either directly blocking the hydrophobic active site or binding with a hydrophilic off-site with almost equal probability, which can be understood from its intrinsic amphiphilic nature. In a binding competition with the PRM onto the SH3 domain, however, the on-site binding mode is depleted while Gd@C82(OH)22 effectively intercepts the PRM from the putative binding site of the SH3 domain, implying that Gd@C82(OH)22 can disturb protein-protein interactions mediated by the SH3 domain. Despite a successful surface modification in an aqueous biological medium and a more recent demonstration as potential de novo cancer therapeutics, our study indicates that greater attention is needed in assessing the potential cytotoxicity of these nanomaterials. Electronic supplementary information (ESI) available. See DOI: 10.1039/c3nr33756a
In Silico Prediction and In Vitro Characterization of Multifunctional Human RNase3
Kuo, Ping-Hsueh; Chen, Chien-Jung; Chang, Hsiu-Hui; Fang, Shun-lung; Wu, Wei-Shuo; Lai, Yiu-Kay; Pai, Tun-Wen; Chang, Margaret Dah-Tsyr
2013-01-01
Human ribonucleases A (hRNaseA) superfamily consists of thirteen members with high-structure similarities but exhibits divergent physiological functions other than RNase activity. Evolution of hRNaseA superfamily has gained novel functions which may be preserved in a unique region or domain to account for additional molecular interactions. hRNase3 has multiple functions including ribonucleolytic, heparan sulfate (HS) binding, cellular binding, endocytic, lipid destabilization, cytotoxic, and antimicrobial activities. In this study, three putative multifunctional regions, 34RWRCK38 (HBR1), 75RSRFR79 (HBR2), and 101RPGRR105 (HBR3), of hRNase3 have been identified employing in silico sequence analysis and validated employing in vitro activity assays. A heparin binding peptide containing HBR1 is characterized to act as a key element associated with HS binding, cellular binding, and lipid binding activities. In this study, we provide novel insights to identify functional regions of hRNase3 that may have implications for all hRNaseA superfamily members. PMID:23484086
Medrano, Francisco Javier; de Souza, Cristiane Santos; Romero, Antonio; Balan, Andrea
2014-01-01
The uptake of maltose and related sugars in Gram-negative bacteria is mediated by an ABC transporter encompassing a periplasmic component (the maltose-binding protein or MalE), a pore-forming membrane protein (MalF and MalG) and a membrane-associated ATPase (MalK). In the present study, the structure determination of the apo form of the putative maltose/trehalose-binding protein (Xac-MalE) from the citrus pathogen Xanthomonas citri in space group P6522 is described. The crystals contained two protein molecules in the asymmetric unit and diffracted to 2.8 Å resolution. Xac-MalE conserves the structural and functional features of sugar-binding proteins and a ligand-binding pocket with similar characteristics to eight different orthologues, including the residues for maltose and trehalose interaction. This is the first structure of a sugar-binding protein from a phytopathogenic bacterium, which is highly conserved in all species from the Xanthomonas genus. PMID:24817711
ERIC Educational Resources Information Center
Khakzad, Mohammad Reza; Javanbakht, Maryam; Shayegan, Mohammad Reza; Kianoush, Sina; Omid, Fatemeh; Hojati, Maryam; Meshkat, Mojtaba
2012-01-01
C-reactive protein (CRP) is a beneficial diagnostic test for the evaluation of inflammatory response. Extremely low levels of CRP can be detected using high-sensitivity CRP (hs-CRP) test. A considerable body of evidence has demonstrated that inflammatory response has an important role in the pathophysiology of autism. In this study, we evaluated…
Out, Dorothée; Hall, Rosalie J.; Granger, Douglas A.; Page, Gayle G.; Woods, Stephanie J.
2012-01-01
This study evaluated individual differences in levels of C-reactive protein (CRP) measured in saliva, cross-sectionally and prospectively, in relation to systemic inflammation and risk for cardiovascular disease (CVD). Plasma and saliva samples, later assayed for CRP, were collected multiple times from an ethnically diverse group of women seeking help from domestic violence crisis shelters-agencies (N = 107; mean age at study start = 34 years). Plasma and saliva CRP levels were moderately associated cross-sectionally and across two years. There were indications that saliva CRP levels were, on average, higher in the morning than evening. Higher levels of saliva and plasma CRP were associated with a higher body mass index, but did not differ between women who did and did not smoke. Salivary CRP reliably discriminated between high and low levels of plasma CRP, using a clinically relevant cutoff point of 3 mg/L, recommended by the American Heart Association. Results build upon an emerging literature suggesting that under specific conditions levels of CRP in saliva may reflect low-grade inflammation and have the potential to serve as a screen for CVD risk status. PMID:22326517
C-reactive protein, marker for evaluation of systemic inflammatory response in preeclampsia.
Mihu, D; Costin, N; Mihu, Carmen Mihaela; Blaga, Ligia Daniela; Pop, Raluca Bogdana
2008-01-01
Determination by a high sensitivity technique of serum C-reactive protein (CRP), a sensitive marker of inflammation in women with preeclampsia compared to normal pregnancy and investigation of the relationship between CRP and the severity of the preeclamptic syndrome. The study included 40 women with preeclampsia and 40 control subjects with normal pregnancies in the last trimester of pregnancy. The serum CRP concentration was determined using the universal high sensitivity immunoturbidimetric assay. The serum CRP concentration was significantly higher (p < 0.001) in preclampsia (5.69 +/- 1.8 mg/L) compared to normal pregnancy (2.89 +/- 1.2 mg/L). In women with preeclampsia, CRP correlated positively and significantly with diastolic blood pressure, proteinuria and uric acid levels. Maternal CRP values also correlated negatively and significantly with fetal weight at birth. Our results demonstrate that serum CRP is increased in preeclampsia and represents a marker of the severity of the preeclamptic syndrome and of fetal weight at birth. Taking into consideration these observations and the fact that CRP testing is rapid and relatively inexpensive, we recommend the use of this acute phase reagent in clinical practice, in all women with preeclampsia in order to establish the prognosis of the disease.
C-reactive protein levels: a prognostic marker for patients with head and neck cancer?
2010-01-01
Background Recent advances in understanding complex tumor interactions have led to the discovery of an association between inflammation and cancer, in particular for colon and lung cancer, but only a very few have dealt with oral cancer. Therefore, the aim of the current study was to investigate the significance of preoperative C-reactive protein (CRP) levels as a parameter for development of lymph node metastases or recurrence. Materials and methods In 278 patients with oral cancer, preoperative CRP levels were compared with development of recurrence and metastasis. Results In 27 patients from the normal CRP group, and in 21 patients from the elevated CRP group, local recurrence was observed. Concerning lymph node metastases, 37 patients were in the normal group and 9 patients in the elevated CRP group. No significant correlation could be found between elevated CRP levels and metastasis (p = 0.468) or recurrence (p = 0.137). Conclusion Our findings do not appear to support a correlation between preoperative CRP levels and development of recurrence or metastases. In further studies, CRP levels in precancerous lesions and in Human Papilloma Virus (HPV) positive patients with oral squamous cell carcinoma (SCC) should be studied. PMID:20673375
C-reactive protein levels: a prognostic marker for patients with head and neck cancer?
Kruse, Astrid L; Luebbers, Heinz T; Grätz, Klaus W
2010-08-02
Recent advances in understanding complex tumor interactions have led to the discovery of an association between inflammation and cancer, in particular for colon and lung cancer, but only a very few have dealt with oral cancer. Therefore, the aim of the current study was to investigate the significance of preoperative C-reactive protein (CRP) levels as a parameter for development of lymph node metastases or recurrence. In 278 patients with oral cancer, preoperative CRP levels were compared with development of recurrence and metastasis. In 27 patients from the normal CRP group, and in 21 patients from the elevated CRP group, local recurrence was observed. Concerning lymph node metastases, 37 patients were in the normal group and 9 patients in the elevated CRP group. No significant correlation could be found between elevated CRP levels and metastasis (p = 0.468) or recurrence (p = 0.137). Our findings do not appear to support a correlation between preoperative CRP levels and development of recurrence or metastases. In further studies, CRP levels in precancerous lesions and in Human Papilloma Virus (HPV) positive patients with oral squamous cell carcinoma (SCC) should be studied.
The tip of the iceberg: RNA-binding proteins with prion-like domains in neurodegenerative disease
King, Oliver D.; Gitler, Aaron D.; Shorter, James
2012-01-01
Prions are self-templating protein conformers that are naturally transmitted between individuals and promote phenotypic change. In yeast, prion-encoded phenotypes can be beneficial, neutral or deleterious depending upon genetic background and environmental conditions. A distinctive and portable ‘prion domain’ enriched in asparagine, glutamine, tyrosine and glycine residues unifies the majority of yeast prion proteins. Deletion of this domain precludes prionogenesis and appending this domain to reporter proteins can confer prionogenicity. An algorithm designed to detect prion domains has successfully identified 19 domains that can confer prion behavior. Scouring the human genome with this algorithm enriches a select group of RNA-binding proteins harboring a canonical RNA recognition motif (RRM) and a putative prion domain. Indeed, of 210 human RRM-bearing proteins, 29 have a putative prion domain, and 12 of these are in the top 60 prion candidates in the entire genome. Startlingly, these RNA-binding prion candidates are inexorably emerging, one by one, in the pathology and genetics of devastating neurodegenerative disorders, including: amyotrophic lateral sclerosis (ALS), frontotemporal lobar degeneration with ubiquitin-positive inclusions (FTLD-U), Alzheimer’s disease and Huntington’s disease. For example, FUS and TDP-43, which rank 1st and 10th among RRM-bearing prion candidates, form cytoplasmic inclusions in the degenerating motor neurons of ALS patients and mutations in TDP-43 and FUS cause familial ALS. Recently, perturbed RNA-binding proteostasis of TAF15, which is the 2nd ranked RRM-bearing prion candidate, has been connected with ALS and FTLD-U. We strongly suspect that we have now merely reached the tip of the iceberg. We predict that additional RNA-binding prion candidates identified by our algorithm will soon surface as genetic modifiers or causes of diverse neurodegenerative conditions. Indeed, simple prion-like transfer mechanisms involving the prion-like domains of RNA-binding proteins could underlie the classical non-cell-autonomous emanation of neurodegenerative pathology from originating epicenters to neighboring portions of the nervous system. PMID:22445064
CisMiner: Genome-Wide In-Silico Cis-Regulatory Module Prediction by Fuzzy Itemset Mining
Navarro, Carmen; Lopez, Francisco J.; Cano, Carlos; Garcia-Alcalde, Fernando; Blanco, Armando
2014-01-01
Eukaryotic gene control regions are known to be spread throughout non-coding DNA sequences which may appear distant from the gene promoter. Transcription factors are proteins that coordinately bind to these regions at transcription factor binding sites to regulate gene expression. Several tools allow to detect significant co-occurrences of closely located binding sites (cis-regulatory modules, CRMs). However, these tools present at least one of the following limitations: 1) scope limited to promoter or conserved regions of the genome; 2) do not allow to identify combinations involving more than two motifs; 3) require prior information about target motifs. In this work we present CisMiner, a novel methodology to detect putative CRMs by means of a fuzzy itemset mining approach able to operate at genome-wide scale. CisMiner allows to perform a blind search of CRMs without any prior information about target CRMs nor limitation in the number of motifs. CisMiner tackles the combinatorial complexity of genome-wide cis-regulatory module extraction using a natural representation of motif combinations as itemsets and applying the Top-Down Fuzzy Frequent- Pattern Tree algorithm to identify significant itemsets. Fuzzy technology allows CisMiner to better handle the imprecision and noise inherent to regulatory processes. Results obtained for a set of well-known binding sites in the S. cerevisiae genome show that our method yields highly reliable predictions. Furthermore, CisMiner was also applied to putative in-silico predicted transcription factor binding sites to identify significant combinations in S. cerevisiae and D. melanogaster, proving that our approach can be further applied genome-wide to more complex genomes. CisMiner is freely accesible at: http://genome2.ugr.es/cisminer. CisMiner can be queried for the results presented in this work and can also perform a customized cis-regulatory module prediction on a query set of transcription factor binding sites provided by the user. PMID:25268582
Jakka, Siva R. K.; Gong, Liang; Hasler, James; Banerjee, Rahul; Sheets, Joel J.; Narva, Kenneth; Blanco, Carlos A.
2015-01-01
Insecticidal protein genes from the bacterium Bacillus thuringiensis (Bt) are expressed by transgenic Bt crops (Bt crops) for effective and environmentally safe pest control. The development of resistance to these insecticidal proteins is considered the most serious threat to the sustainability of Bt crops. Resistance in fall armyworm (Spodoptera frugiperda) populations from Puerto Rico to transgenic corn producing the Cry1Fa insecticidal protein resulted, for the first time in the United States, in practical resistance, and Bt corn was withdrawn from the local market. In this study, we used a field-collected Cry1Fa corn-resistant strain (456) of S. frugiperda to identify the mechanism responsible for field-evolved resistance. Binding assays detected reduced Cry1Fa, Cry1Ab, and Cry1Ac but not Cry1Ca toxin binding to midgut brush border membrane vesicles (BBMV) from the larvae of strain 456 compared to that from the larvae of a susceptible (Ben) strain. This binding phenotype is descriptive of the mode 1 type of resistance to Bt toxins. A comparison of the transcript levels for putative Cry1 toxin receptor genes identified a significant downregulation (>90%) of a membrane-bound alkaline phosphatase (ALP), which translated to reduced ALP protein levels and a 75% reduction in ALP activity in BBMV from 456 compared to that of Ben larvae. We cloned and heterologously expressed this ALP from susceptible S. frugiperda larvae and demonstrated that it specifically binds with Cry1Fa toxin. This study provides a thorough mechanistic description of field-evolved resistance to a transgenic Bt crop and supports an association between resistance and reduced Cry1Fa toxin binding and levels of a putative Cry1Fa toxin receptor, ALP, in the midguts of S. frugiperda larvae. PMID:26637593
[hsCRP protein in children and adolescents with diabetes type 1].
Głowińska-Olszewska, Barbara; Urban, Mirosława; Peczyńska, Jadwiga; Koput, Alicja
2007-01-01
HsCRP protein is known as a novel marker of low grade inflammatory state, which characterises an atherosclerotic process in its early stages. Contrary to a large amount of data on inflammatory markers in diabetes type 2 and metabolic syndrome in adults, little is known so far about the inflammatory process in diabetes type 1, especially in children. The aim of the study was to estimate the level of hsCRP protein in children and adolescents with diabetes type 1 depending on coexisting additional risk factors for atherosclerosis and microvascular complications. 127 children and adolescents with diabetes duration 6.7+/-3.3 years, aged 14.9+/-3.1, were studied. The control group consisted of 52 healthy children aged 14.9+/-2.8 years, matched acc. to gender. HsCRP level was assessed with use of immunoturbidymetric, latex augmented method (Tina-quant CRP (Latex) HS, Roche). HsCRP in the whole study group was nearly significantly higher compared to control group: 0.17+/-0.2 vs. 0.078+/-0.1 mg/dl, p=0.072. In diabetic hypertensive children (n=38) we found significantly higher levels of hsCRP compared to controls (0.27+/-0.3 vs. 0.07 mg/dl, p=0.008) and compared to diabetic normotensive children (0.13+/-0.22 mg/dl; p=0.024). Diabetic obese patients (n=23) had significantly higer hsCRP compared to controls (0.24+/-0.3 vs. 0.07+/-0.1 mg/dl, p=0.04). In 14 studied diabetic children we found coexisting hypertension and obesity, and we found further increase in hsCRP level - 0.28+/-0.3 mg/dl. In diabetic children with microangiopathy hsCRP level was 0.22+/-0.2 mg/dl, and it was insignificantly higher compared to controls and to diabetic children without complications. Correlation analysis showed interrelations between hsCRP and systolic blood pressure (r=0.2; p=0.04) and HbA1c (r=0.25; p=0.015). In stepwise regression analysis hsCRP was related to systolic blood pressure, HbA1c and the triglycerides level (R=0.37; p=0.003). In children and adolescents with diabetes type 1 we proved significantly higher levels of hsCRP in case of a coexistence of hypertension and/or obesity. Elevated hsCRP in children with diabetes type 1 and hypertension and/or obesity reflects low grade inflammatory state in the course of metabolic syndrome.
Djeghader, Ahmed; Gotthard, Guillaume; Suh, Andrew; Gonzalez, Daniel; Scott, Ken; Chabriere, Eric; Elias, Mikael
2013-01-01
In prokaryotes, phosphate starvation induces the expression of numerous phosphate-responsive genes, such as the pst operon including the high-affinity phosphate-binding protein (PBP or pstS) and alkaline phosphatases such as PhoA. This response increases the cellular inorganic phosphate import efficiency. Notably, some Pseudomonas species secrete, via a type-2 secretion system, a phosphate-binding protein dubbed LapA endowed with phosphatase activity. Here, the expression, purification, crystallization and X-ray data collection at 0.87 Å resolution of LapA are described. Combined with biochemical and enzymatic characterization, the structure of this intriguing phosphate-binding protein will help to elucidate the molecular origin of its phosphatase activity and to decipher its putative role in phosphate uptake. PMID:24100568
The Role of the EGF Receptor First Intron in Its Regulation in Breast Canceer.
1997-08-01
of EGFR, to malignantly transform mammary glands in transgenic mice (46). Future work could determine if these putative oncogene factor binding sites...general transcription factors, and the use or overuse of one promoter could monopolize the abundance of these transcription factors within a cell. The ideal
Hillström, Anna; Bylin, Jonas; Hagman, Ragnvi; Björhall, Karin; Tvedten, Harold; Königsson, Kristian; Fall, Tove; Kjelgaard-Hansen, Mads
2016-10-28
In a dog with joint pain, it is important to determine whether it has suppurative joint disease, characterized by exudation of neutrophils in the synovial fluid, or not, as this affects choice of diagnostic tests and treatments. The aim of this study was to evaluate whether measurement of serum C-reactive protein (CRP) concentration could be used to discriminate between dogs with suppurative arthritis and osteoarthritis (OA). Furthermore, the concentrations of serum and synovial fluid interleukin (IL) 6 concentrations were measured in dogs with joint disease and in healthy dogs, and were correlated to serum CRP concentrations. Dogs with joint pain were enrolled prospectively and were classified to have suppurative arthritis or OA based on synovial fluid analysis and radiographic/arthroscopic findings. Healthy Beagles were enrolled as a comparative group. CRP and IL-6 concentrations were measured with canine-specific immunoassays. The performance of CRP concentration in discriminating between dogs with suppurative arthritis and OA was evaluated using a previously established clinical decision limit for CRP (20 mg/l), and by receiver operator characteristic (ROC) curve and logistic regression analysis. Comparisons of CRP and IL-6 concentrations between groups were performed using t-tests, and correlations by Spearman rank correlation coefficients. Samples were obtained from 31 dogs with suppurative arthritis, 34 dogs with OA, and 17 healthy dogs. Sixty-two out of 65 dogs with joint disease were correctly classified using the clinical decision limit for CRP. Evaluation of ROC curve and regression analysis indicated that serum CRP concentrations could discriminate between suppurative arthritis and OA. Dogs with suppurative arthritis had higher serum CRP and serum and synovial fluid IL-6 concentrations compared to dogs with OA (p < 0.001). Dogs with OA had higher synovial fluid IL-6 concentrations (p < 0.001), but not higher serum CRP (p = 0.29) or serum IL-6 (p = 0.07) concentrations, compared to healthy dogs. There was a positive correlation between synovial fluid IL-6 and serum CRP concentrations (r s = 0.733, p < 0.001), and between serum IL-6 and serum CRP concentrations (r s = 0.729, p < 0.001). CRP concentration was found to discriminate well between dogs with suppurative arthritis and OA.
Identification of regulatory targets for the bacterial Nus factor complex.
Baniulyte, Gabriele; Singh, Navjot; Benoit, Courtney; Johnson, Richard; Ferguson, Robert; Paramo, Mauricio; Stringer, Anne M; Scott, Ashley; Lapierre, Pascal; Wade, Joseph T
2017-12-11
Nus factors are broadly conserved across bacterial species, and are often essential for viability. A complex of five Nus factors (NusB, NusE, NusA, NusG and SuhB) is considered to be a dedicated regulator of ribosomal RNA folding, and has been shown to prevent Rho-dependent transcription termination. Here, we identify an additional cellular function for the Nus factor complex in Escherichia coli: repression of the Nus factor-encoding gene, suhB. This repression occurs primarily by translation inhibition, followed by Rho-dependent transcription termination. Thus, the Nus factor complex can prevent or promote Rho activity depending on the gene context. Conservation of putative NusB/E binding sites upstream of Nus factor genes suggests that Nus factor autoregulation occurs in many bacterial species. Additionally, many putative NusB/E binding sites are also found upstream of other genes in diverse species, and we demonstrate Nus factor regulation of one such gene in Citrobacter koseri. We conclude that Nus factors have an evolutionarily widespread regulatory function beyond ribosomal RNA, and that they are often autoregulatory.
Structural Analysis of a Putative Aminoglycoside N-Acetyltransferase from Bacillus anthracis
DOE Office of Scientific and Technical Information (OSTI.GOV)
Klimecka, Maria M.; Chruszcz, Maksymilian; Font, Jose
2012-02-15
For the last decade, worldwide efforts for the treatment of anthrax infection have focused on developing effective vaccines. Patients that are already infected are still treated traditionally using different types of standard antimicrobial agents. The most popular are antibiotics such as tetracyclines and fluoroquinolones. While aminoglycosides appear to be less effective antimicrobial agents than other antibiotics, synthetic aminoglycosides have been shown to act as potent inhibitors of anthrax lethal factor and may have potential application as antitoxins. Here, we present a structural analysis of the BA2930 protein, a putative aminoglycoside acetyltransferase, which may be a component of the bacterium's aminoglycosidemore » resistance mechanism. The determined structures revealed details of a fold characteristic only for one other protein structure in the Protein Data Bank, namely, YokD from Bacillus subtilis. Both BA2930 and YokD are members of the Antibiotic-NAT superfamily (PF02522). Sequential and structural analyses showed that residues conserved throughout the Antibiotic-NAT superfamily are responsible for the binding of the cofactor acetyl coenzyme A. The interaction of BA2930 with cofactors was characterized by both crystallographic and binding studies.« less
Kim, Kye-Won; Smith, Clyde A; Daily, Michael D; Cort, John R; Davin, Laurence B; Lewis, Norman G
2015-01-16
Control over phenoxy radical-radical coupling reactions in vivo in vascular plants was enigmatic until our discovery of dirigent proteins (DPs, from the Latin dirigere, to guide or align). The first three-dimensional structure of a DP ((+)-pinoresinol-forming DP, 1.95 Å resolution, rhombohedral space group H32)) is reported herein. It has a tightly packed trimeric structure with an eight-stranded β-barrel topology for each DP monomer. Each putative substrate binding and orientation coupling site is located on the trimer surface but too far apart for intermolecular coupling between sites. It is proposed that each site enables stereoselective coupling (using either two coniferyl alcohol radicals or a radical and a monolignol). Interestingly, there are six differentially conserved residues in DPs affording either the (+)- or (-)-antipodes in the vicinity of the putative binding site and region known to control stereoselectivity. DPs are involved in lignan biosynthesis, whereas dirigent domains/sites have been implicated in lignin deposition. © 2015 by The American Society for Biochemistry and Molecular Biology, Inc.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Hong, R. L., Hamaguchi, L., Busch, M. A., and Weigel, D.
2003-06-01
OAK-B135 In Arabidopsis thaliana, cis-regulatory sequences of the floral homeotic gene AGAMOUS (AG) are located in the second intron. This 3 kb intron contains binding sites for two direct activators of AG, LEAFY (LFY) and WUSCHEL (WUS), along with other putative regulatory elements. We have used phylogenetic footprinting and the related technique of phylogenetic shadowing to identify putative cis-regulatory elements in this intron. Among 29 Brassicaceae, several other motifs, but not the LFY and WUS binding sites previously identified, are largely invariant. Using reporter gene analyses, we tested six of these motifs and found that they are all functionally importantmore » for activity of AG regulatory sequences in A. thaliana. Although there is little obvious sequence similarity outside the Brassicaceae, the intron from cucumber AG has at least partial activity in A. thaliana. Our studies underscore the value of the comparative approach as a tool that complements gene-by-gene promoter dissection, but also highlight that sequence-based studies alone are insufficient for a complete identification of cis-regulatory sites.« less
Identification and characterization of cell-specific enhancer elements for the mouse ETF/Tead2 gene.
Tanoue, Y; Yasunami, M; Suzuki, K; Ohkubo, H
2001-12-21
We have identified and characterized by transient transfection assays the cell-specific 117-bp enhancer sequence in the first intron of the mouse ETF (Embryonic TEA domain-containing factor)/Tead2 gene required for transcriptional activation in ETF/Tead2 gene-expressing cells, such as P19 cells. The 117-bp enhancer contains one GC-rich sequence (5'-GGGGCGGGG-3'), termed the GC box, and two tandemly repeated GA-rich sequences (5'-GGGGGAGGGG-3'), termed the proximal and distal GA elements. Further analyses, including transfection studies and electrophoretic mobility shift assays using a series of deletion and mutation constructs, indicated that Sp1, a putative activator, may be required to predominate over its competition with another unknown putative repressor, termed the GA element-binding factor, for binding to both the GC box, which overlapped with the proximal GA element, and the distal GA element in the 117-bp sequence in order to achieve a full enhancer activity. We also discuss a possible mechanism underlying the cell-specific enhancer activity of the 117-bp sequence.
Torres, Jaume; Maheswari, Uma; Parthasarathy, Krupakar; Ng, Lifang; Liu, Ding Xiang; Gong, Xiandi
2007-01-01
The coronavirus responsible for the severe acute respiratory syndrome (SARS-CoV) contains a small envelope protein, E, with putative involvement in host cell apoptosis and virus morphogenesis. It has been suggested that E protein can form a membrane destabilizing transmembrane (TM) hairpin, or homooligomerize to form a regular TM α-helical bundle. We have shown previously that the topology of the α-helical putative TM domain of E protein (ETM), flanked by two lysine residues at C and N termini to improve solubility, is consistent with a regular TM α-helix, with orientational parameters in lipid bilayers that are consistent with a homopentameric model. Herein, we show that this peptide, reconstituted in lipid bilayers, shows sodium conductance. Channel activity is inhibited by the anti-influenza drug amantadine, which was found to bind our preparation with moderate affinity. Results obtained from single or double mutants indicate that the organization of the transmembrane pore is consistent with our previously reported pentameric α-helical bundle model. PMID:17766393
The Leptospiral Antigen Lp49 is a Two-Domain Protein with Putative Protein Binding Function
DOE Office of Scientific and Technical Information (OSTI.GOV)
Oliveira Giuseppe,P.; Oliveira Neves, F.; Nascimento, A.
2008-01-01
Pathogenic Leptospira is the etiological agent of leptospirosis, a life-threatening disease that affects populations worldwide. Currently available vaccines have limited effectiveness and therapeutic interventions are complicated by the difficulty in making an early diagnosis of leptospirosis. The genome of Leptospira interrogans was recently sequenced and comparative genomic analysis contributed to the identification of surface antigens, potential candidates for development of new vaccines and serodiagnosis. Lp49 is a membrane-associated protein recognized by antibodies present in sera from early and convalescent phases of leptospirosis patients. Its crystal structure was determined by single-wavelength anomalous diffraction using selenomethionine-labelled crystals and refined at 2.0 Angstromsmore » resolution. Lp49 is composed of two domains and belongs to the all-beta-proteins class. The N-terminal domain folds in an immunoglobulin-like beta-sandwich structure, whereas the C-terminal domain presents a seven-bladed beta-propeller fold. Structural analysis of Lp49 indicates putative protein-protein binding sites, suggesting a role in Leptospira-host interaction. This is the first crystal structure of a leptospiral antigen described to date.« less
Hsieh, Sheng-Kuo; Lo, Yuan-Hao; Wu, Chia-Chang; Chung, Tse-Yu; Tzen, Jason T C
2015-12-01
Teaghrelins are unique acylated flavonoid tetraglycosides found in Chin-shin oolong tea, and have been demonstrated to be promising oral ghrelin analogues. The biosynthetic pathway of teaghrelins from quercetin-3-O-rutinoside (rutin) or kaempferol-3-O-rutinoside (nicotiflorin) was proposed to comprise three enzymatic steps according to the identification of putative intermediates in Chin-shin oolong tea. In addition to the two known teaghrelins in Chin-shin oolong tea, four teaghrelin-like compounds with different attachments of glycosides were identified in various oolong teas. Molecular modeling and docking were used to evaluate theoretically whether the putative biosynthetic intermediates of teaghrelins and the four teaghrelin-like compounds could be potential candidates of ghrelin analogues. The results showed that the attachment of a coumaroyl group was crucial for these tea compounds to bind to the ghrelin receptor. However, the additional attachment of a rhamnosyl glycoside to the flavonoid backbone of teaghrelin-like compounds at C-7 significantly reduced their binding affinity with the ghrelin receptor. Copyright © 2015. Published by Elsevier B.V.
Ashraf, Naeem Mahmood; Bilal, Muhammad; Mahmood, Malik Siddique; Hussain, Aadil; Mehboob, Muhammad Zubair
2016-09-01
Mounting burden of HCV-infected individuals and soaring cost of treatment is a serious source of unease for developing countries. Numbers of various approaches have been anticipated to develop a vaccine against HCV but the majority of them proved ineffective. Development of vaccine by considering geographical distribution of HCV genotypes and host genetics shows potential. In this research article, we have tried to predict most putative HCV epitopes which are efficiently restricted by most common HLA alleles in Pakistani population through different computational algorithms. Thirteen selected, experimentally identified epitopes sequences were used to derived consensus sequences in all genotypes of HCV. Obtained consensus sequences were used to predict their binding affinities with most prevalent HLA alleles in Pakistani population. Two Class-I epitopes from NS4B region, one from Class-I epitope from NS5A and one Class-II epitope from NS3 region showed effective binding and proved to be highly putative to boost immune response. A cocktail of these four have been checked for population coverage and they gave 75.53% for Pakistani Asian and 70.77% for Pakistani Mixed populations with no allergenic response. Computational algorithms are robust way to shortlist potential candidate epitopes for vaccine development but further, in vivo and in-vitro studies are required to confirm their immunogenic properties. Copyright © 2016 Elsevier B.V. All rights reserved.
Arsenite activates NFκB through induction of C-reactive protein
DOE Office of Scientific and Technical Information (OSTI.GOV)
Druwe, Ingrid L.; Sollome, James J.; Sanchez-Soria, Pablo
2012-06-15
C-reactive protein (CRP) is an acute phase protein in humans. Elevated levels of CRP are produced in response to inflammatory cytokines and are associated with atherosclerosis, hypertension, cardiovascular disease and insulin resistance. Exposure to inorganic arsenic, a common environmental toxicant, also produces cardiovascular disorders, namely atherosclerosis and is associated with insulin-resistance. Inorganic arsenic has been shown to contribute to cardiac toxicities through production of reactive oxygen species (ROS) that result in the activation of NFκB. In this study we show that exposure of the hepatic cell line, HepG2, to environmentally relevant levels of arsenite (0.13 to 2 μM) results inmore » elevated CRP expression and secretion. ROS analysis of the samples showed that a minimal amount of ROS are produced by HepG2 cells in response to these concentrations of arsenic. In addition, treatment of FvB mice with 100 ppb sodium arsenite in the drinking water for 6 months starting at weaning age resulted in dramatically higher levels of CRP in both the liver and inner medullary region of the kidney. Further, mouse Inner Medullary Collecting Duct cells (mIMCD-4), a mouse kidney cell line, were stimulated with 10 ng/ml CRP which resulted in activation of NFκB. Pretreatment with 10 nM Y27632, a known Rho-kinase inhibitor, prior to CRP exposure attenuated NFκB activation. These data suggest that arsenic causes the expression and secretion of CRP and that CRP activates NFκB through activation of the Rho-kinase pathway, thereby providing a novel pathway by which arsenic can contribute to metabolic syndrome and cardiovascular disease. -- Highlights: ► Exposure to arsenic can induce the expression and secretion of CRP. ► Mice treated with NaAsO{sub 2} showed higher levels of CRP in both the liver and kidney. ► mIMCD-3 were stimulated with CRP which resulted in activation of NFκB. ► CRP activates NFκB through activation of the Rho-kinase pathway. ► Data provide novel pathway for arsenic role in metabolic and cardiovascular disease.« less
High C-reactive protein levels are associated with depressive symptoms in schizophrenia.
Faugere, M; Micoulaud-Franchi, J-A; Faget-Agius, C; Lançon, C; Cermolacce, M; Richieri, R
2018-01-01
Depressive symptoms are frequently associated with schizophrenia symptoms. C - Reactive protein (CRP), a marker of chronic inflammation, had been found elevated in patients with schizophrenia and in patients with depressive symptoms. However, the association between CRP level and depressive symptoms has been poorly investigated in patients with schizophrenia. The only study conducted found an association between high CRP levels and antidepressant consumption, but not with depressive symptoms investigated with the Calgary Depression Rating Scale for Schizophrenia (CDSS). The aim of this study was to evaluate CRP levels and depressive symptoms in patients with schizophrenia, and to determine whether high CRP levels are associated with depressive symptoms and/or antidepressant consumption, independently of potential confounding factors, especially tobacco-smoking and metabolic syndrome. Three hundred and seven patients with schizophrenia were enrolled in this study (mean age = 35.74 years, 69.1% male gender). Depressive symptoms was investigated with the CDSS. Patients were classified in two groups: normal CRP level (≤ 3.0mg/L) and high CRP level (> 3.0mg/L). Current medication was recorded. 124 subjects (40.4%) were classified in the high CRP level group. After adjusting for confounding factors, these patients were found to have higher CDSS scores than those with normal CRP levels in multivariate analyses (p = 0.035, OR = 1.067, 95% CI = 1.004-1.132). No significant association between CRP levels and antidepressants consumption was found. The size sample is relatively small. The cut-off point for high cardiovascular risk was used to define the two groups. CRP was the sole marker of inflammation in this study and was collected at only one time point. The design of this study is cross-sectional and there are no conclusions about the directionality of the association between depression and inflammation in schizophrenia. This study found an association between high rates of CRP levels and depressive symptoms in patients with schizophrenia, but no association with antidepressant consumption. Further studies are needed to investigate the impact of inflammation in schizophrenia. Copyright © 2017 Elsevier B.V. All rights reserved.
Armas, Pablo; Margarit, Ezequiel; Mouguelar, Valeria S; Allende, Miguel L; Calcaterra, Nora B
2013-01-01
CNBP is a nucleic acid chaperone implicated in vertebrate craniofacial development, as well as in myotonic dystrophy type 2 (DM2) and sporadic inclusion body myositis (sIBM) human muscle diseases. CNBP is highly conserved among vertebrates and has been implicated in transcriptional regulation; however, its DNA binding sites and molecular targets remain elusive. The main goal of this work was to identify CNBP DNA binding sites that might reveal target genes involved in vertebrate embryonic development. To accomplish this, we used a recently described yeast one-hybrid assay to identify DNA sequences bound in vivo by CNBP. Bioinformatic analyses revealed that these sequences are G-enriched and show high frequency of putative G-quadruplex DNA secondary structure. Moreover, an in silico approach enabled us to establish the CNBP DNA-binding site and to predict CNBP putative targets based on gene ontology terms and synexpression with CNBP. The direct interaction between CNBP and candidate genes was proved by EMSA and ChIP assays. Besides, the role of CNBP upon the identified genes was validated in loss-of-function experiments in developing zebrafish. We successfully confirmed that CNBP up-regulates tbx2b and smarca5, and down-regulates wnt5b gene expression. The highly stringent strategy used in this work allowed us to identify new CNBP target genes functionally important in different contexts of vertebrate embryonic development. Furthermore, it represents a novel approach toward understanding the biological function and regulatory networks involving CNBP in the biology of vertebrates.
BLSSpeller: exhaustive comparative discovery of conserved cis-regulatory elements.
De Witte, Dieter; Van de Velde, Jan; Decap, Dries; Van Bel, Michiel; Audenaert, Pieter; Demeester, Piet; Dhoedt, Bart; Vandepoele, Klaas; Fostier, Jan
2015-12-01
The accurate discovery and annotation of regulatory elements remains a challenging problem. The growing number of sequenced genomes creates new opportunities for comparative approaches to motif discovery. Putative binding sites are then considered to be functional if they are conserved in orthologous promoter sequences of multiple related species. Existing methods for comparative motif discovery usually rely on pregenerated multiple sequence alignments, which are difficult to obtain for more diverged species such as plants. As a consequence, misaligned regulatory elements often remain undetected. We present a novel algorithm that supports both alignment-free and alignment-based motif discovery in the promoter sequences of related species. Putative motifs are exhaustively enumerated as words over the IUPAC alphabet and screened for conservation using the branch length score. Additionally, a confidence score is established in a genome-wide fashion. In order to take advantage of a cloud computing infrastructure, the MapReduce programming model is adopted. The method is applied to four monocotyledon plant species and it is shown that high-scoring motifs are significantly enriched for open chromatin regions in Oryza sativa and for transcription factor binding sites inferred through protein-binding microarrays in O.sativa and Zea mays. Furthermore, the method is shown to recover experimentally profiled ga2ox1-like KN1 binding sites in Z.mays. BLSSpeller was written in Java. Source code and manual are available at http://bioinformatics.intec.ugent.be/blsspeller Klaas.Vandepoele@psb.vib-ugent.be or jan.fostier@intec.ugent.be. Supplementary data are available at Bioinformatics online. © The Author 2015. Published by Oxford University Press.
BLSSpeller: exhaustive comparative discovery of conserved cis-regulatory elements
De Witte, Dieter; Van de Velde, Jan; Decap, Dries; Van Bel, Michiel; Audenaert, Pieter; Demeester, Piet; Dhoedt, Bart; Vandepoele, Klaas; Fostier, Jan
2015-01-01
Motivation: The accurate discovery and annotation of regulatory elements remains a challenging problem. The growing number of sequenced genomes creates new opportunities for comparative approaches to motif discovery. Putative binding sites are then considered to be functional if they are conserved in orthologous promoter sequences of multiple related species. Existing methods for comparative motif discovery usually rely on pregenerated multiple sequence alignments, which are difficult to obtain for more diverged species such as plants. As a consequence, misaligned regulatory elements often remain undetected. Results: We present a novel algorithm that supports both alignment-free and alignment-based motif discovery in the promoter sequences of related species. Putative motifs are exhaustively enumerated as words over the IUPAC alphabet and screened for conservation using the branch length score. Additionally, a confidence score is established in a genome-wide fashion. In order to take advantage of a cloud computing infrastructure, the MapReduce programming model is adopted. The method is applied to four monocotyledon plant species and it is shown that high-scoring motifs are significantly enriched for open chromatin regions in Oryza sativa and for transcription factor binding sites inferred through protein-binding microarrays in O.sativa and Zea mays. Furthermore, the method is shown to recover experimentally profiled ga2ox1-like KN1 binding sites in Z.mays. Availability and implementation: BLSSpeller was written in Java. Source code and manual are available at http://bioinformatics.intec.ugent.be/blsspeller Contact: Klaas.Vandepoele@psb.vib-ugent.be or jan.fostier@intec.ugent.be Supplementary information: Supplementary data are available at Bioinformatics online. PMID:26254488
Cammen, Kristina M; Rosel, Patricia E; Wells, Randall S; Read, Andrew J
2014-12-01
In coastal marine ecosystems, neurotoxins produced by harmful algal blooms (HABs) often result in large-scale mortality events of many marine species. Historical and frequent exposure to HABs therefore may provide a strong selective pressure for adaptations that result in toxin resistance. Neurotoxin resistance has independently evolved in a variety of terrestrial and marine species via mutations in genes encoding the toxin binding sites within the voltage-gated sodium channel gene complex. Accordingly, we tested the hypothesis that genetic variation in the putative binding site of brevetoxins in common bottlenose dolphins (Tursiops truncatus) explains differences among individuals or populations in resistance to harmful Karenia brevis blooms in the Gulf of Mexico. We found very little variation in the sodium channel exons encoding the putative brevetoxin binding site among bottlenose dolphins from central-west Florida and the Florida Panhandle. Our study included samples from several bottlenose dolphin mortality events associated with HABs, but we found no association between genetic variation and survival. We observed a significant effect of geographic region on genetic variation for some sodium channel isoforms, but this can be primarily explained by rare private alleles and is more likely a reflection of regional genetic differentiation than the cause of different levels of HAB resistance between regions. In contrast to many other previously studied neurotoxin-resistant species, we conclude that bottlenose dolphins have not evolved resistance to HABs via mutations in genes encoding the brevetoxin binding site on the voltage-gated sodium channels. Copyright © 2014 Elsevier B.V. All rights reserved.
Silva-Brandão, Karina Lucas; Peruchi, Aline; Seraphim, Noemy; Murad, Natália Faraj; Carvalho, Renato Assis; Farias, Juliano Ricardo; Omoto, Celso; Cônsoli, Fernando Luis; Figueira, Antonio; Brandão, Marcelo Mendes
2018-01-01
We applied the ddRAD genotyping-by-sequencing technique to investigate the genetic distinctiveness of Brazilian populations of the noctuid moth Spodoptera frugiperda, the fall armyworm (FAW), and the role of host-plant association as a source of genetic diversification. By strain-genotyping all field-collected individuals we found that populations collected from corn were composed primarily of corn-strain individuals, while the population collected from rice was composed almost entirely of rice-strain individuals. Outlier analyses indicated 1,184 loci putatively under selection (ca. 15% of the total) related to 194 different Gene Ontologies (GOs); the most numerous GOs were nucleotide binding, ATP binding, metal-ion binding and nucleic-acid binding. The association analyses indicated 326 loci associated with the host plant, and 216 loci associated with the individual strain, including functions related to Bacillus thuringiensis and insecticide resistance. The genetic-structure analyses indicated a moderate level of differentiation among all populations, and lower genetic structure among populations collected exclusively from corn, which suggests that the population collected from rice has a strong influence on the overall genetic structure. Populations of S. frugiperda are structured partially due to the host plant, and pairs of populations using the same host plant are more genetically similar than pairs using different hosts. Loci putatively under selection are the main factors responsible for the genetic structure of these populations, which indicates that adaptive selection on important traits, including the response to control tactics, is acting in the genetic differentiation of FAW populations in Brazil.
Mouguelar, Valeria S.; Allende, Miguel L.; Calcaterra, Nora B.
2013-01-01
CNBP is a nucleic acid chaperone implicated in vertebrate craniofacial development, as well as in myotonic dystrophy type 2 (DM2) and sporadic inclusion body myositis (sIBM) human muscle diseases. CNBP is highly conserved among vertebrates and has been implicated in transcriptional regulation; however, its DNA binding sites and molecular targets remain elusive. The main goal of this work was to identify CNBP DNA binding sites that might reveal target genes involved in vertebrate embryonic development. To accomplish this, we used a recently described yeast one-hybrid assay to identify DNA sequences bound in vivo by CNBP. Bioinformatic analyses revealed that these sequences are G-enriched and show high frequency of putative G-quadruplex DNA secondary structure. Moreover, an in silico approach enabled us to establish the CNBP DNA-binding site and to predict CNBP putative targets based on gene ontology terms and synexpression with CNBP. The direct interaction between CNBP and candidate genes was proved by EMSA and ChIP assays. Besides, the role of CNBP upon the identified genes was validated in loss-of-function experiments in developing zebrafish. We successfully confirmed that CNBP up-regulates tbx2b and smarca5, and down-regulates wnt5b gene expression. The highly stringent strategy used in this work allowed us to identify new CNBP target genes functionally important in different contexts of vertebrate embryonic development. Furthermore, it represents a novel approach toward understanding the biological function and regulatory networks involving CNBP in the biology of vertebrates. PMID:23667590
Peruchi, Aline; Seraphim, Noemy; Murad, Natália Faraj; Carvalho, Renato Assis; Farias, Juliano Ricardo; Omoto, Celso; Cônsoli, Fernando Luis; Figueira, Antonio; Brandão, Marcelo Mendes
2018-01-01
We applied the ddRAD genotyping-by-sequencing technique to investigate the genetic distinctiveness of Brazilian populations of the noctuid moth Spodoptera frugiperda, the fall armyworm (FAW), and the role of host-plant association as a source of genetic diversification. By strain-genotyping all field-collected individuals we found that populations collected from corn were composed primarily of corn-strain individuals, while the population collected from rice was composed almost entirely of rice-strain individuals. Outlier analyses indicated 1,184 loci putatively under selection (ca. 15% of the total) related to 194 different Gene Ontologies (GOs); the most numerous GOs were nucleotide binding, ATP binding, metal-ion binding and nucleic-acid binding. The association analyses indicated 326 loci associated with the host plant, and 216 loci associated with the individual strain, including functions related to Bacillus thuringiensis and insecticide resistance. The genetic-structure analyses indicated a moderate level of differentiation among all populations, and lower genetic structure among populations collected exclusively from corn, which suggests that the population collected from rice has a strong influence on the overall genetic structure. Populations of S. frugiperda are structured partially due to the host plant, and pairs of populations using the same host plant are more genetically similar than pairs using different hosts. Loci putatively under selection are the main factors responsible for the genetic structure of these populations, which indicates that adaptive selection on important traits, including the response to control tactics, is acting in the genetic differentiation of FAW populations in Brazil. PMID:29787608
Napolitano, Mauro; Rubio, Miguel Ángel; Santamaría-Gómez, Javier; Olmedo-Verd, Elvira; Robinson, Nigel J; Luque, Ignacio
2012-05-01
Zur regulators control zinc homeostasis by repressing target genes under zinc-sufficient conditions in a wide variety of bacteria. This paper describes how part of a survey of duplicated genes led to the identification of the open reading frame all2473 as the gene encoding the Zur regulator of the cyanobacterium Anabaena sp. strain PCC 7120. All2473 binds to DNA in a zinc-dependent manner, and its DNA-binding sequence was characterized, which allowed us to determine the relative contribution of particular nucleotides to Zur binding. A zur mutant was found to be impaired in the regulation of zinc homeostasis, showing sensitivity to elevated concentrations of zinc but not other metals. In an effort to characterize the Zur regulon in Anabaena, 23 genes containing upstream putative Zur-binding sequences were identified and found to be regulated by Zur. These genes are organized in six single transcriptional units and six operons, some of them containing multiple Zur-regulated promoters. The identities of genes of the Zur regulon indicate that Anabaena adapts to conditions of zinc deficiency by replacing zinc metalloproteins with paralogues that fulfill the same function but presumably with a lower zinc demand, and with inducing putative metallochaperones and membrane transport systems likely being involved in the scavenging of extracellular zinc, including plasma membrane ABC transport systems and outer membrane TonB-dependent receptors. Among the Zur-regulated genes, the ones showing the highest induction level encode proteins of the outer membrane, suggesting a primary role for components of this cell compartment in the capture of zinc cations from the extracellular medium.
Delongui, Francieli; Lozovoy, Marcell Allyson Batisti; Iriyoda, Tatiana Mayiumi Veiga; Costa, Neide Tomimura; Stadtlober, Nicole Perugini; Alfieri, Daniela Frizon; Flauzino, Tamires; Dichi, Isaias; Simão, Andréa Name Colado; Reiche, Edna Maria Vissoci
2017-08-01
The T rare allele of +1444CT (rs1130864) polymorphism of C-reactive protein (CRP) has been associated with increased CRP levels in some inflammatory conditions, but its role on systemic lupus erythematosus (SLE) susceptibility and on CRP levels in SLE patients remains uncertain. The objective of the study was to evaluate the association between the rs1130864 CRP polymorphism with SLE susceptibility, disease activity, and CRP levels in SLE Brazilian patients. The study enrolled 176 SLE patients and 137 controls. SLE disease activity was assessed using the SLE Disease Activity Index (SLEDAI). The rs1130864 CRP polymorphism was determined using polymerase chain reaction and restriction fragment length polymorphism. SLE patients presented higher body mass index (p = 0.046) and CRP levels (p = 0.017) than controls. The genotype and allele frequencies of patients differed from controls [CC vs. CT = odds ratio (OR) 1.730, 95% confidence interval (CI) 1.068-2.803, p = 0.035; CC vs. TT = OR 3.667, 95% CI 1.410-9.533, p = 0.009; C vs. T = OR 1.883, 95% CI 1.299-2.728, p = 0.001)]. Patients carrying the T allele presented higher CRP levels (p = 0.009), were more frequent Caucasians (p = 0.018), and with no use of immunosuppressive treatment (p = 0.004) than those carrying the C allele. However, the SLEDAI and anti-double-stranded DNA positivity did not differ from those carrying T vs. C allele (p = 0.595 and p = 0.243, respectively). The rs1130864 CRP polymorphism was associated with SLE susceptibility and CRP levels, but not with disease activity, suggesting that this polymorphism may play a role in the pathophysiology of SLE through increasing the CRP that, probably, plays an inflammatory role in SLE pathophysiology.
Reynoso-Villalpando, Gabriela Lizet; Padilla-Gutiérrez, Jorge Ramón; Valdez-Haro, Angélica; Casillas-Muñoz, Fidel; Muñoz-Valle, José Francisco; Castellanos-Nuñez, Edgar; Chávez-Herrera, Juan Carlos; Valle, Yeminia
2017-05-01
To determine the relationship among the 1846 C>T (rs1205) polymorphism, C-reactive protein (CRP) concentration, and interleukin 6 (IL-6) serum levels in patients with acute coronary syndrome (ACS) from Western Mexico. Three hundred participants in the control group (CG) and 300 patients with ACS from Western Mexico were included in the study. Genotyping was performed with polymerase chain reaction-restriction fragment length polymorphism (PCR-RFLP). High-sensitivity CRP (hs-CRP) concentration was measured by immunonephelometry. For IL-6 measurement, we used a solid-phase sandwich Enzyme-Linked Immunosorbent Assay. Serum CRP concentration was increased in patients compared with controls (19 mg/L vs. 2.00 mg/L; p < 0.0001). ST-segment elevation myocardial infarction exhibited a higher CRP concentration than without elevation (non-ST-segment elevation myocardial infarction) and patients with unstable angina (21.81, 17.10, and 5.91 mg/L; p < 0.01). The rs1205 CRP polymorphism was not associated with ACS; however, T carriers had lower CRP concentrations than C/C (2.80 mg/L vs. 5.20 mg/L; p = 0.004) in CG and ACS (17.76 vs. 21.45; p = 0.046). IL-6 showed a strong positive correlation with CRP concentration in ACS patients (rho = 0.74, p < 0.0001). Patients with ACS had increased CRP levels compared with CG, and this appears to be related with ACS clinical spectrum severity. The rs1205 polymorphism is not a susceptibility genetic marker to ACS in Western Mexico population; however, the T allele is associated with lower CRP concentration. Further studies are needed to confirm the prognostic value of ACS and IL-6/CRP correlation, but it could be a reliable test for predicting adverse cardiac events in the Mexican population.
Li, Ya-Jun; Li, Zhi-Ming; Xia, Yi; Huang, Jia-Jia; Huang, Hui-Qiang; Xia, Zhong-Jun; Lin, Tong-Yu; Li, Su; Cai, Xiu-Yu; Wu-Xiao, Zhi-Jun; Jiang, Wen-Qi
2013-01-01
C-reactive protein (CRP) is a biomarker of the inflammatory response, and it shows significant prognostic value for several types of solid tumors. The prognostic significance of CRP for lymphoma has not been fully examined. We evaluated the prognostic role of baseline serum CRP levels in patients with extranodal natural killer (NK)/T-cell lymphoma (ENKTL). We retrospectively analyzed 185 patients with newly diagnosed ENKTL. The prognostic value of the serum CRP level was evaluated for the low-CRP group (CRP≤10 mg/L) versus the high-CRP group (CRP>10 mg/L). The prognostic value of the International Prognostic Index (IPI) and the Korean Prognostic Index (KPI) were evaluated and compared with the newly developed prognostic model. Patients in the high-CRP group tended to display increased adverse clinical characteristics, lower rates of complete remission (P<0.001), inferior progression-free survival (PFS, P = 0.001), and inferior overall survival (OS, P<0.001). Multivariate analysis demonstrated that elevated serum CRP levels, age >60 years, hypoalbuminemia, and elevated lactate dehydrogenase levels were independent adverse predictors of OS. Based on these four independent predictors, we constructed a new prognostic model that identified 4 groups with varying OS: group 1, no adverse factors; group 2, 1 factor; group 3, 2 factors; and group 4, 3 or 4 factors (P<0.001). The novel prognostic model was found to be superior to both the IPI in discriminating patients with different outcomes in the IPI low-risk group and the KPI in distinguishing between the low- and intermediate-low-risk groups, the intermediate-low- and high-intermediate-risk groups, and the high-intermediate- and high-risk groups. Our results suggest that pretreatment serum CRP levels represent an independent predictor of clinical outcome for patients with ENKTL. The prognostic value of the new prognostic model is superior to both IPI and KPI.
Xia, Yi; Huang, Jia-Jia; Huang, Hui-Qiang; Xia, Zhong-Jun; Lin, Tong-Yu; Li, Su; Cai, Xiu-Yu; Wu-Xiao, Zhi-Jun; Jiang, Wen-Qi
2013-01-01
Background C-reactive protein (CRP) is a biomarker of the inflammatory response, and it shows significant prognostic value for several types of solid tumors. The prognostic significance of CRP for lymphoma has not been fully examined. We evaluated the prognostic role of baseline serum CRP levels in patients with extranodal natural killer (NK)/T-cell lymphoma (ENKTL). Methods We retrospectively analyzed 185 patients with newly diagnosed ENKTL. The prognostic value of the serum CRP level was evaluated for the low-CRP group (CRP≤10 mg/L) versus the high-CRP group (CRP>10 mg/L). The prognostic value of the International Prognostic Index (IPI) and the Korean Prognostic Index (KPI) were evaluated and compared with the newly developed prognostic model. Results Patients in the high-CRP group tended to display increased adverse clinical characteristics, lower rates of complete remission (P<0.001), inferior progression-free survival (PFS, P = 0.001), and inferior overall survival (OS, P<0.001). Multivariate analysis demonstrated that elevated serum CRP levels, age >60 years, hypoalbuminemia, and elevated lactate dehydrogenase levels were independent adverse predictors of OS. Based on these four independent predictors, we constructed a new prognostic model that identified 4 groups with varying OS: group 1, no adverse factors; group 2, 1 factor; group 3, 2 factors; and group 4, 3 or 4 factors (P<0.001). The novel prognostic model was found to be superior to both the IPI in discriminating patients with different outcomes in the IPI low-risk group and the KPI in distinguishing between the low- and intermediate-low-risk groups, the intermediate-low- and high-intermediate-risk groups, and the high-intermediate- and high-risk groups. Conclusions Our results suggest that pretreatment serum CRP levels represent an independent predictor of clinical outcome for patients with ENKTL. The prognostic value of the new prognostic model is superior to both IPI and KPI. PMID:23724031
[Impact of metabolic syndrome on CRP levels].
Rodilla, E; Costa, J A; Mares, S; Miralles, A; González, C; Sánchez, C; Pascual, J M
2006-09-01
C-reactive protein (CRP) is considered a marker of subclinical atherosclerosis. The aim of the study was to assess whether the metabolic syndrome (MS) and parameters involved in its diagnosis might influence serum CRP values. Cross-sectional study in outpatients of a HTA and Vascular Risk clinic. MS was diagnosed according to National Cholesterol Educational Program ATP-III guidelines, and hs-CRP was analyzed by nephelometry. A total of 1,969 patients (47% male) were evaluated and distributed into four groups: 1) 1,220 non-diabetics without MS; 2) 384 non-diabetics with MS; 3) 153 diabetics without MS, and 4) 212 diabetics with MS. Patients with MS had higher CRP in both non-diabetic 3.0 (1.7-4.4) mg/l vs. 1.7 (0.9-3.4) mg/l; p=0.001 (MW), and diabetic patients: 2.8 (1.5-4.6) mg/l vs. 2.2 (0.9-4.3) mg/l; p=0.01 (MW). Diabetic patients without MS had CRP values not different to non-diabetic without MS. CRP values increased in relation to the number of parameters included in the MS from 1.7 (2.2) mg/l, in patients without any parameters, to 4.2 (2.8) mg/l in patients who fulfilled five parameters (p=0.001) (KW). In multiple regression analysis abdominal obesity (p=0.001), TG (p=0.001) and glucose (p=0.02) were associated with CRP levels after correcting for other factors. Abdominal obesity (OR: 1.9; 95% CI: 1.5-2.4; p=0.001) and TG (OR: 1.4; 95% CI: 1.1 -1.7; p=0.003), but not glucose were independent factors related to the presence of high levels of CRP (>3 mg/l) in a logistic regression analysis. Diabetic and non-diabetic patients with MS have high CRP levels. Of the five components of MS, the most closely related to CRP is abdominal obesity.
Higdon, Melissa M; Le, Tham; O'Brien, Katherine L; Murdoch, David R; Prosperi, Christine; Baggett, Henry C; Brooks, W Abdullah; Feikin, Daniel R; Hammitt, Laura L; Howie, Stephen R C; Kotloff, Karen L; Levine, Orin S; Scott, J Anthony G; Thea, Donald M; Awori, Juliet O; Baillie, Vicky L; Cascio, Stephanie; Chuananon, Somchai; DeLuca, Andrea N; Driscoll, Amanda J; Ebruke, Bernard E; Endtz, Hubert P; Kaewpan, Anek; Kahn, Geoff; Karani, Angela; Karron, Ruth A; Moore, David P; Park, Daniel E; Rahman, Mohammed Ziaur; Salaudeen, Rasheed; Seidenberg, Phil; Somwe, Somwe Wa; Sylla, Mamadou; Tapia, Milagritos D; Zeger, Scott L; Deloria Knoll, Maria; Madhi, Shabir A
2017-06-15
Lack of a gold standard for identifying bacterial and viral etiologies of pneumonia has limited evaluation of C-reactive protein (CRP) for identifying bacterial pneumonia. We evaluated the sensitivity and specificity of CRP for identifying bacterial vs respiratory syncytial virus (RSV) pneumonia in the Pneumonia Etiology Research for Child Health (PERCH) multicenter case-control study. We measured serum CRP levels in cases with World Health Organization-defined severe or very severe pneumonia and a subset of community controls. We evaluated the sensitivity and specificity of elevated CRP for "confirmed" bacterial pneumonia (positive blood culture or positive lung aspirate or pleural fluid culture or polymerase chain reaction [PCR]) compared to "RSV pneumonia" (nasopharyngeal/oropharyngeal or induced sputum PCR-positive without confirmed/suspected bacterial pneumonia). Receiver operating characteristic (ROC) curves were constructed to assess the performance of elevated CRP in distinguishing these cases. Among 601 human immunodeficiency virus (HIV)-negative tested controls, 3% had CRP ≥40 mg/L. Among 119 HIV-negative cases with confirmed bacterial pneumonia, 77% had CRP ≥40 mg/L compared with 17% of 556 RSV pneumonia cases. The ROC analysis produced an area under the curve of 0.87, indicating very good discrimination; a cut-point of 37.1 mg/L best discriminated confirmed bacterial pneumonia (sensitivity 77%) from RSV pneumonia (specificity 82%). CRP ≥100 mg/L substantially improved specificity over CRP ≥40 mg/L, though at a loss to sensitivity. Elevated CRP was positively associated with confirmed bacterial pneumonia and negatively associated with RSV pneumonia in PERCH. CRP may be useful for distinguishing bacterial from RSV-associated pneumonia, although its role in discriminating against other respiratory viral-associated pneumonia needs further study. © The Author 2017. Published by Oxford University Press for the Infectious Diseases Society of America.
Allen, Arthur W.; Vandever, Mark W.
2003-01-01
A national survey of Conservation Reserve Program (CRP) contractees was completed to obtain information about Abstract environmental and social effects of the program on participants, farms, and communities. Of interest were observations concerning wildlife, attitudes about long-term management of program lands, and effectiveness of U.S. Department of Agriculture (USDA) assistance in relation to these issues. Surveys were delivered to 2,189 CRP participants with a resultant response rate of 64.5%. Retired farmers represented the largest category of respondents (52%). Enhanced control of soil erosion was the leading benefit of the CRP reported. Over 73% of respondents observed increased numbers of wildlife associated with lands enrolled in the program. The majority of respondents reported CRP benefits, including increased quality of surface and ground waters, improved air quality, control of drifting snow, and elevated opportunities to hunt or simply observe wildlife as part of daily activities. Income stability, improved scenic quality of farms and landscapes, and potential increases in property values and future incomes also were seen as program benefits. Negative aspects, reported by a smaller number of respondents, included seeing the CRP as a source of weeds, fire hazard, and attracting unwanted requests for trespass. Over 75% of respondents believed CRP benefits to wildlife were important. A majority of respondents (82%) believed the amount of assistance furnished by USDA related to planning and maintaining wildlife habitat associated with CRP lands was appropriate. Nearly 51% of respondents would accept incorporation of periodic management of vegetation into long-term management of CRP lands to maintain quality of wildlife habitats. Provision of funds to address additional costs and changes in CRP regulations would be required to maximize long-term management of program lands. Additional, on-ground assistance related to management of CRP, and other agricultural lands, to maintain wildlife habitats was commonly identified as a need by survey respondents.
Hellwinckel, Chad; Clark, Christopher; Langholtz, Matthew; ...
2015-07-29
We used a socioeconomic model to estimate the land-use implications on the U.S. Conservation Reserve Program from potential increases in second-generation biofuel production. A baseline scenario with no second-generation biofuel production is compared to a scenario where the Renewable Fuels Standard (RFS2) volumes are met by 2022. We allow for the possibility of converting expiring CRP lands to alternative uses such as conventional crops, dedicated second-generation biofuel crops, or harvesting existing CRP grasses for biomass. Our results indicate that RFS2 volumes (RFS2-v) can be met primarily with crop residues (78% of feedstock demand) and woody residues (19% of feedstock demand)more » compared with dedicated biomass (3% of feedstock demand), with only minimal conversion of cropland (0.27 million hectares, <1% of total cropland), pastureland (0.28 million hectares of pastureland, <1% of total pastureland), and CRP lands (0.29 million hectares of CRP lands, 3% of existing CRP lands) to biomass production. Meeting RFS2 volumes would reduce CRP re-enrollment by 0.19 million hectares, or 4%, below the baseline scenario where RFS2 is not met. Yet under RFS2-v scenario, expiring CRP lands are more likely to be converted to or maintain perennial cover, with 1.78 million hectares of CRP lands converting to hay production, and 0.29 million hectares being harvested for existing grasses. A small amount of CRP is harvested for existing biomass, but no conversion of CRP to dedicated biomass crops, such as switchgrass, are projected to occur. Although less land is enrolled in CRP under RFS2-v scenario, total land in perennial cover increases by 0.15 million hectares, or 2%, under RFS2-v. Sensitivity to yield, payment and residue retention assumptions are evaluated.« less
Chronic kidney disease, inflammation, and cardiovascular disease risk in rheumatoid arthritis.
Kochi, Masako; Kohagura, Kentaro; Shiohira, Yoshiki; Iseki, Kunitoshi; Ohya, Yusuke
2018-03-01
Rheumatoid arthritis (RA), a prototypic systemic autoimmune inflammatory condition, confers an increased risk of cardiovascular disease (CVD). Recently, chronic kidney disease (CKD) was suggested to increase the risk of CVD in RA patients, and inflammation was identified as a critical, nontraditional CKD-associated risk factor for CVD. This study aimed to examine the combined effects of CKD and CVD in RA patients. In this retrospective evaluation of 428 RA patients, the outcome of interest was the incidence of CVD. CKD was defined as an estimated glomerular filtration rate of <60mL/min/1.73m 2 and/or positive dipstick tests for proteinuria of ≥3 months duration. C-reactive protein (CRP) was used as an inflammation marker, and a high CRP level was defined as a mean CRP value of ≥0.57mg/dL during the first 6 months of follow-up. Patients were categorized as follows: non-CKD with low CRP, non-CKD with high CRP, CKD with low CRP, and CKD with high CRP. During a median follow-up of 89 months, 67 patients (16%) had CKD, and 38 (9%) developed CVD. Using patients with non-CKD and low CRP as a reference group, the adjusted hazard ratios (HR, 95% confidence interval) for CVD were 1.88 (0.25-9.44) for patients with CKD/low CRP and 9.71 (3.27-31.97) for those with CKD/high CRP. The coexistence of CKD and inflammation was associated with a higher risk of CVD than either condition alone in RA patients. Inflammation might increase the risk of CVD especially in patients with CKD. Copyright © 2017 Japanese College of Cardiology. Published by Elsevier Ltd. All rights reserved.
Kahn, Steven E.; Haffner, Steven M.; Viberti, Giancarlo; Herman, William H.; Lachin, John M.; Kravitz, Barbara G.; Yu, Dahong; Paul, Gitanjali; Holman, Rury R.; Zinman, Bernard
2010-01-01
OBJECTIVE C-reactive protein (CRP) is closely associated with obesity and cardiovascular disease in both diabetic and nondiabetic populations. In the short term, commonly prescribed antidiabetic agents have different effects on CRP; however, the long-term effects of those agents are unknown. RESEARCH DESIGN AND METHODS In A Diabetes Outcome Progression Trial (ADOPT), we examined the long-term effects of rosiglitazone, glyburide, and metformin on CRP and the relationship among CRP, weight, and glycemic variables in 904 subjects over 4 years. RESULTS Baseline CRP was significantly correlated with homeostasis model assessment of insulin resistance (HOMA-IR), A1C, BMI, waist circumference, and waist-to-hip ratio. CRP reduction was greater in the rosiglitazone group by −47.6% relative to glyburide and by −30.5% relative to metformin at 48 months. Mean weight gain from baseline (at 48 months) was 5.6 kg with rosiglitazone, 1.8 kg with glyburide, and −2.8 kg with metformin. The change in CRP from baseline to 12 months was correlated positively with change in BMI in glyburide (r = 0.18) and metformin (r = 0.20) groups but not in the rosiglitazone (r = −0.05, NS) group. However, there was no longer a significant correlation between change in CRP and change in HOMA-IR, A1C, or waist-to-hip ratio in any of the three treatment groups. CONCLUSIONS Rosiglitazone treatment was associated with durable reductions in CRP independent of changes in insulin sensitivity, A1C, and weight gain. CRP in the glyburide and metformin groups was positively associated with changes in weight, but this was not the case with rosiglitazone. PMID:19808911
Serum hsCRP: A Novel Marker for Prediction of Cerebrovascular Accidents (Stroke).
Patgiri, Dibyaratna; Pathak, Mauchumi Saikia; Sharma, Pradeep; Kutum, Tridip; Mattack, Nirmali
2014-12-01
Strokes are caused by disruption of the blood supply to the brain. This may result from either blockage or rupture of a blood vessel. Yearly 15 million people worldwide suffer a stroke. India ranks second worldwide in terms of deaths from stroke. The incidence of stroke increases with age affecting the economically productive middle aged population. Hypertension and male sex are other risk factors for stroke. C-Reactive Protein (CRP) is an acute phase protein whose concentration rises in blood following inflammation. Formerly, assays for CRP detected its rise only after significant inflammation. However, recently developed high sensitivity assays (hsCRP) enable the measurement of CRP in individuals who are apparently healthy. Several studies indicate that hsCRP is elevated in individuals who are at risk of developing Coronary Artery Disease or Cerebrovascular events, the elevation may be found years before the first detection of vascular problems. In the absence of other biochemical markers, the present study aimed to evaluate the predictive and diagnostic role of hsCRP in stroke. The study consisted of 50 patients of acute stroke admitted in Gauhati Medical College and Hospital. The control population consisted of two groups - 50 age and sex matched controls with hypertension (Hypertensive control group) and 50 age and sex matched controls with no obvious disease constituted the Normal control group. hsCRP levels were measured in all the groups and compared statistically. hsCRP is an acute phase reactant whose concentration rises in stroke as well as in those at risk. The rise may be identified even before the appearance of risk factors. Hence, hsCRP may be useful as a predictive and diagnostic marker in stroke.
Malla, Kalpana K.; Malla, Tejesh; Rao, K. Seshagiri; Basnet, Sahisnuta; Shah, Ravi
2013-01-01
Objectives: This study aimed to test whether C-reactive protein (CRP) measurement could differentiate between different types of meningitis and become a routine test. Methods: A prospective study included 140 children admitted to Manipal Teaching Hospital, Pokhara, Nepal, between July 2009 and June 2011. The subjects had a blood test and detailed cerebrospinal fluid (CSF) analysis, including blood and CSF CRP levels. Results: Of those admitted, 31.1% had pyogenic meningitis (PM), 26.2% partially treated meningitis (PPM), 33% viral meningitis (VM), and 9.7% tubercular meningitis (TBM), with 26.4% controls. Organisms were isolated in 12.5% of the cases by blood culture and 25% of cases through CSF culture. Blood CRP was positive in all groups, with the highest values in PM (53.12 ± 28.88 mg/dl) and PPM (47.55 ± 34.34 mg/dl); this was not statistically significant (P = 0.08). The CSF CRP levels were significantly higher (P <0.001) in PM (45.75 ± 28.50 mg/dl) and PPM (23.11 ± 23.98 mg/dl). The sensitivity and specificity of blood CRP was 90.62%, 88.88%, 64.7%, 70% and 32.4%, 30.97%, 24.52%, 26.12% and that of CSF CRP was 96.87%, 66.66%, 20.58%, 10% and 74.73%, 63.71%, 50.94%, 55.35% for PM, PPM, VM and TBM, respectively. Conclusion: Because of its high sensitivity, both CSF CRP and blood CRP can be used to screen for bacterial meningitis (both PM and PPM). CSF CRP screening yielded results with a higher specificity than blood CRP; hence, it can be a supportive test along with CSF cytology, biochemistry, and microbiology for diagnosing meningitis. PMID:23573388
Cheng, Hui G; Alshaarawy, Omayma; Cantave, Marven D; Anthony, James C
2016-10-01
Exposures to antioxidants (AO) are associated with levels of C-reactive protein (CRP), but the pattern of evidence is mixed, due in part to studying each potential AO, one at a time, when multiple AO exposures might affect CRP levels. By studying multiple AO via a composite indicator approach, we estimate the degree to which serum CRP level is associated with serum AO level. Standardised field survey protocols for the US National Health and Nutrition Examination Survey (NHANES) 2003-2006 yielded nationally representative cross-sectional samples of adults aged 20 years and older (n 8841). NHANES latex-enhanced nephelometry quantified serum CRP levels. Liquid chromatography quantified serum concentrations of vitamins A, E and C and carotenoids. Using structural equations, we regressed CRP level on AO levels, and derived a summary estimate for a composite of these potential antioxidants (CPA), with covariates held constant. The association linking CPA with CRP was inverse, stronger for slightly elevated CRP (1·8≤CRP<10 mg/l; slope= -1·08; 95 % CI -1·39, -0·77) and weaker for highly elevated CRP (≥10 mg/l; slope= -0·52; 95 % CI -0·68, -0·35), with little change when covariates were added. Vitamins A and C, as well as lutein+zeaxanthin, were prominent contributors to the composite. In these cross-sectional data studied via a composite indicator approach, the CPA level and the CRP level were inversely related. The stage is set for more confirmatory longitudinal or intervention research on multiple vitamins. The composite indicator approach might be most useful in epidemiology when several exposure constructs are too weakly inter-correlated to be studied via formal measurement models for underlying latent dimensions.
Chromium Supplementation Improves Glucose Tolerance in Diabetic Goto-Kakizaki Rats
Abdourahman, Aicha; Edwards, John G.
2016-01-01
Summary Chromium supplementation (Cr) may be useful in the management of diabetes and appears to improve some aspects of glucose handling. However, several studies have used either high doses of Cr supplementation or have placed control animals on a Cr-deficient diet. We therefore wanted to test whether Cr dosages in the ranges that more closely approximate recommended levels of supplementation in humans are efficacious in glycemic control under normal dietary conditions. Euglycemic Wistar or diabetic Goto-Kakizaki (GK) rats (a model of nonobese NIDDM) were assigned to water (control) or chromium picolinate (Cr-P) supplementation (1 or 10 mg/kg/day) groups for up to 32 weeks. Glucose tolerance was tested following an overnight fast by injecting sterile glucose (1.0 g/kg, i.p.) and then measuring blood glucose at select times to determine the sensitivity to glucose by calculation of the area under the curve. Cr-P did not significantly alter the growth of the animals. In the euglycemic Wistar rats, Cr-P supplementation did not alter the response to a glucose tolerance test. In the GK rats, Cr-P supplementation significantly improved glucose tolerance at both levels of Cr-P supplementation (1 mg/kg/day: H20; 100 ± 11%; Cr-P 70 6 8%; 10 mg/kg/day: H20; 100 ± 10%; Cr-P 66 ± 9 %). Cr-P supplementation produced a small improvement in some indices of glycemic control. There were no differences observed for the two levels of Cr-P supplementation suggested that we did not identify a threshold for Cr-P effects, and future studies may use lower doses to find a threshold effect for improving glucose tolerance in diabetics. PMID:18629917
Yang, Zhen; Zhi, Shaotao; Feng, Zhu; Lei, Chong; Zhou, Yong
2018-01-01
A sensitive and innovative assay system based on a micro-MEMS-fluxgate sensor and immunomagnetic beads-labels was developed for the rapid analysis of C-reactive proteins (CRP). The fluxgate sensor presented in this study was fabricated through standard micro-electro-mechanical system technology. A multi-loop magnetic core made of Fe-based amorphous ribbon was employed as the sensing element, and 3-D solenoid copper coils were used to control the sensing core. Antibody-conjugated immunomagnetic microbeads were strategically utilized as signal tags to label the CRP via the specific conjugation of CRP to polyclonal CRP antibodies. Separate Au film substrates were applied as immunoplatforms to immobilize CRP-beads labels through classical sandwich assays. Detection and quantification of the CRP at different concentrations were implemented by detecting the stray field of CRP labeled magnetic beads using the newly-developed micro-fluxgate sensor. The resulting system exhibited the required sensitivity, stability, reproducibility, and selectivity. A detection limit as low as 0.002 μg/mL CRP with a linearity range from 0.002 μg/mL to 10 μg/mL was achieved, and this suggested that the proposed biosystem possesses high sensitivity. In addition to the extremely low detection limit, the proposed method can be easily manipulated and possesses a quick response time. The response time of our sensor was less than 5 s, and the entire detection period for CRP analysis can be completed in less than 30 min using the current method. Given the detection performance and other advantages such as miniaturization, excellent stability and specificity, the proposed biosensor can be considered as a potential candidate for the rapid analysis of CRP, especially for point-of-care platforms. PMID:29601593
Brummett, Beverly H; Babyak, Michael A; Singh, Abanish; Jiang, Rong; Williams, Redford B; Harris, Kathleen Mullan; Siegler, Ilene C
2013-01-01
To examine the association between socioeconomic status (SES) and C-reactive protein (CRP) to understand how SES may increase the risk of cardiovascular disease and thus identify targets for prevention measures. Path models were used to examine direct and indirect associations of four indices of SES (objective early life built environment ratings, parental and participant education, and income) with CRP measured during early adulthood using data from the National Longitudinal Adolescent Health Study (n = 11,371; mean age = 29 years, range = 24-32 years; 53.8% women, 28.0% black participants). The present study examined potential mediation of the association of SES with CRP by way of body mass index (BMI), smoking, and alcohol consumption within white and black men and women. BMI was a mediator of the relation between parent education and CRP for white men (path coefficient [γ] = -0.05, p < .001) and women (γ = -0.05, p < .001). Smoking mediated the income-CRP (γ = -0.01, p < .01) and the education-CRP (γ = -0.07, p < .001) relation for white men. BMI mediated the relation between all measures of SES and CRP for white women (γ values between -0.02 and -0.05; p values < .01). None of the risk factors mediated the SES-CRP relation in black participants. These findings indicate that the association of SES with CRP is influenced by both the timing and type of SES measure examined. In addition, race and sex play a role in how potential mediators are involved with the SES-CRP relationship, such that BMI and smoking were mediators in white men, whereas BMI was the sole mediator in white women.
Salgia, Gaurav; Kulkarni, Deepak G; Shetty, Lakshmi
2015-01-01
C-reactive protein (CRP) estimation for quantitative analysis to assess anti-inflammatory action of nonsteroidal anti-inflammatory drugs (NSAIDs) after surgery in maxillofacial surgery. This study was to evaluate the efficacy of CRP as a quantitative analysis for objective assessment of efficacy of three NSAIDs in postoperative inflammation and pain control. The parallel study group design of randomization was done. Totally 60 patients were divided into three groups. CRP was evaluated at baseline and postoperatively (immediate and 72 h) after surgical removal of impacted lower third molar. The respective group received the drugs by random coding postoperatively. The assessment of pain control and inflammation using NSAIDs postoperatively after surgical removal of impacted lower third molar was qualitatively and quantitatively assessed with CRP levels. The blood sample of the patient was assessed immediate postoperatively and after 72 h. The visual analog scale (VAS) was used for assessment of pain and its correlation with CRP levels. Comparison of difference in levels of CRP levels had P < 0.05 with immediate postoperative and baseline levels. The duration of surgery with association of CRP levels P = 0.425 which was nonsignificant. The pain score was increased with mefenamic acid (P = 0.003), which was significant on VAS. Diclofenac had the best anti-inflammatory action. There was a significant increase in CRP levels in immediate postoperative values and 72 h. CRP test proved to be a useful indicator as a quantitative assessment tool for monitoring postsurgical inflammation and therapeutic effects of various anti-inflammatory drugs. CRP test is a useful indicator for quantitative assessment for comparative evaluation of NSAIDs.
C-Reactive Protein and Prediction of 1-Year Mortality in Prevalent Hemodialysis Patients
Bazeley, Jonathan; Bieber, Brian; Li, Yun; Morgenstern, Hal; de Sequera, Patricia; Combe, Christian; Yamamoto, Hiroyasu; Gallagher, Martin; Port, Friedrich K.
2011-01-01
Summary Background and objectives Measurement of C-reactive protein (CRP) levels remains uncommon in North America, although it is now routine in many countries. Using Dialysis Outcomes and Practice Patterns Study data, our primary aim was to evaluate the value of CRP for predicting mortality when measured along with other common inflammatory biomarkers. Design, setting, participants, & measurements We studied 5061 prevalent hemodialysis patients from 2005 to 2008 in 140 facilities routinely measuring CRP in 10 countries. The association of CRP with mortality was evaluated using Cox regression. Prediction of 1-year mortality was assessed in logistic regression models with differing adjustment variables. Results Median baseline CRP was lower in Japan (1.0 mg/L) than other countries (6.0 mg/L). CRP was positively, monotonically associated with mortality. No threshold below which mortality rate leveled off was identified. In prediction models, CRP performance was comparable with albumin and exceeded ferritin and white blood cell (WBC) count based on measures of model discrimination (c-statistics, net reclassification improvement [NRI]) and global model fit (generalized R2). The primary analysis included age, gender, diabetes, catheter use, and the four inflammatory markers (omitting one at a time). Specifying NRI ≥5% as appropriate reclassification of predicted mortality risk, NRI for CRP was 12.8% compared with 10.3% for albumin, 0.8% for ferritin, and <0.1% for WBC. Conclusions These findings demonstrate the value of measuring CRP in addition to standard inflammatory biomarkers to improve mortality prediction in hemodialysis patients. Future studies are indicated to identify interventions that lower CRP and to identify whether they improve clinical outcomes. PMID:21868617
Kahn, Steven E; Haffner, Steven M; Viberti, Giancarlo; Herman, William H; Lachin, John M; Kravitz, Barbara G; Yu, Dahong; Paul, Gitanjali; Holman, Rury R; Zinman, Bernard
2010-01-01
C-reactive protein (CRP) is closely associated with obesity and cardiovascular disease in both diabetic and nondiabetic populations. In the short term, commonly prescribed antidiabetic agents have different effects on CRP; however, the long-term effects of those agents are unknown. In A Diabetes Outcome Progression Trial (ADOPT), we examined the long-term effects of rosiglitazone, glyburide, and metformin on CRP and the relationship among CRP, weight, and glycemic variables in 904 subjects over 4 years. Baseline CRP was significantly correlated with homeostasis model assessment of insulin resistance (HOMA-IR), A1C, BMI, waist circumference, and waist-to-hip ratio. CRP reduction was greater in the rosiglitazone group by -47.6% relative to glyburide and by -30.5% relative to metformin at 48 months. Mean weight gain from baseline (at 48 months) was 5.6 kg with rosiglitazone, 1.8 kg with glyburide, and -2.8 kg with metformin. The change in CRP from baseline to 12 months was correlated positively with change in BMI in glyburide (r = 0.18) and metformin (r = 0.20) groups but not in the rosiglitazone (r = -0.05, NS) group. However, there was no longer a significant correlation between change in CRP and change in HOMA-IR, A1C, or waist-to-hip ratio in any of the three treatment groups. Rosiglitazone treatment was associated with durable reductions in CRP independent of changes in insulin sensitivity, A1C, and weight gain. CRP in the glyburide and metformin groups was positively associated with changes in weight, but this was not the case with rosiglitazone.
Grovenburg, Troy W.; Klaver, Robert W.; Jenks, Jonathan A.
2012-01-01
Few studies have evaluated how wildlife, and white-tailed deer (Odocoileus virginianus) in particular, respond to Conservation Reserve Program (CRP) grasslands. We conducted a 3-year study (2007–2009) to determine the influence of CRP on fawn ecology during a time of declining CRP enrollment. We captured and radiocollared 81 fawn white-tailed deer during 15 May to 15 June 2007–2009 in north-central South Dakota, collected 6,505 locations, and documented 70 summer home ranges. Mean summer home ranges increased temporally during 2007–2009 (P P < 0.001) from 2007 to 2009. Analysis of covariance models indicated that change in CRP influenced home-range size, and change in CRP and wheat influenced daily movement. Smaller home ranges and reduced movements were associated with greater quantity of CRP available to fawns, and increased movements were associated with more acreage of wheat available to fawns. Fawns shifted resource selection during the summer at a mean age ranging from 48.8 days to 58.6 days, and this shift was associated with height of corn (83–87 cm). During early summer, fawns consistently selected for CRP; selection of wheat progressed temporally from avoidance in 2007 to selection in 2009. During late summer, fawns consistently selected for corn habitat and used CRP at least in proportion to its availability. Reduction in CRP-grasslands seemed to increase fawn home-range size and daily movements and, influenced change in resource selection to wheat. Current legislation mandates continued decrease in CRP enrollment and concomitant increase in the planting of corn for ethanol production. Management of habitat throughout the grasslands of the Northern Great Plains that maximizes cover habitats would provide neonates with adequate cover for protection from predators.
C-Reactive Protein (CRP) and its Association with Periodontal Disease: A Brief Review.
Bansal, Tushika; Pandey, Anita; D, Deepa; Asthana, Ashish K
2014-07-01
Periodontal disease is a chronic infection of the gums characterised by a loss of attachment between the tooth and bone, and bone loss. C-reactive protein (CRP) elevation is a part of the acute phase response to acute and chronic inflammation. Many epidemiological studies have shown that serum CRP levels were elevated in patients with chronic periodontitis. CRP levels increase to hundreds of μg/ml within hours following infection. It out-performs erythrocyte sedimentation rate (ESR) in terms of responsiveness and specificity for inflammation. While CRP elevation is suggestive of inflammation or infection in the appropriate clinical context, it can also occur with obesity and renal dysfunction. Conversely, a lack of CRP elevation in inflammation may be seen with hepatic failure, as well as during flares of conditions such as systemic lupus erythematosus.
Yeo, Sang Seok; Jang, Sung Ho; Son, Su Min
2014-01-01
Background and Purpose: The corticospinal tract (CST) and corticoreticular pathway (CRP) are known to be important neural tracts for motor development. However, little is known about the difference in maturation of the CST and CRP. In this study, using diffusion tensor imaging (DTI), we investigated maturation of the CST and CRP in typically developed children and normal healthy adults. Methods: We recruited 75 normal healthy subjects for this study. DTI was performed using 1.5-T, and the CST and CRP were reconstructed using DTI-Studio software. Values of fractional anisotropy (FA) and fiber volume (FV) of the CST and CRP were measured. Results: In the current study, the threshold points for CST and CRP maturation were different in normal brain development. Change in FA value of the CST showed a steep increase until 7 years of age and then a gradual increase until adulthood, however, the CRP showed a steep increase only until 2 years of age and then a very gradual increase or plateau until adulthood. In terms of FV, the CST showed a steep increase until 12 years and then a gradual increase until adulthood, in contrast, the CRP showed gradual increase of FV across whole age range (0–25 years). Conclusion: The difference in maturation process between CST and CRP appears to be related to different periods of fine and gross motor development. This radiologic information can provide a scientific basis for understanding development in motor function. PMID:25309378
Shimanoe, Chisato; Hara, Megumi; Nishida, Yuichiro; Nanri, Hinako; Otsuka, Yasuko; Horita, Mikako; Yasukata, Jun; Miyoshi, Nobuyuki; Yamada, Yosuke; Higaki, Yasuki; Tanaka, Keitaro
2018-05-01
Inconsistent associations have been reported between perceived stress and C-reactive protein (CRP), a marker of systemic inflammation. We previously observed a male-specific inverse relationship between perceived stress and CRP in a cross-sectional study. In the present study, we examined the longitudinal association between changes in perceived stress and CRP, and further analyzed whether changes in coping strategies and social support modify this association. This study included 8454 participants in both a baseline survey and a follow-up survey 5 years later. Psychosocial measures (i.e. perceived stress, coping strategies, and social support) and CRP concentrations were measured by identical means in both surveys. Consistent with our previous findings, increased perceived stress was significantly associated with lower CRP in men (p trend = .037), but not in women. Increased "emotional expression," a coping strategy, was also associated with lower CRP in women (p trend = .024). Furthermore, interactions between perceived stress and a coping strategy (positive reappraisal) or social support on CRP were found in men (p interaction = .007 and .038, respectively); the above inverse association between stress and CRP was not detected for participants with diminished positive reappraisal or social support. In conclusion, increases in perceived stress during a 5-year period were associated with decreases in CRP among healthy men, and the observed association was possibly modified by coping strategy or social support.
Comparison of cardiovascular disease risk in two main forms of periodontitis
Chopra, Rahul; Patil, Sudhir R.; Mathur, Shivani
2012-01-01
Background: C-reactive protein (CRP) is an acute phase reactant and has been proved to be a significant predictor of future cardiovascular events. Recent studies have demonstrated a correlation between periodontitis and elevated CRP levels. However, comparison between the levels of CRP in two main forms of periodontitis is ambiguous. This study aims at determining and comparing the relative levels of serum CRP in aggressive and chronic periodontitis patients. Materials and Methods: A total of 240 systemically healthy subjects were divided into three groups of 80 based on having generalized aggressive periodontitis, chronic generalized periodontitis and non-periodontitis (NP; controls). Venous blood samples were collected for quantitative CRP analysis using turbidimetric immunoassay. Results: Mean CRP levels were significantly greater in both generalized aggressive periodontitis (7.49±2.31 mg/l) and chronic generalized periodontitis (4.88±1.80 mg/l) groups as compared to NP (0.68±0.23 mg/l) controls. Moreover, CRP levels were significantly higher in aggressive periodontitis as compared to chronic periodontitis patients. Also, CRP levels positively correlated with the amount of periodontal destruction as measured by probing depth and clinical attachment loss for both chronic generalized periodontitis and generalized aggressive periodontitis. Conclusion: Findings of the present study indicated that periodontitis should be of particular concern in younger individuals, where elevated levels of CRP may contribute to early or more rapid cardiovascular disease in susceptible patients. Thus, further research should be carried out at a community level to ascertain these findings. PMID:22363367
Brown, Daniel E; Mautz, William J; Warrington, Miyako; Allen, Lenard; Tefft, Harold A T; Gotshalk, Lincoln; Katzmarzyk, Peter T
2010-01-01
Adipose cells secrete proinflammatory cytokines that stimulate hepatic production of C-reactive protein (CRP). CRP levels are associated with adiposity levels in adults, adolescents, and older children but not in young children (age 2-3). This study examined the relation between CRP, adiposity, and cardiovascular and metabolic variables including blood pressure, glucose, and blood lipids in two young cohorts of children, averaging approximately 5.5 and 8.5 years, respectively. Children (N = 125) from eight elementary schools in the multiethnic community of Hilo Hawaii were recruited to fill out questionnaires, undergo anthropometrics and air displacement plethysmography, have resting blood pressure measured, and provide a finger stick blood sample for analysis of CRP, glucose, and blood lipids. There were no significant differences between the cohorts in ethnic make up, household income, or parents' educational attainment. No significant relation was found between CRP and either adiposity or cardiovascular/metabolic variables in the younger cohort. However, significant correlations were found between CRP and adiposity measures and blood pressure in the older cohort. There was no marked difference in association of CRP with BMI versus waist circumference or waist-to-hip ratio. In neither cohort was CRP significantly related to glucose or blood lipids. Both amount of fat mass and time duration for possessing the adipose tissue may be important factors in determining the relation between CRP and both adiposity and blood pressure. (c) 2010 Wiley-Liss, Inc.
Autoradiographic demonstration of oxytocin-binding sites in the macula densa
DOE Office of Scientific and Technical Information (OSTI.GOV)
Stoeckel, M.E.; Freund-Mercier, M.J.
1989-08-01
Specific oxytocin (OT)-binding sites were localized in the rat kidney with use of a selective {sup 125}I-labeled OT antagonist ({sup 125}I-OTA). High concentrations of OT binding sites were detected on the juxtaglomerular apparatus with use of the conventional film autoradiographic technique. No labeling occurred on other renal structures. The cellular localization of the OT binding sites within the juxtaglomerular apparatus was studied in light microscope autoradiography, on semithin sections from paraformaldehyde-fixed kidney slices incubated in the presence of {sup 125}I-OTA. These preparations revealed selective labeling of the macula densa, mainly concentrated at the basal pole of the cells. Control experimentsmore » showed first that {sup 125}I-OTA binding characteristics were not noticeably altered by prior paraformaldehyde fixation of the kidneys and second that autoradiographic detection of the binding sites was not impaired by histological treatments following binding procedures. In view of the role of the macula densa in the tubuloglomerular feedback, the putative OT receptors of this structure might mediate the stimulatory effect of OT on glomerular filtration.« less
Odorant-binding proteins from a primitive termite.
Ishida, Yuko; Chiang, Vicky P; Haverty, Michael I; Leal, Walter S
2002-09-01
Hitherto, odorant-binding proteins (OBPs) have been identified from insects belonging to more highly evolved insect orders (Lepidoptera, Coleoptera, Diptera, Hymenoptera, and Hemiptera), whereas only chemosensory proteins have been identified from more primitive species, such as orthopteran and phasmid species. Here, we report for the first time the isolation and cloning of odorant-binding proteins from a primitive termite species, the dampwood termite. Zootermopsis nevadensis nevadensis (Isoptera: Termopsidae). A major antennae-specific protein was detected by native PAGE along with four other minor proteins, which were also absent in the extract from control tissues (hindlegs). Multiple cDNA cloning led to the full characterization of the major antennae-specific protein (ZnevOBP1) and to the identification of two other antennae-specific cDNAs, encoding putative odorant-binding proteins (ZnevOBP2 and ZnevOBP3). N-terminal amino acid sequencing of the minor antennal bands and cDNA cloning showed that olfaction in Z. n. nevadensis may involve multiple odorant-binding proteins. Database searches suggest that the OBPs from this primitive termite are homologues of the pheromone-binding proteins from scarab beetles and antennal-binding proteins from moths.
Assessing the binding of cholinesterase inhibitors by docking and molecular dynamics studies.
Ali, M Rejwan; Sadoqi, Mostafa; Møller, Simon G; Boutajangout, Allal; Mezei, Mihaly
2017-09-01
In this report we assessed by docking and molecular dynamics the binding mechanisms of three FDA-approved Alzheimer drugs, inhibitors of the enzyme acetylcholinesterase (AChE): donepezil, galantamine and rivastigmine. Dockings by the softwares Autodock-Vina, PatchDock and Plant reproduced the docked conformations of the inhibitor-enzyme complexes within 2Å of RMSD of the X-ray structure. Free-energy scores show strong affinity of the inhibitors for the enzyme binding pocket. Three independent Molecular Dynamics simulation runs indicated general stability of donepezil, galantamine and rivastigmine in their respective enzyme binding pocket (also referred to as gorge) as well as the tendency to form hydrogen bonds with the water molecules. The binding of rivastigmine in the Torpedo California AChE binding pocket is interesting as it eventually undergoes carbamylation and breaks apart according to the X-ray structure of the complex. Similarity search in the ZINC database and targeted docking on the gorge region of the AChE enzyme gave new putative inhibitor molecules with high predicted binding affinity, suitable for potential biophysical and biological assessments. Copyright © 2017 Elsevier Inc. All rights reserved.
Intracellular Localization Map of Human Herpesvirus 8 Proteins▿
Sander, Gaby; Konrad, Andreas; Thurau, Mathias; Wies, Effi; Leubert, Rene; Kremmer, Elisabeth; Dinkel, Holger; Schulz, Thomas; Neipel, Frank; Stürzl, Michael
2008-01-01
Human herpesvirus 8 (HHV-8) is the etiological agent of Kaposi's sarcoma. We present a localization map of 85 HHV-8-encoded proteins in mammalian cells. Viral open reading frames were cloned with a Myc tag in expression plasmids, confirmed by full-length sequencing, and expressed in HeLa cells. Protein localizations were analyzed by immunofluorescence microscopy. Fifty-one percent of all proteins were localized in the cytoplasm, 22% were in the nucleus, and 27% were found in both compartments. Surprisingly, we detected viral FLIP (v-FLIP) in the nucleus and in the cytoplasm, whereas cellular FLIPs are generally localized exclusively in the cytoplasm. This suggested that v-FLIP may exert additional or alternative functions compared to cellular FLIPs. In addition, it has been shown recently that the K10 protein can bind to at least 15 different HHV-8 proteins. We noticed that K10 and only five of its 15 putative binding factors were localized in the nucleus when the proteins were expressed in HeLa cells individually. Interestingly, in coexpression experiments K10 colocalized with 87% (13 of 15) of its putative binding partners. Colocalization was induced by translocation of either K10 alone or both proteins. These results indicate active intracellular translocation processes in virus-infected cells. Specifically in this framework, the localization map may provide a useful reference to further elucidate the function of HHV-8-encoded genes in human diseases. PMID:18077714
Faheem, Muhammad; Martins-de-Sa, Diogo; Vidal, Julia F D; Álvares, Alice C M; Brandão-Neto, José; Bird, Louise E; Tully, Mark D; von Delft, Frank; Souto, Betulia M; Quirino, Betania F; Freitas, Sonia M; Barbosa, João Alexandre R G
2016-12-09
A current metagenomics focus is to interpret and transform collected genomic data into biological information. By combining structural, functional and genomic data we have assessed a novel bacterial protein selected from a carbohydrate-related activity screen in a microbial metagenomic library from Capra hircus (domestic goat) gut. This uncharacterized protein was predicted as a bacterial cell wall-modifying enzyme (CWME) and shown to contain four domains: an N-terminal, a cysteine protease, a peptidoglycan-binding and an SH3 bacterial domain. We successfully cloned, expressed and purified this putative cysteine protease (PCP), which presented autoproteolytic activity and inhibition by protease inhibitors. We observed cell wall hydrolytic activity and ampicillin binding capacity, a characteristic of most bacterial CWME. Fluorimetric binding analysis yielded a K b of 1.8 × 10 5 M -1 for ampicillin. Small-angle X-ray scattering (SAXS) showed a maximum particle dimension of 95 Å with a real-space R g of 28.35 Å. The elongated molecular envelope corroborates the dynamic light scattering (DLS) estimated size. Furthermore, homology modeling and SAXS allowed the construction of a model that explains the stability and secondary structural changes observed by circular dichroism (CD). In short, we report a novel cell wall-modifying autoproteolytic PCP with insight into its biochemical, biophysical and structural features.
Schlenz, H; Intemann, T; Wolters, M; González-Gil, E M; Nappo, A; Fraterman, A; Veidebaum, T; Molnar, D; Tornaritis, M; Sioen, I; Mårild, S; Iacoviello, L; Ahrens, W
2014-09-01
C-reactive protein (CRP) is involved in a wide range of diseases. It is a powerful marker for inflammatory processes used for diagnostic and monitoring purposes. We aimed to establish reference values as data on the distribution of serum CRP levels in young European children are scarce. Reference values of high-sensitivity CRP concentrations were calculated for 9855 children aged 2.0-10.9 years, stratified by age and sex. The children were recruited during the population-based European IDEFICS study (Identification and prevention of Dietary- and lifestyle-induced health Effects in Children and infantS) with 18 745 participants recruited from 2007 to 2010. In 44.1% of the children, CRP values were below or equal the detection limit of 0.2 mg/l. Median CRP concentrations showed a slight negative age trend in boys and girls, whereas serum CRP values were slightly higher in girls than in boys across all age groups. Our population-based reference values of CRP may guide paediatric practice as elevated values may require further investigation or treatment. Therefore, the presented reference values represent a basis for clinical evaluation and for future research on risk assessment of diseases associated with increased CRP levels among children.
Bodner-Adler, Barbara; Kimberger, Oliver; Schneidinger, Cora; Kölbl, Heinz; Bodner, Klaus
2016-09-01
To evaluate pre-treatment serum C-reactive protein (CRP) level as a prognostic parameter in patients with adenocarcinoma of the uterine cervix. Pre-treatment CRP levels were analyzed to determine potential associations with clinicopathological parameters and to assess prognostic value in 46 patients with sole adenocarcinoma of the uterine cervix. The mean (±SD) pre-treatment serum CRP level was 5.82 (7.21) mg/l. Serum CRP concentration significantly correlated positively with age at diagnosis (p=0.001), lymphovascular space invasion (p=0.0026), recurrent disease (p=0.0001) and International Federation of Gynecology and Obstetrics (FIGO) stage (p=0.0002). In multivariate Cox regression models with age, FIGO stage, histological grade and lymph node status, elevated CRP and cancer antigen 125 levels were associated with shortened survival (p<0.05). Overall 5-year survival rate of patients with pre-treatment serum CRP level <5.0 mg/l was 100% compared to 46.9% for patients with pre-treatment CRP level ≥5.0 mg/l. Serum CRP level can be seen as an additional independent prognostic parameter in patients with the rare histological subtype adenocarcinoma of the uterine cervix. Copyright© 2016 International Institute of Anticancer Research (Dr. John G. Delinassios), All rights reserved.
Socioeconomic position, health behaviors, and C-reactive protein: A moderated-mediation analysis
Kershaw, Kiarri N.; Mezuk, Briana; Abdou, Cleopatra M.; Rafferty, Jane A.; Jackson, James S.
2010-01-01
Objective We sought to understand the link between low SEP and cardiovascular disease (CVD) by examining the association between SEP, health-related coping behaviors, and C-reactive protein (CRP), an inflammatory marker and independent risk factor for CVD in a US sample of adults. Design We used a multiple mediation model to evaluate how these behaviors work in concert to influence CRP levels and whether these relationships were moderated by gender and race/ethnicity. Main outcome measures CRP levels were divided into two categories: elevated CRP (3.1–10.0 mg/L) and normal CRP (≤ 3.0 mg/L). Results Both poverty and low educational attainment were associated with elevated CRP, and these associations were primarily explained through higher levels of smoking and lower levels of exercise. In the education model, poor diet also emerged as a significant mediator. These behaviors accounted for 87.9% of the total effect of education on CRP and 55.8% the total effect of poverty on CRP. We also found significant moderation of these mediated effects by gender and race/ethnicity. Conclusion These findings demonstrate the influence of socioeconomically-patterned environmental constraints on individual-level health behaviors. Specifically, reducing socioeconomic inequalities may have positive effects on CVD disparities through reducing cigarette smoking and increasing vigorous exercise. PMID:20496985
Homocysteine and C-reactive protein as useful surrogate markers for evaluating CKD risk in adults.
Chuang, Chung-Hsun; Lee, Yi-Yen; Sheu, Bor-Fuh; Hsiao, Cheng-Ting; Loke, Song-Seng; Chen, Jih-Chang; Li, Wen-Cheng
2013-01-01
This study aimed to evaluate the effectiveness of homocysteine and C-reactive protein (CRP) as potential markers for chronic kidney disease (CKD) in adults in Taiwan, and to identify associations between these factors and CKD, stratifying by gender. This cross-sectional study analyzed multi-center data retrospectively. Data were collected from 22,043 adult Taiwanese at Chang-Gung Memorial Hospital from 2005 to 2011. Smoking/drinking history, personal medical/medication history, pregnancy, fasting times as well as laboratory parameters, including homocysteine and CRP were measured and analyzed. Significant differences were observed between four homocysteine and CRP quartiles in eGFR and CKD. For males, only one model showed significant associations between plasma homocysteine and CKD, while in females, all three models showed significant associations with CKD. On the contrary, the gender difference in the case of CRP was opposite. Combined homocysteine and CRP were associated with CKD in males but not in females. Among Taiwanese adults, plasma homocysteine is associated with CKD in females and plasma hsCRP is associated with CKD in males. High hsCRP/high homocysteine is associated with elevated CKD risk in male. Our results suggest that homocysteine and hsCRP may be useful surrogate markers for evaluating CKD risk in adults. © 2013 S. Karger AG, Basel.
Identification and preliminary characterization of a protein motif related to the zinc finger.
Lovering, R; Hanson, I M; Borden, K L; Martin, S; O'Reilly, N J; Evan, G I; Rahman, D; Pappin, D J; Trowsdale, J; Freemont, P S
1993-01-01
We have identified a protein motif, related to the zinc finger, which defines a newly discovered family of proteins. The motif was found in the sequence of the human RING1 gene, which is proximal to the major histocompatibility complex region on chromosome six. We propose naming this motif the "RING finger" and it is found in 27 proteins, all of which have putative DNA binding functions. We have synthesized a peptide corresponding to the RING1 motif and examined a number of properties, including metal and DNA binding. We provide evidence to support the suggestion that the RING finger motif is the DNA binding domain of this newly defined family of proteins. Images Fig. 1 Fig. 4 PMID:7681583
Spudich, James A.
2015-01-01
No matter how many times one explores the structure of the myosin molecule, there is always something new to discover. Here, I describe the myosin mesa, a structural feature of the motor domain that has the characteristics of a binding domain for another protein, possibly myosin-binding protein C (MyBP-C). Interestingly, many well-known hypertrophic cardiomyopathy (HCM) mutations lie along this surface and may affect the putative interactions proposed here. A potential unifying hypothesis for the molecular basis of human hypertrophic cardiomyopathy is discussed here. It involves increased power output of the cardiac muscle as a result of HCM mutations causing the release of inhibition by myosin binding protein C. PMID:25619247
Code of Federal Regulations, 2010 CFR
2010-01-01
...) If a participant fails to carry out the terms and conditions of a CRP contract, CCC may terminate the CRP contract. (2) If the CRP contract is terminated by CCC in accordance with this paragraph: (i) The...
FEV1 inversely correlates with metalloproteinases 1, 7, 9 and CRP in COPD by biomass smoke exposure
2014-01-01
Background Matrix metalloproteinases (MMPs) and C-reactive protein (CRP) are involved in chronic obstructive pulmonary disease (COPD) pathogenesis. The aim of the present work was to determine plasma concentrations of MMPs and CRP in COPD associated to biomass combustion exposure (BE) and tobacco smoking (TS). Methods Pulmonary function tests, plasma levels of MMP-1, MMP-7, MMP-9, MMP-9/TIMP-1 and CRP were measured in COPD associated to BE (n = 40) and TS (n =40) patients, and healthy non-smoking (NS) healthy women (controls, n = 40). Results Plasma levels of MMP-1, MMP-7, MMP-9, and MMP-9/TIMP-1 and CRP were higher in BE and TS than in the NS healthy women (p <0.01). An inverse correlation between MMP-1, MMP-7, MMP-9, MMP-9/TIMP-1 and CRP plasma concentrations and FEV1 was observed. Conclusions Increase of MMPs and CRP plasma concentrations in BE suggests a systemic inflammatory phenomenon similar to that observed in COPD associated to tobacco smoking, which may also play a role in COPD pathogenesis. PMID:24980707
Ramanathan, Kumaresan; Padmanabhan, Giri; Vijayaraghavan, Bhooma
2016-05-01
Severe peritonitis causing death is one of the most devastating complications of peritoneal dialysis (PD). Since the predictive value of C-reactive protein (CRP) in PD fluid has not been assessed, the objective of the present study is to evaluate its predictive value and clinical correlation in patients on PD with peritonitis. One hundred and twenty patients on continuous ambulatory PD (CAPD) were enrolled and their serum and fluid CRP (Fl. CRP) were evaluated at the start of CAPD. All patients who developed peritonitis were further evaluated for serum and fluid CRP. The patients were categorized into four groups, namely: normal patients (control group), patients with peritonitis, patients with peritonitis leading to catheter removal, and death due to peritonitis. Sixty-five patients developed peritonitis of whom, catheter removal was performed in eight patients. Five patients died due to peritonitis-related complications. Fl. CRP showed a significant difference among the three groups, unlike S. CRP. Estimation of CRP in the peritoneal fluid may be a useful marker to monitor the onset of peritonitis.
FEV1 inversely correlates with metalloproteinases 1, 7, 9 and CRP in COPD by biomass smoke exposure.
Montaño, Martha; Sansores, Raul H; Becerril, Carina; Cisneros, Jose; González-Avila, Georgina; Sommer, Bettina; Ochoa, Leticia; Herrera, Iliana; Ramírez-Venegas, Alejandra; Ramos, Carlos
2014-06-30
Matrix metalloproteinases (MMPs) and C-reactive protein (CRP) are involved in chronic obstructive pulmonary disease (COPD) pathogenesis. The aim of the present work was to determine plasma concentrations of MMPs and CRP in COPD associated to biomass combustion exposure (BE) and tobacco smoking (TS). Pulmonary function tests, plasma levels of MMP-1, MMP-7, MMP-9, MMP-9/TIMP-1 and CRP were measured in COPD associated to BE (n = 40) and TS (n =40) patients, and healthy non-smoking (NS) healthy women (controls, n = 40). Plasma levels of MMP-1, MMP-7, MMP-9, and MMP-9/TIMP-1 and CRP were higher in BE and TS than in the NS healthy women (p <0.01). An inverse correlation between MMP-1, MMP-7, MMP-9, MMP-9/TIMP-1 and CRP plasma concentrations and FEV1 was observed. Increase of MMPs and CRP plasma concentrations in BE suggests a systemic inflammatory phenomenon similar to that observed in COPD associated to tobacco smoking, which may also play a role in COPD pathogenesis.
Relationship of HS CRP and Sacroiliac Joint Inflammation in Undifferentiated Spondyloarthritis.
Liu, Te-Jung; Chang, Cheng-Chiang; Chen, Liang-Cheng; Chu, Heng-Yi; Hsu, Chun-Sheng; Chang, Shin-Tsu
2018-01-01
Elevation of serum high sensitivity C-reactive protein (hs-CRP) level has been demonstrated as a risk factor for varying diseases, as well as a biomarker for predicting recovery after operation of lumber disc herniation. Our objective was to investigate the relationship between serum hs-CRP and sacroiliac (SI) joint inflammation in patients with undifferentiated spondyloarthritis (uSpA). In this retrospective study, we enrolled patients with uSpA who underwent hs-CRP testing between January 2007 and September 2013. Serum hs-CRP was analyzed at our central laboratory. All enrolled patients underwent skeletal scintigraphic scan with quantitative sacroiliac measurement. A total of 29 patients were enrolled with mean age 32.27 years and female:male ratio of 6:23. Pearson's correlation coefficient showed a significant difference between hs-CRP in serum and SI/S ratio in uSpA, particularly the middle part of the sacroiliac joint, either right side or left side. The significantly high concentration of serum hs-CRP might indicate a systemic inflammatory response to flare-up of the SI joint and might be an indicator of SI inflammation in uSpA.
Kaya, Cemil; Akgül, Ebru; Pabuccu, Recai
2010-06-01
To determine heart rate recovery (HRR) in patients with polycystic ovary syndrome (PCOS) and its relation to C-reactive protein (CRP) and homocysteine (Hcy) levels. Prospective clinical study. University hospital. Sixty-eight women with PCOS and 68 healthy women were included this study. Heart rate recovery was evaluated. We measured serum levels of CRP and Hcy. The presence of insulin resistance was investigated using homeostasis model assesment (HOMA-IR). Heart rate recovery, CRP, Hcy. Heart rate recovery was significantly decreased in women with PCOS compared with control group women. Subjects with abnormal HRR had significantly greater levels of CRP and Hcy. The PCOS patients with HRR in the top tertile compared with the bottom quartile tended to have lower mean CRP and Hcy levels. The HRR was significantly and negatively correlated with age, CRP, Hcy, HOMA-IR, and body mass index. C-reactive protein and Hcy are independent determinants of HRR. The CRP and Hcy levels may affect the development and progression of abnormal HRR in PCOS. Crown Copyright (c) 2010. Published by Elsevier Inc. All rights reserved.
Zyśko, Dorota; Gajek, Jacek; Mazurek, Walentyna
2005-02-01
The inflammatory process plays important role in pathogenesis of some cardiovascular diseases. Atrial fibrillation is atrial arrhythmia with rapid, asynchronous activation of atrial myocytes. The inflammatory process can be responsible for atrial electrical and anatomical remodeling and therefore shifts towards arrhythmia persistence. The presence of systemic inflammation may be assessed by means of C-reactive protein (CRP) measurement. Maximal concentration of CRP coincidences with the peak of paroxysmal atrial fibrillation occurrence in patients after cardiac surgery. In patients with sinus rhythm the concentration of CRP is a risk factor for this arrhythmia in long-term follow-up. In patients with atrial fibrillation mean CRP concentration is 2-fold higher comparing to control group. CRP concentration is higher in patients with chronic than paroxysmal form of this arrhythmia. High CRP level predicts worse results of direct current cardioversion and more frequent paroxysms of atrial fibrillation during follow-up. Besides of, the patients with echocardiographic signs of thromboembolic risk have higher CRP levels than control subjects. There is no data about the influence of anti-inflammatory therapy on atrial fibrillation or its recurrences.
Land Conservation in an Evolving Agricultural Industry: Trade-offs to Consider
NASA Astrophysics Data System (ADS)
Baker, J. S.; Murray, B. C.; McCarl, B. A.; Jackson, R. B.
2008-12-01
This study analyzes the interactions of land conservation policy with biofuel expansion using an economic model of the U.S. forest and agricultural sectors. The world agricultural industry is changing rapidly under emerging market and policy-based pressures. An important driver in the U.S. is the Renewable Fuels Standard (RFS), which mandates significant expansion in biofuels production (up to 36 billion gallons/year by 2022). Traditional land conservation practices such as the Conservation Reserve Program (CRP) are at risk in this changing agricultural climate, as the opportunity costs of reverting to cropland continue to rise. Large- scale reversion of CRP acreage is likely to lead to substantial losses in soil carbon, biodiversity, soil erosion protection, and water quality. However, given the increased competition for land resources, continued efforts to maintain the CRP could induce land use change (LUC) and agricultural development from even more sensitive ecosystems, including native grasslands and forests. This study uses economic modeling to study CRP reversion and LUC under multiple scenarios, including: 1) Baseline assumptions of growth in world agricultural demand and energy prices, with and without CRP reversion; 2) Implementation of the RFS while maintaining the CRP; and 3) RFS with CRP reversion allowed. The study is done using the FASOMGHG model (Lee, McCarl et al, 2008), which is well suited for this analysis as it: 1) Depicts land use competition between crops, pasture, CRP, and forestry over a 100 year period 2) Contains comprehensive GHG accounting across the sectors, 3) Allows land in the CRP to revert to cultivation at an economically optimal rate as land values increase, and 4) Extensively models biofuel and conventional agricultural production possibilities. Results generated to date show significant reversion to cultivation, even under the baseline (36% of the total CRP stock by 2020). Implementing the RFS further pressures conservation practices (exhibiting a 53.4% reversion rate). This reversion is a logical, low cost extensification of crop land; higher reversion rates are observed where agricultural land is most valuable, such as in Iowa and Illinois. Forecasted CRP re-cultivation accompanies environmental degradation in the form of increased chemical applications, irrigation water use and soil erosion relative to the baseline. However, if the CRP is maintained at current levels then this would shift LUC to other conversions, including a greater loss of forest amounting to 6.3 million acres relative to a case where land in CRP freely reverts. This increase in deforestation is likely to spill over into other countries as well. The net carbon loss of deforested land negates the carbon benefits of maintaining the CRP in its current state. Thus, while the environmental impacts of re-cultivating conservation lands are potentially serious, maintaining the CRP in its current form could induce LUC and even greater GHG and environmental emissions. The study concludes by discussing the environmental and economic trade-offs of land conservation under the aforementioned scenarios, and offers policy recommendations for future land conservation initiatives.
Lee, Donghan; Walsh, Joseph D; Yu, Ping; Markus, Michelle A; Choli-Papadopoulou, Theodora; Schwieters, Charles D; Krueger, Susan; Draper, David E; Wang, Yun-Xing
2007-04-06
The L11 binding site is one of the most important functional sites in the ribosome. The N-terminal domain of L11 has been implicated as a "reversible switch" in facilitating the coordinated movements associated with EF-G-driven GTP hydrolysis. The reversible switch mechanism has been hypothesized to require conformational flexibility involving re-orientation and re-positioning of the two L11 domains, and warrants a close examination of the structure and dynamics of L11. Here we report the solution structure of free L11, and relaxation studies of free L11, L11 complexed to its 58 nt RNA recognition site, and L11 in a ternary complex with the RNA and thiostrepton antibiotic. The binding site of thiostrepton on L11 was also defined by analysis of structural and dynamics data and chemical shift mapping. The conclusions of this work are as follows: first, the binding of L11 to RNA leads to sizable conformation changes in the regions flanking the linker and in the hinge area that links a beta-sheet and a 3(10)-helix-turn-helix element in the N terminus. Concurrently, the change in the relative orientation may lead to re-positioning of the N terminus, as implied by a decrease of radius of gyration from 18.5 A to 16.2 A. Second, the regions, which undergo large conformation changes, exhibit motions on milliseconds-microseconds or nanoseconds-picoseconds time scales. Third, binding of thiostrepton results in more rigid conformations near the linker (Thr71) and near its putative binding site (Leu12). Lastly, conformational changes in the putative thiostrepton binding site are implicated by the re-emergence of cross-correlation peaks in the spectrum of the ternary complex, which were missing in that of the binary complex. Our combined analysis of both the chemical shift perturbation and dynamics data clearly indicates that thiostrepton binds to a pocket involving residues in the 3(10)-helix in L11.
Lee, Donghan; Walsh, Joseph D.; Yu, Ping; Markus, Michelle A.; Choli-Papadopoulou, Theodora; Schwieters, Charles D.; Krueger, Susan; Draper, David E.; Wang, Yun-Xing
2007-01-01
Summary The L11 binding site is one of the most important functional sites in the ribosome. The N-terminal domain of L11 has been implicated as a “reversible switch” in facilitating the coordinated movements associated with EF-G–driven GTP hydrolysis. The “reversible switch” mechanism has been hypothesized to require conformational flexibility involving re-orientation and re-positioning of the two L11 domains, and warrants a close examination of the structure and dynamics of L11. Here we report the solution structure of free L11, and relaxation studies of free L11, L11complexed to its 58 nt RNA recognition site, and L11 in a ternary complex with the RNA and thiostrepton antibiotic. The binding site of thiostrepton on L11 was also defined by analysis of structural and dynamics data and chemical shift mapping. The conclusions of this work are as follows: First, the binding of L11 to RNA leads to sizable conformation changes in the regions flanking the linker and in the hinge area that links a β-sheets and a 310-helix-turn-helix element in the N-terminus. Concurrently, the change in the relative orientation may lead to re-positioning of the N-terminus, as implied by a decrease of radius of gyration from 18.5 Å to 16.2 Å. Second, the regions, which undergo large conformation changes, exhibit motions on ms-μs or ns-ps time scales. Third, binding of thiostrepton results in more rigid conformations near the linker (Thr71) and near its putative binding site (Leu12). Lastly, conformational changes in the putative thiostrepton binding site are implicated by the re-emergence of cross-correlation peaks in the spectrum of the ternary complex, which were missing in that of the binary complex. Our combined analysis of both the chemical shift perturbation and dynamics data clearly indicates that thiostrepton binds to a pocket involving residues in the 310-helix in L11. PMID:17292917
1992-01-01
either human p ~ulmo(nary,. Delectaible in the absence of estrmcclular CaCI’. i’Potent 4.23ug/105 cells, or rat peritoneal mast cells. bousbesin...ABSTRACT (Maximum 200 words) Abstract-Binding of )kH substance P (SP) and histamine release were examined using a cloned mouse mast cell line SP binding...the cells with the NK2 antagonist peptide A reduced NKA-induced histamine release ID.Arg’,D.Phe’,D-Trp 0 3 .Leu t )nsu b s tance P , a putative SP
Naz, Sadia; Ngo, Tony; Farooq, Umar
2017-01-01
Background The rapid increase in antibiotic resistance by various bacterial pathogens underlies the significance of developing new therapies and exploring different drug targets. A fraction of bacterial pathogens abbreviated as ESKAPE by the European Center for Disease Prevention and Control have been considered a major threat due to the rise in nosocomial infections. Here, we compared putative drug binding pockets of twelve essential and mostly conserved metabolic enzymes in numerous bacterial pathogens including those of the ESKAPE group and Mycobacterium tuberculosis. The comparative analysis will provide guidelines for the likelihood of transferability of the inhibitors from one species to another. Methods Nine bacterial species including six ESKAPE pathogens, Mycobacterium tuberculosis along with Mycobacterium smegmatis and Eschershia coli, two non-pathogenic bacteria, have been selected for drug binding pocket analysis of twelve essential enzymes. The amino acid sequences were obtained from Uniprot, aligned using ICM v3.8-4a and matched against the Pocketome encyclopedia. We used known co-crystal structures of selected target enzyme orthologs to evaluate the location of their active sites and binding pockets and to calculate a matrix of pairwise sequence identities across each target enzyme across the different species. This was used to generate sequence maps. Results High sequence identity of enzyme binding pockets, derived from experimentally determined co-crystallized structures, was observed among various species. Comparison at both full sequence level and for drug binding pockets of key metabolic enzymes showed that binding pockets are highly conserved (sequence similarity up to 100%) among various ESKAPE pathogens as well as Mycobacterium tuberculosis. Enzymes orthologs having conserved binding sites may have potential to interact with inhibitors in similar way and might be helpful for design of similar class of inhibitors for a particular species. The derived pocket alignments and distance-based maps provide guidelines for drug discovery and repurposing. In addition they also provide recommendations for the relevant model bacteria that may be used for initial drug testing. Discussion Comparing ligand binding sites through sequence identity calculation could be an effective approach to identify conserved orthologs as drug binding pockets have shown higher level of conservation among various species. By using this approach we could avoid the problems associated with full sequence comparison. We identified essential metabolic enzymes among ESKAPE pathogens that share high sequence identity in their putative drug binding pockets (up to 100%), of which known inhibitors can potentially antagonize these identical pockets in the various species in a similar manner. PMID:28948099
Naz, Sadia; Ngo, Tony; Farooq, Umar; Abagyan, Ruben
2017-01-01
The rapid increase in antibiotic resistance by various bacterial pathogens underlies the significance of developing new therapies and exploring different drug targets. A fraction of bacterial pathogens abbreviated as ESKAPE by the European Center for Disease Prevention and Control have been considered a major threat due to the rise in nosocomial infections. Here, we compared putative drug binding pockets of twelve essential and mostly conserved metabolic enzymes in numerous bacterial pathogens including those of the ESKAPE group and Mycobacterium tuberculosis . The comparative analysis will provide guidelines for the likelihood of transferability of the inhibitors from one species to another. Nine bacterial species including six ESKAPE pathogens, Mycobacterium tuberculosis along with Mycobacterium smegmatis and Eschershia coli , two non-pathogenic bacteria, have been selected for drug binding pocket analysis of twelve essential enzymes. The amino acid sequences were obtained from Uniprot, aligned using ICM v3.8-4a and matched against the Pocketome encyclopedia. We used known co-crystal structures of selected target enzyme orthologs to evaluate the location of their active sites and binding pockets and to calculate a matrix of pairwise sequence identities across each target enzyme across the different species. This was used to generate sequence maps. High sequence identity of enzyme binding pockets, derived from experimentally determined co-crystallized structures, was observed among various species. Comparison at both full sequence level and for drug binding pockets of key metabolic enzymes showed that binding pockets are highly conserved (sequence similarity up to 100%) among various ESKAPE pathogens as well as Mycobacterium tuberculosis . Enzymes orthologs having conserved binding sites may have potential to interact with inhibitors in similar way and might be helpful for design of similar class of inhibitors for a particular species. The derived pocket alignments and distance-based maps provide guidelines for drug discovery and repurposing. In addition they also provide recommendations for the relevant model bacteria that may be used for initial drug testing. Comparing ligand binding sites through sequence identity calculation could be an effective approach to identify conserved orthologs as drug binding pockets have shown higher level of conservation among various species. By using this approach we could avoid the problems associated with full sequence comparison. We identified essential metabolic enzymes among ESKAPE pathogens that share high sequence identity in their putative drug binding pockets (up to 100%), of which known inhibitors can potentially antagonize these identical pockets in the various species in a similar manner.
Venco, Luigi; Bertazzolo, Walter; Giordano, Guglielmo; Paltrinieri, Saverio
2014-11-15
Canine heartworm disease caused by Dirofilaria immitis is considered a pulmonary disease, which leads to pulmonary hypertension, and in the late stage, may induce right cardiac insufficiency. Adult worms are localized in the pulmonary arteries, which undergo endothelial damage (proliferative endoarteritis), the severity of which depends on the duration of infection and the worm burden. C-reactive protein (CRP) is a major canine acute-phase protein that rapidly increases in a wide range of inflammatory conditions and rapidly decreases when inflammation resolves. CRP is therefore considered a sensitive but nonspecific marker of inflammation. Pulmonary arterial damage in canine heartworm may induce an increase in CRP concentrations similar to what occurs in humans with endoarteritis. The aim of the present study was to investigate whether CRP may be a diagnostic and/or prognostic marker in canine heartworm, whether it may be used for staging and monitoring canine heartworm, and whether its concentration depends on worm burden or on pulmonary arterial damage. Serum CRP concentrations were determined in 57 dogs with heartworm disease, 47 of which were grouped according to parasite burden (low: n=11; high: n=10) or on severity of pulmonary hypertension (mild: n=16; severe: n=10). An additional 23 heartworm-free cardiopathic dogs were grouped on the absence of pulmonary hypertension (n=8), presence of dilated cardiomyopathy (DCM) (n=6), or presence of cardiomyopathy and pulmonary hypertension (n=3) due to previous heartworm disease that had been treated (n=6). Twenty control dogs also were sampled for CRP concentrations. Results show that CRP was significantly increased (p<0.001) in dogs with heartworm or cardiomyopathy compared with concentrations in controls. In the heartworm group, CRP was significantly increased (p<0.001) in dogs with mild or severe pulmonary hypertension but not in dogs with low or high parasite burden without pulmonary hypertension. Heartworm-free cardiopathic dogs had significantly high (p<0.01) CRP concentrations if affected by DCM or pulmonary hypertension. ROC curves showed that CRP has good discriminating power for pulmonary hypertension (AUC=0.92 for the entire dataset, 1.00 for dogs with heartworm) and that pulmonary hypertension in heartworm must be suspected when CRP values are higher than 6.8 mg/dL. Conversely, severe pulmonary hypertension is suspected only if CRP values are very high (>29.8 mg/L). In conclusion, CRP can be used as a marker of endothelial arteritis and pulmonary hypertension in dogs with heartworm. Copyright © 2014 Elsevier B.V. All rights reserved.
Waaijer, M E C; Westendorp, R G J; Goldeck, D; Gunn, D A; Pawelec, G; Stijntjes, M; Slagboom, P E; Maier, A B
2017-01-01
In addition to measures already used in clinical practice, molecular measures have been proposed to assess health status, but these have not yet been introduced into clinical practice. We aimed to test the association of functional capacity measures used in current practice and molecular measures with age and health status. The cohort consisted of 178 middle-aged to old participants of the Leiden Longevity Study (range 42-82years). We tested associations between functional capacity measures (physical tests: grip strength, 4-meter walk, chair stand test; cognitive tests: Stroop test, digit symbol substitution test and 15-picture learning test) with age and with cardiovascular or metabolic disease as a measure of the health status. These associations with age and health status were also tested for molecular measures (C reactive protein (CRP), numbers of senescent p16INK4a positive cells in the epidermis and dermis and putative immunosenescence (presence of CD57+ T cells)). All functional capacity measures were associated with age. CRP and epidermal p16INK4a positivity were also associated with age, but with smaller estimates. Grip strength and the Stroop test were associated with cardiovascular or metabolic disease, as was epidermal p16INK4a positivity. All associations with cardiovascular or metabolic disease attenuated when adjusting for age. In conclusion, in middle-aged to old persons, the molecular measures tested here were more weakly associated with age and health status than functional capacity measures. Whether these molecular measures associate more closely with health status in the elderly or in specific groups of patients needs to be explored further. Crown Copyright © 2016. Published by Elsevier Inc. All rights reserved.
da Graça Cantarelli, Maria; Nardin, Patrícia; Buffon, Andréia; Eidt, Murilo Castilhos; Antônio Godoy, Luiz; Fernandes, Brisa S; Gonçalves, Carlos-Alberto
2015-02-01
Many peripheral biomarkers, including low cholesterol and its fractions, have been examined to identify suicidal behavior. Herein, we assessed serum lipid profile and some proteins putatively associated with suicidal behavior in subjects with mood disorder (bipolar disorder or major depressive disorder) with a recent suicide attempt and with no lifetime history of suicide attempts. Fifty subjects had presented an episode of attempted suicide during the last 15 days, and 36 subjects had no history of any suicide attempt. We measured total cholesterol, HDL, LDL and triglycerides as well as serum leptin, brain-derived neurotrophic factor (BDNF), S100B and C-reactive protein (CRP). Individuals that had attempted suicide presented decreased body mass index (BMI) and waist circumference. After adjusting for these confounders, we found that triglycerides were decreased in attempted suicide subjects. We found no differences among total cholesterol, LDL, and HDL or leptin, S100B, CRP and BDNF. This is a cross-sectional study, and we cannot therefore assess whether a decrease in triglycerides caused a mood episode with suicidal ideation that led to a suicide attempt or if the presence of a mood episode originated a loss of appetite and consequent loss of weight, therefore decreasing triglyceride levels. These results do not support the hypothesis that lower levels of cholesterol are associated with suicidal behavior in a mood disorder sample. However, our data support the idea that adiposity is differentiated in these patients (reduced BMI, waist circumference and serum triglycerides), which could lead to an altered communication between the adipose tissue and brain. Copyright © 2014 The Authors. Published by Elsevier B.V. All rights reserved.
Yo, Chia-Hung; Lee, Si-Huei; Chang, Shy-Shin; Lee, Matthew Chien-Hung; Lee, Chien-Chang
2014-02-20
We performed a systematic review and meta-analysis of studies on high-sensitivity C-reactive protein (hs-CRP) assays to see whether these tests are predictive of atrial fibrillation (AF) recurrence after cardioversion. Systematic review and meta-analysis. PubMed, EMBASE and Cochrane databases as well as a hand search of the reference lists in the retrieved articles from inception to December 2013. This review selected observational studies in which the measurements of serum CRP were used to predict AF recurrence. An hs-CRP assay was defined as any CRP test capable of measuring serum CRP to below 0.6 mg/dL. We summarised test performance characteristics with the use of forest plots, hierarchical summary receiver operating characteristic curves and bivariate random effects models. Meta-regression analysis was performed to explore the source of heterogeneity. We included nine qualifying studies comprising a total of 347 patients with AF recurrence and 335 controls. A CRP level higher than the optimal cut-off point was an independent predictor of AF recurrence after cardioversion (summary adjusted OR: 3.33; 95% CI 2.10 to 5.28). The estimated pooled sensitivity and specificity for hs-CRP was 71.0% (95% CI 63% to 78%) and 72.0% (61% to 81%), respectively. Most studies used a CRP cut-off point of 1.9 mg/L to predict long-term AF recurrence (77% sensitivity, 65% specificity), and 3 mg/L to predict short-term AF recurrence (73% sensitivity, 71% specificity). hs-CRP assays are moderately accurate in predicting AF recurrence after successful cardioversion.
Inflammation as a Risk of Developing Chronic Kidney Disease in Rheumatoid Arthritis.
Kochi, Masako; Kohagura, Kentaro; Shiohira, Yoshiki; Iseki, Kunitoshi; Ohya, Yusuke
2016-01-01
The relationship between chronic inflammation and the incidence of chronic kidney disease (CKD) remained not-clear in patients with rheumatoid arthritis (RA). This study aims to examine the relationship between persistently high C-reactive protein (CRP), a marker of inflammation, and the incidence of CKD in RA. We retrospectively examined the relationship between the levels of CRP and incidence of CKD in 345 RA patients. The outcome of interest was incidence of CKD, defined as an estimated glomerular filtration rate (eGFR) <60 mL/min/1.73 m2 and/or positive dipstick testing for proteinuria for ≥3 months. We defined high CRP, as >3.0 mg/L. On the basis of three measurements of CRP for 6-months period, patients were divided into three groups: group 1, including patients with no high CRP values; group 2, patients with transient high CRP values (once or twice) and group 3, patients with persistently high CRP values. During a median follow-up period of 89 months, 14% of all patients developed CKD. The cumulative incidence of CKD was 7% in group 1, 14% in group 2 and 22% in group 3 (P = 0.008, log-rank test). In a multivariate analysis, including classical risk factors for CKD, persistently high CRP was an independent predictor of the incidence of CKD (hazard ratio, 3.00; 95% confidence interval, 1.23-8.53; P = 0.01). Persistently high CRP was a significant risk factor for the incidence of CKD. Results suggest that persistent inflammation is a marker for the high risk of CKD in RA.
López-Mejías, Raquel; Genre, Fernanda; Remuzgo-Martínez, Sara; González-Juanatey, Carlos; Robustillo-Villarino, Montserrat; Llorca, Javier; Corrales, Alfonso; Vicente, Esther; Miranda-Filloy, José A; Magro, César; Tejera-Segura, Beatriz; Ramírez Huaranga, Marco A; Pina, Trinitario; Blanco, Ricardo; Alegre-Sancho, Juan J; Raya, Enrique; Mijares, Verónica; Ubilla, Begoña; Mínguez Sánchez, María D; Gómez-Vaquero, Carmen; Balsa, Alejandro; Pascual-Salcedo, Dora; López-Longo, Francisco J; Carreira, Patricia; González-Álvaro, Isidoro; Rodríguez-Rodríguez, Luis; Fernández-Gutiérrez, Benjamín; Ferraz-Amaro, Iván; Castañeda, Santos; Martín, Javier; González-Gay, Miguel A
2016-08-18
Association between elevated C-reactive protein (CRP) serum levels and subclinical atherosclerosis and cardiovascular (CV) events was described in rheumatoid arthritis (RA). CRP, HNF1A, LEPR, GCKR, NLRP3, IL1F10, PPP1R3B, ASCL1, HNF4A and SALL1 exert an influence on elevated CRP serum levels in non-rheumatic Caucasians. Consequently, we evaluated the potential role of these genes in the development of CV events and subclinical atherosclerosis in RA patients. Three tag CRP polymorphisms and HNF1A, LEPR, GCKR, NLRP3, IL1F10, PPP1R3B, ASCL1, HNF4A and SALL1 were genotyped in 2,313 Spanish patients by TaqMan. Subclinical atherosclerosis was determined in 1,298 of them by carotid ultrasonography (by assessment of carotid intima-media thickness-cIMT-and presence/absence of carotid plaques). CRP serum levels at diagnosis and at the time of carotid ultrasonography were measured in 1,662 and 1,193 patients, respectively, by immunoturbidimetry. Interestingly, a relationship between CRP and CRP serum levels at diagnosis and at the time of the carotid ultrasonography was disclosed. However, no statistically significant differences were found when CRP, HNF1A, LEPR, GCKR, NLRP3, IL1F10, PPP1R3B, ASCL1, HNF4A and SALL1 were evaluated according to the presence/absence of CV events, carotid plaques and cIMT after adjustment. Our results do not confirm an association between these genes and CV disease in RA.
Jaworski, Radoslaw; Haponiuk, Ireneusz; Irga-Jaworska, Ninela; Chojnicki, Maciej; Steffens, Mariusz; Szofer-Sendrowska, Aneta; Zielinski, Jacek; Juscinski, Jacek
2014-03-01
The aim of the study was to assess postoperative C-reactive protein (CRP) serum kinetics in children without clinical signs of infection after atrial and ventricular septal defects closure in terms of extracorporeal circulation (ECC). Fifty-two patients met inclusion criteria and were divided into 2 groups: group A (antibiotic prophylaxis with cefazolin given up to 48 h postoperatively) and group B (antibiotic prophylaxis with amoxicillin and clavunic acid given more than 48 h postoperatively). The CRP was measured perioperatively in both groups. The CRP evaluation was the part of routine lab-tests during perioperative period, without any modification of the typical perioperative strategy. In the postoperative period CRP was measured after 24h, 48 h, 72 h and 96 h in both groups. There were no differences between CRP levels between both groups of patients. The peak CRP values were observed after 48 h after the operation in ECC in both groups and decreased in the next postoperative days. In children with congenital heart defects undergoing cardiosurgical treatment with the use of ECC the assessing CRP values in the first postoperative day remains questionable. The maximum peak CRP value after operation with ECC can be much higher than the reference values without infection complications. Single CRP assessment in early postoperative period in these groups of children can lead to over-diagnosis of infections and antibiotics abuse. Copyright © 2014 Medical University of Bialystok. Published by Elsevier Urban & Partner Sp. z o.o. All rights reserved.
Bjorkman, M P; Sorva, A J; Tilvis, R S
2009-05-01
To elucidate the association between vitamin D status, C-reactive protein (CRP) and fibrinogen. Secondary analysis of a randomised double-blind placebo controlled trial. Four longterm care hospitals (1215 beds) in Helsinki, Finland. 218 long-term inpatients aged over 65 years. Eligible patients (n = 218) were randomized to receive 0 IU/d, 400 IU/d, or 1200 IU/d cholecalciferol for six months. Plasma 25-hydroxyvitamin D (25-OHD), parathyroid hormone (PTH), high sensitive CRP, fibrinogen, amino-terminal propeptide of type I procollagen (PINP), and carboxy-terminal telopeptide of type I collagen (ICTP) were measured. The patients were aged (84.5 +/- 7.5 years), vitamin D deficient (25-OHD = 23 +/- 10 nmol/l), chronically bedridden and in stable general condition. The mean baseline CRP and fibrinogen were 10.86 mg/l (0.12 mg/l - 125.00 mg/l) and 4,7 g/l (2.3 g/l - 8.6 g/l), respectively. CRP correlated with ICTP (r = 0.217, p = 0.001), but not with vitamin D status. Supplementation significantly increased 25-OHD concentrations, but the changes in CRP and fibrinogen were insignificant and inconsistent. The post-trial CRP concentrations (0.23 mg/l -138.00 mg/l) correlated with ICTP (r = 0.156, p < 0.001), but no association was found with vitamin D status. The baseline and post-trial fibrinogen correlated with CRP, only. CRP concentrations are associated with bone turnover, but not with vitamin D status, and vitamin D supplementation has no major effect on CRP or fibrinogen concentrations in bedridden older patients.
Kupelian, Varant; McVary, Kevin T.; Barry, Michael J.; Link, Carol L.; Rosen, Raymond C.; Aiyer, Lalitha Padmanabhan; Mollon, Patrick; McKinlay, John B.
2012-01-01
Objectives The objectives of this study were: 1) to determine whether there is an association between C-reactive protein (CRP) levels and lower urinary tract symptoms (LUTS) as assessed by the American Urological Association Symptom Index (AUA-SI) among both men and women, 2) to determine the association of CRP levels with individual urologic symptoms comprising the AUA-SI among both men and women. Methods The Boston Area Community Health (BACH) Survey used a multistage stratified design to recruit a random sample of 5,502 adults age 30–79. Blood samples were obtained on 3,752 participants. Analyses were conducted on 1,898 men and 1,854 women with complete data on C-Reactive Protein (CRP) levels. Overall LUTS was defined as an AUA-SI≥8 (moderate to severe LUTS). Urologic symptoms comprising the AUA-SI were included in the analysis as reports of fairly often to almost always vs. non/rarely/a few times. Results A statistically significant association was observed between CRP levels and overall LUTS among both men and women. The pattern of associations between individual symptoms and CRP levels varied by gender. Nocturia and straining were associated with higher CRP levels among men, while incomplete emptying and weak stream were associated with higher CRP levels among women. Conclusions This study demonstrates an association between CRP levels and LUTS in both men and women. The dose-response relationship between increased CRP levels and increased odds of LUTS supports the hypothesized role of inflammatory processes in the etiology of LUTS. PMID:19394490
Binding of HBGA-expressing bacteria does not protect Tulane virus from acute heat stress
USDA-ARS?s Scientific Manuscript database
Human noroviruses (HuNoVs) are the major cause of gastroenteritis outbreaks worldwide. Human noroviruses can interact with histo-blood group antigens (HBGAs) on the surface of mammalian cells as well as bacterial cells. HBGAs have been considered as putative receptors or co-receptors for HuNoVs in m...
USDA-ARS?s Scientific Manuscript database
Proteomic analyses were done on 2 chemosensory appendages of the lone star tick, Amblyomma americanum. Proteins in the fore tarsi, which contain the olfactory Haller's organ, and in the palps, that include gustatory sensilla, were compared with proteins in the third tarsi. Also, male and female tick...
Priyanka, N.; Kumari, Minal; Kalra, Nitish; Arjun, P.; Naik, Savitha B.; Pradeep, A. R.
2013-01-01
Introduction. This study was designed to correlate the serum and gingival crevicular fluid (GCF) levels of progranulin (PGRN) and high sensitivity C-reactive protein (hs CRP) in chronic periodontitis and type 2 diabetes mellitus (DM). Design. PGRN and hs CRP levels were estimated in 3 groups: healthy, chronic periodontitis, and type 2 DM with chronic periodontitis. Results. The mean PGRN and hs CRP concentrations in serum and GCF were the highest for group 3 followed by group 2 and the least in group 1. Conclusion. PGRN and hs CRP may be biomarkers of the inflammatory response in type 2 DM and chronic periodontitis. PMID:24191130
Chlamydia trachomatis elementary bodies possess proteins which bind to eucaryotic cell membranes
DOE Office of Scientific and Technical Information (OSTI.GOV)
Wenman, W.M.; Meuser, R.U.
1986-02-01
Chlamydia trachomatis proteins were electrophoresed and then transferred to nitrocellulose paper to detect chlamydial proteins which bind to eucaryotic cell membranes. Resolved polypeptides of C. trachomatis serovars J and L/sub 2/ were reacted with iodinated HeLa cell membranes and autoradiographed. Infectious elementary bodies of both serovars possess 31,000- and 18,000-dalton proteins which bind to HeLa cells. In contrast, noninfectious reticulate bodies do not possess eucaryotic cell-binding proteins. Both proteins are antigenic when reacted with hyperimmune rabbit antisera in immunoblots and antisera raised against the 31,000- and 18,000-dalton proteins are inhibitory to chlamydia-host cell association. In addition, these antisera exhibit neutralizingmore » activity. These data suggest that these putative chlamydial adhesions play a key role in the early steps of chlamydia-host cell interaction and that antibody directed against them may be protective.« less
Chai, Kian Piaw; Othman, Noor Farhan Binti; Teh, Aik-Hong; Ho, Kok Lian; Chan, Kok-Gan; Shamsir, Mohd Shahir; Goh, Kian Mau; Ng, Chyan Leong
2016-03-15
A new subfamily of glycosyl hydrolase family GH13 was recently proposed for α-amylases from Anoxybacillus species (ASKA and ADTA), Geobacillus thermoleovorans (GTA, Pizzo, and GtamyII), Bacillus aquimaris (BaqA), and 95 other putative protein homologues. To understand this new GH13 subfamily, we report crystal structures of truncated ASKA (TASKA). ASKA is a thermostable enzyme capable of producing high levels of maltose. Unlike GTA, biochemical analysis showed that Ca(2+) ion supplementation enhances the catalytic activities of ASKA and TASKA. The crystal structures reveal the presence of four Ca(2+) ion binding sites, with three of these binding sites are highly conserved among Anoxybacillus α-amylases. This work provides structural insights into this new GH13 subfamily both in the apo form and in complex with maltose. Furthermore, structural comparison of TASKA and GTA provides an overview of the conformational changes accompanying maltose binding at each subsite.
Tomie, Tetsuya; Ishibashi, Jun; Furukawa, Seiichi; Kobayashi, Satoe; Sawahata, Ryoko; Asaoka, Ai; Tagawa, Michito; Yamakawa, Minoru
2003-07-25
A novel antifungal peptide, scarabaecin (4080Da), was isolated from the coconut rhinoceros beetle, Oryctes rhinoceros. Scarabaecin cDNA was cloned by reverse transcriptase-polymerase chain reactions (RT-PCR) using a primer based on the N-terminal amino acid sequence. The amino acid sequence deduced from scarabaecin cDNA showed no significant similarity to those of reported proteins. Chemically synthesized scarabaecin indicated antifungal activity against phytopathogenic fungi such as Pyricularia oryzae, Rhizoctonia solani, and Botrytis cinerea, but not against phytopathogenic bacteria. It showed weak activity against Bauberia bassiana, an insect pathogenic fungus, and Staphylococcus aureus, a pathogenic bacterium. Scarabaecin showed chitin binding property and its K(d) was 1.315 microM. A comparison of putative chitin-binding domains among scarabaecin, invertebrate, and plant chitin-binding proteins suggests that scarabaecin is a new member of chitin-binding antimicrobial proteins.
Structure of the bacteriophage T4 long tail fiber receptor-binding tip
Bartual, Sergio G.; Otero, José M.; Garcia-Doval, Carmela; Llamas-Saiz, Antonio L.; Kahn, Richard; Fox, Gavin C.; van Raaij, Mark J.
2010-01-01
Bacteriophages are the most numerous organisms in the biosphere. In spite of their biological significance and the spectrum of potential applications, little high-resolution structural detail is available on their receptor-binding fibers. Here we present the crystal structure of the receptor-binding tip of the bacteriophage T4 long tail fiber, which is highly homologous to the tip of the bacteriophage lambda side tail fibers. This structure reveals an unusual elongated six-stranded antiparallel beta-strand needle domain containing seven iron ions coordinated by histidine residues arranged colinearly along the core of the biological unit. At the end of the tip, the three chains intertwine forming a broader head domain, which contains the putative receptor interaction site. The structure reveals a previously unknown beta-structured fibrous fold, provides insights into the remarkable stability of the fiber, and suggests a framework for mutations to expand or modulate receptor-binding specificity. PMID:21041684
The poly(C)-binding proteins: a multiplicity of functions and a search for mechanisms.
Makeyev, Aleksandr V; Liebhaber, Stephen A
2002-01-01
The poly(C) binding proteins (PCBPs) are encoded at five dispersed loci in the mouse and human genomes. These proteins, which can be divided into two groups, hnRNPs K/J and the alphaCPs (alphaCP1-4), are linked by a common evolutionary history, a shared triple KH domain configuration, and by their poly(C) binding specificity. Given these conserved characteristics it is remarkable to find a substantial diversity in PCBP functions. The roles of these proteins in mRNA stabilization, translational activation, and translational silencing suggest a complex and diverse set of post-transcriptional control pathways. Their additional putative functions in transcriptional control and as structural components of important DNA-protein complexes further support their remarkable structural and functional versatility. Clearly the identification of additional binding targets and delineation of corresponding control mechanisms and effector pathways will establish highly informative models for further exploration. PMID:12003487
The poly(C)-binding proteins: a multiplicity of functions and a search for mechanisms.
Makeyev, Aleksandr V; Liebhaber, Stephen A
2002-03-01
The poly(C) binding proteins (PCBPs) are encoded at five dispersed loci in the mouse and human genomes. These proteins, which can be divided into two groups, hnRNPs K/J and the alphaCPs (alphaCP1-4), are linked by a common evolutionary history, a shared triple KH domain configuration, and by their poly(C) binding specificity. Given these conserved characteristics it is remarkable to find a substantial diversity in PCBP functions. The roles of these proteins in mRNA stabilization, translational activation, and translational silencing suggest a complex and diverse set of post-transcriptional control pathways. Their additional putative functions in transcriptional control and as structural components of important DNA-protein complexes further support their remarkable structural and functional versatility. Clearly the identification of additional binding targets and delineation of corresponding control mechanisms and effector pathways will establish highly informative models for further exploration.
Lagoutte, N; Facy, O; Ravoire, A; Chalumeau, C; Jonval, L; Rat, P; Ortega-Deballon, P
2012-10-01
Anastomotic leakage is the most important complication after colorectal surgery. Its prognosis depends on its early diagnosis. C-reactive protein (CRP) has already shown its usefulness for the early detection of anastomotic leaks. Procalcitonin (PCT) is widely used in intensive care units and is more expensive, but its usefulness in the postoperative period of digestive surgery is not well established. Between May 2010 and June 2011, 100 patients undergoing elective colorectal surgery were prospectively included in a database. CRP and PCT were measured before surgery and daily until postoperative day 4. All intraabdominal infections were considered as anastomotic leaks, regardless of their clinical impact and their management. The kinetics of PCT and CRP were recorded, as well as their accuracy for the detection of anastomotic fistula. The incidence of fistula was 13% and the overall mortality rate was 2%. Both CRP and PCT were significantly higher in patients with leakage. Areas under the receiver-operating characteristics (ROC) for CRP were higher than those for PCT each day. The best accuracy was obtained for CRP on postoperative day 4 (areas under the ROC curve were 0.869 for CRP and 0.750 for PCT). Procalcitonin is neither earlier nor more accurate than CRP for the detection of anastomotic leakage after elective colorectal surgery. Copyright © 2012 Elsevier Masson SAS. All rights reserved.
Zhu, Dao-min; Liu, Yong; Zhang, Ai-guo; Chu, Zhao-xue; Wu, Qing; Li, Hui; Ge, Jin-fang; Dong, Yi; Zhu, Peng
2015-08-30
There is growing evidence on the novel role of vitamin D in reducing inflammation. This study aimed to examine the hypothesis that vitamin D is inversely associated with C-reactive protein (CRP) in patients with schizophrenia, and high levels of vitamin D may be linked to reduced risk of schizophrenia with elevated CRP. Ninety-three patients with schizophrenia and 93 family-matched controls were recruited in this cross-sectional study. Plasma concentrations of CRP and 25-hydroxyvitamin D [25(OH)D] were measured using commercial kits. Information about demographic characteristics and clinic data were obtained by interviews or medical records. Mean levels of CRP and 25(OH)D were 43.3% higher and 26.7% lower for patients compared to controls, respectively. 25(OH)D were inversely associated with CRP in the patients, but not in the controls. The proportions of patients significantly increased with increasing quartiles of CRP, while significantly decreased with increasing quartiles of 25(OH)D. Among individuals with high CRP, participants with high 25(OH)D have significantly lower proportion (adjusted OR =0.217, 95% CI 0.063, 0.751) of schizophrenia compared to those with low 25(OH)D. The evidence suggested that high levels of vitamin D may be linked to reduced risk of schizophrenia with elevated CRP. Copyright © 2015 Elsevier Ireland Ltd. All rights reserved.